A new technique for Auger analysis of surface species subject to electron-induced desorption.

NASA Technical Reports Server (NTRS)

Pepper, S. V.

1973-01-01

A method is presented to observe surface species subject to electron-induced desorption by Auger electron spectroscopy. The surface to be examined is moved under the electron beam at constant velocity, establishing a time-independent condition and eliminating the time response of the electron spectrometer as a limiting factor. The dependence of the Auger signal on the sample velocity, incident electron current, beam diameter, and desorption cross section is analyzed. It is shown that it is advantageous to analyze the moving sample with a high beam current, in contrast to the usual practice of using a low beam current to minimize desorption from a stationary sample. The method is illustrated by the analysis of a friction transfer film of PTFE, in which the fluorine is removed by electron-induced desorption. The method is relevant to surface studies in the field of lubrication and catalysis.

Constant-current corona triode adapted and optimized for the characterization of thin dielectric films

NASA Astrophysics Data System (ADS)

Giacometti, José A.

2018-05-01

This work describes an enhanced corona triode with constant current adapted to characterize the electrical properties of thin dielectric films used in organic electronic devices. A metallic grid with a high ionic transparency is employed to charge thin films (100 s of nm thick) with a large enough charging current. The determination of the surface potential is based on the grid voltage measurement, but using a more sophisticated procedure than the previous corona triode. Controlling the charging current to zero, which is the open-circuit condition, the potential decay can be measured without using a vibrating grid. In addition, the electric capacitance and the characteristic curves of current versus the stationary surface potential can also be determined. To demonstrate the use of the constant current corona triode, we have characterized poly(methyl methacrylate) thin films with films with thicknesses in the range from 300 to 500 nm, frequently used as gate dielectric in organic field-effect transistors.

Spin-polarized currents in a two-terminal double quantum ring driven by magnetic fields and Rashba spin-orbit interaction

NASA Astrophysics Data System (ADS)

Dehghan, E.; Khoshnoud, D. Sanavi; Naeimi, A. S.

2018-06-01

Aim of this study is to investigate spin transportation in double quantum ring (DQR). We developed an array of DQR to measure the transmission coefficient and analyze the spin transportation through this system in the presence of Rashba spin-orbit interaction (RSOI) and magnetic flux estimated using S-matrix method. In this article, we compute the spin transport and spin-current characteristics numerically as functions of electron energy, angles between the leads, coupling constant of the leads, RSOI, and magnetic flux. Our results suggest that, for typical values of the magnetic flux (ϕ /ϕ0) and Rashba constant (αR), such system can demonstrates many spintronic properties. It is possible to design a new geometry of DQR by incoming electrons polarization in a way to optimize the system to work as a spin-filtering and spin-inverting nano-device with very high efficiency. The results prove that the spin current will strongly modulate with an increase in the magnetic flux and Rashba constant. Moreover it is shown that, when the lead coupling is weak, the perfect spin-inverter does not occur.

Al/CuxO/Cu Memristive Devices: Fabrication, Characterization, and Modeling

DTIC Science & Technology

2012-01-01

where Js is the current density, q is the electron charge, ε0 is the permittivity of free space, εr is the dielectric constant of the material, k is...and N. Nagaosa, “Interfaces of Correlated Electron Systems: Proposed Mechanism for Colossal Electroresistance,” Phys. Rev. Lett., Vol. 95, p. 266403

Measurement of cardiac output using improved chromatographic analysis of sulfur hexafluoride (SF6).

PubMed

Klocke, F J; Roberts, D L; Farhi, E R; Naughton, B J; Sekovski, B; Klocke, R A

1977-06-01

A constant current variable frequency pulsed electron capture detector has been incorporated into the gas chromatographic analysis of trace amounts of sulfur hexafluoride (SF6) in water and blood. The resulting system offers a broader effective operating range than more conventional electron capture units and has been utilized for measurements of cardiac output employing constant-rate infusion of dissolved SF6. The SF6 technique has been validated against direct volumetric measurements of cardiac output in a canine right-heart bypass preparation and used subsequently for rapidly repeated measurements in conscious animals and man.

Electron counting and a large family of two-dimensional semiconductors

NASA Astrophysics Data System (ADS)

Miao, Maosheng; Botana, Jorge; Zurek, Eva; Liu, Jingyao; Yang, Wen

Two-dimensional semiconductors (2DSC) are currently the focus of many studies, thanks to their novel and superior transport properties that may greatly influence future electronic devices. The potential applications of 2DSCs range from low-dimensional electronics, topological insulators and vallytronics all the way to novel photolysis. However, compared with the conventional semiconductors that are comprised of main group elements and cover a large range of band gaps and lattice constants, the choice of 2D materials is very limited. In this work, we propose and demonstrate a large family of 2DSCs, all adopting the same structure and consisting of only main group elements. Using advanced density functional calculations, we demonstrate the attainability of these materials, and show that they cover a large range of lattice constants, band gaps and band edge states, making them good candidate materials for heterojunctions. This family of two dimensional materials may be instrumental in the fabrication of 2DSC devices that may rival the currently employed 3D semiconductors.

Assessment of Scanning Tunneling Spectroscopy Modes Inspecting Electron Confinement in Surface-Confined Supramolecular Networks

PubMed Central

Krenner, Wolfgang; Kühne, Dirk; Klappenberger, Florian; Barth, Johannes V.

2013-01-01

Scanning tunneling spectroscopy (STS) enables the local, energy-resolved investigation of a samples surface density of states (DOS) by measuring the differential conductance (dI/dV) being approximately proportional to the DOS. It is popular to examine the electronic structure of elementary samples by acquiring dI/dV maps under constant current conditions. Here we demonstrate the intricacy of STS mapping of samples exhibiting a strong corrugation originating from electronic density and local work function changes. The confinement of the Ag(111) surface state by a porous organic network is studied with maps obtained under constant-current (CC) as well as open-feedback-loop (OFL) conditions. We show how the CC maps deviate markedly from the physically more meaningful OFL maps. By applying a renormalization procedure to the OFL data we can mimic the spurious effects of the CC mode and thereby rationalize the physical effects evoking the artefacts in the CC maps. PMID:23503526

A simplified controller and detailed dynamics of constant off-time peak current control

NASA Astrophysics Data System (ADS)

Van den Bossche, Alex; Dimitrova, Ekaterina; Valchev, Vencislav; Feradov, Firgan

2017-09-01

A fast and reliable current control is often the base of power electronic converters. The traditional constant frequency peak control is unstable above 50 % duty ratio. In contrast, the constant off-time peak current control (COTCC) is unconditionally stable and fast, so it is worth analyzing it. Another feature of the COTCC is that one can combine a current control together with a current protection. The time dynamics show a zero-transient response, even when the inductor changes in a wide range. It can also be modeled as a special transfer function for all frequencies. The article shows also that it can be implemented in a simple analog circuit using a wide temperature range IC, such as the LM2903, which is compatible with PV conversion and automotive temperature range. Experiments are done using a 3 kW step-up converter. A drawback is still that the principle does not easily fit in usual digital controllers up to now.

A modification of the Hammett equation for predicting ionisation constants of p-vinyl phenols.

PubMed

Sipilä, Julius; Nurmi, Harri; Kaukonen, Ann Marie; Hirvonen, Jouni; Taskinen, Jyrki; Yli-Kauhaluoma, Jari

2005-01-01

Currently there are several compounds used as drugs or studied as new chemical entities, which have an electron withdrawing group connected to a vinylic double bond in a phenolic or catecholic core structure. These compounds share a common feature--current computational methods utilizing the Hammett type equation for the prediction of ionisation constants fail to give accurate prediction of pK(a)'s for compounds containing the vinylic moiety. The hypothesis was that the effect of electron-withdrawing substituents on the pK(a) of p-vinyl phenols is due to the delocalized electronic structure of these compounds. Thus, this effect should be additive for multiple substituents attached to the vinylic double bond and quantifiable by LFER-based methods. The aim of this study was to produce an improved equation with a reduced tendency to underestimate the effect of the double bond on the ionisation of the phenolic hydroxyl. To this end a set of 19 para-substituted vinyl phenols was used. The ionisation constants were measured potentiometrically, and a training set of 10 compounds was selected to build a regression model (r2 = 0.987 and S.E. = 0.09). The average error with an external test set of six compounds was 0.19 for our model and 1.27 for the ACD-labs 7.0. Thus, we have been able to significantly improve the existing model for prediction of the ionisation constants of substituted p-vinyl phenols.

Induced charging of shuttle orbiter by high electron-beam currents

NASA Technical Reports Server (NTRS)

Liemohn, H. B.

1977-01-01

Emission of high-current electron beams that was proposed for some Spacelab payloads required substantial return currents to the orbiter skin in order to neutralize the beam charge. Since the outer skin of the vehicle was covered with approximately 1200 sq m of thermal insulation which has the dielectric quality of air and an electrical conductivity that was estimated by NASA at 10 to the -9 power to 10 to the -10 power mhos/m, considerable transient charging and local potential differences were anticipated across the insulation. The theory for induced charging of spacecraft due to operation of electron guns was only developed for spherical metal vehicles and constant emission currents, which were not directly applicable to the orbiter situation. Field-aligned collection of electron return current from the ambient ionosphere at orbiter altitudes provides up to approximately 150 mA on the conducting surfaces and approximately 2.4 A on the dielectric thermal insulation. Local ionization of the neutral atmosphere by energetic electron bombardment or electrical breakdown may provide somewhat more return current.

Shot noise at high temperatures

NASA Astrophysics Data System (ADS)

Gutman, D. B.; Gefen, Yuval

2003-07-01

We consider the possibility of measuring nonequilibrium properties of the current correlation functions at high temperatures (and small bias). Through the example of the third cumulant of the current (S3) we demonstrate that odd-order correlation functions represent nonequilibrium physics even at small external bias and high temperatures. We calculate S3=y(eV/T)e2I for a quasi-one-dimensional diffusive constriction. We calculate the scaling function y in two regimes: when the scattering processes are purely elastic and when the inelastic electron-electron scattering is strong. In both cases we find that y interpolates between two constants. In the low- (high-) temperature limit y is strongly (weakly) enhanced (suppressed) by the electron-electron scattering.

A new technique for Auger analysis of surface species subject to electron-induced desorption

NASA Technical Reports Server (NTRS)

Pepper, S. V.

1973-01-01

A method is presented to observe surface species subject to electron-induced desorption by Auger electron spectroscopy. The surface to be examined is moved under the electron beam at constant velocity, establishing a time independent condition and eliminating the time response of the electron spectrometer as a limiting factor. The dependence of the Auger signal on the surface velocity, incident electron current, beam diameter, and desorption cross section are analyzed. The method is illustrated by the Auger analysis of PTFE, in which the fluorine is removed by electron induced desorption.

Julius Edgar Lilienfeld Prize Talk: Measuring the Electron Magnetic Moment and the Fine Structure Constant

NASA Astrophysics Data System (ADS)

Gabrielse, Gerald

2011-05-01

The electron magnetic moment in Bohr magnetons has been measured to a precision of 3 parts in 1013. This measurement, with quantum electrodynamics (AED) theory, provides the most precise value of the fine structure constant. This measurement, with a value of the fine structure from other measurements, also tests QED and sets a limit on the internal structure of the electron. A one-electron quantum cyclotron is at the heart of the measurement -- an electron suspended in a magnetic field and cooled enough that its lowest cyclotron and spin quantum states can be deduced with quantum nondemolition (QND) measurements. A cylindrical Penning trap cavity inhibits spontaneous emission and feedback methods make the electron excite and sustain its own motion for detection. A new apparatus is being commissioned in pursuit of more precise measurements. Adapted methods are promising for observing a proton spin flip, which should make it possible to compare the antiproton and proton magnetic moments a million times more accurately than is currently possible.

The dc power circuits: A compilation

NASA Technical Reports Server (NTRS)

1972-01-01

A compilation of reports concerning power circuits is presented for the dissemination of aerospace information to the general public as part of the NASA Technology Utilization Program. The descriptions for the electronic circuits are grouped as follows: dc power supplies, power converters, current-voltage power supply regulators, overload protection circuits, and dc constant current power supplies.

Moderate temperature-dependent surface and volume resistivity and low-frequency dielectric constant measurements of pure and multi-walled carbon nanotube (MWCNT) doped polyvinyl alcohol thin films

NASA Astrophysics Data System (ADS)

Edwards, Matthew; Guggilla, Padmaja; Reedy, Angela; Ijaz, Quratulann; Janen, Afef; Uba, Samuel; Curley, Michael

2017-08-01

Previously, we have reported measurements of temperature-dependent surface resistivity of pure and multi-walled carbon nanotube (MWNCT) doped amorphous Polyvinyl Alcohol (PVA) thin films. In the temperature range from 22 °C to 40 °C with humidity-controlled environment, we found the surface resistivity to decrease initially, but to rise steadily as the temperature continued to increase. Moreover, electric surface current density (Js) was measured on the surface of pure and MWCNT doped PVA thin films. In this regard, the surface current density and electric field relationship follow Ohm's law at low electric fields. Unlike Ohmic conduction in metals where free electrons exist, selected captive electrons are freed or provided from impurities and dopants to become conduction electrons from increased thermal vibration of constituent atoms in amorphous thin films. Additionally, a mechanism exists that seemingly decreases the surface resistivity at higher temperatures, suggesting a blocking effect for conducting electrons. Volume resistivity measurements also follow Ohm's law at low voltages (low electric fields), and they continue to decrease as temperatures increase in this temperature range, differing from surface resistivity behavior. Moreover, we report measurements of dielectric constant and dielectric loss as a function of temperature and frequency. Both the dielectric constant and dielectric loss were observed to be highest for MWCNT doped PVA compared to pure PVA and commercial paper, and with frequency and temperature for all samples.

Mechanism of formation of subnanosecond current front in high-voltage pulse open discharge

NASA Astrophysics Data System (ADS)

Schweigert, I. V.; Alexandrov, A. L.; Zakrevsky, Dm. E.; Bokhan, P. A.

2014-11-01

The mechanism of subnanosecond current front rise observed previously in the experiment in high-voltage pulse open discharge in helium is studied in kinetic particle-in-cell simulations. The Boltzmann equations for electrons, ions, and fast atoms are solved self-consistently with the Poisson equations for the electrical potential. The partial contributions to the secondary electron emission from the ions, fast atoms, photons, and electrons, bombarding the electrode, are calculated. In simulations, as in the experiment, the discharge glows between two symmetrical cathodes and the anode grid in the midplane at P =6 Torr and the applied voltage of 20 kV. The electron avalanche development is considered for two experimental situations during the last stage of breakdown: (i) with constant voltage and (ii) with decreasing voltage. For case (i), the subnanosecond current front rise is set by photons from the collisional excitation transfer reactions. For the case (ii), the energetic electrons swamp the cathode during voltage drop and provide the secondary electron emission for the subnanosecond current rise, observed in the experiment.

Rocks, when Stressed, turn into a Battery that is Rechargeable

NASA Astrophysics Data System (ADS)

Lau, B. T.; Takeuchi, A. H.; Freund, F. T.

2006-12-01

Igneous rocks, when subjected to deviatory stresses, turn into a battery. We report on gabbro (Shanxi, China). We use steel pistons to load repeatedly ~10 cm3 in the center of 30 x 30 x 0.9 cm3 tiles, from 0 to 60 MPa, 1/3 failure strength, at 0.2 MPa/sec with 20-30 min at constant load. Instantly upon loading, a current begins to flow, increasing to 200-300 pA, equivalent to 30,000 to 50,000 A/km3. Under constant load the current continues to flow for at least 24 hrs with barely 10-20% reduction. During unloading the current stops but resumes during repetitive loading-unloading cycles for at least 22 times. One part of the current is carried by electrons. The electrons flow from the stressed rock into the steel pistons, through the external circuit to the edges of the tile. The other part is carried by holes. The holes flow inside the rock, from the stressed to the unstressed rock and to the edges of the tile. There they meet the electrons, thereby closing the circuit. Both types of charge carriers, electrons and holes, are associated with oxygen anions that changed their valence from 2- to 1- (peroxy). An O- among O2- represents a defect electron in the O2- sublattice, known as positive hole or p-hole for short. In unstressed rocks the O- exist in an electrically inactive form as O- pairs, chemically equivalent to peroxy links, O3X-OO-XO3 with X = Si4+, Al3+ etc. Deviatory stresses cause the peroxy links to break, allowing electrons from neighboring O2- to jump in and p-holes to jump out. The p-holes can spread into and through the unstressed rock using energy levels in the valence band. To observe sustained currents the battery circuit has to close.

High current densities enable exoelectrogens to outcompete aerobic heterotrophs for substrate.

PubMed

Ren, Lijiao; Zhang, Xiaoyuan; He, Weihua; Logan, Bruce E

2014-11-01

In mixed-culture microbial fuel cells (MFCs), exoelectrogens and other microorganisms compete for substrate. It has previously been assumed that substrate losses to other terminal electron acceptors over a fed-batch cycle, such as dissolved oxygen, are constant. However, a constant rate of substrate loss would only explain small increases in coulombic efficiencies (CEs, the fraction of substrate recovered as electrical current) with shorter cycle times, but not the large increases in CE that are usually observed with higher current densities and reduced cycle times. To better understand changes in CEs, COD concentrations were measured over time in fed-batch, single-chamber, air-cathode MFCs at different current densities (external resistances). COD degradation rates were all found to be first-order with respect to COD concentration, even under open circuit conditions with no current generation (first-order rate constant of 0.14 ± 0.01 h(-1) ). The rate of COD removal increased when there was current generation, with the highest rate constant (0.33 ± 0.02 h(-1) ) obtained at the lowest external resistance (100 Ω). Therefore, as the substrate concentration was reduced more quickly due to current generation, the rate of loss of substrate to non-exoelectrogens decreased due to this first-order substrate-concentration dependence. As a result, coulombic efficiencies rapidly increased due to decreased, and not constant, removal rates of substrate by non-exoelectrogens. These results show that higher current densities (lower resistances) redirect a greater percentage of substrate into current generation, enabling large increase in CEs with increased current densities. Biotechnol. Bioeng. 2014;111: 2163-2169. © 2014 Wiley Periodicals, Inc. © 2014 Wiley Periodicals, Inc.

The Measurement of e/k in the Introductory Physics Laboratory

ERIC Educational Resources Information Center

Inman, Fred W.; Miller, Carl E.

1973-01-01

The ratio of electronic charge to Boltzmann's constant can be easily determined by measuring the short-circuit collector current versus the emitter-base voltage characteristic of a silicon transistor connected in the common-base mode. (Author/DF)

Self-consistent non-stationary theory of the gyrotron

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dumbrajs, Olgierd; Nusinovich, Gregory S.

2016-08-15

For a long time, the gyrotron theory was developed assuming that the transit time of electrons through the interaction space is much shorter than the cavity fill time. Correspondingly, it was assumed that during this transit time, the amplitude of microwave oscillations remains constant. A recent interest to such additional effects as the after-cavity interaction between electrons and the outgoing wave in the output waveguide had stimulated some studies of the beam-wave interaction processes over much longer distances than a regular part of the waveguide which serves as a cavity in gyrotrons. Correspondingly, it turned out that the gyrotron theorymore » free from the assumption about constant amplitude of microwave oscillations during the electron transit time should be developed. The present paper contains some results obtained in the framework of such theory. The main attention is paid to modification of the boundary between the regions of oscillations with constant amplitude and automodulation in the plane of normalized parameters characterizing the external magnetic field and the beam current. It is shown that the theory free from the assumption about the frozen wave amplitude during the electron transit time predicts some widening of the region of automodulation.« less

Electron attachment to CF3 and CF3Br at temperatures up to 890 K: experimental test of the kinetic modeling approach.

PubMed

Shuman, Nicholas S; Miller, Thomas M; Viggiano, Albert A; Troe, Jürgen

2013-05-28

Thermal rate constants and product branching fractions for electron attachment to CF3Br and the CF3 radical have been measured over the temperature range 300-890 K, the upper limit being restricted by thermal decomposition of CF3Br. Both measurements were made in Flowing Afterglow Langmuir Probe apparatuses; the CF3Br measurement was made using standard techniques, and the CF3 measurement using the Variable Electron and Neutral Density Attachment Mass Spectrometry technique. Attachment to CF3Br proceeds exclusively by the dissociative channel yielding Br(-), with a rate constant increasing from 1.1 × 10(-8) cm(3) s(-1) at 300 K to 5.3 × 10(-8) cm(3) s(-1) at 890 K, somewhat lower than previous data at temperatures up to 777 K. CF3 attachment proceeds through competition between associative attachment yielding CF3 (-) and dissociative attachment yielding F(-). Prior data up to 600 K showed the rate constant monotonically increasing, with the partial rate constant of the dissociative channel following Arrhenius behavior; however, extrapolation of the data using a recently proposed kinetic modeling approach predicted the rate constant to turn over at higher temperatures, despite being only ~5% of the collision rate. The current data agree well with the previous kinetic modeling extrapolation, providing a demonstration of the predictive capabilities of the approach.

1998 Conference on Precision Electromagnetic Measurements Digest. Proceedings.

NASA Astrophysics Data System (ADS)

Nelson, T. L.

The following topics were dealt with: fundamental constants; caesium standards; AC-DC transfer; impedance measurement; length measurement; units; statistics; cryogenic resonators; time transfer; QED; resistance scaling and bridges; mass measurement; atomic fountains and clocks; single electron transport; Newtonian constant of gravitation; stabilised lasers and frequency measurements; cryogenic current comparators; optical frequency standards; high voltage devices and systems; international compatibility; magnetic measurement; precision power measurement; high resolution spectroscopy; DC transport standards; waveform acquisition and analysis; ion trap standards; optical metrology; quantised Hall effect; Josephson array comparisons; signal generation and measurement; Avogadro constant; microwave networks; wideband power standards; antennas, fields and EMC; quantum-based standards.

Laser collisional induced fluorescence electron density measurements as a function of ring bias and the onset of anode spot formation in a ring cusp magnetic field

NASA Astrophysics Data System (ADS)

Arthur, N. A.; Foster, J. E.; Barnat, E. V.

2018-05-01

Two-dimensional electron density measurements are made in a magnetic ring cusp discharge using laser collisional induced fluorescence. The magnet rings are isolated from the anode structure such that they can be biased independently in order to modulate electron flows through the magnetic cusps. Electron density images are captured as a function of bias voltage in order to assess the effects of current flow through the cusp on the spatial extent of the cusp. We anticipated that for a fixed current density being funneled through the magnetic cusp, the leak width would necessarily increase. Unexpectedly, the leak width, as measured by LCIF images, does not increase. This suggests that the current density is not constant, and that possibly either electrons are being heated or additional ionization events are occurring within the cusp. Spatially resolving electron temperature would be needed to determine if electrons are being heated within the cusp. We also observe breakdown of the anode magnetosheath and formation of anode spots at high bias voltage.

Theoretical derivation of anodizing current and comparison between fitted curves and measured curves under different conditions.

PubMed

Chong, Bin; Yu, Dongliang; Jin, Rong; Wang, Yang; Li, Dongdong; Song, Ye; Gao, Mingqi; Zhu, Xufei

2015-04-10

Anodic TiO2 nanotubes have been studied extensively for many years. However, the growth kinetics still remains unclear. The systematic study of the current transient under constant anodizing voltage has not been mentioned in the original literature. Here, a derivation and its corresponding theoretical formula are proposed to overcome this challenge. In this paper, the theoretical expressions for the time dependent ionic current and electronic current are derived to explore the anodizing process of Ti. The anodizing current-time curves under different anodizing voltages and different temperatures are experimentally investigated in the anodization of Ti. Furthermore, the quantitative relationship between the thickness of the barrier layer and anodizing time, and the relationships between the ionic/electronic current and temperatures are proposed in this paper. All of the current-transient plots can be fitted consistently by the proposed theoretical expressions. Additionally, it is the first time that the coefficient A of the exponential relationship (ionic current j(ion) = A exp(BE)) has been determined under various temperatures and voltages. And the results indicate that as temperature and voltage increase, ionic current and electronic current both increase. The temperature has a larger effect on electronic current than ionic current. These results can promote the research of kinetics from a qualitative to quantitative level.

Theoretical derivation of anodizing current and comparison between fitted curves and measured curves under different conditions

NASA Astrophysics Data System (ADS)

Chong, Bin; Yu, Dongliang; Jin, Rong; Wang, Yang; Li, Dongdong; Song, Ye; Gao, Mingqi; Zhu, Xufei

2015-04-01

Anodic TiO2 nanotubes have been studied extensively for many years. However, the growth kinetics still remains unclear. The systematic study of the current transient under constant anodizing voltage has not been mentioned in the original literature. Here, a derivation and its corresponding theoretical formula are proposed to overcome this challenge. In this paper, the theoretical expressions for the time dependent ionic current and electronic current are derived to explore the anodizing process of Ti. The anodizing current-time curves under different anodizing voltages and different temperatures are experimentally investigated in the anodization of Ti. Furthermore, the quantitative relationship between the thickness of the barrier layer and anodizing time, and the relationships between the ionic/electronic current and temperatures are proposed in this paper. All of the current-transient plots can be fitted consistently by the proposed theoretical expressions. Additionally, it is the first time that the coefficient A of the exponential relationship (ionic current jion = A exp(BE)) has been determined under various temperatures and voltages. And the results indicate that as temperature and voltage increase, ionic current and electronic current both increase. The temperature has a larger effect on electronic current than ionic current. These results can promote the research of kinetics from a qualitative to quantitative level.

Synthesis, morphological, electromechanical characterization of (CaMgFex)Fe1-xTi3O12-δ/PDMS nanocomposite thin films for energy storage application

NASA Astrophysics Data System (ADS)

Tripathy, Ashis; Sharma, Priyaranjan; Sahoo, Narayan

2018-03-01

At the present time, flexible and stretchable electronics has intended to use the new cutting-edge technologies for advanced electronic application. Currently, Polymers are being employed for such applications but they are not effective due to their low dielectric constant. To enhance the dielectric properties of polymer for energy storage application, it is necessary to add ceramic material of high dielectric constant to synthesize a polymer-ceramic composite. Therefore, a novel attempt has been made to enhance the dielectric properties of the Polydimethylsiloxane (PDMS) polymer by adding (CaMgFex)Fe1-xTi3O12-δ(0 90%), which can make it a potential material for advanced flexible electronic devices, energy storage and biomedical applications.

Nonlinear photomagnetism of metals: Theory of nonlinear photoinduced dc current

NASA Astrophysics Data System (ADS)

Afonin, V. V.; Gurevich, V. L.; Laiho, R.

1995-07-01

Photoinduced magnetic flux has recently been observed in normal metals exposed to light. This effect is partly due to the fact that the light reflected from a metal surface transfers to the conduction electrons some of its quasimomentum. This creates a dc surface current which, for an appropriate geometry, brings about the photomagnetic effect. There is another contribution to the current that is due to anisotropy of the probabilities of electron transitions induced by the light, in combination with diffuse reflection of the electrons at the surface. We present here a theory of the dependence of the photoinduced current on the intensity of light Q. We assume that the light intensity is either constant or the time scale of its variation is much larger than the inverse Rabi frequency corresponding to the interband electron transition. At comparatively low intensities the current is proportional to Q. At higher intensities it varies as Q1/2. The physical origin of such behavior is analyzed. Various factors that allow a lowering of the critical intensity for the onset of the nonlinear behavior are discussed.

The Effect of Constant and Pulsed Current Gas Tungsten Arc Welding on Joint Properties of 2205 Duplex Stainless Steel to 316L Austenitic Stainless Steel

NASA Astrophysics Data System (ADS)

Neissi, R.; Shamanian, M.; Hajihashemi, M.

2016-05-01

In this study, dissimilar 316L austenitic stainless steel/2205 duplex stainless steel (DSS) joints were fabricated by constant and pulsed current gas tungsten arc welding process using ER2209 DSS as a filler metal. Microstructures and joint properties were characterized using optical and electron scanning microscopy, tensile, Charpy V-notch impact and micro-hardness tests, and cyclic polarization measurements. Microstructural observations confirmed the presence of chromium nitride and delta ferrite in the heat-affected zone of DSS and 316L, respectively. In addition, there was some deviation in the austenite/ferrite ratio of the surface welding pass in comparison to the root welding pass. Besides having lower pitting potential, welded joints produced by constant current gas tungsten arc welding process, consisted of some brittle sigma phase precipitates, which resulted in some impact energy reduction. The tensile tests showed high tensile strength for the weld joints in which all the specimens were broken in 316L base metal.

Experimental determination of the effective point of measurement of cylindrical ionization chambers for high-energy photon and electron beams.

PubMed

Huang, Yanxiao; Willomitzer, Christian; Zakaria, Golam Abu; Hartmann, Guenther H

2010-01-01

Measurements of depth-dose curves in water phantom using a cylindrical ionization chamber require that its effective point of measurement is located at the measuring depth. Recommendations for the position of the effective point of measurement with respect to the central axis valid for high-energy electron and photon beams are given in dosimetry protocols. According to these protocols, the use of a constant shift P(eff) is currently recommended. However, this is still based on a very limited set of experimental results. It is therefore expected that an improved knowledge of the exact position of the effective point of measurement will further improve the accuracy of dosimetry. Recent publications have revealed that the position of the effective point of measurement is indeed varying with beam energy, field size and also with chamber geometry. The aim of this study is to investigate whether the shift of P(eff) can be taken to be constant and independent from the beam energy. An experimental determination of the effective point of measurement is presented based on a comparison between cylindrical chambers and a plane-parallel chamber using conventional dosimetry equipment. For electron beams, the determination is based on the comparison of halfvalue depth R(50) between the cylindrical chamber of interest and a well guarded plane-parallel Roos chamber. For photon beams, the depth of dose maximum, d(max), the depth of 80% dose, d(80), and the dose parameter PDD(10) were used. It was again found that the effective point of measurement for both, electron and photon beams Dosimetry, depends on the beam energy. The deviation from a constant value remains very small for photons, whereas significant deviations were found for electrons. It is therefore concluded that use of a single upstream shift value from the centre of the cylindrical chamber as recommended in current dosimetry protocols is adequate for photons, however inadequate for accurate electron beam dosimetry.

Integrated Power Adapter: Isolated Converter with Integrated Passives and Low Material Stress

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

2010-09-01

ADEPT Project: CPES at Virginia Tech is developing an extremely efficient power converter that could be used in power adapters for small, lightweight laptops and other types of mobile electronic devices. Power adapters convert electrical energy into useable power for an electronic device, and they currently waste a lot of energy when they are plugged into an outlet to power up. CPES at Virginia Tech is integrating high-density capacitors, new magnetic materials, high-frequency integrated circuits, and a constant-flux transformer to create its efficient power converter. The high-density capacitors enable the power adapter to store more energy. The new magnetic materialsmore » also increase energy storage, and they can be precisely dispensed using a low-cost ink-jet printer which keeps costs down. The high-frequency integrated circuits can handle more power, and they can handle it more efficiently. And, the constant-flux transformer processes a consistent flow of electrical current, which makes the converter more efficient.« less

Scaling laws for AC gas breakdown and implications for universality

NASA Astrophysics Data System (ADS)

Loveless, Amanda M.; Garner, Allen L.

2017-10-01

The reduced dependence on secondary electron emission and electrode surface properties makes radiofrequency (RF) and microwave (MW) plasmas advantageous over direct current (DC) plasmas for various applications, such as microthrusters. Theoretical models relating molecular constants to alternating current (AC) breakdown often fail due to incomplete understanding of both the constants and the mechanisms involved. This work derives simple analytic expressions for RF and MW breakdown, demonstrating the transition between these regimes at their high and low frequency limits, respectively. We further show that the limiting expressions for DC, RF, and MW breakdown voltage all have the same universal scaling dependence on pressure and gap distance at high pressure, agreeing with experiment.

The Sheath-less Planar Langmuir Probe

NASA Astrophysics Data System (ADS)

Cooke, D. L.

2017-12-01

The Langmuir probe is one of the oldest plasma diagnostics, provided the plasma density and species temperature from analysis of a current-voltage curve as the voltage is swept over a practically chosen range. The analysis depends on a knowledge or theory of the many factors that influence the current-voltage curve including, probe shape, size, nearby perturbations, and the voltage reference. For applications in Low Earth Orbit, the Planar Langmuir Probe, PLP, is an attractive geometry because the ram ion current is very constant over many Volts of a sweep, allowing the ion density and electron temperature to be determined independently with the same instrument, at different points on the sweep. However, when the physical voltage reference is itself small and electrically floating as with a small spacecraft, the spacecraft and probe system become a double probe where the current collection theory depends on the interaction of the spacecraft with the plasma which is generally not as simple as the probe itself. The Sheath-less PLP, SPLP, interlaces on a single ram facing surface, two variably biased probe elements, broken into many small and intertwined segments on a scale smaller than the plasma Debye length. The SPLP is electrically isolated from the rest of the spacecraft. For relative bias potentials of a few volts, the ion current to all segments of each element will be constant, while the electron currents will vary as a function of the element potential and the electron temperature. Because the segments are small, intertwined, and floating, the assembly will always present the same floating potential to the plasma, with minimal growth as a function of voltage, thus sheath-less and still planar. This concept has been modelled with Nascap, and tested with a physical model inserted into a Low Earth Orbit-like chamber plasma. Results will be presented.

Variable temperature performance of a fully screen printed transistor switch

NASA Astrophysics Data System (ADS)

Zambou, Serges; Magunje, Batsirai; Rhyme, Setshedi; Walton, Stanley D.; Idowu, M. Florence; Unuigbe, David; Britton, David T.; Härting, Margit

2016-12-01

This article reports on the variable temperature performance of a flexible printed transistor which works as a current driven switch. In this work, electronic ink is formulated from nanostructured silicon produced by milling polycrystalline silicon. The study of the silicon active layer shows that its conductivity is based on thermal activation of carriers, and could be used as active layers in active devices. We further report on the transistors switching operation and their electrical performance under variable temperature. The reliability of the transistors at constant current bias was also investigated. Analysis of the electrical transfer characteristics from 340 to 10 K showed that the printed devices' current ON/OFF ratio increases as temperature decreases making it a better switch at lower temperatures. A constant current bias on a terminal for up to six hours shows extraordinary stability in electrical performance of the device.

Nanoscale Electronic Structure of Cuprate Superconductors Investigated with Scanning Tunneling Spectroscopy

NASA Astrophysics Data System (ADS)

Williams, Tess Lawanna

Despite 25 years of intense research activity, high-temperature superconductors remain poorly understood, with the underlying pairing mechanism still unidentified. Efforts are complicated by the remarkably complex phase diagram, rich in energy-dependent charge and spin orders. In this thesis I describe the use of a Scanning Tunneling Microscope (STM) to study energy-dependent charge orders in Bi2-- yPbySr2CuO6+delta , a cuprate high-temperature superconductor. STM, a surface-sensitive probe used to map electronic structure with sub-meV energy resolution and sub-A spatial resolution, has contributed greatly to our current understanding of the cuprate high-temperature superconductors. However, STM data is acquired with a constant-current normalization condition. The measured differential conductance, g(x, y, V), is often taken to be proportional to the density of states at energy eV (where V is the voltage applied between tip and sample). In fact, due to the normalization condition, the measured g(x, y, V) is actually the quotient of the density of states at energy eV and the integrated density of states from the Fermi energy to eV. This unavoidable quotient may fold electronic structure from its true energy range into other energies. I discuss a new method to correct STM differential conductance spectra to remove the constant-current normalization condition. Using local work function measurements and the constant-current topograph, I create a map which does not suffer from the setpoint effect and contains a mixture of topographic information and properly normalized spectroscopic information. I apply this method to the extraction of the incommensurate charge modulation at q⃗˜34 2pa0 . I also extend the study of electronic nematic order, an atomic-lattice-periodic C4 → C2 symmetry breaking, from highly underdoped Bi2 Sr2CaCu2O 8+delta [28] to overdoped Bi2--yPb ySr2CuO6+/-delta. I find that the electronic nematic order parameter is robust to change of scan angle. I define and contrast three different electronic nematic orders with different phases with respect to the crystal. I discuss the effect of the choice of normalization and possible alternate explanations for the source of the calculated nematic order. Finally, I discuss a drift-correction technique, which removes picometer scale drift that is introduced into a spectral map by experimental imperfections, and characterize the optimal algorithm and potential artifacts that drift-correction may introduce.

Electron attachment to C{sub 2} fluorocarbon radicals at high temperature

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shuman, Nicholas S.; Miller, Thomas M.; Viggiano, Albert A., E-mail: afrl.rvborgmailbox@kirtland.af.mil

Thermal electron attachment to the radical species C{sub 2}F{sub 3} and C{sub 2}F{sub 5} has been studied over the temperature range 300–890 K using the Variable Electron and Neutral Density Attachment Mass Spectrometry technique. Both radicals exclusively undergo dissociative attachment to yield F{sup −}. The rate constant for C{sub 2}F{sub 5} shows little dependence over the temperature range, remaining ∼4 × 10{sup −9} cm{sup 3} s{sup −1}. The rate constant for C{sub 2}F{sub 3} attachment rises steeply with temperature from 3 × 10{sup −11} cm{sup 3} s{sup −1} at 300 K to 1 × 10{sup −9} cm{sup 3} s{sup −1} at 890 K.more » The behaviors of both species at high temperature are in agreement with extrapolations previously made from data below 600 K using a recently developed kinetic modeling approach. Measurements were also made on C{sub 2}F{sub 3}Br and C{sub 2}F{sub 5}Br (used in this work as precursors to the radicals) over the same temperature range, and, for C{sub 2}F{sub 5}Br as a function of electron temperature. The attachment rate constants to both species rise with temperature following Arrhenius behavior. The attachment rate constant to C{sub 2}F{sub 5}Br falls with increasing electron temperature, in agreement with the kinetic modeling. The current data fall in line with past predictions of the kinetic modeling approach, again showing the utility of this simplified approach.« less

Examination of the formation process of pre-solvated and solvated electron in n-alcohol using femtosecond pulse radiolysis

NASA Astrophysics Data System (ADS)

Toigawa, Tomohiro; Gohdo, Masao; Norizawa, Kimihiro; Kondoh, Takafumi; Kan, Koichi; Yang, Jinfeng; Yoshida, Yoichi

2016-06-01

The formation process of pre-solvated and solvated electron in methanol (MeOH), ethanol (EtOH), n-butanol (BuOH), and n-octanol (OcOH) were investigated using a fs-pulse radiolysis technique by observing the pre-solvated electron at 1400 nm. The formation time constants of the pre-solvated electrons were determined to be 1.2, 2.2, 3.1, and 6.3 ps for MeOH, EtOH, BuOH, and OcOH, respectively. The formation time constants of the solvated electrons were determined to be 6.7, 13.6, 22.2, and 32.9 ps for MeOH, EtOH, BuOH, and OcOH, respectively. The formation dynamics and structure of the pre-solvated and solvated electrons in n-alcohols were discussed based on relation between the obtained time constant and dielectric relaxation time constant from the view point of kinetics. The observed formation time constants of the solvated electrons seemed to be strongly correlated with the second component of the dielectric relaxation time constants, which are related to single molecule motion. On the other hand, the observed formation time constants of the pre-solvated electrons seemed to be strongly correlated with the third component of the dielectric relaxation time constants, which are related to dynamics of hydrogen bonds.

Automatic Control Of Length Of Welding Arc

NASA Technical Reports Server (NTRS)

Iceland, William F.

1991-01-01

Nonlinear relationships among current, voltage, and length stored in electronic memory. Conceptual microprocessor-based control subsystem maintains constant length of welding arc in gas/tungsten arc-welding system, even when welding current varied. Uses feedback of current and voltage from welding arc. Directs motor to set position of torch according to previously measured relationships among current, voltage, and length of arc. Signal paths marked "calibration" or "welding" used during those processes only. Other signal paths used during both processes. Control subsystem added to existing manual or automatic welding system equipped with automatic voltage control.

Module Eleven: Capacitance; Basic Electricity and Electronics Individualized Learning System.

ERIC Educational Resources Information Center

Bureau of Naval Personnel, Washington, DC.

In this module the student will learn about another circuit quantity, capacitance, and discover the effects of this component on circuit current, voltage, and power. The module is divided into seven lessons: the capacitor, theory of capacitance, total capacitance, RC (resistive-capacitive circuit) time constant, capacitive reactance, phase and…

Predicting the Rate Constant of Electron Tunneling Reactions at the CdSe-TiO2 Interface.

PubMed

Hines, Douglas A; Forrest, Ryan P; Corcelli, Steven A; Kamat, Prashant V

2015-06-18

Current interest in quantum dot solar cells (QDSCs) motivates an understanding of the electron transfer dynamics at the quantum dot (QD)-metal oxide (MO) interface. Employing transient absorption spectroscopy, we have monitored the electron transfer rate (ket) at this interface as a function of the bridge molecules that link QDs to TiO2. Using mercaptoacetic acid, 3-mercaptopropionic acid, 8-mercaptooctanoic acid, and 16-mercaptohexadecanoic acid, we observe an exponential attenuation of ket with increasing linker length, and attribute this to the tunneling of the electron through the insulating linker molecule. We model the electron transfer reaction using both rectangular and trapezoidal barrier models that have been discussed in the literature. The one-electron reduction potential (equivalent to the lowest unoccupied molecular orbital) of each molecule as determined by cyclic voltammetry (CV) was used to estimate the effective barrier height presented by each ligand at the CdSe-TiO2 interface. The electron transfer rate (ket) calculated for each CdSe-ligand-TiO2 interface using both models showed the results in agreement with the experimentally determined trend. This demonstrates that electron transfer between CdSe and TiO2 can be viewed as electron tunneling through a layer of linking molecules and provides a useful method for predicting electron transfer rate constants.

Probing the electronic transport on the reconstructed Au/Ge(001) surface

PubMed Central

Krok, Franciszek; Kaspers, Mark R; Bernhart, Alexander M; Nikiel, Marek; Jany, Benedykt R; Indyka, Paulina; Wojtaszek, Mateusz; Möller, Rolf

2014-01-01

Summary By using scanning tunnelling potentiometry we characterized the lateral variation of the electrochemical potential µec on the gold-induced Ge(001)-c(8 × 2)-Au surface reconstruction while a lateral current flows through the sample. On the reconstruction and across domain boundaries we find that µec shows a constant gradient as a function of the position between the contacts. In addition, nanoscale Au clusters on the surface do not show an electronic coupling to the gold-induced surface reconstruction. In combination with high resolution scanning electron microscopy and transmission electron microscopy, we conclude that an additional transport channel buried about 2 nm underneath the surface represents a major transport channel for electrons. PMID:25247129

Development of a tester for evaluation of prototype thermal cells and batteries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guidotti, R.A.

1994-10-01

A tester was developed to evaluate prototype thermal cells and batteries--especially high-voltage units--under a wide range of constant-current and constant-resistance discharge conditions. Programming of the steady-state and pulsing conditions was by software control or by hardware control via an external pulse generator. The tester was assembled from primarily Hewlett-Packard (H-P) instrumentation and was operated under H-P`s Rocky Mountain Basic (RMB). Constant-current electronic loads rated up to 4 kW (400 V at up to 100 A) were successfully used with the setup. For testing under constant-resistance conditions, power metal-oxide field-effect transistors (MOSFETs) controlled by a programmable pulse generator were used tomore » switch between steady-state and pulse loads. The pulses were digitized at up to a 50 kHz rate (20 {mu} s/pt) using high-speed DVMs; steady-state voltages were monitored with standard DVMs. This paper describes several of the test configurations used and discusses the limitations of each. Representative data are presented for a number of the test conditions.« less

Electron attachment to CF{sub 3} and CF{sub 3}Br at temperatures up to 890 K: Experimental test of the kinetic modeling approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shuman, Nicholas S.; Miller, Thomas M.; Viggiano, Albert A.

Thermal rate constants and product branching fractions for electron attachment to CF{sub 3}Br and the CF{sub 3} radical have been measured over the temperature range 300-890 K, the upper limit being restricted by thermal decomposition of CF{sub 3}Br. Both measurements were made in Flowing Afterglow Langmuir Probe apparatuses; the CF{sub 3}Br measurement was made using standard techniques, and the CF{sub 3} measurement using the Variable Electron and Neutral Density Attachment Mass Spectrometry technique. Attachment to CF{sub 3}Br proceeds exclusively by the dissociative channel yielding Br{sup -}, with a rate constant increasing from 1.1 Multiplication-Sign 10{sup -8} cm{sup 3} s{sup -1}more » at 300 K to 5.3 Multiplication-Sign 10{sup -8} cm{sup 3} s{sup -1} at 890 K, somewhat lower than previous data at temperatures up to 777 K. CF{sub 3} attachment proceeds through competition between associative attachment yielding CF{sub 3}{sup -} and dissociative attachment yielding F{sup -}. Prior data up to 600 K showed the rate constant monotonically increasing, with the partial rate constant of the dissociative channel following Arrhenius behavior; however, extrapolation of the data using a recently proposed kinetic modeling approach predicted the rate constant to turn over at higher temperatures, despite being only {approx}5% of the collision rate. The current data agree well with the previous kinetic modeling extrapolation, providing a demonstration of the predictive capabilities of the approach.« less

Effect of electronegative additives on physical properties and chemical activity of gas discharge plasma

NASA Astrophysics Data System (ADS)

Kuznetsov, D. L.; Filatov, I. E.; Uvarin, V. V.

2018-01-01

Effect of electronegative additives (oxygen O2, sulfur dioxide SO2, carbon disulfide CS2, and carbon tetrachloride CCl4) on physical properties and chemical activity of plasma formed by pulsed corona discharge and by non-self-sustained discharge supported by pulsed electron beam in atmospheric pressure gas mixtures was investigated. It is shown that a decrease in discharge current depends on a sort of the additive and on its concentration. The reason is the difference in rate constants of electron attachment processes for the above molecules. In experiments on volatile organic compounds (VOCs) conversion in air by streamer corona it is obtained that an addition of CCl4 both decreases the discharge current amplitude and increases the VOCs conversion degree. An installation for investigation of electron attachment processes and for study of toxic impurities conversion in plasma formed by non-self-sustained discharge initiated by pulsed nanosecond electron beam is created.

Influence of excitons interaction with charge carriers on photovoltaic parameters in organic solar cells

NASA Astrophysics Data System (ADS)

Głowienka, Damian; Szmytkowski, Jędrzej

2018-03-01

We report on theoretical analysis of excitons annihilation on charge carriers in organic solar cells. Numerical calculations based on transient one-dimensional drift-diffusion model have been carried out. An impact of three quantities (an annihilation rate constant, an exciton mobility and a recombination reduction factor) on current density and concentrations of charge carriers and excitons is investigated. Finally, we discuss the influence of excitons interaction with electrons and holes on four photovoltaic parameters (a short-circuit current, an open-circuit voltage, a fill factor and a power conversion efficiency). The conclusion is that the annihilation process visibly decreases the efficiency of organic photocells, if the annihilation rate constant is greater than 10-15m3s-1 .

Andreev current for low temperature thermometry

NASA Astrophysics Data System (ADS)

Faivre, T.; Golubev, D. S.; Pekola, J. P.

2015-05-01

We demonstrate experimentally that disorder enhanced Andreev current in a tunnel junction between a normal metal and a superconductor provides a method to measure electronic temperature, specifically at temperatures below 200 mK when aluminum is used. This Andreev thermometer has some advantages over conventional quasiparticle thermometers: For instance, it does not conduct heat and its reading does not saturate until at lower temperatures. Another merit is that the responsivity is constant over a wide temperature range.

Communication: theoretical study of ThO for the electron electric dipole moment search.

PubMed

Skripnikov, L V; Petrov, A N; Titov, A V

2013-12-14

An experiment to search for the electron electric dipole moment (eEDM) on the metastable H(3)Δ1 state of ThO molecule was proposed and now prepared by the ACME Collaboration [http://www.electronedm.org]. To interpret the experiment in terms of eEDM and dimensionless constant kT, P characterizing the strength of the T,P-odd pseudoscalar-scalar electron-nucleus neutral current interaction, an accurate theoretical study of an effective electric field on electron, Eeff, and a parameter of the T,P-odd pseudoscalar-scalar interaction, WT, P, in ThO is required. We report our results for Eeff (84 GV/cm) and WT, P (116 kHz) together with the hyperfine structure constant, molecule frame dipole moment, and H(3)Δ1 → X(1)Σ(+) transition energy, which can serve as a measure of reliability of the obtained Eeff and WT, P values. Besides, our results include a parity assignment and evaluation of the electric-field dependence for the magnetic g factors in the Ω-doublets of H(3)Δ1.

Fabrication of nylon/fullerene polymer memory

NASA Astrophysics Data System (ADS)

Jayan, Manuvel; Davis, Rosemary; Karthik, M. P.; Devika, K.; Kumar, G. Vijay; Sriraj, B.; Predeep, P.

2017-06-01

Two terminal Organic memories in passive matrix array form with device structure, Al/Nylon/ (Nylon+C60)/Nylon/ Al are fabricated. The current-voltage measurements showed hysteresis and the devices are thoroughly characterized for write-read-erase-read cycles. The control over the dispersion concentration, capacity of fullerene to readily accept electrons and the constant diameter of fullerene made possible uniform device fabrication with reproducible results. Scanning electron micrographs indicated that the device thickness remained uniform in the range of 19 micrometers.

Ultrahigh-rate supercapacitors based on eletrochemically reduced graphene oxide for ac line-filtering.

PubMed

Sheng, Kaixuan; Sun, Yiqing; Li, Chun; Yuan, Wenjing; Shi, Gaoquan

2012-01-01

The recent boom in multifunction portable electronic equipments requires the development of compact and miniaturized electronic circuits with high efficiencies, low costs and long lasting time. For the operation of most line-powered electronics, alternating current (ac) line-filters are used to attenuate the leftover ac ripples on direct current (dc) voltage busses. Today, aluminum electrolytic capacitors (AECs) are widely applied for this purpose. However, they are usually the largest components in electronic circuits. Replacing AECs by more compact capacitors will have an immense impact on future electronic devices. Here, we report a double-layer capacitor based on three-dimensional (3D) interpenetrating graphene electrodes fabricated by electrochemical reduction of graphene oxide (ErGO-DLC). At 120-hertz, the ErGO-DLC exhibited a phase angle of -84 degrees, a specific capacitance of 283 microfaradays per centimeter square and a resistor-capacitor (RC) time constant of 1.35 milliseconds, making it capable of replacing AECs for the application of 120-hertz filtering.

Ultrahigh-rate supercapacitors based on eletrochemically reduced graphene oxide for ac line-filtering

NASA Astrophysics Data System (ADS)

Sheng, Kaixuan; Sun, Yiqing; Li, Chun; Yuan, Wenjing; Shi, Gaoquan

2012-02-01

The recent boom in multifunction portable electronic equipments requires the development of compact and miniaturized electronic circuits with high efficiencies, low costs and long lasting time. For the operation of most line-powered electronics, alternating current (ac) line-filters are used to attenuate the leftover ac ripples on direct current (dc) voltage busses. Today, aluminum electrolytic capacitors (AECs) are widely applied for this purpose. However, they are usually the largest components in electronic circuits. Replacing AECs by more compact capacitors will have an immense impact on future electronic devices. Here, we report a double-layer capacitor based on three-dimensional (3D) interpenetrating graphene electrodes fabricated by electrochemical reduction of graphene oxide (ErGO-DLC). At 120-hertz, the ErGO-DLC exhibited a phase angle of -84 degrees, a specific capacitance of 283 microfaradays per centimeter square and a resistor-capacitor (RC) time constant of 1.35 milliseconds, making it capable of replacing AECs for the application of 120-hertz filtering.

Ultrahigh-rate supercapacitors based on eletrochemically reduced graphene oxide for ac line-filtering

PubMed Central

Sheng, Kaixuan; Sun, Yiqing; Li, Chun; Yuan, Wenjing; Shi, Gaoquan

2012-01-01

The recent boom in multifunction portable electronic equipments requires the development of compact and miniaturized electronic circuits with high efficiencies, low costs and long lasting time. For the operation of most line-powered electronics, alternating current (ac) line-filters are used to attenuate the leftover ac ripples on direct current (dc) voltage busses. Today, aluminum electrolytic capacitors (AECs) are widely applied for this purpose. However, they are usually the largest components in electronic circuits. Replacing AECs by more compact capacitors will have an immense impact on future electronic devices. Here, we report a double-layer capacitor based on three-dimensional (3D) interpenetrating graphene electrodes fabricated by electrochemical reduction of graphene oxide (ErGO-DLC). At 120-hertz, the ErGO-DLC exhibited a phase angle of −84 degrees, a specific capacitance of 283 microfaradays per centimeter square and a resistor-capacitor (RC) time constant of 1.35 milliseconds, making it capable of replacing AECs for the application of 120-hertz filtering. PMID:22355759

Defect and field-enhancement characterization through electron-beam-induced current analysis

NASA Astrophysics Data System (ADS)

Umezawa, Hitoshi; Gima, Hiroki; Driche, Khaled; Kato, Yukako; Yoshitake, Tsuyoshi; Mokuno, Yoshiaki; Gheeraert, Etienne

2017-05-01

To investigate the effects of defects and field enhancement in diamond power devices, a biased Schottky barrier diode was characterized by electron-beam-induced current (EBIC) analysis. The nonuniform distribution of the electrical field was revealed by bright spots on the laterally expanded depletion layer of the EBIC intensity map when the applied electrical field exceeded 0.95 MV/cm. The nonuniformity is partly due to a structural effect: the roughness at the edge of the Schottky electrode, induced by lithography and lift-off processes. A second family of spots was shown to increase the leakage current of the device. The time constant associated with this second spot family was 0.98 ms, which is three orders of magnitude shorter than that for defects previously characterized by deep-level transient spectroscopy.

Graphene Double-Layer Capacitor with ac Line-Filtering Performance

NASA Astrophysics Data System (ADS)

Miller, John R.; Outlaw, R. A.; Holloway, B. C.

2010-09-01

Electric double-layer capacitors (DLCs) can have high storage capacity, but their porous electrodes cause them to perform like resistors in filter circuits that remove ripple from rectified direct current. We have demonstrated efficient filtering of 120-hertz current with DLCs with electrodes made from vertically oriented graphene nanosheets grown directly on metal current collectors. This design minimized electronic and ionic resistances and produced capacitors with RC time constants of less than 200 microseconds, in contrast with ~1 second for typical DLCs. Graphene nanosheets have a preponderance of exposed edge planes that greatly increases charge storage as compared with that of designs that rely on basal plane surfaces. Capacitors constructed with these electrodes could be smaller than the low-voltage aluminum electrolyte capacitors that are typically used in electronic devices.

Graphene double-layer capacitor with ac line-filtering performance.

PubMed

Miller, John R; Outlaw, R A; Holloway, B C

2010-09-24

Electric double-layer capacitors (DLCs) can have high storage capacity, but their porous electrodes cause them to perform like resistors in filter circuits that remove ripple from rectified direct current. We have demonstrated efficient filtering of 120-hertz current with DLCs with electrodes made from vertically oriented graphene nanosheets grown directly on metal current collectors. This design minimized electronic and ionic resistances and produced capacitors with RC time constants of less than 200 microseconds, in contrast with ~1 second for typical DLCs. Graphene nanosheets have a preponderance of exposed edge planes that greatly increases charge storage as compared with that of designs that rely on basal plane surfaces. Capacitors constructed with these electrodes could be smaller than the low-voltage aluminum electrolyte capacitors that are typically used in electronic devices.

Inertial Currents in Isotropic Plasma

NASA Technical Reports Server (NTRS)

Heinemann, M.; Erickson, G. M.; Pontius, D. H., Jr.

1993-01-01

The magnetospheric convection electric field contributes to Birkeland currents. The effects of the field are to polarize the plasma by displacing the bounce paths of the ions from those of electrons, to redistribute the pressure so that it is not constant along magnetic field lines, and to enhance the pressure gradient by the gradient of the bulk speed. Changes in the polarization charge during the convection of the plasma are neutralized by electrons in the form of field-aligned currents that close through the ionosphere. The pressure drives field-aligned currents through its gradient in the same manner as in quasi-static plasma, but with modifications that are important if the bulk speed is of the order of the ion thermal speed; the variations in the pressure along field lines are maintained by a weak parallel potential drop. These effects are described in terms of the field-aligned currents in steady state, isotropic, MED plasma. Solutions are developed by taking the MHD limit of two-fluid solutions and illustrated in the special case of Maxwellian plasma for which the temperature is constant along magnetic field lines. The expression for the Birkeland current density is a generalization of Vasyliunas' expression for the field-aligned current density in quasi-static plasma and provides a unifying expression when both pressure gradients and ion inertia operate simultaneously as sources of field-aligned currents. It contains a full account of different aspects of the ion flow (parallel and perpendicular velocity and vorticity) that contribute to the currents. Contributions of ion inertia to field-aligned currents will occur in regions of strong velocity shear, electric field reversal, or large gradients in the parallel velocity or number density, and may be important in the low-latitude boundary layer, plasma sheet boundary layer, and the inner edge region of the plasma sheet.

Inertial currents in isotropic plasma

NASA Technical Reports Server (NTRS)

Heinemann, M.; Erickson, G. M.; Pontius, D. H. JR.

1994-01-01

The magnetospheric convection electric field contributes to Birkeland currents. The effects of the field are to polarize the plasma by displacing the bounce paths of the ions from those of electrons, to redistribute the pressure so that it is not constant along magnetic field lines, and to enhance the pressure gradient by the gradient of the bulk speed. Changes in the polarization charge during the convection of the plasma are neutralized by electrons in the form of field-aligned currents that close through the ionosphere. The pressure drives field-aligned currents through its gradient in the same manner as in quasi-static plasma, but with modifications that are important if the bulk speed is of the order of the ion thermal speed; the variations in the pressure along field lines are maintained by a weak parallel potential drop. These effects are described in terms of the field-aligned currents in steady state, isotropic, magnetohyrodynamic (MHD) plasma. Solutions are developed by taking the MHD limit of two-fluid solutions and illustrated in the special case of Maxwellian plasma for which the temperature is constant along magnetic field lines. The expression for the Birkeland current density is a generalization of Vasyliunas' expression for the field-aligned current density in quasi-static plasma and provides a unifying expression when both pressure gradients and ion inertia operate simultaneously as sources of field-aligned currents. It contains a full account of different aspects of the ion flow (parallel and perpendicular velocity and vorticity) that contribute to the currents. Contributions of ion inertia to field-aligned currents will occur in regions of strong velocity shear, electric field reversal, or large gradients in the parallel velocity or number density, and may be important in the low-latitude boundary layer, plasma sheet boundary layer, and the inner edge region of the plasma sheet.

Inertial currents in isotropic plasma

NASA Technical Reports Server (NTRS)

Heinemann, M.; Erickson, G. M.; Pontius, D. H., Jr.

1994-01-01

The magnetospheric convection electric field contributes to Birkeland currents. The effects of the field are to polarize the plasma by displacing the bounce paths of the ions from those of electrons, to redistribute the pressure so that it is not constant along magnetic field lines, and to enhance the pressure gradient by the gradient of the bulk speed. Changes in the polarization charge during the convection of the plasma are neutralized by electrons in the form of field-aligned currents that close through the ionosphere. The pressure drives field-aligned currents through its gradient in the same manner as in quasi-static plasmas, but with modifications that are important if the bulk speed is of the order of the ion thermal speed; the variations in the pressure along field lines are maintained by a weak parallel potential drop. These effects are described in terms of the field-aligned currents in steady state, isotropic, MHD plasma. Solutions are developed by taking the MHD limit ot two-fluid solutions and illustrated in the special case of Maxwellian plasma for which the temperature is constant along magnetic field lines. The expression for the Birkeland current density is a generalization of Vasyliunas' expression for the field-aligned current density in quasi-static plasma and provides a unifying expression when both pressure gradients and ion inertia operate simultaneously as sources of field-aligned currents. It contains a full account of different aspects of the ion flow (parallel and perpendicular velocity and vorticity) that contribute to the currents. Contributions of ion inertia to field-aligned currents will occur in regions of strong velocity shear, electric field reversal, or large gradients in the parallel velocity or number density, and may be important in the low-latitude boundary layer, plasma sheet boundary layer, and the inner edge region of the plasma sheet.

Hybrid electronic/optical synchronized chaos communication system.

PubMed

Toomey, J P; Kane, D M; Davidović, A; Huntington, E H

2009-04-27

A hybrid electronic/optical system for synchronizing a chaotic receiver to a chaotic transmitter has been demonstrated. The chaotic signal is generated electronically and injected, in addition to a constant bias current, to a semiconductor laser to produce an optical carrier for transmission. The optical chaotic carrier is photodetected to regenerate an electronic signal for synchronization in a matched electronic receiver The system has been successfully used for the transmission and recovery of a chaos masked message that is added to the chaotic optical carrier. Past demonstrations of synchronized chaos based, secure communication systems have used either an electronic chaotic carrier or an optical chaotic carrier (such as the chaotic output of various nonlinear laser systems). This is the first electronic/optical hybrid system to be demonstrated. We call this generation of a chaotic optical carrier by electronic injection.

LabVIEW Serial Driver Software for an Electronic Load

NASA Technical Reports Server (NTRS)

Scullin, Vincent; Garcia, Christopher

2003-01-01

A LabVIEW-language computer program enables monitoring and control of a Transistor Devices, Inc., Dynaload WCL232 (or equivalent) electronic load via an RS-232 serial communication link between the electronic load and a remote personal computer. (The electronic load can operate at constant voltage, current, power consumption, or resistance.) The program generates a graphical user interface (GUI) at the computer that looks and acts like the front panel of the electronic load. Once the electronic load has been placed in remote-control mode, this program first queries the electronic load for the present values of all its operational and limit settings, and then drops into a cycle in which it reports the instantaneous voltage, current, and power values in displays that resemble those on the electronic load while monitoring the GUI images of pushbuttons for control actions by the user. By means of the pushbutton images and associated prompts, the user can perform such operations as changing limit values, the operating mode, or the set point. The benefit of this software is that it relieves the user of the need to learn one method for operating the electronic load locally and another method for operating it remotely via a personal computer.

Interfacial electronic structure and full spectral Hamaker constants of Si{sub 3}N{sub 4} intergranular films from VUV and SR-VEEL spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

French, R.H.; Scheu, C.; Duscher, G.

1995-09-01

The interfacial electronic structure, presented as the interband transition strength J{sub cv}({omega}) of the interatomic bonds, can be determined by Kramers Kronig (KK) analysis of vacuum ultraviolet (VUV) reflectance or spatially resolved valence electron energy loss (SR-VEEL) spectra. For the wetted interfaces in Si{sub 3}N{sub 4}, equilibrium thin glass films are formed whose thickness is determined by a force balance between attractive and repulsive force terms KK analysis of J{sub cv}({omega}) to yield {var_epsilon}{sub 2}({xi}) for the phases present, permits the direct calculation of the configuration-dependent Hamaker constants for the attractive vdW forces from the interfacial electronic structure. Interband transitionmore » strengths and full spectral Hamaker constants for Si{sub 3}N{sub 4}samples containing a SiYAlON glass have been determined using SR-VEELS from grains and grain boundaries and compared with results from bulk VUV spectroscopy on separate samples of glass and nitride. The A{sub 121}Hamaker constant for Si{sub 3}N{sub 4} with glass of the bulk composition is 8 zJ (zJ = 10{sup {minus}21}J) from the more established optical method. The EELS method permits the determination of vdW forces based upon actual local compositions and structure, which may differ noticeably from bulk standards. Current results show that full spectral Hamaker constants determined from VUV and SR-VEEL measurements of uniform bulk samples agree, but care must be take in the single scattering and zero loss subtraction corrections, and more work is ongoing in this area. Still the results show that for the grain boundary films present in these polycrystalline Si{sub 3}N{sub 4} samples the glass composition is of lower index of refraction. This can arise from increased oxygen content in determined in situ from the SR-VEELS of a particular grain boundary film. 45 refs.« less

Investigations on the Influence of Parameters During Electron Beam Surface Hardening Using the Flash Technique

NASA Astrophysics Data System (ADS)

Grafe, S.; Hengst, P.; Buchwalder, A.; Zenker, R.

2018-06-01

The electron beam hardening (EBH) process is one of today’s most innovative industrial technologies. Due to the almost inertia-free deflection of the EB (up to 100 kHz), the energy transfer function can be adapted locally to the component geometry and/or loading conditions. The current state-of-the-art technology is that of EBH with continuous workpiece feed. Due to the large range of parameters, the potentials and limitations of EBH using the flash technique (without workpiece feed) have not been investigated sufficiently to date. The aim of this research was to generate surface isothermal energy transfer within the flash field. This paper examines the effects of selected process parameters on the EBH surface layer microstructure and the properties achieved when treating hardened and tempered C45E steel. When using constant point distribution within the flash field and a constant beam current, surface isothermal energy input was not generated. However, by increasing the deflection frequency, point density and beam current, a more homogeneous EBH surface layer microstructure could be achieved, along with higher surface hardness and greater surface hardening depths. Furthermore, using temperature-controlled power regulation, surface isothermal energy transfer could be realised over a larger area in the centre of the sample.

Plasma parameters in a multidipole plasma system

NASA Astrophysics Data System (ADS)

Ruscanu, D.; Anita, V.; Popa, G.

Plasma potential and electron number densities and electron temperatures under bi-Maxwellian approximation for electron distribution function of the multidipole argon plasma source system were measured for a gas pressure ranging between 10-4 and 10-3 mbar and an anode-cathode voltage ranging between 40 and 120 V but a constant discharge current intensity. The first group, as ultimate or cold electrons and main electron plasma population, results by trapping of the slow electrons produced by ionisation process due to primary-neutral collisions. The trapping process is produced by potential well due to positive plasma potential with respect to the anode so that electron temperature of the ultimate electrons does not depend on both the gas pressure and discharge voltage. The second group, as secondary or hot electrons, results as degrading process of the primaries and their number density increases while their temperature decreases with the increase of both the gas pressure and discharge voltage.

HTS cryogenic current comparator for non-invasive sensing of charged-particle beams

NASA Astrophysics Data System (ADS)

Hao, L.; Gallop, J. C.; Macfarlane, J. C.; Carr, C.

2002-03-01

The principle of the superconducting cryogenic direct-current comparator (CCC) is applied to the non-invasive sensing of charged-particle beams (ions, electrons). With the use of HTS components it is feasible to envisage applications, for example, in precision mass spectrometry, in real-time monitoring of ion-beam implantation currents and for the determination of the Faraday fundamental constant. We have developed a novel current concentrating technique using HTS thick-film material, to increase the sensitivity of the CCC. Recent simulations and experimental measurements of the flux and current concentration ratios, frequency response and linearity of a prototype HTS-CCC operating at 77 K are described.

Kinetics of NH3 -oxidation, NO-turnover, N2 O-production and electron flow during oxygen depletion in model bacterial and archaeal ammonia oxidisers.

PubMed

Hink, Linda; Lycus, Pawel; Gubry-Rangin, Cécile; Frostegård, Åsa; Nicol, Graeme W; Prosser, James I; Bakken, Lars R

2017-12-01

Ammonia oxidising bacteria (AOB) are thought to emit more nitrous oxide (N 2 O) than ammonia oxidising archaea (AOA), due to their higher N 2 O yield under oxic conditions and denitrification in response to oxygen (O 2 ) limitation. We determined the kinetics of growth and turnover of nitric oxide (NO) and N 2 O at low cell densities of Nitrosomonas europaea (AOB) and Nitrosopumilus maritimus (AOA) during gradual depletion of TAN (NH 3  + NH4+) and O 2 . Half-saturation constants for O 2 and TAN were similar to those determined by others, except for the half-saturation constant for ammonium in N. maritimus (0.2 mM), which is orders of magnitudes higher than previously reported. For both strains, cell-specific rates of NO turnover and N 2 O production reached maxima near O 2 half-saturation constant concentration (2-10 μM O 2 ) and decreased to zero in response to complete O 2 -depletion. Modelling of the electron flow in N. europaea demonstrated low electron flow to denitrification (≤1.2% of the total electron flow), even at sub-micromolar O 2 concentrations. The results corroborate current understanding of the role of NO in the metabolism of AOA and suggest that denitrification is inconsequential for the energy metabolism of AOB, but possibly important as a route for dissipation of electrons at high ammonium concentration. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Transport simulation of EAST long-pulse H-mode discharge with integrated modeling

NASA Astrophysics Data System (ADS)

Wu, M. Q.; Li, G. Q.; Chen, J. L.; Du, H. F.; Gao, X.; Ren, Q. L.; Li, K.; Chan, Vincent; Pan, C. K.; Ding, S. Y.; Jian, X.; Zhu, X.; Lian, H.; Qian, J. P.; Gong, X. Z.; Zang, Q.; Duan, Y. M.; Liu, H. Q.; Lyu, B.

2018-04-01

In the 2017 EAST experimental campaign, a steady-state long-pulse H-mode discharge lasting longer than 100 s has been obtained using only radio frequency heating and current drive, and the confinement quality is slightly better than standard H-mode, H98y2 ~ 1.1, with stationary peaked electron temperature profiles. Integrated modeling of one long-pulse H-mode discharge in the 2016 EAST experimental campaign has been performed with equilibrium code EFIT, and transport codes TGYRO and ONETWO under integrated modeling framework OMFIT. The plasma current is fully-noninductively driven with a combination of ~2.2 MW LHW, ~0.3 MW ECH and ~1.1 MW ICRF. Time evolution of the predicted electron and ion temperature profiles through integrated modeling agree closely with that from measurements. The plasma current (I p ~ 0.45 MA) and electron density are kept constantly. A steady-state is achieved using integrated modeling, and the bootstrap current fraction is ~28%, the RF drive current fraction is ~72%. The predicted current density profile matches the experimental one well. Analysis shows that electron cyclotron heating (ECH) makes large contribution to the plasma confinement when heating in the core region while heating in large radius does smaller improvement, also a more peaked LHW driven current profile is got when heating in the core. Linear analysis shows that the high-k modes instability (electron temperature gradient driven modes) is suppressed in the core region where exists weak electron internal transport barriers. The trapped electron modes dominates in the low-k region, which is mainly responsible for driving the electron energy flux. It is found that the ECH heating effect is very local and not the main cause to sustained the good confinement, the peaked current density profile has the most important effect on plasma confinement improvement. Transport analysis of the long-pulse H-mode experiments on EAST will be helpful to build future experiments.

Lightning protection of aircraft

NASA Technical Reports Server (NTRS)

Fisher, F. A.; Plumer, J. A.

1977-01-01

The current knowledge concerning potential lightning effects on aircraft and the means that are available to designers and operators to protect against these effects are summarized. The increased use of nonmetallic materials in the structure of aircraft and the constant trend toward using electronic equipment to handle flight-critical control and navigation functions have served as impetus for this study.

Efficiency Analysis of a High-Specific Impulse Hall Thruster

NASA Technical Reports Server (NTRS)

Jacobson, David (Technical Monitor); Hofer, Richard R.; Gallimore, Alec D.

2004-01-01

Performance and plasma measurements of the high-specific impulse NASA-173Mv2 Hall thruster were analyzed using a phenomenological performance model that accounts for a partially-ionized plasma containing multiply-charged ions. Between discharge voltages of 300 to 900 V, the results showed that although the net decrease of efficiency due to multiply-charged ions was only 1.5 to 3.0 percent, the effects of multiply-charged ions on the ion and electron currents could not be neglected. Between 300 to 900 V, the increase of the discharge current was attributed to the increasing fraction of multiply-charged ions, while the maximum deviation of the electron current from its average value was only +5/-14 percent. These findings revealed how efficient operation at high-specific impulse was enabled through the regulation of the electron current with the applied magnetic field. Between 300 to 900 V, the voltage utilization ranged from 89 to 97 percent, the mass utilization from 86 to 90 percent, and the current utilization from 77 to 81 percent. Therefore, the anode efficiency was largely determined by the current utilization. The electron Hall parameter was nearly constant with voltage, decreasing from an average of 210 at 300 V to an average of 160 between 400 to 900 V. These results confirmed our claim that efficient operation can be achieved only over a limited range of Hall parameters.

Optical control of spin-dependent thermal transport in a quantum ring

NASA Astrophysics Data System (ADS)

Abdullah, Nzar Rauf

2018-05-01

We report on calculation of spin-dependent thermal transport through a quantum ring with the Rashba spin-orbit interaction. The quantum ring is connected to two electron reservoirs with different temperatures. Tuning the Rashba coupling constant, degenerate energy states are formed leading to a suppression of the heat and thermoelectric currents. In addition, the quantum ring is coupled to a photon cavity with a single photon mode and linearly polarized photon field. In a resonance regime, when the photon energy is approximately equal to the energy spacing between two lowest degenerate states of the ring, the polarized photon field can significantly control the heat and thermoelectric currents in the system. The roles of the number of photon initially in the cavity, and electron-photon coupling strength on spin-dependent heat and thermoelectric currents are presented.

Graphene Mechanics: Current Status and Perspectives.

PubMed

Galiotis, Costas; Frank, Otakar; Koukaras, Emmanuel N; Sfyris, Dimitris

2015-01-01

The mechanical properties of 2D materials such as monolayer graphene are of extreme importance for several potential applications. We summarize the experimental and theoretical results to date on mechanical loading of freely suspended or fully supported graphene. We assess the obtained axial properties of the material in tension and compression and comment on the methods used for deriving the various reported values. We also report on past and current efforts to define the elastic constants of graphene in a 3D representation. Current areas of research that are concerned with the effect of production method and/or the presence of defects upon the mechanical integrity of graphene are also covered. Finally, we examine extensively the work related to the effect of graphene deformation upon its electronic properties and the possibility of employing strained graphene in future electronic applications.

Evidence for electron-based ion generation in radio-frequency ionization.

PubMed

Olaitan, Abayomi D; Zekavat, Behrooz; Solouki, Touradj

2016-01-01

Radio-frequency ionization (RFI) is a novel ionization method coupled to mass spectrometry (MS) for analysis of semi-volatile and volatile organic compounds (VOCs). Despite the demonstrated capabilities of RFI MS for VOC analysis in both positive- and negative-ion modes, mechanism of RFI is not completely understood. Improved understanding of the ion generation process in RFI should expand its utility in MS. Here, we studied the possibility of electron emission in RFI using both direct charged particle current measurements and indirect electron detection in a 9.4-T Fourier transform-ion cyclotron resonance (FT-ICR) mass spectrometer. We show that RF-generated electrons can be trapped in the ICR cell and, subsequently, reacted with neutral hexafluorobenzene (C6 F6 ) molecules to generate C6 F6 (●-) . Intensity of observed C6 F6 (●-) species correlated with the number of trapped electrons and decreased as a function of electron quenching period. We also measured the electron attachment rate constant of hexafluorobenzene using a post-RF electron trapping experiment. Measured electron attachment rate constant of hexafluorobenzene (1.19 (±0.53) × 10(-9)  cm(3)  molecule(-1)  s(-1) ) for post-RF FT-ICR MS agreed with the previously reported value (1.60 (±0.30) × 10(-9)  cm(3)  molecule(-1)  s(-1) ) from low-pressure ICR MS measurements. Experimental results from direct and indirect electron measurements suggest that RFI process involves RF-generated electrons under ultrahigh vacuum conditions. Copyright © 2015 John Wiley & Sons, Ltd.

Generation of a pulsed low-energy electron beam using the channel spark device

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elgarhy, M. A. I., E-mail: elgarhy@azhar.edu.eg; Hassaballa, S. E.; Rashed, U. M.

2015-12-15

For the generation of low-energy electron beam, the design and characteristics of channel spark discharge (CSD) operating at a low voltage are presented in this paper. The discharge voltage, discharge current, X-ray emissions, and electron beam current were experimentally determined. The effects of the applied voltage, working gas pressure, and external capacitance on the CSD and beam parameters were measured. At an applied voltage of 11 kV, an oxygen gas pressure of 25 mTorr, and an external capacitance of 16.45 nF, the maximum measured current was 900 A. The discharge current increased with the increase in the pressure and capacitance,more » while its periodic time decreased with the increase in the pressure. Two types of the discharge were identified and recorded: the hollow cathode discharge and the conduction discharge. A Faraday cup was used to measure the beam current. The maximum measured beam current was 120 A, and the beam signal exhibited two peaks. The increase in both the external capacitance and the applied discharge voltage increased the maximum electron beam current. The electron-beam pulse time decreased with the increase in the gas pressure at a constant voltage and increased with the decrease in the applied discharge voltage. At an applied voltage of 11 kV and an oxygen gas pressure of 15 mTorr, the maximum beam energy was 2.8 keV. The X-ray signal intensity decreased with the increase in the gas pressure and increased with the increase in the capacitance.« less

Microscopic theoretical study of frequency dependent dielectric constant of heavy fermion systems

NASA Astrophysics Data System (ADS)

Shadangi, Keshab Chandra; Rout, G. C.

2017-05-01

The dielectric polarization and the dielectric constant plays a vital role in the deciding the properties of the Heavy Fermion Systems. In the present communication we consider the periodic Anderson's Model which consists of conduction electron kinetic energy, localized f-electron kinetic energy and the hybridization between the conduction and localized electrons, besides the Coulomb correlation energy. We calculate dielectric polarization which involves two particle Green's functions which are calculated by using Zubarev's Green's function technique. Using the equations of motion of the fermion electron operators. Finally, the temperature and frequency dependent dielectric constant is calculated from the dielectric polarization function. The charge susceptibility and dielectric constant are computed numerically for different physical parameters like the position (Ef) of the f-electron level with respect to fermi level, the strength of the hybridization (V) between the conduction and localized f-electrons, Coulomb correlation potential temperature and optical phonon wave vector (q). The results will be discussed in a reference to the experimental observations of the dielectric constants.

Can the Dielectric Constant of Fullerene Derivatives Be Enhanced by Side-Chain Manipulation? A Predictive First-Principles Computational Study.

PubMed

Sami, Selim; Haase, Pi A B; Alessandri, Riccardo; Broer, Ria; Havenith, Remco W A

2018-04-19

The low efficiency of organic photovoltaic (OPV) devices has often been attributed to the strong Coulombic interactions between the electron and hole, impeding the charge separation process. Recently, it has been argued that by increasing the dielectric constant of materials used in OPVs, this strong interaction could be screened. In this work, we report the application of periodic density functional theory together with the coupled perturbed Kohn-Sham method to calculate the electronic contribution to the dielectric constant for fullerene C 60 derivatives, a ubiquitous class of molecules in the field of OPVs. The results show good agreement with experimental data when available and also reveal an important undesirable outcome when manipulating the side chain to maximize the static dielectric constant: in all cases, the electronic contribution to the dielectric constant decreases as the side chain increases in size. This information should encourage both theoreticians and experimentalists to further investigate the relevance of contributions to the dielectric constant from slower processes like vibrations and dipolar reorientations for facilitating the charge separation, because electronically, enlarging the side chain of conventional fullerene derivatives only lowers the dielectric constant, and consequently, their electronic dielectric constant is upper bound by the one of C 60 .

Can the Dielectric Constant of Fullerene Derivatives Be Enhanced by Side-Chain Manipulation? A Predictive First-Principles Computational Study

PubMed Central

2018-01-01

The low efficiency of organic photovoltaic (OPV) devices has often been attributed to the strong Coulombic interactions between the electron and hole, impeding the charge separation process. Recently, it has been argued that by increasing the dielectric constant of materials used in OPVs, this strong interaction could be screened. In this work, we report the application of periodic density functional theory together with the coupled perturbed Kohn–Sham method to calculate the electronic contribution to the dielectric constant for fullerene C60 derivatives, a ubiquitous class of molecules in the field of OPVs. The results show good agreement with experimental data when available and also reveal an important undesirable outcome when manipulating the side chain to maximize the static dielectric constant: in all cases, the electronic contribution to the dielectric constant decreases as the side chain increases in size. This information should encourage both theoreticians and experimentalists to further investigate the relevance of contributions to the dielectric constant from slower processes like vibrations and dipolar reorientations for facilitating the charge separation, because electronically, enlarging the side chain of conventional fullerene derivatives only lowers the dielectric constant, and consequently, their electronic dielectric constant is upper bound by the one of C60. PMID:29561616

Electronic Properties of Grain Boundaries in GaAs: A Study of Oriented Bicrystals Prepared by Epitaxial Lateral Overgrowth.

DTIC Science & Technology

1984-05-10

overgrowth from a spoke 90 pattern of radial stripe openings at 1 intervals on an Si0 2 coated (110) surface. Bright regions are GaAs and dark regions are Si0...the dark current for such an ideal device is given by Idark - Io[exp(eVbi/AokT) - 1] , (11-l) where Io is a proportionality constant describing the...recombination and leakage currents which contribute to an increased dark current. The value of Voc is determined by the built-in junction barrier height and the

Reliability Assessment of Critical Electronic Components

DTIC Science & Technology

1992-07-01

Failures FLHP - Full Horse Power FSN - Federal Stock Number I Current IC - Integrated Circuit IPB - Illustrated Parts Breakdown K - Boltzmans Constant L...Classified P - Power PC - Printed Circuit PCB - Printed Circuit Board PGA - Pin Grid Array PPM - Parts Per Million PWB - Printed Wiring Board 0...4-59 4.4.3.2.3 Circuit Brcakers ......................................................... 4-59 4.4.3.2.4 Thermal

Calculation of nuclear spin-spin coupling constants using frozen density embedding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Götz, Andreas W., E-mail: agoetz@sdsc.edu; Autschbach, Jochen; Visscher, Lucas, E-mail: visscher@chem.vu.nl

2014-03-14

We present a method for a subsystem-based calculation of indirect nuclear spin-spin coupling tensors within the framework of current-spin-density-functional theory. Our approach is based on the frozen-density embedding scheme within density-functional theory and extends a previously reported subsystem-based approach for the calculation of nuclear magnetic resonance shielding tensors to magnetic fields which couple not only to orbital but also spin degrees of freedom. This leads to a formulation in which the electron density, the induced paramagnetic current, and the induced spin-magnetization density are calculated separately for the individual subsystems. This is particularly useful for the inclusion of environmental effects inmore » the calculation of nuclear spin-spin coupling constants. Neglecting the induced paramagnetic current and spin-magnetization density in the environment due to the magnetic moments of the coupled nuclei leads to a very efficient method in which the computationally expensive response calculation has to be performed only for the subsystem of interest. We show that this approach leads to very good results for the calculation of solvent-induced shifts of nuclear spin-spin coupling constants in hydrogen-bonded systems. Also for systems with stronger interactions, frozen-density embedding performs remarkably well, given the approximate nature of currently available functionals for the non-additive kinetic energy. As an example we show results for methylmercury halides which exhibit an exceptionally large shift of the one-bond coupling constants between {sup 199}Hg and {sup 13}C upon coordination of dimethylsulfoxide solvent molecules.« less

Temporal evolution of the electric field accelerating electrons away from the auroral ionosphere.

PubMed

Marklund, G T; Ivchenko, N; Karlsson, T; Fazakerley, A; Dunlop, M; Lindqvist, P A; Buchert, S; Owen, C; Taylor, M; Vaivalds, A; Carter, P; André, M; Balogh, A

2001-12-13

The bright night-time aurorae that are visible to the unaided eye are caused by electrons accelerated towards Earth by an upward-pointing electric field. On adjacent geomagnetic field lines the reverse process occurs: a downward-pointing electric field accelerates electrons away from Earth. Such magnetic-field-aligned electric fields in the collisionless plasma above the auroral ionosphere have been predicted, but how they could be maintained is still a matter for debate. The spatial and temporal behaviour of the electric fields-a knowledge of which is crucial to an understanding of their nature-cannot be resolved uniquely by single satellite measurements. Here we report on the first observations by a formation of identically instrumented satellites crossing a beam of upward-accelerated electrons. The structure of the electric potential accelerating the beam grew in magnitude and width for about 200 s, accompanied by a widening of the downward-current sheet, with the total current remaining constant. The 200-s timescale suggests that the evacuation of the electrons from the ionosphere contributes to the formation of the downward-pointing magnetic-field-aligned electric fields. This evolution implies a growing load in the downward leg of the current circuit, which may affect the visible discrete aurorae.

Design and Evaluation of a Clock Multiplexing Circuit for the SSRL Booster Accelerator Timing System - Oral Presentation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Araya, Million

2015-08-25

SPEAR3 is a 234 m circular storage ring at SLAC’s synchrotron radiation facility (SSRL) in which a 3 GeV electron beam is stored for user access. Typically the electron beam decays with a time constant of approximately 10hr due to electron lose. In order to replenish the lost electrons, a booster synchrotron is used to accelerate fresh electrons up to 3GeV for injection into SPEAR3. In order to maintain a constant electron beam current of 500mA, the injection process occurs at 5 minute intervals. At these times the booster synchrotron accelerates electrons for injection at a 10Hz rate. A 10Hzmore » 'injection ready' clock pulse train is generated when the booster synchrotron is operating. Between injection intervalswhere the booster is not running and hence the 10 Hz ‘injection ready’ signal is not present-a 10Hz clock is derived from the power line supplied by Pacific Gas and Electric (PG&E) to keep track of the injection timing. For this project I constructed a multiplexing circuit to 'switch' between the booster synchrotron 'injection ready' clock signal and PG&E based clock signal. The circuit uses digital IC components and is capable of making glitch-free transitions between the two clocks. This report details construction of a prototype multiplexing circuit including test results and suggests improvement opportunities for the final design.« less

Design and Evaluation of a Clock Multiplexing Circuit for the SSRL Booster Accelerator Timing System - Final Paper

DOE Office of Scientific and Technical Information (OSTI.GOV)

Araya, Million

2015-08-21

SPEAR3 is a 234 m circular storage ring at SLAC’s synchrotron radiation facility (SSRL) in which a 3 GeV electron beam is stored for user access. Typically the electron beam decays with a time constant of approximately 10hr due to electron lose. In order to replenish the lost electrons, a booster synchrotron is used to accelerate fresh electrons up to 3GeV for injection into SPEAR3. In order to maintain a constant electron beam current of 500mA, the injection process occurs at 5 minute intervals. At these times the booster synchrotron accelerates electrons for injection at a 10Hz rate. A 10Hzmore » 'injection ready' clock pulse train is generated when the booster synchrotron is operating. Between injection intervals-where the booster is not running and hence the 10 Hz ‘injection ready’ signal is not present-a 10Hz clock is derived from the power line supplied by Pacific Gas and Electric (PG&E) to keep track of the injection timing. For this project I constructed a multiplexing circuit to 'switch' between the booster synchrotron 'injection ready' clock signal and PG&E based clock signal. The circuit uses digital IC components and is capable of making glitch-free transitions between the two clocks. This report details construction of a prototype multiplexing circuit including test results and suggests improvement opportunities for the final design.« less

Wavelength dependence and multiple-induced states in photoresponses of copper phthalocyanine-doped gold nanoparticle single-electron device

NASA Astrophysics Data System (ADS)

Yamamoto, Makoto; Ueda, Rieko; Terui, Toshifumi; Imazu, Keisuke; Tamada, Kaoru; Sakano, Takeshi; Matsuda, Kenji; Ishii, Hisao; Noguchi, Yutaka

2014-01-01

We have proposed a gold nanoparticle (GNP)-based single-electron transistor (SET) doped with a dye molecule, where the molecule works as a photoresponsive floating gate. Here, we examined the source-drain current (I_{\\text{SD}}) at a constant drain voltage under light irradiation with various wavelengths ranging from 400 to 700 nm. Current change was enhanced at the wavelengths of 600 and 700 nm, corresponding to the optical absorption band of the doped molecule (copper phthalocyanine: CuPc). Moreover, several peaks appear in the histograms of I_{\\text{SD}} during light irradiation, indicating that multiple discrete states were induced in the device. The results suggest that the current change was initiated by the light absorption of CuPc and multiple CuPc molecules near the GNP working as a floating gate. Molecular doping can activate advanced device functions in GNP-based SETs.

Infrared photoemitting diode having reduced work function

DOEpatents

Hirschfeld, T.B.

1982-05-06

In electro-optical detectors which include as elements a photoemitting photocathode and anode, a photoemitting diode is fabricated which lowers the diode's work function, thus reducing the cooling requirement typically needed for this type of device. The work function is reduced by sandwiching between the photocathode and anode a liquid meidum of the formula NR/sub 3/ and having an electron affinity for the electrons of the photocathode, which liquid medium permits free electrons leaving the photocathode to remain as stable solvated species in the liquid medium. Thus, highly light-absorbent, and therefore thin, metallic layers can be used for detection, thereby reducing dark current at a given temperature, with a consequent reduction in cooling requirements at constant detector performance.

Infrared photoemitting diode having reduced work function

DOEpatents

Hirschfeld, Tomas B.

1984-01-01

In electro-optical detectors which include as elements a photoemitting photocathode and anode, a photoemitting diode is fabricated which lowers the diode's work function, thus reducing the cooling requirement typically needed for this type of device. The work function is reduced by sandwiching between the photocathode and anode a liquid medium of the formula NR.sub.3 and having an electron affinity for the electrons of the photocathode, which liquid medium permits free electrons leaving the photocathode to remain as stable solvated species in the liquid medium. Thus, highly light-absorbent, and therefore thin, metallic layers can be used for detection, thereby reducing dark current at a given temperature, with a consequent reduction in cooling requirements at constant detector performance.

Mapping the plasmon response of Ag nanoislands on graphite at 100 nm resolution with scanning probe energy loss spectroscopy

NASA Astrophysics Data System (ADS)

Murphy, Shane; Bauer, Karl; Sloan, Peter A.; Lawton, James J.; Tang, Lin; Palmer, Richard E.

2015-12-01

We demonstrate plasmon mapping of Ag nanostructures on graphite using scanning probe energy loss spectroscopy (SPELS) with a spatial resolution of 100 nm. In SPELS, an STM tip is used as a localized source of field-emitted electrons to probe the sample surface. The energy loss spectrum of the backscattered electrons is measured to provide a chemical signature of the surface under the tip. We acquire three images simultaneously with SPELS: i) constant-current field-emission images, which provide topographical information; ii) backscattered electron images, which display material contrast; and iii) SPELS images, where material-dependent features such as plasmons are mapped.

Impact ionization and transport properties of hexagonal boron nitride in a constant-voltage measurement

NASA Astrophysics Data System (ADS)

Hattori, Yoshiaki; Taniguchi, Takashi; Watanabe, Kenji; Nagashio, Kosuke

2018-01-01

The electrical evaluation of the crystallinity of hexagonal boron nitride (h -BN) is still limited to the measurement of dielectric breakdown strength, in spite of its importance as the substrate for two-dimensional van der Waals heterostructure devices. In this study, physical phenomena for degradation and failure in exfoliated single-crystal h -BN films were investigated using the constant-voltage stress test. At low electrical fields, the current gradually reduced and saturated with time, while the current increased at electrical fields higher than ˜8 MV /cm and finally resulted in the catastrophic dielectric breakdown. These transient behaviors may be due to carrier trapping to the defect sites in h -BN because trapped carriers lower or enhance the electrical fields in h -BN depending on their polarities. The key finding is the current enhancement with time at the high electrical field, suggesting the accumulation of electrons generated by the impact ionization process. Therefore, a theoretical model including the electron generation rate by an impact ionization process was developed. The experimental data support the expected degradation mechanism of h -BN. Moreover, the impact ionization coefficient was successfully extracted, which is comparable to that of Si O2 , even though the fundamental band gap for h -BN is smaller than that for Si O2 . Therefore, the dominant impact ionization in h -BN could be band-to-band excitation, not defect-assisted impact ionization.

Evaluation of the Ca/P concentration ratio in hydroxyapatite by STEM-EDXS: influence of the electron irradiation dose and temperature processing

NASA Astrophysics Data System (ADS)

Benhayoune, H.; Charlier, D.; Jallot, E.; Laquerriere, P.; Balossier, G.; Bonhomme, P.

2001-01-01

Biomaterials used in dental and orthopaedic surgery to fill bony loss and to coat prostheses are either of natural or synthetic origin. Amongst these biomaterials, hydroxyapatites (HA) offer good properties of biocompatibility and bioactivity when they interact with bone. This interaction depends mainly on the physico-chemical properties of HA particles. In this work, using a scanning transmission electronic microscope equipped with an Si(Li) detector for x-ray analysis, we analysed three kinds of hydroxyapatite: non-sintered particles, 600 °C sintered particles and 1180 °C sintered particles. Then, we determined the Ca/P concentration ratio in order to observe the influence of the temperature processing on this ratio. Concurrently, we carried out measurements on the HA powders by varying the electron irradiation dose either with the current density or with irradiation time. When the electron irradiation dose varied with the current density (at constant and short irradiation time), the Ca/P concentration ratio did not vary. But, at fixed current density and increasing irradiation time, the calcium and phosphorus intensities decreased, leading to an increase of the Ca/P concentration ratio at high electron irradiation dose. This phenomenon represents a mass loss of the specimen during electronic bombardment. We propose an experimental procedure to avoid all these problems.

A new evaluation method of electron optical performance of high beam current probe forming systems.

PubMed

Fujita, Shin; Shimoyama, Hiroshi

2005-10-01

A new numerical simulation method is presented for the electron optical property analysis of probe forming systems with point cathode guns such as cold field emitters and the Schottky emitters. It has long been recognized that the gun aberrations are important parameters to be considered since the intrinsically high brightness of the point cathode gun is reduced due to its spherical aberration. The simulation method can evaluate the 'threshold beam current I(th)' above which the apparent brightness starts to decrease from the intrinsic value. It is found that the threshold depends on the 'electron gun focal length' as well as on the spherical aberration of the gun. Formulas are presented to estimate the brightness reduction as a function of the beam current. The gun brightness reduction must be included when the probe property (the relation between the beam current l(b) and the probe size on the sample, d) of the entire electron optical column is evaluated. Formulas that explicitly consider the gun aberrations into account are presented. It is shown that the probe property curve consists of three segments in the order of increasing beam current: (i) the constant probe size region, (ii) the brightness limited region where the probe size increases as d approximately I(b)(3/8), and (iii) the angular current intensity limited region in which the beam size increases rapidly as d approximately I(b)(3/2). Some strategies are suggested to increase the threshold beam current and to extend the effective beam current range of the point cathode gun into micro ampere regime.

Combined 4-component and relativistic pseudopotential study of ThO for the electron electric dipole moment search.

PubMed

Skripnikov, L V

2016-12-07

A precise theoretical study of the electronic structure of heavy atom diatomic molecules is of key importance to interpret the experiments in the search for violation of time-reversal (T) and spatial-parity (P) symmetries of fundamental interactions in terms of the electron electric dipole moment, eEDM, and dimensionless constant, k T,P , characterizing the strength of the T,P-odd pseudoscalar-scalar electron-nucleus neutral current interaction. The ACME collaboration has recently improved limits on these quantities using a beam of ThO molecules in the electronic H 3 Δ 1 state [J. Baron et al., Science 343, 269 (2014)]. We apply the combined direct relativistic 4-component and two-step relativistic pseudopotential/restoration approaches to a benchmark calculation of the effective electric field, E eff , parameter of the T,P-odd pseudoscalar-scalar interaction, W T,P , and hyperfine structure constant in Δ13 state of the ThO molecule. The first two parameters are required to interpret the experimental data in terms of the eEDM and k T,P constant. We have investigated the electron correlation for all of the 98 electrons of ThO simultaneously up to the level of the coupled cluster with single, double, and noniterative triple amplitudes, CCSD(T), theory. Contributions from iterative triple and noniterative quadruple cluster amplitudes for the valence electrons have been also treated. The obtained values are E eff = 79.9 GV/cm, W T,P = 113.1 kHz. The theoretical uncertainty of these values is estimated to be about two times smaller than that of our previous study [L. V. Skripnikov and A. V. Titov, J. Chem. Phys., 142, 024301 (2015)]. It was found that the correlation of the inner- and outer-core electrons contributes 9% to the effective electric field. The values of the molecule frame dipole moment of the Δ13 state and the H 3 Δ 1 →X 1 Σ + transition energy of ThO calculated within the same methods are in a very good agreement with the experiment.

Observation of extreme ultraviolet transitions in highly charged Ba{sup 16+} to Ba{sup 23+} ions with electron beam ion trap

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ali, S.; Shimizu, E.; Nakamura, N.

2016-03-15

We have investigated extreme ultraviolet emission from highly charged barium using a compact electron beam ion trap at the Tokyo EBIT laboratory. The spectra were recorded for several beam energies ranging from 440 to 740 eV, while keeping the electron beam current constant at 10 mA. Radiation from charge states Zr-like Ba{sup 16+} to As-like Ba{sup 23+} were recorded and identified by varying the electron beam energy across the ionization thresholds and comparing with calculated results. The calculations were performed with a detailed relativistic configuration interaction approach using the Flexible Atomic Code. Several new lines belonging to electric dipole transitions were observedmore » and identified.« less

Millimeter-Wave Time Resolved Studies of the Formation and Decay of CO^+

NASA Astrophysics Data System (ADS)

Oesterling, Lee; Herbst, Eric; de Lucia, Frank

1998-04-01

Since the rate constants for ion-molecule interactions are typically much larger than neutral-neutral interactions, understanding ion-molecule interactions is essential to interpreting radio astronomical spectra from interstellar clouds and modeling the processes which lead to the formation of stars in these regions. We have developed a cell which allows us to study ion-molecule interactions in gases at low temperatures and pressures by using an electron gun technique to create ions. By centering our millimeter-wave source on a rotational resonance and gating the electron beam on and off, we are able to study the time-dependent rotational state distribution of the ion during its formation and decay, and so learn about excitation and relaxation processes as functions of temperature, pressure, electron beam energy, and electron beam current.

Effects of confinement and electron transport on magnetic switching in single Co nanoparticles

PubMed Central

Jiang, W.; Birk, F. T.; Davidović, D.

2013-01-01

This work reports the first study of current-driven magnetization noise in a single, nanometerscale, ferromagnetic (Co) particle, attached to normal metal leads by high-resistance tunneling junctions. As the tunnel current increases at low temperature, the magnetic switching field decreases, its probability distribution widens, while the temperature of the environment remains nearly constant. These observations demonstrate nonequilibrium magnetization noise. A classical model of the noise is provided, where the spin-orbit interaction plays a central role in driving magnetic tunneling transitions. PMID:23383370

Excitation of THz hybrid modes in an elliptical dielectric rod waveguide with a cold collisionless unmagnetized plasma column by an annular electron beam

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahmani, Z., E-mail: z.rahmani@kashanu.ac.ir; Safari, S.; Heidari-Semiromi, E.

2016-06-15

The dispersion relation of electromagnetic waves propagating in an elliptical plasma waveguide with a cold collisionless unmagnetized plasma column and a dielectric rod is studied analytically. The frequency spectrum of the hybrid waves and the growth rate for excitation of the waves by a thin annular relativistic elliptical electron beam (TAREEB) is obtained. The effects of relative permittivity constant of dielectric rod, geometrical dimensions, plasma frequency, accelerating voltage, and current density of TAREEB on the growth rate and frequency spectra of the waveguide will be investigated.

Novel concept for driving the linear compressor of a micro-miniature split Stirling cryogenic cooler

NASA Astrophysics Data System (ADS)

Maron, V.; Veprik, A.; Finkelstein, L.; Vilenchik, H.; Ziv, I.; Pundak, N.

2009-05-01

New methods of carrying out homeland security and antiterrorist operations call for the development of a new generation of mechanically cooled, portable, battery powered infrared imagers, relying on micro-miniature Stirling cryogenic coolers of rotary or linear types. Since split Stirling linearly driven micro-miniature cryogenic coolers have inherently longer life spans, low vibration export and better aural stealth as compared to their rotary driven rivals, they are more suitable for the above applications. The performance of such cryogenic coolers depends strongly on the efficacy of their electronic drivers. In a traditional approach, the PWM power electronics produce the fixed frequency tonal driving voltage/current, the magnitude of which is modulated via a PID control law so as to maintain the desired focal plane array temperature. The disadvantage of such drivers is that they draw high ripple current from the system's power bus. This results in the need for an oversized DC power supply (battery packs) and power electronic components, low efficiency due to excessive conductive losses and high residual electromagnetic interference which in turn degrades the performance of other systems connected to the same power bus. Without either an active line filter or large and heavy passive filtering, other electronics can not be powered from the same power bus, unless they incorporate heavy filtering at their inputs. The authors present the results of a feasibility study towards developing a novel "pumping" driver consuming essentially constant instant battery power/current without making use of an active or passive filter. In the tested setup, the driver relies on a bidirectional controllable bridge, invertible with the driving frequency, and a fast regulated DC/DC converter which maintains a constant level of current consumed from the DC power supply and thus operates in input current control mode. From the experimental results, the steady-state power consumed by the linear compressor remains the same as compared with the traditional sine wave driver, the voltage and current drawn from the battery pack is essentially free of low frequency ripple (this without use of any kind of filtering) and the overall coefficient of performance of the driver is in excess of 94% over the entire working range of supply voltages. Such a driver free of sine forming PWM stage and have reduced power peaks in all power conversion components.

Theoretical Discussion of Electron Transport Rate Constant at TCNQ / Ge and TiO2 System

NASA Astrophysics Data System (ADS)

Al-agealy, Hadi J. M.; Alshafaay, B.; Hassooni, Mohsin A.; Ashwiekh, Ahmed M.; Sadoon, Abbas K.; Majeed, Raad H.; Ghadhban, Rawnaq Q.; Mahdi, Shatha H.

2018-05-01

We have been studying and estimation the electronic transport constant at TCNQ / Ge and Tio2 interface by means of tunneling potential (TP), transport energy reorientation (TER), driving transition energy DTE and coupling coefficient constant. A simple quantum model for the transition processes was adapted to estimation and analysis depending on the quantum state for donor state |α D > and acceptor stated |α A > and assuming continuum levels of the system. Evaluation results were performed for the surfaces of Ge and Tio2 as best as for multilayer TCNQ. The results show an electronic transfer feature for electronic TCNQ density of states and a semiconductor behavior. The electronic rate constant result for both systems shows a good tool to election system in applied devices. All these results indicate the

The vibrational dependence of dissociative recombination: Rate constants for N{sub 2}{sup +}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guberman, Steven L., E-mail: slg@sci.org

Dissociative recombination rate constants are reported with electron temperature dependent uncertainties for the lowest 5 vibrational levels of the N{sub 2}{sup +} ground state. The rate constants are determined from ab initio calculations of potential curves, electronic widths, quantum defects, and cross sections. At 100 K electron temperature, the rate constants overlap with the exception of the third vibrational level. At and above 300 K, the rate constants for excited vibrational levels are significantly smaller than that for the ground level. It is shown that any experimentally determined total rate constant at 300 K electron temperature that is smaller thanmore » 2.0 × 10{sup −7} cm{sup 3}/s is likely to be for ions that have a substantially excited vibrational population. Using the vibrational level specific rate constants, the total rate constant is in very good agreement with that for an excited vibrational distribution found in a storage ring experiment. It is also shown that a prior analysis of a laser induced fluorescence experiment is quantitatively flawed due to the need to account for reactions with unknown rate constants. Two prior calculations of the dissociative recombination rate constant are shown to be inconsistent with the cross sections upon which they are based. The rate constants calculated here contribute to the resolution of a 30 year old disagreement between modeled and observed N{sub 2}{sup +} ionospheric densities.« less

Surface roughness scattering of electrons in bulk mosfets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zuverink, Amanda Renee

2015-11-01

Surface-roughness scattering of electrons at the Si-SiO 2 interface is a very important consideration when analyzing Si metal-oxide-semiconductor field-effect transistors (MOSFETs). Scattering reduces the mobility of the electrons and degrades the device performance. 250-nm and 50-nm bulk MOSFETs were simulated with varying device parameters and mesh sizes in order to compare the effects of surface-roughness scattering in multiple devices. The simulation framework includes the ensemble Monte Carlo method used to solve the Boltzmann transport equation coupled with a successive over-relaxation method used to solve the two-dimensional Poisson's equation. Four methods for simulating the surface-roughness scattering of electrons were implemented onmore » both devices and compared: the constant specularity parameter, the momentum-dependent specularity parameter, and the real-space-roughness method with both uniform and varying electric fields. The specularity parameter is the probability of an electron scattering speculariy from a rough surface. It can be chosen as a constant, characterizing partially diffuse scattering of all electrons from the surface the same way, or it can be momentum dependent, where the size of rms roughness and the normal component of the electron wave number determine the probability of electron-momentum randomization. The real-space rough surface method uses the rms roughness height and correlation length of an actual MOSFET to simulate a rough interface. Due to their charge, electrons scatter from the electric field and not directly from the surface. If the electric field is kept uniform, the electrons do not perceive the roughness and scatter as if from a at surface. However, if the field is allowed to vary, the electrons scatter from the varying electric field as they would in a MOSFET. These methods were implemented for both the 50-nm and 250-nm MOSFETs, and using the rms roughness heights and correlation lengths for real devices. The current-voltage and mobility-electric field curves were plotted for each method on the two devices and compared. The conclusion is that the specularity-parameter methods are valuable as simple models for relatively smooth interfaces. However, they have limitations, as they cannot accurately describe the drastic reduction in the current and the electron mobility that occur in MOSFETs with very rough Si-SiO 2 interfaces.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lehtomäki, Jouko; Makkonen, Ilja; Harju, Ari

We present a computational scheme for orbital-free density functional theory (OFDFT) that simultaneously provides access to all-electron values and preserves the OFDFT linear scaling as a function of the system size. Using the projector augmented-wave method (PAW) in combination with real-space methods, we overcome some obstacles faced by other available implementation schemes. Specifically, the advantages of using the PAW method are twofold. First, PAW reproduces all-electron values offering freedom in adjusting the convergence parameters and the atomic setups allow tuning the numerical accuracy per element. Second, PAW can provide a solution to some of the convergence problems exhibited in othermore » OFDFT implementations based on Kohn-Sham (KS) codes. Using PAW and real-space methods, our orbital-free results agree with the reference all-electron values with a mean absolute error of 10 meV and the number of iterations required by the self-consistent cycle is comparable to the KS method. The comparison of all-electron and pseudopotential bulk modulus and lattice constant reveal an enormous difference, demonstrating that in order to assess the performance of OFDFT functionals it is necessary to use implementations that obtain all-electron values. The proposed combination of methods is the most promising route currently available. We finally show that a parametrized kinetic energy functional can give lattice constants and bulk moduli comparable in accuracy to those obtained by the KS PBE method, exemplified with the case of diamond.« less

A high-resolution photoelectron imaging and theoretical study of CP- and C2P-

NASA Astrophysics Data System (ADS)

Czekner, Joseph; Cheung, Ling Fung; Johnson, Eric L.; Fortenberry, Ryan C.; Wang, Lai-Sheng

2018-01-01

The discovery of interstellar anions has been a milestone in astrochemistry. In the search for new interstellar anions, CP- and C2P- are viable candidates since their corresponding neutrals have already been detected astronomically. However, scarce data exist for these negatively charged species. Here we report the electron affinities of CP and C2P along with the vibrational frequencies of their anions using high-resolution photoelectron imaging. These results along with previous spectroscopic data of the neutral species are used further to benchmark very accurate quartic force field quantum chemical methods that are applied to CP, CP-, C2P, and two electronic states of C2P-. The predicted electron affinities, vibrational frequencies, and rotational constants are in excellent agreement with the experimental data. The electron affinities of CP (2.8508 ± 0.0007 eV) and C2P (2.6328 ± 0.0006 eV) are measured accurately and found to be quite high, suggesting that the CP- and C2P- anions are thermodynamically stable and possibly observable. The current study suggests that the combination of high-resolution photoelectron imaging and quantum chemistry can be used to determine accurate molecular constants for exotic radical species of astronomical interest.

A high-resolution photoelectron imaging and theoretical study of CP- and C2P.

PubMed

Czekner, Joseph; Cheung, Ling Fung; Johnson, Eric L; Fortenberry, Ryan C; Wang, Lai-Sheng

2018-01-28

The discovery of interstellar anions has been a milestone in astrochemistry. In the search for new interstellar anions, CP - and C 2 P - are viable candidates since their corresponding neutrals have already been detected astronomically. However, scarce data exist for these negatively charged species. Here we report the electron affinities of CP and C 2 P along with the vibrational frequencies of their anions using high-resolution photoelectron imaging. These results along with previous spectroscopic data of the neutral species are used further to benchmark very accurate quartic force field quantum chemical methods that are applied to CP, CP - , C 2 P, and two electronic states of C 2 P - . The predicted electron affinities, vibrational frequencies, and rotational constants are in excellent agreement with the experimental data. The electron affinities of CP (2.8508 ± 0.0007 eV) and C 2 P (2.6328 ± 0.0006 eV) are measured accurately and found to be quite high, suggesting that the CP - and C 2 P - anions are thermodynamically stable and possibly observable. The current study suggests that the combination of high-resolution photoelectron imaging and quantum chemistry can be used to determine accurate molecular constants for exotic radical species of astronomical interest.

Universal Features of Electron Dynamics in Solar Cells with TiO2 Contact: From Dye Solar Cells to Perovskite Solar Cells.

PubMed

Todinova, Anna; Idígoras, Jesús; Salado, Manuel; Kazim, Samrana; Anta, Juan A

2015-10-01

The electron dynamics of solar cells with mesoporous TiO2 contact is studied by electrochemical small-perturbation techniques. The study involved dye solar cells (DSC), solid-state perovskite solar cells (SSPSC), and devices where the perovskite acts as sensitizer in a liquid-junction device. Using a transport-recombination continuity equation we found that mid-frequency time constants are proper lifetimes that determine the current-voltage curve. This is not the case for the SSPSC, where a lifetime of ∼1 μs, 1 order of magnitude longer, is required to reproduce the current-voltage curve. This mismatch is attributed to the dielectric response on the mid-frequency component. Correcting for this effect, lifetimes lie on a common exponential trend with respect to open-circuit voltage. Electron transport times share a common trend line too. This universal behavior of lifetimes and transport times suggests that the main difference between the cells is the power to populate the mesoporous TiO2 contact with electrons.

Forward-biased current annealing of radiation degraded indium phosphide and gallium arsenide solar cells

NASA Technical Reports Server (NTRS)

Michael, Sherif; Cypranowski, Corinne; Anspaugh, Bruce

1990-01-01

The preliminary results of a novel approach to low-temperature annealing of previously irradiated indium phosphide and gallium arsenide solar cells are reported. The technique is based on forward-biased current annealing. The two types of III-V solar cells were irradiated with 1-MeV electrons to a fluence level of (1-10) x 10 to the 14th electrons/sq cm. Several annealing attempts were made, varying all conditions. Optimum annealing was achieved when cells were injected with minority currents at a constant 90 C. The current density for each type of cell was also determined. Significant recovery of degraded parameters was achieved in both cases. However, the InP cell recovery notably exceeded the recovery in GaAs cells. The recovery is thought to be caused by current-stimulated reordering of the radiator-induced displacement damage. Both types of cell were then subjected to several cycles of irradiation and annealing. The results were also very promising. The significant recovery of degraded cell parameters at low temperature might play a major role in considerably extending the end of life of future spacecraft.

Particle-in-cell simulations of sheath formation around biased interconnectors in a low-earth-orbit plasma

NASA Technical Reports Server (NTRS)

Thiemann, H.; Schunk, R. W.

1990-01-01

The interaction between satellite solar arrays and the LEO plasma is presently studied with particle-in-cell simulations in which an electrical potential was suddenly applied to the solar cell interconnector. The consequent temporal response was followed for the real O(+)-electron mass ratio in the cases of 100- and 250-V solar cells, various solar cell thicknesses, and solar cells with secondary electron emission. Larger applied potentials and thinner solar cells lead to greater initial polarization surface charges, and therefore longer discharging and shielding times. When secondary electron emission from the cover glass is brought to bear, however, the potential structure is nearly planar, allowing constant interaction between plasma electrons and cover glass; a large fraction of the resulting secondary electrons is collected by the interconnector, constituting an order-of-magnitude increase in collected current.

Note: Self-biased voltage to suppress secondary electrons by a ZnO varistor in a compact pulsed neutron generator

NASA Astrophysics Data System (ADS)

Yang, Z.; Li, X.; Li, J.; Long, J. D.; Lan, C. H.; Wang, T.; Dong, P.; He, J. L.

2017-03-01

A large amount of back streaming electrons will bring about a part of current drain on power supply, cause sparking or high-voltage breakdowns, and affect the neutron yield and waveform for a compact sealed-tube pulsed neutron generator. A novel idea which uses a ZnO varistor to provide a constant self-biased voltage to suppress the secondary electrons is introduced. The I-V curve for the ZnO varistor was measured in the experiment. The effects of suppressing the secondary electrons were investigated using a ZnO varistor, linear resistors, and an independent power supply, respectively. The results show that the secondary electrons are suppressed effectively by the compact ZnO varistor, while not increasing the size and the component of the device. It is a promising design for compact sealed-tube neutron generators.

Flux-Feedback Magnetic-Suspension Actuator

NASA Technical Reports Server (NTRS)

Groom, Nelson J.

1990-01-01

Flux-feedback magnetic-suspension actuator provides magnetic suspension and control forces having linear transfer characteristics between force command and force output over large range of gaps. Hall-effect devices used as sensors for electronic feedback circuit controlling currents flowing in electromagnetic windings to maintain flux linking suspended element at substantially constant value independent of changes in length of gap. Technique provides effective method for maintenance of constant flux density in gap and simpler than previous methods. Applications include magnetic actuators for control of shapes and figures of antennas and of precise segmented reflectors, magnetic suspensions in devices for storage of angular momentum and/or kinetic energy, and systems for control, pointing, and isolation of instruments.

Particle-in-cell simulations of electron beam control using an inductive current divider

DOE PAGES

Swanekamp, S. B.; Angus, J. R.; Cooperstein, G.; ...

2015-11-18

Kinetic, time-dependent, electromagnetic, particle-in-cell simulations of the inductive current divider are presented. The inductive current divider is a passive method for controlling the trajectory of an intense, hollow electron beam using a vacuum structure that inductively splits the beam’s return current. The current divider concept was proposed and studied theoretically in a previous publication [Phys. Plasmas 22, 023107 (2015)] A central post carries a portion of the return current (I 1) while the outer conductor carries the remainder (I 2) with the injected beam current given by I b=I 1+I 2. The simulations are in agreement with the theory whichmore » predicts that the total force on the beam trajectory is proportional to (I 2-I 1) and the force on the beam envelope is proportional to I b. For a fixed central post, the beam trajectory is controlled by varying the outer conductor radius which changes the inductance in the return-current path. The simulations show that the beam emittance is approximately constant as the beam propagates through the current divider to the target. As a result, independent control over both the current density and the beam angle at the target is possible by choosing the appropriate return-current geometry.« less

Different roles of electron beam in two stream instability in an elliptical waveguide for generation and amplification of THz electromagnetic waves

DOE Office of Scientific and Technical Information (OSTI.GOV)

Safari, S.; Jazi, B., E-mail: jaziada@kashanu.ac.ir; Jahanbakht, S.

2016-08-15

In this work, two stream instability in a metallic waveguide with elliptical cross-section and with a hollow annular dielectric layer is studied for generation and amplification of THz electromagnetic waves. Dispersion relation of waves and their dependents to geometric dimensions and characteristics of the electron beam are analyzed. In continuation, the diagrams of growth rate for some operating frequencies are presented, so that effective factors on the growth rates, such as geometrical dimensions, dielectric constant of dielectric layer, accelerating voltage, and applied current intensity are analyzed. It is shown that while an electron beam is responsible for instability, another electronmore » beam plays a stabilizing role.« less

Electronically Tunable Differential Integrator: Linear Voltage Controlled Quadrature Oscillator.

PubMed

Nandi, Rabindranath; Pattanayak, Sandhya; Venkateswaran, Palaniandavar; Das, Sagarika

2015-01-01

A new electronically tunable differential integrator (ETDI) and its extension to voltage controlled quadrature oscillator (VCQO) design with linear tuning law are proposed; the active building block is a composite current feedback amplifier with recent multiplication mode current conveyor (MMCC) element. Recently utilization of two different kinds of active devices to form a composite building block is being considered since it yields a superior functional element suitable for improved quality circuit design. The integrator time constant (τ) and the oscillation frequency (ω o ) are tunable by the control voltage (V) of the MMCC block. Analysis indicates negligible phase error (θ e ) for the integrator and low active ω o -sensitivity relative to the device parasitic capacitances. Satisfactory experimental verifications on electronic tunability of some wave shaping applications by the integrator and a double-integrator feedback loop (DIFL) based sinusoid oscillator with linear f o variation range of 60 KHz~1.8 MHz at low THD of 2.1% are verified by both simulation and hardware tests.

Electro-Thermal Transient Simulation of Silicon Carbide Power Mosfet

DTIC Science & Technology

2013-06-01

ionization rate than electron in silicon carbide , the breakdown voltage almost remains constant even at elevated temperatures . This is due to the positive... temperature coefficient of holes in case of silicon carbide as discussed in [7, 8]. The higher ambient temperature influences the leakage current...in the RLC ring down circuit . E. Power Dissipation and Lattice Temperature The power dissipation for any switching device is dependent on the

The Thermal Conductivity of Earth's Core: A Key Geophysical Parameter's Constraints and Uncertainties

NASA Astrophysics Data System (ADS)

Williams, Q.

2018-05-01

The thermal conductivity of iron alloys at high pressures and temperatures is a critical parameter in governing ( a) the present-day heat flow out of Earth's core, ( b) the inferred age of Earth's inner core, and ( c) the thermal evolution of Earth's core and lowermost mantle. It is, however, one of the least well-constrained important geophysical parameters, with current estimates for end-member iron under core-mantle boundary conditions varying by about a factor of 6. Here, the current state of calculations, measurements, and inferences that constrain thermal conductivity at core conditions are reviewed. The applicability of the Wiedemann-Franz law, commonly used to convert electrical resistivity data to thermal conductivity data, is probed: Here, whether the constant of proportionality, the Lorenz number, is constant at extreme conditions is of vital importance. Electron-electron inelastic scattering and increases in Fermi-liquid-like behavior may cause uncertainties in thermal conductivities derived from both first-principles-associated calculations and electrical conductivity measurements. Additional uncertainties include the role of alloying constituents and local magnetic moments of iron in modulating the thermal conductivity. Thus, uncertainties in thermal conductivity remain pervasive, and hence a broad range of core heat flows and inner core ages appear to remain plausible.

Adjustable electronic load-alarm relay

DOEpatents

Mason, Charles H.; Sitton, Roy S.

1976-01-01

This invention is an improved electronic alarm relay for monitoring the current drawn by an AC motor or other electrical load. The circuit is designed to measure the load with high accuracy and to have excellent alarm repeatability. Chattering and arcing of the relay contacts are minimal. The operator can adjust the set point easily and can re-set both the high and the low alarm points by means of one simple adjustment. The relay includes means for generating a signal voltage proportional to the motor current. In a preferred form of the invention a first operational amplifier is provided to generate a first constant reference voltage which is higher than a preselected value of the signal voltage. A second operational amplifier is provided to generate a second constant reference voltage which is lower than the aforementioned preselected value of the signal voltage. A circuit comprising a first resistor serially connected to a second resistor is connected across the outputs of the first and second amplifiers, and the junction of the two resistors is connected to the inverting terminal of the second amplifier. Means are provided to compare the aforementioned signal voltage with both the first and second reference voltages and to actuate an alarm if the signal voltage is higher than the first reference voltage or lower than the second reference voltage.

Liquid Nitrogen as Fast High Voltage Switching Medium

NASA Astrophysics Data System (ADS)

Dickens, J.; Neuber, A.; Haustein, M.; Krile, J.; Krompholz, H.

2002-12-01

Compact pulsed power systems require new switching technologies. For high voltages, liquid nitrogen seems to be a suitable switching medium, with high hold-off voltage, low dielectric constant, and no need for pressurized systems as in high pressure gas switches. The discharge behavior in liquid nitrogen, such as breakdown voltages, formative times, current rise as function of voltage, recovery, etc. are virtually unknown, however. The phenomenology of breakdown in liquid nitrogen is investigated with high speed (temporal resolution < 1 ns) electrical and optical diagnostics, in a coaxial system with 50-Ohm impedance. Discharge current and voltage are determined with transmission line type current sensors and capacitive voltage dividers. The discharge luminosity is measured with photomultiplier tubes. Preliminary results of self-breakdown investigations (gap 1 mm, breakdown voltage 44 kV, non-boiling supercooled nitrogen) show a fast (2 ns) transition from an unknown current level to several mA, a long-duration (100 ns) phase with constant current superimposed by ns-spikes, and a final fast transition to the impedance limited current during several nanoseconds. The optical measurements will be expanded toward spectroscopy and high speed photography with the aim of clarifying the overall breakdown mechanisms, including electronic initiation, bubble formation, bubble dynamics, and their role in breakdown, for different electrode geometries (different macroscopic field enhancements).

Treatment of Electronic Energy Level Transition and Ionization Following the Particle-Based Chemistry Model

NASA Technical Reports Server (NTRS)

Liechty, Derek S.; Lewis, Mark

2010-01-01

A new method of treating electronic energy level transitions as well as linking ionization to electronic energy levels is proposed following the particle-based chemistry model of Bird. Although the use of electronic energy levels and ionization reactions in DSMC are not new ideas, the current method of selecting what level to transition to, how to reproduce transition rates, and the linking of the electronic energy levels to ionization are, to the author s knowledge, novel concepts. The resulting equilibrium temperatures are shown to remain constant, and the electronic energy level distributions are shown to reproduce the Boltzmann distribution. The electronic energy level transition rates and ionization rates due to electron impacts are shown to reproduce theoretical and measured rates. The rates due to heavy particle impacts, while not as favorable as the electron impact rates, compare favorably to values from the literature. Thus, these new extensions to the particle-based chemistry model of Bird provide an accurate method for predicting electronic energy level transition and ionization rates in gases.

Differential Mobility Spectrometry: Preliminary Findings on Determination of Fundamental Constants

NASA Technical Reports Server (NTRS)

Limero, Thomas; Cheng, Patti; Boyd, John

2007-01-01

The electron capture detector (ECD) has been used for 40+ years (1) to derive fundamental constants such as a compound's electron affinity. Given this historical perspective, it is not surprising that differential mobility spectrometry (DMS) might be used in a like manner. This paper will present data from a gas chromatography (GC)-DMS instrument that illustrates the potential capability of this device to derive fundamental constants for electron-capturing compounds. Potential energy curves will be used to provide possible explanation of the data.

In vitro and in vivo comparisons of constant resistance AC iontophoresis and DC iontophoresis.

PubMed

Li, S Kevin; Higuchi, William I; Zhu, Honggang; Kern, Steven E; Miller, David J; Hastings, Matthew S

2003-09-04

A previous in vitro constant electrical resistance alternating current (AC) iontophoresis study with human epidermal membrane (HEM) and a model neutral permeant has shown less inter- and intra-sample variability in iontophoretic transport relative to conventional constant direct current (DC) iontophoresis. The objectives of the present study were to address the following questions. (1) Can the skin electrical resistance be maintained at a constant level by AC in humans in vivo? (2) Are the in vitro data with HEM representative of those in vivo? (3) Does constant skin resistance AC iontophoresis have less inter- and intra-sample variability than conventional constant current DC iontophoresis in vivo? (4) What are the electrical and the barrier properties of skin during iontophoresis in vivo? In the present study, in vitro HEM experiments were carried out with the constant resistance AC and the conventional constant current DC methods using mannitol and glucose as the neutral model permeants. In vivo human experiments were performed using glucose as the permeant with a constant skin resistance AC only protocol and two conventional constant current DC methods (continuous constant current DC and constant current DC with its polarity alternated every 10 min with a 3:7 on:off duty cycle). Constant current DC iontophoresis was conducted with commercial constant current DC devices, and constant resistance AC iontophoresis was carried out by reducing and maintaining the skin resistance at a constant target value with AC supplied from a function generator. This study shows that (1) skin electrical resistance can be maintained at a constant level during AC iontophoresis in vivo; (2) HEM in vitro and human skin in vivo demonstrate similar electrical and barrier properties, and these properties are consistent with our previous findings; (3) there is general qualitative and semi-quantitative agreement between the HEM data in vitro and human skin data in vivo; and (4) constant skin resistance AC iontophoresis generally provides less inter- and intra-subject variability than conventional constant current DC.

Nitrogen-Doped Holey Graphene Film-Based Ultrafast Electrochemical Capacitors.

PubMed

Zhou, Qinqin; Zhang, Miao; Chen, Ji; Hong, Jong-Dal; Shi, Gaoquan

2016-08-17

The commercialized aluminum electrolytic capacitors (AECs) currently used for alternating current (AC) line-filtering are usually the largest components in the electronic circuits because of their low specific capacitances and bulky sizes. Herein, nitrogen-doped holey graphene (NHG) films were prepared by thermal annealing the composite films of polyvinylpyrrolidone (PVP), graphene oxide (GO), and ferric oxide (Fe2O3) nanorods followed by chemical etching with hydrochloride acid. The typical electrochemical capacitor with NHG electrodes exhibited high areal and volumetric specific capacitances of 478 μF cm(-2) and 1.2 F cm(-3) at 120 Hz, ultrafast frequency response with a phase angle of -81.2° and a resistor-capacitor time constant of 203 μs at 120 Hz, as well as excellent cycling stability. Thus, it is promising to replace conventional AEC for AC line-filtering in miniaturized electronics.

CLEARING MAGNET DESIGN FOR APS-U

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abliz, M.; Grimmer, J.; Jaski, Y.

2017-06-25

The Advanced Photon Source is in the process of developing an upgrade (APS-U) of the storage ring. The upgrade will be converting the current double bend achromat (DBA) lattice to a multi-bend achromat (MBA) lattice. In addition, the storage ring will be operated at 6 GeV and 200 mA with regular swap-out injection to keep the stored beam current constant [1]. The swap-out injection will take place with beamline shutters open. For radiation safety to ensure that no electrons can exit the storage ring, a passive method of protecting the beamline and containing the electrons inside the storage ring ismore » proposed. A clearing magnet will be located in all beamline front ends inside the storage ring tunnel. This article will discuss the features and design of the clearing magnet scheme for APS-U.« less

Doping effect of polyaniline/MWCNT composites on capacitance and cyclic stability of supercapacitors.

PubMed

Karthikeyan, G; Sahoo, S; Nayak, G C; Das, C K

2012-03-01

Polyaniline doped by Zn2+ ions was synthesized as nanocomposites with multiwalled carbon nanotubes (MWCNT) by in-situ oxidative polymerization and investigated as electrode material for supercapacitors. The uniform coating of polyaniline on MWCNT was characterized by field emission scanning electron microscopy (FESEM) and high resolution transmission electron microscopy (HRTEM). The effect of Zn2+ ions on nanocomposites were characterized by Fourier transform infrared (FTIR) spectroscopy. The electrochemical performances were investigated by cyclic voltammetry (CV), constant current charging/discharging cyclic test (CC) and electrochemical impedance spectroscopy (EIS) using a three-electrode system. The doped polyaniline composites show higher specific capacitance and better cyclic stability.

Temporal survey of electron number density and electron temperature in the exhaust of a megawatt MPD-arc thruster.

NASA Technical Reports Server (NTRS)

Michels, C. J.; Rose, J. R.; Sigman, D. R.

1972-01-01

Temporal and radial profiles are obtained 30 cm downstream from the anode for two peak arc currents (11.2 kA and 20 kA) and for various auxiliary magnetic fields (0, 1.0 T, and 2.0 T) using the Thomson scattering technique. Average density and temperature are relatively constant for over 100 microseconds with significant fluctuations. Radial profiles obtained are relatively flat for 4 cm from the axis. Compared to earlier 20 cm data, the exhaust density has decreased significantly, the average temperature has not changed, and the density ?hole' with an auxiliary magnetic field has enlarged.

Electrodeposition of Gold to Conformally Fill High Aspect Ratio Nanometric Silicon Grating Trenches: A Comparison of Pulsed and Direct Current Protocols

PubMed Central

Znati, Sami A.; Chedid, Nicholas; Miao, Houxun; Chen, Lei; Bennett, Eric E.; Wen, Han

2016-01-01

Filling high-aspect-ratio trenches with gold is a frequent requirement in the fabrication of x-ray optics as well as micro-electronic components and other fabrication processes. Conformal electrodeposition of gold in sub-micron-width silicon trenches with an aspect ratio greater than 35 over a grating area of several square centimeters is challenging and has not been described in the literature previously. A comparison of pulsed plating and constant current plating led to a gold electroplating protocol that reliably filled trenches for such structures. PMID:27042384

Verification of the electron/proton coupled mechanism for phenolic H-atom transfer using a triplet π,π ∗ carbonyl

NASA Astrophysics Data System (ADS)

Yamaji, Minoru; Oshima, Juro; Hidaka, Motohiko

2009-06-01

Evidence for the coupled electron/proton transfer mechanism of the phenolic H-atom transfer between triplet π,π ∗ 3,3'-carbonylbis(7-diethylaminocoumarin) and phenol derivatives is obtained by using laser photolysis techniques. It was confirmed that the quenching rate constants of triplet CBC by phenols having positive Hammett constants do not follow the Rehm-Weller equation for electron transfer while those by phenols with negative Hammett constants do it. From the viewpoint of thermodynamic parameters for electron transfer, the crucial factors for phenolic H-atom transfer to π,π ∗ triplet are discussed.

Diamagnetic currents

NASA Astrophysics Data System (ADS)

Macris, N.; Martin, Ph. A.; Pulé, J. V.

1988-06-01

We study the diamagnetic surface currents of particles in thermal equilibrium submitted to a constant magnetic field. The current density of independent electrons with Boltzmann (respectively Fermi) statistics has a gaussian (respectively exponential) bound for its fall off into the bulk. For a system of interacting particles at low activity with Boltzmann statistics, the current density is localized near to the boundary and integrable when the two-body potential decays as |x|-α, α >4, α>4, in three dimensions. In all cases, the integral of the current density is independent of the nature of the confining wall and correctly related to the bulk magnetisation. The results hold for hard and soft walls and all field strength. The analysis relies on the Feynman-Kac-Ito representation of the Gibbs state and on specific properties of the Brownian bridge process.

Merger and reconnection of Weibel separated relativistic electron beam

NASA Astrophysics Data System (ADS)

Shukla, Chandrasekhar; Kumar, Atul; Das, Amita; Patel, Bhavesh G.

2018-02-01

The relativistic electron beam (REB) propagation in a plasma is fraught with beam plasma instabilities. The prominent amongst them is the collisionless Weibel destabilization which spatially separates the forward propagating REB and the return shielding currents. This results in the formation of REB current filaments which are typically of the size of electron skin depth during the linear stage of the instability. It has been observed that in the nonlinear stage, the size of filaments increases as they merge with each other. With the help of 2-D particle-in-cell simulations in the plane perpendicular to the REB propagation, it is shown that these mergers occur in two distinct nonlinear phases. In the first phase, the total magnetic energy increases. Subsequently, however, during the second phase, one observes a reduction in magnetic energy. It is shown that the transition from one nonlinear regime to another occurs when the typical current associated with individual filaments hits the Alfvén threshold. In the second nonlinear regime, therefore, the filaments can no longer permit any increase in current. Magnetic reconnection events then dissipate the excess current (and its associated magnetic energy) that would result from a merger process leading to the generation of energetic electron jets in the perpendicular plane. At later times when there are only few filaments left, the individual reconnection events can be clearly identified. It is observed that in between such events, the magnetic energy remains constant and shows a sudden drop as and when two filaments merge. The electron jets released in these reconnection events are thus responsible for the transverse heating which has been mentioned in some previous studies [Honda et al., Phys. Plasmas 7, 1302 (2000)].

Experimental research of different plasma cathodes for generation of high-current electron beams

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shafir, G.; Kreif, M.; Gleizer, J. Z.

2015-11-21

The results of experimental studies of different types of cathodes—carbon-epoxy rods, carbon-epoxy capillary, edged graphite, and metal-dielectric—under the application of high-voltage pulses with an amplitude of several hundreds of kV and pulse duration of several nanoseconds are presented. The best diode performance was achieved with the edged graphite and carbon-epoxy-based cathodes characterized by uniform and fast (<1 ns) formation of explosive emission plasma spots and quasi-constant diode impedance. This result was achieved for both annular cathodes in a strong magnetic field and planar cathodes of a similar diameter (∼2 cm) with no external magnetic field. The cathodes based on carbon-epoxy rods andmore » carbon-epoxy capillaries operating with an average current density up to 1 kA/cm{sup 2} showed insignificant erosion along 10{sup 6} pulses of the generator and the generated electron beam current showed excellent reproducibility in terms of the amplitude and waveform.« less

Improvements on the accuracy of beam bugs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Y.J.; Fessenden, T.

1998-08-17

At LLNL resistive wall monitors are used to measure the current and position used on ETA-II show a droop in signal due to a fast redistribution time constant of the signals. This paper presents the analysis and experimental test of the beam bugs used for beam current and position measurements in and after the fast kicker. It concludes with an outline of present and future changes that can be made to improve the accuracy of these beam bugs. of intense electron beams in electron induction linacs and beam transport lines. These, known locally as ''beam bugs'', have been used throughoutmore » linear induction accelerators as essential diagnostics of beam current and location. Recently, the development of a fast beam kicker has required improvement in the accuracy of measuring the position of beams. By picking off signals at more than the usual four positions around the monitor, beam position measurement error can be greatly reduced. A second significant source of error is the mechanical variation of the resistor around the bug.« less

Improvements on the accuracy of beam bugs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Y J; Fessenden, T

1998-09-02

At LLNL resistive wall monitors are used to measure the current and position used on ETA-II show a droop in signal due to a fast redistribution time constant of the signals. This paper presents the analysis and experimental test of the beam bugs used for beam current and position measurements in and after the fast kicker. It concludes with an outline of present and future changes that can be made to improve the accuracy of these beam bugs. of intense electron beams in electron induction linacs and beam transport lines. These, known locally as "beam bugs", have been used throughoutmore » linear induction accelerators as essential diagnostics of beam current and location. Recently, the development of a fast beam kicker has required improvement in the accuracy of measuring the position of beams. By picking off signals at more than the usual four positions around the monitor, beam position measurement error can be greatly reduced. A second significant source of error is the mechanical variation of the resistor around the bug.« less

Experimental measurement of the plasma conductivity of Z93 and Z93P thermal control paint

NASA Technical Reports Server (NTRS)

Hillard, G. Barry

1993-01-01

Two samples each of Z93 and Z93P thermal control paint were exposed to a simulated space environment in a plasma chamber. The samples were biased through a series of voltages ranging from -200 volts to +300 volts and electron and ion currents measured. By comparing the currents to those of pure metal samples of the same size and shape, the conductivity of the samples was calculated. Measured conductivity was dependent on the bias potential in all cases. For Z93P, conductivity was approximately constant over much of the bias range and we find a value of 0.5 micro-mhos per square meter for both electron and ion current. For Z93, the dependence on bias was much more pronounced but conductivity can be said to be approximately one order of magnitude larger. In addition to presenting these results, this report documents all of the experimental data as well as the statistical analyses performed.

First-principles study on leakage current caused by oxygen vacancies at HfO2/SiO2/Si interface

NASA Astrophysics Data System (ADS)

Takagi, Kensuke; Ono, Tomoya

2018-06-01

The relationship between the position of oxygen vacancies in HfO2/SiO2/Si gate stacks and the leakage current is studied by first-principles electronic-structure and electron-conduction calculations. We find that the increase in the leakage current due to the creation of oxygen vacancies in the HfO2 layer is much larger than that in the SiO2 interlayer. According to previous first-principles total energy calculations, the formation energy of oxygen vacancies is smaller in the SiO2 interlayer than that in the HfO2 layer under the same conditions. Therefore, oxygen vacancies will be attracted from the SiO2 interlayer to minimize the energy, thermodynamically justifying the scavenging technique. Thus, the scavenging process efficiently improves the dielectric constant of HfO2-based gate stacks without increasing the number of oxygen vacancies, which cause the dielectric breakdown.

Photo-triggering and secondary electron produced ionization in electric discharge ArF* excimer lasers

NASA Astrophysics Data System (ADS)

Xiong, Zhongmin; Kushner, Mark J.

2011-10-01

Electric discharge excimer lasers are sustained in multi-atmosphere attaching gas mixtures that are typically preionized to enable a reproducible, uniform glow, which maximizes optical quality and gain. This preionization is often accomplished using UV light produced by a corona discharge within the plasma cavity. To quantify the relationship between corona discharge properties and those of the laser discharge, the triggering of electron avalanche by preionizing UV light in an electric discharge-pumped ArF* excimer laser was numerically investigated using a two-dimensional model. The preionizing UV fluxes were generated by a corona-bar discharge driven by the same voltage pulse as the main discharge sustained in a multi-atmospheric Ne/Ar/Xe/F2 gas mixture. The resulting peak photo-electron density in the inter-electrode spacing is around 108 cm-3, and its distribution is biased toward the UV source. The preionization density increases with increasing dielectric constant and capacitance of the corona bar. The symmetry and uniformity of the discharge are, however, improved significantly once the main avalanche develops. In addition to bulk electron impact ionization, the ionization generated by sheath accelerated secondary electrons was found to be important in sustaining the discharge current at experimentally observed values. At peak current, the magnitude of the ionization by sheath accelerated electrons is comparable to that from bulk electron impact in the vicinity of the cathode.

An easy-to-implement filter for separating photo-excited signals from topography in scanning tunneling microscopy.

PubMed

Wang, Kangkang; Rosenmann, Daniel; Holt, Martin; Winarski, Robert; Hla, Saw-Wai; Rose, Volker

2013-06-01

In order to achieve elemental and chemical sensitivity in scanning tunneling microscopy (STM), synchrotron x-rays have been applied to excite core-level electrons during tunneling. The x-ray photo-excitations result in tip currents that are superimposed onto conventional tunneling currents. While carrying important physical information, the varying x-ray induced currents can destabilize the feedback loop causing it to be unable to maintain a constant tunneling current, sometimes even causing the tip to retract fully or crash. In this paper, we report on an easy-to-implement filter circuit that can separate the x-ray induced currents from conventional tunneling currents, thereby allowing simultaneous measurements of topography and chemical contrasts. The filter and the schematic presented here can also be applied to other variants of light-assisted STM such as laser STM.

Uncovering the nonadiabatic response of geosynchronous electrons to geomagnetic disturbance

USGS Publications Warehouse

Gannon, Jennifer; Elkington, Scot R.; Onsager, Terrance G.

2012-01-01

We describe an energy spectrum method for scaling electron integral flux, which is measured at a constant energy, to phase space density at a constant value of the first adiabatic invariant which removes much of the variation due to reversible adiabatic effects. Applying this method to nearly a solar cycle (1995 - 2006) of geosynchronous electron integral flux (E>2.0MeV) from the GOES satellites, we see that much of the diurnal variation in electron phase space density at constant energy can be removed by the transformation to phase space density at constant μ (4000 MeV/G). This allows us a clearer picture of underlying non-adiabatic electron population changes due to geomagnetic activity. Using scaled phase space density, we calculate the percentage of geomagnetic storms resulting in an increase, decrease or no change in geosynchronous electrons as 38%, 7%, and 55%, respectively. We also show examples of changes in the electron population that may be different than the unscaled fluxes alone suggest. These examples include sudden electron enhancements during storms which appear during the peak of negative Dst for μ-scaled phase space density, contrary to the slow increase seen during the recovery phase for unscaled phase space density for the same event.

Asymmetric Marcus-Hush theory for voltammetry.

PubMed

Laborda, Eduardo; Henstridge, Martin C; Batchelor-McAuley, Christopher; Compton, Richard G

2013-06-21

The current state-of-the-art in modeling the rate of electron transfer between an electroactive species and an electrode is reviewed. Experimental studies show that neither the ubiquitous Butler-Volmer model nor the more modern symmetric Marcus-Hush model are able to satisfactorily reproduce the experimental voltammetry for both solution-phase and surface-bound redox couples. These experimental deviations indicate the need for revision of the simplifying approximations used in the above models. Within this context, models encompassing asymmetry are considered which include different vibrational and solvation force constants for the electroactive species. The assumption of non-adiabatic electron transfer is also examined. These refinements have provided more satisfactory models of the electron transfer process and they enable us to gain more information about the microscopic characteristics of the system by means of simple electrochemical measurements.

Cathodochromic storage device

NASA Technical Reports Server (NTRS)

Bosomworth, D. R.; Moles, W. H.

1969-01-01

A memory and display device has been developed by combing a fast phosphor layer with a cathodochromic layer in a cathode ray tube. Images are stored as patterns of electron beam induced optical density in the cathodo-chromic material. The stored information is recovered by exciting the backing, fast phosphor layer with a constant current electron beam and detecting the emitted radiation which is modulated by absorption in the cathodochromic layer. The storage can be accomplished in one or more TV frames (1/30 sec each). More than 500 TV line resolution and close to 2:1 contrast ratio are possible. The information storage time in a dark environment is approximately 24 hours. A reconstituted (readout) electronic video signal can be generated continuously for times in excess of 10 minutes or periodically for several hours.

Segregation Phenomena on the Crystal Surface of Chemical Compounds

NASA Astrophysics Data System (ADS)

Tomashpol'skii, Yu. Ya.

2018-06-01

The current state of the theoretical and experimental studies of changes in the chemical structure and composition caused by segregation phenomena on the surface of chemical compounds was reviewed. The review considers the experimental data obtained exclusively on single crystals, which were studied by modern instrumental methods, including in situ Auger electron spectrometry, X-ray spectral microanalysis, high-resolution scanning and transmission electron microscopy, secondary electron emission, and atomic force microscopy. The models that suggest the crystal-chemical diffusion and liquid-phase mechanisms of segregation were described. The parameters of the theory include the type of chemical bond, elastic constants, and crystal-chemical characteristics of substances. The models make it possible to predict the nature of changes in the surface composition: segregation tendency, segregant type, and degree of nonstoichiometry. A new direction in surface segregation was considered, which is promising for nanoelectronics and emission electronics.

Comparative study on extinction process of gas-blasted air and CO2 arc discharge using two-dimensional electron density imaging sensor

NASA Astrophysics Data System (ADS)

Inada, Yuki; Kumada, Akiko; Ikeda, Hisatoshi; Hidaka, Kunihiko; Nakano, Tomoyuki; Murai, Kosuke; Tanaka, Yasunori; Shinkai, Takeshi

2017-05-01

Shack-Hartmann type laser wavefront sensors were applied to gas-blasted arc discharges under current-zero phases, generated in a 50 mm-long interelectrode gap confined by a gas flow nozzle, in order to conduct a systematic comparison of electron density decaying processes for two kinds of arc-quenching gas media: air and \\text{C}{{\\text{O}}2} . The experimental results for the air and \\text{C}{{\\text{O}}2} arc plasmas showed that the electron densities and arc diameters became thinner toward the nozzle-throat inlet due to a stronger convection loss in the arc radial direction. In addition, \\text{C}{{\\text{O}}2} had a shorter electron density decaying time constant than air, which could be caused by convection loss and turbulent flow of \\text{C}{{\\text{O}}2} stronger than air.

Time-resolved study of the electron temperature and number density of argon metastable atoms in argon-based dielectric barrier discharges

NASA Astrophysics Data System (ADS)

Desjardins, E.; Laurent, M.; Durocher-Jean, A.; Laroche, G.; Gherardi, N.; Naudé, N.; Stafford, L.

2018-01-01

A combination of optical emission spectroscopy and collisional-radiative modelling is used to determine the time-resolved electron temperature (assuming Maxwellian electron energy distribution function) and number density of Ar 1s states in atmospheric pressure Ar-based dielectric barrier discharges in presence of either NH3 or ethyl lactate. In both cases, T e values were higher early in the discharge cycle (around 0.8 eV), decreased down to about 0.35 eV with the rise of the discharge current, and then remained fairly constant during discharge extinction. The opposite behaviour was observed for Ar 1s states, with cycle-averaged values in the 1017 m-3 range. Based on these findings, a link was established between the discharge ionization kinetics (and thus the electron temperature) and the number density of Ar 1s state.

Structural and electronic properties of L-amino acids

NASA Astrophysics Data System (ADS)

Tulip, P. R.; Clark, S. J.

2005-05-01

The structural and electronic properties of four L-amino acids alanine, leucine, isoleucine, and valine have been investigated using density functional theory (DFT) and the generalized gradient approximation. Within the crystals, it is found that the constituent molecules adopt zwitterionic configurations, in agreement with experimental work. Lattice constants are found to be in good agreement with experimentally determined values, although certain discrepancies do exist due to the description of van der Waals interactions. We find that these materials possess wide DFT band gaps in the region of 5 eV, with electrons highly localized to the constituent molecules. It is found that the main mechanisms behind crystal formation are dipolar interactions and hydrogen bonding of a primarily electrostatic character, in agreement with current biochemical understanding of these systems. The electronic structure suggests that the amine and carboxy functional groups are dominant in determining band structure.

Experimental Potential Energy Curve for the 43 Π Electronic State of NaCs

NASA Astrophysics Data System (ADS)

Steely, Andrew; Cooper, Hannah; Zain, Hareem; Whipp, Ciara; Faust, Carl; Kortyna, Andrew; Huennekens, John

2017-04-01

We present results from experimental studies of the 43 Π electronic state of the NaCs molecule. This electronic state is interesting in that its potential energy curve likely exhibits a double minimum. As a result, interference effects are observed in the resolved bound-free fluorescence spectra. The optical-optical double resonance method was used to obtain Doppler-free excitation spectra for the 43 Π state. This dataset of measured level energies was expanded largely by observing fluorescence from levels populated by collisions. To aid in level assignments, simulations of resolved bound-free fluorescence spectra were calculated using the BCONT program (R. J. Le Roy, University of Waterloo). Spectroscopic constants were determined to summarize data belonging to inner well, outer well, and above barrier regions of the electronic state. Current work focuses on using the IPA method to construct an experimental potential energy curve. Work supported by NSF and Susquehanna University.

Electron transfer by excited benzoquinone anions: slow rates for two-electron transitions.

PubMed

Zamadar, Matibur; Cook, Andrew R; Lewandowska-Andralojc, Anna; Holroyd, Richard; Jiang, Yan; Bikalis, Jin; Miller, John R

2013-09-05

Electron transfer (ET) rate constants from the lowest excited state of the radical anion of benzoquinone, BQ(-•)*, were measured in THF solution. Rate constants for bimolecular electron transfer reactions typically reach the diffusion-controlled limit when the free-energy change, ΔG°, reaches -0.3 eV. The rate constants for ET from BQ(-•)* are one-to-two decades smaller at this energy and do not reach the diffusion-controlled limit until -ΔG° is 1.5-2.0 eV. The rates are so slow probably because a second electron must also undergo a transition to make use of the energy of the excited state. Similarly, ET, from solvated electrons to neutral BQ to form the lowest excited state, is slow, while fast ET is observed at a higher excited state, which can be populated in a transition involving only one electron. A simple picture based on perturbation theory can roughly account for the control of electron transfer by the need for transition of a second electron. The picture also explains how extra driving force (-ΔG°) can restore fast rates of electron transfer.

The effect of grain size on aluminum anodes for Al-air batteries in alkaline electrolytes

NASA Astrophysics Data System (ADS)

Fan, Liang; Lu, Huimin

2015-06-01

Aluminum is an ideal material for metallic fuel cells. In this research, different grain sizes of aluminum anodes are prepared by equal channel angular pressing (ECAP) at room temperature. Microstructure of the anodes is examined by electron backscatter diffraction (EBSD) in scanning electron microscope (SEM). Hydrogen corrosion rates of the Al anodes in 4 mol L-1 NaOH are determined by hydrogen collection method. The electrochemical properties of the aluminum anodes are investigated in the same electrolyte using electrochemical impedance spectroscopy (EIS) and polarization curves. Battery performance is also tested by constant current discharge at different current densities. Results confirm that the electrochemical properties of the aluminum anodes are related to grain size. Finer grain size anode restrains hydrogen evolution, improves electrochemical activity and increases anodic utilization rate. The proposed method is shown to effectively improve the performance of Al-air batteries.

Measurement technology of RF interference current in high current system

NASA Astrophysics Data System (ADS)

Zhao, Zhihua; Li, Jianxuan; Zhang, Xiangming; Zhang, Lei

2018-06-01

Current probe is a detection method commonly used in electromagnetic compatibility. With the development of power electronics technology, the power level of power conversion devices is constantly increasing, and the power current of the electric energy conversion device in the electromagnetic launch system can reach 10kA. Current probe conventionally used in EMC (electromagnetic compatibility) detection cannot meet the test requirements on high current system due to the magnetic saturation problem. The conventional high current sensor is also not suitable for the RF (Radio Frequency) interference current measurement in high current power device due to the high noise level in the output of active amplifier. In this paper, a passive flexible current probe based on Rogowski coil and matching resistance is proposed that can withstand high current and has low noise level, to solve the measurement problems of interference current in high current power converter. And both differential mode and common mode current detection can be easily carried out with the proposed probe because of the probe's flexible structure.

Use of a small overpotential approximation to analyze Geobacter sulfurreducens biofilm impedance

NASA Astrophysics Data System (ADS)

Babauta, Jerome T.; Beyenal, Haluk

2017-07-01

The electrochemical impedance of Geobacter sulfurreducens biofilms reflects the extracellular electron transfer mechanisms determining the rate of current output. Binned into two characteristic parameters, conductance and capacitance, biofilm impedance has received significant attention. The goal of this study was to evaluate a small overpotential approximation for extracellular electron transfer in G. sulfurreducens biofilms. Our motivation was to determine whether conductance over biofilm growth behaved linearly with respect to limiting current. Biofilm impedance was tracked during growth using electrochemical impedance spectroscopy (EIS) and electrochemical quartz crystal microbalance (eQCM). We showed that normalization of the biofilm impedance is useful for characterizing the changes during growth. When the conductance and capacitance were compared to the biofilm current, we found that: 1) conductance had a linear response and 2) constant phase elements (CPE) had a saturating response that coincided with the limiting current. We provided a framework using a simple iV relationship that predicted the conductance-current slope to be 9.57 V-1. CPEs showed more variability across biofilm replicates than conductance values. Although G. sulfurreducens biofilms were used here, other electrochemically active biofilms exhibiting catalytic waves could be studied using the same methods.

Dissipative NEGF methodology to treat short range Coulomb interaction: Current through a 1D nanostructure.

PubMed

Martinez, Antonio; Barker, John R; Di Prieto, Riccardo

2018-06-13

A methodology describing Coulomb blockade in the Non-equilibrium Green Function formalism is presented. We carried out ballistic and dissipative simulations through a 1D quantum dot using an Einstein phonon model. Inelastic phonons with different energies have been considered. The methodology incorporates the short-range Coulomb interaction between two electrons through the use of a two-particle Green's function. Unlike previous work, the quantum dot has spatial resolution i.e. it is not just parameterized by the energy level and coupling constants of the dot. Our method intends to describe the effect of electron localization while maintaining an open boundary or extended wave function. The formalism conserves the current through the nanostructure. A simple 1D model is used to explain the increase of mobility in semi-crystalline polymers as a function of the electron concentration. The mechanism suggested is based on the lifting of energy levels into the transmission window as a result of the local electron-electron repulsion inside a crystalline domain. The results are aligned with recent experimental findings. Finally, as a proof of concept, we present a simulation of a low temperature resonant structure showing the stability diagram in the Coulomb blockade regime. . © 2018 IOP Publishing Ltd.

A computational study of photo-induced electron transfer rate constants in subphthalocyanine/C60 organic photovoltaic materials via Fermi's golden rule

NASA Astrophysics Data System (ADS)

Lee, Myeong H.; Dunietz, Barry D.; Geva, Eitan

2014-03-01

We present a methodology to obtain the photo-induced electron transfer rate constant in organic photovoltaic (OPV) materials within the framework of Fermi's golden rule, using inputs obtained from first-principles electronic structure calculation. Within this approach, the nuclear vibrational modes are treated quantum-mechanically and a short-time approximation is avoided in contrast to the classical Marcus theory where these modes are treated classically within the high-temperature and short-time limits. We demonstrate our methodology on boron-subphthalocyanine-chloride/C60 OPV system to determine the rate constants of electron transfer and electron recombination processes upon photo-excitation. We consider two representative donor/acceptor interface configurations to investigate the effect of interface configuration on the charge transfer characteristics of OPV materials. In addition, we determine the time scale of excited states population by employing a master equation after obtaining the rate constants for all accessible electronic transitions. This work is pursued as part of the Center for Solar and Thermal Energy Conversion, an Energy Frontier Research Center funded by the US Department of Energy Office of Science, Office of Basic Energy Sciences under 390 Award No. DE-SC0000957.

The derivative discontinuity of the exchange-correlation functional.

PubMed

Mori-Sánchez, Paula; Cohen, Aron J

2014-07-28

The derivative discontinuity is a key concept in electronic structure theory in general and density functional theory in particular. The electronic energy of a quantum system exhibits derivative discontinuities with respect to different degrees of freedom that are a consequence of the integer nature of electrons. The classical understanding refers to the derivative discontinuity of the total energy as a function of the total number of electrons (N), but it can also manifest at constant N. Examples are shown in models including several hydrogen systems with varying numbers of electrons or nuclear charge (Z), as well as the 1-dimensional Hubbard model (1DHM). Two sides of the problem are investigated: first, the failure of currently used approximate exchange-correlation functionals in DFT and, second, the importance of the derivative discontinuity in the exact electronic structure of molecules, as revealed by full configuration interaction (FCI). Currently, all approximate functionals, including hybrids, miss the derivative discontinuity, leading to basic errors that can be seen in many ways: from the complete failure to give the total energy of H2 and H2(+), to the missing gap in Mott insulators such as stretched H2 and the thermodynamic limit of the 1DHM, or a qualitatively incorrect density in the HZ molecule with two electrons and incorrect electron transfer processes. Description of the exact particle behaviour of electrons is emphasised, which is key to many important physical processes in real systems, especially those involving electron transfer, and offers a challenge for the development of new exchange-correlation functionals.

Motor/generator and electronic control considerations for energy storage flywheels

NASA Technical Reports Server (NTRS)

Nola, F. J.

1984-01-01

A spacecraft electric power supply system is described. Requirements of the system are to accelerate a momentum wheel to a fixed maximum speed when solar energy is available and to maintain a constant voltage on the spacecraft bus under varying loads when solar energy is not available. Candidate motor types, pulse width modulated current control systems, and efficiency considerations are discussed. In addition, the Lunar Roving Vehicle motors are described along with their respective efficiencies.

Real Time Quantification of Ultrafast Photoinduced Bimolecular Electron Transfer Rate: Direct Probing of the Transient Intermediate.

PubMed

Mukherjee, Puspal; Biswas, Somnath; Sen, Pratik

2015-08-27

Fluorescence quenching studies through steady-state and time-resolved measurements are inadequate to quantify the bimolecular electron transfer rate in bulk homogeneous solution due to constraints from diffusion. To nullify the effect of diffusion, direct evaluation of the rate of formation of a transient intermediate produced upon the electron transfer is essential. Methyl viologen, a well-known electron acceptor, produces a radical cation after accepting an electron, which has a characteristic strong and broad absorption band centered at 600 nm. Hence it is a good choice to evaluate the rate of photoinduced electron transfer reaction employing femtosecond broadband transient absorption spectroscopy. The time constant of the aforementioned process between pyrene and methyl viologen in methanol has been estimated to be 2.5 ± 0.4 ps using the same technique. The time constant for the backward reaction was found to be 14 ± 1 ps. These values did not change with variation of concentration of quencher, i.e., methyl viologen. Hence, we can infer that diffusion has no contribution in the estimation of rate constants. However, on changing the solvent from methanol to ethanol, the time constant of the electron transfer reaction has been found to increase and has accounted for the change in solvent reorganization energy.

Thin-film composite materials as a dielectric layer for flexible metal-insulator-metal capacitors.

PubMed

Tiwari, Jitendra N; Meena, Jagan Singh; Wu, Chung-Shu; Tiwari, Rajanish N; Chu, Min-Ching; Chang, Feng-Chih; Ko, Fu-Hsiang

2010-09-24

A new organic-organic nanoscale composite thin-film (NCTF) dielectric has been synthesized by solution deposition of 1-bromoadamantane and triblock copolymer (Pluronic P123, BASF, EO20-PO70-EO20), in which the precursor solution has been achieved with organic additives. We have used a sol-gel process to make a metal-insulator-metal capacitor (MIM) comprising a nanoscale (10 nm-thick) thin-film on a flexible polyimide (PI) substrate at room temperature. Scanning electron microscope and atomic force microscope revealed that the deposited NCTFs were crack-free, uniform, highly resistant to moisture absorption, and well adhered on the Au-Cr/PI. The electrical properties of 1-bromoadamantane-P123 NCTF were characterized by dielectric constant, capacitance, and leakage current measurements. The 1-bromoadamantane-P123 NCTF on the PI substrate showed a low leakage current density of 5.5 x 10(-11) A cm(-2) and good capacitance of 2.4 fF at 1 MHz. In addition, the calculated dielectric constant of 1-bromoadamantane-P123 NCTF was 1.9, making them suitable candidates for use in future flexible electronic devices as a stable intermetal dielectric. The electrical insulating properties of 1-bromoadamantane-P123 NCTF have been improved due to the optimized dipole moments of the van der Waals interactions.

Fabrication of Carbon-Platinum Interdigitated Array Electrodes and Their Application for Investigating Homogeneous Hydrogen Evolution Catalysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Fei; Divan, Ralu; Parkinson, Bruce A.

2015-06-29

Carbon interdigitated array (IDA) electrodes have been applied to study the homogeneous hydrogen evolution electrocatalyst [Ni(PPh2NBn2)2]2+ (where PPh2NBn2 is 1,5-dibenzyl-3,7-diphenyl-1,5-diaza-3,7-diphosphacyclooctane). The existence of reaction intermediates in the catalytic cycle is inferred from the electrochemical behavior of a glassy carbon disk electrodes and carbon IDA electrodes. The currents on IDA electrodes for an EC’ (electron transfer reaction followed by a catalytic reaction) mechanism are derived from the number of redox cycles and the contribution of non-catalytic currents. The catalytic reaction rate constant was then extracted from the IDA current equations. Applying the IDA current and kinetic equations to the electrochemical responsemore » of the [Ni(PPh2NBn2)2]2+ catalyst yielded a rate constant of 0.10 s-1 for the hydrogen evolution reaction that agrees with the literature value. The quantitative analysis of IDA cyclic voltammetry can be used as a simple and straightforward method for determining rate constants in other catalytic systems. This work was supported as part of the Center for Molecular Electrocatalysis, an Energy Frontier Research Center funded by the Department of Energy, Office of Science, Office of Basic Energy Sciences. Pacific Northwest National Laboratory is operated by Battelle for DOE. Use of the Center for Nanoscale Materials was supported by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, under Contract No. DE-AC02-06CH11357.« less

Direct observation of 0.57 eV trap-related RF output power reduction in AlGaN/GaN high electron mobility transistors

NASA Astrophysics Data System (ADS)

Arehart, A. R.; Sasikumar, A.; Rajan, S.; Via, G. D.; Poling, B.; Winningham, B.; Heller, E. R.; Brown, D.; Pei, Y.; Recht, F.; Mishra, U. K.; Ringel, S. A.

2013-02-01

This paper reports direct evidence for trap-related RF output power loss in GaN high electron mobility transistors (HEMTs) grown by metal organic chemical vapor deposition (MOCVD) through increased concentration of a specific electron trap at EC-0.57 eV that is located in the drain access region, as a function of accelerated life testing (ALT). The trap is detected by constant drain current deep level transient spectroscopy (CID-DLTS) and the CID-DLTS thermal emission time constant precisely matches the measured drain lag. Both drain lag and CID-DLTS measurements show this state to already exist in pre-stressed devices, which coupled with its strong increase in concentration as a function of stress in the absence of significant increases in concentrations of other detected traps, imply its role in causing degradation, in particular knee walkout. This study reveals EC-0.57 eV trap concentration tracks degradation induced by ALT for MOCVD-grown HEMTs supplied by several commercial and university sources. The results suggest this defect has a common source and may be a key degradation pathway in AlGaN/GaN HEMTs and/or an indicator to predict device lifetime.

Simulation-Based Approach to Determining Electron Transfer Rates Using Square-Wave Voltammetry.

PubMed

Dauphin-Ducharme, Philippe; Arroyo-Currás, Netzahualcóyotl; Kurnik, Martin; Ortega, Gabriel; Li, Hui; Plaxco, Kevin W

2017-05-09

The efficiency with which square-wave voltammetry differentiates faradic and charging currents makes it a particularly sensitive electroanalytical approach, as evidenced by its ability to measure nanomolar or even picomolar concentrations of electroactive analytes. Because of the relative complexity of the potential sweep it uses, however, the extraction of detailed kinetic and mechanistic information from square-wave data remains challenging. In response, we demonstrate here a numerical approach by which square-wave data can be used to determine electron transfer rates. Specifically, we have developed a numerical approach in which we model the height and the shape of voltammograms collected over a range of square-wave frequencies and amplitudes to simulated voltammograms as functions of the heterogeneous rate constant and the electron transfer coefficient. As validation of the approach, we have used it to determine electron transfer kinetics in both freely diffusing and diffusionless surface-tethered species, obtaining electron transfer kinetics in all cases in good agreement with values derived using non-square-wave methods.

Analysis of Blockade in Charge Transport Across Polymeric Heterojunctions as a Function of Thermal Annealing: A Different Perspective

NASA Astrophysics Data System (ADS)

Rathi, Sonika; Chauhan, Gayatri; Gupta, Saral K.; Srivastava, Ritu; Singh, Amarjeet

2017-02-01

A blend of poly(3-hexylthiophene-2,5diyl) (P3HT) and [6,6]-phenyl C61 butyric acid methyl ester (PCBM) is popularly used as an active medium in polymeric solar devices. According to the most recent understanding, the blend is a three-phase system contrary to its earlier understanding of two-phase bicontinuous network. We have synthesized a P3HT-PCBM based layered heterostructure system by spin coating and thermal vacuum evaporations. Current density ( J) was measured as a function of applied electric field ( E) across the system bound between two metal electrodes. J- E relations were analyzed into the backdrop of space charge limited current model and Schottky model. The later was used to predict dc-dielectric constants from the linear slopes of ln ( J) versus E 1/2. The curves were not monotonously linear, but observe a knee-bend separating into two linear segments for each curve. Thermal annealing from 40°C to 80°C was used as an activation tool for driving changes in the internal morphology via inter-diffusion of polymers and current measurements were performed at room temperature after each annealing. At the last stage of annealing the two linear slopes were highly distinct. The presence of sharp knee-bend results in approximately 20 times jump in dielectric constant as a function of electric field. Such high jumps in dielectric constant illustrate the potential for switching applications and charge storage. The high dielectric constants can be understood in terms of space charge polarization due to isolated domains which hindrance to charge transport. The high dielectric constants were confirmed by another experiment of capacitance measurements of a different set of similar samples. A study of thermal evolution of internal morphology was also carried out using x-ray diffraction and scanning electron microscopy techniques to correlate the morphological changes with the transport properties.

The electronic structure, elastic and optical properties of Cu2ZnGe(SexS1 - x)4 alloys: density functional calculations

NASA Astrophysics Data System (ADS)

Shen, Kesheng; Jia, Guangrui; Zhang, Xianzhou; Jiao, Zhaoyong

2016-10-01

The electronic structure, elastic and optical properties of Cu2ZnGe(SexS1 - x)4 alloys are systematically analysed using first-principles calculations. The lattice parameters agree well with the theoretical and experimental values which are searched as complete as possible indicating our calculations are reliable. The elastic properties are investigated first and are compared with the similar compounds CZTS and CZTSe due to the unavailable experimental data currently. The variation of the optical properties caused by the increase of Se/S ratio is discussed. The static optical constants are calculated and the corrected values are also predicted according to the available experimental data.

Vertically aligned cobalt hydroxide nano-flake coated electro-etched carbon fiber cloth electrodes for supercapacitors

NASA Astrophysics Data System (ADS)

Cheng, Qian; Tang, Jie; Zhang, Han; Qin, Lu-Chang

2014-11-01

We describe preparation and characterization of nanostructured electrodes using Co(OH)2 nano-flakes and carbon fiber cloth for supercapacitors. Nanostructured Co(OH)2 flakes are produced by electrodeposition and they are coated onto the electro-etched carbon fiber cloth. A highest specific capacitance of 3404.8 F g-1 and an area-normalized specific capacitance of 3.3 F cm-2 have been obtained from such electrodes. Morphology and structure of the nanostructured electrodes have been characterized by scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The electrochemical properties have been studied by cyclic voltammetry (CV), constant-current charge and discharge, electrochemical impedance spectroscopy (EIS), and long-time cycling.

Difluoro-and Trifluoromethylation of Electron-Deficient Alkenes in an Electrochemical Microreactor.

PubMed

Arai, Kenta; Watts, Kevin; Wirth, Thomas

2014-02-01

Electrochemical microreactors, which have electrodes integrated into the flow path, can afford rapid and efficient electrochemical reactions without redox reagents due to the intrinsic properties of short diffusion distances. Taking advantage of electrochemical microreactors, Kolbe electrolysis of di-and trifluoroacetic acid in the presence of various electron-deficient alkenes was performed under constant current at continuous flow at room temperature. As a result, di-and trifluoromethylated compounds were effectively produced in either equal or higher yields than identical reactions under batch conditions previously reported by Uneyamas group. The strategy of using electrochemical microreactor technology is useful for an effective fluoromethylation of alkenes based on Kolbe electrolysis in significantly shortened reaction times.

Extreme ultraviolet spectra of S IX and S X relevant to solar coronal plasmas

NASA Astrophysics Data System (ADS)

Ali, Safdar; Kato, Hiroyuki; Nakamura, Nobuyuki

2017-10-01

We present extreme ultraviolet laboratory spectra of highly charged S IX and S X measured using a compact electron beam ion trap. The data were recorded using a flat-field grazing incidence spectrometer in the wavelength range between 210 and 290 Å. The beam energy was tuned for three different values at 365, 410 and 465 eV while keeping electron beam current constant at 10 mA. By measuring the beam energy dependence, we identified several lines originating from S IX and S X ions with the support of collisional-radiative modeling. We compared them with the present calculations and transitions listed in the NIST data base and found in good agreement.

Temporal survey of electron number density and electron temperature in the exhaust of a megawatt MPD-Arc thruster

NASA Technical Reports Server (NTRS)

Michels, C. J.; Rose, J. R.; Sigman, D. R.

1971-01-01

Temporal and radial profiles are obtained 30 cm downstream from the anode for two peak arc currents (11.2 kA and 20 kA) and for various auxiliary magnetic fields (0, 1.0 T, and 2.0T) using the Thomson scattering technique. Average density and temperature are relatively constant for over 100 microseconds with significant fluctuations. Radial profiles obtained are relatively flat for 4 cm from the axis. Compared to earlier 20 cm data, the exhaust density has decreased significantly, the average temperature (4.6 eV) has not changed, and the density hole with an auxiliary magnetic field has enlarged.

An inventory of publications on electronic medical records revisited.

PubMed

Moorman, P W; Schuemie, M J; van der Lei, J

2009-01-01

In this short review we provide an update of our earlier inventories of publications indexed in MedLine with the MeSH term 'Medical Records Systems, Computerized'. We retrieved and analyzed all references to English articles published before January 1, 2008, and indexed in PubMed with the MeSH term 'Medical Records Systems, Computerized'. We retrieved a total of 11,924 publications, of which 3937 (33%) appeared in a journal with an impact factor. Since 2002 the number of yearly publications, and the number of journals in which those publications appeared, increased. A cluster analysis revealed three clusters: an organizational issues cluster, a technically oriented cluster and a cluster about order-entry and research. Although our previous inventory in 2003 suggested a constant yearly production of publications on electronic medical records since 1998, the current inventory shows another rise in production since 2002. In addition, many new journals and countries have shown interest during the last five years. In the last 15 years, interest in organizational issues remained fairly constant, order entry and research with systems gained attention, while interest in technical issues relatively decreased.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

An integrated aerobic-anaerobic strategy for performance enhancement of Pseudomonas aeruginosa-inoculated microbial fuel cell.

PubMed

Yong, Xiao-Yu; Yan, Zhi-Ying; Shen, Hai-Bo; Zhou, Jun; Wu, Xia-Yuan; Zhang, Li-Juan; Zheng, Tao; Jiang, Min; Wei, Ping; Jia, Hong-Hua; Yong, Yang-Chun

2017-10-01

Microbial fuel cell (MFC) is a promising device for energy generation and organic waste treatment simultaneously by electrochemically active bacteria (EAB). In this study, an integrated aerobic-anaerobic strategy was developed to improve the performance of P. aeruginosa-inoculated MFC. With an aerobic start-up and following an anaerobic discharge process, the current density of MFC reached a maximum of 99.80µA/cm 2 , which was 91.6% higher than the MFC with conventional constant-anaerobic operation. Cyclic voltammetry and HPLC analysis showed that aerobic start-up significantly increased electron shuttle (pyocyanin) production (76% higher than the constant-anaerobic MFC). Additionally, enhanced anode biofilm formation was also observed in the integrated aerobic-anaerobic MFC. The increased pyocyanin production and biofilm formation promoted extracellular electron transfer from EAB to the anode and were the underlying mechanism for the MFC performance enhancement. This work demonstrated the integrated aerobic-anaerobic strategy would be a practical strategy to enhance the electricity generation of MFC. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effect of black clay soil moisture on the electrochemical behavior of API X70 pipeline steel

NASA Astrophysics Data System (ADS)

Hendi, R.; Saifi, H.; Belmokre, K.; Ouadah, M.; Smili, B.; Talhi, B.

2018-03-01

The effect of moisture content variation (20–100 wt.%) on the electrochemical behavior of API X70 pipeline steel buried in the soil of Skikda (East of Algeria) was studied using electrochemical techniques, scanning electron microscopy (SEM), X ray diffraction analysis (XRD) and weight loss measurement. The electrochemical measurements showed that the corrosion current Icorr is directly proportional to the moisture content up to 50 wt.%, beyond this content, this value becomes almost constant. The result were confirmed by electrochemical impedance spectroscopy; the capacitance of the double layer formed on the surface is the highest at 50 wt.%. A single time constant was detected by plotting the Bode diagrams. The steel surface degradation has been appreciated using the scanning electron microscopy observations. A few pitting corrosion at 20 wt.% moisture, followed by more degradation at 50 wt.% have been revealed. However, when the moisture amount exceeded 50 wt.%, the surface became entirely covered by a corrosion product. XRD analysis revealed the dominance of FeOOH and Fe3O4 phases on steel surface for a moisture content of 50 wt.%.

Higher success rate with transcranial electrical stimulation of motor-evoked potentials using constant-voltage stimulation compared with constant-current stimulation in patients undergoing spinal surgery.

PubMed

Shigematsu, Hideki; Kawaguchi, Masahiko; Hayashi, Hironobu; Takatani, Tsunenori; Iwata, Eiichiro; Tanaka, Masato; Okuda, Akinori; Morimoto, Yasuhiko; Masuda, Keisuke; Tanaka, Yuu; Tanaka, Yasuhito

2017-10-01

During spine surgery, the spinal cord is electrophysiologically monitored via transcranial electrical stimulation of motor-evoked potentials (TES-MEPs) to prevent injury. Transcranial electrical stimulation of motor-evoked potential involves the use of either constant-current or constant-voltage stimulation; however, there are few comparative data available regarding their ability to adequately elicit compound motor action potentials. We hypothesized that the success rates of TES-MEP recordings would be similar between constant-current and constant-voltage stimulations in patients undergoing spine surgery. The objective of this study was to compare the success rates of TES-MEP recordings between constant-current and constant-voltage stimulation. This is a prospective, within-subject study. Data from 100 patients undergoing spinal surgery at the cervical, thoracic, or lumbar level were analyzed. The success rates of the TES-MEP recordings from each muscle were examined. Transcranial electrical stimulation with constant-current and constant-voltage stimulations at the C3 and C4 electrode positions (international "10-20" system) was applied to each patient. Compound muscle action potentials were bilaterally recorded from the abductor pollicis brevis (APB), deltoid (Del), abductor hallucis (AH), tibialis anterior (TA), gastrocnemius (GC), and quadriceps (Quad) muscles. The success rates of the TES-MEP recordings from the right Del, right APB, bilateral Quad, right TA, right GC, and bilateral AH muscles were significantly higher using constant-voltage stimulation than those using constant-current stimulation. The overall success rates with constant-voltage and constant-current stimulations were 86.3% and 68.8%, respectively (risk ratio 1.25 [95% confidence interval: 1.20-1.31]). The success rates of TES-MEP recordings were higher using constant-voltage stimulation compared with constant-current stimulation in patients undergoing spinal surgery. Copyright © 2017 Elsevier Inc. All rights reserved.

Electrical resistivity well-logging system with solid-state electronic circuitry

USGS Publications Warehouse

Scott, James Henry; Farstad, Arnold J.

1977-01-01

An improved 4-channel electrical resistivity well-logging system for use with a passive probe with electrodes arranged in the 'normal' configuration has been designed and fabricated by Westinghouse Electric Corporation to meet technical specifications developed by the U.S. Geological Survey. Salient features of the system include solid-state switching and current regulation in the transmitter circuit to produce a constant-current source square wave, and synchronous solid-state switching and sampling of the potential waveform in the receiver circuit to provide an analog dc voltage proportions to the measured resistivity. Technical specifications and design details are included in this report.

An easy-to-implement filter for separating photo-excited signals from topography in scanning tunneling microscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Kangkang; Rosenmann, Daniel; Holt, Martin

2013-06-15

In order to achieve elemental and chemical sensitivity in scanning tunneling microscopy (STM), synchrotron x-rays have been applied to excite core-level electrons during tunneling. The x-ray photo-excitations result in tip currents that are superimposed onto conventional tunneling currents. While carrying important physical information, the varying x-ray induced currents can destabilize the feedback loop causing it to be unable to maintain a constant tunneling current, sometimes even causing the tip to retract fully or crash. In this paper, we report on an easy-to-implement filter circuit that can separate the x-ray induced currents from conventional tunneling currents, thereby allowing simultaneous measurements ofmore » topography and chemical contrasts. The filter and the schematic presented here can also be applied to other variants of light-assisted STM such as laser STM.« less

Size-dependent Hamaker constants for silver and gold nanoparticles

NASA Astrophysics Data System (ADS)

Pinchuk, Pavlo; Jiang, Ke

2015-08-01

Hamaker-Lifshitz constants are material specific constants that are used to calculate van der Waals interaction forces between small particles in solution. Typically, these constants are size-independent and material specific. According to the Lifshitz theory, the Hamaker-Lifshitz constants can be calculated by taking integrals that include the dielectric permittivity, as a function of frequency, of the interacting particles and the medium around particles. The dielectric permittivity of interacting metal nanoparticles can be calculated using the Drude model, which is based on the assumption of motion of free conducting electrons. For bulk metals, the Drude model does not predict any sizedependence of the dielectric permittivity. However, the conducting electrons in small noble metal nanoparticles (R ~ 10nm) exhibit surface scattering, which changes the complex permittivity function. In this work, we show theoretically that scattering of the free conducting electrons inside silver and gold nanoparticles with the size of 1 - 50 nm leads to size-dependent dielectric permittivity and Hamaker-Lifshitz constants. We calculate numerically the Hamaker-Lifshitz constants for silver and gold nanoparticles with different diameters. The results of the study might be of interests for understanding colloidal stability of metal nanoparticles.

Breakdown in helium in high-voltage open discharge with subnanosecond current front rise

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schweigert, I. V., E-mail: ischweig@itam.nsc.ru; Alexandrov, A. L.; Bokhan, P. A.

Investigations of high-voltage open discharge in helium have shown a possibility of generation of current pulses with subnanosecond front rise, due to ultra-fast breakdown development. The open discharge is ignited between two planar cathodes with mesh anode in the middle between them. For gas pressure 6 Torr and 20 kV applied voltage, the rate of current rise reaches 500 A/(cm{sup 2} ns) for current density 200 A/cm{sup 2} and more. The time of breakdown development was measured for different helium pressures and a kinetic model of breakdown in open discharge is presented, based on elementary reactions for electrons, ions andmore » fast atoms. The model also includes various cathode emission processes due to cathode bombardment by ions, fast atoms, electrons and photons of resonant radiation with Doppler shift of frequency. It is shown, that the dominating emission processes depend on the evolution of the discharge voltage during the breakdown. In the simulations, two cases of voltage behavior were considered: (i) the voltage is kept constant during the breakdown; (ii) the voltage is reduced with the growth of current. For the first case, the exponentially growing current is maintained due to photoemission by the resonant photons with Doppler-shifted frequency. For the second case, the dominating factor of current growth is the secondary electron emission. In both cases, the subnanosecond rise of discharge current was obtained. Also the effect of gas pressure on breakdown development was considered. It was found that for 20 Torr gas pressure the time of current rise decreases to 0.1 ns, which is in agreement with experimental data.« less

Influence of Manufacturing Parameters on Microstructure and Hydrogen Sorption Behavior of Electron Beam Melted Titanium Ti-6Al-4V Alloy

PubMed Central

Pushilina, Natalia; Syrtanov, Maxim; Murashkina, Tatyana; Kudiiarov, Viktor; Lider, Andrey; Koptyug, Andrey

2018-01-01

Influence of manufacturing parameters (beam current from 13 to 17 mA, speed function 98 and 85) on microstructure and hydrogen sorption behavior of electron beam melted (EBM) Ti-6Al-4V parts was investigated. Optical and scanning electron microscopies as well as X-ray diffraction were used to investigate the microstructure and phase composition of EBM Ti-6Al-4V parts. The average α lath width decreases with the increase of the speed function at the fixed beam current (17 mA). Finer microstructure was formed at the beam current 17 mA and speed function 98. The hydrogenation of EBM Ti-6Al-4V parts was performed at the temperatures 500 and 650 °С at the constant pressure of 1 atm up to 0.3 wt %. The correlation between the microstructure and hydrogen sorption kinetics by EBM Ti-6Al-4V parts was demonstrated. Lower average hydrogen sorption rate at 500 °C was in the sample with coarser microstructure manufactured at the beam current 17 mA and speed function 85. The difference of hydrogen sorption kinetics between the manufactured samples at 650 °C was insignificant. The shape of the kinetics curves of hydrogen sorption indicates the phase transition αH + βH→βH. PMID:29747471

Influence of Manufacturing Parameters on Microstructure and Hydrogen Sorption Behavior of Electron Beam Melted Titanium Ti-6Al-4V Alloy.

PubMed

Pushilina, Natalia; Syrtanov, Maxim; Kashkarov, Egor; Murashkina, Tatyana; Kudiiarov, Viktor; Laptev, Roman; Lider, Andrey; Koptyug, Andrey

2018-05-10

Influence of manufacturing parameters (beam current from 13 to 17 mA, speed function 98 and 85) on microstructure and hydrogen sorption behavior of electron beam melted (EBM) Ti-6Al-4V parts was investigated. Optical and scanning electron microscopies as well as X-ray diffraction were used to investigate the microstructure and phase composition of EBM Ti-6Al-4V parts. The average α lath width decreases with the increase of the speed function at the fixed beam current (17 mA). Finer microstructure was formed at the beam current 17 mA and speed function 98. The hydrogenation of EBM Ti-6Al-4V parts was performed at the temperatures 500 and 650 °С at the constant pressure of 1 atm up to 0.3 wt %. The correlation between the microstructure and hydrogen sorption kinetics by EBM Ti-6Al-4V parts was demonstrated. Lower average hydrogen sorption rate at 500 °C was in the sample with coarser microstructure manufactured at the beam current 17 mA and speed function 85. The difference of hydrogen sorption kinetics between the manufactured samples at 650 °C was insignificant. The shape of the kinetics curves of hydrogen sorption indicates the phase transition α H + β H →β H .

Electromigration and the structure of metallic nanocontacts

NASA Astrophysics Data System (ADS)

Hoffmann-Vogel, R.

2017-09-01

This article reviews efforts to structurally characterize metallic nanocontacts. While the electronic characterization of such junctions is relatively straight forward, usually it is technically challenging to study the nanocontact's structure at small length scales. However, knowing that the structure is the basis for understanding the electronic properties of the nanocontact, for example, it is necessary to explain the electronic properties by calculations based on structural models. Besides using a gate electrode, controlling the structure is an important way of understanding how the electronic transport properties can be influenced. A key to make structural information directly accessible is to choose a fabrication method that is adapted to the structural characterization method. Special emphasis is given to transmission electron microscopy fabrication and to thermally assisted electromigration methods due to their potential for obtaining information on both electrodes of the forming nanocontact. Controlled electromigration aims at studying the contact at constant temperature of the contact during electromigration compared to studies at constant temperature of the environment as done previously. We review efforts to calculate electromigration forces. We describe how hot spots are formed during electromigration. We summarize implications for the structure obtained from studies of the ballistic transport regime, tunneling, and Coulomb-blockade. We review the structure of the nanocontacts known from direct structural characterization. Single-crystalline wires allow suppressing grain boundary electromigration. In thin films, the substrate plays an important role in influencing the defect and temperature distribution. Hot-spot formation and recrystallization are observed. We add information on the local temperature and current density and on alloys important for microelectronic interconnects.

Holmium hafnate: An emerging electronic device material

NASA Astrophysics Data System (ADS)

Pavunny, Shojan P.; Sharma, Yogesh; Kooriyattil, Sudheendran; Dugu, Sita; Katiyar, Rajesh K.; Scott, James F.; Katiyar, Ram S.

2015-03-01

We report structural, optical, charge transport, and temperature properties as well as the frequency dependence of the dielectric constant of Ho2Hf2O7 (HHO) which make this material desirable as an alternative high-k dielectric for future silicon technology devices. A high dielectric constant of ˜20 and very low dielectric loss of ˜0.1% are temperature and voltage independent at 100 kHz near ambient conditions. The Pt/HHO/Pt capacitor exhibits exceptionally low Schottky emission-based leakage currents. In combination with the large observed bandgap Eg of 5.6 eV, determined by diffuse reflectance spectroscopy, our results reveal fundamental physics and materials science of the HHO metal oxide and its potential application as a high-k dielectric for the next generation of complementary metal-oxide-semiconductor devices.

(In)validity of the constant field and constant currents assumptions in theories of ion transport.

PubMed Central

Syganow, A; von Kitzing, E

1999-01-01

Constant electric fields and constant ion currents are often considered in theories of ion transport. Therefore, it is important to understand the validity of these helpful concepts. The constant field assumption requires that the charge density of permeant ions and flexible polar groups is virtually voltage independent. We present analytic relations that indicate the conditions under which the constant field approximation applies. Barrier models are frequently fitted to experimental current-voltage curves to describe ion transport. These models are based on three fundamental characteristics: a constant electric field, negligible concerted motions of ions inside the channel (an ion can enter only an empty site), and concentration-independent energy profiles. An analysis of those fundamental assumptions of barrier models shows that those approximations require large barriers because the electrostatic interaction is strong and has a long range. In the constant currents assumption, the current of each permeating ion species is considered to be constant throughout the channel; thus ion pairing is explicitly ignored. In inhomogeneous steady-state systems, the association rate constant determines the strength of ion pairing. Among permeable ions, however, the ion association rate constants are not small, according to modern diffusion-limited reaction rate theories. A mathematical formulation of a constant currents condition indicates that ion pairing very likely has an effect but does not dominate ion transport. PMID:9929480

Wide-temperature integrated operational amplifier

NASA Technical Reports Server (NTRS)

Mojarradi, Mohammad (Inventor); Levanas, Greg (Inventor); Chen, Yuan (Inventor); Cozy, Raymond S. (Inventor); Greenwell, Robert (Inventor); Terry, Stephen (Inventor); Blalock, Benjamin J. (Inventor)

2009-01-01

The present invention relates to a reference current circuit. The reference circuit comprises a low-level current bias circuit, a voltage proportional-to-absolute temperature generator for creating a proportional-to-absolute temperature voltage (VPTAT), and a MOSFET-based constant-IC regulator circuit. The MOSFET-based constant-IC regulator circuit includes a constant-IC input and constant-IC output. The constant-IC input is electrically connected with the VPTAT generator such that the voltage proportional-to-absolute temperature is the input into the constant-IC regulator circuit. Thus the constant-IC output maintains the constant-IC ratio across any temperature range.

A theory of single-electron non-adiabatic tunneling through a small metal nanoparticle with due account of the strong interaction of valence electrons with phonons of the condensed matter environment.

PubMed

Medvedev, Igor G

2011-11-07

A theory of electrochemical behavior of small metal nanoparticles (NPs) which is governed both by the charging effect and the effect of the solvent reorganization on the dynamic of the electron transfer (ET) is considered under ambient conditions. The exact expression for the rate constant of ET from an electrode to NP which is valid for all values of the reorganization free energy E(r), bias voltage, and overpotential is obtained in the non-adiabatic limit. The tunnel current/overpotential relations are studied and calculated for different values of the bias voltage and E(r). The effect of E(r) on the full width at half maximum of the charging peaks is investigated at different values of the bias voltage. The differential conductance/bias voltage and the tunnel current/bias voltage dependencies are also studied and calculated. It is shown that, at room temperature, the pronounced Coulomb blockade oscillations in the differential conductance/bias voltage curves and the noticeable Coulomb staircase in the tunnel current/bias voltage relations are observed only at rather small values of E(r) in the case of the strongly asymmetric tunneling contacts.

Correlative analysis of hard and soft x ray observations of solar flares

NASA Technical Reports Server (NTRS)

Zarro, Dominic M.

1994-01-01

We have developed a promising new technique for jointly analyzing BATSE hard X-ray observations of solar flares with simultaneous soft X-ray observations. The technique is based upon a model in which electric currents and associated electric fields are responsible for the respective heating and particle acceleration that occur in solar flares. A useful by-product of this technique is the strength and evolution of the coronal electric field. The latter permits one to derive important flare parameters such as the current density, the number of current filaments composing the loop, and ultimately the hard X-ray spectrum produced by the runaway electrons. We are continuing to explore the technique by applying it to additional flares for which we have joint BATSE/Yohkoh observations. A central assumption of our analysis is the constant of proportionality alpha relating the hard X-ray flux above 50 keV and the rate of electron acceleration. For a thick-target model of hard X-ray production, it can be shown that cv is in fact related to the spectral index and low-energy cutoff of precipitating electrons. The next step in our analysis is to place observational constraints on the latter parameters using the joint BATSE/Yohkoh data.

A Spectral Algorithm for Solving the Relativistic Vlasov-Maxwell Equations

NASA Technical Reports Server (NTRS)

Shebalin, John V.

2001-01-01

A spectral method algorithm is developed for the numerical solution of the full six-dimensional Vlasov-Maxwell system of equations. Here, the focus is on the electron distribution function, with positive ions providing a constant background. The algorithm consists of a Jacobi polynomial-spherical harmonic formulation in velocity space and a trigonometric formulation in position space. A transform procedure is used to evaluate nonlinear terms. The algorithm is suitable for performing moderate resolution simulations on currently available supercomputers for both scientific and engineering applications.

Temperature Dependence of Dissociative Electron Attachment to Halogenated Hydrocarbons

NASA Astrophysics Data System (ADS)

Wang, Yicheng; Christophorou, Loucas G.

1996-10-01

Most of the gas mixtures currently in use for plasma processing of semiconductors involve halogenated hydrocarbons such as the strongly electronegative gases CCl4 and CFCl_3, the weakly electronegative gas CF_2Cl2 and the very weakly electronegative gases CHF3 and CF_4. Many dissociation processes are known to occur for these molecules. One of these dissociation reactions which is particularly effective for the strongly electronegative hydrocarbons is dissociative electron attachment. Even for weakly electron attaching gases, molecular dissociation via dissociative electron attachment at low energies can be an efficient dissociation process if the gas temperature is higher than ambient. Dissociative electron attachment is known to increase with increasing temperature above room temperature for many such compounds. In this paper, we report our measurements on the increases of the total electron attachment rate constant for CF_2Cl2 with increasing gas temperature from room temperature to about 600 K. -Research sponsored in part by the U.S. Air Force Wright Laboratory under contract F33615-96-C-2600 with the University of Tennessee. Also, Department of Physics, The University of Tennessee, Knoxville, TN.

Mapping Ion and Electron Remagnetization Distance in the Reconnection Outflow Exhaust Region with MMS

NASA Astrophysics Data System (ADS)

Sturner, A. P.; Eriksson, S.; Gershman, D. J.; Plaschke, F.; Burch, J.

2017-12-01

Magnetopause current sheets have been fertile ground for understanding kinetic-scale physics of magnetic reconnection, but can also be used to study more macroscopic scale phenomena statistically. Post-reconnection, magnetic flux and plasma are accelerated away from the x-line into exhaust regions. As the exhausting plasma exits the electron diffusion region, electrons become remagnetized and are accelerated by the magnetic field into an E x B jet while the ions remain unmagnetized. Further along the exhaust, at the edge of the ion diffusion region, the ions become frozen into the magnetic field, and are accelerated to join the electrons in the exhaust jet. By assuming a constant reconnection rate of 0.1, we can infer the distance to the x-line from the normal width of the exhaust. We present a statistical study using the Magnetospheric Multiscale Mission (MMS) to map out the electron and ion remagnetization distances that define the edge of the electron and ion diffusion regions for magnetopause reconnection, and explore the effects of a guide magnetic field.

Electron Attachment to Radicals and Highly-Excited States in Laser-Irradiated CCl_2F_2*

NASA Astrophysics Data System (ADS)

Pinnaduwage, Lal; Datskos, Panos

1997-10-01

We have measured electron attachment rate constants for two species produced via ArF-excimer- laser irradiated CF_2Cl_2, i.e., the CF_2Cl radical and the highly-excited electronically-excited states of CF_2Cl_2. These measurements show that while electron attachment to the fragment radical has a rate constants about an order of magnitude higher compared to the ground states of CF_2Cl_2, electron attachment to the highly- excited states have many orders of magnitude larger rate constants. To our knowledge, only one other electron attachment measurement has been conducted on molecular fragments up to now. Implications of these measurements for plasma processing discharges will be discussed. Research supported by the National Science Foundation under contract No. ECS-9626217 with the University of Tennessee, Knoxville. The Oak Ridge National Laboratory is managed by Lockheed Martin Energy Research Corp. for the U. S. DOE under contract No. DE-AC05- 96OR22464.

Screening of a dust particle charge in a humid air plasma created by an electron beam

NASA Astrophysics Data System (ADS)

Filippov, A. V.; Derbenev, I. N.; Kurkin, S. A.

2018-01-01

A kinetic model has been developed for charged particle reactions in a humid air plasma produced by a fast electron beam. The model includes over 550 reactions with electrons, 33 positive ion species and 14 negative ion species. The model has been tested by solving 48 non-steady state equations for number densities of charged particles in humid air electron beam plasma, and by comparing with the available experimental data. The system of 48 steady state equations has been solved by iterative method in order to define the main ion species of the humid air plasma. A reduced kinetic model has been developed to describe the processes with the main ions and electrons. Screening constants have been calculated on the basis of the reduced system by means of Leverrier-Fadeev method. The dependencies of screening constants on gas ionization rates have been found for the rates from 10 to 1018 cm-3s-1 and the fraction of water molecules from 0 to 2%. The analysis of the constants has revealed that one of them is close to the inverse Debye length, and the other constants are defined by the inverse diffusion lengths passed by ions in the characteristic times of the attachment, recombination, and ion conversion. Pure imaginary screening constants appear at low rates of gas ionization.

Oxidation kinetics of guanine in DNA molecules adsorbed onto indium tin oxide electrodes.

PubMed

Armistead, P M; Thorp, H H

2001-02-01

Oligonucleotides containing the guanine nucleobase were adsorbed onto ITO electrodes from mixtures of DMF and acetate buffer. Chronocoulometry and chronoamperometry were performed on the modified electrodes in both phosphate buffer and buffer containing low concentrations of the inorganic complex Ru(bpy)3(2+) (bpy = 2,2' bipyridine), which catalyzes guanine oxidation. The charge and current evolution with and without the catalyst were compared to the charge and current evolution for electrodes that were treated with identical oligonucleotides that were substituted at every guanine with the electrochemically inert nucleobase hypoxanthine. Chronocoulometry over 2.5 s shows that roughly 2 electrons per guanine were transferred to the electrode in both the presence and absence of Ru(bpy)3(2+), although at a slower rate for the uncatalyzed process. Chronoamperograms measured over 250 ms can be fit to a double exponential decay, with the intensity of the fast component roughly 6-20 times greater than that of the slow component. First- and second-order rate constants for catalytic and direct guanine oxidation were determined from the fast component. The maximum catalytic enhancement for immobilized guanine was found to be i(cat)/i(d) = 4 at 25 microM Ru(bpy)3(2+). The second-order rate constant for the catalyzed reaction was 1.3 x 10(7) M(-1) s(-1), with an apparent dissociation constant of 8.8 microM. When compared to parallel studies in solution, a smaller value of the dissociation constant and a larger value of the second-order rate constant are observed, probably due to distortion of the immobilized DNA, an increase in the local negative charge due to the oxygen sites on the ITO surface, and redox cycling of the catalyst, which maintains the surface concentration of the active form.

Nonadiabatic rate constants for proton transfer and proton-coupled electron transfer reactions in solution: Effects of quadratic term in the vibronic coupling expansion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Soudackov, Alexander V.; Hammes-Schiffer, Sharon

2015-11-21

Rate constant expressions for vibronically nonadiabatic proton transfer and proton-coupled electron transfer reactions are presented and analyzed. The regimes covered include electronically adiabatic and nonadiabatic reactions, as well as high-frequency and low-frequency proton donor-acceptor vibrational modes. These rate constants differ from previous rate constants derived with the cumulant expansion approach in that the logarithmic expansion of the vibronic coupling in terms of the proton donor-acceptor distance includes a quadratic as well as a linear term. The analysis illustrates that inclusion of this quadratic term in the framework of the cumulant expansion framework may significantly impact the rate constants at highmore » temperatures for proton transfer interfaces with soft proton donor-acceptor modes that are associated with small force constants and weak hydrogen bonds. The effects of the quadratic term may also become significant in these regimes when using the vibronic coupling expansion in conjunction with a thermal averaging procedure for calculating the rate constant. In this case, however, the expansion of the coupling can be avoided entirely by calculating the couplings explicitly for the range of proton donor-acceptor distances sampled. The effects of the quadratic term for weak hydrogen-bonding systems are less significant for more physically realistic models that prevent the sampling of unphysical short proton donor-acceptor distances. Additionally, the rigorous relation between the cumulant expansion and thermal averaging approaches is clarified. In particular, the cumulant expansion rate constant includes effects from dynamical interference between the proton donor-acceptor and solvent motions and becomes equivalent to the thermally averaged rate constant when these dynamical effects are neglected. This analysis identifies the regimes in which each rate constant expression is valid and thus will be important for future applications to proton transfer and proton-coupled electron transfer in chemical and biological processes.« less

Electrical Conductance Tuning and Bistable Switching in Poly(N-vinylcarbazole)-Carbon Nanotube Composite Films.

PubMed

Liu, Gang; Ling, Qi-Dan; Teo, Eric Yeow Hwee; Zhu, Chun-Xiang; Chan, D Siu-Hung; Neoh, Koon-Gee; Kang, En-Tang

2009-07-28

By varying the carbon nanotube (CNT) content in poly(N-vinylcarbazole) (PVK) composite thin films, the electrical conductance behavior of an indium-tin oxide/PVK-CNT/aluminum (ITO/PVK-CNT/Al) sandwich structure can be tuned in a controlled manner. Distinctly different electrical conductance behaviors, such as (i) insulator behavior, (ii) bistable electrical conductance switching effects (write-once read-many-times (WORM) memory effect and rewritable memory effect), and (iii) conductor behavior, are discernible from the current density-voltage characteristics of the composite films. The turn-on voltage of the two bistable conductance switching devices decreases and the ON/OFF state current ratio of the WORM device increases with the increase in CNT content of the composite film. Both the WORM and rewritable devices are stable under a constant voltage stress or a continuous pulse voltage stress, with an ON/OFF state current ratio in excess of 10(3). The conductance switching effects of the composite films have been attributed to electron trapping in the CNTs of the electron-donating/hole-transporting PVK matrix.

Toroidal Ampere-Faraday Equations Solved Simultaneously with CQL3D Fokker-Planck Time-Evolution

NASA Astrophysics Data System (ADS)

Harvey, R. W. (Bob); Petrov, Yu. V. (Yuri); Forest, C. B.; La Haye, R. J.

2017-10-01

A self-consistent, time-dependent toroidal electric field calculation is a key feature of a complete 3D Fokker-Planck kinetic distribution radial transport code for f(v,theta,rho,t). We discuss benchmarking and first applications of an implementation of the Ampere-Faraday equation for the self-consistent toroidal electric field, as applied to (1) resistive turn on of applied electron cyclotron current in the DIII-D tokamak giving initial back current adjacent to the direct CD region and having possible NTM stabilization implications, and (2) runaway electron production in tokamaks due to rapid reduction of the plasma temperature as occurs in pellet injection, massive gas injection, or a plasma disruption. Our previous results assuming a constant current density (Lenz' Law) model showed that prompt ``hot-tail runaways'' dominated ``knock-on'' and Dreicer ``drizzle'' runaways; we perform full-radius modeling and examine modifications due to the more complete Ampere-Faraday solution. Presently, the implementation relies on a fixed shape eqdsk, and this limitation will be addressed in future work. Research supported by USDOE FES award ER54744.

Size- and temperature-dependent Hamaker constants for heterogeneous systems of interacting nanoparticles

NASA Astrophysics Data System (ADS)

Pinchuk, P.; Pinchuk, A. O.

2016-09-01

Hamaker-Lifshitz constants are used to calculate van der Waals interaction forces between small particles in solution. Typically, these constants are size-independent and material specific. According to the Lifshitz theory, the Hamaker-Lifshitz constants can be calculated by taking integrals that include the dielectric permittivity, as a function of frequency, of the interacting particles and the medium around particles. The dielectric permittivity of interacting metal nanoparticles can be calculated using the free-electron Drude model for metals. For bulk metals, the Drude model does is size independent. However, the conducting electrons in small metal nanoparticles exhibit surface scattering, which changes the complex dielectric permittivity function. Additionally, the Drude model can be modified to include temperature dependence. That is, an increase in temperature leads to thermal volume expansion and increased phonon population, which affect the scattering rate of the electrons and the plasma frequency. Both of these terms contribute significantly to the Drude model for the dielectric permittivity of the particles. In this work, we show theoretically that scattering of the free conducting electrons inside noble metal nanoparticles with the size of 1 - 50 nm leads to size-dependent dielectric permittivity and Hamaker-Lifshitz constants. In addition, we calculate numerically the Hamaker-Lifshitz constants for a variety of temperatures. The results of the study might be of interest for understanding colloidal stability of metal nanoparticles.

Constant-current control method of multi-function electromagnetic transmitter.

PubMed

Xue, Kaichang; Zhou, Fengdao; Wang, Shuang; Lin, Jun

2015-02-01

Based on the requirements of controlled source audio-frequency magnetotelluric, DC resistivity, and induced polarization, a constant-current control method is proposed. Using the required current waveforms in prospecting as a standard, the causes of current waveform distortion and current waveform distortion's effects on prospecting are analyzed. A cascaded topology is adopted to achieve 40 kW constant-current transmitter. The responsive speed and precision are analyzed. According to the power circuit of the transmitting system, the circuit structure of the pulse width modulation (PWM) constant-current controller is designed. After establishing the power circuit model of the transmitting system and the PWM constant-current controller model, analyzing the influence of ripple current, and designing an open-loop transfer function according to the amplitude-frequency characteristic curves, the parameters of the PWM constant-current controller are determined. The open-loop transfer function indicates that the loop gain is no less than 28 dB below 160 Hz, which assures the responsive speed of the transmitting system; the phase margin is 45°, which assures the stabilization of the transmitting system. Experimental results verify that the proposed constant-current control method can keep the control error below 4% and can effectively suppress load change caused by the capacitance of earth load.

Constant-current control method of multi-function electromagnetic transmitter

NASA Astrophysics Data System (ADS)

Xue, Kaichang; Zhou, Fengdao; Wang, Shuang; Lin, Jun

2015-02-01

Based on the requirements of controlled source audio-frequency magnetotelluric, DC resistivity, and induced polarization, a constant-current control method is proposed. Using the required current waveforms in prospecting as a standard, the causes of current waveform distortion and current waveform distortion's effects on prospecting are analyzed. A cascaded topology is adopted to achieve 40 kW constant-current transmitter. The responsive speed and precision are analyzed. According to the power circuit of the transmitting system, the circuit structure of the pulse width modulation (PWM) constant-current controller is designed. After establishing the power circuit model of the transmitting system and the PWM constant-current controller model, analyzing the influence of ripple current, and designing an open-loop transfer function according to the amplitude-frequency characteristic curves, the parameters of the PWM constant-current controller are determined. The open-loop transfer function indicates that the loop gain is no less than 28 dB below 160 Hz, which assures the responsive speed of the transmitting system; the phase margin is 45°, which assures the stabilization of the transmitting system. Experimental results verify that the proposed constant-current control method can keep the control error below 4% and can effectively suppress load change caused by the capacitance of earth load.

Measuring the Electron’s Charge and the Fine-Structure Constant by Counting Electrons on a Capacitor

PubMed Central

Williams, E. R.; Ghosh, Ruby N.; Martinis, John M.

1992-01-01

The charge of the electron can be determined by simply placing a known number of electrons on one electrode of a capacitor and measuring the voltage, Vs, across the capacitor. If Vs is measured in terms of the Josephson volt and the capacitor is measured in SI units then the fine-structure constant is the quantity determined. Recent developments involving single electron tunneling, SET, have shown bow to count the electrons as well as how to make an electrometer with sufficient sensitivity to measure the charge. PMID:28053434

Theoretical rate constants of super-exchange hole transfer and thermally induced hopping in DNA.

PubMed

Shimazaki, Tomomi; Asai, Yoshihiro; Yamashita, Koichi

2005-01-27

Recently, the electronic properties of DNA have been extensively studied, because its conductivity is important not only to the study of fundamental biological problems, but also in the development of molecular-sized electronics and biosensors. We have studied theoretically the reorganization energies, the activation energies, the electronic coupling matrix elements, and the rate constants of hole transfer in B-form double-helix DNA in water. To accommodate the effects of DNA nuclear motions, a subset of reaction coordinates for hole transfer was extracted from classical molecular dynamics (MD) trajectories of DNA in water and then used for ab initio quantum chemical calculations of electron coupling constants based on the generalized Mulliken-Hush model. A molecular mechanics (MM) method was used to determine the nuclear Franck-Condon factor. The rate constants for two types of mechanisms of hole transfer-the thermally induced hopping (TIH) and the super-exchange mechanisms-were determined based on Marcus theory. We found that the calculated matrix elements are strongly dependent on the conformations of the nucleobase pairs of hole-transferable DNA and extend over a wide range of values for the "rise" base-step parameter but cluster around a particular value for the "twist" parameter. The calculated activation energies are in good agreement with experimental results. Whereas the rate constant for the TIH mechanism is not dependent on the number of A-T nucleobase pairs that act as a bridge, the rate constant for the super-exchange process rapidly decreases when the length of the bridge increases. These characteristic trends in the calculated rate constants effectively reproduce those in the experimental data of Giese et al. [Nature 2001, 412, 318]. The calculated rate constants were also compared with the experimental results of Lewis et al. [Nature 2000, 406, 51].

Current Mode Neutron Noise Measurements in the Zero Power Reactor CROCUS

NASA Astrophysics Data System (ADS)

Pakari, O.; Lamirand, V.; Perret, G.; Braun, L.; Frajtag, P.; Pautz, A.

2018-01-01

The present article is an overview of developments and results regarding neutron noise measurements in current mode at the CROCUS zero power facility. Neutron noise measurements offer a non-invasive method to determine kinetic reactor parameters such as the prompt decay constant at criticality α = βeff / λ, the effective delayed neutron fraction βeff, and the mean generation time λ for code validation efforts. At higher detection rates, i.e. above 2×104 cps in the used configuration at 0.1 W, the previously employed pulse charge amplification electronics with BF3 detectors yielded erroneous results due to dead time effects. Future experimental needs call for higher sensitivity in detectors, higher detection rates or higher reactor powers, and thus a generally more versatile measurement system. We, therefore, explored detectors operated with current mode acquisition electronics to accommodate the need. We approached the matter in two ways: 1) By using the two compensated 10B-coated ionization chambers available in CROCUS as operational monitors. The compensated current signal of these chambers was extracted from coremonitoring output channels. 2) By developing a new current mode amplification station to be used with other available detectors in core. Characteristics and first noise measurements of the new current system are presented. We implemented post-processing of the current signals from 1)and 2) with the APSD/CPSD method to determine α. At two critical states (0.5 and 1.5 W), using the 10B ionization chambers and their CPSD estimate, the prompt decay constant was measured after 1.5 hours to be α=(156.9 ± 4.3) s-1 (1σ). This result is within 1σ of statistical uncertainties of previous experiments and MCNPv5-1.6 predictions using the ENDF/B-7.1 library. The newsystem connected to a CFUL01 fission chamber using the APSDestimate at 100 mW after 33 min yielded α = (160.8 ± 6.3) s-1, also within 1σ agreement. The improvements to previous neutron noise measurementsinclude shorter measurement durations that can achievecomparable statistical uncertainties and measurements at higherdetection rates.

A study of the effect of in-line and perpendicular magnetic fields on beam characteristics of electron guns in medical linear accelerators.

PubMed

Constantin, Dragoş E; Fahrig, Rebecca; Keall, Paul J

2011-07-01

Using magnetic resonance imaging (MRI) for real-time guidance during radiotherapy is an active area of research and development. One aspect of the problem is the influence of the MRI scanner, modeled here as an external magnetic field, on the medical linear accelerator (linac) components. The present work characterizes the behavior of two medical linac electron guns with external magnetic fields for in-line and perpendicular orientations of the linac with respect to the MRI scanner. Two electron guns, Litton L-2087 and Varian VTC6364, are considered as representative models for this study. Emphasis was placed on the in-line design approach in which case the MRI scanner and the linac axes of symmetry coincide and assumes no magnetic shielding of the linac. For the in-line case, the magnetic field from a 0.5 T open MRI (GE Signa SP) magnet with a 60 cm gap between its poles was computed and used in full three dimensional (3D) space charge simulations, whereas for the perpendicular case the magnetic field was constant. For the in-line configuration, it is shown that the electron beam is not deflected from the axis of symmetry of the gun and the primary beam current does not vanish even at very high values of the magnetic field, e.g., 0.16 T. As the field strength increases, the primary beam current has an initial plateau of constant value after which its value decreases to a minimum corresponding to a field strength of approximately 0.06 T. After the minimum is reached, the current starts to increase slowly. For the case when the beam current computation is performed at the beam waist position the initial plateau ends at 0.016 T for Litton L-2087 and at 0.012 T for Varian VTC6364. The minimum value of the primary beam current is 27.5% of the initial value for Litton L-2087 and 22.9% of the initial value for Varian VTC6364. The minimum current is reached at 0.06 and 0.062 T for Litton L-2087 and Varian VTC6364, respectively. At 0.16 T the beam current increases to 40.2 and 31.4% from the original value of the current for Litton L-2087 and Varian VTC6364, respectively. In contrast, for the case when the electron gun is perpendicular to the magnetic field, the electron beam is deflected from the axis of symmetry even at small values of the magnetic field. As the strength of the magnetic field increases, so does the beam deflection, leading to a sharp decrease of the primary beam current which vanishes at about 0.007 T for Litton L-2087 and at 0.006 T for Varian VTC6364, respectively. At zero external field, the beam rms emittance computed at beam waist is 1.54 and 1.29n-mm-mrad for Litton L-2087 and Varian VTC6364, respectively. For the inline configuration, there are two particular values of the external field where the beam rms emittance reaches a minimum. Litton L-2087 rms emittance reaches a minimum of 0.72n and 2.01 n-mm-mrad at 0.026 and 0.132 T, respectively. Varian VTC6364 rms emittance reaches a minimum of 0.34n and 0.35n-mm-mrad at 0.028 and 0.14 T, respectively. Beam radius dependence on the external field is shown for the in-line configuration for both electron guns. 3D space charge simulation of two electron guns, Litton L-2087 and Varian VTC6364, were performed for in-line and perpendicular external magnetic fields. A consistent behavior of Pierce guns in external magnetic fields was proven. For the in-line configuration, the primary beam current does not vanish but a large reduction of beam current (up to 77.1%) is observed at higher field strengths; the beam directionality remains unchanged. It was shown that for a perpendicular configuration the current vanishes due to beam bending under the action of the Lorentz force. For in-line configuration it was determined that the rms beam emittance reaches two minima for relatively high values of the external magnetic field.

A study of the effect of in-line and perpendicular magnetic fields on beam characteristics of electron guns in medical linear accelerators

PubMed Central

Constantin, Dragoş E.; Fahrig, Rebecca; Keall, Paul J.

2011-01-01

Purpose: Using magnetic resonance imaging (MRI) for real-time guidance during radiotherapy is an active area of research and development. One aspect of the problem is the influence of the MRI scanner, modeled here as an external magnetic field, on the medical linear accelerator (linac) components. The present work characterizes the behavior of two medical linac electron guns with external magnetic fields for in-line and perpendicular orientations of the linac with respect to the MRI scanner. Methods: Two electron guns, Litton L-2087 and Varian VTC6364, are considered as representative models for this study. Emphasis was placed on the in-line design approach in which case the MRI scanner and the linac axes of symmetry coincide and assumes no magnetic shielding of the linac. For the in-line case, the magnetic field from a 0.5 T open MRI (GE Signa SP) magnet with a 60 cm gap between its poles was computed and used in full three dimensional (3D) space charge simulations, whereas for the perpendicular case the magnetic field was constant. Results: For the in-line configuration, it is shown that the electron beam is not deflected from the axis of symmetry of the gun and the primary beam current does not vanish even at very high values of the magnetic field, e.g., 0.16 T. As the field strength increases, the primary beam current has an initial plateau of constant value after which its value decreases to a minimum corresponding to a field strength of approximately 0.06 T. After the minimum is reached, the current starts to increase slowly. For the case when the beam current computation is performed at the beam waist position the initial plateau ends at 0.016 T for Litton L-2087 and at 0.012 T for Varian VTC6364. The minimum value of the primary beam current is 27.5% of the initial value for Litton L-2087 and 22.9% of the initial value for Varian VTC6364. The minimum current is reached at 0.06 and 0.062 T for Litton L-2087 and Varian VTC6364, respectively. At 0.16 T the beam current increases to 40.2 and 31.4% from the original value of the current for Litton L-2087 and Varian VTC6364, respectively. In contrast, for the case when the electron gun is perpendicular to the magnetic field, the electron beam is deflected from the axis of symmetry even at small values of the magnetic field. As the strength of the magnetic field increases, so does the beam deflection, leading to a sharp decrease of the primary beam current which vanishes at about 0.007 T for Litton L-2087 and at 0.006 T for Varian VTC6364, respectively. At zero external field, the beam rms emittance computed at beam waist is 1.54 and 1.29π-mm-mrad for Litton L-2087 and Varian VTC6364, respectively. For the in-line configuration, there are two particular values of the external field where the beam rms emittance reaches a minimum. Litton L-2087 rms emittance reaches a minimum of 0.72π and 2.01π-mm-mrad at 0.026 and 0.132 T, respectively. Varian VTC6364 rms emittance reaches a minimum of 0.34π and 0.35π-mm-mrad at 0.028 and 0.14 T, respectively. Beam radius dependence on the external field is shown for the in-line configuration for both electron guns. Conclusions: 3D space charge simulation of two electron guns, Litton L-2087 and Varian VTC6364, were performed for in-line and perpendicular external magnetic fields. A consistent behavior of Pierce guns in external magnetic fields was proven. For the in-line configuration, the primary beam current does not vanish but a large reduction of beam current (up to 77.1%) is observed at higher field strengths; the beam directionality remains unchanged. It was shown that for a perpendicular configuration the current vanishes due to beam bending under the action of the Lorentz force. For in-line configuration it was determined that the rms beam emittance reaches two minima for relatively high values of the external magnetic field. PMID:21859019

Search for Varying Constants of Nature from Astronomical Observation of Molecules

NASA Astrophysics Data System (ADS)

Ubachs, Wim

2018-02-01

The status of searches for possible variation in the constants of nature from astronomical observation of molecules is reviewed, focusing on the dimensionless constant representing the proton-electron mass ratio μ =mp/me. The optical detection of H2 and CO molecules with large ground-based telescopes (as the ESO-VLT and the Keck telescopes), as well as the detection of H2 with the Cosmic Origins Spectrograph aboard the Hubble Space Telescope is discussed in the context of varying constants, and in connection to different theoretical scenarios. Radio astronomy provides an alternative search strategy bearing the advantage that molecules as NH3 (ammonia) and CH3OH (methanol) can be used, which are much more sensitive to a varying μ than diatomic molecules. Current constraints are |Δ μ /μ | < 5 × 10^{-6} for redshift z=2.0-4.2, corresponding to look-back times of 10-12.5 Gyrs, and |Δ μ / μ | < 1.5 × 10^{-7} for z=0.88, corresponding to half the age of the Universe (both at 3σ statistical significance). Existing bottlenecks and prospects for future improvement with novel instrumentation are discussed.

New determination of the fine structure constant from the electron value and QED.

PubMed

Gabrielse, G; Hanneke, D; Kinoshita, T; Nio, M; Odom, B

2006-07-21

Quantum electrodynamics (QED) predicts a relationship between the dimensionless magnetic moment of the electron (g) and the fine structure constant (alpha). A new measurement of g using a one-electron quantum cyclotron, together with a QED calculation involving 891 eighth-order Feynman diagrams, determine alpha(-1)=137.035 999 710 (96) [0.70 ppb]. The uncertainties are 10 times smaller than those of nearest rival methods that include atom-recoil measurements. Comparisons of measured and calculated g test QED most stringently, and set a limit on internal electron structure.

Field induced transient current in one-dimensional nanostructure

NASA Astrophysics Data System (ADS)

Sako, Tokuei; Ishida, Hiroshi

2018-07-01

Field-induced transient current in one-dimensional nanostructures has been studied by a model of an electron confined in a 1D attractive Gaussian potential subjected both to electrodes at the terminals and to an ultrashort pulsed oscillatory electric field with the central frequency ω and the FWHM pulse width Γ. The time-propagation of the electron wave packet has been simulated by integrating the time-dependent Schrödinger equation directly relying on the second-order symplectic integrator method. The transient current has been calculated as the flux of the probability density of the escaping wave packet emitted from the downstream side of the confining potential. When a static bias-field E0 is suddenly applied, the resultant transient current shows an oscillatory decay behavior with time followed by a minimum structure before converging to a nearly constant value. The ω-dependence of the integrated transient current induced by the pulsed electric field has shown an asymmetric resonance line-shape for large Γ while it shows a fringe pattern on the spectral line profile for small Γ. These observations have been rationalized on the basis of the energy-level structure and lifetime of the quasibound states in the bias-field modified confining potential obtained by the complex-scaling Fourier grid Hamiltonian method.

Design of fast signal processing readout front-end electronics implemented in CMOS 40 nm technology

NASA Astrophysics Data System (ADS)

Kleczek, Rafal

2016-12-01

The author presents considerations on the design of fast readout front-end electronics implemented in a CMOS 40 nm technology with an emphasis on the system dead time, noise performance and power dissipation. The designed processing channel consists of a charge sensitive amplifier with different feedback types (Krummenacher, resistive and constant current blocks), a threshold setting block, a discriminator and a counter with logic circuitry. The results of schematic and post-layout simulations with randomly generated input pulses in a time domain according to the Poisson distribution are presented and analyzed. Dead time below 20 ns is possible while keeping noise ENC ≈ 90 e- for a detector capacitance CDET = 160 fF.

Investigation of structural, electronic, elastic and optical properties of Cd1-x-yZnxHgyTe alloys

NASA Astrophysics Data System (ADS)

Tamer, M.

2016-06-01

Structural, optical and electronic properties and elastic constants of Cd1-x-yZnx HgyTe alloys have been studied by employing the commercial code Castep based on density functional theory. The generalized gradient approximation and local density approximation were utilized as exchange correlation. Using elastic constants for compounds, bulk modulus, band gap, Fermi energy and Kramers-Kronig relations, dielectric constants and the refractive index have been found through calculations. Apart from these, X-ray measurements revealed elastic constants and Vegard's law. It is seen that results obtained from theory and experiments are all in agreement.

Battery charging and discharging research based on the interactive technology of smart grid and electric vehicle

NASA Astrophysics Data System (ADS)

Zhang, Mingyang

2018-06-01

To further study the bidirectional flow problem of V2G (Vehicle to Grid) charge and discharge motor, the mathematical model of AC/DC converter and bi-directional DC/DC converter was established. Then, lithium battery was chosen as the battery of electric vehicle and its mathematical model was established. In order to improve the service life of lithium battery, bidirectional DC/DC converter adopted constant current and constant voltage control strategy. In the initial stage of charging, constant current charging was adopted with current single closed loop control. After reaching a certain value, voltage was switched to constant voltage charging controlled by voltage and current. Subsequently, the V2G system simulation model was built in MATLAB/Simulink. The simulation results verified the correctness of the control strategy and showed that when charging, constant current and constant voltage charging was achieved, the grid side voltage and current were in the same phase, and the power factor was about 1. When discharging, the constant current discharge was applied, and the grid voltage and current phase difference was r. To sum up, the simulation results are correct and helpful.

Quantum confinement and dielectric profiles of colloidal nanoplatelets of halide inorganic and hybrid organic-inorganic perovskites

NASA Astrophysics Data System (ADS)

Sapori, Daniel; Kepenekian, Mikaël; Pedesseau, Laurent; Katan, Claudine; Even, Jacky

2016-03-01

Quantum confinement as well as high frequency ε∞ and static εs dielectric profiles are described for nanoplatelets of halide inorganic perovskites CsPbX3 (X = I, Br, Cl) and hybrid organic-inorganic perovskites (HOP) in two-dimensional (2D) and three-dimensional (3D) structures. 3D HOP are currently being sought for their impressive photovoltaic ability. Prior to this sudden popularity, 2D HOP materials were driving intense activity in the field of optoelectronics. Such developments have been enriched by the recent ability to synthesize colloidal nanostructures of controlled sizes of 2D and 3D HOP. This raises the need to achieve a thorough description of the electronic structure and dielectric properties of these systems. In this work, we go beyond the abrupt dielectric interface model and reach the atomic scale description. We examine the influence of the nature of the halogen and of the cation on the band structure and dielectric constants. Similarly, we survey the effect of dimensionality and shape of the perovskite. In agreement with recent experimental results, we show an increase of the band gap and a decrease of ε∞ when the size of a nanoplatelet reduces. By inspecting 2D HOP, we find that it cannot be described as a simple superposition of independent inorganic and organic layers. Finally, the dramatic impact of ionic contributions on the dielectric constant εs is analysed.Quantum confinement as well as high frequency ε∞ and static εs dielectric profiles are described for nanoplatelets of halide inorganic perovskites CsPbX3 (X = I, Br, Cl) and hybrid organic-inorganic perovskites (HOP) in two-dimensional (2D) and three-dimensional (3D) structures. 3D HOP are currently being sought for their impressive photovoltaic ability. Prior to this sudden popularity, 2D HOP materials were driving intense activity in the field of optoelectronics. Such developments have been enriched by the recent ability to synthesize colloidal nanostructures of controlled sizes of 2D and 3D HOP. This raises the need to achieve a thorough description of the electronic structure and dielectric properties of these systems. In this work, we go beyond the abrupt dielectric interface model and reach the atomic scale description. We examine the influence of the nature of the halogen and of the cation on the band structure and dielectric constants. Similarly, we survey the effect of dimensionality and shape of the perovskite. In agreement with recent experimental results, we show an increase of the band gap and a decrease of ε∞ when the size of a nanoplatelet reduces. By inspecting 2D HOP, we find that it cannot be described as a simple superposition of independent inorganic and organic layers. Finally, the dramatic impact of ionic contributions on the dielectric constant εs is analysed. Electronic supplementary information (ESI) available: Complementary results on the electronic structure and dielectric constants of CsPbX3 and CH3NH3PbX3 (X = I, Br, Cl). See DOI: 10.1039/c5nr07175e

A Constant-Field Interrupted Resonance System for Percutaneous Electromagnetic Measurement of Blood Flow

PubMed Central

Kolin, Alexander; Steele, James R.; Imai, James S.; Macalpin, Rex N.

1974-01-01

A combination of deformable flow probes of negligible lateral dimensions with an electronic circuit capable of providing a prolonged plateau of dB/dt = 0 and of sampling the flow signal at the end of this interval permits electromagnetic measurement of blood flow with a reliable zero base line secured by switching off the magnet. An extracorporeal magnet provides the magnetic field. The flow transducer is introduced into the vascular system percutaneously through a standard angiographic catheter by conventional technique. The idea of the current generator can be described as “principle of interrupted resonance.” The current wave form can be described as a sequence of disconnected bisected sine waves joined at the apices by horizontal current plateaus where di/dt is strictly zero. Images PMID:4275395

TiO2 reinforced PMMA-TiO2 nanocomposite for its application in organic light emitting diode (OLED) as electron transport layer material

NASA Astrophysics Data System (ADS)

Kandulna, R.; Choudhary, R. B.; Singh, R.

2018-04-01

PMMA, TiO2 and PMMA-TiO2 nanocomposite were successfully synthesized in the laboratory via free radical polymerization process. The formation of PMMA corresponding change in the nanostructure with the embodiment of TiO2 nanofillers was confirmed by X-ray diffraction technique (XRD) analysis. Irregular tetragonal bipyramidal arrangement of TiO2 was formed within the spherical type structure of PMMA polymeric matrix, as examined by the surface morphological image. Relatively higher electron-hole non-radiative recombination of PMMA-TiO2 nanocomposite corresponded to blue-violet band, blue band, and green band was examined from PL spectra. An enhanced current density ˜ 165 % was observed with significantly improved p-type conductivity for PMMA-TiO2 nanocomposite. The improved specific capacitance with high dielectric constant and high electron-hole recombination rate confirmed that it can possibly use as electron transport layer material in the OLED devices fabrication.

Study of high field side/low field side asymmetry in the electron temperature profile with electron cyclotron emission

NASA Astrophysics Data System (ADS)

Gugliada, V. R.; Austin, M. E.; Brookman, M. W.

2017-10-01

Electron cyclotron emission (ECE) provides high resolution measurements of electron temperature profiles (Te(R , t)) in tokamaks. Calibration accuracy of this data can be improved using a sawtooth averaging technique. This improved calibration will then be utilized to determine the symmetry of Te profiles by comparing low field side (LFS) and high field side (HFS) measurements. Although Te is considered constant on flux surfaces, cases have been observed in which there are pronounced asymmetries about the magnetic axis, particularly with increased pressure. Trends in LFS/HFS overlap are examined as functions of plasma pressure, MHD mode presence, heating techniques, and other discharge conditions. This research will provide information on the accuracy of the current two-dimensional mapping of flux surfaces in the tokamak. Findings can be used to generate higher quality EFITs and inform ECE calibration. Work supported in part by US DoE under the Science Undergraduate Laboratory Internship (SULI) program and under DE-FC02-04ER549698.

Improved linearity in AlGaN/GaN metal-insulator-semiconductor high electron mobility transistors with nonlinear polarization dielectric

NASA Astrophysics Data System (ADS)

Gao, Tao; Xu, Ruimin; Kong, Yuechan; Zhou, Jianjun; Kong, Cen; Dong, Xun; Chen, Tangsheng

2015-06-01

We demonstrate highly improved linearity in a nonlinear ferroelectric of Pb(Zr0.52Ti0.48)-gated AlGaN/GaN metal-insulator-semiconductor high electron mobility transistor (MIS-HEMT). Distinct double-hump feature in the transconductance-gate voltage (gm-Vg) curve is observed, yielding remarkable enhancement in gate voltage swing as compared to MIS-HEMT with conventional linear gate dielectric. By incorporating the ferroelectric polarization into a self-consistent calculation, it is disclosed that in addition to the common hump corresponding to the onset of electron accumulation, the second hump at high current level is originated from the nonlinear polar nature of ferroelectric, which enhances the gate capacitance by increasing equivalent dielectric constant nonlinearly. This work paves a way for design of high linearity GaN MIS-HEMT by exploiting the nonlinear properties of dielectric.

A hydrothermally synthesized LiFePO4/C composite with superior low-temperature performance and cycle life

NASA Astrophysics Data System (ADS)

Wu, Guan; Liu, Na; Gao, Xuguang; Tian, Xiaohui; Zhu, Yanbin; Zhou, Yingke; Zhu, Qingyou

2018-03-01

The LiFePO4/C composites have been successfully synthesized by a hydrothermal process, with the combined carbon sources of fructose and calcium lignosulfonate. The morphology and microstructure of LiFePO4/C were investigated by X-ray diffraction, scanning electron microscopy, transmission electron microscopy and Fourier transform infrared spectroscopy. The electrochemical properties were evaluated by the constant-current charge/discharge tests, cyclic voltammetry and electrochemical impedance spectroscopy. The uniform carbon coating layer derived from calcium lignosulfonate can effectively improve the electronic conductivity, lithium-ion diffusivity and surface stability of the LiFePO4/C composites and prevent the side reactions between the LiFePO4 particles and electrolytes. The LiFePO4/C composites display excellent rate capability, superior cycle life and outstanding low temperature performance, which are promising for lithium-ion battery applications in electrical vehicles and electrical energy storage systems.

Freeze-drying synthesis of three-dimensional porous LiFePO4 modified with well-dispersed nitrogen-doped carbon nanotubes for high-performance lithium-ion batteries

NASA Astrophysics Data System (ADS)

Tu, Xiaofeng; Zhou, Yingke; Song, Yijie

2017-04-01

The three-dimensional porous LiFePO4 modified with uniformly dispersed nitrogen-doped carbon nanotubes has been successfully prepared by a freeze-drying method. The morphology and structure of the porous composites are characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray diffraction (XRD) and X-ray photoelectron spectroscopy (XPS), and the electrochemical performances are evaluated using the constant current charge/discharge tests, cyclic voltammetry and electrochemical impedance spectroscopy. The nitrogen-doped carbon nanotubes are uniformly dispersed inside the porous LiFePO4 to construct a superior three-dimensional conductive network, which remarkably increases the electronic conductivity and accelerates the diffusion of lithium ion. The porous composite displays high specific capacity, good rate capability and excellent cycling stability, rendering it a promising positive electrode material for high-performance lithium-ion batteries.

40 CFR 91.421 - Dilute gaseous exhaust sampling and analytical system description.

Code of Federal Regulations, 2014 CFR

2014-07-01

... Pump—Constant Volume Sampler (PDP-CVS) system with a heat exchanger, or a Critical Flow Venturi—Constant Volume Sampler (CFV-CVS) system with CVS sample probes and/or a heat exchanger or electronic flow... sampling point. (ii) For the CFV-CVS, either a heat exchanger or electronic flow compensation is required...

40 CFR 91.421 - Dilute gaseous exhaust sampling and analytical system description.

Code of Federal Regulations, 2012 CFR

2012-07-01

... Pump—Constant Volume Sampler (PDP-CVS) system with a heat exchanger, or a Critical Flow Venturi—Constant Volume Sampler (CFV-CVS) system with CVS sample probes and/or a heat exchanger or electronic flow... sampling point. (ii) For the CFV-CVS, either a heat exchanger or electronic flow compensation is required...

40 CFR 91.421 - Dilute gaseous exhaust sampling and analytical system description.

Code of Federal Regulations, 2013 CFR

2013-07-01

... Pump—Constant Volume Sampler (PDP-CVS) system with a heat exchanger, or a Critical Flow Venturi—Constant Volume Sampler (CFV-CVS) system with CVS sample probes and/or a heat exchanger or electronic flow... sampling point. (ii) For the CFV-CVS, either a heat exchanger or electronic flow compensation is required...

Connecting Fundamental Constants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Di Mario, D.

2008-05-29

A model for a black hole electron is built from three basic constants only: h, c and G. The result is a description of the electron with its mass and charge. The nature of this black hole seems to fit the properties of the Planck particle and new relationships among basic constants are possible. The time dilation factor in a black hole associated with a variable gravitational field would appear to us as a charge; on the other hand the Planck time is acting as a time gap drastically limiting what we are able to measure and its dimension willmore » appear in some quantities. This is why the Planck time is numerically very close to the gravitational/electric force ratio in an electron: its difference, disregarding a {pi}{radical}(2) factor, is only 0.2%. This is not a coincidence, it is always the same particle and the small difference is between a rotating and a non-rotating particle. The determination of its rotational speed yields accurate numbers for many quantities, including the fine structure constant and the electron magnetic moment.« less

Improved transistorized AC motor controller for battery powered urban electric passenger vehicles

NASA Technical Reports Server (NTRS)

Peak, S. C.

1982-01-01

An ac motor controller for an induction motor electric vehicle drive system was designed, fabricated, tested, evaluated, and cost analyzed. A vehicle performance analysis was done to establish the vehicle tractive effort-speed requirements. These requirements were then converted into a set of ac motor and ac controller requirements. The power inverter is a three-phase bridge using power Darlington transistors. The induction motor was optimized for use with an inverter power source. The drive system has a constant torque output to base motor speed and a constant horsepower output to maximum speed. A gear shifting transmission is not required. The ac controller was scaled from the base 20 hp (41 hp peak) at 108 volts dec to an expanded horsepower and battery voltage range. Motor reversal was accomplished by electronic reversal of the inverter phase sequence. The ac controller can also be used as a boost chopper battery charger. The drive system was tested on a dynamometer and results are presented. The current-controlled pulse width modulation control scheme yielded improved motor current waveforms. The ac controller favors a higher system voltage.

Effects of a parallel resistor on electrical characteristics of a piezoelectric transformer in open-circuit transient state.

PubMed

Chang, Kuo-Tsai

2007-01-01

This paper investigates electrical transient characteristics of a Rosen-type piezoelectric transformer (PT), including maximum voltages, time constants, energy losses and average powers, and their improvements immediately after turning OFF. A parallel resistor connected to both input terminals of the PT is needed to improve the transient characteristics. An equivalent circuit for the PT is first given. Then, an open-circuit voltage, involving a direct current (DC) component and an alternating current (AC) component, and its related energy losses are derived from the equivalent circuit with initial conditions. Moreover, an AC power control system, including a DC-to-AC resonant inverter, a control switch and electronic instruments, is constructed to determine the electrical characteristics of the OFF transient state. Furthermore, the effects of the parallel resistor on the transient characteristics at different parallel resistances are measured. The advantages of adding the parallel resistor also are discussed. From the measured results, the DC time constant is greatly decreased from 9 to 0.04 ms by a 10 k(omega) parallel resistance under open output.

WE-G-BRD-09: Novel MRI Compatible Electron Accelerator for MRI-Linac Radiotherapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Whelan, B; Keall, P; Gierman, S

Purpose: MRI guided radiotherapy is a rapidly growing field; however current linacs are not designed to operate in MRI fringe fields. As such, current MRI- Linac systems require magnetic shielding, impairing MR image quality and system flexibility. Here, we present a bespoke electron accelerator concept with robust operation in in-line magnetic fields. Methods: For in-line MRI-Linac systems, electron gun performance is the major constraint on accelerator performance. To overcome this, we propose placing a cathode directly within the first accelerating cavity. Such a configuration is used extensively in high energy particle physics, but not previously for radiotherapy. Benchmarked computational modellingmore » (CST, Darmstadt, Germany) was employed to design and assess a 5.5 cell side coupled accelerator with a temperature limited thermionic cathode in the first accelerating cell. This simulation was coupled to magnetic fields from a 1T MRI model to assess robustness in magnetic fields for Source to Isocenter Distance between 1 and 2 meters. Performance was compared to a conventional electron gun based system in the same magnetic field. Results: A temperature limited cathode (work function 1.8eV, temperature 1245K, emission constant 60A/K/cm{sup 2}) will emit a mean current density of 24mA/mm{sup 2} (Richardson’s Law). We modeled a circular cathode with radius 2mm and mean current 300mA. Capture efficiency of the device was 43%, resulting in target current of 130 mA. The electron beam had a FWHM of 0.2mm, and mean energy of 5.9MeV (interquartile spread of 0.1MeV). Such an electron beam is suitable for radiotherapy, comparing favourably to conventional systems. This model was robust to operation the MRI fringe field, with a maximum current loss of 6% compared to 85% for the conventional system. Conclusion: The bespoke electron accelerator is robust to operation in in-line magnetic fields. This will enable MRI-Linacs with no accelerator magnetic shielding, and minimise painstaking optimisation of the MRI fringe field. This work was supported by US (NIH) and Australian (NHMRC & Cancer Institute NSW) government research funding. In addition, I would like to thank cancer institute NSW and the Ingham Institute for scholarship support.« less

Practical Framework for an Electron Beam Induced Current Technique Based on a Numerical Optimization Approach

NASA Astrophysics Data System (ADS)

Yamaguchi, Hideshi; Soeda, Takeshi

2015-03-01

A practical framework for an electron beam induced current (EBIC) technique has been established for conductive materials based on a numerical optimization approach. Although the conventional EBIC technique is useful for evaluating the distributions of dopants or crystal defects in semiconductor transistors, issues related to the reproducibility and quantitative capability of measurements using this technique persist. For instance, it is difficult to acquire high-quality EBIC images throughout continuous tests due to variation in operator skill or test environment. Recently, due to the evaluation of EBIC equipment performance and the numerical optimization of equipment items, the constant acquisition of high contrast images has become possible, improving the reproducibility as well as yield regardless of operator skill or test environment. The technique proposed herein is even more sensitive and quantitative than scanning probe microscopy, an imaging technique that can possibly damage the sample. The new technique is expected to benefit the electrical evaluation of fragile or soft materials along with LSI materials.

Anode power in a quasi-steady MPD thruster. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Saber, A. J.

1974-01-01

Local anode heat flux in a quasi-steady MPD thruster is measured by thermocouples attached to the inside surface of a shell anode. Over a range of arc currents J from 5.5 to 44 kiloamperes and argon propellant mass flows m from 1 to 48 g/sec, with the ratio J2/m held constant, the fraction of arc power deposited in the anode is found to decrease with increasing arc power. Specifically, this anode power fraction decreases from 50% at 200 kW arc power, to 10% at 20 MW. In an effort to account for this functional behavior, the current density, plasma potential, and electron temperature in the plasma adjacent to the anode are measured with probes, and the results are used in a theoretical anode heat flux model. The model asserts that energy exchange between electrons and heavy particles in the plasma near the anode occur over distances greater than the anode sheath thickness.

A quality monitor and monitoring technique employing optically stimulated electron emission

NASA Technical Reports Server (NTRS)

Yost, William T. (Inventor); Welch, Christopher S. (Inventor); Joe, Edmond J. (Inventor); Hefner, Bill Bryan, Jr. (Inventor)

1995-01-01

A light source directs ultraviolet light onto a test surface and a detector detects a current of photoelectrons generated by the light. The detector includes a collector which is positively biased with respect to the test surface. Quality is indicated based on the photoelectron current. The collector is then negatively biased to replace charges removed by the measurement of a nonconducting substrate to permit subsequent measurements. Also, the intensity of the ultraviolet light at a particular wavelength is monitored and the voltage of the light source varied to maintain the light a constant desired intensity. The light source is also cooled via a gas circulation system. If the test surface is an insulator, the surface is bombarded with ultraviolet light in the presence of an electron field to remove the majority of negative charges from the surface. The test surface is then exposed to an ion field until it possesses no net charge. The technique described above is then performed to assess quality.

Observation of autoionization in O 2 by an electron-electron coincidence method

NASA Astrophysics Data System (ADS)

Doering, J. P.; Yang, J.; Cooper, J. W.

1995-01-01

A strong transition to an autoionizing stata has been observed in O 2 at 16.83 ± 0.11 eV by means of a new electron-electron conincidence method. The method uses the fact that electrons arising from autoionizing states appear at a constant energy loss corresponding to the excitation energy of the autoionizing state rather than at a constant ionization potential as do electrons produced by direct ionization. Comparison of the present data with previous photoionization studies suggests that the autoionizing O 2 state is the same state deduced to be responsible for abnormal vibrational intensities in the O 2+X 2Πg ground state when 16.85 eV Ne(I) photons are used. These electron-electron coincidence experiments provide a direct new method for the study of autoionization produced by electron impact.

Trends in electron-ion dissociative recombination of benzene analogs with functional group substitutions: Negative Hammett σpara values

NASA Astrophysics Data System (ADS)

Osborne, David; Lawson, Patrick Andrew; Adams, Nigel; Dotan, Itzhak

2014-06-01

An in-depth study of the effects of functional group substitution on benzene's electron-ion dissociative recombination (e-IDR) rate constant has been conducted. The e-IDR rate constants for benzene, biphenyl, toluene, ethylbenzene, anisole, phenol, and aniline have been measured using a Flowing Afterglow equipped with an electrostatic Langmuir probe (FALP). These measurements have been made over a series of temperatures from 300 to 550 K. A relationship between the Hammett σpara values for each compound and rate constant has indicated a trend in the e-IDR rate constants and possibly in their temperature dependence data. The Hammett σpara value is a method to describe the effect a functional group substituted to a benzene ring has upon the reaction rate constant.

Theoretical study of thorium monoxide for the electron electric dipole moment search: electronic properties of H(3)Δ(1) in ThO.

PubMed

Skripnikov, L V; Titov, A V

2015-01-14

Recently, improved limits on the electron electric dipole moment, and dimensionless constant, kT,P, characterizing the strength of the T,P-odd pseudoscalar-scalar electron-nucleus neutral current interaction in the H(3)Δ1 state of ThO molecule were obtained by the ACME collaboration [J. Baron et al., Science 343, 269 (2014)]. The interpretation of the experiment in terms of these fundamental quantities is based on the results of theoretical study of appropriate ThO characteristics, the effective electric field acting on electron, Eeff, and a parameter of the T,P-odd pseudoscalar-scalar interaction, WT,P, given in Skripnikov et al. [J. Chem. Phys. 139, 221103 (2013)] by St. Petersburg group. To reduce the uncertainties of the given limits, we report improved calculations of the molecular state-specific quantities Eeff, 81.5 GV/cm, and WT,P, 112 kHz, with the uncertainty within 7% of the magnitudes. Thus, the values recommended to use for the upper limits of the quantities are 75.8 GV/cm and 104 kHz, correspondingly. The hyperfine structure constant, molecule-frame dipole moment of the H(3)Δ1 state, and the H(3)Δ1 → X(1)Σ(+) transition energy which, in general, can serve as a measure of reliability of the obtained Eeff and WT,P values are also calculated. In addition, we report the first calculation of g-factor for the H(3)Δ1 state of ThO. The results are compared to the earlier experimental and theoretical studies, and a detailed analysis of uncertainties of the calculations is given.

Au particle formation on the electron beam induced membrane

NASA Astrophysics Data System (ADS)

Choi, Seong Soo; Park, Myoung Jin; Han, Chul Hee; Oh, Sae-Joong; Kim, Sung-In; Park, Nam Kyou; Park, Doo-Jae; Choi, Soo Bong; Kim, Yong-Sang

2017-02-01

Recently the single molecules such as protein and deoxyribonucleic acid (DNA) have been successfully characterized by using a portable solidstate nanopore (MinION) with an electrical detection technique. However, there have been several reports about the high error rates of the fabricated nanopore device, possibly due to an electrical double layer formed inside the pore channel. The current DNA sequencing technology utilized is based on the optical detection method. In order to utilize the current optical detection technique, we will present the formation of the Au nano-pore with Au particle under the various electron beam irradiations. In order to provide the diffusion of Au atoms, a 2 keV electron beam irradiation has been performed During electron beam irradiations by using field emission scanning electron microscopy (FESEM), Au and C atoms would diffuse together and form the binary mixture membrane. Initially, the Au atoms diffused in the membrane are smaller than 1 nm, below the detection limit of the transmission electron microscopy (TEM), so that we are unable to observe the Au atoms in the formed membrane. However, after several months later, the Au atoms became larger and larger with expense of the smaller particles: Ostwald ripening. Furthermore, we also observe the Au crystalline lattice structure on the binary Au-C membrane. The formed Au crystalline lattice structures were constantly changing during electron beam imaging process due to Spinodal decomposition; the unstable thermodynamic system of Au-C binary membrane. The fabricated Au nanopore with an Au nanoparticle can be utilized as a single molecule nanobio sensor.

Epitaxial ZnO gate dielectrics deposited by RF sputter for AlGaN/GaN metal-oxide-semiconductor high-electron-mobility transistors

NASA Astrophysics Data System (ADS)

Yoon, Seonno; Lee, Seungmin; Kim, Hyun-Seop; Cha, Ho-Young; Lee, Hi-Deok; Oh, Jungwoo

2018-01-01

Radio frequency (RF)-sputtered ZnO gate dielectrics for AlGaN/GaN metal-oxide-semiconductor high-electron-mobility transistors (MOS-HEMTs) were investigated with varying O2/Ar ratios. The ZnO deposited with a low oxygen content of 4.5% showed a high dielectric constant and low interface trap density due to the compensation of oxygen vacancies during the sputtering process. The good capacitance-voltage characteristics of ZnO-on-AlGaN/GaN capacitors resulted from the high crystallinity of oxide at the interface, as investigated by x-ray diffraction and high-resolution transmission electron microscopy. The MOS-HEMTs demonstrated comparable output electrical characteristics with conventional Ni/Au HEMTs but a lower gate leakage current. At a gate voltage of -20 V, the typical gate leakage current for a MOS-HEMT with a gate length of 6 μm and width of 100 μm was found to be as low as 8.2 × 10-7 mA mm-1, which was three orders lower than that of the Ni/Au Schottky gate HEMT. The reduction of the gate leakage current improved the on/off current ratio by three orders of magnitude. These results indicate that RF-sputtered ZnO with a low O2/Ar ratio is a good gate dielectric for high-performance AlGaN/GaN MOS-HEMTs.

Characterization of sputter deposited thin film scandate cathodes for miniaturized thermionic converter applications

NASA Astrophysics Data System (ADS)

Zavadil, Kevin R.; Ruffner, Judith H.; King, Donald B.

1999-01-01

We have successfully developed a method for fabricating scandate-based thermionic emitters in thin film form. The primary goal of our effort is to develop thin film emitters that exhibit low work function, high intrinsic electron emissivity, minimum thermal activation properties and that can be readily incorporated into a microgap converter. Our approach has been to incorporate BaSrO into a Sc2O3 matrix using rf sputtering to produce thin films. Diode testing has shown the resulting films to be electron emissive at temperatures as low as 900 K with current densities of 0.1 mA.cm-2 at 1100 K and saturation voltages. We calculate an approximate maximum work function of 1.8 eV and an apparent emission constant (Richardson's constant, A*) of 36 mA.cm-2.K-2. Film compositional and structural analysis shows that a significant surface and subsurface alkaline earth hydroxide phase can form and probably explains the limited utilization and stability of Ba and its surface complexes. The flexibility inherent in sputter deposition suggests alternate strategies for eliminating undesirable phases and optimizing thin film emitter properties.

The effects of temperature on optical properties of InGaN/GaN multiple quantum well light-emitting diodes

NASA Astrophysics Data System (ADS)

Li, Yi; Zhu, Youhua; Huang, Jing; Deng, Honghai; Wang, Meiyu; Yin, HaiHong

2017-02-01

The effects of temperature on the optical properties of InGaN/GaN quantum well (QW) light-emitting diodes have been investigated by using the six-by-six K-P method taking into account the temperature dependence of band gaps, lattice constants, and elastic constants. The numerical results indicate that the increase of temperature leads to the decrease of the spontaneous emission rate at the same injection current density due to the redistribution of carrier density and the increase of the non-radiative recombination rate. The product of Fermi-Dirac distribution functions of electron fc n and hole ( 1 - fv U m ) for the transitions between the three lowest conduction subbands (c1-c3) and the top six valence subbands (v1-v6) is larger at the lower temperature, which indicates that there are more electron-hole pairs distributed on the energy levels. It should be noted that the optical matrix elements of the inter-band transitions slightly increase at the higher temperature. In addition, the internal quantum efficiency of the InGaN/GaN QW structure is evidently decreased with increasing temperature.

Simple constant-current-regulated power supply

NASA Technical Reports Server (NTRS)

Priebe, D. H. E.; Sturman, J. C.

1977-01-01

Supply incorporates soft-start circuit that slowly ramps current up to set point at turn-on. Supply consists of full-wave rectifier, regulating pass transistor, current feedback circuit, and quad single-supply operational-amplifier circuit providing control. Technique is applicable to any system requiring constant dc current, such as vacuum tube equipment, heaters, or battery charges; it has been used to supply constant current for instrument calibration.

Soft-type trap-induced degradation of MoS2 field effect transistors.

PubMed

Cho, Young-Hoon; Ryu, Min-Yeul; Lee, Kook Jin; Park, So Jeong; Choi, Jun Hee; Lee, Byung-Chul; Kim, Wungyeon; Kim, Gyu-Tae

2018-06-01

The practical applicability of electronic devices is largely determined by the reliability of field effect transistors (FETs), necessitating constant searches for new and better-performing semiconductors. We investigated the stress-induced degradation of MoS 2 multilayer FETs, revealing a steady decrease of drain current by 56% from the initial value after 30 min. The drain current recovers to the initial state when the transistor is completely turned off, indicating the roles of soft-traps in the apparent degradation. The noise current power spectrum follows the model of carrier number fluctuation-correlated mobility fluctuation (CNF-CMF) regardless of stress time. However, the reduction of the drain current was well fitted to the increase of the trap density based on the CNF-CMF model, attributing the presence of the soft-type traps of dielectric oxides to the degradation of the MoS 2 FETs.

Soft-type trap-induced degradation of MoS2 field effect transistors

NASA Astrophysics Data System (ADS)

Cho, Young-Hoon; Ryu, Min-Yeul; Lee, Kook Jin; Park, So Jeong; Choi, Jun Hee; Lee, Byung-Chul; Kim, Wungyeon; Kim, Gyu-Tae

2018-06-01

The practical applicability of electronic devices is largely determined by the reliability of field effect transistors (FETs), necessitating constant searches for new and better-performing semiconductors. We investigated the stress-induced degradation of MoS2 multilayer FETs, revealing a steady decrease of drain current by 56% from the initial value after 30 min. The drain current recovers to the initial state when the transistor is completely turned off, indicating the roles of soft-traps in the apparent degradation. The noise current power spectrum follows the model of carrier number fluctuation–correlated mobility fluctuation (CNF–CMF) regardless of stress time. However, the reduction of the drain current was well fitted to the increase of the trap density based on the CNF–CMF model, attributing the presence of the soft-type traps of dielectric oxides to the degradation of the MoS2 FETs.

Cellobiose Dehydrogenase Aryl Diazonium Modified Single Walled Carbon Nanotubes: Enhanced Direct Electron Transfer through a Positively Charged Surface

PubMed Central

2011-01-01

One of the challenges in the field of biosensors and biofuel cells is to establish a highly efficient electron transfer rate between the active site of redox enzymes and electrodes to fully access the catalytic potential of the biocatalyst and achieve high current densities. We report on very efficient direct electron transfer (DET) between cellobiose dehydrogenase (CDH) from Phanerochaete sordida (PsCDH) and surface modified single walled carbon nanotubes (SWCNT). Sonicated SWCNTs were adsorbed on the top of glassy carbon electrodes and modified with aryl diazonium salts generated in situ from p-aminobenzoic acid and p-phenylenediamine, thus featuring at acidic pH (3.5 and 4.5) negative or positive surface charges. After adsorption of PsCDH, both electrode types showed excellent long-term stability and very efficient DET. The modified electrode presenting p-aminophenyl groups produced a DET current density of 500 μA cm−2 at 200 mV vs normal hydrogen reference electrode (NHE) in a 5 mM lactose solution buffered at pH 3.5. This is the highest reported DET value so far using a CDH modified electrode and comes close to electrodes using mediated electron transfer. Moreover, the onset of the electrocatalytic current for lactose oxidation started at 70 mV vs NHE, a potential which is 50 mV lower compared to when unmodified SWCNTs were used. This effect potentially reduces the interference by oxidizable matrix components in biosensors and increases the open circuit potential in biofuel cells. The stability of the electrode was greatly increased compared with unmodified but cross-linked SWCNTs electrodes and lost only 15% of the initial current after 50 h of constant potential scanning. PMID:21417322

Cellobiose dehydrogenase aryl diazonium modified single walled carbon nanotubes: enhanced direct electron transfer through a positively charged surface.

PubMed

Tasca, Federico; Harreither, Wolfgang; Ludwig, Roland; Gooding, John Justin; Gorton, Lo

2011-04-15

One of the challenges in the field of biosensors and biofuel cells is to establish a highly efficient electron transfer rate between the active site of redox enzymes and electrodes to fully access the catalytic potential of the biocatalyst and achieve high current densities. We report on very efficient direct electron transfer (DET) between cellobiose dehydrogenase (CDH) from Phanerochaete sordida (PsCDH) and surface modified single walled carbon nanotubes (SWCNT). Sonicated SWCNTs were adsorbed on the top of glassy carbon electrodes and modified with aryl diazonium salts generated in situ from p-aminobenzoic acid and p-phenylenediamine, thus featuring at acidic pH (3.5 and 4.5) negative or positive surface charges. After adsorption of PsCDH, both electrode types showed excellent long-term stability and very efficient DET. The modified electrode presenting p-aminophenyl groups produced a DET current density of 500 μA cm(-2) at 200 mV vs normal hydrogen reference electrode (NHE) in a 5 mM lactose solution buffered at pH 3.5. This is the highest reported DET value so far using a CDH modified electrode and comes close to electrodes using mediated electron transfer. Moreover, the onset of the electrocatalytic current for lactose oxidation started at 70 mV vs NHE, a potential which is 50 mV lower compared to when unmodified SWCNTs were used. This effect potentially reduces the interference by oxidizable matrix components in biosensors and increases the open circuit potential in biofuel cells. The stability of the electrode was greatly increased compared with unmodified but cross-linked SWCNTs electrodes and lost only 15% of the initial current after 50 h of constant potential scanning. © 2011 American Chemical Society

An investigation of accelerating mode and decelerating mode constant-momentum mass spectrometry and their application to a residual gas analyzer

NASA Technical Reports Server (NTRS)

Ng, Y. S.

1977-01-01

A theoretical analysis of constant momentum mass spectrometry was made. A maximum resolving power for the decelerating mode constant momentum mass spectrometer was shown theoretically to exist for a beam of ions of known energy. A vacuum system and an electron beam ionization source was constructed. Supporting electronics for a residual gas analyzer were built. Experimental investigations of various types of accelerating and decelerating impulsive modes of a constant momentum mass spectrometer as applied to a residual gas analyzer were made. The data indicate that the resolving power for the decelerating mode is comparable to that of the accelerating mode.

Investigation of structural, electronic, elastic and optical properties of Cd{sub 1-x-y}Zn{sub x}Hg{sub y}Te alloys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tamer, M., E-mail: mehmet.tamer@zirve.edu.tr

2016-06-15

Structural, optical and electronic properties and elastic constants of Cd1{sub -x-y}Zn{sub x} Hg{sub y}Te alloys have been studied by employing the commercial code Castep based on density functional theory. The generalized gradient approximation and local density approximation were utilized as exchange correlation. Using elastic constants for compounds, bulk modulus, band gap, Fermi energy and Kramers–Kronig relations, dielectric constants and the refractive index have been found through calculations. Apart from these, X-ray measurements revealed elastic constants and Vegard’s law. It is seen that results obtained from theory and experiments are all in agreement.

Ultrafast electronic relaxation in superheated bismuth

NASA Astrophysics Data System (ADS)

Gamaly, E. G.; Rode, A. V.

2013-01-01

Interaction of moving electrons with vibrating ions in the lattice forms the basis for many physical properties from electrical resistivity and electronic heat capacity to superconductivity. In ultrafast laser interaction with matter the electrons are heated much faster than the electron-ion energy equilibration, leading to a two-temperature state with electron temperature far above that of the lattice. The rate of temperature equilibration is governed by the strength of electron-phonon energy coupling, which is conventionally described by a coupling constant, neglecting the dependence on the electron and lattice temperature. The application of this constant to the observations of fast relaxation rate led to a controversial notion of ‘ultra-fast non-thermal melting’ under extreme electronic excitation. Here we provide theoretical grounds for a strong dependence of the electron-phonon relaxation time on the lattice temperature. We show, by taking proper account of temperature dependence, that the heating and restructuring of the lattice occurs much faster than were predicted on the assumption of a constant, temperature independent energy coupling. We applied the temperature-dependent momentum and energy transfer time to experiments on fs-laser excited bismuth to demonstrate that all the observed ultra-fast transformations of the transient state of bismuth are purely thermal in nature. The developed theory, when applied to ultrafast experiments on bismuth, provides interpretation of the whole variety of transient phase relaxation without the non-thermal melting conjecture.

Electron Drift Speed And Current-Induced Drive Torques On A Domain Wall

NASA Astrophysics Data System (ADS)

Berger, Luc

2009-03-01

It has become fashionable to describe [1] current-induced torques on a DW in terms of an electron drift speed u = - P*j*muB/e*M where muB is the Bohr magneton and M the saturation magnetization. While appropriate for adiabatic torques, this quantity u is misleading and not the best choice in the case of non-adiabatic torques. For example, it leads [2] to beta not equal to alpha, where beta represents the intensity of the non-adiabatic torque, and alpha is the damping parameter. By writing equations of motion for conduction- electron spins in a moving frame where the electron gas is at rest, we find [3] a direct relation between damping and non- adiabatic torques. The correct electron drift speed turns out to be the speed of the frame, and is v = P*j/(n*q) where n and q are the carrier density and charge. It is related to the ordinary Hall constant R0 by v P*R0*j. After substituting v for u in the expression of the non-adiabatic torque, we find that beta = alpha holds now. Because v is larger than u in Permalloy, it can explain better the large current-induced DW speeds found [4] experimentally. In materials where R0> 0 and the carriers are dominantly hole-like, v and u have opposite signs, leading to different predictions for the sense of DW motion. We discuss examples of such materials. 1. G. Tatara and H. Kohno, Phys. Rev. Lett. 92, 086601 (2004). 2. H. Kohno et al., J. Phys. Soc. Japan, 75, 113706 (2006). 3. L. Berger, Phys. Rev. B 75, 174401 (2007). 4. M. Hayashi et al., Phys. Rev. Lett. 98, 037204 (2007).

Electrical properties of radio-frequency sputtered HfO2 thin films for advanced CMOS technology

NASA Astrophysics Data System (ADS)

Sarkar, Pranab Kumar; Roy, Asim

2015-08-01

The Hafnium oxide (HfO2) high-k thin films have been deposited by radio frequency (rf) sputtering technique on p-type Si (100) substrate. The thickness, composition and phases of films in relation to annealing temperatures have been investigated by using cross sectional FE-SEM (Field Emission Scanning Electron Microscope) and grazing incidence x-ray diffraction (GI-XRD), respectively. GI-XRD analysis revealed that at annealing temperatures of 350°C, films phases change to crystalline from amorphous. The capacitance-voltage (C-V) and current-voltage (I-V) characteristics of the annealed HfO2 film have been studied employing Al/HfO2/p-Si metal-oxide-semiconductor (MOS) structures. The electrical properties such as dielectric constant, interface trap density and leakage current density have been also extracted from C-V and I-V Measurements. The value of dielectric constant, interface trap density and leakage current density of annealed HfO2 film is obtained as 23,7.57×1011eV-1 cm-2 and 2.7×10-5 Acm-2, respectively. In this work we also reported the influence of post deposition annealing onto the trapping properties of hafnium oxide and optimized conditions under which no charge trapping is observed into the dielectric stack.

Low-dielectric constant insulators for future integrated circuits and packages.

PubMed

Kohl, Paul A

2011-01-01

Future integrated circuits and packages will require extraordinary dielectric materials for interconnects to allow transistor advances to be translated into system-level advances. Exceedingly low-permittivity and low-loss materials are required at every level of the electronic system, from chip-level insulators to packages and printed wiring boards. In this review, the requirements and goals for future insulators are discussed followed by a summary of current state-of-the-art materials and technical approaches. Much work needs to be done for insulating materials and structures to meet future needs.

Optical and Electrical Characteristics of Silver Ion Conducting Nanocomposite Solid Polymer Electrolytes Based on Chitosan

NASA Astrophysics Data System (ADS)

Aziz, Shujahadeen B.; Rasheed, Mariwan A.; Abidin, Zul H. Z.

2017-10-01

Optical and electrical properties of nanocomposite solid polymer electrolytes based on chitosan have been investigated. Incorporation of alumina nanoparticles into the chitosan:silver triflate (AgTf) system broadened the surface plasmon resonance peaks of the silver nanoparticles and shifted the absorption edge to lower photon energy. A clear decrease of the optical bandgap in nanocomposite samples containing alumina nanoparticles was observed. The variation of the direct-current (DC) conductivity and dielectric constant followed the same trend with alumina concentration. The DC conductivity increased by two orders of magnitude, which can be attributed to hindrance of silver ion reduction. Transmission electron microscopy was used to interpret the space-charge and blocking effects of alumina nanoparticles on the DC conductivity and dielectric constant. The ion conduction mechanism was interpreted based on the dependences of the electrical and dielectric parameters. The dependence of the DC conductivity on the dielectric constant is explained empirically. Relaxation processes associated with conductivity and viscoelasticity were distinguished based on the incomplete semicircular arcs in plots of the real and imaginary parts of the electric modulus.

Progress towards measuring the Rydberg Constant Using Circular Rydberg Atoms in an Intensity-Modulated Optical Lattice

NASA Astrophysics Data System (ADS)

Ramos, Andira; Moore, Kaitlin; Raithel, Georg

2015-05-01

Recent significant disagreement with the previously established size of the proton demonstrates a need to reconsider the current value of the Rydberg constant, the effects of the nuclear charge distribution and QED in hydrogen-like atoms. An experiment is in progress to obtain a measurement of the Rydberg constant by studying circular Rydberg atoms, which exhibit very small QED shifts and electron wavefunctions which do not overlap with the nucleus. Cold Rydberg atoms are trapped using a ponderomotive potential. To drive the transitions, a novel type of spectroscopy is used which utilizes an optical-lattice field that is intensity-modulated at the frequencies of atomic transitions. The method is free of typical spectroscopic selection rules and has been shown to drive transitions up to fifth order. Combined with optical Rydberg-atom trapping, the method enables the measurement of narrow, sub-THz transitions between long-lived circular Rydberg levels. Energy shifts affecting this precision measurement will also be discussed. This work is suported by NSF, NIST and NASA grants.

Temperature and size-dependent Hamaker constants for metal nanoparticles

NASA Astrophysics Data System (ADS)

Jiang, K.; Pinchuk, P.

2016-08-01

Theoretical values of the Hamaker constant have been calculated for metal nanoparticles using Lifshitz theory. The theory describes the Hamaker constant in terms of the permittivity of the interacting bodies. Metal nanoparticles exhibit an internal size effect that alters the dielectric permittivity of the particle when its size falls below the mean free path of the conducting electrons. This size dependence of the permittivity leads to size-dependence of the Hamaker constant for metal nanoparticles. Additionally, the electron damping and the plasma frequency used to model the permittivity of the particle exhibit temperature-dependence, which lead to temperature dependence of the Hamaker constant. In this work, both the size and temperature dependence for gold, silver, copper, and aluminum nanoparticles is demonstrated. The results of this study might be of interest for studying the colloidal stability of nanoparticles in solution.

Temperature and size-dependent Hamaker constants for metal nanoparticles.

PubMed

Jiang, K; Pinchuk, P

2016-08-26

Theoretical values of the Hamaker constant have been calculated for metal nanoparticles using Lifshitz theory. The theory describes the Hamaker constant in terms of the permittivity of the interacting bodies. Metal nanoparticles exhibit an internal size effect that alters the dielectric permittivity of the particle when its size falls below the mean free path of the conducting electrons. This size dependence of the permittivity leads to size-dependence of the Hamaker constant for metal nanoparticles. Additionally, the electron damping and the plasma frequency used to model the permittivity of the particle exhibit temperature-dependence, which lead to temperature dependence of the Hamaker constant. In this work, both the size and temperature dependence for gold, silver, copper, and aluminum nanoparticles is demonstrated. The results of this study might be of interest for studying the colloidal stability of nanoparticles in solution.

First-principles calculation of photo-induced electron transfer rate constants in phthalocyanine-C60 organic photovoltaic materials: Beyond Marcus theory

NASA Astrophysics Data System (ADS)

Lee, Myeong H.; Dunietz, Barry D.; Geva, Eitan

2014-03-01

Classical Marcus theory is commonly adopted in solvent-mediated charge transfer (CT) process to obtain the CT rate constant, but it can become questionable when the intramolecular vibrational modes dominate the CT process as in OPV devices because Marcus theory treats these modes classically and therefore nuclear tunneling is not accounted for. We present a computational scheme to obtain the electron transfer rate constant beyond classical Marcus theory. Within this approach, the nuclear vibrational modes are treated quantum-mechanically and a short-time approximation is avoided. Ab initio calculations are used to obtain the basic parameters needed for calculating the electron transfer rate constant. We apply our methodology to phthalocyanine(H2PC)-C60 organic photovoltaic system where one C60 acceptor and one or two H2PC donors are included to model the donor-acceptor interface configuration. We obtain the electron transfer and recombination rate constants for all accessible charge transfer (CT) states, from which the CT exciton dynamics is determined by employing a master equation. The role of higher lying excited states in CT exciton dynamics is discussed. This work is pursued as part of the Center for Solar and Thermal Energy Conversion, an Energy Frontier Research Center funded by the US Department of Energy Office of Science, Office of Basic Energy Sciences under 390 Award No. DE-SC0000957.

Stability of Electrons in the Virtual Cathode Region of an IEC

NASA Astrophysics Data System (ADS)

Kim, Hyng-Jin; Miley, George; Momota, Hiromu

2003-04-01

In the Inertial Electrostatic Confinement (IEC) device, electrons are confined inside a virtual anode that in turn confines ions. Prior stability studies [1, 2] have considered systems in which one species is electrostatically confined by the other, and either or both species are out of local thermal equilibrium. In the present research, electron stability in the virtual cathode region of an ion injected IEC is being studied. The ion density in an IEC is non-uniform due to the radial electrostatic potential, and increases toward the center region. The potential near the virtual cathode is assumed to have a parabolic shape and is determined assuming that the net space charge density is constant in that region. The corresponding ion distribution function is assumed to have the form f = C [sigma] (H W) /L^0.5 and the electron response is taken to be diabatic. Then using a variational principle after linearizing the hydrodynamic equations, stability properties of the electron layer are determined. Results will be presented as a function of injected ion/electron current ratios. 1. L. Chacon and D. C. Barnes, Phys. Plasma 7, 4774 (2000). 2. D. C. Barnes, L. Chacon, and J. M. Finn, Phys. Plasmas 9, 4448 (2002).

Corkscrew Motion of an Electron Beam due to Coherent Variations in Accelerating Potentials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ekdahl, Carl August

2016-09-13

Corkscrew motion results from the interaction of fluctuations of beam electron energy with accidental magnetic dipoles caused by misalignment of the beam transport solenoids. Corkscrew is a serious concern for high-current linear induction accelerators (LIA). A simple scaling law for corkscrew amplitude derived from a theory based on a constant-energy beam coasting through a uniform magnetic field has often been used to assess LIA vulnerability to this effect. We use a beam dynamics code to verify that this scaling also holds for an accelerated beam in a non-uniform magnetic field, as in a real accelerator. Results of simulations with thismore » code are strikingly similar to measurements on one of the LIAs at Los Alamos National Laboratory.« less

Fine structure constant defines visual transparency of graphene.

PubMed

Nair, R R; Blake, P; Grigorenko, A N; Novoselov, K S; Booth, T J; Stauber, T; Peres, N M R; Geim, A K

2008-06-06

There are few phenomena in condensed matter physics that are defined only by the fundamental constants and do not depend on material parameters. Examples are the resistivity quantum, h/e2 (h is Planck's constant and e the electron charge), that appears in a variety of transport experiments and the magnetic flux quantum, h/e, playing an important role in the physics of superconductivity. By and large, sophisticated facilities and special measurement conditions are required to observe any of these phenomena. We show that the opacity of suspended graphene is defined solely by the fine structure constant, a = e2/hc feminine 1/137 (where c is the speed of light), the parameter that describes coupling between light and relativistic electrons and that is traditionally associated with quantum electrodynamics rather than materials science. Despite being only one atom thick, graphene is found to absorb a significant (pa = 2.3%) fraction of incident white light, a consequence of graphene's unique electronic structure.

Free Radical Chemistry of Disinfection Byproducts 2: Rate Constants and Degradation Mechanism of Trichloronitromethane (Chloropicrin)

DOE Office of Scientific and Technical Information (OSTI.GOV)

B. J. Mincher; S. K. Cole; W. J. Cooper

2007-02-01

Absolute rate constants for the free-radical-induced degradation of trichloronitromethane (TCNM, chloropicrin) were determined using electron pulse radiolysis and transient absorption spectroscopy. Rate constants for hydroxyl radical, OH, and hydrated electron, eaq-, reactions were (4.97 ± 0.28) × 107 M-1 s-1 and (2.13 ± 0.03) × 1010 M-1 s-1, respectively. It appears that the OH adds to the nitro-group, while the eaq- reacts via dissociative electron attachment to give two carbon centered radicals. The mechanisms of these free radical reactions with TCNM were investigated, using 60Co gamma irradiation at various absorbed doses, measuring the disappearance of TCNM and the appearance ofmore » the product nitrate and chloride ions. The rate constants and mechanistic data were combined in a kinetic computer model that was used to describe the major free radical pathways for the destruction of TCNM in solution. These data are applicable to other advanced oxidation/reduction processes.« less

Enhancement of anodic current attributed to oxygen evolution on α-Fe2O3 electrode by microwave oscillating electric field

PubMed Central

Kishimoto, Fuminao; Matsuhisa, Masayuki; Kawamura, Shinichiro; Fujii, Satoshi; Tsubaki, Shuntaro; Maitani, Masato M.; Suzuki, Eiichi; Wada, Yuji

2016-01-01

Various microwave effects on chemical reactions have been observed, reported and compared to those carried out under conventional heating. These effects are classified into thermal effects, which arise from the temperature rise caused by microwaves, and non-thermal effects, which are attributed to interactions between substances and the oscillating electromagnetic fields of microwaves. However, there have been no direct or intrinsic demonstrations of the non-thermal effects based on physical insights. Here we demonstrate the microwave enhancement of oxidation current of water to generate dioxygen with using an α-Fe2O3 electrode induced by pulsed microwave irradiation under constantly applied potential. The rectangular waves of current density under pulsed microwave irradiation were observed, in other words the oxidation current of water was increased instantaneously at the moment of the introduction of microwaves, and stayed stably at the plateau under continuous microwave irradiation. The microwave enhancement was observed only for the α-Fe2O3 electrode with the specific surface electronic structure evaluated by electrochemical impedance spectroscopy. This discovery provides a firm evidence of the microwave special non-thermal effect on the electron transfer reactions caused by interaction of oscillating microwaves and irradiated samples. PMID:27739529

Revealing metabolic storage processes in electrode respiring bacteria by differential electrochemical mass spectrometry.

PubMed

Kubannek, F; Schröder, U; Krewer, U

2018-06-01

In this work we employ differential electrochemical mass spectrometry (DEMS) in combination with static and dynamic electrochemical techniques for the study of metabolic processes of electrochemically active bacteria. CO 2 production during acetate oxidation by electrode respiring bacteria was measured, in-vivo and online with a sensitivity of 6.5 ⋅ 10 -13 mol/s. The correlation of ion current and electrical current provides insight into the interaction of metabolic processes and extra-cellular electron transfer. In low-turnover CVs, two competing potential dependent electron transfer mechanisms were observed and formal potentials of two redox systems that are involved in complete oxidation of acetate to CO 2 were determined. By balancing charge and carbon flows during dynamic measurements, two significant storage mechanisms in electrochemically active bacteria were identified: 1) a charge storage mechanism that allows substrate oxidation to proceed at a constant rate despite of external current flowing in cathodic direction. 2) a carbon storage mechanism that allows the biofilm to take up acetate at an unchanged rate at very low potentials even though the oxidation to CO 2 stops. These storage capabilities allow a limited decoupling of electrical current and CO 2 production rate. Copyright © 2018 Elsevier B.V. All rights reserved.

Gallium Electromagnetic (GEM) Thruster Performance Measurements

NASA Technical Reports Server (NTRS)

Thomas, Robert E.; Burton, Rodney L.; Polzin, K. A.

2009-01-01

Discharge current, terminal voltage, and mass bit measurements are performed on a coaxial gallium electromagnetic thruster at discharge currents in the range of 7-23 kA. It is found that the mass bit varies quadratically with the discharge current which yields a constant exhaust velocity of 20 km/s. Increasing the electrode radius ratio of the thruster from to 2.6 to 3.4 increases the thruster efficiency from 21% to 30%. When operating with a central gallium anode, macroparticles are ejected at all energy levels tested. A central gallium cathode ejects macroparticles when the current density exceeds 3.7 10(exp 8) A/square m . A spatially and temporally broad spectroscopic survey in the 220-520 nm range is used to determine which species are present in the plasma. The spectra show that neutral, singly, and doubly ionized gallium species are present in the discharge, as well as annular electrode species at higher energy levels. Axial Langmuir triple probe measurements yield electron temperatures in the range of 0.8-3.8 eV and electron densities in the range of 8 x 10(exp )20 to 1.6 x 10(exp 21) m(exp -3) . Triple probe measurements suggest an exhaust plume with a divergence angle of 9 , and a completely doubly ionized plasma at the ablating thruster cathode.

Rate constants measured for hydrated electron reactions with peptides and proteins

NASA Technical Reports Server (NTRS)

Braams, R.

1968-01-01

Effects of ionizing radiation on the amino acids of proteins and the reactivity of the protonated amino group depends upon the pK subscript a of the group. Estimates of the rate constants for reactions involving the amino acid side chains are presented. These rate constants gave an approximate rate constant for three different protein molecules.

Optical impedance spectroscopy with single-mode electro-active-integrated optical waveguides.

PubMed

Han, Xue; Mendes, Sergio B

2014-02-04

An optical impedance spectroscopy (OIS) technique based on a single-mode electro-active-integrated optical waveguide (EA-IOW) was developed to investigate electron-transfer processes of redox adsorbates. A highly sensitive single-mode EA-IOW device was used to optically follow the time-dependent faradaic current originated from a submonolayer of cytochrome c undergoing redox exchanges driven by a harmonic modulation of the electric potential at several dc bias potentials and at several frequencies. To properly retrieve the faradaic current density from the ac-modulated optical signal, we introduce here a mathematical formalism that (i) accounts for intrinsic changes that invariably occur in the optical baseline of the EA-IOW device during potential modulation and (ii) provides accurate results for the electro-chemical parameters. We are able to optically reconstruct the faradaic current density profile against the dc bias potential in the working electrode, identify the formal potential, and determine the energy-width of the electron-transfer process. In addition, by combining the optically reconstructed faradaic signal with simple electrical measurements of impedance across the whole electrochemical cell and the capacitance of the electric double-layer, we are able to determine the time-constant connected to the redox reaction of the adsorbed protein assembly. For cytochrome c directly immobilized onto the indium tin oxide (ITO) surface, we measured a reaction rate constant of 26.5 s(-1). Finally, we calculate the charge-transfer resistance and pseudocapacitance associated with the electron-transfer process and show that the frequency dependence of the redox reaction of the protein submonolayer follows as expected the electrical equivalent of an RC-series admittance diagram. Above all, we show here that OIS with single-mode EA-IOW's provide strong analytical signals that can be readily monitored even for small surface-densities of species involved in the redox process (e.g., fmol/cm(2), 0.1% of a full protein monolayer). This experimental approach, when combined with the analytical formalism described here, brings additional sensitivity, accuracy, and simplicity to electro-chemical analysis and is expected to become a useful tool in investigations of redox processes.

Preliminary Study of Electron Emission for Use in the PIC Portion of MAFIA

NASA Technical Reports Server (NTRS)

Freeman, Jon C.

2001-01-01

This memorandum summarizes a study undertaken to apply the program MAFIA to the modeling of an electron gun in a traveling wave tube (TWT). The basic problem is to emit particles from the cathode in the proper manner. The electrons are emitted with the classical Maxwell-Boltzmann (M-B) energy distribution; and for a small patch of emitting surface; the distribution with angle obeys Lambert's law. This states that the current density drops off as the cosine of the angle from the normal. The motivation for the work is to extend the analysis beyond that which has been done using older codes. Some existing programs use the Child-Langmuir, or 3/2 power law, for the description of the gun. This means the current varies as the 3/2 power of the anode voltage. The proportionality constant is termed the perveance of the gun. This is limited, however, since the 3/2 variation is only an approximation. Also, if the cathode is near saturation, the 3/2 law definitely will not hold. In most of the older codes, the electron beam is decomposed into current tubes, which imply laminar flow in the beam; even though experiments show the flow to be turbulent. Also, the proper inclusion of noise in the beam is not possible. These older methods of calculation do, however, give reasonable values for parameters of the electron beam and the overall gun, and these values will be used as the starting point for a more precise particle-in-cell (PIC) calculation. To minimize the time needed for a given computer run, all beams will use the same number of particles in a simulation. This is accomplished by varying the mass and charge of the emitted particles (macroparticles) in a certain manner, to be consistent with the desired beam current.

Channel length dependence of field-effect mobility of c-axis-aligned crystalline In-Ga-Zn-O field-effect transistors

NASA Astrophysics Data System (ADS)

Matsuda, Shinpei; Kikuchi, Erumu; Yamane, Yasumasa; Okazaki, Yutaka; Yamazaki, Shunpei

2015-04-01

Field-effect transistors (FETs) with c-axis-aligned crystalline In-Ga-Zn-O (CAAC-IGZO) active layers have extremely low off-state leakage current. Exploiting this feature, we investigated the application of CAAC-IGZO FETs to LSI memories. A high on-state current is required for the high-speed operation of these LSI memories. The field-effect mobility μFE of a CAAC-IGZO FET is relatively low compared with the electron mobility of single-crystal Si (sc-Si). In this study, we measured and calculated the channel length L dependence of μFE for CAAC-IGZO and sc-Si FETs. For CAAC-IGZO FETs, μFE remains almost constant, particularly when L is longer than 0.3 µm, whereas that of sc-Si FETs decreases markedly as L shortens. Thus, the μFE difference between both FET types is reduced by miniaturization. This difference in μFE behavior is attributed to the different susceptibilities of electrons to phonon scattering. On the basis of this result and the extremely low off-state leakage current of CAAC-IGZO FETs, we expect high-speed LSI memories with low power consumption.

Enhancement-mode GaAs metal-oxide-semiconductor high-electron-mobility transistors with atomic layer deposited Al2O3 as gate dielectric

NASA Astrophysics Data System (ADS)

Lin, H. C.; Yang, T.; Sharifi, H.; Kim, S. K.; Xuan, Y.; Shen, T.; Mohammadi, S.; Ye, P. D.

2007-11-01

Enhancement-mode GaAs metal-oxide-semiconductor high-electron-mobility transistors (MOS-HEMTs) with ex situ atomic-layer-deposited Al2O3 as gate dielectrics are studied. Maximum drain currents of 211 and 263mA/mm are obtained for 1μm gate-length Al2O3 MOS-HEMTs with 3 and 6nm thick gate oxide, respectively. C-V characteristic shows negligible hysteresis and frequency dispersion. The gate leakage current density of the MOS-HEMTs is 3-5 orders of magnitude lower than the conventional HEMTs under similar bias conditions. The drain current on-off ratio of MOS-HEMTs is ˜3×103 with a subthreshold swing of 90mV/decade. A maximum cutoff frequency (fT) of 27.3GHz and maximum oscillation frequency (fmax) of 39.9GHz and an effective channel mobility of 4250cm2/Vs are measured for the 1μm gate-length Al2O3 MOS-HEMT with 6nm gate oxide. Hooge's constant measured by low frequency noise spectral density characterization is 3.7×10-5 for the same device.

Macroscopic Quantum Phase-Locking Model for the Quantum Hall = Effect

NASA Astrophysics Data System (ADS)

Wang, Te-Chun; Gou, Yih-Shun

1997-08-01

A macroscopic model of nonlinear dissipative phase-locking between a Josephson-like frequency and a macroscopic electron wave frequency is proposed to explain the Quantum Hall Effect. It is well known that a r.f-biased Josephson junction displays a collective phase-locking behavior which can be described by a non-autonomous second order equation or an equivalent 2+1-dimensional dynamical system. Making a direct analogy between the QHE and the Josephson system, this report proposes a computer-solving nonlinear dynamical model for the quantization of the Hall resistance. In this model, the Hall voltage is assumed to be proportional to a Josephson-like frequency and the Hall current is assumed related to a coherent electron wave frequency. The Hall resistance is shown to be quantized in units of the fine structure constant as the ratio of these two frequencies are locked into a rational winding number. To explain the sample-width dependence of the critical current, the 2DEG under large applied current is further assumed to develop a Josephson-like junction array in which all Josephson-like frequencies are synchronized. Other remarkable features of the QHE such as the resistance fluctuation and the even-denominator states are also discussed within this picture.

A Finite-Orbit-Width Fokker-Planck solver for modeling of RF Current Drive in ITER

NASA Astrophysics Data System (ADS)

Petrov, Yu. V.; Harvey, R. W.

2017-10-01

The bounce-average (BA) finite-difference Fokker-Planck (FP) code CQL3D now includes the essential physics to describe the RF heating of Finite-Orbit-Width (FOW) ions in tokamaks. The FP equation is reformulated in terms of constants-of-motion coordinates, which we select to be particle speed, pitch angle, and major radius on the equatorial plane thus obtaining the distribution function directly at this location. A recent development is the capability to obtain solution simultaneously for FOW ions and Zero-Orbit-Width (ZOW) electrons. As a practical application, the code is used for simulation of alpha-particle heating by high-harmonic waves in ITER scenarios. Coupling of high harmonic or helicon fast waves power to electrons is a promising current drive (CD) scenario for high beta plasmas. However, the efficiency of current drive can be diminished by parasitic channeling of RF power into fast ions such as alphas or NBI-produced deuterons, through finite Larmor-radius effects. Based on simulations, we formulate conditions where the fast ions absorb less than 10% of RF power. Supported by USDOE Grants ER54649, ER54744, and SC0006614.

Electron-transfer oxidation properties of DNA bases and DNA oligomers.

PubMed

Fukuzumi, Shunichi; Miyao, Hiroshi; Ohkubo, Kei; Suenobu, Tomoyoshi

2005-04-21

Kinetics for the thermal and photoinduced electron-transfer oxidation of a series of DNA bases with various oxidants having the known one-electron reduction potentials (E(red)) in an aqueous solution at 298 K were examined, and the resulting electron-transfer rate constants (k(et)) were evaluated in light of the free energy relationship of electron transfer to determine the one-electron oxidation potentials (E(ox)) of DNA bases and the intrinsic barrier of the electron transfer. Although the E(ox) value of GMP at pH 7 is the lowest (1.07 V vs SCE) among the four DNA bases, the highest E(ox) value (CMP) is only 0.19 V higher than that of GMP. The selective oxidation of GMP in the thermal electron-transfer oxidation of GMP results from a significant decrease in the pH dependent oxidation potential due to the deprotonation of GMP*+. The one-electron reduced species of the photosensitizer produced by photoinduced electron transfer are observed as the transient absorption spectra when the free energy change of electron transfer is negative. The rate constants of electron-transfer oxidation of the guanine moieties in DNA oligomers with Fe(bpy)3(3+) and Ru(bpy)3(3+) were also determined using DNA oligomers containing different guanine (G) sequences from 1 to 10 G. The rate constants of electron-transfer oxidation of the guanine moieties in single- and double-stranded DNA oligomers with Fe(bpy)3(2+) and Ru(bpy)3(3+) are dependent on the number of sequential guanine molecules as well as on pH.

Poole-Frenkel-effect as dominating current mechanism in thin oxide films—An illusion?!

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schroeder, Herbert

2015-06-07

In many of the publications, over 50 per year for the last five years, the Poole-Frenkel-effect (PFE) is identified or suggested as dominating current mechanism to explain measured current–electric field dependencies in metal-insulator-metal (MIM) thin film stacks. Very often, the insulating thin film is a metal oxide as this class of materials has many important applications, especially in information technology. In the overwhelming majority of the papers, the identification of the PFE as dominating current mechanism is made by the slope of the current–electric field curve in the so-called Poole-Frenkel plot, i.e., logarithm of current density, j, divided by themore » applied electric field, F, versus the square root of that field. This plot is suggested by the simplest current equation for the PFE, which comprises this proportionality (ln(j/F) vs. F{sup 1/2}) leading to a straight line in this plot. Only one other parameter (except natural constants) may influence this slope: the optical dielectric constant of the insulating film. In order to identify the importance of the PFE simulation studies of the current through MIM stacks with thin insulating films were performed and the current–electric field curves without and with implementation of the PFE were compared. For the simulation, an advanced current model has been used combining electronic carrier injection/ejection currents at the interfaces, described by thermionic emission, with the carrier transport in the dielectric, described by drift and diffusion of electrons and holes in a wide band gap semiconductor. Besides the applied electric field (or voltage), many other important parameters have been varied: the density of the traps (with donor- and acceptor-like behavior); the zero-field energy level of the traps within the energy gap, this energy level is changed by the PFE (also called internal Schottky effect); the thickness of the dielectric film; the permittivity of the dielectric film simulating different oxide materials; the barriers for electrons and holes at the interfaces simulating different electrode materials; the temperature. The main results and conclusions are: (1) For a single type of trap present only (donor-like or acceptor-like), none of the simulated current density curves shows the expected behavior of the PFE and in most cases within the tested parameter field the effect of PFE is negligibly small. (2) For both types of traps present (compensation) only in the case of exact compensation, the expected slope in the PF-plot was nearly found for a wider range of the applied electric field, but for a very small range of the tested parameter field because of the very restricting additional conditions: first, the quasi-fermi level of the current controlling particle (electrons or holes) has to be 0.1 to 0.5 eV closer to the respective band limit than the zero-field energy level of the respective traps and, second, the compensating trap energy level has to be shallow. The conclusion from all these results is: the observation of the PFE as dominating current mechanism in MIM stacks with thin dielectric (oxide) films (typically 30 nm) is rather improbable!.« less

Tunneling measurement of quantum spin oscillations

NASA Astrophysics Data System (ADS)

Bulaevskii, L. N.; Hruška, M.; Ortiz, G.

2003-09-01

We consider the problem of tunneling between two leads via a localized spin 1/2 or any other microscopic system (e.g., a quantum dot) which can be modeled by a two-level Hamiltonian. We assume that a constant magnetic field B0 acts on the spin, that electrons in the leads are in a voltage driven thermal equilibrium, and that the tunneling electrons are coupled to the spin through exchange and spin-orbit interactions. Using the nonequilibrium Keldysh formalism we find the dependence of the spin-spin and current-current correlation functions on the applied voltage between leads V, temperature T, B0, and on the degree and orientation mα of spin polarization of the electrons in the right (α=R) and left (α=L) leads. We show the following (a) The spin-spin correlation function exhibits a peak at the Larmor frequency, ωL, corresponding to the effective magnetic field B acting upon the spin as determined by B0 and the exchange field induced by tunneling of spin-polarized electrons. (b) If the mα’s are not parallel to B the second-order derivative of the average tunneling current I(V) with respect to V is proportional to the spectral density of the spin-spin correlation function, i.e., exhibits a peak at the voltage V=ħωL/e. (c) In the same situation when V>B the current-current correlation function exhibits a peak at the same frequency. (d) The signal-to-noise (shot-noise) ratio R for this peak reaches a maximum value of order unity, R⩽4, at large V when the spin is decoupled from the environment and the electrons in both leads are fully polarized in the direction perpendicular to B. (e) R≪1 if the electrons are weakly polarized, or if they are polarized in a direction close to B0, or if the spin interacts with the environment stronger than with the tunneling electrons. Our results of a full quantum-mechanical treatment of the tunneling-via-spin model when V≫B are in agreement with those previously obtained in the quasiclassical approach. We discuss also the experimental results observed using scanning tunneling microscopy dynamic probes of the localized spin.

Spectroscopic Constants of the Known Electronic States of Lead Monofluoride

DOE Office of Scientific and Technical Information (OSTI.GOV)

McRaven, C.P.; Sivakumar, P.; Shafer-Ray, N.E.

2010-08-01

Based on measurements made by mass-resolved 1 + 1{prime} + 1{double_prime} resonance-enhanced multiphoton ionization spectroscopy, we have determined new molecular constants describing the rotational and fine structure levels of the B, D, E, and F states of the most abundant isotopic variant {sup 208}Pb{sup 19}F, and we summarize the spectroscopic constants for all the know electronic states of the radical. Many spectroscopic constants for the isotopologues {sup 206}Pb{sup 19}F and {sup 207}Pb{sup 19}F have also been determined. The symmetry of the D-state is found to be {sup 2}{pi}{sub 1/2}, and the F-state is found to be an {Omega} = 3/2more » state.« less

Composite polarizability and the construction of an invariant function of refraction and mass density for solutions.

PubMed

Szymański, Krzysztof; Petrache, Horia I

2011-04-14

Re-examination of dynamical ionic polarizabilities in water solutions leads to the formulation of a solution function r(c), which combines the indices of refraction and mass densities of solutions. We show that this function should be independent of ionic concentration if the composite polarizabilities of hydrated solute clusters are constant. Using existing experimental data for a number of aqueous salt and organic solutions, we find that the r(c) function is either constant or varies linearly with concentration, in most cases with negligible slope. We use this function to compare ionic polarizabilities of crystals and aqueous solutions and to highlight how solute polarizabilities at infinite dilution scale with the electronic valence shell of cations and anions. The proposed r(c) function can be used generally to verify the consistency of experimental measurements and of simulation results, and it provides a test of assumptions in current theories of ionic polarizabilities.

Graphene as a Promising Electrode for Low-Current Attenuation in Nonsymmetric Molecular Junctions.

PubMed

Zhang, Qian; Liu, Longlong; Tao, Shuhui; Wang, Congyi; Zhao, Cezhou; González, César; Dappe, Yannick J; Nichols, Richard J; Yang, Li

2016-10-12

We have measured the single-molecule conductance of 1,n-alkanedithiol molecular bridges (n = 4, 6, 8, 10, 12) on a graphene substrate using scanning tunneling microscopy (STM)-formed electrical junctions. The conductance values of this homologous series ranged from 2.3 nS (n = 12) to 53 nS (n = 4), with a decay constant β n of 0.40 per methylene (-CH 2 ) group. This result is explained by a combination of density functional theory (DFT) and Keldysh-Green function calculations. The obtained decay, which is much lower than the one obtained for symmetric gold junctions, is related to the weak coupling at the molecule-graphene interface and the electronic structure of graphene. As a consequence, we show that using graphene nonsymmetric junctions and appropriate anchoring groups may lead to a much-lower decay constant and more-conductive molecular junctions at longer lengths.

Degradation and decoloration of textiles wastewater by electron beam irradiation: Effect of energy, current and absorbed dose

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bakar, Khomsaton Abu; Zulkafli,; Hashim, Siti A'aisah

2014-09-03

In this study, electron beam accelerator (EB) was used to treat textiles wastewater from Rawang Industrial Park, Selangor. The objectives were to determine effective energy, beam current and absorbed dose required for decoloration and degradation of the textiles effluent. The textiles effluent was irradiated in a batch with various energy of 1MeV to 3MeV at constant beam current of 30mA. It was observed that removal of color and COD increases with higher beam energy. The EB energy of 1MeV effectively to removed 58% color and 19% COD. For textile effluent sample irradiated at fix energy of 1MeV and 3Mev butmore » at different beam current 10mA, 20mA and 30mA. It was observed that removal of color and COD increases with the increased of beam current at each energy. However removal of color was significantly better at 1Mev as compared to 3Mev. In the case of textiles effluent, irradiated at doses of 17, 20,25,30, 35, 100 and 200kGy using 30 kW power of EB (1Mev, 30mA), results shows removal of BOD{sub 5}, COD and color were in the range 9%-33%, 14%-38% and 43%-78% respectively.« less

Measurement of Rate Constants for Homodimer Subunit Exchange Using Double Electron-Electron Resonance and Paramagnetic Relaxation Enhancements

PubMed Central

Yang, Yunhuang; Ramelot, Theresa A.; Ni, Shuisong; McCarrick, Robert M.; Kennedy, Michael A.

2013-01-01

Here, we report novel methods to measure rate constants for homodimer subunit exchange using double electron-electron resonance (DEER) electron paramagnetic resonance spectroscopy measurements and nuclear magnetic resonance spectroscopy based paramagnetic relaxation enhancement (PRE) measurements. The techniques were demonstrated using the homodimeric protein Dsy0195 from the strictly anaerobic bacterium Desulfitobacterium hafniense Y51. At specific times following mixing site-specific MTSL-labeled Dsy0195 with uniformly 15N-labeled Dsy0195, the extent of exchange was determined either by monitoring the decrease of MTSL-labeled homodimer from the decay of the DEER modulation depth or by quantifying the increase of MTSL-labeled/15N-labeled heterodimer using PREs. Repeated measurements at several time points following mixing enabled determination of the homodimer subunit dissociation rate constant, k−1;, which was 0.037 ± 0.005 min−1 derived from DEER experiments with a corresponding half-life time of 18.7 minutes. These numbers agreed with independent measurements obtained from PRE experiments. These methods can be broadly applied to protein-protein and protein-DNA complex studies. PMID:23180051

Systems and methods for providing power to a load based upon a control strategy

DOEpatents

Perisic, Milun; Kajouke, Lateef A; Ransom, Ray M

2013-12-24

Systems and methods are provided for an electrical system. The electrical system includes a load, an interface configured to receive a voltage from a voltage source, and a controller configured to receive the voltage from the voltage source through the interface and to provide a voltage and current to the load. Wherein, when the controller is in a constant voltage mode, the controller provides a constant voltage to the load, when the controller is in a constant current mode, the controller provides a constant current to the load, and when the controller is in a constant power mode, the controller provides a constant power to the load.

A Hot-Electron Far-Infrared Direct Detector

NASA Technical Reports Server (NTRS)

Karasik, B. S.; McGrath, W. R.; LeDuc, H. G.

2000-01-01

A new approach is proposed to improve the sensitivity of direct-detection bolometers at millimeter, submillimeter and far-infrared wavelengths. The idea is to adjust a speed of the thermal relaxation of hot-electrons in a nanometer size normal metal or super-conductive transition edge bolometer by controlling the elastic electron mean free path. If the bolometer contacts are made of a superconductor with high critical temperature (Nb, Pb etc.) then the thermal diffusion into the contacts is absent because of the Andreev's reflection and the electron-phonon relaxation is the only mechanism for heat removal. The relaxation rate should behave as T(sup 4)l at subkelvin temperatures (l is the electron elastic mean free path) and can be reduced by factor of 10-100 by decreasing l. Then an antenna- or waveguide-coupled bolometer with a time constant about 10(exp -3) to 10(exp -5) s at T approximately equals 0.1-0.3 K will exhibit photon-noise limited performance in millimeter and submillimeter range. The choice of the bolometer material is a tradeoff between a low electron heat capacity and fabrication. A state-of-the-art bolometer currently offers NEP = 10(exp -17) W(Square root of (Hz)) at 100 mK along with a approximately equals 2 msec time constant. The bolometer we propose will have a figure-of-merit, NEP(square root (r)), which is 10(exp 3) times smaller. This will allow for a tremendous increase in speed which will have a significant impact for observational mapping applications. Alternatively, the bolometer could operate at higher temperature with still superior sensitivity. This device can significantly increase a science return and reduce the cost for future observational missions. This research was performed by the Center for Space Microelectronics Technology, Jet Propulsion Laboratory, California Institute of Technology, and was sponsored by NASA, Office of Space Science.

Thermal transport across metal silicide-silicon interfaces: First-principles calculations and Green's function transport simulations

NASA Astrophysics Data System (ADS)

Sadasivam, Sridhar; Ye, Ning; Feser, Joseph P.; Charles, James; Miao, Kai; Kubis, Tillmann; Fisher, Timothy S.

2017-02-01

Heat transfer across metal-semiconductor interfaces involves multiple fundamental transport mechanisms such as elastic and inelastic phonon scattering, and electron-phonon coupling within the metal and across the interface. The relative contributions of these different transport mechanisms to the interface conductance remains unclear in the current literature. In this work, we use a combination of first-principles calculations under the density functional theory framework and heat transport simulations using the atomistic Green's function (AGF) method to quantitatively predict the contribution of the different scattering mechanisms to the thermal interface conductance of epitaxial CoSi2-Si interfaces. An important development in the present work is the direct computation of interfacial bonding from density functional perturbation theory (DFPT) and hence the avoidance of commonly used "mixing rules" to obtain the cross-interface force constants from bulk material force constants. Another important algorithmic development is the integration of the recursive Green's function (RGF) method with Büttiker probe scattering that enables computationally efficient simulations of inelastic phonon scattering and its contribution to the thermal interface conductance. First-principles calculations of electron-phonon coupling reveal that cross-interface energy transfer between metal electrons and atomic vibrations in the semiconductor is mediated by delocalized acoustic phonon modes that extend on both sides of the interface, and phonon modes that are localized inside the semiconductor region of the interface exhibit negligible coupling with electrons in the metal. We also provide a direct comparison between simulation predictions and experimental measurements of thermal interface conductance of epitaxial CoSi2-Si interfaces using the time-domain thermoreflectance technique. Importantly, the experimental results, performed across a wide temperature range, only agree well with predictions that include all transport processes: elastic and inelastic phonon scattering, electron-phonon coupling in the metal, and electron-phonon coupling across the interface.

Low noise constant current source for bias dependent noise measurements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Talukdar, D.; Bose, Suvendu; Bardhan, K. K.

2011-01-15

A low noise constant current source used for measuring the 1/f noise in disordered systems in ohmic as well as nonohmic regime is described. The source can supply low noise constant current starting from as low as 1 {mu}A to a few tens of milliampere with a high voltage compliance limit of around 20 V. The constant current source has several stages, which can work in a standalone manner or together to supply the desired value of load current. The noise contributed by the current source is very low in the entire current range. The fabrication of a low noisemore » voltage preamplifier modified for bias dependent noise measurements and based on the existing design available in the MAT04 data sheet is also described.« less

Electronic structure of the BaO molecule with dipole moments and ro-vibrational calculations

NASA Astrophysics Data System (ADS)

Khatib, Mohamed; Korek, Mahmoud

2018-03-01

The twenty-three low-lying electronic states (singlet and triplet) of the BaO molecule have been studied by using an ab initio method. These electronic states have been investigated by using the Complete Active Apace Self-Consistent Field (CASSCF) followed by multi-reference configuration interaction (MRCI + Q) with Davidson correction. The potential energy curves, the internuclear distance Re, the harmonic frequency ωe, the rotational constant Be, the electronic energy with respect to the ground state Te and the static and transition dipole moment have been investigated. The Einstein spontaneous and induced emission coefficients A21 and B21ω as well as the spontaneous radiative lifetime τspon, emission wavelength λ21 and oscillator strength f21 have been calculated by using the transition dipole moment between some doublet electronic states. The calculation of the eigenvalues Ev, the rotational constant Bv, the centrifugal distortion constant Dv, and the abscissas of the turning points Rmin and Rmax have been done by using the canonical functions approach. A very good agreement is shown by comparing the values of our work to those found in the literature for many electronic states. Eighteen new electronic states have been studied here for the first time.

Predictive methods of some optoelectronic properties for blends based on quaternized polysulfones

NASA Astrophysics Data System (ADS)

Dobos, Adina Maria; Filimon, Anca

2017-11-01

Blends based on quaternized polysulfones were investigated in terms of optical and electronic properties. By applying the Bicerano formalism the refractive index and dielectric constant were evaluated. Also, the dielectric constant of these blends was studied as a function of temperature and frequency. As the result of the main chain structure and charged groups, an increase in theoretical values of the refractive index and dielectric constant with increasing of the ionic quaternized units content in the polymer blend occurs. Additionally, decrease in the dielectric constant with the increase of frequency and decrease of temperature was observed. Refractive index and dielectric constant values indicate that the analyzed samples are transparent and can be used in obtaining of materials with applications involving a small polarizability. Thus, the results are important in prediction of the special optoelectronic features of new polymers blends to obtain high-performance materials with applications in electronic and biomedical fields.

Electron-ion dissociative recombination rate constants relevant to the Titan atmosphere and the Interstellar Medium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osborne, David; Lawson, Patrick; Adams, Nigel, E-mail: ngadams@uga.edu

Following the arrival of Cassini at Titan in 2004, the Titan atmosphere has been shown to contain large complex polycyclic-aromatic hydrocarbons. Since Cassini has provided a great deal of data, there exists a need for kinetic rate data to help with modeling this atmosphere. One type of kinetic data needed is electron-ion dissociative recombination (e-IDR) rate constants. These data are not readily available for larger compounds, such as naphthalene, or oxygen containing compounds, such as 1,4 dioxane or furan. Here, the rate constants for naphthalene, 1,4 dioxane, and furan have been measured and their temperature dependencies are determined when possible,more » using the University of Georgia's Variable Temperature Flowing Afterglow. The rate constants are compared with those previously published for other compounds; these show trends which illustrate the effects which multi-rings and oxygen heteroatoms substitutions have upon e-IDR rate constants.« less

Electron-ion dissociative recombination rate constants relevant to the Titan atmosphere and the Interstellar Medium

NASA Astrophysics Data System (ADS)

Osborne, David; Lawson, Patrick; Adams, Nigel

2014-01-01

Following the arrival of Cassini at Titan in 2004, the Titan atmosphere has been shown to contain large complex polycyclic-aromatic hydrocarbons. Since Cassini has provided a great deal of data, there exists a need for kinetic rate data to help with modeling this atmosphere. One type of kinetic data needed is electron-ion dissociative recombination (e-IDR) rate constants. These data are not readily available for larger compounds, such as naphthalene, or oxygen containing compounds, such as 1,4 dioxane or furan. Here, the rate constants for naphthalene, 1,4 dioxane, and furan have been measured and their temperature dependencies are determined when possible, using the University of Georgia's Variable Temperature Flowing Afterglow. The rate constants are compared with those previously published for other compounds; these show trends which illustrate the effects which multi-rings and oxygen heteroatoms substitutions have upon e-IDR rate constants.

Large Quantum Probability Backflow and the Azimuthal Angle-Angular Momentum Uncertainty Relation for an Electron in a Constant Magnetic Field

ERIC Educational Resources Information Center

Strange, P.

2012-01-01

In this paper we demonstrate a surprising aspect of quantum mechanics that is accessible to an undergraduate student. We discuss probability backflow for an electron in a constant magnetic field. It is shown that even for a wavepacket composed entirely of states with negative angular momentum the effective angular momentum can take on positive…

dParFit: A computer program for fitting diatomic molecule spectral data to parameterized level energy expressions

NASA Astrophysics Data System (ADS)

Le Roy, Robert J.

2017-01-01

This paper describes FORTRAN program dParFit, which performs least-squares fits of diatomic molecule spectroscopic data involving one or more electronic states and one or more isotopologues, to parameterized expressions for the level energies. The data may consist of any combination of microwave, infrared or electronic vibrotational bands, fluorescence series or binding energies (from photo-association spectroscopy). The level energies for each electronic state may be described by one of: (i) band constants {Gv ,Bv ,Dv , … } for each vibrational level, (ii) generalized Dunham expansions, (iii) pure near-dissociation expansions (NDEs), (iv) mixed Dunham/NDE expressions, or (v) individual term values for each distinct level of each isotopologue. Different representations may be used for different electronic states and/or for different types of constants in a given fit (e.g., Gv and Bv may be represented one way and centrifugal distortion constants another). The effect of Λ-doubling or 2Σ splittings may be represented either by band constants (qvB or γvB, qvD or γvD, etc.) for each vibrational level of each isotopologue, or by using power series expansions in (v + 1/2) to represent those constants. Fits to Dunham or NDE expressions automatically incorporate normal first-order semiclassical mass scaling to allow combined analyses of multi-isotopologue data. In addition, dParFit may fit to determine atomic-mass-dependent terms required to account for breakdown of the Born-Oppenheimer and first-order semiclassical approximations. In any of these types of fits, one or more subsets of these parameters for one or more of the electronic states may be held fixed, while a limited parameter set is varied. The program can also use a set of read-in constants to make predictions and calculate deviations [ycalc -yobs ] for any chosen input data set, or to generate predictions of arbitrary data sets.

Substitution and protonation effects on spin-spin coupling constants in prototypical aromatic rings: C6H6, C5H5N and C5H5P.

PubMed

Del Bene, Janet E; Elguero, José

2006-08-01

Ab initio equation-of-motion coupled cluster calculations have been carried out to evaluate one-, two-, and three-bond 13C-13C, 15N-13C, 31P-13C coupling constants in benzene, pyridine, pyridinium, phosphinine, and phosphininium. The introduction of N or P heteroatoms into the aromatic ring not only changes the magnitudes of the corresponding X-C coupling constants (J, for X = C, N, or P) but also the signs and magnitudes of corresponding reduced coupling constants (K). Protonation of the heteroatoms also produces dramatic changes in coupling constants and, by removing the lone pair of electrons from the sigma-electron framework, leads to the same signs for corresponding reduced coupling constants for benzene, pyridinium, and phosphininium. C-C coupling constants are rather insensitive to the presence of the heteroatoms and protonation. All terms that contribute to the total coupling constant (except for the diamagnetic spin-orbit (DSO) term) must be computed if good agreement with experimental data is to be obtained. Copyright 2006 John Wiley & Sons, Ltd.

Understanding Molecular Conduction: Old Wine in a New Bottle?

NASA Astrophysics Data System (ADS)

Ghosh, Avik

2007-03-01

Molecules provide an opportunity to test our understanding of fundamental non-equilibrium transport processes, as well as explore new device possibilities. We have developed a unified approach to nanoscale conduction, coupling bandstructure and electrostatics of the channel and contacts with a quantum kinetic theory of current flow. This allows us to describe molecular conduction at various levels of detail, -- from quantum corrected compact models, to semi-empirical models for quick physical insights, and `first-principles' calculations of current-voltage (I-V) characteristics with no adjustable parameters. Using this suite of tools, we can quantitatively explain various experimental I-Vs, including complex reconstructed silicon substrates. We find that conduction in most molecules is contact dominated, and limited by fundamental electrostatic and thermodynamic restrictions quite analogous to those faced by the silicon industry, barring a few interesting exceptions. The distinction between molecular and silicon electronics must therefore be probed at a more fundamental level. Ultra-short molecules are unique in that they possess large Coulomb energies as well as anomalous vibronic couplings with current flow -- in other words, strong non-equilibrium electron-electron and electron-phonon correlations. These effects yield prominent experimental signatures, but require a completely different modeling approach -- in fact, popular approaches to include correlation typically do not work for non-equilibrium. Molecules exhibit rich physics, including the ability to function both as weakly interacting current conduits (quantum wires) as well as strongly correlated charge storage centers (quantum dots). Theoretical treatment of the intermediate coupling regime is particularly challenging, with a large `fine structure constant' for transport that negates orthodox theories of Coulomb Blockade and phonon-assisted tunneling. It is in this regime that the scientific and technological merits of molecular conductors may need to be explored. For instance, the tunable quantum coupling of current flow in silicon transistors with engineered molecular scatterers could lead to devices that operate on completely novel principles.

SmB6 electron-phonon coupling constant from time- and angle-resolved photoelectron spectroscopy

NASA Astrophysics Data System (ADS)

Sterzi, A.; Crepaldi, A.; Cilento, F.; Manzoni, G.; Frantzeskakis, E.; Zacchigna, M.; van Heumen, E.; Huang, Y. K.; Golden, M. S.; Parmigiani, F.

2016-08-01

SmB6 is a mixed valence Kondo system resulting from the hybridization between localized f electrons and delocalized d electrons. We have investigated its out-of-equilibrium electron dynamics by means of time- and angle-resolved photoelectron spectroscopy. The transient electronic population above the Fermi level can be described by a time-dependent Fermi-Dirac distribution. By solving a two-temperature model that well reproduces the relaxation dynamics of the effective electronic temperature, we estimate the electron-phonon coupling constant λ to range from 0.13 ±0.03 to 0.04 ±0.01 . These extremes are obtained assuming a coupling of the electrons with either a phonon mode at 10 or 19 meV. A realistic value of the average phonon energy will give an actual value of λ within this range. Our results provide an experimental report on the material electron-phonon coupling, contributing to both the electronic transport and the macroscopic thermodynamic properties of SmB6.

Flexible, Low-Power Thin-Film Transistors Made of Vapor-Phase Synthesized High-k, Ultrathin Polymer Gate Dielectrics.

PubMed

Choi, Junhwan; Joo, Munkyu; Seong, Hyejeong; Pak, Kwanyong; Park, Hongkeun; Park, Chan Woo; Im, Sung Gap

2017-06-21

A series of high-k, ultrathin copolymer gate dielectrics were synthesized from 2-cyanoethyl acrylate (CEA) and di(ethylene glycol) divinyl ether (DEGDVE) monomers by a free radical polymerization via a one-step, vapor-phase, initiated chemical vapor deposition (iCVD) method. The chemical composition of the copolymers was systematically optimized by tuning the input ratio of the vaporized CEA and DEGDVE monomers to achieve a high dielectric constant (k) as well as excellent dielectric strength. Interestingly, DEGDVE was nonhomopolymerizable but it was able to form a copolymer with other kinds of monomers. Utilizing this interesting property of the DEGDVE cross-linker, the dielectric constant of the copolymer film could be maximized with minimum incorporation of the cross-linker moiety. To our knowledge, this is the first report on the synthesis of a cyanide-containing polymer in the vapor phase, where a high-purity polymer film with a maximized dielectric constant was achieved. The dielectric film with the optimized composition showed a dielectric constant greater than 6 and extremely low leakage current densities (<3 × 10 -8 A/cm 2 in the range of ±2 MV/cm), with a thickness of only 20 nm, which is an outstanding thickness for down-scalable cyanide polymer dielectrics. With this high-k dielectric layer, organic thin-film transistors (OTFTs) and oxide TFTs were fabricated, which showed hysteresis-free transfer characteristics with an operating voltage of less than 3 V. Furthermore, the flexible OTFTs retained their low gate leakage current and ideal TFT characteristics even under 2% applied tensile strain, which makes them some of the most flexible OTFTs reported to date. We believe that these ultrathin, high-k organic dielectric films with excellent mechanical flexibility will play a crucial role in future soft electronics.

Quantum Hall resistance standard in graphene devices under relaxed experimental conditions

NASA Astrophysics Data System (ADS)

Ribeiro-Palau, R.; Lafont, F.; Brun-Picard, J.; Kazazis, D.; Michon, A.; Cheynis, F.; Couturaud, O.; Consejo, C.; Jouault, B.; Poirier, W.; Schopfer, F.

2015-11-01

The quantum Hall effect provides a universal standard for electrical resistance that is theoretically based on only the Planck constant h and the electron charge e. Currently, this standard is implemented in GaAs/AlGaAs, but graphene's electronic properties have given hope for a more practical device. Here, we demonstrate that the experimental conditions necessary for the operation of devices made of high-quality graphene grown by chemical vapour deposition on silicon carbide can be extended and significantly relaxed compared with those for state-of-the-art GaAs/AlGaAs devices. In particular, the Hall resistance can be accurately quantized to within 1 × 10-9 over a 10 T wide range of magnetic flux density, down to 3.5 T, at a temperature of up to 10 K or with a current of up to 0.5 mA. This experimental simplification highlights the great potential of graphene in the development of user-friendly and versatile quantum standards that are compatible with broader industrial uses beyond those in national metrology institutes. Furthermore, the measured agreement of the quantized Hall resistance in graphene and GaAs/AlGaAs, with an ultimate uncertainty of 8.2 × 10-11, supports the universality of the quantum Hall effect. This also provides evidence of the relation of the quantized Hall resistance with h and e, which is crucial for the new Système International d'unités to be based on fixing such fundamental constants of nature.

Multiplexing of Hot-Electron Nanobolometers Using Microwave SQUIDs

NASA Technical Reports Server (NTRS)

Karasik, Boris S.; Day, Peter K.; Kawamura, Jonathan H.; Bumble, Bruce; LeDuc, Henry G.

2009-01-01

We have obtained the first data on the multiplexed operation of titanium hot-electron bolometers (HEB). Because of their low thermal conductance and small electron heat capacity nanobolometers are particularly interesting as sensors for far-infrared spectroscopy and mid- and near-IR calorimetry. However, the short time constant of these devices (approximately microseconds at 300-400 mK) makes time domain or audio-frequency domain multiplexing impractical. The Microwave SQUID (MSQUID) approach pursued in this work uses dc SQUIDs coupled to X-band microresonators which are, in turn, coupled to a transmission line. We used a 4-element array of Ti HEBs operated at 415 mK in a He3 dewar with an optical fiber access. The microwave signal exhibited 10-MHz wide resonances at individual MSQUD frequencies between 9 GHz and 10 GHz. The resonance depth is modulated by the current through the bolometer via a change of the SQUID flux state. The transmitted signal was amplified by a cryogenic amplifier and downconverted to baseband using an IQ mixer. A 1-dB per ??/2 responsivity was sufficient for keeping the system noise at the level of 2 pA/Hz1/2. This is more than an order of magnitude smaller than phonon noise in the HEB. The devices were able to detect single near- IR photons (1550 nm) with a time constant of 3.5 ?s. Follow-on work will scale the array to larger size and will address the microwave frequency signal generation and processing using a digital transceiver.

High accuracy electronic material level sensor

DOEpatents

McEwan, T.E.

1997-03-11

The High Accuracy Electronic Material Level Sensor (electronic dipstick) is a sensor based on time domain reflectometry (TDR) of very short electrical pulses. Pulses are propagated along a transmission line or guide wire that is partially immersed in the material being measured; a launcher plate is positioned at the beginning of the guide wire. Reflected pulses are produced at the material interface due to the change in dielectric constant. The time difference of the reflections at the launcher plate and at the material interface are used to determine the material level. Improved performance is obtained by the incorporation of: (1) a high accuracy time base that is referenced to a quartz crystal, (2) an ultrawideband directional sampler to allow operation without an interconnect cable between the electronics module and the guide wire, (3) constant fraction discriminators (CFDs) that allow accurate measurements regardless of material dielectric constants, and reduce or eliminate errors induced by triple-transit or ``ghost`` reflections on the interconnect cable. These improvements make the dipstick accurate to better than 0.1%. 4 figs.

High accuracy electronic material level sensor

DOEpatents

McEwan, Thomas E.

1997-01-01

The High Accuracy Electronic Material Level Sensor (electronic dipstick) is a sensor based on time domain reflectometry (TDR) of very short electrical pulses. Pulses are propagated along a transmission line or guide wire that is partially immersed in the material being measured; a launcher plate is positioned at the beginning of the guide wire. Reflected pulses are produced at the material interface due to the change in dielectric constant. The time difference of the reflections at the launcher plate and at the material interface are used to determine the material level. Improved performance is obtained by the incorporation of: 1) a high accuracy time base that is referenced to a quartz crystal, 2) an ultrawideband directional sampler to allow operation without an interconnect cable between the electronics module and the guide wire, 3) constant fraction discriminators (CFDs) that allow accurate measurements regardless of material dielectric constants, and reduce or eliminate errors induced by triple-transit or "ghost" reflections on the interconnect cable. These improvements make the dipstick accurate to better than 0.1%.

The Effect of Sn Orientation on Intermetallic Compound Growth in Idealized Sn-Cu-Ag Interconnects

NASA Astrophysics Data System (ADS)

Kinney, Chris; Linares, Xioranny; Lee, Kyu-Oh; Morris, J. W.

2013-04-01

The work reported here explores the influence of crystal orientation on the growth of the interfacial intermetallic layer during electromigration in Cu||Sn||Cu solder joints. The samples were thin, planar Sn-Ag-Cu (SAC) solder layers between Cu bars subject to a uniaxial current. Electron backscatter diffraction (EBSD) was used to characterize the microstructure before and after testing. The most useful representation of the EBSD data identifies the Sn grain orientation by the angle between the Sn c-axis and the current direction. The tested samples included single-crystal joints with c-axis nearly parallel to the current ("green" samples) and with c-axis perpendicular to the current ("red" samples). At current density of 104 A/cm2 (steady-state temperature of ~150°C), an intermetallic layer grew at an observable rate in the "green" samples, but not in the "red" ones. A current density of 1.15 × 104 A/cm2 (temperature ~160°C) led to measurable intermetallic growth in both samples. The growth fronts were nearly planar and the growth rates constant (after an initial incubation period); the growth rates in the "green" samples were about 10× those in the "red" samples. The Cu concentrations were constant within the joints, showing that the intermetallic growth is dominated by the electromigration flux. The measured growth rates and literature values for the diffusion of Cu in Sn were used to extract values for the effective charge, z *, that governs the electromigration of Cu. The calculated value of z * is significantly larger for current perpendicular to the c-axis than along it.

Interfacial morphology of low-voltage anodic aluminium oxide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Naiping; Dongcinn, Xuecheng; He, Xueying

X-ray reflectivity (XRR) and neutron reflectivity (NR), as well as ultra-smallangle X-ray scattering (USAXS), are used to examine the in-plane and surfacenormal structure of anodic films formed on aluminium alloy AA2024 and pure aluminium. Aluminium and alloy films up to 3500 A thick were deposited on Si wafers by electron beam evaporation of ingots. Porous anodic aluminium oxide (AAO) films are formed by polarizing at constant voltage up to 20 V noble to the open circuit potential. The voltage sweet spot (5 V) appropriate for constant-voltage anodization of such thin films was determined for both alloy and pure Al. Inmore » addition, a new concurrent voltage- and current-control protocol was developed to prepare films with larger pores (voltages higher than 5 V), but formed at a controlled current so that pore growth is slow enough to avoid stripping the aluminium substrate layer. USAXS shows that the pore size and interpore spacing are fixed in the first 10 s after initiation of anodization. Pores then grow linearly in time, at constant radius and interpore spacing. Using a combination of XRR and NR, the film density and degree of hydration of the films were determined from the ratio of scattering length densities. Assuming a chemical formula Al2O3xH2O, it was found that x varies from 0.29 for the native oxide to 1.29 for AAO grown at 20 V under concurrent voltage and current control. The average AAO film density of the porous film at the air surface is 2.45 (20) g cm3. The density of the barrier layer at the metal interface is 2.9 (4) g cm3, which indicates that this layer is also quite porous« less

Spectroscopy of selected metal-containing diatomic molecules

NASA Astrophysics Data System (ADS)

Gordon, Iouli E.

Fourier transform infrared emission spectra of MnH and MnD were observed in the ground X7Sigma+ electronic state. The vibration-rotation bands from v = 1 → 0 to v = 3 → 2 for MnH, and from v = 1 → 0 to v = 4 → 3 for MnD were recorded at an instrumental resolution of 0.0085 cm-1. Spectroscopic constants were determined for each vibrational level and equilibrium constants were found from a Dunham-type fit. The equilibrium vibrational constant oe for MnH was found to be 1546.84518(65) cm-1, the equilibrium rotational constant Be was found to be 5.6856789(103) cm-1 and the equilibrium bond distance re was determined to be 1.7308601(47) A. New high resolution emission spectra of CoH and CoD molecules have been recorded in the 640 nm to 3.5 mum region using a Fourier transform spectrometer. Many bands were observed for the A'3phi- X3phi electronic transition of CoH and CoD. In addition, a new [13.3]4 electronic state was found by observing the [13.3]4-X3phi3 and [13.3]4- X3phi4 transitions in the spectrum of CoD. Analysis of the transitions with DeltaO = 0, +/-1 provided more accurate values of spin-orbit splittings between O = 4 and O = 3 components. The ground state for both molecules was fitted both to band and Dunham-type constants. The estimated band constants of the perturbed upper states were also obtained. The emission spectrum of gas-phase YbO has been investigated using a Fourier transform spectrometer. A total of 8 red-degraded bands in the range 9 800--11 300 cm-1 were recorded at a resolution of 0.04 cm-1. Because of the multiple isotopomers present in the spectra, only 3 bands were rotationally analyzed. Perturbations were identified in two of these bands and all 3 transitions were found to terminate at the X1Sigma+ ground electronic state. The electronic configurations that give rise to the observed states are discussed and molecular parameters for all of the analyzed bands are reported. Electronic spectra of the previously unobserved EuH and EuD molecules were studied by means of Fourier transform spectroscopy and laser-induced fluorescence. The extreme complexity of these transitions made rotational assignments of EuH bands impossible. However, the spin-spin interaction constant, lambda, and Fermi contact parameter, bF, in the ground X9Sigma- electronic state were estimated for the 151EuH and 153EuH isotopologues. Electronic spectra of SmH, SmCl, TmH and ErF molecules were recorded for the first time using Fourier transform spectrometer. The poor signal to noise ratio of the observed bands coupled with their complexity prevented a rotational analysis. The electronic states that may be involved in the observed transitions are discussed.

Spectroscopy of selected metal-containing diatomic molecules

NASA Astrophysics Data System (ADS)

Gordon, Iouli

Fourier transform infrared emission spectra of MnH and MnD were observed in the ground X7[sigma]+ electronic state. The vibration-rotation bands from v = 1 to 0 to v = 3 to 2 for MnH, and from v = 1 to 0 to v = 4 to 3 for MnD were recorded at an instrumental resolution of 0. 0085 cm-1. Spectroscopic constants were determined for each vibrational level and equilibrium constants were found from a Dunham-type fit. The equilibrium vibrational constant [omega]e for MnH was found to be 1546. 84518(65) cm-1, the equilibrium rotational constant Be was found to be 5. 6856789(103) cm-1 and the equilibrium bond distance re was determined to be 1. 7308601(47) ?. New high resolution emission spectra of CoH and CoD molecules have been recorded in the 640 nm to 3. 5 _m region using a Fourier transform spectrometer. Many bands were observed for the A'3?-X3? electronic transition of CoH and CoD. In addition, a new [13. 3]4 electronic state was found by observing the [13. 3]4- X3?3 and [13. 3]4-X3?4 transitions in the spectrum of CoD. Analysis of the transitions with [delta][omega] = 0, ?1 provided more accurate values of spin-orbit splittings between [omega] = 4 and [omega] = 3 components. The ground state for both molecules was fitted both to band and Dunham-type constants. The estimated band constants of the perturbed upper states were also obtained. The emission spectrum of gas-phase YbO has been investigated using a Fourier transform spectrometer. A total of 8 red-degraded bands in the range 9 800 ? 11 300 cm-1 were recorded at a resolution of 0. 04 cm-1. Because of the multiple isotopomers present in the spectra, only 3 bands were rotationally analyzed. Perturbations were identified in two of these bands and all 3 transitions were found to terminate at the X1[sigma]+ ground electronic state. The electronic configurations that give rise to the observed states are discussed and molecular parameters for all of the analyzed bands are reported. Electronic spectra of the previously unobserved EuH and EuD molecules were studied by means of Fourier transform spectroscopy and laser-induced fluorescence. The extreme complexity of these transitions made rotational assignments of EuH bands impossible. However, the spin-spin interaction constant, [lambda], and Fermi contact parameter, bF, in the ground X9[sigma]- electronic state were estimated for the 151EuH and 153EuH isotopologues. Electronic spectra of SmH, SmCl, TmH and ErF molecules were recorded for the first time using Fourier transform spectrometer. The poor signal to noise ratio of the observed bands coupled with their complexity prevented a rotational analysis. The electronic states that may be involved in the observed transitions are discussed.

Contributive research in compound semiconductor material and related devices

NASA Astrophysics Data System (ADS)

Twist, James R.

1988-05-01

The objective of this program was to provide the Electronic Device Branch (AFWAL/AADR) with the support needed to perform state of the art electronic device research. In the process of managing and performing on the project, UES has provided a wide variety of scientific and engineering talent who worked in-house for the Avionics Laboratory. These personnel worked on many different types of research programs from gas phase microwave driven lasers, CVD and MOCVD of electronic materials to Electronic Device Technology for new devices. The fields of research included MBE and theoretical research in this novel growth technique. Much of the work was slanted towards the rapidly developing technology of GaAs and the general thrust of the research that these tasks started has remained constant. This work was started because the Avionics Laboratory saw a chance to advance the knowledge and level of the current device technology by working in the compounds semiconductor field. UES is pleased to have had the opportunity to perform on this program and is looking forward to future efforts with the Avionics Laboratory.

A study of the effect of in-line and perpendicular magnetic fields on beam characteristics of electron guns in medical linear accelerators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Constantin, Dragos E.; Fahrig, Rebecca; Keall, Paul J.

Purpose: Using magnetic resonance imaging (MRI) for real-time guidance during radiotherapy is an active area of research and development. One aspect of the problem is the influence of the MRI scanner, modeled here as an external magnetic field, on the medical linear accelerator (linac) components. The present work characterizes the behavior of two medical linac electron guns with external magnetic fields for in-line and perpendicular orientations of the linac with respect to the MRI scanner. Methods: Two electron guns, Litton L-2087 and Varian VTC6364, are considered as representative models for this study. Emphasis was placed on the in-line design approachmore » in which case the MRI scanner and the linac axes of symmetry coincide and assumes no magnetic shielding of the linac. For the in-line case, the magnetic field from a 0.5 T open MRI (GE Signa SP) magnet with a 60 cm gap between its poles was computed and used in full three dimensional (3D) space charge simulations, whereas for the perpendicular case the magnetic field was constant. Results: For the in-line configuration, it is shown that the electron beam is not deflected from the axis of symmetry of the gun and the primary beam current does not vanish even at very high values of the magnetic field, e.g., 0.16 T. As the field strength increases, the primary beam current has an initial plateau of constant value after which its value decreases to a minimum corresponding to a field strength of approximately 0.06 T. After the minimum is reached, the current starts to increase slowly. For the case when the beam current computation is performed at the beam waist position the initial plateau ends at 0.016 T for Litton L-2087 and at 0.012 T for Varian VTC6364. The minimum value of the primary beam current is 27.5% of the initial value for Litton L-2087 and 22.9% of the initial value for Varian VTC6364. The minimum current is reached at 0.06 and 0.062 T for Litton L-2087 and Varian VTC6364, respectively. At 0.16 T the beam current increases to 40.2 and 31.4% from the original value of the current for Litton L-2087 and Varian VTC6364, respectively. In contrast, for the case when the electron gun is perpendicular to the magnetic field, the electron beam is deflected from the axis of symmetry even at small values of the magnetic field. As the strength of the magnetic field increases, so does the beam deflection, leading to a sharp decrease of the primary beam current which vanishes at about 0.007 T for Litton L-2087 and at 0.006 T for Varian VTC6364, respectively. At zero external field, the beam rms emittance computed at beam waist is 1.54 and 1.29{pi}-mm-mrad for Litton L-2087 and Varian VTC6364, respectively. For the in-line configuration, there are two particular values of the external field where the beam rms emittance reaches a minimum. Litton L-2087 rms emittance reaches a minimum of 0.72{pi} and 2.01{pi}-mm-mrad at 0.026 and 0.132 T, respectively. Varian VTC6364 rms emittance reaches a minimum of 0.34{pi} and 0.35{pi}-mm-mrad at 0.028 and 0.14 T, respectively. Beam radius dependence on the external field is shown for the in-line configuration for both electron guns. Conclusions: 3D space charge simulation of two electron guns, Litton L-2087 and Varian VTC6364, were performed for in-line and perpendicular external magnetic fields. A consistent behavior of Pierce guns in external magnetic fields was proven. For the in-line configuration, the primary beam current does not vanish but a large reduction of beam current (up to 77.1%) is observed at higher field strengths; the beam directionality remains unchanged. It was shown that for a perpendicular configuration the current vanishes due to beam bending under the action of the Lorentz force. For in-line configuration it was determined that the rms beam emittance reaches two minima for relatively high values of the external magnetic field.« less

An Evaluation of Bipolar Junction Transistors as Dosimeter for Megavoltage Electron Beams

DOE Office of Scientific and Technical Information (OSTI.GOV)

Passos, Renan Garcia de; Vidal da Silva, Rogerio Matias; Silva, Malana Marcelina Almeida

Dosimetry is an extremely important field in medical applications of radiation and nowadays, electron beam is a good option for superficial tumor radiotherapy. Normally, the applied dose to the patient both in diagnostic and therapy must be monitored to prevent injuries and ensure the success of the treatment, therefore, we should always look for improving of the dosimetric methods. Accordingly, the aim of this work is about the use of a bipolar junction transistor (BJT) for electron beam dosimetry. After previous studies, such an electronic device can work as a dosimeter when submitted to ionizing radiation of photon beam. Actually,more » a typical BJT consists of two PN semiconductor junctions resulting in the NPN structure device, for while, and each semiconductor is named as collector (C), base (B) and emitter (E), respectively. Although the transistor effect, which corresponds to the current amplification, be accurately described by the quantum physics, one can utilize a simple concept from the circuit theory: the base current IB (input signal) is amplified by a factor of β resulting in the collector current IC (output signal) at least one hundred times greater the IB. In fact, the BJT is commonly used as a current amplifier with gain β=I{sub C}/I{sub B}, therefore, it was noticed that this parameter is altered when the device is exposed to ionizing radiation. The current gain alteration can be explained by the trap creation and the positive charges build up, beside the degradation of the lattice structure. Then, variations of the gain of irradiated transistors may justify their use as a dosimeter. Actually, the methodology is based on the measurements of the I{sub C} variations whereas I{sub B} is maintained constant. BC846 BJT type was used for dose monitoring from passive-mode measurements: evaluation of its electrical characteristic before and after irradiation procedure. Thus, IC readings were plotted as a function of the applied dose in 6 MeV electron beam from a linear accelerator, Clinac iX. The results show that this new methodology could be an alternative to study the dose in superficial tumors in radiation oncology. (authors)« less

Synthesis, integration, and characterization of metal oxide films as alternative gate dielectric materials

NASA Astrophysics Data System (ADS)

Lin, You-Sheng

ZrO2 and HfO2 were investigated in this study to replace SiO2 as the potential gate dielectric materials in metal-oxide-semiconductor field effect transistors. ZrO2 and HfO2 films were deposited on p-type Si (100) wafers by an atomic layer chemical vapor deposition (ALCVD) process using zirconium (IV) t-butoxide and hafnium (IV) t-butoxide as the metal precursors, respectively. Oxygen was used alternatively with these metal alkoxide precursors into the reactor with purging and evacuation in between. The as-deposited ZrO2 and HfO2 films were stoichiometric and uniform based on X-ray photoemission spectroscopy and ellipsometry measurements. X-ray diffraction analysis indicated that the deposited films were amorphous, however, the high-resolution transmission electron microscopy showed an interfacial layer formation on the silicon substrate. Time-of-flight secondary ion mass spectrometry and medium energy ion scattering analysis showed significant intermixing between metal oxides and Si, indicating the formation of metal silicates, which were confirmed by their chemical etching resistance in HF solutions. The thermal stability of ZrO2 and HfO2 thin films on silicon was examined by monitoring their decomposition temperatures in ultra-high vacuum, using in-situ synchrotron radiation ultra-violet photoemission spectroscopy. The as-deposited ZrO2 and HfO2 thin films were thermally stable up to 880°C and 950°C in vacuum, respectively. The highest achieveable dielectric constants of as-deposited ZrO 2 and HfO2 were 21 and 24, respectively, which were slightly lower than the reported dielectric constants of bulk ZrO2 and HfO 2. These slight reductions in dielectric constants were attributed to the formation of the interfacial metal silicate layers. Very small hysteresis and interface state density were observed for both metal oxide films. Their leakage currents were a few orders of magnitude lower than that of SiO 2 at the same equivalent oxide thickness. NMOSFETs were also fabricated with the as-deposited metal oxide films, and reasonable ID-V D and IG-VG results were obtained. The electron mobilities were high from devices built using a plasma etching process to pattern the metal oxide films. However, they can be degraded if an HF wet etching process was used due to the large contact resistences. Upon oxygen annealing, the formation of SiOx at the interface improved the thermal stability of the as-deposited metal oxide films, however, lower overall dielectric constant and higher leakage current were observed. Upon ammonia annealing, the formation of SiOxNy improved not only the thermal stability but also reduced the leakage current. However, the overall dielectric constant of the film was still reduced due to the formation of the additional interfacial layer.

Searching for dilaton dark matter with atomic clocks

NASA Astrophysics Data System (ADS)

Arvanitaki, Asimina; Huang, Junwu; Van Tilburg, Ken

2015-01-01

We propose an experiment to search for ultralight scalar dark matter (DM) with dilatonic interactions. Such couplings can arise for the dilaton as well as for moduli and axion-like particles in the presence of C P violation. Ultralight dilaton DM acts as a background field that can cause tiny but coherent oscillations in Standard Model parameters such as the fine-structure constant and the proton-electron mass ratio. These minute variations can be detected through precise frequency comparisons of atomic clocks. Our experiment extends current searches for drifts in fundamental constants to the well-motivated high-frequency regime. Our proposed setups can probe scalars lighter than 1 0-15 eV with a discovery potential of dilatonic couplings as weak as 1 0-11 times the strength of gravity, improving current equivalence principle bounds by up to 8 orders of magnitude. We point out potential 1 04 sensitivity enhancements with future optical and nuclear clocks, as well as possible signatures in gravitational-wave detectors. Finally, we discuss cosmological constraints and astrophysical hints of ultralight scalar DM, and show they are complimentary to and compatible with the parameter range accessible to our proposed laboratory experiments.

Sub-band gap photo-enhanced secondary electron emission from high-purity single-crystal chemical-vapor-deposited diamond

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yater, J. E., E-mail: joan.yater@nrl.navy.mil; Shaw, J. L.; Pate, B. B.

2016-02-07

Secondary-electron-emission (SEE) current measured from high-purity, single-crystal (100) chemical-vapor-deposited diamond is found to increase when sub-band gap (3.06 eV) photons are incident on the hydrogenated surface. Although the light does not produce photoemission directly, the SEE current increases by more than a factor of 2 before saturating with increasing laser power. In energy distribution curves (EDCs), the emission peak shows a corresponding increase in intensity with increasing laser power. However, the emission-onset energy in the EDCs remains constant, indicating that the bands are pinned at the surface. On the other hand, changes are observed on the high-energy side of the distributionmore » as the laser power increases, with a well-defined shoulder becoming more pronounced. From an analysis of this feature in the EDCs, it is deduced that upward band bending is present in the near-surface region during the SEE measurements and this band bending suppresses the SEE yield. However, sub-band gap photon illumination reduces the band bending and thereby increases the SEE current. Because the bands are pinned at the surface, we conclude that the changes in the band levels occur below the surface in the electron transport region. Sample heating produces similar effects as observed with sub-band gap photon illumination, namely, an increase in SEE current and a reduction in band bending. However, the upward band bending is not fully removed by either increasing laser power or temperature, and a minimum band bending of ∼0.8 eV is established in both cases. The sub-band gap photo-excitation mechanism is under further investigation, although it appears likely at present that defect or gap states play a role in the photo-enhanced SEE process. In the meantime, the study demonstrates the ability of visible light to modify the electronic properties of diamond and enhance the emission capabilities, which may have potential impact for diamond-based vacuum electron sources, particle detectors, and other electronic devices.« less

Efficient Ionization Investigation for Flow Control and Energy Extraction

NASA Technical Reports Server (NTRS)

Schneider, Steven J.; Kamhawi, Hani; Blankson, Isaiah M.

2009-01-01

Nonequilibrium ionization of air by nonthermal means is explored for hypersonic vehicle applications. The method selected for evaluation generates a weakly ionized plasma using pulsed nanosecond, high-voltage discharges sustained by a lower dc voltage. These discharges promise to provide a means of energizing and sustaining electrons in the air while maintaining a nearly constant ion/neutral molecule temperature. This paper explores the use of short approx.5 nsec, high-voltage approx.12 to 22 kV, repetitive (40 to 100 kHz) discharges in generating a weakly ionized gas sustained by a 1 kV dc voltage in dry air at pressures from 10 to 80 torr. Demonstrated lifetimes of the sustainer discharge current approx.10 to 25 msec are over three orders of magnitude longer than the 5 nsec pulse that generates the electrons. This life is adequate for many high speed flows, enabling the possibility of exploiting weakly ionized plasma phenomena in flow-fields such as those in hypersonic inlets, combustors, and nozzles. Results to date are obtained in a volume of plasma between electrodes in a bell jar. The buildup and decay of the visible emission from the pulser excited air is photographed on an ICCD camera with nanosecond resolution and the time constants for visible emission decay are observed to be between 10 to 15 nsec decreasing as pressure increases. The application of the sustainer voltage does not change the visible emission decay time constant. Energy consumption as indicated by power output from the power supplies is 194 to 669 W depending on pulse repetition rate.

Nonadiabatic rate constants for proton transfer and proton-coupled electron transfer reactions in solution: Effects of quadratic term in the vibronic coupling expansion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Soudackov, Alexander; Hammes-Schiffer, Sharon

2015-11-17

Rate constant expressions for vibronically nonadiabatic proton transfer and proton-coupled electron transfer reactions are presented and analyzed. The regimes covered include electronically adiabatic and nonadiabatic reactions, as well as high-frequency and low-frequency regimes for the proton donor-acceptor vibrational mode. These rate constants differ from previous rate constants derived with the cumulant expansion approach in that the logarithmic expansion of the vibronic coupling in terms of the proton donor-acceptor distance includes a quadratic as well as a linear term. The analysis illustrates that inclusion of this quadratic term does not significantly impact the rate constants derived using the cumulant expansion approachmore » in any of the regimes studied. The effects of the quadratic term may become significant when using the vibronic coupling expansion in conjunction with a thermal averaging procedure for calculating the rate constant, however, particularly at high temperatures and for proton transfer interfaces with extremely soft proton donor-acceptor modes that are associated with extraordinarily weak hydrogen bonds. Even with the thermal averaging procedure, the effects of the quadratic term for weak hydrogen-bonding systems are less significant for more physically realistic models that prevent the sampling of unphysical short proton donor-acceptor distances, and the expansion of the coupling can be avoided entirely by calculating the couplings explicitly for the range of proton donor-acceptor distances. This analysis identifies the regimes in which each rate constant expression is valid and thus will be important for future applications to proton transfer and proton-coupled electron transfer in chemical and biological processes. We are grateful for support from National Institutes of Health Grant GM056207 (applications to enzymes) and the Center for Molecular Electrocatalysis, an Energy Frontier Research Center funded by the U.S. Department of Energy, Office of Science, Basic Energy Sciences (applications to molecular electrocatalysts).« less

Well-dispersed LiFePO4 nanoparticles anchored on a three-dimensional graphene aerogel as high-performance positive electrode materials for lithium-ion batteries

NASA Astrophysics Data System (ADS)

Tian, Xiaohui; Zhou, Yingke; Tu, Xiaofeng; Zhang, Zhongtang; Du, Guodong

2017-02-01

A three-dimensional graphene aerogel supporting LiFePO4 nanoparticles (LFP/GA) has been synthesized by a hydrothermal process. The morphology and microstructure of LFP/GA were investigated by X-ray diffraction, scanning electron microscopy, transmission electron microscopy and thermal gravimetric analysis. The electrochemical properties were evaluated by constant-current charge/discharge tests, cyclic voltammetry and electrochemical impedance spectroscopy. Well-distributed LFP nanoparticles are anchored on both sides of graphene and then assemble into a highly porous three-dimensional aerogel architecture. Conductive graphene networks provide abundant paths to facilitate the transfer of electrons, while the aerogel structures offer plenty of interconnected open pores for the storage of electrolyte to enable the fast supply of Li ions. The LFP and graphene aerogel composites present superior specific capacity, rate capability and cycling performance in comparison to the pristine LFP or LFP supported on graphene sheets and are thus promising for lithium-ion battery applications.

Improved linearity in AlGaN/GaN metal-insulator-semiconductor high electron mobility transistors with nonlinear polarization dielectric

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Tao; Science and Technology on Monolithic Integrated Circuits and Modules Laboratory, Nanjing Electronic Devices Institute, Nanjing 210016; Xu, Ruimin

2015-06-15

We demonstrate highly improved linearity in a nonlinear ferroelectric of Pb(Zr{sub 0.52}Ti{sub 0.48})-gated AlGaN/GaN metal-insulator-semiconductor high electron mobility transistor (MIS-HEMT). Distinct double-hump feature in the transconductance-gate voltage (g{sub m}-V{sub g}) curve is observed, yielding remarkable enhancement in gate voltage swing as compared to MIS-HEMT with conventional linear gate dielectric. By incorporating the ferroelectric polarization into a self-consistent calculation, it is disclosed that in addition to the common hump corresponding to the onset of electron accumulation, the second hump at high current level is originated from the nonlinear polar nature of ferroelectric, which enhances the gate capacitance by increasing equivalent dielectricmore » constant nonlinearly. This work paves a way for design of high linearity GaN MIS-HEMT by exploiting the nonlinear properties of dielectric.« less

THz Hot-Electron Photon Counter

NASA Technical Reports Server (NTRS)

Karasik, Boris S.; Sergeev, Andrei V.

2004-01-01

We present a concept for the hot-electron transition-edge sensor capable of counting THz photons. The main need for such a sensor is a spectroscopy on future space telescopes where a background limited NEP approx. 10(exp -20) W/H(exp 1/2) is expected at around 1 THz. Under these conditions, the rate of photon arrival is very low and any currently imaginable detector with sufficient sensitivity will operate in the photon counting mode. The Hot-Electron Photon Counter based on a submicron-size Ti bridge has a very low heat capacity which provides a high enough energy resolution (approx.140 GHz) at 0.3 K. With the sensor time constant of a few microseconds, the dynamic range would be approx. 30 dB. The sensor couples to radiation via a planar antenna and is read by a SQUID amplifier or by a 1-bit RSFQ ADC. A compact array of the antenna-coupled counters can be fabricated on a silicon wafer without membranes.

Lattice constant changes leading to significant changes of the spin-gapless features and physical nature in a inverse Heusler compound Zr2MnGa

NASA Astrophysics Data System (ADS)

Wang, Xiaotian; Cheng, Zhenxiang; Khenata, Rabah; Wu, Yang; Wang, Liying; Liu, Guodong

2017-12-01

The spin-gapless semiconductors with parabolic energy dispersions [1-3] have been recently proposed as a new class of materials for potential applications in spintronic devices. In this work, according to the Slater-Pauling rule, we report the fully-compensated ferrimagnetic (FCF) behavior and spin-gapless semiconducting (SGS) properties for a new inverse Heusler compound Zr2MnGa by means of the plane-wave pseudo-potential method based on density functional theory. With the help of GGA-PBE, the electronic structures and the magnetism of Zr2MnGa compound at its equilibrium and strained lattice constants are systematically studied. The calculated results show that the Zr2MnGa is a new SGS at its equilibrium lattice constant: there is an energy gap between the conduction and valence bands for both the majority and minority electrons, while there is no gap between the majority electrons in the valence band and the minority electrons in the conduction band. Remarkably, not only a diverse physical nature transition, but also different types of spin-gapless features can be observed with the change of the lattice constants. Our calculated results of Zr2MnGa compound indicate that this material has great application potential in spintronic devices.

Modelling bio-electrosynthesis in a reverse microbial fuel cell to produce acetate from CO2 and H2O.

PubMed

Kazemi, M; Biria, D; Rismani-Yazdi, H

2015-05-21

Bio-electrosynthesis is one of the significant developments in reverse microbial fuel cell technology which is potentially capable of creating organic compounds by combining CO2 with H2O. Accordingly, the main objective in the current study was to present a model of microbial electrosynthesis for producing organic compounds (acetate) based on direct conduction of electrons in biofilms. The proposed model enjoys a high degree of rigor because it can predict variations in the substrate concentration, electrical potential, current density and the thickness of the biofilm. Additionally, coulombic efficiency was investigated as a function of substrate concentration and cathode potential. For a system containing CO2 as the substrate and Sporomusa ovata as the biofilm forming microorganism, an increase in the substrate concentration at a constant potential can lead to a decrease in coulombic efficiency as well as an increase in current density and biofilm thickness. On the other hand, an increase in the surface cathodic voltage at a constant substrate concentration may result in an increase in the coulombic efficiency and a decrease in the current density. The maximum coulombic efficiency was revealed to be 75% at a substrate concentration of 0.025 mmol cm(-3) and 55% at a surface cathodic voltage of -0.3 V producing a high range of acetate production by creating an optimal state in the concentration and potential intervals. Finally, the validity of the model was verified by comparing the obtained results with related experimental findings.

New measurement of the electron magnetic moment and the fine structure constant.

PubMed

Hanneke, D; Fogwell, S; Gabrielse, G

2008-03-28

A measurement using a one-electron quantum cyclotron gives the electron magnetic moment in Bohr magnetons, g/2=1.001 159 652 180 73 (28) [0.28 ppt], with an uncertainty 2.7 and 15 times smaller than for previous measurements in 2006 and 1987. The electron is used as a magnetometer to allow line shape statistics to accumulate, and its spontaneous emission rate determines the correction for its interaction with a cylindrical trap cavity. The new measurement and QED theory determine the fine structure constant, with alpha{-1}=137.035 999 084 (51) [0.37 ppb], and an uncertainty 20 times smaller than for any independent determination of alpha.

Anode sheath transition in an anodic arc for synthesis of nanomaterials

NASA Astrophysics Data System (ADS)

Nemchinsky, V. A.; Raitses, Y.

2016-06-01

The arc discharge with ablating anode or so-called anodic arc is widely used for synthesis of nanomaterials, including carbon nanotubes and fullerens, metal nanoparticles etc. We present the model of this arc, which confirms the existence of the two different modes of the arc operation with two different anode sheath regimes, namely, with negative anode sheath and with positive anode sheath. It was previously suggested that these regimes are associated with two different anode ablating modes—low ablation mode with constant ablation rate and the enhanced ablation mode (Fetterman et al 2008 Carbon 46 1322). The transition of the arc operation from low ablation mode to high ablation mode is determined by the current density at the anode. The model can be used to self-consistently determine the distribution of the electric field, electron density and electron temperature in the near-anode region of the arc discharge. Simulations of the carbon arc predict that for low arc ablating modes, the current is driven mainly by the electron diffusion to the anode. For positive anode sheath, the anode voltage is close to the ionization potential of anode material, while for negative anode sheath, the anode voltage is an order of magnitude smaller. It is also shown that the near-anode plasma, is far from the ionization equilibrium.

A Limited In-Flight Evaluation of the Constant Current Loop Strain Measurement Method

NASA Technical Reports Server (NTRS)

Olney, Candida D.; Collura, Joseph V.

1997-01-01

For many years, the Wheatstone bridge has been used successfully to measure electrical resistance and changes in that resistance. However, the inherent problem of varying lead wire resistance can cause errors when the Wheatstone bridge is used to measure strain in a flight environment. The constant current loop signal-conditioning card was developed to overcome that difficulty. This paper describes a limited evaluation of the constant current loop strain measurement method as used in the F-16XL ship 2 Supersonic Laminar Flow Control flight project. Several identical strain gages were installed in close proximity on a shock fence which was mounted under the left wing of the F- 1 6XL ship 2. Two strain gage bridges were configured using the constant current loop, and two were configured using the Wheatstone bridge circuitry. Flight data comparing the output from the constant current loop configured gages to that of the Wheatstone bridges with respect to signal output, error, and noise are given. Results indicate that the constant current loop strain measurement method enables an increased output, unaffected by lead wire resistance variations, to be obtained from strain gages.

Open-circuit voltage improvements in low-resistivity solar cells

NASA Technical Reports Server (NTRS)

Godlewski, M. P.; Klucher, T. M.; Mazaris, G. A.; Weizer, V. G.

1979-01-01

Mechanisms limiting the open-circuit voltage in 0.1 ohm-cm solar cells were investigated. It was found that a rather complicated multistep diffusion process could produce cells with significantly improved voltages. The voltage capabilities of various laboratory cells were compared independent of their absorption and collection efficiencies. This was accomplished by comparing the cells on the basis of their saturation currents or, equivalently, comparing their voltage outputs at a constant current-density level. The results show that for both the Lewis diffused emitter cell and the Spire ion-implanted emitter cell the base component of the saturation current is voltage controlling. The evidence for the University of Florida cells, although not very conclusive, suggests emitter control of the voltage in this device. The data suggest further that the critical voltage-limiting parameter for the Lewis cell is the electron mobility in the cell base.

Production of atmospheric-pressure glow discharge in nitrogen using needle-array electrode

NASA Astrophysics Data System (ADS)

Takaki, K.; Hosokawa, M.; Sasaki, T.; Mukaigawa, S.; Fujiwara, T.

2005-04-01

An atmospheric pressure glow discharge was generated using a needle-array electrode in nitrogen, and the voltage-current characteristics of the glow discharge were obtained in a range from 1 mA to 60 A. A pulsed high voltage with short rise time under 10 ns was employed to generate streamer discharges simultaneously at all needle tips. The large number of streamer discharges prevented the glow-to-arc transition caused by inhomogeneous thermalization. Semiconductor opening switch diodes were employed as an opening switch to shorten the rise time. The glow voltage was almost constant until the discharge current became 0.3 A, whereas the voltage increased with the current higher than 0.3 A. Electron density and temperature in a positive column of the glow discharge at 60 A were obtained to 1.4×1012cm-3 and 1.3 eV from calculation based on nitrogen swarm data.

Perspective: Machine learning potentials for atomistic simulations

NASA Astrophysics Data System (ADS)

Behler, Jörg

2016-11-01

Nowadays, computer simulations have become a standard tool in essentially all fields of chemistry, condensed matter physics, and materials science. In order to keep up with state-of-the-art experiments and the ever growing complexity of the investigated problems, there is a constantly increasing need for simulations of more realistic, i.e., larger, model systems with improved accuracy. In many cases, the availability of sufficiently efficient interatomic potentials providing reliable energies and forces has become a serious bottleneck for performing these simulations. To address this problem, currently a paradigm change is taking place in the development of interatomic potentials. Since the early days of computer simulations simplified potentials have been derived using physical approximations whenever the direct application of electronic structure methods has been too demanding. Recent advances in machine learning (ML) now offer an alternative approach for the representation of potential-energy surfaces by fitting large data sets from electronic structure calculations. In this perspective, the central ideas underlying these ML potentials, solved problems and remaining challenges are reviewed along with a discussion of their current applicability and limitations.

Ultraflat Au nanoplates as a new building block for molecular electronics.

PubMed

Jeong, Wooseok; Lee, Miyeon; Lee, Hyunsoo; Lee, Hyoban; Kim, Bongsoo; Park, Jeong Young

2016-05-27

We demonstrate the charge transport properties of a self-assembled organic monolayer on Au nanoplates with conductive probe atomic force microscopy (CP-AFM). Atomically flat Au nanoplates, a few hundred micrometers on each side, that have only (111) surfaces, were synthesized using the chemical vapor transport method; these nanoplates were employed as the substrates for hexadecanethiol (HDT) self-assembled monolayers (SAMs). Atomic-scale high-resolution images show (√3 x √3) R30° molecular periodicity, indicating a well-ordered structure of the HDT on the Au nanoplates. We observed reduced friction and adhesion forces on the HDT SAMs on Au nanoplates, compared with Si substrates, which is consistent with the lubricating nature of HDT SAMs. The electrical properties, such as I-V characteristics and current as a function of load, were measured using CP-AFM. We obtained a tunneling decay constant (β) of 0.57 Å(-1), including through-bond (βtb = 0.99 Å(-1)) and through-space (βts = 1.36 Å(-1)) decay constants for the two-pathway model. This indicates that the charge transport properties of HDT SAMs on Au nanoplates are consistent with those on a Au (111) film, suggesting that SAMs on nanoplates can provide a new building block for molecular electronics.

Electrical and band structural analyses of Ti1-x Al x O y films grown by atomic layer deposition on p-type GaAs

NASA Astrophysics Data System (ADS)

An, Youngseo; Mahata, Chandreswar; Lee, Changmin; Choi, Sungho; Byun, Young-Chul; Kang, Yu-Seon; Lee, Taeyoon; Kim, Jiyoung; Cho, Mann-Ho; Kim, Hyoungsub

2015-10-01

Amorphous Ti1-x Al x O y films in the Ti-oxide-rich regime (x  <  0.5) were deposited on p-type GaAs via atomic layer deposition with titanium isopropoxide, trimethylaluminum, and H2O precursor chemistry. The electrical properties and energy band alignments were examined for the resulting materials with their underlying substrates, and significant frequency dispersion was observed in the accumulation region of the Ti-oxide-rich Ti1-x Al x O y films. Although a further reduction in the frequency dispersion and leakage current (under gate electron injection) could be somewhat achieved through a greater addition of Al-oxide in the Ti1-x Al x O y film, the simultaneous decrease in the dielectric constant proved problematic in finding an optimal composition for application as a gate dielectric on GaAs. The spectroscopic band alignment measurements of the Ti-oxide-rich Ti1-x Al x O y films indicated that the band gaps had a rather slow increase with the addition of Al-oxide, which was primarily compensated for by an increase in the valance band offset, while a nearly-constant conduction band offset with a negative electron barrier height was maintained.

Insights on dramatic radial fluctuations in track formation by energetic ions

DOE PAGES

Sachan, Ritesh; Lang, Maik; Trautmann, Christina; ...

2016-06-02

We discuss the insights on the unexpected dramatic radial variations in the ion tracks formed by energetic ion (2.3 GeV 208Pb) irradiation at a constant electronic energy-loss (~42 keV/nm) in pyrochlore structured Gd 2TiZrO 7. Though previous studies have shown track formation and average track diameter measurements, this work brings further clarity on why quantitative analysis of ion track formation in Gd 2Ti xZr (1-x)O 7 systems can be more complicated than the currently accepted behavior for ion tracks. The ion track profile is usually considered to be diametrically uniform at constant values of the electronic energy-loss. This study showsmore » the diameter variations to be as large as ~40% within an extremely short incremental track length of ~20 nm. Our molecular dynamics simulations show that these fluctuations in diameter of amorphous core and overall track diameter are attributed to (i) the stochastic nature of inelastic energy loss along the track and (ii) the random substitution of Ti atoms by Zr atoms on the B-site in the pyrochlore lattice. Furthermore, the partial substitution of Ti by Zr increases the favorability of the defect-fluorite structure formation over amorphous phase stochastically, by introducing localized inhomogeneity in atomic structure, density and strain.« less

Insights on dramatic radial fluctuations in track formation by energetic ions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sachan, Ritesh; Lang, Maik; Trautmann, Christina

We discuss the insights on the unexpected dramatic radial variations in the ion tracks formed by energetic ion (2.3 GeV 208Pb) irradiation at a constant electronic energy-loss (~42 keV/nm) in pyrochlore structured Gd 2TiZrO 7. Though previous studies have shown track formation and average track diameter measurements, this work brings further clarity on why quantitative analysis of ion track formation in Gd 2Ti xZr (1-x)O 7 systems can be more complicated than the currently accepted behavior for ion tracks. The ion track profile is usually considered to be diametrically uniform at constant values of the electronic energy-loss. This study showsmore » the diameter variations to be as large as ~40% within an extremely short incremental track length of ~20 nm. Our molecular dynamics simulations show that these fluctuations in diameter of amorphous core and overall track diameter are attributed to (i) the stochastic nature of inelastic energy loss along the track and (ii) the random substitution of Ti atoms by Zr atoms on the B-site in the pyrochlore lattice. Furthermore, the partial substitution of Ti by Zr increases the favorability of the defect-fluorite structure formation over amorphous phase stochastically, by introducing localized inhomogeneity in atomic structure, density and strain.« less

Graphene bolometer with thermoelectric readout and capacitive coupling to an antenna

NASA Astrophysics Data System (ADS)

Skoblin, Grigory; Sun, Jie; Yurgens, August

2018-02-01

We report on a prototype graphene radiation detector based on the thermoelectric effect. We used a split top gate to create a p-n junction in the graphene, thereby making an effective thermocouple to read out the electronic temperature in the graphene. The electronic temperature is increased due to the AC currents induced in the graphene from the incoming radiation, which is first received by an antenna and then directed to the graphene via the top-gate capacitance. With the exception of the constant DC voltages applied to the gate, the detector does not need any bias and is therefore very simple to use. The measurements showed a clear response to microwaves at 94 GHz with the signal being almost temperature independent in the 4-100 K temperature range. The optical responsivity reached ˜700 V/W.

Spin manipulation and spin-lattice interaction in magnetic colloidal quantum dots

NASA Astrophysics Data System (ADS)

Moro, Fabrizio; Turyanska, Lyudmila; Granwehr, Josef; Patanè, Amalia

2014-11-01

We report on the spin-lattice interaction and coherent manipulation of electron spins in Mn-doped colloidal PbS quantum dots (QDs) by electron spin resonance. We show that the phase memory time,TM , is limited by Mn-Mn dipolar interactions, hyperfine interactions of the protons (1H) on the QD capping ligands with Mn ions in their proximity (<1 nm), and surface phonons originating from thermal fluctuations of the capping ligands. In the low Mn concentration limit and at low temperature, we achieve a long phase memory time constant TM˜0.9 μ s , thus enabling the observation of Rabi oscillations. Our findings suggest routes to the rational design of magnetic colloidal QDs with phase memory times exceeding the current limits of relevance for the implementation of QDs as qubits in quantum information processing.

Lanthanum Gadolinium Oxide: A New Electronic Device Material for CMOS Logic and Memory Devices

PubMed Central

Pavunny, Shojan P.; Scott, James F.; Katiyar, Ram S.

2014-01-01

A comprehensive study on the ternary dielectric, LaGdO3, synthesized and qualified in our laboratory as a novel high-k dielectric material for logic and memory device applications in terms of its excellent features that include a high linear dielectric constant (k) of ~22 and a large energy bandgap of ~5.6 eV, resulting in sufficient electron and hole band offsets of ~2.57 eV and ~1.91 eV, respectively, on silicon, good thermal stability with Si and lower gate leakage current densities within the International Technology Roadmap for Semiconductors (ITRS) specified limits at the sub-nanometer electrical functional thickness level, which are desirable for advanced complementary metal-oxide-semiconductor (CMOS), bipolar (Bi) and BiCMOS chips applications, is presented in this review article. PMID:28788589

Equivalent Electromagnetic Constants for Microwave Application to Composite Materials for the Multi-Scale Problem

PubMed Central

Fujisaki, Keisuke; Ikeda, Tomoyuki

2013-01-01

To connect different scale models in the multi-scale problem of microwave use, equivalent material constants were researched numerically by a three-dimensional electromagnetic field, taking into account eddy current and displacement current. A volume averaged method and a standing wave method were used to introduce the equivalent material constants; water particles and aluminum particles are used as composite materials. Consumed electrical power is used for the evaluation. Water particles have the same equivalent material constants for both methods; the same electrical power is obtained for both the precise model (micro-model) and the homogeneous model (macro-model). However, aluminum particles have dissimilar equivalent material constants for both methods; different electric power is obtained for both models. The varying electromagnetic phenomena are derived from the expression of eddy current. For small electrical conductivity such as water, the macro-current which flows in the macro-model and the micro-current which flows in the micro-model express the same electromagnetic phenomena. However, for large electrical conductivity such as aluminum, the macro-current and micro-current express different electromagnetic phenomena. The eddy current which is observed in the micro-model is not expressed by the macro-model. Therefore, the equivalent material constant derived from the volume averaged method and the standing wave method is applicable to water with a small electrical conductivity, although not applicable to aluminum with a large electrical conductivity. PMID:28788395

A novel electro-driven membrane for removal of chromium ions using polymer inclusion membrane under constant D.C. electric current.

PubMed

Kaya, Ahmet; Onac, Canan; Alpoguz, H Korkmaz

2016-11-05

In this study, the use of polymer inclusion membrane under constant electric current for the removal of Cr(VI) from water has investigated for the first time. Transport of Cr(VI) is performed by an electric current from the donor phase to the acceptor phase with a constant electric current of 0.5A. The optimized membrane includes of 12.1% 2-nitrophenyl octyl ether (2-NPOE), 77.6% cellulose triacetate (CTA), 10.3% tricapryl-methylammonium chloride (Aliquat 336) as a carrier. We tested the applicability of the selected membrane for Cr(VI) removal in real environmental water samples and evaluated its reusability. Electro membrane experiments were carried out under various parameters, such as the effect of electro membrane voltage at constant DC electric current; electro membrane current at constant voltage, acceptor phase pH, and stable electro membrane; and a comparison of polymer inclusion membrane and electro membrane transport studies. The Cr(VI) transport was achieved 98.33% after 40min under optimized conditions. An alternative method has been employed that eliminates the changing of electrical current by the application of constant electric current for higher reproducibility of electro membrane extraction experiments by combining the excellent selective and long-term use features of polymer inclusion membrane. Copyright © 2016 Elsevier B.V. All rights reserved.

Coupling time constants of striated and copper-plated coated conductors and the potential of striation to reduce shielding-current-induced fields in pancake coils

NASA Astrophysics Data System (ADS)

Amemiya, Naoyuki; Tominaga, Naoki; Toyomoto, Ryuki; Nishimoto, Takuma; Sogabe, Yusuke; Yamano, Satoshi; Sakamoto, Hisaki

2018-07-01

The shielding-current-induced field is a serious concern for the applications of coated conductors to magnets. The striation of the coated conductor is one of the countermeasures, but it is effective only after the decay of the coupling current, which is characterised with the coupling time constant. In a non-twisted striated coated conductor, the coupling time constant is determined primarily by its length and the transverse resistance between superconductor filaments, because the coupling current could flow along its entire length. We measured and numerically calculated the frequency dependences of magnetisation losses in striated and copper-plated coated conductors with various lengths and their stacks at 77 K and determined their coupling time constants. Stacked conductors simulate the turns of a conductor wound into a pancake coil. Coupling time constants are proportional to the square of the conductor length. Stacking striated coated conductors increases the coupling time constants because the coupling currents in stacked conductors are coupled to one another magnetically to increase the mutual inductances for the coupling current paths. We carried out the numerical electromagnetic field analysis of conductors wound into pancake coils and determined their coupling time constants. They can be explained by the length dependence and mutual coupling effect observed in stacked straight conductors. Even in pancake coils with practical numbers of turns, i.e. conductor lengths, the striation is effective to reduce the shielding-current-induced fields for some dc applications.

Nonadiabatic effects on the charge transfer rate constant: A numerical study of a simple model system

NASA Astrophysics Data System (ADS)

Shin, Seokmin; Metiu, Horia

1995-06-01

We use a minimal model to study the effects of the upper electronic states on the rate of a charge transfer reaction. The model consists of three ions and an electron, all strung on a line. The two ions at the ends of the structure are held fixed, but the middle ion and the electron are allowed to move in one dimension, along the line joining them. The system has two bound states, one in which the electron ties the movable ion to the fixed ion at the left, and the other in which the binding takes place to the fixed ion at the right. The transition between these bound states is a charge transfer reaction. We use the flux-flux correlation function theory to perform two calculations of the rate constant for this reaction. In one we obtain numerically the exact rate constant. In the other we calculate the exact rate constant for the case when the reaction proceeds exclusively on the ground adiabatic state. The difference between these calculations gives the magnitude of the nonadiabatic effects. We find that the nonadiabatic effects are fairly large even when the gap between the ground and the excited adiabatic state substantially exceeds the thermal energy. The rate in the nonadiabatic theory is always smaller than that of the adiabatic one. Both rate constants satisfy the Arrhenius formula. Their activation energies are very close but the nonadiabatic one is always higher. The nonadiabatic preexponential is smaller, due to the fact that the upper electronic state causes an early recrossing of the reactive flux. The description of this reaction in terms of two diabatic states, one for reactants and one for products, is not always adequate. In the limit when nonadiabaticity is small, we need to use a third diabatic state, in which the electron binds to the moving ion as the latter passes through the transition state; this is an atom transfer process. The reaction changes from an atom transfer to an electron transfer, as nonadiabaticity is increased.

Organic solar cells based on high dielectric constant materials: An approach to increase efficiency

NASA Astrophysics Data System (ADS)

Hamam, Khalil Jumah Tawfiq

The efficiency of organic solar cells still lags behind inorganic solar cells due to their low dielectric constant which results in a weakly screened columbic attraction between the photogenerated electron-hole system, therefore the probability of charge separating is low. Having an organic material with a high dielectric constant could be the solution to get separated charges or at least weakly bounded electron-hole pairs. Therefore, high dielectric constant materials have been investigated and studied by measuring modified metal-phthalocyanine (MePc) and polyaniline in pellets and thin films. The dielectric constant was investigated as a function of temperature and frequency in the range of 20Hz to1MHz. For MePc we found that the high dielectric constant was an extrinsic property due to water absorption and the formation of hydronuim ion allowed by the ionization of the functional groups such as sulphonated and carboxylic groups. The dielectric constant was high at low frequencies and decreasing as the frequency increase. Investigated materials were applied in fabricated bilayer heterojunction organic solar cells. The application of these materials in an organic solar cells show a significant stability under room conditions rather than improvement in their efficiency.

Multi-wavelength spectrophotometric determination of acidity constant of some newly synthesized Schiff bases and their QSPR study

NASA Astrophysics Data System (ADS)

Hemmateenejad, Bahram; Emami, Leila; Sharghi, Hashem

2010-01-01

The acidity constants of some newly synthesized Schiff base derivatives were determined by hard-model based multivariate data analysis of the spectrophotometric data in the course of pH-metric titration in 50% (v/v) methanol-water binary solvent. The employed data analysis method was also able to extract the pure spectra and pH-dependent concentration profiles of the acid-base species. The molecules that possess different substituents (both electron donating and withdrawing) on the ortho-, meta- and para-positions of one of the phenyl ring showed variable acidity constants ranging from 8.77 to 11.07 whereas the parent molecule had an acidity constant of 10.25. To investigate the quantitative effects of changing of substitution pattern on the acidity constant, a quantitative structure-property relation analysis was conducted using substituent constants and molecular descriptor. Some models with high statistical quality (measured by cross-validation Q2) were obtained. It was found that the acidity constant of the studied molecules in the methanol-water mixed solvent not only is affected by electronic features of the solutes but also by the lipophilic interaction between methanol part of solvent and the deprotonated solutes.

Hammett analyses of halocarbene-halocarbanion equilibria.

PubMed

Wang, Lei; Moss, Robert A; Krogh-Jespersen, Karsten

2013-04-19

Substituted arylchlorocarbenes (X = H, p-Cl, p-CF3, p-F, m-Cl) reacted reversibly with Cl(-) in dichloroethane to form the corresponding aryldichloromethide carbanions. Equilibrium constants and rate constants for the forward and reverse reactions were correlated by the Hammett equation. DFT methods were used to compute equilibrium constants and electronic absorption spectra.

Ab initio calculations of the electronic structure of the low-lying states for the ultracold LiYb molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tohme, Samir N.; Korek, Mahmoud, E-mail: mahmoud.korek@bau.edu.lb, E-mail: fkorek@yahoo.com; Awad, Ramadan

Ab initio techniques have been applied to investigate the electronic structure of the LiYb molecule. The potential energy curves have been computed in the Born–Oppenheimer approximation for the ground and 29 low-lying doublet and quartet excited electronic states. Complete active space self-consistent field, multi-reference configuration interaction, and Rayleigh Schrödinger perturbation theory to second order calculations have been utilized to investigate these states. The spectroscopic constants, ω{sub e}, R{sub e}, B{sub e}, …, and the static dipole moment, μ, have been investigated by using the two different techniques of calculation with five different types of basis. The eigenvalues, E{sub v}, themore » rotational constant, B{sub v}, the centrifugal distortion constant, D{sub v}, and the abscissas of the turning points, R{sub min} and R{sub max}, have been calculated by using the canonical functions approach. The comparison between the values of the present work, calculated by different techniques, and those available in the literature for several electronic states shows a very good agreement. Twenty-one new electronic states have been studied here for the first time.« less

Nonlocal electron-phonon coupling in the pentacene crystal: Beyond the Γ-point approximation

NASA Astrophysics Data System (ADS)

Yi, Yuanping; Coropceanu, Veaceslav; Brédas, Jean-Luc

2012-10-01

There is currently increasing interest in understanding the impact of the nonlocal (Peierls-type) electron-phonon mechanism on charge transport in organic molecular semiconductors. Most estimates of the non-local coupling constants reported in the literature are based on the Γ-point phonon modes. Here, the influence of phonon modes spanning the entire Brillouin zone (phonon dispersion) on the nonlocal electron-phonon couplings is investigated for the pentacene crystal. The phonon modes are obtained by using a supercell approach. The results underline that the overall nonlocal couplings are substantially underestimated by calculations taking sole account of the phonons at the Γ point of the unit cell. The variance of the transfer integrals based on Γ-point normal-mode calculations at room temperature is underestimated in some cases by 40% for herringbone-type dimers and by over 80% for cofacial dimers. Our calculations show that the overall coupling is somewhat larger for holes than for electrons. The results also suggest that the interactions of charge carriers (both electrons and holes) with acoustic and optical phonons are comparable. Therefore, an adequate description of the charge-transport properties in pentacene and similar systems requires that these two electron-phonon coupling mechanisms be treated on the same footing.

Long-Term Efficacy of Constant Current Deep Brain Stimulation in Essential Tremor.

PubMed

Rezaei Haddad, Ali; Samuel, Michael; Hulse, Natasha; Lin, Hsin-Ying; Ashkan, Keyoumars

2017-07-01

Ventralis intermedius deep brain stimulation is an established intervention for medication-refractory essential tremor. Newer constant current stimulation technology offers theoretical advantage over the traditional constant voltage systems in terms of delivering a more biologically stable therapy. There are no previous reports on the outcomes of constant current deep brain stimulation in the treatment of essential tremor. This study aimed to evaluate the long-term efficacy of ventralis intermedius constant current deep brain stimulation in patients diagnosed with essential tremor. Essential tremor patients implanted with constant current deep brain stimulation for a minimum of three years were evaluated. Clinical outcomes were assessed using the Fahn-Tolosa-Marin tremor rating scale at baseline and postoperatively at the time of evaluation. The quality of life in the patients was assessed using the Quality of Life in Essential Tremor questionnaire. Ten patients were evaluated with a median age at evaluation of 74 years (range 66-79) and a mean follow up time of 49.7 (range 36-78) months since starting stimulation. Constant current ventralis intermedius deep brain stimulation was well tolerated and effective in all patients with a mean score improvement from 50.7 ± 5.9 to 17.4 ± 5.7 (p = 0.0020) in the total Fahn-Tolosa-Marin rating scale score (65.6%). Furthermore, the total combined mean Quality of Life in Essential Tremor score was improved from 56.2 ± 4.9 to 16.8 ± 3.5 (p value = 0.0059) (70.1%). This report shows that long-term constant current ventralis intermedius deep brain stimulation is a safe and effective intervention for essential tremor patients. © 2017 International Neuromodulation Society.

Bolometric detector systems for IR and mm-wave space astronomy

NASA Technical Reports Server (NTRS)

Church, S. E.; Lange, A. E.; Mauskopf, P. D.; Hristov, V.; Bock, J. J.; DelCastillo, H. M.; Beeman, J.; Ade, P. A. R.; Griffin, M. J.

1996-01-01

Recent developments in bolometric detector systems for millimeter and submillimeter wave space astronomy are described. Current technologies meet all the requirements for the high frequency instrument onboard the cosmic background radiation anisotropy satellite/satellite for the measurement of background anisotropies (COBRAS/SAMBA) platform. It is considered that the technologies that are currently being developed will significantly reduce the effective time constant and/or the cooling requirements of bolometric detectors. These technologies lend themselves to the fabrication of the large format arrays required for the Far Infrared and Submillimeter Space Telescope (FIRST). The scientific goals and detector requirements of the COBRAS/SAMBA platform that will use infrared bolometers are reviewed and the baseline detector system is described, including the feed optics, the infrared filters, the cold amplifiers and the warm readout electronics.

Magnetic shielding investigation for a 6 MV in-line linac within the parallel configuration of a linac-MR system.

PubMed

Santos, D M; St Aubin, J; Fallone, B G; Steciw, S

2012-02-01

In our current linac-magnetic resonance (MR) design, a 6 MV in-line linac is placed along the central axis of the MR's magnet where the MR's fringe magnetic fields are parallel to the overall electron trajectories in the linac waveguide. Our previous study of this configuration comprising a linac-MR SAD of 100 cm and a 0.5 T superconducting (open, split) MR imager. It showed the presence of longitudinal magnetic fields of 0.011 T at the electron gun, which caused a reduction in target current to 84% of nominal. In this study, passive and active magnetic shielding was investigated to recover the linac output losses caused by magnetic deflections of electron trajectories in the linac within a parallel linac-MR configuration. Magnetic materials and complex shield structures were used in a 3D finite element method (FEM) magnetic field model, which emulated the fringe magnetic fields of the MR imagers. The effects of passive magnetic shielding was studied by surrounding the electron gun and its casing with a series of capped steel cylinders of various inner lengths (26.5-306.5 mm) and thicknesses (0.75-15 mm) in the presence of the fringe magnetic fields from a commercial MR imager. In addition, the effects of a shield of fixed length (146.5 mm) with varying thicknesses were studied against a series of larger homogeneous magnetic fields (0-0.2 T). The effects of active magnetic shielding were studied by adding current loops around the electron gun and its casing. The loop currents, separation, and location were optimized to minimize the 0.011 T longitudinal magnetic fields in the electron gun. The magnetic field solutions from the FEM model were added to a validated linac simulation, consisting of a 3D electron gun (using OPERA-3d/scala) and 3D waveguide (using comsol Multiphysics and PARMELA) simulations. PARMELA's target current and output phase-space were analyzed to study the linac's output performance within the magnetic shields. The FEM model above agreed within 1.5% with the manufacturer supplied fringe magnetic field isoline data. When passive magnetic shields are used, the target current is recoverable to greater than 99% of nominal for shield thicknesses greater than 0.75 mm. The optimized active shield which resulted in 100% target current recovery consists of two thin current rings 110 mm in diameter with 625 and 430 A-turns in each ring. With the length of the passive shield kept constant, the thickness of the shield had to be increased to achieve the same target current within the increased longitudinal magnetic fields. A ≥99% original target current is recovered with passive shield thicknesses >0.75 mm. An active shield consisting of two current rings of diameter of 110 mm with 625 and 430 A-turns fully recovers the loss that would have been caused by the magnetic fields. The minimal passive or active shielding requirements to essentially fully recover the current output of the linac in our parallel-configured linac-MR system have been determined and are easily achieved for practical implementation of the system.

Quantitative study of interactions between oxygen lone pair and aromatic rings: substituent effect and the importance of closeness of contact.

PubMed

Gung, Benjamin W; Zou, Yan; Xu, Zhigang; Amicangelo, Jay C; Irwin, Daniel G; Ma, Shengqian; Zhou, Hong-Cai

2008-01-18

Current models describe aromatic rings as polar groups based on the fact that benzene and hexafluorobenzene are known to have large and permanent quadrupole moments. This report describes a quantitative study of the interactions between oxygen lone pair and aromatic rings. We found that even electron-rich aromatic rings and oxygen lone pairs exhibit attractive interactions. Free energies of interactions are determined using the triptycene scaffold and the equilibrium constants were determined by low-temperature 1H NMR spectroscopy. An X-ray structure analysis for one of the model compounds confirms the close proximity between the oxygen and the center of the aromatic ring. Theoretical calculations at the MP2/aug-cc-pVTZ level corroborate the experimental results. The origin of attractive interactions was explored by using aromatic rings with a wide range of substituents. The interactions between an oxygen lone pair and an aromatic ring are attractive at van der Waals' distance even with electron-donating substituents. Electron-withdrawing groups increase the strength of the attractive interactions. The results from this study can be only partly rationalized by using the current models of aromatic system. Electrostatic-based models are consistent with the fact that stronger electron-withdrawing groups lead to stronger attractions, but fail to predict or rationalize the fact that weak attractions even exist between electron-rich arenes and oxygen lone pairs. The conclusion from this study is that aromatic rings cannot be treated as a simple quadrupolar functional group at van der Waals' distance. Dispersion forces and local dipole should also be considered.

Structural stability, mechanical properties, electronic structures and thermal properties of XS (X = Ti, V, Cr, Mn, Fe, Co, Ni) binary compounds

NASA Astrophysics Data System (ADS)

Liu, Yangzhen; Xing, Jiandong; Fu, Hanguang; Li, Yefei; Sun, Liang; Lv, Zheng

2017-08-01

The properties of sulfides are important in the design of new iron-steel materials. In this study, first-principles calculations were used to estimate the structural stability, mechanical properties, electronic structures and thermal properties of XS (X = Ti, V, Cr, Mn, Fe, Co, Ni) binary compounds. The results reveal that these XS binary compounds are thermodynamically stable, because their formation enthalpy is negative. The elastic constants, Cij, and moduli (B, G, E) were investigated using stress-strain and Voigt-Reuss-Hill approximation, respectively. The sulfide anisotropy was discussed from an anisotropic index and three-dimensional surface contours. The electronic structures reveal that the bonding characteristics of the XS compounds are a mixture of metallic and covalent bonds. Using a quasi-harmonic Debye approximation, the heat capacity at constant pressure and constant volume was estimated. NiS possesses the largest CP and CV of the sulfides.

The Pressure Dependence of Structural, Electronic, Mechanical, Vibrational, and Thermodynamic Properties of Palladium-Based Heusler Alloys

NASA Astrophysics Data System (ADS)

Çoban, Cansu

2017-08-01

The pressure dependent behaviour of the structural, electronic, mechanical, vibrational, and thermodynamic properties of Pd2TiX (X=Ga, In) Heusler alloys was investigated by ab initio calculations. The lattice constant, the bulk modulus and its first pressure derivative, the electronic band structure and the density of states (DOS), mechanical properties such as elastic constants, anisotropy factor, Young's modulus, etc., the phonon dispersion curves and phonon DOS, entropy, heat capacity, and free energy were obtained under pressure. It was determined that the calculated lattice parameters are in good agreement with the literature, the elastic constants obey the stability criterion, and the phonon dispersion curves have no negative frequency which shows that the compounds are stable. The band structures at 0, 50, and 70 GPa showed valence instability at the L point which explains the superconductivity in Pd2TiX (X=Ga, In).

Inner reorganization limiting electron transfer controlled hydrogen bonding: intra- vs. intermolecular effects.

PubMed

Martínez-González, Eduardo; Frontana, Carlos

2014-05-07

In this work, experimental evidence of the influence of the electron transfer kinetics during electron transfer controlled hydrogen bonding between anion radicals of metronidazole and ornidazole, derivatives of 5-nitro-imidazole, and 1,3-diethylurea as the hydrogen bond donor, is presented. Analysis of the variations of voltammetric EpIcvs. log KB[DH], where KB is the binding constant, allowed us to determine the values of the binding constant and also the electron transfer rate k, confirmed by experiments obtained at different scan rates. Electronic structure calculations at the BHandHLYP/6-311++G(2d,2p) level for metronidazole, including the solvent effect by the Cramer/Truhlar model, suggested that the minimum energy conformer is stabilized by intramolecular hydrogen bonding. In this structure, the inner reorganization energy, λi,j, contributes significantly (0.5 eV) to the total reorganization energy of electron transfer, thus leading to a diminishment of the experimental k.

8 MeV electron beam induced modifications in the thermal, structural and electrical properties of nanophase CeO2 for potential electronics applications

NASA Astrophysics Data System (ADS)

Babitha, K. K.; Sreedevi, A.; Priyanka, K. P.; Ganesh, S.; Varghese, Thomas

2018-06-01

The effect of 8 MeV electron beam irradiation on the thermal, structural and electrical properties of CeO2 nanoparticles synthesized by chemical precipitation route was investigated. The dose dependent effect of electron irradiation was studied using various characterization techniques such as, thermogravimetric and differential thermal analyses, X-ray diffraction, Fourier transformed infrared spectroscopy and impedance spectroscopy. Systematic investigation based on the results of structural studies confirm that electron beam irradiation induces defects and particle size variation on CeO2 nanoparticles, which in turn results improvements in AC conductivity, dielectric constant and loss tangent. Structural modifications and high value of dielectric constant for CeO2 nanoparticles due to electron beam irradiation make it as a promising material for the fabrication of gate dielectric in metal oxide semiconductor devices.

Charge Characteristics of Rechargeable Batteries

NASA Astrophysics Data System (ADS)

Maheswaranathan, Ponn; Kelly, Cormac

2014-03-01

Rechargeable batteries play important role in technologies today and they are critical for the future. They are used in many electronic devices and their capabilities need to keep up with the accelerated pace of technology. Efficient energy capture and storage is necessary for the future rechargeable batteries. Charging and discharging characteristics of three popular commercially available re-chargeable batteries (NiCd, NiMH, and Li Ion) are investigated and compared with regular alkaline batteries. Pasco's 850 interface and their voltage & current sensors are used to monitor the current through and the potential difference across the battery. The discharge current and voltage stayed fairly constant until the end, with a slightly larger drop in voltage than current, which is more pronounced in the alkaline batteries. After 25 charge/discharge cycling there is no appreciable loss of charge capacities in the Li Ion battery. Energy densities, cycle characteristics, and memory effects will also be presented. Sponsored by the South Carolina Governor's school for Science and Mathematics under the Summer Program for Research Interns program.

Ultrafast current imaging by Bayesian inversion

DOE Data Explorer

Somnath, Suhas; Law, Kody J. H.; Morozovska, Anna; Maksymovych, Petro; Kim, Yunseok; Lu, Xiaoli; Alexe, Marin; Archibald, Richard K; Kalinin, Sergei V; Jesse, Stephen; Vasudevan, Rama K

2016-01-01

Spectroscopic measurements of current-voltage curves in scanning probe microscopy is the earliest and one of the most common methods for characterizing local energy-dependent electronic properties, providing insight into superconductive, semiconductor, and memristive behaviors. However, the quasistatic nature of these measurements renders them extremely slow. Here, we demonstrate a fundamentally new approach for dynamic spectroscopic current imaging via full information capture and Bayesian inference analysis. This "general-mode I-V"method allows three orders of magnitude faster rates than presently possible. The technique is demonstrated by acquiring I-V curves in ferroelectric nanocapacitors, yielding >100,000 I-V curves in <20 minutes. This allows detection of switching currents in the nanoscale capacitors, as well as determination of dielectric constant. These experiments show the potential for the use of full information capture and Bayesian inference towards extracting physics from rapid I-V measurements, and can be used for transport measurements in both atomic force and scanning tunneling microscopy. The data was analyzed using pycroscopy - an open-source python package available at https://github.com/pycroscopy/pycroscopy

Synthesis of zirconium oxynitride in air under DC electric fields

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morisaki, Nobuhiro; Tokunaga, Tomoharu; Sasaki, Katsuhiro

We synthesized zirconium oxynitride from yttria-stabilized zirconia (YSZ) in air by applying DC electric fields that produced a controlled electric current in the specimen. When YSZ was heated under an applied DC electric field, the electric current of the specimen steeply increased at a critical temperature, called a flash event, during flash sintering. By keeping the electric current of the specimen constant during the flash event and then holding the specimen at the critical temperature, YSZ was transformed into zirconium oxynitride under the optimal conditions of 50 V/cm, 500 mA, and 1000 °C. We confirmed that zirconium oxynitride formed using high-resolution transmission electronmore » microscopy, electron energy-loss spectroscopy, and energy-dispersive spectrometry. To convert oxides to nitrides, reducing conditions are necessary to form excess oxygen vacancies. Our technique produced the strong reducing conditions necessary to form nitrides from the oxides by delivering a controlled electric current to the specimen.« less

Photon-induced tunability of the thermospin current in a Rashba ring

NASA Astrophysics Data System (ADS)

Abdullah, Nzar Rauf; Arnold, Thorsten; Tang, Chi-Shung; Manolescu, Andrei; Gudmundsson, Vidar

2018-04-01

The goal of this work is to show how the thermospin polarization current in a quantum ring changes in the presence of Rashba spin-orbit coupling and a quantized single photon mode of a cavity the ring is placed in. Employing the reduced density operator and a general master equation formalism, we find that both the Rashba interaction and the photon field can significantly modulate the spin polarization and the thermospin polarization current. Tuning the Rashba coupling constant, degenerate energy levels are formed corresponding to the Aharonov-Casher destructive phase interference in the quantum ring system. Our analysis indicates that the maximum spin polarization can be observed at the points of degenerate energy levels due to spin accumulation in the system without the photon field. The thermospin current is thus suppressed. In the presence of the cavity, the photon field leads to an additional kinetic momentum of the electron. As a result the spin polarization can be enhanced by the photon field.

Ultra High Strain Rate Nanoindentation Testing.

PubMed

Sudharshan Phani, Pardhasaradhi; Oliver, Warren Carl

2017-06-17

Strain rate dependence of indentation hardness has been widely used to study time-dependent plasticity. However, the currently available techniques limit the range of strain rates that can be achieved during indentation testing. Recent advances in electronics have enabled nanomechanical measurements with very low noise levels (sub nanometer) at fast time constants (20 µs) and high data acquisition rates (100 KHz). These capabilities open the doors for a wide range of ultra-fast nanomechanical testing, for instance, indentation testing at very high strain rates. With an accurate dynamic model and an instrument with fast time constants, step load tests can be performed which enable access to indentation strain rates approaching ballistic levels (i.e., 4000 1/s). A novel indentation based testing technique involving a combination of step load and constant load and hold tests that enables measurement of strain rate dependence of hardness spanning over seven orders of magnitude in strain rate is presented. A simple analysis is used to calculate the equivalent uniaxial response from indentation data and compared to the conventional uniaxial data for commercial purity aluminum. Excellent agreement is found between the indentation and uniaxial data over several orders of magnitude of strain rate.

QSAR models based on quantum topological molecular similarity.

PubMed

Popelier, P L A; Smith, P J

2006-07-01

A new method called quantum topological molecular similarity (QTMS) was fairly recently proposed [J. Chem. Inf. Comp. Sc., 41, 2001, 764] to construct a variety of medicinal, ecological and physical organic QSAR/QSPRs. QTMS method uses quantum chemical topology (QCT) to define electronic descriptors drawn from modern ab initio wave functions of geometry-optimised molecules. It was shown that the current abundance of computing power can be utilised to inject realistic descriptors into QSAR/QSPRs. In this article we study seven datasets of medicinal interest : the dissociation constants (pK(a)) for a set of substituted imidazolines , the pK(a) of imidazoles , the ability of a set of indole derivatives to displace [(3)H] flunitrazepam from binding to bovine cortical membranes , the influenza inhibition constants for a set of benzimidazoles , the interaction constants for a set of amides and the enzyme liver alcohol dehydrogenase , the natriuretic activity of sulphonamide carbonic anhydrase inhibitors and the toxicity of a series of benzyl alcohols. A partial least square analysis in conjunction with a genetic algorithm delivered excellent models. They are also able to highlight the active site, of the ligand or the molecule whose structure determines the activity. The advantages and limitations of QTMS are discussed.

Ultrafast dynamics of non-equilibrium electrons and strain generation under femtosecond laser irradiation of Nickel

NASA Astrophysics Data System (ADS)

Tsibidis, George D.

2018-04-01

We present a theoretical study of the ultrafast electron dynamics in transition metals of large electron-phonon coupling constant using ultrashort pulsed laser beams. The significant influence of the dynamics of produced nonthermal electrons to electron thermalisation and electron-phonon interaction is thoroughly investigated for various values of the pulse duration (i.e., from 10 fs to 2.3 ps). The model correlates the role of nonthermal electrons, relaxation processes and induced stress-strain fields. Simulations are presented by choosing Nickel (Ni) as a test material to compute electron-phonon relaxation time due to its large electron-phonon coupling constant. We demonstrate that the consideration of the aforementioned factors leads to significant changes compared to the results the traditional two-temperature model provides. The proposed model predicts a substantially ( 33%) smaller damage threshold and a large increase of the stress ( 20%, at early times) which first underlines the role of the nonthermal electron interactions and second enhances its importance with respect to the precise determination of laser specifications in material micromachining techniques.

Advanced tokamak investigations in full-tungsten ASDEX Upgrade

NASA Astrophysics Data System (ADS)

Bock, A.; Doerk, H.; Fischer, R.; Rittich, D.; Stober, J.; Burckhart, A.; Fable, E.; Geiger, B.; Mlynek, A.; Reich, M.; Zohm, H.; ASDEX Upgrade Team

2018-05-01

The appropriate tailoring of the q-profile is the key to accessing Advanced Tokamak (AT) scenarios, which are of great benefit to future all-metal fusion power plants. Such scenarios depend on low collisionality ν* which permits efficient external current drive and high amounts of intrinsic bootstrap current. At constant pressure, lowering of the electron density ne leads to a strong decrease in the collisionality with increasing electron temperature ν* ˜ Te-3 . Simultaneously, the conditions for low ne also benefit impurity accumulation. This paper reports on how radiative collapses due to central W accumulation were overcome by improved understanding of the changes to recycling and pumping, substantially expanded ECRH capacities for both heating and current drive, and a new solid W divertor capable of withstanding the power loads at low ne. Furthermore, it reports on various improvements to the reliability of the q-profile reconstruction. A candidate steady state scenario for ITER/DEMO (q95 = 5.3, βN = 2.7, fbs > 40%) is presented. The ion temperature profiles are steeper than predicted by TGLF, but nonlinear electromagnetic gyro-kinetic analyses with GENE including fast particle effects matched the experimental heat fluxes. A fully non-inductive scenario at higher q95 = 7.1 for current drive model validation is also discussed. The results show that non-inductive operation is principally compatible with full-metal machines.

Implications of Marcus-Hush theory for steady-state heterogeneous electron transfer at an inlaid disk electrode.

PubMed

Feldberg, Stephen W

2010-06-15

For an outer-sphere heterogeneous electron transfer, Ox + e = Red, between an electrode and a redox couple, the Butler-Volmer formalism predicts that the operative heterogeneous rate constant, k(red) (cm s(-1)) for reduction (or k(ox) for oxidation) increases without limit as an exponential function of -alpha (E - E(0)) for reduction (or (1 - alpha)(E - E(0)) for oxidation), where E is the applied electrode potential, alpha (~1/2) is the transfer coefficient and E(0) is the formal potential. The Marcus-Hush formalism, as exposited by Chidsey (Chidsey, C. E. D. Science 1991, 215, 919), predicts that the value of k(red) or k(ox) limits at sufficiently large values of -(E - E(0)) or (E - E(0)). The steady-state currents at an inlaid disk electrode obtained for a redox species in solution were computed using both formalisms with the Oldham-Zoski approximation (Oldham, K. B.; Zoski, C. G. J. Electroanal. Chem. 1988, 256, 11). Significant differences are noted for the two formalisms. When k(0)r(0)/D is sufficiently small (k(0) is the standard rate constant, r(0) is the radius of the disk electrode, and D is the diffusion coefficient of the redox species), the Marcus-Hush formalism effects a limiting current that can be significantly smaller than the mass transport limited current. This is easily explained in terms of the limiting values of k(red) and k(ox) predicted by the Marcus-Hush formalism. The experimental conditions that must be met to effect significant differences in behavior are discussed; experimental conditions that effect virtually identical behavior are also discussed. As a caveat for experimentalists, applications of the Butler-Volmer formalism to systems that are more properly described using the Marcus-Hush formalism are shown to yield incorrect values of k(0) and meaningless values of alpha, which serves only as a fitting parameter.

A maximum power point tracking algorithm for photovoltaic applications

NASA Astrophysics Data System (ADS)

Nelatury, Sudarshan R.; Gray, Robert

2013-05-01

The voltage and current characteristic of a photovoltaic (PV) cell is highly nonlinear and operating a PV cell for maximum power transfer has been a challenge for a long time. Several techniques have been proposed to estimate and track the maximum power point (MPP) in order to improve the overall efficiency of a PV panel. A strategic use of the mean value theorem permits obtaining an analytical expression for a point that lies in a close neighborhood of the true MPP. But hitherto, an exact solution in closed form for the MPP is not published. This problem can be formulated analytically as a constrained optimization, which can be solved using the Lagrange method. This method results in a system of simultaneous nonlinear equations. Solving them directly is quite difficult. However, we can employ a recursive algorithm to yield a reasonably good solution. In graphical terms, suppose the voltage current characteristic and the constant power contours are plotted on the same voltage current plane, the point of tangency between the device characteristic and the constant power contours is the sought for MPP. It is subject to change with the incident irradiation and temperature and hence the algorithm that attempts to maintain the MPP should be adaptive in nature and is supposed to have fast convergence and the least misadjustment. There are two parts in its implementation. First, one needs to estimate the MPP. The second task is to have a DC-DC converter to match the given load to the MPP thus obtained. Availability of power electronics circuits made it possible to design efficient converters. In this paper although we do not show the results from a real circuit, we use MATLAB to obtain the MPP and a buck-boost converter to match the load. Under varying conditions of load resistance and irradiance we demonstrate MPP tracking in case of a commercially available solar panel MSX-60. The power electronics circuit is simulated by PSIM software.

Dielectric constant extraction of graphene nanostructured on SiC substrates from spectroscopy ellipsometry measurement using Gauss–Newton inversion method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maulina, Hervin; Santoso, Iman, E-mail: iman.santoso@ugm.ac.id; Subama, Emmistasega

2016-04-19

The extraction of the dielectric constant of nanostructured graphene on SiC substrates from spectroscopy ellipsometry measurement using the Gauss-Newton inversion (GNI) method has been done. This study aims to calculate the dielectric constant and refractive index of graphene by extracting the value of ψ and Δ from the spectroscopy ellipsometry measurement using GNI method and comparing them with previous result which was extracted using Drude-Lorentz (DL) model. The results show that GNI method can be used to calculate the dielectric constant and refractive index of nanostructured graphene on SiC substratesmore faster as compared to DL model. Moreover, the imaginary partmore » of the dielectric constant values and coefficient of extinction drastically increases at 4.5 eV similar to that of extracted using known DL fitting. The increase is known due to the process of interband transition and the interaction between the electrons and electron-hole at M-points in the Brillouin zone of graphene.« less

Chemical and quantum simulation of electron transfer through a polypeptide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ungar, L.W.; Voth, G.A.; Newton, M.D.

1999-08-26

Quantum rate theory, molecular dynamics simulations, and semiempirical electronic structure calculations are used to fully investigate electron transfer mediated by a solvated polypeptide for the first time. Using a stationary-phase approximation, the nonadiabatic electron-transfer rate constant is calculated from the nuclear free energies and the electronic coupling between the initial and final states. The former are obtained from quantum path integral and classical molecular dynamics simulations; the latter are calculated using semiempirical electronic structure calculations and the generalized Mulliken-Hush method. Importantly, no parameters are fit to kinetic data. The simulated system consists of a solvated four-proline polypeptide with a tris(bipyridine)rutheniummore » donor group and an oxypentamminecobalt acceptor group. From the simulation data entropy and energy contributions to the free energies are distinguished. Quantum suppression of the barrier, including important solvent contributions, is demonstrated. Although free energy profiles along the reaction coordinate are nearly parabolic, pronounced departures from harmonic behavior are found for the separate energy and entropy functions. Harmonic models of the system are compared to simulation results in order to quantify anharmonic effects. Electronic structure calculations show that electronic coupling elements vary considerably with system conformation, even when the effective donor-acceptor separation remains roughly constant. The calculations indicate that electron transfer in a significant range of conformations linking the polypeptide to the acceptor may contribute to the overall rate constant. After correction for limitations of the solvent model, the simulations and calculations agree well with the experimental activation energy and Arrhenius prefactor.« less

Grain size effect on the giant dielectric constant of CaCu3Ti4O12 nanoceramics prepared by mechanosynthesis and spark plasma sintering

NASA Astrophysics Data System (ADS)

Ahmad, Mohamad M.; Yamada, Koji

2014-04-01

In the present work, CaCu3Ti4O12 (CCTO) nanoceramics with different grain sizes were prepared by spark plasma sintering (SPS) at different temperatures (SPS-800, SPS-900, SPS-975, and SPS-1050) of the mechanosynthesized nano-powder. Structural and microstructural properties were studied by XRD and field-emission scanning electron microscope measurements. The grain size of CCTO nanoceramics increases from 80 nm to ˜200 nm for the ceramics sintered at 800 °C and 975 °C, respectively. Further increase of SPS temperature to 1050 °C leads to micro-sized ceramics of 2-3 μm. The electrical and dielectric properties of the investigated ceramics were studied by impedance spectroscopy. Giant dielectric constant was observed in CCTO nanoceramics. The dielectric constant increases with increasing the grain size of the nanoceramics with values of 8.3 × 103, 2.4 × 104, and 3.2 × 104 for SPS-800, SPS-900, and SPS-975, respectively. For the micro-sized SPS-1050 ceramics, the dielectric constant dropped to 2.14 × 104. The dielectric behavior is interpreted within the internal barrier layer capacitance picture due to the electrical inhomogeneity of the ceramics. Besides the resistive grain boundaries that are usually observed in CCTO ceramics, domain boundaries appear as a second source of internal layers in the current nanoceramics.

Combined experimental and theoretical description of direct current magnetron sputtering of Al by Ar and Ar/N2 plasma

NASA Astrophysics Data System (ADS)

Trieschmann, Jan; Ries, Stefan; Bibinov, Nikita; Awakowicz, Peter; Mráz, Stanislav; Schneider, Jochen M.; Mussenbrock, Thomas

2018-05-01

Direct current magnetron sputtering of Al by Ar and Ar/N2 low pressure plasmas was characterized by experimental and theoretical means in a unified consideration. Experimentally, the plasmas were analyzed by optical emission spectroscopy, while the film deposition rate was determined by weight measurements and laser optical microscopy, and the film composition by energy dispersive x-ray spectroscopy. Theoretically, a global particle and power balance model was used to estimate the electron temperature T e and the electron density n e of the plasma at constant discharge power. In addition, the sputtering process and the transport of the sputtered atoms were described using Monte Carlo models—TRIDYN and dsmcFoam, respectively. Initially, the non-reactive situation is characterized based on deposition experiment results, which are in agreement with predictions from simulations. Subsequently, a similar study is presented for the reactive case. The influence of the N2 addition is found to be twofold, in terms of (i) the target and substrate surface conditions (e.g., sputtering, secondary electron emission, particle sticking) and (ii) the volumetric changes of the plasma density n e governing the ion flux to the surfaces (e.g., due to additional energy conversion channels). It is shown that a combined experimental/simulation approach reveals a physically coherent and, in particular, quantitative understanding of the properties (e.g., electron density and temperature, target surface nitrogen content, sputtered Al density, deposited mass) involved in the deposition process.

QED Based Calculation of the Fine Structure Constant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lestone, John Paul

2016-10-13

Quantum electrodynamics is complex and its associated mathematics can appear overwhelming for those not trained in this field. Here, semi-classical approaches are used to obtain a more intuitive feel for what causes electrostatics, and the anomalous magnetic moment of the electron. These intuitive arguments lead to a possible answer to the question of the nature of charge. Virtual photons, with a reduced wavelength of λ, are assumed to interact with isolated electrons with a cross section of πλ 2. This interaction is assumed to generate time-reversed virtual photons that are capable of seeking out and interacting with other electrons. Thismore » exchange of virtual photons between particles is assumed to generate and define the strength of electromagnetism. With the inclusion of near-field effects the model presented here gives a fine structure constant of ~1/137 and an anomalous magnetic moment of the electron of ~0.00116. These calculations support the possibility that near-field corrections are the key to understanding the numerical value of the dimensionless fine structure constant.« less

Methods and apparatus for measurement of electronic properties of geological formations through borehole casing

DOEpatents

Vail, W.B. III.

1991-08-27

Methods and apparatus are provided for measuring electronic properties of geological formations and cement layers adjacent to cased boreholes including resistivities, polarization phenomena and dielectric constants. Current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. At least three voltage measuring electrodes in electrical contact with the interior of the casing measure the voltage at various points thereon. The voltage differences between discrete pairs of the voltage measuring electrodes provide a measurement of the differential current conducted into the formation in the vicinity of those electrodes. These measurements facilitate calculation of the resistivities of the adjacent geological formations as well as an indication of whether cement is present. Measurements of the differential voltage response to transient currents provide a measurement of the polarization phenomena in formation as well as the capacitance of the casing in contact with the formation which is useful for determining whether oil and gas are present. Lithological characteristics of the formation such as the presence or absence of clay can also be determined. A calibration procedure is provided for minimizing errors induced by variations in the casing. The device also may be placed within the pipe attached to a drill bit while drilling open holes. 48 figures.

Methods and apparatus for measurement of electronic properties of geological formations through borehole casing

DOEpatents

Vail, W.B. III.

1989-11-21

Methods and apparatus are provided for measuring electronic properties of geological formations and cement layers adjacent to cased boreholes including resistivities, polarization phenomena and dielectric constants. Current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. At least three voltage measuring electrodes in electrical contact with the interior of the casing measure the voltage at various points thereon. The voltage differences between discrete pairs of the voltage measuring electrodes provide a measurement of differential current conducted into formation in the vicinity of those electrodes. These measurements facilitate calculation of the resistivities of the adjacent geological formations as well as an indication of whether cement is present. Measurements of the differential voltage response to transient currents provide a measurement of the polarization phenomena in formation as well as the capacitance of the casing in contact with the formation which is useful for determining whether oil and gas are present. Lithological characteristics of the formation such as the presence or absence of clay can also be determined. A calibration procedure is provided for minimizing errors induced by variations in the casing. The device also may be placed within the pipe attached to a drill bit while drilling open holes. 48 figs.

Methods and apparatus for measurement of electronic properties of geological formations through borehole casing

DOEpatents

Vail, III, William B.

1991-01-01

Methods and apparatus are provided for measuring electronic properties of geological formations and cement layers adjacent to cased boreholes including resistivities, polarization phenomena and dielectric constants. Current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. At least three voltage measuring electrodes in electrical contact with the interior of the casing measure the voltage at various points thereon. The voltage differences between discrete pairs of the voltage measuring electrodes provide a measurement of the differential current conducted into formation in the vicinity of those electrodes. These measurements facilitate calculation of the resistivities of the adjacent geological formations as well as an indication of whether cement is present. Measurements of the differential voltage response to transient currents provide a measurement of the polarization phenomena in formation as well as the capacitance of the casing in contact with the formation which is useful for determining whether oil and gas present. Lithological characteristics of the formation such as the pressence or absence of clay can also be determined. A calibration procedure is provided for minimizing errors induced by variations in the casing. The device also may be placed within the pipe attached to a drill bit while drilling open holes.

Methods and apparatus for measurement of electronic properties of geological formations through borehole casing

DOEpatents

Vail, III, William B.

1989-01-01

Methods and apparatus are provided for measuring electronic properties of geological formations and cement layers adjacent to cased boreholes including resistivities, polarization phenomena and dielectric constants. Current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. At least three voltage measuring electrodes in electrical contact with the interior of the casing measure the voltage at various points thereon. The voltage differences between discrete pairs of the voltage measuring electrodes provide a measurement of differential current conducted into formation in the vicinity of those electrodes. These measurements facilitate calculation of the resistivities of the adjacent geological formations as well as an indication of whether cement is present. Measurements of the differential voltage response to transient currents provide a measurement of the polarization phenomena in formation as well as the capacitance of the casing in contact with the formation which is useful for determining whether oil and gas are present. Lithological characteristics of the formation such as the presence or absence of clay can also be determined. A calibration procedure is provided for minimizing errors induced by variations in the casing. The device also may be placed within the pipe attached to a drill bit while drilling open holes.

Experimental studies of fundamental issues in electron transfer through nanometer scale devices

NASA Astrophysics Data System (ADS)

Yamamoto, Hiromichi

Electron transfer reactions constitute many of the primary events in materials science, chemistry, physics, and biochemistry, e.g. the electron transport properties and photoexcited processes in solids and molecules, chemical reactions, corrosion, photosynthesis, respiration, and so forth. A self-assembled monolayer (SAM) film provides us with a unique environment not only to understand and manipulate the surface electronic properties of a solid, but also to control electron transfer processes at the interface. The first topic in this thesis describes the structure and electron tunneling characterization of alkanethiol SAMs on InP(100). Angle-resolved X-ray photoelectron spectroscopy was used to characterize the bonding of alkanethiols to n-InP surfaces and to measure the monolayer thickness. The results showed that the sulfur binds to In atoms on the surface, and provided film thicknesses of 6.4 A for C8H17SH, 11.1 A for C12H25SH, and 14.9 A for C16H 33SH, resulting in an average tilt angle of 55°. The analysis indicated that super-exchange coupling between the alkane chains plays an important role in defining electron tunneling barriers, especially for highly tilted chains. The second topic describes studies of cytochrome c bound to pure and mixed SAMs of o-terminated alkanethiol (terminated with pyridine, imidazole or nitrile groups) and alkanethiol on gold. Electrochemical methods are used to determine electron transfer rate constants of cytochrome c, and scanning tunneling microscopy to observe the cytochrome c on the SAM. Detailed analysis revealed direct association of the heme of cytochrome c with the terminal groups of the SAMs and a 'turning-over' of the electron transfer of cytochrome c from adiabatic to non-adiabatic regime. The third topic describes studies of oxidation and reduction of cytochrome c in solution through eleven different self-assembled monolayers (SAMs) on gold electrodes by cyclic voltammetry. Electron transfer rate constants of cytochrome c through the eleven SAMs ranged from ≤10-4 to ˜10-1 cm/sec. A strong correlation between the electron transfer rate constants and the hydrogen bonding ability of the SAM is identified. This correlation is discussed in terms of the dependence of the rate constant on the outer-sphere reorganization energy and the electronic coupling between the cytochrome and the differently terminated monolayer films.

Correlation of eddy current responses between fatigue cracks and electrical-discharge-machining notches

NASA Astrophysics Data System (ADS)

Seo, Sukho; Choi, Gyudong; Eom, Tae Jhoun; Lee, Bokwon; Lee, Soo Yeol

2017-07-01

The eddy current responses of Electrical Discharge Machining (EDM) notches and fatigue cracks are directly compared to verify the reliability of eddy current inspection. The fatigue crack growth tests using a constant load range control mode were conducted to obtain a variety of edge crack sizes, ranging from 0.9 to 6.6 mm for Al alloy and from 0.1 to 3 mm for Ti alloy. EDM notch specimens of Al and Ti alloys were accordingly prepared in lengths similar to that of the fatigued specimen. The crack length was determined by optical microscope and scanning electron microscope. The eddy current responses between the EDM and fatigued specimens with varying notch/crack length were examined using probe sensors at (100-500) kHz and (1-2) MHz for Al and Ti alloys, respectively. The results show a significant difference in the eddy current signal between the two specimens, based on the correlation between the eddy current response and notch/crack length. This suggests that eddy current inspection using the EDM reference specimen is inaccurate in determining the precise crack size, unless the eddy current response data base is obtained from a fatigue-cracked specimen.

Electrochemical Measurement of Electron Transfer Kinetics by Shewanella oneidensis MR-1*

PubMed Central

Baron, Daniel; LaBelle, Edward; Coursolle, Dan; Gralnick, Jeffrey A.; Bond, Daniel R.

2009-01-01

Shewanella oneidensis strain MR-1 can respire using carbon electrodes and metal oxyhydroxides as electron acceptors, requiring mechanisms for transferring electrons from the cell interior to surfaces located beyond the cell. Although purified outer membrane cytochromes will reduce both electrodes and metals, S. oneidensis also secretes flavins, which accelerate electron transfer to metals and electrodes. We developed techniques for detecting direct electron transfer by intact cells, using turnover and single turnover voltammetry. Metabolically active cells attached to graphite electrodes produced thin (submonolayer) films that demonstrated both catalytic and reversible electron transfer in the presence and absence of flavins. In the absence of soluble flavins, electron transfer occurred in a broad potential window centered at ∼0 V (versus standard hydrogen electrode), and was altered in single (ΔomcA, ΔmtrC) and double deletion (ΔomcA/ΔmtrC) mutants of outer membrane cytochromes. The addition of soluble flavins at physiological concentrations significantly accelerated electron transfer and allowed catalytic electron transfer to occur at lower applied potentials (−0.2 V). Scan rate analysis indicated that rate constants for direct electron transfer were slower than those reported for pure cytochromes (∼1 s−1). These observations indicated that anodic current in the higher (>0 V) window is due to activation of a direct transfer mechanism, whereas electron transfer at lower potentials is enabled by flavins. The electrochemical dissection of these activities in living cells into two systems with characteristic midpoint potentials and kinetic behaviors explains prior observations and demonstrates the complementary nature of S. oneidensis electron transfer strategies. PMID:19661057

Redox polymer mediation for enzymatic biofuel cells

NASA Astrophysics Data System (ADS)

Gallaway, Joshua

Mediated biocatalytic cathodes prepared from the oxygen-reducing enzyme laccase and redox-conducting osmium hydrogels were characterized for use as cathodes in enzymatic biofuel cells. A series of osmium-based redox polymers was synthesized with redox potentials spanning the range from 0.11 V to 0.85 V (SHE), and the resulting biocatalytic electrodes were modeled to determine reaction kinetic constants using the current response, measured osmium concentration, and measured apparent electron diffusion. As in solution-phase systems, the bimolecular rate constant for mediation was found to vary greatly with mediator potential---from 250 s-1M-1 when mediator and enzyme were close in potential to 9.4 x 10 4 s-1M-1 when this overpotential was large. Optimum mediator potential for a cell operating with a non-limiting platinum anode and having no mass transport limitation from bulk solution was found to be 0.66 V (SHE). Redox polymers were synthesized under different concentrations, producing osmium variation. An increase from 6.6% to 7.2% osmium increased current response from 1.2 to 2.1 mA/cm2 for a planar film in 40°C oxygen-saturated pH 4 buffer, rotating at 900 rpm. These results translated to high surface area electrodes, nearly doubling current density to 13 mA/cm2, the highest to date for such an electrode. The typical fungal laccase from Trametes versicolor was replaced by a bacterially-expressed small laccase from Streptomyces coelicolor, resulting in biocatalytic films that reduced oxygen at increased pH, with full functionality at pH 7, producing 1.5 mA/cm 2 in planar configuration. Current response was biphasic with pH, matching the activity profile of the free enzyme in solution. The mediated enzyme electrode system was modeled with respect to apparent electron diffusion, mediator concentration, and transport of oxygen from bulk solution, all of which are to some extent controlled by design. Each factor was found to limit performance in certain circumstances. In systems relying on stagnant solution, oxygen transport was found to dominate. However, if mass transport was efficient, differences in mediator design greatly affected performance.

Imidazoline derivative templated synthesis of broccoli-like Bi2S3 and its electrocatalysis towards the direct electrochemistry of hemoglobin.

PubMed

Chen, Xiaoqian; Wang, Qingxiang; Wang, Liheng; Gao, Feng; Wang, Wei; Hu, Zhengshui

2015-04-15

A broccoli-like bismuth sulfide (bBi2S3) was synthesized via a solvothermal method using a self-made imidazoline derivative of 2-undecyl-1-dithioureido-ethyl-imidazoline as the soft template. The morphology and chemical constitution of the product were characterized by scanning electron microscope (SEM), transmission electron microscope (TEM) and X-ray diffraction (XRD). Electrochemical characterization experiments show that the bBi2S3 has the higher specific surface area and standard heterogeneous electron transfer rate constant than the rod-like Bi2S3 (rBi2S3). Hemoglobin (Hb) was then chosen as a protein model to investigate the electrocatalytic property of the synthesized bBi2S3. The results show that Hb entrapped in the composite film of chitosan and bBi2S3 displays an excellent direct electrochemistry, and retains its biocatalytic activity toward the electro-reduction of hydrogen peroxide. The current response in the amperometry shows a linear response to H2O2 concentrations in the range from 0.4 to 4.8µM with high sensitivity (444µAmM(-1)) and low detection limit (0.096µM). The Michaelis-Menten constant (KM(app)) of the fabricated bioelectrode for H2O2 was determined as low as 1µM. These results demonstrate that the synthesized bBi2S3 offers a new path for the immobilization of redox-active protein and the construction of the third-generation biosensors. Copyright © 2014 Elsevier B.V. All rights reserved.

Facile synthesis of Ni/NiO@GO nanocomposites and its enhanced dielectric constant

NASA Astrophysics Data System (ADS)

Sarkar, S.; Giri, N.; Mondal, A.; Ray, R.

2018-05-01

Ni/NiO embedded Graphene Oxide (GO): Ni/NiO@GO is synthesized by citric acid assisted Pechini-type method. Structural and morphological characterizations are performed by X-ray powdered diffraction (XRD), field emission scanning electron microscopy (FESEM) and tunneling electron microscopy (TEM). Defects in GO sheets are probed by RAMAN spectroscopy. The temperature variation of dielectric constant (ɛR) and dielectric loss (tan δ) are investigated in the temperature range 300 - 400 K. Decoration of GO with Ni/NiO nanoparticles enhances its ɛR by˜55 times. Moreover, its dielectric constant measured at 5 MHz is found to be˜430 times to that of Ni/NiO along with the reduction of dielectric loss by a factor˜0.5. The enhanced dielectric constant makes the composite Ni/NiO@GO a potential candidate for using in ecologically friendly energy storage devices.

Amino acid residues in Anabaena ferredoxin crucial to interaction with ferredoxin-NADP+ reductase: site-directed mutagenesis and laser flash photolysis.

PubMed

Hurley, J K; Salamon, Z; Meyer, T E; Fitch, J C; Cusanovich, M A; Markley, J L; Cheng, H; Xia, B; Chae, Y K; Medina, M

1993-09-14

Ferredoxin (Fd) functions in photosynthesis to transfer electrons from photosystem I to ferredoxin-NADP+ reductase (FNR). We have made several site-directed mutants of Anabaena 7120 Fd and have used laser flash photolysis to investigate the effects of these mutations on the kinetics of reduction of oxidized Fd by deazariboflavin semiquinone (dRfH.) and the reduction of oxidized Anabaena FNR by reduced Fd. None of the mutations influenced the second-order rate constant for dRfH. reduction by more than a factor of 2, suggesting that the ability of the [2Fe-2S] cluster to participate in electron transfer was not seriously affected. In contrast, a surface charge reversal mutation, E94K, resulted in a 20,000-fold decrease in the second-order rate constant for electron transfer from Fd to FNR, whereas a similar mutation at an adjacent site, E95K, produced little or no change in reaction rate constant compared to wild-type Fd. Such a dramatic difference between contiguous surface mutations suggests a very precise surface complementarity at the protein-protein interface. Mutations introduced at F65 (F65I and F65A) also decreased the rate constant for the Fd/FNR electron transfer reaction by more than 3 orders of magnitude. Spectroscopic and thermodynamic measurements with both the E94 and F65 mutants indicated that the kinetic differences cannot be ascribed to changes in gross conformation, redox potential, or FNR binding constant but rather reflect the protein-protein interactions that control electron transfer. Several mutations at other sites in the vicinity of E94 and F65 (R42, T48, D68, and D69) resulted in little or no perturbation of the Fd/FNR interaction.(ABSTRACT TRUNCATED AT 250 WORDS)

Load positioning system with gravity compensation

NASA Technical Reports Server (NTRS)

Hollow, R. H.

1984-01-01

A load positioning system with gravity compensation has a servomotor, position sensing feedback potentiometer and velocity sensing tachometer in a conventional closed loop servo arrangement to cause a lead screw and a ball nut to vertically position a load. Gravity compensating components comprise the DC motor, gears, which couple torque from the motor to the lead screw, and constant current power supply. The constant weight of the load applied to the lead screw via the ball nut tend to cause the lead screw to rotate, the constant torque of which is opposed by the constant torque produced by the motor when fed from the constant current source. The constant current is preset as required by the potentiometer to effect equilibration of the load which thereby enables the positioning servomotor to see the load as weightless under both static and dynamic conditions. Positioning acceleration and velocity performance are therefore symmetrical.

Effect of traps on the charge transport in semiconducting polymer PCDTBT

NASA Astrophysics Data System (ADS)

Khan, Mohd Taukeer; Agrawal, Vikash; Almohammedi, Abdullah; Gupta, Vinay

2018-07-01

Organic semiconductors (OSCs) are nowadays called upon as promising candidates for next generation electronics devices. Due to disorder structure of these materials, a high density of traps are present in their energy band gap which affect the performance of these devices. In the present manuscript, we have investigated the role of traps on charge transport in PCDTBT thin film by measuring the temperature dependent J(V) characteristics in hole only device configuration. The obtained results were analyzed by space charge limited (SCL) conduction model. It has been found that the room temperature J(V) characteristics follow Mott-Gurney square law for trap-free SCL conduction. But below 278 K, the current increases according to trap-filling SCL law with traps distributed exponentially in the band gap of semiconductor. Furthermore, after reaching a crossover voltage of VC ∽ 12 V, all the traps filled by injected carriers and the trap-filling SCL current switch to trap-free SCL current. The hole mobility of trap-free SCL current is about one order higher as compared trap-filling SCL current and remains constant with temperature.

Controlling electrostatic charging of nanocrystalline diamond at nanoscale.

PubMed

Verveniotis, Elisseos; Kromka, Alexander; Rezek, Bohuslav

2013-06-11

Constant electrical current in the range of -1 to -200 pA is applied by an atomic force microscope (AFM) in contact mode regime to induce and study local electrostatic charging of oxygen-terminated nanocrystalline diamond (NCD) thin films. The NCD films are deposited on silicon in 70 nm thickness and with 60% relative sp(2) phase content. Charging current is monitored by conductive AFM. Electric potential contrast induced by the current is evaluated by Kelvin force microscopy (KFM). KFM shows well-defined, homogeneous, and reproducible microscopic patterns that are not influenced by inherent tip-surface junction fluctuations during the charging process. The charged patterns are persistent for at least 72 h due to charge trapping inside the NCD film. The current-induced charging also clearly reveals field-induced detrapping at current amplitudes >-50 pA and tip instability at >-150 pA, both of which limit the achievable potential contrast. In addition, we show that the field also determines the range of electronic states that can trap the charge. We present a model and discuss implications for control of the nanoscale charging process.

Electrochemical oxidation of ciprofloxacin in two different processes: the electron transfer process on the anode surface and the indirect oxidation process in bulk solutions.

PubMed

Shen, Bo; Wen, Xianghua; Korshin, Gregory V

2018-05-14

Herein, the rotating disk electrode technique was used for the first time to investigate the effects of mass-transfer limitations and pH on the electrochemical oxidation of CPX, to determine the kinetics of CPX oxidation and to explore intrinsic mechanisms during the electron transfer process. Firstly, cyclic voltammetry revealed that an obvious irreversible CPX oxidation peak was observed within the potential window from 0.70 to 1.30 V at all pHs. Based on the Levich equation, the electrochemical oxidation of CPX in the electron transfer process was found to be controlled by both diffusion and kinetic processes when pH = 2, 5, 7 and 9; the diffusion coefficient of CPX at pH = 2 was calculated to be 1.5 × 10-7 cm2 s-1. Kinetic analysis indicated that the reaction on the electrode surface was adsorption-controlled compared to a diffusion process; the surface concentration of electroactive species was estimated to be 1.15 × 10-9 mol cm-2, the standard rate constant of the surface reaction was calculated to be 1.37 s-1, and CPX oxidation was validated to be a two-electron transfer process. Finally, a possible CPX oxidation pathway during the electron transfer process was proposed. The electrochemical degradation of CPX on a Ti-based anode was also conducted subsequently to investigate the electrochemical oxidation of CPX in the indirect oxidation process in bulk solutions. The effects of pH and current density were determined and compared to related literature results. The oxidation of CPX at different pHs is believed to be the result of a counterbalance between favorable and unfavorable factors, namely electromigration and side reactions of oxygen evolution, respectively. The effects of current density indicated a diffusion- and reaction-controlled process at low currents followed by a reaction-controlled process at high currents. The results presented in this study provide better understanding of the electrochemical oxidation of CPX and would enable the development of new treatment methods based on electrochemistry.

Kinetics of the hydrogen atom abstraction reactions from 1-butanol by hydroxyl radical: theory matches experiment and more.

PubMed

Seal, Prasenjit; Oyedepo, Gbenga; Truhlar, Donald G

2013-01-17

In the present work, we study the H atom abstraction reactions by hydroxyl radical at all five sites of 1-butanol. Multistructural variational transition state theory (MS-VTST) was employed to estimate the five thermal rate constants. MS-VTST utilizes a multifaceted dividing surface that accounts for the multiple conformational structures of the transition state, and we also include all the structures of the reactant molecule. The vibrational frequencies and minimum energy paths (MEPs) were computed using the M08-HX/MG3S electronic structure method. The required potential energy surfaces were obtained implicitly by direct dynamics employing interpolated variational transition state theory with mapping (IVTST-M) using a variational reaction path algorithm. The M08-HX/MG3S electronic model chemistry was then used to calculate multistructural torsional anharmonicity factors to complete the MS-VTST rate constant calculations. The results indicate that torsional anharmonicity is very important at higher temperatures, and neglecting it would lead to errors of 26 and 32 at 1000 and 1500 K, respectively. Our results for the sums of the site-specific rate constants agree very well with the experimental values of Hanson and co-workers at 896-1269 K and with the experimental results of Campbell et al. at 292 K, but slightly less well with the experiments of Wallington et al., Nelson et al., and Yujing and Mellouki at 253-372 K; nevertheless, the calculated rates are within a factor of 1.61 of all experimental values at all temperatures. This gives us confidence in the site-specific values, which are currently inaccessible to experiment.

Absolute Determination of High DC Voltages by Means of Frequency Measurement

NASA Astrophysics Data System (ADS)

Peier, Dirk; Schulz, Bernd

1983-01-01

A novel absolute measuring procedure is presented for the definition of fixed points of the voltage in the 100 kV range. The method is based on transit time measurements with accelerated electrons. By utilizing the selective interaction of a monoenergetic electron beam with the electromagnetic field of a special cavity resonator, the voltage is referred to fundamental constants and the base unit second. Possible balance voltages are indicated by a current detector. Experimental investigations are carried out with resonators in the normal conducting range. With a copper resonator operating at the temperature of boiling nitrogen (77 K), the relative uncertainty of the voltage points is estimated to be +/- 4 × 10-4. The technically realizable uncertainty can be reduced to +/- 1 × 10-5 by the proposed application of a superconducting niobium resonator. Thus this measuring device becomes suitable as a primary standard for the high-voltage range.

Acceleration of deuterons with suppression of electronic conductance in a vacuum diode with a laser target on the anode

NASA Astrophysics Data System (ADS)

Shikanov, A. E.; Vovchenko, E. D.; Kozlovskii, K. I.; Shatokhin, V. L.

2016-12-01

We report new experimental results on the acceleration of deuterons in a compact coaxial diode with the suppression of electronic conductance by a constant longitudinal magnetic field. Plasma containing deuterons is created on a laser TiD target located on the anode. The pulse of accelerating voltage is formed by means of the Arkad'ev-Marx generator. The cathode symmetrically surrounds the anode and comprises a hollow permanent ring magnet with an inner radius of no more than 0.02 m and an on-axis induction of up to 0.4 T, which provides the magnetic insulation of the accelerating gap. The experiments demonstrate the possibility of obtaining accelerated deuterons with energy of up to 300 keV and a current of up to 0.5 kA with a pulse duration of 0.2 μs.

Accelerated reliability testing of highly aligned single-walled carbon nanotube networks subjected to DC electrical stressing.

PubMed

Strus, Mark C; Chiaramonti, Ann N; Kim, Young Lae; Jung, Yung Joon; Keller, Robert R

2011-07-01

We investigate the electrical reliability of nanoscale lines of highly aligned, networked, metallic/semiconducting single-walled carbon nanotubes (SWCNTs) fabricated through a template-based fluidic assembly process. We find that these SWCNT networks can withstand DC current densities larger than 10 MA cm(-2) for several hours and, in some cases, several days. We develop test methods that show that the degradation rate, failure predictability and total device lifetime can be linked to the initial resistance. Scanning electron and transmission electron microscopy suggest that fabrication variability plays a critical role in the rate of degradation, and we offer an empirical method of quickly determining the long-term performance of a network. We find that well-fabricated lines subject to constant electrical stress show a linear accumulation of damage reminiscent of electromigration in metallic interconnects, and we explore the underlying physical mechanisms that could cause such behavior.

Phonon-driven electron scattering and magnetothermoelectric effect in two-dimensional tin selenide

NASA Astrophysics Data System (ADS)

Yang, Kaike; Ren, Ji-Chang; Qiu, Hongfei; Wang, Jian-Sheng

2018-02-01

The bulk tin selenide (SnSe) is the best thermoelectric material currently with the highest figure-of-merit due to strong phonon-phonon interactions. We investigate the effect of electron-phonon coupling (EPC) on the transport properties of a two-dimensional (2D) SnSe sheet. We demonstrate that EPC plays a key role in the scattering rate when the constant relaxation time approximation is deficient. The EPC strength is especially large in contrast to that of pristine graphene. The scattering rate depends sensitively on the system temperatures and the carrier densities when the Fermi energy approaches the band edge. We also investigate the magnetothermoelectric effect of the 2D SnSe. It is found that at low temperatures there is enormous magnetoelectrical resistivity and magnetothermal resistivity above 200%, suggesting possible potential applications in device design. Our results agree qualitatively well with the experimental data.

Constant-Current Source For Measuring Low Resistances

NASA Technical Reports Server (NTRS)

Toomath, Robert L.

1996-01-01

Constant-current source constructed for measuring electrical resistances up to few ohms in power-supply equipment. By setting current at 1 A and measuring resulting voltage drop across item under test, one obtains voltage reading numerically equal to resistance in ohms.

A constant current charge technique for low Earth orbit life testing

NASA Technical Reports Server (NTRS)

Glueck, Peter

1991-01-01

A constant current charge technique for low earth orbit testing of nickel cadmium cells is presented. The method mimics the familiar taper charge of the constant potential technique while maintaining cell independence for statistical analysis. A detailed example application is provided and the advantages and disadvantages of this technique are discussed.

Solubility, ionization, and partitioning behavior of unsymmetrical disulfide compounds: alkyl 2-imidazolyl disulfides.

PubMed

Hashash, Ahmad; Kirkpatrick, D Lynn; Lazo, John S; Block, Lawrence H

2002-07-01

Alkyl 2-imidazolyl disulfide compounds are novel antitumor agents, one of which is currently being evaluated in Phase I clinical trials. These molecules contain an unsymmetrical disulfide fragment, the lipophilic and electronic contributions of which are still not defined in the literature. Lipophilicity, ionization, and solubility of a number of alkyl 2-imidazolyl disulfides were studied. Based on the additivity of lipophilicity and ionization properties, the contribution of the unsymmetrical disulfide fragment to lipophilicity and ionization was elucidated. The unsymmetrical disulfide fragment contributed a Rekker's hydrophobic constant of 0.761 to the lipophilicity of these compounds and an approximated Hammett constant (sigma) of 0.30 to their ionization. The applicability of the general solubility equation (GSE) proposed by Jain and Yalkowsky in predicting the aqueous solubility of these analogs was evaluated. The GSE correctly ranked the aqueous solubilities of these compounds and estimated their log molar solubilities with an average absolute error of 0.35. Copyright 2002 Wiley-Liss Inc.

Bimolecular Rate Constants for FAD-Dependent Glucose Dehydrogenase from Aspergillus terreus and Organic Electron Acceptors.

PubMed

Tsuruoka, Nozomu; Sadakane, Takuya; Hayashi, Rika; Tsujimura, Seiya

2017-03-10

The flavin adenine dinucleotide-dependent glucose dehydrogenase (FAD-GDH) from Aspergillus species require suitable redox mediators to transfer electrons from the enzyme to the electrode surface for the application of bioelectrical devices. Although several mediators for FAD-GDH are already in use, they are still far from optimum in view of potential, kinetics, sustainability, and cost-effectiveness. Herein, we investigated the efficiency of various phenothiazines and quinones in the electrochemical oxidation of FAD-GDH from Aspergillus terreus . At pH 7.0, the logarithm of the bimolecular oxidation rate constants appeared to depend on the redox potentials of all the mediators tested. Notably, the rate constant of each molecule for FAD-GDH was approximately 2.5 orders of magnitude higher than that for glucose oxidase from Aspergillus sp. The results suggest that the electron transfer kinetics is mainly determined by the formal potential of the mediator, the driving force of electron transfer, and the electron transfer distance between the redox active site of the mediator and the FAD, affected by the steric or chemical interactions. Higher k ₂ values were found for ortho-quinones than for para-quinones in the reactions with FAD-GDH and glucose oxidase, which was likely due to less steric hindrance in the active site in the case of the ortho-quinones.

New Measurement of the Electron Magnetic Moment and the Fine Structure Constant: A First Application of a One-Electron Quantum Cyclotron

ScienceCinema

Gabrielse, Gerald

2018-05-22

Remarkably, the famous UW measurement of the electron magnetic moment has stood since 1987. With QED theory, this measurement has determined the accepted value of the fine structure constant. This colloquium is about a new Harvard measurement of these fundamental constants. The new measurement has an uncertainty that is about six times smaller, and it shifts the values by 1.7 standard deviations. One electron suspended in a Penning trap is used for the new measurement, like in the old measurement. What is different is that the lowest quantum levels of the spin and cyclotron motion are resolved, and the cyclotron as well as spin frequencies are determined using quantum jump spectroscopy. In addition, a 0.1 mK Penning trap that is also a cylindrical microwave cavity is used to control the radiation field, to suppress spontaneous emission by more than a factor of 100, to control cavity shifts, and to eliminate the blackbody photons that otherwise stimulate excitations from the cyclotron ground state. Finally, great signal-to-noise for one-quantum transitions is obtained using electronic feedback to realize the first one-particle self-excited oscillator. The new methods may also allow a million times improved measurement of the 500 times small antiproton magnetic moment.

Spectroscopy of antiprotonic helium atoms and its contribution to the fundamental physical constants

PubMed Central

Hayano, Ryugo S.

2010-01-01

Antiprotonic helium atom, a metastable neutral system consisting of an antiproton, an electron and a helium nucleus, was serendipitously discovered, and has been studied at CERN’s antiproton decelerator facility. Its transition frequencies have recently been measured to nine digits of precision by laser spectroscopy. By comparing these experimental results with three-body QED calculations, the antiproton-to-electron massratio was determined as 1836.152674(5). This result contributed to the CODATA recommended values of the fundamental physical constants. PMID:20075605

Josephson junctions of multiple superconducting wires

NASA Astrophysics Data System (ADS)

Deb, Oindrila; Sengupta, K.; Sen, Diptiman

2018-05-01

We study the spectrum of Andreev bound states and Josephson currents across a junction of N superconducting wires which may have s - or p -wave pairing symmetries and develop a scattering matrix based formalism which allows us to address transport across such junctions. For N ≥3 , it is well known that Berry curvature terms contribute to the Josephson currents; we chart out situations where such terms can have relatively large effects. For a system of three s -wave or three p -wave superconductors, we provide analytic expressions for the Andreev bound-state energies and study the Josephson currents in response to a constant voltage applied across one of the wires; we find that the integrated transconductance at zero temperature is quantized to integer multiples of 4 e2/h , where e is the electron charge and h =2 π ℏ is Planck's constant. For a sinusoidal current with frequency ω applied across one of the wires in the junction, we find that Shapiro plateaus appear in the time-averaged voltage across that wire for any rational fractional multiple (in contrast to only integer multiples in junctions of two wires) of 2 e /(ℏ ω ) . We also use our formalism to study junctions of two p -wave and one s -wave wires. We find that the corresponding Andreev bound-state energies depend on the spin of the Bogoliubov quasiparticles; this produces a net magnetic moment in such junctions. The time variation of these magnetic moments may be controlled by an external voltage applied across the junction. We discuss experiments which may test our theory.

Anodic Behavior of the Aluminum Current Collector in Imide-Based Electrolytes: Influence of Solvent, Operating Temperature, and Native Oxide-Layer Thickness.

PubMed

Meister, Paul; Qi, Xin; Kloepsch, Richard; Krämer, Elisabeth; Streipert, Benjamin; Winter, Martin; Placke, Tobias

2017-02-22

The inability of imide salts to form a sufficiently effective passivation layer on aluminum current collectors is one of the main obstacles that limit their broad application in electrochemical energy-storage systems. However, under certain circumstances, the use of electrolytes with imide electrolyte salts in combination with the aluminum current collector is possible. In this contribution, the stability of the aluminum current collector in electrolytes containing either lithium bis(trifluoromethanesulfonyl) imide (LiTFSI) or lithium fluorosulfonyl-(trifluoromethanesulfonyl) imide (LiFTFSI) as conductive salt was investigated by electrochemical techniques, that is, cyclic voltammetry (CV) and chronocoulometry (CC) in either room-temperature ionic liquids or in ethyl methyl sulfone. In particular, the influence of the solvent, operating temperature, and thickness of the native oxide layer of aluminum on the pit formation at the aluminum current collector surface was studied by means of scanning electron microscopy. In general, a more pronounced aluminum dissolution and pit formation was found at elevated temperatures as well as in solvents with a high dielectric constant. An enhanced thickness of the native aluminum oxide layer increases the oxidative stability versus dissolution. Furthermore, we found a different reaction rate depending on dwell time at the upper cut-off potential for aluminum dissolution in TFSI- and FTFSI-based electrolytes during the CC measurements; the use of LiFTFSI facilitated the dissolution of aluminum compared to LiTFSI. Overall, the mechanism of anodic aluminum dissolution is based on: i) the attack of the Al 2 O 3 surface by acidic species and ii) the dissolution of bare aluminum into the electrolyte, which, in turn, is influenced by the electrolyte's dielectric constant. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A nonmonotonic dependence of standard rate constant on reorganization energy for heterogeneous electron transfer processes on electrode surface

NASA Astrophysics Data System (ADS)

Xu, Weilin; Li, Songtao; Zhou, Xiaochun; Xing, Wei; Huang, Mingyou; Lu, Tianhong; Liu, Changpeng

2006-05-01

In the present work a nonmonotonic dependence of standard rate constant (k0) on reorganization energy (λ) was discovered qualitatively from electron transfer (Marcus-Hush-Levich) theory for heterogeneous electron transfer processes on electrode surface. It was found that the nonmonotonic dependence of k0 on λ is another result, besides the disappearance of the famous Marcus inverted region, coming from the continuum of electronic states in electrode: with the increase of λ, the states for both Process I and Process II ET processes all vary from nonadiabatic to adiabatic state continuously, and the λ dependence of k0 for Process I is monotonic thoroughly, while for Process II on electrode surface the λ dependence of k0 could show a nonmonotonicity.

Radiosensitization of DNA by Cisplatin Adducts Results from an Increase in the Rate Constant for the Reaction with Hydrated Electrons and Formation of Pt(I).

PubMed

Behmand, B; Marignier, J-L; Mostafavi, M; Wagner, J R; Hunting, D J; Sanche, L

2015-07-30

Pulse radiolysis measurements of the decay of hydrated electrons in solutions containing different concentrations of the oligonucleotide GTG with and without a cisplatin adduct show that the presence of a cisplatin moiety accelerates the reaction between hydrated electrons and the oligonucleotide. The rate constant of the reaction is found to be 2.23 × 10(10) mol(-1) L s(-1), which indicates that it is diffusion controlled. In addition, we show for the first time the formation of a Pt(I) intermediate as a result of the reaction of hydrated electrons with GTG-cisplatin. A putative reaction mechanism is proposed, which may form the basis of the radiosensitization of cancer cells in concomitant chemoradiation therapy with cisplatin.

Dielectric response of a nondegenerate electron gas in semiconductor nanocrystallites

NASA Astrophysics Data System (ADS)

van Faassen, E.

1998-12-01

We investigate the low-frequency dielectric response of a dilute electron gas in a small spherical semiconductor particle. The flow of the electrons is described by hydrodynamic equations which incorporate the electrostatic interactions between the electrons in a self-consistent fashion. In the low-frequency regime, the dielectric loss is small and proportional to the frequency, despite substantial field penetration into the semiconductor. The loss remains small even for high doping levels due to effective cancellation between field-induced drift and diffusion. The model is used to estimate the complex dielectric constant of a system of weakly conducting nanosized semiconductor particles. The most prominent manifestation of spatial dispersion is that photoinduced changes in the real and imaginary parts of the dielectric constant are positive and of comparable magnitude.

Inelastic scattering of electrons at real metal surfaces

NASA Astrophysics Data System (ADS)

Ding, Z.-J.

1997-04-01

A theory is presented to calculate the electron inelastic scattering cross section for a moving electron near the surface region at an arbitrary takeoff angle. The theory is based on using a bulk plasmon-pole approximation to derive the numerically computable expression of the electron self-energy in the random-phase approximation for a surface system, through the use of experimental optical constants. It is shown that the wave-vector-dependent surface dielectric function satisfies the surface sum rules in this scheme. The theory provides a detailed knowledge of electron self-energy depending on the kinetic energy, distance from surface, and velocity vector of an electron moving in any metal of a known dielectric constant, accommodating the formulation to practical situation in surface electron spectroscopies. Numerical computations of the energy-loss cross section have been made for Si and Au. The contribution to the total differential scattering cross section from each component is analyzed. The depth dependence informs us in detail how the bulk excitation mode changes to a surface excitation mode with an electron approaching the surface from the interior of a medium.

Support for the existence of invertible maps between electronic densities and non-analytic 1-body external potentials in non-relativistic time-dependent quantum mechanics

NASA Astrophysics Data System (ADS)

Mosquera, Martín A.

2017-10-01

Provided the initial state, the Runge-Gross theorem establishes that the time-dependent (TD) external potential of a system of non-relativistic electrons determines uniquely their TD electronic density, and vice versa (up to a constant in the potential). This theorem requires the TD external potential and density to be Taylor-expandable around the initial time of the propagation. This paper presents an extension without this restriction. Given the initial state of the system and evolution of the density due to some TD scalar potential, we show that a perturbative (not necessarily weak) TD potential that induces a non-zero divergence of the external force-density, inside a small spatial subset and immediately after the initial propagation time, will cause a change in the density within that subset, implying that the TD potential uniquely determines the TD density. In this proof, we assume unitary evolution of wavefunctions and first-order differentiability (which does not imply analyticity) in time of the internal and external force-densities, electronic density, current density, and their spatial derivatives over the small spatial subset and short time interval.

Dissociative electron attachment to C{sub 2}F{sub 5} radicals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haughey, Sean A.; Field, Thomas A.; Langer, Judith

Dissociative electron attachment to the reactive C{sub 2}F{sub 5} molecular radical has been investigated with two complimentary experimental methods; a single collision beam experiment and a new flowing afterglow Langmuir probe technique. The beam results show that F{sup -} is formed close to zero electron energy in dissociative electron attachment to C{sub 2}F{sub 5}. The afterglow measurements also show that F{sup -} is formed in collisions between electrons and C{sub 2}F{sub 5} molecules with rate constants of 3.7 Multiplication-Sign 10{sup -9} cm{sup 3} s{sup -1} to 4.7 Multiplication-Sign 10{sup -9} cm{sup 3} s{sup -1} at temperatures of 300-600 K. Themore » rate constant increases slowly with increasing temperature, but the rise observed is smaller than the experimental uncertainty of 35%.« less

Two-electron bond-orbital model, 1

NASA Technical Reports Server (NTRS)

Huang, C.; Moriarty, J. A.; Sher, A.; Breckenridge, R. A.

1975-01-01

Harrison's one-electron bond-orbital model of tetrahedrally coordinated solids was generalized to a two-electron model, using an extension of the method of Falicov and Harris for treating the hydrogen molecule. The six eigenvalues and eigenstates of the two-electron anion-cation Hamiltonian entering this theory can be found exactly general. The two-electron formalism is shown to provide a useful basis for calculating both non-magnetic and magnetic properties of semiconductors in perturbation theory. As an example of the former, expressions for the electric susceptibility and the dielectric constant were calculated. As an example of the latter, new expressions for the nuclear exchanges and pseudo-dipolar coefficients were calculated. A simple theoretical relationship between the dielectric constant and the exchange coefficient was also found in the limit of no correlation. These expressions were quantitatively evaluated in the limit of no correlation for twenty semiconductors.

Measurement and dynamics of the spatial distribution of an electron localized at a metal-dielectric interface

NASA Astrophysics Data System (ADS)

Bezel, Ilya; Gaffney, Kelly J.; Garrett-Roe, Sean; Liu, Simon H.; Miller, André D.; Szymanski, Paul; Harris, Charles B.

2004-01-01

The ability of time- and angle-resolved two-photon photoemission to estimate the size distribution of electron localization in the plane of a metal-adsorbate interface is discussed. It is shown that the width of angular distribution of the photoelectric current is inversely proportional to the electron localization size within the most common approximations in the description of image potential states. The localization of the n=1 image potential state for two monolayers of butyronitrile on Ag(111) is used as an example. For the delocalized n=1 state, the shape of the signal amplitude as a function of momentum parallel to the surface changes rapidly with time, indicating efficient intraband relaxation on a 100 fs time scale. For the localized state, little change was observed. The latter is related to the constant size distribution of electron localization, which is estimated to be a Gaussian with a 15±4 Å full width at half maximum in the plane of the interface. A simple model was used to study the effect of a weak localization potential on the overall width of the angular distribution of the photoemitted electrons, which exhibited little sensitivity to the details of the potential. This substantiates the validity of the localization size estimate.

Dose rate constants for the quantity Hp(3) for frequently used radionuclides in nuclear medicine.

PubMed

Szermerski, Bastian; Bruchmann, Iris; Behrens, Rolf; Geworski, Lilli

2016-12-01

According to recent studies, the human eye lens is more sensitive to ionising radiation than previously assumed. Therefore, the dose limit for personnel occupationally exposed to ionising radiation will be lowered from currently 150 mSv to 20 mSv per year. Currently, no data base for a reliable estimation of the dose to the lens of the eye is available for nuclear medicine. Furthermore, the dose is usually not monitored. The aim of this work was to determine dose rate constants for the quantity H p (3), which is supposed to estimate the dose to the lens of the eye. For this, H p (3)-dosemeters were fixed to an Alderson Phantom at different positions. The dosemeters were exposed to radiation from nuclides typically used in nuclear medicine in their geometries analog to their application in nuclear medicine, e.g. syringe or vial. The results show that the handling of high-energy beta (i.e. electron or positron) emitters may lead to a relevant dose to the lens of the eye. For low-energy beta emitters and gamma emitters, an exceeding of the lowered dose limit seems to be unlikely. Copyright © 2015. Published by Elsevier GmbH.

Capillary suspensions as beneficial formulation concept for high energy density Li-ion battery electrodes

NASA Astrophysics Data System (ADS)

Bitsch, Boris; Gallasch, Tobias; Schroeder, Melanie; Börner, Markus; Winter, Martin; Willenbacher, Norbert

2016-10-01

We introduce a novel formulation concept to prepare high capacity graphite electrodes for lithium ion batteries. The concept is based on the capillary suspension phenomenon: graphite and conductive agent are dispersed in an aqueous binder solution and the organic solvent octanol is added as immiscible, secondary fluid providing the formation of a sample-spanning network resulting in unique stability and coating properties. No additional processing steps compared to conventional slurry preparation are required. The resulting ultra-thick electrodes comprise mass loadings of about 16.5 mg cm-2, uniform layer thickness, and superior edge contours. The adjustment of mechanical energy input ensures uniform distribution of the conductive agent and sufficient electronic conductivity of the final dry composite electrode. The resulting pore structure is due to the stable network provided by the secondary fluid which evaporates residue-free during drying. Constant current-constant potential (CC-CP) cycling clearly indicates that the corresponding microstructure significantly improves the kinetics of reversible Li+ (de-) intercalation. A double layer electrode combining a conventionally prepared layer coated directly onto the Cu current collector with an upper layer stabilized with octanol was prepared applying wet-on-wet coating. CC-CP cycling data confirms that staged porosity within the electrode cross section results in superior electrochemical performance.

An area and power-efficient analog li-ion battery charger circuit.

PubMed

Do Valle, Bruno; Wentz, Christian T; Sarpeshkar, Rahul

2011-04-01

The demand for greater battery life in low-power consumer electronics and implantable medical devices presents a need for improved energy efficiency in the management of small rechargeable cells. This paper describes an ultra-compact analog lithium-ion (Li-ion) battery charger with high energy efficiency. The charger presented here utilizes the tanh basis function of a subthreshold operational transconductance amplifier to smoothly transition between constant-current and constant-voltage charging regimes without the need for additional area- and power-consuming control circuitry. Current-domain circuitry for end-of-charge detection negates the need for precision-sense resistors in either the charging path or control loop. We show theoretically and experimentally that the low-frequency pole-zero nature of most battery impedances leads to inherent stability of the analog control loop. The circuit was fabricated in an AMI 0.5-μm complementary metal-oxide semiconductor process, and achieves 89.7% average power efficiency and an end voltage accuracy of 99.9% relative to the desired target 4.2 V, while consuming 0.16 mm(2) of chip area. To date and to the best of our knowledge, this design represents the most area-efficient and most energy-efficient battery charger circuit reported in the literature.

Evaluation of constant current alternating current iontophoresis for transdermal drug delivery.

PubMed

Yan, Guang; Li, S Kevin; Higuchi, William I

2005-12-10

Previous studies in our laboratory have demonstrated that alternating current (AC) iontophoresis can significantly decrease skin electric resistance and enhance the transport of charged permeants across skin. Flux variability of neutral permeants during AC iontophoresis was also found to be less than that of conventional direct current (DC) iontophoresis. The objectives of the present study were to evaluate flux enhancement of constant current AC transdermal iontophoresis and compare the AC flux with that of constant current DC iontophoresis. Iontophoresis studies of AC amplitude of 1, 2, and 5 mA were conducted in side-by-side diffusion cells with donor solution of 0.015, 0.15, and 1.0 M tetraethylammonium (TEA) chloride and receiver solution of phosphate buffered saline (PBS) using human epidermal membrane (HEM). Conventional constant current DC iontophoresis of 0.2 mA was also performed under similar conditions. TEA and mannitol were the model permeants. The following are the major findings in the present study. The flux of TEA increased proportionally with the AC current for all three TEA chloride concentrations and at the AC frequency used in the present study. When the permeant and its counter ion were the only ionic species in the donor chamber, the fluxes during DC iontophoresis were weakly dependent of its donor concentration. The fluxes of TEA during constant current AC iontophoresis were moderately related to the donor concentration with the highest TEA flux observed under the 1.0 M TEA chloride condition although the relationship between flux and donor concentration was not linear. A trend of decreasing electroosmotic transport with increasing donor TEA chloride concentration was observed with significant sample-to-sample variability during DC iontophoresis. Mannitol permeability was also observed to decrease with increasing TEA chloride concentration in the donor under the AC conditions, but data variability under AC was significantly smaller than that under DC. The results in the present study indicate that constant current AC iontophoresis under conditions tolerable to human (2 and 5 mA) can provide predictable fluxes that were lower than but of comparable magnitude as those of conventional constant current DC iontophoresis (0.2 mA).

Charge transport in vertically aligned, self-assembled peptide nanotube junctions.

PubMed

Mizrahi, Mordechay; Zakrassov, Alexander; Lerner-Yardeni, Jenny; Ashkenasy, Nurit

2012-01-21

The self-assembly propensity of peptides has been extensively utilized in recent years for the formation of supramolecular nanostructures. In particular, the self-assembly of peptides into fibrils and nanotubes makes them promising building blocks for electronic and electro-optic applications. However, the mechanisms of charge transfer in these wire-like structures, especially in ambient conditions, are not yet fully understood. We describe here a layer-by-layer deposition methodology of short self-assembled cyclic peptide nanotubes, which results in vertically oriented nanotubes on gold substrates. Using this novel deposition methodology, we have fabricated molecular junctions with a conductive atomic force microscopy tip as a second electrode. Studies of the junctions' current-voltage characteristics as a function of the nanotube length revealed an efficient charge transfer in these supramolecular structures, with a low current attenuation constant of 0.1 Å(-1), which indicate that electron transfer is dominated by hopping. Moreover, the threshold voltage to field-emission dominated transport was found to increase with peptide length in a manner that depends on the nature of the contact with the electrodes. The flexibility in the design of the peptide monomers and the ability to control their sequential order over the nanotube by means of the layer-by-layer assembly process, which is demonstrated in this work, can be used to engineer the electronic properties of self-assembled peptide nanotubes toward device applications.

NbN single-photon detectors with saturated dependence of quantum efficiency

NASA Astrophysics Data System (ADS)

Smirnov, Konstantin; Divochiy, Alexander; Vakhtomin, Yury; Morozov, Pavel; Zolotov, Philipp; Antipov, Andrey; Seleznev, Vitaliy

2018-07-01

The possibility of creating NbN superconducting single-photon detectors with saturated dependence of quantum efficiency (QE) versus normalized bias current was investigated. It was shown that the saturation increases for the detectors based on finer films with a lower value of R s300/R s20. The decreasing of R s300/R s20 was related to the increasing influence of quantum corrections to conductivity of superconductors and, in turn, to the decrease of the electron diffusion coefficient. The best samples have a constant value of system QE 94% at I b /I c ∼ 0.8 and wavelength 1310 nm.

Investigation of terbium scandate as an alternative gate dielectric in fully depleted transistors

NASA Astrophysics Data System (ADS)

Roeckerath, M.; Lopes, J. M. J.; Özben, E. Durǧun; Urban, C.; Schubert, J.; Mantl, S.; Jia, Y.; Schlom, D. G.

2010-01-01

Terbium scandate thin films were deposited by e-gun evaporation on (100) silicon substrates. Rutherford backscattering spectrometry and x-ray diffraction studies revealed homogeneous chemical compositions of the films. A dielectric constant of 26 and CV-curves with small hystereses were measured as well as low leakage current densities of <1 nA/cm2. Fully depleted n-type field-effect transistors on thin silicon-on-insulator substrates with terbium scandate gate dielectrics were fabricated with a gate-last process. The devices show inverse subthreshold slopes of 80 mV/dec and a carrier mobility for electrons of 225 cm2/V•s was extracted.

Thermoelectric properties of n-type SrTiO 3

DOE PAGES

Sun, Jifeng; Singh, David J.

2016-05-26

We present an investigation of the thermoelectric properties of cubic perovskite SrTiO 3. The results are derived from a combination of calculated transport functions obtained from Boltzmann transport theory in the constant scattering time approximation based on the electronic structure and existing experimental data for La-doped SrTiO 3. The figure of merit ZT is modeled with respect to carrier concentration and temperature. The model predicts a relatively high ZT at optimized doping and suggests that the ZT value can reach 0.7 at T = 1400 K. Thus ZT can be improved from the current experimental values by carrier concentration optimization.

Voltage-Induced Nonlinear Conduction Properties of Epoxy Resin/Micron-Silver Particles Composites

NASA Astrophysics Data System (ADS)

Qu, Zhaoming; Lu, Pin; Yuan, Yang; Wang, Qingguo

2018-01-01

The nonlinear conduction properties of epoxy resin (ER)/micron-silver particles (MP) composites were investigated. Under sufficient high intensity applied constant voltage, the obvious nonlinear conduction properties of the samples with volume fraction 25% were found. With increments in the voltage, the conductive switching effect was observed. The nonlinear conduction mechanism of the ER/MP composites under high applied voltages could be attributed to the electrical current conducted via discrete paths of conductive particles induced by the electric field. The test results show that the ER/MP composites with nonlinear conduction properties are of great potential application in electromagnetic protection of electron devices and systems.

Thermoelectric properties of n-type SrTiO3

NASA Astrophysics Data System (ADS)

Sun, Jifeng; Singh, David J.

2016-10-01

We present an investigation of the thermoelectric properties of cubic perovskite SrTiO3. The results are derived from a combination of calculated transport functions obtained from Boltzmann transport theory in the constant scattering time approximation based on the electronic structure and existing experimental data for La-doped SrTiO3. The figure of merit ZT is modeled with respect to carrier concentration and temperature. The model predicts a relatively high ZT at optimized doping and suggests that the ZT value can reach 0.7 at T = 1400 K. Thus ZT can be improved from the current experimental values by carrier concentration optimization.

First-Principles Calculations of Structural, Electronic and Optical Properties of Ternary Semiconductor Alloys ZAs x Sb1- x ( Z = B, Al, Ga, In)

NASA Astrophysics Data System (ADS)

Bounab, S.; Bentabet, A.; Bouhadda, Y.; Belgoumri, Gh.; Fenineche, N.

2017-08-01

We have investigated the structural and electronic properties of the BAs x Sb 1- x , AlAs x Sb 1- x , GaAs x Sb 1- x and InAs x Sb 1- x semiconductor alloys using first-principles calculations under the virtual crystal approximation within both the density functional perturbation theory and the pseudopotential approach. In addition the optical properties have been calculated by using empirical methods. The ground state properties such as lattice constants, both bulk modulus and derivative of bulk modulus, energy gap, refractive index and optical dielectric constant have been calculated and discussed. The obtained results are in reasonable agreement with numerous experimental and theoretical data. The compositional dependence of the lattice constant, bulk modulus, energy gap and effective mass of electrons for ternary alloys show deviations from Vegard's law where our results are in agreement with the available data in the literature.

Electrochemical characterization and control of triple-layer muscles

NASA Astrophysics Data System (ADS)

Otero, Toribio F.; Cortes, Maria T.

2000-06-01

The electrochemical characterization of triple-layers formed by a EPA (Electroactive Polymer)/double-sided tape/EPA, like artificial muscles is described. Those muscles were characterized working under constant potential or under constant current. Due to the electrochemical nature of the electrochemomechanical property, muscles working under constant current produce constant movements, consuming increasing energies at decreasing temperatures, decreasing concentrations of electrolytes or trailing increasing masses. Muscles working at constant potential response with a faster movement if the temperature or the concentration of the electrolyte increase, or if the trailed weight decreases. Specific charges and specific energies were determined for every experimental condition.

One-electron versus electron-electron interaction contributions to the spin-spin coupling mechanism in nuclear magnetic resonance spectroscopy: Analysis of basic electronic effects

NASA Astrophysics Data System (ADS)

Gräfenstein, Jürgen; Cremer, Dieter

2004-12-01

For the first time, the nuclear magnetic resonance (NMR) spin-spin coupling mechanism is decomposed into one-electron and electron-electron interaction contributions to demonstrate that spin-information transport between different orbitals is not exclusively an electron-exchange phenomenon. This is done using coupled perturbed density-functional theory in conjunction with the recently developed J-OC-PSP [=J-OC-OC-PSP: Decomposition of J into orbital contributions using orbital currents and partial spin polarization)] method. One-orbital contributions comprise Ramsey response and self-exchange effects and the two-orbital contributions describe first-order delocalization and steric exchange. The two-orbital effects can be characterized as external orbital, echo, and spin transport contributions. A relationship of these electronic effects to zeroth-order orbital theory is demonstrated and their sign and magnitude predicted using simple models and graphical representations of first order orbitals. In the case of methane the two NMR spin-spin coupling constants result from totally different Fermi contact coupling mechanisms. 1J(C,H) is the result of the Ramsey response and the self-exchange of the bond orbital diminished by external first-order delocalization external one-orbital effects whereas 2J(H,H) spin-spin coupling is almost exclusively mitigated by a two-orbital steric exchange effect. From this analysis, a series of prediction can be made how geometrical deformations, electron lone pairs, and substituent effects lead to a change in the values of 1J(C,H) and 2J(H,H), respectively, for hydrocarbons.

Power-control switch

NASA Technical Reports Server (NTRS)

Kessler, L. L.

1976-01-01

Constant-current source creates drive current independent of input-voltage variations, 50% reduction in power loss in base drive circuitry, maintains essentially constant charge rate, and improves rise-time consistency over input voltage range.

Dibenzothiophene-Substituted Fullerene Derivative as Electron Acceptor for Polymer Solar Cells.

PubMed

Kim, Hee Un; Park, Jong Baek; Hwang, Do-Hoon

2016-05-01

A new fullerene derivative, [6,6]-dibenzo[b,d]thiophene-C61-butyric acid methyl ester (DBTC61BM) was synthesized from C60 using tosylhydrazone, and used as an electron-acceptor material for poly(3-hexylthiophene) (P3HT)-based organic photovoltaic cells. The synthesized DBTC61BM was used to modify the basic structure of [6,6]-phenyl-C61-butyric acid methyl ester (PC61BM) by replacing the aromatic part with dibenzo[b,d]thiophene. The solubilities of DBTC61BM and PC61BM are similar; they have good solubilities in common organic solvents such as dichloromethane, chloroform, toluene, and 1,2-dichlorobenzene. The Stern-Volmer quenching constant (K(sv)) of DBTC61BM was 7.14 x 10(3) M(-1), and was correlated with the binding affinity between the fluorophore and a quencher. The lowest unoccupied molecular orbital energy level of DBTC61BM was -3.71 eV. The charge-carrier mobility of a P3HT:DBTC61BM blend film was determined using the space-charge-limited current method; the electron mobility value obtained for the P3HT:DBTC61BM blend film was 2.13 x 10(-4) cm2 V(-1) s(-1). Photovoltaic devices were fabricated using P3HT as the electron donor and DBTC61BM as the electron acceptor. Among the fabricated devices, photovoltaic cells with the structure ITO/PEDOT:PSS/P3HT:DBTC61BM/LiF/Al showed the highest power conversion efficiency, namely 3.23%, with an open-circuit voltage of 0.64 V, short-circuit-current density of 8.14 mA cm(-2), and fill factor of 0.59, under AM 1.5 G (100 mW cm(-2)) illumination.

Hole injection and dielectric breakdown in 6H-SiC and 4H-SiC metal-oxide-semiconductor structures during substrate electron injection via Fowler-Nordheim tunneling

NASA Astrophysics Data System (ADS)

Samanta, Piyas; Mandal, Krishna C.

2015-12-01

Hole injection into silicon dioxide (SiO2) films (8-40 nm thick) is investigated for the first time during substrate electron injection via Fowler-Nordheim (FN) tunneling in n-type 4H- and 6H-SiC (silicon carbide) based metal-oxide-semiconductor (MOS) structures at a wide range of temperatures (T) between 298 and 598 K and oxide electric fields Eox from 6 to 10 MV/cm. Holes are generated in heavily doped n-type polycrystalline silicon (n+ -polySi) gate serving as the anode as well as in the bulk silicon dioxide (SiO2) film via hot-electron initiated band-to-band ionization (BTBI). In absence of oxide trapped charges, it is shown that at a given temperature, the hole injection rates from either of the above two mechanisms are higher in n-4H-SiC MOS devices than those in n-6H-SiC MOS structures when compared at a given Eox and SiO2 thickness (tox). On the other hand, relative to n-4H-SiC devices, n-6H-SiC structures exhibit higher hole injection rates for a given tox during substrate electron injection at a given FN current density je,FN throughout the temperature range studied here. These two observations clearly reveal that the substrate material (n-6H-SiC and n-4H-SiC) dependencies on time-to-breakdown (tBD) or injected charge (electron) to breakdown (QBD) of the SiO2 film depend on the mode of FN injections (constant field/voltage and current) from the substrate which is further verified from the rigorous device simulation as well.

Bioconjugation of zirconium uridine monophosphate: application to myoglobin direct electrochemistry.

PubMed

Qiao, Yuanbiao; Jian, Fangfang; Bai, Qian

2008-03-14

Porous nano-granule of zirconium uridine monophosphate, Zr(UMP)2.H2O is, for the first time, synthesized under mild experimental conditions and applied to the bioconjugation of myoglobin (Mb) to realize its direct electron transfer. UV-vis and resonance Raman spectroscopies prove that Mb in the Zr(UMP)2.H2O film maintains its secondary structure similar to the native state. The conjugation film of the Mb-Zr(UMP)2.H2O on the glassy carbon (GC) electrode gives a well-defined and quasi-reversible cyclic voltammogram, which reflects the direct electron transfer of the heme Fe III/Fe II couple of Mb. On the basis of the satisfying bioelectrocatalysis of the nano-conjugation of Mb and genetic substrate, a kind of mediator-free biosensor for H2O2 is developed. The linear range for H2O2 detection is estimated to be 3.92-180.14 microM. The apparent Michaelis-Menten constant (Km) and the detection limit based on the signal-to-noise ratio of 3 are found to be 196.1 microM and 1.52 microM, respectively. Both the apparent Michaelis-Menten constant and the detection limit herein are much lower than currently reported values from other Mb films. This kind of sensor possesses excellent stability, long-term life (more than 20 days) and good reproducibility.

Study of short atmospheric pressure dc glow microdischarge in air

NASA Astrophysics Data System (ADS)

Kudryavtsev, Anatoly; Bogdanov, Eugene; Chirtsov, Alexander; Emelin, Sergey

2011-10-01

The results of experiments and simulations of short (without positive column) atmospheric pressure dc glow discharge in air are presented. We used metal steel electrodes with a gap of 5-100 microns. The experimental voltage-current characteristic's (VAC) have a constant or slightly increasing form at low gap. The most stable microdischarges were burning with a flat cathode and rounded anode, when the length of the discharge is automatically established near the minimum of the Paschen curve by changing their binding on the anode. In this case microdischarge was stable and it had growing VAC. For simulations we used 2D fluid model with kinetic description of electrons. We solved the balance equations for the vibrationally- and the electronically-excited states of a nitrogen and oxygen molecules; nitrogen and oxygen atoms; ozone molecule; and different nitrogen and oxygen ions with different plasmochemical reactions between them. Simulations predicted the main regions of the dc glow discharges including cathode and anode sheath and plasma of negative glow, Faraday dark space and transition region. Gas heating plays an important role in shaping the discharge profiles. The results of experiments and simulations of short (without positive column) atmospheric pressure dc glow discharge in air are presented. We used metal steel electrodes with a gap of 5-100 microns. The experimental voltage-current characteristic's (VAC) have a constant or slightly increasing form at low gap. The most stable microdischarges were burning with a flat cathode and rounded anode, when the length of the discharge is automatically established near the minimum of the Paschen curve by changing their binding on the anode. In this case microdischarge was stable and it had growing VAC. For simulations we used 2D fluid model with kinetic description of electrons. We solved the balance equations for the vibrationally- and the electronically-excited states of a nitrogen and oxygen molecules; nitrogen and oxygen atoms; ozone molecule; and different nitrogen and oxygen ions with different plasmochemical reactions between them. Simulations predicted the main regions of the dc glow discharges including cathode and anode sheath and plasma of negative glow, Faraday dark space and transition region. Gas heating plays an important role in shaping the discharge profiles. This work was supported by the FZP and SPbGU

Structural, electronic and thermal properties of super hard ternary boride, WAlB

NASA Astrophysics Data System (ADS)

Rajpoot, Priyanka; Rastogi, Anugya; Verma, U. P.

2018-04-01

A first principle study of the structural, electronic and thermal properties of Tungsten Aluminum Boride (WAlB) using full-potential linearized augmented plane wave (FP-LAPW) in the frame work of density function theory (DFT) have been calculated. The calculated equilibrium structural parameters are in excellent agreement with available experimental results. The calculated electronic band structure reveals that WAlB is metallic in nature. The quasi-harmonic Debye model is applied to study of the temperature and pressure effect on volume, Debye temperature, thermal expansion coefficient and specific heat at constant volume and constant pressure. To the best of our knowledge theoretical investigation of these properties of WAlB is reported for the first time.

First-principles study of structural and electronic properties of Be0.25Zn0.75S mixed compound

NASA Astrophysics Data System (ADS)

Paliwal, U.; Joshi, K. B.

2018-05-01

In this work the first-principles study of structural and electronic properties of Be0.25Zn0.75S mixed compound is presented. The calculations are performed applying the QUANTUM ESPRESSO code utilizing the Perdew, Becke, Ernzerhof generalized gradient approximation in the framework of density functional theory. Adopting standard optimization strategy, the ground state equilibrium lattice constant and bulk modulus are calculated. After settling the structure the electronic band structure, bandgap and static dielectric constant are evaluated. In absence of any experimental work on this system our findings are compared with the available theoretical calculations which are found to follow well anticipated general trends.

Theoretical calculations of structural, electronic, and elastic properties of CdSe1-x Te x : A first principles study

NASA Astrophysics Data System (ADS)

M, Shakil; Muhammad, Zafar; Shabbir, Ahmed; Muhammad Raza-ur-rehman, Hashmi; M, A. Choudhary; T, Iqbal

2016-07-01

The plane wave pseudo-potential method was used to investigate the structural, electronic, and elastic properties of CdSe1-x Te x in the zinc blende phase. It is observed that the electronic properties are improved considerably by using LDA+U as compared to the LDA approach. The calculated lattice constants and bulk moduli are also comparable to the experimental results. The cohesive energies for pure CdSe and CdTe binary and their mixed alloys are calculated. The second-order elastic constants are also calculated by the Lagrangian theory of elasticity. The elastic properties show that the studied material has a ductile nature.

Formation of tetragonal gas bubble superlattice in bulk molybdenum under helium ion implantation

DOE PAGES

Sun, Cheng; Sprouster, David J.; Hattar, K.; ...

2018-02-09

In this paper, we report the formation of tetragonal gas bubble superlattice in bulk molybdenum under helium ion implantation at 573 K. The transmission electron microscopy study shows that the helium bubble lattice constant measured from the in-plane d-spacing is ~4.5 nm, while it is ~3.9 nm from the out-of-plane measurement. The results of synchrotron-based small-angle x-ray scattering agree well with the transmission electron microscopy results in terms of the measurement of bubble lattice constant and bubble size. The coupling of transmission electron microscopy and synchrotron high-energy X-ray scattering provides an effective approach to study defect superlattices in irradiated materials.

Formation of tetragonal gas bubble superlattice in bulk molybdenum under helium ion implantation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Cheng; Sprouster, David J.; Hattar, K.

In this paper, we report the formation of tetragonal gas bubble superlattice in bulk molybdenum under helium ion implantation at 573 K. The transmission electron microscopy study shows that the helium bubble lattice constant measured from the in-plane d-spacing is ~4.5 nm, while it is ~3.9 nm from the out-of-plane measurement. The results of synchrotron-based small-angle x-ray scattering agree well with the transmission electron microscopy results in terms of the measurement of bubble lattice constant and bubble size. The coupling of transmission electron microscopy and synchrotron high-energy X-ray scattering provides an effective approach to study defect superlattices in irradiated materials.

Anisotropic electrical transport of flexible tungsten carbide nanostructures: towards nanoscale interconnects and electron emitters

NASA Astrophysics Data System (ADS)

Sun, Bo; Sun, Yong; Wang, Chengxin

2017-11-01

Due to the coexistence of metal- and ionic-bonds in a hexagonal tungsten carbide (WC) lattice, disparate electron behaviors were found in the basal plane and along the c-axial direction, which may create an interesting anisotropic mechanical and electrical performance. To demonstrate this, low-dimensional nanostructures such as nanowires and nanosheets are suitable for investigation because they usually grow in single crystals with special orientations. Herein, we report the experimental research regarding the anisotropic conductivity of [0001] grown WC nanowires and basal plane-expanded nanosheets, which resulted in a conductivity of 7.86 × 103 Ω-1 · m-1 and 7.68 × 104 Ω-1 · m-1 respectively. This conforms to the fact that the highly localized W d state aligns along the c direction, while there is little intraplanar directional bonding in the W planes. With advanced micro-manipulation technology, the conductivity of a nanowire was tested to be approximately constant, even under a considerable bending state. Moreover, the field electron emission of WC was evaluated based on large area emission and single nanowire (nanosheet) emission. A single nanowire exhibits a stable electron emission performance, which can output emission currents >3 uA before fusing. These results provide useful references to assess low-dimensional WC nanostructures as electronic materials in flexible devices, such as nanoscale interconnects and electron emitters.

Insulation Resistance Degradation in Ni-BaTiO3 Multilayer Ceramic Capacitors

NASA Technical Reports Server (NTRS)

Liu, Donhang (David)

2015-01-01

Insulation resistance (IR) degradation in Ni-BaTiO3 multilayer ceramic capacitors has been characterized by the measurement of both time to failure and direct-current (DC) leakage current as a function of stress time under highly accelerated life test conditions. The measured leakage current-time dependence data fit well to an exponential form, and a characteristic growth time ?SD can be determined. A greater value of tau(sub SD) represents a slower IR degradation process. Oxygen vacancy migration and localization at the grain boundary region results in the reduction of the Schottky barrier height and has been found to be the main reason for IR degradation in Ni-BaTiO3 capacitors. The reduction of barrier height as a function of time follows an exponential relation of phi (??)=phi (0)e(exp -2?t), where the degradation rate constant ??=??o??(????/????) is inversely proportional to the mean time to failure (MTTF) and can be determined using an Arrhenius plot. For oxygen vacancy electromigration, a lower barrier height phi(0) will favor a slow IR degradation process, but a lower phi(0) will also promote electronic carrier conduction across the barrier and decrease the insulation resistance. As a result, a moderate barrier height phi(0) (and therefore a moderate IR value) with a longer MTTF (smaller degradation rate constant ??) will result in a minimized IR degradation process and the most improved reliability in Ni-BaTiO3 multilayer ceramic capacitors.

Insulation Resistance Degradation in Ni-BaTiO3 Multilayer Ceramic Capacitors

NASA Technical Reports Server (NTRS)

Liu, Donhang David

2015-01-01

Insulation resistance (IR) degradation in NiBaTiO3 multilayer ceramic capacitors has been characterized by the measurement of both time to failure (TTF) and direct current leakage current as a function of stress time under highly accelerated life test conditions. The measured leakage current time dependence data fit well to an exponential form, and a characteristic growth time tau (sub SD) can be determined. A greater value of tau (sub SD) represents a slower IR degradation process. Oxygen vacancy migration and localization at the grain boundary region results in the reduction of the Schottky barrier height and has been found to be the main reason for IR degradation in NiBaTiO3 capacitors. The reduction of barrier height as a function oftime follows an exponential relation of phi (t ) = phi (0) e (exp -2Kt), where 13 the degradation rate constant K Koe (Ek/kT) is inversely proportional to the mean TTF (MTTF) and can be determined using an Arrhenius plot. For oxygen vacancy electromigration, a lower barrier height phi (0) will favor a slow IR degradation process, but a lower phi (0) will also promote electronic carrier conduction across the barrier and decrease the IR. As a result, a moderate barrier height phi (0) (and therefore a moderate IR value) with a longer MTTF (smaller degradation rate constant K) will result in a minimized IR degradation process and the most improved reliability in NiBaTiO3 multilayer ceramic capacitors.

Ab Initio Prediction of the Structural, Electronic, Elastic, and Thermoelectric Properties of Half-Heusler Ternary Compounds TiIrX (X = As and Sb)

NASA Astrophysics Data System (ADS)

Chibani, S.; Arbouche, O.; Zemouli, M.; Amara, K.; Benallou, Y.; Azzaz, Y.; Belgoumène, B.; Bentayeb, A.; Ameri, M.

2018-01-01

The structural, electronic, elastic, and thermoelectric properties of TiIrX (X = As and Sb) half-Heusler compounds with 18 valence electrons were studied using density functional theory. The generalized gradient approximation of Perdew-Burke and Ernzerhof used for calculation of the structural parameters and elastic properties of TiIrAs and TiIrSb denotes that the computed lattice constants were in excellent agreement with the available experimental data and previous theoretical works. Furthermore, the calculated elastic constants for both compounds satisfy the Born criteria indicating their mechanical stabilities. The modified Becke-Johnson potential (TB-mBJ) was used to provide a better description of the electronic structures, which indicate that both compounds are narrow-gap semiconductors. Additionally, the investigations of thermoelectric performance were carried out using the results of ab initio band-structure calculations and the semi-classical Boltzmann theory within the constant relaxation time approximations. The predicted values of the figure of merit ZT e are close to unity at room temperature. This reveals that TiIrAs and TiIrSb compounds are excellent candidates for practical applications in the thermoelectric devices.

Facile synthesis of three dimensional hierarchical Co-Al layered double hydroxides on graphene as high-performance materials for supercapacitor electrode.

PubMed

Hao, Jinhui; Yang, Wenshu; Zhang, Zhe; Lu, Baoping; Ke, Xi; Zhang, Bailin; Tang, Jilin

2014-07-15

A facile simple hydrothermal method combined with a post-solution reaction is developed to grow interconnected three dimensional (3D) hierarchical Co-Al layered double hydroxides (LDHs) on reduced graphene oxide (rGO). The obtained 3D hierarchical rGO-LDHs are characterized by field emission scanning electron microscopy, X-ray diffraction, and X-ray photo-electron spectroscopy. As LDHs nanosheets directly grow on the surface of rGO via chemical covalent bonding, the rGO could provide facile electron transport paths in the electrode for the fast Faradaic reaction. Moreover, benefiting from the rational 3D hierarchical structural, the rGO-LDHs demonstrate excellent electrochemical properties with a combination of high charge storage capacitance, fast rate capability and stable cycling performance. Remarkably, the 3D hierarchical rGO-LDHs exhibit specific capacitance values of 599 F g(-1) at a constant current density of 4 A g(-1). The rGO-LDHs also show high charge-discharge reversibility with an efficiency of 92.4% after 5000 cycles. Copyright © 2014 Elsevier Inc. All rights reserved.

Axion Induced Oscillating Electric Dipole Moment of the Electron

DOE PAGES

Hill, Christopher T.

2016-01-12

A cosmic axion, via the electromagnetic anomaly, induces an oscillating electric dipole for the electron of frequency ma and strength ~(few) x 10 -32 e-cm, two orders of magnitude above the nucleon, and within a few orders of magnitude of the present standard model constant limit. We give a detailed study of this phenomenon via the interaction of the cosmic axion, through the electromagnetic anomaly, with particular emphasis on the decoupling limit of the axion, ∂ ta(t) ∝ m α → 0. The analysis is subtle, and we find the general form of the action involves a local contact interactionmore » and a nonlocal contribution, analogous to the “transverse current” in QED, that enforces the decoupling limit. We carefully derive the effective action in the Pauli-Schroedinger non-relativistic formalism, and in Georgi’s heavy quark formalism adapted to the “heavy electron” (m e >> m a). We compute the electric dipole radiation emitted by free electrons, magnets and currents, immersed in the cosmic axion field, and discuss experimental configurations that may yield a detectable signal.« less

Axion Induced Oscillating Electric Dipole Moment of the Electron

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hill, Christopher T.

A cosmic axion, via the electromagnetic anomaly, induces an oscillating electric dipole for the electron of frequency ma and strength ~(few) x 10 -32 e-cm, two orders of magnitude above the nucleon, and within a few orders of magnitude of the present standard model constant limit. We give a detailed study of this phenomenon via the interaction of the cosmic axion, through the electromagnetic anomaly, with particular emphasis on the decoupling limit of the axion, ∂ ta(t) ∝ m α → 0. The analysis is subtle, and we find the general form of the action involves a local contact interactionmore » and a nonlocal contribution, analogous to the “transverse current” in QED, that enforces the decoupling limit. We carefully derive the effective action in the Pauli-Schroedinger non-relativistic formalism, and in Georgi’s heavy quark formalism adapted to the “heavy electron” (m e >> m a). We compute the electric dipole radiation emitted by free electrons, magnets and currents, immersed in the cosmic axion field, and discuss experimental configurations that may yield a detectable signal.« less

THz-circuits driven by photo-thermoelectric, gate-tunable graphene-junctions

NASA Astrophysics Data System (ADS)

Brenneis, Andreas; Schade, Felix; Drieschner, Simon; Heimbach, Florian; Karl, Helmut; Garrido, Jose A.; Holleitner, Alexander W.

2016-10-01

For future on-chip communication schemes, it is essential to integrate nanoscale materials with an ultrafast optoelectronic functionality into high-frequency circuits. The atomically thin graphene has been widely demonstrated to be suitable for photovoltaic and optoelectronic devices because of its broadband optical absorption and its high electron mobility. Moreover, the ultrafast relaxation of photogenerated charge carriers has been verified in graphene. Here, we show that dual-gated graphene junctions can be functional parts of THz-circuits. As the underlying optoelectronic process, we exploit ultrafast photo-thermoelectric currents. We describe an immediate photo-thermoelectric current of the unbiased device following a femtosecond laser excitation. For a picosecond time-scale after the optical excitation, an additional photo-thermoelectric contribution shows up, which exhibits the fingerprint of a spatially inverted temperature profile. The latter can be understood by the different time-constants and thermal coupling mechanisms of the electron and phonon baths within graphene to the substrate and the metal contacts. The interplay of the processes gives rise to ultrafast electromagnetic transients in high-frequency circuits, and it is equally important for a fundamental understanding of graphene-based ultrafast photodetectors and switches.

THz-circuits driven by photo-thermoelectric, gate-tunable graphene-junctions

PubMed Central

Brenneis, Andreas; Schade, Felix; Drieschner, Simon; Heimbach, Florian; Karl, Helmut; Garrido, Jose A.; Holleitner, Alexander W.

2016-01-01

For future on-chip communication schemes, it is essential to integrate nanoscale materials with an ultrafast optoelectronic functionality into high-frequency circuits. The atomically thin graphene has been widely demonstrated to be suitable for photovoltaic and optoelectronic devices because of its broadband optical absorption and its high electron mobility. Moreover, the ultrafast relaxation of photogenerated charge carriers has been verified in graphene. Here, we show that dual-gated graphene junctions can be functional parts of THz-circuits. As the underlying optoelectronic process, we exploit ultrafast photo-thermoelectric currents. We describe an immediate photo-thermoelectric current of the unbiased device following a femtosecond laser excitation. For a picosecond time-scale after the optical excitation, an additional photo-thermoelectric contribution shows up, which exhibits the fingerprint of a spatially inverted temperature profile. The latter can be understood by the different time-constants and thermal coupling mechanisms of the electron and phonon baths within graphene to the substrate and the metal contacts. The interplay of the processes gives rise to ultrafast electromagnetic transients in high-frequency circuits, and it is equally important for a fundamental understanding of graphene-based ultrafast photodetectors and switches. PMID:27762291

THz-circuits driven by photo-thermoelectric, gate-tunable graphene-junctions.

PubMed

Brenneis, Andreas; Schade, Felix; Drieschner, Simon; Heimbach, Florian; Karl, Helmut; Garrido, Jose A; Holleitner, Alexander W

2016-10-20

For future on-chip communication schemes, it is essential to integrate nanoscale materials with an ultrafast optoelectronic functionality into high-frequency circuits. The atomically thin graphene has been widely demonstrated to be suitable for photovoltaic and optoelectronic devices because of its broadband optical absorption and its high electron mobility. Moreover, the ultrafast relaxation of photogenerated charge carriers has been verified in graphene. Here, we show that dual-gated graphene junctions can be functional parts of THz-circuits. As the underlying optoelectronic process, we exploit ultrafast photo-thermoelectric currents. We describe an immediate photo-thermoelectric current of the unbiased device following a femtosecond laser excitation. For a picosecond time-scale after the optical excitation, an additional photo-thermoelectric contribution shows up, which exhibits the fingerprint of a spatially inverted temperature profile. The latter can be understood by the different time-constants and thermal coupling mechanisms of the electron and phonon baths within graphene to the substrate and the metal contacts. The interplay of the processes gives rise to ultrafast electromagnetic transients in high-frequency circuits, and it is equally important for a fundamental understanding of graphene-based ultrafast photodetectors and switches.

Artificial intelligence applications in the intensive care unit.

PubMed

Hanson, C W; Marshall, B E

2001-02-01

To review the history and current applications of artificial intelligence in the intensive care unit. The MEDLINE database, bibliographies of selected articles, and current texts on the subject. The studies that were selected for review used artificial intelligence tools for a variety of intensive care applications, including direct patient care and retrospective database analysis. All literature relevant to the topic was reviewed. Although some of the earliest artificial intelligence (AI) applications were medically oriented, AI has not been widely accepted in medicine. Despite this, patient demographic, clinical, and billing data are increasingly available in an electronic format and therefore susceptible to analysis by intelligent software. Individual AI tools are specifically suited to different tasks, such as waveform analysis or device control. The intensive care environment is particularly suited to the implementation of AI tools because of the wealth of available data and the inherent opportunities for increased efficiency in inpatient care. A variety of new AI tools have become available in recent years that can function as intelligent assistants to clinicians, constantly monitoring electronic data streams for important trends, or adjusting the settings of bedside devices. The integration of these tools into the intensive care unit can be expected to reduce costs and improve patient outcomes.

Renewable Electrolysis | Hydrogen and Fuel Cells | NREL

Science.gov Websites

variable-input power conditions Designing and developing shared power-electronics packages and controllers Development NREL develops power electronics interfaces for renewable electrolysis systems to characterize and constant voltage DC bus and power electronics to regulate power output and to convert wild alternating

System for improving measurement accuracy of transducer by measuring transducer temperature and resistance change using thermoelectric voltages

NASA Technical Reports Server (NTRS)

Anderson, Karl F. (Inventor); Parker, Allen R., Jr. (Inventor)

1993-01-01

A constant current loop measuring system measures a property including the temperature of a sensor responsive to an external condition being measured. The measuring system includes thermocouple conductors connected to the sensor, sensing first and second induced voltages responsive to the external condition. In addition, the measuring system includes a current generator and reverser generating a constant current, and supplying the constant current to the thermocouple conductors in forward and reverse directions generating first and second measured voltages, and a determining unit receiving the first and second measured voltages from the current generator and reverser, and determining the temperature of the sensor responsive to the first and second measured voltages.

Origin of the U(1) field mass in superconductors

NASA Astrophysics Data System (ADS)

Koizumi, Hiroyasu

2017-05-01

Recently, a new theory for superconductivity has been put forward, in which the persistent current generation is attributed to the emergent singularities of the electronic wave function that are created by the spin-twisting itinerant circular motion of electrons. The persistent current generated by this mechanism behaves in every respect like supercurrent in superconductors, yielding the flux quantum h/2e and the Josephson frequency 2eV/h, where h is Planck’s constant, -e is the electron charge, and V is the voltage across the Josephson junction. The mass generation of the U(1) gauge field (or the Meissner effect) in the new theory is due to the emergence of topological objects, ‘instantons’ generated by the single-valued requirement of the wave function in the presence of the emergent singularities. The current standard theory of superconductivity is based on the BCS theory, and explains the emergence of superconductivity as due to the global U(1) gauge symmetry breaking realized by the Cooper pair formation. The U(1) field mass generation is believed to be due to this global U(1) gauge symmetry breaking. However, the feasibility of this mechanism has been questioned since no known interaction can prepare the global U(1) symmetry broken state from the normal state. We argue here that the U(1) mass generation in the BCS superconductor can be attributed to the one by the instanton mentioned above if the Rashba spin-orbit interaction is added. Then, the occurrence of persistent current generation becomes due to the instanton formation, and the role of the Cooper pair formation is to stabilize the instanton by providing an energy gap for perturbative excitations. Upon forming the Cooper pair, the instanton is stabilized and persistent current generation becomes possible. Thus, the superconducting transition temperature coincides with the Cooper pair formation temperature.

Inclusion of Indium, with doping in the barriers of InxGa1-xN/InyGa1-yN quantum wells reveals striking modifications of the emission properties with current for better operation of LEDs

NASA Astrophysics Data System (ADS)

Gorai, Anup; Mistry, Apu; Panda, Siddhartha; Biswas, Dipankar

2018-02-01

Although that the continuous tunability of InGaN/GaN QW LEDs, carries the promise of a significant impact in optoelectronics, the reduction of the square of the overlap of electron and hole wave functions (Meh2) in InGaN/GaN QW LEDs, under certain conditions, is a sizable problem, difficult to overcome. Theoretical investigations have been carried out on the incorporation of Indium (In) in the GaN barrier layers, with an aim of increasing the overlap of electron and hole wave functions. Rigorous studies through the self consistent solution of Schrödinger and Poison equations expose some new and striking results. With suitable doping, the inclusion of In in the barriers can increase Meh2 to more than two times that of a conventional InGaN/GaN QW LED. In in the barrier along with doping may be suitably utilized to tailor the transition energy and Meh2 with current density, as desired. The transition energy and the Meh2 may be made to have a positive or a negative slope with current density or they may be made fairly constant. This paper will outline the theoretical details, computational methodologies, the parameters used, and the striking new results with suitable depictions and discussions. These new information ought to be interesting for current optoelectronics.

Analyzing the dependence of oxygen incorporation current density on overpotential and oxygen partial pressure in mixed conducting oxide electrodes.

PubMed

Guan, Zixuan; Chen, Di; Chueh, William C

2017-08-30

The oxygen incorporation reaction, which involves the transformation of an oxygen gas molecule to two lattice oxygen ions in a mixed ionic and electronic conducting solid, is a ubiquitous and fundamental reaction in solid-state electrochemistry. To understand the reaction pathway and to identify the rate-determining step, near-equilibrium measurements have been employed to quantify the exchange coefficients as a function of oxygen partial pressure and temperature. However, because the exchange coefficient contains contributions from both forward and reverse reaction rate constants and depends on both oxygen partial pressure and oxygen fugacity in the solid, unique and definitive mechanistic assessment has been challenging. In this work, we derive a current density equation as a function of both oxygen partial pressure and overpotential, and consider both near and far from equilibrium limits. Rather than considering specific reaction pathways, we generalize the multi-step oxygen incorporation reaction into the rate-determining step, preceding and following quasi-equilibrium steps, and consider the number of oxygen ions and electrons involved in each. By evaluating the dependence of current density on oxygen partial pressure and overpotential separately, one obtains the reaction orders for oxygen gas molecules and for solid-state species in the electrode. We simulated the oxygen incorporation current density-overpotential curves for praseodymium-doped ceria for various candidate rate-determining steps. This work highlights a promising method for studying the exchange kinetics far away from equilibrium.

Unconventional iron-based superconductor CsCa2Fe4As4F2: A first-principle study

NASA Astrophysics Data System (ADS)

Singh, Birender; Kumar, Pradeep

2018-05-01

In the present work, we have investigated the structural and electronic properties of newly discovered iron based superconductor CsCa2Fe4As4F2 using first principles calculations. Analysis of the density of states at the Fermi level suggests that Fe-3d states have dominating contribution, and within these 3d states contribution of eg states is significant suggesting multi-band nature of this superconductor. The upper bound of superconducting transition temperature, estimated using electron-phonon coupling constant is found to be ˜2.6 K. To produce the experimental value of transition temperature (28.2 K), a 4-5 times increase in the electron-phonon constant is necessary, hinting that conventional electron-phonon coupling is not enough to explain the origin of superconductivity.

A nonmonotonic dependence of standard rate constant on reorganization energy for heterogeneous electron transfer processes on electrode surface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu Weilin; Li Songtao; Zhou Xiaochun

2006-05-07

In the present work a nonmonotonic dependence of standard rate constant (k{sup 0}) on reorganization energy ({lambda}) was discovered qualitatively from electron transfer (Marcus-Hush-Levich) theory for heterogeneous electron transfer processes on electrode surface. It was found that the nonmonotonic dependence of k{sup 0} on {lambda} is another result, besides the disappearance of the famous Marcus inverted region, coming from the continuum of electronic states in electrode: with the increase of {lambda}, the states for both Process I and Process II ET processes all vary from nonadiabatic to adiabatic state continuously, and the {lambda} dependence of k{sup 0} for Process Imore » is monotonic thoroughly, while for Process II on electrode surface the {lambda} dependence of k{sup 0} could show a nonmonotonicity.« less

Radiosensitization of DNA by Cisplatin Adducts Results from an Increase in the Rate Constant for the Reaction with Hydrated Electrons and Formation of PtI

PubMed Central

Behmand, B.; Marignier, J.-L.; Mostafavi, M.; Wagner, J. R.; Hunting, D. J.; Sanche, L.

2015-01-01

Pulse radiolysis measurements of the decay of hydrated electrons in solutions containing different concentrations of the oligonucleotide GTG with and without a cisplatin adduct show that the presence of a cisplatin moiety accelerates the reaction between hydrated electrons and the oligonucleotide. The rate constant of the reaction is found to be 2.23 × 1010 mol−1 L s−1, which indicates that it is diffusion controlled. In addition, we show for the first time the formation of a PtI intermediate as a result of the reaction of hydrated electrons with GTG-cisplatin. A putative reaction mechanism is proposed, which may form the basis of the radiosensitization of cancer cells in concomitant chemoradiation therapy with cisplatin. PMID:26098937

Molecular complexes of some anthraquinone anti-cancer drugs: experimental and computational study

NASA Astrophysics Data System (ADS)

El-Gogary, Tarek M.

2003-03-01

It is known that anti-cancer drugs target DNA in the cell. The mechanism of interaction of anti-cancer drugs with DNA is not fully understood. It is thought that the forces of interaction have some contribution from charge-transfer (CT) binding. The ability of some anthraquinones (AQs) anti-cancer drugs to form CT complexes with well-known electron donor molecules was investigated by NMR. The NMR spectroscopy has indicated the formation of CT complexes between 1,4-bis{[2-(dimethylamino) ethyl]amino}-5,8-dihydroxyanthracene-9,10-dione, (AQ4), and its des-hydroxylated equivalent 1,4-bis{[2-(dimethylamino) ethyl]amino}anthracene-9,10-dione, (AQ4H), as electron acceptors and pyrene (PY) and hexamethylbenzene (HMB) as electron donors. Association constants of the formed CT complexes were determined from the NMR data. AQ4 showed weaker electron accepting power than AQ4H, which could be easily explained on the basis of the electron donating nature of the two-hydroxyl groups. AQ4 and AQ4H have higher stability constant with PY than with HMB. This reflects the weaker interaction of the AQs with the latter, which is a direct effect of the six bulky methyl groups. Electronic absorption spectroscopy of the studied system was performed in chloroform and showed the absence of new absorption bands. The extent of interaction between AQs and donors has been computed using molecular mechanics and quantum mechanics. The computed values were compared with the experimental results of association constants.

High-Throughput Screening of Sulfide Thermoelectric Materials Using Electron Transport Calculations with OpenMX and BoltzTraP

NASA Astrophysics Data System (ADS)

Miyata, Masanobu; Ozaki, Taisuke; Takeuchi, Tsunehiro; Nishino, Shunsuke; Inukai, Manabu; Koyano, Mikio

2018-06-01

The electron transport properties of 809 sulfides have been investigated using density functional theory (DFT) calculations in the relaxation time approximation, and a material design rule established for high-performance sulfide thermoelectric (TE) materials. Benchmark electron transport calculations were performed for Cu12Sb4S13 and Cu26V2Ge6S32, revealing that the ratio of the scattering probability of electrons and phonons ( κ lat τ el -1 ) was constant at about 2 × 1014 W K-1 m-1 s-1. The calculated thermopower S dependence of the theoretical dimensionless figure of merit ZT DFT of the 809 sulfides showed a maximum at 140 μV K-1 to 170 μV K-1. Under the assumption of constant κ lat τ el -1 of 2 × 1014 W K-1 m-1 s-1 and constant group velocity v of electrons, a slope of the density of states of 8.6 states eV-2 to 10 states eV-2 is suitable for high- ZT sulfide TE materials. The Lorenz number L dependence of ZT DFT for the 809 sulfides showed a maximum at L of approximately 2.45 × 10-8 V2 K-2. This result demonstrates that the potential of high- ZT sulfide materials is highest when the electron thermal conductivity κ el of the symmetric band is equal to that of the asymmetric band.

Hole trap formation in polymer light-emitting diodes under current stress

NASA Astrophysics Data System (ADS)

Niu, Quan; Rohloff, Roland; Wetzelaer, Gert-Jan A. H.; Blom, Paul W. M.; Crǎciun, N. Irina

2018-06-01

Polymer light-emitting diodes (PLEDs) are attractive for use in large-area displays and lighting panels, but their limited stability under current stress impedes commercialization. In spite of large efforts over the last two decades a fundamental understanding of the degradation mechanisms has not been accomplished. Here we demonstrate that the voltage drift of a PLED driven at constant current is caused by the formation of hole traps, which leads to additional non-radiative recombination between free electrons and trapped holes. The observed trap formation rate is consistent with exciton-free hole interactions as the main mechanism behind PLED degradation, enabling us to unify the degradation behaviour of various poly(p-phenylene) derivatives. The knowledge that hole trap formation is the cause of PLED degradation means that we can suppress the negative effect of hole traps on voltage and efficiency by blending the light-emitting polymer with a large-bandgap semiconductor. Owing to trap-dilution these blended PLEDs show unprecedented stability.

Real-time combustion control and diagnostics sensor-pressure oscillation monitor

DOEpatents

Chorpening, Benjamin T [Morgantown, WV; Thornton, Jimmy [Morgantown, WV; Huckaby, E David [Morgantown, WV; Richards, George A [Morgantown, WV

2009-07-14

An apparatus and method for monitoring and controlling the combustion process in a combustion system to determine the amplitude and/or frequencies of dynamic pressure oscillations during combustion. An electrode in communication with the combustion system senses hydrocarbon ions and/or electrons produced by the combustion process and calibration apparatus calibrates the relationship between the standard deviation of the current in the electrode and the amplitudes of the dynamic pressure oscillations by applying a substantially constant voltage between the electrode and ground resulting in a current in the electrode and by varying one or more of (1) the flow rate of the fuel, (2) the flow rate of the oxidant, (3) the equivalence ratio, (4) the acoustic tuning of the combustion system, and (5) the fuel distribution in the combustion chamber such that the amplitudes of the dynamic pressure oscillations in the combustion chamber are calculated as a function of the standard deviation of the electrode current. Thereafter, the supply of fuel and/or oxidant is varied to modify the dynamic pressure oscillations.

High performance dendrimer functionalized single-walled carbon nanotubes field effect transistor biosensor for protein detection

NASA Astrophysics Data System (ADS)

Rajesh, Sharma, Vikash; Puri, Nitin K.; Mulchandani, Ashok; Kotnala, Ravinder K.

2016-12-01

We report a single-walled carbon nanotube (SWNT) field-effect transistor (FET) functionalized with Polyamidoamine (PAMAM) dendrimer with 128 carboxyl groups as anchors for site specific biomolecular immobilization of protein antibody for C-reactive protein (CRP) detection. The FET device was characterized by scanning electron microscopy and current-gate voltage (I-Vg) characteristic studies. A concentration-dependent decrease in the source-drain current was observed in the regime of clinical significance, with a detection limit of ˜85 pM and a high sensitivity of 20% change in current (ΔI/I) per decade CRP concentration, showing SWNT being locally gated by the binding of CRP to antibody (anti-CRP) on the FET device. The low value of the dissociation constant (Kd = 0.31 ± 0.13 μg ml-1) indicated a high affinity of the device towards CRP analyte arising due to high anti-CRP loading with a better probe orientation on the 3-dimensional PAMAM structure.

INSTRUMENTATION AND TECHNIQUES. A SELF-CONTAINED, REGULATED, BURST-FIRING CONSTANT-CURRENT AC SHOCK GENERATOR

EPA Science Inventory

A line- and load-regulated constant-current ac shock generator has been designed for animal behavior experiments. The self-contained unit has four operating modes, amplitude adjustment, and a leakage current detection circuit. A unique feature of this generator is that the good l...

Analysis of the dynamics of renal vascular resistance and urine flow rate in the cat following electrical stimulation of the renal nerves.

PubMed

Celler, B G; Stella, A; Golin, R; Zanchetti, A

1996-08-01

In ten sino aortic denervated, vagotomized and aneasthetized cats, renal efferent nerves were stimulated for 30 s with trains of constant current pulses at frequencies in the range 5-30 Hz. The arterial pressure, heart rate, urine flow rate (electronic drop counter) and renal blood flow (electromagnetic technique) were recorded. Subsequent computer processing gave the true means of renal artery pressure (MRAP) and renal blood flow (MRBF) and hence the renal vascular resistance (MRVR), over each cardiac cycle. Recovery of MRVR after the end of stimulation exhibited two distinct time constants. The fast component had a time constant of 2.03 +/- 0.26 s and represented 60.2 +/- 1.71% of the recovery. The time constant of the slower component was 14.1 +/- 1.9 s and represented 36.0 +/- 1.6% of the recovery. The relationship between MRVR and stimulus frequency was sigmoidal with maximum sensitivity at stimulus frequencies of 12.6 +/- 0.76 Hz. Changes in urine flow rate, in contrast, followed a hyperbolic function with maximum response sensitivity occurring at very low stimulus frequencies. Changes in urine flow rate were 50% complete at stimulus frequencies of 5 Hz. Identification of two distinct components in the relaxation phase of renal vascular resistance leads to a reasonable hypothesis that 60% of total renal vascular resistance may lie proximal to the glomerulus, whereas 36% may be accounted for by the efferent arterioles.

A study of trap-limited conduction influenced by plasma damage on the source/drain regions of amorphous InGaZnO TFTs

NASA Astrophysics Data System (ADS)

Hsu, Chih-Chieh; Sun, Jhen-Kai; Wu, Chien-Hsun

2015-11-01

This study investigated electrical characteristics and stability variations of amorphous indium gallium zinc oxide thin film transistors (a-IGZO TFTs) with plasma damage on their source/drain (S/D) regions. The influence of the plasma damage on the TFT performance is absent as the channel length is 36-100 μm. When the channel length is decreased to 3-5 μm, the mobility (μ ) of the bottom gate TFT (BG TFT) with plasma damage is significantly degraded to 0.6 cm2 (V s)-1, which is much lower than 4.3 cm2 (V s)-1 of a damage-free BG TFT. We utilized the TFT passivation layer and the indium tin oxide (ITO), which was used as the pixel electrode material in the TFT backplane, to be the top gate insulator and top gate electrode of the defective BG TFT to obtain the defective dual-gate TFT. The mobility can be restored to 5.1 cm2 (V s)-1. Additional process steps are not required. Besides, this method is easily implemented and is fully compatible with TFT backplane fabrication process. The transfer curves, hysteresis characteristics, stabilities under constant voltage stress and constant current stress tests were measured to give evidences that the traps created by the plasma damage on the S/D regions indeed can affect electron transport. This trap-limited conduction can be improved by using the top gate. It was proven that the top gate was not for contributing an observably additional current. It was for inducing electrons to electrically passivate the plasma-induced defects near the back channel. Thus, the trapping/detrapping of the electrons transporting in the front channel can be reduced. The trap density near the Fermi level, hopping distance and hopping energy are 1.1  ×  1018 cm-3 eV-1, 162 Å, and 52 meV for the BG TFT with plasma damage on the S/D regions.

Polarization-Induced Interfacial Reactions between Nickel and Selenium in Ni/Zirconia SOFC Anodes and Comparison with Sulfur Poisoning

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marina, Olga A.; Pederson, Larry R.; Coyle, Christopher A.

2011-01-10

Three distinctly different characteristic responses of a nickel/yttria-stabilized zirconia (Ni/YSZ) cermet anode to the presence of hydrogen selenide in synthetic coal gas were observed, depending on temperature (650-800oC), H2Se concentration (0-40 ppm), and especially on the extent of anodic polarization (0 to ~0.5 V). The first level of response was characterized by a rapid but modest decrease in power density to a new steady state, with no further degradation observed in tests up to 700 hours in duration. Mostly observed at high temperatures, low H2Se concentrations, and low anodic polarizations, this response level was similar to effects caused by themore » presence of H2S, but with slower onset and lower reversibility. Higher anodic polarization at a constant current could trigger a second level of response characterized by oscillatory behavior involving cycles of rapid performance loss followed by rapid recovery. Oscillations at the constant current density were accompanied by the appearance and disappearance of a new feature in the electrochemical impedance spectrum with a summit frequency of ~100 Hz. Oscillatory behavior ceased when the current density was lowered. Such behavior was not observed for cells operated at a constant potential of similar magnitude, though. A third level of response, irreversible cell failure, could be induced by further increases in anodic polarization, additionally favored by low temperature and high H2Se concentration. Post-test analyses of failed cells by electron microscopy revealed the extensive microstructural changes including the appearance of nickel oxide and nickel selenide alteration phases, only at the anode/electrolyte interface. From bulk thermochemical considerations the formation of nickel selenides could not be expected. Local chemical conditions created at the anode/electrolyte interface appear to be of overriding importance with respect to the extent of Ni/YSZ anode interactions with H2Se in coal gas.« less

Fast Faraday fading of long range satellite signals.

NASA Technical Reports Server (NTRS)

Heron, M. L.

1972-01-01

20 MHz radio signals have been received during the day from satellite Beacon-B when it was below the optical horizon by using a bank of narrow filters to improve the signal to noise ratio. The Faraday fading rate becomes constant, under these conditions, at a level determined by the plasma frequency just below the F-layer peak. Variations in the Faraday fading rate reveal fluctuations in the electron density near the peak, while the rate of attaining the constant level depends on the shape of the electron density profile.

A numerical study of Coulomb interaction effects on 2D hopping transport.

PubMed

Kinkhabwala, Yusuf A; Sverdlov, Viktor A; Likharev, Konstantin K

2006-02-15

We have extended our supercomputer-enabled Monte Carlo simulations of hopping transport in completely disordered 2D conductors to the case of substantial electron-electron Coulomb interaction. Such interaction may not only suppress the average value of hopping current, but also affect its fluctuations rather substantially. In particular, the spectral density S(I)(f) of current fluctuations exhibits, at sufficiently low frequencies, a 1/f-like increase which approximately follows the Hooge scaling, even at vanishing temperature. At higher f, there is a crossover to a broad range of frequencies in which S(I)(f) is nearly constant, hence allowing characterization of the current noise by the effective Fano factor [Formula: see text]. For sufficiently large conductor samples and low temperatures, the Fano factor is suppressed below the Schottky value (F = 1), scaling with the length L of the conductor as F = (L(c)/L)(α). The exponent α is significantly affected by the Coulomb interaction effects, changing from α = 0.76 ± 0.08 when such effects are negligible to virtually unity when they are substantial. The scaling parameter L(c), interpreted as the average percolation cluster length along the electric field direction, scales as [Formula: see text] when Coulomb interaction effects are negligible and [Formula: see text] when such effects are substantial, in good agreement with estimates based on the theory of directed percolation.

Electronic structure, magnetism, and exchange integrals in transition-metal oxides: Role of the spin polarization of the functional in DFT+U calculations

NASA Astrophysics Data System (ADS)

Keshavarz, Samara; Schött, Johan; Millis, Andrew J.; Kvashnin, Yaroslav O.

2018-05-01

Density functional theory augmented with Hubbard-U corrections (DFT+U ) is currently one of the most widely used methods for first-principles electronic structure modeling of insulating transition-metal oxides (TMOs). Since U is relatively large compared to bandwidths, the magnetic excitations in TMOs are expected to be well described by a Heisenberg model. However, in practice the calculated exchange parameters Ji j depend on the magnetic configuration from which they are extracted and on the functional used to compute them. In this work we investigate how the spin polarization dependence of the underlying exchange-correlation functional influences the calculated magnetic exchange constants of TMOs. We perform a systematic study of the predictions of calculations based on the local density approximation plus U (LDA+U ) and the local spin density approximation plus U (LSDA+U ) for the electronic structures, total energies, and magnetic exchange interactions Ji j extracted from ferromagnetic (FM) and antiferromagnetic (AFM) configurations of several transition-metal oxide materials. We report that for realistic choices of Hubbard U and Hund's J parameters, LSDA+U and LDA+U calculations result in different values of the magnetic exchange constants and band gap. The dependence of the band gap on the magnetic configuration is stronger in LDA+U than in LSDA+U and we argue that this is the main reason why the configuration dependence of Ji j is found to be systematically more pronounced in LDA+U than in LSDA+U calculations. We report a very good correspondence between the computed total energies and the parametrized Heisenberg model for LDA+U calculations, but not for LSDA+U , suggesting that LDA+U is a more appropriate method for estimating exchange interactions.

Photoinduced electron transfer of oxazine 1/TiO2 nanoparticles at single molecule level by using confocal fluorescence microscopy.

PubMed

Chen, Yi-Ju; Tzeng, Hsin-Yu; Fan, Hsiu-Fang; Chen, Ming-Shiang; Huang, Jer-Shing; Lin, King-Chuen

2010-06-01

Kinetics of photoinduced electron transfer (ET) from oxazine 1 dye to TiO(2) nanoparticles (NPs) surface is studied at a single molecule level by using confocal fluorescence microscopy. Upon irradiation with a pulsed laser at 630 nm, the fluorescence lifetimes sampled among 100 different dye molecules are determined to yield an average lifetime of 2.9 +/- 0.3 ns, which is close to the value of 3.0 +/- 0.6 ns measured on the bare coverslip. The lifetime proximity suggests that most interfacial electron transfer (IFET) processes for the current system are inefficient, probably caused by physisorption between dye and the TiO(2) film. However, there might exist some molecules which are quenched before fluorescing and fail to be detected. With the aid of autocorrelation analysis under a three-level energy system, the IFET kinetics of single dye molecules in the conduction band of TiO(2) NPs is evaluated to be (1.0 +/- 0.1) x 10(4) s(-1) averaged over 100 single molecules and the back ET rate constant is 4.7 +/- 0.9 s(-1). When a thicker TiO(2) film is substituted, the resultant kinetic data do not make a significant difference. The trend of IFET efficacy agrees with the method of fluorescence lifetime measurements. The obtained forward ET rate constants are about ten times smaller than the photovoltage response measured in an assembled dye-sensitized solar cell. The discrepancy is discussed. The inhomogeneous and fluctuation characters for the IFET process are attributed to microenvironment variation for each single molecule. The obtained ET rates are much slower than the fluorescence relaxation. Such a small ET quantum yield is yet feasibly detectable at a single molecule level.

Electrochemical Catalyst-Support Effects and Their Stabilizing Role for IrOx Nanoparticle Catalysts during the Oxygen Evolution Reaction.

PubMed

Oh, Hyung-Suk; Nong, Hong Nhan; Reier, Tobias; Bergmann, Arno; Gliech, Manuel; Ferreira de Araújo, Jorge; Willinger, Elena; Schlögl, Robert; Teschner, Detre; Strasser, Peter

2016-09-28

Redox-active support materials can help reduce the noble-metal loading of a solid chemical catalyst while offering electronic catalyst-support interactions beneficial for catalyst durability. This is well known in heterogeneous gas-phase catalysis but much less discussed for electrocatalysis at electrified liquid-solid interfaces. Here, we demonstrate experimental evidence for electronic catalyst-support interactions in electrochemical environments and study their role and contribution to the corrosion stability of catalyst/support couples. Electrochemically oxidized Ir oxide nanoparticles, supported on high surface area carbons and oxides, were selected as model catalyst/support systems for the electrocatalytic oxygen evolution reaction (OER). First, the electronic, chemical, and structural state of the catalyst/support couple was compared using XANES, EXAFS, TEM, and depth-resolved XPS. While carbon-supported oxidized Ir particle showed exclusively the redox state (+4), the Ir/IrOx/ATO system exhibited evidence of metal/metal-oxide support interactions (MMOSI) that stabilized the metal particles on antimony-doped tin oxide (ATO) in sustained lower Ir oxidation states (Ir(3.2+)). At the same time, the growth of higher valent Ir oxide layers that compromise catalyst stability was suppressed. Then the electrochemical stability and the charge-transfer kinetics of the electrocatalysts were evaluated under constant current and constant potential conditions, where the analysis of the metal dissolution confirmed that the ATO support mitigates Ir(z+) dissolution thanks to a stronger MMOSI effect. Our findings raise the possibility that MMOSI effects in electrochemistry-largely neglected in the past-may be more important for a detailed understanding of the durability of oxide-supported nanoparticle OER catalysts than previously thought.

Identification of parameters through which surface chemistry determines the lifetimes of hot electrons in small Au nanoparticles

PubMed Central

Aruda, Kenneth O.; Tagliazucchi, Mario; Sweeney, Christina M.; Hannah, Daniel C.; Schatz, George C.; Weiss, Emily A.

2013-01-01

This paper describes measurements of the dynamics of hot electron cooling in photoexcited gold nanoparticles (Au NPs) with diameters of ∼3.5 nm, and passivated with either a hexadecylamine or hexadecanethiolate adlayer, using ultrafast transient absorption spectroscopy. Fits of these dynamics with temperature-dependent Mie theory reveal that both the electronic heat capacity and the electron–phonon coupling constant are larger for the thiolated NPs than for the aminated NPs, by 40% and 30%, respectively. Density functional theory calculations on ligand-functionalized Au slabs show that the increase in these quantities is due to an increased electronic density of states near the Fermi level upon ligand exchange from amines to thiolates. The lifetime of hot electrons, which have thermalized from the initial plasmon excitation, increases with increasing electronic heat capacity, but decreases with increasing electron–phonon coupling, so the effects of changing surface chemistry on these two quantities partially cancel to yield a hot electron lifetime of thiolated NPs that is only 20% longer than that of aminated NPs. This analysis also reveals that incorporation of a temperature-dependent electron–phonon coupling constant is necessary to adequately fit the dynamics of electron cooling. PMID:23440215

Revisiting the Bohr Atom 100 Years Later

NASA Astrophysics Data System (ADS)

Wall, Ernst

2013-03-01

We use a novel electron model wherein the electron is modeled as a point charge behaving as a trapped photon revolving in a Compton wavelength orbit at light speed. The revolving point charge gives rise to spiraling Compton wavelets around the electron, which give rise to de Broglie waves. When applied to the Bohr model, the orbital radius of the electron scales to the first Bohr orbit's radius via the fine structure constant. The orbiting electron's orbital velocity, Vb, scales to that of the electron's charge's internal velocity (the velocity of light, c) via the fine structure constant. The Compton wavelets, if they reflect off the nucleus, have a round trip time just long enough to allow the electron to move one of its diameters in distance in the first Bohr orbit. The ratio of the electron's rotational frequency, fe, to its rotational frequency in the Bohr orbit fb, is fe/fb = 1/α2, which is also the number of electron rotations in single orbit. If we scale the electron's rotational energy (h*fe) to that of the orbit using this, the orbital energy value (h*fb) would be 27.2114 eV. However, the virial theorem reduces it to 13.6057, the ground state energy of the first Bohr orbit. Ref: www.tachyonmodel.com.

Energy dependence of effective electron mass and laser-induced ionization of wide band-gap solids

NASA Astrophysics Data System (ADS)

Gruzdev, V. E.

2008-10-01

Most of the traditional theoretical models of laser-induced ionization were developed under the assumption of constant effective electron mass or weak dependence of the effective mass on electron energy. Those assumptions exclude from consideration all the effects resulting from significant increase of the effective mass with increasing of electron energy in real the conduction band. Promotion of electrons to the states with high effective mass can be done either via laserinduced electron oscillations or via electron-particle collisions. Increase of the effective mass during laser-material interactions can result in specific regimes of ionization. Performing a simple qualitative analysis by comparison of the constant-mass approximation vs realistic dependences of the effective mass on electron energy, we demonstrate that the traditional ionization models provide reliable estimation of the ionization rate in a very limited domain of laser intensity and wavelength. By taking into account increase of the effective mass with electron energy, we demonstrate that special regimes of high-intensity photo-ionization are possible depending on laser and material parameters. Qualitative analysis of the energy dependence of the effective mass also leads to conclusion that the avalanche ionization can be stopped by the effect of electron trapping in the states with large values of the effective mass.

Photo-Initiated Electron Transfer Within the P. denitrificans Cytochrome bc1 Complex: The mobility of the Iron Sulfur Protein is modulated by the occupant of the Qo site†

PubMed Central

Havens, Jeffrey; Castellani, Michela; Kleinschroth, Thomas; Ludwig, Bernd; Durham, Bill; Millett, Francis

2011-01-01

Domain rotation of the Rieske iron-sulfur protein (ISP) between the cytochrome (cyt) b and cyt c1 redox centers plays a key role in the mechanism of the cyt bc1 complex. Electron transfer within the cyt bc1 complex of P. denitrificans was studied using a ruthenium dimer to rapidly photo-oxidize cyt c1 within 1 μs and initiate the reaction. In the absence of any added quinol or inhibitor of the bc1 complex at pH 8.0, electron transfer from reduced ISP to cyt c1 was biphasic with rate constants of k1f = 6300 ± 3000 s−1 and k1s = 640 ± 300 s−1 and amplitudes of 10 ± 3% and 16 ± 4 % of the total amount of cyt c1 photooxidized. Upon addition of any of the Pm type inhibitors MOA-stilbene, myxothiazol, or azoxystrobin to cyt bc1 in the absence of quinol, the total amplitude increased 2-fold, consistent with a decrease in redox potential of the ISP. In addition, the relative amplitude of the fast phase increased significantly, consistent with a change in the dynamics of the ISP domain rotation. In contrast, addition of the Pf type inhibitors JG-144 and famoxadone decreased the rate constant k1f by 5 to 10-fold, and increased the amplitude over 2-fold. Addition of quinol substrate in the absence of inhibitors led to a two-fold increase in the amplitude of the k1f phase. The effect of QH2 on the kinetics of electron transfer from reduced ISP to cyt c1 was thus similar to that of the Pm inhibitors and very different from that of the Pf inhibitors. The current results indicate that the species occupying the Qo site has a significant conformational influence on the dynamics of the ISP domain rotation. PMID:22026826

Design of laser diode driver with constant current and temperature control system

NASA Astrophysics Data System (ADS)

Wang, Ming-cai; Yang, Kai-yong; Wang, Zhi-guo; Fan, Zhen-fang

2017-10-01

A laser Diode (LD) driver with constant current and temperature control system is designed according to the LD working characteristics. We deeply researched the protection circuit and temperature control circuit based on thermos-electric cooler(TEC) cooling circuit and PID algorithm. The driver could realize constant current output and achieve stable temperature control of LD. Real-time feedback control method was adopted in the temperature control system to make LD work on its best temperature point. The output power variety and output wavelength shift of LD caused by current and temperature instability were decreased. Furthermore, the driving current and working temperature is adjustable according to specific requirements. The experiment result showed that the developed LD driver meets the characteristics of LD.

Tuning the effective fine structure constant in graphene: opposing effects of dielectric screening on short- and long-range potential scattering.

PubMed

Jang, C; Adam, S; Chen, J-H; Williams, E D; Das Sarma, S; Fuhrer, M S

2008-10-03

We reduce the dimensionless interaction strength alpha in graphene by adding a water overlayer in ultrahigh vacuum, thereby increasing dielectric screening. The mobility limited by long-range impurity scattering is increased over 30%, due to the background dielectric constant enhancement leading to a reduced interaction of electrons with charged impurities. However, the carrier-density-independent conductivity due to short-range impurities is decreased by almost 40%, due to reduced screening of the impurity potential by conduction electrons. The minimum conductivity is nearly unchanged, due to canceling contributions from the electron-hole puddle density and long-range impurity mobility. Experimental data are compared with theoretical predictions with excellent agreement.

Rigorous Relativistic Methods for Addressing {P}- and {T}-NONCONSERVATION in Heavy-Element Molecules

NASA Astrophysics Data System (ADS)

Fleig, Timo

2013-06-01

A new and rigorous method for accurate ab-initio calculations of the electron electric dipole moment {P,T}-odd interaction constant is presented. The approach uses string-based Configuration Interaction wavefunctions and Dirac four-component spinors as one-particle basis functions, and the {P,T}-odd constant is obtained as an expectation value over these correlated wavefunctions. The method has been applied to the HfF^+ molecular ion to determine spectroscopic constants for four low-lying electronic states. For one of these states (Ω = 1) we have determined a new accurate benchmark value for the effective electric field E_{ eff} correlating 34 valence and outer atomic core electrons and using wavefunction expansions with nearly 5 \\cdot 10^8 coefficients. For the Ω = 1 state of the ThO molecule the first ab-initio result for the electron EDM interaction constant is presented. Aspects of modern all-electron relativistic many-body approaches applicable to both atoms and molecules will be discussed, including perspectives for the treatment of other interesting candidate systems and {P}- or {P,T}-non-conserving effects in molecular systems. %Zero-kinetic-energy (ZEKE) photoelectron spectroscopy was used to probe the vibrational levels in the ground electronic state of the chlorobenzene cation using a two-color photoionization scheme via the S{_1} electronic state of the neutral. Exciting through different S{_1} vibrational levels has revealed mixing of some S{_1} normal coordinates in the ground state of the cation. A previously-identified Fermi resonance in the S{_1} state of the neutral is also confirmed by the ZEKE spectra. The adiabatic ionization energy is measured as 73 170±5 cm^{-1}. S. Knecht, H. J. Å. Jensen and T. Fleig J. Chem. Phys. {132}, 014108 (2010 T. Fleig, H. J. Å. Jensen, J. Olsen and L. Visscher J. Chem. Phys. {124}, 104106 (2006) T. Fleig and M. K. Nayak Phys. Rev. X {XXX}, XXXX (submitted). T. G. Wright, S. I. Panov and T. A. Miller J. Chem. Phys. {102}(12), XXXX March 1995.

The effects of capillary forces on the axisymmetric propagation of two-phase, constant-flux gravity currents in porous media

NASA Astrophysics Data System (ADS)

Golding, Madeleine J.; Huppert, Herbert E.; Neufeld, Jerome A.

2013-03-01

The effects of capillary forces on the propagation of two-phase, constant-flux gravity currents in a porous medium are studied analytically and numerically in an axisymmetric geometry. The fluid within a two-phase current generally only partially saturates the pore space it invades. For long, thin currents, the saturation distribution is set by the vertical balance between gravitational and capillary forces. The capillary pressure and relative permeability of the fluid in the current depend on this saturation. The action of capillary forces reduces the average saturation, thereby decreasing the relative permeability throughout the current. This results in a thicker current, which provides a steeper gradient to drive flow, and a more blunt-nose profile. The relative strength of gravity and capillary forces remains constant within a two-phase gravity current fed by a constant flux and spreading radially, due to mass conservation. For this reason, we use an axisymmetric representation of the framework developed by Golding et al. ["Two-phase gravity currents in porous media," J. Fluid Mech. 678, 248-270 (2011)], 10.1017/jfm.2011.110, to investigate the effect on propagation of varying the magnitude of capillary forces and the pore-size distribution. Scaling analysis indicates that axisymmetric two-phase gravity currents fed by a constant flux propagate like t1/2, similar to their single-phase counterparts [S. Lyle, H. E. Huppert, M. Hallworth, M. Bickle, and A. Chadwick, "Axisymmetric gravity currents in a porous medium," J. Fluid Mech. 543, 293-302 (2005)], 10.1017/S0022112005006713, with the effects of capillary forces encapsulated in the constant of proportionality. As a practical application of our new concepts and quantitative evaluations, we discuss the implications of our results for the process of carbon dioxide (CO2) sequestration, during which gravity currents consisting of supercritical CO2 propagate in rock saturated with aqueous brine. We apply our two-phase model including capillary forces to quantitatively assess seismic images of CO2 spreading at Sleipner underneath the North Sea.

Pulse charging of lead-acid traction cells

NASA Technical Reports Server (NTRS)

Smithrick, J. J.

1980-01-01

Pulse charging, as a method of rapidly and efficiently charging 300 amp-hour lead-acid traction cells for an electric vehicle application was investigated. A wide range of charge pulse current square waveforms were investigated and the results were compared to constant current charging at the time averaged pulse current values. Representative pulse current waveforms were: (1) positive waveform-peak charge pulse current of 300 amperes (amps), discharge pulse-current of zero amps, and a duty cycle of about 50%; (2) Romanov waveform-peak charge pulse current of 300 amps, peak discharge pulse current of 15 amps, and a duty of 50%; and (3) McCulloch waveform peak charge pulse current of 193 amps, peak discharge pulse current of about 575 amps, and a duty cycle of 94%. Experimental results indicate that on the basis of amp-hour efficiency, pulse charging offered no significant advantage as a method of rapidly charging 300 amp-hour lead-acid traction cells when compared to constant current charging at the time average pulse current value. There were, however, some disadvantages of pulse charging in particular a decrease in charge amp-hour and energy efficiencies and an increase in cell electrolyte temperature. The constant current charge method resulted in the best energy efficiency with no significant sacrifice of charge time or amp-hour output. Whether or not pulse charging offers an advantage over constant current charging with regard to the cell charge/discharge cycle life is unknown at this time.

Optimization of Aluminum Anodization Conditions for the Fabrication of Nanowires by Electrodeposition

NASA Technical Reports Server (NTRS)

Fucsko, Viola

2005-01-01

Anodized alumina nanotemplates have a variety of potential applications in the development of nanotechnology. Alumina nanotemplates are formed by oxidizing aluminum film in an electrolyte solution.During anodization, aluminum oxidizes, and, under the proper conditions, nanometer-sized pores develop. A series of experiments was conducted to determine the optimal conditions for anodization. Three-micrometer thick aluminum films on silicon and silicon oxide substrates were anodized using constant voltages of 13-25 V. 0.1-0.3M oxalic acid was used as the electrolyte. The anodization time was found to increase and the overshooting current decreased as both the voltage and the electrolyte concentrations were decreased. The samples were observed under a scanning electron microscope. Anodizing with 25V in 0.3M oxalic acid appears to be the best process conditions. The alumina nanotemplates are being used to fabricate nanowires by electrodeposition. The current-voltage characteristics of copper nanowires have also been studied.

11th International Conference "Correlation Optics": Propolis films for hybrid biomaterial-inorganic electronics and optoelectronics.

PubMed

Brus, Viktor V; Pidkamin, Leonid J; Ilashchuk, Maria I; Maryanchuk, Pavlo D

2014-04-01

We report on the analysis of optical, polarimetric, and electrical properties of propolis films and hybrid biomaterial-inorganic heterojunctions based on them. It was shown that the material of the propolis films belongs to wide-bandgap optically active substances with the light-scattering centers, which possess complex optical properties. The values of the specific resistance ρ(P)=1.9·10⁷ Ω·cm and dielectric constant ε(P)=19.5 of the propolis film were determined from the spectral distribution of the real and imaginary components of its impedance at room temperature, respectively. The dominating current transport mechanisms through the hybrid bioinorganic heterojunction propolis/p-CdTe were established to be the interface-states-assisted generation-recombination within the depletion region via deep energy levels at forward bias as well as the leakage current through the shunt resistance at reverse bias.

Electrical characterization and modeling of the Au/CaF{sub 2}/nSi(111) structures with high-quality tunnel-thin fluoride layer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vexler, M. I.; A. F. Ioffe Physical-Technical Institute of the Russian Academy of Sciences, 26 Polytechnicheskaya Str., 194021 St.-Petersburg; Sokolov, N. S.

2009-04-15

Au/CaF{sub 2}/nSi(111) structures with 4-5 monolayers of epitaxial fluoride are fabricated and electrically tested. The leakage current in these structures was substantially smaller than in similar samples reported previously. Simulations adopting a Franz-type dispersion relation with Franz mass of m{sub F}approx1.2m{sub 0} for carriers in the forbidden band of CaF{sub 2} reproduced the measured current-voltage curves quite satisfactorily. Roughly, these curves could also be reproduced using the parabolic dispersion law with the electron mass of m{sub e}=1.0m{sub 0}, which is a material constant rather than a fitting parameter. Experimental facts and their comparison to modeling results allow qualification of themore » crystalline quality of fabricated structures as sufficient for device applications.« less

Behavior of moving plasma in solenoidal magnetic field in a laser ion source

NASA Astrophysics Data System (ADS)

Ikeda, S.; Takahashi, K.; Okamura, M.; Horioka, K.

2016-02-01

In a laser ion source, a solenoidal magnetic field is useful to guide the plasma and to control the extracted beam current. However, the behavior of the plasma drifting in the magnetic field has not been well understood. Therefore, to investigate the behavior, we measured the plasma ion current and the total charge within a single pulse in the solenoid by changing the distance from the entrance of the solenoid to a detector. We observed that the decrease of the total charge along the distance became smaller as the magnetic field became larger and then the charge became almost constant with a certain magnetic flux density. The results indicate that the transverse spreading speed of the plasma decreased with increasing the field and the plasma was confined transversely with the magnetic flux density. We found that the reason of the confinement was not magnetization of ions but an influence induced by electrons.

Behavior of moving plasma in solenoidal magnetic field in a laser ion source.

PubMed

Ikeda, S; Takahashi, K; Okamura, M; Horioka, K

2016-02-01

In a laser ion source, a solenoidal magnetic field is useful to guide the plasma and to control the extracted beam current. However, the behavior of the plasma drifting in the magnetic field has not been well understood. Therefore, to investigate the behavior, we measured the plasma ion current and the total charge within a single pulse in the solenoid by changing the distance from the entrance of the solenoid to a detector. We observed that the decrease of the total charge along the distance became smaller as the magnetic field became larger and then the charge became almost constant with a certain magnetic flux density. The results indicate that the transverse spreading speed of the plasma decreased with increasing the field and the plasma was confined transversely with the magnetic flux density. We found that the reason of the confinement was not magnetization of ions but an influence induced by electrons.

Alternating current line-filter based on electrochemical capacitor utilizing template-patterned graphene.

PubMed

Wu, Zhenkun; Li, Liyi; Lin, Ziyin; Song, Bo; Li, Zhuo; Moon, Kyoung-Sik; Wong, Ching-Ping; Bai, Shu-Lin

2015-06-17

Aluminum electrolytic capacitors (AECs) are widely used for alternating current (ac) line-filtering. However, their bulky size is becoming more and more incompatible with the rapid development of portable electronics. Here we report a scalable process to fabricate miniaturized graphene-based ac line-filters on flexible substrates at room temperature. In this work, graphene oxide (GO) is reduced by patterned metal interdigits at room temperature and used directly as the electrode material. The as-fabricated device shows a phase angle of -75.4° at 120 Hz with a specific capacitance of 316 µF/cm(2) and a RC time constant of 0.35 ms. In addition, it retains 97.2% of the initial capacitance after 10000 charge/discharge cycles. These outstanding performance characteristics of our device demonstrate its promising to replace the conventional AECs for ac line filtering.

Heat treatment condition of EN AW-7075 influencing the anodic oxidation process and coating properties

NASA Astrophysics Data System (ADS)

Morgenstern, R.; Scharf, I.; Lampke, T.

2018-06-01

The age-hardenable aluminium alloy EN AW-7075 exhibits outstanding specific mechanical properties and therefore offers a high potential for lightweight construction. Anodising in aqueous oxalic acid solutions is suitable to produce a protective oxide ceramic conversion layer on this alloy. This study examines the influence of the precipitation state of the substrate alloy on microstructure and properties of anodic oxide layers. Therefore, EN AW-7075 sheets in the heat treatment conditions T4, T6 and T73 were anodized in 0.8 M oxalic acid solution at constant voltage. The current efficiency was determined on the basis of the electrical charge quantity, coating thickness and coating mass. Instrumented indentation tests were applied in order to evaluate the coating hardness. The microstructure of the anodic oxide layer was illustrated using field emission electron microscopy. It was shown that the current efficiency strongly depends on the heat treatment condition.

Toroidal Ampere-Faraday Equations Solved Consistently with the CQL3D Fokker-Planck Time-Evolution

NASA Astrophysics Data System (ADS)

Harvey, R. W.; Petrov, Yu. V.

2013-10-01

A self-consistent, time-dependent toroidal electric field calculation is a key feature of a complete 3D Fokker-Planck kinetic distribution radial transport code for f(v,theta,rho,t). In the present CQL3D finite-difference model, the electric field E(rho,t) is either prescribed, or iteratively adjusted to obtain prescribed toroidal or parallel currents. We discuss first results of an implementation of the Ampere-Faraday equation for the self-consistent toroidal electric field, as applied to the runaway electron production in tokamaks due to rapid reduction of the plasma temperature as occurs in a plasma disruption. Our previous results assuming a constant current density (Lenz' Law) model showed that prompt ``hot-tail runaways'' dominated ``knock-on'' and Dreicer ``drizzle'' runaways; we will examine modifications due to the more complete Ampere-Faraday solution. Work supported by US DOE under DE-FG02-ER54744.

First measurements of the temporal evolution of the plasma density in HiPIMS discharges using THz time domain spectroscopy

NASA Astrophysics Data System (ADS)

Meier, Steffen M.; Hecimovic, Ante; Tsankov, Tsanko V.; Luggenhölscher, Dirk; Czarnetzki, Uwe

2018-03-01

In this paper, the novel technique of THz time domain spectroscopy has been applied to obtain time-resolved measurements of the plasma density in the active zone of a HiPIMS discharge with a titanium target. The obtained peak values are in the range of 1012-1013 cm-3 for discharge current densities of 1-4 A cm-2 at 0.5 and 2 Pa argon pressure. The measured densities show good correlation with the discharge current and voltage and the intensity of various atomic and ionic lines. The well known phases of the discharge have been identified and related to the variation of the electron density. The measurement results show that the plasma density remains nearly constant during the runaway/self-sputtering phase. Based on that, it is conjectured that singly charged titanium ions are the dominant ion species during this phase.

Local electrophoretic deposition using a nanopipette for micropillar fabrication

NASA Astrophysics Data System (ADS)

Iwata, Futoshi; Metoki, Junya

2017-12-01

A novel and simple technique was developed for the fabrication of micropillars using a nanopipette that is a tapered glass capillary with a micrometer-sized aperture at the tip. The nanopipette was filled with a colloidal solution that included metal nanoparticles. Its tip was put in contact with a substrate, and the substrate was moved downward for continuous deposition of the metal colloidal solution to form micropillars. To improve fabrication reproducibility, the amount of Au colloidal solution deposited was controlled by a feedback loop that maintained a predefined constant current during electrophoretic deposition. The stiffness of the fabricated micropillars was evaluated by applying a loading force using a microcantilever under scanning electron microscopy. The Young’s modulus of the fabricated pillars was measured to be in the range of 7.7-14.8 GPa, depending on the fabrication parameters of the predefined current and fabrication speed.

Analysis of the structural, electronic and optic properties of Ni doped MgSiP{sub 2} semiconductor chalcopyrite compound

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kocak, Belgin, E-mail: koakbelgin@gmail.com; Ciftci, Yasemin Oztekin, E-mail: yasemin@gazi.edu.tr

2016-03-25

The structural, electronic band structure and optic properties of the Ni doped MgSiP{sub 2} chalcopyrite compound have been performed by using first-principles method in the density functional theory (DFT) as implemented in Vienna Ab-initio Simulation Package (VASP). The generalized gradient approximation (GGA) in the scheme of Perdew, Burke and Ernzerhof (PBE) is used for the exchange and correlation functional. The present lattice constant (a) follows generally the Vegard’s law. The electronic band structure, total and partial density of states (DOS and PDOS) are calculated. We present data for the frequency dependence of imaginary and real parts of dielectric functions ofmore » Ni doped MgSiP{sub 2}. For further investigation of the optical properties the reflectivity, refractive index, extinction coefficient and electron energy loss function are also predicted. Our obtained results indicate that the lattice constants, electronic band structure and optical properties of this compound are dependent on the substitution concentration of Ni.« less

Influence of functional group on the electrical transport properties of polyvinyl alcohol grafted multiwall carbon nanotube composite thick film

NASA Astrophysics Data System (ADS)

Kumar Das, Amit; Dharmana, Reuben; Mukherjee, Ayan; Baba, Koumei; Hatada, Ruriko; Kumar Meikap, Ajit

2018-04-01

We present a novel technique to obtain a higher or lower value of dielectric constant due to the variation of a functional group on the surface of multiwall carbon nanotube (MWCNTs) for a polyvinyl alcohol (PVA) grafted MWCNT system. We have prepared PVA grafted pristine and different types of functionalized (-COOH, -OH, and -NH2) MWCNT nanocomposite films. The strong interfacial interaction between the host PVA matrix and nanofiller is characterized by different experimental techniques. The frequency variation of the electrical transport properties of the composite films is investigated in a wide temperature range (303 ≤ T ≤ 413 K) and frequency range (20 Hz ≤ f ≤ 1 MHz). The dielectric constant of the amine (-NH2) functionalized MWCNT incorporated PVA film is about 2 times higher than that of the pristine MWCNT embedded PVA film. The temperature variation of the dielectric constant shows an anomalous behaviour. The modified Cole-Cole equation simulated the experimentally observed dielectric spectroscopy at high temperature. The ac conductivity of the composite films obeys the correlated barrier hopping model. The imaginary part of the electric modulus study shows the ideal Debye-type behaviour at low frequency and deviation of that at high frequency. To illustrate the impedance spectroscopy of the nanocomposite films, we have proposed an impedance based battery equivalent circuit model. The current-voltage characteristic shows hysteresis behaviour of the nanocomposite films. The trap state height for all composite films is evaluated by simulating the current density-electric field data with the Poole-Frenkel emission model. This investigation opens a new avenue for designing electronic devices with a suitable combination of cost effective soft materials.

Optical characteristics and parameters of gas-discharge plasma in a mixture of mercury dibromide vapor with neon

NASA Astrophysics Data System (ADS)

Malinina, A. A.; Malinin, A. N.

2013-12-01

Results are presented from studies of the optical characteristics and parameters of plasma of a dielectric barrier discharge in a mixture of mercury dibromide vapor with neon—the working medium of a non-coaxial exciplex gas-discharge emitter. The electron energy distribution function, the transport characteristics, the specific power losses for electron processes, the electron density and temperature, and the rate constants for the processes of elastic and inelastic electron scattering by the working mixture components are determined as functions of the reduced electric field. The rate constant of the process leading to the formation of exciplex mercury monobromide molecules is found to be 1.6 × 10-14 m3/s for a reduced electric field of E/ N = 15 Td, at which the maximum emission intensity in the blue-green spectral region (λmax = 502 nm) was observed in this experiment.

A generalized two-fluid picture of non-driven collisionless reconnection and its relation to whistler waves

NASA Astrophysics Data System (ADS)

Yoon, Young Dae

2017-10-01

A generalized, intuitive two-fluid picture of 2D non-driven collisionless magnetic reconnection is described using results from a full-3D numerical simulation. The relevant two-fluid equations simplify to the condition that the flux associated with canonical circulation Q =me ∇ ×ue +qe B is perfectly frozen into the electron fluid. Q is the curl of P =meue +qe A , which is the electron canonical momenrum. Since ∇ . Q = 0 , the Q flux tubes are incompressible and so have a fixed volume. Because they are perfectly frozen into the electron fluid, the Q flux tubes cannot reconnect. Following the behavior of these Q flux tubes provides an intuitive insight into 2D collisionless reconnection of B . In the reconnection geometry, a small perturbation to the central electron current sheet effectively brings a localized segment of a Q flux tube towards the X-point. This flux tube segment is convected downwards with the central electron current, effectively stretching the flux tube, decreasing its cross-section to maintain a fixed volume and so increasing the magnitude of Q . Also, because Q is the sum of the electron vorticity and the magnetic field, the two terms may change in such a way that one term becomes smaller while the other becomes larger while preserving constant Q flux. This allows magnetic reconnection, which is a conversion of magnetic field into particle velocity, to occur without any dissipation mechanism. The entire process has positive feedback with no restoring mechanism and therefore is an instability. The Q motion provides an interpretation for other phenomena as well, such as spiked central electron current filaments. The simulated reconnection rate was found to agree with a previous analytical calculation having the same geometry. Energy analysis shows that the magnetic energy is converted and propagated mainly in the form of the Poynting flux, while helicity analysis shows that the canonical helicity ∫ P . QdV as a whole must be considered when analyzing reconnection. A mechanism for whistler wave generation and propagation is also described, with comparisons to recent spacecraft observations. National Science Foundation under Award no. 1059519, Air Force Office of Scientific Research under Award No. FA9550-11-1-0184, U.S. Department of Energy Office of Science, Office of Fusion Energy Sciences under Award No. DE-FG02-04ER54755.

Search for a Variation of Fundamental Constants

NASA Astrophysics Data System (ADS)

Ubachs, W.

2013-06-01

Since the days of Dirac scientists have speculated about the possibility that the laws of nature, and the fundamental constants appearing in those laws, are not rock-solid and eternal but may be subject to change in time or space. Such a scenario of evolving constants might provide an answer to the deepest puzzle of contemporary science, namely why the conditions in our local Universe allow for extreme complexity: the fine-tuning problem. In the past decade it has been established that spectral lines of atoms and molecules, which can currently be measured at ever-higher accuracies, form an ideal test ground for probing drifting constants. This has brought this subject from the realm of metaphysics to that of experimental science. In particular the spectra of molecules are sensitive for probing a variation of the proton-electron mass ratio μ, either on a cosmological time scale, or on a laboratory time scale. A comparison can be made between spectra of molecular hydrogen observed in the laboratory and at a high redshift (z=2-3), using the Very Large Telescope (Paranal, Chile) and the Keck telescope (Hawaii). This puts a constraint on a varying mass ratio Δμ/μ at the 10^{-5} level. The optical work can also be extended to include CO molecules. Further a novel direction will be discussed: it was discovered that molecules exhibiting hindered internal rotation have spectral lines in the radio-spectrum that are extremely sensitive to a varying proton-electron mass ratio. Such lines in the spectrum of methanol were recently observed with the radio-telescope in Effelsberg (Germany). F. van Weerdenburg, M.T. Murphy, A.L. Malec, L. Kaper, W. Ubachs, Phys. Rev. Lett. 106, 180802 (2011). A. Malec, R. Buning, M.T. Murphy, N. Milutinovic, S.L. Ellison, J.X. Prochaska, L. Kaper, J. Tumlinson, R.F. Carswell, W. Ubachs, Mon. Not. Roy. Astron. Soc. 403, 1541 (2010). E.J. Salumbides, M.L. Niu, J. Bagdonaite, N. de Oliveira, D. Joyeux, L. Nahon, W. Ubachs, Phys. Rev. A 86, 022510 (2012). J. Bagdonaite, P. Jansen, C. Henkel, H.L. Bethlem, K. Menten, W. Ubachs, Science 339, 46 (2013).

Electronic contributions to the sigma(p) parameter of the Hammett equation.

PubMed

Domingo, Luis R; Pérez, Patricia; Contreras, Renato

2003-07-25

A statistical procedure to obtain the intrinsic electronic contributions to the Hammett substituent constant sigma(p) is reported. The method is based on the comparison between the experimental sigma(p) values and the electronic electrophilicity index omega evaluated for a series of 42 functional groups commonly present in organic compounds.

The interaction of trimethylamine dehydrogenase and electron-transferring flavoprotein.

PubMed

Shi, Weiwei; Mersfelder, John; Hille, Russ

2005-05-27

The interaction between the physiological electron transfer partners trimethylamine dehydrogenase (TMADH) and electron-transferring flavoprotein (ETF) from Methylophilus methylotrophus has been examined with particular regard to the proposal that the former protein "imprints" a conformational change on the latter. The results indicate that the absorbance change previously attributed to changes in the environment of the FAD of ETF upon binding to TMADH is instead caused by electron transfer from partially reduced, as-isolated TMADH to ETF. Prior treatment of the as-isolated enzyme with the oxidant ferricenium essentially abolishes the observed spectral change. Further, when the semiquinone form of ETF is used instead of the oxidized form, the mirror image of the spectral change seen with as-isolated TMADH and oxidized ETF is observed. This is attributable to a small amount of electron transfer in the reverse of the physiological direction. Kinetic determination of the dissociation constant and limiting rate constant for electron transfer within the complex of (reduced) TMADH with (oxidized) ETF is reconfirmed and discussed in the context of a recently proposed model for the interaction between the two proteins that involves "structural imprinting" of ETF.

SU-F-T-554: Dark Current Effect On CyberKnife Beam Dosimetry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, H; Chang, A

Purpose: All RF linear accelerators produce dark current to varying degrees when an accelerating voltage and RF input is applied in the absence of electron gun injection. This study is to evaluate how dark current from the linear accelerator of CyberKnife affect the dose in the reference dosimetry. Methods: The G4 CyberKnife system with 6MV photon beam was used in this study. Using the ion chamber and the diode detector, the dose was measured in water with varying time delay between acquiring charges and staring beam-on after applying high-voltage into the linear accelerator. The dose was measured after the timemore » delay with over the range of 0 to 120 seconds in the accelerating high-voltage mode without beam-on, applying 0, 10, 50, 100, and 200 MUs. For the measurements, the collimator of 60 mm was used and the detectors were placed at the depths of 10 cm with the source-to-surface distance of 80 cm. Results: The dark current was constant over time regardless of MU. The dose due to the dark current increased over time linearly with the R-squared value of 0.9983 up to 4.4 cGy for the time 120 seconds. In the dose rate setting of 720 MU/min, the relative dose when applying the accelerating voltage without beam-on was increased over time up to 0.6% but it was less than the leakage radiation resulted from the accelerated head. As the reference dosimetry condition, when 100 MU was delivered after 10 seconds time delay, the relative dose increased by 0.7% but 6.7% for the low MU (10 MU). Conclusion: In the dosimetry using CyberKnife system, the constant dark current affected to the dose. Although the time delay in the accelerating high-voltage mode without beam-on is within 10 seconds, the dose less than 100 cGy can be overestimated more than 1%.« less

Free energy functionals for polarization fluctuations: Pekar factor revisited

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dinpajooh, Mohammadhasan; Newton, Marshall D.; Matyushov, Dmitry V.

The separation of slow nuclear and fast electronic polarization in problems related to electron mobility in polarizable media was considered by Pekar 70 years ago. Within dielectric continuum models, this separation leads to the Pekar factor in the free energy of solvation by the nuclear degrees of freedom. The main qualitative prediction of Pekar’s perspective is a significant, by about a factor of two, drop of the nuclear solvation free energy compared to the total (electronic plus nuclear) free energy of solvation. The Pekar factor enters the solvent reorganization energy of electron transfer reactions and is a significant mechanistic parametermore » accounting for the solvent effect on electron transfer. Here, we study the separation of the fast and slow polarization modes in polar molecular liquids (polarizable dipolar liquids and polarizable water force fields) without relying on the continuum approximation. We derive the nonlocal free energy functional and use atomistic numerical simulations to obtain nonlocal, reciprocal space electronic and nuclear susceptibilities. A consistent transition to the continuum limit is introduced by extrapolating the results of finite-size numerical simulation to zero wavevector. The continuum nuclear susceptibility extracted from simulations is numerically close to the Pekar factor. However, we derive a new functionality involving the static and high-frequency dielectric constants. The main distinction of our approach from the traditional theories is found for the solvation free energy due to the nuclear polarization: the anticipated significant drop of its magnitude with increasing liquid polarizability does not occur. The reorganization energy of electron transfer is either nearly constant with increasing the solvent polarizability and the corresponding high-frequency dielectric constant (polarizable dipolar liquids) or actually noticeably increases (polarizable force fields of water).« less

Free energy functionals for polarization fluctuations: Pekar factor revisited

DOE PAGES

Dinpajooh, Mohammadhasan; Newton, Marshall D.; Matyushov, Dmitry V.

2017-02-13

The separation of slow nuclear and fast electronic polarization in problems related to electron mobility in polarizable media was considered by Pekar 70 years ago. Within dielectric continuum models, this separation leads to the Pekar factor in the free energy of solvation by the nuclear degrees of freedom. The main qualitative prediction of Pekar’s perspective is a significant, by about a factor of two, drop of the nuclear solvation free energy compared to the total (electronic plus nuclear) free energy of solvation. The Pekar factor enters the solvent reorganization energy of electron transfer reactions and is a significant mechanistic parametermore » accounting for the solvent effect on electron transfer. Here, we study the separation of the fast and slow polarization modes in polar molecular liquids (polarizable dipolar liquids and polarizable water force fields) without relying on the continuum approximation. We derive the nonlocal free energy functional and use atomistic numerical simulations to obtain nonlocal, reciprocal space electronic and nuclear susceptibilities. A consistent transition to the continuum limit is introduced by extrapolating the results of finite-size numerical simulation to zero wavevector. The continuum nuclear susceptibility extracted from simulations is numerically close to the Pekar factor. However, we derive a new functionality involving the static and high-frequency dielectric constants. The main distinction of our approach from the traditional theories is found for the solvation free energy due to the nuclear polarization: the anticipated significant drop of its magnitude with increasing liquid polarizability does not occur. The reorganization energy of electron transfer is either nearly constant with increasing the solvent polarizability and the corresponding high-frequency dielectric constant (polarizable dipolar liquids) or actually noticeably increases (polarizable force fields of water).« less

Free energy functionals for polarization fluctuations: Pekar factor revisited.

PubMed

Dinpajooh, Mohammadhasan; Newton, Marshall D; Matyushov, Dmitry V

2017-02-14

The separation of slow nuclear and fast electronic polarization in problems related to electron mobility in polarizable media was considered by Pekar 70 years ago. Within dielectric continuum models, this separation leads to the Pekar factor in the free energy of solvation by the nuclear degrees of freedom. The main qualitative prediction of Pekar's perspective is a significant, by about a factor of two, drop of the nuclear solvation free energy compared to the total (electronic plus nuclear) free energy of solvation. The Pekar factor enters the solvent reorganization energy of electron transfer reactions and is a significant mechanistic parameter accounting for the solvent effect on electron transfer. Here, we study the separation of the fast and slow polarization modes in polar molecular liquids (polarizable dipolar liquids and polarizable water force fields) without relying on the continuum approximation. We derive the nonlocal free energy functional and use atomistic numerical simulations to obtain nonlocal, reciprocal space electronic and nuclear susceptibilities. A consistent transition to the continuum limit is introduced by extrapolating the results of finite-size numerical simulation to zero wavevector. The continuum nuclear susceptibility extracted from the simulations is numerically close to the Pekar factor. However, we derive a new functionality involving the static and high-frequency dielectric constants. The main distinction of our approach from the traditional theories is found in the solvation free energy due to the nuclear polarization: the anticipated significant drop of its magnitude with increasing liquid polarizability does not occur. The reorganization energy of electron transfer is either nearly constant with increasing the solvent polarizability and the corresponding high-frequency dielectric constant (polarizable dipolar liquids) or actually noticeably increases (polarizable force fields of water).

Electron electric dipole moment and hyperfine interaction constants for ThO

NASA Astrophysics Data System (ADS)

Fleig, Timo; Nayak, Malaya K.

2014-06-01

A recently implemented relativistic four-component configuration interaction approach to study P- and T-odd interaction constants in atoms and molecules is employed to determine the electron electric dipole moment effective electric field in the Ω=1 first excited state of the ThO molecule. We obtain a value of Eeff=75.2GV/cm with an estimated error bar of 3% and 10% smaller than a previously reported result (Skripnikov et al., 2013). Using the same wavefunction model we obtain an excitation energy of TvΩ=1=5410 (cm), in accord with the experimental value within 2%. In addition, we report the implementation of the magnetic hyperfine interaction constant A|| as an expectation value, resulting in A||=-1339 (MHz) for the Ω=1 state in ThO. The smaller effective electric field increases the previously determined upper bound (Baron et al., 2014) on the electron electric dipole moment to |de|<9.7×10-29e cm and thus mildly mitigates constraints to possible extensions of the Standard Model of particle physics.

Diffusion in liquid Germanium using ab initio molecular dynamics

NASA Astrophysics Data System (ADS)

Kulkarni, R. V.; Aulbur, W. G.; Stroud, D.

1996-03-01

We describe the results of calculations of the self-diffusion constant of liquid Ge over a range of temperatures. The calculations are carried out using an ab initio molecular dynamics scheme which combines an LDA model for the electronic structure with the Bachelet-Hamann-Schlüter norm-conserving pseudopotentials^1. The energies associated with electronic degrees of freedom are minimized using the Williams-Soler algorithm, and ionic moves are carried out using the Verlet algorithm. We use an energy cutoff of 10 Ry, which is sufficient to give results for the lattice constant and bulk modulus of crystalline Ge to within 1% and 12% of experiment. The program output includes not only the self-diffusion constant but also the structure factor, electronic density of states, and low-frequency electrical conductivity. We will compare our results with other ab initio and semi-empirical calculations, and discuss extension to impurity diffusion. ^1 We use the ab initio molecular dynamics code fhi94md, developed at 1cm the Fritz-Haber Institute, Berlin. ^2 Work supported by NASA, Grant NAG3-1437.

First-principles study of the variation of electron transport in a single molecular junction with the length of the molecular wire

NASA Astrophysics Data System (ADS)

Pal, Partha Pratim; Pati, Ranjit

2010-07-01

We report a first-principles study of quantum transport in a prototype two-terminal device consisting of a molecular nanowire acting as an inter-connect between two gold electrodes. The wire is composed of a series of bicyclo[1.1.1]pentane (BCP) cage-units. The length of the wire (L) is increased by sequentially increasing the number of BCP cage units in the wire from 1 to 3. A two terminal model device is made out of each of the three wires. A parameter free, nonequilibrium Green’s function approach, in which the bias effect is explicitly included within a many body framework, is used to calculate the current-voltage characteristics of each of the devices. In the low bias regime that is considered in our study, the molecular devices are found to exhibit Ohmic behavior with resistances of 0.12, 1.4, and 6.5μΩ for the wires containing one, two, and three cages respectively. Thus the conductance value, Gc , which is the reciprocal of resistance, decreases as e-βL with a decay constant (β) of 0.59Å-1 . This observed variation of conductance with the length of the wire is in excellent agreement with the earlier reported exponential decay feature of the electron transfer rate predicted from the electron transfer coupling matrix values obtained using the two-state Marcus-Hush model and the Koopman’s theorem approximation. The downright suppression of the computed electrical current for a bias up to 0.4 V in the longest wire can be exploited in designing a three terminal molecular transistor; this molecular wire could potentially be used as a throttle to avoid leakage gate current.

Self-consistent average-atom scheme for electronic structure of hot and dense plasmas of mixture.

PubMed

Yuan, Jianmin

2002-10-01

An average-atom model is proposed to treat the electronic structures of hot and dense plasmas of mixture. It is assumed that the electron density consists of two parts. The first one is a uniform distribution with a constant value, which is equal to the electron density at the boundaries between the atoms. The second one is the total electron density minus the first constant distribution. The volume of each kind of atom is proportional to the sum of the charges of the second electron part and of the nucleus within each atomic sphere. By this way, one can make sure that electrical neutrality is satisfied within each atomic sphere. Because the integration of the electron charge within each atom needs the size of that atom in advance, the calculation is carried out in a usual self-consistent way. The occupation numbers of electron on the orbitals of each kind of atom are determined by the Fermi-Dirac distribution with the same chemical potential for all kinds of atoms. The wave functions and the orbital energies are calculated with the Dirac-Slater equations. As examples, the electronic structures of the mixture of Au and Cd, water (H2O), and CO2 at a few temperatures and densities are presented.

Theoretical study of the hyperfine-interaction constants and the isotope-shift factors for the 3 s21S0-3 s 3 p 3,1P1o transitions in Al+

NASA Astrophysics Data System (ADS)

Zhang, Tingxian; Xie, Luyou; Li, Jiguang; Lu, Zehuang

2017-07-01

We calculated the magnetic dipole and the electric quadrupole hyperfine interaction constants of 3 s 3 p 3,1P1o states and the isotope shift, including mass and field shift, factors for transitions from these two states to the ground state 3 s 2 1S0 in Al+ ions using the multiconfiguration Dirac-Hartree-Fock method. The effects of the electron correlations and the Breit interaction on these physical quantities were investigated in detail based on the active space approach. It is found that the core-core and the higher order correlations are considerable for evaluating the uncertainties of the atomic parameters concerned. The uncertainties of the hyperfine interaction constants in this work are less than 1.6%. Although the isotope shift factors are highly sensitive to the electron correlations, reasonable uncertainties were obtained by exploring the effects of the electron correlations. Moreover, we found that the relativistic nuclear recoil corrections to the mass shift factors are very small and insensitive to the electron correlations for Al+. These atomic parameters present in this work are valuable for extracting the nuclear electric quadrupole moments and the mean-square charge radii of Al isotopes.

Pixelated Geiger-Mode Avalanche Photo-Diode Characterization Through Dark Current Measurement

NASA Astrophysics Data System (ADS)

Amaudruz, Pierre-Andre; Bishop, Daryl; Gilhully, Colleen; Goertzen, Andrew; James, Lloyd; Kozlowski, Piotr; Retiere, Fabrice; Shams, Ehsan; Sossi, Vesna; Stortz, Greg; Thiessen, Jonathan D.; Thompson, Christopher J.

2014-06-01

PIXELATED geiger-mode avalanche photodiodes (PPDs), often called silicon photomultipliers (SiPMs) are emerging as an excellent replacement for traditional photomultiplier tubes (PMTs) in a variety of detectors, especially those for subatomic physics experiments, which requires extensive test and operation procedures in order to achieve uniform responses from all the devices. In this paper, we show for two PPD brands, Hamamatsu MPPC and SensL SPM, that at room temperature, the dark noise rate, breakdown voltage and rate of correlated avalanches can be inferred from the sole measure of dark current as a function of operating voltage, hence greatly simplifying the characterization procedure. We introduce a custom electronics system that allows measurement for many devices concurrently, hence allowing rapid testing and monitoring of many devices at low cost. Finally, we show that the dark current of Hamamastu Multi-Pixel Photon Counter (MPPC) is rather independent of temperature at constant operating voltage, hence the current measure cannot be used to probe temperature variations. On the other hand, the MPPC current can be used to monitor light source conditions in DC mode without requiring strong temperature stability, as long as the integrated source brightness is comparable to the dark noise rate.

Pulsed laser illumination of photovoltaic cells

NASA Technical Reports Server (NTRS)

Yater, Jane A.; Lowe, Roland A.; Jenkins, Phillip P.; Landis, Geoffrey A.

1995-01-01

In future space missions, free electron lasers (FEL) may be used to illuminate photovoltaic receivers to provide remote power. Both the radio-frequency (RF) and induction FEL produce pulsed rather than continuous output. In this work we investigate cell response to pulsed laser light which simulates the RF FEL format. The results indicate that if the pulse repetition is high, cell efficiencies are only slightly reduced compared to constant illumination at the same wavelength. The frequency response of the cells is weak, with both voltage and current outputs essentially dc in nature. Comparison with previous experiments indicates that the RF FEL pulse format yields more efficient photovoltaic conversion than does an induction FEL format.

Pulsed laser illumination of photovoltaic cells

NASA Technical Reports Server (NTRS)

Yater, Jane A.; Lowe, Roland A.; Jenkins, Phillip P.; Landis, Geoffrey A.

1994-01-01

In future space missions, free electron lasers (FEL) may be used to illuminate photovoltaic array receivers to provide remote power. Both the radio-frequency (RF) and induction FEL provide FEL produce pulsed rather than continuous output. In this work we investigate cell response to pulsed laser light which simulates the RF FEL format. The results indicate that if the pulse repetition is high, cell efficiencies are only slightly reduced compared to constant illumination at the same wavelength. The frequency response of the cells is weak, with both voltage and current outputs essentially dc in nature. Comparison with previous experiments indicates that the RF FEL pulse format yields more efficient photovoltaic conversion than does an induction FEL pulse format.

A Brief Review of Recent Superconductivity Research at NIST

PubMed Central

Lundy, D. R.; Swartzendruber, L. J.; Bennett, L. H.

1989-01-01

A brief overview of recent superconductivity research at NIST is presented. Emphasis is placed on the new high-temperature oxide superconductors, though mention is made of important work on low-temperature superconductors, and a few historical notes are included. NIST research covers a wide range of interests. For the new high-temperature superconductors, research activities include determination of physical properties such as elastic constants and electronic structure, development of new techniques such as magnetic-field modulated microwave-absorption and determination of phase diagrams and crystal structure. For the low-temperature superconductors, research spans studying the effect of stress on current density to the fabrication of a new Josephson junction voltage standard. PMID:28053408

B-side charge separation in bacterial photosynthetic reaction centers: nanosecond time scale electron transfer from HB- to QB.

PubMed

Kirmaier, Christine; Laible, Philip D; Hanson, Deborah K; Holten, Dewey

2003-02-25

We report time-resolved optical measurements of the primary electron transfer reactions in Rhodobacter capsulatus reaction centers (RCs) having four mutations: Phe(L181) --> Tyr, Tyr(M208) --> Phe, Leu(M212) --> His, and Trp(M250) --> Val (denoted YFHV). Following direct excitation of the bacteriochlorophyll dimer (P) to its lowest excited singlet state P, electron transfer to the B-side bacteriopheophytin (H(B)) gives P(+)H(B)(-) in approximately 30% yield. When the secondary quinone (Q(B)) site is fully occupied, P(+)H(B)(-) decays with a time constant estimated to be in the range of 1.5-3 ns. In the presence of excess terbutryn, a competitive inhibitor of Q(B) binding, the observed lifetime of P(+)H(B)(-) is noticeably longer and is estimated to be in the range of 4-8 ns. On the basis of these values, the rate constant for P(+)H(B)(-) --> P(+)Q(B)(-) electron transfer is calculated to be between approximately (2 ns)(-)(1) and approximately (12 ns)(-)(1), making it at least an order of magnitude smaller than the rate constant of approximately (200 ps)(-)(1) for electron transfer between the corresponding A-side cofactors (P(+)H(A)(-) --> P(+)Q(A)(-)). Structural and energetic factors associated with electron transfer to Q(B) compared to Q(A) are discussed. Comparison of the P(+)H(B)(-) lifetimes in the presence and absence of terbutryn indicates that the ultimate (i.e., quantum) yield of P(+)Q(B)(-) formation relative to P is 10-25% in the YFHV RC.

Interstate vibronic coupling constants between electronic excited states for complex molecules

NASA Astrophysics Data System (ADS)

Fumanal, Maria; Plasser, Felix; Mai, Sebastian; Daniel, Chantal; Gindensperger, Etienne

2018-03-01

In the construction of diabatic vibronic Hamiltonians for quantum dynamics in the excited-state manifold of molecules, the coupling constants are often extracted solely from information on the excited-state energies. Here, a new protocol is applied to get access to the interstate vibronic coupling constants at the time-dependent density functional theory level through the overlap integrals between excited-state adiabatic auxiliary wavefunctions. We discuss the advantages of such method and its potential for future applications to address complex systems, in particular, those where multiple electronic states are energetically closely lying and interact. We apply the protocol to the study of prototype rhenium carbonyl complexes [Re(CO)3(N,N)(L)]n+ for which non-adiabatic quantum dynamics within the linear vibronic coupling model and including spin-orbit coupling have been reported recently.

Kinetic and mechanism of the oxidation of chromium(III) complex with anthranil- N, N-diacetic acid by periodate ion in acidic aqueous solutions

NASA Astrophysics Data System (ADS)

Ali, Ismat H.

2015-06-01

The kinetics of oxidation of [CrIII(atda)(H2O)2] (atda = anthranil- N, N-diacetato) complex by IO{4/-} was studied spectrophotometrically in aqueous solutions with pH range 2.20-3.34, 0.30 M ionic strength and in 20.0-40.0°C temperature range. The rate law of the reaction exhibited saturation kinetics. Values of the rate constant for the electron transfer process, the equilibrium constant for dissociation of [CrIII (atda)(H2O)2] to [CrIII (atda) (H2O)OH]+ + H+ and the pre-equilibrium formation constant were calculated. The thermodynamic activation parameters are reported. It is proposed that electron transfer proceeds through an inner-sphere mechanism via coordination of the IVII to chromium(III).

Prediction of electronic and optical properties of ZnAl2Te4 defect chalcopyrite semiconductor: an ab-initio study

NASA Astrophysics Data System (ADS)

Mayengbam, Rishikanta; Tripathy, S. K.; Pandey, B. P.

2018-03-01

In this paper, we have investigated the structural, electronic and optical properties of ZnAl2Te4 defect chalcopyrite semiconductor using generalized gradient approximation (GGA) within density functional theory (DFT). We have calculated the optimized lattice constants (a and c) and compared with the available experimental values. The optimized lattice constants have been used to calculate the energy band gap and found to be 1.57 eV. The partial density of states and total density of states have been discussed in detail. The frequency dependent dielectric constant and refractive index have been calculated and plotted in the energy range 0-13 eV. All the above parameters have been compared with the available experimental and theoretical values and found good agreement between them.

Electron Temperature Evolution During Local Helicity Injection on the Pegasus Toroidal Experiment

NASA Astrophysics Data System (ADS)

Schlossberg, D. J.; Barr, J. L.; Bodner, G. M.; Bongard, M. W.; Fonck, R. J.; Perry, J. M.; Reusch, J. A.; Rodriguez Sanchez, C.

2016-10-01

Understanding the electron temperature (Te) evolution during local helicity injection (LHI) is critical for scaling up this non-solenoidal startup technique to MA-class devices. The first comprehensive Te measurements during LHI reveal centrally-peaked profiles with Te > 100 eV for plasma current Ip > 120 kA, toroidal field 0.15 T, and electron density ne 1019 m-3. Te rises and is sustained from just after magnetic relaxation through the plasma decoupling from edge-localized injectors. Results are presented for two injector edge locations: outboard midplane and inboard divertor. Outboard midplane injection couples LHI with inductive drive from poloidal field ramps and radial compression during inward plasma growth. Comparisons of Te at different LHI-to-inductive drive ratios show some profile flattening for higher LHI drive fraction. The latter, constant-shape discharges were necessarily lower performance, with Ip 50 kA and reduced Te , max. Inboard divertor injection achieves higher Ip using minimal inductive drive and thus isolates effects of LHI drive on Te. Initial results in this configuration show Te rising rapidly at the injector location as the discharge grows, settling to a roughly flat profile 100 eV. Thus far, both scenarios provide relatively stable discharges with moderate ne and high-Te, suitable for coupling to auxiliary current drive. Detailed studies of confinement dynamics and discharge optimization are planned for the near future. Work supported by US DOE Grant DE-FG02-96ER54375.

Epitaxial-Growth-Induced Junction Welding of Silver Nanowire Network Electrodes.

PubMed

Kang, Hyungseok; Song, Sol-Ji; Sul, Young Eun; An, Byeong-Seon; Yin, Zhenxing; Choi, Yongsuk; Pu, Lyongsun; Yang, Cheol-Woong; Kim, Youn Sang; Cho, Sung Min; Kim, Jung-Gu; Cho, Jeong Ho

2018-05-22

In this study, we developed a roll-to-roll Ag electroplating process for metallic nanowire electrodes using a galvanostatic mode. Electroplating is a low-cost and facile method for deposition of metal onto a target surface with precise control of both the composition and the thickness. Metallic nanowire networks [silver nanowires (AgNWs) and copper nanowires (CuNWs)] coated onto a polyethylene terephthalate (PET) film were immersed directly in an electroplating bath containing AgNO 3 . Solvated silver ions (Ag + ions) were deposited onto the nanowire surface through application of a constant current via an external circuit between the nanowire networks (cathode) and a Ag plate (anode). The amount of electroplated Ag was systematically controlled by changing both the applied current density and the electroplating time, which enabled precise control of the sheet resistance and optical transmittance of the metallic nanowire networks. The optimized Ag-electroplated AgNW (Ag-AgNW) films exhibited a sheet resistance of ∼19 Ω/sq at an optical transmittance of 90% (550 nm). A transmission electron microscopy study confirmed that Ag grew epitaxially on the AgNW surface, but a polycrystalline Ag structure was formed on the CuNW surface. The Ag-electroplated metallic nanowire electrodes were successfully applied to various electronic devices such as organic light-emitting diodes, triboelectric nanogenerators, and a resistive touch panel. The proposed roll-to-roll Ag electroplating process provides a simple, low-cost, and scalable method for the fabrication of enhanced transparent conductive electrode materials for next-generation electronic devices.

An investigation into the effects of frequency-modulated transcutaneous electrical nerve stimulation (TENS) on experimentally-induced pressure pain in healthy human participants.

PubMed

Chen, Chih-Chung; Johnson, Mark I

2009-10-01

Frequency-modulated transcutaneous electrical nerve stimulation (TENS) delivers currents that fluctuate between preset boundaries over a fixed period of time. This study compared the effects of constant-frequency TENS and frequency-modulated TENS on blunt pressure pain in healthy human volunteers. Thirty-six participants received constant-frequency TENS (80 pps), frequency-modulated TENS (20 to 100 pps), and placebo (no current) TENS at a strong nonpainful intensity in a randomized cross-over manner. Pain threshold was taken from the forearm using pressure algometry. There were no statistical differences between constant-frequency TENS and frequency-modulated TENS after 20 minutes (OR = 1.54; CI, 0.29, 8.23, P = 1.0). Both constant-frequency TENS and frequency-modulated TENS were superior to placebo TENS (OR = 59.5, P < .001 and OR = 38.5, P < .001, respectively). Frequency-modulated TENS does not influence hypoalgesia to any greater extent than constant-frequency TENS when currents generate a strong nonpainful paraesthesia at the site of pain. The finding that frequency-modulated TENS and constant-frequency TENS were superior to placebo TENS provides further evidence that a strong yet nonpainful TENS intensity is a prerequisite for hypoalgesia. This study provides evidence that TENS, delivered at a strong nonpainful intensity, increases pain threshold to pressure algometry in healthy participants over and above that seen with placebo (no current) TENS. Frequency-modulated TENS does not increase hypoalgesia to any appreciable extent to that seen with constant-frequency TENS.

Low-Dielectric Polyimides

NASA Technical Reports Server (NTRS)

St. Clair, Anne K.; St. Clair, Terry L.; Winfree, William P.; Emerson, Bert R., Jr.

1989-01-01

New process developed to produce aromatic condensation polyimide films and coatings having dielectric constants in range of 2.4 to 3.2. Materials better electrical insulators than state-of-the-art commercial polyimides. Several low-dielectric-constant polyimides have excellent resistance to moisture. Useful as film and coating materials for both industrial and aerospace applications where high electrical insulation, resistance to moisture, mechanical strength, and thermal stability required. Applicable to production of high-temperature and moisture-resistance adhesives, films, photoresists, and coatings. Electronic applications include printed-circuit boards, both of composite and flexible-film types and potential use in automotive, aerospace, and electronic industries.

LED characterization for development of on-board calibration unit of CCD-based advanced wide-field sensor camera of Resourcesat-2A

NASA Astrophysics Data System (ADS)

Chatterjee, Abhijit; Verma, Anurag

2016-05-01

The Advanced Wide Field Sensor (AWiFS) camera caters to high temporal resolution requirement of Resourcesat-2A mission with repeativity of 5 days. The AWiFS camera consists of four spectral bands, three in the visible and near IR and one in the short wave infrared. The imaging concept in VNIR bands is based on push broom scanning that uses linear array silicon charge coupled device (CCD) based Focal Plane Array (FPA). On-Board Calibration unit for these CCD based FPAs is used to monitor any degradation in FPA during entire mission life. Four LEDs are operated in constant current mode and 16 different light intensity levels are generated by electronically changing exposure of CCD throughout the calibration cycle. This paper describes experimental setup and characterization results of various flight model visible LEDs (λP=650nm) for development of On-Board Calibration unit of Advanced Wide Field Sensor (AWiFS) camera of RESOURCESAT-2A. Various LED configurations have been studied to meet dynamic range coverage of 6000 pixels silicon CCD based focal plane array from 20% to 60% of saturation during night pass of the satellite to identify degradation of detector elements. The paper also explains comparison of simulation and experimental results of CCD output profile at different LED combinations in constant current mode.

Growth of ZnO films in sol-gel electrophoretic deposition by different solvents

NASA Astrophysics Data System (ADS)

Hallajzadeh, Amir Mohammad; Abdizadeh, Hossein; Taheri, Mahtab; Golobostanfard, Mohammad Reza

2018-01-01

This article introduces a process to fabricate zinc oxide (ZnO) films through combining sol preparation and electrophoretic deposition (EPD). The experimental results have proved that the EPD process is a powerful route to fabricate ZnO films with desire thickness from stable colloidal suspension under a direct current (DC) electric field. In this method, ZnO sol is prepared by dissolving zinc acetate dehydrate (ZAD) as the main precursor and diethanolamine (DEA) as the additive in various solvents such as methanol (MeOH), ethanol (EtOH), and 2-proponal (2-PrOH). The deposition was performed under a constant voltage of 30 V for 2 min. Scanning electron microscopy (SEM), X-ray diffraction (XRD), and diffuse reflectance spectroscopy (DRS) were used to characterize ZnO films. XRD pattern of the ZnO film prepared by MeOH shows the highest degree of preferential orientation and this is mainly attributed to the higher dielectric constant of the MeOH which results in higher current density in electrophoretic deposit ion. The SEM cross section images also show that the thickness of the ZnO film enhances by decreasing the solvent chain length. According to SEM results, as the viscosity of the medium increased, more compact layers are formed, which can be attributed to the lower deposition rates in heavier alcohols.

First-principles study of the structural, elastic, vibrational, thermodynamic and electronic properties of the Mo2B intermetallic under pressure

NASA Astrophysics Data System (ADS)

Escamilla, R.; Carvajal, E.; Cruz-Irisson, M.; Romero, M.; Gómez, R.; Marquina, V.; Galván, D. H.; Durán, A.

2016-12-01

The structural, elastic, vibrational, thermodynamic and electronic properties of the Mo2B intermetallic under pressure are assessed using first-principles calculations based on the generalized gradient approximation (GGA) proposed by Perdew-Wang (PW91). Our results show that the calculated structural parameters at a pressure of zero GPa are in good agreement with the available experimental data. The effect of high pressures on the lattice constants shows that the compression along the c-axis and along the a-axis are similar. The elastic constants were calculated using the static finite strain technique, and the bulk shear moduli are derived from the ideal polycrystalline aggregate. We find that the elastic constants, elastic modulus and hardness monotonically increase as a function of pressure; consequently, the structure is dynamically stable and tends from brittle to ductile behavior under pressure. The Debye temperature θD increases and the so-called Gru¨ neisen constant γ decreases due to stiffening of the crystal structure. The phonon dispersion curves were obtained using the direct method. Additionally, the internal energy (ΔE), the Helmholtz free energy (ΔF), the entropy (S) and the lattice contribution to the heat capacity Cv were calculated and analyzed with the help of the phonon dispersion curves. The N(EF) and the electron transfer between the B and Mo atoms increase as a function of pressure.

Structural, electronic, elastic, and thermal properties of CaNiH3 perovskite obtained from first-principles calculations

NASA Astrophysics Data System (ADS)

Benlamari, S.; Bendjeddou, H.; Boulechfar, R.; Amara Korba, S.; Meradji, H.; Ahmed, R.; Ghemid, S.; Khenata, R.; Omran, S. Bin

2018-03-01

A theoretical study of the structural, elastic, electronic, mechanical, and thermal properties of the perovskite-type hydride CaNiH3 is presented. This study is carried out via first-principles full potential (FP) linearized augmented plane wave plus local orbital (LAPW+lo) method designed within the density functional theory (DFT). To treat the exchange–correlation energy/potential for the total energy calculations, the local density approximation (LDA) of Perdew–Wang (PW) and the generalized gradient approximation (GGA) of Perdew–Burke–Ernzerhof (PBE) are used. The three independent elastic constants (C 11, C 12, and C 44) are calculated from the direct computation of the stresses generated by small strains. Besides, we report the variation of the elastic constants as a function of pressure as well. From the calculated elastic constants, the mechanical character of CaNiH3 is predicted. Pertaining to the thermal properties, the Debye temperature is estimated from the average sound velocity. To further comprehend this compound, the quasi-harmonic Debye model is used to analyze the thermal properties. From the calculations, we find that the obtained results of the lattice constant (a 0), bulk modulus (B 0), and its pressure derivative ({B}0^{\\prime }) are in good agreement with the available theoretical as well as experimental results. Similarly, the obtained electronic band structure demonstrates the metallic character of this perovskite-type hydride.