Cell-flow technique.

PubMed

Hess, George P; Lewis, Ryan W; Chen, Yongli

2014-10-01

Various devices have been used to flow neurotransmitter solutions over cells containing receptors (e.g., ligand-gated ion channels) for whole-cell current recordings. With many of the devices, the orientation between the porthole of the flow device and the cell is not maintained absolutely constant. Orientation is critical for reproducibility in kinetic experiments. To be able to change the composition of the flowing solution during an experiment and still maintain a constant orientation, we use the cell-flow device described here. A peristaltic pump, a stainless steel U-tube, two different sizes of peristaltic tubing, and a solenoid valve are required to create a simple solution exchange system that can rapidly apply and remove solutions over the surface of a cell in tens of milliseconds. This system allows one to test multiple conditions on a cell containing the receptor of interest while constantly "washing" the cell with extracellular buffer solution between experimental applications. The use of the solenoid valve allows for the application of solutions to be precisely timed and controlled by a computer during electrophysiological current recording. © 2014 Cold Spring Harbor Laboratory Press.

Modular Exhaust Design and Manufacturing Techniques for Low Cost Mid Volume Rapid Buidl to Order Systems

DTIC Science & Technology

2014-08-06

the pressure field is uniform across them, but which allow mass flow to be diverted. Series elements have a constant mass flow across the ports...they can be used to calculate the pressure and mass flow after the element from the pressure and mass flow prior to the element, as shown in...the matrix product of each transfer matrix in turn. The final matrix gives no information about the pressures and mass flows within the element

Bounding the Resource Availability of Partially Ordered Events with Constant Resource Impact

NASA Technical Reports Server (NTRS)

Frank, Jeremy

2004-01-01

We compare existing techniques to bound the resource availability of partially ordered events. We first show that, contrary to intuition, two existing techniques, one due to Laborie and one due to Muscettola, are not strictly comparable in terms of the size of the search trees generated under chronological search with a fixed heuristic. We describe a generalization of these techniques called the Flow Balance Constraint to tightly bound the amount of available resource for a set of partially ordered events with piecewise constant resource impact We prove that the new technique generates smaller proof trees under chronological search with a fixed heuristic, at little increase in computational expense. We then show how to construct tighter resource bounds but at increased computational cost.

Measurement Techniques for Flow Diagnostic in ITAM Impulse Wind Tunnels

DTIC Science & Technology

2010-04-01

time of wind - tunnel operation, so that oscillations caused by initial shock loads could decay and a comparatively long time period with constant flow...Flow Diagnostic in ITAM Impulse Wind Tunnels 7 - 4 RTO-EN-AVT-186 A strain-gauge pressure probe is an elastic element (membrane) in a sealed...Diagnostic in ITAM Impulse Wind Tunnels RTO-EN-AVT-186 7 - 5 probes are individually calibrated. Piezoelectric pressure gauges are based

AUTOMATED TECHNIQUE FOR FLOW MEASUREMENTS FROM MARIOTTE RESERVOIRS.

USGS Publications Warehouse

Constantz, Jim; Murphy, Fred

1987-01-01

The mariotte reservoir supplies water at a constant hydraulic pressure by self-regulation of its internal gas pressure. Automated outflow measurements from mariotte reservoirs are generally difficult because of the reservoir's self-regulation mechanism. This paper describes an automated flow meter specifically designed for use with mariotte reservoirs. The flow meter monitors changes in the mariotte reservoir's gas pressure during outflow to determine changes in the reservoir's water level. The flow measurement is performed by attaching a pressure transducer to the top of a mariotte reservoir and monitoring gas pressure changes during outflow with a programmable data logger. The advantages of the new automated flow measurement techniques include: (i) the ability to rapidly record a large range of fluxes without restricting outflow, and (ii) the ability to accurately average the pulsing flow, which commonly occurs during outflow from the mariotte reservoir.

Analysis of the dynamics of renal vascular resistance and urine flow rate in the cat following electrical stimulation of the renal nerves.

PubMed

Celler, B G; Stella, A; Golin, R; Zanchetti, A

1996-08-01

In ten sino aortic denervated, vagotomized and aneasthetized cats, renal efferent nerves were stimulated for 30 s with trains of constant current pulses at frequencies in the range 5-30 Hz. The arterial pressure, heart rate, urine flow rate (electronic drop counter) and renal blood flow (electromagnetic technique) were recorded. Subsequent computer processing gave the true means of renal artery pressure (MRAP) and renal blood flow (MRBF) and hence the renal vascular resistance (MRVR), over each cardiac cycle. Recovery of MRVR after the end of stimulation exhibited two distinct time constants. The fast component had a time constant of 2.03 +/- 0.26 s and represented 60.2 +/- 1.71% of the recovery. The time constant of the slower component was 14.1 +/- 1.9 s and represented 36.0 +/- 1.6% of the recovery. The relationship between MRVR and stimulus frequency was sigmoidal with maximum sensitivity at stimulus frequencies of 12.6 +/- 0.76 Hz. Changes in urine flow rate, in contrast, followed a hyperbolic function with maximum response sensitivity occurring at very low stimulus frequencies. Changes in urine flow rate were 50% complete at stimulus frequencies of 5 Hz. Identification of two distinct components in the relaxation phase of renal vascular resistance leads to a reasonable hypothesis that 60% of total renal vascular resistance may lie proximal to the glomerulus, whereas 36% may be accounted for by the efferent arterioles.

Flow Tube Studies of Gas Phase Chemical Processes of Atmospheric Importance

NASA Technical Reports Server (NTRS)

Molina, Mario J.

1997-01-01

The objective of this project is to conduct measurements of elementary reaction rate constants and photochemistry parameters for processes of importance in the atmosphere. These measurements are being carried out under temperature and pressure conditions covering those applicable to the stratosphere and upper troposphere, using the chemical ionization mass spectrometry turbulent flow technique developed in our laboratory.

Renormalization group analysis of turbulence

NASA Technical Reports Server (NTRS)

Smith, Leslie M.

1989-01-01

The objective is to understand and extend a recent theory of turbulence based on dynamic renormalization group (RNG) techniques. The application of RNG methods to hydrodynamic turbulence was explored most extensively by Yakhot and Orszag (1986). An eddy viscosity was calculated which was consistent with the Kolmogorov inertial range by systematic elimination of the small scales in the flow. Further, assumed smallness of the nonlinear terms in the redefined equations for the large scales results in predictions for important flow constants such as the Kolmogorov constant. It is emphasized that no adjustable parameters are needed. The parameterization of the small scales in a self-consistent manner has important implications for sub-grid modeling.

Performance of Improved High-Order Filter Schemes for Turbulent Flows with Shocks

NASA Technical Reports Server (NTRS)

Kotov, Dmitry Vladimirovich; Yee, Helen M C.

2013-01-01

The performance of the filter scheme with improved dissipation control ? has been demonstrated for different flow types. The scheme with local ? is shown to obtain more accurate results than its counterparts with global or constant ?. At the same time no additional tuning is needed to achieve high accuracy of the method when using the local ? technique. However, further improvement of the method might be needed for even more complex and/or extreme flows.

Method and apparatus for fringe-scanning chromosome analysis

DOEpatents

Norgren, R.M.; Gray, J.W.; Hirschfeld, T.B.

1983-08-31

Apparatus and method are provided for analyzing sub-micron-sized features of microscopic particles. Two central features of the invention are (1) constraining microscopic particles to flow with substantially constant orientation through a predetermined interference fringe pattern, and (2) estimating particle structure by analyzing its fringe profile. The invention allows nearly an order of magnitude higher resolution of chromosome structure than possible with currently available flow system techniques. The invention allows rapid and accurate flow karyotyping of chromosomes.

Design of a pulsed-mode fluidic pump using a venturi-like reverse flow diverter. [With no packing glands, mechanical seals or moving parts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, G.V.; Lewis, B.E.

1987-02-01

This report presents a design procedure for pulsed-mode, venturi-like reverse flow diverter (RFD) pumping systems. Design techniques are presented for systems in which the output line area is allowed to vary proportionally with the throat area of the RFD as well as situations in which the output line area is held constant. The results show that for cases in which the output line area is allowed to vary, an optimum RFD throat area exists for a given input pressure. For situations in which the output line area is held constant, the average output flow decreases in almost a linear fashionmore » with increasing RFD throat area. 6 refs., 8 figs.« less

Unsteady flow past an airfoil pitched at constant rate

NASA Technical Reports Server (NTRS)

Lourenco, L.; Vandommelen, L.; Shib, C.; Krothapalli, A.

1992-01-01

The unsteady flow past a NACA 0012 airfoil that is undertaking a constant-rate pitching up motion is investigated experimentally by the PIDV technique in a water towing tank. The Reynolds number is 5000, based upon the airfoil's chord and the free-stream velocity. The airfoil is pitching impulsively from 0 to 30 deg. with a dimensionless pitch rate alpha of 0.131. Instantaneous velocity and associated vorticity data have been acquired over the entire flow field. The primary vortex dominates the flow behavior after it separates from the leading edge of the airfoil. Complete stall emerges after this vortex detaches from the airfoil and triggers the shedding of a counter-rotating vortex near the trailing edge. A parallel computational study using the discrete vortex, random walk approximation has also been conducted. In general, the computational results agree very well with the experiment.

Development of an Active Flow Control Technique for an Airplane High-Lift Configuration

NASA Technical Reports Server (NTRS)

Shmilovich, Arvin; Yadlin, Yoram; Dickey, Eric D.; Hartwich, Peter M.; Khodadoust, Abdi

2017-01-01

This study focuses on Active Flow Control methods used in conjunction with airplane high-lift systems. The project is motivated by the simplified high-lift system, which offers enhanced airplane performance compared to conventional high-lift systems. Computational simulations are used to guide the implementation of preferred flow control methods, which require a fluidic supply. It is first demonstrated that flow control applied to a high-lift configuration that consists of simple hinge flaps is capable of attaining the performance of the conventional high-lift counterpart. A set of flow control techniques has been subsequently considered to identify promising candidates, where the central requirement is that the mass flow for actuation has to be within available resources onboard. The flow control methods are based on constant blowing, fluidic oscillators, and traverse actuation. The simulations indicate that the traverse actuation offers a substantial reduction in required mass flow, and it is especially effective when the frequency of actuation is consistent with the characteristic time scale of the flow.

Calculation of stability derivatives for slowly oscillating bodies of revolution at Mach 1.0

NASA Technical Reports Server (NTRS)

Ruo, S. Y.; Liu, D. D.

1971-01-01

A parabolic method for steady transonic flow is extended to bodies of revolution oscillating in a sonic flow field. A Laplace transform technique is employed to derive the dipole solution, and the Adams-Sears iterative technique is used in the stability derivative calculation. A computer program is developed to perform the stability derivative calculation for the slowly oscillating cone and parabolic ogive. Inputs for the program are body geometry thickness ratio, acceleration constant, and pitch axis location. Sample calculations were performed for the parabolic ogive and circular cone and results are compared with those obtained by using other techniques and the available experimental data for circular cones.

Multiphase imaging of gas flow in a nanoporous material using remote-detection NMR

NASA Astrophysics Data System (ADS)

Harel, Elad; Granwehr, Josef; Seeley, Juliette A.; Pines, Alex

2006-04-01

Pore structure and connectivity determine how microstructured materials perform in applications such as catalysis, fluid storage and transport, filtering or as reactors. We report a model study on silica aerogel using a time-of-flight magnetic resonance imaging technique to characterize the flow field and explain the effects of heterogeneities in the pore structure on gas flow and dispersion with 129Xe as the gas-phase sensor. The observed chemical shift allows the separate visualization of unrestricted xenon and xenon confined in the pores of the aerogel. The asymmetrical nature of the dispersion pattern alludes to the existence of a stationary and a flow regime in the aerogel. An exchange time constant is determined to characterize the gas transfer between them. As a general methodology, this technique provides insights into the dynamics of flow in porous media where several phases or chemical species may be present.

The dynamic interaction of a marine hydrokinetic turbine with its environment

NASA Astrophysics Data System (ADS)

Kolekar, Nitin; Banerjee, Arindam

2014-11-01

Unlike wind turbines, marine hydrokinetic and tidal turbines operate in a bounded flow environment where flow is constrained between deformable free surface and fixed river/sea bed. The proximity to free surface modifies the wake dynamics behind the turbine. Further, size & shape of this wake is not constant but depends on multiple factors like flow speed, turbine blade geometry, and rotational speed. In addition, the turbulence characteristics of incoming flow also affects the flow field and hence the performance. The current work aims at understanding the dynamic interaction of a hydrokinetic turbine (HkT) with free surface and flow turbulence through experimental investigations. Results will be presented from experimental study carried out in an open channel test facility at Lehigh University with a three bladed, constant chord, zero twist HkT under various operating conditions. Froude number (ratio of characteristic flow velocity to gravitational wave velocity) is used to characterize the effect of free surface proximity on turbine performance. Experimental results will be compared with analytical models based on blade element momentum theory. Characterization of wake meandering and flow around turbine will be performed using a stereo-Particle Image Velocimetry technique.

Use of pressure in reversed-phase liquid chromatography to study protein conformational changes by differential deuterium exchange.

PubMed

Makarov, Alexey A; Schafer, Wes A; Helmy, Roy

2015-02-17

The market of protein therapeutics is exploding, and characterization methods for proteins are being further developed to understand and explore conformational structures with regards to function and activity. There are several spectroscopic techniques that allow for analyzing protein secondary structure in solution. However, a majority of these techniques need to use purified protein, concentrated enough in the solution to produce a relevant spectrum. In this study, we describe a novel approach which uses ultrahigh pressure liquid chromatography (UHPLC) coupled with mass-spectrometry (MS) to explore compressibility of the secondary structure of proteins under increasing pressure detected by hydrogen-deuterium exchange (HDX). Several model proteins were used for these studies. The studies were conducted with UHPLC in isocratic mode at constant flow rate and temperature. The pressure was modified by a backpressure regulator up to about 1200 bar. It was found that the increase of retention factors upon pressure increase, at constant flow rate and temperature, was based on reduction of the proteins' molecular molar volume. The change in the proteins' molecular molar volume was caused by changes in protein folding, as was revealed by differential deuterium exchange. The degree of protein folding under certain UHPLC conditions can be controlled by pressure, at constant temperature and flow rate. By modifying pressure during UHPLC separation, it was possible to achieve changes in protein folding, which were manifested as changes in the number of labile protons exchanged to deuterons, or vice versa. Moreover, it was demonstrated with bovine insulin that a small difference in the number of protons exchanged to deuterons (based on protein folding under pressure) could be observed between batches obtained from different sources. The use of HDX during UHPLC separation allowed one to examine protein folding by pressure at constant flow rate and temperature in a mixture of sample solution with minimal amounts of sample used for analysis.

Physiological breakdown of Jeffrey six constant nanofluid flow in an endoscope with nonuniform wall

NASA Astrophysics Data System (ADS)

Nadeem, S.; Shaheen, A.; Hussain, S.

2015-12-01

This paper analyse the endoscopic effects of peristaltic nanofluid flow of Jeffrey six-constant fluid model in the presence of magnetohydrodynamics flow. The current problem is modeled in the cylindrical coordinate system and exact solutions are managed (where possible) under low Reynolds number and long wave length approximation. The influence of emerging parameters on temperature and velocity profile are discussed graphically. The velocity equation is solved analytically by utilizing the homotopy perturbation technique strongly, while the exact solutions are computed from temperature equation. The obtained expressions for velocity , concentration and temperature is sketched during graphs and the collision of assorted parameters is evaluate for transform peristaltic waves. The solution depend on thermophoresis number Nt, local nanoparticles Grashof number Gr, and Brownian motion number Nb. The obtained expressions for the velocity, temperature, and nanoparticles concentration profiles are plotted and the impact of various physical parameters are investigated for different peristaltic waves.

Dynamic Characteristics of The DSI-Type Constant-Flow Valves

NASA Astrophysics Data System (ADS)

Kang, Yuan; Hu, Sheng-Yan; Chou, Hsien-Chin; Lee, Hsing-Han

Constant flow valves have been presented in industrial applications or academic studies, which compensate recess pressures of a hydrostatic bearing to resist load fluctuating. The flow rate of constant-flow valves can be constant in spite of the pressure changes in recesses, however the design parameters must be specified. This paper analyzes the dynamic responses of DSI-type constant-flow valves that is designed as double pistons on both ends of a spool with single feedback of working pressure and regulating restriction at inlet. In this study the static analysis presents the specific relationships among design parameters for constant flow rate and the dynamic analyses give the variations around the constant flow rate as the working pressure fluctuates.

Bubble formation dynamics in a planar co-flow configuration: Influence of geometric and operating characteristics

NASA Astrophysics Data System (ADS)

Gutiérrez-Montes, Cándido; Bolaños-Jiménez, Rocío; Martínez-Bazán, Carlos; Sevilla, Alejandro

2014-11-01

An experimental and numerical study has been performed to explore the influence of different geometric features and operating conditions on the dynamics of a water-air-water planar co-flow. Specifically, regarding the nozzle used, the inner-to-outer thickness ratio of the air injector, β = Hi/Ho, the water-to-air thickness ratio, h = Hw/Ho, and the shape of the injector tip, have been described. As for the operating conditions, the water exit velocity profile under constant flow rate and constant air feeding pressure has been assessed. The results show that the jetting-bubbling transition is promoted for increasing values of β, decreasing values of h, rounded injector tip, and for uniform water exit velocity profiles. As for the bubble formation frequency, it increases with increasing values of β, decreasing values of h, rounded injector and parabolic-shaped water exit profiles. Furthermore, the bubble formation frequency has been shown to be lower under constant air feeding pressure conditions than at constant gas flow rate conditions. Finally, the effectiveness of a time-variable air feeding stream has been numerically studied, determining the forcing receptivity space in the amplitude-frequency plane. Experimental results corroborate the effectiveness of this control technique. Work supported by Spanish MINECO, Junta de Andalucía, European Funds and UJA under Projects DPI2011-28356-C03-02, DPI2011-28356-C03-03, P11-TEP7495 and UJA2013/08/05.

Using Wirtinger calculus and holomorphic matching to obtain the discharge potential for an elliptical pond

NASA Astrophysics Data System (ADS)

Strack, O. D. L.

2009-01-01

We present in this paper a new method for deriving discharge potentials for groundwater flow. Discharge potentials are two-dimensional functions; the discharge potential to be presented represents steady groundwater flow with an elliptical pond of constant rate of extraction or infiltration. The method relies on Wirtinger calculus. We demonstrate that it is possible, in principle, to construct a holomorphic function Ω(z), defined so as to produce the same gradient vector in two dimensions as that obtained from an arbitrary function F(x, y) along any Jordan curve ?. We will call Ω(z) the holomorphic match of F(x, y) along ?. Let the line ? be a closed contour bounding a domain ?, and let F(x, y) be defined in ? and represent the discharge potential for some case of divergent groundwater flow. Holomorphic matching makes it possible to create a function Ω(z), valid outside ?, such that ?Ω equals F(x, y) and the gradient of ?Ω equals that of F(x, y) along ?. (Note that the technique applies also if ? is the domain outside ?.) We can use this technique to construct solutions for cases of flow where there is nonzero divergence (due to infiltration or leakage, for example) in ? but zero divergence outside ?. The special case that the divergence within ? is constant and is zero outside ? is chosen to illustrate the approach and to obtain a solution that, to the knowledge of the author, does not exist in the field of groundwater flow.

Stress and flow analyses of ultraviolet-curable resin during curing

NASA Astrophysics Data System (ADS)

Umezaki, Eisaku; Okano, Akira; Koyama, Hiroto

2014-06-01

The stress and flow generated in ultraviolet (UV)-curable resin during curing in molds were measured to investigate their relationship. The specimens were molds consisting of glass plates and acrylic bars, and UV-curable liquid resin. The specimens were illuminated from above with UV rays. Photoelastic and visual images were separately obtained at a constant time interval using cameras during curing. To help obtain the visual images, acrylic powder was mixed with the liquid resin. The stress was obtained from the photoelastic images by a digital photoelastic technique with phase stepping, and the flow was obtained from the visual images by a particle-tracking velocimetry technique. Results indicate that the stress generated in the UV-curable resin during curing depends on the degree of contact between the mold and the cured area of the resin, and is hardly related to the flow.

Measurements in the Turbulent Boundary Layer at Constant Pressure in Subsonic and Supersonic Flow. Part I. Mean Flow

DTIC Science & Technology

1978-05-01

distribution unlimited. I REPORTS ":-- r , Prepared for ARNOLD ENGINEERING DEVELOPMENT CENTER/DOTR AiR FORCE SYSTEMS COMMAND ARNOLD AIR FORCE STATIONI...section and diffuser. The measurements used the JPL multlport measuring system , which simultaneously recorded the stag- nation temperature and...stagnation and static pressures were recorded by the data system . For. the experiments.at CIT, two techniques were employed. Within the first i00 cm from

Very high pressure liquid chromatography using core-shell particles: quantitative analysis of fast gradient separations without post-run times.

PubMed

Stankovich, Joseph J; Gritti, Fabrice; Stevenson, Paul G; Beaver, Lois A; Guiochon, Georges

2014-01-17

Five methods for controlling the mobile phase flow rate for gradient elution analyses using very high pressure liquid chromatography (VHPLC) were tested to determine thermal stability of the column during rapid gradient separations. To obtain rapid separations, instruments are operated at high flow rates and high inlet pressure leading to uneven thermal effects across columns and additional time needed to restore thermal equilibrium between successive analyses. The purpose of this study is to investigate means to minimize thermal instability and obtain reliable results by measuring the reproducibility of the results of six replicate gradient separations of a nine component RPLC standard mixture under various experimental conditions with no post-run times. Gradient separations under different conditions were performed: constant flow rates, two sets of constant pressure operation, programmed flow constant pressure operation, and conditions which theoretically should yield a constant net heat loss at the column's wall. The results show that using constant flow rates, programmed flow constant pressures, and constant heat loss at the column's wall all provide reproducible separations. However, performing separations using a high constant pressure with programmed flow reduces the analysis time by 16% compared to constant flow rate methods. For the constant flow rate, programmed flow constant pressure, and constant wall heat experiments no equilibration time (post-run time) was required to obtain highly reproducible data. Copyright © 2013 Elsevier B.V. All rights reserved.

A two-thermocouple probe technique for estimating thermocouple time constants in flows with combustion: In situ parameter identification of a first-order lag system

NASA Astrophysics Data System (ADS)

Tagawa, M.; Shimoji, T.; Ohta, Y.

1998-09-01

A two-thermocouple probe, composed of two fine-wire thermocouples of unequal diameters, is a novel technique for estimating thermocouple time constants without any dynamic calibration of the thermocouple response. This technique is most suitable for measuring fluctuating temperatures in turbulent combustion. In the present study, the reliability and applicability of this technique are appraised in a turbulent wake of a heated cylinder (without combustion). A fine-wire resistance thermometer (cold wire) of fast response is simultaneously used to provide a reference temperature. A quantitative and detailed comparison between the cold-wire measurement and the compensated thermocouple ones shows that a previous estimation scheme gives thermocouple time constants smaller than appropriate values, unless the noise in the thermocouple signals is negligible and/or the spatial resolution of the two-thermocouple probe is sufficiently high. The scheme has been improved so as to maximize the correlation coefficient between the two compensated-thermocouple outputs. The improved scheme offers better compensation of the thermocouple response. The present approach is generally applicable to in situ parameter identification of a first-order lag system.

Torsion effect on fully developed flow in a helical pipe

NASA Technical Reports Server (NTRS)

Kao, Hsiao C.

1987-01-01

Two techniques, a series expansion method of perturbed Poiseuille flow valid for low Dean numbers and a solution of the complete Navier-Stokes equation applicable to intermediate Dean values, are used to investigate the torsion effect on the fully developed laminar flow in a helical pipe of constant circular cross section. For the secondary flow patterns, the results show that the presence of torsion can produce a significant effect if the ratio of the curvature to the torsion is of order unity. The secondary flow is distorted in these cases. It is noted that the torsion effect is, however, usually small, and that the secondary flow has the usual pattern of a pair of counter-rotating vortices of nearly equal strength.

Smart catheter flow sensor for real-time continuous regional cerebral blood flow monitoring

NASA Astrophysics Data System (ADS)

Li, Chunyan; Wu, Pei-Ming; Hartings, Jed A.; Wu, Zhizhen; Ahn, Chong H.; LeDoux, David; Shutter, Lori A.; Narayan, Raj K.

2011-12-01

We present a smart catheter flow sensor for real-time, continuous, and quantitative measurement of regional cerebral blood flow using in situ temperature and thermal conductivity compensation. The flow sensor operates in a constant-temperature mode and employs a periodic heating and cooling technique. This approach ensures zero drift and provides highly reliable data with microelectromechanical system-based thin film sensors. The developed flow sensor has a sensitivity of 0.973 mV/ml/100 g/min in the range from 0 to 160 ml/100 g/min with a linear correlation coefficient of R2 = 0.9953. It achieves a resolution of 0.25 ml/100 g/min and an accuracy better than 5 ml/100 g/min.

Microgravity liquid propellant management

NASA Technical Reports Server (NTRS)

Hung, R. J.

1990-01-01

The requirement to settle or to position liquid fluid over the outlet end of a spacecraft propellant tank prior to main engine restart, poses a microgravity fluid behavior problem. Resettlement or reorientation of liquid propellant can be accomplished by providing optimal acceleration to the spacecraft such that the propellant is reoriented over the tank outlet without any vapor entrainment, any excessive geysering, or any other undersirable fluid motion for the space fluid management under microgravity environment. The most efficient technique is studied for propellant resettling through the minimization of propellant usage and weight penalties. Both full scale and subscale liquid propellant tank of Space Transfer Vehicle were used to simulate flow profiles for liquid hydrogen reorientation over the tank outlet. In subscale simulation, both constant and impulsive resettling acceleration were used to simulate the liquid flow reorientation. Comparisons between the constant reverse gravity acceleration and impulsive reverse gravity acceleration to be used for activation of propellant resettlement shows that impulsive reverse gravity thrust is superior to constant reverse gravity thrust.

Characterization of polymerized liposomes using a combination of dc and cyclical electrical field-flow fractionation.

PubMed

Sant, Himanshu J; Chakravarty, Siddharth; Merugu, Srinivas; Ferguson, Colin G; Gale, Bruce K

2012-10-02

Characterization of polymerized liposomes (PolyPIPosomes) was carried out using a combination of normal dc electrical field-flow fractionation and cyclical electrical field-flow fractionation (CyElFFF) as an analytical technique. The constant nature of the carrier fluid and channel configuration for this technique eliminates many variables associated with multidimensional analysis. CyElFFF uses an oscillating field to induce separation and is performed in the same channel as standard dc electrical field-flow fractionation separation. Theory and experimental methods to characterize nanoparticles in terms of their sizes and electrophoretic mobilities are discussed in this paper. Polystyrene nanoparticles are used for system calibration and characterization of the separation performance, whereas polymerized liposomes are used to demonstrate the applicability of the system to biomedical samples. This paper is also the first to report separation and a higher effective field when CyElFFF is operated at very low applied voltages. The technique is shown to have the ability to quantify both particle size and electrophoretic mobility distributions for colloidal polystyrene nanoparticles and PolyPIPosomes.

Measurements in the Turbulent Boundary Layer at Constant Pressure in Subsonic and Supersonic Flow. Part 2: Laser-Doppler Velocity Measurements

NASA Technical Reports Server (NTRS)

Dimotakis, P. E.; Collins, D. J.; Lang, D. B.

1979-01-01

A description of both the mean and the fluctuating components of the flow, and of the Reynolds stress as observed using a dual forward scattering laser-Doppler velocimeter is presented. A detailed description of the instrument and of the data analysis techniques were included in order to fully document the data. A detailed comparison was made between the laser-Doppler results and those presented in Part 1, and an assessment was made of the ability of the laser-Doppler velocimeter to measure the details of the flows involved.

Electromagnetic probe technique for fluid flow measurements

NASA Technical Reports Server (NTRS)

Arndt, G. D.; Carl, J. R.

1994-01-01

The probes described herein, in various configurations, permit the measurement of the volume fraction of two or more fluids flowing through a pipe. Each probe measures the instantaneous relative dielectric constant of the fluid in immediate proximity. As long as separation of the relative dielectric constant of the fluid is possible, several or even many fluids can be measured in the same flow stream. By using multiple probes, the velocity of each fluid can generally be determined as well as the distribution of each constituent in the pipe. The values are determined by statistical computation. There are many potential applications for probes of this type in industry and government. Possible NASA applications include measurements of helium/hydrazine flow during rocket tests at White Sands, liquid/gas flow in hydrogen or oxygen lines in Orbiter engines, and liquid/gaseous Freon flow in zero gravity tests with the KS135 aircraft at JSC. Much interest has been shown recently by the oil industry. In this a good method is needed to measure the fractions of oil, water, and natural gas flowing in a pipeline and the velocity of each. This particular problem involves an extension of what has been developed to date and our plans to solve this problem will be discussed herein.

An Optimization Technique for the Development of Two-Dimensional Steady Turbulent Boundary Layer Models.

DTIC Science & Technology

1982-03-01

observed coherent structure of the wall layer flow and will now be briefly described. Over the past decade, it has been well documented (see, for example...D2, and x are all arbitrary constants. Equilibrium flows have been examined experimentally for a number of years and an equilibrium boundary layer...CP93, Paper No. 27, 6. Clauser, F.H. (1954). "Turbulent Boundary Layers in Adverse Pressure Gradients", J. Aeronaut. Sci., 21, pp. 91-108. 7. Clauser

A Posteriori Quantification of Rate-Controlling Effects from High-Intensity Turbulence-Flame Interactions Using 4D Measurements

DTIC Science & Technology

2016-11-22

Unclassified REPORT DOCUMENTATION PAGE Form ApprovedOMB No. 0704-0188 The public reporting burden for this collection of information is estimated to average 1...compact at all conditions tested, as indicated by the overlap of OH and CH2O distributions. 5. We developed analytical techniques for pseudo- Lagrangian ...condition in a constant density flow requires that the flow divergence is zero, ∇ · ~u = 0. Three smoothing schemes were examined, a moving average (i.e

Toward large eddy simulation of turbulent flow over an airfoil

NASA Technical Reports Server (NTRS)

Choi, Haecheon

1993-01-01

The flow field over an airfoil contains several distinct flow characteristics, e.g. laminar, transitional, turbulent boundary layer flow, flow separation, unstable free shear layers, and a wake. This diversity of flow regimes taxes the presently available Reynolds averaged turbulence models. Such models are generally tuned to predict a particular flow regime, and adjustments are necessary for the prediction of a different flow regime. Similar difficulties are likely to emerge when the large eddy simulation technique is applied with the widely used Smagorinsky model. This model has not been successful in correctly representing different turbulent flow fields with a single universal constant and has an incorrect near-wall behavior. Germano et al. (1991) and Ghosal, Lund & Moin have developed a new subgrid-scale model, the dynamic model, which is very promising in alleviating many of the persistent inadequacies of the Smagorinsky model: the model coefficient is computed dynamically as the calculation progresses rather than input a priori. The model has been remarkably successful in prediction of several turbulent and transitional flows. We plan to simulate turbulent flow over a '2D' airfoil using the large eddy simulation technique. Our primary objective is to assess the performance of the newly developed dynamic subgrid-scale model for computation of complex flows about aircraft components and to compare the results with those obtained using the Reynolds average approach and experiments. The present computation represents the first application of large eddy simulation to a flow of aeronautical interest and a key demonstration of the capabilities of the large eddy simulation technique.

Nature of convection-stabilized dc arcs in dual-flow nozzle geometry. I - The cold flow field and dc arc characteristics. II - Optical diagnostics and theory

NASA Astrophysics Data System (ADS)

Serbetci, Ilter; Nagamatsu, H. T.

1990-02-01

Steady-state low-current air arcs in a dual-flow nozzle system are studied experimentally. The cold flow field with no arc is investigated using a 12.7-mm diameter dual-flow nozzle in a steady-flow facility. Mach number and mass flux distributions are determined for various nozzle-pressure ratios and nozzle-gap spacing. It is found that the shock waves in the converging-diverging nozzles result in a decrease in overal resistance by about 15 percent. Also, Schlieren and differential interferometry techniques are used to visualize the density gradients within the arc plasma and thermal mantle. Both optical techniques reveal a laminar arc structure for a reservoir pressure of 1 atm at various current levels. Experimentally determined axial static pressure and cold-flow mass flux rate distributions and a channel-flow model with constant arc temperatre are used to solve the energy integral for the arc radius as a function of axial distance. The arc electric field strength, voltage, resistance, and power are determined with Ohm's law and the total heat transfer is related to arc power.

Direct observation of vibrational energy flow in cytochrome c.

PubMed

Fujii, Naoki; Mizuno, Misao; Mizutani, Yasuhisa

2011-11-10

Vibrational energy flow in ferric cytochrome c has been examined by picosecond time-resolved anti-Stokes ultraviolet resonance Raman (UVRR) measurements. By taking advantage of the extremely short nonradiative excited state lifetime of heme in the protein (< ps), excess vibrational energy of 20000-25000 cm(-1) was optically deposited selectively at the heme site. Subsequent energy relaxation in the protein moiety was investigated by monitoring the anti-Stokes UVRR intensities of the Trp59 residue, which is a single tryptophan residue involved in the protein that is located close to the heme group. It was found from temporal changes of the anti-Stokes UVRR intensities that the energy flow from the heme to Trp59 and the energy release from Trp59 took place with the time constants of 1-3 and ~8 ps, respectively. These data are consistent with the time constants for the vibrational relaxation of the heme and heating of water reported for hemeproteins. The kinetics of the energy flow were not affected by the amount of excess energy deposited at the heme group. These results demonstrate that the present technique is a powerful tool for studying the vibrational energy flow in proteins.

Role of endothelium sensitivity to shear stress in noradrenaline-induced constriction of feline femoral arterial bed under constant flow and constant pressure perfusions.

PubMed

Kartamyshev, Sergey P; Balashov, Sergey A; Melkumyants, Arthur M

2007-01-01

The effect of shear stress at the endothelium in the attenuation of the noradrenaline-induced constriction of the femoral vascular bed perfused at a constant blood flow was investigated in 16 anesthetized cats. It is known that the adrenergic vasoconstriction of the femoral vascular bed is considerably greater at a constant pressure perfusion than at a constant blood flow. This difference may depend on the ability of the endothelium to relax smooth muscle in response to an increase in wall shear stress. Since the shear stress is directly related to the blood flow and inversely related to the third power of vessel diameter, vasoconstriction at a constant blood flow increases the wall shear stress that is the stimulus for smooth muscle relaxation opposing constriction. On the other hand, at a constant perfusion pressure, vasoconstriction is accompanied by a decrease in flow rate, which prevents a wall shear stress increase. To reveal the effect of endothelial sensitivity to shear stress, we compared noradrenaline-induced changes in total and proximal arterial resistances during perfusion of the hind limb at a constant blood flow and at a constant pressure in vessels with intact and injured endothelium. We found that in the endothelium-intact bed the same concentration of noradrenaline at a constant flow caused an increase in overall vascular peripheral resistance that was half as large as at a constant perfusion pressure. This difference is mainly confined to the proximal arterial vessels (arteries and large arterioles) whose resistance at a constant flow increased only 0.19 +/- 0.03 times compared to that at a constant pressure. The removal of the endothelium only slightly increased constrictor responses at the perfusion under a constant pressure (noradrenaline-induced increases of both overall and proximal arterial resistance augmented by 12%), while the responses of the proximal vessels at a constant flow became 4.7 +/- 0.4 times greater than in the endothelium-intact bed. A selective blockage of endothelium sensitivity to shear stress using a glutaraldehyde dimer augmented the constrictor responses of the proximal vessels at a constant flow 4.6-fold (+/-0.3), but had no significant effect on the responses at a constant pressure. These results are consistent with the conclusion that the difference in constrictor responses at constant flow and pressure perfusions depends mainly on the smooth muscle relaxation caused by increased wall shear stress. Copyright (c) 2007 S. Karger AG, Basel.

Test and evaluation of constant-flow devices for use in SSN AFFF proportioning systems. Interim report, January-May 1986

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, F.W.; Back, G.G.; Burns, R.E.

1986-11-04

Constant flow devices, which deliver a constant flow of liquid over a range of upstream and downstream pressures, have been suggested as an alternative to orifice plates for proportioning AFFF in SSN 21 fire-suppression systems. Operational and performance characteristics of two lightweight, inexpensive, commercially available constant-flow devices have significant advantages over orifice plates. Both models tested, however, showed performance degradation when subjected to simulated service conditions. A constant flow device with improved resistance to wear and to AFFF exposure is desirable. Since the constant-flow control devices tested improves proportioning efficiency but do not have optimum characteristics, investigation of improved devicesmore » or methods is recommended.« less

Development of a Rayleigh Scattering Diagnostic for Time-Resolved Gas Flow Velocity, Temperature, and Density Measurements in Aerodynamic Test Facilities

NASA Technical Reports Server (NTRS)

Mielke, Amy F.; Elam, Kristie A.; Sung, Chih-Jen

2007-01-01

A molecular Rayleigh scattering technique is developed to measure time-resolved gas velocity, temperature, and density in unseeded turbulent flows at sampling rates up to 32 kHz. A high power continuous-wave laser beam is focused at a point in an air flow field and Rayleigh scattered light is collected and fiber-optically transmitted to the spectral analysis and detection equipment. The spectrum of the light, which contains information about the temperature and velocity of the flow, is analyzed using a Fabry-Perot interferometer. Photomultiplier tubes operated in the photon counting mode allow high frequency sampling of the circular interference pattern to provide time-resolved flow property measurements. An acoustically driven nozzle flow is studied to validate velocity fluctuation measurements, and an asymmetric oscillating counterflow with unequal enthalpies is studied to validate the measurement of temperature fluctuations. Velocity fluctuations are compared with constant temperature anemometry measurements and temperature fluctuations are compared with constant current anemometry measurements at the same locations. Time-series and power spectra of the temperature and velocity measurements are presented. A numerical simulation of the light scattering and detection process was developed and compared with experimental data for future use as an experiment design tool.

Stability of Dirac Liquids with Strong Coulomb Interaction.

PubMed

Tupitsyn, Igor S; Prokof'ev, Nikolay V

2017-01-13

We develop and apply the diagrammatic Monte Carlo technique to address the problem of the stability of the Dirac liquid state (in a graphene-type system) against the strong long-range part of the Coulomb interaction. So far, all attempts to deal with this problem in the field-theoretical framework were limited either to perturbative or random phase approximation and functional renormalization group treatments, with diametrically opposite conclusions. Our calculations aim at the approximation-free solution with controlled accuracy by computing vertex corrections from higher-order skeleton diagrams and establishing the renormalization group flow of the effective Coulomb coupling constant. We unambiguously show that with increasing the system size L (up to ln(L)∼40), the coupling constant always flows towards zero; i.e., the two-dimensional Dirac liquid is an asymptotically free T=0 state with divergent Fermi velocity.

A proposed through-flow inverse method for the design of mixed-flow pumps

NASA Technical Reports Server (NTRS)

Borges, Joao Eduardo

1991-01-01

A through-flow (hub-to-shroud) truly inverse method is proposed and described. It uses an imposition of mean swirl, i.e., radius times mean tangential velocity, given throughout the meridional section of the turbomachine as an initial design specification. In the present implementation, it is assumed that the fluid is inviscid, incompressible, and irrotational at inlet and that the blades are supposed to have zero thickness. Only blade rows that impart to the fluid a constant work along the space are considered. An application of this procedure to design the rotor of a mixed-flow pump is described in detail. The strategy used to find a suitable mean swirl distribution and the other design inputs is also described. The final blade shape and pressure distributions on the blade surface are presented, showing that it is possible to obtain feasible designs using this technique. Another advantage of this technique is the fact that it does not require large amounts of CPU time.

Gas transfer in a bubbly wake flow

NASA Astrophysics Data System (ADS)

Karn, A.; Gulliver, J. S.; Monson, G. M.; Ellis, C.; Arndt, R. E. A.; Hong, J.

2016-05-01

The present work reports simultaneous bubble size and gas transfer measurements in a bubbly wake flow of a hydrofoil, designed to be similar to a hydroturbine blade. Bubble size was measured by a shadow imaging technique and found to have a Sauter mean diameter of 0.9 mm for a reference case. A lower gas flow rate, greater liquid velocities, and a larger angle of attack all resulted in an increased number of small size bubbles and a reduced weighted mean bubble size. Bubble-water gas transfer is measured by the disturbed equilibrium technique. The gas transfer model of Azbel (1981) is utilized to characterize the liquid film coefficient for gas transfer, with one scaling coefficient to reflect the fact that characteristic turbulent velocity is replaced by cross-sectional mean velocity. The coefficient was found to stay constant at a particular hydrofoil configuration while it varied within a narrow range of 0.52-0.60 for different gas/water flow conditions.

Keep Your Distance! Using Second-Order Ordinary Differential Equations to Model Traffic Flow

ERIC Educational Resources Information Center

McCartney, Mark

2004-01-01

A simple mathematical model for how vehicles follow each other along a stretch of road is presented. The resulting linear second-order differential equation with constant coefficients is solved and interpreted. The model can be used as an application of solution techniques taught at first-year undergraduate level and as a motivator to encourage…

Visualizing dissolved oxygen transport for liquid ventilation in an in vitro model of the human airways

NASA Astrophysics Data System (ADS)

Janke, T.; Bauer, K.

2017-04-01

Up until to now, the measurement of dissolved oxygen concentrations during liquid ventilation is limited to the determination of averaged concentrations of the liquid entering or leaving the body. The work presented in this paper aims to extend the possible measurement techniques in the research of liquid ventilation. Therefore optical measurements of the dissolved oxygen concentration, using a luminescent sensor dye, are performed. The preparation of a suitable sensor liquid, based on the metal complex Dichlorotris(1,10)-(phenanthroline)ruthenium(II), is presented. A transparent simplified human lung geometry is used for conducting the experiments. Inspiratory as well as expiratory flow at three different constant flow rates is investigated, covering the flow regimes \\text{Re}=83 -333 and \\text{Pe}=33 300 -133 000. The applied measurement technique is capable to reveal distinctive concentration patterns during inspiration and expiration caused by the laminar flow characteristics. Allowing a sufficiently long flow duration, local concentration inhomogeneities disappear and an exponential rise and decay of the mean values can be observed for inspiration and expiration.

A Constant-Field Interrupted Resonance System for Percutaneous Electromagnetic Measurement of Blood Flow

PubMed Central

Kolin, Alexander; Steele, James R.; Imai, James S.; Macalpin, Rex N.

1974-01-01

A combination of deformable flow probes of negligible lateral dimensions with an electronic circuit capable of providing a prolonged plateau of dB/dt = 0 and of sampling the flow signal at the end of this interval permits electromagnetic measurement of blood flow with a reliable zero base line secured by switching off the magnet. An extracorporeal magnet provides the magnetic field. The flow transducer is introduced into the vascular system percutaneously through a standard angiographic catheter by conventional technique. The idea of the current generator can be described as “principle of interrupted resonance.” The current wave form can be described as a sequence of disconnected bisected sine waves joined at the apices by horizontal current plateaus where di/dt is strictly zero. Images PMID:4275395

Microbubble transport through a bifurcating vessel network with pulsatile flow.

PubMed

Valassis, Doug T; Dodde, Robert E; Esphuniyani, Brijesh; Fowlkes, J Brian; Bull, Joseph L

2012-02-01

Motivated by two-phase microfluidics and by the clinical applications of air embolism and a developmental gas embolotherapy technique, experimental and theoretical models of microbubble transport in pulsatile flow are presented. The one-dimensional time-dependent theoretical model is developed from an unsteady Bernoulli equation that has been modified to include viscous and unsteady effects. Results of both experiments and theory show that roll angle (the angle the plane of the bifurcating network makes with the horizontal) is an important contributor to bubble splitting ratio at each bifurcation within the bifurcating network. When compared to corresponding constant flow, pulsatile flow was shown to produce insignificant changes to the overall splitting ratio of the bubble despite the order one Womersley numbers, suggesting that bubble splitting through the vasculature could be modeled adequately with a more modest constant flow model. However, bubble lodging was affected by the flow pulsatility, and the effects of pulsatile flow were evident in the dependence of splitting ratio of bubble length. The ability of bubbles to remain lodged after reaching a steady state in the bifurcations is promising for the effectiveness of gas embolotherapy to occlude blood flow to tumors, and indicates the importance of understanding where lodging will occur in air embolism. The ability to accurately predict the bubble dynamics in unsteady flow within a bifurcating network is demonstrated and suggests the potential for bubbles in microfluidics devices to encode information in both steady and unsteady aspects of their dynamics.

Flow-through electroporation based on constant voltage for large-volume transfection of cells.

PubMed

Geng, Tao; Zhan, Yihong; Wang, Hsiang-Yu; Witting, Scott R; Cornetta, Kenneth G; Lu, Chang

2010-05-21

Genetic modification of cells is a critical step involved in many cell therapy and gene therapy protocols. In these applications, cell samples of large volume (10(8)-10(9)cells) are often processed for transfection. This poses new challenges for current transfection methods and practices. Here we present a novel flow-through electroporation method for delivery of genes into cells at high flow rates (up to approximately 20 mL/min) based on disposable microfluidic chips, a syringe pump, and a low-cost direct current (DC) power supply that provides a constant voltage. By eliminating pulse generators used in conventional electroporation, we dramatically lowered the cost of the apparatus and improved the stability and consistency of the electroporation field for long-time operation. We tested the delivery of pEFGP-C1 plasmids encoding enhanced green fluorescent protein into Chinese hamster ovary (CHO-K1) cells in the devices of various dimensions and geometries. Cells were mixed with plasmids and then flowed through a fluidic channel continuously while a constant voltage was established across the device. Together with the applied voltage, the geometry and dimensions of the fluidic channel determined the electrical parameters of the electroporation. With the optimal design, approximately 75% of the viable CHO cells were transfected after the procedure. We also generalize the guidelines for scaling up these flow-through electroporation devices. We envision that this technique will serve as a generic and low-cost tool for a variety of clinical applications requiring large volume of transfected cells. Copyright 2010 Elsevier B.V. All rights reserved.

Effect of sputtering parameters on optical and electrical properties of ITO films on PET substrates

NASA Astrophysics Data System (ADS)

Tseng, Kun-San; Lo, Yu-Lung

2013-11-01

The optical and electrical properties of indium tin oxide (ITO) thin films deposited on flexible polyethylene terephthalate (PET) substrates using a DC magnetron sputtering technique are investigated as a function of the deposition time, the argon flow rate and the target-substrate distance. It is found that all of the ITO films contain a high fraction of amorphous phase. The volume fraction of crystallite precipitates in the amorphous host increases with an increasing deposition time or a reducing argon flow rate. The deposition time and argon flow rate have higher effects on the optical transparency of the ITO films than the target-substrate distance has. Increasing film thickness is not the only reason for the transmittance reduced. It is found that an increase of the extinction coefficient by increasing deposition time or an increase of the refractive index by decreasing argon flow rate also reduces the transmittance of thin film. For a constant deposition time, the resistivity of the ITO films reduces with a reducing argon flow rate or a reducing target-substrate distance. For a constant argon flow rate, a critical value of the deposition time exists at which both the resistivity and the effect of the target-substrate distance are minimized. Finally, it is concluded that the film resistivity has low sensitivity to the target-substrate distance if the best deposition conditions which mostly attain the lowest resistivity are matched.

Arc Jet Flow Properties Determined from Laser-Induced Fluorescence of Atomic Nitrogen

NASA Technical Reports Server (NTRS)

Fletcher, Douglas; Wercinski, Paul F. (Technical Monitor)

1998-01-01

An laser-spectroscopic investigation of the thermocheMical state of arcjet flows is currently being conducted in the Aerodynamic Heating Facility (AHF) Circlet at NASA Ames Research Center. Downstream of the nozzle exit, but upstream of the test article, Laser-Induced Fluorescence (LIF) of atomic nitrogen is used to assess the nonequilibriuM distribution of flow enthalpy in the free stream. The two-photon LIF technique provides simultaneous measurements of free stream velocity, translational temperature, and nitrogen number density on the flow centerline. Along with information from facility instrumentation, these measurements allow a determination of the free stream total enthalpy, and its apportionment in to thermal, kinetic, and chemical mode contributions. Experimental results are presented and discussed for two different niti-ogen/argon test gas flow runs during which the current is varied while the pressure remains constant .

Numerical investigation of MHD flow with Soret and Dufour effect

NASA Astrophysics Data System (ADS)

Hayat, Tasawar; Nasir, Tehreem; Khan, Muhammad Ijaz; Alsaedi, Ahmed

2018-03-01

This paper describes the flow due to an exponentially curved surface subject to Soret and Dufour effects. Nonlinear velocity is considered. Exponentially curved stretchable sheet induced the flow. Fluid is electrical conducting through constant applied magnetic field. The governing flow expressions are reduced to ordinary ones and then tackled by numerical technique (Built-in-Shooting). Impacts of various flow variables on the dimensionless velocity, concentration and temperature fields are graphically presented and discussed in detail. Skin friction coefficient and Sherwood and Nusselt numbers are studied through graphs. Furthermore it is observed that Soret and Dufour variables regulate heat and mass transfer rates. It is also noteworthy that velocity decays for higher magnetic variable. Skin friction magnitude decays via curvature and magnetic variables. Also mass transfer gradient or rate of mass transport enhances for higher estimations of curvature parameter and Schmidt number.

An integral turbulent kinetic energy analysis of free shear flows

NASA Technical Reports Server (NTRS)

Peters, C. E.; Phares, W. J.

1973-01-01

Mixing of coaxial streams is analyzed by application of integral techniques. An integrated turbulent kinetic energy (TKE) equation is solved simultaneously with the integral equations for the mean flow. Normalized TKE profile shapes are obtained from incompressible jet and shear layer experiments and are assumed to be applicable to all free turbulent flows. The shear stress at the midpoint of the mixing zone is assumed to be directly proportional to the local TKE, and dissipation is treated with a generalization of the model developed for isotropic turbulence. Although the analysis was developed for ducted flows, constant-pressure flows were approximated with the duct much larger than the jet. The axisymmetric flows under consideration were predicted with reasonable accuracy. Fairly good results were also obtained for the fully developed two-dimensional shear layers, which were computed as thin layers at the boundary of a large circular jet.

A laser flash photolysis-resonance fluorescence kinetics study of the reaction Cl/2P/ + CH4 yields CH3 + HCl

NASA Technical Reports Server (NTRS)

Ravishankara, A. R.; Wine, P. H.

1980-01-01

The technique of laser flash photolysis-resonance fluorescence is employed to study the kinetics of the reaction Cl(2P) + CH4 yields CH3 + HCl over the temperature range 221-375 K. At temperatures less than or equal to 241 K the apparent bimolecular rate constant is found to be dependent upon the identity of the chemically inert gases in the reaction mixture. For Cl2/CH4/He reaction mixtures (total pressure = 50 torr) different bimolecular rate constants are measured at low and high methane concentrations. For Cl2/CH4/CCl/He and Cl2/CH4/Ar reaction mixtures, the bimolecular rate constant is independent of methane concentration, being approximately equal to the rate constant measured at low methane concentrations for Cl2/CH4/He mixtures. These rate constants are in good agreement with previous results obtained using the discharge flow-resonance fluorescence and competitive chlorination techniques. At 298 K the measured bimolecular rate constant is independent of the identity of the chemically inert gases in the reaction mixture and in good agreement with all previous investigations. The low-temperature results obtained in this investigation and all previous investigations can be rationalized in terms of a model which assumes that the Cl(2P 1/2) state reacts with CH4 much faster than the Cl(2P 3/2) state. Extrapolation of this model to higher temperatures, however, is not straightforward.

Electron attachment to CF3 and CF3Br at temperatures up to 890 K: experimental test of the kinetic modeling approach.

PubMed

Shuman, Nicholas S; Miller, Thomas M; Viggiano, Albert A; Troe, Jürgen

2013-05-28

Thermal rate constants and product branching fractions for electron attachment to CF3Br and the CF3 radical have been measured over the temperature range 300-890 K, the upper limit being restricted by thermal decomposition of CF3Br. Both measurements were made in Flowing Afterglow Langmuir Probe apparatuses; the CF3Br measurement was made using standard techniques, and the CF3 measurement using the Variable Electron and Neutral Density Attachment Mass Spectrometry technique. Attachment to CF3Br proceeds exclusively by the dissociative channel yielding Br(-), with a rate constant increasing from 1.1 × 10(-8) cm(3) s(-1) at 300 K to 5.3 × 10(-8) cm(3) s(-1) at 890 K, somewhat lower than previous data at temperatures up to 777 K. CF3 attachment proceeds through competition between associative attachment yielding CF3 (-) and dissociative attachment yielding F(-). Prior data up to 600 K showed the rate constant monotonically increasing, with the partial rate constant of the dissociative channel following Arrhenius behavior; however, extrapolation of the data using a recently proposed kinetic modeling approach predicted the rate constant to turn over at higher temperatures, despite being only ~5% of the collision rate. The current data agree well with the previous kinetic modeling extrapolation, providing a demonstration of the predictive capabilities of the approach.

Instantaneous temperature field measurements using planar laser-induced fluorescence.

PubMed

Seitzman, J M; Kychakoff, G; Hanson, R K

1985-09-01

A single-pulse, laser-induced-fluorescence diagnostic for the measurement of two-dimensional temperature fields in combustion flows is described. The method uses sheet illumination from a tunable laser to excite planar laserinduced fluorescence in a stable tracer molecule, seeded at constant mole fraction into the flow field. The temporal resolution of this technique is determined by the laser pulse length. Experimental results are presented for a rodstabilized, premixed methane-air flame, using the Q(1) (22) line of the nitric oxide A(2) Sigma(+) (v = 0) ? X(2)II((1/2))(v = 0) transition (lambda approximately 225.6 nm).

Acoustic structure and propagation in highly porous, layered, fibrous materials

NASA Technical Reports Server (NTRS)

Lambert, R. F.; Tesar, J. S.

1984-01-01

The acoustic structure and propagation of sound in highly porous, layered, fine fiber materials is examined. Of particular interest is the utilization of the Kozeny number for determining the static flow resistance and the static structure factor based on flow permeability measurements. In this formulation the Kozeny number is a numerical constant independent of volume porosity at high porosities. The other essential parameters are then evaluated employing techniques developed earlier for open cell foams. The attenuation and progressive phase characteristics in bulk samples are measured and compared with predicted values. The agreements on the whole are very satisfactory.

A numerical and experimental study of confined swirling jets

NASA Technical Reports Server (NTRS)

Nikjooy, M.; Mongia, H. C.; Samuelsen, G. S.; Mcdonell, V. G.

1989-01-01

A numerical and experimental study of a confined strong swirling flow is presented. Detailed velocity measurements are made using a two-component laser Doppler velocimeter (LDV) technique. Computations are performed using a differential second-moment (DSM) closure. The effect of inlet dissipation rate on calculated mean and turbulence fields is investigated. Various model constants are employed in the pressure-strain model to demonstrate their influences on the predicted results. Finally, comparison of the DSM calculations with the algebraic second-monent (ASM) closure results shows that the DSM is better suited for complex swirling flow analysis.

Validating Whole-Airway CFD Predictions of DPI Aerosol Deposition at Multiple Flow Rates.

PubMed

Longest, P Worth; Tian, Geng; Khajeh-Hosseini-Dalasm, Navvab; Hindle, Michael

2016-12-01

The objective of this study was to compare aerosol deposition predictions of a new whole-airway CFD model with available in vivo data for a dry powder inhaler (DPI) considered across multiple inhalation waveforms, which affect both the particle size distribution (PSD) and particle deposition. The Novolizer DPI with a budesonide formulation was selected based on the availability of 2D gamma scintigraphy data in humans for three different well-defined inhalation waveforms. Initial in vitro cascade impaction experiments were conducted at multiple constant (square-wave) particle sizing flow rates to characterize PSDs. The whole-airway CFD modeling approach implemented the experimentally determined PSDs at the point of aerosol formation in the inhaler. Complete characteristic airway geometries for an adult were evaluated through the lobar bronchi, followed by stochastic individual pathway (SIP) approximations through the tracheobronchial region and new acinar moving wall models of the alveolar region. It was determined that the PSD used for each inhalation waveform should be based on a constant particle sizing flow rate equal to the average of the inhalation waveform's peak inspiratory flow rate (PIFR) and mean flow rate [i.e., AVG(PIFR, Mean)]. Using this technique, agreement with the in vivo data was acceptable with <15% relative differences averaged across the three regions considered for all inhalation waveforms. Defining a peripheral to central deposition ratio (P/C) based on alveolar and tracheobronchial compartments, respectively, large flow-rate-dependent differences were observed, which were not evident in the original 2D in vivo data. The agreement between the CFD predictions and in vivo data was dependent on accurate initial estimates of the PSD, emphasizing the need for a combination in vitro-in silico approach. Furthermore, use of the AVG(PIFR, Mean) value was identified as a potentially useful method for characterizing a DPI aerosol at a constant flow rate.

Validating Whole-Airway CFD Predictions of DPI Aerosol Deposition at Multiple Flow Rates

PubMed Central

Tian, Geng; Khajeh-Hosseini-Dalasm, Navvab; Hindle, Michael

2016-01-01

Abstract Background: The objective of this study was to compare aerosol deposition predictions of a new whole-airway CFD model with available in vivo data for a dry powder inhaler (DPI) considered across multiple inhalation waveforms, which affect both the particle size distribution (PSD) and particle deposition. Methods: The Novolizer DPI with a budesonide formulation was selected based on the availability of 2D gamma scintigraphy data in humans for three different well-defined inhalation waveforms. Initial in vitro cascade impaction experiments were conducted at multiple constant (square-wave) particle sizing flow rates to characterize PSDs. The whole-airway CFD modeling approach implemented the experimentally determined PSDs at the point of aerosol formation in the inhaler. Complete characteristic airway geometries for an adult were evaluated through the lobar bronchi, followed by stochastic individual pathway (SIP) approximations through the tracheobronchial region and new acinar moving wall models of the alveolar region. Results: It was determined that the PSD used for each inhalation waveform should be based on a constant particle sizing flow rate equal to the average of the inhalation waveform's peak inspiratory flow rate (PIFR) and mean flow rate [i.e., AVG(PIFR, Mean)]. Using this technique, agreement with the in vivo data was acceptable with <15% relative differences averaged across the three regions considered for all inhalation waveforms. Defining a peripheral to central deposition ratio (P/C) based on alveolar and tracheobronchial compartments, respectively, large flow-rate-dependent differences were observed, which were not evident in the original 2D in vivo data. Conclusions: The agreement between the CFD predictions and in vivo data was dependent on accurate initial estimates of the PSD, emphasizing the need for a combination in vitro–in silico approach. Furthermore, use of the AVG(PIFR, Mean) value was identified as a potentially useful method for characterizing a DPI aerosol at a constant flow rate. PMID:27082824

Free Convection from a Semi-Infinite Vertical Plate with Discontinuous Blowing or Suction.

DTIC Science & Technology

1981-03-01

SCHIESSR UNCLASSIFIED; EhEllllEllEE EE[E]hEEEIllIEllhlEEIl EEEEEIIIEEEEI EEEIIIIIIIIII EIIIEIIEEEEII EEEIIIIIIIIIIE LVEL NAVAL POSTGRADUATE SCHOOL Monterey...the unsteady free convective flow past a simi-infinite porous plate with constant suction were studied through mathematical analysis by Soundalgekar...boundary-layers and; therefore, will often indicate a preferred method of analytical solution. Although there are several possible mathematical techniques

Evaluation of infiltration for the determination of palms water needs

NASA Astrophysics Data System (ADS)

Benlarbi, Dalila; Boutaoutaou, Djamel; Saggaï, Sofiane

2018-05-01

In arid climate conditions, irrigation water requirements increase, but available water resources are limited. And therefore the Saharan regions, large consumers of water can be seriously threatened if they do not make the necessary to become as parsimonious as allow the irrigation techniques whose technological aspect on their improvement has been privileged until now but all the problems are not solved. The objective of this work is to know the process of infiltration of water in the soil, i.e.: to try to determine exactly its value with obtaining the best combination (flow of entry, board length and irrigation time) in order to have a more or less uniform distribution in the soil and especially by avoiding significant water losses that would cause rise in the water table. The infiltration will allow us to calculate at any point the dose of water received that we will compare with the needs of the date palm. For this purpose; we varied the input flow for a constant board length. Then we varied the board length for a constant input rate. In both cases we varied the irrigation time according to the water requirements of the date palm. The flow remains of course constant during the entire feeding period. This study is primarily experimental and aims to meet practical applications but not immediately because it is necessary to continue the experiments with several other combinations to achieve practical results.

An exact closed form solution for constant area compressible flow with friction and heat transfer

NASA Technical Reports Server (NTRS)

Sturas, J. I.

1971-01-01

The well-known differential equation for the one-dimensional flow of a compressible fluid with heat transfer and wall friction has no known solution in closed form for the general case. This report presents a closed form solution for the special case of constant heat flux per unit length and constant specific heat. The solution was obtained by choosing the square of a dimensionless flow parameter as one of the independent variables to describe the flow. From this exact solution, an approximate simplified form is derived that is applicable for predicting subsonic flow performance characteristics for many types of constant area passages in internal flow. The data included in this report are considered sufficiently accurate for use as a guide in analyzing and designing internal gas flow systems.

Particle loading time and humidity effects on the efficiency of an N95 filtering facepiece respirator model under constant and inhalation cyclic flows.

PubMed

Mahdavi, Alireza; Haghighat, Fariborz; Bahloul, Ali; Brochot, Clothilde; Ostiguy, Claude

2015-06-01

It is necessary to investigate the efficiencies of filtering facepiece respirators (FFRs) exposed to ultrafine particles (UFPs) for long periods of time, since the particle loading time may potentially affect the efficiency of FFRs. This article aims to investigate the filtration efficiency for a model of electrostatic N95 FFRs with constant and 'inhalation-only' cyclic flows, in terms of particle loading time effect, using different humidity conditions. Filters were exposed to generated polydisperse NaCl particles. Experiments were performed mimicking an 'inhalation-only' scenario with a cyclic flow of 85 l min(-1) as the minute volume [or 170 l min(-1) as mean inhalation flow (MIF)] and for two constant flows of 85 and 170 l min(-1), under three relative humidity (RH) levels of 10, 50, and 80%. Each test was performed for loading time periods of 6h and the particle penetration (10-205.4nm in electrical mobility diameter) was measured once every 2h. For a 10% RH, the penetration of smaller size particles (<80nm), including the most penetrating particle size (MPPS), decreased over time for both constant and cyclic flows. For 50 and 80% RH levels, the changes in penetration were typically observed in an opposite direction with less magnitude. The penetrations at MPPS increased with respect to loading time under constant flow conditions (85 and 170 l min(-1)): it did not substantially increase under cyclic flows. The comparison of the cyclic flow (85 l min(-1) as minute volume) and constant flow equal to the cyclic flow minute volume indicated that, for all conditions the penetration was significantly less for the constant flow than that of cyclic flow. The comparison between the cyclic (170 l min(-1) as MIF) and constant flow equal to cyclic flow MIF indicated that, for the initial stage of loading, the penetrations were almost equal, but they were different for the final stages of the loading time. For a 10% RH, the penetration of a wide range of sizes was observed to be higher with the cyclic flow (170 as MIF) than with the equivalent constant flow (170 l min(-1)). For 50 and 80% RH levels, the penetrations were usually greater with a constant flow (170 l min(-1)) than with a cyclic flow (170 l min(-1) as MIF). It is concluded that, for the tested electrostatic N95 filters, the change in penetration as a function of the loading time does not necessarily take place with the same rate under constant (MIF) and cyclic flow. Moreover, for all tested flow rates, the penetration is not only affected by the loading time but also by the RH level. Lower RH levels (10%) have decreasing penetration rates in terms of loading time, while higher RH levels (50 and 80%) have increasing penetration rates. Also, the loading of the filter is normally accompanied with a shift of MPPS towards larger sizes. © The Author 2015. Published by Oxford University Press on behalf of the British Occupational Hygiene Society.

Analysis of nanoliter samples of electrolytes using a flow-through microfluorometer.

PubMed

Zhelyaskov, V R; Liu, S; Broderick, M P

2000-04-01

Several techniques have been developed to study the transport properties of nanoliter samples of renal tubule segments, such as continuous flow colorimetry and continuous fluorometry. We have extended the capability of the NANOFLO, a flow-through microfluorometer, designed for measurement of carbon dioxide, urea, ammonia, glucose, lactate, etc., to analyze sodium, calcium and chloride ions, using three commercially available fluorescent indicators for intracellular and extracellular measurements. The selection of fluorescent indicator for each electrolyte was dependent on the optimal match of the dissociation constant and the analyte concentration range of interest. Using Fluo-3 dye we achieved a detection limit for Ca2+ of 0.1 pmol and selectivity over Mg2+ of between 7:1 to 10:1. Using sodium green dye we achieved detection limit for Na+ of 12 pmol and a selectivity over K+ of 40:1. The detection limit for Cl- using lucigenin dye was 10 pmol. This technique can be readily adapted for the measurement of other physiologically important ultralow volume.

Pulmonary hypoxic vasoconstriction: how strong? How fast?

NASA Technical Reports Server (NTRS)

Sheehan, D. W.; Klocke, R. A.; Farhi, L. E.

1992-01-01

We have developed a minimally invasive technique for studying regional blood flow in conscious sheep, bypassing the complications of open-chest surgery, flow probes and tracer infusion. We quantitate regional perfusion continuously on the basis of regional clearance of methane (methane is produced in the sheep rumen, enters the circulation and is eliminated nearly completely (greater than 95%) in the lung). Tracheal intubation with a dual-lumen catheter isolates the gas exchange of the right apical lobe (RAL; less than 15% of the lung) from that of the remainder of the lung, which serves as a control (CL). We measure RAL and CL methane elimination by entraining expirates in constant flows, sampled continuously for methane. Results obtained with this technique and from regional oxygen uptake are in excellent agreement. We have found that hypoxic vasoconstriction is far more potent and stable during eucapnic hypoxia than during hypocapnic hypoxia. The time course of the vasoconstriction suggests that many of the data in the literature may have been obtained prior to steady state.

A root-mean-square pressure fluctuations model for internal flow applications

NASA Technical Reports Server (NTRS)

Chen, Y. S.

1985-01-01

A transport equation for the root-mean-square pressure fluctuations of turbulent flow is derived from the time-dependent momentum equation for incompressible flow. Approximate modeling of this transport equation is included to relate terms with higher order correlations to the mean quantities of turbulent flow. Three empirical constants are introduced in the model. Two of the empirical constants are estimated from homogeneous turbulence data and wall pressure fluctuations measurements. The third constant is determined by comparing the results of large eddy simulations for a plane channel flow and an annulus flow.

Fractionating power and outlet stream polydispersity in asymmetrical flow field-flow fractionation. Part II: programmed operation.

PubMed

Williams, P Stephen

2017-01-01

Asymmetrical flow field-flow fractionation (As-FlFFF) is a widely used technique for analyzing polydisperse nanoparticle and macromolecular samples. The programmed decay of cross flow rate is often employed. The interdependence of the cross flow rate through the membrane and the fluid flow along the channel length complicates the prediction of elution time and fractionating power. The theory for their calculation is presented. It is also confirmed for examples of exponential decay of cross flow rate with constant channel outlet flow rate that the residual sample polydispersity at the channel outlet is quite well approximated by the reciprocal of four times the fractionating power. Residual polydispersity is of importance when online MALS or DLS detection are used to extract quantitative information on particle size or molecular weight. The theory presented here provides a firm basis for the optimization of programmed flow conditions in As-FlFFF. Graphical abstract Channel outlet polydispersity remains significant following fractionation by As-FlFFF under conditions of programmed decay of cross flow rate.

Modelling of Seismic and Resistivity Responses during the Injection of CO2 in Sandstone Reservoir

NASA Astrophysics Data System (ADS)

Omar, Muhamad Nizarul Idhafi Bin; Almanna Lubis, Luluan; Nur Arif Zanuri, Muhammad; Ghosh, Deva P.; Irawan, Sonny; Regassa Jufar, Shiferaw

2016-07-01

Enhanced oil recovery plays vital role in production phase in a producing oil field. Initially, in many cases hydrocarbon will naturally flow to the well as respect to the reservoir pressure. But over time, hydrocarbon flow to the well will decrease as the pressure decrease and require recovery method so called enhanced oil recovery (EOR) to recover the hydrocarbon flow. Generally, EOR works by injecting substances, such as carbon dioxide (CO2) to form a pressure difference to establish a constant productive flow of hydrocarbon to production well. Monitoring CO2 performance is crucial in ensuring the right trajectory and pressure differences are established to make sure the technique works in recovering hydrocarbon flow. In this paper, we work on computer simulation method in monitoring CO2 performance by seismic and resistivity model, enabling geoscientists and reservoir engineers to monitor production behaviour as respect to CO2 injection.

A new method for determining acoustic-liner admittance in a rectangular duct with grazing flow from experimental data

NASA Technical Reports Server (NTRS)

Watson, W. R.

1984-01-01

A method is developed for determining acoustic liner admittance in a rectangular duct with grazing flow. The axial propagation constant, cross mode order, and mean flow profile is measured. These measured data are then input into an analytical program which determines the unknown admittance value. The analytical program is based upon a finite element discretization of the acoustic field and a reposing of the unknown admittance value as a linear eigenvalue problem on the admittance value. Gaussian elimination is employed to solve this eigenvalue problem. The method used is extendable to grazing flows with boundary layers in both transverse directions of an impedance tube (or duct). Predicted admittance values are compared both with exact values that can be obtained for uniform mean flow profiles and with those from a Runge Kutta integration technique for cases involving a one dimensional boundary layer.

Rough-to-smooth transition of an equilibrium neutral constant stress layer. [atmospheric flow over rough terrain

NASA Technical Reports Server (NTRS)

Logan, E., Jr.; Fichtl, G. H.

1975-01-01

A model is proposed for low-level atmospheric flows over terrains of changing roughness length, such as those found at the windward end of landing strips adjoining rough terrain. The proposed model is used to develop a prediction technique for calculating transition wind and shear-stress profiles in the region following surface roughness discontinuity. The model for the transition region comprises two layers: a logarithmic layer and a buffer layer. The flow is assumed to be steady, two-dimensional, and incompressible, with neutral hydrostatic stability. A diagram is presented for a typical wind profile in the transition region, obtained from the logarithmic and velocity defect profiles using shear stress calculated by relevant equations.

Flow-injection analysis of catecholamine secretion from bovine adrenal medulla cells on microbeads.

PubMed

Herrera, M; Kao, L S; Curran, D J; Westhead, E W

1985-01-01

Bovine adrenal medullary cells have been cultured on microbeads which are placed in a low-volume flow system for measurements of stimulation-response parameters. Electronically controlled stream switching allows stimulation of cells with pulse lengths from 1 s to many minutes; pulses may be repeated indefinitely. Catecholamines secreted are detected by an electrochemical detector downstream from the cells. This flow-injection analysis technique provides a new level of sensitivity and precision for measurement of kinetic parameters of secretion. A manual injection valve allows stimulation by higher levels of stimulant in the presence of constant low levels of stimulant. Such experiments show interesting differences between the effects of K+ and acetylcholine on cells partially desensitized to acetylcholine.

A new contrast-assisted method in microcirculation volumetric flow assessment

NASA Astrophysics Data System (ADS)

Lu, Sheng-Yi; Chen, Yung-Sheng; Yeh, Chih-Kuang

2007-03-01

Microcirculation volumetric flow rate is a significant index in diseases diagnosis and treatment such as diabetes and cancer. In this study, we propose an integrated algorithm to assess microcirculation volumetric flow rate including estimation of blood perfused area and corresponding flow velocity maps based on high frequency destruction/contrast replenishment imaging technique. The perfused area indicates the blood flow regions including capillaries, arterioles and venules. Due to the echo variance changes between ultrasonic contrast agents (UCAs) pre- and post-destruction two images, the perfused area can be estimated by the correlation-based approach. The flow velocity distribution within the perfused area can be estimated by refilling time-intensity curves (TICs) after UCAs destruction. Most studies introduced the rising exponential model proposed by Wei (1998) to fit the TICs. Nevertheless, we found the TICs profile has a great resemblance to sigmoid function in simulations and in vitro experiments results. Good fitting correlation reveals that sigmoid model was more close to actual fact in describing destruction/contrast replenishment phenomenon. We derived that the saddle point of sigmoid model is proportional to blood flow velocity. A strong linear relationship (R = 0.97) between the actual flow velocities (0.4-2.1 mm/s) and the estimated saddle constants was found in M-mode and B-mode flow phantom experiments. Potential applications of this technique include high-resolution volumetric flow rate assessment in small animal tumor and the evaluation of superficial vasculature in clinical studies.

Electrokinetic effects on motion of submicron particles in microchannel

NASA Astrophysics Data System (ADS)

Sato, Yohei; Hishida, Koichi

2006-11-01

Two-fluid mixing utilizing electrokinetically driven flow in a micro-channel is investigated by micron-resolution particle image velocimetry and an image processing technique. Submicron particles are transported and mixed with deionized water by electrophoresis. The particle electrophoretic velocity that is proportional to an applied electric field is measured in a closed cell, which is used to calculate the electroosmotic flow velocity. At a constant electric field, addition of pressure-driven flow to electrokinetically driven flow in a T-shaped micro-channel enhances two-fluid mixing because the momentum flux is increased. On the other hand, on application of an alternative sinusoidal electric field, the velocity difference between pressure-driven and electroosmotic flows has a significant effect on increasing the length of interface formed between two fluids. It is concluded from the present experiments that the transport and mixing process in the micro-channel will be enhanced by accurate flow-rate control of both pressure-driven and electroosmotic flows.

Fabrication of microfluidic architectures for optimal flow rate and concentration measurement for lab on chip application

NASA Astrophysics Data System (ADS)

Adam, Tijjani; Hashim, U.

2017-03-01

Optimum flow in micro channel for sensing purpose is challenging. In this study, The optimizations of the fluid sample flows are made through the design and characterization of the novel microfluidics' architectures to achieve the optimal flow rate in the micro channels. The biocompatibility of the Polydimetylsiloxane (Sylgard 184 silicon elastomer) polymer used to fabricate the device offers avenue for the device to be implemented as the universal fluidic delivery system for bio-molecules sensing in various bio-medical applications. The study uses the following methodological approaches, designing a novel microfluidics' architectures by integrating the devices on a single 4 inches silicon substrate, fabricating the designed microfluidic devices using low-cost solution soft lithography technique, characterizing and validating the flow throughput of urine samples in the micro channels by generating pressure gradients through the devices' inlets. The characterization on the urine samples flow in the micro channels have witnessed the constant flow throughout the devices.

Quantification aspects of constant pressure (ultra) high pressure liquid chromatography using mass-sensitive detectors with a nebulizing interface.

PubMed

Verstraeten, M; Broeckhoven, K; Lynen, F; Choikhet, K; Landt, K; Dittmann, M; Witt, K; Sandra, P; Desmet, G

2013-01-25

The present contribution investigates the quantitation aspects of mass-sensitive detectors with nebulizing interface (ESI-MSD, ELSD, CAD) in the constant pressure gradient elution mode. In this operation mode, the pressure is controlled and maintained at a set value and the liquid flow rate will vary according to the inverse mobile phase viscosity. As the pressure is continuously kept at the allowable maximum during the entire gradient run, the average liquid flow rate is higher compared to that in the conventional constant flow rate operation mode, thus shortening the analysis time. The following three mass-sensitive detectors were investigated: mass spectrometry detector (MS), evaporative light scattering detector (ELSD) and charged aerosol detector (CAD) and a wide variety of samples (phenones, polyaromatic hydrocarbons, wine, cocoa butter) has been considered. It was found that the nebulizing efficiency of the LC-interfaces of the three detectors under consideration changes with the increasing liquid flow rate. For the MS, the increasing flow rate leads to a lower peak area whereas for the ELSD the peak area increases compared to the constant flow rate mode. The peak area obtained with a CAD is rather insensitive to the liquid flow rate. The reproducibility of the peak area remains similar in both modes, although variation in system permeability compromises the 'long-term' reproducibility. This problem can however be overcome by running a flow rate program with an optimized flow rate and composition profile obtained from the constant pressure mode. In this case, the quantification remains reproducibile, despite any occuring variations of the system permeability. Furthermore, the same fragmentation pattern (MS) has been found in the constant pressure mode compared to the customary constant flow rate mode. Copyright © 2012 Elsevier B.V. All rights reserved.

Investigation of dynamic characteristics of a turbine-propeller engine

NASA Technical Reports Server (NTRS)

Oppenheimer, Frank L; Jacques, James R

1951-01-01

Time constants that characterize engine speed response of a turbine-propeller engine over the cruising speed range for various values of constant fuel flow and constant blade angle were obtained both from steady-state characteristics and from transient operation. Magnitude of speed response to changes in fuel flow and blade angle was investigated and is presented in the form of gain factors. Results indicate that at any given value of speed in the engine cruising speed range, time constants obtained both from steady-state characteristics and from transient operation agree satisfactorily for any given constant fuel flow, whereas time constants obtained from transient operation exceed time constants obtained from steady-state characteristics by approximately 14 percent for any given blade angle.

A theoretical evaluation of rigid baffles in suppression of combustion instability

NASA Technical Reports Server (NTRS)

Baer, M. R.; Mitchell, C. E.

1976-01-01

An analytical technique for the prediction of the effects of rigid baffles on the stability of liquid propellant combustors is presented. A three dimensional combustor model characterized by a concentrated combustion source at the chamber injector and a constant Mach number nozzle is used. The linearized partial differential equations describing the unsteady flow field are solved by an eigenfunction matching method. Boundary layer corrections to this unsteady flow are used to evaluate viscous and turbulence effects within the flow. An integral stability relationship is then employed to predict the decay rate of the oscillations. Results show that sufficient dissipation exists to indicate that the proper mechanism of baffle damping is a fluid dynamic loss. The response of the dissipation model to varying baffle blade length, mean flow Mach number and oscillation amplitude is examined.

A drag measurement technique for free piston shock tunnels

NASA Technical Reports Server (NTRS)

Sanderson, S. R.; Simmons, J. M.; Tuttle, S. L.

1991-01-01

A new technique is described for measuring drag with 100-microsecond rise time on a nonlifting model in a free piston shock tunnel. The technique involves interpretation of the stress waves propagating within the model and its support. A finite element representation and spectral methods are used to obtain a mean square optimal estimate of the time history of the aerodynamic loading. Thus, drag is measured instantaneously and the previous restriction caused by the mechanical time constant of balances is overcome. The effectiveness of the balance is demonstrated by measuring the drag on cones with 5 and 15 deg semi-vertex angles in nominally Mach 5.6 flow with stagnation enthalpies from 2.6 to 33 MJ/kg.

Fast gradient separation by very high pressure liquid chromatography: reproducibility of analytical data and influence of delay between successive runs.

PubMed

Stankovicha, Joseph J; Gritti, Fabrice; Beaver, Lois Ann; Stevensona, Paul G; Guiochon, Georges

2013-11-29

Five methods were used to implement fast gradient separations: constant flow rate, constant column-wall temperature, constant inlet pressure at moderate and high pressures (controlled by a pressure controller),and programmed flow constant pressure. For programmed flow constant pressure, the flow rates and gradient compositions are controlled using input into the method instead of the pressure controller. Minor fluctuations in the inlet pressure do not affect the mobile phase flow rate in programmed flow. There producibilities of the retention times, the response factors, and the eluted band width of six successive separations of the same sample (9 components) were measured with different equilibration times between 0 and 15 min. The influence of the length of the equilibration time on these reproducibilities is discussed. The results show that the average column temperature may increase from one separation to the next and that this contributes to fluctuation of the results.

Role of dielectric constant in electrohydrodynamics of conducting fluids

NASA Technical Reports Server (NTRS)

Rhodes, Percy H.; Snyder, Robert S.; Roberts, Glyn O.

1992-01-01

Electrohydrodynamic (EHD) flows are driven by the interaction of an electric field with variations in electric conductivity or dielectric constant. In reported EHD experiments on the deformation of drops of immiscible dielectric fluids, the role of conductivity has tended to overshadow the role of dielectric constant. Often, large conductivity contrasts were convenient because the conductivities of the dielectric fluid were relatively uncertain. As a result, the observed effects were always qualitatively the same as if there had been no contrast in dielectric constant. Our early experiments studying the EHC deformations of cylindrical streams readily showed the conductivity effect but the dielectric constant effect was not discernible. We have modified our flow chamber and improved our method of observation and can now see an unequivocal dielectric constant effect which is in agreement with the prior theory. In this paper we first give a brief description of the physics of charge buildup at the interface of an immersed spherical drop or flowing cylindrical sample stream and then show how these charge distributions lead to interface distortions and accompanying viscous flows which constitute EHD. We next review theory and experiment describing the deformation of spherical drops. We show that in the reported drop deformation experiments, the contrast in dielectric constant was never sufficient to reverse the deformation due to the conductivity contrast. We review our work describing the deformation of a cylindrical stream of one fluid flowing in a parallel flow of another, and we compare the deformation equations with those for spherical drops. Finally, we show a definite experimental dielectric constant effect for cylindrical stream of aqueous polystyrene latex suspension. The dielectric constant varies with the frequency of the imposed electric field, and the associated EHD flow change is very apparent.

Measurement of labile copper in wine by medium exchange stripping potentiometry utilising screen printed carbon electrodes.

PubMed

Clark, Andrew C; Kontoudakis, Nikolaos; Barril, Celia; Schmidtke, Leigh M; Scollary, Geoffrey R

2016-07-01

The presence of copper in wine is known to impact the reductive, oxidative and colloidal stability of wine, and techniques enabling measurement of different forms of copper in wine are of particular interest in understanding these spoilage processes. Electrochemical stripping techniques developed to date require significant pretreatment of wine, potentially disturbing the copper binding equilibria. A thin mercury film on a screen printed carbon electrode was utilised in a flow system for the direct analysis of labile copper in red and white wine by constant current stripping potentiometry with medium exchange. Under the optimised conditions, including an enrichment time of 500s and constant current of 1.0μA, the response range was linear from 0.015 to 0.200mg/L. The analysis of 52 red and white wines showed that this technique generally provided lower labile copper concentrations than reported for batch measurement by related techniques. Studies in a model system and in finished wines showed that the copper sulfide was not measured as labile copper, and that loss of hydrogen sulfide via volatilisation induced an increase in labile copper within the model wine system. Copyright © 2016 Elsevier B.V. All rights reserved.

Double-layer optical fiber coating analysis in MHD flow of an elastico-viscous fluid using wet-on-wet coating process

NASA Astrophysics Data System (ADS)

Khan, Zeeshan; Islam, Saeed; Shah, Rehan Ali; Khan, Muhammad Altaf; Bonyah, Ebenezer; Jan, Bilal; Khan, Aurangzeb

Modern optical fibers require a double-layer coating on the glass fiber in order to provide protection from signal attenuation and mechanical damage. The most important plastic resins used in wires and optical fibers are plastic polyvinyl chloride (PVC) and low and high density polyethylene (LDPE/HDPE), nylon and Polysulfone. One of the most important things which affect the final product after processing is the design of the coating die. In the present study, double-layer optical fiber coating is performed using melt polymer satisfying Oldroyd 8-constant fluid model in a pressure type die with the effect of magneto-hydrodynamic (MHD). Wet-on-wet coating process is applied for double-layer optical fiber coating. The coating process in the coating die is modeled as a simple two-layer Couette flow of two immiscible fluids in an annulus with an assigned pressure gradient. Based on the assumptions of fully developed laminar and MHD flow, the Oldroyd 8-constant model of non-Newtonian fluid of two immiscible resin layers is modeled. The governing nonlinear equations are solved analytically by the new technique of Optimal Homotopy Asymptotic Method (OHAM). The convergence of the series solution is established. The results are also verified by the Adomian Decomposition Method (ADM). The effect of important parameters such as magnetic parameter Mi , the dilatant constant α , the Pseodoplastic constant β , the radii ratio δ , the pressure gradient Ω , the speed of fiber optics V , and the viscosity ratio κ on the velocity profiles, thickness of coated fiber optics, volume flow rate, and shear stress on the fiber optics are investigated. At the end the result of the present work is also compared with the experimental results already available in the literature by taking non-Newtonian parameters tends to zero.

A flowing partially penetrating well in a finite-thickness aquifer: a mixed-type initial boundary value problem

NASA Astrophysics Data System (ADS)

Chang, Chien-Chieh; Chen, Chia-Shyun

2003-02-01

An analytical approach using integral transform techniques is developed to deal with a well hydraulics model involving a mixed boundary of a flowing partially penetrating well, where constant drawdown is stipulated along the well screen and no-flux condition along the remaining unscreened part. The aquifer is confined of finite thickness. First, the mixed boundary is changed into a homogeneous Neumann boundary by discretizing the well screen into a finite number of segments, each of which at constant drawdown is subject to unknown a priori well bore flux. Then, the Laplace and the finite Fourier transforms are used to solve this modified model. Finally, the prescribed constant drawdown condition is reinstated to uniquely determine the well bore flux function, and to restore the relation between the solution and the original model. The transient and the steady-state solutions for infinite aquifer thickness can be derived from the semi-analytical solution, complementing the currently available dual integral solution. If the distance from the edge of the well screen to the bottom/top of the aquifer is 100 times greater than the well screen length, aquifer thickness can be assumed infinite for times of practical significance, and groundwater flow can reach a steady-state condition, where the well will continuously supply water under a constant discharge. However, if aquifer thickness is smaller, the well discharge decreases with time. The partial penetration effect is most pronounced in the vicinity of the flowing well, decreases with increasing horizontal distance, and vanishes at distances larger than 1-2 times the aquifer thickness divided by the square root of aquifer anisotropy. The horizontal hydraulic conductivity and the specific storage coefficient can be determined from vertically averaged drawdown as measured by fully penetrating observation wells. The vertical hydraulic conductivity can be determined from the well discharge under two particular partial penetration conditions.

Flux-Feedback Magnetic-Suspension Actuator

NASA Technical Reports Server (NTRS)

Groom, Nelson J.

1990-01-01

Flux-feedback magnetic-suspension actuator provides magnetic suspension and control forces having linear transfer characteristics between force command and force output over large range of gaps. Hall-effect devices used as sensors for electronic feedback circuit controlling currents flowing in electromagnetic windings to maintain flux linking suspended element at substantially constant value independent of changes in length of gap. Technique provides effective method for maintenance of constant flux density in gap and simpler than previous methods. Applications include magnetic actuators for control of shapes and figures of antennas and of precise segmented reflectors, magnetic suspensions in devices for storage of angular momentum and/or kinetic energy, and systems for control, pointing, and isolation of instruments.

Multiple solutions in MHD flow and heat transfer of Sisko fluid containing nanoparticles migration with a convective boundary condition: Critical points

NASA Astrophysics Data System (ADS)

Dhanai, Ruchika; Rana, Puneet; Kumar, Lokendra

2016-05-01

The motivation behind the present analysis is to focus on magneto-hydrodynamic flow and heat transfer characteristics of non-Newtonian fluid (Sisko fluid) past a permeable nonlinear shrinking sheet utilizing nanoparticles involving convective boundary condition. The non-homogenous nanofluid transport model considering the effect of Brownian motion, thermophoresis, suction/injection and no nanoparticle flux at the sheet with convective boundary condition has been solved numerically by the RKF45 method with shooting technique. Critical points for various pertinent parameters are evaluated in this study. The dual solutions (both first and second solutions) are captured in certain range of material constant (nc< n < ∞) , mass transfer parameter (sc < s < ∞) and shrinking parameter (χc < χ < 0) . For both the branches (upper and lower branch), the rate of heat transfer is an increasing function of the power-law index, Prandtl number and Biot number, whereas it is a decreasing function of the material constant and thermophoresis parameter.

Flow and volume dependence of rat airway resistance during constant flow inflation and deflation.

PubMed

Rubini, Alessandro; Carniel, Emanuele Luigi; Parmagnani, Andrea; Natali, Arturo Nicola

2011-12-01

The aim of this study was to measure the flow and volume dependence of both the ohmic and the viscoelastic pressure dissipations of the normal rat respiratory system separately during inflation and deflation. The study was conducted in the Respiratory Physiology Laboratory in our institution. Measurements were obtained for Seven albino Wistar rats of both sexes by using the flow interruption method during constant flow inflations and deflations. Measurements included anesthesia induction, tracheostomy and positioning of a tracheal cannula, positive pressure ventilation, constant flow respiratory system inflations and deflations at two different volumes and flows. The ohmic resistance exhibited volume and flow dependence, decreasing with lung volume and increasing with flow rate, during both inflation and deflation. The stress relaxation-related viscoelastic resistance also exhibited volume and flow dependence. It decreased with the flow rate at a constant lung volume during both inflation and deflation, but exhibited a different behavior with the lung volume at a constant flow rate (i.e., increased during inflations and decreased during deflations). Thus, stress relaxation in the rat lungs exhibited a hysteretic behavior. The observed flow and volume dependence of respiratory system resistance may be predicted by an equation derived from a model of the respiratory system that consists of two distinct compartments. The equation agrees well with the experimental data and indicates that the loading time is the critical parameter on which stress relaxation depends, during both lung inflation and deflation.

Calibration of the k- ɛ model constants for use in CFD applications

NASA Astrophysics Data System (ADS)

Glover, Nina; Guillias, Serge; Malki-Epshtein, Liora

2011-11-01

The k- ɛ turbulence model is a popular choice in CFD modelling due to its robust nature and the fact that it has been well validated. However it has been noted in previous research that the k- ɛ model has problems predicting flow separation as well as unconfined and transient flows. The model contains five empirical model constants whose values were found through data fitting for a wide range of flows (Launder 1972) but ad-hoc adjustments are often made to these values depending on the situation being modeled. Here we use the example of flow within a regular street canyon to perform a Bayesian calibration of the model constants against wind tunnel data. This allows us to assess the sensitivity of the CFD model to changes in these constants, find the most suitable values for the constants as well as quantifying the uncertainty related to the constants and the CFD model as a whole.

On framing potential features of SWCNTs and MWCNTs in mixed convective flow

NASA Astrophysics Data System (ADS)

Hayat, T.; Ullah, Siraj; Khan, M. Ijaz; Alsaedi, A.

2018-03-01

Our target in this research article is to elaborate the characteristics of Darcy-Forchheimer relation in carbon-water nanoliquid flow induced by impermeable stretched cylinder. Energy expression is modeled through viscous dissipation and nonlinear thermal radiation. Application of appropriate transformations yields nonlinear ODEs through nonlinear PDEs. Shooting technique is adopted for the computations of nonlinear ODEs. Importance of influential variables for velocity and thermal fields is elaborated graphically. Moreover rate of heat transfer and drag force are calculated and demonstrated through Tables. Our analysis reports that velocity is higher for ratio of rate constant and buoyancy factor when compared with porosity and volume fraction.

Flow Tube Studies of Gas Phase Chemical Processes of Atmospheric Importance

NASA Technical Reports Server (NTRS)

Molina, Mario J.

1998-01-01

The objective of this project is to conduct measurements of elementary reaction rate constants and photochemical parameters for processes of importance in the atmosphere. These measurements are being carried out under temperature and pressure conditions covering those applicable to the stratosphere and upper troposphere, using the chemical ionization mass spectrometry turbulent flow technique developed in our laboratory. The next section summarizes our research activities during the first year of the project, and the section that follows consists of the statement of work for the third year. Additional details concerning the projects listed in the statement of work were described in our original proposal.

Inertia effects in thin film flow with a corrugated boundary

NASA Technical Reports Server (NTRS)

Serbetci, Ilter; Tichy, John A.

1991-01-01

An analytical solution is presented for two-dimensional, incompressible film flow between a sinusoidally grooved (or rough) surface and a flat-surface. The upper grooved surface is stationary whereas the lower, smooth surface moves with a constant speed. The Navier-Stokes equations were solved employing both mapping techniques and perturbation expansions. Due to the inclusion of the inertia effects, a different pressure distribution is obtained than predicted by the classical lubrication theory. In particular, the amplitude of the pressure distribution of the classical lubrication theory is found to be in error by over 100 perent (for modified Reynolds number of 3-4).

Molecular Rayleigh Scattering Diagnostic for Dynamic Temperature, Velocity, and Density Measurements

NASA Technical Reports Server (NTRS)

Mielke, Amy R.; Elam, Kristie A.; Sung, Chi-Jen

2006-01-01

A molecular Rayleigh scattering technique is developed to measure dynamic gas temperature, velocity, and density in unseeded turbulent flows at sampling rates up to 16 kHz. A high power CW laser beam is focused at a point in an air jet plume and Rayleigh scattered light is collected and spectrally resolved. The spectrum of the light, which contains information about the temperature and velocity of the flow, is analyzed using a Fabry-Perot interferometer. The circular interference fringe pattern is divided into four concentric regions and sampled at 1 and 16 kHz using photon counting electronics. Monitoring the relative change in intensity within each region allows for measurement of gas temperature and velocity. Independently monitoring the total scattered light intensity provides a measure of gas density. A low speed heated jet is used to validate the measurement of temperature fluctuations and an acoustically excited nozzle flow is studied to validate velocity fluctuation measurements. Power spectral density calculations of the property fluctuations, as well as mean and fluctuating quantities are presented. Temperature fluctuation results are compared with constant current anemometry measurements and velocity fluctuation results are compared with constant temperature anemometry measurements at the same locations.

1200 and 1300 K slow plastic compression properties of Ni-50Al composites

NASA Technical Reports Server (NTRS)

Whittenberger, J. D.; Kumar, K. S.; Mannan, S. K.

1991-01-01

XD synthesis, powder blending, and hot pressing techniques have been utilized to produce NiAl composites containing 4, 7.5, 15, and 25 vol pct alumina whiskers and hybrid composite materials with 15 vol pct Al2O3 + 10 or 20 vol pct, nominally 1 micron TiB2 particles. The resistance to slow plastic flow was determined at 1200 and 1300 K via compression testing in air under constant velocity conditions. The stress-strain behavior of the intermetallic composites depended on the fraction of second phases where the 4 and 7.5 percent Al2O3 materials flowed at a nominally constant stress after about 2 percent deformation, while all the other composites exhibited diffuse yielding followed by strain softening. The flow stress-strain rate properties increased with volume fraction of Al2O3 whiskers except for the 4 and 7.5 percent materials, which had similar strengths. The hybrid composite NiAl + 15Al2O3 + 10TiB2 was substantially stronger than the materials simply containing alumina. Deformation in these composites can be described by the Kelly and Street model of creep in perfectly bonded, rigid, discontinuous fiber materials.

Process viscometry in flows of non-Newtonian fluids using an anchor agitator

NASA Astrophysics Data System (ADS)

Jo, Hae Jin; Jang, Hye Kyeong; Kim, Young Ju; Hwang, Wook Ryol

2017-11-01

In this work, we present a viscosity measurement technique for inelastic non-Newtonian fluids directly in flows of anchor agitators that are commonly used in highly viscous fluid mixing particularly with yield stress. A two-blade anchor impeller is chosen as a model flow system and Carbopol 940 solutions and Xanthan gum solutions with various concentrations are investigated as test materials. Following the Metzner-Otto correlation, the effective shear rate constant and the energy dissipation rate constant have been estimated experimentally by establishing (i) the relationship between the power number and the Reynolds number using a reference Newtonian fluid and (ii) the proportionality between the effective shear rate and the impeller speed with a reference non-Newtonian fluid. The effective viscosity that reproduces the same amount of the energy dissipation rate, corresponding to that of Newtonian fluid, has been obtained by measuring torques for various impeller speeds and the accuracy in the viscosity prediction as a function of the shear rate has been compared with the rheological measurement. We report that the process viscometry with the anchor impeller yields viscosity estimation within the relative error of 20% with highly shear-thinning fluids.

Viscoelastic behavior of lung and chest wall in dogs determined by flow interruption.

PubMed

Similowski, T; Levy, P; Corbeil, C; Albala, M; Pariente, R; Derenne, J P; Bates, J H; Jonson, B; Milic-Emili, J

1989-12-01

Pulmonary and chest wall mechanics were studied in six anesthetized paralyzed dogs, by use of the technique of rapid airway occlusion during constant flow inflation. Analysis of the pressure changes after flow interruption allowed us to partition the overall resistance of the lung (Rl) and chest wall (Rw) and total respiratory system (Rrs) into two components, one (Rinit) reflecting in the lung airway resistance (Raw), the other (delta R) reflecting primarily the viscoelastic properties of the pulmonary and chest wall tissues. The effects of varying inspiratory flow and inflation volume were interpreted in terms of frequency dependence of resistance, by using a spring-and-dashpot model previously proposed and substantiated by Bates et al. (Proc. 9th Annu. Conf. IEEE Med. Biol. Soc., 1987, vol. 3, p. 1802-1803). We observed that 1) Raw and Rw,init were nearly equal and small relative to Rl and Rw (both were unaffected by flow); 2) Rrs,init decreased slightly with increasing volume; 3) both delta Rl and delta Rw decreased with increasing flow and increased with increasing lung volume. These changes were manifestations of frequency dependence of delta R, as it is predicted by the model; 4) Rrs, Rl, and Rw followed the same trends as delta R. These results corroborate data previously reported in the literature with the use of different techniques to measure airways and pulmonary tissue resistances and confirm that the use of Rl to assess bronchial reactivity is problematic. The interrupter techniques provides a convenient way to obtain Raw values, as well as analogs of lung and chest wall tissue resistances in intact dogs.

Installation effects on the tonal noise generated by axial flow fans

NASA Astrophysics Data System (ADS)

Canepa, Edward; Cattanei, Andrea; Mazzocut Zecchin, Fabio

2015-03-01

The paper presents the results of experiments on a low-speed axial-flow fan flush mounted on flat panels typically employed in tests on automotive cooling fans. The experiments have been conducted in a hemi-anechoic chamber and were aimed at evaluating the installation effects of the whole test configuration, including chamber floor and size and shape of the mounting panel. The largest panels cause important SPL variations in a narrow, low frequency range. Their effect on the propagation function has been verified by means of parametric BEM computations. A regular wavy trend associated with reflections from the floor is also present. In both cases, the tonal noise is more strongly affected than the broadband one. The analysis is performed by means of an existing spectral decomposition technique and a new one, which allows to consider different noise generating mechanisms and also to separate the emitted tonal and broadband noise from the associated propagation effects. In order to better identify the features of the noise at the blade passing frequency (BPF) harmonics, the phase of the acoustic pressure is also analysed. Measurements are taken during speed ramps, which allow to obtain both constant-Strouhal number SPL data and constant-speed data. The former data set is employed in the new technique, while the latter may be employed in the standard spectral decomposition techniques. Based on both the similarity theory and the analysis of the Green's function of the problem, a theoretical description of the structure of the received SPL spectrum is given. Then, the possibility of discriminating between tonal and broadband noise generating mechanisms is analysed and a theoretical base for the new spectral decomposition technique is provided.

Quantitative measurement of regional blood flow with gadolinium diethylenetriaminepentaacetate bolus track NMR imaging in cerebral infarcts in rats: validation with the iodo[14C]antipyrine technique.

PubMed Central

Wittlich, F; Kohno, K; Mies, G; Norris, D G; Hoehn-Berlage, M

1995-01-01

NMR bolus track measurements were correlated with autoradiographically determined regional cerebral blood flow (rCBF). The NMR method is based on bolus infusion of the contrast agent gadolinium diethylenetriaminepentaacetate and high-speed T*2-sensitive NMR imaging. The first pass of the contrast agent through the image plane causes a transient decrease of the signal intensity. This time course of the signal intensity is transformed into relative concentrations of the contrast agent in each pixel. The mean transit time and relative blood flow and volume are calculated from such indicator dilution curves. We investigated whether this NMR technique correctly expresses the relative rCBF. The relative blood flow data, calculated from NMR bolus track experiments, and the absolute values of iodo[14C]antipyrine autoradiography were compared. A linear relationship was observed, indicating the proportionality of the transient NMR signal change with CBF. Excellent interindividual reproducibility of calibration constants is observed (r = 0.963). For a given NMR protocol, bolus track measurements calibrated with autoradiography after the experiment allow determination of absolute values for rCBF and regional blood volume. Images Fig. 2 Fig. 3 PMID:7892189

Laboratory investigation of the erosion of cohesive sediments under oscillatory flows using a synchronized imaging technique

NASA Astrophysics Data System (ADS)

Sou, In Mei; Calantoni, Joseph; Reed, Allen; Furukawa, Yoko

2012-11-01

A synchronized dual stereo particle image velocimetry (PIV) measurement technique is used to examine the erosion process of a cohesive sediment core in the Small Oscillatory Flow Tunnel (S-OFT) in the Sediment Dynamics Laboratory at the Naval Research Laboratory, Stennis Space Center, MS. The dual stereo PIV windows were positioned on either side of a sediment core inserted along the centerline of the S-OFT allowing for a total measurement window of about 20 cm long by 10 cm high with sub-millimeter spacing on resolved velocity vectors. The period of oscillation ranged from 2.86 to 6.12 seconds with constant semi-excursion amplitude in the test section of 9 cm. During the erosion process, Kelvin-Helmholtz instabilities were observed as the flow accelerated in each direction and eventually were broken down when the flow reversed. The relative concentration of suspended sediments under different flow conditions was estimated using the intensity of light scattered from the sediment particles in suspension. By subtracting the initial light scattered from the core, the residual light intensity was assumed to be scattered from suspended sediments eroded from the core. Results from two different sediment core samples of mud and sand mixtures will be presented.

Very high pressure liquid chromatography using fully porous particles: quantitative analysis of fast gradient separations without post-run times.

PubMed

Stankovich, Joseph J; Gritti, Fabrice; Stevenson, Paul G; Beaver, Lois Ann; Guiochon, Georges

2014-01-10

Using a column packed with fully porous particles, four methods for controlling the flow rates at which gradient elution runs are conducted in very high pressure liquid chromatography (VHPLC) were tested to determine whether reproducible thermal conditions could be achieved, such that subsequent analyses would proceed at nearly the same initial temperature. In VHPLC high flow rates are achieved, producing fast analyses but requiring high inlet pressures. The combination of high flow rates and high inlet pressures generates local heat, leading to temperature changes in the column. Usually in this case a post-run time is input into the analytical method to allow the return of the column temperature to its initial state. An alternative strategy involves operating the column without a post-run equilibration period and maintaining constant temperature variations for subsequent analysis after conducting one or a few separations to bring the column to a reproducible starting temperature. A liquid chromatography instrument equipped with a pressure controller was used to perform constant pressure and constant flow rate VHPLC separations. Six replicate gradient separations of a nine component mixture consisting of acetophenone, propiophenone, butyrophenone, valerophenone, hexanophenone, heptanophenone, octanophenone, benzophenone, and acetanilide dissolved in water/acetonitrile (65:35, v/v) were performed under various experimental conditions: constant flow rate, two sets of constant pressure, and constant pressure operation with a programmed flow rate. The relative standard deviations of the response factors for all the analytes are lower than 5% across the methods. Programming the flow rate to maintain a fairly constant pressure instead of using instrument controlled constant pressure improves the reproducibility of the retention times by a factor of 5, when plotting the chromatograms in time. Copyright © 2013 Elsevier B.V. All rights reserved.

Gravity flow of powder in a lunar environment. Part 2: Analysis of flow initiation

NASA Technical Reports Server (NTRS)

Pariseau, W. G.

1971-01-01

A small displacement-small strain finite element technique utilizing the constant strain triangle and incremental constitutive equations for elasticplastic (media nonhardening and obeying a Coulomb yield condition) was applied to the analysis of gravity flow initiation. This was done in a V-shaped hopper containing a powder under lunar environmental conditions. Three methods of loading were examined. Of the three, the method of computing the initial state of stress in a filled hopper prior to drawdown, by adding material to the hopper layer by layer, was the best. Results of the analysis of a typical hopper problem show that the initial state of stress, the elastic moduli, and the strength parameters have an important influence on material response subsequent to the opening of the hopper outlet.

Jovian vortices by simulated annealing

NASA Astrophysics Data System (ADS)

Morrison, P. J.; Flierl, G. R.; Swaminathan, R. V.

2017-11-01

We explore the conditions required for isolated vortices to exist in sheared zonal flows and the stability of the underlying zonal winds. This is done using the standard 2-layer quasigeostrophic model with the lower layer depth becoming infinite; however, this model differs from the usual layer model because the lower layer is not assumed to be motionless but has a steady configuration of alternating zonal flows. Steady state vortices are obtained by a simulated annealing computational method introduced in, generalized and applied in in fluid flow, and used in the context of magnetohydrodynamics in. Various cases of vortices with a constant potential vorticity anomaly atop zonal winds and the stability of the underlying winds are considered using a mix of computational and analytical techniques. U.S. Department of Energy Contract DE-FG05-80ET-53088.

On the modelling of scalar and mass transport in combustor flows

NASA Technical Reports Server (NTRS)

Nikjooy, M.; So, R. M. C.

1989-01-01

Results are presented of a numerical study of swirling and nonswirling combustor flows with and without density variations. Constant-density arguments are used to justify closure assumptions invoked for the transport equations for turbulent momentum and scalar fluxes, which are written in terms of density-weighted variables. Comparisons are carried out with measurements obtained from three different axisymmetric model combustor experiments covering recirculating flow, swirling flow, and variable-density swirling flow inside the model combustors. Results show that the Reynolds stress/flux models do a credible job of predicting constant-density swirling and nonswirling combustor flows with passive scalar transport. However, their improvements over algebraic stress/flux models are marginal. The extension of the constant-density models to variable-density flow calculations shows that the models are equally valid for such flows.

The noise and flow characteristics of inverted-profile coannular jets

NASA Technical Reports Server (NTRS)

Tanna, H. K.; Tester, B. J.; Lau, J. C.

1979-01-01

A basic understanding of the noise reduction mechanisms in shock-free inverted-velocity-profile coannular jets was studied. Acoustic measurements are first conducted in an anechoic facility to isolate the effects of inverted velocity and inverted temperature for coannular jets having constant total thrust, mass flow rate and exit area. To obtain physical explanations of the measured noise changes, several types of experiments are conducted. These include (1) source location experiments using the polar correlation technique, (2) mean flow surveys using a combination pressure/temperature probe, and (3) detailed mean flow and turbulence measurements using a two-point four-channel laser velocimeter. The results from these experiments are presented and discussed in detail. Finally, the measured variations of coannular jet mixing noise with fan-to-primary velocity ratio and static temperature ratio are interpreted by utilizing the results from the various experimental phases in conjunction with the existing Lockheed single jet noise prediction model.

Food sensing: selection and characterization of DNA aptamers to Alicyclobacillus spores for trapping and detection from orange juice.

PubMed

Hünniger, Tim; Fischer, Christin; Wessels, Hauke; Hoffmann, Antonia; Paschke-Kratzin, Angelika; Haase, Ilka; Fischer, Markus

2015-03-04

The quality of the beverage industry's products has to be constantly monitored to fulfill consumers' high expectations. The thermo-acidophilic Gram-positive Alicyclobacillus spp. are not pathogenic, but their heat-resistant endospores can survive juice-processing conditions and have become a major economic concern for the fruit juice industry. Current detection methods rely on cultivation, isolation, and organism identification, which can take up to a week, resulting in economic loss. This work presents the selection and identification of DNA aptamers targeting Alicyclobacillus spores by spore-SELEX (systematic evolution of ligands by exponential enrichment) in orange-juice-simulating buffer. The selection process was verified by various techniques, including flow cytometric binding assays, radioactive binding assays, and agarose gel electrophoresis. The subsequent aptamer characterization included the determination of dissociations constants and selectivity by different techniques, such as surface plasmon resonance spectroscopy and fluorescence microscopy. In summary, 10 different aptamers with an affinity to Alicyclobacillus spp. have been developed, analyzed, and characterized in terms of affinity and specificity.

Etude hydromecanique d'une fracture en cisaillement sous contrainte normale constante

NASA Astrophysics Data System (ADS)

Lamontagne, Eric

This research study deals with the effects of shear direction and injection flow rate on the flow directional anisotropy for a given normal stress. It presents experimental works on hydromechanical shear behaviour of a fracture under constant normal stress conditions that permits the characterisation of the intrinsic hydraulic transmissivity in relation with the directional anisotropy of the roughness morphology on the fracture surfaces. Tests were performed on mortar replicas of a natural fracture so that the fracture roughness and void space geometry were kept the same for each test. The experimental work program was performed through direct shear tests on the fracture replicas in four shear directions under four constant normal stress levels. The application of the normal stress was followed by several injections of fluid under constant flow rate. Then, for each defined shear displacement, several injections of fluid were done at different flow rate but under constant flow rate. The test results show that: (1) for the whole shear tests, the global intrinsic transmissivity is included within an enveloping zone of about one order of size. The transmissivity curves within the enveloping zone has a particularity to increase about two orders of size in the first millimetre of shear displacement and subsequently stabilised rapidly; (2) the highest dilatancy do not correspond necessarily with the highest intrinsic transmissivity so that, the behaviour of the global intrinsic transmissivity is not directly proportional to the fracture dilatancy during shear; (3) after the peak shear stress, the divergence is more marked between the global intrinsic transmissivity curves at various flow rate; (4) after peak shear strength and the beginning of asperity degradation, the gradual passage to residual friction shear behaviour causes a directional flow anisotropy and a reorientation of the flow chenalisation direction sub perpendicularly to the shear direction; (5) the anisotropy is not to develop equally between the two sense in the perpendicular direction to shear direction. In order to characterise the dynamics of the flow pattern in the fracture, a statistical analysis of the surfaces morphology of the fracture and the casting of void space geometry were performed before and after shear. A statistical analysis of asperity heights, on the global scale of the fracture surfaces, permits to characterise the fracture morphology and put in evidence a large morphological structure on which are superposed smaller asperities of variable dimensions. This large dimension structure generate a higher level landing occupying more than half of the fracture area. The study of the surfaces morphology of the fracture, performed with the geostatistical mean asperity heights variogram by direction before shearing, show the presence of two entangled morphologic structure families (28 and 15 mm). This same study done after shearing shows that the asperity degradation seems associated with the reduction of the global intrinsic transmissivity of the fracture. Finally, the void spaces morphology evaluated by casting techniques, during the shear tests, has permitted to verify the contacts evolution with the increasing shear displacement and visualised flow chenalisation during fracture shearing.

Sandia Higher Order Elements (SHOE) v 0.5 alpha

DOE Office of Scientific and Technical Information (OSTI.GOV)

2013-09-24

SHOE is research code for characterizing and visualizing higher-order finite elements; it contains a framework for defining classes of interpolation techniques and element shapes; methods for interpolating triangular, quadrilateral, tetrahedral, and hexahedral cells using Lagrange and Legendre polynomial bases of arbitrary order; methods to decompose each element into domains of constant gradient flow (using a polynomial solver to identify critical points); and an isocontouring technique that uses this decomposition to guarantee topological correctness. Please note that this is an alpha release of research software and that some time has passed since it was actively developed; build- and run-time issues likelymore » exist.« less

Simultaneous Temperature and Velocity Measurements in a Large-Scale, Supersonic, Heated Jet

NASA Technical Reports Server (NTRS)

Danehy, P. M.; Magnotti, G.; Bivolaru, D.; Tedder, S.; Cutler, A. D.

2008-01-01

Two laser-based measurement techniques have been used to characterize an axisymmetric, combustion-heated supersonic jet issuing into static room air. The dual-pump coherent anti-Stokes Raman spectroscopy (CARS) measurement technique measured temperature and concentration while the interferometric Rayleigh scattering (IRS) method simultaneously measured two components of velocity. This paper reports a preliminary analysis of CARS-IRS temperature and velocity measurements from selected measurement locations. The temperature measurements show that the temperature along the jet axis remains constant while dropping off radially. The velocity measurements show that the nozzle exit velocity fluctuations are about 3% of the maximum velocity in the flow.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chandrasekhar, S.

In 1991 the Charles Greely Abbot Award of the American Solar Energy Society was awarded to Dr. Subrahmanyan Chandrasekhar, in recognition of his well-known work on the internal operation and life cycle of stars such as the sun, and for his development of the new radiation heat transfer and fluid flow analysis techniques he had found to be necessary to do this work. His acceptance address is presented here, which explains the relationship between Abbot's work on the solar constant and Dr. Chandrasekhar's research.

A noninvasive method for measuring the velocity of diffuse hydrothermal flow by tracking moving refractive index anomalies

NASA Astrophysics Data System (ADS)

Mittelstaedt, Eric; Davaille, Anne; van Keken, Peter E.; Gracias, Nuno; Escartin, Javier

2010-10-01

Diffuse flow velocimetry (DFV) is introduced as a new, noninvasive, optical technique for measuring the velocity of diffuse hydrothermal flow. The technique uses images of a motionless, random medium (e.g., rocks) obtained through the lens of a moving refraction index anomaly (e.g., a hot upwelling). The method works in two stages. First, the changes in apparent background deformation are calculated using particle image velocimetry (PIV). The deformation vectors are determined by a cross correlation of pixel intensities across consecutive images. Second, the 2-D velocity field is calculated by cross correlating the deformation vectors between consecutive PIV calculations. The accuracy of the method is tested with laboratory and numerical experiments of a laminar, axisymmetric plume in fluids with both constant and temperature-dependent viscosity. Results show that average RMS errors are ˜5%-7% and are most accurate in regions of pervasive apparent background deformation which is commonly encountered in regions of diffuse hydrothermal flow. The method is applied to a 25 s video sequence of diffuse flow from a small fracture captured during the Bathyluck'09 cruise to the Lucky Strike hydrothermal field (September 2009). The velocities of the ˜10°C-15°C effluent reach ˜5.5 cm/s, in strong agreement with previous measurements of diffuse flow. DFV is found to be most accurate for approximately 2-D flows where background objects have a small spatial scale, such as sand or gravel.

Transient well flow in layered aquifer systems: the uniform well-face drawdown solution

NASA Astrophysics Data System (ADS)

Hemker, C. J.

1999-11-01

Previously a hybrid analytical-numerical solution for the general problem of computing transient well flow in vertically heterogeneous aquifers was proposed by the author. The radial component of flow was treated analytically, while the finite-difference technique was used for the vertical flow component only. In the present work the hybrid solution has been modified by replacing the previously assumed uniform well-face gradient (UWG) boundary condition in such a way that the drawdown remains uniform along the well screen. The resulting uniform well-face drawdown (UWD) solution also includes the effects of a finite diameter well, wellbore storage and a thin skin, while partial penetration and vertical heterogeneity are accommodated by the one-dimensional discretization. Solutions are proposed for well flow caused by constant, variable and slug discharges. The model was verified by comparing wellbore drawdowns and well-face flux distributions with published numerical solutions. Differences between UWG and UWD well flow will occur in all situations with vertical flow components near the well, which is demonstrated by considering: (1) partially penetrating wells in confined aquifers, (2) fully penetrating wells in unconfined aquifers with delayed response and (3) layered aquifers and leaky multiaquifer systems. The presented solution can be a powerful tool for solving many well-hydraulic problems, including well tests, flowmeter tests, slug tests and pumping tests. A computer program for the analysis of pumping tests, based on the hybrid analytical-numerical technique and UWG or UWD conditions, is available from the author.

Visualization of an air-water interface on superhydrophobic surfaces in turbulent channel flows

NASA Astrophysics Data System (ADS)

Kim, Hyunseok; Park, Hyungmin

2017-11-01

In the present study, three-dimensional deformation of air-water interface on superhydrophobic surfaces in turbulent channel flows at the Reynolds numbers of Re = 3000 and 10000 is measured with RICM (Reflection Interference Contrast Microscopy) technique. Two different types of roughness feature of circular hole and rectangular grate are considered, whose depth is 20 μm and diameter (or width) is varied between 20-200 μm. Since the air-water interface is always at de-pinned state at the considered condition, air-water interface shape and its sagging velocity is maintained to be almost constant as time goes one. In comparison with the previous results under the laminar flow, due to turbulent characteristics of the flow, sagging velocity is much faster. Based on the measured sagging profiles, a modified model to describe the air-water interface dynamics under turbulent flows is suggested. Supported by City of Seoul through Seoul Urban Data Science Laboratory Project (Grant No 0660-20170004) administered by SNU Big Data Institute.

Pre-clinical validation of a new intra-operative "dual beam Doppler" blood flowmeter in an artificial circuit.

PubMed

Cikirikcioglu, Mustafa; Cikirikcioglu, Y Banu; Khabiri, Ebrahim; Djebaili, M Karim; Kalangos, Afksendiyos; Walpoth, Beat H

2006-01-01

Intra-operative flow measurement during coronary or peripheral bypass operations is helpful for ruling out technical failures and for prediction of complication and patency rates. Preclinical validation of the flowmeters is required in order to rely on the intra-operatively measured results. The aim of this study is to evaluate a new "dual beam Doppler" blood flowmeter before clinical application and to compare it with the established "transit time flow measure-ment" technique in an artificial circuit. Measurements were performed in an experimental flow model using pig blood and pig arteries. Three different flowmeters were used: Quantix OR (dual beam doppler flowmeter), CardioMed (transit time flowmeter), and Transonic (transit time flowmeter). Three validation tests were performed to assess correlation, precision, and repeatability of devices. (1) Correlation and agreement analysis was performed with various flow amounts (10-350 mL/min) (n = 160). (2) Device reproducibility and measurement stability were tested with a constant flow (flow amount = 300 mL/min) (n = 30). (3) A user accuracy test (intra- and inter-observer variability) was performed by 5 different observers with a constant flow (flow amount = 205 mL/min) (n = 75). Time collected true flow was used as a reference method in all steps and all tests were performed in a blind manner. Results are shown as mean values +/- standard deviations. Pear-son's correlation and Bland-Altman plot analyses were used to compare measurements. The mean flow was 167 +/- 98 mL/min for true flow and 162 +/- 94 mL/min, 165 +/- 94 mL/min, and 166 +/- 100 mL/min for Quantix OR, CardioMed, and Transonic, respectively. Correlation coefficients between Quantix OR, Medi-Stim, Transonic, and time collected true flow were over 0.98 (P = .01). Most of the measured results ( > 90%) were between +/- 1.96 SD agreement limits in Bland and Altman plot analysis. All devices showed good results in the reproducibility test. During the user accuracy test, larger variance changes were observed between intra- and inter-observer results with the dual beam Doppler flowmeter compared to the 2 used transit time flowmeters when used for single sided vessel access without stabilization device (available from the manufacturer). All 3 tested flowmeters showed an excellent correlation to the true flow in an artificial circuit and the accuracy of the tested devices was within agreement limits. Reproducibility of all devices was good and linear. The new dual beam Doppler flow measurement technique compares favorably to the classic transit time method. Clinical use may depend on operator, location, and condition, thus more studies may be required to ensure uniform results using the currently available blood flow measurement devices.

Transient shear banding in the nematic dumbbell model of liquid crystalline polymers

NASA Astrophysics Data System (ADS)

Adams, J. M.; Corbett, D.

2018-05-01

In the shear flow of liquid crystalline polymers (LCPs) the nematic director orientation can align with the flow direction for some materials but continuously tumble in others. The nematic dumbbell (ND) model was originally developed to describe the rheology of flow-aligning semiflexible LCPs, and flow-aligning LCPs are the focus in this paper. In the shear flow of monodomain LCPs, it is usually assumed that the spatial distribution of the velocity is uniform. This is in contrast to polymer solutions, where highly nonuniform spatial velocity profiles have been observed in experiments. We analyze the ND model, with an additional gradient term in the constitutive model, using a linear stability analysis. We investigate the separate cases of constant applied shear stress and constant applied shear rate. We find that the ND model has a transient flow instability to the formation of a spatially inhomogeneous flow velocity for certain starting orientations of the director. We calculate the spatially resolved flow profile in both constant applied stress and constant applied shear rate in start up from rest, using a model with one spatial dimension to illustrate the flow behavior of the fluid. For low shear rates flow reversal can be seen as the director realigns with the flow direction, whereas for high shear rates the director reorientation occurs simultaneously across the gap. Experimentally, this inhomogeneous flow is predicted to be observed in flow reversal experiments in LCPs.

Electron attachment to CF{sub 3} and CF{sub 3}Br at temperatures up to 890 K: Experimental test of the kinetic modeling approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shuman, Nicholas S.; Miller, Thomas M.; Viggiano, Albert A.

Thermal rate constants and product branching fractions for electron attachment to CF{sub 3}Br and the CF{sub 3} radical have been measured over the temperature range 300-890 K, the upper limit being restricted by thermal decomposition of CF{sub 3}Br. Both measurements were made in Flowing Afterglow Langmuir Probe apparatuses; the CF{sub 3}Br measurement was made using standard techniques, and the CF{sub 3} measurement using the Variable Electron and Neutral Density Attachment Mass Spectrometry technique. Attachment to CF{sub 3}Br proceeds exclusively by the dissociative channel yielding Br{sup -}, with a rate constant increasing from 1.1 Multiplication-Sign 10{sup -8} cm{sup 3} s{sup -1}more » at 300 K to 5.3 Multiplication-Sign 10{sup -8} cm{sup 3} s{sup -1} at 890 K, somewhat lower than previous data at temperatures up to 777 K. CF{sub 3} attachment proceeds through competition between associative attachment yielding CF{sub 3}{sup -} and dissociative attachment yielding F{sup -}. Prior data up to 600 K showed the rate constant monotonically increasing, with the partial rate constant of the dissociative channel following Arrhenius behavior; however, extrapolation of the data using a recently proposed kinetic modeling approach predicted the rate constant to turn over at higher temperatures, despite being only {approx}5% of the collision rate. The current data agree well with the previous kinetic modeling extrapolation, providing a demonstration of the predictive capabilities of the approach.« less

Application of low-dimensional techniques for closed-loop control of turbulent flows

NASA Astrophysics Data System (ADS)

Ausseur, Julie

The groundwork for an advanced closed-loop control of separated shear layer flows is laid out in this document. The experimental testbed for the present investigation is the turbulent flow over a NACA-4412 model airfoil tested in the Syracuse University subsonic wind tunnel at Re=135,000. The specified control objective is to delay separation - or stall - by constantly keeping the flow attached to the surface of the wing. The proper orthogonal decomposition (POD) is shown to he a valuable tool to provide a low-dimensional estimate of the flow state and the first POD expansion coefficient is proposed to he used as the control variable. Other reduced-order techniques such as the modified linear and quadratic stochastic measurement methods (mLSM, mQSM) are applied to reduce the complexity of the flow field and their ability to accurately estimate the flow state from surface pressure measurements alone is examined. A simple proportional feedback control is successfully implemented in real-time using these tools and flow separation is efficiently delayed by over 3 degrees angle of attack. To further improve the quality of the flow state estimate, the implementation of a Kalman filter is foreseen, in which the knowledge of the flow dynamics is added to the computation of the control variable to correct for the potential measurement errors. To this aim, a reduced-order model (ROM) of the flow is developed using the least-squares method to obtain the coefficients of the POD/Galerkin projection of the Navier-Stokes equations from experimental data. To build the training ensemble needed in this experimental procedure, the spectral mLSM is performed to generate time-resolved series of POD expansion coefficients from which temporal derivatives are computed. This technique, which is applied to independent PIV velocity snapshots and time-resolved surface measurements, is able to retrieve the rational temporal evolution of the flow physics in the entire 2-D measurement area. The quality of the spectral measurements is confirmed by the results from both the linear and quadratic dynamical systems. The preliminary results from the linear ROM strengthens the motivation for future control implementation of a linear Kalman filter in this flow.

Velocity-Resolved LES (VR-LES) technique for simulating turbulent transport of high Schmidt number passive scalars

NASA Astrophysics Data System (ADS)

Verma, Siddhartha; Blanquart, Guillaume; P. K. Yeung Collaboration

2011-11-01

Accurate simulation of high Schmidt number scalar transport in turbulent flows is essential to studying pollutant dispersion, weather, and several oceanic phenomena. Batchelor's theory governs scalar transport in such flows, but requires further validation at high Schmidt and high Reynolds numbers. To this end, we use a new approach with the velocity field fully resolved, but the scalar field only partially resolved. The grid used is fine enough to resolve scales up to the viscous-convective subrange where the decaying slope of the scalar spectrum becomes constant. This places the cutoff wavenumber between the Kolmogorov scale and the Batchelor scale. The subgrid scale terms, which affect transport at the supergrid scales, are modeled under the assumption that velocity fluctuations are negligible beyond this cutoff wavenumber. To ascertain the validity of this technique, we performed a-priori testing on existing DNS data. This Velocity-Resolved LES (VR-LES) technique significantly reduces the computational cost of turbulent simulations of high Schmidt number scalars, and yet provides valuable information of the scalar spectrum in the viscous-convective subrange.

Transient well flow in vertically heterogeneous aquifers

NASA Astrophysics Data System (ADS)

Hemker, C. J.

1999-11-01

A solution for the general problem of computing well flow in vertically heterogeneous aquifers is found by an integration of both analytical and numerical techniques. The radial component of flow is treated analytically; the drawdown is a continuous function of the distance to the well. The finite-difference technique is used for the vertical flow component only. The aquifer is discretized in the vertical dimension and the heterogeneous aquifer is considered to be a layered (stratified) formation with a finite number of homogeneous sublayers, where each sublayer may have different properties. The transient part of the differential equation is solved with Stehfest's algorithm, a numerical inversion technique of the Laplace transform. The well is of constant discharge and penetrates one or more of the sublayers. The effect of wellbore storage on early drawdown data is taken into account. In this way drawdowns are found for a finite number of sublayers as a continuous function of radial distance to the well and of time since the pumping started. The model is verified by comparing results with published analytical and numerical solutions for well flow in homogeneous and heterogeneous, confined and unconfined aquifers. Instantaneous and delayed drainage of water from above the water table are considered, combined with the effects of partially penetrating and finite-diameter wells. The model is applied to demonstrate that the transient effects of wellbore storage in unconfined aquifers are less pronounced than previous numerical experiments suggest. Other applications of the presented solution technique are given for partially penetrating wells in heterogeneous formations, including a demonstration of the effect of decreasing specific storage values with depth in an otherwise homogeneous aquifer. The presented solution can be a powerful tool for the analysis of drawdown from pumping tests, because hydraulic properties of layered heterogeneous aquifer systems with partially penetrating wells may be estimated without the need to construct transient numerical models. A computer program based on the hybrid analytical-numerical technique is available from the author.

Pre-steady-state kinetic analysis of the three Escherichia coli pseudouridine synthases TruB, TruA, and RluA reveals uniformly slow catalysis

PubMed Central

Wright, Jaden R.; Keffer-Wilkes, Laura C.; Dobing, Selina R.; Kothe, Ute

2011-01-01

Pseudouridine synthases catalyze formation of the most abundant modification of functional RNAs by site-specifically isomerizing uridines to pseudouridines. While the structure and substrate specificity of these enzymes have been studied in detail, the kinetic and the catalytic mechanism of pseudouridine synthases remain unknown. Here, the first pre-steady-state kinetic analysis of three Escherichia coli pseudouridine synthases is presented. A novel stopped-flow absorbance assay revealed that substrate tRNA binding by TruB takes place in two steps with an overall rate of 6 sec−1. In order to observe catalysis of pseudouridine formation directly, the traditional tritium release assay was adapted for the quench-flow technique, allowing, for the first time, observation of a single round of pseudouridine formation. Thereby, the single-round rate constant of pseudouridylation (kΨ) by TruB was determined to be 0.5 sec−1. This rate constant is similar to the kcat obtained under multiple-turnover conditions in steady-state experiments, indicating that catalysis is the rate-limiting step for TruB. In order to investigate if pseudouridine synthases are characterized by slow catalysis in general, the rapid kinetic quench-flow analysis was also performed with two other E. coli enzymes, RluA and TruA, which displayed rate constants of pseudouridine formation of 0.7 and 0.35 sec−1, respectively. Hence, uniformly slow catalysis might be a general feature of pseudouridine synthases that share a conserved catalytic domain and supposedly use the same catalytic mechanism. PMID:21998096

Exact solution for heat transfer free convection flow of Maxwell nanofluids with graphene nanoparticles

NASA Astrophysics Data System (ADS)

Aman, Sidra; Zuki Salleh, Mohd; Ismail, Zulkhibri; Khan, Ilyas

2017-09-01

This article focuses on the flow of Maxwell nanofluids with graphene nanoparticles over a vertical plate (static) with constant wall temperature. Possessing high thermal conductivity, engine oil is useful to be chosen as base fluid with free convection. The problem is modelled in terms of PDE’s with boundary conditions. Some suitable non-dimensional variables are interposed to transform the governing equations into dimensionless form. The generated equations are solved via Laplace transform technique. Exact solutions are evaluated for velocity and temperature. These solutions are significantly controlled by some parameters involved. Temperature rises with elevation in volume fraction while Velocity decreases with increment in volume fraction. A comparison with previous published results are established and discussed. Moreover, a detailed discussion is made for influence of volume fraction on the flow and heat profile.

Measurement of myeloid maturation by flow cytochemistry in HL-60 leukemia: esterase is inducible, myeloperoxidase is not.

PubMed

Ross, D W

1986-05-01

The phenomenon of leukemic cell maturation requires a measurement of myeloid maturation to understand the process and to exploit it as a means of therapy for leukemia. The HL-60 leukemic cell line was used as a model of induced leukemic cell maturation in order to develop a method of quantitating granulocytic and monocytic maturation in response to drug therapy. An automated flow cytochemistry system (Hemalog-D) was employed to measure mean cell volume, myeloperoxidase (MPO), and nonspecific esterase (NSE). For granulocytic maturation induced by vitamin A or DMSO, MPO and cell volume decreased by 50%, maintaining a constant mean cellular MPO concentration throughout maturation from promyelocyte to neutrophil-like forms. For monocytic maturation induced by low-dose ARA-c, the mean NSE increased substantially, while cell volume remained constant. Unlike MPO concentration, NSE was truly inducible and thus a useful quantitative measure of maturation caused by low-dose ARA-c. Flow cytochemistry and cytofluorometry may be developed to allow for quantitative monitoring of therapeutic trials of induced maturation in human leukemias. However, this will require adapting these techniques to the complexity of human leukemias in vivo, and the necessity of handling heterogeneous populations encountered in bone marrow samples.

Modeling Hybridization Kinetics of Gene Probes in a DNA Biochip Using FEMLAB

PubMed Central

Munir, Ahsan; Waseem, Hassan; Williams, Maggie R.; Stedtfeld, Robert D.; Gulari, Erdogan; Tiedje, James M.; Hashsham, Syed A.

2017-01-01

Microfluidic DNA biochips capable of detecting specific DNA sequences are useful in medical diagnostics, drug discovery, food safety monitoring and agriculture. They are used as miniaturized platforms for analysis of nucleic acids-based biomarkers. Binding kinetics between immobilized single stranded DNA on the surface and its complementary strand present in the sample are of interest. To achieve optimal sensitivity with minimum sample size and rapid hybridization, ability to predict the kinetics of hybridization based on the thermodynamic characteristics of the probe is crucial. In this study, a computer aided numerical model for the design and optimization of a flow-through biochip was developed using a finite element technique packaged software tool (FEMLAB; package included in COMSOL Multiphysics) to simulate the transport of DNA through a microfluidic chamber to the reaction surface. The model accounts for fluid flow, convection and diffusion in the channel and on the reaction surface. Concentration, association rate constant, dissociation rate constant, recirculation flow rate, and temperature were key parameters affecting the rate of hybridization. The model predicted the kinetic profile and signal intensities of eighteen 20-mer probes targeting vancomycin resistance genes (VRGs). Predicted signal intensities and hybridization kinetics strongly correlated with experimental data in the biochip (R2 = 0.8131). PMID:28555058

Modeling Hybridization Kinetics of Gene Probes in a DNA Biochip Using FEMLAB.

PubMed

Munir, Ahsan; Waseem, Hassan; Williams, Maggie R; Stedtfeld, Robert D; Gulari, Erdogan; Tiedje, James M; Hashsham, Syed A

2017-05-29

Microfluidic DNA biochips capable of detecting specific DNA sequences are useful in medical diagnostics, drug discovery, food safety monitoring and agriculture. They are used as miniaturized platforms for analysis of nucleic acids-based biomarkers. Binding kinetics between immobilized single stranded DNA on the surface and its complementary strand present in the sample are of interest. To achieve optimal sensitivity with minimum sample size and rapid hybridization, ability to predict the kinetics of hybridization based on the thermodynamic characteristics of the probe is crucial. In this study, a computer aided numerical model for the design and optimization of a flow-through biochip was developed using a finite element technique packaged software tool (FEMLAB; package included in COMSOL Multiphysics) to simulate the transport of DNA through a microfluidic chamber to the reaction surface. The model accounts for fluid flow, convection and diffusion in the channel and on the reaction surface. Concentration, association rate constant, dissociation rate constant, recirculation flow rate, and temperature were key parameters affecting the rate of hybridization. The model predicted the kinetic profile and signal intensities of eighteen 20-mer probes targeting vancomycin resistance genes (VRGs). Predicted signal intensities and hybridization kinetics strongly correlated with experimental data in the biochip (R² = 0.8131).

Determination of Yield and Flow Surfaces for Inconel 718 Under Axial-Torsional Loading at Temperatures Up to 649 C

NASA Technical Reports Server (NTRS)

Gil, Christopher M.

1998-01-01

An experimental program to determine flow surfaces has been established and implemented for solution annealed and aged IN718. The procedure involved subjecting tubular specimens to various ratios of axial-torsional stress at temperatures between 23 and 649 C and measuring strain with a biaxial extensometer. Each stress probe corresponds to a different direction in stress space, and unloading occurs when a 30 microstrain (1 micro eplison = 10(exp -6) mm/mm) offset is detected. This technique was used to map out yield loci in axial-torsional stress space. Flow surfaces were determined by post-processing the experimental data to determine the inelastic strain rate components. Surfaces of constant inelastic strain rate (SCISRS) and surfaces of constant inelastic power (SCIPS) were mapped out in the axial-shear stress plane. The von Mises yield criterion appeared to closely fit the initial loci for solutioned IN718 at 23 C. However, the initial loci for solutioned IN718 at 371 and 454 C, and all of the initial loci for aged IN718 were offset in the compression direction. Subsequent loci showed translation, distortion, and for the case of solutioned IN718, a slight cross effect. Aged IN718 showed significantly more hardening behavior than solutioned IN718.

Finite difference model for aquifer simulation in two dimensions with results of numerical experiments

USGS Publications Warehouse

Trescott, Peter C.; Pinder, George Francis; Larson, S.P.

1976-01-01

The model will simulate ground-water flow in an artesian aquifer, a water-table aquifer, or a combined artesian and water-table aquifer. The aquifer may be heterogeneous and anisotropic and have irregular boundaries. The source term in the flow equation may include well discharge, constant recharge, leakage from confining beds in which the effects of storage are considered, and evapotranspiration as a linear function of depth to water. The theoretical development includes presentation of the appropriate flow equations and derivation of the finite-difference approximations (written for a variable grid). The documentation emphasizes the numerical techniques that can be used for solving the simultaneous equations and describes the results of numerical experiments using these techniques. Of the three numerical techniques available in the model, the strongly implicit procedure, in general, requires less computer time and has fewer numerical difficulties than do the iterative alternating direction implicit procedure and line successive overrelaxation (which includes a two-dimensional correction procedure to accelerate convergence). The documentation includes a flow chart, program listing, an example simulation, and sections on designing an aquifer model and requirements for data input. It illustrates how model results can be presented on the line printer and pen plotters with a program that utilizes the graphical display software available from the Geological Survey Computer Center Division. In addition the model includes options for reading input data from a disk and writing intermediate results on a disk.

Numerical Assessment of Four-Port Through-Flow Wave Rotor Cycles with Passage Height Variation

NASA Technical Reports Server (NTRS)

Paxson, D. E.; Lindau, Jules W.

1997-01-01

The potential for improved performance of wave rotor cycles through the use of passage height variation is examined. A Quasi-one-dimensional CFD code with experimentally validated loss models is used to determine the flowfield in the wave rotor passages. Results indicate that a carefully chosen passage height profile can produce substantial performance gains. Numerical performance data are presented for a specific profile, in a four-port, through-flow cycle design which yielded a computed 4.6% increase in design point pressure ratio over a comparably sized rotor with constant passage height. In a small gas turbine topping cycle application, this increased pressure ratio would reduce specific fuel consumption to 22% below the un-topped engine; a significant improvement over the already impressive 18% reductions predicted for the constant passage height rotor. The simulation code is briefly described. The method used to obtain rotor passage height profiles with enhanced performance is presented. Design and off-design results are shown using two different computational techniques. The paper concludes with some recommendations for further work.

Competitive adsorption/desorption of tetracycline, oxytetracycline and chlortetracycline on two acid soils: Stirred flow chamber experiments.

PubMed

Fernández-Calviño, David; Bermúdez-Couso, Alipio; Arias-Estévez, Manuel; Nóvoa-Muñoz, Juan Carlos; Fernández-Sanjurjo, Maria J; Álvarez-Rodríguez, Esperanza; Núñez-Delgado, Avelino

2015-09-01

The objective of this work was to study the competitive adsorption/desorption of tetracycline (TC), oxytetracycline (OTC) and chlortetracycline (CTC) on two acid soils. We used the stirred flow chamber technique to obtain experimental data on rapid kinetic processes affecting the retention/release of the antibiotics. Both adsorption and desorption were higher on soil 1 (which showed the highest carbon, clay and Al and Fe oxides content) than on soil 2. Moreover, hysteresis affected the adsorption/desorption processes. Experimental data were fitted to a pseudo-first order equation, resulting qamax (adsorption maximum) values that were higher for soil 1 than for soil 2, and indicating that CTC competed with TC more intensely than OTC in soil 1. Regarding soil 2, the values corresponding to the adsorption kinetics constants (ka) and desorption kinetics constants for fast sites (kd1), followed a trend inverse to qamax and qdmax respectively. In conclusion, competition affected adsorption/desorption kinetics for the three antibiotics assayed, and thus retention/release and subsequent transport processes in soil and water environments. Copyright © 2015 Elsevier Ltd. All rights reserved.

Non Lyapunov stability of a constant spatially developing 2-D gas flow

NASA Astrophysics Data System (ADS)

Balint, Agneta M.; Balint, Stefan; Tanasie, Loredana

2017-01-01

Different types of stabilities (global, local) and instabilities (global absolute, local convective) of the constant spatially developing 2-D gas flow are analyzed in a particular phase space of continuously differentiable functions, endowed with the usual algebraic operations and the topology generated by the uniform convergence on the plane. For this purpose the Euler equations linearized at the constant flow are used. The Lyapunov stability analysis was presented in [1] and this paper is a continuation of [1].

An experimental study of the elastic theory for granular flows

NASA Astrophysics Data System (ADS)

Guo, Tongtong; Campbell, Charles S.

2016-08-01

This paper reports annular shear cell measurements granular flows with an eye towards experimentally confirming the flow regimes laid out in the elastic theory of granular flow. Tests were carried out on four different kinds of plastic spherical particles under both constant volume flows and constant applied stress flows. In particular, observations were made of the new regime in that model, the elastic-inertial regime, and the predicted transitions between the elastic-inertial and both the elastic-quasistatic and pure inertial regimes.

Effect of jet-mainstream velocity ratio on flow characteristics and heat transfer enhancement of jet on flat plate flow

NASA Astrophysics Data System (ADS)

Puzu, N.; Prasertsan, S.; Nuntadusit, C.

2017-09-01

The aim of this research was to study the effect of jet-mainstream velocity ratio on flow and heat transfer characteristics of jet on flat plate flow. The jet from pipe nozzle with inner diameter of D=14 mm was injected perpendicularly to mainstream on flat plate. The flat plate was blown by mainstream with uniform velocity profile at 10 m/s. The velocity ratio (jet to mainstream velociy) was varied at VR=0.25 and 3.5 by adjusting velocity of jet flow. For heat transfer measurement, a thin foil technique was used to evaluate the heat transfer coefficient by measuring temperature distributions on heat transfer surface with constant heat flux by using infrared camera. Flow characteristics were simulated by using a computational fluid dynamics (CFD) with commercial software ANSYS Fluent (Ver.15.0). The results showed that the enhancement of heat transfer along downstream direction for the case of VR=0.25 was from the effect of jet stream whereas for the case of VR=3.5 was from the effect of mainstream.

Quantitative analysis of skin flap blood flow in the rat using laser Doppler velocimetry.

PubMed Central

Marks, N J

1985-01-01

Two experiments carried out on rat skin flaps are described, where microvascular flow has been measured noninvasively by a laser Doppler velocimeter. Using this technique it is possible to define the limits of an axial pattern flap in terms of microvascular flow; this was found to increase when the flap is elevated. 'Random-pattern' perfusion is defined by a fall in flow. This recovers sequentially along the flap, and at a constant rate at all sites. A differential in microvascular perfusion is thus maintained along a random-pattern flap for at least the first postoperative week. In a second experiment it is shown that there appears to be a linear relationship between the reduction in skin blood flow in a random-pattern flap and the distance from the base at which the measurements are made. It is suggested that these data support the view that the blood flow in a skin flap recovers primarily from its base rather than via peripheral neovascularization, and that this is due to vascular collaterals opening within the flap rather than to a relaxation of sympathetic tone. PMID:3156992

Optical and probe determination of soot concentrations in a model gas turbine combustor

NASA Technical Reports Server (NTRS)

Eckerle, W. A.; Rosfjord, T. J.

1986-01-01

An experimental program was conducted to track the variation in soot loading in a generic gas turbine combustor. The burner is a 12.7-cm dia cylindrical device consisting of six sheet-metal louvers. Determination of soot loading along the burner length is achieved by measurement at the exit of the combustor and then at upstream stations by sequential removal of liner louvers to shorten burner length. Alteration of the flow field approaching and within the shortened burners is minimized by bypassing flow in order to maintain a constant linear pressure drop. The burner exhaust flow is sampled at the burner centerline to determine soot mass concentration and smoke number. Characteristic particle size and number density, transmissivity of the exhaust flow, and local radiation from luminous soot particles in the exhaust are determined by optical techniques. Four test fuels are burned at three fuel-air ratios to determine fuel chemical property and flow temperature influences. Particulate concentration data indicate a strong oxidation mechanism in the combustor secondary zone, though the oxidation is significantly affected by flow temperature. Soot production is directly related to fuel smoke point.

Calculation procedure for transient heat transfer to a cooled plate in a heated stream whose temperature varies arbitrarily with time. [turbine blades

NASA Technical Reports Server (NTRS)

Sucec, J.

1975-01-01

Solutions for the surface temperature and surface heat flux are found for laminar, constant property, slug flow over a plate convectively cooled from below, when the temperature of the fluid over the plate varies arbitrarily with time at the plate leading edge. A simple technique is presented for handling arbitrary fluid temperature variation with time by approximating it by a sequence of ramps or steps for which exact analytical solutions are available.

Direct numerical simulation of the flow around an aerofoil in ramp-up motion

NASA Astrophysics Data System (ADS)

Rosti, Marco E.; Omidyeganeh, Mohammad; Pinelli, Alfredo

2016-02-01

A detailed analysis of the flow around a NACA0020 aerofoil at Rec = 2 × 104 undergoing a ramp up motion has been carried out by means of direct numerical simulations. During the manoeuvre, the angle of attack is linearly varied in time between 0° and 20° with a constant rate of change of α ˙ rad = 0 . 12 U ∞ / c . When the angle of incidence has reached the final value, the lift experiences a first overshoot and then suddenly decreases towards the static stall asymptotic value. The transient instantaneous flow is dominated by the generation and detachment of the dynamic stall vortex, a large scale structure formed by the merging of smaller scales vortices generated by an instability originating at the trailing edge. New insights on the vorticity dynamics leading to the lift overshoot, lift crisis, and the damped oscillatory cycle that gradually matches the steady condition are discussed using a number of post-processing techniques. These include a detailed analysis of the flow ensemble average statistics and coherent structures identification carried out using the Q -criterion and the finite-time Lyapunov exponent technique. The results are compared with the one obtained in a companion simulation considering a static stall condition at the final angle of incidence α = 20°.

Quantitative flow visualization applied to wake flow studies

NASA Astrophysics Data System (ADS)

Rukweza, Godfrey

An experimental study of the flow past stationary cylinders of circular, triangular and rectangular cross-section in cross-flow has been made using three different techniques. These are hot-film anemometry, smoke-wire flow visualization, and particle image velocimetry. The point measurement technique of constant temperature hot-film anemometry was used to confirm the findings of earlier investigations on the performance of cylinders with rectangular and triangular cross-sections. The thesis presents distributions of the mean streamwise velocity, fluctuation levels and spectra in the Reynolds number range 200 < Re[D] < 2.2 x 10[4]. Variations of the vortex shedding frequency with Reynolds number within the near-wake region are shown and related to the flow patterns obtained using the technique of smoke-wire flow visualisation. Finally, PIV was applied in a water channel to determine wake flow properties created by a circular cylinder at three Reynolds numbers of 200, 300 and 2.2 x 10[4]. For the PIV investigation, a technique was developed which enables a continuous wave laser beam to be pulsed using a Bragg cell : this system can be used to produce pulses of light which are separated by a specified time interval which is typically in the range 10[-4] to 10[-2] s. This was successfully used in the implementation of PIV in the highest Reynolds number conditions for which standard video frame rates of 25 fps are inadequate. In this relatively high speed flow, a novel technique was also developed for sampling the image data of seeding particles at a fixed phase. This enabled the phase-averaging of data derived by analysis of PIV system output with a good degree of success. Analysis of the flow image data was then performed using a customized PIV software package developed in the Department, in conjunction with a special purpose software package QFV. Results are presented for both the instantaneous and the phase-averaged distributions of velocity, vorticity, and shear in the near-wake of a stationary, circular-section cylinder in cross-flow, the phase-averaging being applied only to the two low Reynolds number flows because hardware limitations precluded phase sampling at the highest Reynolds number. These results reveal the time evolution of the flow in the near-wake region and also permit estimates to be made of the vortex convection velocities in the near-wake flow field. The experimental results are in close agreement with those previously published in the literature, including those obtained using a variety of different techniques. Qualitative consideration is given to the general experimental errors which are encountered in PIV and the limitations on accuracy of PIV implementation in wake flow are reviewed. The overall outcome of the investigation is seen to be a better and systematic understanding of the flow in the near-wake of a cylinder in cross-flow. This improved understanding is coupled with a wealth of detailed data which shows how the large scale motion is superimposed on the wake flow region.

Lattice Boltzmann simulations of heat transfer in fully developed periodic incompressible flows

NASA Astrophysics Data System (ADS)

Wang, Zimeng; Shang, Helen; Zhang, Junfeng

2017-06-01

Flow and heat transfer in periodic structures are of great interest for many applications. In this paper, we carefully examine the periodic features of fully developed periodic incompressible thermal flows, and incorporate them in the lattice Boltzmann method (LBM) for flow and heat transfer simulations. Two numerical approaches, the distribution modification (DM) approach and the source term (ST) approach, are proposed; and they can both be used for periodic thermal flows with constant wall temperature (CWT) and surface heat flux boundary conditions. However, the DM approach might be more efficient, especially for CWT systems since the ST approach requires calculations of the streamwise temperature gradient at all lattice nodes. Several example simulations are conducted, including flows through flat and wavy channels and flows through a square array with circular cylinders. Results are compared to analytical solutions, previous studies, and our own LBM calculations using different simulation techniques (i.e., the one-module simulation vs. the two-module simulation, and the DM approach vs. the ST approach) with good agreement. These simple, however, representative simulations demonstrate the accuracy and usefulness of our proposed LBM methods for future thermal periodic flow simulations.

Retinal blood flow during hyperoxia in humans revisited: concerted results using different measurement techniques.

PubMed

Kiss, Barbara; Polska, Elzbieta; Dorner, Guido; Polak, Kaija; Findl, Oliver; Mayrl, Gabriele Fuchsjäger; Eichler, Hans-Georg; Wolzt, Michael; Schmetterer, Leopold

2002-07-01

Retinal vasculature shows pronounced vasoconstriction in response to hyperoxia, which appears to be related to the constant oxygen demand of the retina. However, the exact amount of blood flow reduction and the exact time course of this phenomenon are still a matter of debate. We set out to investigate the retinal response to hyperoxia using innovative techniques for the assessment of retinal hemodynamics. In a total of 48 healthy volunteers we studied the effect of 100% O(2) breathing on retinal blood flow using two methods. Red blood cell movement in larger retinal veins was quantified with combined laser Doppler velocimetry and retinal vessel size measurement. Retinal white blood cell movement was quantified with the blue field entoptic technique. The time course of retinal vasoconstriction in response to hyperoxia was assessed by continuous vessel size determination using the Zeiss retinal vessel analyzer. The response to hyperoxia as measured with combined laser Doppler velocimetry and vessel size measurement was almost twice as high as that observed with the blue field technique. Vasoconstriction in response to 100% O(2) breathing occurred within the first 5 min and no counterregulatory or adaptive mechanisms were observed. Based on these results we hypothesize that hyperoxia-induced vasoconstriction differentially affects red and white blood cell movement in the human retina. This hypothesis is based on the complex interactions between red and white blood cells in microcirculation, which have been described in detail for other vascular beds.

40 CFR 91.421 - Dilute gaseous exhaust sampling and analytical system description.

Code of Federal Regulations, 2014 CFR

2014-07-01

... Pump—Constant Volume Sampler (PDP-CVS) system with a heat exchanger, or a Critical Flow Venturi—Constant Volume Sampler (CFV-CVS) system with CVS sample probes and/or a heat exchanger or electronic flow... sampling point. (ii) For the CFV-CVS, either a heat exchanger or electronic flow compensation is required...

40 CFR 91.421 - Dilute gaseous exhaust sampling and analytical system description.

Code of Federal Regulations, 2012 CFR

2012-07-01

... Pump—Constant Volume Sampler (PDP-CVS) system with a heat exchanger, or a Critical Flow Venturi—Constant Volume Sampler (CFV-CVS) system with CVS sample probes and/or a heat exchanger or electronic flow... sampling point. (ii) For the CFV-CVS, either a heat exchanger or electronic flow compensation is required...

40 CFR 91.421 - Dilute gaseous exhaust sampling and analytical system description.

Code of Federal Regulations, 2013 CFR

2013-07-01

... Pump—Constant Volume Sampler (PDP-CVS) system with a heat exchanger, or a Critical Flow Venturi—Constant Volume Sampler (CFV-CVS) system with CVS sample probes and/or a heat exchanger or electronic flow... sampling point. (ii) For the CFV-CVS, either a heat exchanger or electronic flow compensation is required...

Micromachined lab-on-a-tube sensors for simultaneous brain temperature and cerebral blood flow measurements.

PubMed

Li, Chunyan; Wu, Pei-Ming; Hartings, Jed A; Wu, Zhizhen; Cheyuo, Cletus; Wang, Ping; LeDoux, David; Shutter, Lori A; Ramaswamy, Bharat Ram; Ahn, Chong H; Narayan, Raj K

2012-08-01

This work describes the development of a micromachined lab-on-a-tube device for simultaneous measurement of brain temperature and regional cerebral blood flow. The device consists of two micromachined gold resistance temperature detectors with a 4-wire configuration. One is used as a temperature sensor and the other as a flow sensor. The temperature sensor operates with AC excitation current of 500 μA and updates its outputs at a rate of 5 Hz. The flow sensor employs a periodic heating and cooling technique under constant-temperature mode and updates its outputs at a rate of 0.1 Hz. The temperature sensor is also used to compensate for temperature changes during the heating period of the flow sensor to improve the accuracy of flow measurements. To prevent thermal and electronic crosstalk between the sensors, the temperature sensor is located outside the "thermal influence" region of the flow sensor and the sensors are separated into two different layers with a thin-film Copper shield. We evaluated the sensors for accuracy, crosstalk and long-term drift in human blood-stained cerebrospinal fluid. These in vitro experiments showed that simultaneous temperature and flow measurements with a single lab-on-a-tube device are accurate and reliable over the course of 5 days. It has a resolution of 0.013 °C and 0.18 ml/100 g/min; and achieves an accuracy of 0.1 °C and 5 ml/100 g/min for temperature and flow sensors respectively. The prototype device and techniques developed here establish a foundation for a multi-sensor lab-on-a-tube, enabling versatile multimodality monitoring applications.

Experimental study of laminar forced convective heat transfer of deionized water based copper (I) oxide nanofluids in a tube with constant wall heat flux

NASA Astrophysics Data System (ADS)

Umer, Asim; Naveed, Shahid; Ramzan, Naveed

2016-10-01

Nanofluids, having 1-100 nm size particles in any base fluid are promising fluid for heat transfer intensification due to their enhanced thermal conductivity as compared with the base fluid. The forced convection of nanofluids is the major practical application in heat transfer equipments. In this study, heat transfer enhancements at constant wall heat flux under laminar flow conditions were investigated. Nanofluids of different volume fractions (1, 2 and 4 %) of copper (I) oxide nanoparticles in deionized water were prepared using two step technique under mechanical mixing and ultrasonication. The results were investigated by increasing the Reynolds number of the nanofluids at constant heat flux. The trends of Nusselt number variation with dimensionless length (X/D) and Reynolds numbers were studied. It was observed that heat transfer coefficient increases with increases particles volume concentration and Reynolds number. The maximum enhancement in heat transfer coefficient of 61 % was observed with 4 % particle volume concentration at Reynolds number (Re ~ 605).

Capillary pressure curves for low permeability chalk obtained by NMR imaging of core saturation profiles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Norgaard, J.V.; Olsen, D.; Springer, N.

1995-12-31

A new technique for obtaining water-oil capillary pressure curves, based on NMR imaging of the saturation distribution in flooded cores is presented. In this technique, a steady state fluid saturation profile is developed by flooding the core at a constant flow rate. At the steady state situation where the saturation distribution no longer changes, the local pressure difference between the wetting and non-wetting phases represents the capillary pressure. The saturation profile is measured using an NMR technique and for a drainage case, the pressure in the non-wetting phase is calculated numerically. The paper presents the NMR technique and the proceduremore » for calculating the pressure distribution in the sample. Inhomogeneous samples produce irregular saturation profiles, which may be interpreted in terms of variation in permeability, porosity, and capillary pressure. Capillary pressure curves for North Sea chalk obtained by the new technique show good agreement with capillary pressure curves obtained by traditional techniques.« less

Stochastic-field cavitation model

NASA Astrophysics Data System (ADS)

Dumond, J.; Magagnato, F.; Class, A.

2013-07-01

Nonlinear phenomena can often be well described using probability density functions (pdf) and pdf transport models. Traditionally, the simulation of pdf transport requires Monte-Carlo codes based on Lagrangian "particles" or prescribed pdf assumptions including binning techniques. Recently, in the field of combustion, a novel formulation called the stochastic-field method solving pdf transport based on Eulerian fields has been proposed which eliminates the necessity to mix Eulerian and Lagrangian techniques or prescribed pdf assumptions. In the present work, for the first time the stochastic-field method is applied to multi-phase flow and, in particular, to cavitating flow. To validate the proposed stochastic-field cavitation model, two applications are considered. First, sheet cavitation is simulated in a Venturi-type nozzle. The second application is an innovative fluidic diode which exhibits coolant flashing. Agreement with experimental results is obtained for both applications with a fixed set of model constants. The stochastic-field cavitation model captures the wide range of pdf shapes present at different locations.

A cavitation model based on Eulerian stochastic fields

NASA Astrophysics Data System (ADS)

Magagnato, F.; Dumond, J.

2013-12-01

Non-linear phenomena can often be described using probability density functions (pdf) and pdf transport models. Traditionally the simulation of pdf transport requires Monte-Carlo codes based on Lagrangian "particles" or prescribed pdf assumptions including binning techniques. Recently, in the field of combustion, a novel formulation called the stochastic-field method solving pdf transport based on Eulerian fields has been proposed which eliminates the necessity to mix Eulerian and Lagrangian techniques or prescribed pdf assumptions. In the present work, for the first time the stochastic-field method is applied to multi-phase flow and in particular to cavitating flow. To validate the proposed stochastic-field cavitation model, two applications are considered. Firstly, sheet cavitation is simulated in a Venturi-type nozzle. The second application is an innovative fluidic diode which exhibits coolant flashing. Agreement with experimental results is obtained for both applications with a fixed set of model constants. The stochastic-field cavitation model captures the wide range of pdf shapes present at different locations.

Combined two-dimensional velocity and temperature measurements of natural convection using a high-speed camera and temperature-sensitive particles

NASA Astrophysics Data System (ADS)

Someya, Satoshi; Li, Yanrong; Ishii, Keiko; Okamoto, Koji

2011-01-01

This paper proposes a combined method for two-dimensional temperature and velocity measurements in liquid and gas flows using temperature-sensitive particles (TSPs), a pulsed ultraviolet laser, and a high-speed camera. TSPs respond to temperature changes in the flow and can also serve as tracers for the velocity field. The luminescence from the TSPs was recorded at 15,000 frames per second as sequential images for a lifetime-based temperature analysis. These images were also used for the particle image velocimetry calculations. The temperature field was estimated using several images, based on the lifetime method. The decay curves for various temperature conditions fit well to exponential functions, and from these the decay constants at each temperature were obtained. The proposed technique was applied to measure the temperature and velocity fields in natural convection driven by a Marangoni force and buoyancy in a rectangular tank. The accuracy of the temperature measurement of the proposed technique was ±0.35-0.40°C.

Through thick and thin: a microfluidic approach for continuous measurements of biofilm viscosity and the effect of ionic strength.

PubMed

Paquet-Mercier, F; Parvinzadeh Gashti, M; Bellavance, J; Taghavi, S M; Greener, J

2016-11-29

Continuous, non-intrusive measurements of time-varying viscosity of Pseudomonas sp. biofilms are made using a microfluidic method that combines video tracking with a semi-empirical viscous flow model. The approach uses measured velocity and height of tracked biofilm segments, which move under the constant laminar flow of a nutrient solution. Following a low viscosity growth stage, rapid thickening was observed. During this stage, viscosity increased by over an order of magnitude in less than ten hours. The technique was also demonstrated as a promising platform for parallel experiments by subjecting multiple biofilm-laden microchannels to nutrient solutions containing NaCl in the range of 0 to 34 mM. Preliminary data suggest a strong relationship between ionic strength and biofilm properties, such as average viscosity and rapid thickening onset time. The technique opens the way for a combinatorial approach to study the response of biofilm viscosity under well-controlled physical, chemical and biological growth conditions.

Stochastic-field cavitation model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dumond, J., E-mail: julien.dumond@areva.com; AREVA GmbH, Erlangen, Paul-Gossen-Strasse 100, D-91052 Erlangen; Magagnato, F.

2013-07-15

Nonlinear phenomena can often be well described using probability density functions (pdf) and pdf transport models. Traditionally, the simulation of pdf transport requires Monte-Carlo codes based on Lagrangian “particles” or prescribed pdf assumptions including binning techniques. Recently, in the field of combustion, a novel formulation called the stochastic-field method solving pdf transport based on Eulerian fields has been proposed which eliminates the necessity to mix Eulerian and Lagrangian techniques or prescribed pdf assumptions. In the present work, for the first time the stochastic-field method is applied to multi-phase flow and, in particular, to cavitating flow. To validate the proposed stochastic-fieldmore » cavitation model, two applications are considered. First, sheet cavitation is simulated in a Venturi-type nozzle. The second application is an innovative fluidic diode which exhibits coolant flashing. Agreement with experimental results is obtained for both applications with a fixed set of model constants. The stochastic-field cavitation model captures the wide range of pdf shapes present at different locations.« less

Effect of pressure on secondary structure of proteins under ultra high pressure liquid chromatographic conditions.

PubMed

Makarov, Alexey; LoBrutto, Rosario; Karpinski, Paul

2013-11-29

There are several spectroscopic techniques such as IR and CD, that allow for analyzing protein secondary structure in solution. However, a majority of these techniques require using purified protein, concentrated enough in the solution, to produce a relevant spectrum. Fundamental principles for the usage of reversed-phase ultra high pressure liquid chromatography (UHPLC) as an alternative technique to study protein secondary structures in solution were investigated. Several "model" proteins, as well as several small ionizable and neutral molecules, were used for these studies. The studies were conducted with UHPLC in isocratic mode, using premixed mobile phases at constant flow rate and temperature. The pressure was modified by a backpressure regulator from about 6000psi to about 12,000psi. It was found that when using a mobile phase composition at which proteins were fully denatured (loss of alpha-helix secondary structure), the retention factors of the proteins increased upon pressure increase in the same manner as non-proteins. When using a mobile phase composition in which proteins were not fully denatured, it was observed that the retention factors of the proteins displayed a much steeper (by one order of magnitude) increase in retention upon pressure increase. It was concluded that in a mobile phase in which the protein is not initially fully denatured, the increase of pressure may facilitate the folding back of the protein to its native state (alpha-helix secondary structure). The impact of different mobile phase compositions on the denaturation of the proteins was studied using CD (Circular Dichroism). Moreover, the effect of flow rate on retention of proteins and small molecules was studied at constant pressure on the different pore size silicas and the impact of internal frictional heating was evaluated. Copyright © 2013 Elsevier B.V. All rights reserved.

Microplastic bases for constitutive characterization of aluminum alloys and their correlation to sheet formability

NASA Astrophysics Data System (ADS)

Diak, Bradley James

Forming limit predictions that incorporate crystal plasticity models still cannot adequately predict the deformation performance of polycrystalline materials. The reason for the limitation in predictive power is that the constitutive equations used to connect to the atomic scale assume an affine deformation which do not have a physical basis, but give general trends. This study was undertaken to better elucidate the microplastic process and how it manifests itself phenomenologically. In this endeavour, the strain rate sensitivity of the flow stress was identified as one parameter that greatly affects the forming limit. Hence, an attempt was made to properly define and measure the strain rate sensitivity according to the dictates of thermodynamics. The thermodynamics of systems can delineate the evolution of the state of a material if the state variables can be characterized and measured. Inevitably, these variables must be determined at constant structure. Using the theory of thermally activated flow, where the movement of dislocations past obstacles is the rate controlling step, the mechanical testing techniques have been designed to statistically assess the dynamic evolution of the microstructure by controlling the temperature, T, and strain rate, dotvarepsilon, and measuring the stress, sigma, mean slip distance, lambda, and mean slip velocity, dotlambda, to define sigma=f(lambda,dotlambda, T). The apparent activation volume, which characterizes the obstacle resistance of strain centres, is determined at constant structure by applying the strain rate change technique. Strain rate sensitivity data are compared to the Cottrell-Stokes relation, and the Haasen plot is used to separate the different contributions to the flow stress. Using these precise measurements at interrupted segments of strain, the evolution of a microstructure during plastic flow can be monitored. By this examination of different rate controlling obstacles, the microstructural parameters which correlate to formability were assessed. Detailed experimental evidence is given for different aluminum alloys containing mainly fast or slow diffusing solute species, transition precipitates, dispersed particles, and/or dislocation debris. These systems of Al-Fe, Al-Cr, Al-Cu, Al-Mg, and Al-Mg-Si, all displayed unique dislocation-defect interactions which could be elucidated by the current theory of thermally activated flow.

In microfluidico: Recreating in vivo hemodynamics using miniaturized devices

PubMed Central

Zhu, Shu; Herbig, Bradley A.; Li, Ruizhi; Colace, Thomas V.; Muthard, Ryan W.; Neeves, Keith B.; Diamond, Scott L.

2016-01-01

Microfluidic devices create precisely controlled reactive blood flows and typically involve: (i) validated anticoagulation/pharmacology protocols, (ii) defined reactive surfaces, (iii) defined flow-transport regimes, and (iv) optical imaging. An 8-channel device can be run at constant flow rate or constant pressure drop for blood perfusion over a patterned collagen, collagen/kaolin, or collagen/tissue factor (TF) to measure platelet, thrombin, and fibrin dynamics during clot growth. A membrane-flow device delivers a constant flux of platelet agonists or coagulation enzymes into flowing blood. A trifurcated device sheaths a central blood flow on both sides with buffer, an ideal approach for on-chip recalcification of citrated blood or drug delivery. A side-view device allows clotting on a porous collagen/TF plug at constant pressure differential across the developing clot. The core-shell architecture of clots made in mouse models can be replicated in this device using human blood. For pathological flows, a stenosis device achieves shear rates of >100,000 s−1 to drive plasma von Willebrand factor (VWF) to form thick long fibers on collagen. Similarly, a micropost-impingement device creates extreme elongational and shear flows for VWF fiber formation without collagen. Overall, microfluidics are ideal for studies of clotting, bleeding, fibrin polymerization/fibrinolysis, cell/clot mechanics, adhesion, mechanobiology, and reaction-transport dynamics. PMID:26600269

Experimental Investigation on the Resonance of a Liquid Column in a Capillary Tube.

PubMed

Hilpert; Miller

1999-11-01

Using a visualization technique, we observed the resonance of a water column trapped in a vertically oriented capillary tube due to acoustic excitation. The analysis of the quasi-static response suggests that the upper nonvisible meniscus followed the imposed flow by means of a sliding contact line without changing its shape. We compared the experiments with a previously developed theoretical model that addresses dissipation by assuming an axially symmetric and incompressible flow field that is spatially constant along the tube axis. Whereas the model agrees well with the measured quasi-static response, the deviations in the dynamic response reveal shortcomings of the model due to the simplified treatment of the viscous dissipation. Copyright 1999 Academic Press.

Osmotic contribution to the flow-driven tube formation of copper-phosphate and copper-silicate chemical gardens.

PubMed

Rauscher, Evelin; Schuszter, Gábor; Bohner, Bíborka; Tóth, Ágota; Horváth, Dezső

2018-02-21

We have produced hollow copper-containing precipitate tubes using a flow-injection technique, and characterized their linear and volume growth. It is shown that the ratio of the volume increase rate to that of pumping is constant independent of the chemical composition. It is also found that osmosis significantly contributes to the tube growth, since the inward flux of chemical species dominates during the precipitate pattern formation. The asymmetric hydrodynamic field coupled with the inherent concentration and pH gradients results in different particle morphology on the two sides of the precipitate membrane. While the tubes have a smooth outer surface, the inner walls are covered with nanoflowers for copper phosphate and with nanoballs for copper silicate.

Non Lyapunov stability of the constant spatially developing 1-D gas flow in presence of solutions having strictly positive exponential growth rate

NASA Astrophysics Data System (ADS)

Balint, Stefan; Balint, Agneta M.

2017-01-01

Different types of stabilities (global, local) and instabilities (global absolute, local convective) of the constant spatially developing 1-D gas flow are analyzed in the phase space of continuously differentiable functions, endowed with the usual algebraic operations and the topology generated by the uniform convergence on the real axis. For this purpose the Euler equations linearized at the constant flow are used. The Lyapunov stability analysis was presented in [1] and this paper is a continuation of [1].

Effect of Red Blood Cell Storage on Cardiac Performance. Improved Myocardial Oxygen Delivery and Function during Constant Flow Coronary Perfusion with Low Oxy-Hemoglobin Affinity Human Red Blood Cells in Normothermic and Hypothermic Rabbit Hearts.

DTIC Science & Technology

1983-02-01

with an isovolumic left ven- tricular balloon. Coronary flow was held constant to simulate the physiolog of coronary atherosclerosis and other...erythrocyte DPG content can potentially benefit patients with coronary atherosclerosis , or other states with a limited coronary vasodilator reserve, who...Coronary flow was held constant to simulate the physiology of coronary atherosclerosis and other conditions of limited coronary vasodilator reserve

Chemical preconcentrator with integral thermal flow sensor

DOEpatents

Manginell, Ronald P.; Frye-Mason, Gregory C.

2003-01-01

A chemical preconcentrator with integral thermal flow sensor can be used to accurately measure fluid flow rate in a microanalytical system. The thermal flow sensor can be operated in either constant temperature or constant power mode and variants thereof. The chemical preconcentrator with integral thermal flow sensor can be fabricated with the same MEMS technology as the rest of the microanlaytical system. Because of its low heat capacity, low-loss, and small size, the chemical preconcentrator with integral thermal flow sensor is fast and efficient enough to be used in battery-powered, portable microanalytical systems.

Graphical method for determining the coefficient of consolidation cv from a flow-pump permeability test

USGS Publications Warehouse

Morin, Roger H.; Olsen, Harold W.; Nelson, Karl R.; Gill, James D.

1989-01-01

A graphical method has been developed for determining the coefficient of consolidation from the transient phases of a flow-pump permeability test. The flow pump can be used to infuse fluid into or withdraw fluid from a laboratory sediment specimen at a constant volumetric rate in order to obtain data that can be used to calculate permeability using Darcy's law. Representative type-curve solutions to the associated forced-flow and pressure-decay models are derived. These curves provide the basis for graphically evaluating the permeability k, the coefficient of consolidation cv, and the coefficient of volume change mv. The curve-matching technique is easy and rapid. Values of k, cv and mv for a laterally confined kaolinite specimen were determined by this graphical method and appear to be in reasonably good agreement with numerically derived estimates (within 20%). Discrepancies between the two sets of results seem to be largely a function of data quality.

Unconfined laminar nanofluid flow and heat transfer around a rotating circular cylinder in the steady regime

NASA Astrophysics Data System (ADS)

Bouakkaz, Rafik; Salhi, Fouzi; Khelili, Yacine; Quazzazi, Mohamed; Talbi, Kamel

2017-06-01

In this work, steady flow-field and heat transfer through a copper- water nanofluid around a rotating circular cylinder with a constant nondimensional rotation rate α varying from 0 to 5 was investigated for Reynolds numbers of 5-40. Furthermore, the range of nanoparticle volume fractions considered is 0-5%. The effect of volume fraction of nanoparticles on the fluid flow and heat transfer characteristics are carried out by using a finite-volume method based commercial computational fluid dynamics solver. The variation of the local and the average Nusselt numbers with Reynolds number, volume fractions, and rotation rate are presented for the range of conditions. The average Nusselt number is found to decrease with increasing value of the rotation rate for the fixed value of the Reynolds number and volume fraction of nanoparticles. In addition, rotation can be used as a drag reduction technique.

Unsteady free convection flow past a semi-infinite vertical plate with constant heat flux in water based nanofluids

NASA Astrophysics Data System (ADS)

Narahari, Marneni

2018-04-01

The unsteady free convective flow of nanofluids past a semi-infinite vertical plate with uniform heat flux has been investigated numerically. An implicit finite difference technique of Crank-Nicolson scheme has been employed to solve the governing partial differential equations. Five different types of water based nanofluids containing Cu, Ag, Al2O3, CuO and TiO2 nanoparticles are considered to study the fluid flow characteristics with various time and solid volume fraction parameters. It is found that the local as well as the average Nusselt number for nanofluids is higher than the pure fluid (water). The local skin-friction is higher for pure fluid as compared to the nanofluids. The present numerical results obtained for local Nusselt number are validated with the previously published correlation results for a limiting case and it is found that the results are in good agreement.

Design, Validation, and Testing of a Hot-Film Anemometer for Hypersonic Flow

NASA Astrophysics Data System (ADS)

Sheplak, Mark

The application of constant-temperature hot-film anemometry to hypersonic flow has been reviewed and extended in this thesis. The objective of this investigation was to develop a measurement tool capable of yielding continuous, high-bandwidth, quantitative, normal mass-flux and total -temperature measurements in moderate-enthalpy environments. This research has produced a probe design that represents a significant advancement over existing designs, offering the following improvements: (1) a five-fold increase in bandwidth; (2) true stagnation-line sensor placement; (3) a two order-of-magnitude decrease in sensor volume; and (4) over a 70% increase in maximum film temperature. These improvements were achieved through substrate design, sensor placement, the use of high-temperature materials, and state -of-the-art microphotolithographic fabrication techniques. The experimental study to characterize the probe was performed in four different hypersonic wind tunnels at NASA-Langley Research Center. The initial test consisted of traversing the hot film through a Mach 6, flat-plate, turbulent boundary layer in air. The detailed static-calibration measurements that followed were performed in two different hypersonic flows: a Mach 11 helium flow and Mach 6 air flow. The final test of this thesis consisted of traversing the probe through the Mach 6 wake of a 70^ circ blunt body. The goal of this test was to determine the state (i.e., laminar or turbulent) of the wake. These studies indicate that substrate conduction effects result in instrumentation characteristics that prevent the hot-film anemometer from being used as a quantitative tool. The extension of this technique to providing quantitative information is dependent upon the development of lower thermal-conductivity substrate materials. However, the probe durability, absence of strain gauging, and high bandwidth represent significant improvements over the hot-wire technique for making qualitative measurements. Potential uses for this probe are: frequency identification for resonant flows, transition studies, turbulence detection for quiet-tunnel development and reattaching turbulent shear flows, and qualitative turbulence studies of shock-wave/turbulent boundary layer interactions.

Kinetics study of the reaction of OH radicals with C5-C8 cycloalkanes at 240-340 K using the relative rate/discharge flow/mass spectrometry technique.

PubMed

Singh, Sumitpal; de Leon, Maria Fatima; Li, Zhuangjie

2013-10-24

Rate constants of reactions of hydroxyl radical with cyclopentane (k1), cyclohexane (k2), cycloheptane (k3), and cyclooctane (k4) have been acquired at 240-340 K and a total pressure of about 1 Torr using the technique of relative rate combined with discharge flow and mass spectrometry (RR/DF/MS). At 298 K, the rate constants are determined using two reference compounds, which are averaged to be k1 = (4.81 ± 0.88) × 10(-12), k2 = (6.41 ± 0.85) × 10(-12), k3 = (10.30 ± 1.44) × 10(-12), and k4 = (1.42 ± 0.27) × 10(-11) cm(3) molecule(-1) s(-1). The Arrhenius expressions at 240-340 K for these reactions are determined to be k1(T) = (2.43 ± 0.50) × 10(-11)exp[-(481 ± 58)/T], k2(T) = (3.96 ± 0.60) × 10(-11)exp[-554 ± 42)/T], k3(T) = (5.74 ± 0.66) × 10(-11)exp[-527 ± 33)/T], and k4(T) = (1.12 ± 0.21) × 10(-10)exp[-626 ± 53)/T]. Using the kcycloalkane+OH(277 K) values measured in the present work, the atmospheric lifetime for cyclopentane, cyclohexane, cycloheptane, and cyclooctane is estimated to be about 78, 64, 38, and 29 h, respectively.

Calculation of Weibull strength parameters and Batdorf flow-density constants for volume- and surface-flaw-induced fracture in ceramics

NASA Technical Reports Server (NTRS)

Pai, Shantaram S.; Gyekenyesi, John P.

1988-01-01

The calculation of shape and scale parameters of the two-parameter Weibull distribution is described using the least-squares analysis and maximum likelihood methods for volume- and surface-flaw-induced fracture in ceramics with complete and censored samples. Detailed procedures are given for evaluating 90 percent confidence intervals for maximum likelihood estimates of shape and scale parameters, the unbiased estimates of the shape parameters, and the Weibull mean values and corresponding standard deviations. Furthermore, the necessary steps are described for detecting outliers and for calculating the Kolmogorov-Smirnov and the Anderson-Darling goodness-of-fit statistics and 90 percent confidence bands about the Weibull distribution. It also shows how to calculate the Batdorf flaw-density constants by uing the Weibull distribution statistical parameters. The techniques described were verified with several example problems, from the open literature, and were coded. The techniques described were verified with several example problems from the open literature, and were coded in the Structural Ceramics Analysis and Reliability Evaluation (SCARE) design program.

Morphological comparison of PVA scaffolds obtained by gas foaming and microfluidic foaming techniques.

PubMed

Colosi, Cristina; Costantini, Marco; Barbetta, Andrea; Pecci, Raffaella; Bedini, Rossella; Dentini, Mariella

2013-01-08

In this article, we have exploited a microfluidic foaming technique for the generation of highly monodisperse gas-in-liquid bubbles as a templating system for scaffolds characterized by an ordered and homogeneous porous texture. An aqueous poly(vinyl alcohol) (PVA) solution (containing a surfactant) and a gas (argon) are injected simultaneously at constant flow rates in a flow-focusing device (FFD), in which the gas thread breaks up to form monodisperse bubbles. Immediately after its formation, the foam is collected and frozen in liquid nitrogen, freeze-dried, and cross-linked with glutaraldehyde. In order to highlight the superior morphological quality of the obtained porous material, a comparison between this scaffold and another one, also constituted of PVA but obtained with a traditional gas foaming technique, was carried out. Such a comparison has been conducted by analyzing electron microscopy and X-ray microtomographic images of the two samples. It turned out that the microfluidic produced scaffold was characterized by much more uniform porous texture than the gas-foaming one as witnessed by narrower pore size, interconnection, and wall thickness distributions. On the other side, scarce pore interconnectivity, relatively low pore volume, and limited production rate represent, by now, the principal disadvantages of microfluidic foaming as scaffold fabrication method, emphasizing the kind of improvement that this technique needs to undergo.

Constant-head pumping test of a multiaquifer well to determine characteristics of individual aquifers

USGS Publications Warehouse

Bennett, Gordon D.; Patten, E.P.

1962-01-01

This report describes the theory and field procedures for determining the transmissibility and storage coefficients and the original hydrostatic head of each aquifer penetrated by a multiaquifer well. The procedure involves pumping the well in such a manner that the drawdown of water level is constant while the discharges of the different aquifers are measured by means of borehole flowmeters. The theory is developed by analogy to the heat-flow problem solved by Smith. The internal discharge between aquifers after the well is completed is analyzed as the first step. Pumping at constant, drawdown constitutes the second step. Transmissibility and storage coefficients are determined by a method described by Jacob and Lohman, after the original internal discharge to or from the aquifer has been compensated for in the calculations. The original hydrostatic head of each aquifer is then determined by resubstituting the transmissibility and storage coefficients into the first step of the analysis. The method was tested on a well in Chester County, Pa., but the results were not entirely satisfactory, owing to the lack of sufficiently accurate methods of flow measurement and, probably, to the effects of entrance losses in the well. The determinations of the transmissibility coefficient and static head can be accepted as having order-of-magnitude significance, but the determinations of the storage coefficient, which is highly sensitive to experimental error, must be rejected. It is felt that better results may be achieved in the future, as more reliable devices for metering the flow become available and as more is learned concerning the nature of entrance losses. If accurate data can be obtained, recently developed techniques of digital or analog computation may permit determination of the response of each aquifer in the well to any form of pumping.

Traveltime and dispersion in the Shenandoah River and its tributaries, Waynesboro, Virginia, to Harpers Ferry, West Virginia

USGS Publications Warehouse

Taylor, K.R.; James, R.W.; Helinsky, B.M.

1986-01-01

Two traveltime and dispersion measurements using rhodamin dye were conducted on a 178-mile reach of the Shenandoah River between Waynesboro, Virginia, and Harpers Ferry, West Virginia. The flows during the two measurements were at approximately the 85% and 45% flow durations. The two sets of data were used to develop a generalized procedure for predicting traveltimes and downstream concentrations resulting from spillage of water soluble substances at any point along the river reach studied. The procedure can be used to calculate traveltime and concentration data for almost any spillage that occurs during relatively steady flow between a 40% to 95% flow duration. Based on an analogy between the general shape of a time concentration curve and a scalene triangle, the procedures can be used on long river reaches to approximate the conservative time concentration curve for instantaneous spills of contaminants. The triangular approximation technique can be combined with a superposition technique to predict the approximate, conservative time concentration curve for constant rate and variable rate injections of contaminants. The procedure was applied to a hypothetical situation in which 5,000 pounds of contaminants is spilled instantaneously at Island Ford, Virginia. The times required for the leading edge, the peak concentration, and the trailing edge of the contaminant cloud to reach the water intake at Front Royal, Virginia (85 miles downstream), are 234,280, and 340 hrs, respectively, for a flow at an 80% flow duration. The conservative peak concentration would be approximately 940 micrograms/L at Front Royal. The procedures developed cannot be depended upon when a significant hydraulic wave or other unsteady flow condition exists in the flow system or when the spilled material floats or is immiscible in water. (Author 's abstract)

A coupled Eulerian/Lagrangian method for the solution of three-dimensional vortical flows

NASA Technical Reports Server (NTRS)

Felici, Helene Marie

1992-01-01

A coupled Eulerian/Lagrangian method is presented for the reduction of numerical diffusion observed in solutions of three-dimensional rotational flows using standard Eulerian finite-volume time-marching procedures. A Lagrangian particle tracking method using particle markers is added to the Eulerian time-marching procedure and provides a correction of the Eulerian solution. In turn, the Eulerian solutions is used to integrate the Lagrangian state-vector along the particles trajectories. The Lagrangian correction technique does not require any a-priori information on the structure or position of the vortical regions. While the Eulerian solution ensures the conservation of mass and sets the pressure field, the particle markers, used as 'accuracy boosters,' take advantage of the accurate convection description of the Lagrangian solution and enhance the vorticity and entropy capturing capabilities of standard Eulerian finite-volume methods. The combined solution procedures is tested in several applications. The convection of a Lamb vortex in a straight channel is used as an unsteady compressible flow preservation test case. The other test cases concern steady incompressible flow calculations and include the preservation of turbulent inlet velocity profile, the swirling flow in a pipe, and the constant stagnation pressure flow and secondary flow calculations in bends. The last application deals with the external flow past a wing with emphasis on the trailing vortex solution. The improvement due to the addition of the Lagrangian correction technique is measured by comparison with analytical solutions when available or with Eulerian solutions on finer grids. The use of the combined Eulerian/Lagrangian scheme results in substantially lower grid resolution requirements than the standard Eulerian scheme for a given solution accuracy.

Vibrational energy flow in photoactive yellow protein revealed by infrared pump-visible probe spectroscopy.

PubMed

Nakamura, Ryosuke; Hamada, Norio

2015-05-14

Vibrational energy flow in the electronic ground state of photoactive yellow protein (PYP) is studied by ultrafast infrared (IR) pump-visible probe spectroscopy. Vibrational modes of the chromophore and the surrounding protein are excited with a femtosecond IR pump pulse, and the subsequent vibrational dynamics in the chromophore are selectively probed with a visible probe pulse through changes in the absorption spectrum of the chromophore. We thus obtain the vibrational energy flow with four characteristic time constants. The vibrational excitation with an IR pulse at 1340, 1420, 1500, or 1670 cm(-1) results in ultrafast intramolecular vibrational redistribution (IVR) with a time constant of 0.2 ps. The vibrational modes excited through the IVR process relax to the initial ground state with a time constant of 6-8 ps in parallel with vibrational cooling with a time constant of 14 ps. In addition, upon excitation with an IR pulse at 1670 cm(-1), we observe the energy flow from the protein backbone to the chromophore that occurs with a time constant of 4.2 ps.

A constant current charge technique for low Earth orbit life testing

NASA Technical Reports Server (NTRS)

Glueck, Peter

1991-01-01

A constant current charge technique for low earth orbit testing of nickel cadmium cells is presented. The method mimics the familiar taper charge of the constant potential technique while maintaining cell independence for statistical analysis. A detailed example application is provided and the advantages and disadvantages of this technique are discussed.

Ergodicity of Traffic Flow with Constant Penetration Rate for Traffic Monitoring via Floating Vehicle Technique

NASA Astrophysics Data System (ADS)

Gunawan, Fergyanto E.; Abbas, Bahtiar S.; Atmadja, Wiedjaja; Yoseph Chandra, Fajar; Agung, Alexander AS; Kusnandar, Erwin

2014-03-01

Traffic congestion in Asian megacities has become extremely worse, and any means to lessen the congestion level is urgently needed. Building an efficient mass transportation system is clearly necessary. However, implementing Intelligent Transportation Systems (ITS) have also been demonstrated effective in various advanced countries. Recently, the floating vehicle technique (FVT), an ITS implementation, has become cost effective to provide real-time traffic information with proliferation of the smartphones. Although many publications have discussed various issues related to the technique, none of them elaborates the discrepancy of a single floating car data (FCD) and the associated fleet data. This work addresses the issue based on an analysis of Sugiyama et al's experimental data. The results indicate that there is an optimum averaging time interval such that the estimated velocity by the FVT reasonably representing the traffic velocity.

Control of fluid flow during Bridgman crystal growth using low-frequency vibrational stirring

NASA Astrophysics Data System (ADS)

Zawilski, Kevin Thomas

The goal of this research program was to develop an in depth understanding of a promising new method for stirring crystal growth melts called coupled vibrational stirring (CVS). CVS is a mixing technique that can be used in sealed systems and produces rapid mixing through vortex flows. Under normal operating conditions, CVS uses low-frequency vibrations to move the growth crucible along a circular path, producing a surface wave and convection in the melt. This research focused on the application of CVS to the vertical Bridgman technique. CVS generated flows were directly studied using a physical modeling system containing water/glycerin solutions. Sodium nitrate was chosen as a model growth system because the growth process could be directly observed using a transparent furnace. Lead magnesium niobate-lead titanate (PMNT) was chosen as the third system because of its potential application for high performance solid state transducers and actuators. In this study, the critical parameters for controlling CVS flows in cylindrical Bridgman systems were established. One of the most important results obtained was the dependence of an axial velocity gradient on the vibrational frequency. By changing the frequency, the intensity of fluid flow at a given depth can be easily manipulated. The intensity of CVS flows near the crystal-melt interface was found to be important. When flow intensity near the interface increased during growth, large growth rate fluctuations and significant changes in interface shape were observed. To eliminate such fluctuations, a constant flow rate near the crystal-melt interface was maintained by decreasing the vibrational frequency. A continuous frequency ramp was found to be essential to grow crystals of good quality under strong CVS flows. CVS generated flows were also useful in controlling the shape of the growth interface. In the sodium nitrate system without stirring, high growth rates produced a very concave interface. By adjusting the flow intensity near the interface, CVS flows were able to flatten the growth interface under these extreme growth conditions.

Assessing the effusion rate of lava flows from their thermal radiated energy: theoretical study and lab-scale experiments

NASA Astrophysics Data System (ADS)

Garel, F.; Kaminski, E.; Tait, S.; Limare, A.

2010-12-01

A quantitative monitoring of lava flow is required to manage a volcanic crisis, in order to assess where the flow will go, and when will it stop. As the spreading of lava flows is mainly controlled by its rheology and the eruptive mass flux, the key question is how to evaluate them during the eruption (rather than afterwards.) A relationship between the lava flow temperature and the eruption rate is likely to exist, based on the first-order argument that higher eruption rates should correspond to larger energy radiated by a lava flow. The semi-empirical formula developed by Harris and co-workers (e.g. Harris et al., 2007) is used to estimate lava flow rate from satellite observations. However, the complete theoretical bases of this technique, especially its domain of validity, remain to be firmly established. Here we propose a theoretical study of the cooling of a viscous axisymmetric gravity current fed at constant flux rate to investigate whether or not this approach can and/or should be refined and/or modify to better assess flow rates. Our study focuses on the influence of boundary conditions at the surface of the flow, where cooling can occur both by radiation and convection, and at the base of the flow. Dimensionless numbers are introduced to quantify the relative interplay between the model parameters, such as the lava flow rate and the efficiency of the various cooling processes (conduction, convection, radiation.) We obtain that the thermal evolution of the flow can be described as a two-stage evolution. After a transient phase of dynamic cooling, the flow reaches a steady state, characterized by a balance between surface and base cooling and heat advection in the flow, in which the surface temperature structure is constant. The duration of the transient phase and the radiated energy in the steady regime are shown to be a function of the dimensionless numbers. In the case of lava flows, we obtain that the steady state regime is reached after a few days. In this regime, a thermal image provides a consistent estimate of the flow rate if the external cooling conditions are reasonably well constrained.

An experimental investigation of wall boundary layer transition Reynolds numbers in an expansion tube

NASA Technical Reports Server (NTRS)

Weilmuenster, K. J.

1974-01-01

Experimental measurements of boundary-layer transition in an expansion-tube test-gas flow are presented along with radial distributions of pitot pressure. An integral method for calculating constant Reynolds number lines for an expansion-tube flow is introduced. Comparison of experimental data and constant Reynolds number calculations has shown that for given conditions, wall boundary-layer transition occurs at a constant Reynolds number in an expansion-tube flow. Operating conditions in the expansion tube were chosen so that the effects of test-gas nonequilibrium on boundary-layer transition could be studied.

Characterization of In-Flight Processing of Alumina Powder Using a DC-RF Hybrid Plasma Flow System at Constant Low Operating Power

NASA Astrophysics Data System (ADS)

Nishiyama, H.; Onodera, M.; Igawa, J.; Nakajima, T.

2009-12-01

The aim of this study is to provide the optimum operating conditions for enhancing in-flight alumina particle heating as much as possible for particle spheroidization and aggregation of melted particles using a DC-RF hybrid plasma flow system even at constant low operating power based on the thermofluid considerations. It is clarified that the swirl flow and higher operating pressure enhance the particle melting and aggregation of melted particles coupled with increasing gas temperature downstream of a plasma uniformly in the radial direction at constant electrical discharge conditions.

Determination of the DNA-binding characteristics of ethidium bromide, proflavine, and cisplatin by flow injection analysis: usefulness in studies on antitumor drugs.

PubMed

Alonso, A; Almendral, M J; Curto, Y; Criado, J J; Rodríguez, E; Manzano, J L

2006-08-15

Flow injection analysis was used to study the reactions occurring between DNA and certain compounds that bind to its double helix, deforming this and even breaking it, such that some of them (e.g., cisplatin) are endowed with antitumoral activity. Use of this technique in the merging zones and stopped-flow modes afforded data on the binding parameters and the kinetic characteristics of the process. The first compound studied was ethidium bromide (EtdBr), used as a fluorescent marker because its fluorescence is enhanced when it binds to DNA. The DNA-EtdBr binding parameters, the apparent intrinsic binding constant (0.31+/-0.02 microM(-1)), and the maximum number of binding sites per nucleotide (0.327+/-0.009) were determined. The modification introduced in these parameters by the presence of proflavine (Prf), a classic competitive inhibitor of the binding of EtdBr to the DNA double helix, was also studied, determining the value of the intrinsic binding constant of Prf (K(Prf) = 0.119+/-9x10(-3) microM(-1)). Finally, we determined the binding parameters between DNA and EtdBr in the presence of the antitumor agent cisplatin, a noncompetitive inhibitor of such binding. This provided information about the binding mechanism as well as the duration and activity of the binding of the compound in its pharmacological use.

A conflict analysis of 4D descent strategies in a metered, multiple-arrival route environment

NASA Technical Reports Server (NTRS)

Izumi, K. H.; Harris, C. S.

1990-01-01

A conflict analysis was performed on multiple arrival traffic at a typical metered airport. The Flow Management Evaluation Model (FMEM) was used to simulate arrival operations using Denver Stapleton's arrival route structure. Sensitivities of conflict performance to three different 4-D descent strategies (clear-idle Mach/Constant AirSpeed (CAS), constant descent angle Mach/CAS and energy optimal) were examined for three traffic mixes represented by those found at Denver Stapleton, John F. Kennedy and typical en route metering (ERM) airports. The Monte Carlo technique was used to generate simulation entry point times. Analysis results indicate that the clean-idle descent strategy offers the best compromise in overall performance. Performance measures primarily include susceptibility to conflict and conflict severity. Fuel usage performance is extrapolated from previous descent strategy studies.

Forced convection flow boiling and two-phase flow phenomena in a microchannel

NASA Astrophysics Data System (ADS)

Na, Yun Whan

2008-07-01

The present study was performed to numerically analyze the evaporation phenomena through the liquid-vapor interface and to investigate bubble dynamics and heat transfer behavior during forced convective flow boiling in a microchannel. Flow instabilities of two-phase flow boiling in a microchannel were studied as well. The main objective of this research is to investigate the fundamental mechanisms of two-phase flow boiling in a microchannel and provide predictive tools to design thermal management systems, for example, microchannel heat sinks. The numerical results obtained from this study were qualitatively and quantitatively compared with experimental results in the open literature. Physical and mathematical models, accounting for evaporating phenomena through the liquid-vapor interface in a microchannel at constant heat flux and constant wall temperature, have been developed, respectively. The heat transfer mechanism is affected by the dominant heat conduction through the thin liquid film and vaporization at the liquid-vapor interface. The thickness of the liquid film and the pressure of the liquid and vapor phases were simultaneously solved by the governing differential equations. The developed semi-analytical evaporation model that takes into account of the interfacial phenomena and surface tension effects was used to obtain solutions numerically using the fourth-order Runge-Kutta method. The effects of heat flux 19 and wall temperature on the liquid film were evaluated. The obtained pressure drops in a microchannel were qualitatively consistent with the experimental results of Qu and Mudawar (2004). Forced convective flow boiling in a single microchannel with different channel heights was studied through a numerical simulation to investigate bubble dynamics, flow patterns, and heat transfer. The momentum and energy equations were solved using the finite volume method while the liquid-vapor interface of a bubble is captured using the VOF (Volume of Fluid) technique. The effects of different constant heat fluxes and different channel heights on the boiling mechanisms were investigated. The effects of liquid velocity on the bubble departure diameter were analyzed. The obtained results showed that the wall superheats at the position of nucleate boiling are relatively independent of the mass flow rates at the same channel height. The obtained results, however, showed that the heat flux at the onset of nucleate boiling strongly depends on the channel height. With a decrease of the channel height and an increase of the liquid velocity at the channel inlet, the departure diameter of a bubble was smaller. The periodic flow patterns, such as the bubbly flow, elongated slug flow, and churn flow were observed in the microchannel. Flow instabilities of two-phase flow boiling in a trapezoidal microchannel using a three-dimensional model were investigated. Fluctuation behaviors of flow boiling parameters such as wall temperature and inlet pressure caused by periodic flow patterns were studied at different heat fluxes and mass fluxes. The numerical results showed large amplitude and short period oscillations for wall temperature and inlet pressure fluctuations. Stable and unstable flow boiling regime with short period oscillations were investigated. Those flow boiling regimes were not listed in stable and unstable boiling regime map proposed by Wang et al. (2007).

An experimental study of wall-injected flows in a rectangular cylinder

NASA Astrophysics Data System (ADS)

Perrotta, A.; Romano, G. P.; Favini, B.

2018-01-01

An experimental investigation of the flow inside a rectangular cylinder with air injected continuously along the wall is performed. This kind of flow is a two-dimensional approximation of what happens inside a solid rocket motor, where the lateral grain burns expelling exhaust gas or in processes with air filtration or devices to attain uniform flows. We propose a brief derivation of some analytical solutions and a comparison between these solutions and experimental data, which are obtained using the particle image velocimetry technique, to provide a global reconstruction of the flowfield. The flow, which enters orthogonal to the injecting wall, turns suddenly its direction being pushed towards the exit of the chamber. Under the incompressible and inviscid flow hypothesis, two analytical solutions are reported and compared. The first one, known as Hart-McClure solution, is irrotational and the injection velocity is non-perpendicular to the injecting wall. The other one, due to Taylor and Culick, has non-zero vorticity and constant, vertical injection velocity. The comparison with laminar solutions is useful to assess whether transition to turbulence is reached and how the disturbance thrown in by the porous injection influences and modifies those solutions.

Numerical modeling of heat transfer in molten silicon during directional solidification process

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srinivasan, M.; Ramasamy, P., E-mail: ramasamyp@ssn.edu.in

2015-06-24

Numerical investigation is performed for some of the thermal and fluid flow properties of silicon melt during directional solidification by numerical modeling. Dimensionless numbers are extremely useful to understand the heat and mass transfer of fluid flow on Si melt and control the flow patterns during crystal growth processes. The average grain size of whole crystal would increase when the melt flow is laminar. In the silicon growth process, the melt flow is mainly driven by the buoyancy force resulting from the horizontal temperature gradient. The thermal and flow pattern influences the quality of the crystal through the convective heatmore » and mass transport. The computations are carried out in a 2D axisymmetric model using the finite-element technique. The buoyancy effect is observed in the melt domain for a constant Rayleigh number and for different Prandtl numbers. The convective heat flux and Reynolds numbers are studied in the five parallel horizontal cross section of melt silicon region. And also, velocity field is simulated for whole melt domain with limited thermal boundaries. The results indicate that buoyancy forces have a dramatic effect on the most of melt region except central part.« less

A stepwise model to predict monthly streamflow

NASA Astrophysics Data System (ADS)

Mahmood Al-Juboori, Anas; Guven, Aytac

2016-12-01

In this study, a stepwise model empowered with genetic programming is developed to predict the monthly flows of Hurman River in Turkey and Diyalah and Lesser Zab Rivers in Iraq. The model divides the monthly flow data to twelve intervals representing the number of months in a year. The flow of a month, t is considered as a function of the antecedent month's flow (t - 1) and it is predicted by multiplying the antecedent monthly flow by a constant value called K. The optimum value of K is obtained by a stepwise procedure which employs Gene Expression Programming (GEP) and Nonlinear Generalized Reduced Gradient Optimization (NGRGO) as alternative to traditional nonlinear regression technique. The degree of determination and root mean squared error are used to evaluate the performance of the proposed models. The results of the proposed model are compared with the conventional Markovian and Auto Regressive Integrated Moving Average (ARIMA) models based on observed monthly flow data. The comparison results based on five different statistic measures show that the proposed stepwise model performed better than Markovian model and ARIMA model. The R2 values of the proposed model range between 0.81 and 0.92 for the three rivers in this study.

Soot loading in a generic gas turbine combustor

NASA Technical Reports Server (NTRS)

Eckerle, W. A.; Rosfjord, T. J.

1987-01-01

Variation in soot loading along the centerline of a generic gas turbine combustor was experimentally investigated. The 12.7-cm dia burner consisted of six sheet-metal louvers. Soot loading along the burner length was quantified by acquiring measurements first at the exit of the full-length combustor and then at upstream stations by sequential removal of liner louvers to shorten the burner length. Alteration of the flow field approaching removed louvers, maintaining a constant liner pressure drop. Burner exhaust flow was sampled at the burner centerline to determine soot mass concentration and smoke number. Characteristic particle size and number density, transmissivity of the exhaust flow, and local radiation from luminous soot particles in the exhaust flow were determined by optical techniques. Four test fuels were burned at three fuel-air ratios to determine fuel chemical property and flow temperature influences. Data were acquired at two combustor pressures. Particulate concentration data indicated a strong oxidation mechanism in the combustor secondary zone, though the oxidation was significantly affected by flow temperature. Soot production was directly related to fuel smoke point. Less soot production and lower secondary-zone oxidation rates were observed at reduced combustor pressure.

G-Jitter Induced Magnetohydrodynamics Flow of Nanofluid with Constant Convective Thermal and Solutal Boundary Conditions

PubMed Central

Uddin, Mohammed J.; Khan, Waqar A.; Ismail, Ahmad Izani Md.

2015-01-01

Taking into account the effect of constant convective thermal and mass boundary conditions, we present numerical solution of the 2-D laminar g-jitter mixed convective boundary layer flow of water-based nanofluids. The governing transport equations are converted into non-similar equations using suitable transformations, before being solved numerically by an implicit finite difference method with quasi-linearization technique. The skin friction decreases with time, buoyancy ratio, and thermophoresis parameters while it increases with frequency, mixed convection and Brownian motion parameters. Heat transfer rate decreases with time, Brownian motion, thermophoresis and diffusion-convection parameters while it increases with the Reynolds number, frequency, mixed convection, buoyancy ratio and conduction-convection parameters. Mass transfer rate decreases with time, frequency, thermophoresis, conduction-convection parameters while it increases with mixed convection, buoyancy ratio, diffusion-convection and Brownian motion parameters. To the best of our knowledge, this is the first paper on this topic and hence the results are new. We believe that the results will be useful in designing and operating thermal fluids systems for space materials processing. Special cases of the results have been compared with published results and an excellent agreement is found. PMID:25933066

Centrifugal study of zone of influence during air-sparging.

PubMed

Hu, Liming; Meegoda, Jay N; Du, Jianting; Gao, Shengyan; Wu, Xiaofeng

2011-09-01

Air sparging (AS) is one of the groundwater remediation techniques for remediating volatile organic compounds (VOCs) in saturated soil. However, in spite of the success of air sparging as a remediation technique for the cleanup of contaminated soils, to date, the fundamental mechanisms or the physics of air flow through porous media is not well understood. In this study, centrifugal modeling tests were performed to investigate air flow rates and the evolution of the zone of influence during the air sparging under various g-levels. The test results show that with the increase in sparging pressure the mass flow rate of the air sparging volume increases. The air mass flow rate increases linearly with the effective sparging pressure ratio, which is the difference between sparging pressure and hydrostatic pressure normalized with respect to the effective overburden pressure at the sparging point. Also the slope of mass flow rate with effective sparging pressure ratio increases with higher g-levels. This variation of the slope of mass flow rate of air sparging volume versus effective sparging pressure ratio, M, is linear with g-level confirming that the air flow through soil for a given effective sparging pressure ratio only depends on the g-level. The test results also show that with increasing sparging pressure, the zone of influence (ZOI), which consists of the width at the tip of the cone or lateral intrusion and the cone angle, will lead to an increase in both lateral intrusion and the cone angle. With a further increase in air injection pressure, the cone angle reaches a constant value while the lateral intrusion becomes the main contributor to the enlargement of the ZOI. However, beyond a certain value of effective sparging pressure ratio, there is no further enlargement of the ZOI.

Self-potential method for characterizing streaming flows in the saturated and vadose zones: state of the art and limitations

NASA Astrophysics Data System (ADS)

Sailhac, P.

2005-12-01

Self-Potential (SP) method is sensitive not only to the water content, but, above all, to flow velocities within the underground porous medium. So it can be considered as a crucial help in hydrogeophysics. This is underlined by the so-called electrokinetic coupling and has been early used in geophysics (e.g. Bogoslovsky and Ogilvy, 1970) and hydrology (Abaza and Clyde 1969). During the last decade, both experimental and theoretical progresses have moved ahead SP to provide quantitative flow parameters. Now SP time and/or spatial variations can be used to monitor water fluxes during infiltration (e.g. Thony et al. 1997, Doussan et al. 2002, Darnet & Marquis 2004), seepage (Titov et al. 2000), or pumping (e.g. Fagerlund & Heinson 2003, Darnet et al. 2003, Revil et al. 2003). In order that SP is used by a larger community, it would be useful to recall the fundamentals, to review recent interpretation techniques in a simple framework and to precise their limitations. First considering flows in the saturated zone and a pumping experiment, I will show different interpretation techniques that are based upon Green function decompositions (e.g. wavelets, COP tomography of Patella, and iso-α line of Revil et al.). Classical application of theses techniques is underlined by the assumption of a constant electrical conductivity medium that involves uncertainty and bias in quantitative flow parameter estimates. For instance, the diffusive effect of a conductive shallow layer tends to increase the apparent depth of an underground flow source or sink. To correct this problem, one can use Green functions of a tabular medium in the COP tomography. In the complex case of unsaturated zone, the hydraulic and electric conductivities are depending on the water content. We will discuss on different soil models and different experiments that can be used for the monitoring of the infiltration and the characterisation of the soil hydraulic parameters.

Spray Gun With Constant Mixing Ratio

NASA Technical Reports Server (NTRS)

Simpson, William G.

1987-01-01

Conceptual mechanism mounted in handle of spray gun maintains constant ratio between volumetric flow rates in two channels leading to spray head. With mechanism, possible to keep flow ratio near 1:1 (or another desired ratio) over range of temperatures, orifice or channel sizes, or clogging conditions.

Determination of Hamaker constants of polymeric nanoparticles in organic solvents by asymmetrical flow field-flow fractionation.

PubMed

Noskov, Sergey; Scherer, Christian; Maskos, Michael

2013-01-25

Interaction forces between all objects are either of repulsive or attractive nature. Concerning attractive interactions, the determination of dispersion forces are of special interest since they appear in all colloidal systems and have a crucial influence on the properties and processes in these systems. One possibility to link theory and experiment is the description of the London-Van der Waals forces in terms of the Hamaker constant, which leads to the challenging problem of calculating the van der Waals interaction energies between colloidal particles. Hence, the determination of a Hamaker constant for a given material is needed when interfacial phenomena such as adhesion are discussed in terms of the total potential energy between particles and substrates. In this work, the asymmetrical flow field-flow fractionation (AF-FFF) in combination with a Newton algorithm based iteration process was used for the determination of Hamaker constants of different nanoparticles in toluene. Copyright © 2012 Elsevier B.V. All rights reserved.

Three-dimensional Bayesian geostatistical aquifer characterization at the Hanford 300 Area using tracer test data

NASA Astrophysics Data System (ADS)

Chen, Xingyuan; Murakami, Haruko; Hahn, Melanie S.; Hammond, Glenn E.; Rockhold, Mark L.; Zachara, John M.; Rubin, Yoram

2012-06-01

Tracer tests performed under natural or forced gradient flow conditions can provide useful information for characterizing subsurface properties, through monitoring, modeling, and interpretation of the tracer plume migration in an aquifer. Nonreactive tracer experiments were conducted at the Hanford 300 Area, along with constant-rate injection tests and electromagnetic borehole flowmeter tests. A Bayesian data assimilation technique, the method of anchored distributions (MAD) (Rubin et al., 2010), was applied to assimilate the experimental tracer test data with the other types of data and to infer the three-dimensional heterogeneous structure of the hydraulic conductivity in the saturated zone of the Hanford formation.In this study, the Bayesian prior information on the underlying random hydraulic conductivity field was obtained from previous field characterization efforts using constant-rate injection and borehole flowmeter test data. The posterior distribution of the conductivity field was obtained by further conditioning the field on the temporal moments of tracer breakthrough curves at various observation wells. MAD was implemented with the massively parallel three-dimensional flow and transport code PFLOTRAN to cope with the highly transient flow boundary conditions at the site and to meet the computational demands of MAD. A synthetic study proved that the proposed method could effectively invert tracer test data to capture the essential spatial heterogeneity of the three-dimensional hydraulic conductivity field. Application of MAD to actual field tracer data at the Hanford 300 Area demonstrates that inverting for spatial heterogeneity of hydraulic conductivity under transient flow conditions is challenging and more work is needed.

Compressible Flow Toolbox

NASA Technical Reports Server (NTRS)

Melcher, Kevin J.

2006-01-01

The Compressible Flow Toolbox is primarily a MATLAB-language implementation of a set of algorithms that solve approximately 280 linear and nonlinear classical equations for compressible flow. The toolbox is useful for analysis of one-dimensional steady flow with either constant entropy, friction, heat transfer, or Mach number greater than 1. The toolbox also contains algorithms for comparing and validating the equation-solving algorithms against solutions previously published in open literature. The classical equations solved by the Compressible Flow Toolbox are as follows: The isentropic-flow equations, The Fanno flow equations (pertaining to flow of an ideal gas in a pipe with friction), The Rayleigh flow equations (pertaining to frictionless flow of an ideal gas, with heat transfer, in a pipe of constant cross section), The normal-shock equations, The oblique-shock equations, and The expansion equations.

Adaptation of the Carter-Tracy water influx calculation to groundwater flow simulation

USGS Publications Warehouse

Kipp, Kenneth L.

1986-01-01

The Carter-Tracy calculation for water influx is adapted to groundwater flow simulation with additional clarifying explanation not present in the original papers. The Van Everdingen and Hurst aquifer-influence functions for radial flow from an outer aquifer region are employed. This technique, based on convolution of unit-step response functions, offers a simple but approximate method for embedding an inner region of groundwater flow simulation within a much larger aquifer region where flow can be treated in an approximate fashion. The use of aquifer-influence functions in groundwater flow modeling reduces the size of the computational grid with a corresponding reduction in computer storage and execution time. The Carter-Tracy approximation to the convolution integral enables the aquifer influence function calculation to be made with an additional storage requirement of only two times the number of boundary nodes more than that required for the inner region simulation. It is a good approximation for constant flow rates but is poor for time-varying flow rates where the variation is large relative to the mean. A variety of outer aquifer region geometries, exterior boundary conditions, and flow rate versus potentiometric head relations can be used. The radial, transient-flow case presented is representative. An analytical approximation to the functions of Van Everdingen and Hurst for the dimensionless potentiometric head versus dimensionless time is given.

Accuracy of 1D microvascular flow models in the limit of low Reynolds numbers.

PubMed

Pindera, Maciej Z; Ding, Hui; Athavale, Mahesh M; Chen, Zhijian

2009-05-01

We describe results of numerical simulations of steady flows in tubes with branch bifurcations using fully 3D and reduced 1D geometries. The intent is to delineate the range of validity of reduced models used for simulations of flows in microcapillary networks, as a function of the flow Reynolds number Re. Results from model problems indicate that for Re less than 1 and possibly as high as 10, vasculatures may be represented by strictly 1D Poiseuille flow geometries with flow variation in the axial dimensions only. In that range flow rate predictions in the different branches generated by 1D and 3D models differ by a constant factor, independent of Re. When the cross-sectional areas of the branches are constant these differences are generally small and appear to stem from an uncertainty of how the individual branch lengths are defined. This uncertainty can be accounted for by a simple geometrical correction. For non-constant cross-sections the differences can be much more significant. If additional corrections for the presence of branch junctions and flow area variations are not taken into account in 1D models of complex vasculatures, the resultant flow predictions should be interpreted with caution.

40 CFR 86.078-3 - Abbreviations.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., and for 1985 and Later Model Year New Gasoline Fueled, Natural Gas-Fueled, Liquefied Petroleum Gas... feet per hour. CFV—Critical flow venturi. CFV-CVS—Critical flow venturi—constant volume sampler... pump—constant volume sampler. ppm—parts per million by volume. ppm C—parts per million, carbon. psi...

High-resolution hot-film measurement of surface heat flux to an impinging jet

NASA Astrophysics Data System (ADS)

O'Donovan, T. S.; Persoons, T.; Murray, D. B.

2011-10-01

To investigate the complex coupling between surface heat transfer and local fluid velocity in convective heat transfer, advanced techniques are required to measure the surface heat flux at high spatial and temporal resolution. Several established flow velocity techniques such as laser Doppler anemometry, particle image velocimetry and hot wire anemometry can measure fluid velocities at high spatial resolution (µm) and have a high-frequency response (up to 100 kHz) characteristic. Equivalent advanced surface heat transfer measurement techniques, however, are not available; even the latest advances in high speed thermal imaging do not offer equivalent data capture rates. The current research presents a method of measuring point surface heat flux with a hot film that is flush mounted on a heated flat surface. The film works in conjunction with a constant temperature anemometer which has a bandwidth of 100 kHz. The bandwidth of this technique therefore is likely to be in excess of more established surface heat flux measurement techniques. Although the frequency response of the sensor is not reported here, it is expected to be significantly less than 100 kHz due to its physical size and capacitance. To demonstrate the efficacy of the technique, a cooling impinging air jet is directed at the heated surface, and the power required to maintain the hot-film temperature is related to the local heat flux to the fluid air flow. The technique is validated experimentally using a more established surface heat flux measurement technique. The thermal performance of the sensor is also investigated numerically. It has been shown that, with some limitations, the measurement technique accurately measures the surface heat transfer to an impinging air jet with improved spatial resolution for a wide range of experimental parameters.

On the Kolmogorov constant in stochastic turbulence models

NASA Astrophysics Data System (ADS)

Heinz, Stefan

2002-11-01

The Kolmogorov constant is fundamental in stochastic models of turbulence. To explain the reasons for observed variations of this quantity, it is calculated for two flows by various methods and data. Velocity fluctuations are considered as the sum of contributions due to anisotropy, acceleration fluctuations and stochastic forcing that is controlled by the Kolmogorov constant. It is shown that the effects of anisotropy and acceleration fluctuations are responsible for significant variations of the Kolmogorov constant. It is found near 2 for flows where anisotropy and acceleration fluctuations contribute to the energy budget, and near 6 if such contributions disappear.

Acoustic analysis of aft noise reduction techniques measured on a subsonic tip speed 50.8 cm (twenty inch) diameter fan. [quiet engine program

NASA Technical Reports Server (NTRS)

Stimpert, D. L.; Clemons, A.

1977-01-01

Sound data which were obtained during tests of a 50.8 cm diameter, subsonic tip speed, low pressure ratio fan were analyzed. The test matrix was divided into two major investigations: (1) source noise reduction techniques; and (2) aft duct noise reduction with acoustic treatment. Source noise reduction techniques were investigated which include minimizing second harmonic noise by varying vane/blade ratio, variation in spacing, and lowering the Mach number through the vane row to lower fan broadband noise. Treatment in the aft duct which includes flow noise effects, faceplate porosity, rotor OGV treatment, slant cell treatment, and splitter simulation with variable depth on the outer wall and constant thickness treatment on the inner wall was investigated. Variable boundary conditions such as variation in treatment panel thickness and orientation, and mixed porosity combined with variable thickness were examined. Significant results are reported.

Quantifying liquid boundary and vapor distributions in a fuel spray by rainbow schlieren deflectometry.

PubMed

Taber Wanstall, C; Agrawal, Ajay K; Bittle, Joshua A

2017-10-20

The rainbow schlieren deflectometry (RSD) technique is used to determine the liquid boundary and the fuel volume fraction distributions in the vapor region of a high-pressure fuel spray. Experiments were conducted in a constant pressure flow vessel, whereby a customized single-hole common-rail diesel injector is used to introduce n-heptane fuel into a coflow of low-speed ambient air at two different test conditions. Only the quasi-steady period of the fuel spray is considered, and multiple injections are performed to acquire statistically significant data at an image acquisition rate of 20 kHz. An algorithm to identify the liquid boundary using intensity recorded by the RSD images is presented. The results are compared against measurements obtained by the Mie scattering technique. Results demonstrate that the RSD can be a powerful optical diagnostics technique to simultaneously quantify both the vapor and liquid regions in the high-pressure fuel sprays.

An automated cell analysis sensing system based on a microfabricated rheoscope for the study of red blood cells physiology.

PubMed

Bransky, Avishay; Korin, Natanel; Nemirovski, Yael; Dinnar, Uri

2006-08-15

An automated rheoscope has been developed, utilizing a microfabricated glass flow cell, high speed camera and advanced image-processing software. RBCs suspended in a high viscosity medium were filmed flowing through a microchannel. Under these conditions, RBCs exhibit different orientations and deformations according to their location in the velocity profile. The rheoscope system produces valuable data such as velocity profile of RBCs, spatial distribution within a microchannel and deformation index (DI) curves. The variation of DI across the channel height, due to change in shear stress, was measured carrying implications for diffractometry methods. These curves of DI were taken at a constant flow rate and cover most of the relevant shear stress spectrum. This is an improvement of the existing techniques for deformability measurements and may serve as a diagnostic tool for certain blood disorders. The DI curves were compared to measurements of the flowing RBCs velocity profile. In addition, we found that RBCs flowing in a microchannel are mostly gathered in the center of the flow and maintain a characteristic spatial distribution. The spatial distribution in this region changes slightly with increasing flow rate. Hence, the system described, provides means for examining the behavior of individual RBCs, and may serve as a microfabricated diagnostic device for deformability measurement.

Extraction of long-chain fatty acids in isolated rat heart during acute low-flow ischemia.

PubMed

Richter, W S; Fischer, S; Ernst, N; Munz, D L

2001-07-01

Although beta-oxidation of fatty acids is suppressed rapidly during ischemia, the behavior of fatty acid extraction at different flow rates is incompletely understood. This study assessed the relationship between flow and extraction of (123)I-iodophenylpentadecanoic acid (IPPA) in the isolated heart model, especially at low flow. Isolated hearts from male Wistar rats (n = 15) were subjected to retrograde perfusion with constant flow (Krebs Henseleit solution containing 10 mmol/L glucose). A latex balloon in the left ventricle allowed isovolumetric contractions and ventricular pressure measurements. The extraction of (123)I-IPPA was assessed with the indicator dilution technique and (99m)Tc-albumin as the intravascular reference. The flow was either increased from the control flow (8 mL/min) until 300% or reduced until 10%. (123)I-IPPA extraction was measured three times before and 10 min after flow alteration. The tracer uptake was estimated from the product of net extraction and flow. The mean (123)I-IPPA extraction at the control flow (third measurement) was 51.6% +/- 2.8%. Between flow rates of approximately 25% and 300%, (123)I-IPPA extraction increased exponentially at decreasing flow rates. At flow rates < or =25% of the control flow, (123)I-IPPA extraction was exponentially higher than predicted. (123)I-IPPA uptake and flow changed largely in parallel. During low flow, the rate-pressure product showed the expected decline (perfusion-contraction matching). The extraction of (123)I-IPPA is preserved and slightly increased (relative to flow) during acute low-flow ischemia.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sarma, Abhisakh; Sanyal, Milan K., E-mail: milank.sanyal@saha.ac.in

In-situ x-ray diffraction technique has been used to study the growth process of gold incorporated polypyrrole nanotubes that exhibit colossal dielectric constant due to existence of quasi-one-dimensional charge density wave state. These composite nanotubes were formed within nanopores of a polycarbonate membrane by flowing pyrrole monomer from one side and mixture of ferric chloride and chloroauric acid from other side in a sample cell that allows collection of x-ray data during the reaction. The size of the gold nanoparticle embedded in the walls of the nanotubes was found to be dependent on chloroauric acid concentration for nanowires having diameter moremore » than 100 nm. For lower diameter nanotubes the nanoparticle size become independent of chloroauric acid concentration and depends on the diameter of nanotubes only. The result of this study also shows that for 50 nm gold-polypyrrole composite nanotubes obtained with 5.3 mM chloroauric acid gives colossal dielectric constant of about 10{sup 7}. This value remain almost constant over a frequency range from 1Hz to 10{sup 6} Hz even at 80 K temperature.« less

High resolution gas volume change sensor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dirckx, Joris J. J.; Aernouts, Jef E. F.; Aerts, Johan R. M.

2007-05-15

Changes of gas quantity in a system can be measured either by measuring pressure changes or by measuring volume changes. As sensitive pressure sensors are readily available, pressure change is the commonly used technique. In many physiologic systems, however, buildup of pressure influences the gas exchange mechanisms, thus changing the gas quantity change rate. If one wants to study the gas flow in or out of a biological gas pocket, measurements need to be done at constant pressure. In this article we present a highly sensitive sensor for quantitative measurements of gas volume change at constant pressure. The sensor ismore » based on optical detection of the movement of a droplet of fluid enclosed in a capillary. The device is easy to use and delivers gas volume data at a rate of more than 15 measurements/s and a resolution better than 0.06 {mu}l. At the onset of a gas quantity change the sensor shows a small pressure artifact of less than 15 Pa, and at constant change rates the pressure artifact is smaller than 10 Pa or 0.01% of ambient pressure.« less

Direct rate constant measurements for the reaction of ground-state atomic oxygen with ethylene, 244-1052 K

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klemm, R.B.; Nesbitt, F.L.; Skolnik, E.G.

The rate constant for the reaction of ground-state atomic oxygen with ethylene was determined by using two techniques: flash photolysis-resonance fluorescence (FP-RF, 244-1052 K) and discharge flow-resonance fluorescence (DF-RF, 298-1017 K). Kinetic complications due to the presence of molecular oxygen in the FP-RF experiments at high temperatures (T > 800 K) were overcome by using NO as the photolytic source of the O atoms. The rate constant, k/sub 1/ (T), derived in this study exhibits extreme non-Arrhenius behavior, but it can be successfully fit to the sum of exponentials expression, 244-1052 K, k/sub 1/(T) = (1.02 +/- 0.06) x 10/supmore » -11/ exp(-753 +/- 17 K/T) + (2.75 +/- 0.26) x 10/sup -10/ exp(-4220 +/- 550 K/T), in units of cm/sup 3/ molecule/sup -1/ s/sup -1/. Additionally, a fit of the results of this work to a simple transition-state theory expression and the comparison of these results with those of other workers are discussed.« less

Measurement of xenon plasma properties in an ion thruster using laser Thomson scattering technique

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamamoto, N.; Tomita, K.; Sugita, K.

2012-07-15

This paper reports on the development of a method for measuring xenon plasma properties using the laser Thomson scattering technique, for application to ion engine system design. The thresholds of photo-ionization of xenon plasma were investigated and the number density of metastable atoms, which are photo-ionized by a probe laser, was measured using laser absorption spectroscopy, for several conditions. The measured threshold energy of the probe laser using a plano-convex lens with a focal length of 200 mm was 150 mJ for a xenon mass flow rate of 20 {mu}g/s and incident microwave power of 6 W; the probe lasermore » energy was therefore set as 80 mJ. Electron number density was found to be (6.2 {+-} 0.4) Multiplication-Sign 10{sup 17} m{sup -3} and electron temperature was found to be 2.2 {+-} 0.4 eV at a xenon mass flow rate of 20 {mu}g/s and incident microwave power of 6 W. The threshold of the probe laser intensity against photo-ionization in a miniature xenon ion thruster is almost constant for various mass flow rates, since the ratio of population of the metastable atoms to the electron number density is little changed.« less

Determination of Acidity Constants by Gradient Flow-Injection Titration

ERIC Educational Resources Information Center

Conceicao, Antonio C. L.; Minas da Piedade, Manuel E.

2006-01-01

A three-hour laboratory experiment, designed for an advanced undergraduate course in instrumental analysis that illustrates the application of the gradient chamber flow-injection titration (GCFIT) method with spectrophotometric detection to determine acidity constants is presented. The procedure involves the use of an acid-base indicator to obtain…

The effect of topography on pyroclastic flow mobility

NASA Astrophysics Data System (ADS)

Ogburn, S. E.; Calder, E. S.

2010-12-01

Pyroclastic flows are among the most destructive volcanic phenomena. Hazard mitigation depends upon accurate forecasting of possible flow paths, often using computational models. Two main metrics have been proposed to describe the mobility of pyroclastic flows. The Heim coefficient, height-dropped/run-out (H/L), exhibits an inverse relationship with flow volume. This coefficient corresponds to the coefficient of friction and informs computational models that use Coulomb friction laws. Another mobility measure states that with constant shear stress, planimetric area is proportional to the flow volume raised to the 2/3 power (A∝V^(2/3)). This relationship is incorporated in models using constant shear stress instead of constant friction, and used directly by some empirical models. Pyroclastic flows from Soufriere Hills Volcano, Montserrat; Unzen, Japan; Colima, Mexico; and Augustine, Alaska are well described by these metrics. However, flows in specific valleys exhibit differences in mobility. This study investigates the effect of topography on pyroclastic flow mobility, as measured by the above mentioned mobility metrics. Valley width, depth, and cross-sectional area all influence flow mobility. Investigating the appropriateness of these mobility measures, as well as the computational models they inform, indicates certain circumstances under which each model performs optimally. Knowing which conditions call for which models allows for better model selection or model weighting, and therefore, more realistic hazard predictions.

BODYFIT-1FE: a computer code for three-dimensional steady-state/transient single-phase rod-bundle thermal-hydraulic analysis. Draft report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, B.C.J.; Sha, W.T.; Doria, M.L.

1980-11-01

The governing equations, i.e., conservation equations for mass, momentum, and energy, are solved as a boundary-value problem in space and an initial-value problem in time. BODYFIT-1FE code uses the technique of boundary-fitted coordinate systems where all the physical boundaries are transformed to be coincident with constant coordinate lines in the transformed space. By using this technique, one can prescribe boundary conditions accurately without interpolation. The transformed governing equations in terms of the boundary-fitted coordinates are then solved by using implicit cell-by-cell procedure with a choice of either central or upwind convective derivatives. It is a true benchmark rod-bundle code withoutmore » invoking any assumptions in the case of laminar flow. However, for turbulent flow, some empiricism must be employed due to the closure problem of turbulence modeling. The detailed velocity and temperature distributions calculated from the code can be used to benchmark and calibrate empirical coefficients employed in subchannel codes and porous-medium analyses.« less

Elongational flow of polymer melts at constant strain rate, constant stress and constant force

NASA Astrophysics Data System (ADS)

Wagner, Manfred H.; Rolón-Garrido, Víctor H.

2013-04-01

Characterization of polymer melts in elongational flow is typically performed at constant elongational rate or rarely at constant tensile stress conditions. One of the disadvantages of these deformation modes is that they are hampered by the onset of "necking" instabilities according to the Considère criterion. Experiments at constant tensile force have been performed even more rarely, in spite of the fact that this deformation mode is free from necking instabilities and is of considerable industrial relevance as it is the correct analogue of steady fiber spinning. It is the objective of the present contribution to present for the first time a full experimental characterization of a long-chain branched polyethylene melt in elongational flow. Experiments were performed at constant elongation rate, constant tensile stress and constant tensile force by use of a Sentmanat Extensional Rheometer (SER) in combination with an Anton Paar MCR301 rotational rheometer. The accessible experimental window and experimental limitations are discussed. The experimental data are modelled by using the Wagner I model. Predictions of the steady-start elongational viscosity in constant strain rate and creep experiments are found to be identical, albeit only by extrapolation of the experimental data to Hencky strains of the order of 6. For constant stress experiments, a minimum in the strain rate and a corresponding maximum in the elongational viscosity is found at a Hencky strain of the order of 3, which, although larger than the steady-state value, follows roughly the general trend of the steady-state elongational viscosity. The constitutive analysis also reveals that constant tensile force experiments indicate a larger strain hardening potential than seen in constant elongation rate or constant tensile stress experiments. This may be indicative of the effect of necking under constant elongation rate or constant tensile stress conditions according to the Considère criterion.

Effective use of flow-spoiled FBI and time-SLIP methods in the diagnostic study of an aberrant vessel of the head and neck: "left jugular venous steal by the right jugular vein".

PubMed

Kogure, Taroh; Kogure, Kyuya; Iizuka, Mitsumasa; Ino, Azusa; Ishii, Masako

2010-08-01

Three-dimensional (3D) time-of-flight (TOF) is now commonly used in routine magnetic resonance angiography (MRA) studies of the head and neck. However, there are limits to its diagnostic abilities in the clinical field and, in some instances, a more invasive supplementary examination may be required. We incidentally discovered a patient with an aberrant vessel of the head and neck that ran alongside the left carotid artery and contained a constant, slowly pulsating efferent blood flow. 3D-TOF and carotid ultrasonography could not determine the nature and origin of this vessel. Additional studies using flow-spoiled fresh blood imaging (flow-spoiled FBI) and time spatial labeling inversion pulse (time-SLIP) methods were effective in determining that the vessel was the left jugular vein, and that the continuous venous reflux was a result of a venous steal by the right jugular vein. We show that by combining different MRA techniques we can effectively achieve diagnosis without resorting to more invasive examinations. 2010 Wiley-Liss, Inc.

Low Velocity Difference Thermal Shear Layer Mixing Rate Measurements

NASA Technical Reports Server (NTRS)

Bush, Robert H.; Culver, Harry C. M.; Weissbein, Dave; Georgiadis, Nicholas J.

2013-01-01

Current CFD modeling techniques are known to do a poor job of predicting the mixing rate and persistence of slot film flow in co-annular flowing ducts with relatively small velocity differences but large thermal gradients. A co-annular test was devised to empirically determine the mixing rate of slot film flow in a constant area circular duct (D approx. 1ft, L approx. 10ft). The axial rate of wall heat-up is a sensitive measure of the mixing rate of the two flows. The inflow conditions were varied to simulate a variety of conditions characteristic of moderate by-pass ratio engines. A series of air temperature measurements near the duct wall provided a straightforward means to measure the axial temperature distribution and thus infer the mixing rate. This data provides a characterization of the slot film mixing rates encountered in typical jet engine environments. The experimental geometry and entrance conditions, along with the sensitivity of the results as the entrance conditions vary, make this a good test for turbulence models in a regime important to modern air-breathing propulsion research and development.

The use of laminar tube flow in the study of hydrodynamic and chemical influences on polymer flocculation of Escherichia coli.

PubMed

Whittington, P N; George, N

1992-08-05

The optimization of microbial flocculation for subsequent biomass separation must relate the floc properties to separation process criteria. The effects of flocculant type, dose, and hydrodynamic conditions on floc formation in laminar tube flow were determined for an Escherichia coli system. Combined with an on-line aggregation sensor, this technique allows the flocculation process to be rapidly optimized. This is important, because interbatch variation in fermentation broth has consequences for flocculation control and subsequent downstream processing. Changing tube diameter and length while maintaining a constant flow rate allowed independent study of the effects of shear and time on the flocculation rate and floc characteristics. Tube flow at higher shear rates increased the rate and completeness of flocculation, but reduced the maximum floc size attained. The mechanism for this size limitation does not appear to be fracture or erosion of existing flocs. Rearrangement of particles within the flocs appears to be most likely. The Camp number predicted the extent of flocculation obtained in terms of the reduction in primary particle number, but not in terms of floc size.

Numerical Solution of the Flow of a Perfect Gas Over A Circular Cylinder at Infinite Mach Number

NASA Technical Reports Server (NTRS)

Hamaker, Frank M.

1959-01-01

A solution for the two-dimensional flow of an inviscid perfect gas over a circular cylinder at infinite Mach number is obtained by numerical methods of analysis. Nonisentropic conditions of curved shock waves and vorticity are included in the solution. The analysis is divided into two distinct regions, the subsonic region which is analyzed by the relaxation method of Southwell and the supersonic region which was treated by the method of characteristics. Both these methods of analysis are inapplicable on the sonic line which is therefore considered separately. The shapes of the sonic line and the shock wave are obtained by iteration techniques. The striking result of the solution is the strong curvature of the sonic line and of the other lines of constant Mach number. Because of this the influence of the supersonic flow on the sonic line is negligible. On comparison with Newtonian flow methods, it is found that the approximate methods show a larger variation of surface pressure than is given by the present solution.

Bioinspired optical sensors for unmanned aerial systems

NASA Astrophysics Data System (ADS)

Chahl, Javaan; Rosser, Kent; Mizutani, Akiko

2011-04-01

Insects are dependant on the spatial, spectral and temporal distributions of light in the environment for flight control and navigation. This paper reports on flight trials of implementations of insect inspired behaviors on unmanned aerial vehicles. Optical flow methods for maintaining a constant height above ground and a constant course have been demonstrated to provide navigation capabilities that are impossible using conventional avionics sensors. Precision control of height above ground and ground course were achieved over long distances. Other vision based techniques demonstrated include a biomimetic stabilization sensor that uses the ultraviolet and green bands of the spectrum, and a sky polarization compass. Both of these sensors were tested over long trajectories in different directions, in each case showing performance similar to low cost inertial heading and attitude systems. The behaviors demonstrate some of the core functionality found in the lower levels of the sensorimotor system of flying insects and shows promise for more integrated solutions in the future.

Dissociative electron attachment to C{sub 2}F{sub 5} radicals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haughey, Sean A.; Field, Thomas A.; Langer, Judith

Dissociative electron attachment to the reactive C{sub 2}F{sub 5} molecular radical has been investigated with two complimentary experimental methods; a single collision beam experiment and a new flowing afterglow Langmuir probe technique. The beam results show that F{sup -} is formed close to zero electron energy in dissociative electron attachment to C{sub 2}F{sub 5}. The afterglow measurements also show that F{sup -} is formed in collisions between electrons and C{sub 2}F{sub 5} molecules with rate constants of 3.7 Multiplication-Sign 10{sup -9} cm{sup 3} s{sup -1} to 4.7 Multiplication-Sign 10{sup -9} cm{sup 3} s{sup -1} at temperatures of 300-600 K. Themore » rate constant increases slowly with increasing temperature, but the rise observed is smaller than the experimental uncertainty of 35%.« less

A novel modeling approach to the mixing process in twin-screw extruders

NASA Astrophysics Data System (ADS)

Kennedy, Amedu Osaighe; Penlington, Roger; Busawon, Krishna; Morgan, Andy

2014-05-01

In this paper, a theoretical model for the mixing process in a self-wiping co-rotating twin screw extruder by combination of statistical techniques and mechanistic modelling has been proposed. The approach was to examine the mixing process in the local zones via residence time distribution and the flow dynamics, from which predictive models of the mean residence time and mean time delay were determined. Increase in feed rate at constant screw speed was found to narrow the shape of the residence time distribution curve, reduction in the mean residence time and time delay and increase in the degree of fill. Increase in screw speed at constant feed rate was found to narrow the shape of the residence time distribution curve, decrease in the degree of fill in the extruder and thus an increase in the time delay. Experimental investigation was also done to validate the modeling approach.

Determining the hydraulic properties of saturated, low-permeability geological materials in the laboratory: Advances in theory and practice

USGS Publications Warehouse

Zhang, M.; Takahashi, M.; Morin, R.H.; Endo, H.; Esaki, T.; ,

2002-01-01

The accurate hydraulic characterization of low-permeability subsurface environments has important practical significance. In order to examine this issue from the perspective of laboratory-based approaches, we review some recent advancements in the theoretical analyses of three different laboratory techniques specifically applied to low-permeability geologic materials: constant-head, constant flow-rate and transient-pulse permeability tests. Some potential strategies for effectively decreasing the time required to confidently estimate the permeability of these materials are presented. In addition, a new and versatile laboratory system is introduced that can implement any of these three test methods while simultaneously subjecting a specimen to high confining pressures and pore pressures, thereby simulating in situ conditions at great depths. The capabilities and advantages of this innovative system are demonstrated using experimental data derived from Shirahama sandstone and Inada granite, two rock types widely encountered in Japan.

Predicting membrane flux decline from complex mixtures using flow-field flow fractionation measurements and semi-empirical theory.

PubMed

Pellegrino, J; Wright, S; Ranvill, J; Amy, G

2005-01-01

Flow-Field Flow Fractionation (FI-FFF) is an idealization of the cross flow membrane filtration process in that, (1) the filtration flux and crossflow velocity are constant from beginning to end of the device, (2) the process is a relatively well-defined laminar-flow hydrodynamic condition, and (3) the solutes are introduced as a pulse-input that spreads due to interactions with each other and the membrane in the dilute-solution limit. We have investigated the potential for relating FI-FFF measurements to membrane fouling. An advection-dispersion transport model was used to provide 'ideal' (defined as spherical, non-interacting solutes) solute residence time distributions (RTDs) for comparison with 'real' RTDs obtained experimentally at different cross-field velocities and solution ionic strength. An RTD moment analysis based on a particle diameter probability density function was used to extract "effective" characteristic properties, rather than uniquely defined characteristics, of the standard solute mixture. A semi-empirical unsteady-state, flux decline model was developed that uses solute property parameters. Three modes of flux decline are included: (1) concentration polarization, (2) cake buildup, and (3) adsorption on/in pores, We have used this model to test the hypothesis-that an analysis of a residence time distribution using FI-FFF can describe 'effective' solute properties or indices that can be related to membrane flux decline in crossflow membrane filtration. Constant flux filtration studies included the changes of transport hydrodynamics (solvent flux to solute back diffusion (J/k) ratios), solution ionic strength, and feed water composition for filtration using a regenerated cellulose ultrafiltration membrane. Tests of the modeling hypothesis were compared with experimental results from the filtration measurements using several correction parameters based on the mean and variance of the solute RTDs. The corrections used to modify the boundary layer mass transfer coefficient and the specific resistance of cake or adsorption layers demonstrated that RTD analysis is potentially useful technique to describe colloid properties but requires improvements.

Renormalization group analysis of anisotropic diffusion in turbulent shear flows

NASA Technical Reports Server (NTRS)

Rubinstein, Robert; Barton, J. Michael

1991-01-01

The renormalization group is applied to compute anisotropic corrections to the scalar eddy diffusivity representation of turbulent diffusion of a passive scalar. The corrections are linear in the mean velocity gradients. All model constants are computed theoretically. A form of the theory valid at arbitrary Reynolds number is derived. The theory applies only when convection of the velocity-scalar correlation can be neglected. A ratio of diffusivity components, found experimentally to have a nearly constant value in a variety of shear flows, is computed theoretically for flows in a certain state of equilibrium. The theoretical value is well within the fairly narrow range of experimentally observed values. Theoretical predictions of this diffusivity ratio are also compared with data from experiments and direct numerical simulations of homogeneous shear flows with constant velocity and scalar gradients.

Hybrid LES/RANS Simulation of Transverse Sonic Injection into a Mach 2 Flow

NASA Technical Reports Server (NTRS)

Boles, John A.; Edwards, Jack R.; Baurle, Robert A.

2008-01-01

A computational study of transverse sonic injection of air and helium into a Mach 1.98 cross-flow is presented. A hybrid large-eddy simulation / Reynolds-averaged Navier-Stokes (LES/RANS) turbulence model is used, with the two-equation Menter baseline (Menter-BSL) closure for the RANS part of the flow and a Smagorinsky-type model for the LES part of the flow. A time-dependent blending function, dependent on modeled turbulence variables, is used to shift the closure from RANS to LES. Turbulent structures are initiated and sustained through the use of a recycling / rescaling technique. Two higher-order discretizations, the Piecewise Parabolic Method (PPM) of Colella and Woodward, and the SONIC-A ENO scheme of Suresh and Huyhn are used in the study. The results using the hybrid model show reasonably good agreement with time-averaged Mie scattering data and with experimental surface pressure distributions, even though the penetration of the jet into the cross-flow is slightly over-predicted. The LES/RANS results are used to examine the validity of commonly-used assumptions of constant Schmidt and Prandtl numbers in the intense mixing zone downstream of the injection location.

Verification of Experimental Techniques for Flow Surface Determination

NASA Technical Reports Server (NTRS)

Lissenden, Cliff J.; Lerch, Bradley A.; Ellis, John R.; Robinson, David N.

1996-01-01

The concept of a yield surface is central to the mathematical formulation of a classical plasticity theory. However, at elevated temperatures, material response can be highly time-dependent, which is beyond the realm of classical plasticity. Viscoplastic theories have been developed for just such conditions. In viscoplastic theories, the flow law is given in terms of inelastic strain rate rather than the inelastic strain increment used in time-independent plasticity. Thus, surfaces of constant inelastic strain rate or flow surfaces are to viscoplastic theories what yield surfaces are to classical plasticity. The purpose of the work reported herein was to validate experimental procedures for determining flow surfaces at elevated temperatures. Since experimental procedures for determining yield surfaces in axial/torsional stress space are well established, they were employed -- except inelastic strain rates were used rather than total inelastic strains. In yield-surface determinations, the use of small-offset definitions of yield minimizes the change of material state and allows multiple loadings to be applied to a single specimen. The key to the experiments reported here was precise, decoupled measurement of axial and torsional strain. With this requirement in mind, the performance of a high-temperature multi-axial extensometer was evaluated by comparing its results with strain gauge results at room temperature. Both the extensometer and strain gauges gave nearly identical yield surfaces (both initial and subsequent) for type 316 stainless steel (316 SS). The extensometer also successfully determined flow surfaces for 316 SS at 650 C. Furthermore, to judge the applicability of the technique for composite materials, yield surfaces were determined for unidirectional tungsten/Kanthal (Fe-Cr-Al).

Streamflow record extension using power transformations and application to sediment transport

NASA Astrophysics Data System (ADS)

Moog, Douglas B.; Whiting, Peter J.; Thomas, Robert B.

1999-01-01

To obtain a representative set of flow rates for a stream, it is often desirable to fill in missing data or extend measurements to a longer time period by correlation to a nearby gage with a longer record. Linear least squares regression of the logarithms of the flows is a traditional and still common technique. However, its purpose is to generate optimal estimates of each day's discharge, rather than the population of discharges, for which it tends to underestimate variance. Maintenance-of-variance-extension (MOVE) equations [Hirsch, 1982] were developed to correct this bias. This study replaces the logarithmic transformation by the more general Box-Cox scaled power transformation, generating a more linear, constant-variance relationship for the MOVE extension. Combining the Box-Cox transformation with the MOVE extension is shown to improve accuracy in estimating order statistics of flow rate, particularly for the nonextreme discharges which generally govern cumulative transport over time. This advantage is illustrated by prediction of cumulative fractions of total bed load transport.

Experimental and computational study and development of the bituminous coal entrained-flow air-blown gasifier for IGCC

NASA Astrophysics Data System (ADS)

Abaimov, N. A.; Osipov, P. V.; Ryzhkov, A. F.

2016-10-01

In the paper the development of the advanced bituminous coal entrained-flow air- blown gasifier for the high power integrated gasification combined cycle is considered. The computational fluid dynamics technique is used as the basic development tool. The experiment on the pressurized entrained-flow gasifier was performed by “NPO CKTI” JSC for the thermochemical processes submodel verification. The kinetic constants for Kuznetsk bituminous coal (flame coal), obtained by thermal gravimetric analysis method, are used in the model. The calculation results obtained by the CFD model are in satisfactory agreements with experimental data. On the basis of the verified model the advanced gasifier structure was suggested which permits to increase the hydrogen content in the synthesis gas and consequently to improve the gas turbine efficiency. In order to meet the specified requirements vapor is added on the second stage of MHI type gasifier and heat necessary for air gasification is compensated by supplemental heating of the blasting air.

Effect of argon ion activity on the properties of Y 2O 3 thin films deposited by low pressure PACVD

NASA Astrophysics Data System (ADS)

Barve, S. A.; Jagannath; Deo, M. N.; Kishore, R.; Biswas, A.; Gantayet, L. M.; Patil, D. S.

2010-10-01

Yttrium oxide thin films are deposited by microwave electron cyclotron resonance (ECR) plasma assisted metal organic chemical vapour deposition process using an indegeneously developed Y(thd) 3 {(2,2,6,6-tetramethyl-3,5-heptanedionate)yttrium} precursor. Depositions were carried out at two different argon gas flow rates keeping precursor and oxygen gas flow rate constant. The deposited coatings are characterized by X-ray photoelectron spectroscopy (XPS), glancing angle X-ray diffraction (GIXRD) and infrared spectroscopy. Optical properties of the films are studied by spectroscopic ellipsometry. Hardness and elastic modulus of the films are measured by load depth sensing nanoindentation technique. Stability of the film and its adhesion with the substrate is inferred from the nanoscratch test. It is shown here that, the change in the argon gas flow rates changes the ionization of the gas in the microwave ECR plasma and imposes a drastic change in the characteristics like composition, structure as well as mechanical properties of the deposited film.

Transient well flow in leaky multiple-aquifer systems

NASA Astrophysics Data System (ADS)

Hemker, C. J.

1985-10-01

A previously developed eigenvalue analysis approach to groundwater flow in leaky multiple aquifers is used to derive exact solutions for transient well flow problems in leaky and confined systems comprising any number of aquifers. Equations are presented for the drawdown distribution in systems of infinite extent, caused by wells penetrating one or more of the aquifers completely and discharging each layer at a constant rate. Since the solution obtained may be regarded as a combined analytical-numerical technique, a type of one-dimensional modelling can be applied to find approximate solutions for several complicating conditions. Numerical evaluations are presented as time-drawdown curves and include effects of storage in the aquitard, unconfined conditions, partially penetrating wells and stratified aquifers. The outcome of calculations for relatively simple systems compares very well with published corresponding results. The proposed multilayer solution can be a valuable tool in aquifer test evaluation, as it provides the analytical expression required to enable the application of existing computer methods to the determination of aquifer characteristics.

Anomalous heat transport and condensation in convection of cryogenic helium

PubMed Central

Urban, Pavel; Schmoranzer, David; Hanzelka, Pavel; Sreenivasan, Katepalli R.; Skrbek, Ladislav

2013-01-01

When a hot body A is thermally connected to a cold body B, the textbook knowledge is that heat flows from A to B. Here, we describe the opposite case in which heat flows from a colder but constantly heated body B to a hotter but constantly cooled body A through a two-phase liquid–vapor system. Specifically, we provide experimental evidence that heat flows through liquid and vapor phases of cryogenic helium from the constantly heated, but cooler, bottom plate of a Rayleigh–Bénard convection cell to its hotter, but constantly cooled, top plate. The bottom plate is heated uniformly, and the top plate is cooled by heat exchange with liquid helium maintained at 4.2 K. Additionally, for certain experimental conditions, a rain of helium droplets is detected by small sensors placed in the cell at about one-half of its height. PMID:23576759

Experimental study of the solid-liquid interface in a yield-stress fluid flow upstream of a step

NASA Astrophysics Data System (ADS)

Luu, Li-Hua; Pierre, Philippe; Guillaume, Chambon

2014-11-01

We present an experimental study where a yield-stress fluid is implemented to carefully examine the interface between a liquid-like unyielded region and a solid-like yielded region. The studied hydrodynamics consists of a rectangular pipe-flow disturbed by the presence of a step. Upstream of the step, a solid-liquid interface between a dead zone and a flow zone appears. This configuration can both model geophysical erosion phenomenon in debris flows or find applications for industrial extrusion processes. We aim to investigate the dominant physical mechanism underlying the formation of the static domain, by combining the rheological characterization of the yield-stress fluid with local measurements of the related hydrodynamic parameters. In this work, we use a model fluid, namely polymer micro-gel Carbopol, that exhibits a Hershel-Bulkley viscoplastic rheology. Exploiting the fluid transparency, the flow is monitored by Particle Image Velocimetry thanks to internal visualization technique. In particular, we demonstrate that the flow above the dead zone roughly behaves as a plug flow whose velocity profile can successfully be described by a Poiseuille equation including a Hershel-Bulkley rheology (PHB theory), with exception of a thin zone at the close vicinity of the static domain. The border inside the flow zone above which the so-called PHB flow starts, is found to be the same regardless of the flow rate and to move with a constant velocity that increases with the flow rate. We interpret this feature as a slip frontier.

Thiacarbocyanine as ligand in dye-affinity chromatography for protein purification. II. Dynamic binding capacity using lysozyme as a model.

PubMed

Boto, R E F; Anyanwu, U; Sousa, F; Almeida, P; Queiroz, J A

2009-09-01

A constant development of dye-affinity chromatography to replace more traditional techniques is verified, with the aim of increasing specificity in the purification of biomolecules. The establishment of a new dye-affinity chromatographic support imposes their complete characterization, namely with relation to the binding capacity for proteins, in order to evaluate its applicability on global purification processes. Following previous studies, the adsorption of lysozyme onto a thiacarbocyanine dye immobilized on beaded cellulose was investigated. The effect of different parameters, such as temperature, ionic strength, pH, protein concentration and flow rate, on the dynamic binding capacity of the support to retain lysozyme was also studied. Increasing the temperature and the lysozyme concentration had a positive effect on the dynamic binding capacity (DBC), whereas increasing the ionic strength and the flow rate resulted in the opposite. It was also discovered that the pH used had an important impact on the lysozyme binding onto the immobilized dye. The maximum DBC value obtained for lysozyme was 8.6 mg/mL, which was achieved at 30 degrees C and pH 9 with a protein concentration of 0.5 mg/mL and a flow rate of 0.05 mL/min. The dissociation constant (K(d)) obtained was 2.61 +/- 0.36 x 10(-5 )m, proving the affinity interaction between the thiacarbocyanine dye ligand and the lysozyme. Copyright (c) 2009 John Wiley & Sons, Ltd.

Microfluidic electroporation for delivery of small molecules and genes into cells using a common DC power supply.

PubMed

Wang, Hsiang-Yu; Lu, Chang

2008-06-15

Electroporation is an efficient method of introducing foreign impermeant molecules such as drugs and genes into cells. Conventional electroporation has been based on the application of short electrical pulses (electropulsation). Electropulsation requires specialized equipment and cannot be integrated easily with techniques such as electrophoresis which is based on constant voltage. Here we demonstrate the delivery of small molecules and genes into cells, using a microfluidic electroporation technique based on constant direct current (DC) voltage that we developed earlier. We demonstrate the delivery of two molecules into Chinese hamster ovary (CHO-K1) cells: a membrane impermeable nucleic acid dye (SYTOX Green) and a plasmid vector carrying the gene for green fluorescent protein (pEGFP-C1). Our devices can exert field variations to flowing cells that are analogous to the application of single or multiple pulses by having different geometries. We investigate the effects of the electrical parameters and different geometries of the device on the transfection efficiency and cell viability. Our technique provides a simple solution to electroporation-based drug and gene delivery by eliminating the need for a pulse generator. We envision that these simple microscale electroporation devices will have the potential to work in parallel on a microchip platform and such technology will allow high-throughput functional screening of drugs and genes. (c) 2008 Wiley Periodicals, Inc.

Analysis of inlet flow distortion and turbulence effects on compressor stability

NASA Technical Reports Server (NTRS)

Melick, H. C., Jr.

1973-01-01

The effect of steady state circumferential total pressure distortion on the loss in compressor stall pressure ratio has been established by analytical techniques. Full scale engine and compressor/fan component test data were used to provide direct evaluation of the analysis. Specifically, since a circumferential total pressure distortion in an inlet system will result in unsteady flow in the coordinate system of the rotor blades, analysis of this type distortion must be performed from an unsteady aerodynamic point of view. By application of the fundamental aerothermodynamic laws to the inlet/compressor system, parameters important in the design of such a system for compatible operation have been identified. A time constant, directly related to the compressor rotor chord, was found to be significant, indicating compressor sensitivity to circumferential distortion is directly dependent on the rotor chord.

Effect of Detonation through a Turbine Stage

NASA Technical Reports Server (NTRS)

Ellis, Matthew T.

2004-01-01

Pulse detonation engines (PDE) have been investigated as a more efficient means of propulsion due to its constant volume combustion rather than the more often used constant pressure combustion of other propulsion systems. It has been proposed that a hybrid PDE-gas turbine engine would be a feasible means of improving the efficiency of the typical constant pressure combustion gas turbine cycle. In this proposed system, multiple pulse detonation tubes would replace the conventional combustor. Also, some of the compressor stages may be removed due to the pressure rise gained across the detonation wave. The benefits of higher thermal efficiency and reduced compressor size may come at a cost. The first question that arises is the unsteadiness in the flow created by the pulse detonation tubes. A constant pressure combustor has the advantage of supplying a steady and large mass flow rate. The use of the pulse detonation tubes will create an unsteady mass flow which will have currently unknown effects on the turbine located downstream of the combustor. Using multiple pulse detonation tubes will hopefully improve the unsteadiness. The interaction between the turbine and the shock waves exiting the tubes will also have an unknown effect. Noise levels are also a concern with this hybrid system. These unknown effects are being investigated using TURBO, an unsteady turbomachinery flow simulation code developed at Mississippi State University. A baseline case corresponding to a system using a constant pressure combustor with the same mass flow rate achieved with the pulse detonation hybrid system will be investigated first.

High order spectral difference lattice Boltzmann method for incompressible hydrodynamics

NASA Astrophysics Data System (ADS)

Li, Weidong

2017-09-01

This work presents a lattice Boltzmann equation (LBE) based high order spectral difference method for incompressible flows. In the present method, the spectral difference (SD) method is adopted to discretize the convection and collision term of the LBE to obtain high order (≥3) accuracy. Because the SD scheme represents the solution as cell local polynomials and the solution polynomials have good tensor-product property, the present spectral difference lattice Boltzmann method (SD-LBM) can be implemented on arbitrary unstructured quadrilateral meshes for effective and efficient treatment of complex geometries. Thanks to only first oder PDEs involved in the LBE, no special techniques, such as hybridizable discontinuous Galerkin method (HDG), local discontinuous Galerkin method (LDG) and so on, are needed to discrete diffusion term, and thus, it simplifies the algorithm and implementation of the high order spectral difference method for simulating viscous flows. The proposed SD-LBM is validated with four incompressible flow benchmarks in two-dimensions: (a) the Poiseuille flow driven by a constant body force; (b) the lid-driven cavity flow without singularity at the two top corners-Burggraf flow; and (c) the unsteady Taylor-Green vortex flow; (d) the Blasius boundary-layer flow past a flat plate. Computational results are compared with analytical solutions of these cases and convergence studies of these cases are also given. The designed accuracy of the proposed SD-LBM is clearly verified.

Focused Flow During Infiltration Into Ethanol-Contaminated Unsaturated Porous Media

NASA Astrophysics Data System (ADS)

Jazwiec, A.; Smith, J. E.

2017-12-01

The increasing commercial and industrial use of ethanol, e.g. in biofuels, has generated increased incidents of vadose zone contamination by way of ethanol spills and releases. This has increased the interest in better understanding behaviors of ethanol in unsaturated porous media and it's multiphase interactions in the vadose zone. This study uses highly controlled laboratory experiments in a 2-D (0.6mx0.6mx0.01m) flow cell to investigate water infiltration behaviors into ethanol-contaminated porous media. Ethanol and water were applied by either constant head or constant flux methods onto the surface of sands homogenously packed into the flow cell. The constant flux experiments at both low and high application rates were conducted using a rainulator with a row of hypodermic needles connected to a peristaltic pump. The constant head experiments were conducted using an 8cm diameter tension disk infiltrometer set to both low and high tensions. The presence of ethanol contamination generated solute-dependent capillarity induced focused flow (SCIFF) of water infiltration, which was primarily due to decreases in interfacial tensions at the air-liquid interfaces in the unsaturated sands as a function of ethanol concentration. SCIFF was clearly expressed as an unsaturated water flow phenomenon comprised of narrowly focused vertical flow fingers of water within the initially ethanol contaminated porous media. Using analyses of photos and video, comparisons were made between constant flux and constant head application methods. Further comparisons were made between low and high infiltration rates and the two sand textures used. A high degree of sensitivity to minor heterogeneity in relatively homogeneous sands was also observed. The results of this research have implications for rainfall infiltration into ethanol contaminated vadose zones expressing SCIFF, including implications for associated mass fluxes and the nature of flushing of ethanol from the unsaturated zone to groundwaters.

The effect of hydrogen on the parameters of plastic deformation localization in low carbon steel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lunev, Aleksey G., E-mail: agl@ispms.tsc.ru, E-mail: nadjozhkin@ispms.tsc.ru; Nadezhkin, Mikhail V., E-mail: agl@ispms.tsc.ru, E-mail: nadjozhkin@ispms.tsc.ru; Shlyakhova, Galina V., E-mail: shgv@ispms.tsc.ru

2014-11-14

In the present study, the effect of interstitial hydrogen atoms on the mechanical properties and plastic strain localization patterns in tensile tested polycrystals of low-carbon steel Fe-0.07%C has been studied using double exposure speckle photography technique. The main parameters of plastic flow localization at various stages of deformation hardening have been determined in polycrystals of steel electrolytically saturated with hydrogen in a three-electrode electrochemical cell at a controlled constant cathode potential. Also, the effect of hydrogen on changing of microstructure by using optical microscopy has been demonstrated.

Finite volume for three-flavour Partially Quenched Chiral Perturbation Theory through NNLO in the meson sector

NASA Astrophysics Data System (ADS)

Bijnens, Johan; Rössler, Thomas

2015-11-01

We present a calculation of the finite volume corrections to meson masses and decay constants in three flavour Partially Quenched Chiral Perturbation Theory (PQChPT) through two-loop order in the chiral expansion for the flavour-charged (or off-diagonal) pseudoscalar mesons. The analytical results are obtained for three sea quark flavours with one, two or three different masses. We reproduce the known infinite volume results and the finite volume results in the unquenched case. The calculation has been performed using the supersymmetric formulation of PQChPT as well as with a quark flow technique.

A preliminary study of the benefits of flying by ground speed during final approach

NASA Technical Reports Server (NTRS)

Hastings, E. C., Jr.

1978-01-01

A study was conducted to evaluate the benefits of an approach technique which utilized constant ground speed on approach. It was determined that the technique reduced the capacity losses in headwinds experienced with the currently used constant airspeed technique. The benefits of technique were found to increase as headwinds increased and as the wake avoidance separation intervals were reduced. An additional benefit noted for the constant ground speed technique was a reduction in stopping distance variance due to the approach wind environment.

Direct Determination of the Dependence of the Surface Shear and Dilatational Viscosities on the Thermodynamic State of the Interface: Theoretical Foundations.

PubMed

Lopez; Hirsa

1998-10-01

Recent developments in nonlinear optical techniques for noninvasive probing of a surfactant influenced gas/liquid interface allow for the measurement of the surfactant surface concentration, c, and thus provide new opportunities for the direct determination of its intrinsic viscosities. Here, we present the theoretical foundations, based on the Boussinesq-Scriven surface model without the usual simplification of constant viscosities, for an experimental technique to directly measure the surface shear (µs) and dilatational (kappas) viscosities of a Newtonian interface as functions of the surfactant surface concentration. This ability to directly measure the surfactant concentration permits the use of a simple surface flow for the measurement of the surface viscosities. The requirements are that the interface must be nearly flat, and the flow steady, axisymmetric, and swirling; these flow conditions can be achieved in the deep-channel viscometer driven at relatively fast rates. The tangential stress balance on such an interface leads to two equations; the balance in the azimuthal direction involves only µs and its gradients, and the balance in the radial direction involves both µs and kappas and their gradients. By further exploiting recent developments in laser-based flow measuring techniques, the surface velocities and their gradients which appear in the two equations can be measured directly. The surface tension gradient, which appears in the radial balance equation, is incorporated from the equation of state for the surfactant system and direct measurements of the surfactant surface concentration distribution. The stress balance equations are then ordinary differential equations in the surface viscosities as functions of radial position, which can be readily integrated. Since c is measured as a function of radial position, we then have a direct measurement of µs and kappas as functions of c. Numerical computations of the Navier-Stokes equations are performed to determine the appropriate conditions to achieve the requisite secondary flow. Copyright 1998 Academic Press.

μ-PIV measurements of the ensemble flow fields surrounding a migrating semi-infinite bubble.

PubMed

Yamaguchi, Eiichiro; Smith, Bradford J; Gaver, Donald P

2009-08-01

Microscale particle image velocimetry (μ-PIV) measurements of ensemble flow fields surrounding a steadily-migrating semi-infinite bubble through the novel adaptation of a computer controlled linear motor flow control system. The system was programmed to generate a square wave velocity input in order to produce accurate constant bubble propagation repeatedly and effectively through a fused glass capillary tube. We present a novel technique for re-positioning of the coordinate axis to the bubble tip frame of reference in each instantaneous field through the analysis of the sudden change of standard deviation of centerline velocity profiles across the bubble interface. Ensemble averages were then computed in this bubble tip frame of reference. Combined fluid systems of water/air, glycerol/air, and glycerol/Si-oil were used to investigate flows comparable to computational simulations described in Smith and Gaver (2008) and to past experimental observations of interfacial shape. Fluorescent particle images were also analyzed to measure the residual film thickness trailing behind the bubble. The flow fields and film thickness agree very well with the computational simulations as well as existing experimental and analytical results. Particle accumulation and migration associated with the flow patterns near the bubble tip after long experimental durations are discussed as potential sources of error in the experimental method.

Aquifer test interpretation using derivative analysis and diagnostic plots

NASA Astrophysics Data System (ADS)

Hernández-Espriú, Antonio; Real-Rangel, Roberto; Cortés-Salazar, Iván; Castro-Herrera, Israel; Luna-Izazaga, Gabriela; Sánchez-León, Emilio

2017-04-01

Pumping tests remain a method of choice to deduce fundamental aquifer properties and to assess well condition. In the oil and gas (O&G) industry, well testing has been the core technique in examining reservoir behavior over the last 50 years. The pressure derivative by Bourdet, it is perhaps, the most significant single development in the history of well test analysis. Recently, the so-called diagnostics plots (e.g. drawdown and drawdown derivative in a log-log plot) have been successfully tested in aquifers. However, this procedure is still underutilized by groundwater professionals. This research illustrates the applicability range, advantages and drawbacks (e.g. smoothing procedures) of diagnostic plots using field examples from a wide spectrum of tests (short/long tests, constant/variable flow rates, drawdown/buildup stages, pumping well/observation well) in dissimilar geological conditions. We analyze new and pre-existent aquifer tests in Mexico, USA, Canada, Germany, France and Saudi Arabia. In constant flow rate tests, our results show that derivative analysis is an easy, robust and powerful tool to assess near-borehole damage effects, formation heterogeneity, boundaries, flow regimes, infinite-acting radial stages, i.e., valid Theisian framework, and fracture-driven flow. In step tests, the effectiveness relies on high-frequency drawdown measurements. Moreover, we adapt O&G analytical solutions to cater for the conditions in groundwater systems. In this context, further parameters can be computed analytically from the plots, such as skin factor, head losses, wellbore storage, distance to the boundary, channel-aquifer and/or fracture zone width, among others. Therefore, diagnostic plots should be considered a mandatory tool for pumping tests analysis among hydrogeologists. This project has been supported by DGAPA (UNAM) under the research project PAPIIT IN-112815.

Thermal control of electroosmotic flow in a microchannel through temperature-dependent properties.

PubMed

Kwak, Ho Sang; Kim, Hyoungsoo; Hyun, Jae Min; Song, Tae-Ho

2009-07-01

A numerical investigation is conducted on the electroosmotic flow and associated heat transfer in a two-dimensional microchannel. The objective of this study is to explore a new conceptual idea that is control of an electroosmotic flow by using a thermal field effect through the temperature-dependent physical properties. Two exemplary problems are examined: a flow in a microchannel with a constant vertical temperature difference between two horizontal walls and a flow in a microchannel with the wall temperatures varying horizontally in a sinusoidal manner. The results of numerical computations showed that a proper control of thermal field may be a viable means to manipulate various non-plug-like flow patterns. A constant vertical temperature difference across the channel produces a shear flow. The horizontally-varying thermal condition results in spatial variation of physical properties to generate fluctuating flow patterns. The temperature variation at the wall with alternating vertical temperature gradient induces a wavy flow.

Graviton fluctuations erase the cosmological constant

NASA Astrophysics Data System (ADS)

Wetterich, C.

2017-10-01

Graviton fluctuations induce strong non-perturbative infrared renormalization effects for the cosmological constant. The functional renormalization flow drives a positive cosmological constant towards zero, solving the cosmological constant problem without the need to tune parameters. We propose a simple computation of the graviton contribution to the flow of the effective potential for scalar fields. Within variable gravity, with effective Planck mass proportional to the scalar field, we find that the potential increases asymptotically at most quadratically with the scalar field. The solutions of the derived cosmological equations lead to an asymptotically vanishing cosmological "constant" in the infinite future, providing for dynamical dark energy in the present cosmological epoch. Beyond a solution of the cosmological constant problem, our simplified computation also entails a sizeable positive graviton-induced anomalous dimension for the quartic Higgs coupling in the ultraviolet regime, substantiating the successful prediction of the Higgs boson mass within the asymptotic safety scenario for quantum gravity.

On accelerated flow of MHD powell-eyring fluid via homotopy analysis method

NASA Astrophysics Data System (ADS)

Salah, Faisal; Viswanathan, K. K.; Aziz, Zainal Abdul

2017-09-01

The aim of this article is to obtain the approximate analytical solution for incompressible magnetohydrodynamic (MHD) flow for Powell-Eyring fluid induced by an accelerated plate. Both constant and variable accelerated cases are investigated. Approximate analytical solution in each case is obtained by using the Homotopy Analysis Method (HAM). The resulting nonlinear analysis is carried out to generate the series solution. Finally, Graphical outcomes of different values of the material constants parameters on the velocity flow field are discussed and analyzed.

Determination of Noncovalent Binding Using a Continuous Stirred Tank Reactor as a Flow Injection Device Coupled to Electrospray Ionization Mass Spectrometry

NASA Astrophysics Data System (ADS)

Santos, Inês C.; Waybright, Veronica B.; Fan, Hui; Ramirez, Sabra; Mesquita, Raquel B. R.; Rangel, António O. S. S.; Fryčák, Petr; Schug, Kevin A.

2015-07-01

Described is a new method based on the concept of controlled band dispersion, achieved by hyphenating flow injection analysis with ESI-MS for noncovalent binding determinations. A continuous stirred tank reactor (CSTR) was used as a FIA device for exponential dilution of an equimolar host-guest solution over time. The data obtained was treated for the noncovalent binding determination using an equimolar binding model. Dissociation constants between vancomycin and Ac-Lys(Ac)-Ala-Ala-OH peptide stereoisomers were determined using both the positive and negative ionization modes. The results obtained for Ac- L-Lys(Ac)- D-Ala- D-Ala (a model for a Gram-positive bacterial cell wall) binding were in reasonable agreement with literature values made by other mass spectrometry binding determination techniques. Also, the developed method allowed the determination of dissociation constants for vancomycin with Ac- L-Lys(Ac)- D-Ala- L-Ala, Ac- L-Lys(Ac)- L-Ala- D-Ala, and Ac- L-Lys(Ac)- L-Ala- L-Ala. Although some differences in measured binding affinities were noted using different ionization modes, the results of each determination were generally consistent. Differences are likely attributable to the influence of a pseudo-physiological ammonium acetate buffer solution on the formation of positively- and negatively-charged ionic complexes.

Development of a modified Hess-Murray law for non-Newtonian fluids in bifurcating micro-channels

NASA Astrophysics Data System (ADS)

Emerson, David; Barber, Robert

2012-11-01

Microfluidic manifolds frequently require the use of bifurcating channels and these can be used to create precise concentration gradients for chemical applications. More recently, novel devices have been attempting to replicate vasculatures or bronchial structures occurring in nature with the goal of creating artificial bifurcations that mimic the basic principles of designs found in nature. In previous work, we have used the biological principles behind the Hess-Murray Law, where bifurcating structures exhibit a constant stress profile and follow a third-power rule, to enable rectangular or trapezoidal micro-channels to be fabricated using conventional lithographic or wet-etching techniques. Using biological principles to design man made devices is generally referred to as biomimetics and this approach has found success in a range of new and emerging topics. However, our previous work was limited to Newtonian flows. More recently, we have used the Rabinovitsch-Mooney equation to be able to extend our analysis to non-Newtonian fluids. This has allowed us to develop a new rule that can provide a design criterion to predict channel dimensions for non-Newtonian flows obeying a constant stress biological principle. The Engineering and Physical Sciences Research Council for support of CCP12 and Programme Grant award (grant number EP/I011927/1).

Imaging electron motion in graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhandari, Sagar; Westervelt, Robert M.

A cooled scanning probe microscope (SPM) is an ideal tool to image electronic motion in graphene: the SPM tip acts as a scanning gate, which interacts with the electron gas below. We introduce the technique using our group's previous work on imaging electron flow from a quantum point contact in a GaAs 2DEG and tuning an InAs quantum dot in an InAs/InP nanowire. Carriers in graphene have very different characteristics: electrons and holes travel at a constant speed with no bandgap, and they pass through potential barriers via Klein tunneling. In this paper, we review the extension of SPM imagingmore » techniques to graphene. We image the cyclotron orbits passing between two narrow contacts in a single-atomic-layer graphene device in a perpendicular magnetic field. Magnetic focusing produces a peak in transmission between the contacts when the cyclotron diameter is equal to the contact spacing. The charged SPM tip deflects electrons passing from one contact to the other, changing the transmission when it interrupts the flow. By displaying the change in transmission as the tip is raster scanned above the sample, an image of flow is obtained. In addition, we have developed a complementary technique to image electronic charge using a cooled scanning capacitance microscope (SCM) that uses a sensitive charge preamplifier near the SPM tip to achieve a charge noise level 0.13 e Hz -1/2 with high spatial resolution 100 nm. The cooled SPM and SCM can be used to probe the motion of electrons on the nanoscale in graphene devices.« less

Imaging electron motion in graphene

DOE PAGES

Bhandari, Sagar; Westervelt, Robert M.

2017-01-05

A cooled scanning probe microscope (SPM) is an ideal tool to image electronic motion in graphene: the SPM tip acts as a scanning gate, which interacts with the electron gas below. We introduce the technique using our group's previous work on imaging electron flow from a quantum point contact in a GaAs 2DEG and tuning an InAs quantum dot in an InAs/InP nanowire. Carriers in graphene have very different characteristics: electrons and holes travel at a constant speed with no bandgap, and they pass through potential barriers via Klein tunneling. In this paper, we review the extension of SPM imagingmore » techniques to graphene. We image the cyclotron orbits passing between two narrow contacts in a single-atomic-layer graphene device in a perpendicular magnetic field. Magnetic focusing produces a peak in transmission between the contacts when the cyclotron diameter is equal to the contact spacing. The charged SPM tip deflects electrons passing from one contact to the other, changing the transmission when it interrupts the flow. By displaying the change in transmission as the tip is raster scanned above the sample, an image of flow is obtained. In addition, we have developed a complementary technique to image electronic charge using a cooled scanning capacitance microscope (SCM) that uses a sensitive charge preamplifier near the SPM tip to achieve a charge noise level 0.13 e Hz -1/2 with high spatial resolution 100 nm. The cooled SPM and SCM can be used to probe the motion of electrons on the nanoscale in graphene devices.« less

User Guide for Compressible Flow Toolbox Version 2.1 for Use With MATLAB(Registered Trademark); Version 7

NASA Technical Reports Server (NTRS)

Melcher, Kevin J.

2006-01-01

This report provides a user guide for the Compressible Flow Toolbox, a collection of algorithms that solve almost 300 linear and nonlinear classical compressible flow relations. The algorithms, implemented in the popular MATLAB programming language, are useful for analysis of one-dimensional steady flow with constant entropy, friction, heat transfer, or shock discontinuities. The solutions do not include any gas dissociative effects. The toolbox also contains functions for comparing and validating the equation-solving algorithms against solutions previously published in the open literature. The classical equations solved by the Compressible Flow Toolbox are: isentropic-flow equations, Fanno flow equations (pertaining to flow of an ideal gas in a pipe with friction), Rayleigh flow equations (pertaining to frictionless flow of an ideal gas, with heat transfer, in a pipe of constant cross section.), normal-shock equations, oblique-shock equations, and Prandtl-Meyer expansion equations. At the time this report was published, the Compressible Flow Toolbox was available without cost from the NASA Software Repository.

Effect of dissolved organic matter on pre-equilibrium passive sampling: A predictive QSAR modeling study.

PubMed

Lin, Wei; Jiang, Ruifen; Shen, Yong; Xiong, Yaxin; Hu, Sizi; Xu, Jianqiao; Ouyang, Gangfeng

2018-04-13

Pre-equilibrium passive sampling is a simple and promising technique for studying sampling kinetics, which is crucial to determine the distribution, transfer and fate of hydrophobic organic compounds (HOCs) in environmental water and organisms. Environmental water samples contain complex matrices that complicate the traditional calibration process for obtaining the accurate rate constants. This study proposed a QSAR model to predict the sampling rate constants of HOCs (polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs) and pesticides) in aqueous systems containing complex matrices. A homemade flow-through system was established to simulate an actual aqueous environment containing dissolved organic matter (DOM) i.e. humic acid (HA) and (2-Hydroxypropyl)-β-cyclodextrin (β-HPCD)), and to obtain the experimental rate constants. Then, a quantitative structure-activity relationship (QSAR) model using Genetic Algorithm-Multiple Linear Regression (GA-MLR) was found to correlate the experimental rate constants to the system state including physicochemical parameters of the HOCs and DOM which were calculated and selected as descriptors by Density Functional Theory (DFT) and Chem 3D. The experimental results showed that the rate constants significantly increased as the concentration of DOM increased, and the enhancement factors of 70-fold and 34-fold were observed for the HOCs in HA and β-HPCD, respectively. The established QSAR model was validated as credible (R Adj. 2 =0.862) and predictable (Q 2 =0.835) in estimating the rate constants of HOCs for complex aqueous sampling, and a probable mechanism was developed by comparison to the reported theoretical study. The present study established a QSAR model of passive sampling rate constants and calibrated the effect of DOM on the sampling kinetics. Copyright © 2018 Elsevier B.V. All rights reserved.

Correlation between cerebral hemodynamic and perfusion pressure changes in non-human primates

NASA Astrophysics Data System (ADS)

Ruesch, A.; Smith, M. A.; Wollstein, G.; Sigal, I. A.; Nelson, S.; Kainerstorfer, J. M.

2017-02-01

The mechanism that maintains a stable blood flow in the brain despite changes in cerebral perfusion pressure (CPP), and therefore guaranties a constant supply of oxygen and nutrients to the neurons, is known as cerebral auto-regulation (CA). In a certain range of CPP, blood flow is mediated by a vasomotor adjustment in vascular resistance through dilation of blood vessels. CA is known to be impaired in diseases like traumatic brain injury, Parkinson's disease, stroke, hydrocephalus and others. If CA is impaired, blood flow and pressure changes are coupled and thee oxygen supply might be unstable. Lassen's blood flow auto-regulation curve describes this mechanism, where a plateau of stable blood flow in a specific range of CPP corresponds to intact auto-regulation. Knowing the limits of this plateau and maintaining CPP within these limits can improve patient outcome. Since CPP is influenced by both intracranial pressure and arterial blood pressure, long term changes in either can lead to auto-regulation impairment. Non-invasive methods for monitoring blood flow auto-regulation are therefore needed. We propose too use Near infrared spectroscopy (NIRS) too fill this need. NIRS is an optical technique, which measures microvascular changes in cerebral hemoglobin concentration. We performed experiments on non-human primates during exsanguination to demonstrate that thee limits of blood flow auto-regulation can be accessed with NIRS.

Characterization of Preferential Flow Path in Fractured Rock Using Heat-pulse Flowmeter

NASA Astrophysics Data System (ADS)

Lee, Tsai-Ping; Lin, Ming-Hsuan; Chuang, Po-Yu; Chia, Yeeping

2015-04-01

Rigorous thinking on how to dispose radioactive wastes safely is essential to mankind and living environment. The concepts of multiple barriers and deep geologic disposal remain the preferred option to retard the radionuclide migration in most countries. However, the investigation of preferential groundwater flow path in a fractured rock is a challenge to the characterization of potential disposal site. Heat-pulse flowmeter is a developing logging tool for measuring the vertical flow velocity in a borehole under a constant pumping or injection rate and provides a promising direct measurement method for determining the vertical distribution of hydraulic conductivity of formation. As heat-pulse flowmeter is a potential technique to measure low-velocity borehole flow, we adopted it to test the feasibility of detecting permeable fractures. Besides, a new magnetic tracer made by nano-iron particles is developed to identify the possible flow path precisely and to verify the permeable section detected by the heat-pulse flowmeter. The magnetic tracer was received by a magnet array and can also be detected by a sensor of electric conductivity. The test site is located in the Heshe of Taiwan. Eight wells were established in a fractured sandy siltstone for characterizing the fracture network. The test wells are 25 to 45 m depth and opened ranging from 15 to 45 m. Prior to the heat-pulse flowmeter measurement, we also performed surface geological investigation, pumping test, geophysical logging, and salt tracer test. Field measurements using heat-pulse flowmeter were then conducted at a constant pumping rate. The measurement interval is 50 to 100 cm in depth but improved to 25 cm near the relatively permeable zone. Based on the results of heat-pulse flowmeter, several permeable sections were identified. The magnetic tracer tests were then conducted to verify the potential preferential flow pathway between adjacent wells. Test results indicated that water flow in borehole is produced primarily from a few fractures. However, the large aperture and high density of fractures did not certainly correlate well to the permeable section. Integration of heat-pulse flowmeter measurement with other in-situ tests, it is possible to identify the exact location of the highly permeable fractures.

A Two-Dimensional Flow Sensor with Integrated Micro Thermal Sensing Elements and a Back Propagation Neural Network

PubMed Central

Que, Ruiyi; Zhu, Rong

2014-01-01

This paper demonstrates a novel flow sensor with two-dimensional 360° direction sensitivity achieved with a simple structure and a novel data fusion algorithm. Four sensing elements with roundabout wires distributed in four quadrants of a circle compose the sensor probe, and work in constant temperature difference (CTD) mode as both Joule heaters and temperature detectors. The magnitude and direction of a fluid flow are measured by detecting flow-induced temperature differences among the four elements. The probe is made of Ti/Au thin-film with a diameter of 2 mm, and is fabricated using micromachining techniques. When a flow goes through the sensor, the flow-induced temperature differences are detected by the sensing elements that also serve as the heaters of the sensor. By measuring the temperature differences among the four sensing elements symmetrically distributed in the sensing area, a full 360° direction sensitivity can be obtained. By using a BP neural network to model the relationship between the readouts of the four sensor elements and flow parameters and execute data fusion, the magnitude and direction of the flow can be deduced. Validity of the sensor design was proven through both simulations and experiments. Wind tunnel experimental results show that the measurement accuracy of the airflow speed reaches 0.72 m/s in the range of 3 m/s–30 m/s and the measurement accuracy of flow direction angle reaches 1.9° in the range of 360°. PMID:24385032

A two-dimensional flow sensor with integrated micro thermal sensing elements and a back propagation neural network.

PubMed

Que, Ruiyi; Zhu, Rong

2013-12-31

This paper demonstrates a novel flow sensor with two-dimensional 360° direction sensitivity achieved with a simple structure and a novel data fusion algorithm. Four sensing elements with roundabout wires distributed in four quadrants of a circle compose the sensor probe, and work in constant temperature difference (CTD) mode as both Joule heaters and temperature detectors. The magnitude and direction of a fluid flow are measured by detecting flow-induced temperature differences among the four elements. The probe is made of Ti/Au thin-film with a diameter of 2 mm, and is fabricated using micromachining techniques. When a flow goes through the sensor, the flow-induced temperature differences are detected by the sensing elements that also serve as the heaters of the sensor. By measuring the temperature differences among the four sensing elements symmetrically distributed in the sensing area, a full 360° direction sensitivity can be obtained. By using a BP neural network to model the relationship between the readouts of the four sensor elements and flow parameters and execute data fusion, the magnitude and direction of the flow can be deduced. Validity of the sensor design was proven through both simulations and experiments. Wind tunnel experimental results show that the measurement accuracy of the airflow speed reaches 0.72 m/s in the range of 3 m/s-30 m/s and the measurement accuracy of flow direction angle reaches 1.9° in the range of 360°.

Bio-medical flow sensor. [intrvenous procedures

NASA Technical Reports Server (NTRS)

Winkler, H. E. (Inventor)

1981-01-01

A bio-medical flow sensor including a packageable unit of a bottle, tubing and hypodermic needle which can be pre-sterilized and is disposable. The tubing has spaced apart tubular metal segments. The temperature of the metal segments and fluid flow therein is sensed by thermistors and at a downstream location heat is input by a resistor to the metal segment by a control electronics. The fluids flow and the electrical power required for the resisto to maintain a constant temperature differential between the tubular metal segments is a measurable function of fluid flow through the tubing. The differential temperature measurement is made in a control electronics and also can be used to control a flow control valve or pump on the tubing to maintain a constant flow in the tubing and to shut off the tubing when air is present in the tubing.

Automatic exposure control systems designed to maintain constant image noise: effects on computed tomography dose and noise relative to clinically accepted technique charts.

PubMed

Favazza, Christopher P; Yu, Lifeng; Leng, Shuai; Kofler, James M; McCollough, Cynthia H

2015-01-01

To compare computed tomography dose and noise arising from use of an automatic exposure control (AEC) system designed to maintain constant image noise as patient size varies with clinically accepted technique charts and AEC systems designed to vary image noise. A model was developed to describe tube current modulation as a function of patient thickness. Relative dose and noise values were calculated as patient width varied for AEC settings designed to yield constant or variable noise levels and were compared to empirically derived values used by our clinical practice. Phantom experiments were performed in which tube current was measured as a function of thickness using a constant-noise-based AEC system and the results were compared with clinical technique charts. For 12-, 20-, 28-, 44-, and 50-cm patient widths, the requirement of constant noise across patient size yielded relative doses of 5%, 14%, 38%, 260%, and 549% and relative noises of 435%, 267%, 163%, 61%, and 42%, respectively, as compared with our clinically used technique chart settings at each respective width. Experimental measurements showed that a constant noise-based AEC system yielded 175% relative noise for a 30-cm phantom and 206% relative dose for a 40-cm phantom compared with our clinical technique chart. Automatic exposure control systems that prescribe constant noise as patient size varies can yield excessive noise in small patients and excessive dose in obese patients compared with clinically accepted technique charts. Use of noise-level technique charts and tube current limits can mitigate these effects.

From catastrophic acceleration to deceleration of liquid plugs in prewetted capillary tubes

NASA Astrophysics Data System (ADS)

Magniez, Juan; Baudoin, Michael; Zoueshtiagh, Farzam; Lemac/Lics Team

2016-11-01

Liquid/gas flows in capillaries are involved in a multitude of systems including flow in porous media, petroleum extraction, imbibition of paper or flows in pulmonary airways in pathological conditions. Liquid plugs, witch compose the biphasic flows, can have a dramatic impact on patients with pulmonary obstructive diseases, since they considerably alter the circulation of air in the airways and thus can lead to severe breathing difficulties. Here, the dynamics of liquid plugs in prewetted capillary tube is investigated experimentally and theoretically, with a particular emphasis on the role of the prewetting films and of the driving condition (constant flow rate, constant pressure). For both driving conditions, the plugs can either experience a continuous increase or decrease of their size. While this phenomenon is regular in the case of imposed flow rate, a constant pressure head can lead to a catastrophic acceleration of the plug and eventually its rupture or a dramatic increase of the plug size. A theoretical model is proposed to explain the transition between theses two regimes. These results give a new insight on the critical pressure required for airways obstruction and reopening. IEMN, International Laboratory LEMAC/LICS, UMR CNRS 8520, University of Lille.

An exploration of the reflow technique for the fabrication of an in vitro microvascular system to study occlusive clots.

PubMed

Li, Yang; Pan, Chuer; Li, Yunfeng; Kumacheva, Eugenia; Ramachandran, Arun

2017-09-08

Embolic ischemia and pulmonary embolism are health emergencies that arise when a particle such as a blood clot occludes a smaller blood vessel in the brain or the lungs, and restricts flow of blood downstream of the vessel. In this work, the reflow technique (Wang et al. Biomed. Microdevices 2007, 9, 657) was adapted to produce a microchannel network that mimics the occlusion process. The technique was first revisited and a simple geometrical model was developed to quantitatively explain the shapes of the resulting microchannels for different reflow parameters. A critical modification was introduced to the reflow protocol to fabricate nearly circular microchannels of different diameters from the same master, which is not possible with the traditional reflow technique. To simulate the phenomenon of occlusion by clots, a microchannel network with three generations of branches with different diameters and branching angles was fabricated, into which fibrin clots were introduced. At low constant pressure drop (ΔP), a clot blocked a branch entrance only partially, while at higher ΔP, the branch was completely blocked. Instances of simultaneous blocking of multiple channels by clots, and the consequent changes in the flow rates in the unblocked branches of the network, were also monitored. This work provides the framework for a systematic study of the distribution of clots in a network, and the rate of dissolution of embolic clots upon the introduction of a thrombolytic drug into the network.

Pulse echo and combined resonance techniques: a full set of LGT acoustic wave constants and temperature coefficients.

PubMed

Sturtevant, Blake T; Davulis, Peter M; da Cunha, Mauricio Pereira

2009-04-01

This work reports on the determination of langatate elastic and piezoelectric constants and their associated temperature coefficients employing 2 independent methods, the pulse echo overlap (PEO) and a combined resonance technique (CRT) to measure bulk acoustic wave (BAW) phase velocities. Details on the measurement techniques are provided and discussed, including the analysis of the couplant material in the PEO technique used to couple signal to the sample, which showed to be an order of magnitude more relevant than the experimental errors involved in the data extraction. At room temperature, elastic and piezoelectric constants were extracted by the PEO and the CRT methods and showed results consistent to within a few percent for the elastic constants. Both raw acquired data and optimized constants, based on minimization routines applied to all the modes involved in the measurements, are provided and discussed. Comparison between the elastic constants and their temperature behavior with the literature reveals the recent efforts toward the consistent growth and characterization of LGT, in spite of significant variations (between 1 and 30%) among the constants extracted by different groups at room temperature. The density, dielectric permittivity constants, and respective temperature coefficients used in this work have also been independently determined based on samples from the same crystal boule. The temperature behavior of the BAW modes was extracted using the CRT technique, which has the advantage of not relying on temperature dependent acoustic couplants. Finally, the extracted temperature coefficients for the elastic and piezoelectric constants between room temperature and 120 degrees C are reported and discussed in this work.

System Regulates the Water Contents of Fuel-Cell Streams

NASA Technical Reports Server (NTRS)

Vasquez, Arturo; Lazaroff, Scott

2005-01-01

An assembly of devices provides for both humidification of the reactant gas streams of a fuel cell and removal of the product water (the water generated by operation of the fuel cell). The assembly includes externally-sensing forward-pressure regulators that supply reactant gases (fuel and oxygen) at variable pressures to ejector reactant pumps. The ejector supply pressures depend on the consumption flows. The ejectors develop differential pressures approximately proportional to the consumption flow rates at constant system pressure and with constant flow restriction between the mixer-outlet and suction ports of the ejectors. For removal of product water from the circulating oxygen stream, the assembly includes a water/gas separator that contains hydrophobic and hydrophilic membranes. The water separator imposes an approximately constant flow restriction, regardless of the quality of the two-phase flow that enters it from the fuel cell. The gas leaving the water separator is nearly 100 percent humid. This gas is returned to the inlet of the fuel cell along with a quantity of dry incoming oxygen, via the oxygen ejector, thereby providing some humidification.

Analysis and Modeling of a Two-Phase Jet Pump of a Thermal Management System for Aerospace Applications

NASA Technical Reports Server (NTRS)

Sherif, S.A.; Hunt, P. L.; Holladay, J. B.; Lear, W. E.; Steadham, J. M.

1998-01-01

Jet pumps are devices capable of pumping fluids to a higher pressure by inducing the motion of a secondary fluid employing a high speed primary fluid. The main components of a jet pump are a primary nozzle, secondary fluid injectors, a mixing chamber, a throat, and a diffuser. The work described in this paper models the flow of a two-phase primary fluid inducing a secondary liquid (saturated or subcooled) injected into the jet pump mixing chamber. The model is capable of accounting for phase transformations due to compression, expansion, and mixing. The model is also capable of incorporating the effects of the temperature and pressure dependency in the analysis. The approach adopted utilizes an isentropic constant pressure mixing in the mixing chamber and at times employs iterative techniques to determine the flow conditions in the different parts of the jet pump.

Large-Scale Coherent Vortex Formation in Two-Dimensional Turbulence

NASA Astrophysics Data System (ADS)

Orlov, A. V.; Brazhnikov, M. Yu.; Levchenko, A. A.

2018-04-01

The evolution of a vortex flow excited by an electromagnetic technique in a thin layer of a conducting liquid was studied experimentally. Small-scale vortices, excited at the pumping scale, merge with time due to the nonlinear interaction and produce large-scale structures—the inverse energy cascade is formed. The dependence of the energy spectrum in the developed inverse cascade is well described by the Kraichnan law k -5/3. At large scales, the inverse cascade is limited by cell sizes, and a large-scale coherent vortex flow is formed, which occupies almost the entire area of the experimental cell. The radial profile of the azimuthal velocity of the coherent vortex immediately after the pumping was switched off has been established for the first time. Inside the vortex core, the azimuthal velocity grows linearly along a radius and reaches a constant value outside the core, which agrees well with the theoretical prediction.

Experiences in using DISCUS for visualizing human communication

NASA Astrophysics Data System (ADS)

Groehn, Matti; Nieminen, Marko; Haho, Paeivi; Smeds, Riitta

2000-02-01

In this paper, we present further improvement to the DISCUS software that can be used to record and analyze the flow and constants of business process simulation session discussion. The tool was initially introduced in 'visual data exploration and analysis IV' conference. The initial features of the tool enabled the visualization of discussion flow in business process simulation sessions and the creation of SOM analyses. The improvements of the tool consists of additional visualization possibilities that enable quick on-line analyses and improved graphical statistics. We have also created the very first interface to audio data and implemented two ways to visualize it. We also outline additional possibilities to use the tool in other application areas: these include usability testing and the possibility to use the tool for capturing design rationale in a product development process. The data gathered with DISCUS may be used in other applications, and further work may be done with data ming techniques.

Laser Doppler velocimeter system simulation for sensing aircraft wake vortices

NASA Technical Reports Server (NTRS)

Thomson, J. A. L.; Meng, J. C. S.

1974-01-01

A hydrodynamic model of aircraft vortex wakes in an irregular wind shear field near the ground is developed and used as a basis for modeling the characteristics of a laser Doppler detection and vortex location system. The trailing vortex sheet and the wind shear are represented by discrete free vortices distributed over a two-dimensional grid. The time dependent hydrodynamic equations are solved by direct numerical integration in the Boussinesq approximation. The ground boundary is simulated by images, and fast Fourier Transform techniques are used to evaluate the vorticity stream function. The atmospheric turbulence was simulated by constructing specific realizations at time equal to zero, assuming that Kolmogoroff's law applies, and that the dissipation rate is constant throughout the flow field. The response of a simulated laser Doppler velocimeter is analyzed by simulating the signal return from the flow field as sensed by a simulation of the optical/electronic system.

Visualization of the separation and subsequent transition near the leading edge of airfoils

NASA Technical Reports Server (NTRS)

Arena, A. V.; Mueller, T. J.

1978-01-01

A visual study was performed using the low speed smoke wind tunnels with the objective of obtaining a better understanding of the structure of leading edge separation bubbles on airfoils. The location of separation, transition and reattachment for a cylindrical nose constant-thickness airfoil model were obtained from smoke photographs and surface oil flow techniques. These data, together with static pressure distributions along the leading edge and upper surface of the model, produced the influence of Reynolds number, angle of attack, and trailing edge flap angle on the size and characteristics of the bubble. Additional visual insight into the unsteady nature of the separation bubble was provided by high speed 16 mm movies. The 8 mm color movies taken of the surface oil flow supported the findings of the high speed movies and clearly showed the formation of a scalloped spanwise separation line at the higher Reynolds number.

A review of turbulent-boundary-layer heat transfer research at Stanford, 1958-1983

NASA Technical Reports Server (NTRS)

Moffat, R. J.; Kays, W. M.

1984-01-01

For the past 25 years, there has existed in the Thermosciences Laboratory of the Mechanical Engineering Department of Stanford University a research program, primarily experimental, concerned with heat transfer through turbulent boundary layers. In the early phases of the program, the topics considered were the simple zero-pressure-gradient turbulent boundary layer with constant and with varying surface temperature, and the accelerated boundary layer. Later equilibrium boundary layers were considered along with factors affecting the boundary layer, taking into account transpired flows, flows with axial pressure gradients, transpiration, acceleration, deceleration, roughness, full-coverage film cooling, surface curvature, free convection, and mixed convection. A description is provided of the apparatus and techniques used, giving attention to the smooth plate rig, the rough plate rig, the full-coverage film cooling rig, the curvature rig, the concave wall rig, the mixed convection tunnel, and aspects of data reduction and uncertainty analysis.

Fluid Dynamics Prize Otto Laporte Lecture:Turbulence and Aeroacoustics

NASA Astrophysics Data System (ADS)

Comte-Bellot, Genevieve

2014-11-01

Some significant advances obtained over the years for two closely related fields, Turbulence and Aeroacoustics, are presented. Particular focus is placed on experimental results and on physical mechanisms. For example, for a 2D channel flow, skewness factors of velocity fluctuations are discussed. The study of isotropic turbulence generated by grids in the «Velvet wind tunnel» of Stanley Corrsin, constitutes a masterpiece. Of particular note are the Eulerian memory times, analysed for all wavenumbers. Concerning hot-wire anemometry, the potential of the new constant voltage technique is presented. Some results obtained with Particule Image Velocimetry are also reported. Two flow control examples are illustrated: lift generation for a circular cylinder, and noise reduction for a high speed jet. Finally, the propagation of acoustic waves through turbulence is considered. Experimental data are here completed by numerical simulations showing the possible occurrence of caustics.

Gaseous film cooling investigation in a multi-element splash platelet injector

NASA Astrophysics Data System (ADS)

Yin, Liang; Liu, Weiqiang

2018-03-01

Film cooling is an effective technique that protects chamber walls in rocket combustion against chemical attacks and heat fluxes. This study discusses cooling effect in a multi-element GO2/CH4 splash platelet injector. Influence parameters, such as slot height, slot number, percentage of coolant, and injection position on cooling effect, were investigated. GCH4 with 298.15 K was applied as film coolant. In the first step, slot heights of 0.2 and 0.4 mm were compared by applying a constant film mass flow rate. Temperature, CH4 mole fraction distribution, and flow field structure were obtained. The effects of slot number, percentage of coolant, and injection position on wall temperature distribution were then determined. Finally, the reasons for the low cooling efficiency were analyzed. Improvement in the method is proposed to achieve improved cooling effect for splash platelet injectors.

Laser Measurements of the H Atom + Ozone Rate Constant at Atmospheric Temperatures

NASA Astrophysics Data System (ADS)

Liu, Y.; Smith, G. P.; Peng, J.; Reppert, K. J.; Callahan, S. L.

2015-12-01

The exothermic H + O3 reaction produces OH(v) Meinel band emissions, used to derive mesospheric H concentrations and chemical heating rates. We have remeasured its rate constant to reduce resulting uncertainties and the measurement extend to lower mesospheric temperatures using modern laser techniques. H atoms are produced by pulsed ultraviolet laser trace photolysis of O3, followed by reaction of O(D) with added H2. A second, delayed, frequency-mixed dye laser measures the reaction decay rate with the remaining ozone by laser induced fluorescence. We monitor either the H atom decay by 2 photon excitation at 205 nm and detection of red fluorescence, or the OH(v=9) product time evolution with excitation of the B-X (0,9) band at 237 nm and emission in blue B-A bands. By cooling the enclosed low pressure flow cell we obtained measurements from 146-305 K. Small kinetic modeling corrections are made for secondary regeneration of H atoms. The results fully confirm the current NASA JPL recommendation for this rate constant, and establish its extrapolation down to the lower temperatures of the mesosphere. This work was supported by the NSF Aeronomy Program and an NSF Physics summer REU student grant.

A new analytical solution solved by triple series equations method for constant-head tests in confined aquifers

NASA Astrophysics Data System (ADS)

Chang, Ya-Chi; Yeh, Hund-Der

2010-06-01

The constant-head pumping tests are usually employed to determine the aquifer parameters and they can be performed in fully or partially penetrating wells. Generally, the Dirichlet condition is prescribed along the well screen and the Neumann type no-flow condition is specified over the unscreened part of the test well. The mathematical model describing the aquifer response to a constant-head test performed in a fully penetrating well can be easily solved by the conventional integral transform technique under the uniform Dirichlet-type condition along the rim of wellbore. However, the boundary condition for a test well with partial penetration should be considered as a mixed-type condition. This mixed boundary value problem in a confined aquifer system of infinite radial extent and finite vertical extent is solved by the Laplace and finite Fourier transforms in conjunction with the triple series equations method. This approach provides analytical results for the drawdown in a partially penetrating well for arbitrary location of the well screen in a finite thickness aquifer. The semi-analytical solutions are particularly useful for the practical applications from the computational point of view.

Non-Friedmann cosmology for the Local Universe, significance of the universal Hubble constant, and short-distance indicators of dark energy

NASA Astrophysics Data System (ADS)

Chernin, A. D.; Teerikorpi, P.; Baryshev, Yu. V.

2006-09-01

Based on the increasing evidence of the cosmological relevance of the local Hubble flow, we consider a simple analytical cosmological model for the Local Universe. This is a non-Friedmann model with a non-uniform static space-time. The major dynamical factor controlling the local expansion is the antigravity produced by the omnipresent and permanent dark energy of the cosmic vacuum (or the cosmological constant). The antigravity dominates at larger distances than 1-2 Mpc from the center of the Local group. The model gives a natural explanation of the two key quantitative characteristics of the local expansion flow, which are the local Hubble constant and the velocity dispersion of the flow. The observed kinematical similarity of the local and global flows of expansion is clarified by the model. We analytically demonstrate the efficiency of the vacuum cooling mechanism that allows one to see the Hubble law this close to the Local group. The "universal Hubble constant" HV (≈60 km s-1 Mpc-1), depending only on the vacuum density, has special significance locally and globally. The model makes a number of verifiable predictions. It also unexpectedly shows that the dwarf galaxies of the local flow with the shortest distances and lowest redshifts may be the most sensitive indicators of dark energy in our neighborhood.

3-Dimensional numerical study of cooling performance of a heat sink with air-water flow through mini-channel

NASA Astrophysics Data System (ADS)

Majumder, Sambit; Majumder, Abhik; Bhaumik, Swapan

2016-07-01

The present microelectronics market demands devices with high power dissipation capabilities having enhanced cooling per unit area. The drive for miniaturizing the devices to even micro level dimensions is shooting up the applied heat flux on such devices, resulting in complexity in heat transfer and cooling management. In this paper, a method of CPU processor cooling is introduced where active and passive cooling techniques are incorporated simultaneously. A heat sink consisting of fins is designed, where water flows internally through the mini-channel fins and air flows externally. Three dimensional numerical simulations are performed for large set of Reynolds number in laminar region using finite volume method for both developing flows. The dimensions of mini-channel fins are varied for several aspect ratios such as 1, 1.33, 2 and 4. Constant temperature (T) boundary condition is applied at heat sink base. Channel fluid temperature, pressure drop are analyzed to obtain best cooling option in the present study. It has been observed that as the aspect ratio of the channel decreases Nusselt number decreases while pressure drop increases. However, Nusselt number increases with increase in Reynolds number.

Feasibility study of three-dimensional holographic interferometry for aerodynamics

NASA Technical Reports Server (NTRS)

Craig, J. E.

1983-01-01

Laser holographic interferometry was tried as a nonintrusive diagnostic tool for studying unsteady two dimensional flows. A NACA 0012 airfoil was tested, while undergoing dynamic stall, over a range of Mach numbers of 0.3 to 0.5, Reynolds number of 0.5 x 10 to the 6th power to 2 x 10 to the 6th power, and at reduced frequencies of 0.015 to 0.15. It was found that both quantitative and qualitative data could be obtained by the technique. Surface pressures on the airfoil can be measured to within 1% of those measured with orifices and pressure transducers when the flow is attached. Velocity profiles were measured near the wake region, and they compared very well with laser velocimeter data for attached flows. For separated flows with large scale vortices, densities can be measured, but pressures and velocities cannot be deduced with the assumption of constant pressure gradient in the normal direction. The sensitivity of the interferograms was good at a Mach number of 0.4 and a Reynolds number of 4 x 10 to the 6th power/ft; the sensitivity worsened at smaller Mach numbers and Reynolds numbers, and improved at larger ones.

Measurement of discharge using tracers

USGS Publications Warehouse

Kilpatrick, Frederick A.; Cobb, Ernest D.

1984-01-01

The development of fluorescent dyes and fluorometers that can measure these dyes at very low concentrations has made dye-dilution methods practical for measuring discharge. These methods are particularly useful for determining discharge under certain flow conditions that are unfavorable for current meter measurements. These include small streams, canals, and pipes where:Turbulence is excessive for current meter measurement but conducive to good mixing.Moving rocks and debris are damaging to any instruments placed in the flow.Cross-sectional areas or velocities are indeterminant or changing.There are some unsteady flows such as exist with storm-runoff events on small streams.The flow is physically inaccessible or unsafe.From a practical standpoint, such measurements are limited primarily to small streams due to excessively long channel mixing lengths required of larger streams. Very good accuracy can be obtained provided:Adequate mixing length and time are allowed.Careful field and laboratory techniques are employed.Dye losses are not significant.This manual describes the slug-injection and constant-rate injection methods of performing tracer-dilution measurements. Emphasis is on the use of fluorescent dyes as tracers and the equipment, field methods, and Laboratory procedures for performing such measurements. The tracer-velocity method is also briefly discussed.

Investigation of the frequency response of constant voltage anemometers in turbulent flows

NASA Astrophysics Data System (ADS)

Sadeghi Hassanlouei, Atabak

A commercially available anemometer system considered as a prototype, the constant voltage anemometer (CVA), is presented and its working principle is studied and analyzed. We detail the different procedures and corrections that have to be applied to voltage signals to deduce corresponding velocity signals, including the effect of the thermal inertia of the sensor. Results are compared to another anemometer system widely used in research and industry, the constant temperature anemometer (CTA), for validation requirements. Measurements are performed in the turbulent region of a subsonic axisymmetric jet and include mean velocities, root-mean-square (rms) values of velocity fluctuations and power spectral densities. In the same range of operation, we show that the two instruments give similar results. The CVA anemometer slightly underestimates the rms velocity values given by the CTA anemometer which is attributed to a non-linear effect. We show that the cut-off frequency of the CVA system is higher than the more commonly used CTA system, and that the electronic noise level is lower. The constant voltage anemometer is thus an excellent alternative to the constant temperature anemometer for low turbulent flows with rich frequency content, such as supersonic and hypersonic flows.

Quantifying liquid boundary and vapor distributions in a fuel spray by rainbow schlieren deflectometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taber Wanstall, C.; Agrawal, Ajay K.; Bittle, Joshua A.

The rainbow schlieren deflectometry (RSD) technique is used to determine the liquid boundary and the fuel volume fraction distributions in the vapor region of a high-pressure fuel spray. Experiments were conducted in a constant pressure flow vessel, whereby a customized single-hole common-rail diesel injector is used to introduce n-heptane fuel into a coflow of low-speed ambient air at two different test conditions. Only the quasi-steady period of the fuel spray is considered, and multiple injections are performed to acquire statistically significant data at an image acquisition rate of 20 kHz. An algorithm to identify the liquid boundary using intensity recordedmore » by the RSD images is presented. The results are compared against measurements obtained by the Mie scattering technique. Our results demonstrate that the RSD can be a powerful optical diagnostics technique to simultaneously quantify both the vapor and liquid regions in the high-pressure fuel sprays.« less

Quantifying liquid boundary and vapor distributions in a fuel spray by rainbow schlieren deflectometry

DOE PAGES

Taber Wanstall, C.; Agrawal, Ajay K.; Bittle, Joshua A.

2017-01-01

The rainbow schlieren deflectometry (RSD) technique is used to determine the liquid boundary and the fuel volume fraction distributions in the vapor region of a high-pressure fuel spray. Experiments were conducted in a constant pressure flow vessel, whereby a customized single-hole common-rail diesel injector is used to introduce n-heptane fuel into a coflow of low-speed ambient air at two different test conditions. Only the quasi-steady period of the fuel spray is considered, and multiple injections are performed to acquire statistically significant data at an image acquisition rate of 20 kHz. An algorithm to identify the liquid boundary using intensity recordedmore » by the RSD images is presented. The results are compared against measurements obtained by the Mie scattering technique. Our results demonstrate that the RSD can be a powerful optical diagnostics technique to simultaneously quantify both the vapor and liquid regions in the high-pressure fuel sprays.« less

On blockage effects for a marine hydrokinetic turbine in free surface proximity

NASA Astrophysics Data System (ADS)

Banerjee, A.; Kolekar, N.

2016-12-01

Experimental investigation was carried out with a three-bladed, constant chord marine hydrokinetic turbine to understand the influence of free surface proximity on blockage effects and near wake flow field. The turbine was placed at various depths of immersion as rotational speeds and flow speeds were varied; thrust and torque data was acquired through a submerged thrust torque sensor positioned in-line with the turbine axis. Blockage effects were quantified in terms of changes in power coefficient and were found to be dependent on flow velocity, rotational speed and blade-tip clearence (from free-surface). Flow acceleration near turbine rotation plane was attributed to blockage offered by the rotor, wake, and free surface deformation; the resulting performance improvements were calculated based on the measured thrust values. In addition, stereoscopic particle imaging velocimetry was carried out in the near-wake region using time-averaged and phase-averaged techniques to understand the mechanism responsible for variation of torque (and power coefficient) with rotational speed and free-surface proximity. Flow vizualisation revealed slower wake propagation for higher rotational velocities and increased assymetry in the wake with increasing free surface proximity. Improved performance at high rotational speed was attributed to enhanced wake blockage; performance enhancements with free-surface proximity was attributed to additional blockage effects caused by free surface deformation.

Turbulent flows over superhydrophobic surfaces with shear-dependent slip length

NASA Astrophysics Data System (ADS)

Khosh Aghdam, Sohrab; Seddighi, Mehdi; Ricco, Pierre

2015-11-01

Motivated by recent experimental evidence, shear-dependent slip length superhydrophobic surfaces are studied. Lyapunov stability analysis is applied in a 3D turbulent channel flow and extended to the shear-dependent slip-length case. The feedback law extracted is recognized for the first time to coincide with the constant-slip-length model widely used in simulations of hydrophobic surfaces. The condition for the slip parameters is found to be consistent with the experimental data and with values from DNS. The theoretical approach by Fukagata (PoF 18.5: 051703) is employed to model the drag-reduction effect engendered by the shear-dependent slip-length surfaces. The estimated drag-reduction values are in very good agreement with our DNS data. For slip parameters and flow conditions which are potentially realizable in the lab, the maximum computed drag reduction reaches 50%. The power spent by the turbulent flow on the walls is computed, thereby recognizing the hydrophobic surfaces as a passive-absorbing drag-reduction method, as opposed to geometrically-modifying techniques that do not consume energy, e.g. riblets, hence named passive-neutral. The flow is investigated by visualizations, statistical analysis of vorticity and strain rates, and quadrants of the Reynolds stresses. Part of this work was funded by Airbus Group. Simulations were performed on the ARCHER Supercomputer (UKTC Grant).

Measurement of discharge using tracers

USGS Publications Warehouse

Kilpatrick, F.A.; Cobb, Ernest D.

1985-01-01

The development of fluorescent dyes and fluorometers that can measure these dyes at very low concentrations has made dye-dilution methods practical for measuring discharge. These methods are particularly useful for determining discharge under certain flow conditions that are unfavorable for current meter measurements. These include small streams, canals, and pipes where 1. Turbulence is excessive for current-meter measurement but conducive to good mixing. 2. Moving rocks and debris may damage instruments placed in the flow. 3. Cross-sectional areas or velocities are indeterminate or changing. 4. The flow is unsteady, such as the flow that exists with storm-runoff events on small streams and urban storm-sewer systems. 5. The flow is physically inaccessible or unsafe. From a practical standpoint, such methods are limited primarily to small streams, because of the excessively long channel-mixing lengths required for larger streams. Very good accuracy can be obtained provided that 1. Adequate mixing length and time are allowed. 2. Careful field and laboratory techniques are used. 3. Dye losses are not significant. This manual describes the slug-injection and constant-rate injection methods of performing tracer-dilution measurements. Emphasis is on the use of fluorescent dyes as tracers and the equipment, field methods, and laboratory procedures for performing such measurements. The tracer-velocity method is also briefly discussed.

Microconfined flow behavior of red blood cells.

PubMed

Tomaiuolo, Giovanna; Lanotte, Luca; D'Apolito, Rosa; Cassinese, Antonio; Guido, Stefano

2016-01-01

Red blood cells (RBCs) perform essential functions in human body, such as gas exchange between blood and tissues, thanks to their ability to deform and flow in the microvascular network. The high RBC deformability is mainly due to the viscoelastic properties of the cell membrane. Since an impaired RBC deformability could be found in some diseases, such as malaria, sickle cell anemia, diabetes and hereditary disorders, there is the need to provide further insight into measurement of RBC deformability in a physiologically relevant flow field. Here, RBCs deformability has been studied in terms of the minimum apparent plasma-layer thickness by using high-speed video microscopy of RBCs flowing in cylindrical glass capillaries. An in vitro systematic microfluidic investigation of RBCs in micro-confined conditions has been performed, resulting in the determination of the RBCs time recovery constant, RBC volume and surface area and RBC membrane shear elastic modulus and surface viscosity. It has been noticed that the deformability of RBCs induces cells aggregation during flow in microcapillaries, allowing the formation of clusters of cells. Overall, our results provide a novel technique to estimate RBC deformability and also RBCs collective behavior, which can be used for the analysis of pathological RBCs, for which reliable quantitative methods are still lacking. Copyright © 2015 IPEM. Published by Elsevier Ltd. All rights reserved.

In-Situ Characterization of Tissue Blood Flow, Blood Content, and Water State Using New Techniques in Magnetic Resonance Imaging.

NASA Astrophysics Data System (ADS)

Conturo, Thomas Edward

Tissue blood flow, blood content, and water state have been characterized in-situ with new nuclear magnetic resonance imaging techniques. The sensitivities of standard techniques to the physiologic tissue parameters spin density (N_{rm r}) and relaxation times (T_1 and T_2 ) are mathematically defined. A new driven inversion method is developed so that tissue T_1 and T_2 changes produce cooperative intensity changes, yielding high contrast, high signal to noise, and sensitivity to a wider range of tissue parameters. The actual tissue parameters were imaged by automated collection of multiple-echo data having multiple T _1 dependence. Data are simultaneously fit by three-parameters to a closed-form expression, producing lower inter-parameter correlation and parameter noise than in separate T_1 or T_2 methods or pre-averaged methods. Accurate parameters are obtained at different field strengths. Parametric images of pathology demonstrate high sensitivity to tissue heterogeneity, and water content is determined in many tissues. Erythrocytes were paramagnetically labeled to study blood content and relaxation mechanisms. Liver and spleen relaxation were enhanced following 10% exchange of animal blood volumes. Rapid water exchange between intracellular and extracellular compartments was validated. Erythrocytes occupied 12.5% of renal cortex volume, and blood content was uniform in the liver, spleen and kidney. The magnitude and direction of flow velocity was then imaged. To eliminate directional artifacts, a bipolar gradient technique sensitized to flow in different directions was developed. Phase angle was reconstructed instead of intensity since the former has a 2pi -fold higher dynamic range. Images of flow through curves demonstrated secondary flow with a centrifugally-biased laminar profile and stationary velocity peaks along the curvature. Portal vein flow velocities were diminished or reversed in cirrhosis. Image artifacts have been characterized and removed. The foldover in magnified images was eliminated by exciting limited regions with orthogonal pi/2 and pi pulses. Off-midline regions were imaged by tandemly offsetting the phase-encoding and excitation. Artifacts due to non-steady-state conditions were demonstrated. The approach to steady state was defined by operators and vectors, and any repeated series of RF pulses was proven to produce a steady-state. The vector difference between the magnetization and its steady state value is relatively constant during the approach. The repetition time relative to T_1 is the main determinant of approach rate, and off-resonant RF pulses incoherent with the magnetization produce a more rapid approach than on-resonant pulses.

Flow limitation and wheezes in a constant flow and volume lung preparation.

PubMed

Gavriely, N; Grotberg, J B

1988-01-01

To facilitate the study of respiratory wheezes in an animal lung model, an isovolume, constant-flow excised dog lung preparation was developed. Dog lungs were inflated to 26 +/- 4 cmH2O and coated with layers of epoxy glue and polyester compound. A rigid shell 2 mm thick was obtained around the entire pleural surface and the extra-pulmonary airways. The adhesive forces between the pleura and the shell were strong enough to hold the lung distended after the inflation pressure was removed. Holes 2 mm diam were drilled through the shell over one of the lung lobes in an array, 4 cm across. The holes penetrated the pleural surface, so that constant flow could be maintained in the expiratory direction by activating a suction pump connected to the trachea. Downstream suction pressure and flow rate were measured with a mercury manometer and a rotameter, respectively. Sounds were recorded by a small (0.6 cm OD) microphone inserted into the trachea. When suction pressure was increased, flow initially increased to 31 +/- 3 l/min. Further increase of suction pressure caused only very slight additional increase in flow (i.e., flow limitation). During this plateau of flow, a pure tone was generated with acoustic properties similar to respiratory wheezes. Both the flow plateau and the wheezing sounds could be eliminated by freezing the lungs. It is concluded that wheezing sounds were associated with flow limitation in this preparation. It is suggested that the stable acoustic properties obtained by this preparation may become useful in the analysis of mechanisms of wheezing lung sounds generation.

Partially to fully saturated flow through smooth, clean, open fractures: qualitative experimental studies

NASA Astrophysics Data System (ADS)

Jones, Brendon R.; Brouwers, Luke B.; Dippenaar, Matthys A.

2018-05-01

Fractures are both rough and irregular but can be expressed by a simple model concept of two smooth parallel plates and the associated cubic law governing discharge through saturated fractures. However, in natural conditions and in the intermediate vadose zone, these assumptions are likely violated. This paper presents a qualitative experimental study investigating the cubic law under variable saturation in initially dry free-draining discrete fractures. The study comprised flow visualisation experiments conducted on transparent replicas of smooth parallel plates with inlet conditions of constant pressure and differing flow rates over both vertical and horizontal inclination. Flow conditions were altered to investigate the influence of intermittent and continuous influx scenarios. Findings from this research proved, for instance, that saturated laminar flow is not likely achieved, especially in nonhorizontal fractures. In vertical fractures, preferential flow occupies the minority of cross-sectional area despite the water supply. Movement of water through the fractured vadose zone therefore becomes a matter of the continuity principle, whereby water should theoretically be transported downward at significantly higher flow rates given the very low degree of water saturation. Current techniques that aim to quantify discrete fracture flow, notably at partial saturation, are questionable. Inspired by the results of this study, it is therefore hypothetically improbable to achieve saturation in vertical fractures under free-draining wetting conditions. It does become possible under extremely excessive water inflows or when not free-draining; however, the converse is not true, as a wet vertical fracture can be drained.

Heat-flow measurements at shot points along the 1978 Saudi Arabia seismic deep-refraction line; Part I, Results of the measurements

USGS Publications Warehouse

Gettings, M.E.; Showail, Abdullah

1982-01-01

Heat-flow measurements were made at five onland shot points of the 1978 Saudi Arabian seismic deep-refraction line, which sample major tectonic elements of the Arabian Shield along a profile from Ar Riyad to the Farasan Islands. Because of the pattern drilling at each shot point, several holes (60 m deep) could be logged for temperature at each site and thus allow a better estimate of the geothermal gradient. Each site was mapped and sampled in detail, and modal and. chemical analyses of representative specimens were made in the laboratory. Thermal conductivities were computed from the modal analyses and single-mineral conductivity data. The resulting heat-flow values, combined with published values for the Red Sea and coastal plain, indicate a three-level pattern, with a heat flow of about 4.5 heat-flow unit (HFU) over the Red Sea axial trough, about 3.0 HFU over the shelf and coastal plain, and an essentially constant 1.0 HFU over the Arabian Shield at points well away from the suture zone with the oceanic crust. At three sites where the rocks are granitic, gamma-ray spectrometry techniques were employed to estimate thorium, potassium, and uranium concentrations. The resulting plot of heat generation versus heat flow suggests that in the Arabian Shield the relationship between heat flow and heat production is not linear. More heat-flow data are essential to establish or reject this conclusion.

Mixed Convection Opposing Flow in a Vertical Porous Annulus-Two Temperature Model

NASA Astrophysics Data System (ADS)

Al-Rashed, Abdullah A. AA; J, Salman Ahmed N.; Khaleed, H. M. T.; Yunus Khan, T. M.; NazimAhamed, K. S.

2016-09-01

The opposing flow in a porous medium refers to a condition when the forcing velocity flows in opposite direction to thermal buoyancy obstructing the buoyant force. The present research refers to the effect of opposing flow in a vertical porous annulus embedded with fluid saturated porous medium. The thermal non-equilibrium approach with Darcy modal is considered. The boundary conditions are such that the inner radius is heated with constant temperature Tw the outer radius is maintained at constant temperature Tc. The coupled nonlinear partial differential equations such as momentum equation, energy equation for fluid and energy equation for solid are solved using the finite element method. The opposing flow variation of average Nusselt number with respect to radius ratio Rr, Aspect ratioAr and Radiation parameter Rd for different values of Peclet number Pe are investigated. It is found that the flow behavior is quite different from that of aiding flow.

Automatic Exposure Control Systems Designed to Maintain Constant Image Noise: Effects on Computed Tomography Dose and Noise Relative to Clinically Accepted Technique Charts

PubMed Central

Favazza, Christopher P.; Yu, Lifeng; Leng, Shuai; Kofler, James M.; McCollough, Cynthia H.

2015-01-01

Objective To compare computed tomography dose and noise arising from use of an automatic exposure control (AEC) system designed to maintain constant image noise as patient size varies with clinically accepted technique charts and AEC systems designed to vary image noise. Materials and Methods A model was developed to describe tube current modulation as a function of patient thickness. Relative dose and noise values were calculated as patient width varied for AEC settings designed to yield constant or variable noise levels and were compared to empirically derived values used by our clinical practice. Phantom experiments were performed in which tube current was measured as a function of thickness using a constant-noise-based AEC system and the results were compared with clinical technique charts. Results For 12-, 20-, 28-, 44-, and 50-cm patient widths, the requirement of constant noise across patient size yielded relative doses of 5%, 14%, 38%, 260%, and 549% and relative noises of 435%, 267%, 163%, 61%, and 42%, respectively, as compared with our clinically used technique chart settings at each respective width. Experimental measurements showed that a constant noise–based AEC system yielded 175% relative noise for a 30-cm phantom and 206% relative dose for a 40-cm phantom compared with our clinical technique chart. Conclusions Automatic exposure control systems that prescribe constant noise as patient size varies can yield excessive noise in small patients and excessive dose in obese patients compared with clinically accepted technique charts. Use of noise-level technique charts and tube current limits can mitigate these effects. PMID:25938214

Water quality determination by photographic analysis. [optical density and water turbidity

NASA Technical Reports Server (NTRS)

Klooster, S. A.; Scherz, J. P.

1973-01-01

Aerial reconnaissance techniques to extract water quality parameters from aerial photos are reported. The turbidity can be correlated with total suspended solids if the constituent parts of the effluent remain the same and the volumetric flow remains relatively constant. A monochromator is used for the selection of the bandwidths containing the most information. White reflectance panels are used to locate sampling points and eliminate inherent energy changes from lens flare, radial lens fall-off, and changing subject illumination. Misleading information resulting from bottom effects is avoided by the use of Secchi disc readings and proper choice of wavelength for analyzing the photos.

Determination of relative phase permeabilities in stochastic model of pore channel distribution by diameter

NASA Astrophysics Data System (ADS)

Zemenkova, M. Y.; Shabarov, A.; Shatalov, A.; Puldas, L.

2018-05-01

The problem of the pore space description and the calculation of relative phase permeabilities (RPP) for two-phase filtration is considered. A technique for constructing a pore-network structure for constant and variable channel diameters is proposed. A description of the design model of RPP based on the capillary pressure curves is presented taking into account the variability of diameters along the length of pore channels. By the example of the calculation analysis for the core samples of the Urnenskoye and Verkhnechonskoye deposits, the possibilities of calculating RPP are shown when using the stochastic distribution of pores by diameters and medium-flow diameters.

Numerical solution of stiff systems of ordinary differential equations with applications to electronic circuits

NASA Technical Reports Server (NTRS)

Rosenbaum, J. S.

1971-01-01

Systems of ordinary differential equations in which the magnitudes of the eigenvalues (or time constants) vary greatly are commonly called stiff. Such systems of equations arise in nuclear reactor kinetics, the flow of chemically reacting gas, dynamics, control theory, circuit analysis and other fields. The research reported develops an A-stable numerical integration technique for solving stiff systems of ordinary differential equations. The method, which is called the generalized trapezoidal rule, is a modification of the trapezoidal rule. However, the method is computationally more efficient than the trapezoidal rule when the solution of the almost-discontinuous segments is being calculated.

An analytical model for flow induced by a constant-head pumping in a leaky unconfined aquifer system with considering unsaturated flow

NASA Astrophysics Data System (ADS)

Lin, Ye-Chen; Li, Ming-Hsu; Yeh, Hund-Der

2017-09-01

A new mathematical model is developed to describe the flow in response to a constant-head pumping (or constant-head test, CHT) in a leaky unconfined aquifer system of infinite lateral extent with considering unsaturated flow. The model consists of an unsaturated zone on the top, an unconfined aquifer in the middle, and a second aquifer (aquitard) at the bottom. The unsaturated flow is described by Richard's equation, and the flows in unconfined aquifer and second layer are governed by the groundwater flow equation. The well partially penetrates the unconfined aquifer with a constant head in the well due to CHT. The governing equations of the model are linearized by the perturbation method and Gardner's exponential model is adopted to describe the soil retention curves. The solution of the model for drawdown distribution is obtained by applying the methods of Laplace transform and Weber transform. Then the solution for the wellbore flowrate is derived from the drawdown solution with Darcy's law. The issue of the equivalence of normalized drawdown predicted by the present solution for constant-head pumping and Tartakovsky and Neuman's (2007) solution for constant-rate pumping is discussed. On the basis of the wellbore flowrate solution, the results of the sensitivity analysis indicate that the wellbore flowrate is very sensitive to the changes in the radial hydraulic conductivity and the thickness of the saturated zone. Moreover, the results predicted from the present wellbore flowrate solution indicate that this new solution can reduce to Chang's et al. (2010a) solution for homogenous aquifers when the dimensionless unsaturated exponent approaches 100. The unsaturated zone can be considered as infinite extent in the vertical direction if the thickness ratio of the unsaturated zone to the unconfined aquifer is equal to or greater than one. As for the leakage effect, it can be ignored when the vertical hydraulic conductivity ratio (i.e., the vertical hydraulic conductivity of the lower layer over that of the unconfined aquifer) is smaller than 0.1. The present solution is compared with the numerical solution from FEMWATER for validation and the results indicate good match between these two solutions. Finally, the present solution is applied to a set of field drawdown data obtained from a CHT for the estimation of hydrogeologic parameters.

Characterizing Sub-Daily Flow Regimes: Implications of Hydrologic Resolution on Ecohydrology Studies

DOE PAGES

Bevelhimer, Mark S.; McManamay, Ryan A.; O'Connor, B.

2014-05-26

Natural variability in flow is a primary factor controlling geomorphic and ecological processes in riverine ecosystems. Within the hydropower industry, there is growing pressure from environmental groups and natural resource managers to change reservoir releases from daily peaking to run-of-river operations on the basis of the assumption that downstream biological communities will improve under a more natural flow regime. In this paper, we discuss the importance of assessing sub-daily flows for understanding the physical and ecological dynamics within river systems. We present a variety of metrics for characterizing sub-daily flow variation and use these metrics to evaluate general trends amongmore » streams affected by peaking hydroelectric projects, run-of-river projects and streams that are largely unaffected by flow altering activities. Univariate and multivariate techniques were used to assess similarity among different stream types on the basis of these sub-daily metrics. For comparison, similar analyses were performed using analogous metrics calculated with mean daily flow values. Our results confirm that sub-daily flow metrics reveal variation among and within streams that are not captured by daily flow statistics. Using sub-daily flow statistics, we were able to quantify the degree of difference between unaltered and peaking streams and the amount of similarity between unaltered and run-of-river streams. The sub-daily statistics were largely uncorrelated with daily statistics of similar scope. Furthermore, on short temporal scales, sub-daily statistics reveal the relatively constant nature of unaltered streamreaches and the highly variable nature of hydropower-affected streams, whereas daily statistics show just the opposite over longer temporal scales.« less

Vibroconvective mixing applied to vertical Bridgman growth

NASA Astrophysics Data System (ADS)

Zawilski, Kevin T.; Claudia, M.; Custodio, C.; DeMattei, Robert C.; Feigelson, Robert S.

2003-10-01

A promising method for stirring melts during vertical Bridgman growth is the coupled vibrational stirring (CVS) method. It involves the application of low frequency vibrations to the outside of the growth ampoule and produces strong flows emanating from the fluid surface. Although the technique was pioneered a number of years ago, previous studies have not provided sufficient information to explain how to control CVS generated flows in a particular system. This paper examines both the fluid flow produced by CVS and the effect of these flows on a model oxide growth system. CVS generated flows were studied using tracer particles in a water/glycerin system. The particle velocities were measured as a function of distance from the fluid surface. A large velocity gradient, decreasing from the surface, was found to be present. The velocity profile produced was dependent on the vibrational amplitude and frequency, the crucible diameter, and the fluid viscosity. The effects of CVS flows on the crystal growth interface were studied using NaNO 3 as a model oxide. Under non-growth conditions (i.e. no furnace or crucible translation), the solid-liquid interface position was found to be a strong function of vibrational frequency once CVS generated flows approached the interface. During crystal growth, undesirable growth rate fluctuations were found as the growth interface moved into regions of increasing fluid flow. This data suggests that a control system in which CVS flows are continuously decreased during growth to maintain a constant flow rate in the vicinity of the growth interface is necessary in order to prevent or reduce growth rate fluctuations.

Investigation of Spray Cooling Schemes for Dynamic Thermal Management

NASA Astrophysics Data System (ADS)

Yata, Vishnu Vardhan Reddy

This study aims to investigate variable flow and intermittent flow spray cooling characteristics for efficiency improvement in active two-phase thermal management systems. Variable flow spray cooling scheme requires control of pump input voltage (or speed), while intermittent flow spray cooling scheme requires control of solenoid valve duty cycle and frequency. Several testing scenarios representing dynamic heat load conditions are implemented to characterize the overall performance of variable flow and intermittent flow spray cooling cases in comparison with the reference, steady flow spray cooling case with constant flowrate, continuous spray cooling. Tests are conducted on a small-scale, closed loop spray cooling system featuring a pressure atomized spray nozzle. HFE-7100 dielectric liquid is selected as the working fluid. Two types of test samples are prepared on 10 mm x 10 mm x 2 mm copper substrates with matching size thick film resistors attached onto the opposite side, to generate heat and simulate high heat flux electronic devices. The test samples include: (i) plain, smooth surface, and (ii) microporous surface featuring 100 ?m thick copper-based coating prepared by dual stage electroplating technique. Experimental conditions involve HFE-7100 at atmospheric pressure and 30°C and 10°C subcooling. Steady flow spray cooling tests are conducted at flow rates of 2-5 ml/cm2.s, by controlling the heat flux in increasing steps, and recording the corresponding steady-state temperatures to obtain cooling curves in the form of surface superheat vs. heat flux. Variable flow and intermittent flow spray cooling tests are done at selected flowrate and subcooling conditions to investigate the effects of dynamic flow conditions on maintaining the target surface temperatures defined based on reference steady flow spray cooling performance.

An approximate analytical solution for describing surface runoff and sediment transport over hillslope

NASA Astrophysics Data System (ADS)

Tao, Wanghai; Wang, Quanjiu; Lin, Henry

2018-03-01

Soil and water loss from farmland causes land degradation and water pollution, thus continued efforts are needed to establish mathematical model for quantitative analysis of relevant processes and mechanisms. In this study, an approximate analytical solution has been developed for overland flow model and sediment transport model, offering a simple and effective means to predict overland flow and erosion under natural rainfall conditions. In the overland flow model, the flow regime was considered to be transitional with the value of parameter β (in the kinematic wave model) approximately two. The change rate of unit discharge with distance was assumed to be constant and equal to the runoff rate at the outlet of the plane. The excess rainfall was considered to be constant under uniform rainfall conditions. The overland flow model developed can be further applied to natural rainfall conditions by treating excess rainfall intensity as constant over a small time interval. For the sediment model, the recommended values of the runoff erosion calibration constant (cr) and the splash erosion calibration constant (cf) have been given in this study so that it is easier to use the model. These recommended values are 0.15 and 0.12, respectively. Comparisons with observed results were carried out to validate the proposed analytical solution. The results showed that the approximate analytical solution developed in this paper closely matches the observed data, thus providing an alternative method of predicting runoff generation and sediment yield, and offering a more convenient method of analyzing the quantitative relationships between variables. Furthermore, the model developed in this study can be used as a theoretical basis for developing runoff and erosion control methods.

The analytical representation of viscoelastic material properties using optimization techniques

NASA Technical Reports Server (NTRS)

Hill, S. A.

1993-01-01

This report presents a technique to model viscoelastic material properties with a function of the form of the Prony series. Generally, the method employed to determine the function constants requires assuming values for the exponential constants of the function and then resolving the remaining constants through linear least-squares techniques. The technique presented here allows all the constants to be analytically determined through optimization techniques. This technique is employed in a computer program named PRONY and makes use of commercially available optimization tool developed by VMA Engineering, Inc. The PRONY program was utilized to compare the technique against previously determined models for solid rocket motor TP-H1148 propellant and V747-75 Viton fluoroelastomer. In both cases, the optimization technique generated functions that modeled the test data with at least an order of magnitude better correlation. This technique has demonstrated the capability to use small or large data sets and to use data sets that have uniformly or nonuniformly spaced data pairs. The reduction of experimental data to accurate mathematical models is a vital part of most scientific and engineering research. This technique of regression through optimization can be applied to other mathematical models that are difficult to fit to experimental data through traditional regression techniques.

Flow cytometric HyPer-based assay for hydrogen peroxide.

PubMed

Lyublinskaya, O G; Antonov, S A; Gorokhovtsev, S G; Pugovkina, N A; Kornienko, Ju S; Ivanova, Ju S; Shatrova, A N; Aksenov, N D; Zenin, V V; Nikolsky, N N

2018-05-30

HyPer is a genetically encoded fluorogenic sensor for hydrogen peroxide which is generally used for the ratiometric imaging of H 2 O 2 fluxes in living cells. Here, we demonstrate the advantages of HyPer-based ratiometric flow cytometry assay for H 2 O 2 , by using K562 and human mesenchymal stem cell lines expressing HyPer. We show that flow cytometry analysis is suitable to detect HyPer response to submicromolar concentrations of extracellularly added H 2 O 2 that is much lower than concentrations addressed previously in the other HyPer-based assays (such as cell imaging or fluorimetry). Suggested technique is also much more sensitive to hydrogen peroxide than the widespread flow cytometry assay exploiting H 2 O 2 -reactive dye H 2 DCFDA and, contrary to the H 2 DCFDA-based assay, can be employed for the kinetic studies of H 2 O 2 utilization by cells, including measurements of the rate constants of H 2 O 2 removal. In addition, flow cytometry multi-parameter ratiometric measurements enable rapid and high-throughput detection of endogenously generated H 2 O 2 in different subpopulations of HyPer-expressing cells. To sum up, HyPer can be used in multi-parameter flow cytometry studies as a highly sensitive indicator of intracellular H 2 O 2 . Copyright © 2018. Published by Elsevier Inc.

Riparian vegetation controls on braided stream dynamics

NASA Astrophysics Data System (ADS)

Gran, Karen; Paola, Chris

2001-12-01

Riparian vegetation can significantly influence the morphology of a river, affecting channel geometry and flow dynamics. To examine the effects of riparian vegetation on gravel bed braided streams, we conducted a series of physical experiments at the St. Anthony Falls Laboratory with varying densities of bar and bank vegetation. Water discharge, sediment discharge, and grain size were held constant between runs. For each run, we allowed a braided system to develop, then seeded the flume with alfalfa (Medicago sativa), allowed the seeds to grow, and then continued the run. We collected data on water depth, surface velocity, and bed elevation throughout each run using image-based techniques designed to collect data over a large spatial area with minimal disturbance to the flow. Our results show that the influence of vegetation on overall river patterns varied systematically with the spatial density of plant stems. Vegetation reduced the number of active channels and increased bank stability, leading to lower lateral migration rates, narrower and deeper channels, and increased channel relief. These effects increased with vegetation density. Vegetation influenced flow dynamics, increasing the variance of flow direction in vegetated runs and increasing scour depths through strong downwelling where the flow collided with relatively resistant banks. This oblique bank collision also provides a new mechanism for producing secondary flows. We found it to be more important than the classical curvature-driven mechanism in vegetated runs.

Constant-concentration boundary condition: Lessons from the HYDROCOIN variable-density groundwater benchmark problem

USGS Publications Warehouse

Konikow, Leonard F.; Sanford, W.E.; Campbell, P.J.

1997-01-01

In a solute-transport model, if a constant-concentration boundary condition is applied at a node in an active flow field, a solute flux can occur by both advective and dispersive processes. The potential for advective release is demonstrated by reexamining the Hydrologic Code Intercomparison (HYDROCOIN) project case 5 problem, which represents a salt dome overlain by a shallow groundwater system. The resulting flow field includes significant salinity and fluid density variations. Several independent teams simulated this problem using finite difference or finite element numerical models. We applied a method-of-characteristics model (MOCDENSE). The previous numerical implementations by HYDROCOIN teams of a constant-concentration boundary to represent salt release by lateral dispersion only (as stipulated in the original problem definition) was flawed because this boundary condition allows the release of salt into the flow field by both dispersion and advection. When the constant-concentration boundary is modified to allow salt release by dispersion only, significantly less salt is released into the flow field. The calculated brine distribution for case 5 depends very little on which numerical model is used, as long as the selected model is solving the proper equations. Instead, the accuracy of the solution depends strongly on the proper conceptualization of the problem, including the detailed design of the constant-concentration boundary condition. The importance and sensitivity to the manner of specification of this boundary does not appear to have been recognized previously in the analysis of this problem.

Advances in the analysis and design of constant-torque springs

NASA Technical Reports Server (NTRS)

McGuire, John R.; Yura, Joseph A.

1996-01-01

In order to improve the design procedure of constant-torque springs used in aerospace applications, several new analysis techniques have been developed. These techniques make it possible to accurately construct a torque-rotation curve for any general constant-torque spring configuration. These new techniques allow for friction in the system to be included in the analysis, an area of analysis that has heretofore been unexplored. The new analysis techniques also include solutions for the deflected shape of the spring as well as solutions for drum and roller support reaction forces. A design procedure incorporating these new capabilities is presented.

Spatially averaged flow over a wavy boundary revisited

USGS Publications Warehouse

McLean, S.R.; Wolfe, S.R.; Nelson, J.M.

1999-01-01

Vertical profiles of streamwise velocity measured over bed forms are commonly used to deduce boundary shear stress for the purpose of estimating sediment transport. These profiles may be derived locally or from some sort of spatial average. Arguments for using the latter procedure are based on the assumption that spatial averaging of the momentum equation effectively removes local accelerations from the problem. Using analogies based on steady, uniform flows, it has been argued that the spatially averaged velocity profiles are approximately logarithmic and can be used to infer values of boundary shear stress. This technique of using logarithmic profiles is investigated using detailed laboratory measurements of flow structure and boundary shear stress over fixed two-dimensional bed forms. Spatial averages over the length of the bed form of mean velocity measurements at constant distances from the mean bed elevation yield vertical profiles that are highly logarithmic even though the effect of the bottom topography is observed throughout the water column. However, logarithmic fits of these averaged profiles do not yield accurate estimates of the measured total boundary shear stress. Copyright 1999 by the American Geophysical Union.

Rayleigh Scattering Diagnostic for Measurement of Temperature, Velocity, and Density Fluctuation Spectra

NASA Technical Reports Server (NTRS)

Mielke, Amy F.; Elam, Kristie A.; Sung, Chih-Jen; Panda, Jayanta

2006-01-01

A molecular Rayleigh scattering technique is developed to measure dynamic gas temperature, velocity, and density in unseeded turbulent flows at sampling rates up to 10 kHz. A high power CW laser beam is focused at a point in a heated air jet plume and Rayleigh scattered light is collected and spectrally resolved. The spectrum of the light, which contains information about the temperature, velocity, and density of the flow, is analyzed using a Fabry-Perot interferometer. The circular interference fringe pattern is divided into four concentric regions and sampled at 1 and 10 kHz using photon counting electronics. Monitoring the relative change in intensity within each region allows for measurement of gas temperature and velocity. Independently monitoring the total scattered light intensity provides a measure of gas density. Power spectral density calculations of temperature, velocity, and density fluctuations, as well as mean and fluctuating quantities are demonstrated for various radial locations in the jet flow at a fixed axial distance from the jet exit plane. Results are compared with constant current anemometry and pitot probe measurements at the same locations.

Enhanced ethanol production at commercial scale from molasses using high gravity technology by mutant S. cerevisiae.

PubMed

Arshad, Muhammad; Hussain, Tariq; Iqbal, Munawar; Abbas, Mazhar

Very high gravity (VHG) technology was employed on industrial scale to produce ethanol from molasses (fermented) as well as by-products formation estimation. The effect of different Brix° (32, 36 and 40) air-flow rates (0.00, 0.20, 0.40, and 0.60vvm) was studied on ethanol production. The maximum ethanol production was recorded to be 12.2% (v/v) at 40 Brix° with 0.2vvm air-flow rate. At optimum level aeration and 40 Brix° VHG, the residual sugar level was recorded in the range of 12.5-18.5g/L, whereas the viable cell count remained constant up to 50h of fermentation and dry matter production increased with fermentation time. Both water and steam consumption reduced significantly under optimum conditions of Brix° and aeration rate with compromising the ethanol production. Results revealed VHG with continuous air flow is viable technique to reduce the ethanol production cost form molasses at commercial scale. Copyright © 2017. Published by Elsevier Editora Ltda.

Transient Effects in Planar Solidification of Dilute Binary Alloys

NASA Technical Reports Server (NTRS)

Mazuruk, Konstantin; Volz, Martin P.

2008-01-01

The initial transient during planar solidification of dilute binary alloys is studied in the framework of the boundary integral method that leads to the non-linear Volterra integral governing equation. An analytical solution of this equation is obtained for the case of a constant growth rate which constitutes the well-known Tiller's formula for the solute transient. The more physically relevant, constant ramping down temperature case has been studied both numerically and analytically. In particular, an asymptotic analytical solution is obtained for the initial transient behavior. A numerical technique to solve the non-linear Volterra equation is developed and the solution is obtained for a family of the governing parameters. For the rapid solidification condition, growth rate spikes have been observed even for the infinite kinetics model. When recirculating fluid flow is included into the analysis, the spike feature is dramatically diminished. Finally, we have investigated planar solidification with a fluctuating temperature field as a possible mechanism for frequently observed solute trapping bands.

New solutions to the constant-head test performed at a partially penetrating well

NASA Astrophysics Data System (ADS)

Chang, Y. C.; Yeh, H. D.

2009-05-01

SummaryThe mathematical model describing the aquifer response to a constant-head test performed at a fully penetrating well can be easily solved by the conventional integral transform technique. In addition, the Dirichlet-type condition should be chosen as the boundary condition along the rim of wellbore for such a test well. However, the boundary condition for a test well with partial penetration must be considered as a mixed-type condition. Generally, the Dirichlet condition is prescribed along the well screen and the Neumann type no-flow condition is specified over the unscreened part of the test well. The model for such a mixed boundary problem in a confined aquifer system of infinite radial extent and finite vertical extent is solved by the dual series equations and perturbation method. This approach provides analytical results for the drawdown in the partially penetrating well and the well discharge along the screen. The semi-analytical solutions are particularly useful for the practical applications from the computational point of view.

Calculation of Weibull strength parameters and Batdorf flow-density constants for volume- and surface-flaw-induced fracture in ceramics

NASA Technical Reports Server (NTRS)

Shantaram, S. Pai; Gyekenyesi, John P.

1989-01-01

The calculation of shape and scale parametes of the two-parameter Weibull distribution is described using the least-squares analysis and maximum likelihood methods for volume- and surface-flaw-induced fracture in ceramics with complete and censored samples. Detailed procedures are given for evaluating 90 percent confidence intervals for maximum likelihood estimates of shape and scale parameters, the unbiased estimates of the shape parameters, and the Weibull mean values and corresponding standard deviations. Furthermore, the necessary steps are described for detecting outliers and for calculating the Kolmogorov-Smirnov and the Anderson-Darling goodness-of-fit statistics and 90 percent confidence bands about the Weibull distribution. It also shows how to calculate the Batdorf flaw-density constants by using the Weibull distribution statistical parameters. The techniques described were verified with several example problems, from the open literature, and were coded in the Structural Ceramics Analysis and Reliability Evaluation (SCARE) design program.

A one-dimensional model for gas-solid heat transfer in pneumatic conveying

NASA Astrophysics Data System (ADS)

Smajstrla, Kody Wayne

A one-dimensional ODE model reduced from a two-fluid model of a higher dimensional order is developed to study dilute, two-phase (air and solid particles) flows with heat transfer in a horizontal pneumatic conveying pipe. Instead of using constant air properties (e.g., density, viscosity, thermal conductivity) evaluated at the initial flow temperature and pressure, this model uses an iteration approach to couple the air properties with flow pressure and temperature. Multiple studies comparing the use of constant or variable air density, viscosity, and thermal conductivity are conducted to study the impact of the changing properties to system performance. The results show that the fully constant property calculation will overestimate the results of the fully variable calculation by 11.4%, while the constant density with variable viscosity and thermal conductivity calculation resulted in an 8.7% overestimation, the constant viscosity with variable density and thermal conductivity overestimated by 2.7%, and the constant thermal conductivity with variable density and viscosity calculation resulted in a 1.2% underestimation. These results demonstrate that gas properties varying with gas temperature can have a significant impact on a conveying system and that the varying density accounts for the majority of that impact. The accuracy of the model is also validated by comparing the simulation results to the experimental values found in the literature.

HYDRAULIC SERVO

DOEpatents

Wiegand, D.E.

1962-05-01

A hydraulic servo is designed in which a small pressure difference produced at two orifices by an electrically operated flapper arm in a constantly flowing hydraulic loop is hydraulically amplified by two constant flow pumps, two additional orifices, and three unconnected ball pistons. Two of the pistons are of one size and operate against the additional orifices, and the third piston is of a different size and operates between and against the first two pistons. (AEC)

Harbingers and latecomers - the order of appearance of exact coherent structures in plane Poiseuille flow

NASA Astrophysics Data System (ADS)

Zammert, Stefan; Eckhardt, Bruno

2017-02-01

The transition to turbulence in plane Poiseuille flow (PPF) is connected with the presence of exact coherent structures. We here discuss a variety of different structures that are relevant for the transition, compare the critical Reynolds numbers and optimal wavelengths for their appearance, and explore the differences between flows operating at constant mass flux or at constant pressure drop. The Reynolds numbers quoted here are based on the mean flow velocity and refer to constant mass flux. Reynolds numbers based on constant pressure drop are always higher. The Tollmien-Schlichting (TS) waves bifurcate subcritically from the laminar profile at Re = 5772 at wavelength 6.16 and reach down to Re = 2610 at a different optimal wave length of 4.65. Their streamwise localised counter part bifurcates at the even lower value Re = 2334. Three-dimensional exact solutions appear at much lower Reynolds numbers. We describe one exact solutions that has a critical Reynolds number of 316. Streamwise localised versions of this state require higher Reynolds numbers, with the lowest bifurcation occurring near Re = 1018. The analysis shows that the various branches of TS-waves cannot be connected with transition observed near Re ≈ 1000 and that the exact coherent structures related to downstream vortices come in at lower Reynolds numbers and prepare for the transition.

System analysis of the dynamic response of the coronary circulation to a sudden change in heart rate.

PubMed

Dankelman, J; Stassen, H G; Spaan, J A

1990-03-01

In this study the response of driving pressure/flow ration on an abrupt change in heart rate was analysed. The difference between the response obtained with constant pressure and constant flow perfusion was also studied. The responses show a fast initial reversed phase followed by a slow phase caused by regulation. To test whether the initial phase could be the result of mechanical changes in the coronary circulation, a model for regulation was extended by the addition of four different mechanical models originating from the literature. These extended models were able to explain the fast initial phase. However, the mechanical model consisting of an intramyocardial compliance (C = 0.08 ml mm Hg-1 100 g-1) with a variable venous resistance, and the model consisting of a waterfall and a small compliance (C = 0.007 ml mm Hg-1 100g-1) both explained these responses best. The analysis showed that there is no direct relationship between rate of change of vascular tone and rate of change of pressure/flow ratio. However, on the basis of the two extended models, it can be predicted that the half-time for the response of regulation to be complete is about 9s with constant pressure perfusion and 15 s with constant flow perfusion.

Determining resistivity of a formation adjacent to a borehole having casing by generating constant current flow in portion of casing and using at least two voltage measurement electrodes

DOEpatents

Vail, III, William Banning

2000-01-01

Methods of operation of different types of multiple electrode apparatus vertically disposed in a cased well to measure information related to the resistivity of adjacent geological formations from within the cased well are described. The multiple electrode apparatus has a minimum of two spaced apart voltage measurement electrodes that electrically engage a first portion of the interior of the cased well and that provide at least first voltage information. Current control means are used to control the magnitude of any selected current that flows along a second portion of the interior of the casing to be equal to a predetermined selected constant. The first portion of the interior of the cased well is spaced apart from the second portion of the interior of the cased well. The first voltage information and the predetermined selected constant value of any selected current flowing along the casing are used in part to determine a magnitude related to the formation resistivity adjacent to the first portion of the interior of the cased well. Methods and apparatus having a plurality of voltage measurement electrodes are disclosed that provide voltage related information in the presence of constant currents flowing along the casing which is used to provide formation resistivity.

Gas Phase Molecular Spectroscopy: Electronic Spectroscopy of Combustion Intermediates, Chlorine Azide kinetics, and Rovibrational Energy Transfer in Acetylene

NASA Astrophysics Data System (ADS)

Freel, Keith A.

This dissertation is composed of three sections. The first deals with the electronic spectroscopy of combustion intermediates that are related to the formation of polycyclic aromatic hydrocarbons. Absorption spectra for phenyl, phenoxy, benzyl, and phenyl peroxy radicals were recorded using the technique of cavity ring-down spectroscopy. When possible, molecular constants, vibrational frequencies, and excited state lifetimes for these radicals were derived from these data. The results were supported by theoretical predictions. The second section presents a study of electron attachment to chlorine azide (ClN3) using a flowing-afterglow Langmuir-probe apparatus. Electron attachment rates were measured to be 3.5x10-8 and 4.5x10-8 cm3s-1 at 298 and 400 K respectively. The reactions of ClN3 with eighteen cations and seventeen anions were characterized. Rate constants were measured using a selected ion flow tube. The ionization energy (>9.6eV), proton affinity (713+/-41 kJ mol-1), and electron affinity (2.48+/-0.2 eV) for ClN 3 were determined from these data. The third section demonstrates the use of double resonance spectroscopy to observe state-selected rovibrational energy transfer from the first overtone asymmetric stretch of acetylene. The total population removal rate constants from various rotational levels of the (1,0,1,00,00) vibrational state were determined to be in the range of (9-17) x 10 -10 cm3s-1. Rotational energy transfer accounted for approximately 90% of the total removal rate from each state. Therefore, the upper limit of vibrational energy transfer from the (1,0,1,0 0,00) state was 10%.

Streamline similarity method for flow distributions and shock losses at the impeller inlet of the centrifugal pump

NASA Astrophysics Data System (ADS)

Zhang, Zh.

2018-02-01

An analytical method is presented, which enables the non-uniform velocity and pressure distributions at the impeller inlet of a pump to be accurately computed. The analyses are based on the potential flow theory and the geometrical similarity of the streamline distribution along the leading edge of the impeller blades. The method is thus called streamline similarity method (SSM). The obtained geometrical form of the flow distribution is then simply described by the geometrical variable G( s) and the first structural constant G I . As clearly demonstrated and also validated by experiments, both the flow velocity and the pressure distributions at the impeller inlet are usually highly non-uniform. This knowledge is indispensible for impeller blade designs to fulfill the shockless inlet flow condition. By introducing the second structural constant G II , the paper also presents the simple and accurate computation of the shock loss, which occurs at the impeller inlet. The introduction of two structural constants contributes immensely to the enhancement of the computational accuracies. As further indicated, all computations presented in this paper can also be well applied to the non-uniform exit flow out of an impeller of the Francis turbine for accurately computing the related mean values.

Active thermal isolation for temperature responsive sensors

NASA Technical Reports Server (NTRS)

Martinson, Scott D. (Inventor); Gray, David L. (Inventor); Carraway, Debra L. (Inventor); Reda, Daniel C. (Inventor)

1994-01-01

The detection of flow transition between laminar and turbulent flow and of shear stress or skin friction of airfoils is important in basic research for validation of airfoil theory and design. These values are conventionally measured using hot film nickel sensors deposited on a polyimide substrate. The substrate electrically insulates the sensor and underlying airfoil but is prevented from thermally isolating the sensor by thickness constraints necessary to avoid flow contamination. Proposed heating of the model surface is difficult to control, requires significant energy expenditures, and may alter the basic flow state of the airfoil. A temperature responsive sensor is located in the airflow over the specified surface of a body and is maintained at a constant temperature. An active thermal isolator is located between this temperature responsive sensor and the specific surface of the body. The total thickness of the isolator and sensor avoid any contamination of the flow. The temperature of this isolator is controlled to reduce conductive heat flow from the temperature responsive sensor to the body. This temperature control includes (1) operating the isolator at the same temperature as the constant temperature of the sensor; and (2) establishing a fixed boundary temperature which is either less than or equal to, or slightly greater than the sensor constant temperature. The present invention accordingly thermally isolates a temperature responsive sensor in an energy efficient, controllable manner while avoiding any contamination of the flow.

Drop-Off Detection with the Long Cane: Effects of Different Cane Techniques on Performance

ERIC Educational Resources Information Center

Kim, Dae Shik; Emerson, Robert Wall; Curtis, Amy

2009-01-01

This study compared the drop-off detection performance with the two-point touch and constant contact cane techniques using a repeated-measures design with a convenience sample of 15 cane users with visual impairments. The constant contact technique was superior to the two-point touch technique in the drop-off detection rate and the 50% detection…

Computational and theoretical analysis of free surface flow in a thin liquid film under zero and normal gravity

NASA Technical Reports Server (NTRS)

Faghri, Amir; Swanson, Theodore D.

1988-01-01

The results of a numerical computation and theoretical analysis are presented for the flow of a thin liquid film in the presence and absence of a gravitational body force. Five different flow systems were used. Also presented are the governing equations and boundary conditions for the situation of a thin liquid emanating from a pressure vessel; traveling along a horizontal plate with a constant initial height and uniform initial velocity; and traveling radially along a horizontal disk with a constant initial height and uniform initial velocity.

Gene delivery by direct injection (microinjection) using a controlled-flow system.

PubMed

Dean, David A

2006-12-01

INTRODUCTIONThis protocol describes a method for constant-flow microinjection using the Pneumatic PicoPump (World Precision Instruments). This type of system is very simple and can be assembled on a relatively low budget. In this method, a constant flow of sample is delivered from the tip of the pipette, and the amount of sample injected into the cell is determined by how long the pipette remains in the cell. A typical system is composed of a pressure regulator that can be adjusted for two pressures (back pressure and injection pressure), a capillary holder, and a coarse and fine micromanipulator.

42 CFR 84.94 - Gas flow test; closed-circuit apparatus.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 42 Public Health 1 2011-10-01 2011-10-01 false Gas flow test; closed-circuit apparatus. 84.94...-Contained Breathing Apparatus § 84.94 Gas flow test; closed-circuit apparatus. (a) Where oxygen is supplied... rated service time of the apparatus. (b) Where constant flow is used in conjunction with demand flow...

42 CFR 84.94 - Gas flow test; closed-circuit apparatus.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 42 Public Health 1 2010-10-01 2010-10-01 false Gas flow test; closed-circuit apparatus. 84.94...-Contained Breathing Apparatus § 84.94 Gas flow test; closed-circuit apparatus. (a) Where oxygen is supplied... rated service time of the apparatus. (b) Where constant flow is used in conjunction with demand flow...

Direct simulation of isothermal-wall supersonic channel flow

NASA Technical Reports Server (NTRS)

Coleman, Gary N.

1993-01-01

The motivation for this work is the fact that in turbulent flows where compressibility effects are important, they are often poorly understood. A few examples of such flows are those associated with astrophysical phenomena and those found in combustion chambers, supersonic diffusers and nozzles, and over high-speed airfoils. For this project, we are primarily interested in compressibility effects near solid surfaces. Our main objective is an improved understanding of the fundamentals of compressible wall-bounded turbulence, which can in turn be used to cast light upon modeling concepts such as the Morkovin hypothesis and the Van Driest transformation. To this end, we have performed a direct numerical simulation (DNS) study of supersonic turbulent flow in a plane channel with constant-temperature walls. All of the relevant spatial and temporal scales are resolved so that no sub grid scale or turbulence model is necessary. The channel geometry was chosen so that finite Mach number effects can be isolated by comparing the present results to well established incompressible channel data. Here the fluid is assumed to be an ideal gas with constant specific heats, constant Prandtl number, and power-law temperature-dependent viscosity. Isothermal-wall boundary conditions are imposed so that a statistically stationary state may be obtained. The flow is driven by a uniform (in space) body force (rather than a mean pressure gradient) to preserve stream wise homogeneity, with the body force defined so that the total mass flux is constant.

Normal stress effects on Knudsen flow

NASA Astrophysics Data System (ADS)

Eu, Byung Chan

2018-01-01

Normal stress effects are investigated on tube flow of a single-component non-Newtonian fluid under a constant pressure gradient in a constant temperature field. The generalized hydrodynamic equations are employed, which are consistent with the laws of thermodynamics. In the cylindrical tube flow configuration, the solutions of generalized hydrodynamic equations are exactly solvable and the flow velocity is obtained in a simple one-dimensional integral quadrature. Unlike the case of flow in the absence of normal stresses, the flow develops an anomaly in that the flow in the boundary layer becomes stagnant and the thickness of such a stagnant velocity boundary layer depends on the pressure gradient, the aspect ratio of the radius to the length of the tube, and the pressure (or density and temperature) at the entrance of the tube. The volume flow rate formula through the tube is derived for the flow. It generalizes the Knudsen flow rate formula to the case of a non-Newtonian stress tensor in the presence of normal stress differences. It also reduces to the Navier-Stokes theory formula in the low shear rate limit near equilibrium.

Regulator for intravenous feeding

NASA Technical Reports Server (NTRS)

Dimeff, J.

1975-01-01

Float valve maintains constant level of solution, providing constant drop rate as long as solution can flow into patient's vein. Second float valve allows solution to enter vein, but prevents entry of air.

Effects of ionic concentration gradient on electroosmotic flow mixing in a microchannel.

PubMed

Peng, Ran; Li, Dongqing

2015-02-15

Effects of ionic concentration gradient on electroosmotic flow (EOF) mixing of one stream of a high concentration electrolyte solution with a stream of a low concentration electrolyte solution in a microchannel are investigated numerically. The concentration field, flow field and electric field are strongly coupled via concentration dependent zeta potential, dielectric constant and electric conductivity. The results show that the electric field and the flow velocity are non-uniform when the concentration dependence of these parameters is taken into consideration. It is also found that when the ionic concentration of the electrolyte solution is higher than 1M, the electrolyte solution essentially cannot enter the channel due to the extremely low electroosmotic flow mobility. The effects of the concentration dependence of zeta potential, dielectric constant and electric conductivity on electroosmotic flow mixing are studied. Copyright © 2014 Elsevier Inc. All rights reserved.

Topologically massive gravity and Ricci-Cotton flow

NASA Astrophysics Data System (ADS)

Lashkari, Nima; Maloney, Alexander

2011-05-01

We consider topologically massive gravity (TMG), which is three-dimensional general relativity with a cosmological constant and a gravitational Chern-Simons term. When the cosmological constant is negative the theory has two potential vacuum solutions: anti-de Sitter space and warped anti-de Sitter space. The theory also contains a massive graviton state which renders these solutions unstable for certain values of the parameters and boundary conditions. We study the decay of these solutions due to the condensation of the massive graviton mode using Ricci-Cotton flow, which is the appropriate generalization of Ricci flow to TMG. When the Chern-Simons coupling is small the AdS solution flows to warped AdS by the condensation of the massive graviton mode. When the coupling is large the situation is reversed, and warped AdS flows to AdS. Minisuperspace models are constructed where these flows are studied explicitly.

On compressible and piezo-viscous flow in thin porous media.

PubMed

Pérez-Ràfols, F; Wall, P; Almqvist, A

2018-01-01

In this paper, we study flow through thin porous media as in, e.g. seals or fractures. It is often useful to know the permeability of such systems. In the context of incompressible and iso-viscous fluids, the permeability is the constant of proportionality relating the total flow through the media to the pressure drop. In this work, we show that it is also relevant to define a constant permeability when compressible and/or piezo-viscous fluids are considered. More precisely, we show that the corresponding nonlinear equation describing the flow of any compressible and piezo-viscous fluid can be transformed into a single linear equation. Indeed, this linear equation is the same as the one describing the flow of an incompressible and iso-viscous fluid. By this transformation, the total flow can be expressed as the product of the permeability and a nonlinear function of pressure, which represents a generalized pressure drop.

Air ejector augmented compressed air energy storage system

DOEpatents

Ahrens, F.W.; Kartsounes, G.T.

Energy is stored in slack demand periods by charging a plurality of underground reservoirs with air to the same peak storage pressure, during peak demand periods throttling the air from one storage reservoir into a gas turbine system at a constant inlet pressure until the air presure in the reservoir falls to said constant inlet pressure, thereupon permitting air in a second reservoir to flow into said gas turbine system while drawing air from the first reservoir through a variable geometry air ejector and adjusting said variable geometry air ejector, said air flow being essentially at the constant inlet pressure of the gas turbine system.

Air ejector augmented compressed air energy storage system

DOEpatents

Ahrens, Frederick W.; Kartsounes, George T.

1980-01-01

Energy is stored in slack demand periods by charging a plurality of underground reservoirs with air to the same peak storage pressure, during peak demand periods throttling the air from one storage reservoir into a gas turbine system at a constant inlet pressure until the air pressure in the reservoir falls to said constant inlet pressure, thereupon permitting air in a second reservoir to flow into said gas turbine system while drawing air from the first reservoir through a variable geometry air ejector and adjusting said variable geometry air ejector, said air flow being essentially at the constant inlet pressure of the gas turbine system.

Numerical Modeling of Cavitating Venturi: A Flow Control Element of Propulsion System

NASA Technical Reports Server (NTRS)

Majumdar, Alok; Saxon, Jeff (Technical Monitor)

2002-01-01

In a propulsion system, the propellant flow and mixture ratio could be controlled either by variable area flow control valves or by passive flow control elements such as cavitating venturies. Cavitating venturies maintain constant propellant flowrate for fixed inlet conditions (pressure and temperature) and wide range of outlet pressures, thereby maintain constant, engine thrust and mixture ratio. The flowrate through the venturi reaches a constant value and becomes independent of outlet pressure when the pressure at throat becomes equal to vapor pressure. In order to develop a numerical model of propulsion system, it is necessary to model cavitating venturies in propellant feed systems. This paper presents a finite volume model of flow network of a cavitating venturi. The venturi was discretized into a number of control volumes and mass, momentum and energy conservation equations in each control volume are simultaneously solved to calculate one-dimensional pressure, density, and flowrate and temperature distribution. The numerical model predicts cavitations at the throat when outlet pressure was gradually reduced. Once cavitation starts, with further reduction of downstream pressure, no change in flowrate is found. The numerical predictions have been compared with test data and empirical equation based on Bernoulli's equation.

Time Domain Estimation of Arterial Parameters using the Windkessel Model and the Monte Carlo Method

NASA Astrophysics Data System (ADS)

Gostuski, Vladimir; Pastore, Ignacio; Rodriguez Palacios, Gaspar; Vaca Diez, Gustavo; Moscoso-Vasquez, H. Marcela; Risk, Marcelo

2016-04-01

Numerous parameter estimation techniques exist for characterizing the arterial system using electrical circuit analogs. However, they are often limited by their requirements and usually high computational burdain. Therefore, a new method for estimating arterial parameters based on Monte Carlo simulation is proposed. A three element Windkessel model was used to represent the arterial system. The approach was to reduce the error between the calculated and physiological aortic pressure by randomly generating arterial parameter values, while keeping constant the arterial resistance. This last value was obtained for each subject using the arterial flow, and was a necessary consideration in order to obtain a unique set of values for the arterial compliance and peripheral resistance. The estimation technique was applied to in vivo data containing steady beats in mongrel dogs, and it reliably estimated Windkessel arterial parameters. Further, this method appears to be computationally efficient for on-line time-domain estimation of these parameters.

Determination of stream reaeration coefficients by use of tracers

USGS Publications Warehouse

Kilpatrick, F.A.; Rathbun, R.E.; Yotsukura, N.; Parker, G.W.; DeLong, L.L.

1987-01-01

Stream reaeration is the physical absorption of oxygen from the atmosphere by a flowing stream. This is the primary process by which a stream replenishes the oxygen consumed in the biodegradation of organic wastes.Prior to 1965, reaeration rate coefficients could be estimated only by indirect methods. In 1965, a direct method of measuring stream reaeration coefficients was developed in which a radioactive tracer gas was injected into a stream--the tracer gas being desorbed from the stream inversely to how oxygen would be absorbed. The technique has since been modified by substituting hydrocarbon gases for the radioactive tracer gas.This manual describes the slug-injection and constant-rate injection methods of performing gas-tracer desorption measurements. Emphasis is on the use of rhodamine WT dye as a relatively conservative tracer and propane as the nonconservative gas tracer, on planning field tests, methods of injection, sampling and analysis, and computational techniques to compute desorption and reaeration coefficients.

Bubble pump: scalable strategy for in-plane liquid routing.

PubMed

Oskooei, Ali; Günther, Axel

2015-07-07

We present an on-chip liquid routing technique intended for application in well-based microfluidic systems that require long-term active pumping at low to medium flowrates. Our technique requires only one fluidic feature layer, one pneumatic control line and does not rely on flexible membranes and mechanical or moving parts. The presented bubble pump is therefore compatible with both elastomeric and rigid substrate materials and the associated scalable manufacturing processes. Directed liquid flow was achieved in a microchannel by an in-series configuration of two previously described "bubble gates", i.e., by gas-bubble enabled miniature gate valves. Only one time-dependent pressure signal is required and initiates at the upstream (active) bubble gate a reciprocating bubble motion. Applied at the downstream (passive) gate a time-constant gas pressure level is applied. In its rest state, the passive gate remains closed and only temporarily opens while the liquid pressure rises due to the active gate's reciprocating bubble motion. We have designed, fabricated and consistently operated our bubble pump with a variety of working liquids for >72 hours. Flow rates of 0-5.5 μl min(-1), were obtained and depended on the selected geometric dimensions, working fluids and actuation frequencies. The maximum operational pressure was 2.9 kPa-9.1 kPa and depended on the interfacial tension of the working fluids. Attainable flow rates compared favorably with those of available micropumps. We achieved flow rate enhancements of 30-100% by operating two bubble pumps in tandem and demonstrated scalability of the concept in a multi-well format with 12 individually and uniformly perfused microchannels (variation in flow rate <7%). We envision the demonstrated concept to allow for the consistent on-chip delivery of a wide range of different liquids that may even include highly reactive or moisture sensitive solutions. The presented bubble pump may provide active flow control for analytical and point-of-care diagnostic devices, as well as for microfluidic cells culture and organ-on-chip platforms.

Quantification of rapid environmental redox processes with quick-scanning x-ray absorption spectroscopy (Q-XAS)

PubMed Central

Ginder-Vogel, Matthew; Landrot, Gautier; Fischel, Jason S.; Sparks, Donald L.

2009-01-01

Quantification of the initial rates of environmental reactions at the mineral/water interface is a fundamental prerequisite to determining reaction mechanisms and contaminant transport modeling and predicting environmental risk. Until recently, experimental techniques with adequate time resolution and elemental sensitivity to measure initial rates of the wide variety of environmental reactions were quite limited. Techniques such as electron paramagnetic resonance and Fourier transform infrared spectroscopies suffer from limited elemental specificity and poor sensitivity to inorganic elements, respectively. Ex situ analysis of batch and stirred-flow systems provides high elemental sensitivity; however, their time resolution is inadequate to characterize rapid environmental reactions. Here we apply quick-scanning x-ray absorption spectroscopy (Q-XAS), at sub-second time-scales, to measure the initial oxidation rate of As(III) to As(V) by hydrous manganese(IV) oxide. Using Q-XAS, As(III) and As(V) concentrations were determined every 0.98 s in batch reactions. The initial apparent As(III) depletion rate constants (t < 30 s) measured with Q-XAS are nearly twice as large as rate constants measured with traditional analytical techniques. Our results demonstrate the importance of developing analytical techniques capable of analyzing environmental reactions on the same time scale as they occur. Given the high sensitivity, elemental specificity, and time resolution of Q-XAS, it has many potential applications. They could include measuring not only redox reactions but also dissolution/precipitation reactions, such as the formation and/or reductive dissolution of Fe(III) (hydr)oxides, solid-phase transformations (i.e., formation of layered-double hydroxide minerals), or almost any other reaction occurring in aqueous media that can be measured using x-ray absorption spectroscopy. PMID:19805269

Application of dielectric constant measurement in microwave sludge disintegration and wastewater purification processes.

PubMed

Kovács, Petra Veszelovszki; Lemmer, Balázs; Keszthelyi-Szabó, Gábor; Hodúr, Cecilia; Beszédes, Sándor

2018-05-01

It has been numerously verified that microwave radiation could be advantageous as a pre-treatment for enhanced disintegration of sludge. Very few data related to the dielectric parameters of wastewater of different origins are available; therefore, the objective of our work was to measure the dielectric constant of municipal and meat industrial wastewater during a continuous flow operating microwave process. Determination of the dielectric constant and its change during wastewater and sludge processing make it possible to decide on the applicability of dielectric measurements for detecting the organic matter removal efficiency of wastewater purification process or disintegration degree of sludge. With the measurement of dielectric constant as a function of temperature, total solids (TS) content and microwave specific process parameters regression models were developed. Our results verified that in the case of municipal wastewater sludge, the TS content has a significant effect on the dielectric constant and disintegration degree (DD), as does the temperature. The dielectric constant has a decreasing tendency with increasing temperature for wastewater sludge of low TS content, but an adverse effect was found for samples with high TS and organic matter contents. DD of meat processing wastewater sludge was influenced significantly by the volumetric flow rate and power level, as process parameters of continuously flow microwave pre-treatments. It can be concluded that the disintegration process of food industry sludge can be detected by dielectric constant measurements. From technical purposes the applicability of dielectric measurements was tested in the purification process of municipal wastewater, as well. Determination of dielectric behaviour was a sensitive method to detect the purification degree of municipal wastewater.

Estimation of the zeta potential and the dielectric constant using velocity measurements in the electroosmotic flows.

PubMed

Park, H M; Hong, S M

2006-12-15

In this paper we develop a method for the determination of the zeta potential zeta and the dielectric constant epsilon by exploiting velocity measurements of the electroosmotic flow in microchannels. The inverse problem is solved through the minimization of a performance function utilizing the conjugate gradient method. The present method is found to estimate zeta and epsilon with reasonable accuracy even with noisy velocity measurements.

Tecnical Note: Analysis of non-regulated vehicular emissions by extractive FTIR spectrometry: tests on a hybrid car in Mexico City

NASA Astrophysics Data System (ADS)

Reyes, F.; Grutter, M.; Jazcilevich, A.; González-Oropeza, R.

2006-11-01

A methodology to acquire valuable information on the chemical composition and evolution of vehicular emissions is presented. The analysis of the gases is performed by passing a constant flow of a sample gas from the tail-pipe into a 10 L multi-pass cell. The absorption spectra within the cell are obtained using an FTIR spectrometer at 0.5 cm-1 resolution along a 13.1 m optical path. Additionally, the total flow from the exhaust is continuously measured from a differential pressure sensor on a textit{Pitot} tube installed at the exit of the exhaust. This configuration aims to obtain a good speciation capability by coadding spectra during 30 s and reporting the emission (in g/km) of both criteria and non-regulated pollutants, such as CO2, CO, NO, SO2, NH3, HCHO and some NMHC, during predetermined driving cycles. The advantages and disadvantages of increasing the measurement frequency, as well as the effect of other parameters such as spectral resolution, cell volume and flow rate, are discussed. To test and evaluate the proposed technique, experiments were performed on a dynamometer running FTP-75 and typical driving cycles for the Mexico City Metropolitan Area (MCMA) on a Toyota Prius hybrid vehicle. This car is an example of recent marketed automotive technology dedicated to reduced emissions, increasing the need for sensitive detection techniques. This study shows the potential of the proposed technique to measure and report in real time the emissions of a large variety of pollutants, even from a super ultra-low emission vehicle (SULEV). The emissions of HC's, NOx, CO and CO2 obtained here were compared to experiments performed in other locations with the same model vehicle. The proposed technique provides a tool for future studies comparing in detail the emissions of vehicles using alternative fuels and emission control systems.

Constraining Path-Dependent Processes During Basalt-CO2 Interactions with Observations From Flow-Through and Batch Experiments

NASA Astrophysics Data System (ADS)

Thomas, D.; Garing, C.; Zahasky, C.; Harrison, A. L.; Bird, D. K.; Benson, S. M.; Oelkers, E. H.; Maher, K.

2017-12-01

Predicting the timing and magnitude of CO2 storage in basaltic rocks relies partly on quantifying the dependence of reactivity on flow path and mineral distribution. Flow-through experiments that use intact cores are advantageous because the spatial heterogeneity of pore space and reactive phases is preserved. Combining aqueous geochemical analyses and petrologic characterization with non-destructive imaging techniques (e.g. micro-computed tomography) constrains the relationship between irreversible reactions, pore connectivity and accessible surface area. Our work enhances these capabilities by dynamically imaging flow through vesicular basalts with Positron Emission Tomography (PET) scanning. PET highlights the path a fluid takes by detecting photons produced during radioactive decay of an injected radiotracer (FDG). We have performed single-phase, CO2-saturated flow-through experiments with basaltic core from Iceland at CO2 sequestration conditions (50 °C; 76-90 bar Ptot). Constant flow rate and continuous pressure measurements at the inlet and outlet of the core constrain permeability. We monitor geochemical evolution through cation and anion analysis of outlet fluid sampled periodically. Before and after reaction, we perform PET scans and characterize the core using micro-CT. The PET scans indicate a discrete, localized flow path that appears to be a micro-crack connecting vesicles, suggesting that vesicle-lining minerals are immediately accessible and important reactants. Rapid increases in aqueous cation concentration, pH and HCO3- indicate that the rock reacts nearly immediately after CO2 injection. After 24 hours the solute release decreases, which may reflect a transition to reaction with phases with slower kinetic dissolution rates (e.g. zeolites and glasses to feldspar), a decrease in available reactive surface area or precipitation. We have performed batch experiments using crushed material of the same rock to elucidate the effect of flow path geometry and mineral accessibility on geochemical evolution. Interestingly, surface area-normalized dissolution rates as evinced by SiO2 release in all experiments approach similar values ( 10-15 mol/cm2/s). Our experiments show how imaging techniques are helpful in interpreting path-dependent processes in open systems.

Microfluidic oscillators with widely tunable periods

PubMed Central

Kim, Sung-Jin; Yokokawa, Ryuji; Takayama, Shuichi

2013-01-01

We present experiments and theory of a constant flow-driven microfluidic oscillator with widely tunable oscillation periods. This oscillator converts two constant input-flows from a syringe pump into an alternating, periodic output-flow with oscillation periods that can be adjusted to between 0.3 s to 4.1 h by tuning an external membrane capacitor. This capacitor allows multiple adjustable periods at a given input flow-rate, thus providing great flexibility in device operation. Also, we show that a sufficiently large external capacitance, relative to the internal capacitance of the microfluidic valve itself, is a critical requirement for oscillation. These widely tunable microfluidic oscillators are envisioned to be broadly useful for the study of biological rhythms, as on-chip timing sources for microfluidic logic circuits, and other applications that require variation in timed flow switching. PMID:23429765

Influence of fast advective flows on pattern formation of Dictyostelium discoideum

PubMed Central

Bae, Albert; Zykov, Vladimir; Bodenschatz, Eberhard

2018-01-01

We report experimental and numerical results on pattern formation of self-organizing Dictyostelium discoideum cells in a microfluidic setup under a constant buffer flow. The external flow advects the signaling molecule cyclic adenosine monophosphate (cAMP) downstream, while the chemotactic cells attached to the solid substrate are not transported with the flow. At high flow velocities, elongated cAMP waves are formed that cover the whole length of the channel and propagate both parallel and perpendicular to the flow direction. While the wave period and transverse propagation velocity are constant, parallel wave velocity and the wave width increase linearly with the imposed flow. We also observe that the acquired wave shape is highly dependent on the wave generation site and the strength of the imposed flow. We compared the wave shape and velocity with numerical simulations performed using a reaction-diffusion model and found excellent agreement. These results are expected to play an important role in understanding the process of pattern formation and aggregation of D. discoideum that may experience fluid flows in its natural habitat. PMID:29590179

Experimental study on waves propagation over a coarse-grained sloping beach

NASA Astrophysics Data System (ADS)

Hsu, Tai-Wen; Lai, Jian-Wu

2013-04-01

This study investigates velocity fields of wave propagation over a coarse-grained sloping beach using laboratory experiments. The experiment was conducted in a wave flume of 25 m long, 0.5 m wide and 0.6 m high in which a coarse-grained sloping 1:5 beach was placed with two layers ball. The glass ball is D=7.9 cm and the center to center distance of each ball is 8.0 cm. The test section for observing wave and flow fields is located at the middle part of the flume. A piston type wave maker driven by an electromechanical hydraulic serve system is installed at the end of the flume. The intrinsic permeability Kp and turbulent drag coefficient Cf were obtained from steady flow water-head experiments. The flow velocity was measured by the particle image velocimeter (PIV) and digital image process (DIP) techniques. Eleven fields of view (FOVS) were integrated into a complete representation including the outer, surf and swash zone. Details of the definition sketch of the coarse-grained sloping beach model as well as experimental setup are referred to Lai et al. (2008). A high resolution of CCD camera was used to capture the images which was calibrated by the direct linear transform (DCT) algorithm proposed by Abed El-Aziz and Kar-Ara (1971). The water surface between the interface of air and water at each time step are calculated by Otsu' (1978) detect algorithm. The comparison shows that the water surface elevation observed by integrated image agrees well with that of Otsu' detection results. For the flow field measurement, each image pair was cross correlated with 32X32 pixel inter rogation window and a half overlap between adjacent windows. The repeatability and synchronization are the key elements for both wave motion and PIV technique. The wave profiles and flow field were compared during several wave periods to ensure that they can be reproduced by the present system. The water depth is kept as a constant of h=32 cm. The incident wave conditions are set to be wave height H0 = 3.86 cm or 7.75 cm and wave period T = 1.0 s. The illumination source of the PIV system is a dual-head frequency-doubled Nd:YAG laser, which has a maximum energy output of 120 mJ per pulse at two wavelengths of 523nm and 266nm. A synchronizer controls the emission time of a pulse laser beam as well as the camera exposure and shutter time. Linear wave theory (LWT) of wave propagation over a constant water depth was tested to validate the DIP/PIV algorithm. The comparison of velocity profiles in X and Z directions are in good agreement with those of LWT. Waves propagating over a coarse-grained sloping beach were investigated using PIV/DIP techniques. Detailed analysis of experimental results show that the flow field, turbulent intensity and vorticity are primarily located above the wave trough. A detailed description is provided in terms of free surface, velocity field, and turbulent energy transport. References 1. Abdel-Aziz, Karara.1971, Direct linear transformation into object space coordinates in closerange photogrametry. In Proc. Symp. Close-Range Photogrametry, 1-18. 2. Flow-3D (2008) user manual, version 9.3. 3. Otsu N. 1978. A threshold selection method from gray level histogram, IEEE Trans. on System, Man, and Cybernetics, 8, 62-66.

Validation of a multilevel sampling device to determine the vertical variability of chlorinated solvent in a contaminated aquifer.

PubMed

Barnier, C; Palmier, C; Atteia, O

2013-01-01

The vertical heterogeneity of contaminant concentrations in aquifers is well known, but obtaining representative samples is still a subject of debate. In this paper, the question arises from sites where numerous fully screened wells exist and there is a need to define the vertical distribution of contaminants. For this purpose, several wells were investigated with different techniques on a site contaminated with chlorinated solvents. A core-bored well shows that a tetrachloroethene (PCE) phase is sitting on and infiltrating a less permeable layer. Downstream of the cored well, the following sampling techniques were compared on fully screened wells: low flow pumping at several depths, pumping between packers and a new multilevel sampler for fully screened wells. Concerning low flow rate pumping, very low gradients were found, which may be due to the existence of vertical flow inside the well or in the gravel pack. Sampling between packers gave results comparable with the cores, separating a layer with PCE and trichloroethene from another one with cis 1,2-dichloroethene and vinyl chloride as major compounds. Detailed sampling according to pumped volume shows that even between packers, cleaning of the inter-packer volume is necessary before each sampling. Lastly, the proposed new multilevel sampler gives results similar to the packers but has the advantages of much faster sampling and a constant vertical positioning, which is fairly important for long-term monitoring in highly stratified aquifers.

Force determination in lateral magnetic tweezers combined with TIRF microscopy.

PubMed

Madariaga-Marcos, J; Hormeño, S; Pastrana, C L; Fisher, G L M; Dillingham, M S; Moreno-Herrero, F

2018-03-01

Combining single-molecule techniques with fluorescence microscopy has attracted much interest because it allows the correlation of mechanical measurements with directly visualized DNA : protein interactions. In particular, its combination with total internal reflection fluorescence microscopy (TIRF) is advantageous because of the high signal-to-noise ratio this technique achieves. This, however, requires stretching long DNA molecules across the surface of a flow cell to maximize polymer exposure to the excitation light. In this work, we develop a module to laterally stretch DNA molecules at a constant force, which can be easily implemented in regular or combined magnetic tweezers (MT)-TIRF setups. The pulling module is further characterized in standard flow cells of different thicknesses and glass capillaries, using two types of micrometer size superparamagnetic beads, long DNA molecules, and a home-built device to rotate capillaries with mrad precision. The force range achieved by the magnetic pulling module was between 0.1 and 30 pN. A formalism for estimating forces in flow-stretched tethered beads is also proposed, and the results compared with those of lateral MT, demonstrating that lateral MT achieve higher forces with lower dispersion. Finally, we show the compatibility with TIRF microscopy and the parallelization of measurements by characterizing DNA binding by the centromere-binding protein ParB from Bacillus subtilis. Simultaneous MT pulling and fluorescence imaging demonstrate the non-specific binding of BsParB on DNA under conditions restrictive to condensation.

Pressure-Drop Considerations in the Characterization of Dew-Point Transfer Standards at High Temperatures

NASA Astrophysics Data System (ADS)

Mitter, H.; Böse, N.; Benyon, R.; Vicente, T.

2012-09-01

During calibration of precision optical dew-point hygrometers (DPHs), it is usually necessary to take into account the pressure drop induced by the gas flow between the "point of reference" and the "point of use" (mirror or measuring head of the DPH) either as a correction of the reference dew-point temperature or as part of the uncertainty estimation. At dew-point temperatures in the range of ambient temperature and below, it is sufficient to determine the pressure drop for the required gas flow, and to keep the volumetric flow constant during the measurements. In this case, it is feasible to keep the dry-gas flow into the dew-point generator constant or to measure the flow downstream the DPH at ambient temperature. In normal operation, at least one DPH in addition to the monitoring DPH are used, and this operation has to be applied to each instrument. The situation is different at high dew-point temperatures up to 95 °C, the currently achievable upper limit reported in this paper. With increasing dew-point temperatures, the reference gas contains increasing amounts of water vapour and a constant dry-gas flow will lead to a significant enhanced volume flow at the conditions at the point of use, and therefore, to a significantly varying pressure drop depending on the applied dew-point temperature. At dew-point temperatures above ambient temperature, it is also necessary to heat the reference gas and the mirror head of the DPH sufficiently to avoid condensation which will additionally increase the volume flow and the pressure drop. In this paper, a method is provided to calculate the dry-gas flow rate needed to maintain a known wet-gas flow rate through a chilled mirror for a range of temperature and pressures.

Pressure distribution in a converging-diverging nozzle during two-phase choked flow of subcooled nitrogen

NASA Technical Reports Server (NTRS)

Simoneau, R. J.

1975-01-01

Choked flow rates and axial pressure distributions were measured for subcooled nitrogen in a converging-diverging nozzle with a constant area section in the throat region. Stagnation pressures ranged from slightly above saturation to twice the thermodynamic critical pressure. Stagnation temperatures ranged from 0.75 to 1.03 times the thermodynamic critical temperature. The choking plane is at the divergence end of the constant area throat section. At high stagnation pressures the fluid stays liquid well into the constant area throat region; at near saturation stagnation pressures it appears that vaporization occurs at or before the entrance to the constant area throat region. The throat-to-stagnation pressure ratio data exhibits an anomalous flat region, and this anomaly is related to the two-phase process. The fluid is metastably all liquid below the saturation pressure.

Evaluation of Improvements to Brayton Cycle Performance.

DTIC Science & Technology

1986-05-29

cogeneration systems. They are International Power Technology (IPT), Palo Alto, California and Mechanical Technology, Inc. (MTI), Latham, New York [13]. IPT...constant (10) For a constant Reynold’s number and dimensions, the friction factor will be constant. The relationship for friction of internal ...equation for the friction factor of internal turbulent flow is expressed as Ap -friction =f(Re) - constant. (12) pV 2 Applying Equation (11), Equation (12

Expiratory muscle loading increases intercostal muscle blood flow during leg exercise in healthy humans

PubMed Central

Athanasopoulos, Dimitris; Louvaris, Zafeiris; Cherouveim, Evgenia; Andrianopoulos, Vasilis; Roussos, Charis; Zakynthinos, Spyros

2010-01-01

We investigated whether expiratory muscle loading induced by the application of expiratory flow limitation (EFL) during exercise in healthy subjects causes a reduction in quadriceps muscle blood flow in favor of the blood flow to the intercostal muscles. We hypothesized that, during exercise with EFL quadriceps muscle blood flow would be reduced, whereas intercostal muscle blood flow would be increased compared with exercise without EFL. We initially performed an incremental exercise test on eight healthy male subjects with a Starling resistor in the expiratory line limiting expiratory flow to ∼ 1 l/s to determine peak EFL exercise workload. On a different day, two constant-load exercise trials were performed in a balanced ordering sequence, during which subjects exercised with or without EFL at peak EFL exercise workload for 6 min. Intercostal (probe over the 7th intercostal space) and vastus lateralis muscle blood flow index (BFI) was calculated by near-infrared spectroscopy using indocyanine green, whereas cardiac output (CO) was measured by an impedance cardiography technique. At exercise termination, CO and stroke volume were not significantly different during exercise, with or without EFL (CO: 16.5 vs. 15.2 l/min, stroke volume: 104 vs. 107 ml/beat). Quadriceps muscle BFI during exercise with EFL (5.4 nM/s) was significantly (P = 0.043) lower compared with exercise without EFL (7.6 nM/s), whereas intercostal muscle BFI during exercise with EFL (3.5 nM/s) was significantly (P = 0.021) greater compared with that recorded during control exercise (0.4 nM/s). In conclusion, increased respiratory muscle loading during exercise in healthy humans causes an increase in blood flow to the intercostal muscles and a concomitant decrease in quadriceps muscle blood flow. PMID:20507965

Differences in Landsat TM derived lava flow thermal structures during summit and flank eruption at Mount Etna

NASA Astrophysics Data System (ADS)

Lombardo, V.; Buongiorno, M. F.; Pieri, D.; Merucci, L.

2004-06-01

The simultaneous solution of the Planck equation (the so-called "dual-band" technique) for two shortwave infrared Landsat Thematic Mapper (TM) bands allows an estimate of the fractional area of the hottest part of an active flow and the temperature of the cooler crust. Here, the dual-band method has been applied to a time series of Mount Etna eruptions. The frequency distribution of the fractional area of the hottest component reveals specific differences between summit and flank lava flows. The shape of the density function shows a trend consistent with a Gaussian distribution and suggests a relationship between the moments of the distribution and the emplacement environment. Because flow composition of Etnean lavas generally remains constant during the duration of their emplacement, it appears that the shape of any particular frequency distribution is probably related to fluid mechanical aspects of flow emplacement that affect flow velocity and flow heat loss and thus the rate of formation of the surface crust. These factors include the influence of topographical features such as changes in slope gradient, changes in volume effusion rate, and progressive downflow increases in bulk or effective viscosity. A form of the general theoretical solution for the 'dual-band' system, which illustrates the relationship between radiance in TM bands 5 and 7, corresponding to hot fractional area and crust temperature, is presented. Generally speaking, it appears that for a given flow at any point in time, larger fractional areas of exposed hot material are correlated with higher temperatures and that, while the overall shape of that distribution is common for the flows studied, its amplitude and slope reflect individual flow rheological regimes.

Three-Dimensional Bayesian Geostatistical Aquifer Characterization at the Hanford 300 Area using Tracer Test Data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Xingyuan; Murakami, Haruko; Hahn, Melanie S.

2012-06-01

Tracer testing under natural or forced gradient flow holds the potential to provide useful information for characterizing subsurface properties, through monitoring, modeling and interpretation of the tracer plume migration in an aquifer. Non-reactive tracer experiments were conducted at the Hanford 300 Area, along with constant-rate injection tests and electromagnetic borehole flowmeter (EBF) profiling. A Bayesian data assimilation technique, the method of anchored distributions (MAD) [Rubin et al., 2010], was applied to assimilate the experimental tracer test data with the other types of data and to infer the three-dimensional heterogeneous structure of the hydraulic conductivity in the saturated zone of themore » Hanford formation. In this study, the Bayesian prior information on the underlying random hydraulic conductivity field was obtained from previous field characterization efforts using the constant-rate injection tests and the EBF data. The posterior distribution of the conductivity field was obtained by further conditioning the field on the temporal moments of tracer breakthrough curves at various observation wells. MAD was implemented with the massively-parallel three-dimensional flow and transport code PFLOTRAN to cope with the highly transient flow boundary conditions at the site and to meet the computational demands of MAD. A synthetic study proved that the proposed method could effectively invert tracer test data to capture the essential spatial heterogeneity of the three-dimensional hydraulic conductivity field. Application of MAD to actual field data shows that the hydrogeological model, when conditioned on the tracer test data, can reproduce the tracer transport behavior better than the field characterized without the tracer test data. This study successfully demonstrates that MAD can sequentially assimilate multi-scale multi-type field data through a consistent Bayesian framework.« less

The oceanic boundary layer driven by wave breaking with stochastic variability. Part 1. Direct numerical simulations

NASA Astrophysics Data System (ADS)

Sullivan, Peter P.; McWilliams, James C.; Melville, W. Kendall

2004-05-01

We devise a stochastic model for the effects of breaking waves and fit its distribution functions to laboratory and field data. This is used to represent the space time structure of momentum and energy forcing of the oceanic boundary layer in turbulence-resolving simulations. The aptness of this breaker model is evaluated in a direct numerical simulation (DNS) of an otherwise quiescent fluid driven by an isolated breaking wave, and the results are in good agreement with laboratory measurements. The breaker model faithfully reproduces the bulk features of a breaking event: the mean kinetic energy decays at a rate approaching t(-1) , and a long-lived vortex (eddy) is generated close to the water surface. The long lifetime of this vortex (more than 50 wave periods) makes it effective in energizing the surface region of oceanic boundary layers. Next, a comparison of several different DNS of idealized oceanic boundary layers driven by different surface forcing (i.e. constant current (as in Couette flow), constant stress, or a mixture of constant stress plus stochastic breakers) elucidates the importance of intermittent stress transmission to the underlying currents. A small amount of active breaking, about 1.6% of the total water surface area at any instant in time, significantly alters the instantaneous flow patterns as well as the ensemble statistics. Near the water surface a vigorous downwelling upwelling pattern develops at the head and tail of each three-dimensional breaker. This enhances the vertical velocity variance and generates both negative- and positive-signed vertical momentum flux. Analysis of the mean velocity and scalar profiles shows that breaking effectively increases the surface roughness z_o by more than a factor of 30; for our simulations z_o/lambda {≈} 0.04 to 0.06, where lambda is the wavelength of the breaking wave. Compared to a flow driven by a constant current, the extra mixing from breakers increases the mean eddy viscosity by more than a factor of 10 near the water surface. Breaking waves alter the usual balance of production and dissipation in the turbulent kinetic energy (TKE) budget; turbulent and pressure transports and breaker work are important sources and sinks in the budget. We also show that turbulent boundary layers driven by constant current and constant stress (i.e. with no breaking) differ in fundamental ways. The additional freedom provided by a constant-stress boundary condition permits finite velocity variances at the water surface, so that flows driven by constant stress mimic flows with weakly and statistically homogeneous breaking waves.

Experimental and Numerical Characterization of a Pulsed Supersonic Uniform Flow for Kinetics and Spectroscopy

NASA Astrophysics Data System (ADS)

Suas-David, Nicolas; Thawoos, Shameemah; Broderick, Bernadette M.; Suits, Arthur

2017-06-01

The current CPUF (Chirped Pulse Uniform Flow) and the new UF-CRDS (Uniform Flow Cavity Ring-Down Spectroscopy) setups relie mostly on the production of a good quality supersonic uniform flow. A supersonic uniform flow is produced by expanding a gas through a Laval nozzle - similar to the nozzles used in aeronautics - linked to a vacuum chamber. The expansion is characterized by an isentropic core where constant very low kinetic temperature (down to 20K) and constant density are observed. The relatively large diameter of the isentropic core associated with homogeneous thermodynamic conditions makes it a relevant tool for low temperature spectroscopy. On the other hand, the length along the axis of the flow of this core (could be longer than 50cm) allows kinetic studies which is one of the main interest of this setup (CRESU technique. The formation of a uniform flow requires an extreme accuracy in the design of the shape of the nozzle for a set of defined temperature/density. The design is based on a Matlab program which retrieves the shape of the isentropic core according to the method of characteristics prior to calculate the thickness of the boundary layer. Two different approaches are used to test the viability of a new nozzle derived from the program. First, a computational fluid dynamic software (OpenFOAM) models the distribution of the thermodynamic properties of the expansion. Then, fabricated nozzles using 3-D printing are tested based on Pitot measurements and spectroscopic analyses. I will present comparisons of simulation and measured performance for a range of nozzles. We will see how the high level of accuracy of numerical simulations provides a deeper knowledge of the experimental conditions. J. M. Oldham, C. Abeysekera, J. Joalland, L. N. Zack, K. Prozument, I. R. Sims, G. Barrat Park, R. W. Filed and A. G. Suits, J. Chem. Phys. 141, 154202, (2014). I. Sims, J. L. Queffelec, A. Defrance, C. Rebrion-Rowe, D. Travers, P. Bocherel, B. Rowe, I. W. Smith, J. Chem. Phys. 100, 4229-4241, (1994). D. B. Atkinson and M. A. Smith, Rev. Sci. Instrum. 66, 4434, (1995). N. Suas-David, V. Kulkarni, A. Benidar, S. Kassi and R. Georges, Chem. Phys. Lett. 659, 209-215, (2016)

Characteristics of transonic spherical symmetric accretion flow in Schwarzschild-de Sitter and Schwarzschild anti-de Sitter backgrounds, in pseudo-general relativistic paradigm

NASA Astrophysics Data System (ADS)

Ghosh, Shubhrangshu; Banik, Prabir

2015-07-01

In this paper, we present a complete work on steady state spherically symmetric Bondi type accretion flow in the presence of cosmological constant (Λ) in both Schwarzschild-de Sitter (SDS) and Schwarzschild anti-de Sitter (SADS) backgrounds considering an isolated supermassive black hole (SMBH), with the inclusion of a simple radiative transfer scheme, in the pseudo-general relativistic paradigm. We do an extensive analysis on the transonic behavior of the Bondi type accretion flow onto the cosmological BHs including a complete analysis of the global parameter space and the stability of flow, and do a complete study of the global family of solutions for a generic polytropic flow. Bondi type accretion flow in SADS background renders multiplicity in its transonic behavior with inner "saddle" type and outer "center" type sonic points, with the transonic solutions forming closed loops or contours. There is always a limiting value for ∣Λ∣ up to which we obtain valid stationary transonic solutions, which correspond to both SDS and SADS geometries; this limiting value moderately increases with the increasing radiative efficiency of the flow, especially correspond to Bondi type accretion flow in SADS background. Repulsive Λ suppresses the Bondi accretion rate by an order of magnitude for relativistic Bondi type accretion flow for a certain range in temperature, and with a marginal increase in the Bondi accretion rate if the corresponding accretion flow occurs in SADS background. However, for a strongly radiative Bondi type accretion flow with high mass accretion rate, the presence of cosmological constant do not much influence the corresponding Bondi accretion rate of the flow. Our analysis show that the relic cosmological constant has a substantial effect on Bondi type accretion flow onto isolated SMBHs and their transonic solutions beyond length-scale of kiloparsecs, especially if the Bondi type accretion occurs onto the host supergiant ellipticals or central dominant (CD) galaxies directly from ambient intercluster medium (ICM). However, for high mass accretion rate, the influence of cosmological constant on Bondi accretion dynamics, generically, diminishes. As active galactic nuclei (AGN)/ICM feedback can be advertently linked to Bondi type spherical accretion, any proper modeling of AGN feedback or megaparsecs-scale jet dynamics or accretion flow from ICM onto the central regions of host galaxies should take into account the relevant information of repulsive Λ, especially in context to supergiant elliptical galaxies or CD galaxies present in rich galaxy clusters. This could also explore the feasibility to limit the value of Λ, from the kinematics in local galactic-scales.

Unsteady stokes flow of dusty fluid between two parallel plates through porous medium in the presence of magnetic field

NASA Astrophysics Data System (ADS)

Sasikala, R.; Govindarajan, A.; Gayathri, R.

2018-04-01

This paper focus on the result of dust particle between two parallel plates through porous medium in the presence of magnetic field with constant suction in the upper plate and constant injection in the lower plate. The partial differential equations governing the flow are solved by similarity transformation. The velocity of the fluid and the dust particle decreases when there is an increase in the Hartmann number.

Group solution for unsteady free-convection flow from a vertical moving plate subjected to constant heat flux

NASA Astrophysics Data System (ADS)

Kassem, M.

2006-03-01

The problem of heat and mass transfer in an unsteady free-convection flow over a continuous moving vertical sheet in an ambient fluid is investigated for constant heat flux using the group theoretical method. The nonlinear coupled partial differential equation governing the flow and the boundary conditions are transformed to a system of ordinary differential equations with appropriate boundary conditions. The obtained ordinary differential equations are solved numerically using the shooting method. The effect of Prandlt number on the velocity and temperature of the boundary-layer is plotted in curves. A comparison with previous work is presented.

Towards a delimitation of southwestern Nigeria into hydrological regions

NASA Astrophysics Data System (ADS)

Ogunkoya, O. O.

1988-05-01

Fifteen third-order drainage basins (1:50,000) on the Basement Complex rocks of southwestern Nigeria are classified into hydrological regions using hydrologic response parameters of average daily mean specific discharge ( QA); daily mean specific discharges equalled or exceeded 90% ( Q90), 50% ( Q50) and 10% ( Q10) of the study period; variability index of flow ( VI); recession constant ( K) of flow from peak discharge at the end of the rainy season to minimum discharge in the dry season; total annual runoff ( RO); total runoff within the dry season ( DSRO); dry season runoff as a percentage of total annual runoff (% DSRO); runoff coefficient ( ROC); and, number of days during the study period when there was no flow ( NFD). An ordination technique and a classification algorithm derived from cluster analysis technique and incorporating the analysis of variance (ANOVA) tests to determine the level of significance of the homogeneity of derived classes, were used to classify the fifteen basins into five hydrologically homogeneous regions. The constituent basins of each region were observed to share common basin geology. It was observed that those drainage basins having at least 50% of their basin area underlain by quartzitic rocks form two groups and have the most desirable or optimal hydrologic response patterns, desirability or optimality being in terms of ability to potentially meet water resource development requirements (i.e. high perennial discharge, low variability and large groundwater contribution to stream flow). The basins predominantly underlain by granite-gneisses and amphibolitic rocks have much poorer hydrologic response patterns. Hydrological regionalization in southwestern Nigeria appears to be influenced by drainage basin geology while percentage area of the basin underlain by massive quartzites could be used as an index of occurrence of desirable hydrologic response pattern.

Probing and quantifying DNA-protein interactions with asymmetrical flow field-flow fractionation.

PubMed

Ashby, Jonathan; Schachermeyer, Samantha; Duan, Yaokai; Jimenez, Luis A; Zhong, Wenwan

2014-09-05

Tools capable of measuring binding affinities as well as amenable to downstream sequencing analysis are needed for study of DNA-protein interaction, particularly in discovery of new DNA sequences with affinity to diverse targets. Asymmetrical flow field-flow fractionation (AF4) is an open-channel separation technique that eliminates interference from column packing to the non-covalently bound complex and could potentially be applied for study of macromolecular interaction. The recovery and elution behaviors of the poly(dA)n strand and aptamers in AF4 were investigated. Good recovery of ssDNAs was achieved by judicious selection of the channel membrane with consideration of the membrane pore diameter and the radius of gyration (Rg) of the ssDNA, which was obtained with the aid of a Molecular Dynamics tool. The Rg values were also used to assess the folding situation of aptamers based on their migration times in AF4. The interactions between two ssDNA aptamers and their respective protein components were investigated. Using AF4, near-baseline resolution between the free and protein-bound aptamer fractions could be obtained. With this information, dissociation constants of ∼16nM and ∼57nM were obtained for an IgE aptamer and a streptavidin aptamer, respectively. In addition, free and protein-bound IgE aptamer was extracted from the AF4 eluate and amplified, illustrating the potential of AF4 in screening ssDNAs with high affinity to targets. Our results demonstrate that AF4 is an effective tool holding several advantages over the existing techniques and should be useful for study of diverse macromolecular interaction systems. Copyright © 2014 Elsevier B.V. All rights reserved.

Assessing Constitutive Models for Prediction of High-Temperature Flow Behavior with a Perspective of Alloy Development

NASA Astrophysics Data System (ADS)

Kumar, Santosh; Aashranth, B.; Davinci, M. Arvinth; Samantaray, Dipti; Borah, Utpal; Bhaduri, A. K.

2018-02-01

The utility of different constitutive models describing high-temperature flow behavior has been evaluated from the perspective of alloy development. Strain compensated Arrhenius model, modified Johnson-Cook (MJC) model, model D8A and artificial neural network (ANN) have been used to describe flow behavior of different model alloys. These alloys are four grades of SS 316LN with different nitrogen contents ranging from 0.07 to 0.22%. Grades with 0.07%N and 0.22%N have been used to determine suitable material constants of the constitutive equations and also to train the ANN model. While the ANN model has been developed with chemical composition as a direct input, the MJC and D8A models have been amended to incorporate the effect of nitrogen content on flow behavior. The prediction capabilities of all models have been validated using the experimental data obtained from grades containing 0.11%N and 0.14%N. The comparative analysis demonstrates that `N-amended D8A' and `N-amended MJC' are preferable to the ANN model for predicting flow behavior of different grades of 316LN. The work provides detailed insights into the usual statistical error analysis technique and frames five additional criteria which must be considered when a model is analyzed from the perspective of alloy development.

Application of the ideas and techniques of classical fluid mechanics to some problems in physical oceanography.

PubMed

Johnson, R S

2018-01-28

This review makes a case for describing many of the flows observed in our oceans, simply based on the Euler equation, with (piecewise) constant density and with suitable boundary conditions. The analyses start from the Euler and mass conservation equations, expressed in a rotating, spherical coordinate system (but the f -plane and β -plane approximations are also mentioned); five examples are discussed. For three of them, a suitable non-dimensionalization is introduced, and a single small parameter is identified in each case. These three examples lead straightforwardly and directly to new results for: waves on the Pacific Equatorial Undercurrent (EUC) with a thermocline (in the f -plane); a nonlinear, three-dimensional model for EUC-type flows (in the β -plane); and a detailed model for large gyres. The other two examples are exact solutions of the complete system: a flow which corresponds to the underlying structure of the Pacific EUC; and a flow based on the necessary requirement to use a non-conservative body force, which produces the type of flow observed in the Antarctic Circumpolar Current. (All these examples have been discussed in detail in the references cited.) This review concludes with a few comments on how these solutions can be extended and expanded.This article is part of the theme issue 'Nonlinear water waves'. © 2017 The Author(s).

Data standardization. The key to effective management

USGS Publications Warehouse

Wagner, C. Russell

1991-01-01

Effective management of the nation's water resources is dependent upon accurate and consistent hydrologic information. Before the emergence of environmental concerns in the 1960's, most hydrologic information was collected by the U.S. Geological Survey and other Federal agencies that used fairly consistent methods and equipment. In the past quarter century, however, increased environmental awareness has resulted in an expansion of hydrologic data collection not only by Federal agencies, but also by state and municipal governments, university investigators, and private consulting firms. The acceptance and use of standard methods of collecting and processing hydrologic data would contribute to cost savings and to greater credibility of flow information vital to responsible assessment and management of the nation's water resources. This paper traces the evolution of the requirements and uses of open-channel flow information in the U.S., and the sequence of efforts to standardize the methods used to obtain this information in the future. The variable nature of naturally flowing rivers results in continually changing hydraulic properties of their channels. Those persons responsible for measurement of water flowing in open channels (streamflow) must use a large amount of judgement in the selection of appropriate equipment and technique to obtain accurate flow information. Standardization of the methods used in the measurement of streamflow is essential to assure consistency of data, but must also allow considerable latitude for individual judgement to meet constantly changing field conditions.

Depth resolved granular transport driven by shearing fluid flow

NASA Astrophysics Data System (ADS)

Allen, Benjamin; Kudrolli, Arshad

2017-02-01

We investigate granular transport by a fluid flow under steady-state driving conditions, from the bed-load regime to the suspension regime, with an experimental system based on a conical rheometer. The mean granular volume fraction ϕg, the mean granular velocity ug, and the fluid velocity uf are obtained as a function of depth inside the bed using refractive index matching and particle-tracking techniques. A torque sensor is utilized to measure the applied shear stress to complement estimates obtained from measured strain rates high above the bed where ϕg≈0 . The flow is found to be transitional at the onset of transport and the shear stress required to transport grains rises sharply as grains are increasingly entrained by the fluid flow. A significant slip velocity between the fluid and the granular phases is observed at the bed surface before the onset of transport as well as in the bed-load transport regime. We show that ug decays exponentially deep into the bed for ϕg>0.45 with a decay constant which is described by a nonlocal rheology model of granular flow that neglects fluid stress. Further, we show that uf and ug can be described using the applied shear stress and the Krieger-Dougherty model for the effective viscosity in the suspension regime, where 0 <ϕg<0.45 and where ug≈uf .

Exact solutions of laminar-boundary-layer equations with constant property values for porous wall with variable temperature

NASA Technical Reports Server (NTRS)

Donoughe, Patrick L; Livingood, John N B

1955-01-01

Exact solution of the laminar-boundary-layer equations for wedge-type flow with constant property values are presented for transpiration-cooled surfaces with variable wall temperatures. The difference between wall and stream temperature is assumed proportional to a power of the distance from the leading edge. Solutions are given for a Prandtl number of 0.7 and ranges of pressure-gradient, cooling-air-flow, and wall-temperature-gradient parameters. Boundary-layer profiles, dimensionless boundary-layer thicknesses, and convective heat-transfer coefficients are given in both tabular and graphical form. Corresponding results for constant wall temperature and for impermeable surfaces are included for comparison purposes.

Effect of grain size on the high temperature properties of B2 aluminides

NASA Technical Reports Server (NTRS)

Whittenberger, J. Daniel

1987-01-01

Measurements of the slow plastic flow behavior of cobalt, iron and nickel B2 crystal structure aluminides were conducted on materials fabricated by metallurical techniques. Due to this processing, the aluminides invariably had small equiaxed grains, ranging in size from about 3 to 60 microns in diameter. Grain size was dependent on the extrusion temperature used for powder consolidation, and it proved to be remarkably stable at elevated temperatures. Mechanical properties of all three aluminides were determined via constant velocity compression testing in air between 1000 and 1400 K at strain rates ranging from approx. 10 to the minus 3 power to 10 to the minus 7 power s (-1).

SPM oxidation and parallel writing on zirconium nitride thin films

NASA Astrophysics Data System (ADS)

Farkas, N.; Comer, J. R.; Zhang, G.; Evans, E. A.; Ramsier, R. D.; Dagata, J. A.

2005-07-01

Systematic investigation of the SPM oxidation process of sputter-deposited ZrN thin films is reported. During the intrinsic part of the oxidation, the density of the oxide increases until the total oxide thickness is approximately twice the feature height. Further oxide growth is sustainable as the system undergoes plastic flow followed by delamination from the ZrN-silicon interface keeping the oxide density constant. ZrN exhibits superdiffusive oxidation kinetics in these single tip SPM studies. We extend this work to the fabrication of parallel oxide patterns 70 nm in height covering areas in the square centimeter range. This simple, quick, and well-controlled parallel nanolithographic technique has great potential for biomedical template fabrication.

Visualizing Time-Varying Phenomena In Numerical Simulations Of Unsteady Flows

NASA Technical Reports Server (NTRS)

Lane, David A.

1996-01-01

Streamlines, contour lines, vector plots, and volume slices (cutting planes) are commonly used for flow visualization. These techniques are sometimes referred to as instantaneous flow visualization techniques because calculations are based on an instant of the flowfield in time. Although instantaneous flow visualization techniques are effective for depicting phenomena in steady flows,they sometimes do not adequately depict time-varying phenomena in unsteady flows. Streaklines and timelines are effective visualization techniques for depicting vortex shedding, vortex breakdown, and shock waves in unsteady flows. These techniques are examples of time-dependent flow visualization techniques, which are based on many instants of the flowfields in time. This paper describes the algorithms for computing streaklines and timelines. Using numerically simulated unsteady flows, streaklines and timelines are compared with streamlines, contour lines, and vector plots. It is shown that streaklines and timelines reveal vortex shedding and vortex breakdown more clearly than instantaneous flow visualization techniques.

Electro-chemical grinding

NASA Technical Reports Server (NTRS)

Feagans, P. L.

1972-01-01

Electro-chemical grinding technique has rotation speed control, constant feed rates, and contour control. Hypersonic engine parts of nickel alloys can be almost 100% machined, keeping tool pressure at virtual zero. Technique eliminates galling and permits constant surface finish and burr-free interrupted cutting.

A similarity hypothesis for the two-point correlation tensor in a temporally evolving plane wake

NASA Technical Reports Server (NTRS)

Ewing, D. W.; George, W. K.; Moser, R. D.; Rogers, M. M.

1995-01-01

The analysis demonstrated that the governing equations for the two-point velocity correlation tensor in the temporally evolving wake admit similarity solutions, which include the similarity solutions for the single-point moment as a special case. The resulting equations for the similarity solutions include two constants, beta and Re(sub sigma), that are ratios of three characteristic time scales of processes in the flow: a viscous time scale, a time scale characteristic of the spread rate of the flow, and a characteristic time scale of the mean strain rate. The values of these ratios depend on the initial conditions of the flow and are most likely measures of the coherent structures in the initial conditions. The occurrences of these constants in the governing equations for the similarity solutions indicates that these solutions, in general, will only be the same for two flows if these two constants are equal (and hence the coherent structures in the flows are related). The comparisons between the predictions of the similarity hypothesis and the data presented here and elsewhere indicate that the similarity solutions for the two-point correlation tensors provide a good approximation of the measures of those motions that are not significantly affected by the boundary conditions caused by the finite extent of real flows. Thus, the two-point similarity hypothesis provides a useful tool for both numerical and physical experimentalist that can be used to examine how the finite extent of real flows affect the evolution of the different scales of motion in the flow.

Exact solutions of the Navier-Stokes equations generalized for flow in porous media

NASA Astrophysics Data System (ADS)

Daly, Edoardo; Basser, Hossein; Rudman, Murray

2018-05-01

Flow of Newtonian fluids in porous media is often modelled using a generalized version of the full non-linear Navier-Stokes equations that include additional terms describing the resistance to flow due to the porous matrix. Because this formulation is becoming increasingly popular in numerical models, exact solutions are required as a benchmark of numerical codes. The contribution of this study is to provide a number of non-trivial exact solutions of the generalized form of the Navier-Stokes equations for parallel flow in porous media. Steady-state solutions are derived in the case of flows in a medium with constant permeability along the main direction of flow and a constant cross-stream velocity in the case of both linear and non-linear drag. Solutions are also presented for cases in which the permeability changes in the direction normal to the main flow. An unsteady solution for a flow with velocity driven by a time-periodic pressure gradient is also derived. These solutions form a basis for validating computational models across a wide range of Reynolds and Darcy numbers.

Atomistic simulation of flow-induced crystallization at constant temperature

NASA Astrophysics Data System (ADS)

Baig, C.; Edwards, B. J.

2010-02-01

Semi-crystalline fibers, such as nylon, orlon, and spectra, play a crucial role in modern society in applications including clothing, medical devices, and aerospace technology. These applications rely on the enhanced properties that are generated in these fibers through the orientation and deformation of the constituent molecules of a molten liquid undergoing flow prior to crystallization; however, the atomistic mechanisms of flow-induced crystallization are not understood, and macroscopic theories that have been developed in the past to describe this behavior are semi-empirical. We present here the results of the first successful simulation of flow-induced crystallization at constant temperature using a nonequilibrium Monte Carlo algorithm for a short-chain polyethylene liquid. A phase transition between the liquid and crystalline phases was observed at a critical flow rate in elongational flow. The simulation results quantitatively matched experimental X-ray diffraction data of the crystalline phase. Examination of the configurational temperature generated under flow confirmed for the first time the hypothesis that flow-induced stresses within the liquid effectively raised the crystallization temperature of the liquid.

Fuel control for gas turbine with continuous pilot flame

DOEpatents

Swick, Robert M.

1983-01-01

An improved fuel control for a gas turbine engine having a continuous pilot flame and a fuel distribution system including a pump drawing fuel from a source and supplying a line to the main fuel nozzle of the engine, the improvement being a control loop between the pump outlet and the pump inlet to bypass fuel, an electronically controlled throttle valve to restrict flow in the control loop when main nozzle demand exists and to permit substantially unrestricted flow without main nozzle demand, a minimum flow valve in the control loop downstream of the throttle valve to maintain a minimum pressure in the loop ahead of the flow valve, a branch tube from the pilot flame nozzle to the control loop between the throttle valve and the minimum flow valve, an orifice in the branch tube, and a feedback tube from the branch tube downstream of the orifice to the minimum flow valve, the minimum flow valve being operative to maintain a substantially constant pressure differential across the orifice to maintain constant fuel flow to the pilot flame nozzle.

Drop-off Detection with the Long Cane: Effects of Different Cane Techniques on Performance

PubMed Central

Kim, Dae Shik; Emerson, Robert Wall; Curtis, Amy

2010-01-01

This study compared the drop-off detection performance with the two-point touch and constant contact cane techniques using a repeated-measures design with a convenience sample of 15 cane users with visual impairments. The constant contact technique was superior to the two-point touch technique in the drop-off detection rate and the 50% detection threshold. The findings may help an orientation and mobility instructor select an appropriate technique for a particular client or training situation. PMID:21209791

Thermal Analysis of a Carbon Fiber Rope Barrier for Use in the Reusable Solid Rocket Motor Nozzle Joint-2

NASA Technical Reports Server (NTRS)

Clayton, J. Louie

2002-01-01

This study provides development and verification of analysis methods used to assess performance of a carbon fiber rope (CFR) thermal barrier system that is currently being qualified for use in Reusable Solid Rocket Motor (RSRM) nozzle joint-2. Modeled geometry for flow calculations considers the joint to be vented with the porous CFR barriers placed in the 'open' assembly gap. Model development is based on a 1-D volume filling approach where flow resistances (assembly gap and CFRs) are defined by serially connected internal flow and the porous media 'Darcy' relationships. Combustion gas flow rates are computed using the volume filling code by assuming a lumped distribution total joint fill volume on a per linear circumferential inch basis. Gas compressibility, friction and heat transfer are included in the modeling. Gas-to-wall heat transfer is simulated by concurrent solution of the compressible flow equations and a large thermal 2-D finite element (FE) conduction grid. The derived numerical technique loosely couples the FE conduction matrix with the compressible gas flow equations. Free constants that appear in the governing equations are calibrated by parametric model comparison to hot fire subscale test results. The calibrated model is then used to make full-scale motor predictions using RSRM aft dome environments. Model results indicate that CFR thermal barrier systems will provide a thermally benign and controlled pressurization environment for the RSRM nozzle joint-2 primary seal activation.

Thermal Analysis of a Carbon Fiber Rope Barrier for Use in the Reusable Solid Rocket Motor Nozzle Joint-2

NASA Technical Reports Server (NTRS)

Clayton, J. Louie; Phelps, Lisa (Technical Monitor)

2001-01-01

This study provides for development and verification of analysis methods used to assess performance of a carbon fiber rope (CFR) thermal barrier system that is currently being qualified for use in Reusable Solid Rocket Motor (RSRM) nozzle joint-2. Modeled geometry for flow calculations considers the joint to be vented with the porous CFR barriers placed in the "open' assembly gap. Model development is based on a 1-D volume filling approach where flow resistances (assembly gap and CFRs) are defined by serially connected internal flow and the porous media "Darcy" relationships. Combustion gas flow rates are computed using the volume filling code by assuming a lumped distribution total joint fill volume on a per linear circumferential inch basis. Gas compressibility, friction and heat transfer are included in the modeling. Gas-to-wall heat transfer is simulated by concurrent solution of the compressible flow equations and a large thermal 2-D finite element (FE) conduction grid. The derived numerical technique loosely couples the FE conduction matrix with the compressible gas flow equations, Free constants that appear in the governing equations are calibrated by parametric model comparison to hot fire subscale test results. The calibrated model is then used to make full-scale motor predictions using RSRM aft dome environments. Model results indicate that CFR thermal barrier systems will provide a thermally benign and controlled pressurization environment for the RSRM nozzle joint-2 primary seal activation.

Measurement of pulmonary capillary blood flow in infants by plethysmography.

PubMed Central

Stocks, J; Costeloe, K; Winlove, C P; Godfrey, S

1977-01-01

An accurate method for measuring effective pulmonary capillary blood flow (Qc eff) in infants has been developed with an adaptation of the plethysmographic technique. Measurements were made on 19 preterm. 14 small-for-dates, and 7 fullterm normal infants with a constant volume whole body plethysmograph in which the infant rebreathed nitrous oxide. There was a highly significant correlation between Qc eff and body weight, and this relationship was unaffected by premature delivery or intrauterine growth retardation. Mean Qc eff in preterm, small-for dates, and fullterm infants was 203, 208 and 197 ml min-1 kg-1, respectively, with no significant differences between the groups. A significant negative correlation existed between Qc eff and haematocrit in the preterm infants. There was no relationship between weight standardized Qc eff and postnatal age in any of the groups. With this technique, it was possible to readily recognise the presence of rapid recirculation (indicative of shunting) in several of the infants, suggesting that rebreathing methods for the assessment of Qc eff should not be applied indiscriminately during the neonatal period. By taking care to overcome the potential sources of technical error, it was possible to obtain highly reproducible results of Qc eff in infants over a wider age range than has been previously reported. PMID:838861

Frequency-Modulated Continuous Flow Analysis Electrospray Ionization Mass Spectrometry (FM-CFA-ESI-MS) for Sample Multiplexing.

PubMed

Filla, Robert T; Schrell, Adrian M; Coulton, John B; Edwards, James L; Roper, Michael G

2018-02-20

A method for multiplexed sample analysis by mass spectrometry without the need for chemical tagging is presented. In this new method, each sample is pulsed at unique frequencies, mixed, and delivered to the mass spectrometer while maintaining a constant total flow rate. Reconstructed ion currents are then a time-dependent signal consisting of the sum of the ion currents from the various samples. Spectral deconvolution of each reconstructed ion current reveals the identity of each sample, encoded by its unique frequency, and its concentration encoded by the peak height in the frequency domain. This technique is different from other approaches that have been described, which have used modulation techniques to increase the signal-to-noise ratio of a single sample. As proof of concept of this new method, two samples containing up to 9 analytes were multiplexed. The linear dynamic range of the calibration curve was increased with extended acquisition times of the experiment and longer oscillation periods of the samples. Because of the combination of the samples, salt had little effect on the ability of this method to achieve relative quantitation. Continued development of this method is expected to allow for increased numbers of samples that can be multiplexed.

Unsteady streamflow simulation using a linear implicit finite-difference model

USGS Publications Warehouse

Land, Larry F.

1978-01-01

A computer program for simulating one-dimensional subcritical, gradually varied, unsteady flow in a stream has been developed and documented. Given upstream and downstream boundary conditions and channel geometry data, roughness coefficients, stage, and discharge can be calculated anywhere within the reach as a function of time. The program uses a linear implicit finite-difference technique that discritizes the partial differential equations. Then it arranges the coefficients of the continuity and momentum equations into a pentadiagonal matrix for solution. Because it is a reasonable compromise between computational accuracy, speed and ease of use,the technique is one of the most commonly used. The upstream boundary condition is a depth hydrograph. However, options also allow the boundary condition to be discharge or water-surface elevation. The downstream boundary condition is a depth which may be constant, self-setting, or unsteady. The reach may be divided into uneven increments and the cross sections may be nonprismatic and may vary from one to the other. Tributary and lateral inflow may enter the reach. The digital model will simulate such common problems as (1) flood waves, (2) releases from dams, and (3) channels where storage is a consideration. It may also supply the needed flow information for mass-transport simulation. (Woodard-USGS)

Regional Myocardial Blood Flow*

PubMed Central

Sullivan, Jay M.; Taylor, Warren J.; Elliott, William C.; Gorlin, Richard

1967-01-01

A method is described which measures the local effectiveness of the myocardial circulation, expressed as a clearance constant. Uniform clearance constants have been demonstrated in the normal canine and human myocardium. A distinct difference in clearance constants has been demonstrated between the normal canine myocardium and areas of naturally occurring disease. Heterogeneous clearance constants have been found in a majority of human subjects with coronary artery disease—the lowest rates being noted in areas of fibrous aneurysm. PMID:6036537

Critique of Macro Flow/Damage Surface Representations for Metal Matrix Composites Using Micromechanics

NASA Technical Reports Server (NTRS)

Lissenden, Cliff J.; Arnold, Steven M.

1996-01-01

Guidance for the formulation of robust, multiaxial, constitutive models for advanced materials is provided by addressing theoretical and experimental issues using micromechanics. The multiaxial response of metal matrix composites, depicted in terms of macro flow/damage surfaces, is predicted at room and elevated temperatures using an analytical micromechanical model that includes viscoplastic matrix response as well as fiber-matrix debonding. Macro flow/damage surfaces (i.e., debonding envelopes, matrix threshold surfaces, macro 'yield' surfaces, surfaces of constant inelastic strain rate, and surfaces of constant dissipation rate) are determined for silicon carbide/titanium in three stress spaces. Residual stresses are shown to offset the centers of the flow/damage surfaces from the origin and their shape is significantly altered by debonding. The results indicate which type of flow/damage surfaces should be characterized and what loadings applied to provide the most meaningful experimental data for guiding theoretical model development and verification.

Measurements in the turbulent boundary layer at constant pressure in subsonic and supersonic flow. Part 1: Mean flow

NASA Technical Reports Server (NTRS)

Collins, D. J.; Coles, D. E.; Hicks, J. W.

1978-01-01

Experiments were carried out to test the accuracy of laser Doppler instrumentation for measurement of Reynolds stresses in turbulent boundary layers in supersonic flow. Two facilities were used to study flow at constant pressure. In one facility, data were obtained on a flat plate at M sub e = 0.1, with Re theta up to 8,000. In the other, data were obtained on an adiabatic nozzle wall at M sub e = 0.6, 0.8, 1.0, 1.3, and 2.2, with Re theta = 23,000 and 40,000. The mean flow as observed using Pitot tube, Preston tube, and floating element instrumentation is described. Emphasis is on the use of similarity laws with Van Driest scaling and on the inference of the shearing stress profile and the normal velocity component from the equations of mean motion. The experimental data are tabulated.

On the development of lift and drag in a rotating and translating cylinder

NASA Astrophysics Data System (ADS)

Martin-Alcantara, Antonio; Sanmiguel-Rojas, Enrique; Fernandez-Feria, Ramon

2014-11-01

The two-dimensional flow around a rotating cylinder is investigated numerically using a vorticity forces formulation with the aim of analyzing the flow structures, and their evolutions, that contribute to the lift and drag forces on the cylinder. The Reynolds number, based on the cylinder diameter and steady free-stream speed, considered is Re = 200 , while the non-dimensional rotation rate (ratio of the surface speed and free-stream speed) selected were α = 1 and 3. For α = 1 the wake behind the cylinder for the fully developed flow is oscillatory due to vortex shedding, and so are the lift and drag forces. For α = 3 the fully developed flow is steady with constant (high) lift and (low) drag. Each of these cases is considered in two different transient problems, one with angular acceleration of the cylinder and constant speed, and the other one with translating acceleration of the cylinder and constant rotation. Special attention is paid to explaining the mechanisms of vortex shedding suppression for high rotation (when α = 3) and its relation to the mechanisms by which the lift is enhanced and the drag is almost suppressed when the fully developed flow is reached. Supported by the Ministerio de Economia y Competitividad of Spain Grant No. DPI2013-40479-P.

Time-to-Passage Judgments in Nonconstant Optical Flow Fields

NASA Technical Reports Server (NTRS)

Kaiser, Mary K.; Hecht, Heiko

1995-01-01

The time until an approaching object will pass an observer (time to passage, or TTP) is optically specified by a global flow field even in the absence of local expansion or size cues. Kaiser and Mowafy have demonstrated that observers are in fact sensitive to this global flow information. The present studies investigate two factors that are usually ignored in work related to TTP: (1) non-constant motion functions and (2) concomitant eye rotation. Non-constant velocities violate an assumption of some TTP derivations, and eye rotations may complicate heading extraction. Such factors have practical significance, for example, in the case of a pilot accelerating an aircraft or executing a roll. In our studies, a flow field of constant-sized stars was presented monocularly on a large screen. TIP judgments had to be made on the basis of one target star. The flow field varied in its acceleration pattern and its roll component. Observers did not appear to utilize acceleration information. In particular, TTP with decelerating motion were consistently underestimated. TTP judgments were fairly robust with respect to roll, even when roll axis and track vector were decoupled. However, substantial decoupling between heading and track vector led to a decrement in performance, in both the presence and the absence of roll.

A Study of Laminar Compressible Viscous Pipe Flow Accelerated by an Axial Body Force, with Application to Magnetogasdynamics

NASA Technical Reports Server (NTRS)

Martin, E. Dale

1961-01-01

A study is made of the steady laminar flow of a compressible viscous fluid in a circular pipe when the fluid is accelerated by an axial body force. The application of the theory to the magnetofluidmechanics of an electrically conducting gas accelerated by electric and magnetic fields is discussed. Constant viscosity, thermal conductivity, and electrical conductivity are assumed. Fully developed flow velocity and temperature profiles are shown, and detailed results of the accelerating flow development, including velocity and pressure as functions of distance, are given for the case where the axial body force is constant and for the case where it is a linear function of velocity. From these results are determined the pipe entry length and the pressure difference required.

Gene delivery by microfluidic flow-through electroporation based on constant DC and AC field.

PubMed

Geng, Tao; Zhan, Yihong; Lu, Chang

2012-01-01

Electroporation is one of the most widely used physical methods to deliver exogenous nucleic acids into cells with high efficiency and low toxicity. Conventional electroporation systems typically require expensive pulse generators to provide short electrical pulses at high voltage. In this work, we demonstrate a flow-through electroporation method for continuous transfection of cells based on disposable chips, a syringe pump, and a low-cost power supply that provides a constant voltage. We successfully transfect cells using either DC or AC voltage with high flow rates (ranging from 40 µl/min to 20 ml/min) and high efficiency (up to 75%). We also enable the entire cell membrane to be uniformly permeabilized and dramatically improve gene delivery by inducing complex migrations of cells during the flow.

Pressure compensated flow control valve

DOEpatents

Minteer, Daniel J.

1999-01-01

The invention is an air flow control valve which is capable of maintaining a constant flow at the outlet despite changes in the inlet or outlet pressure. The device consists of a shell assembly with an inlet chamber and outlet chamber separated by a separation plate. The chambers are connected by an orifice. Also located within the inlet chamber is a port controller assembly. The port controller assembly consists of a differential pressure plate and port cap affixed thereon. The cap is able to slide in and out of the orifice separating the inlet and outlet chambers. When the pressure differential is sufficient, the differential pressure plate rises or falls to maintain a constant air flow. Movement of the port controller assembly does not require the use of seals, diaphragms, tight tolerances, bushings, bearings, hinges, guides, or lubricants.

Comparison of entrainment in constant volume and constant flux dense currents over sloping bottoms

NASA Astrophysics Data System (ADS)

Bhaganagar, K.; Nayamatullah, M.; Cenedese, C.

2014-12-01

Three dimensional high resolution large eddy simulations (LES) are employed to simulate lock-exchange and constant flux dense flows over inclined surface with the aim of investigating, visualizing and describing the turbulent structure and the evolution of bottom-propagating compositional density current at the channel bottom. The understanding of dynamics of density current is largely determined by the amount of interfacial mixing or entrainment between the ambient and dense fluids. No previous experimental or numerical studies have been done to estimate entrainment in classical lock-exchange system. The differences in entrainment between the lock-exchange and constant flux are explored. Comparing the results of flat bed with inclined surface results, flow exhibits significant differences near the leading edge or nose of the front of the density currents due to inclination of surface. Further, the instabilities are remarkably enhanced resulting Kelvin-Helmholtz and lobe-cleft type of instabilities arises much earlier in time. In this study, a brief analysis of entrainment on lock-exchange density current is presented using different bed slopes and a set of reduced gravity values (g'). We relate the entrainment value with different flow parameters such as Froude number (Fr) and Reynolds number (Re).

Length and time for development of laminar flow in tubes following a step increase of volume flux

NASA Astrophysics Data System (ADS)

Chaudhury, Rafeed A.; Herrmann, Marcus; Frakes, David H.; Adrian, Ronald J.

2015-01-01

Laminar flows starting up from rest in round tubes are relevant to numerous industrial and biomedical applications. The two most common types are flows driven by an abruptly imposed constant pressure gradient or by an abruptly imposed constant volume flux. Analytical solutions are available for transient, fully developed flows, wherein streamwise development over the entrance length is absent (Szymanski in J de Mathématiques Pures et Appliquées 11:67-107, 1932; Andersson and Tiseth in Chem Eng Commun 112(1):121-133, 1992, respectively). They represent the transient responses of flows in tubes that are very long compared with the entrance length, a condition that is seldom satisfied in biomedical tube networks. This study establishes the entrance (development) length and development time of starting laminar flow in a round tube of finite length driven by a piston pump that produces a step change from zero flow to a constant volume flux for Reynolds numbers between 500 and 3,000. The flows are examined experimentally, using stereographic particle image velocimetry and computationally using computational fluid dynamics, and are then compared with the known analytical solutions for fully developed flow conditions in infinitely long tubes. Results show that step function volume flux start-up flows reach steady state and fully developed flow five times more quickly than those driven by a step function pressure gradient, a 500 % change when compared with existing estimates. Based on these results, we present new, simple guidelines for achieving experimental flows that are fully developed in space and time in realistic (finite) tube geometries. To a first approximation, the time to achieve steady spatially developing flow is nearly equal to the time needed to achieve steady, fully developed flow. Conversely, the entrance length needed to achieve fully developed transient flow is approximately equal to the length needed to achieve fully developed steady flow. Beyond this level of description, the numerical results reveal interaction between the effects of space and time development and nonlinear Reynolds number effects.

Fouling resilient perforated feed spacers for membrane filtration.

PubMed

Kerdi, Sarah; Qamar, Adnan; Vrouwenvelder, Johannes S; Ghaffour, Noreddine

2018-04-24

The improvement of feed spacers with optimal geometry remains a key challenge for spiral-wound membrane systems in water treatment due to their impact on the hydrodynamic performance and fouling development. In this work, novel spacer designs are proposed by intrinsically modifying cylindrical filaments through perforations. Three symmetric perforated spacers (1-Hole, 2-Hole, and 3-Hole) were in-house 3D-printed and experimentally evaluated in terms of permeate flux, feed channel pressure drop and membrane fouling. Spacer performance is characterized and compared with standard no perforated (0-Hole) design under constant feed pressure and constant feed flow rate. Perforations in the spacer filaments resulted in significantly lowering the net pressure drop across the spacer filled channel. The 3-Hole spacer was found to have the lowest pressure drop (50%-61%) compared to 0-Hole spacer for various average flow velocities. Regarding permeate flux production, the 0-Hole spacer produced 5.7 L m -2 .h -1 and 6.6 L m -2 .h -1 steady state flux for constant pressure and constant feed flow rate, respectively. The 1-Hole spacer was found to be the most efficient among the perforated spacers with 75% and 23% increase in permeate production at constant pressure and constant feed flow, respectively. Furthermore, membrane surface of 1-Hole spacer was found to be cleanest in terms of fouling, contributing to maintain higher permeate flux production. Hydrodynamic understanding of these perforated spacers is also quantified by performing Direct Numerical Simulation (DNS). The performance enhancement of these perforated spacers is attributed to the formation of micro-jets in the spacer cell that aided in producing enough unsteadiness/turbulence to clean the membrane surface and mitigate fouling phenomena. In the case of 1-Hole spacer, the unsteadiness intensity at the outlet of micro-jets and the shear stress fluctuations created inside the cells are higher than those observed with other perforated spacers, resulting in the cleanest membrane surface. Copyright © 2018 Elsevier Ltd. All rights reserved.

Computing aerodynamic sound using advanced statistical turbulence theories

NASA Technical Reports Server (NTRS)

Hecht, A. M.; Teske, M. E.; Bilanin, A. J.

1981-01-01

It is noted that the calculation of turbulence-generated aerodynamic sound requires knowledge of the spatial and temporal variation of Q sub ij (xi sub k, tau), the two-point, two-time turbulent velocity correlations. A technique is presented to obtain an approximate form of these correlations based on closure of the Reynolds stress equations by modeling of higher order terms. The governing equations for Q sub ij are first developed for a general flow. The case of homogeneous, stationary turbulence in a unidirectional constant shear mean flow is then assumed. The required closure form for Q sub ij is selected which is capable of qualitatively reproducing experimentally observed behavior. This form contains separation time dependent scale factors as parameters and depends explicitly on spatial separation. The approximate forms of Q sub ij are used in the differential equations and integral moments are taken over the spatial domain. The velocity correlations are used in the Lighthill theory of aerodynamic sound by assuming normal joint probability.

Measurement of the initial phase of ozone decomposition in water and wastewater by means of a continuous quench-flow system: application to disinfection and pharmaceutical oxidation.

PubMed

Buffle, Marc-Olivier; Schumacher, Jochen; Salhi, Elisabeth; Jekel, Martin; von Gunten, Urs

2006-05-01

Due to a lack of adequate experimental techniques, the kinetics of the first 20s of ozone decomposition in natural water and wastewater is still poorly understood. Introducing a continuous quench-flow system (CQFS), measurements starting 350 ms after ozone addition are presented for the first time. Very high HO. to O3 exposures ratios (Rct=integralHO.dt/integralO3dt) reveal that the first 20s of ozonation present oxidation conditions that are similar to ozone-based advanced oxidation processes (AOP). The oxidation of carbamazepine could be accurately modeled using O3 and HO. exposures measured with CQFS during wastewater ozonation. These results demonstrate the applicability of bench scale determined second-order rate constants for wastewater ozonation. Important degrees of pharmaceutical oxidation and microbial inactivation are predicted, indicating that a significant oxidation potential is available during wastewater ozonation, even when ozone is entirely decomposed in the first 20s.

Wake effect on a uniform flow behind wind-turbine model

NASA Astrophysics Data System (ADS)

Okulov, V. L.; Naumov, I. V.; Mikkelsen, R. F.; Sørensen, J. N.

2015-06-01

LDA experiments were carried out to study the development of mean velocity profiles of the very far wake behind a wind turbine model in a water flume. The model of the rotor is placed in a middle of the flume. The initial flume flow is subjected to a very low turbulence level, limiting the influence of external disturbances on the development of the inherent wake instability. The rotor is three-bladed and designed using Glauert's optimum theory at a tip speed ratio λ = 5 with a constant of the lift coefficient along the span, CL= 0.8. The wake development has been studied in the range of tip speed ratios from 3 to 9, and at different cross-sections from 10 to 100 rotor radii downstream from the rotor. By using regression techniques to fit the velocity profiles it was possible to obtain accurate velocity deficits and estimate length scales of the wake attenuation. The data are compared with different analytical models for wind turbine wakes.

On-chip isothermal, chemical cycling polymerase chain reaction (ccPCR)

NASA Astrophysics Data System (ADS)

Persat, Alexandre; Santiago, Juan

2008-11-01

We demonstrate a novel ccPCR technique for microfluidic DNA amplification where temperature is held constant in space and time. The polymerase chain reaction is a platform of choice for biological assays and typically based on a three-step thermal cycling: DNA denaturation, primers annealing and extension by an enzyme. We here demonstrate a novel technique where high concentration chemical denaturants (solvents) denature DNA. We leverage the high electrophoretic mobility of DNA and the electrical neutrality of denaturants to achieve chemical cycling. We focus DNA with isotachophoresis (ITP); a robust electrophoretic preconcentration technique which generates strong electric field gradients and protects the sample from dispersion. We apply a pressure-driven flow to balance electromigration velocity and keep the DNA sample stationary in a microchannel. We drive the DNA through a series of high denaturant concentration zones. DNA denatures at high denaturant concentration. At low denaturant concentration, the enzyme creates complementary strands. DNA reaction kinetics are slower than buffer reactions involved in ITP. We demonstrate successful ccPCR amplification for detection of E. Coli. The ccPCR has the potential for simpler chemistry than traditional PCR.

Phase Resolved Angular Velocity Control of Cross Flow Turbines

NASA Astrophysics Data System (ADS)

Strom, Benjamin; Brunton, Steven; Polagye, Brian

2015-11-01

Cross flow turbines have a number of operational advantages for the conversion of kinetic energy in marine or fluvial currents, but they are often less efficient than axial flow devices. Here a control scheme is presented in which the angular velocity of a cross flow turbine with two straight blades is prescribed as a function of azimuthal blade position, altering the time-varying effective angle of attack. Flume experiments conducted with a scale model turbine show approximately an 80% increase in turbine efficiency versus optimal constant angular velocity and constant resistive torque control schemes. Torque, drag, and lateral forces on one- and two-bladed turbines are analyzed and interpreted with bubble flow visualization to develop a simple model that describes the hydrodynamics responsible for the observed increase in mean efficiency. Challenges associated with implementing this control scheme on commercial-scale devices are discussed. If solutions are found, the performance increase presented here may impact the future development of cross flow turbines.

An experimental study of a self-confined flow with ring-vorticity distribution. Ph.D. Thesis. Final Report

NASA Technical Reports Server (NTRS)

Lin, K. M.; Moore, F. K.

1976-01-01

A new form of self-confined flow was investigated in which a recirculation zone forms away from any solid boundary. An inviscid flow analysis indicated that in a purely meridional axisymmetric flow a stationary, spherical, self-confined region should occur in the center of a streamlined divergent-convergent enlargement zone. The spherical confinement region would be at rest and at constant pressure. Experimental investigations were carried out in a specially built test apparatus to establish the desired confined flow. The streamlined divergent-convergent interior shape of the test section was fabricated according to the theoretical calculation for a particular streamline. The required inlet vorticity distribution was generated by producing a velocity profile with a shaped gauze screen in the straight pipe upstream of the test section. Fluid speed and turbulence intensity were measured with a constant-temperature hot-wire anemometer system. The measured results indicated a very orderly and stable flow field.

Quantifying the flow efficiency in constant-current capacitive deionization.

PubMed

Hawks, Steven A; Knipe, Jennifer M; Campbell, Patrick G; Loeb, Colin K; Hubert, McKenzie A; Santiago, Juan G; Stadermann, Michael

2018-02-01

Here we detail a previously unappreciated loss mechanism inherent to capacitive deionization (CDI) cycling operation that has a substantial role determining performance. This mechanism reflects the fact that desalinated water inside a cell is partially lost to re-salination if desorption is carried out immediately after adsorption. We describe such effects by a parameter called the flow efficiency, and show that this efficiency is distinct from and yet multiplicative with other highly-studied adsorption efficiencies. Flow losses can be minimized by flowing more feed solution through the cell during desalination; however, this also results in less effluent concentration reduction. While the rationale outlined here is applicable to all CDI cell architectures that rely on cycling, we validate our model with a flow-through electrode CDI device operated in constant-current mode. We find excellent agreement between flow efficiency model predictions and experimental results, thus giving researchers simple equations by which they can estimate this distinct loss process for their operation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Development of an Experimental Data Base to Validate Compressor-Face Boundary Conditions Used in Unsteady Inlet Flow Computations

NASA Technical Reports Server (NTRS)

Sajben, Miklos; Freund, Donald D.

1998-01-01

The ability to predict the dynamics of integrated inlet/compressor systems is an important part of designing high-speed propulsion systems. The boundaries of the performance envelope are often defined by undesirable transient phenomena in the inlet (unstart, buzz, etc.) in response to disturbances originated either in the engine or in the atmosphere. Stability margins used to compensate for the inability to accurately predict such processes lead to weight and performance penalties, which translate into a reduction in vehicle range. The prediction of transients in an inlet/compressor system requires either the coupling of two complex, unsteady codes (one for the inlet and one for the engine) or else a reliable characterization of the inlet/compressor interface, by specifying a boundary condition. In the context of engineering development programs, only the second option is viable economically. Computations of unsteady inlet flows invariably rely on simple compressor-face boundary conditions (CFBC's). Currently, customary conditions include choked flow, constant static pressure, constant axial velocity, constant Mach number or constant mass flow per unit area. These conditions are straightforward extensions of practices that are valid for and work well with steady inlet flows. Unfortunately, it is not at all likely that any flow property would stay constant during a complex system transient. At the start of this effort, no experimental observation existed that could be used to formulate of verify any of the CFBC'S. This lack of hard information represented a risk for a development program that has been recognized to be unacceptably large. The goal of the present effort was to generate such data. Disturbances reaching the compressor face in flight may have complex spatial structures and temporal histories. Small amplitude disturbances may be decomposed into acoustic, vorticity and entropy contributions that are uncoupled if the undisturbed flow is uniform. This study is focused on the response of an inlet/compressor system to acoustic disturbances. From the viewpoint of inlet computations, acoustic disturbances are clearly the most important, since they are the only ones capable of moving upstream. Convective and entropy disturbances may also produce upstream-moving acoustic waves, but such processes are outside the scope of the present study.

A novel technique for measurement of thermal rate constants and temperature dependences of dissociative recombination: CO{sub 2}{sup +}, CF{sub 3}{sup +}, N{sub 2}O{sup +}, C{sub 7}H{sub 8}{sup +}, C{sub 7}H{sub 7}{sup +}, C{sub 6}H{sub 6}{sup +}, C{sub 6}H{sub 5}{sup +}, C{sub 5}H{sub 6}{sup +}, C{sub 4}H{sub 4}{sup +}, and C{sub 3}H{sub 3}{sup +}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fournier, Joseph A.; Shuman, Nicholas S.; Melko, Joshua J.

A novel technique using a flowing afterglow-Langmuir probe apparatus for measurement of temperature dependences of rate constants for dissociative recombination (DR) is presented. Low ({approx}10{sup 11} cm{sup -3}) concentrations of a neutral precursor are added to a noble gas/electron afterglow plasma thermalized at 300-500 K. Charge exchange yields one or many cation species, each of which may undergo DR. Relative ion concentrations are monitored at a fixed reaction time while the initial plasma density is varied between 10{sup 9} and 10{sup 10} cm{sup -3}. Modeling of the decrease in concentration of each cation relative to the non-recombining noble gas cationmore » yields the rate constant for DR. The technique is applied to several species (O{sub 2}{sup +}, CO{sub 2}{sup +}, CF{sub 3}{sup +}, N{sub 2}O{sup +}) with previously determined 300 K values, showing excellent agreement. The measurements of those species are extended to 500 K, with good agreement to literature values where they exist. Measurements are also made for a range of C{sub n}H{sub m}{sup +} (C{sub 7}H{sub 7}{sup +}, C{sub 7}H{sub 8}{sup +}, C{sub 5}H{sub 6}{sup +}, C{sub 4}H{sub 4}{sup +}, C{sub 6}H{sub 5}{sup +}, C{sub 3}H{sub 3}{sup +}, and C{sub 6}H{sub 6}{sup +}) derived from benzene and toluene neutral precursors. C{sub n}H{sub m}{sup +} DR rate constants vary from 8-12 Multiplication-Sign 10{sup -7} cm{sup 3} s{sup -1} at 300 K with temperature dependences of approximately T{sup -0.7}. Where prior measurements exist these results are in agreement, with the exception of C{sub 3}H{sub 3}{sup +} where the present results disagree with a previously reported flat temperature dependence.« less

Microvascular flow estimation by contrast-assisted ultrasound B-scan and statistical parametric images.

PubMed

Tsui, Po-Hsiang; Yeh, Chih-Kuang; Chang, Chien-Cheng

2009-05-01

The microbubbles destruction/replenishment technique has been previously applied to estimating blood flow in the microcirculation. The rate of increase of the time-intensity curve (TIC) due to microbubbles flowing into the region of interest (ROI), as measured from B-mode images, closely reflects the flow velocity. In previous studies, we proposed a new approach called the time-Nakagami-parameter curve (TNC) obtained from Nakagami images to monitor microbubble replenishment for quantifying the microvascular flow velocity. This study aimed to further explore some effects that may affect the TNC to estimate the microflow, including microbubble concentration, ultrasound transmitting energy, attenuation, intrinsic noise, and tissue clutter. In order to well control each effect production, we applied a typical simulation method to investigate the TIC and TNC. The rates of increase of the TIC and TNC were expressed by the rate constants beta(I) and beta(N), respectively, of a monoexponential model. The results show that beta(N) quantifies the microvascular flow velocity similarly to the conventional beta(I) . Moreover, the measures of beta(I) and beta(N) are not influenced by microbubble concentration, transducer excitation energy, and attenuation effect. Although the effect of intrinsic signals contributed by noise and blood would influence the TNC behavior, the TNC method has a better tolerance of tissue clutter than the TIC does, allowing the presence of some clutter components in the ROI. The results suggest that the TNC method can be used as a complementary tool for the conventional TIC to reduce the wall filter requirements for blood flow measurement in the microcirculation.

A spectrally accurate boundary-layer code for infinite swept wings

NASA Technical Reports Server (NTRS)

Pruett, C. David

1994-01-01

This report documents the development, validation, and application of a spectrally accurate boundary-layer code, WINGBL2, which has been designed specifically for use in stability analyses of swept-wing configurations. Currently, we consider only the quasi-three-dimensional case of an infinitely long wing of constant cross section. The effects of streamwise curvature, streamwise pressure gradient, and wall suction and/or blowing are taken into account in the governing equations and boundary conditions. The boundary-layer equations are formulated both for the attachment-line flow and for the evolving boundary layer. The boundary-layer equations are solved by marching in the direction perpendicular to the leading edge, for which high-order (up to fifth) backward differencing techniques are used. In the wall-normal direction, a spectral collocation method, based upon Chebyshev polynomial approximations, is exploited. The accuracy, efficiency, and user-friendliness of WINGBL2 make it well suited for applications to linear stability theory, parabolized stability equation methodology, direct numerical simulation, and large-eddy simulation. The method is validated against existing schemes for three test cases, including incompressible swept Hiemenz flow and Mach 2.4 flow over an airfoil swept at 70 deg to the free stream.

Effect of Elevated Free Stream Turbulence on the Hydrodynamic Performance of a Tidal Turbine Blade Section

NASA Astrophysics Data System (ADS)

Vinod, Ashwin; Lawrence, Angela; Banerjee, Arindam

2016-11-01

The effects of elevated freestream turbulence (FST) on the performance of a tidal turbine blade is studied using laboratory experiments. Of interest for the current investigation is elevated levels of FST in the range of 6-24% that is prevalent in deployment sites of tidal turbines. A constant chord, no twist blade section (SG6043) is tested at an operating Reynolds number of 1.5x105 and at angles of attack ranging from -90o to +90o. The parameter space encompasses the entire operational range of a tidal turbine that includes flow reversal. Multiple levels of controlled FST are achieved using an active grid type turbulence generator placed at the entrance to the water tunnel test section. The hydrodynamic loads experienced by the blade section are measured using a 3-axis load cell; a Stereo-PIV technique is used to analyze the flow field around the blade. The results indicate that elevated levels of FST cause a delay in flow separation when compared to the case of a laminar freestream. Furthermore, the lift to drag ratio of the blade is considerably altered depending on the level of FST and angle of attack tested.

Microprocessor-Based Valved Controller

NASA Technical Reports Server (NTRS)

Norman, Arnold M., Jr.

1987-01-01

New controller simpler, more precise, and lighter than predecessors. Mass-flow controller compensates for changing supply pressure and temperature such as occurs when gas-supply tank becomes depleted. By periodically updating calculation of mass-flow rate, controller determines correct new position for valve and keeps mass-flow rate nearly constant.

Continuous-flow free acid monitoring method and system

DOEpatents

Strain, J.E.; Ross, H.H.

1980-01-11

A free acid monitoring method and apparatus is provided for continuously measuring the excess acid present in a process stream. The disclosed monitoring system and method is based on the relationship of the partial pressure ratio of water and acid in equilibrium with an acid solution at constant temperature. A portion of the process stream is pumped into and flows through the monitor under the influence of gravity and back to the process stream. A continuous flowing sample is vaporized at a constant temperature and the vapor is subsequently condensed. Conductivity measurements of the condensate produces a nonlinear response function from which the free acid molarity of the sample process stream is determined.

Application of velocity filtering to optical-flow passive ranging

NASA Technical Reports Server (NTRS)

Barniv, Yair

1992-01-01

The performance of the velocity filtering method as applied to optical-flow passive ranging under real-world conditions is evaluated. The theory of the 3-D Fourier transform as applied to constant-speed moving points is reviewed, and the space-domain shift-and-add algorithm is derived from the general 3-D matched filtering formulation. The constant-speed algorithm is then modified to fit the actual speed encountered in the optical flow application, and the passband of that filter is found in terms of depth (sensor/object distance) so as to cover any given range of depths. Two algorithmic solutions for the problems associated with pixel interpolation and object expansion are developed, and experimental results are presented.

Continuous-flow free acid monitoring method and system

DOEpatents

Strain, James E.; Ross, Harley H.

1981-01-01

A free acid monitoring method and apparatus is provided for continuously measuring the excess acid present in a process stream. The disclosed monitoring system and method is based on the relationship of the partial pressure ratio of water and acid in equilibrium with an acid solution at constant temperature. A portion of the process stream is pumped into and flows through the monitor under the influence of gravity and back to the process stream. A continuous flowing sample is vaporized at a constant temperature and the vapor is subsequently condensed. Conductivity measurements of the condensate produces a nonlinear response function from which the free acid molarity of the sample process stream is determined.

Fracture Flow Characterization from Seismic and Electric Properties: Insight from Experimental and Numerical Approaches

NASA Astrophysics Data System (ADS)

Sawayama, K.; Kitamura, K.; Tsuji, T.; Fujimitsu, Y.

2017-12-01

The estimation of fluid flow and its distribution in the fracture is essential to evaluate subsurface fluid (e.g., geothermal water, ground water, oil and gas). Recently, fluid flow in the geothermal reservoir has been attracting attention to develop EGS (enhanced geothermal system) technique. To detect the fluid distribution under the ground, geophysical exploration such as seismic and electromagnetic methods have been broadly applied. For better interpretation of these exploration data, more detailed investigation about the effect of fluid on seismic and electric properties of fracture is required. In this study, we measured and calculated seismic and electric properties of a cracked rock to discuss the effect of water distribution and saturation on them as well as fluid flow. For the experimental observation, we developed the technique to measure electrical impedance, P-wave velocity and water saturation simultaneously during the fluid-flow test. The test has been conducted as follows; a cracked andesite core sample was filled with nitrogen gas (Pp = 10 MPa) under 20 MPa of confining pressure and then, brine (1wt.%-KCl, 1.75 S/m) was injected into the sample to replace the gas. During the test, water saturation, permeability, electrical impedance and P-wave velocity were measured. As a result of this experimental study, electrical impedance dramatically decreased from 105 to 103 Ω and P-wave velocity increased by 2% due to the brine injection. This remarkable change of the electrical impedance could be due to the replacement of pre-filled nitrogen gas to the brine in the broad fracture. After the brine injection, electrical impedance decreased with injection pressure by up to 40% while P-wave velocity was almost constant. This decrease of electrical impedance could be related to the flow to the narrow path (microcrack) which cannot be detected by P-wave velocity. These two types of fluid flow mechanism were also suggested from other parameters such as permeability, water saturation and saturation exponent of Archie's law. To quantify the fluid flow and its distribution in the fracture, we applied fluid flow simulation by LBM (Lattice Boltzmann Method). From this result, we calculate physical parameters by FEM and FDM and then discuss effect of fluid on them as well as their comparison with experimental results.

Laboratory investigation of the erosion of cohesive sediments under oscillatory flows using a synchronized imaging technique

NASA Astrophysics Data System (ADS)

Sou, I.; Calantoni, J.; Reed, A. H.; Furukawa, Y.

2012-12-01

A synchronized dual stereo particle image velocimetry (PIV) measurement technique is used to examine the erosion process of a cohesive sediment core in the Small Oscillatory Flow Tunnel (S-OFT) in the Sediment Dynamics Laboratory at the Naval Research Laboratory, Stennis Space Center, MS. The PIV system uses four cameras and a dual cavity Nd:YAG laser. The system allows for a pair of stereo PIV windows of about 10 cm by 10 cm each to be arbitrarily located within a single light sheet. Image pairs were acquired with all four cameras at 50 Hz for 50 consecutive seconds for each flow condition. The stereo PIV windows were positioned on either side of sediment cores inserted along the centerline of the S-OFT allowing for a total measurement window of about 20 cm long by 10 cm high with sub-millimeter spacing on resolved velocity vectors. The oscillatory flows are generated by two types of driving mechanism (scotch yoke and crank lever) for converting the rotational motion of the flywheel into the linear motion of a piston. The period of oscillation ranged from 2.86 to 6.12 seconds with constant semi-excursion amplitude in the test section of 9 cm. Two kinds of inorganic sediment samples were examined. One was a mixture of 50% kaolinite and 50% 500-micron sand under flows driven by the crank lever mechanism. Another sediment core was a mixture of 50% mud collected in Galveston Bay, TX, and 50% 250-micron sand under flows driven by the scotch-yoke mechanism. During the erosion process, Kelvin-Helmholtz instabilities were observed as the flow accelerated in each direction and eventually were broken down when the flow reversed. An example of the instantaneous velocity field superimposed on the raw image is shown in Figure 1. The relative concentration of suspended sediments under different flow conditions was estimated using the intensity of light scattered from the sediment particles in suspension. By subtracting the initial light scattered from the mud core, the residual light intensity was assumed to be scattered from suspended sediments eroded from the core. Relative comparisons were only made using the same sample mixture since it is difficult, if not impossible, to calibrate the light scattering from different sediments.; Figure 1. An example of the instantaneous time-resolved velocity field superimposed on the raw image.

Impact of water use efficiency on eddy covariance flux partitioning using correlation structure analysis

NASA Astrophysics Data System (ADS)

Anderson, Ray; Skaggs, Todd; Alfieri, Joseph; Kustas, William; Wang, Dong; Ayars, James

2016-04-01

Partitioned land surfaces fluxes (e.g. evaporation, transpiration, photosynthesis, and ecosystem respiration) are needed as input, calibration, and validation data for numerous hydrological and land surface models. However, one of the most commonly used techniques for measuring land surface fluxes, Eddy Covariance (EC), can directly measure net, combined water and carbon fluxes (evapotranspiration and net ecosystem exchange/productivity). Analysis of the correlation structure of high frequency EC time series (hereafter flux partitioning or FP) has been proposed to directly partition net EC fluxes into their constituent components using leaf-level water use efficiency (WUE) data to separate stomatal and non-stomatal transport processes. FP has significant logistical and spatial representativeness advantages over other partitioning approaches (e.g. isotopic fluxes, sap flow, microlysimeters), but the performance of the FP algorithm is reliant on the accuracy of the intercellular CO2 (ci) concentration used to parameterize WUE for each flux averaging interval. In this study, we tested several parameterizations for ci as a function of atmospheric CO2 (ca), including (1) a constant ci/ca ratio for C3 and C4 photosynthetic pathway plants, (2) species-specific ci/ca-Vapor Pressure Deficit (VPD) relationships (quadratic and linear), and (3) generalized C3 and C4 photosynthetic pathway ci/ca-VPD relationships. We tested these ci parameterizations at three agricultural EC towers from 2011-present in C4 and C3 crops (sugarcane - Saccharum officinarum L. and peach - Prunus persica), and validated again sap-flow sensors installed at the peach site. The peach results show that the species-specific parameterizations driven FP algorithm came to convergence significantly more frequently (~20% more frequently) than the constant ci/ca ratio or generic C3-VPD relationship. The FP algorithm parameterizations with a generic VPD relationship also had slightly higher transpiration (5 Wm-2 difference) than the constant ci/ca ratio. However, photosynthesis and respiration fluxes over sugarcane were ~15% lower with a VPD-ci/ca relationship than a constant ci/ca ratio. The results illustrate the importance of combining leaf-level physiological observations with EC to improve the performance of the FP algorithm.

Experimental observations of granular debris flows

NASA Astrophysics Data System (ADS)

Ghilardi, P.

2003-04-01

Various tests are run using two different laboratory flumes with rectangular cross section and transparent walls. The grains used in a single experiment have an almost constant grain sizes; mean diameter ranges from 5 mm to 20 mm. In each test various measurements are taken: hydrograms, velocity distribution near the transparent walls and on the free surface, average flow concentration. Concentration values are measured taking samples. Velocity distributions are obtained from movies recorded by high speed video cameras capable of 350 frames per second; flow rates and depth hydrograms are computed from the same velocity distributions. A gate is installed at the beginning of one of the flumes; this gate slides normally to the bed and opens very quickly, reproducing a dam-break. Several tests are run using this device, varying channel slope, sediment concentration, initial mixture thickness before the gate. Velocity distribution in the flume is almost constant from left to right, except for the flow sections near the front. The observed discharges and velocities are less than those given by a classic dam break formula, and depend on sediment concentration. The other flume is fed by a mixture with constant discharge and concentration, and is mainly used for measuring velocity distributions when the flow is uniform, with both rigid and granular bed, and to study erosion/deposition processes near debris flow dams or other mitigation devices. The equilibrium slope of the granular bed is very close to that given by the classical equilibrium formulas for debris flow. Different deposition processes are observed depending on mixture concentration and channel geometry.

Assessment of placental volume and vascularization at 11-14 weeks of gestation in a Taiwanese population using three-dimensional power Doppler ultrasound.

PubMed

Wang, Hsing-I; Yang, Ming-Jie; Wang, Peng-Hui; Wu, Yi-Cheng; Chen, Chih-Yao

2014-12-01

The placental volume and vascular indices are crucial in helping doctors to evaluate early fetal growth and development. Inadequate placental volume or vascularity might indicate poor fetal growth or gestational complications. This study aimed to evaluate the placental volume and vascular indices during the period of 11-14 weeks of gestation in a Taiwanese population. From June 2006 to September 2009, three-dimensional power Doppler ultrasound was performed in 222 normal pregnancies from 11-14 weeks of gestation. Power Doppler ultrasound was applied to the placenta and the placental volume was obtained by a rotational technique (VOCAL). The three-dimensional power histogram was used to assess the placental vascular indices, including the mean gray value, the vascularization index, the flow index, and the vascularization flow index. The placental vascular indices were then plotted against gestational age (GA) and placental volume. Our results showed that the linear regression equation for placental volume using gestational week as the independent variable was placental volume = 18.852 × GA - 180.89 (r = 0.481, p < 0.05). All the placental vascular indices showed a constant distribution throughout the period 11-14 weeks of gestation. A tendency for a reduction in the placental mean gray value with gestational week was observed, but without statistical significance. All the placental vascular indices estimated by three-dimensional power Doppler ultrasonography showed a constant distribution throughout gestation. Copyright © 2014. Published by Elsevier Taiwan.

Use of diffuse optical spectroscopy to monitor muscle and brain oxygenation dynamics during isometric and isokinetic exercise

NASA Astrophysics Data System (ADS)

Ganesan, Goutham; Cotter, Joshua; Reuland, Warren; Warren, Robert V.; Mirzaei Zarandi, Soroush M.; Cerussi, Albert E.; Tromberg, Bruce J.; Galassetti, Pietro

2013-03-01

The use of near-infrared time-resolved spectroscopy (TRS-20, Hamamatsu Corporation) in two resistance type exercise applications in human subjects is described. First, using isometric flexion of the biceps, we compared the magnitude and relevance of tissue hemoglobin concentration and oxygen saturation (stO2) changes when assuming constant scattering versus continuous measurement of reduced scattering coefficients at three wavelengths. It was found that the assumption of constant scattering resulted in significant errors in hemoglobin concentration assessment during sustained isometric contractions. Secondly, we tested the effect of blood flow restriction (BFR) on oxygenation in a muscle (vastus medialis oblique, VMO) and in the prefrontal cortex (PFC) of the brain. The BFR training technique resulted in considerably more fatigability in subjects, and correlated with reduced muscle stO2 between sets of exertion. Additionally, exercise with BFR resulted in greater PFC deoxygenation than a condition with equivalent work performance but no BFR. These experiments demonstrate novel applications for diffuse optical spectroscopy in strength testing and targeted muscle rehabilitation.

Wind-driven currents in a shallow lake or sea

NASA Technical Reports Server (NTRS)

Goldstein, M. E.; Gedney, R. T.

1971-01-01

For shallow lakes and seas such as the great lakes (especially Lake Erie) where the depth is not much greater than the Ekman depth, the usual Ekman dynamics cannot be used to predict the wind driven currents. The necessary extension to include shallow bodies of water, given by Welander, leads to a partial differential equation for the surface displacement which in turn determines all other flow quantities. A technique for obtaining exact analytical solutions to Welander's equation for bodies of water with large class of bottom topographies which may or may not contain islands is given. It involves applying conformal mapping methods to an extension of Welander's equation into the complex plane. When the wind stress is constant (which is the usual assumption for lakes) the method leads to general solutions which hold for bodies of water of arbitrary shape (the shape appears in the solutions through a set of constants which are the coefficients in the Laurent expansion of a mapping of the particular lake geometry). The method is applied to an elliptically shaped lake and a circular lake containing an eccentrically located circular island.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Structure reactivity and thermodynamic analysis on the oxidation of ampicillin drug by copper(III) complex in aqueous alkaline medium (stopped-flow technique)

NASA Astrophysics Data System (ADS)

Shetti, Nagaraj P.; Hegde, Rajesh N.; Nandibewoor, Sharanappa T.

2009-07-01

Oxidation of penicillin derivative, ampicillin (AMP) by diperiodatocuprate(III) (DPC) in alkaline medium at a constant ionic strength of 0.01-mol dm -3 was studied spectrophotometrically. The reaction between DPC and ampicillin in alkaline medium exhibits 1:4 stoichiometry (ampicillin:DPC). Intervention of free radicals was observed in the reaction. Based on the observed orders and experimental evidences, a mechanism involving the protonated form of DPC as the reactive oxidant species has been proposed. The oxidation reaction in alkaline medium has been shown to proceed via a DPC-AMP complex, which decomposes slowly in a rate determining step to yield phenyl glycine (PG) and free radical species of 6-aminopenicillanic acid (6-APA), followed by other fast steps to give the products. The two major products were characterized by IR, NMR, LC-MS and Spot test. The reaction constants involved in the different steps of the mechanism were calculated. The activation parameters with respect to slow step of the mechanism were computed and discussed and thermodynamic quantities were also determined.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meng Lijian; Teixiera, V.; Santos, M. P. dos

Indium tin oxide (ITO) thin films have been deposited onto glass substrates at room temperature by ion beam assisted deposition technique at different deposition rates. During all the deposition processes, the parameters of the Kaufman ion source and the oxygen gas flow are maintained constants. And only the deposition rate is varied from 0,1 nm/s to 0,3 nm/s by adjusting the e-beam power supply. The effects of the deposition rate on the properties of the deposited films have been studied. The structural, optical and electrical properties of the deposited films have been characterized by X-ray diffraction, AFM, transmittance, FTIR, andmore » Hall effect measurements. The optical constants of the deposited films have been calculated by fitting the transmittance spectra. It has been found that although the film prepared at low deposition rate (0,1 nm/s) shows a high transmittance in the visible region, it has a poor electrical conductivity. The films prepared at 0,2 nm/s deposition rate shows a good electrical conductivity, high IR reflectance which is useable for some electromagnetic wave shielding applications and a reasonable transmittance in the visible region.« less

Anisotropic effects on constitutive model parameters of aluminum alloys

NASA Astrophysics Data System (ADS)

Brar, Nachhatter S.; Joshi, Vasant S.

2012-03-01

Simulation of low velocity impact on structures or high velocity penetration in armor materials heavily rely on constitutive material models. Model constants are determined from tension, compression or torsion stress-strain at low and high strain rates at different temperatures. These model constants are required input to computer codes (LS-DYNA, DYNA3D or SPH) to accurately simulate fragment impact on structural components made of high strength 7075-T651 aluminum alloy. Johnson- Cook model constants determined for Al7075-T651 alloy bar material failed to simulate correctly the penetration into 1' thick Al-7075-T651plates. When simulation go well beyond minor parameter tweaking and experimental results show drastically different behavior it becomes important to determine constitutive parameters from the actual material used in impact/penetration experiments. To investigate anisotropic effects on the yield/flow stress of this alloy quasi-static and high strain rate tensile tests were performed on specimens fabricated in the longitudinal "L", transverse "T", and thickness "TH" directions of 1' thick Al7075 Plate. While flow stress at a strain rate of ~1/s as well as ~1100/s in the thickness and transverse directions are lower than the longitudinal direction. The flow stress in the bar was comparable to flow stress in the longitudinal direction of the plate. Fracture strain data from notched tensile specimens fabricated in the L, T, and Thickness directions of 1' thick plate are used to derive fracture constants.

Characterization of limestone reacted with acid-mine drainage in a pulsed limestone bed treatment system at the Friendship Hill National Historical Site, Pennsylvania, USA

USGS Publications Warehouse

Hammarstrom, J.M.; Sibrell, P.L.; Belkin, H.E.

2003-01-01

Armoring of limestone is a common cause of failure in limestone-based acid-mine drainage (AMD) treatment systems. Limestone is the least expensive material available for acid neutralization, but is not typically recommended for highly acidic, Fe-rich waters due to armoring with Fe(III) oxyhydroxide coatings. A new AMD treatment technology that uses CO2 in a pulsed limestone bed reactor minimizes armor formation and enhances limestone reaction with AMD. Limestone was characterized before and after treatment with constant flow and with the new pulsed limestone bed process using AMD from an inactive coal mine in Pennsylvania (pH = 2.9, Fe = 150 mg/l, acidity = 1000 mg/l CaCO3). In constant flow experiments, limestone is completely armored with reddish-colored ochre within 48 h of contact in a fluidized bed reactor. Effluent pH initially increased from the inflow pH of 2.9 to over 7, but then decreased to 6 during operation. Limestone removed from a pulsed bed pilot plant is a mixture of unarmored, rounded and etched limestone grains and partially armored limestone and refractory mineral grains (dolomite, pyrite). The ???30% of the residual grains in the pulsed flow reactor that are armored have thicker (50- to 100-??m), more aluminous coatings and lack the gypsum rind that develops in the constant flow experiment. Aluminium-rich zones developed in the interior parts of armor rims in both the constant flow and pulsed limestone bed experiments in response to pH changes at the solid/solution interface. ?? 2003 Elsevier Ltd. All rights reserved.

Runout and fine-sediment deposits of axisymmetric turbidity currents

NASA Astrophysics Data System (ADS)

Dade, W. Brian; Huppert, Herbert E.

1995-09-01

We develop a model that describes the runout behavior and resulting deposit of a radially spreading, suspension-driven gravity current on a surface of negligible slope. Our analysis considers the separate cases of constant-volume and constant-flux sources. It incorporates expressions for the conservation of volume, a Froude number condition at the current front, and the evolution of the driving suspension due to settling of particles to the underlying bed. The model captures the key features of a range of experimental observations. The analysis also provides important scaling relationships between the geometry of a deposit and the source conditions for the deposit-forming flow, as well as explicit expressions for flow speed and deposit thickness as functions of radial distance from the source. Among the results of our study we find that, in the absence of information regarding flow history, the geometries of relatively well-sorted deposits generated by flows with source conditions of constant volume or constant flux are virtually indistinguishable. The results of our analysis can be used by geologists in the interpretation of some geologically important gravity-surge deposits. Using our analytical results, we consider three previously studied, radially symmetric turbidites of the Hispaniola-Caicos basin in the western Atlantic Ocean. From gross geometry and grain size of the turbidites alone we estimate for the respective deposit-forming events that upon entry into the basin the initial sediment concentrations were approximately 3% by volume and the total volumes were roughly between 30 km3 and 100 km3. Each of the suspension-driven flows is inferred to have spread into the basin with a characteristic speed of 3-5 m s-1, and reached its ultimate runout length of about 60-75 km while laying down a deposit over a period of about 10-12 hours.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Xiaobing; Zheng, O'Neill; Niu, Fuxin

Most commercial ground source heat pump systems (GSHP) in the United States are in a distributed configuration. These systems circulate water or an anti-freeze solution through multiple heat pump units via a central pumping system, which usually uses variable speed pump(s). Variable speed pumps have potential to significantly reduce pumping energy use; however, the energy savings in reality could be far away from its potential due to improper pumping system design and controls. In this paper, a simplified hydronic pumping system was simulated with the dynamic Modelica models to evaluate three different pumping control strategies. This includes two conventional controlmore » strategies, which are to maintain a constant differential pressure across either the supply and return mains, or at the most hydraulically remote heat pump; and an innovative control strategy, which adjusts system flow rate based on the demand of each heat pump. The simulation results indicate that a significant overflow occurs at part load conditions when the variable speed pump is controlled to main a constant differential pressure across the supply and return mains of the piping system. On the other hand, an underflow occurs at part load conditions when the variable speed pump is controlled to maintain a constant differential pressure across the furthest heat pump. The flow-demand-based control can provide needed flow rate to each heat pump at any given time, and with less pumping energy use than the two conventional controls. Finally, a typical distributed GSHP system was studied to evaluate the energy saving potential of applying the flow-demand-based pumping control strategy. This case study shows that the annual pumping energy consumption can be reduced by 62% using the flow-demand-based control compared with that using the conventional pressure-based control to maintain a constant differential pressure a cross the supply and return mains.« less

Effect of External Pressure and Catheter Gauge on Flow Rate, Kinetic Energy, and Endothelial Injury During Intravenous Fluid Administration in a Rabbit Model.

PubMed

Hu, Mei-Hua; Chan, Wei-Hung; Chen, Yao-Chang; Cherng, Chen-Hwan; Lin, Chih-Kung; Tsai, Chien-Sung; Chou, Yu-Ching; Huang, Go-Shine

2016-01-01

The effects of intravenous (IV) catheter gauge and pressurization of IV fluid (IVF) bags on fluid flow rate have been studied. However, the pressure needed to achieve a flow rate equivalent to that of a 16 gauge (G) catheter through smaller G catheters and the potential for endothelial damage from the increased kinetic energy produced by higher pressurization are unclear. Constant pressure on an IVF bag was maintained by an automatic adjustable pneumatic pressure regulator of our own design. Fluids running through 16 G, 18 G, 20 G, and 22 G catheters were assessed while using IV bag pressurization to achieve the flow rate equivalent to that of a 16 G catheter. We assessed flow rates, kinetic energy, and flow injury to rabbit inferior vena cava endothelium. By applying sufficient external constant pressure to an IVF bag, all fluids could be run through smaller (G) catheters at the flow rate in a 16 G catheter. However, the kinetic energy increased significantly as the catheter G increased. Damage to the venous endothelium was negligible or minimal/patchy cell loss. We designed a new rapid infusion system, which provides a constant pressure that compresses the fluid volume until it is free from visible residual fluid. When large-bore venous access cannot be obtained, multiple smaller catheters, external pressure, or both should be considered. However, caution should be exercised when fluid pressurized to reach a flow rate equivalent to that in a 16 G catheter is run through a smaller G catheter because of the profound increase in kinetic energy that can lead to venous endothelium injury.

A microprocessor-controlled tracheal insufflation-assisted total liquid ventilation system.

PubMed

Parker, James Courtney; Sakla, Adel; Donovan, Francis M; Beam, David; Chekuri, Annu; Al-Khatib, Mohammad; Hamm, Charles R; Eyal, Fabien G

2009-09-01

A prototype time cycled, constant volume, closed circuit perfluorocarbon (PFC) total liquid ventilator system is described. The system utilizes microcontroller-driven display and master control boards, gear motor pumps, and three-way solenoid valves to direct flow. A constant tidal volume and functional residual capacity (FRC) are maintained with feedback control using end-expiratory and end-inspiratory stop-flow pressures. The system can also provide a unique continuous perfusion (bias flow, tracheal insufflation) through one lumen of a double-lumen endotracheal catheter to increase washout of dead space liquid. FRC and arterial blood gases were maintained during ventilation with Rimar 101 PFC over 2-3 h in normal piglets and piglets with simulated pulmonary edema induced by instillation of albumin solution. Addition of tracheal insufflation flow significantly improved the blood gases and enhanced clearance of instilled albumin solution during simulated edema.

Capital dissipation minimization for a class of complex irreversible resource exchange processes

NASA Astrophysics Data System (ADS)

Xia, Shaojun; Chen, Lingen

2017-05-01

A model of a class of irreversible resource exchange processes (REPes) between a firm and a producer with commodity flow leakage from the producer to a competitive market is established in this paper. The REPes are assumed to obey the linear commodity transfer law (LCTL). Optimal price paths for capital dissipation minimization (CDM) (it can measure economic process irreversibility) are obtained. The averaged optimal control theory is used. The optimal REP strategy is also compared with other strategies, such as constant-firm-price operation and constant-commodity-flow operation, and effects of the amount of commodity transferred and the commodity flow leakage on the optimal REP strategy are also analyzed. The commodity prices of both the producer and the firm for the CDM of the REPes with commodity flow leakage change with the time exponentially.

Electrokinetic dispersion in microfluidic separation systems

NASA Astrophysics Data System (ADS)

Molho, Joshua Irving

Numerous efforts have focused on engineering miniaturized chemical analysis devices that are faster, more portable and consume smaller volumes of expensive reagents than their macroscale counterparts. Many of these analysis devices employ electrokinetic effects to transport picoliter volumes of liquids and to separate chemical species from an initially mixed sample volume. In these microfluidic separation systems, dispersion must be minimized to obtain the highest resolution separation possible. This work focuses on modeling, simulation and experimental measurement of two electrokinetic dispersion mechanisms that can reduce the effectiveness of microfluidic separation systems: dispersion resulting from non-uniform wall zeta-potential, and dispersion caused by microchannel turns. When the surface of a microchannel has non-uniform zeta-potential (e.g., if the surface charge varies along the length of the microchannel), an applied electric field creates both electroosmotic and pressure-driven flow. A caged-fluorescence imaging technique was used to visualize the dispersion caused by this electrokinetically induced pressure-driven flow. A simple model for a single channel with an axially varying surface charge is presented and compared to experimental measurements. Microchannel turns have been shown to create dispersion of electrokinetically transported analyte bands. Using a method of moments analysis, a model is developed that quantifies this dispersion and identifies the conditions under which turn dispersion limits the resolution of a microfluidic separation system. Measurements using the caged-fluorescence visualization technique were used to verify this model. New turn geometries are presented and were optimized using both a reduced parameter technique as well as a more generalized, numerical shape optimization approach. These improved turn designs were manufactured using two fabrication techniques and then tested experimentally. The turn optimization approaches and resulting turn geometries described here are shown to reduce turn dispersion to less than 1% of the dispersion caused by unoptimized, constant-width turns.

A modulation technique for the measurement of the DC longitudinal Faraday effect

NASA Astrophysics Data System (ADS)

Hunte, Carlos

2018-03-01

A modulation of light technique, using a lock-in amplifier, is described and tested to investigate the longitudinal Faraday effect in isotropic media. The Faraday rotation is measured directly from the lock-in amplifier. The Verdet constant and dispersion of lead-silica SF-59 Schott glass, at room temperature of 25 °C, were determined for varying wavelengths and expressions for their wavelength dependence were determined. The Verdet constant of water is also investigated. The results compare extremely well with other studies. The technique is suited to measure very small Verdet constants and can be easily conducted in an upper-level undergraduate laboratory.

Direct flow crystal growth system

DOEpatents

Montgomery, Kenneth E.; Milanovich, Fred P.

1992-01-01

A crystal is grown in a constantly filtered solution which is flowed directly into the growing face of a crystal. In a continuous flow system, solution at its saturation temperature is removed from a crystal growth tank, heated above its saturation temperature, filtered, cooled back to its saturation temperature, and returned to the tank.

Thrust and Efficiency Performance of the Microcavity Discharge Thruster

DTIC Science & Technology

2011-05-31

which a constant mass flow rate with heating resulted in a pressure increase of 50 - 75%, and a corresponding stagnation temperature increase of 125...27  4.1  Plasma Dynamics Model .................................................................................. 27  4.2  Flow ...Model ....................................................................................................... 29  4.3  Plasma- Flow Coupling

Influence of vortical flow structures on the glottal jet location in the supraglottal region.

PubMed

Kniesburges, Stefan; Hesselmann, Christina; Becker, Stefan; Schlücker, Eberhard; Döllinger, Michael

2013-09-01

Within the fully coupled multiphysics phonation process, the fluid flow plays an important role for sound production. This study addresses phenomena in the flow downstream of synthetic self-oscillating vocal folds. An experimental setup consisting of devices for producing and conditioning the flow including the main test channel was applied. The supraglottal channel was designed to prevent an acoustic coupling to the vocal folds. Hence, the oscillations were aerodynamically driven. The cross-section of the supraglottal channel was systematically varied by increasing the distance between the lateral channel walls. The vocal folds consisted of silicone rubber of homogenous material distribution generating self-sustained oscillations. The airflow was visualized in the immediate supraglottal region using a laser-sheet technique and a digital high-speed camera. Furthermore, the flow was studied by measuring the static pressure distributions on both lateral supraglottal channel walls. The results clearly showed different flow characteristics depending on the supraglottal configuration. In all cases with supraglottal channel, the jet was located asymmetrical and bent in medial-lateral direction. Furthermore, the side to which the jet was deflected changed in between the consecutive cycles showing a bifurcational behavior. Previously, this phenomenon was explained by the Coanda effect. However, the present data suggest that the deflection of the jet was mainly caused by large air vortices in the supraglottal channel produced by the flow field of previous oscillations. In contrast, for the case without supraglottal channel, the air jet was found totally symmetrical stabilized by the constant pressure in the ambient region. The emitted sound signal showed additional subharmonic tonal peaks for the asymmetric flow cases, which are characteristics for diplophonia. Copyright © 2013 The Voice Foundation. Published by Mosby, Inc. All rights reserved.

Toward Understanding Tip Leakage Flows in Small Compressor Cores Including Stator Leakage Flow

NASA Technical Reports Server (NTRS)

Berdanier, Reid A.; Key, Nicole L.

2017-01-01

The focus of this work was to provide additional data to supplement the work reported in NASA/CR-2015-218868 (Berdanier and Key, 2015b). The aim of that project was to characterize the fundamental flow physics and the overall performance effects due to increased rotor tip clearance heights in axial compressors. Data have been collected in the three-stage axial research compressor at Purdue University with a specific focus on analyzing the multistage effects resulting from the tip leakage flow. Three separate rotor tip clearances were studied with nominal tip clearance gaps of 1.5 percent, 3.0 percent, and 4.0 percent based on a constant annulus height. Overall compressor performance was previously investigated at four corrected speedlines (100 percent, 90 percent, 80 percent, and 68 percent) for each of the three tip clearance configurations. This study extends the previously published results to include detailed steady and time-resolved pressure data at two loading conditions, nominal loading (NL) and high loading (HL), on the 100 percent corrected speedline for the intermediate clearance level (3.0 percent). Steady detailed radial traverses of total pressure at the exit of each stator row are supported by flow visualization techniques to identify regions of flow recirculation and separation. Furthermore, detailed radial traverses of time-resolved total pressures at the exit of each rotor row have been measured with a fast-response pressure probe. These data were combined with existing three-component velocity measurements to identify a novel technique for calculating blockage in a multistage compressor. Time-resolved static pressure measurements have been collected over the rotor tips for all rotors with each of the three tip clearance configurations for up to five loading conditions along the 100 percent corrected speedline using fast-response piezoresistive pressure sensors. These time-resolved static pressure measurements reveal new knowledge about the trajectory of the tip leakage flow through the rotor passage. Further, these data extend previous measurements identifying a modulation of the tip leakage flow due to upstream stator wake propagation. Finally, a novel instrumentation technique has been implemented to measure pressures in the shrouded stator cavities. These data provide boundary conditions relating to the flow across the shrouded stator knife seal teeth. Moreover, the utilization of fast-response pressure sensors provides a new look at the time-resolved pressure field, leading to instantaneous differential pressures across the seal teeth. Ultimately, the data collected for this project represent a unique data set which contributes to build a better understanding of the tip leakage flow field and its associated loss mechanisms. These data will facilitate future engine design goals leading to small blade heights in the rear stages of high pressure compressors and aid in the development of new blade designs which are desensitized to the performance penalties attributed to rotor tip leakage flows.

Separation of Single-Walled Carbon Nanotubes with DEP-FFF

NASA Technical Reports Server (NTRS)

Schmidt, Howard K.; Peng, Haiqing; Alvarez, Noe; Mendes, Manuel; Pasquali, Matteo

2011-01-01

A process using a modified dielectrophoresis device separates single-walled carbon nanotubes (SWNTs) according to their polarizability in electric fields. This depends on the size and dielectric constant of individual nanotubes and easily separates metallic from semiconducting nanotubes. Separation by length has also been demonstrated. Partial separation (enrichment) according to bandgap (which is linked to polarizability) has also been shown and can be improved to full separation of individual types of semiconducting SWNTs with better control over operational parameters and the length of SWNT starting material. This process and device can be scaled affordably to generate useful amounts of semiconducting SWNTs for electronic device development and production. In this study, a flow injection dielectrophoresis technique was used with a modified dielectrophoresis device. The length, width, and height of the modified chamber were 28, 2.5, and 0.025 cm, respectively. On the bottom of the chamber, there are two arrays of 50-m-wide, 2-m-thick gold electrodes, which are connected to an AC voltage generator and are alternately arranged so that every electrode is adjacent to two electrodes of the opposite polar. There is an additional plate electrode on the top of the chamber that is negatively biased. During the experiment, a syringe pump constantly pumps in the mobile phase, 1-percent sodium dodecylbenzene sulfonate (SDBS) solution, into the chamber. The frequency and voltage are set to 1 MHz and 10 V peak-to-peak, respectively. About 150 micro-L of SWNTs in 1- percent SDBS decanted solution are injected to the mobile phase through a septum near the entrance of the chamber. The flow rate of the mobile phase is set to 0.02 cu cm/min. The injected SWNTs sample flows through the chamber before it is lead into a fluorescence flow-through cell and collected for further analysis. The flow-through cell has three windows, thus allowing the fluorometer to collect fluorescence spectrum and visible absorption spectrums simultaneously. Dielectrophoresis field-flow fractionation (DEP-FFF) generally depends on interaction of a sedimentation force and DEP force for particle separation, and SWNTs are neutrally buoyant in water. In this innovation, the third electrode was added to create a sedimentation force based on DC electrophoresis. This makes this particular device applicable to separations on any neutrally buoyant particles in solution and a more general process for a broad range of nanomaterials sorting and separations.

The Numerical Simulation of Time Dependent Flow Structures Over a Natural Gravel Surface.

NASA Astrophysics Data System (ADS)

Hardy, R. J.; Lane, S. N.; Ferguson, R. I.; Parsons, D. R.

2004-05-01

Research undertaken over the last few years has demonstrated the importance of the structure of gravel river beds for understanding the interaction between fluid flow and sediment transport processes. This includes the observation of periodic high-speed fluid wedges interconnected by low-speed flow regions. Our understanding of these flows has been enhanced significantly through a series of laboratory experiments and supported by field observations. However, the potential of high resolution three dimensional Computational Fluid Dynamics (CFD) modeling has yet to be fully developed. This is largely the result of the problems of designing numerically stable meshes for use with complex bed topographies and that Reynolds averaged turbulence schemes are applied. This paper develops two novel techniques for dealing with these issues. The first is the development and validation of a method for representing the complex surface topography of gravel-bed rivers in high resolution three-dimensional computational fluid dynamic models. This is based upon a porosity treatment with a regular structured grid and the application of a porosity modification to the mass conservation equation in which: fully blocked cells are assigned a porosity of zero; fully unblocked cells are assigned a porosity of one; and partly blocked cells are assigned a porosity of between 0 and 1, according to the percentage of the cell volume that is blocked. The second is the application of Large Eddy Simulation (LES) which enables time dependent flow structures to be numerically predicted over the complex bed topographies. The regular structured grid with the embedded porosity algorithm maintains a constant grid cell size throughout the domain implying a constant filter scale for the LES simulation. This enables the prediction of coherent structures, repetitive quasi-cyclic large-scale turbulent motions, over the gravel surface which are of a similar magnitude and frequency to those previously observed in both flume and field studies. These structures are formed by topographic forcing within the domain and are scaled with the flow depth. Finally, this provides the numerical framework for the prediction of sediment transport within a time dependent framework. The turbulent motions make a significant contribution to the turbulent shear stress and the pressure fluctuations which significantly affect the forces acting on the bed and potentially control sediment motion.

Ceramic-metal composites prepared via tape casting and melt infiltration methods

NASA Astrophysics Data System (ADS)

Kim, Hyun Jun

Melt infiltration of preforms prepared by tape casting and lamination has been accomplished using a short-time infiltration process that significantly suppresses reaction product formation. For layered materials produced via infiltration of laminated ceramic tapes, of particular interest is the effect that a large change in microstructure has on infiltration, phase formation, and mechanical properties. Hardness of the fine scale composite layers is approximately three times higher than coarse scale layers, due to greater strength of the fine B4C network. Fractography showed that crack propagation occurred by brittle fracture of the carbide and ductile extension of the metal. Despite large differences in hardness, the fracture mode of the fine and coarse scale microstructures appears identical. Fluid flow modeling for tape casting was conducted with a Newtonian slurry under a parallel blade, and the effect of beveling the blade based on a one dimensional flow model is shown. The discussion on slurry deformation after the blade exit suggests that the mode of slurry deformation depends on the relative importance of the pressure gradient and wall shear and that the existence of zero shear plane might have a negative effect on particle alignment in the tape. The analysis of the flow under a beveled blade predicts that this configuration is more advantageous than the parallel blade for productivity and parallel blade is better for producing uniform particle alignment and thinner tape. Also, the one dimensional flow model for the beveled blade is shown to be a valid approximation of the fluid behavior below a blade angle of 45 degrees. The flow visualization study on tape casting was conducted with a transparent apparatus and model slurry. Most investigators have concluded that the shear stress between the doctor blade and moving carrier causes the particle alignment, but, according to the result of visualization experiment, some degree of particle alignment is already established in the reservoir. The fluid flow concept of tape casting is incorporated with a metal infiltration technique to prepare the ceramic-metal composites with tailored porosity and pore orientation. Boron carbide-aluminum system was used to prepare the composites, and its stiffness constants were investigated. The aligned metal ligaments rarely affect the stiffness constant anisotropy which appears to be caused by tape casting operation.

Using natural distributions of short-lived radium isotopes to quantify groundwater discharge and recharge

USGS Publications Warehouse

Krest, J.M.; Harvey, J.W.

2003-01-01

Radium activity in pore water of wetland sediments often differs from the amount expected from local production, decay, and exchange with solid phases. This disequilibrium results from vertical transport of radium with groundwater that flows between the underlying aquifer and surface water. In situations where groundwater recharge or discharge is significant, the rate of vertical water flow through wetland sediment can be determined from the radium disequilibrium by a combined model of transport, production, decay, and exchange with solid phases. We have developed and tested this technique at three sites in the freshwater portion of the Everglades by quantifying vertical advective velocities in areas with persistent groundwater recharge or discharge and estimating a coefficient of dispersion at a site that is subject to reversals between recharge and discharge. Groundwater velocities (v) were determined to be between 0 and -0.5 cm d-1 for a recharge site and 1.5 ?? 0.4 cm d-1 for a discharge site near Levee 39 in the Everglades. Strong gradients in 223Ra and 224Ra usually occurred at the base of the peat layer, which avoided the problems of other tracers (e.g., chloride) for which greatest sensitivity occurs near the peat surface - a zone readily disturbed by processes unrelated to groundwater flow. This technique should be easily applicable to any wetland system with different production rates of these isotopes in distinct sedimentary layers or surface water. The approach is most straightforward in systems where constant pore-water ionic strength can be assumed, simplifying the modeling of radium exchange.

Multiparameter Flowfield Measurements in High-Pressure, Cryogenic Environments Using Femtosecond Lasers

NASA Technical Reports Server (NTRS)

Burns, Ross A.; Danehy, Paul M.; Peters, Christopher J.

2016-01-01

Femtosecond laser electronic excitation tagging (FLEET) and Rayleigh scattering (RS) from a femtosecond laser are demonstrated in the NASA Langley 0.3-m Transonic Cryogenic Tunnel (TCT). The measured signals from these techniques are examined for their thermodynamic dependencies in pure nitrogen. The FLEET signal intensity and signal lifetimes are found to scale primarily with the gas density, as does the RS signal. Several models are developed, which capture these physical behaviors. Notably, the FLEET and Rayleigh scattering intensities scale linearly with the flow density, while the FLEET signal decay rates are a more complex function of the thermodynamic state of the gas. The measurement of various flow properties are demonstrated using these techniques. While density was directly measured from the signal intensities and FLEET signal lifetime, temperature and pressure were measured using the simultaneous FLEET velocity measurements while assuming the flow had a constant total enthalpy. Measurements of density, temperature, and pressure from the FLEET signal are made with accuracies as high as 5.3 percent, 0.62 percent, and 6.2 percent, respectively, while precisions were approximately 10 percent, 0.26 percent, and 11 percent for these same quantities. Similar measurements of density from Rayleigh scattering showed an overall accuracy of 3.5 percent and a precision of 10.2 percent over a limited temperature range (T greater than 195 K). These measurements suggest a high degree of utility at using the femtosecond-laser based diagnostics for making multiparameter measurements in high-pressure, cryogenic environments such as large-scale TCT facilities.

Recurrent Neural Networks With Auxiliary Memory Units.

PubMed

Wang, Jianyong; Zhang, Lei; Guo, Quan; Yi, Zhang

2018-05-01

Memory is one of the most important mechanisms in recurrent neural networks (RNNs) learning. It plays a crucial role in practical applications, such as sequence learning. With a good memory mechanism, long term history can be fused with current information, and can thus improve RNNs learning. Developing a suitable memory mechanism is always desirable in the field of RNNs. This paper proposes a novel memory mechanism for RNNs. The main contributions of this paper are: 1) an auxiliary memory unit (AMU) is proposed, which results in a new special RNN model (AMU-RNN), separating the memory and output explicitly and 2) an efficient learning algorithm is developed by employing the technique of error flow truncation. The proposed AMU-RNN model, together with the developed learning algorithm, can learn and maintain stable memory over a long time range. This method overcomes both the learning conflict problem and gradient vanishing problem. Unlike the traditional method, which mixes the memory and output with a single neuron in a recurrent unit, the AMU provides an auxiliary memory neuron to maintain memory in particular. By separating the memory and output in a recurrent unit, the problem of learning conflicts can be eliminated easily. Moreover, by using the technique of error flow truncation, each auxiliary memory neuron ensures constant error flow during the learning process. The experiments demonstrate good performance of the proposed AMU-RNNs and the developed learning algorithm. The method exhibits quite efficient learning performance with stable convergence in the AMU-RNN learning and outperforms the state-of-the-art RNN models in sequence generation and sequence classification tasks.

Nonlinear interactions in mixing layers and compressible heated round jets. Ph.D. Thesis Final Report

NASA Technical Reports Server (NTRS)

Jarrah, Yousef Mohd

1989-01-01

The nonlinear interactions between a fundamental instability mode and both its harmonics and the changing mean flow are studied using the weakly nonlinear stability theory of Stuart and Watson, and numerical solutions of coupled nonlinear partial differential equations. The first part focuses on incompressible cold (or isothermal; constant temperature throughout) mixing layers, and for these, the first and second Landau constants are calculated as functions of wavenumber and Reynolds number. It is found that the dominant contribution to the Landau constants arises from the mean flow changes and not from the higher harmonics. In order to establish the range of validity of the weakly nonlinear theory, the weakly nonlinear and numerical solutions are compared and the limitation of each is discussed. At small amplitudes and at low-to-moderate Reynolds numbers, the two results compare well in describing the saturation of the fundamental, the distortion of the mean flow, and the initial stages of vorticity roll-up. At larger amplitudes, the interaction between the fundamental, second harmonic, and the mean flow is strongly nonlinear and the numerical solution predicts flow oscillations, whereas the weakly nonlinear theory yields saturation. In the second part, the weakly nonlinear theory is extended to heated (or nonisothermal; mean temperature distribution) subsonic round jets where quadratic and cubic nonlinear interactions are present, and the Landau constants also depend on jet temperature ratio, Mach number and azimuthal mode number. Under exponential growth and nonlinear saturation, it is found that heating and compressibility suppress the growth of instability waves, that the first azimuthal mode is the dominant instability mode, and that the weakly nonlinear solution describes the early stages of the roll-up of an axisymmetric shear layer. The receptivity of a typical jet flow to pulse type input disturbance is also studied by solving the initial value problem and then examining the behavior of the long-time solution.

Double synchronized switch harvesting (DSSH): a new energy harvesting scheme for efficient energy extraction.

PubMed

Lallart, Mickaël; Garbuio, Lauric; Petit, Lionel; Richard, Claude; Guyomar, Daniel

2008-10-01

This paper presents a new technique for optimized energy harvesting using piezoelectric microgenerators called double synchronized switch harvesting (DSSH). This technique consists of a nonlinear treatment of the output voltage of the piezoelectric element. It also integrates an intermediate switching stage that ensures an optimal harvested power whatever the load connected to the microgenerator. Theoretical developments are presented considering either constant vibration magnitude, constant driving force, or independent extraction. Then experimental measurements are carried out to validate the theoretical predictions. This technique exhibits a constant output power for a wide range of load connected to the microgenerator. In addition, the extracted power obtained using such a technique allows a gain up to 500% in terms of maximal power output compared with the standard energy harvesting method. It is also shown that such a technique allows a fine-tuning of the trade-off between vibration damping and energy harvesting.

Effect of Flow Rate Controller on Liquid Steel Flow in Continuous Casting Mold using Numerical Modeling

NASA Astrophysics Data System (ADS)

Gursoy, Kadir Ali; Yavuz, Mehmet Metin

2014-11-01

In continuous casting operation of steel, the flow through tundish to the mold can be controlled by different flow rate control systems including stopper rod and slide-gate. Ladle changes in continuous casting machines result in liquid steel level changes in tundishes. During this transient event of production, the flow rate controller opening is increased to reduce the pressure drop across the opening which helps to keep the mass flow rate at the desired level for the reduced liquid steel level in tundish. In the present study, computational fluid dynamic (CFD) models are developed to investigate the effect of flow rate controller on mold flow structure, and particularly to understand the effect of flow controller opening on meniscus flow. First, a detailed validation of the CFD models is conducted using available experimental data and the performances of different turbulence models are compared. Then, the constant throughput casting operations for different flow rate controller openings are simulated to quantify the opening effect on meniscus region. The results indicate that the meniscus velocities are significantly affected by the flow rate controller and its opening level. The steady state operations, specified as constant throughput casting, do not provide the same mold flow if the controller opening is altered. Thus, for quality and castability purposes, adjusting the flow controller opening to obtain the fixed mold flow structure is proposed. Supported by Middle East Technical University (METU) BAP (Scientific Research Projects) Coordination.

The importance of flow history in mixed shear and extensional flows

NASA Astrophysics Data System (ADS)

Wagner, Caroline; McKinley, Gareth

2015-11-01

Many complex fluid flows of experimental and academic interest exhibit mixed kinematics with regions of shear and elongation. Examples include flows through planar hyperbolic contractions in microfluidic devices and through porous media or geometric arrays. Through the introduction of a ``flow-type parameter'' α which varies between 0 in pure shear and 1 in pure elongation, the local velocity fields of all such mixed flows can be concisely characterized. It is tempting to then consider the local stress field and interpret the local state of stress in a complex fluid in terms of shearing or extensional material functions. However, the material response of such fluids exhibit a fading memory of the entire deformation history. We consider a dilute solution of Hookean dumbbells and solve the Oldroyd-B model to obtain analytic expressions for the entire stress field in any arbitrary mixed flow of constant strain rate and flow-type parameter α. We then consider a more complex flow for which the shear rate is constant but the flow-type parameter α varies periodically in time (reminiscent of flow through a periodic array or through repeated contractions and expansions). We show that the flow history and kinematic sequencing (in terms of whether the flow was initialized as shearing or extensional) is extremely important in determining the ensuing stress field and rate of dissipated energy in the flow, and can only be ignored in the limit of infinitely slow flow variations.

Prediction of Supersonic Store Separation Characteristics Volume I. Theoretical Methods and Comparisons with Experiment

DTIC Science & Technology

1976-05-01

attached to the wing or under the fuselage.__ DD ’JO77,S 1473 EDITION OF NOV 61 IS OBSOLETE UNICLASSIFILEDV~D.n SEUIYC ASIIAINOFTI -E %inDI I...cruciform fins. 61 7 Shock shape deduced from flow field properties. (a) M D 1. 5. 62 7 Continued. (b) MW = 2.0 63 7 Concluded. (c) M. = 2.5. 64 8 Flow...equation (14) h panel span, figure 2 K constant associated with line source strength function f(•), equation (I-8) SKd constant associated with line

In vivo testing of a magnetically suspended centrifugal pump designed for long-term use.

PubMed

Yamada, T; Nishimura, K; Akamatsu, T; Tsukiya, T; Park, C H; Kono, S; Matsuda, K; Ban, T

1997-10-01

The life of currently-available centrifugal pumps is limited to no more than three days. As a magnetically suspended centrifugal pump (MSCP) contains no shaft or seal, it could be expected to have a longer life expectancy. The MSCP was evaluated in a chronic animal model using eight adult sheep. Left ventricular assist with the MSCP was instituted between the left atrium and the descending aorta. The flow rates ranged from 2.5 to 6.0 L/min. The duration of the experiments ranged from 14 to 60 days. No mechanical failure occurred. The plasma free hemoglobin levels remained within an acceptable range (3-19 mg/dL). No reduction in the counts of red blood cells or platelets was observed. Thrombus formation within the MSCP was recognized in one pump. The main reason for termination was thromboembolism derived from the circuits. Three types of regulation methods (constant rotational speed, constant motor current, and controlled motor current) were also investigated. Regulation by a constant motor current mode altered the pressure-flow (P-Q) characteristics, and thereby, a steadier pump flow was obtained compared with regulation in the constant rotational speed mode. Moreover, the controlled motor current mode can change the P-Q relationship. These results demonstrate that the MSCP is a promising device for long-term use.

Dynamic and Thermal Turbulent Time Scale Modelling for Homogeneous Shear Flows

NASA Technical Reports Server (NTRS)

Schwab, John R.; Lakshminarayana, Budugur

1994-01-01

A new turbulence model, based upon dynamic and thermal turbulent time scale transport equations, is developed and applied to homogeneous shear flows with constant velocity and temperature gradients. The new model comprises transport equations for k, the turbulent kinetic energy; tau, the dynamic time scale; k(sub theta), the fluctuating temperature variance; and tau(sub theta), the thermal time scale. It offers conceptually parallel modeling of the dynamic and thermal turbulence at the two equation level, and eliminates the customary prescription of an empirical turbulent Prandtl number, Pr(sub t), thus permitting a more generalized prediction capability for turbulent heat transfer in complex flows and geometries. The new model also incorporates constitutive relations, based upon invariant theory, that allow the effects of nonequilibrium to modify the primary coefficients for the turbulent shear stress and heat flux. Predictions of the new model, along with those from two other similar models, are compared with experimental data for decaying homogeneous dynamic and thermal turbulence, homogeneous turbulence with constant temperature gradient, and homogeneous turbulence with constant temperature gradient and constant velocity gradient. The new model offers improvement in agreement with the data for most cases considered in this work, although it was no better than the other models for several cases where all the models performed poorly.

Determination of calibration constants for the hole-drilling residual stress measurement technique applied to orthotropic composites. II - Experimental evaluations

NASA Technical Reports Server (NTRS)

Prasad, C. B.; Prabhakaran, R.; Tompkins, S.

1987-01-01

The first step in the extension of the semidestructive hole-drilling technique for residual stress measurement to orthotropic composite materials is the determination of the three calibration constants. Attention is presently given to an experimental determination of these calibration constants for a highly orthotropic, unidirectionally-reinforced graphite fiber-reinforced polyimide composite. A comparison of the measured values with theoretically obtained ones shows agreement to be good, in view of the many possible sources of experimental variation.

An Adaptive Flow Solver for Air-Borne Vehicles Undergoing Time-Dependent Motions/Deformations

NASA Technical Reports Server (NTRS)

Singh, Jatinder; Taylor, Stephen

1997-01-01

This report describes a concurrent Euler flow solver for flows around complex 3-D bodies. The solver is based on a cell-centered finite volume methodology on 3-D unstructured tetrahedral grids. In this algorithm, spatial discretization for the inviscid convective term is accomplished using an upwind scheme. A localized reconstruction is done for flow variables which is second order accurate. Evolution in time is accomplished using an explicit three-stage Runge-Kutta method which has second order temporal accuracy. This is adapted for concurrent execution using another proven methodology based on concurrent graph abstraction. This solver operates on heterogeneous network architectures. These architectures may include a broad variety of UNIX workstations and PCs running Windows NT, symmetric multiprocessors and distributed-memory multi-computers. The unstructured grid is generated using commercial grid generation tools. The grid is automatically partitioned using a concurrent algorithm based on heat diffusion. This results in memory requirements that are inversely proportional to the number of processors. The solver uses automatic granularity control and resource management techniques both to balance load and communication requirements, and deal with differing memory constraints. These ideas are again based on heat diffusion. Results are subsequently combined for visualization and analysis using commercial CFD tools. Flow simulation results are demonstrated for a constant section wing at subsonic, transonic, and a supersonic case. These results are compared with experimental data and numerical results of other researchers. Performance results are under way for a variety of network topologies.

Kinetics of hydrogen isotope exchange in β-phase Pd-H-D

DOE PAGES

Luo, Weifang; Cowgill, Donald F.

2015-07-22

Hydrogen isotope gas exchange within palladium powders is examined using a batch-type reactor coupled to a residual gas analyzer (RGA). Furthermore, the exchange rates in both directions (H 2 + PdD and D 2 + PdH) are measured in the temperature range 178–323 K for the samples with different particle sizes. The results show this batch-type exchange is closely approximated as a first-order kinetic process with a rate directly proportional to the surface area of the powder particles. An exchange rate constant of 1.40 ± 0.24 μmol H 2/atm cm 2 s is found for H 2 + PdD atmore » 298 K, 1.4 times higher than that for D 2 + PdH, with an activation energy of 25.0 ± 3.2 kJ/mol H for both exchange directions. Finally, a comparison of exchange measurement techniques shows these coefficients, and the fundamental exchange probabilities are in good agreement with those obtained by NMR and flow techniques.« less

Experimental Measurements of Sonic Boom Signatures Using a Continuous Data Acquisition Technique

NASA Technical Reports Server (NTRS)

Wilcox, Floyd J.; Elmiligui, Alaa A.

2013-01-01

A wind tunnel investigation was conducted in the Langley Unitary Plan Wind Tunnel to determine the effectiveness of a technique to measure aircraft sonic boom signatures using a single conical survey probe while continuously moving the model past the probe. Sonic boom signatures were obtained using both move-pause and continuous data acquisition methods for comparison. The test was conducted using a generic business jet model at a constant angle of attack and a single model-to-survey-probe separation distance. The sonic boom signatures were obtained at a Mach number of 2.0 and a unit Reynolds number of 2 million per foot. The test results showed that it is possible to obtain sonic boom signatures while continuously moving the model and that the time required to acquire the signature is at least 10 times faster than the move-pause method. Data plots are presented with a discussion of the results. No tabulated data or flow visualization photographs are included.

Determination of stream reaeration coefficients by use of tracers

USGS Publications Warehouse

Kilpatrick, F.A.; Rathbun, R.E.; Yotsukura, Nobuhiro; Parker, G.W.; DeLong, L.L.

1989-01-01

Stream reaeration is the physical absorption of oxygen from the atmosphere by a flowing stream. This is the primary process by which a stream replenishes the oxygen consumed in the biodegradation of organic wastes. Prior to 1965, reaeration rate coefficients could be estimated only by indirect methods. In 1965, a direct method of measuring stream reaeration coefficients was developed whereby a radioactive tracer gas was injected into a stream-the principle being that the tracer gas would be desorbed from the stream inversely to how oxygen would be absorbed. The technique has since been modified by substituting hydrocarbon gases for the radioactive tracer gas. This manual describes the slug-injection and constant-rate-injection methods of measuring gas-tracer desorption. Emphasis is on the use of rhodamine WT dye as a relatively conservative tracer and propane as the nonconservative gas tracer, on planning field tests, on methods of injection, sampling, and analysis, and on techniques for computing desorption and reaeration coefficients.

Nonlinear ship waves and computational fluid dynamics

PubMed Central

MIYATA, Hideaki; ORIHARA, Hideo; SATO, Yohei

2014-01-01

Research works undertaken in the first author’s laboratory at the University of Tokyo over the past 30 years are highlighted. Finding of the occurrence of nonlinear waves (named Free-Surface Shock Waves) in the vicinity of a ship advancing at constant speed provided the start-line for the progress of innovative technologies in the ship hull-form design. Based on these findings, a multitude of the Computational Fluid Dynamic (CFD) techniques have been developed over this period, and are highlighted in this paper. The TUMMAC code has been developed for wave problems, based on a rectangular grid system, while the WISDAM code treats both wave and viscous flow problems in the framework of a boundary-fitted grid system. These two techniques are able to cope with almost all fluid dynamical problems relating to ships, including the resistance, ship’s motion and ride-comfort issues. Consequently, the two codes have contributed significantly to the progress in the technology of ship design, and now form an integral part of the ship-designing process. PMID:25311139

Effects of Solution Chemistry on Nano-Bubbles Transport in Saturated Porous Media

NASA Astrophysics Data System (ADS)

Hamamoto, S.; Takemura, T.; Suzuki, K.; Nihei, N.; Nishimura, T.

2017-12-01

Nano-bubbles (NBs) have a considerable potential for the remediation of soil and groundwater contaminated by organic compounds, especially when used in conjunction with bioremediation technologies. Understanding the transport mechanisms of NBs in soils is essential to optimize NB-based remediation techniques. In this study, one-dimensional column transport experiments using glass beads with 0.1 mm size were conducted, where NBs created by oxygen gas at different pH and ionic strength were injected to the column at the constant flow rate. The NBs concentration in the effluent was quantified using a resonant mass measurement technique. Effects of solution chemistry of the NBs water on NB transport in the porous media were investigated. The results showed that attachment of NBs was enhanced under higher ionic strength and lower pH conditions, caused by the reduced repulsive force between NBs and glass beads. In addition, bubble size distributions in the effluents showed that relatively larger NBs were retained in the column. This trend was more significant at lower pH condition.

Investigation of Density Fluctuations in Supersonic Free Jets and Correlation with Generated Noise

NASA Technical Reports Server (NTRS)

Panda, J.; Seasholtz, R. G.

2000-01-01

The air density fluctuations in the plumes of fully-expanded, unheated free jets were investigated experimentally using a Rayleigh scattering based technique. The point measuring technique used a continuous wave laser, fiber-optic transmission and photon counting electronics. The radial and centerline profiles of time-averaged density and root-mean-square density fluctuation provided a comparative description of jet growth. To measure density fluctuation spectra a two-Photomultiplier tube technique was used. Crosscorrelation between the two PMT signals significantly reduced electronic shot noise contribution. Turbulent density fluctuations occurring up to a Strouhal number (Sr) of 2.5 were resolved. A remarkable feature of density spectra, obtained from the same locations of jets in 0.5< M<1.5 range, is a constant Strouhal frequency for peak fluctuations. A detailed survey at Mach numbers M = 0.95, 1.4 and 1.8 showed that, in general, distribution of various Strouhal frequency fluctuations remained similar for the three jets. In spite of the similarity in the flow fluctuation the noise characteristics were found to be significantly different. Spark schlieren photographs and near field microphone measurements confirmed that the eddy Mach wave radiation was present in Mach 1.8 jet, and was absent in Mach 0.95 jet. To measure correlation between the flow and the far field sound pressure fluctuations, a microphone was kept at a distance of 50 diameters, 30 deg. to the flow direction, and the laser probe volume was moved from point to point in the flow. The density fluctuations in the peripheral shear layer of Mach 1.8 jet showed significant correlation up to the measurement limit of Sr = 2.5, while for Mach 0.95 jet no correlation was measured. Along the centerline measurable correlation was found from the end of the potential core and at the low frequency range (Sr less than 0.5). Usually the normalized correlation values increased with an increase of the jet Mach number. The experimental data point out eddy Mach waves as a strong source of sound generation in supersonic jets and fail to locate the primary noise mechanism in subsonic jets.

Techniques and equipment required for precise stream gaging in tide-affected fresh-water reaches of the Sacramento River, California

USGS Publications Warehouse

Smith, Winchell

1971-01-01

Current-meter measurements of high accuracy will be required for calibration of an acoustic flow-metering system proposed for installation in the Sacramento River at Chipps Island in California. This report presents an analysis of the problem of making continuous accurate current-meter measurements in this channel where the flow regime is changing constantly in response to tidal action. Gaging-system requirements are delineated, and a brief description is given of the several applicable techniques that have been developed by others. None of these techniques provides the accuracies required for the flowmeter calibration. A new system is described--one which has been assembled and tested in prototype and which will provide the matrix of data needed for accurate continuous current-meter measurements. Analysis of a large quantity of data on the velocity distribution in the channel of the Sacramento River at Chipps Island shows that adequate definition of the velocity can be made during the dominant flow periods--that is, at times other than slack-water periods--by use of current meters suspended at elevations 0.2 and 0.8 of the depth below the water surface. However, additional velocity surveys will be necessary to determine whether or not small systematic corrections need be applied during periods of rapidly changing flow. In the proposed system all gaged parameters, including velocities, depths, position in the stream, and related times, are monitored continuously as a boat moves across the river on the selected cross section. Data are recorded photographically and transferred later onto punchcards for computer processing. Computer programs have been written to permit computation of instantaneous discharges at any selected time interval throughout the period of the current meter measurement program. It is anticipated that current-meter traverses will be made at intervals of about one-half hour over periods of several days. Capability of performance for protracted periods was, consequently, one of the important elements in system design. Analysis of error sources in the proposed system indicates that errors in individual computed discharges can be kept smaller than 1.5 percent if the expected precision in all measured parameters is maintained.

The acoustical structure of highly porous open-cell foams

NASA Technical Reports Server (NTRS)

Lambert, R. F.

1982-01-01

This work concerns both the theoretical prediction and measurement of structural parameters in open-cell highly porous polyurethane foams. Of particular interest are the dynamic flow resistance, thermal time constant, and mass structure factor and their dependence on frequency and geometry of the cellular structure. The predictions of cell size parameters, static flow resistance, and heat transfer as accounted for by a Nusselt number are compared with measurement. Since the static flow resistance and inverse thermal time constant are interrelated via the 'mean' pore size parameter of Biot, only two independent measurements such as volume porosity and mean filament diameter are required to make the predictions for a given fluid condition. The agreements between this theory and nonacoustical experiments are excellent.

Single and two-phase flows of shear-thinning media in safety valves.

PubMed

Moncalvo, D; Friedel, L

2009-09-15

This study is the first one in the scientific literature to investigate the liquid and two-phase flows of shear-thinning media, here aqueous solutions of polyvinylpyrrolidone, in a fully opened safety valve. In liquid flows the volume flux at the valve seat does not show any appreciable reduction when increasing the percental weight of polymer in the solution. This result may suggest that the viscous losses in the valve do not increase sensibly from the most aqueous to the most viscous solution. The authors explain it considering that in the region between the seat and the disk, where large pressure and velocity gradients occur, large shear rates are expected. On behalf of the rheological measurements, which show that both the pseudoplasticity and the zero-shear viscosity of the solutions increase with the polymer weight, the difference between the viscosities of the most viscous and those of the most aqueous solution is between the seat and the disk far less than that existing at zero-shear condition. Therefore, the effective viscous pressure drop of the safety valve, which occurs mostly in that region, must increase only modestly with the polymer percental weight in the solution. In two-phase flows the total mass flow rate at constant quality and constant relieving pressure increases remarkably with the polymer weight. The analogy with similar results in cocurrent pipe flows suggests that air entrainment causes large velocity gradients in the liquids and strains them to very large shear rates. It suggests also that a redistribution of the gas agglomerates within the liquid must be expected when increasing the polymer weight in the solutions. In fact, the gas agglomerates react to the larger viscous drag of the liquid by compressing their volume in order to exert a higher internal pressure. The reduction of the void fraction of the mixture at constant quality and constant relieving pressure imposes an increment in the total mass flow rate, since otherwise it would lead to a reduction in the momentum of the mixture and therefore to a drop in the relieving pressure.

Methodology for extracting local constants from petroleum cracking flows

DOEpatents

Chang, Shen-Lin; Lottes, Steven A.; Zhou, Chenn Q.

2000-01-01

A methodology provides for the extraction of local chemical kinetic model constants for use in a reacting flow computational fluid dynamics (CFD) computer code with chemical kinetic computations to optimize the operating conditions or design of the system, including retrofit design improvements to existing systems. The coupled CFD and kinetic computer code are used in combination with data obtained from a matrix of experimental tests to extract the kinetic constants. Local fluid dynamic effects are implicitly included in the extracted local kinetic constants for each particular application system to which the methodology is applied. The extracted local kinetic model constants work well over a fairly broad range of operating conditions for specific and complex reaction sets in specific and complex reactor systems. While disclosed in terms of use in a Fluid Catalytic Cracking (FCC) riser, the inventive methodology has application in virtually any reaction set to extract constants for any particular application and reaction set formulation. The methodology includes the step of: (1) selecting the test data sets for various conditions; (2) establishing the general trend of the parametric effect on the measured product yields; (3) calculating product yields for the selected test conditions using coupled computational fluid dynamics and chemical kinetics; (4) adjusting the local kinetic constants to match calculated product yields with experimental data; and (5) validating the determined set of local kinetic constants by comparing the calculated results with experimental data from additional test runs at different operating conditions.

Blood-brain barrier transport of butanol and water relative to N-isopropyl-p-iodoamphetamine as the internal reference

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pardridge, W.M.; Fierer, G.

1985-06-01

The literature regarding the blood--brain barrier (BBB) transport of butanol is conflicting as studies report both incomplete and complete extraction of butanol by the brain. In this work the BBB transport of both (/sup 14/C)butanol and (/sup 3/H)water was studied using the carotid injection technique in conscious and in ketamine- or pentobarbital-anesthetized rats employing N-isopropyl-p-(/sup 125/I)iodoamphetamine ((/sup 125/I)IMP) as the internal reference and as a fluid microsphere. The three isotopes (/sup 3/H, /sup 125/I, /sup 14/C) were conveniently counted simultaneously in a liquid scintillation spectrometer. IMP is essentially completely sequestered by the brain for at least 1 min in consciousmore » rats and for 2 min in anesthetized animals. Butanol extraction by rat forebrain is not flow limited but ranges between 77 +/- 1 and 87 +/- 1% for the three conditions. The permeability-surface area product/cerebral blood flow ratio of butanol and water in rat forebrain remains relatively constant, despite a twofold increase in cerebral blood flow in conscious relative to pentobarbital-anesthetized rats. The absence of an inverse relationship between flow and butanol or water extraction is consistent with capillary recruitment being the principal mechanism underlying changes in cerebral blood flow in anesthesia. The diffusion restriction of BBB transport of butanol in some regions, but not in others, necessitates a careful regional analysis of BBB permeability to butanol prior to usage of this compound as a cerebral blood flow marker.« less

Cardiovascular control during concomitant dynamic leg exercise and static arm exercise in humans

PubMed Central

Strange, S

1999-01-01

Skeletal muscle blood flow is thought to be determined by a balance between sympathetic vasoconstriction and metabolic vasodilatation. The purpose of this study was to assess the importance of high levels of sympathetic vasoconstrictor activity in control of blood flow to human skeletal muscle during dynamic exercise.Muscle sympathetic nerve activity to the exercising leg was increased by static or static ischaemic arm exercise added to on-going dynamic leg exercise. Ten subjects performed light (20 W) or moderate (40 W) dynamic knee extension for 6 min with one leg alone or concomitant with bilateral static handgrip at 20% of maximal voluntary contraction force with or without forearm muscle ischaemia or post-exercise forearm muscle ischaemia.Muscle sympathetic nerve activity was measured by microneurography (peroneal nerve) and leg muscle blood flow by a constant infusion thermodilution technique (femoral vein).Activation of an exercise pressor reflex from the arms, causing a 2- to 4-fold increase in muscle sympathetic nerve activity and a 15–32% increase in mean arterial blood pressure, did not affect blood flow to the dynamically exercising leg muscles at any level of leg exercise. Leg vascular conductance was reduced in line with the higher perfusion pressure.The results demonstrate that the vasoconstrictor effects of high levels of muscle sympathetic nerve activity does not affect blood flow to human skeletal muscle exercising at moderate intensities. One question remaining is whether the observed decrease in muscle vascular conductance is the result of sympathetic vasoconstriction or metabolic autoregulation of muscle blood flow. PMID:9831733

Evaluation of the carotid artery stenosis based on minimization of mechanical energy loss of the blood flow.

PubMed

Sia, Sheau Fung; Zhao, Xihai; Li, Rui; Zhang, Yu; Chong, Winston; He, Le; Chen, Yu

2016-11-01

Internal carotid artery stenosis requires an accurate risk assessment for the prevention of stroke. Although the internal carotid artery area stenosis ratio at the common carotid artery bifurcation can be used as one of the diagnostic methods of internal carotid artery stenosis, the accuracy of results would still depend on the measurement techniques. The purpose of this study is to propose a novel method to estimate the effect of internal carotid artery stenosis on the blood flow based on the concept of minimization of energy loss. Eight internal carotid arteries from different medical centers were diagnosed as stenosed internal carotid arteries, as plaques were found at different locations on the vessel. A computational fluid dynamics solver was developed based on an open-source code (OpenFOAM) to test the flow ratio and energy loss of those stenosed internal carotid arteries. For comparison, a healthy internal carotid artery and an idealized internal carotid artery model have also been tested and compared with stenosed internal carotid artery in terms of flow ratio and energy loss. We found that at a given common carotid artery bifurcation, there must be a certain flow distribution in the internal carotid artery and external carotid artery, for which the total energy loss at the bifurcation is at a minimum; for a given common carotid artery flow rate, an irregular shaped plaque at the bifurcation constantly resulted in a large value of minimization of energy loss. Thus, minimization of energy loss can be used as an indicator for the estimation of internal carotid artery stenosis.

Constant pressure mode extended simple gradient liquid chromatography system for micro and nanocolumns.

PubMed

Šesták, Jozef; Kahle, Vladislav

2014-07-11

Performing gradient liquid chromatography at constant pressure instead of constant flow rate has serious potential for shortening the analysis time and increasing the productivity of HPLC instruments that use gradient methods. However, in the constant pressure mode the decreasing column permeability during a long period of time negatively affects the repeatability of retention time. Thus a volume-based approach, in which the detector signal is plotted as a function of retention volume, must be taken into consideration. Traditional HPLC equipment, however, requires quite complex hardware and software modifications in order to work at constant pressure and in the volume-based mode. In this short communication, a low cost and easily feasible pressure-controlled extension of the previously described simple gradient liquid chromatography platform is proposed. A test mixture of four nitro esters was separated by 10-60% (v/v) acetone/water gradient and a high repeatability of retention volumes at 20MPa (RSD less than 0.45%) was realized. Separations were also performed at different values of pressure (20, 25, and 31MPa), and only small variations of the retention volumes (up to 0.8%) were observed. In this particular case, the gain in the analysis speed of 7% compared to the constant flow mode was realized at a constant pressure. Copyright © 2014 Elsevier B.V. All rights reserved.

40 CFR 90.421 - Dilute gaseous exhaust sampling and analytical system description.

Code of Federal Regulations, 2014 CFR

2014-07-01

... Volume Sampler (PDP-CVS) system with a heat exchanger, or a Critical Flow Venturi—Constant Volume Sampler (CFV-CVS) system with CFV sample probes and/or a heat exchanger or electronic flow compensation. Figure... sampling point. (ii) For the CFV-CVS, either a heat exchanger or electronic flow compensation is required...

40 CFR 90.421 - Dilute gaseous exhaust sampling and analytical system description.

Code of Federal Regulations, 2013 CFR

2013-07-01

... Volume Sampler (PDP-CVS) system with a heat exchanger, or a Critical Flow Venturi—Constant Volume Sampler (CFV-CVS) system with CFV sample probes and/or a heat exchanger or electronic flow compensation. Figure... sampling point. (ii) For the CFV-CVS, either a heat exchanger or electronic flow compensation is required...

40 CFR 90.421 - Dilute gaseous exhaust sampling and analytical system description.

Code of Federal Regulations, 2012 CFR

2012-07-01

... Volume Sampler (PDP-CVS) system with a heat exchanger, or a Critical Flow Venturi—Constant Volume Sampler (CFV-CVS) system with CFV sample probes and/or a heat exchanger or electronic flow compensation. Figure... sampling point. (ii) For the CFV-CVS, either a heat exchanger or electronic flow compensation is required...

Overhead Projection Cell for Streamline Flow

ERIC Educational Resources Information Center

Waage, Harold M.

1969-01-01

Describes the construction and operation of an overhead projection apparatus designed to demonstrate streamline flow of a liquid. The apparatus consists of a Plexiglass tank containing water in which plates forming the cell are submerged, a constant level reservoir, an overflow device and a system for marking the flow lines with a dye. (LC)

CFD analyses of coolant channel flowfields

NASA Technical Reports Server (NTRS)

Yagley, Jennifer A.; Feng, Jinzhang; Merkle, Charles L.

1993-01-01

The flowfield characteristics in rocket engine coolant channels are analyzed by means of a numerical model. The channels are characterized by large length to diameter ratios, high Reynolds numbers, and asymmetrical heating. At representative flow conditions, the channel length is approximately twice the hydraulic entrance length so that fully developed conditions would be reached for a constant property fluid. For the supercritical hydrogen that is used as the coolant, the strong property variations create significant secondary flows in the cross-plane which have a major influence on the flow and the resulting heat transfer. Comparison of constant and variable property solutions show substantial differences. In addition, the property variations prevent fully developed flow. The density variation accelerates the fluid in the channels increasing the pressure drop without an accompanying increase in heat flux. Analyses of the inlet configuration suggest that side entry from a manifold can affect the development of the velocity profile because of vortices generated as the flow enters the channel. Current work is focused on studying the effects of channel bifurcation on the flow field and the heat transfer characteristics.

A high precision gas flow cell for performing in situ neutron studies of local atomic structure in catalytic materials

DOE PAGES

Olds, Daniel; Page, Katharine; Paecklar, Arnold A.; ...

2017-03-17

Gas-solid interfaces enable a multitude of industrial processes, including heterogeneous catalysis; however, there are few methods available for studying the structure of this interface under operating conditions. Here, we present a new sample environment for interrogating materials under gas-flow conditions using time-of-flight neutron scattering under both constant and pulse probe gas flow. Outlined are descriptions of the gas flow cell and a commissioning example using the adsorption of N 2 by Ca-exchanged zeolite-X (Na 78–2xCa xAl 78Si 144O 384,x ≈ 38). We demonstrate sensitivities to lattice contraction and N 2 adsorption sites in the structure, with both static gas loadingmore » and gas flow. A steady-state isotope transient kinetic analysis of N 2 adsorption measured simultaneously with mass spectrometry is also demonstrated. In the experiment, the gas flow through a plugged-flow gas-solid contactor is switched between 15N 2 and 14N 2 isotopes at a temperature of 300 K and a constant pressure of 1 atm; the gas flow and mass spectrum are correlated with the structure factor determined from event-based neutron total scattering. As a result, available flow conditions, sample considerations, and future applications are discussed.« less

Slip-Flow and Heat Transfer of a Non-Newtonian Nanofluid in a Microtube

PubMed Central

Niu, Jun; Fu, Ceji; Tan, Wenchang

2012-01-01

The slip-flow and heat transfer of a non-Newtonian nanofluid in a microtube is theoretically studied. The power-law rheology is adopted to describe the non-Newtonian characteristics of the flow, in which the fluid consistency coefficient and the flow behavior index depend on the nanoparticle volume fraction. The velocity profile, volumetric flow rate and local Nusselt number are calculated for different values of nanoparticle volume fraction and slip length. The results show that the influence of nanoparticle volume fraction on the flow of the nanofluid depends on the pressure gradient, which is quite different from that of the Newtonian nanofluid. Increase of the nanoparticle volume fraction has the effect to impede the flow at a small pressure gradient, but it changes to facilitate the flow when the pressure gradient is large enough. This remarkable phenomenon is observed when the tube radius shrinks to micrometer scale. On the other hand, we find that increase of the slip length always results in larger flow rate of the nanofluid. Furthermore, the heat transfer rate of the nanofluid in the microtube can be enhanced due to the non-Newtonian rheology and slip boundary effects. The thermally fully developed heat transfer rate under constant wall temperature and constant heat flux boundary conditions is also compared. PMID:22615961

Influence of bed material entrainment and non-Newtonian rheology on turbulent geophysical flows dynamics. Numerical study

NASA Astrophysics Data System (ADS)

Eglit, M. E.; Yakubenko, A. E.; Yakubenko, T. A.

2017-10-01

This paper deals with the mathematical and numerical modeling of the propagation stage of geophysical gravity-driven flows, such as snow avalanches, mudflows, and rapid landslides. New mathematical models are presented which are based on full, not-depth-averaged equations of mechanics of continuous media. The models account for three important issues: non-Newtonian rheology of the moving material, entrainment of the bed material by the flow, and turbulence. The main objective is to investigate the effect of these three factors on the flow dynamics and on the value of the entrainment rate. To exclude the influence of many other factors, e.g., the complicated slope topography, only the motion down a long uniform slope with a constant inclination angle is studied numerically. Moreover, the entire flow from the front to the rear area was not modeled, but only its middle part where the flow is approximately uniform in length. One of the qualitative results is that in motion along homogeneous slope the mass entrainment increases the flow velocity and depth while the entrainment rate at large time tends to become constant which depends on the physical properties of the flow and the underlying material but not on the current values of the flow velocity and depth.

Bioclogging in Porous Media: Preferential Flow Paths and Anomalous Transport

NASA Astrophysics Data System (ADS)

Holzner, M.; Carrel, M.; Morales, V.; Derlon, N.; Beltran, M. A.; Morgenroth, E.; Kaufmann, R.

2016-12-01

Biofilms are sessile communities of microorganisms held together by an extracellular polymeric substance that enables surface colonization. In porous media (e.g. soils, trickling filters etc.) biofilm growth has been shown to affect the hydrodynamics in a complex fashion at the pore-scale by clogging individual pores and enhancing preferential flow pathways and anomalous transport. These phenomena are a direct consequence of microbial growth and metabolism, mass transfer processes and complex flow velocity fields possibly exhibiting pronounced three-dimensional features. Despite considerable past work, however, it is not fully understood how bioclogging interacts with flow and mass transport processes in porous media. In this work we use imaging techniques to determine the flow velocities and the distribution of biofilm in a porous medium. Three-dimensional millimodels are packed with a transparent porous medium and a glucose solution to match the optical refractive index. The models are inoculated with planktonic wildtype bacteria and biofilm cultivated for 60 h under a constant flow and nutrient conditions. The pore flow velocities in the increasingly bioclogged medium are measured using 3D particle tracking velocimetry (3D-PTV). The three-dimensional spatial distribution of the biofilm within the pore space is assessed by imaging the model with X-Ray microtomography. We find that biofilm growth increases the complexity of the pore space, leading to the formation of preferential flow pathways and "dead" pore zones. The probability of persistent high and low velocity regions (within preferential paths resp. stagnant flow regions) thus increases upon biofilm growth, leading to an enhancement of anomalous transport. The structural data seems to indicate that the largest pores are not getting clogged and carry the preferential flow, whereas intricated structures develop in the smallest pores, where the flow becomes almost stagnant. These findings may be relevant for applications such as bioremediation of contaminated aquifers, groundwater injection wells for geothermal or drinking water purposes, tertiary oil recovery.

Characteristics of time-varying intracranial pressure on blood flow through cerebral artery: A fluid-structure interaction approach.

PubMed

Syed, Hasson; Unnikrishnan, Vinu U; Olcmen, Semih

2016-02-01

Elevated intracranial pressure is a major contributor to morbidity and mortality in severe head injuries. Wall shear stresses in the artery can be affected by increased intracranial pressures and may lead to the formation of cerebral aneurysms. Earlier research on cerebral arteries and aneurysms involves using constant mean intracranial pressure values. Recent advancements in intracranial pressure monitoring techniques have led to measurement of the intracranial pressure waveform. By incorporating a time-varying intracranial pressure waveform in place of constant intracranial pressures in the analysis of cerebral arteries helps in understanding their effects on arterial deformation and wall shear stress. To date, such a robust computational study on the effect of increasing intracranial pressures on the cerebral arterial wall has not been attempted to the best of our knowledge. In this work, fully coupled fluid-structure interaction simulations are carried out to investigate the effect of the variation in intracranial pressure waveforms on the cerebral arterial wall. Three different time-varying intracranial pressure waveforms and three constant intracranial pressure profiles acting on the cerebral arterial wall are analyzed and compared with specified inlet velocity and outlet pressure conditions. It has been found that the arterial wall experiences deformation depending on the time-varying intracranial pressure waveforms, while the wall shear stress changes at peak systole for all the intracranial pressure profiles. © IMechE 2015.

Hot air impingement on a flat plate using Large Eddy Simulation (LES) technique

NASA Astrophysics Data System (ADS)

Plengsa-ard, C.; Kaewbumrung, M.

2018-01-01

Impinging hot gas jets to a flat plate generate very high heat transfer coefficients in the impingement zone. The magnitude of heat transfer prediction near the stagnation point is important and accurate heat flux distribution are needed. This research studies on heat transfer and flow field resulting from a single hot air impinging wall. The simulation is carried out using computational fluid dynamics (CFD) commercial code FLUENT. Large Eddy Simulation (LES) approach with a subgrid-scale Smagorinsky-Lilly model is present. The classical Werner-Wengle wall model is used to compute the predicted results of velocity and temperature near walls. The Smagorinsky constant in the turbulence model is set to 0.1 and is kept constant throughout the investigation. The hot gas jet impingement on the flat plate with a constant surface temperature is chosen to validate the predicted heat flux results with experimental data. The jet Reynolds number is equal to 20,000 and a fixed jet-to-plate spacing of H/D = 2.0. Nusselt number on the impingement surface is calculated. As predicted by the wall model, the instantaneous computed Nusselt number agree fairly well with experimental data. The largest values of calculated Nusselt number are near the stagnation point and decrease monotonically in the wall jet region. Also, the contour plots of instantaneous values of wall heat flux on a flat plate are captured by LES simulation.

Balanced Orifice Plate

NASA Technical Reports Server (NTRS)

Kelley, Anthony R. (Inventor); Buskirk, Paul D. (Inventor)

2006-01-01

An orifice plate for use in a conduit through which fluid flows is defined by a central circular region having a radius R, and a ring-shaped region surrounding the central circular region. The ring-shaped region has holes formed therethrough with those holes centered at each radius R thereof satisfying a relationship A(sub R)=al(X(sub R)V(sub R)(sup b)) where A(sub R) is a sum of areas of those holes having centers at radius R, X(sub R) is a flow coefficient at radius R, V(sub R) is a velocity of the fluid that is to flow through the conduit at radius R, b is a constant selected to make at least one process variable (associated with the fluid that is to flow through the conduit) approximately equal at each radius R, and a is a constant that is equal to (X(sub R)A(sub R)V(sub R)(sup b)) at each radius R.

Constant flow-driven microfluidic oscillator for different duty cycles

PubMed Central

Kim, Sung-Jin; Yokokawa, Ryuji; Lesher-Perez, Sasha Cai; Takayama, Shuichi

2012-01-01

This paper presents microfluidic devices that autonomously convert two constant flow inputs into an alternating oscillatory flow output. We accomplish this hardware embedded self-control programming using normally closed membrane valves that have an inlet, an outlet, and a membrane-pressurization chamber connected to a third terminal. Adjustment of threshold opening pressures in these 3-terminal flow switching valves enabled adjustment of oscillation periods to between 57–360 s with duty cycles of 0.2–0.5. These values are in relatively good agreement with theoretical values, providing the way for rational design of an even wider range of different waveform oscillations. We also demonstrate the ability to use these oscillators to perform temporally patterned delivery of chemicals to living cells. The device only needs a syringe pump, thus removing the use of complex, expensive external actuators. These tunable waveform microfluidic oscillators are envisioned to facilitate cell-based studies that require temporal stimulation. PMID:22206453

Modeling of brittle-viscous flow using discrete particles

NASA Astrophysics Data System (ADS)

Thordén Haug, Øystein; Barabasch, Jessica; Virgo, Simon; Souche, Alban; Galland, Olivier; Mair, Karen; Abe, Steffen; Urai, Janos L.

2017-04-01

Many geological processes involve both viscous flow and brittle fractures, e.g. boudinage, folding and magmatic intrusions. Numerical modeling of such viscous-brittle materials poses challenges: one has to account for the discrete fracturing, the continuous viscous flow, the coupling between them, and potential pressure dependence of the flow. The Discrete Element Method (DEM) is a numerical technique, widely used for studying fracture of geomaterials. However, the implementation of viscous fluid flow in discrete element models is not trivial. In this study, we model quasi-viscous fluid flow behavior using Esys-Particle software (Abe et al., 2004). We build on the methodology of Abe and Urai (2012) where a combination of elastic repulsion and dashpot interactions between the discrete particles is implemented. Several benchmarks are presented to illustrate the material properties. Here, we present extensive, systematic material tests to characterize the rheology of quasi-viscous DEM particle packing. We present two tests: a simple shear test and a channel flow test, both in 2D and 3D. In the simple shear tests, simulations were performed in a box, where the upper wall is moved with a constant velocity in the x-direction, causing shear deformation of the particle assemblage. Here, the boundary conditions are periodic on the sides, with constant forces on the upper and lower walls. In the channel flow tests, a piston pushes a sample through a channel by Poisseuille flow. For both setups, we present the resulting stress-strain relationships over a range of material parameters, confining stress and strain rate. Results show power-law dependence between stress and strain rate, with a non-linear dependence on confining force. The material is strain softening under some conditions (which). Additionally, volumetric strain can be dilatant or compactant, depending on porosity, confining pressure and strain rate. Constitutive relations are implemented in a way that limits the range of viscosities. For identical pressure and strain rate, an order of magnitude range in viscosity can be investigated. The extensive material testing indicates that DEM particles interacting by a combination of elastic repulsion and dashpots can be used to model viscous flows. This allows us to exploit the fracturing capabilities of the discrete element methods and study systems that involve both viscous flow and brittle fracturing. However, the small viscosity range achievable using this approach does constraint the applicability for systems where larger viscosity ranges are required, such as folding of viscous layers of contrasting viscosities. References: Abe, S., Place, D., & Mora, P. (2004). A parallel implementation of the lattice solid model for the simulation of rock mechanics and earthquake dynamics. PAGEOPH, 161(11-12), 2265-2277. http://doi.org/10.1007/s00024-004-2562-x Abe, S., and J. L. Urai (2012), Discrete element modeling of boudinage: Insights on rock rheology, matrix flow, and evolution of geometry, JGR., 117, B01407, doi:10.1029/2011JB00855

High-cervical spinal cord electrical stimulation in brain low perfusion syndromes: experimental basis and preliminary clinical report.

PubMed

Broseta, J; García-March, G; Sánchez-Ledesma, M J; Gonçalves, J; Silva, I; Barcia, J A; Llácer, J L; Barcia-Salorio, J L

1994-01-01

Previous studies of our group showed that C1-C2 spinal cord stimulation increases carotid and brain blood flow in normal conditions in the goat and dog and it has a beneficial vasomotor effect in a model of vasospasm in the rat. For further clinical application it seemed rational to investigate the possible vascular changes mediated by this technique in experimental brain infarction. To this aim, 45 New Zealand rabbits were used. Brain infarction was produced by bilateral carotid ligation in 15, unilateral microcoagulation of the middle cerebral artery in 15 and by microcoagulation of the vertebral artery at the craniocervical junction in the other 15. One week later, following daily clinical scoring and cortical and posterior fossa blood flow readings by laser Doppler, a period of 120 min of right C1-C2 spinal cord electric stimulation was performed. A mean of 27% increase in previous blood flow recordings was obtained at the right hemisphere and a mean of 32% in the posterior fossa. This procedure was used in 10 patients presenting with various cerebral low perfusion syndromes. Though not constant, an increase in alertness, retention, speech, emotional lability and performance in skilled acts was achieved. No MR changes were observed, though SPECT readings showed an increase in blood flow in the penumbral perilesional area.

One-dimensional analytical solution for hydraulic head and numerical solution for solute transport through a horizontal fracture for submarine groundwater discharge.

PubMed

He, Cairong; Wang, Tongke; Zhao, Zhixue; Hao, Yonghong; Yeh, Tian-Chyi J; Zhan, Hongbin

2017-11-01

Submarine groundwater discharge (SGD) has been recognized as a major pathway of groundwater flow to coastal oceanic environments. It could affect water quality and marine ecosystems due to pollutants and trace elements transported through groundwater. Relations between different characteristics of aquifers and SGD have been investigated extensively before, but the role of fractures in SGD still remains unknown. In order to better understand the mechanism of groundwater flow and solute transport through fractures in SGD, one-dimensional analytical solutions of groundwater hydraulic head and velocity through a synthetic horizontal fracture with periodic boundary conditions were derived using a Laplace transform technique. Then, numerical solutions of solute transport associated with the given groundwater velocity were developed using a finite-difference method. The results indicated that SGD associated with groundwater flow and solute transport was mainly controlled by sea level periodic fluctuations, which altered the hydraulic head and the hydraulic head gradient in the fracture. As a result, the velocity of groundwater flow associated with SGD also fluctuated periodically. We found that the pollutant concentration associated with SGD oscillated around a constant value, and could not reach a steady state. This was particularly true at locations close to the seashore. This finding of the role of fracture in SGD will assist pollution remediation and marine conservation in coastal regions. Copyright © 2017 Elsevier B.V. All rights reserved.

One-dimensional analytical solution for hydraulic head and numerical solution for solute transport through a horizontal fracture for submarine groundwater discharge

NASA Astrophysics Data System (ADS)

He, Cairong; Wang, Tongke; Zhao, Zhixue; Hao, Yonghong; Yeh, Tian-Chyi J.; Zhan, Hongbin

2017-11-01

Submarine groundwater discharge (SGD) has been recognized as a major pathway of groundwater flow to coastal oceanic environments. It could affect water quality and marine ecosystems due to pollutants and trace elements transported through groundwater. Relations between different characteristics of aquifers and SGD have been investigated extensively before, but the role of fractures in SGD still remains unknown. In order to better understand the mechanism of groundwater flow and solute transport through fractures in SGD, one-dimensional analytical solutions of groundwater hydraulic head and velocity through a synthetic horizontal fracture with periodic boundary conditions were derived using a Laplace transform technique. Then, numerical solutions of solute transport associated with the given groundwater velocity were developed using a finite-difference method. The results indicated that SGD associated with groundwater flow and solute transport was mainly controlled by sea level periodic fluctuations, which altered the hydraulic head and the hydraulic head gradient in the fracture. As a result, the velocity of groundwater flow associated with SGD also fluctuated periodically. We found that the pollutant concentration associated with SGD oscillated around a constant value, and could not reach a steady state. This was particularly true at locations close to the seashore. This finding of the role of fracture in SGD will assist pollution remediation and marine conservation in coastal regions.

Harnessing electrical forces for separation. Capillary zone electrophoresis, isoelectric focusing, field-flow fractionation, split-flow thin-cell continuous-separation and other techniques.

PubMed

Giddings, J C

1989-10-20

A simple analysis, first presented twenty years ago, showed that the effectiveness of a field-driven separation like electrophoresis, as expressed by the maximum number of theoretical plates (N), is given by the dimensionless ratio of two energies N = -delta mu ext/2RT in which -delta mu ext is the electrical potential energy drop of a charged species and RT is the thermal energy (R is the gas constant and T is the absolute temperature). Quantity -delta mu ext is the product of the force F acting on the species and the path length X of separation. The exceptional power of electrophoresis, for which often N approximately 10(6), can be traced directly to the enormous magnitude of the electrical force F. This paper explores the fundamentals underlying several different means for utilizing these powerful electrical forces for separation, including capillary zone electrophoresis, gel electrophoresis, isoelectric focusing, electrical field-flow fractionation and split-flow thin continuous separation cells. Remarkably, the above equation and its relatives are found to describe the approximate performance of all these diverse electrically driven systems. Factors affecting both the resolving power and separation speed of the systems are addressed; from these considerations some broad optimization criteria emerge. The capabilities of the different methods are compared using numerical examples.

Effective optical constants of anisotropic materials

NASA Technical Reports Server (NTRS)

Aronson, J. R.; Emslie, A. G.

1980-01-01

The applicability of a technique for determining the optical constants of soil or aerosol components on the basis of measurements of the reflectance or transmittance of inhomogeneous samples of component material is investigated. Optical constants for a sample of very pure quartzite were obtained by a specular reflection technique and line parameters were calculated by classical dispersion theory. Predictions of the reflectance of powdered quartz were then derived from optical constants measured for the anisotropic quartz and for pure quartz crystals, and compared with experimental measurements. The calculated spectra are found to resemble each other moderately well in shape, however the reflectance level calculated from the psuedo-optical constants (quartzite) is consistently below that calculated from quartz values. The spectrum calculated from the quartz optical constants is also shown to represent the experimental nonrestrahlen features more accurately. It is thus concluded that although optical constants derived from inhomogeneous materials may represent the spectral features of a powdered sample qualitatively a quantitative fit to observed data is not likely.

Hemodynamic response to exercise and head-up tilt of patients implanted with a rotary blood pump: a computational modeling study.

PubMed

Lim, Einly; Salamonsen, Robert Francis; Mansouri, Mahdi; Gaddum, Nicholas; Mason, David Glen; Timms, Daniel L; Stevens, Michael Charles; Fraser, John; Akmeliawati, Rini; Lovell, Nigel Hamilton

2015-02-01

The present study investigates the response of implantable rotary blood pump (IRBP)-assisted patients to exercise and head-up tilt (HUT), as well as the effect of alterations in the model parameter values on this response, using validated numerical models. Furthermore, we comparatively evaluate the performance of a number of previously proposed physiologically responsive controllers, including constant speed, constant flow pulsatility index (PI), constant average pressure difference between the aorta and the left atrium, constant average differential pump pressure, constant ratio between mean pump flow and pump flow pulsatility (ratioP I or linear Starling-like control), as well as constant left atrial pressure ( P l a ¯ ) control, with regard to their ability to increase cardiac output during exercise while maintaining circulatory stability upon HUT. Although native cardiac output increases automatically during exercise, increasing pump speed was able to further improve total cardiac output and reduce elevated filling pressures. At the same time, reduced venous return associated with upright posture was not shown to induce left ventricular (LV) suction. Although P l a ¯ control outperformed other control modes in its ability to increase cardiac output during exercise, it caused a fall in the mean arterial pressure upon HUT, which may cause postural hypotension or patient discomfort. To the contrary, maintaining constant average pressure difference between the aorta and the left atrium demonstrated superior performance in both exercise and HUT scenarios. Due to their strong dependence on the pump operating point, PI and ratioPI control performed poorly during exercise and HUT. Our simulation results also highlighted the importance of the baroreflex mechanism in determining the response of the IRBP-assisted patients to exercise and postural changes, where desensitized reflex response attenuated the percentage increase in cardiac output during exercise and substantially reduced the arterial pressure upon HUT. Copyright © 2014 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

Measurement of the Surface Dilatational Viscosity of an Insoluble Surfactant Monolayer at the Air/Water Interface Using a Pendant Drop Apparatus

NASA Technical Reports Server (NTRS)

Lorenzo, Jose; Couzis, Alex; Maldarelli, Charles; Singh, Bhim S. (Technical Monitor)

2000-01-01

When a fluid interface with surfactants is at rest, the interfacial stress is isotropic (as given by the equilibrium interfacial tension), and is described by the equation of state which relates the surface tension to the surfactant surface concentration. When surfactants are subjected to shear and dilatational flows, flow induced interaction of the surfactants; can create interfacial stresses apart from the equilibrium surface tension. The simplest relationship between surface strain rate and surface stress is the Boussinesq-Scriven constitutive equation completely characterized by three coefficients: equilibrium interfacial tension, surface shear viscosity, and surface dilatational viscosity Equilibrium interfacial tension and surface shear viscosity measurements are very well established. On the other hand, surface dilatational viscosity measurements are difficult because a flow which change the surface area also changes the surfactant surface concentration creating changes in the equilibrium interfacial tension that must be also taken into account. Surface dilatational viscosity measurements of existing techniques differ by five orders of magnitude and use spatially damped surface waves and rapidly expanding bubbles. In this presentation we introduce a new technique for measuring the surface dilatational viscosity by contracting an aqueous pendant drop attached to a needle tip and having and insoluble surfactant monolayer at the air-water interface. The isotropic total tension on the surface consists of the equilibrium surface tension and the tension due to the dilation. Compression rates are undertaken slow enough so that bulk hydrodynamic stresses are small compared to the surface tension force. Under these conditions we show that the total tension is uniform along the surface and that the Young-Laplace equation governs the drop shape with the equilibrium surface tension replaced by the constant surface isotropic stress. We illustrate this technique using DPPC as the insoluble surfacant monolayer and measured for it a surface dilatational viscosity in the LE phase that is 20 surface poise.

High speed digital holographic interferometry for hypersonic flow visualization

NASA Astrophysics Data System (ADS)

Hegde, G. M.; Jagdeesh, G.; Reddy, K. P. J.

2013-06-01

Optical imaging techniques have played a major role in understanding the flow dynamics of varieties of fluid flows, particularly in the study of hypersonic flows. Schlieren and shadowgraph techniques have been the flow diagnostic tools for the investigation of compressible flows since more than a century. However these techniques provide only the qualitative information about the flow field. Other optical techniques such as holographic interferometry and laser induced fluorescence (LIF) have been used extensively for extracting quantitative information about the high speed flows. In this paper we present the application of digital holographic interferometry (DHI) technique integrated with short duration hypersonic shock tunnel facility having 1 ms test time, for quantitative flow visualization. Dynamics of the flow fields in hypersonic/supersonic speeds around different test models is visualized with DHI using a high-speed digital camera (0.2 million fps). These visualization results are compared with schlieren visualization and CFD simulation results. Fringe analysis is carried out to estimate the density of the flow field.

Respiratory mechanics by least squares fitting in mechanically ventilated patients: application on flow-limited COPD patients.

PubMed

Volta, Carlo A; Marangoni, Elisabetta; Alvisi, Valentina; Capuzzo, Maurizia; Ragazzi, Riccardo; Pavanelli, Lina; Alvisi, Raffaele

2002-01-01

Although computerized methods of analyzing respiratory system mechanics such as the least squares fitting method have been used in various patient populations, no conclusive data are available in patients with chronic obstructive pulmonary disease (COPD), probably because they may develop expiratory flow limitation (EFL). This suggests that respiratory mechanics be determined only during inspiration. Eight-bed multidisciplinary ICU of a teaching hospital. Eight non-flow-limited postvascular surgery patients and eight flow-limited COPD patients. Patients were sedated, paralyzed for diagnostic purposes, and ventilated in volume control ventilation with constant inspiratory flow rate. Data on resistance, compliance, and dynamic intrinsic positive end-expiratory pressure (PEEPi,dyn) obtained by applying the least squares fitting method during inspiration, expiration, and the overall breathing cycle were compared with those obtained by the traditional method (constant flow, end-inspiratory occlusion method). Our results indicate that (a) the presence of EFL markedly decreases the precision of resistance and compliance values measured by the LSF method, (b) the determination of respiratory variables during inspiration allows the calculation of respiratory mechanics in flow limited COPD patients, and (c) the LSF method is able to detect the presence of PEEPi,dyn if only inspiratory data are used.

Spike Code Flow in Cultured Neuronal Networks.

PubMed

Tamura, Shinichi; Nishitani, Yoshi; Hosokawa, Chie; Miyoshi, Tomomitsu; Sawai, Hajime; Kamimura, Takuya; Yagi, Yasushi; Mizuno-Matsumoto, Yuko; Chen, Yen-Wei

2016-01-01

We observed spike trains produced by one-shot electrical stimulation with 8 × 8 multielectrodes in cultured neuronal networks. Each electrode accepted spikes from several neurons. We extracted the short codes from spike trains and obtained a code spectrum with a nominal time accuracy of 1%. We then constructed code flow maps as movies of the electrode array to observe the code flow of "1101" and "1011," which are typical pseudorandom sequence such as that we often encountered in a literature and our experiments. They seemed to flow from one electrode to the neighboring one and maintained their shape to some extent. To quantify the flow, we calculated the "maximum cross-correlations" among neighboring electrodes, to find the direction of maximum flow of the codes with lengths less than 8. Normalized maximum cross-correlations were almost constant irrespective of code. Furthermore, if the spike trains were shuffled in interval orders or in electrodes, they became significantly small. Thus, the analysis suggested that local codes of approximately constant shape propagated and conveyed information across the network. Hence, the codes can serve as visible and trackable marks of propagating spike waves as well as evaluating information flow in the neuronal network.

Squeezing flow viscometry for nonelastic semiliquid foods--theory and applications.

PubMed

Campanella, Osvaldo H; Peleg, Micha

2002-01-01

In most conventional rheometers, notably the coaxial cylinders and capillary viscometers, the food specimen is pressed into a narrow gap and its structure is altered by uncontrolled shear. Also, most semiliquid foods exhibit slip, and consequently the measurements do not always reflect their true rheological properties. A feasible solution to these two problems is squeezing flow viscometry where the specimen, practically intact and with or without suspended particles, is squeezed between parallel plates. The outward flow pattern mainly depends on the friction between the fluid and plates or its absence ("lubricated squeezing flow"). Among the possible test geometries, the one of constant area and changing volume is the most practical for foods. The test can be performed at a constant displacement rate using common Universal Testing Machines or under constant loads (creep array). The tests output is in the form of a force-height, force-time, or height-time relationship, from which several rheological parameters can be derived. With the current state of the art, the method can only be applied at small displacement rates. Despite the method's crudeness, its results are remarkably reproducible and sensitive to textural differences among semiliquid food products. The flow patterns observed in foods do not always follow the predictions of rheological models originally developed for polymer melts because of the foods' unique microstructures. The implications of these discrepancies and the role that artifacts may play are evaluated in light of theoretical and practical considerations. The use of squeezing flow viscometry to quantify rheological changes that occur during a product's handling and to determine whether they are perceived sensorily is suggested.

Heat transfer, pressure drop and flow patterns during flow boiling of R407C in a horizontal microfin tube

NASA Astrophysics Data System (ADS)

Rollmann, P.; Spindler, K.; Müller-Steinhagen, H.

2011-08-01

The heat transfer, pressure drop and flow patterns during flow boiling of R407C in a horizontal microfin tube have been investigated. The microfin tube is made of copper with a total fin number of 55 and a helix angle of 15°. The fin height is 0.24 mm and the inner tube diameter at fin root is 8.95 mm. The test tube is 1 m long. It is heated electrically. The experiments have been performed at saturation temperatures between -30°C and +10°C. The mass flux was varied between 25 and 300 kg/m2/s, the heat flux from 20,000 W/m2 down to 1,000 W/m2. The vapour quality was kept constant at 0.1, 0.3, 0.5, 0.7 at the inlet and 0.8, 1.0 at the outlet, respectively. The measured heat transfer coefficient is compared with the correlations of Cavallini et al., Shah as well as Zhang et al. Cavallini's correlation contains seven experimental constants. After fitting these constants to our measured values, the correlation achieves good agreement. The measured pressure drop is compared to the correlations of Pierre, Kuo and Wang as well as Müller-Steinhagen and Heck. The best agreement is achieved with the correlation of Kuo and Wang. Almost all values are calculated within an accuracy of ±30%. The flow regimes were observed. It is shown, that changes in the flow regime affect the heat transfer coefficient significantly.

A collection of flow visualization techniques used in the Aerodynamic Research Branch

NASA Technical Reports Server (NTRS)

1984-01-01

Theoretical and experimental research on unsteady aerodynamic flows is discussed. Complex flow fields that involve separations, vortex interactions, and transonic flow effects were investigated. Flow visualization techniques are used to obtain a global picture of the flow phenomena before detailed quantitative studies are undertaken. A wide variety of methods are used to visualize fluid flow and a sampling of these methods is presented. It is emphasized that the visualization technique is a thorough quantitative analysis and subsequent physical understanding of these flow fields.

New techniques for positron emission tomography in the study of human neurological disorders: Progress report, 15 June 1992--31 October 1992

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1992-01-01

During the past six months, we have continued work on the fronts of kinetic modeling of radioligands for studying neurotransmitter/receptor systems, iterative reconstruction techniques, and methodology for PET cerebral blood flow activation studies. Initial human PET studies have been performed and analyzed with many different kinetic model formulations to determine the quantitative potential of the neuronwsmitter/receptor ligand, ({sup 11}C)N-methyl piperidyl benzilate (NMPB), a muscarinic cholinergic antagonist. In addition, initial human studies using ({sup 11}C)tetrabenazine (TBZ), a marker for monoantine nerve terminal density. Results of the NWB studies have indicated that this new agent yields better estimates of receptor density thanmore » previous muscarinic ligands developed at our facility, ({sup 11}C)-TRB and ({sup 11}C)scopolamine. TRB and scopolamine have previously been shown to be only partially successful ligands due to sub-optimal values of the individual rate constants, causing varying degrees of flow limitation. This is found to be much less of a problem for NMPB due to the 2.0--2.5 fold increase in ligand transport observed in the human studies ({approximately}60% first pass extraction). A 2-parameter 2-compartment simplification had previously been implemented for the benzodiazepine ligand, (C-11)FMZ, and a similar model appears to be suitable for TBZ based on the preliminary human data.« less

New techniques for positron emission tomography in the study of human neurological disorders: Progress report, 15 June 1992--31 October 1992

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1992-10-01

During the past six months, we have continued work on the fronts of kinetic modeling of radioligands for studying neurotransmitter/receptor systems, iterative reconstruction techniques, and methodology for PET cerebral blood flow activation studies. Initial human PET studies have been performed and analyzed with many different kinetic model formulations to determine the quantitative potential of the neuronwsmitter/receptor ligand, [{sup 11}C]N-methyl piperidyl benzilate (NMPB), a muscarinic cholinergic antagonist. In addition, initial human studies using [{sup 11}C]tetrabenazine (TBZ), a marker for monoantine nerve terminal density. Results of the NWB studies have indicated that this new agent yields better estimates of receptor density thanmore » previous muscarinic ligands developed at our facility, [{sup 11}C]-TRB and [{sup 11}C]scopolamine. TRB and scopolamine have previously been shown to be only partially successful ligands due to sub-optimal values of the individual rate constants, causing varying degrees of flow limitation. This is found to be much less of a problem for NMPB due to the 2.0--2.5 fold increase in ligand transport observed in the human studies ({approximately}60% first pass extraction). A 2-parameter 2-compartment simplification had previously been implemented for the benzodiazepine ligand, [C-11]FMZ, and a similar model appears to be suitable for TBZ based on the preliminary human data.« less

Comparison of Respiratory Resistance Measurements Made with an Airflow Perturbation Device with Those from Impulse Oscillometry

PubMed Central

Pan, J.; Saltos, A.; Smith, D.; Johnson, A.; Vossoughi, J.

2013-01-01

The airflow perturbation device (APD) has been developed as a portable, easy to use, and a rapid response instrument for measuring respiratory resistance in humans. However, the APD has limited data validating it against the established techniques. This study used a mechanical system to simulate the normal range of human breathing to validate the APD with the clinically accepted impulse oscillometry (IOS) technique. The validation system consisted of a sinusoidal flow generator with ten standardized resistance configurations that were shown to represent a total range of resistances from 0.12 to 0.95 kPa·L−1 ·s (1.2–9.7 cm H2O·L−1 ·s). Impulse oscillometry measurements and APD measurements of the mechanical system were recorded and compared at a constant airflow of 0.15 L·s−1. Both the IOS and APD measurments were accurate in assessing nominal resistance. In addition, a strong linear relationship was observed between APD measurements and IOS measurements (R 2 = 0.999). A second series of measurements was made on ten human volunteers with external resistors added in their respiratory flow paths. Once calibrated with the mechanical system, the APD gave respiratory resistance measurements within 5% of IOS measurements. Because of their comparability to IOS measurements, APD measurements are shown to be valid representations of respiratory resistance. PMID:27006908

APPARATUS FOR EXPOSING ESTUARINE AQUATIC ORGANISMS TO TOXICANTS IN CONSTANT AND FLUCTUATING SALINITY REGIMES

EPA Science Inventory

A programmable control system for salinity has been developed and coupled with a flow-through toxicant exposure system. The resulting apparatus allow study of influences of constant and fluctuating salinity regimes on responses of One organisms exposed to selected pollutants. Con...

Dense flow around a sphere moving into a cloud of grains

NASA Astrophysics Data System (ADS)

Gondret, Philippe; Faure, Sylvain; Lefebvre-Lepot, Aline; Seguin, Antoine

2017-06-01

A bidimensional simulation of a sphere moving at constant velocity into a cloud of smaller spherical grains without gravity is presented with a non-smooth contact dynamics method. A dense granular "cluster" zone of about constant solid fraction builds progressively around the moving sphere until a stationary regime appears with a constant upstream cluster size that increases with the initial solid fraction ϕ0 of the cloud. A detailed analysis of the local strain rate and local stress fields inside the cluster reveals that, despite different spatial variations of strain and stresses, the local friction coeffcient μ appears to depend only on the local inertial number I as well as the local solid fraction ϕ, which means that a local rheology does exist in the present non parallel flow. The key point is that the spatial variations of I inside the cluster does not depend on the sphere velocity and explore only a small range between about 10-2 and 10-1. The influence of sidewalls is then investigated on the flow and the forces.

A finite-element model for simulation of two-dimensional steady-state ground-water flow in confined aquifers

USGS Publications Warehouse

Kuniansky, E.L.

1990-01-01

A computer program based on the Galerkin finite-element method was developed to simulate two-dimensional steady-state ground-water flow in either isotropic or anisotropic confined aquifers. The program may also be used for unconfined aquifers of constant saturated thickness. Constant head, constant flux, and head-dependent flux boundary conditions can be specified in order to approximate a variety of natural conditions, such as a river or lake boundary, and pumping well. The computer program was developed for the preliminary simulation of ground-water flow in the Edwards-Trinity Regional aquifer system as part of the Regional Aquifer-Systems Analysis Program. Results of the program compare well to analytical solutions and simulations .from published finite-difference models. A concise discussion of the Galerkin method is presented along with a description of the program. Provided in the Supplemental Data section are a listing of the computer program, definitions of selected program variables, and several examples of data input and output used in verifying the accuracy of the program.

Effects of Biofuel and Variant Ambient Pressure on FlameDevelopment and Emissions of Gasoline Engine.

NASA Astrophysics Data System (ADS)

Hashim, Akasha; Khalid, Amir; Sapit, Azwan; Samsudin, Dahrum

2016-11-01

There are many technologies about exhaust emissions reduction for wide variety of spark ignition (SI) engine have been considered as the improvement throughout the combustion process. The stricter on legislation of emission and demands of lower fuel consumption needs to be priority in order to satisfy the demand of emission quality. Besides, alternative fuel such as methanol-gasoline blends is used as working fluid in this study due to its higher octane number and self-sustain concept which capable to contribute positive effect to the combustion process. The purpose of this study is to investigate the effects of methanol-gasoline fuel with different blending ratio and variant ambient pressures on flame development and emission for gasoline engine. An experimental study is carried towards to the flame development of methanol-gasoline fuel in a constant volume chamber. Schlieren optical visualization technique is a visual process that used when high sensitivity is required to photograph the flow of fluids of varying density used for captured the combustion images in the constant volume chamber and analysed through image processing technique. Apart from that, the result showed combustion burn rate increased when the percentage of methanol content in gasoline increased. Thus, high percentage of methanol-gasoline blends gave greater flame development area. Moreover, the emissions of CO, NOX and HC are performed a reduction when the percentage of methanol content in gasoline is increased. Contrarily, the emission of Carbon dioxide, CO2 is increased due to the combustion process is enhanced.

Time response analysis in suspension system design of a high-speed car

NASA Astrophysics Data System (ADS)

Pagwiwoko, Cosmas Pandit

2010-03-01

A land speed record vehicle is designed to run on a flat surface like salt lake where the wheels are normally made from solid metal with a special suspension system. The suspension is designed to provide a stable platform to keep the wheel treads on tract, to insulate the car and the driver from the surface irregularities and to take part of good handling properties. The surface condition of the lake beds is basically flat without undulations but with inconsistent surface textures and ridges. Spring with nonlinear rate is used with the reason that the resistance builds up roughly proportional to the aerodynamic download for keeping the height more nearly constant. The objective of the work is to produce an efficient method for assisting the design of suspension system. At the initial step, the stiffness and the damping constants are determined based on RMS optimization by following the optimization strategy i.e. to minimize the absolute acceleration respect to the relative displacement of the suspension. Power bond graph technique is then used to model the nonlinearity of the components i.e. spring and dashpot of the suspension system. This technique also enables to incorporate the interactions of dynamic response of the vehicle's body with aerodynamic flow as a result of the base excitation of the ground to the wheels. The simulation is conducted on the platform of Simulink-MATLAB and the interactions amongst the components within the system are observed in time domain to evaluate the effectiveness of the suspension.

A flow study in radial inflow turbine scroll-nozzle assembly

NASA Technical Reports Server (NTRS)

Hamed, A.; Baskharone, E.; Tabakoff, W.

1978-01-01

The present analysis describes the flow behavior in the combined scroll-nozzle assembly of a radial inflow turbine. This model was chosen to provide a better understanding of the mutual interaction effects of these two components on the flow. The finite element method is used in the solution of the flow field in this multiply connected domain. The mass flow rates in the different nozzle channels is not presumed constant, but is determined from the solution.

An Investigation into Performance Modelling of a Small Gas Turbine Engine

DTIC Science & Technology

2012-10-01

b = Combustor part load constant f = Fuel to mass flow ratio or scale factor h = Enthalpy F = Force P = Pressure T = Temperature W = Mass flow...HP engine performance parameters[5,6] Parameter Condition (ISA, SLS) Value Thrust 108000 rpm 230 N Pressure Ratio 108000 rpm 4 Mass Flow Rate...system. The reasons for removing the electric starter were to ensure uniform flow through the bell- mouth for mass flow rate measurement, eliminate a

Nematic director reorientation at solid and liquid interfaces under flow: SAXS studies in a microfluidic device

DOE PAGES

Silva, Bruno F. B.; Zepeda-Rosales, Miguel; Venkateswaran, Neeraja; ...

2014-10-30

In this work we investigate the interplay between flow and boundary condition effects on the orientation field of a thermotropic nematic liquid crystal under flow and confinement in a microfluidic device. Two types of experiments were performed using synchrotron small-angle X-ray-scattering (SAXS). In the first, a nematic liquid crystal flows through a square-channel cross section at varying flow rates, while the nematic director orientation projected onto the velocity/velocity gradient plane is measured using a 2D detector. At moderate-to-high flow rates, the nematic director is predominantly aligned in the flow direction, but with a small tilt angle of ~±11° in themore » velocity gradient direction. The director tilt angle is constant throughout most of the channel width but switches sign when crossing the center of the channel, in agreement with the Ericksen–Leslie–Parodi (ELP) theory. At low flow rates, boundary conditions begin to dominate, and a flow profile resembling the escaped radial director configuration is observed, where the director is seen to vary more smoothly from the edges (with homeotropic alignment) to the center of the channel. In the second experiment, hydrodynamic focusing is employed to confine the nematic phase into a sheet of liquid sandwiched between two layers of Triton X-100 aqueous solutions. The average nematic director orientation shifts to some extent from the flow direction toward the liquid boundaries, although it remains unclear if one tilt angle is dominant through most of the nematic sheet (with abrupt jumps near the boundaries) or if the tilt angle varies smoothly between two extreme values (~90 and 0°). Lastly, the technique presented here could be applied to perform high-throughput measurements for assessing the influence of different surfactants on the orientation of nematic phases and may lead to further improvements in areas such as boundary lubrication and clarifying the nature of defect structures in LC displays.« less