Possible microplate generation at RRR triple junctions due to the non-circular finite motion of plates relative to each other

NASA Astrophysics Data System (ADS)

Cronin, V. S.

2012-12-01

First generation ideas of the kinematic stability of triple junctions lead to the common belief that the geometry of ridge-ridge-ridge (RRR) triple junctions remains constant over time under conditions of symmetric spreading. Given constant relative motion between each plate pair -- that is, the pole of plate relative motion is fixed to both plates in each pair during finite motion, as assumed in many accounts of plate kinematics -- there would be no boundary mismatch at the triple junction and no apparent kinematic reason why a microplate might develop there. But if, in a given RRR triple junction, the finite motion of one plate as observed from the other plate is not circular (as is generally the case, given the three-plate problem of plate kinematics), the geometry of the ridges and the triple junction will vary with time (Cronin, 1992, Tectonophys 207, 287-301). To explore the possible consequences of non-circular finite motion between plates at an RRR triple junction, a simple model was coded based on the cycloid finite-motion model (e.g., Cronin, 1987, Geology 15, 1006-1009) using NNR-MORVEL56 velocities for individual plates (Argus et al., 2011, G3 12, doi: 10.1029/2011GC003751). Initial assumptions include a spherical Earth, symmetric spreading, and constant angular velocities during the modeled finite time interval. The assumed-constant angular velocity vectors constitute a reference frame for observing finite plate motion. Typical results are [1] that the triple junction migrates relative to a coordinate system fixed to the angular-velocity vectors, [2] ridge axes rotates relative to each other, and [3] a boundary mismatch develops at the synthetic triple junction that might result in microplate nucleation. In a model simulating the Galapagos triple junction between the Cocos, Nazca and Pacific plates whose initial state did not include the Galapagos microplate, the mismatch gap was as much as ~3.4 km during 3 Myr of model displacement (see figure). The centroid of the synthetic triple junction translates ~81 km toward azimuth ~352° in 3 Myr. Of course, the details will vary as different angular velocity vectors are used; however, modeling indicates that non-circular finite relative motion between adjacent plates generally results in boundary mismatches and rotation of ridge segments relative to each other at RRR triple junctions. Left: synthetic Galapagos triple junction at initial model time, without a microplate. Right: synthetic triple junction after 3 Myr displacement, illustrating the resulting boundary mismatch (gap) and rotated ridge axes.

Nonlinear Dynamics of Turbulent Thermals in Shear Flow

NASA Astrophysics Data System (ADS)

Ingel, L. Kh.

2018-03-01

The nonlinear integral model of a turbulent thermal is extended to the case of the horizontal component of its motion relative to the medium (e.g., thermal floating-up in shear flow). In contrast to traditional models, the possibility of a heat source in the thermal is taken into account. For a piecewise constant vertical profile of the horizontal velocity of the medium and a constant vertical velocity shear, analytical solutions are obtained which describe different modes of dynamics of thermals. The nonlinear interaction between the horizontal and vertical components of thermal motion is studied because each of the components influences the rate of entrainment of the surrounding medium, i.e., the growth rate of the thermal size and, hence, its mobility. It is shown that the enhancement of the entrainment of the medium due to the interaction between the thermal and the cross flow can lead to a significant decrease in the mobility of the thermal.

Backward-walking biological motion orients attention to moving away instead of moving toward.

PubMed

Ding, Xiaowei; Yin, Jun; Shui, Rende; Zhou, Jifan; Shen, Mowei

2017-04-01

Walking direction is an important attribute of biological motion because it carries key information, such as the specific intention of the walker. Although it is known that spatial attention is guided by walking direction, it remains unclear whether this attentional shift is reflexive (i.e., constantly shifts to the walking direction) or not. A richer interpretation of this effect is that attention is guided to seek the information that is necessary to understand the motion. To investigate this issue, we examined how backward-walking biological motion orients attention because the intention of walking backward is usually to avoid something that walking forward would encounter. The results showed that attention was oriented to the walking-away direction of biological motion instead of the walking-toward direction (Experiment 1), and this effect was not due to the gaze direction of biological motion (Experiment 2). Our findings suggest that the attentional shift triggered by walking direction is not reflexive, thus providing support for the rich interpretation of these attentional effects.

Analysis of Piston Slap Motion

NASA Astrophysics Data System (ADS)

Narayan, S.

2015-05-01

Piston slap is the major force contibuting towards noise levels in combustion engines.This type of noise depends upon a number of factors such as the piston-liner gap, type of lubricant used, number of piston pins as well as geometry of the piston. In this work the lateral and rotary motion of the piston in the gap between the cylinder liner and piston has been analyzed. A model that can predict the forces and response of the engine block due to slap has been dicussed. The parameters such as mass, spring and damping constant have been predicted using a vibrational mobility model.

A knitted glove sensing system with compression strain for finger movements

NASA Astrophysics Data System (ADS)

Ryu, Hochung; Park, Sangki; Park, Jong-Jin; Bae, Jihyun

2018-05-01

Development of a fabric structure strain sensor has received considerable attention due to its broad application in healthcare monitoring and human–machine interfaces. In the knitted textile structure, it is critical to understand the surface structural deformation from a different body motion, inducing the electrical signal characteristics. Here, we report the electromechanical properties of the knitted glove sensing system focusing on the compressive strain behavior. Compared with the electrical response of the tensile strain, the compressive strain shows much higher sensitivity, stability, and linearity via different finger motions. Additionally, the sensor exhibits constant electrical properties after repeated cyclic tests and washing processes. The proposed knitted glove sensing system can be readily extended to a scalable and cost-effective production due to the use of a commercialized manufacturing system.

Acute effects of constant torque and constant angle stretching on the muscle and tendon tissue properties.

PubMed

Konrad, Andreas; Budini, Francesco; Tilp, Markus

2017-08-01

Static stretching induces acute structural changes of the muscle-tendon unit (MTU) that are related to the intensity or duration of stretching. It has been reported that stretching with a constant torque (CT) leads to greater joint range of motion changes than stretching with a constant angle (CA). Whether or not this difference is due to different structural changes of the MTUs of the lower leg and ankle plantar flexors is not known. Therefore, the purpose of this study was to compare the acute effects of single CA and CT stretching on various muscle and tendon mechanical properties. Seventeen young, healthy volunteers were tested on two separate days using either CT or CA stretching (4 × 30 s each). Before and after stretching, dorsiflexion range of motion (RoM), passive resistive torque (PRT), and maximum voluntary contraction (MVC) were measured with a dynamometer. Ultrasonography of the medial gastrocnemius (GM) muscle-tendon junction (MTJ) displacement allowed us to determine the length changes in the tendon and muscle, respectively, and hence to calculate their stiffness. Maximum dorsiflexion increased while PRT, muscle-tendon stiffness, and muscle stiffness decreased following both CA and CT stretching. There was a greater increase in RoM following CT stretching compared to CA stretching. Moreover, the decline in PRT was greater during CT stretching compared to CA stretching. As expected, several functional adaptations (RoM, PRT) were different between CT and CA stretching due to the higher intensity of CT stretching. However, no structural differences in the adaptations to the stretching modalities could be detected. We suggest that the different functional adaptations between CA and CT stretching are the consequence of different adaptations in the perception of stretch and pain.

IUTAM symposium on hydrodynamic diffusion of suspended particles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Davis, R.H.

Hydrodynamic diffusion refers to the fluctuating motion of nonBrownian particles (or droplets or bubbles) which occurs in a dispersion due to multiparticle interactions. For example, in a concentrated sheared suspension, particles do not move along streamlines but instead exhibit fluctuating motions as they tumble around each other. This leads to a net migration of particles down gradients in particle concentration and in shear rate, due to the higher frequency of encounters of a test particle with other particles on the side of the test particle which has higher concentration or shear rate. As another example, suspended particles subject to sedimentation,more » centrifugation, or fluidization, do not generally move relative to the fluid with a constant velocity, but instead experience diffusion-like fluctuations in velocity due to interactions with neighboring particles and the resulting variation in the microstructure or configuration of the suspended particles. In flowing granular materials, the particles interact through direct collisions or contacts (rather than through the surrounding fluid); these collisions also cause the particles to undergo fluctuating motions characteristic of diffusion processes. Selected papers are indexed separately for inclusion in the Energy Science and Technology Database.« less

Some Considerations in the Determination of the Accuracy of a Measurement in Space of the Newtonian Gravitational Constant (G)

NASA Technical Reports Server (NTRS)

Baker, Stephen D.

1996-01-01

A commonly suggested method for determining the Newtonian constant of universal gravitation (G) is to observe the motion of two bodies of known mass moving about each other in an orbiting laboratory. In low Earth orbit (LEO), bodies constructed of even the densest material available experience a gravitational attraction that is several times smaller than the 'tidal' forces (due to their proximity to the Earth), which tend to pull them apart. While the tidal forces do not preclude stable orbits of the two objects about each other, they and the Coriolis force (in the rotating laboratory) dominate the motion, and the gravitational attraction of the two bodies may be considered a weak (but significant) contribution to the motion. As a result, compared to an experiment that would be performed in a laboratory far from the Earth, greater accuracy of measuring the motion of the two bodies may be required for a given accuracy in the determination of G. We find that the accuracy with which positions must be determined is not much different in an experiment in LEO than in one performed far from the Earth, but that rotational periods must be determined more accurately. Using a curvature matrix analysis, we also find that a value of G may be extracted (with some loss in accuracy, but probably some practical gain) from an analysis of the time dependence of the distance between the bodies rather than of a full specification (distance and direction) of their relative positions. A measurement of the gravitational constant to one part in 10(exp 4) continues to be thinkable, but one part in 10(exp 5) will be very difficult.

A study of the mechanism of internal gravity wave generation by quasigeostrophic meteorological motions

NASA Technical Reports Server (NTRS)

Medvedev, A. S.

1987-01-01

Numerous experiments on the detection of atmospheric waves in the frequency range from acoustic to planetary at meteor heights have revealed that important wave sources are meteorological processes in the troposphere (cyclones, atmospheric fronts, jet streams, etc.). A dynamical theory based on the others work include describing the adaptation of meteorological fields to the geostropic equilibrium state. According to this theory, wave motions appear as a result of constant competition between the maladjustment of the wind and pressure fields due to nonlinear effects and the tendency of the atmosphere to establish a quasi-geostrophic equilibrium of these fields. These meteorological fields are discussed.

A study of the mechanism of internal gravity wave generation by quasigeostrophic meteorological motions

NASA Astrophysics Data System (ADS)

Medvedev, A. S.

1987-08-01

Numerous experiments on the detection of atmospheric waves in the frequency range from acoustic to planetary at meteor heights have revealed that important wave sources are meteorological processes in the troposphere (cyclones, atmospheric fronts, jet streams, etc.). A dynamical theory based on the others work include describing the adaptation of meteorological fields to the geostropic equilibrium state. According to this theory, wave motions appear as a result of constant competition between the maladjustment of the wind and pressure fields due to nonlinear effects and the tendency of the atmosphere to establish a quasi-geostrophic equilibrium of these fields. These meteorological fields are discussed.

Analysis of the linearity of half periods of the Lorentz pendulum

NASA Astrophysics Data System (ADS)

Wickramasinghe, T.; Ochoa, R.

2005-05-01

We analyze the motion of the Lorentz pendulum, a simple pendulum whose length is changed at a constant rate k. We show both analytically and numerically that the half period Tn, the time between half oscillations as measured from midpoint to midpoint, increases linearly with the oscillation number n such that Tn+1-Tn≈kπ2/2g, where g is the acceleration due to gravity. A video camera is used to record the motion of the oscillating bob of the pendulum and verify the linearity of Tn with oscillation number. The theory and the experiment are suitable for an advanced undergraduate laboratory.

Motion in a Central Field in the Presence of a Constant Perturbing Acceleration in a Coordinate System Comoving with the Velocity Vector

NASA Astrophysics Data System (ADS)

Batmunkh, N.; Sannikova, T. N.; Kholshevnikov, K. V.

2018-04-01

The motion of a zero-mass point under the action of gravitation toward a central body and a perturbing acceleration P is considered. The magnitude of P is taken to be small compared to the main acceleration due to the gravitation of the central body, and the components of the vector P are taken to be constant in a reference frame with its origin at the central body and its axes directed along the velocity vector, normal to the velocity vector in the plane of the osculating orbit, and along the binormal. The equations in the mean elements were obtained in an earlier study. The algorithm used to solve these equations is given in this study. This algorithm is analogous to one constructed earlier for the case when P is constant in a reference frame tied to the radius vector. The properties of the solutions are similar. The main difference is that, in the most important cases, the quadratures to which the solution reduces lead to non-elementary functions. However, they can be expressed as series in powers of the eccentricity e that converge for e < 1, and often also for e = 1.

Classifying Motion.

ERIC Educational Resources Information Center

Duzen, Carl; And Others

1992-01-01

Presents a series of activities that utilizes a leveling device to classify constant and accelerated motion. Applies this classification system to uniform circular motion and motion produced by gravitational force. (MDH)

Illusory motion reversal is caused by rivalry, not by perceptual snapshots of the visual field.

PubMed

Kline, Keith; Holcombe, Alex O; Eagleman, David M

2004-10-01

In stroboscopic conditions--such as motion pictures--rotating objects may appear to rotate in the reverse direction due to under-sampling (aliasing). A seemingly similar phenomenon occurs in constant sunlight, which has been taken as evidence that the visual system processes discrete "snapshots" of the outside world. But if snapshots are indeed taken of the visual field, then when a rotating drum appears to transiently reverse direction, its mirror image should always appeared to reverse direction simultaneously. Contrary to this hypothesis, we found that when observers watched a rotating drum and its mirror image, almost all illusory motion reversals occurred for only one image at a time. This result indicates that the motion reversal illusion cannot be explained by snapshots of the visual field. The same result is found when the two images are presented within one visual hemifield, further ruling out the possibility that discrete sampling of the visual field occurs separately in each hemisphere. The frequency distribution of illusory reversal durations approximates a gamma distribution, suggesting perceptual rivalry as a better explanation for illusory motion reversal. After adaptation of motion detectors coding for the correct direction, the activity of motion-sensitive neurons coding for motion in the reverse direction may intermittently become dominant and drive the perception of motion.

Application of MCM image construction to IRAS comet observations

NASA Technical Reports Server (NTRS)

Schlapfer, Martin F.; Walker, Russell G.

1994-01-01

There is a wealth of IRAS comet data, obtained in both the survey and pointed observations modes. However, these measurements have remained largely untouched due to difficulties in removing instrumental effects from the data. We have developed a version of the Maximum Correlation Method for Image Construction algorithm (MCM) which operates in the moving coordinate system of the comet and properly treats both real cometary motion and apparent motion due to spacecraft parallax. This algorithm has been implemented on a 486/33 PC in FORTRAN and IDL codes. Preprocessing of the IRAS CRDD includes baseline removal, deglitching, and removal of long tails due to dielectric time constants of the detectors. The resulting images are virtually free from instrumental effects and have the highest possible spatial resolution consistent with the data sampling. We present examples of high resolution IRAS images constructed from survey observations of Comets P/Tempel 1 and P/Tempel 2, and pointed observations of IRAS-Araki-Alcock.

Solvent Dependence of Double Proton Transfer in the Formic Acid-Formamidine Complex: Path Integral Molecular Dynamics Investigation.

PubMed

Kungwan, Nawee; Ngaojampa, Chanisorn; Ogata, Yudai; Kawatsu, Tsutomu; Oba, Yuki; Kawashima, Yukio; Tachikawa, Masanori

2017-10-05

Solvent dependence of double proton transfer in the formic acid-formamidine (FA-FN) complex at room temperature was investigated by means of ab initio path integral molecular dynamics (AIPIMD) simulation with taking nuclear quantum and thermal effects into account. The conductor-like screening model (COSMO) was applied for solvent effect. In comparison with gas phase, double proton delocalization between two heavy atoms (O and N) in FA-FN were observed with reduced proton transfer barrier height in low dielectric constant medium (<4.8). For dielectric constant medium at 4.8, the chance of finding these two protons are more pronounced due to the solvent effect which completely washes out the proton transfer barrier. In the case of higher dielectric constant medium (>4.8), the ionic species becomes more stable than the neutral ones and the formate anion and formamidium cation are thermodynamically stable. For ab initio molecular dynamics simulation, in low dielectric constant medium (<4.8) a reduction of proton transfer barrier with solvent effect is found to be less pronounced than the AIPIMD due to the absence of nuclear quantum effect. Moreover, the motions of FA-FN complex are significantly different with increasing dielectric constant medium. Such a difference is revealed in detail by the principal component analysis.

Kinetics of the Shanghai Maglev: Kinematical Analysis of a Real "Textbook" Case of Linear Motion

ERIC Educational Resources Information Center

Hsu, Tung

2014-01-01

A vehicle starts from rest at constant acceleration, then cruises at constant speed for a time. Next, it decelerates at a constant rate.… This and similar statements are common in elementary physics courses. Students are asked to graph the motion of the vehicle or find the velocity, acceleration, and distance traveled by the vehicle from a given…

DROMO formulation for planar motions: solution to the Tsien problem

NASA Astrophysics Data System (ADS)

Urrutxua, Hodei; Morante, David; Sanjurjo-Rivo, Manuel; Peláez, Jesús

2015-06-01

The two-body problem subject to a constant radial thrust is analyzed as a planar motion. The description of the problem is performed in terms of three perturbation methods: DROMO and two others due to Deprit. All of them rely on Hansen's ideal frame concept. An explicit, analytic, closed-form solution is obtained for this problem when the initial orbit is circular (Tsien problem), based on the DROMO special perturbation method, and expressed in terms of elliptic integral functions. The analytical solution to the Tsien problem is later used as a reference to test the numerical performance of various orbit propagation methods, including DROMO and Deprit methods, as well as Cowell and Kustaanheimo-Stiefel methods.

Theoretical calculations of the pressure, forces, and moments at supersonic speeds due to various lateral motions acting on thin isolated vertical tails

NASA Technical Reports Server (NTRS)

Margolis, Kenneth; Bobbitt, Percy J

1956-01-01

Velocity potentials, pressure, distributions, and stability derivatives are derived by use of supersonic linearized theory for families of thin isolated vertical tails performing steady rolling, steady yawing, and constant-lateral-acceleration motions. Vertical-tail families (half-delta and rectangular plan forms) are considered for a broad Mach number range. Also considered are the vertical tail with arbitrary sweepback and taper ratio at Mach numbers for which both the leading edge and trailing edge of the tail are supersonic and the triangular vertical tail with a subsonic leading edge and a supersonic trailing edge. Expressions for potentials, pressures, and stability derivatives are tabulated.

Antiswarming: Structure and dynamics of repulsive chemically active particles

NASA Astrophysics Data System (ADS)

Yan, Wen; Brady, John F.

2017-12-01

Chemically active Brownian particles with surface catalytic reactions may repel each other due to diffusiophoretic interactions in the reaction and product concentration fields. The system behavior can be described by a "chemical" coupling parameter Γc that compares the strength of diffusiophoretic repulsion to Brownian motion, and by a mapping to the classical electrostatic one component plasma (OCP) system. When confined to a constant-volume domain, body-centered cubic (bcc) crystals spontaneously form from random initial configurations when the repulsion is strong enough to overcome Brownian motion. Face-centered cubic (fcc) crystals may also be stable. The "melting point" of the "liquid-to-crystal transition" occurs at Γc≈140 for both bcc and fcc lattices.

The structure of a turbulent flow in a channel of complex shape

USGS Publications Warehouse

Tracy, Hubert Jerome

1976-01-01

Measurements of the Reynolds stresses and the mean motion pattern were made in a uniform turbulent motion in a conduit consisting of a large, nearly square section joined by a smaller rectangular section. The results indicate that the boundary shearing stress is nearly constant over large segments of the boundaries. The magnitudes of the lateral and the vertical components of turbulence are not the same near a boundary and the component normal to the boundary is smaller than the component parallel to the boundary. The difference in the two components in the corner regions of the channel produces secondary mean motions in the plane of the channel section. The strength of the motion depends upon the angle subtended by the corner. A principal function of the secondary motions is to transfer momentum into the corner regions and, elsewhere, to compensate for the excess force due to the shear gradients. In the absence of the secondary motions, the fluid must stagnate and separate from the boundaries in certain regions and be greatly accelerated in others. The secondary motions are conventionally described in terms of symmetrical rotations in cells bounded by the corner bisectors. The measured motion pattern is at variance with this view, unless the symmetry is confined to a very local region. (Woodard-USGS)

Simultaneous dynamic characterization of charge and structural motion during ferroelectric switching

NASA Astrophysics Data System (ADS)

Kwamen, C.; Rössle, M.; Reinhardt, M.; Leitenberger, W.; Zamponi, F.; Alexe, M.; Bargheer, M.

2017-10-01

Monitoring structural changes in ferroelectric thin films during electric field induced polarization switching is important for a full microscopic understanding of the coupled motion of charges, atoms, and domain walls in ferroelectric nanostructures. We combine standard ferroelectric test sequences of switching and nonswitching electrical pulses with time-resolved x-ray diffraction to investigate the structural response of a nanoscale Pb (Zr0.2Ti0.8) O3 ferroelectric oxide capacitor upon charging, discharging, and polarization reversal. We observe that a nonlinear piezoelectric response of the ferroelectric layer develops on a much longer time scale than the R C time constant of the device. The complex atomic motion during the ferroelectric polarization reversal starts with a contraction of the lattice, whereas the expansive piezoelectric response sets in after considerable charge flow due to the applied voltage pulses on the electrodes of the capacitor. Our simultaneous measurements on a working device elucidate and visualize the complex interplay of charge flow and structural motion and challenges theoretical modeling.

Force-motion phase relations and aerodynamic performance of a plunging plate

NASA Astrophysics Data System (ADS)

Son, Onur; Cetiner, Oksan

2018-02-01

Due to the unsteady motion of a plunging plate, forces acting on the body experience a phase difference with respect to the motion. These phase relations are investigated experimentally for a harmonically plunging plate within an amplitude range of 0.05≤ {a/c}≤ 0.6, reduced frequency range of 0.78<{k}<7.06, and at a constant Reynolds number of 10,000. Both streamwise and cross-stream force components are found to have a phase lag following the motion; however, their variations are different. The phase lag of the force on the cross-stream direction increases as the amplitude increases. Drag-thrust transition has an influence on the streamwise force phase lags, which starts to increase when the thrust starts to be produced. Particle image velocimetry measurements are also performed to reveal the relations between vortex structures and force measurements. Leading edge vortex shedding characteristics are observed to be changing from drag occurring cases to thrust producing cases in parallel with the increment in phase lags.

Adiabatic elimination of inertia of the stochastic microswimmer driven by α -stable noise

NASA Astrophysics Data System (ADS)

Noetel, Joerg; Sokolov, Igor M.; Schimansky-Geier, Lutz

2017-10-01

We consider a microswimmer that moves in two dimensions at a constant speed and changes the direction of its motion due to a torque consisting of a constant and a fluctuating component. The latter will be modeled by a symmetric Lévy-stable (α -stable) noise. The purpose is to develop a kinetic approach to eliminate the angular component of the dynamics to find a coarse-grained description in the coordinate space. By defining the joint probability density function of the position and of the orientation of the particle through the Fokker-Planck equation, we derive transport equations for the position-dependent marginal density, the particle's mean velocity, and the velocity's variance. At time scales larger than the relaxation time of the torque τϕ, the two higher moments follow the marginal density and can be adiabatically eliminated. As a result, a closed equation for the marginal density follows. This equation, which gives a coarse-grained description of the microswimmer's positions at time scales t ≫τϕ , is a diffusion equation with a constant diffusion coefficient depending on the properties of the noise. Hence, the long-time dynamics of a microswimmer can be described as a normal, diffusive, Brownian motion with Gaussian increments.

Adiabatic elimination of inertia of the stochastic microswimmer driven by α-stable noise.

PubMed

Noetel, Joerg; Sokolov, Igor M; Schimansky-Geier, Lutz

2017-10-01

We consider a microswimmer that moves in two dimensions at a constant speed and changes the direction of its motion due to a torque consisting of a constant and a fluctuating component. The latter will be modeled by a symmetric Lévy-stable (α-stable) noise. The purpose is to develop a kinetic approach to eliminate the angular component of the dynamics to find a coarse-grained description in the coordinate space. By defining the joint probability density function of the position and of the orientation of the particle through the Fokker-Planck equation, we derive transport equations for the position-dependent marginal density, the particle's mean velocity, and the velocity's variance. At time scales larger than the relaxation time of the torque τ_{ϕ}, the two higher moments follow the marginal density and can be adiabatically eliminated. As a result, a closed equation for the marginal density follows. This equation, which gives a coarse-grained description of the microswimmer's positions at time scales t≫τ_{ϕ}, is a diffusion equation with a constant diffusion coefficient depending on the properties of the noise. Hence, the long-time dynamics of a microswimmer can be described as a normal, diffusive, Brownian motion with Gaussian increments.

Automatic acquisition of motion trajectories: tracking hockey players

NASA Astrophysics Data System (ADS)

Okuma, Kenji; Little, James J.; Lowe, David

2003-12-01

Computer systems that have the capability of analyzing complex and dynamic scenes play an essential role in video annotation. Scenes can be complex in such a way that there are many cluttered objects with different colors, shapes and sizes, and can be dynamic with multiple interacting moving objects and a constantly changing background. In reality, there are many scenes that are complex, dynamic, and challenging enough for computers to describe. These scenes include games of sports, air traffic, car traffic, street intersections, and cloud transformations. Our research is about the challenge of inventing a descriptive computer system that analyzes scenes of hockey games where multiple moving players interact with each other on a constantly moving background due to camera motions. Ultimately, such a computer system should be able to acquire reliable data by extracting the players" motion as their trajectories, querying them by analyzing the descriptive information of data, and predict the motions of some hockey players based on the result of the query. Among these three major aspects of the system, we primarily focus on visual information of the scenes, that is, how to automatically acquire motion trajectories of hockey players from video. More accurately, we automatically analyze the hockey scenes by estimating parameters (i.e., pan, tilt, and zoom) of the broadcast cameras, tracking hockey players in those scenes, and constructing a visual description of the data by displaying trajectories of those players. Many technical problems in vision such as fast and unpredictable players' motions and rapid camera motions make our challenge worth tackling. To the best of our knowledge, there have not been any automatic video annotation systems for hockey developed in the past. Although there are many obstacles to overcome, our efforts and accomplishments would hopefully establish the infrastructure of the automatic hockey annotation system and become a milestone for research in automatic video annotation in this domain.

Theory of thermionic emission from a two-dimensional conductor and its application to a graphene-semiconductor Schottky junction

NASA Astrophysics Data System (ADS)

Trushin, Maxim

2018-04-01

The standard theory of thermionic emission developed for three-dimensional semiconductors does not apply to two-dimensional materials even for making qualitative predictions because of the vanishing out-of-plane quasiparticle velocity. This study reveals the fundamental origin of the out-of-plane charge carrier motion in a two-dimensional conductor due to the finite quasiparticle lifetime and huge uncertainty of the out-of-plane momentum. The theory is applied to a Schottky junction between graphene and a bulk semiconductor to derive a thermionic constant, which, in contrast to the conventional Richardson constant, is determined by the Schottky barrier height and Fermi level in graphene.

How Do Changes in Speed Affect the Perception of Duration?

ERIC Educational Resources Information Center

Matthews, William J.

2011-01-01

Six experiments investigated how changes in stimulus speed influence subjective duration. Participants saw rotating or translating shapes in three conditions: constant speed, accelerating motion, and decelerating motion. The distance moved and average speed were the same in all three conditions. In temporal judgment tasks, the constant-speed…

An analytical approach to the external force-free motion of pendulums on surfaces of constant curvature

NASA Astrophysics Data System (ADS)

Rubio, Rafael M.; Salamanca, Juan J.

2018-07-01

The dynamics of external force free motion of pendulums on surfaces of constant Gaussian curvature is addressed when the pivot moves along a geodesic obtaining the Lagrangian of the system. As an application it is possible the study of elastic and quantum pendulums.

Response of cricket and spider motion-sensing hairs to airflow pulsations

PubMed Central

Kant, R.; Humphrey, J. A. C.

2009-01-01

Closed-form analytical solutions are presented for the angular displacement, velocity and acceleration of motion-sensing filiform hairs exposed to airflow pulsations of short time duration. The specific situations of interest correspond to a spider intentionally moving towards a cricket, or an insect unintentionally moving towards or flying past a spider. The trichobothria of the spider Cupiennius salei and the cercal hairs of the cricket Gryllus bimaculatus are explored. Guided by earlier work, the spatial characteristics of the velocity field due to a flow pulsation are approximated by the local incompressible flow field due to a moving sphere. This spatial field is everywhere modulated in time by a Gaussian function represented by the summation of an infinite Fourier series, thus allowing an exploration of the spectral dependence of hair motion. Owing to their smaller total inertia, torsional restoring constant and total damping constant, short hairs are found to be significantly more responsive than long hairs to a flow pulsation. It is also found that the spider trichobothria are underdamped, while the cercal hairs of the cricket are overdamped. As a consequence, the spider hairs are more responsive to sudden air motions. Analysis shows that while two spiders of different characteristic sizes and lunge velocities can generate pulsations with comparable energy content, the associated velocity fields display different patterns of spatial decay with distance from the pulsation source. As a consequence, a small spider lunging at a high velocity generates a smaller telltale far-field velocity signal than a larger spider lunging at a lower velocity. The results obtained are in broad agreement with several of the observations and conclusions derived from combined flow and behavioural experiments performed by Casas et al. for running spiders, and by Dangles et al. for spiders and a physical model of spiders lunging at crickets. PMID:19324674

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheung, Y; Rahimi, A; Sawant, A

Purpose: Active breathing control (ABC) has been used to reduce treatment margin due to respiratory organ motion by enforcing temporary breath-holds. However, in practice, even if the ABC device indicates constant lung volume during breath-hold, the patient may still exhibit minor chest motion. Consequently, therapists are given a false sense of security that the patient is immobilized. This study aims at quantifying such motion during ABC breath-holds by monitoring the patient chest motion using a surface photogrammetry system, VisionRT. Methods: A female patient with breast cancer was selected to evaluate chest motion during ABC breath-holds. During the entire course ofmore » treatment, the patient’s chest surface was monitored by a surface photogrammetry system, VisionRT. Specifically, a user-defined region-of-interest (ROI) on the chest surface was selected for the system to track at a rate of ∼3Hz. The surface motion was estimated by rigid image registration between the current ROI image captured and a reference image. The translational and rotational displacements computed were saved in a log file. Results: A total of 20 fractions of radiation treatment were monitored by VisionRT. After removing noisy data, we obtained chest motion of 79 breath-hold sessions. Mean chest motion in AP direction during breath-holds is 1.31mm with 0.62mm standard deviation. Of the 79 sessions, the patient exhibited motion ranging from 0–1 mm (30 sessions), 1–2 mm (37 sessions), 2–3 mm (11 sessions) and >3 mm (1 session). Conclusion: Contrary to popular assumptions, the patient is not completely still during ABC breath-hold sessions. In this particular case studied, the patient exhibited chest motion over 2mm in 14 out of 79 breath-holds. Underestimating treatment margin for radiation therapy with ABC could reduce treatment effectiveness due to geometric miss or overdose of critical organs. The senior author receives research funding from NIH, VisionRT, Varian Medical Systems and Elekta.« less

Parallax-sensitive remapping of visual space in occipito-parietal alpha-band activity during whole-body motion

PubMed Central

Selen, L. P. J.; Medendorp, W. P.

2014-01-01

Despite the constantly changing retinal image due to eye, head, and body movements, we are able to maintain a stable representation of the visual environment. Various studies on retinal image shifts caused by saccades have suggested that occipital and parietal areas correct for these perturbations by a gaze-centered remapping of the neural image. However, such a uniform, rotational, remapping mechanism cannot work during translations when objects shift on the retina in a more complex, depth-dependent fashion due to motion parallax. Here we tested whether the brain's activity patterns show parallax-sensitive remapping of remembered visual space during whole-body motion. Under continuous recording of electroencephalography (EEG), we passively translated human subjects while they had to remember the location of a world-fixed visual target, briefly presented in front of or behind the eyes' fixation point prior to the motion. Using a psychometric approach we assessed the quality of the memory update, which had to be made based on vestibular feedback and other extraretinal motion cues. All subjects showed a variable amount of parallax-sensitive updating errors, i.e., the direction of the errors depended on the depth of the target relative to fixation. The EEG recordings show a neural correlate of this parallax-sensitive remapping in the alpha-band power at occipito-parietal electrodes. At parietal electrodes, the strength of these alpha-band modulations correlated significantly with updating performance. These results suggest that alpha-band oscillatory activity reflects the time-varying updating of gaze-centered spatial information during parallax-sensitive remapping during whole-body motion. PMID:25505108

Significance of the impact of motion compensation on the variability of PET image features

NASA Astrophysics Data System (ADS)

Carles, M.; Bach, T.; Torres-Espallardo, I.; Baltas, D.; Nestle, U.; Martí-Bonmatí, L.

2018-03-01

In lung cancer, quantification by positron emission tomography/computed tomography (PET/CT) imaging presents challenges due to respiratory movement. Our primary aim was to study the impact of motion compensation implied by retrospectively gated (4D)-PET/CT on the variability of PET quantitative parameters. Its significance was evaluated by comparison with the variability due to (i) the voxel size in image reconstruction and (ii) the voxel size in image post-resampling. The method employed for feature extraction was chosen based on the analysis of (i) the effect of discretization of the standardized uptake value (SUV) on complementarity between texture features (TF) and conventional indices, (ii) the impact of the segmentation method on the variability of image features, and (iii) the variability of image features across the time-frame of 4D-PET. Thirty-one PET-features were involved. Three SUV discretization methods were applied: a constant width (SUV resolution) of the resampling bin (method RW), a constant number of bins (method RN) and RN on the image obtained after histogram equalization (method EqRN). The segmentation approaches evaluated were 40% of SUVmax and the contrast oriented algorithm (COA). Parameters derived from 4D-PET images were compared with values derived from the PET image obtained for (i) the static protocol used in our clinical routine (3D) and (ii) the 3D image post-resampled to the voxel size of the 4D image and PET image derived after modifying the reconstruction of the 3D image to comprise the voxel size of the 4D image. Results showed that TF complementarity with conventional indices was sensitive to the SUV discretization method. In the comparison of COA and 40% contours, despite the values not being interchangeable, all image features showed strong linear correlations (r  >  0.91, p\\ll 0.001 ). Across the time-frames of 4D-PET, all image features followed a normal distribution in most patients. For our patient cohort, the compensation of tumor motion did not have a significant impact on the quantitative PET parameters. The variability of PET parameters due to voxel size in image reconstruction was more significant than variability due to voxel size in image post-resampling. In conclusion, most of the parameters (apart from the contrast of neighborhood matrix) were robust to the motion compensation implied by 4D-PET/CT. The impact on parameter variability due to the voxel size in image reconstruction and in image post-resampling could not be assumed to be equivalent.

Gravitational self-force on generic bound geodesics in Kerr spacetime

NASA Astrophysics Data System (ADS)

van de Meent, Maarten

2018-05-01

In this work we present the first calculation of the gravitational self-force on generic bound geodesics in Kerr spacetime to first order in the mass ratio. That is, the local correction to equations of motion for a compact object orbiting a larger rotating black hole due to its own impact on the gravitational field. This includes both dissipative and conservative effects. Our method builds on and extends earlier methods for calculating the gravitational self-force on equatorial orbits. In particular we reconstruct the local metric perturbation in the outgoing radiation gauge from the Weyl scalar ψ4 , which in turn is obtained by solving the Teukolsky equation using semianalytical frequency domain methods. The gravitational self-force is subsequently obtained using (spherical) l -mode regularization. We test our implementation by comparing the large l -behavior against the analytically known regularization parameters. In addition we validate our results by comparing the long-term average changes to the energy, angular momentum, and Carter constant to changes to these constants of motion inferred from the gravitational wave flux to infinity and down the horizon.

Demonstrating the Potential for Dynamic Auditory Stimulation to Contribute to Motion Sickness

PubMed Central

Keshavarz, Behrang; Hettinger, Lawrence J.; Kennedy, Robert S.; Campos, Jennifer L.

2014-01-01

Auditory cues can create the illusion of self-motion (vection) in the absence of visual or physical stimulation. The present study aimed to determine whether auditory cues alone can also elicit motion sickness and how auditory cues contribute to motion sickness when added to visual motion stimuli. Twenty participants were seated in front of a curved projection display and were exposed to a virtual scene that constantly rotated around the participant's vertical axis. The virtual scene contained either visual-only, auditory-only, or a combination of corresponding visual and auditory cues. All participants performed all three conditions in a counterbalanced order. Participants tilted their heads alternately towards the right or left shoulder in all conditions during stimulus exposure in order to create pseudo-Coriolis effects and to maximize the likelihood for motion sickness. Measurements of motion sickness (onset, severity), vection (latency, strength, duration), and postural steadiness (center of pressure) were recorded. Results showed that adding auditory cues to the visual stimuli did not, on average, affect motion sickness and postural steadiness, but it did reduce vection onset times and increased vection strength compared to pure visual or pure auditory stimulation. Eighteen of the 20 participants reported at least slight motion sickness in the two conditions including visual stimuli. More interestingly, six participants also reported slight motion sickness during pure auditory stimulation and two of the six participants stopped the pure auditory test session due to motion sickness. The present study is the first to demonstrate that motion sickness may be caused by pure auditory stimulation, which we refer to as “auditorily induced motion sickness”. PMID:24983752

Constants of the motion, universal time and the Hamilton-Jacobi function in general relativity

NASA Astrophysics Data System (ADS)

O'Hara, Paul

2013-04-01

In most text books of mechanics, Newton's laws or Hamilton's equations of motion are first written down and then solved based on initial conditions to determine the constants of the motions and to describe the trajectories of the particles. In this essay, we take a different starting point. We begin with the metrics of general relativity and show how they can be used to construct by inspection constants of motion, which can then be used to write down the equations of the trajectories. This will be achieved by deriving a Hamiltonian-Jacobi function from the metric and showing that its existence requires all of the above mentioned properties. The article concludes by showing that a consistent theory of such functions also requires the need for a universal measure of time which can be identified with the "worldtime" parameter, first introduced by Steuckelberg and later developed by Horwitz and Piron.

Toward Theoretical Foundations of Resistive Force Theory of Granular-Structural Interaction, with Expansions to Flexible Locomotors

DTIC Science & Technology

2015-05-07

the proper depth-dependent pressure distribution before intruder motion begins. We model the intruder as a rigid surface within the granular body by...assigning corresponding planar nodes to move as a rigid body at a constant rate. This resembles a fully rough surface due to the no-slip condition, no...Stokesian fluids. Despite its remarkable capability to predict experimental locomotion and force distributions on mobile bodies in granular media, there is

Detection and Imaging of Moving Targets with LiMIT SAR Data

DTIC Science & Technology

2017-03-03

include space time adaptive processing (STAP) or displaced phase center antenna (DPCA) [4]–[7]. Page et al. combined constant acceleration target...motion focusing with space-time adaptive processing (STAP), and included the refocusing parameters in the STAP steering vector. Due to inhomogenous...wavelength λ and slow time t, of a moving target after matched filter and passband equalization processing can be expressed as: P (t) = exp ( −j 4π λ ||~rp

Fast antibody fragment motion: flexible linkers act as entropic spring

PubMed Central

Stingaciu, Laura R.; Ivanova, Oxana; Ohl, Michael; Biehl, Ralf; Richter, Dieter

2016-01-01

A flexible linker region between three fragments allows antibodies to adjust their binding sites to an antigen or receptor. Using Neutron Spin Echo Spectroscopy we observed fragment motion on a timescale of 7 ns with motional amplitudes of about 1 nm relative to each other. The mechanistic complexity of the linker region can be described by a spring model with Brownian motion of the fragments in a harmonic potential. Displacements, timescale, friction and force constant of the underlying dynamics are accessed. The force constant exhibits a similar strength to an entropic spring, with friction of the fragment matching the unbound state. The observed fast motions are fluctuations in pre-existing equilibrium configurations. The Brownian motion of domains in a harmonic potential is the appropriate model to examine functional hinge motions dependent on the structural topology and highlights the role of internal forces and friction to function. PMID:27020739

Fast antibody fragment motion: flexible linkers act as entropic spring

DOE PAGES

Stingaciu, Laura R.; Ivanova, Oxana; Ohl, Michael; ...

2016-03-29

A flexible linker region between three fragments allows antibodies to adjust their binding sites to an antigen or receptor. Using Neutron Spin Echo Spectroscopy we observed fragment motion on a timescale of 7 ns with motional amplitudes of about 1 nm relative to each other. The mechanistic complexity of the linker region can be described by a spring model with Brownian motion of the fragments in a harmonic potential. Displacements, timescale, friction and force constant of the underlying dynamics are accessed. The force constant exhibits a similar strength to an entropic spring, with friction of the fragment matching the unboundmore » state. The observed fast motions are fluctuations in pre-existing equilibrium configurations. In conclusion, the Brownian motion of domains in a harmonic potential is the appropriate model to examine functional hinge motions dependent on the structural topology and highlights the role of internal forces and friction to function.« less

Fast antibody fragment motion: flexible linkers act as entropic spring.

PubMed

Stingaciu, Laura R; Ivanova, Oxana; Ohl, Michael; Biehl, Ralf; Richter, Dieter

2016-03-29

A flexible linker region between three fragments allows antibodies to adjust their binding sites to an antigen or receptor. Using Neutron Spin Echo Spectroscopy we observed fragment motion on a timescale of 7 ns with motional amplitudes of about 1 nm relative to each other. The mechanistic complexity of the linker region can be described by a spring model with Brownian motion of the fragments in a harmonic potential. Displacements, timescale, friction and force constant of the underlying dynamics are accessed. The force constant exhibits a similar strength to an entropic spring, with friction of the fragment matching the unbound state. The observed fast motions are fluctuations in pre-existing equilibrium configurations. The Brownian motion of domains in a harmonic potential is the appropriate model to examine functional hinge motions dependent on the structural topology and highlights the role of internal forces and friction to function.

Complete integrability of geodesic motion in Sasaki-Einstein toric Yp,q spaces

NASA Astrophysics Data System (ADS)

Babalic, Elena Mirela; Visinescu, Mihai

2015-09-01

We construct explicitly the constants of motion for geodesics in the five-dimensional Sasaki-Einstein spaces Yp,q. To carry out this task, we use the knowledge of the complete set of Killing vectors and Killing-Yano tensors on these spaces. In spite of the fact that we generate a multitude of constants of motion, only five of them are functionally independent implying the complete integrability of geodesic flow on Yp,q spaces. In the particular case of the homogeneous Sasaki-Einstein manifold T1,1 the integrals of motion have simpler forms and the relations between them are described in detail.

Low-Power Photothermal Self-Oscillation of Bimetallic Nanowires.

PubMed

De Alba, Roberto; Abhilash, T S; Rand, Richard H; Craighead, Harold G; Parpia, Jeevak M

2017-07-12

We investigate the nonlinear mechanics of a bimetallic, optically absorbing SiN-Nb nanowire in the presence of incident laser light and a reflecting Si mirror. Situated in a standing wave of optical intensity and subject to photothermal forces, the nanowire undergoes self-induced oscillations at low incident light thresholds of <1 μW due to engineered strong temperature-position (T-z) coupling. Along with inducing self-oscillation, laser light causes large changes to the mechanical resonant frequency ω 0 and equilibrium position z 0 that cannot be neglected. We present experimental results and a theoretical model for the motion under laser illumination. In the model, we solve the governing nonlinear differential equations by perturbative means to show that self-oscillation amplitude is set by the competing effects of direct T-z coupling and 2ω 0 parametric excitation due to T-ω 0 coupling. We then study the linearized equations of motion to show that the optimal thermal time constant τ for photothermal feedback is τ → ∞ rather than the previously reported ω 0 τ = 1. Lastly, we demonstrate photothermal quality factor (Q) enhancement of driven motion as a means to counteract air damping. Understanding photothermal effects on nano- and micromechanical devices, as well as nonlinear aspects of optics-based motion detection, can enable new device applications as oscillators or other electronic elements with smaller device footprints and less stringent ambient vacuum requirements.

Oscillatory motion based measurement method and sensor for measuring wall shear stress due to fluid flow

DOEpatents

Armstrong, William D [Laramie, WY; Naughton, Jonathan [Laramie, WY; Lindberg, William R [Laramie, WY

2008-09-02

A shear stress sensor for measuring fluid wall shear stress on a test surface is provided. The wall shear stress sensor is comprised of an active sensing surface and a sensor body. An elastic mechanism mounted between the active sensing surface and the sensor body allows movement between the active sensing surface and the sensor body. A driving mechanism forces the shear stress sensor to oscillate. A measuring mechanism measures displacement of the active sensing surface relative to the sensor body. The sensor may be operated under periodic excitation where changes in the nature of the fluid properties or the fluid flow over the sensor measurably changes the amplitude or phase of the motion of the active sensing surface, or changes the force and power required from a control system in order to maintain constant motion. The device may be operated under non-periodic excitation where changes in the nature of the fluid properties or the fluid flow over the sensor change the transient motion of the active sensor surface or change the force and power required from a control system to maintain a specified transient motion of the active sensor surface.

Domain Motion Enhanced (DoME) Model for Efficient Conformational Sampling of Multidomain Proteins.

PubMed

Kobayashi, Chigusa; Matsunaga, Yasuhiro; Koike, Ryotaro; Ota, Motonori; Sugita, Yuji

2015-11-19

Large conformational changes of multidomain proteins are difficult to simulate using all-atom molecular dynamics (MD) due to the slow time scale. We show that a simple modification of the structure-based coarse-grained (CG) model enables a stable and efficient MD simulation of those proteins. "Motion Tree", a tree diagram that describes conformational changes between two structures in a protein, provides information on rigid structural units (domains) and the magnitudes of domain motions. In our new CG model, which we call the DoME (domain motion enhanced) model, interdomain interactions are defined as being inversely proportional to the magnitude of the domain motions in the diagram, whereas intradomain interactions are kept constant. We applied the DoME model in combination with the Go model to simulations of adenylate kinase (AdK). The results of the DoME-Go simulation are consistent with an all-atom MD simulation for 10 μs as well as known experimental data. Unlike the conventional Go model, the DoME-Go model yields stable simulation trajectories against temperature changes and conformational transitions are easily sampled despite domain rigidity. Evidently, identification of domains and their interfaces is useful approach for CG modeling of multidomain proteins.

Theory of an experiment in an orbiting space laboratory to determine the gravitational constant.

NASA Technical Reports Server (NTRS)

Vinti, J. P.

1972-01-01

An experiment is discussed for determining the gravitational constant with the aid of an isolated system consisting of an artificial satellite moving around an artificial planet. The experiment is to be conducted in a spherical laboratory traveling in an orbit around the earth. Difficulties due to the gravity-gradient term are considered, and the three-tunnel method proposed by Wilk (1969) is examined. The rotation of the sphere is discussed together with aspects of the reference systems used, the equations of motion of the spacecraft and of the test objects, the field from the earth's gravity gradient at the test object, higher harmonic terms in the gravity gradient force, gravitational effects of the spacecraft itself, and a computer simulation.

Ultrafast dynamics of liquid water: Energy relaxation and transfer processes of the OH stretch and the HOH bend

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imoto, Sho; Xantheas, Sotiris S.; Saito, Shinji

2015-08-27

The vibrational energy relaxation and transfer processes of the OH stretching and the HOH bending vibrations in liquid water are investigated via the theoretical calculation of the pump-probe spectra obtained from non-equilibrium molecular dynamics simulations with the TTM3-F interaction potential. The excitation of the OH stretch induces an instantaneous response of the high frequency librational motions in the 600-1000 cm-1 range. In addition, the excess energy of the OH stretch of a water molecule quickly transfers to the OH stretches of molecules in its first hydration shell with a time constant of ~50 fs, followed by relaxation to the HOHmore » bends of the surrounding molecules with a time constant of 230 fs. The excitation of the HOH bend also results in the ultrafast excitation of the high frequency librational motions. The energy of the excited HOH bend of a water molecule decays, with a time constant of 200 fs, mainly to the relaxation of the HOH bends of its surrounding molecules. The energies of the HOH bends were found to transfer quickly to the intermolecular motions via the coupling with the high frequency librational motions. The excess energy of the OH stretch or the HOH bend relaxes to the high frequency intermolecular librational motions and eventually to the hot ground state with a time scale of ~1 ps via the coupling with the librational and translational motions. The energy relaxation and transfer processes were found to depend on the local hydrogen bonding network; the relaxations of the excess energy of the OH stretch and the HOH bend of four- and five-coordinated molecules are faster than those of a three-coordinated molecule due to the delocalization of the vibrational motions of the former (four- and five-coordinated molecules) compared to those of the later (three-coordinated molecules). The present results highlight the importance of the high frequency intermolecular librational modes in facilitating the ultrafast energy relaxation process in liquid water via their strong nonlinear couplings with the intramolecular OH stretching and HOH bending vibrations. S.S.X. acknowledges the support of the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, Division of Chemical Sciences, Geosciences, and Biosciences. Pacific Northwest National Laboratory (PNNL) is a multiprogram national laboratory operated for DOE by Battelle. The calculation was carried out using the computing resources at the Research Center for Computational Science in Okazaki, Japan.« less

Quantifying the degree of persistence in random amoeboid motion based on the Hurst exponent of fractional Brownian motion.

PubMed

Makarava, Natallia; Menz, Stephan; Theves, Matthias; Huisinga, Wilhelm; Beta, Carsten; Holschneider, Matthias

2014-10-01

Amoebae explore their environment in a random way, unless external cues like, e.g., nutrients, bias their motion. Even in the absence of cues, however, experimental cell tracks show some degree of persistence. In this paper, we analyzed individual cell tracks in the framework of a linear mixed effects model, where each track is modeled by a fractional Brownian motion, i.e., a Gaussian process exhibiting a long-term correlation structure superposed on a linear trend. The degree of persistence was quantified by the Hurst exponent of fractional Brownian motion. Our analysis of experimental cell tracks of the amoeba Dictyostelium discoideum showed a persistent movement for the majority of tracks. Employing a sliding window approach, we estimated the variations of the Hurst exponent over time, which allowed us to identify points in time, where the correlation structure was distorted ("outliers"). Coarse graining of track data via down-sampling allowed us to identify the dependence of persistence on the spatial scale. While one would expect the (mode of the) Hurst exponent to be constant on different temporal scales due to the self-similarity property of fractional Brownian motion, we observed a trend towards stronger persistence for the down-sampled cell tracks indicating stronger persistence on larger time scales.

Detection of a Moving Gas Source and Estimation of its Concentration Field with a Sensing Aerial Vehicle Integration of Theoretical Controls and Computational Fluids

DTIC Science & Technology

2016-07-21

constants. The model (2.42) is popular for simulation of the UAV motion [60], [61], [62] due to the fact that it models the aircraft response to...inputs to the dynamic model (2.42). The concentration sensors onboard the UAV record concentration ( simulated ) data according to its spatial location...vehicle dynamics and guidance, and the onboard sensor modeling . 15. SUBJECT TERMS State estimation; UAVs , mobile sensors; grid adaptationj; plume

Strange nonchaotic self-oscillator

NASA Astrophysics Data System (ADS)

Jalnine, Alexey Yu.; Kuznetsov, Sergey P.

2016-08-01

An example of strange nonchaotic attractor (SNA) is discussed in a dissipative system of mechanical nature driven by a constant torque applied to one of the elements of the construction. So the external force is not oscillatory, and the system is autonomous. Components of the motion with incommensurable frequencies emerge due to the irrational ratio of the sizes of the involved rotating elements. We regard the phenomenon as strange nonchaotic self-oscillations, and its existence sheds new light on the question of feasibility of SNA in autonomous systems.

Optimization of motion control laws for tether crawler or elevator systems

NASA Technical Reports Server (NTRS)

Swenson, Frank R.; Von Tiesenhausen, Georg

1988-01-01

Based on the proposal of a motion control law by Lorenzini (1987), a method is developed for optimizing motion control laws for tether crawler or elevator systems in terms of the performance measures of travel time, the smoothness of acceleration and deceleration, and the maximum values of velocity and acceleration. The Lorenzini motion control law, based on powers of the hyperbolic tangent function, is modified by the addition of a constant-velocity section, and this modified function is then optimized by parameter selections to minimize the peak acceleration value for a selected travel time or to minimize travel time for the selected peak values of velocity and acceleration. It is shown that the addition of a constant-velocity segment permits further optimization of the motion control law performance.

Corkscrew Motion of an Electron Beam due to Coherent Variations in Accelerating Potentials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ekdahl, Carl August

2016-09-13

Corkscrew motion results from the interaction of fluctuations of beam electron energy with accidental magnetic dipoles caused by misalignment of the beam transport solenoids. Corkscrew is a serious concern for high-current linear induction accelerators (LIA). A simple scaling law for corkscrew amplitude derived from a theory based on a constant-energy beam coasting through a uniform magnetic field has often been used to assess LIA vulnerability to this effect. We use a beam dynamics code to verify that this scaling also holds for an accelerated beam in a non-uniform magnetic field, as in a real accelerator. Results of simulations with thismore » code are strikingly similar to measurements on one of the LIAs at Los Alamos National Laboratory.« less

The critical role of velocity storage in production of motion sickness

NASA Technical Reports Server (NTRS)

Cohen, Bernard; Dai, Mingjia; Raphan, Theodore; Young, L. R. (Principal Investigator)

2003-01-01

We propose that motion sickness is mediated through the orientation properties of velocity storage in the vestibular system that tend to align eye velocity produced by the angular vestibulo-ocular reflex (aVOR) with gravito-inertial acceleration (GIA). (GIA is the sum of the linear accelerations acting on the head. In the absence of translational accelerations, gravity is the GIA.) We further postulate that motion sickness produced by cross-coupled vestibular stimulation can be characterized by a metric composed of the disparity between the axis of eye rotation and the GIA, the strength of the response to angular motion, and the response duration, as determined by the central vestibular time constant, that is, by the time constant of velocity storage. The nodulus and uvula of the vestibulocerebellum are likely to be the central sites where the disparity is sensed, where the vestibular time constants are habituated, and where links are made to the autonomic system to produce the symptoms and signs.

UAS stealth: target pursuit at constant distance using a bio-inspired motion camouflage guidance law.

PubMed

Strydom, Reuben; Srinivasan, Mandyam V

2017-09-21

The aim of this study is to derive a guidance law by which an unmanned aerial system(s) (UAS) can pursue a moving target at a constant distance, while concealing its own motion. We derive a closed-form solution for the trajectory of the UAS by imposing two key constraints: (1) the shadower moves in such a way as to be perceived as a stationary object by the shadowee, and (2) the distance between the shadower and shadowee is kept constant. Additionally, the theory presented in this paper considers constraints on the maximum achievable speed and acceleration of the shadower. Our theory is tested through Matlab simulations, which validate the camouflage strategy for both 2D and 3D conditions. Furthermore, experiments using a realistic vision-based implementation are conducted in a virtual environment, where the results demonstrate that even with noisy state information it is possible to remain well camouflaged using the constant distance motion camouflage technique.

H0, q0 and the local velocity field. [Hubble and deceleration constants in Big Bang expansion

NASA Technical Reports Server (NTRS)

Sandage, A.; Tammann, G. A.

1982-01-01

An attempt is made to find a systematic deviation from linearity for distances that are under the control of the Virgo cluster, and to determine the value of the mean random motion about the systematic flow, in order to improve the measurement of the Hubble and the deceleration constants. The velocity-distance relation for large and intermediate distances is studied, and type I supernovae are calibrated relatively as distance indicators and absolutely to obtain a new value for the Hubble constant. Methods of determining the deceleration constant are assessed, including determination from direct measurement, mean luminosity density, virgocentric motion, and the time scale test. The very local velocity field is investigated, and a solution is preferred with a random peculiar radial velocity of very nearby field galaxies of 90-100 km/s, and a Virgocentric motion of the local group of 220 km/s, leading to an underlying expansion rate of 55, in satisfactory agreement with the global value.

Kinematic Optimization of Robot Trajectories for Thermal Spray Coating Application

NASA Astrophysics Data System (ADS)

Deng, Sihao; Liang, Hong; Cai, Zhenhua; Liao, Hanlin; Montavon, Ghislain

2014-12-01

Industrial robots are widely used in the field of thermal spray nowadays. Due to their characteristics of high-accuracy and programmable flexibility, spraying on complex geometrical workpieces can be realized in the equipped spray room. However, in some cases, the robots cannot guarantee the process parameters defined by the robot movement, such as the scanning trajectory, spray angle, relative speed between the torch and the substrate, etc., which have distinct influences on heat and mass transfer during the generation of any thermally sprayed coatings. In this study, an investigation on the robot kinematics was proposed to find the rules of motion in a common case. The results showed that the motion behavior of each axis of robot permits to identify the motion problems in the trajectory. This approach allows to optimize the robot trajectory generation in a limited working envelop. It also minimizes the influence of robot performance to achieve a more constant relative scanning speed which is represented as a key parameter in thermal spraying.

The Motion of a Satellite of the Moon

NASA Technical Reports Server (NTRS)

Lass, Harry

1960-01-01

The motion of a satellite of the Moon depends on the potential field due to the Moon as well as the gravitational effects of the Earth and Sun. If one chooses a frame of reference attached to the Moon, it can be shown that the force field resulting from the Sun can be neglected when compared with the perturbing field of the Moon resulting from its oblateness. The effect of the Earth's field on the satellite is of the some order of magnitude as the Moon's perturbing field and must be included in an analysis of the motion of a satellite of the Moon. We will assume that the distance between Earth and Moon remains constant, and we will consider satellite orbits of small eccentricity. It will be shown that a nearly circular polar orbit will digress less than 1 deg from a polar orbit and that the change in eccentricity is less than a factor of e in one year.

The partially filled viscous ring damper.

NASA Technical Reports Server (NTRS)

Alfriend, K. T.

1973-01-01

The problem of a spinning satellite with a partially filled viscous ring damper is investigated. It is shown that there are two distinct modes of motion, the nutation-synchronous mode and spin-synchronous mode. From an approximate solution of the equations of motion a time constant is obtained for each mode. From a consideration of the fluid dynamics several methods are developed for determining the damping constant.

Extended analytical formulas for the perturbed Keplerian motion under a constant control acceleration

NASA Astrophysics Data System (ADS)

Zuiani, Federico; Vasile, Massimiliano

2015-03-01

This paper presents a set of analytical formulae for the perturbed Keplerian motion of a spacecraft under the effect of a constant control acceleration. The proposed set of formulae can treat control accelerations that are fixed in either a rotating or inertial reference frame. Moreover, the contribution of the zonal harmonic is included in the analytical formulae. It will be shown that the proposed analytical theory allows for the fast computation of long, multi-revolution spirals while maintaining good accuracy. The combined effect of different perturbations and of the shadow regions due to solar eclipse is also included. Furthermore, a simplified control parameterisation is introduced to optimise thrusting patterns with two thrust arcs and two cost arcs per revolution. This simple parameterisation is shown to ensure enough flexibility to describe complex low thrust spirals. The accuracy and speed of the proposed analytical formulae are compared against a full numerical integration with different integration schemes. An averaging technique is then proposed as an application of the analytical formulae. Finally, the paper presents an example of design of an optimal low-thrust spiral to transfer a spacecraft from an elliptical to a circular orbit around the Earth.

Note: Attenuation motion of acoustically levitated spherical rotor

NASA Astrophysics Data System (ADS)

Lü, P.; Hong, Z. Y.; Yin, J. F.; Yan, N.; Zhai, W.; Wang, H. P.

2016-11-01

Here we observe the attenuation motion of spherical rotors levitated by near-field acoustic radiation force and analyze the factors that affect the duration time of free rotation. It is found that the rotating speed of freely rotating rotor decreases exponentially with respect to time. The time constant of exponential attenuation motion depends mainly on the levitation height, the mass of rotor, and the depth of concave ultrasound emitter. Large levitation height, large mass of rotor, and small depth of concave emitter are beneficial to increase the time constant and hence extend the duration time of free rotation.

Note: Attenuation motion of acoustically levitated spherical rotor.

PubMed

Lü, P; Hong, Z Y; Yin, J F; Yan, N; Zhai, W; Wang, H P

2016-11-01

Here we observe the attenuation motion of spherical rotors levitated by near-field acoustic radiation force and analyze the factors that affect the duration time of free rotation. It is found that the rotating speed of freely rotating rotor decreases exponentially with respect to time. The time constant of exponential attenuation motion depends mainly on the levitation height, the mass of rotor, and the depth of concave ultrasound emitter. Large levitation height, large mass of rotor, and small depth of concave emitter are beneficial to increase the time constant and hence extend the duration time of free rotation.

Covariant hamiltonian spin dynamics in curved space-time

NASA Astrophysics Data System (ADS)

d'Ambrosi, G.; Satish Kumar, S.; van Holten, J. W.

2015-04-01

The dynamics of spinning particles in curved space-time is discussed, emphasizing the hamiltonian formulation. Different choices of hamiltonians allow for the description of different gravitating systems. We give full results for the simplest case with minimal hamiltonian, constructing constants of motion including spin. The analysis is illustrated by the example of motion in Schwarzschild space-time. We also discuss a non-minimal extension of the hamiltonian giving rise to a gravitational equivalent of the Stern-Gerlach force. We show that this extension respects a large class of known constants of motion for the minimal case.

Motion sickness susceptibility in parabolic flight and velocity storage activity

NASA Technical Reports Server (NTRS)

Dizio, Paul; Lackner, James R.

1991-01-01

In parabolic flight experiments, postrotary nystagmus is as found to be differentially suppressed in free fall (G) and in a high gravitoinertial force (1.8 G) background relative to 1 G. In addition, the influence of postrotary head movements on nystagmus suppression was found to be contingent on G-dependency of the velocity storage and dumping mechanisms. Here, susceptibility to motion sickness during head movements in 0 G and 1.8 G was rank-correlated with the following: (1) the decay time constant of the slow phase velocity of postrotary nystagmus under 1 G, no head movement, baseline conditions, (2) the extent of time constant reduction elicited in 0 G and 1.8 G; (3) the extent of time constant reduction elicited by head tilts in 1 G; and (4) changes in the extent of time constants reduction in 0 G and 1.8 G over repeated tests. Susceptibility was significantly correlated with the extent to which a head movement reduced the time constant in 1 G, was weakly correlated with the baseline time constant, but was not correlated with the extent of reduction in 0 G or 1.8 G. This pattern suggests a link between mechanisms evoking symptoms of space motion sickness and the mechanisms of velocity storage and dumping. Experimental means of evaluating this link are described.

Determination of constant-volume balloon capabilities for aeronautical research. [specifically measurement of atmospheric phenomena

NASA Technical Reports Server (NTRS)

Tatom, F. B.; King, R. L.

1977-01-01

The proper application of constant-volume balloons (CVB) for measurement of atmospheric phenomena was determined. And with the proper interpretation of the resulting data. A literature survey covering 176 references is included. the governing equations describing the three-dimensional motion of a CVB immersed in a flow field are developed. The flowfield model is periodic, three-dimensional, and nonhomogeneous, with mean translational motion. The balloon motion and flow field equations are cast into dimensionless form for greater generality, and certain significant dimensionless groups are identified. An alternate treatment of the balloon motion, based on first-order perturbation analysis, is also presented. A description of the digital computer program, BALLOON, used for numerically integrating the governing equations is provided.

Locus of the apices of projectile trajectories under constant drag

NASA Astrophysics Data System (ADS)

Hernández-Saldaña, H.

2017-11-01

Using the hodograph method, we present an analytical solution for projectile coplanar motion under constant drag, parametrised by the velocity angle. We find the locus formed by the apices of the projectile trajectories, and discuss its implementation for the motion of a particle on an inclined plane in presence of Coulomb friction. The range and time of flight are obtained numerically, and we find that the optimal launching angle is smaller than in the drag-free case. This is a good example of a problem with constant dissipation of energy that includes curvature; it is appropriate for intermediate courses of mechanics.

Multiscale modeling and simulation for polymer melt flows between parallel plates

NASA Astrophysics Data System (ADS)

Yasuda, Shugo; Yamamoto, Ryoichi

2010-03-01

The flow behaviors of polymer melt composed of short chains with ten beads between parallel plates are simulated by using a hybrid method of molecular dynamics and computational fluid dynamics. Three problems are solved: creep motion under a constant shear stress and its recovery motion after removing the stress, pressure-driven flows, and the flows in rapidly oscillating plates. In the creep/recovery problem, the delayed elastic deformation in the creep motion and evident elastic behavior in the recovery motion are demonstrated. The velocity profiles of the melt in pressure-driven flows are quite different from those of Newtonian fluid due to shear thinning. Velocity gradients of the melt become steeper near the plates and flatter at the middle between the plates as the pressure gradient increases and the temperature decreases. In the rapidly oscillating plates, the viscous boundary layer of the melt is much thinner than that of Newtonian fluid due to the shear thinning of the melt. Three different rheological regimes, i.e., the viscous fluid, viscoelastic liquid, and viscoelastic solid regimes, form over the oscillating plate according to the local Deborah numbers. The melt behaves as a viscous fluid in a region for ωτR≲1 , and the crossover between the liquidlike and solidlike regime takes place around ωτα≃1 (where ω is the angular frequency of the plate and τR and τα are Rouse and α relaxation time, respectively).

Multiscale modeling and simulation for polymer melt flows between parallel plates.

PubMed

Yasuda, Shugo; Yamamoto, Ryoichi

2010-03-01

The flow behaviors of polymer melt composed of short chains with ten beads between parallel plates are simulated by using a hybrid method of molecular dynamics and computational fluid dynamics. Three problems are solved: creep motion under a constant shear stress and its recovery motion after removing the stress, pressure-driven flows, and the flows in rapidly oscillating plates. In the creep/recovery problem, the delayed elastic deformation in the creep motion and evident elastic behavior in the recovery motion are demonstrated. The velocity profiles of the melt in pressure-driven flows are quite different from those of Newtonian fluid due to shear thinning. Velocity gradients of the melt become steeper near the plates and flatter at the middle between the plates as the pressure gradient increases and the temperature decreases. In the rapidly oscillating plates, the viscous boundary layer of the melt is much thinner than that of Newtonian fluid due to the shear thinning of the melt. Three different rheological regimes, i.e., the viscous fluid, viscoelastic liquid, and viscoelastic solid regimes, form over the oscillating plate according to the local Deborah numbers. The melt behaves as a viscous fluid in a region for omegatauR < approximately 1 , and the crossover between the liquidlike and solidlike regime takes place around omegataualpha approximately equal 1 (where omega is the angular frequency of the plate and tauR and taualpha are Rouse and alpha relaxation time, respectively).

Differential equations in airplane mechanics

NASA Technical Reports Server (NTRS)

Carleman, M T

1922-01-01

In the following report, we will first draw some conclusions of purely theoretical interest, from the general equations of motion. At the end, we will consider the motion of an airplane, with the engine dead and with the assumption that the angle of attack remains constant. Thus we arrive at a simple result, which can be rendered practically utilizable for determining the trajectory of an airplane descending at a constant steering angle.

Theory of relativistic Brownian motion in the presence of electromagnetic field in (1+1) dimension

NASA Astrophysics Data System (ADS)

Mukhopadhyay, Annesh; Bandyopadhyay, M.; Bhamidipati, C.

2018-04-01

In this work, we consider the relativistic generalization of the theory of Brownian motion for the (1+1) dimensional case, which is again consistent with Einstein's special theory of relativity and reduces to standard Brownian motion in the Newtonian limit. All the generalizations are made considering Special theory of relativity into account. The particle under consideration has a velocity close to the speed of light and is a free Brownian particle suspended in a heat bath. With this generalization the velocity probability density functions are also obtained using Ito, Stratonovich and Hanggi-Klimontovich approach of pre-point, mid-point and post-point discretization rule. Subsequently, in our work, we have obtained the relativistic Langevin equations in the presence of an electromagnetic field. Finally, taking a special case of a constant vector potential and a constant electric field into account the Langevin equations are solved for the momentum and subsequently the velocity of the particle. Using a similar approach to the Fokker-planck equations of motion, the velocity distributions are also obtained in the presence of a constant vector potential and are plotted, which shows essential deviations from the one obtained without a potential. Our constant potential model can be realized in an optical potential.

The relation of motion sickness to the spatial-temporal properties of velocity storage

NASA Technical Reports Server (NTRS)

Dai, Mingjia; Kunin, Mikhail; Raphan, Theodore; Cohen, Bernard; Young, L. R. (Principal Investigator)

2003-01-01

Tilting the head in roll to or from the upright while rotating at a constant velocity (roll while rotating, RWR) alters the position of the semicircular canals relative to the axis of rotation. This produces vertical and horizontal nystagmus, disorientation, vertigo, and nausea. With recurrent exposure, subjects habituate and can make more head movements before experiencing overpowering motion sickness. We questioned whether promethazine lessened the vertigo or delayed the habituation, whether habituation of the vertigo was related to the central vestibular time constant, i.e., to the time constant of velocity storage, and whether the severity of the motion sickness was related to deviation of the axis of eye velocity from gravity. Sixteen subjects received promethazine and placebo in a double-blind, crossover study in two consecutive 4-day test series 1 month apart, termed series I and II. Horizontal and vertical eye movements were recorded with video-oculography while subjects performed roll head movements of approx. 45 degrees over 2 s to and from the upright position while being rotated at 138 degrees /s around a vertical axis. Motion sickness was scaled from 1 (no sickness) to an endpoint of 20, at which time the subject was too sick to continue or was about to vomit. Habituation was determined by the number of head movements that subjects made before reaching the maximum motion sickness score of 20. Head movements increased steadily in each session with repeated testing, and there was no difference between the number of head movements made by the promethazine and placebo groups. Horizontal and vertical angular vestibulo-ocular reflex (aVOR) time constants declined in each test, with the declines being closely correlated to the increase in the number of head movements. The strength of vertiginous sensation was associated with the amount of deviation of the axis of eye velocity from gravity; the larger the deviation of the eye velocity axis from gravity, the more severe the motion sickness. Thus, promethazine neither reduced the nausea associated with RWR, nor retarded or hastened habituation. The inverse relationship between the aVOR time constants and number of head movements to motion sickness, and the association of the severity of motion sickness with the extent, strength, and time of deviation of eye velocity from gravity supports the postulate that the spatiotemporal properties of velocity storage, which are processed between the nodulus and uvula of the vestibulocerebellum and the vestibular nuclei, are likely to represent the source of the conflict responsible for producing motion sickness.

Impact of mutation on proton transfer reactions in ketosteroid isomerase: insights from molecular dynamics simulations.

PubMed

Chakravorty, Dhruva K; Hammes-Schiffer, Sharon

2010-06-02

The two proton transfer reactions catalyzed by ketosteroid isomerase (KSI) involve a dienolate intermediate stabilized by hydrogen bonds with Tyr14 and Asp99. Molecular dynamics simulations based on an empirical valence bond model are used to examine the impact of mutating these residues on the hydrogen-bonding patterns, conformational changes, and van der Waals and electrostatic interactions during the proton transfer reactions. While the rate constants for the two proton transfer steps are similar for wild-type (WT) KSI, the simulations suggest that the rate constant for the first proton transfer step is smaller in the mutants due to the significantly higher free energy of the dienolate intermediate relative to the reactant. The calculated rate constants for the mutants D99L, Y14F, and Y14F/D99L relative to WT KSI are qualitatively consistent with the kinetic experiments indicating a significant reduction in the catalytic rates along the series of mutants. In the simulations, WT KSI retained two hydrogen-bonding interactions between the substrate and the active site, while the mutants typically retained only one hydrogen-bonding interaction. A new hydrogen-bonding interaction between the substrate and Tyr55 was observed in the double mutant, leading to the prediction that mutation of Tyr55 will have a greater impact on the proton transfer rate constants for the double mutant than for WT KSI. The electrostatic stabilization of the dienolate intermediate relative to the reactant was greater for WT KSI than for the mutants, providing a qualitative explanation for the significantly reduced rates of the mutants. The active site exhibited restricted motion during the proton transfer reactions, but small conformational changes occurred to facilitate the proton transfer reactions by strengthening the hydrogen-bonding interactions and by bringing the proton donor and acceptor closer to each other with the proper orientation for proton transfer. Thus, these calculations suggest that KSI forms a preorganized active site but that the structure of this preorganized active site is altered upon mutation. Moreover, small conformational changes due to stochastic thermal motions are required within this preorganized active site to facilitate the proton transfer reactions.

Effect of Induced Charge Electroosmosis on the Dielectrophoretic Motion of Particles

NASA Astrophysics Data System (ADS)

Swaminathan, T.; Hu, Howard

2006-11-01

Most suspensions involve the formation of ionic double layers next to the surface of particles due to the induced-charge on the surface. These double layers affect the motion of the particle even under AC electric fields. They modify the net dipole moment of the particle and at the same time produce slip velocities on the surfaces of these particles. A method to numerically evaluate the effect of the double layer on the dielectrophoretic motion of particles has been previously developed to study these two effects. The technique involves a matched asymptotic expansion of the electric field near the particle surface, where the double layer is formed, and is written as a jump-boundary-condition for the electric potential when the thickness of the double layer is small compared to the size of the particle. The developed jump-boundary-condition is then used to calculate an effective zeta potential on the particle surface. Unlike classical electroosmosis, this zeta potential is no longer constant on every part of the surface and is dependent on the applied electric field. The effect of the induced-charge electroosmotic slip velocity on the dielectrophoretic motion of particles has been observed using this technique.

Enhanced laser absorption from radiation pressure in intense laser plasma interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dollar, F.; Zulick, C.; Raymond, A.

The reflectivity of a short-pulse laser at intensities of 2 x 10 21Wcm -2 with ultra-high contrast (10 -15) on sub-micrometer silicon nitride foilswas studied experimentally using varying polarizations and target thicknesses. Furthermore, the reflected intensity and beam quality were found to be relatively constant with respect to intensity for bulk targets. For submicron targets, the measured reflectivity drops substantially without a corresponding increase in transmission, indicating increased conversion of fundamental to other wavelengths and particle heating. The experimental results and trends we observed in 3D particle-in-cell simulations emphasize the critical role of ion motion due to radiation pressure onmore » the absorption process. Ion motion during ultra-short pulses enhances the electron heating, which subsequently transfers more energy to the ions.« less

Enhanced laser absorption from radiation pressure in intense laser plasma interactions

DOE PAGES

Dollar, F.; Zulick, C.; Raymond, A.; ...

2017-06-06

The reflectivity of a short-pulse laser at intensities of 2 x 10 21Wcm -2 with ultra-high contrast (10 -15) on sub-micrometer silicon nitride foilswas studied experimentally using varying polarizations and target thicknesses. Furthermore, the reflected intensity and beam quality were found to be relatively constant with respect to intensity for bulk targets. For submicron targets, the measured reflectivity drops substantially without a corresponding increase in transmission, indicating increased conversion of fundamental to other wavelengths and particle heating. The experimental results and trends we observed in 3D particle-in-cell simulations emphasize the critical role of ion motion due to radiation pressure onmore » the absorption process. Ion motion during ultra-short pulses enhances the electron heating, which subsequently transfers more energy to the ions.« less

Preliminary results on the feasibility of using ultrasound to monitor intrafractional motion during radiation therapy for pancreatic cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Omari, Eenas A.; Erickson, Beth; Noid, George

Purpose: Substantial intrafraction organ motion during radiation therapy (RT) for pancreatic cancer is well recognized as a major limiting factor for accurate delivery of RT. The aim of this work is to determine the feasibility of monitoring the intrafractional motion of the pancreas or surrounding structures using ultrasound for RT delivery. Methods: Transabdominal ultrasound (TAUS) and 4DCT data were acquired on ten pancreatic cancer patients during radiation therapy process in a prospective study. In addition, TAUS and MRI were collected for five healthy volunteers. The portal vein (PV) and the head of the pancreas (HP) along with other structures weremore » contoured on these images. Volume changes, distance between the HP and PV, and motion difference between the HP and PV were measured to examine whether PV can be used as a motion surrogate for HP. TAUS images were acquired and processed using a research version of the Clarity autoscan ultrasound system (CAUS). Motion monitoring was performed with the ultrasound probe mounted on an arm fixed to the couch. Video segments of the monitoring sessions were captured. Results: On TAUS, PV is better visualized than HP. The measured mean volume deviation for all patients for the HP and PV was 1.4 and 0.6 ml, respectively. The distance between the HP and PV was close to a constant with 0.22 mm mean deviation throughout the ten breathing phases. The mean of the absolute motion difference for all patients was 1.7 ± 0.8 mm in LR, 1.5 ± 0.5 mm in AP, and 2.3 ± 0.7 mm in SI, suggesting that the PV is a good surrogate for HP motion estimation. By using this surrogate, the HP motion tracking using TAUS was demonstrated. Conclusions: Large intrafractional organ motion due to respiratory and/or bowel motion is a limiting factor in administering curative radiation doses to pancreatic tumors. The authors investigate the use of real-time ultrasound to track pancreas motion. Due to the poor visibility of the pancreas head on an ultrasound image, the portal vein is identified as a surrogate. The authors have demonstrated the feasibility of tracking HP motion through the localization of the PV using TAUS. This will potentially allow real-time tracking of intrafractional motion to justify small PTV-margins and to account for unusual motions, thus, improving normal tissue sparing.« less

The motion of a vortex on a closed surface of constant negative curvature.

PubMed

Ragazzo, C Grotta

2017-10-01

The purpose of this work is to present an algorithm to determine the motion of a single hydrodynamic vortex on a closed surface of constant curvature and of genus greater than one. The algorithm is based on a relation between the Laplace-Beltrami Green function and the heat kernel. The algorithm is used to compute the motion of a vortex on the Bolza surface. This is the first determination of the orbits of a vortex on a closed surface of genus greater than one. The numerical results show that all the 46 vortex equilibria can be explicitly computed using the symmetries of the Bolza surface. Some of these equilibria allow for the construction of the first two examples of infinite vortex crystals on the hyperbolic disc. The following theorem is proved: 'a Weierstrass point of a hyperellitic surface of constant curvature is always a vortex equilibrium'.

Perpendicular diffusion of a dilute beam of charged particles in the PK-4 dusty plasma

NASA Astrophysics Data System (ADS)

Liu, Bin; Goree, John

2015-09-01

We study the random walk of a dilute beam of projectile dust particles that drift through a target dusty plasma. This random walk is a diffusion that occurs mainly due to Coulomb collisions with target particles that have a different size. In the direction parallel to the drift, projectiles exhibit mobility-limited motion with a constant average velocity. We use a 3D molecular dynamics (MD) simulation of the dust particle motion to determine the diffusion and mobility coefficients for the dilute beam. The dust particles are assumed to interact with a shielded Coulomb repulsion. They also experience gas drag. The beam particles are driven by a prescribed net force that is not applied to the target particles; in the experiments this net force is due to an imbalance of the electric and ion drag forces. This simulation is motivated by microgravity experiments, with the expectation that the scattering of projectiles studied here will be observed in upcoming PK-4 experiments on the International Space Station. Supported by NASA and DOE.

Evolution of the Carter constant for inspirals into a black hole: Effect of the black hole quadrupole

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flanagan, Eanna E.; Laboratory for Elementary Particle Physics, Cornell University, Ithaca, New York 14853; Hinderer, Tanja

2007-06-15

We analyze the effect of gravitational radiation reaction on generic orbits around a body with an axisymmetric mass quadrupole moment Q to linear order in Q, to the leading post-Newtonian order, and to linear order in the mass ratio. This system admits three constants of the motion in absence of radiation reaction: energy, angular momentum along the symmetry axis, and a third constant analogous to the Carter constant. We compute instantaneous and time-averaged rates of change of these three constants. For a point particle orbiting a black hole, Ryan has computed the leading order evolution of the orbit's Carter constant,more » which is linear in the spin. Our result, when combined with an interaction quadratic in the spin (the coupling of the black hole's spin to its own radiation reaction field), gives the next to leading order evolution. The effect of the quadrupole, like that of the linear spin term, is to circularize eccentric orbits and to drive the orbital plane towards antialignment with the symmetry axis. In addition we consider a system of two point masses where one body has a single mass multipole or current multipole of order l. To linear order in the mass ratio, to linear order in the multipole, and to the leading post-Newtonian order, we show that there does not exist an analog of the Carter constant for such a system (except for the cases of an l=1 current moment and an l=2 mass moment). Thus, the existence of the Carter constant in Kerr depends on interaction effects between the different multipoles. With mild additional assumptions, this result falsifies the conjecture that all vacuum, axisymmetric spacetimes possess a third constant of the motion for geodesic motion.« less

Microfabricated microengine with constant rotation rate

DOEpatents

Romero, Louis A.; Dickey, Fred M.

1999-01-01

A microengine uses two synchronized linear actuators as a power source and converts oscillatory motion from the actuators into constant rotational motion via direct linkage connection to an output gear or wheel. The microengine provides output in the form of a continuously rotating output gear that is capable of delivering drive torque at a constant rotation to a micromechanism. The output gear can have gear teeth on its outer perimeter for directly contacting a micromechanism requiring mechanical power. The gear is retained by a retaining means which allows said gear to rotate freely. The microengine is microfabricated of polysilicon on one wafer using surface micromachining batch fabrication.

The rate constant of a quantum-diffusion-controlled bimolecular reaction

NASA Astrophysics Data System (ADS)

Bondarev, B. V.

1986-04-01

A quantum-mechanical equation is derived in the tight-bond approximation which describes the motion and chemical interaction of a pair of species A and B when their displacement in the matrix is caused by tunnelling. Within the framework of the discrete model of random walks, definitions are given of the probability and rate constant of a reaction A + B → P (products) proceeding in a condensed medium. A method is suggested for calculating the rate constant of a quantum-diffusion-controlled bimolecular reaction. By this method, an expression is obtained for the rate constant in the stationary spherically symmetrical case. An equation for the density matrix is also proposed which describes the motion and chemical interaction of a pair of species when the quantum and classical diffusion are competitive.

Complex methyl group and hydrogen-bonded proton motions in terms of the Arrhenius and Schrödinger equations.

PubMed

Latanowicz, L

2008-01-01

Equations for the temperature dependence of the spectral densities J(is)(m)(momega(I) +/-omega(T)), where m=1, 2, omega(I) and omega(T) are the resonance and tunnel splitting angular frequencies, in the presence of a complex motion, have been derived. The spin pairs of the protons or deuterons of the methyl group perform a complex motion consisting of three component motions. Two of them involve mass transportation over the barrier and through the barrier. They are characterized by k((H)) (Arrhenius) and k((T)) (Schrödinger) rate constants, respectively. The third motion causes fluctuations of the frequencies (nomega(I)+/-omega(T)) and it is related to the lifetime of the methyl spin at the energy level influenced by the rotor-bath interactions. These interactions induce rapid transitions, changing the symmetry of the torsional sublevels either from A to E or from E(a) to E(b). The correlation function for this third motion (k((omega)) rate constant) has been proposed by Müller-Warmuth et al. The spectral densities of the methyl group hindered rotation (k((H)), k((T)) and k((omega)) rate constants) differ from the spectral densities of the proton transfer (k((H)) and k((T)) rate constants) because three compound motions contribute to the complex motion of the methyl group. The recently derived equation [Formula: see text] , where [Formula: see text] and [Formula: see text] are the fraction and energy of particles with energies from zero to E(H), is taken into account in the calculations of the spectral densities. This equation follows from Maxwell's distribution of thermal energy. The spectral densities derived are applied to analyse the experimental temperature dependencies of proton and deuteron spin-lattice relaxation rate in solids containing the methyl group. A wide range of temperatures from zero Kelvin up to the melting point is considered. It has been established that the motion characterized by k((omega)) influences the spin-lattice relaxation up to the temperature T(tun) only. This temperature is directly determined by the equation C(p)T=E(H) (thermal energy=activation energy), where C(p) is the molar heat capacity. Probably the cessation of the third motion is a result of the de Broglie wavelength related to this motion becoming too short. As shown recently, the potential barrier can be an obstacle for the de Broglie wave. The theoretical equations derived in this paper are compared to those known in the literature.

Driving performance changes of middle-aged experienced taxi drivers due to distraction tasks during unexpected situations.

PubMed

Kim, Hyung-Sik; Choi, Mi-Hyun; Choi, Jin-Seung; Kim, Hyun-Joo; Hong, Sang-Pyo; Jun, Jae-Hoon; Tack, Gye-Rae; Kim, Boseong; Min, Ung-Chan; Lim, Dae-Woon; Chung, Soon-Cheol

2013-10-01

This study investigated the effects of distraction taskssuch as sending a text message with a cellphone and searching navigation with car navigation system-on the driving performance of 29 highly experienced taxi drivers in their 50s. All participants were instructed to drive using a driving simulator for 2 min. while maintaining a constant distance from the vehicle in front and a constant speed. Participants drove without any distractions for the first minute. For an additional minute, they performed Driving Only or performed a task while driving (Driving + Sending Text Message or Driving + Searching Navigation). An unexpected situation, in which the participant had to stop abruptly due to a sudden stop of the preceding vehicle, occurred during this period. Driving performance during the unexpected situation was evaluated by car control variables, medial-lateral coefficient of variation and brake time, and by motion variables such as the jerk-cost function. Compared to Driving Only, jerk-cost function, medial-lateral coefficient of variation, and brake time increased during Driving + Sending Text Message or Driving + Searching Navigation.

Microgravity combustion of dust suspensions

NASA Technical Reports Server (NTRS)

Lee, John H. S.; Peraldi, Olivier; Knystautas, Rom

1993-01-01

Unlike the combustion of homogeneous gas mixtures, there are practically no reliable fundamental data (i.e., laminar burning velocity, flammability limits, quenching distance, minimum ignition energy) for the combustion of heterogeneous dust suspensions. Even the equilibrium thermodynamic data such as the constant pressure volume combustion pressure and the constant pressure adiabatic flame temperature are not accurately known for dust mixtures. This is mainly due to the problem of gravity sedimentation. In normal gravity, turbulence, convective flow, electric and acoustic fields are required to maintain a dust in suspension. These external influences have a dominating effect on the combustion processes. Microgravity offers a unique environment where a quiescent dust cloud can in principle be maintained for a sufficiently long duration for almost all combustion experiments (dust suspensions are inherently unstable due to Brownian motion and particle aggregation). Thus, the microgravity duration provided by drop towers, parabolic flights, and the space shuttle, can all be exploited for different kinds of dust combustion experiments. The present paper describes some recent studies on microgravity combustion of dust suspension carried out on the KC-135 and the Caravelle aircraft. The results reported are obtained from three parabolic flight campaigns.

Analysis of high-speed rotating flow inside gas centrifuge casing

NASA Astrophysics Data System (ADS)

Pradhan, Sahadev, , Dr.

2017-10-01

The generalized analytical model for the radial boundary layer inside the gas centrifuge casing in which the inner cylinder is rotating at a constant angular velocity Ω_i while the outer one is stationary, is formulated for studying the secondary gas flow field due to wall thermal forcing, inflow/outflow of light gas along the boundaries, as well as due to the combination of the above two external forcing. The analytical model includes the sixth order differential equation for the radial boundary layer at the cylindrical curved surface in terms of master potential (χ) , which is derived from the equations of motion in an axisymmetric (r - z) plane. The linearization approximation is used, where the equations of motion are truncated at linear order in the velocity and pressure disturbances to the base flow, which is a solid-body rotation. Additional approximations in the analytical model include constant temperature in the base state (isothermal compressible Couette flow), high aspect ratio (length is large compared to the annular gap), high Reynolds number, but there is no limitation on the Mach number. The discrete eigenvalues and eigenfunctions of the linear operators (sixth-order in the radial direction for the generalized analytical equation) are obtained. The solutions for the secondary flow is determined in terms of these eigenvalues and eigenfunctions. These solutions are compared with direct simulation Monte Carlo (DSMC) simulations and found excellent agreement (with a difference of less than 15%) between the predictions of the analytical model and the DSMC simulations, provided the boundary conditions in the analytical model are accurately specified.

Analysis of high-speed rotating flow inside gas centrifuge casing

NASA Astrophysics Data System (ADS)

Pradhan, Sahadev, , Dr.

2017-09-01

The generalized analytical model for the radial boundary layer inside the gas centrifuge casing in which the inner cylinder is rotating at a constant angular velocity Ωi while the outer one is stationary, is formulated for studying the secondary gas flow field due to wall thermal forcing, inflow/outflow of light gas along the boundaries, as well as due to the combination of the above two external forcing. The analytical model includes the sixth order differential equation for the radial boundary layer at the cylindrical curved surface in terms of master potential (χ) , which is derived from the equations of motion in an axisymmetric (r - z) plane. The linearization approximation is used, where the equations of motion are truncated at linear order in the velocity and pressure disturbances to the base flow, which is a solid-body rotation. Additional approximations in the analytical model include constant temperature in the base state (isothermal compressible Couette flow), high aspect ratio (length is large compared to the annular gap), high Reynolds number, but there is no limitation on the Mach number. The discrete eigenvalues and eigenfunctions of the linear operators (sixth-order in the radial direction for the generalized analytical equation) are obtained. The solutions for the secondary flow is determined in terms of these eigenvalues and eigenfunctions. These solutions are compared with direct simulation Monte Carlo (DSMC) simulations and found excellent agreement (with a difference of less than 15%) between the predictions of the analytical model and the DSMC simulations, provided the boundary conditions in the analytical model are accurately specified.

Analysis of high-speed rotating flow inside gas centrifuge casing

NASA Astrophysics Data System (ADS)

Pradhan, Sahadev

2017-11-01

The generalized analytical model for the radial boundary layer inside the gas centrifuge casing in which the inner cylinder is rotating at a constant angular velocity Ωi while the outer one is stationary, is formulated for studying the secondary gas flow field due to wall thermal forcing, inflow/outflow of light gas along the boundaries, as well as due to the combination of the above two external forcing. The analytical model includes the sixth order differential equation for the radial boundary layer at the cylindrical curved surface in terms of master potential (χ) , which is derived from the equations of motion in an axisymmetric (r - z) plane. The linearization approximation is used, where the equations of motion are truncated at linear order in the velocity and pressure disturbances to the base flow, which is a solid-body rotation. Additional approximations in the analytical model include constant temperature in the base state (isothermal compressible Couette flow), high aspect ratio (length is large compared to the annular gap), high Reynolds number, but there is no limitation on the Mach number. The discrete eigenvalues and eigenfunctions of the linear operators (sixth-order in the radial direction for the generalized analytical equation) are obtained. The solutions for the secondary flow is determined in terms of these eigenvalues and eigenfunctions. These solutions are compared with direct simulation Monte Carlo (DSMC) simulations and found excellent agreement (with a difference of less than 15%) between the predictions of the analytical model and the DSMC simulations, provided the boundary conditions in the analytical model are accurately specified.

Theory of activated penetrant diffusion in viscous fluids and colloidal suspensions

NASA Astrophysics Data System (ADS)

Zhang, Rui; Schweizer, Kenneth S.

2015-10-01

We heuristically formulate a microscopic, force level, self-consistent nonlinear Langevin equation theory for activated barrier hopping and non-hydrodynamic diffusion of a hard sphere penetrant in very dense hard sphere fluid matrices. Penetrant dynamics is controlled by a rich competition between force relaxation due to penetrant self-motion and collective matrix structural (alpha) relaxation. In the absence of penetrant-matrix attraction, three activated dynamical regimes are predicted as a function of penetrant-matrix size ratio which are physically distinguished by penetrant jump distance and the nature of matrix motion required to facilitate its hopping. The penetrant diffusion constant decreases the fastest with size ratio for relatively small penetrants where the matrix effectively acts as a vibrating amorphous solid. Increasing penetrant-matrix attraction strength reduces penetrant diffusivity due to physical bonding. For size ratios approaching unity, a distinct dynamical regime emerges associated with strong slaving of penetrant hopping to matrix structural relaxation. A crossover regime at intermediate penetrant-matrix size ratio connects the two limiting behaviors for hard penetrants, but essentially disappears if there are strong attractions with the matrix. Activated penetrant diffusivity decreases strongly with matrix volume fraction in a manner that intensifies as the size ratio increases. We propose and implement a quasi-universal approach for activated diffusion of a rigid atomic/molecular penetrant in a supercooled liquid based on a mapping between the hard sphere system and thermal liquids. Calculations for specific systems agree reasonably well with experiments over a wide range of temperature, covering more than 10 orders of magnitude of variation of the penetrant diffusion constant.

Theory of activated penetrant diffusion in viscous fluids and colloidal suspensions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Rui; Schweizer, Kenneth S., E-mail: kschweiz@illinois.edu

2015-10-14

We heuristically formulate a microscopic, force level, self-consistent nonlinear Langevin equation theory for activated barrier hopping and non-hydrodynamic diffusion of a hard sphere penetrant in very dense hard sphere fluid matrices. Penetrant dynamics is controlled by a rich competition between force relaxation due to penetrant self-motion and collective matrix structural (alpha) relaxation. In the absence of penetrant-matrix attraction, three activated dynamical regimes are predicted as a function of penetrant-matrix size ratio which are physically distinguished by penetrant jump distance and the nature of matrix motion required to facilitate its hopping. The penetrant diffusion constant decreases the fastest with size ratiomore » for relatively small penetrants where the matrix effectively acts as a vibrating amorphous solid. Increasing penetrant-matrix attraction strength reduces penetrant diffusivity due to physical bonding. For size ratios approaching unity, a distinct dynamical regime emerges associated with strong slaving of penetrant hopping to matrix structural relaxation. A crossover regime at intermediate penetrant-matrix size ratio connects the two limiting behaviors for hard penetrants, but essentially disappears if there are strong attractions with the matrix. Activated penetrant diffusivity decreases strongly with matrix volume fraction in a manner that intensifies as the size ratio increases. We propose and implement a quasi-universal approach for activated diffusion of a rigid atomic/molecular penetrant in a supercooled liquid based on a mapping between the hard sphere system and thermal liquids. Calculations for specific systems agree reasonably well with experiments over a wide range of temperature, covering more than 10 orders of magnitude of variation of the penetrant diffusion constant.« less

Local motion adaptation enhances the representation of spatial structure at EMD arrays

PubMed Central

Lindemann, Jens P.; Egelhaaf, Martin

2017-01-01

Neuronal representation and extraction of spatial information are essential for behavioral control. For flying insects, a plausible way to gain spatial information is to exploit distance-dependent optic flow that is generated during translational self-motion. Optic flow is computed by arrays of local motion detectors retinotopically arranged in the second neuropile layer of the insect visual system. These motion detectors have adaptive response characteristics, i.e. their responses to motion with a constant or only slowly changing velocity decrease, while their sensitivity to rapid velocity changes is maintained or even increases. We analyzed by a modeling approach how motion adaptation affects signal representation at the output of arrays of motion detectors during simulated flight in artificial and natural 3D environments. We focused on translational flight, because spatial information is only contained in the optic flow induced by translational locomotion. Indeed, flies, bees and other insects segregate their flight into relatively long intersaccadic translational flight sections interspersed with brief and rapid saccadic turns, presumably to maximize periods of translation (80% of the flight). With a novel adaptive model of the insect visual motion pathway we could show that the motion detector responses to background structures of cluttered environments are largely attenuated as a consequence of motion adaptation, while responses to foreground objects stay constant or even increase. This conclusion even holds under the dynamic flight conditions of insects. PMID:29281631

Influence of interfacial viscosity on the dielectrophoresis of drops

NASA Astrophysics Data System (ADS)

Mandal, Shubhadeep; Chakraborty, Suman

2017-05-01

The dielectrophoresis of a Newtonian uncharged drop in the presence of an axisymmetric nonuniform DC electric field is studied analytically. The present study is focused on the effects of interfacial viscosities on the dielectrophoretic motion and shape deformation of an isolated suspended drop. The interfacial viscosities generate surface-excess viscous stress which is modeled as a two-dimensional Newtonian fluid which obeys the Boussinesq-Scriven constitutive law with constant values of interfacial tension, interfacial shear, and dilatational viscosities. In the regime of small drop deformation, we have obtained analytical solution for the drop velocity and deformed shape by neglecting surface charge convection and fluid inertia. Our study demonstrates that the drop velocity is independent of the interfacial shear viscosity, while the interfacial dilatational viscosity strongly affects the drop velocity. The interfacial viscous effects always retard the dielectrophoretic motion of a perfectly conducting/dielectric drop. Notably, the interfacial viscous effects can retard or augment the dielectrophoretic motion of a leaky dielectric drop depending on the electrohydrodynamic properties. The shape deformation of a leaky dielectric drop is found to decrease (or increase) due to interfacial shear (or dilatational) viscosity.

Variation in Angular Velocity and Angular Acceleration of a Particle in Rectilinear Motion

ERIC Educational Resources Information Center

Mashood, K. K.; Singh, V. A.

2012-01-01

We discuss the angular velocity ([image omitted]) and angular acceleration ([image omitted]) associated with a particle in rectilinear motion with constant acceleration. The discussion was motivated by an observation that students and even teachers have difficulty in ascribing rotational motion concepts to a particle when the trajectory is a…

A Simon Effect With Stationary Moving Stimuli

ERIC Educational Resources Information Center

Bosbach, Simone; Prinz, Wolfgang; Kerzel, Dirk

2004-01-01

To clarify whether motion information per se has a separable influence on action control, the authors investigated whether irrelevant direction of motion of stimuli whose overall position was constant over time would affect manual left-right responses (i.e., reveal a motion-based Simon effect). In Experiments 1 and 2, significant Simon effects…

A numerical study of circulation driven by mixing over a submarine bank

NASA Astrophysics Data System (ADS)

Cummins, Patrick F.; Foreman, Michael G. G.

1998-04-01

A primitive equation model is applied to study the spin-up of a linearly stratified, rotating fluid over an isolated topographic bank. The model has vertical eddy mixing coefficients that decay away from the bottom over a specified e-folding scale. No external flows are imposed, and a circulation develops due solely to diffusion over the sea bed. Vertical mixing, coupled with the condition of zero diffusive flux of heat through the sea floor, leads to a distortion of isothermal surfaces near the bottom. The associated radial pressure gradients drive a radial-overturning circulation with upslope flow just above the bottom and downslope flows at greater height. Coriolis forces on the radial flows accelerate a verticallysheared azimuthal (alongslope) circulation. Near the bottom the azimuthal motion is cyclonic (upwelling favourable), while outside the boundary layer, the motion is anticyclonic. Sensitivity experiments show that this pattern is robust and maintained even with constant mixing coefficients. Attention is given to the driving mechanism for the depth-averaged azimuthal motion. An analysis of the relative angular momentum balance determines that the torque associated with bottom stresses drives the anticyclonic depth-averaged flow. In terms of vorticity, the anticyclonic vortex over the bank arises due to the curl of bottom stress divided by the depth. A parameter sensitivity study indicates that the depth-averaged flow is relatively insensitive to variations in the bottom drag coefficient.

Self-aligning biaxial load frame

DOEpatents

Ward, M.B.; Epstein, J.S.; Lloyd, W.R.

1994-01-18

An self-aligning biaxial loading apparatus for use in testing the strength of specimens while maintaining a constant specimen centroid during the loading operation. The self-aligning biaxial loading apparatus consists of a load frame and two load assemblies for imparting two independent perpendicular forces upon a test specimen. The constant test specimen centroid is maintained by providing elements for linear motion of the load frame relative to a fixed cross head, and by alignment and linear motion elements of one load assembly relative to the load frame. 3 figures.

Self-aligning biaxial load frame

DOEpatents

Ward, Michael B.; Epstein, Jonathan S.; Lloyd, W. Randolph

1994-01-01

An self-aligning biaxial loading apparatus for use in testing the strength of specimens while maintaining a constant specimen centroid during the loading operation. The self-aligning biaxial loading apparatus consists of a load frame and two load assemblies for imparting two independent perpendicular forces upon a test specimen. The constant test specimen centroid is maintained by providing elements for linear motion of the load frame relative to a fixed crosshead, and by alignment and linear motion elements of one load assembly relative to the load frame.

An Electromagnetically Actuated Vacuum Circuit Breaker Developed by Electromagnetic Analysis Coupled with Motion

NASA Astrophysics Data System (ADS)

Takeuchi, Toshie; Nakagawa, Takafumi; Tsukima, Mitsuru; Koyama, Kenichi; Tohya, Nobumoto; Yano, Tomotaka

A new electromagnetically actuated vacuum circuit breaker (VCB) has been designed and developed on the basis of the transient electromagnetic analysis coupled with motion. The VCB has three advanced bi-stable electromagnetic actuators, which control each phase independently. The VCB serves as a synchronous circuit breaker as well as a standard circuit breaker. In this work, the flux delay due to the eddy current is analytically formulated using the delay time constant of the actuator coil current, thereby leading to accurate driving behavior. With this analytical method, the electromagnetic mechanism for a 24kV rated VCB has been optimized; and as a result, the driving energy is reduced to one fifth of that of a conventional VCB employing spring mechanism, and the number of parts is significantly decreased. Therefore, the developed VCB becomes compact, highly reliable and highly durable.

Generalized parallel-perspective stereo mosaics from airborne video.

PubMed

Zhu, Zhigang; Hanson, Allen R; Riseman, Edward M

2004-02-01

In this paper, we present a new method for automatically and efficiently generating stereoscopic mosaics by seamless registration of images collected by a video camera mounted on an airborne platform. Using a parallel-perspective representation, a pair of geometrically registered stereo mosaics can be precisely constructed under quite general motion. A novel parallel ray interpolation for stereo mosaicing (PRISM) approach is proposed to make stereo mosaics seamless in the presence of obvious motion parallax and for rather arbitrary scenes. Parallel-perspective stereo mosaics generated with the PRISM method have better depth resolution than perspective stereo due to the adaptive baseline geometry. Moreover, unlike previous results showing that parallel-perspective stereo has a constant depth error, we conclude that the depth estimation error of stereo mosaics is in fact a linear function of the absolute depths of a scene. Experimental results on long video sequences are given.

Towards a general neural controller for quadrupedal locomotion.

PubMed

Maufroy, Christophe; Kimura, Hiroshi; Takase, Kunikatsu

2008-05-01

Our study aims at the design and implementation of a general controller for quadruped locomotion, allowing the robot to use the whole range of quadrupedal gaits (i.e. from low speed walking to fast running). A general legged locomotion controller must integrate both posture control and rhythmic motion control and have the ability to shift continuously from one control method to the other according to locomotion speed. We are developing such a general quadrupedal locomotion controller by using a neural model involving a CPG (Central Pattern Generator) utilizing ground reaction force sensory feedback. We used a biologically faithful musculoskeletal model with a spine and hind legs, and computationally simulated stable stepping motion at various speeds using the neuro-mechanical system combining the neural controller and the musculoskeletal model. We compared the changes of the most important locomotion characteristics (stepping period, duty ratio and support length) according to speed in our simulations with the data on real cat walking. We found similar tendencies for all of them. In particular, the swing period was approximately constant while the stance period decreased with speed, resulting in a decreasing stepping period and duty ratio. Moreover, the support length increased with speed due to the posterior extreme position that shifted progressively caudally, while the anterior extreme position was approximately constant. This indicates that we succeeded in reproducing to some extent the motion of a cat from the kinematical point of view, even though we used a 2D bipedal model. We expect that such computational models will become essential tools for legged locomotion neuroscience in the future.

Processing of targets in smooth or apparent motion along the vertical in the human brain: an fMRI study.

PubMed

Maffei, Vincenzo; Macaluso, Emiliano; Indovina, Iole; Orban, Guy; Lacquaniti, Francesco

2010-01-01

Neural substrates for processing constant speed visual motion have been extensively studied. Less is known about the brain activity patterns when the target speed changes continuously, for instance under the influence of gravity. Using functional MRI (fMRI), here we compared brain responses to accelerating/decelerating targets with the responses to constant speed targets. The target could move along the vertical under gravity (1g), under reversed gravity (-1g), or at constant speed (0g). In the first experiment, subjects observed targets moving in smooth motion and responded to a GO signal delivered at a random time after target arrival. As expected, we found that the timing of the motor responses did not depend significantly on the specific motion law. Therefore brain activity in the contrast between different motion laws was not related to motor timing responses. Average BOLD signals were significantly greater for 1g targets than either 0g or -1g targets in a distributed network including bilateral insulae, left lingual gyrus, and brain stem. Moreover, in these regions, the mean activity decreased monotonically from 1g to 0g and to -1g. In the second experiment, subjects intercepted 1g, 0g, and -1g targets either in smooth motion (RM) or in long-range apparent motion (LAM). We found that the sites in the right insula and left lingual gyrus, which were selectively engaged by 1g targets in the first experiment, were also significantly more active during 1g trials than during -1g trials both in RM and LAM. The activity in 0g trials was again intermediate between that in 1g trials and that in -1g trials. Therefore in these regions the global activity modulation with the law of vertical motion appears to hold for both RM and LAM. Instead, a region in the inferior parietal lobule showed a preference for visual gravitational motion only in LAM but not RM.

Simulated self-motion in a visual gravity field: sensitivity to vertical and horizontal heading in the human brain.

PubMed

Indovina, Iole; Maffei, Vincenzo; Pauwels, Karl; Macaluso, Emiliano; Orban, Guy A; Lacquaniti, Francesco

2013-05-01

Multiple visual signals are relevant to perception of heading direction. While the role of optic flow and depth cues has been studied extensively, little is known about the visual effects of gravity on heading perception. We used fMRI to investigate the contribution of gravity-related visual cues on the processing of vertical versus horizontal apparent self-motion. Participants experienced virtual roller-coaster rides in different scenarios, at constant speed or 1g-acceleration/deceleration. Imaging results showed that vertical self-motion coherent with gravity engaged the posterior insula and other brain regions that have been previously associated with vertical object motion under gravity. This selective pattern of activation was also found in a second experiment that included rectilinear motion in tunnels, whose direction was cued by the preceding open-air curves only. We argue that the posterior insula might perform high-order computations on visual motion patterns, combining different sensory cues and prior information about the effects of gravity. Medial-temporal regions including para-hippocampus and hippocampus were more activated by horizontal motion, preferably at constant speed, consistent with a role in inertial navigation. Overall, the results suggest partially distinct neural representations of the cardinal axes of self-motion (horizontal and vertical). Copyright © 2013 Elsevier Inc. All rights reserved.

Motion-based nearest vector metric for reference frame selection in the perception of motion.

PubMed

Agaoglu, Mehmet N; Clarke, Aaron M; Herzog, Michael H; Ögmen, Haluk

2016-05-01

We investigated how the visual system selects a reference frame for the perception of motion. Two concentric arcs underwent circular motion around the center of the display, where observers fixated. The outer (target) arc's angular velocity profile was modulated by a sine wave midflight whereas the inner (reference) arc moved at a constant angular speed. The task was to report whether the target reversed its direction of motion at any point during its motion. We investigated the effects of spatial and figural factors by systematically varying the radial and angular distances between the arcs, and their relative sizes. We found that the effectiveness of the reference frame decreases with increasing radial- and angular-distance measures. Drastic changes in the relative sizes of the arcs did not influence motion reversal thresholds, suggesting no influence of stimulus form on perceived motion. We also investigated the effect of common velocity by introducing velocity fluctuations to the reference arc as well. We found no effect of whether or not a reference frame has a constant motion. We examined several form- and motion-based metrics, which could potentially unify our findings. We found that a motion-based nearest vector metric can fully account for all the data reported here. These findings suggest that the selection of reference frames for motion processing does not result from a winner-take-all process, but instead, can be explained by a field whose strength decreases with the distance between the nearest motion vectors regardless of the form of the moving objects.

Analysis of accelerated motion in the theory of relativity

NASA Technical Reports Server (NTRS)

Jones, R. T.

1976-01-01

Conventional treatments of accelerated motion in the theory of relativity have led to certain difficulties of interpretation. Certain reversals in the apparent gravitational field of an accelerated body may be avoided by simpler analysis based on the use of restricted conformal transformations. In the conformal theory the velocity of light remains constant even for experimenters in accelerated motion. The problem considered is that of rectilinear motion with a variable velocity. The motion takes place along the x or x' axis of two coordinate systems.

Velocity storage contribution to vestibular self-motion perception in healthy human subjects.

PubMed

Bertolini, G; Ramat, S; Laurens, J; Bockisch, C J; Marti, S; Straumann, D; Palla, A

2011-01-01

Self-motion perception after a sudden stop from a sustained rotation in darkness lasts approximately as long as reflexive eye movements. We hypothesized that, after an angular velocity step, self-motion perception and reflexive eye movements are driven by the same vestibular pathways. In 16 healthy subjects (25-71 years of age), perceived rotational velocity (PRV) and the vestibulo-ocular reflex (rVOR) after sudden decelerations (90°/s(2)) from constant-velocity (90°/s) earth-vertical axis rotations were simultaneously measured (PRV reported by hand-lever turning; rVOR recorded by search coils). Subjects were upright (yaw) or 90° left-ear-down (pitch). After both yaw and pitch decelerations, PRV rose rapidly and showed a plateau before decaying. In contrast, slow-phase eye velocity (SPV) decayed immediately after the initial increase. SPV and PRV were fitted with the sum of two exponentials: one time constant accounting for the semicircular canal (SCC) dynamics and one time constant accounting for a central process, known as velocity storage mechanism (VSM). Parameters were constrained by requiring equal SCC time constant and VSM time constant for SPV and PRV. The gains weighting the two exponential functions were free to change. SPV were accurately fitted (variance-accounted-for: 0.85 ± 0.10) and PRV (variance-accounted-for: 0.86 ± 0.07), showing that SPV and PRV curve differences can be explained by a greater relative weight of VSM in PRV compared with SPV (twofold for yaw, threefold for pitch). These results support our hypothesis that self-motion perception after angular velocity steps is be driven by the same central vestibular processes as reflexive eye movements and that no additional mechanisms are required to explain the perceptual dynamics.

The Advanced Part of a Treatise on the Dynamics of a System of Rigid Bodies

NASA Astrophysics Data System (ADS)

Routh, Edward John

2013-03-01

Preface; 1. Moving axes and relative motion; 2. Oscillations about equilibrium; 3. Oscillations about a state of motion; 4. Motion of a body under no forces; 5. Motion of a body under any forces; 6. Nature of the motion given by linear equations and the conditions of stability; 7. Free and forced oscillations; 8. Determination of the constants of integration in terms of the initial conditions; 9. Calculus of finite differences; 10. Calculus of variations; 11. Precession and nutation; 12. Motion of the moon about its centre; 13. Motion of a string or chain; 14. Motion of a membrane; Notes.

T-cell movement on the reticular network.

PubMed

Donovan, Graham M; Lythe, Grant

2012-02-21

The idea that the apparently random motion of T cells in lymph nodes is a result of movement on a reticular network (RN) has received support from dynamic imaging experiments and theoretical studies. We present a mathematical representation of the RN consisting of edges connecting vertices that are randomly distributed in three-dimensional space, and models of lymphocyte movement on such networks including constant speed motion along edges and Brownian motion, not in three-dimensions, but only along edges. The simplest model, in which a cell moves with a constant speed along edges, is consistent with mean-squared displacement proportional to time over intervals long enough to include several changes of direction. A non-random distribution of turning angles is one consequence of motion on a preformed network. Confining cell movement to a network does not, in itself, increase the frequency of cell-cell encounters. Copyright © 2011 Elsevier Ltd. All rights reserved.

Transition from AdS universe to DS universe in the BPP model

NASA Astrophysics Data System (ADS)

Kim, Wontae; Yoon, Myungseok

2007-04-01

It can be shown that in the BPP model the smooth phase transition from the asymptotically decelerated AdS universe to the asymptotically accelerated DS universe is possible by solving the modified semiclassical equations of motion. This transition comes from noncommutative Poisson algebra, which gives the constant curvature scalars asymptotically. The decelerated expansion of the early universe is due to the negative energy density with the negative pressure induced by quantum back reaction, and the accelerated late-time universe comes from the positive energy and the negative pressure which behave like dark energy source in recent cosmological models.

Optimum Orbit Plane Change Using a Skip Reentry Trajectory for the Space Shuttle Orbiter.

DTIC Science & Technology

1978-12-01

by the hat symbol, " , and i,j,k represent unit vectors for the YW frame. The angular velocity of the earth is constant and denoted by w. Thus V re is...the equations of motion can be found. In component form the equations are: (6M/r3)x + 4 (Cos - sn ) vst 1 mm Msv 3 b1 bm y - (uM/r3)y + L (coso...plane change, due to the skip reentry maneuver is determined by comparing the states of the system before and after the maneuver. The angular momentum

Materials separation by dielectrophoresis

NASA Technical Reports Server (NTRS)

Sagar, A. D.; Rose, R. M.

1988-01-01

The feasibility of vacuum dielectrophoresis as a method for particulate materials separation in a microgravity environment was investigated. Particle separations were performed in a specially constructed miniature drop-tower with a residence time of about 0.3 sec. Particle motion in such a system is independent of size and based only on density and dielectric constant, for a given electric field. The observed separations and deflections exceeded the theoretical predictions, probably due to multiparticle effects. In any case, this approach should work well in microgravity for many classes of materials, with relatively simple apparatus and low weight and power requirements.

Analytical Method of Approximating the Motion of a Spinning Vehicle with Variable Mass and Inertia Properties Acted Upon by Several Disturbing Parameters

NASA Technical Reports Server (NTRS)

Buglia, James J.; Young, George R.; Timmons, Jesse D.; Brinkworth, Helen S.

1961-01-01

An analytical method has been developed which approximates the dispersion of a spinning symmetrical body in a vacuum, with time-varying mass and inertia characteristics, under the action of several external disturbances-initial pitching rate, thrust misalignment, and dynamic unbalance. The ratio of the roll inertia to the pitch or yaw inertia is assumed constant. Spin was found to be very effective in reducing the dispersion due to an initial pitch rate or thrust misalignment, but was completely Ineffective in reducing the dispersion of a dynamically unbalanced body.

An analysis of the precision and reliability of the leap motion sensor and its suitability for static and dynamic tracking.

PubMed

Guna, Jože; Jakus, Grega; Pogačnik, Matevž; Tomažič, Sašo; Sodnik, Jaka

2014-02-21

We present the results of an evaluation of the performance of the Leap Motion Controller with the aid of a professional, high-precision, fast motion tracking system. A set of static and dynamic measurements was performed with different numbers of tracking objects and configurations. For the static measurements, a plastic arm model simulating a human arm was used. A set of 37 reference locations was selected to cover the controller's sensory space. For the dynamic measurements, a special V-shaped tool, consisting of two tracking objects maintaining a constant distance between them, was created to simulate two human fingers. In the static scenario, the standard deviation was less than 0.5 mm. The linear correlation revealed a significant increase in the standard deviation when moving away from the controller. The results of the dynamic scenario revealed the inconsistent performance of the controller, with a significant drop in accuracy for samples taken more than 250 mm above the controller's surface. The Leap Motion Controller undoubtedly represents a revolutionary input device for gesture-based human-computer interaction; however, due to its rather limited sensory space and inconsistent sampling frequency, in its current configuration it cannot currently be used as a professional tracking system.

An Analysis of the Precision and Reliability of the Leap Motion Sensor and Its Suitability for Static and Dynamic Tracking

PubMed Central

Guna, Jože; Jakus, Grega; Pogačnik, Matevž; Tomažič, Sašo; Sodnik, Jaka

2014-01-01

We present the results of an evaluation of the performance of the Leap Motion Controller with the aid of a professional, high-precision, fast motion tracking system. A set of static and dynamic measurements was performed with different numbers of tracking objects and configurations. For the static measurements, a plastic arm model simulating a human arm was used. A set of 37 reference locations was selected to cover the controller's sensory space. For the dynamic measurements, a special V-shaped tool, consisting of two tracking objects maintaining a constant distance between them, was created to simulate two human fingers. In the static scenario, the standard deviation was less than 0.5 mm. The linear correlation revealed a significant increase in the standard deviation when moving away from the controller. The results of the dynamic scenario revealed the inconsistent performance of the controller, with a significant drop in accuracy for samples taken more than 250 mm above the controller's surface. The Leap Motion Controller undoubtedly represents a revolutionary input device for gesture-based human-computer interaction; however, due to its rather limited sensory space and inconsistent sampling frequency, in its current configuration it cannot currently be used as a professional tracking system. PMID:24566635

Dynamics and morphology of chiral magnetic bubbles in perpendicularly magnetized ultra-thin films

NASA Astrophysics Data System (ADS)

Sarma, Bhaskarjyoti; Garcia-Sanchez, Felipe; Nasseri, S. Ali; Casiraghi, Arianna; Durin, Gianfranco

2018-06-01

We study bubble domain wall dynamics using micromagnetic simulations in perpendicularly magnetized ultra-thin films with disorder and Dzyaloshinskii-Moriya interaction. Disorder is incorporated into the material as grains with randomly distributed sizes and varying exchange constant at the edges. As expected, magnetic bubbles expand asymmetrically along the axis of the in-plane field under the simultaneous application of out-of-plane and in-plane fields. Remarkably, the shape of the bubble has a ripple-like part which causes a kink-like (steep decrease) feature in the velocity versus in-plane field curve. We show that these ripples originate due to the nucleation and interaction of vertical Bloch lines. Furthermore, we show that the Dzyaloshinskii-Moriya interaction field is not constant but rather depends on the in-plane field. We also extend the collective coordinate model for domain wall motion to a magnetic bubble and compare it with the results of micromagnetic simulations.

Group theoretical formulation of free fall and projectile motion

NASA Astrophysics Data System (ADS)

Düztaş, Koray

2018-07-01

In this work we formulate the group theoretical description of free fall and projectile motion. We show that the kinematic equations for constant acceleration form a one parameter group acting on a phase space. We define the group elements ϕ t by their action on the points in the phase space. We also generalize this approach to projectile motion. We evaluate the group orbits regarding their relations to the physical orbits of particles and unphysical solutions. We note that the group theoretical formulation does not apply to more general cases involving a time-dependent acceleration. This method improves our understanding of the constant acceleration problem with its global approach. It is especially beneficial for students who want to pursue a career in theoretical physics.

On the null trajectories in conformal Weyl gravity

NASA Astrophysics Data System (ADS)

Villanueva, J. R.; Olivares, Marco

2013-06-01

In this work we find analytical solutions to the null geodesics around a black hole in the conformal Weyl gravity. Exact expressions for the horizons are found, and they depend on the cosmological constant and the coupling constants of the conformal Weyl gravity. Then, we study the radial motion from the point of view of the proper and coordinate frames, and compare it with that found in spacetimes of general relativity. The angular motion is also examined qualitatively by means of an effective potential; quantitatively, the equation of motion is solved in terms of wp-Weierstrass elliptic function. Thus, we find the deflection angle for photons without using any approximation, which is a novel result for this kind of gravity.

Thermophoretic transport of water nanodroplets confined in carbon nanotubes: The role of friction

NASA Astrophysics Data System (ADS)

Oyarzua, Elton; Walther, Jens H.; Zambrano, Harvey A.

2017-11-01

The development of efficient nanofluidic devices requires driving mechanisms that provide controlled transport of fluids through nanoconduits. Temperature gradients have been proposed as a mechanism to drive particles, fullerenes and nanodroplets inside carbon nanotubes (CNTs). In this work, molecular dynamics (MD) simulations are conducted to study thermophoresis of water nanodroplets inside CNTs. To gain insight into the interplay between the thermophoretic force acting on the droplet and the retarding liquid-solid friction, sets of constrained and unconstrained MD simulations are conducted. The results indicate that the thermophoretic motion of a nanodroplet displays two kinetic regimes: an initial regime characterized by a decreasing acceleration and afterwards a terminal regime with constant velocity. During the initial regime, the magnitude of the friction force increases linearly with the droplet velocity whereas the thermophoretic force has a constant magnitude defined by the magnitude of the thermal gradient and the droplet size. Subsequently, in the terminal regime, the droplet moves at constant velocity due to a dynamic balance between the thermophoretic force and the retarding friction force. We acknowledge partial support from CONICYT (Chile) under scholarship No. 21140427.

Prospects for an Improved Measurement of Experimental Limit on G-dot

NASA Technical Reports Server (NTRS)

Sanders, Alvin J.

2003-01-01

The orbital motion of an ultra-drag-free satellite, such as the large test body of the SEE (Satellite Energy Exchange) satellite, known as the "Shepherd," may possibly provide the best test for time variation of the gravitational constant G at the level of parts in 10(exp 14). Scarcely anything could be more significant scientifically than the incontestable discovery that a fundamental "constant" of Nature is not constant. A finding of non-zero (G-dot)/G would clearly mark the boundaries where general relativity is valid, and specify the onset of new physics. The requirements for measuring G-dot at the level proposed by SEE will require great care in treating perturbation forces. In the present paper we concentrate on the methods for dealing with the gravitational field due to possible large manufacturing defects in the SEE observatory. We find that, with adequate modeling of the perturbation forces and cancellation methods, the effective time-averaged acceleration on the SEE Shepherd will be approx. 10(exp -18) g (10(exp -17) m/sq s).

Approximate Formula for the Vertical Asymptote of Projectile Motion in Midair

ERIC Educational Resources Information Center

Chudinov, Peter Sergey

2010-01-01

The classic problem of the motion of a point mass (projectile) thrown at an angle to the horizon is reviewed. The air drag force is taken into account with the drag factor assumed to be constant. An analytical approach is used for the investigation. An approximate formula is obtained for one of the characteristics of the motion--the vertical…

The effects of particle shape, size, and interaction on colloidal glasses and gels

NASA Astrophysics Data System (ADS)

Kramb, Ryan C.

Using multiple step seeded emulsion polymerization reactions, colloid particles of tunable shape are synthesized from polystyrene. In all, four particle shapes are studied referred to as spheres (S), heteronuclear dicolloids (hDC), symmetric homonuclear dicolloids (sDC), and tricolloids (TC). Two size ranges of particles are studied with approximate diameters in the range of 200-300nm and 1.1-1.3mum. The solvent ionic strength is varied from 10 -3M to 1M resulting in particle interaction potentials that range from repulsive to attractive. The effect of anisotropic shape is found to increase the glass transition volume fraction (φg) in good agreement with activated naive Mode Coupling Theory (nMCT) calculations. Differences in φg and the linear elastic modulus (G0') due to particle shape can be understood in terms of the Random Close Packed volume fraction (φRCP ) for each shape; φRCP- φg is a constant. In addition, a reentrant phase diagram is found for S and sDC particles with a maximum in the fluid state volume fraction found at weakly attractive interaction potential, in agreement well with theoretical calculations. Nonlinear rheology and yielding behavior of repulsive and attractive spheres and anisotropic particles are examined and understood in terms of barriers constraining motion. The barriers are due to interparticle bonds or cages constraining translational or rotational motion. Yield stress has similar volume fraction dependence as G 0' and a similar framework is used to understand differences due to particle shape and interaction. For larger particles, the effects of shape and interaction are studied with respect to dynamic yielding and shear thickening. The dynamic yield stress is found to increase with volume fraction while the stress at thickening is constant. The intersection of these indicates a possible jamming point below φRCP.

Investigation of energy dissipation due to contact angle hysteresis in capillary effect

NASA Astrophysics Data System (ADS)

Athukorallage, Bhagya; Iyer, Ram

2016-06-01

Capillary action or Capillarity is the ability of a liquid to flow in narrow spaces without the assistance of, and in opposition to, external forces like gravity. Three effects contribute to capillary action, namely, adhesion of the liquid to the walls of the confining solid; meniscus formation; and low Reynolds number fluid flow. We investigate the dissipation of energy during one cycle of capillary action, when the liquid volume inside a capillary tube first increases and subsequently decreases while assuming quasi-static motion. The quasi-static assumption allows us to focus on the wetting phenomenon of the solid wall by the liquid and the formation of the meniscus. It is well known that the motion of a liquid on an non-ideal surface involves the expenditure of energy due to contact angle hysteresis. In this paper, we derive the equations for the menisci and the flow rules for the change of the contact angles for a liquid column in a capillary tube at a constant temperature and volume by minimizing the Helmholtz free energy using calculus of variations. We describe the numerical solution of these equations and present results from computations for the case of a capillary tube with 1 mm diameter.

Formation of a wave on an ice-sheet above the dipole, moving in a fluid

NASA Astrophysics Data System (ADS)

Il'ichev, A. T.; Savin, A. A.; Savin, A. S.

2012-05-01

Theory of wave motions of a fluid with an ice-sheet was developed due to the necessity of solving of a number of problems of marine and land physics. The main attention in these investigations was focused on propagation and interaction of free waves, and also on appearance of waves under action of different loadings on the ice-sheet. From the other side, the problems dealing with waves on the fluid surface, free from the ice due to motion in the mass of the fluid of rigid bodies, has the known solutions. In this connection, it seems natural to disserminate the formulation and methods of such problems to the case of the fluid with the ice-sheet. In the present note we describe the character of formation of waves from the singularity, localized in the fluid of infinite depth beneath the ice-sheet. We use the example of the dipole, which models a cylinder in the infinite mass of the fluid. The character of the formation does not depend on the type of singularity. The ice-sheet is considered as a thin elastic plate of a constant width, floating on the water surface.

Gearbox Reliability Collaborative Investigation of Gearbox Motion and High-Speed-Shaft Loads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keller, Jon; Guo, Yi; Sethuraman, Latha

2016-03-18

This paper extends a model-to-test validation effort to examine the effect of different constant rotor torque and moment conditions and intentional generator misalignment on the gearbox motion and high-speed-shaft loads. Fully validating gearbox motion and high-speed-shaft loads across a range of test conditions is a critical precursor to examining the bearing loads, as the gearbox motion and high-speed-shaft loads are the drivers of these bearing loads.

Anticipating the effects of visual gravity during simulated self-motion: estimates of time-to-passage along vertical and horizontal paths.

PubMed

Indovina, Iole; Maffei, Vincenzo; Lacquaniti, Francesco

2013-09-01

By simulating self-motion on a virtual rollercoaster, we investigated whether acceleration cued by the optic flow affected the estimate of time-to-passage (TTP) to a target. In particular, we studied the role of a visual acceleration (1 g = 9.8 m/s(2)) simulating the effects of gravity in the scene, by manipulating motion law (accelerated or decelerated at 1 g, constant speed) and motion orientation (vertical, horizontal). Thus, 1-g-accelerated motion in the downward direction or decelerated motion in the upward direction was congruent with the effects of visual gravity. We found that acceleration (positive or negative) is taken into account but is overestimated in module in the calculation of TTP, independently of orientation. In addition, participants signaled TTP earlier when the rollercoaster accelerated downward at 1 g (as during free fall), with respect to when the same acceleration occurred along the horizontal orientation. This time shift indicates an influence of the orientation relative to visual gravity on response timing that could be attributed to the anticipation of the effects of visual gravity on self-motion along the vertical, but not the horizontal orientation. Finally, precision in TTP estimates was higher during vertical fall than when traveling at constant speed along the vertical orientation, consistent with a higher noise in TTP estimates when the motion violates gravity constraints.

Coexistence of bounded and unbounded motions in a bouncing ball model

NASA Astrophysics Data System (ADS)

Marò, Stefano

2013-05-01

We consider the model describing the vertical motion of a ball falling with constant acceleration on a wall and elastically reflected. The wall is supposed to move in the vertical direction according to a given periodic function f. We apply the Aubry-Mather theory to the generating function in order to prove the existence of bounded motions with prescribed mean time between the bounces. As the existence of unbounded motions is known, it is possible to find a class of functions f that allow both bounded and unbounded motions.

LAGEOS geodetic analysis-SL7.1

NASA Technical Reports Server (NTRS)

Smith, D. E.; Kolenkiewicz, R.; Dunn, P. J.; Klosko, S. M.; Robbins, J. W.; Torrence, M. H.; Williamson, R. G.; Pavlis, E. C.; Douglas, N. B.; Fricke, S. K.

1991-01-01

Laser ranging measurements to the LAGEOS satellite from 1976 through 1989 are related via geodetic and orbital theories to a variety of geodetic and geodynamic parameters. The SL7.1 analyses are explained of this data set including the estimation process for geodetic parameters such as Earth's gravitational constant (GM), those describing the Earth's elasticity properties (Love numbers), and the temporally varying geodetic parameters such as Earth's orientation (polar motion and Delta UT1) and tracking site horizontal tectonic motions. Descriptions of the reference systems, tectonic models, and adopted geodetic constants are provided; these are the framework within which the SL7.1 solution takes place. Estimates of temporal variations in non-conservative force parameters are included in these SL7.1 analyses as well as parameters describing the orbital states at monthly epochs. This information is useful in further refining models used to describe close-Earth satellite behavior. Estimates of intersite motions and individual tracking site motions computed through the network adjustment scheme are given. Tabulations of tracking site eccentricities, data summaries, estimated monthly orbital and force model parameters, polar motion, Earth rotation, and tracking station coordinate results are also provided.

Cooperative behavior of molecular motions giving rise to two glass transitions in the same supercooled mesophase of a smectogenic liquid crystal dimer

NASA Astrophysics Data System (ADS)

López, David O.; Salud, Josep; de la Fuente, María Rosario; Sebastián, Nerea; Diez-Berart, Sergio

2018-01-01

In the present work, a detailed analysis of the glassy behavior and the relaxation dynamics of the liquid crystal dimer α-(4-cyanobiphenyl-4'-yloxy)-ω-(1-pyrenimine-benzylidene-4'-oxy) heptane (CBO7O.Py) throughout both nematic and smectic-A mesophases by means of broadband dielectric spectroscopy has been performed. CBO7O.Py shows three different dielectric relaxation modes and two glass transition (Tg) temperatures: The higher Tg is due to the freezing of the molecular motions responsible for the relaxation mode with the lowest frequency (μ1 L); the lower Tg is due to the motions responsible for the two relaxation modes with highest frequencies (μ1 H and μ2), which converge just at their corresponding Tg. It is shown how the three modes follow a critical-like description via the dynamic scaling model. The two modes with lowest frequencies (μ1 L and μ1 H) are cooperative in the whole range of the mesophases, whereas the highest frequency mode (μ2) is cooperative just below some crossover temperature. In terms of fragility, at the glass transition, the ensemble (μ1 H+μ2 ) presents a value of the steepness index and μ1 L a different one, meaning that fragility is a property intrinsic to the molecular motion itself. Finally, the steepness index seems to have a universal behavior with temperature for the dielectric relaxation modes of liquid crystal dimers, being almost constant at high temperatures and increasing drastically when cooling the compound down to the glass transition from a temperature about 3/4 TN I .

The vestibulo-ocular reflex of the squirrel monkey during eccentric rotation and roll tilt

NASA Technical Reports Server (NTRS)

Merfeld, D. M.; Young, L. R.

1995-01-01

The vestibulo-ocular reflexes (VOR) are determined not only by angular acceleration, but also by the presence of gravity and linear acceleration. This phenomenon was studied by measuring three-dimensional nystagmic eye movements, with implanted search coils, in six male squirrel monkeys during eccentric rotation. Monkeys were rotated in the dark at a constant velocity of 200 degrees/s (centrally or 79 cm off axis) with the axis of rotation always aligned with gravity and the spinal axis of the upright monkeys. The monkey's orientation (facing-motion or back-to-motion) had a dramatic influence on the VOR. These experiments show that: (a) the axis of eye rotation always shifted toward alignment with gravito-inertial force; (b) the peak value of horizontal slow phase eye velocity was greater with the monkey facing-motion than with back-to-motion; and (c) the time constant of horizontal eye movement decay was smaller with the monkey facing-motion than with back-to-motion. All of these findings were statistically significant and consistent across monkeys. In another set of tests, the same monkeys were rapidly tilted about their naso-occipital (roll) axis. Tilted orientations of 45 degrees and 90 degrees were maintained for 1 min. Other than a compensatory angular VOR during the angular rotation, no consistent eye velocity response was observed during or following the tilt for any of the six monkeys. The absence of any eye movement response following tilt weighs against the possibility that translational linear VOR responses are due to simple high-pass filtering of the otolith signals. The VOR response during eccentric rotation was divided into the more familiar angular VOR and linear VOR components. The angular component is known to depend upon semicircular canal dynamics and central influences. The linear component of the response decays rapidly with a mean duration of only 6.6 s, while the axis of eye rotation rapidly aligns (< 10 s) with gravito-inertial force. These results are consistent with the hypothesis that the measurement of gravito-inertial force by the otolith organs is resolved into central estimates of linear acceleration and gravity, such that the central estimate of gravitational force minus the central estimate of linear acceleration approximately equals the otolith measurement of gravito-inertial force.

Vortex Formation During Unsteady Boundary-Layer Separation

NASA Astrophysics Data System (ADS)

Das, Debopam; Arakeri, Jaywant H.

1998-11-01

Unsteady laminar boundary-layer separation is invariably accompanied by the formation of vortices. The aim of the present work is to study the vortex formation mechanism(s). An adverse pressure gradient causing a separation can be decomposed into a spatial component ( spatial variation of the velocity external to the boundary layer ) and a temporal component ( temporal variation of the external velocity ). Experiments were conducted in a piston driven 2-D water channel, where the spatial component could be be contolled by geometry and the temporal component by the piston motion. We present results for three divergent channel geometries. The piston motion consists of three phases: constant acceleration from start, contant velocity, and constant deceleration to stop. Depending on the geometry and piston motion we observe different types of unsteady separation and vortex formation.

Elimination of secular terms from the differential equations for the elements of perturbed two-body motion

NASA Technical Reports Server (NTRS)

Bond, Victor R.; Fraietta, Michael F.

1991-01-01

In 1961, Sperling linearized and regularized the differential equations of motion of the two-body problem by changing the independent variable from time to fictitious time by Sundman's transformation (r = dt/ds) and by embedding the two-body energy integral and the Laplace vector. In 1968, Burdet developed a perturbation theory which was uniformly valid for all types of orbits using a variation of parameters approach on the elements which appeared in Sperling's equations for the two-body solution. In 1973, Bond and Hanssen improved Burdet's set of differential equations by embedding the total energy (which is a constant when the potential function is explicitly dependent upon time.) The Jacobian constant was used as an element to replace the total energy in a reformulation of the differential equations of motion. In the process, another element which is proportional to a component of the angular momentum was introduced. Recently trajectories computed during numerical studies of atmospheric entry from circular orbits and low thrust beginning in near-circular orbits exhibited numerical instability when solved by the method of Bond and Gottlieb (1989) for long time intervals. It was found that this instability was due to secular terms which appear on the righthand sides of the differential equations of some of the elements. In this paper, this instability is removed by the introduction of another vector integral called the delta integral (which replaces the Laplace Vector) and another scalar integral which removes the secular terms. The introduction of these integrals requires a new derivation of the differential equations for most of the elements. For this rederivation, the Lagrange method of variation of parameters is used, making the development more concise. Numerical examples of this improvement are presented.

Charged anti-de Sitter BTZ black holes in Maxwell-f(T) gravity

NASA Astrophysics Data System (ADS)

Nashed, G. G. L.; Capozziello, S.

2018-05-01

Inspired by the Bañados, Teitelboim and Zanelli (BTZ) formalism, we discuss the Maxwell-f(T) gravity in (2 + 1) dimensions. The main task is to derive exact solutions for a special form of f(T) = T + 𝜖T2, with T being the torsion scalar of Weitzenböck geometry. To this end, a triad field is applied to the equations of motion of charged f(T) and sets of circularly symmetric noncharged and charged solutions have been derived. We show that, in the charged case, the monopole-like and the ln terms are linked by a correlative constant despite the known results in teleparallel geometry and its extensions.39 Furthermore, it is possible to show that the event horizon is not identical with the Cauchy horizon due to such a constant. The singularities and the horizons of these black holes are examined: they are new and have no analogue in the literature due to the fact that their curvature singularities are soft. We calculate the energy content of these solutions by using the general vector form of the energy-momentum within the framework of f(T) gravity. Finally, some thermodynamical quantities, like entropy and Hawking temperature, are derived.

Figure-ground segregation by motion contrast and by luminance contrast.

PubMed

Regan, D; Beverley, K I

1984-05-01

Some naturally camouflaged objects are invisible unless they move; their boundaries are then defined by motion contrast between object and background. We compared the visual detection of such camouflaged objects with the detection of objects whose boundaries were defined by luminance contrast. The summation field area is 0.16 deg2 , and the summation time constant is 750 msec for parafoveally viewed objects whose boundaries are defined by motion contrast; these values are, respectively, about 5 and 12 times larger than the corresponding values for objects defined by luminance contrast. The log detection threshold is proportional to the eccentricity for a camouflaged object of constant area. The effect of eccentricity on threshold is less for large objects than for small objects. The log summation field diameter for detecting camouflaged objects is roughly proportional to the eccentricity, increasing to about 20 deg at 32-deg eccentricity. In contrast to the 100:1 increase of summation area for detecting camouflaged objects, the temporal summation time constant changes by only 40% between eccentricities of 0 and 16 deg.

Effects of several factors on theoretical predictions of airplane spin characteristics. [dynamic models

NASA Technical Reports Server (NTRS)

Bihrle, W., Jr.; Barnhart, B.

1974-01-01

The influence of different mathematical and aerodynamic models on computed spin motion was investigated along with the importance of some of the aerodynamic and nonaerodynamic quantities defined in these models. An analytical technique was used which included the aerodynamic forces and moments acting on a spinning aircraft due to steady rotational flow and the contribution of the rotary derivatives to the oscillatory component of the total angular rates. It was shown that (1) during experimental-analytical correlation studies, the flight-recorded control time histories must be faithfully duplicated since the spinning motion can be sensitive to a small change in the application of the spin entry controls; (2) an error in the assumed inertias, yawing moments at high angle of attack, and initial spin entry bank angle do not influence the developed spin significantly; (3) damping in pitch derivatives and the center of gravity location play a role in the spinning motion; and (4) the experimental spin investigations conducted in a constant atmospheric density environment duplicate the Froude number only at the initial full-scale spin altitude (since the full-scale airplane at high altitudes experiences large density changes during the spin.)

Wake structure and wing motion in bat flight

NASA Astrophysics Data System (ADS)

Hubel, Tatjana; Breuer, Kenneth; Swartz, Sharon

2008-11-01

We report on experiments concerning the wake structure and kinematics of bat flight, conducted in a low-speed wind tunnel using time-resolved PIV (200Hz) and 4 high-speed cameras to capture wake and wing motion simultaneously. 16 Lesser dog-faced fruit bats (C. brachyotis) were trained to fly in the wind tunnel at 3-6.5m/s. The PIV recordings perpendicular to the flow stream allowed observing the development of the tip vortex and circulation over the wing beat cycle. Each PIV acquisition sequence is correlated with the respective kinematic history. Circulation within wing beat cycles were often quite repeatable, however variations due to maneuvering of the bat are clearly visible. While no distinct vortex structure was observed at the upper reversal point (defined according the vertical motion of the wrist) a tip vortex was observed to develop in the first third of the downstroke, growing in strength, and persisting during much of the upstroke. Correlated to the presence of a strong tip vortex the circulation has almost constant strength over the middle half of the wing beat. At relatively low flight speeds (3.4 m/s), a closed vortex structure behind the bat is postulated.

A fully implicit numerical integration of the relativistic particle equation of motion

NASA Astrophysics Data System (ADS)

Pétri, J.

2017-04-01

Relativistic strongly magnetized plasmas are produced in laboratories thanks to state-of-the-art laser technology but can naturally be found around compact objects such as neutron stars and black holes. Detailed studies of the behaviour of relativistic plasmas require accurate computations able to catch the full spatial and temporal dynamics of the system. Numerical simulations of ultra-relativistic plasmas face severe restrictions due to limitations in the maximum possible Lorentz factors that current algorithms can reproduce to good accuracy. In order to circumvent this flaw and repel the limit to 9$ , we design a new fully implicit scheme to solve the relativistic particle equation of motion in an external electromagnetic field using a three-dimensional Cartesian geometry. We show some examples of numerical integrations in constant electromagnetic fields to prove the efficiency of our algorithm. The code is also able to follow the electric drift motion for high Lorentz factors. In the most general case of spatially and temporally varying electromagnetic fields, the code performs extremely well, as shown by comparison with exact analytical solutions for the relativistic electrostatic Kepler problem as well as for linearly and circularly polarized plane waves.

Motion estimation accuracy for visible-light/gamma-ray imaging fusion for portable portal monitoring

NASA Astrophysics Data System (ADS)

Karnowski, Thomas P.; Cunningham, Mark F.; Goddard, James S.; Cheriyadat, Anil M.; Hornback, Donald E.; Fabris, Lorenzo; Kerekes, Ryan A.; Ziock, Klaus-Peter; Gee, Timothy F.

2010-01-01

The use of radiation sensors as portal monitors is increasing due to heightened concerns over the smuggling of fissile material. Portable systems that can detect significant quantities of fissile material that might be present in vehicular traffic are of particular interest. We have constructed a prototype, rapid-deployment portal gamma-ray imaging portal monitor that uses machine vision and gamma-ray imaging to monitor multiple lanes of traffic. Vehicles are detected and tracked by using point detection and optical flow methods as implemented in the OpenCV software library. Points are clustered together but imperfections in the detected points and tracks cause errors in the accuracy of the vehicle position estimates. The resulting errors cause a "blurring" effect in the gamma image of the vehicle. To minimize these errors, we have compared a variety of motion estimation techniques including an estimate using the median of the clustered points, a "best-track" filtering algorithm, and a constant velocity motion estimation model. The accuracy of these methods are contrasted and compared to a manually verified ground-truth measurement by quantifying the rootmean- square differences in the times the vehicles cross the gamma-ray image pixel boundaries compared with a groundtruth manual measurement.

Constraints on the perturbed mutual motion in Didymos due to impact-induced deformation of its primary after the DART impact

NASA Astrophysics Data System (ADS)

Hirabayashi, Masatoshi; Schwartz, Stephen R.; Yu, Yang; Davis, Alex B.; Chesley, Steven R.; Fahnestock, Eugene G.; Michel, Patrick; Richardson, Derek C.; Naidu, Shantanu P.; Scheeres, Daniel J.; Cheng, Andrew F.; Rivkin, Andrew S.; Benner, Lance A. M.

2017-12-01

Binary near-Earth asteroid (65803) Didymos is the target of the proposed NASA Double Asteroid Redirection Test (DART), part of the Asteroid Impact & Deflection Assessment (AIDA) mission concept. In this mission, the DART spacecraft is planned to impact the secondary body of Didymos, perturbing mutual dynamics of the system. The primary body is currently rotating at a spin period close to the spin barrier of asteroids, and materials ejected from the secondary due to the DART impact are likely to reach the primary. These conditions may cause the primary to reshape, due to landslides or internal deformation, changing the permanent gravity field. Here, we propose that if shape deformation of the primary occurs, the mutual orbit of the system would be perturbed due to a change in the gravity field. We use a numerical simulation technique based on the full two-body problem to investigate the shape effect on the mutual dynamics in Didymos after the DART impact. The results show that under constant volume, shape deformation induces strong perturbation in the mutual motion. We find that the deformation process always causes the orbital period of the system to become shorter. If surface layers with a thickness greater than ∼0.4 m on the poles of the primary move down to the equatorial region due to the DART impact, a change in the orbital period of the system and in the spin period of the primary will be detected by ground-based measurement.

The Locomotion of Mouse Fibroblasts in Tissue Culture

PubMed Central

Gail, Mitchell H.; Boone, Charles W.

1970-01-01

Time-lapse cinematography was used to investigate the motion of mouse fibroblasts in tissue culture. Observations over successive short time intervals revealed a tendency for the cells to persist in their direction of motion from one 2.5 hr time interval to the next. Over 5.0-hr time intervals, however, the direction of motion appeared random. This fact suggested that D, the diffusion constant of a random walk model, might serve to characterize cellular motility if suitably long observation times were used. We therefore investigated the effect of “persistence” on the pure random walk model, and we found theoretically and confirmed experimentally that the motility of a persisting cell could indeed be characterized by an augmented diffusion constant, D*. A method for determining confidence limits on D* was also developed. Thus a random walk model, modified to comprehend the persistence effect, was found to describe the motion of fibroblasts in tissue culture and to provide a numerical measure of cellular motility. PMID:5531614

Visual/motion cue mismatch in a coordinated roll maneuver

NASA Technical Reports Server (NTRS)

Shirachi, D. K.; Shirley, R. S.

1981-01-01

The effects of bandwidth differences between visual and motion cueing systems on pilot performance for a coordinated roll task were investigated. Visual and motion cue configurations which were acceptable and the effects of reduced motion cue scaling on pilot performance were studied to determine the scale reduction threshold for which pilot performance was significantly different from full scale pilot performance. It is concluded that: (1) the presence or absence of high frequency error information in the visual and/or motion display systems significantly affects pilot performance; and (2) the attenuation of motion scaling while maintaining other display dynamic characteristics constant, affects pilot performance.

Relationship Between Optimal Gain and Coherence Zone in Flight Simulation

NASA Technical Reports Server (NTRS)

Gracio, Bruno Jorge Correia; Pais, Ana Rita Valente; vanPaassen, M. M.; Mulder, Max; Kely, Lon C.; Houck, Jacob A.

2011-01-01

In motion simulation the inertial information generated by the motion platform is most of the times different from the visual information in the simulator displays. This occurs due to the physical limits of the motion platform. However, for small motions that are within the physical limits of the motion platform, one-to-one motion, i.e. visual information equal to inertial information, is possible. It has been shown in previous studies that one-to-one motion is often judged as too strong, causing researchers to lower the inertial amplitude. When trying to measure the optimal inertial gain for a visual amplitude, we found a zone of optimal gains instead of a single value. Such result seems related with the coherence zones that have been measured in flight simulation studies. However, the optimal gain results were never directly related with the coherence zones. In this study we investigated whether the optimal gain measurements are the same as the coherence zone measurements. We also try to infer if the results obtained from the two measurements can be used to differentiate between simulators with different configurations. An experiment was conducted at the NASA Langley Research Center which used both the Cockpit Motion Facility and the Visual Motion Simulator. The results show that the inertial gains obtained with the optimal gain are different than the ones obtained with the coherence zone measurements. The optimal gain is within the coherence zone.The point of mean optimal gain was lower and further away from the one-to-one line than the point of mean coherence. The zone width obtained for the coherence zone measurements was dependent on the visual amplitude and frequency. For the optimal gain, the zone width remained constant when the visual amplitude and frequency were varied. We found no effect of the simulator configuration in both the coherence zone and optimal gain measurements.

CALIBRATION AND TESTING OF SONIC STIMULATION TECHNOLOGIES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roger Turpening; Wayne Pennington; Christopher Schmidt

2005-03-01

In conjunction with Baker Atlas Inc. Michigan Technological University devised a system capable of recording the earth motion and pressure due to downhole and surface seismic sources. The essential elements of the system are (1) a borehole test site that will remain constant and is available all the time and for any length of time, (2) a downhole sonde that will itself remain constant and, because of its downhole digitization feature, does not require the wireline or surface recording components to remain constant, and (3) a set of procedures that ensures that the amplitude and frequency parameters of a widemore » range of sources can be compared with confidence. This system was used to record four seismic sources, three downhole sources and one surface source. A single activation of each of the downhole sources was not seen on time traces above the ambient noise, however, one sweep of the surface source, a small vertical vibrator, was easily seen in a time trace. One of the downhole sources was seen by means of a spike in its spectrum and a second downhole source was clearly seen after correlation and stacking. The surface vibrator produced a peak to peak particle motion signal of approximately 4.5 x 10{sup -5} cm/sec and a peak to peak pressure of approx. 2.5 x 10{sup -7} microPascals at a depth of 1,485 ft. Theoretical advances were made with our partner, Dr. Igor Beresnev at Iowa State University. A theory has been developed to account for the behavior of oil ganglia trapped in pore throats, and their ultimate release through the additional incremental pressure associated with sonic stimulation.« less

Rotating and binary relativistic stars with magnetic field

NASA Astrophysics Data System (ADS)

Markakis, Charalampos

We develop a geometrical treatment of general relativistic magnetohydrodynamics for perfectly conducting fluids in Einstein--Maxwell--Euler spacetimes. The theory is applied to describe a neutron star that is rotating or is orbiting a black hole or another neutron star. Under the hypotheses of stationarity and axisymmetry, we obtain the equations governing magnetohydrodynamic equilibria of rotating neutron stars with poloidal, toroidal or mixed magnetic fields. Under the hypothesis of an approximate helical symmetry, we obtain the first law of thermodynamics governing magnetized equilibria of double neutron star or black hole - neutron star systems in close circular orbits. The first law is written as a relation between the change in the asymptotic Noether charge deltaQ and the changes in the area and electric charge of black holes, and in the vorticity, baryon rest mass, entropy, charge and magnetic flux of the magnetofluid. In an attempt to provide a better theoretical understanding of the methods used to construct models of isolated rotating stars and corotating or irrotational binaries and their unexplained convergence properties, we analytically examine the behavior of different iterative schemes near a static solution. We find the spectrum of the linearized iteration operator and show for self-consistent field methods that iterative instability corresponds to unstable modes of this operator. On the other hand, we show that the success of iteratively stable methods is due to (quasi-)nilpotency of this operator. Finally, we examine the integrability of motion of test particles in a stationary axisymmetric gravitational field. We use a direct approach to seek nontrivial constants of motion polynomial in the momenta---in addition to energy and angular momentum about the symmetry axis. We establish the existence and uniqueness of quadratic constants and the nonexistence of quartic constants for stationary axisymmetric Newtonian potentials with equatorial symmetry and elucidate their relativistic analogues.

Is back-electron transfer process in Betaine-30 coherent?

NASA Astrophysics Data System (ADS)

Rafiq, Shahnawaz; Scholes, Gregory D.

2017-09-01

The possible role of coherent vibrational motion in ultrafast photo-induced electron transfer remains unclear despite considerable experimental and theoretical advances. We revisited this problem by tracking the back-electron transfer (bET) process in Betaine-30 with broadband pump-probe spectroscopy. Dephasing time constant of certain high-frequency vibrations as a function of solvent shows a trend similar to the ET rates. In the purview of Bixon-Jortner model, high-frequency quantum vibrations bridge the reactant-product energy gap by providing activationless vibronic channels. Such interaction reduces the effective coupling significantly and thereby the coherence effects are eliminated due to energy gap fluctuations, making the back-electron transfer incoherent.

Observation model and parameter partials for the JPL VLBI parameter estimation software MODEST/1991

NASA Technical Reports Server (NTRS)

Sovers, O. J.

1991-01-01

A revision is presented of MASTERFIT-1987, which it supersedes. Changes during 1988 to 1991 included introduction of the octupole component of solid Earth tides, the NUVEL tectonic motion model, partial derivatives for the precession constant and source position rates, the option to correct for source structure, a refined model for antenna offsets, modeling the unique antenna at Richmond, FL, improved nutation series due to Zhu, Groten, and Reigber, and reintroduction of the old (Woolard) nutation series for simulation purposes. Text describing the relativistic transformations and gravitational contributions to the delay model was also revised in order to reflect the computer code more faithfully.

Theory of Enceladus and Dione. [on Saturn satellites orbital motion

NASA Technical Reports Server (NTRS)

Jefferys, W. H.; Ries, L. M.

1975-01-01

A new theory of the motion of Enceladus and Dione is under development. The theory is in literal form, with all constants and parameters appearing explicitly, and is being computed with the aid of the algebraic manipulation system TRIGMAN. The development of the disturbing function; the elimination of the short-period terms; and the resonant Hamiltonian and the constants of integration are discussed. An important feature is that the programs have been written in such a manner that, with only minor modification, they should be able to develop the theories of Mimas-Tethys and Titan-Hyperion as well.

Constraining the local variance of H {sub 0} from directional analyses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bengaly, C.A.P. Jr., E-mail: carlosap@on.br

We evaluate the local variance of the Hubble Constant H {sub 0} with low-z Type Ia Supernovae (SNe). Our analyses are performed using a hemispherical comparison method in order to test whether taking the bulk flow motion into account can reconcile the measurement of the Hubble Constant H {sub 0} from standard candles ( H {sub 0} = 73.8±2.4 km s{sup -1} Mpc {sup -1}) with that of the Planck's Cosmic Microwave Background data ( H {sub 0} = 67.8 ± 0.9km s{sup -1} Mpc{sup -1}). We obtain that H {sub 0} ranges from 68.9±0.5 km s{sup -1} Mpc{sup -1}more » to 71.2±0.7 km s{sup -1} Mpc{sup -1} through the celestial sphere (1 σ uncertainty), implying a Hubble Constant maximal variance of δ H {sub 0} = (2.30±0.86) km s{sup -1} Mpc{sup -1} towards the ( l,b ) = (315°,27°) direction. Interestingly, this result agrees with the bulk flow direction estimates found in the literature, as well as previous evaluations of the H {sub 0} variance due to the presence of nearby inhomogeneities. We assess the statistical significance of this result with different prescriptions of Monte Carlo simulations, obtaining moderate statistical significance, i.e., 68.7% confidence level (CL) for such variance. Furthermore, we test the hypothesis of a higher H {sub 0} value in the presence of a bulk flow velocity dipole, finding some evidence for this result which, however, cannot be claimed to be significant due to the current large uncertainty in the SNe distance modulus. Then, we conclude that the tension between different H {sub 0} determinations can plausibly be caused to the bulk flow motion of the local Universe, even though the current incompleteness of the SNe data set, both in terms of celestial coverage and distance uncertainties, does not allow a high statistical significance for these results or a definitive conclusion about this issue.« less

A novel diamond micro-/nano-machining process for the generation of hierarchical micro-/nano-structures

NASA Astrophysics Data System (ADS)

Zhu, Zhiwei; To, Suet; Ehmann, Kornel F.; Xiao, Gaobo; Zhu, Wule

2016-03-01

A new mechanical micro-/nano-machining process that combines rotary spatial vibrations (RSV) of a diamond tool and the servo motions of the workpiece is proposed and applied for the generation of multi-tier hierarchical micro-/nano-structures. In the proposed micro-/nano-machining system, the servo motion, as the primary cutting motion generated by a slow-tool-servo, is adopted for the fine generation of the primary surfaces with complex shapes. The RSV, as the tertiary cutting operation, is superimposed on the secondary fundamental rotary cutting motion to construct secondary nano-structures on the primary surface. Since the RSV system generally works at much higher frequencies and motion resolution than the primary and secondary motions, it leads to an inherent hierarchical cutting architecture. To investigate the machining performance, complex micro-/nano-structures were generated and explored by both numerical simulations and actual cutting tests. Rotary vibrations of the diamond tool at a constant rotational distance offer an inherent constant cutting velocity, leading to the ability for the generation of homogeneous micro-/nano-structures with fixed amplitudes and frequencies of the vibrations, even over large-scale surfaces. Furthermore, by deliberately combining the non-resonant three-axial vibrations and the servo motion, the generation of a variety of micro-/nano-structures with complex shapes and with flexibly tunable feature sizes can be achieved.

Does immobilization after arthroscopic rotator cuff repair increase tendon healing? A systematic review and meta-analysis.

PubMed

Shen, Chong; Tang, Zhi-Hong; Hu, Jun-Zu; Zou, Guo-Yao; Xiao, Rong-Chi; Yan, Dong-Xue

2014-09-01

To determine whether immobilization after arthroscopic rotator cuff repair improved tendon healing compared with early passive motion. A systematic electronic literature search was conducted to identify randomized controlled trials (RCTs) comparing early passive motion with immobilization after arthroscopic rotator cuff repair. The primary outcome assessed was tendon healing in the repaired cuff. Secondary outcome measures were range of motion (ROM) and American Shoulder and Elbow Surgeons (ASES) shoulder scale, Simple Shoulder Test (SST), Constant, and visual analog scale (VAS) for pain scores. Pooled analyses were performed using a random effects model to obtain summary estimates of treatment effect with 95% confidence intervals. Heterogeneity among included studies was quantified. Three RCTs examining 265 patients were included. Meta-analysis revealed no significant difference in tendon healing in the repaired cuff between the early-motion and immobilization groups. A significant difference in external rotation at 6 months postoperatively favored early motion over immobilization, but no significant difference was observed at 1 year postoperatively. In one study, Constant scores were slightly higher in the early-motion group than in the immobilization group. Two studies found no significant difference in ASES, SST, or VAS score between groups. We found no evidence that immobilization after arthroscopic rotator cuff repair was superior to early-motion rehabilitation in terms of tendon healing or clinical outcome. Patients in the early-motion group may recover ROM more rapidly. Level II; systematic review of levels I and II studies.

Optimized "detectors" for dynamics analysis in solid-state NMR

NASA Astrophysics Data System (ADS)

Smith, Albert A.; Ernst, Matthias; Meier, Beat H.

2018-01-01

Relaxation in nuclear magnetic resonance (NMR) results from stochastic motions that modulate anisotropic NMR interactions. Therefore, measurement of relaxation-rate constants can be used to characterize molecular-dynamic processes. The motion is often characterized by Markov processes using an auto-correlation function, which is assumed to be a sum of multiple decaying exponentials. We have recently shown that such a model can lead to severe misrepresentation of the real motion, when the real correlation function is more complex than the model. Furthermore, multiple distributions of motion may yield the same set of dynamics data. Therefore, we introduce optimized dynamics "detectors" to characterize motions which are linear combinations of relaxation-rate constants. A detector estimates the average or total amplitude of motion for a range of motional correlation times. The information obtained through the detectors is less specific than information obtained using an explicit model, but this is necessary because the information contained in the relaxation data is ambiguous, if one does not know the correct motional model. On the other hand, if one has a molecular dynamics trajectory, one may calculate the corresponding detector responses, allowing direct comparison to experimental NMR dynamics analysis. We describe how to construct a set of optimized detectors for a given set of relaxation measurements. We then investigate the properties of detectors for a number of different data sets, thus gaining an insight into the actual information content of the NMR data. Finally, we show an example analysis of ubiquitin dynamics data using detectors, using the DIFRATE software.

Radiation from an accelerating neutral body: The case of rotation

NASA Astrophysics Data System (ADS)

Yarman, Tolga; Arik, Metin; Kholmetskii, Alexander L.

2013-11-01

When an object is bound at rest to an attractional field, its rest mass (owing to the law of energy conservation, including the mass and energy equivalence of the Special Theory of Relativity) must decrease. The mass deficiency coming into play indicates a corresponding rest energy discharge. Thus, bringing an object to a rotational motion means that the energy transferred for this purpose serves to extract just as much rest mass (or similarly "rest energy", were the speed of light in empty space taken to be unity) out of it. Here, it is shown that during angular acceleration, photons of fundamental energy are emitted, while the object is kept on being delivered to a more and more intense rotational accelerational field, being the instantaneous angular velocity of the rotating object. This fundamental energy, as seen, does not depend on anything else (such as the mass or charge of the object), and it is in harmony with Bohr's Principle of Correspondence. This means at the same time, that emission will be achieved, as long as the angular velocity keeps on increasing, and will cease right after the object reaches a stationary rotational motion (a constant centrifugal acceleration), but if the object were brought to rotation in vacuum with no friction. By the same token, one can affirm that even the rotation at a macroscopic level is quantized, and can only take on "given angular velocities" (which can only be increased, bit by bit). The rate of emission of photons of concern is, on the other hand, proportional to the angular acceleration of the object, similarly to the derivative of the tangential acceleration with respect to time. It is thus constant for a "constant angular acceleration", although the energy of the emitted photons will increase with increasing , until the rotation reaches a stationary level, after which we expect no emission --let us stress-- if the object is in rotation in vacuum, along with no whatsoever friction (such as the case of a rotating diatomic molecule, for instance). If the object reaches its final state in a given medium, say air, and "friction" is present, such as the case of a dental drill, then energy should keep being supplied to it, to overcome friction, which is present either inside the "inner mechanism of rotation" or in its surroundings. In other words, the object in the latter case, would be constantly subject to a friction force, countering its motion, and tending to make it fall to lower rotational energy states. Any fluctuations in the power supply, on the other hand, will slow down the rotating object, no matter how indiscernibly. The small decrease in the rotational velocity is yet reincreased by restoring the power supply, thus perpetually securing a stationary rotational motion. Thereby, the object in this final state, due to fluctuations in either friction or power supply, or both, shall further be expected to emit a radiation of energy , where is the final angular velocity of the object in rotation. What is more is that our team has very successfully measured what is predicted here, and they will report their experimental results in a subsequent article. The approach presented here seems to shed light on the mysterious sonoluminescence. It also triggers the possibility of sensing earthquakes due to radiation that should be emitted by the faults, on which the seismic stress keeps increasing until the crackdown. By the same token, also two colliding (neutral) objects are expected to emit radiation.

Wearing a Wetsuit Alters Upper Extremity Motion during Simulated Surfboard Paddling

PubMed Central

Nessler, J. A.; Silvas, M.; Carpenter, S.; Newcomer, S. C.

2015-01-01

Surfers often wear wetsuits while paddling in the ocean. This neoprene covering may be beneficial to upper extremity movement by helping to improve proprioceptive acuity, or it may be detrimental by providing increased resistance. The purpose of this study was to evaluate the effects of wearing a wetsuit on muscle activation, upper extremity motion, heart rate, and oxygen consumption during simulated surfboard paddling in the laboratory. Twelve male, recreational surfers performed two paddling trials at a constant workload on a swim bench ergometer both with and without a wetsuit. Kinematic data and EMG were acquired from the right arm via motion capture, and oxygen consumption and heart rate were recorded with a metabolic cart and heart rate monitor. Wearing a wetsuit had no significant effect on oxygen consumption or heart rate. A significant increase in EMG activation was observed for the middle deltoid but not for any of the other shoulder muscle evaluated. Finally, approximate entropy and estimates of the maximum Lyapunov exponent increased significantly for vertical trajectory of the right wrist (i.e. stroke height) when a wetsuit was worn. These results suggest that a 2mm wetsuit has little effect on the energy cost of paddling at lower workloads but does affect arm motion. These changes may be the result of enhanced proprioceptive acuity due to mechanical compression from the wetsuit. PMID:26551321

Undergraduate Labs for Biological Physics: Brownian Motion and Optical Trapping

NASA Astrophysics Data System (ADS)

Chu, Kelvin; Laughney, A.; Williams, J.

2006-12-01

We describe a set of case-study driven labs for an upper-division biological physics course. These labs are motivated by case-studies and consist of inquiry-driven investigations of Brownian motion and optical-trapping experiments. Each lab incorporates two innovative educational techniques to drive the process and application aspects of scientific learning. Case studies are used to encourage students to think independently and apply the scientific method to a novel lab situation. Student input from this case study is then used to decide how to best do the measurement, guide the project and ultimately evaluate the success of the program. Where appropriate, visualization and simulation using VPython is used. Direct visualization of Brownian motion allows students to directly calculate Avogadro's number or the Boltzmann constant. Following case-study driven discussion, students use video microscopy to measure the motion of latex spheres in different viscosity fluids arrive at a good approximation of NA or kB. Optical trapping (laser tweezer) experiments allow students to investigate the consequences of 100-pN forces on small particles. The case study consists of a discussion of the Boltzmann distribution and equipartition theorem followed by a consideration of the shape of the potential. Students can then use video capture to measure the distribution of bead positions to determine the shape and depth of the trap. This work supported by NSF DUE-0536773.

Time series analysis of particle tracking data for molecular motion on the cell membrane.

PubMed

Ying, Wenxia; Huerta, Gabriel; Steinberg, Stanly; Zúñiga, Martha

2009-11-01

Biophysicists use single particle tracking (SPT) methods to probe the dynamic behavior of individual proteins and lipids in cell membranes. The mean squared displacement (MSD) has proven to be a powerful tool for analyzing the data and drawing conclusions about membrane organization, including features like lipid rafts, protein islands, and confinement zones defined by cytoskeletal barriers. Here, we implement time series analysis as a new analytic tool to analyze further the motion of membrane proteins. The experimental data track the motion of 40 nm gold particles bound to Class I major histocompatibility complex (MHCI) molecules on the membranes of mouse hepatoma cells. Our first novel result is that the tracks are significantly autocorrelated. Because of this, we developed linear autoregressive models to elucidate the autocorrelations. Estimates of the signal to noise ratio for the models show that the autocorrelated part of the motion is significant. Next, we fit the probability distributions of jump sizes with four different models. The first model is a general Weibull distribution that shows that the motion is characterized by an excess of short jumps as compared to a normal random walk. We also fit the data with a chi distribution which provides a natural estimate of the dimension d of the space in which a random walk is occurring. For the biological data, the estimates satisfy 1 < d < 2, implying that particle motion is not confined to a line, but also does not occur freely in the plane. The dimension gives a quantitative estimate of the amount of nanometer scale obstruction met by a diffusing molecule. We introduce a new distribution and use the generalized extreme value distribution to show that the biological data also have an excess of long jumps as compared to normal diffusion. These fits provide novel estimates of the microscopic diffusion constant. Previous MSD analyses of SPT data have provided evidence for nanometer-scale confinement zones that restrict lateral diffusion, supporting the notion that plasma membrane organization is highly structured. Our demonstration that membrane protein motion is autocorrelated and is characterized by an excess of both short and long jumps reinforces the concept that the membrane environment is heterogeneous and dynamic. Autocorrelation analysis and modeling of the jump distributions are powerful new techniques for the analysis of SPT data and the development of more refined models of membrane organization. The time series analysis also provides several methods of estimating the diffusion constant in addition to the constant provided by the mean squared displacement. The mean squared displacement for most of the biological data shows a power law behavior rather the linear behavior of Brownian motion. In this case, we introduce the notion of an instantaneous diffusion constant. All of the diffusion constants show a strong consistency for most of the biological data.

Self-consistent electrostatic potential due to trapped plasma in the magnetosphere

NASA Technical Reports Server (NTRS)

Miller, Ronald H.; Khazanov, George V.

1993-01-01

A steady state solution for the self-consistent electrostatic potential due to a plasma confined in a magnetic flux tube is considered. A steady state distribution function is constructed for the trapped particles from the constants of the motion, in the absence of waves and collisions. Using Liouville's theorem, the particle density along the geomagnetic field is determined and found to depend on the local magnetic field, self-consistent electric potential, and the equatorial plasma distribution function. A hot anisotropic magnetospheric plasma in steady state is modeled by a bi-Maxwellian at the equator. The self-consistent electric potential along the magnetic field is calculated assuming quasineutrality, and the potential drop is found to be approximately equal to the average kinetic energy of the equatorially trapped plasma. The potential is compared with that obtained by Alfven and Faelthammar (1963).

Beyond a phenomenological description of magnetostriction

DOE PAGES

Reid, A. H.; Shen, X.; Maldonado, P.; ...

2018-01-26

Magnetostriction, the strain induced by a change in magnetization, is a universal effect in magnetic materials. Owing to the difficulty in unraveling its microscopic origin, it has been largely treated phenomenologically. Here in this paper, we show how the source of magnetostriction—the underlying magnetoelastic stress—can be separated in the time domain, opening the door for an atomistic understanding. X-ray and electron diffraction are used to separate the sub-picosecond spin and lattice responses of FePt nanoparticles. Following excitation with a 50-fs laser pulse, time-resolved X-ray diffraction demonstrates that magnetic order is lost within the nanoparticles with a time constant of 146more » fs. Ultrafast electron diffraction reveals that this demagnetization is followed by an anisotropic, three-dimensional lattice motion. Analysis of the size, speed, and symmetry of the lattice motion, together with ab initio calculations accounting for the stresses due to electrons and phonons, allow us to reveal the magnetoelastic stress generated by demagnetization.« less

Local Dynamics of Acid- and Ion-containing Copolymer Melts

NASA Astrophysics Data System (ADS)

Winey, Karen; Middleton, Robert; Tarver, Jacob; Tyagi, Madhusudan; Soles, Christopher; Frischknecht, Amalie

Interest in acid- and ion-containing polymers arises in part from applications as single-ion conductors for selectively transporting a counter ion for battery applications. Structurally, the low dielectric constant of organic polymers and strong ionic interactions leads to ionic aggregation. Here the polymer backbone motion was investigated through quasi-elastic neutron scattering measurements (QENS) and compared with fully atomistic molecular dynamic simulations of precise poly(ethylene-acrylic acid) copolymers and their ionomers (pxAA-y%Li). The effect of carbon spacer length (x =9, 15, 21) between the acid groups and the degree of neutralization (y) with Li on PE backbone dynamics were considered. Systematic slowing in chain dynamics were observed with increasing neutralization where polymer dynamics appear constrained due to anchoring effects. Simulations provide complementary viewpoints indicating a gradient in chain dynamics as a distance away from acid groups. These results indicate that the addition of pendant acid groups inhibit typical PE backbone motion and the neutralized forms strongly suppress the fraction of mobile PE chain.

Motion of Euglena gracilis: Active fluctuations and velocity distribution

NASA Astrophysics Data System (ADS)

Romanczuk, P.; Romensky, M.; Scholz, D.; Lobaskin, V.; Schimansky-Geier, L.

2015-07-01

We study the velocity distribution of unicellular swimming algae Euglena gracilis using optical microscopy and active Brownian particle theory. To characterize a peculiar feature of the experimentally observed distribution at small velocities we use the concept of active fluctuations, which was recently proposed for the description of stochastically self-propelled particles [Romanczuk, P. and Schimansky-Geier, L., Phys. Rev. Lett. 106, 230601 (2011)]. In this concept, the fluctuating forces arise due to internal random performance of the propulsive motor. The fluctuating forces are directed in parallel to the heading direction, in which the propulsion acts. In the theory, we introduce the active motion via the depot model [Schweitzer, et al., Phys. Rev. Lett. 80(23), 5044 (1998)]. We demonstrate that the theoretical predictions based on the depot model with active fluctuations are consistent with the experimentally observed velocity distributions. In addition to the model with additive active noise, we obtain theoretical results for a constant propulsion with multiplicative noise.

MHD Effect on Unsteady Mixed Convection Boundary Layer Flow past a Circular Cylinder with Constant Wall Temperature

NASA Astrophysics Data System (ADS)

Ismail, M. A.; Mohamad, N. F.; Ilias, M. R.; Shafie, S.

2017-09-01

Magnetohydrodynamic (MHD) effect is a study on motion of electrical-conducting fluid under magnetic fields. This effect has great intention due to its applications such as design of heat exchanger and nuclear reactor. In the problem in fluid motion, flow of separation can reduced the effectiveness of the system as well as can increased the energy lost. This study will present the results on reducing the flow separation by considering magnetic effect. In this study, unsteady mixed convection boundary layer flow past a circular cylinder is given attention. Focus of study is on the separation times that affected by the magnetic fields. The mathematical models in the form of partial differential equations are transformed into nonlinear coupled ordinary differential equations and solved numerically using an implicit finite-difference scheme known as Keller-box method. The effect of magnetic parameter on velocity and temperature profiles as well as skin friction and Nusselt number are studied.

Implementation of a Novel Low-Cost Low-Profile Ku-Band Antenna Array for Single Beam Steering from Space

NASA Technical Reports Server (NTRS)

Host, Nicholas K.; Chen, Chi-Chih; Volakis, John L.; Miranda, Felix A.

2013-01-01

Phased array antennas afford many advantages over traditional reflector antennas due to their conformality, high aperture efficiency, and unfettered beam steering capability at the price of increased cost and complexity. This paper eliminates the complex and costly array backend via the implementation of a series fed array employing a propagation constant reconfigurable transmission line connecting each element in series. Scanning can then be accomplished through one small (less than or equal to 100mil) linear motion that controls propagation constant. Specifically, each element is fed via a reconfigurable coplanar stripline transmission line with a tapered dielectric insert positioned between the transmission line traces. The dielectric insert is allowed to move up and down to control propagation constant and therefore induce scanning. We present a 20 element patch array design, scanning from -25 deg. less than or equal to theta less than or equal to 21 deg. at 13GHz. Measurements achieve only10.5 deg. less than or equal to theta less than or equal to 22 deg. scanning due to a faulty, yet correctable, manufacturing process. Beam squint is measured to be plus or minus 3 deg. for a 600MHz bandwidth. This prototype was improved to give scanning of 3.5 deg. less than or equal to theta less than or equal to 22 deg. Cross-pol patterns were shown to be -15dB below the main beam. Simulations accounting for fabrication errors match measured patterns, thus validating the designs.

Projectile Motion without Calculus

ERIC Educational Resources Information Center

Rizcallah, Joseph A.

2018-01-01

Projectile motion is a constant theme in introductory-physics courses. It is often used to illustrate the application of differential and integral calculus. While most of the problems used for this purpose, such as maximizing the range, are kept at a fairly elementary level, some, such as determining the safe domain, involve not so elementary…

Radiation camera motion correction system

DOEpatents

Hoffer, P.B.

1973-12-18

The device determines the ratio of the intensity of radiation received by a radiation camera from two separate portions of the object. A correction signal is developed to maintain this ratio at a substantially constant value and this correction signal is combined with the camera signal to correct for object motion. (Official Gazette)

Proper Motion of the Compact, Nonthermal Radio Source in the Galactic Center, Sagittarius A*

NASA Astrophysics Data System (ADS)

Backer, D. C.; Sramek, R. A.

1999-10-01

Proper motions and radial velocities of luminous infrared stars in the Galactic center have provided strong evidence for a dark mass of 2.5×106 Msolar in the central 0.05 pc of the Galaxy. The leading hypothesis for this mass is a black hole. High angular resolution measurements at radio wavelengths find a compact radio source, Sagittarius (Sgr) A*, that is either the faint glow from a small amount of material accreting onto the hole with low radiative efficiency or a miniature active galactic nucleus (AGN) core-jet system. This paper provides a full report on the first program that has measured the apparent proper motion of Sgr A* with respect to background extragalactic reference frame. Our current result isμl,*=[-6.18+/-0.19] mas yr-1 μb,*=[-0.65+/-0.17] mas yr-1 . The observations were obtained with the NRAO Very Large Array at 4.9 GHz over 16 yr. The proper motion of Sgr A* provides an estimate of its mass based on equipartition of kinetic energy between the hole and the surrounding stars. The measured motion is largest in galactic longitude. This component of the motion is consistent with the secular parallax that results from the rotation of the solar system about the center, which is a global measure of the difference between Oort's constants (A-B), with no additional peculiar motion of Sgr A*. The current uncertainty in Oort's galactic rotation constants limits the use of this component of the proper motion for a mass inference. In latitude, we find a small, and weakly significant, peculiar motion of Sgr A*, -19+/-7 km s-1 after correction for the motion of the solar system with respect to the local standard of rest. We consider sources of peculiar motion of Sgr A* ranging from unstable radio wave propagation through intervening turbulent plasma to the effects of asymmetric masses in the center. These fail to account for a significant peculiar motion. One can appeal to an m=1 dynamical instability that numerical simulations have revealed. However, the measurement of a latitude peculiar proper motion of comparable magnitude and error but with opposite sign in the companion paper by Reid leads us to conclude at the present time that our errors may be underestimated and that the actual peculiar motion might therefore be closer to zero. Improvement of these measurements with further observations and resolving the differences between independent experiments will provide the accuracies of a few km s-1 in both coordinates that will provide both a black hole mass estimate and a definitive determination of Oort's galactic rotation constants on a global Galactic scale.

A Unit-Cell Model for Predicting the Elastic Constants of 3D Four Directional Cylindrical Braided Composite Shafts

NASA Astrophysics Data System (ADS)

Hao, Wenfeng; Liu, Ye; Huang, Xinrong; Liu, Yinghua; Zhu, Jianguo

2018-06-01

In this work, the elastic constants of 3D four directional cylindrical braided composite shafts were predicted using analytical and numerical methods. First, the motion rule of yarn carrier of 3D four directional cylindrical braided composite shafts was analyzed, and the horizontal projection of yarn motion trajectory was obtained. Then, the geometry models of unit-cells with different braiding angles and fiber volume contents were built up, and the meso-scale models of 3D cylindrical braided composite shafts were obtained. Finally, the effects of braiding angles and fiber volume contents on the elastic constants of 3D braided composite shafts were analyzed theoretically and numerically. These results play a crucial role in investigating the mechanical properties of 3D 4-directional braided composites shafts.

Noise in a phosphorelay drives stochastic entry into sporulation in Bacillus subtilis.

PubMed

Russell, Jonathan R; Cabeen, Matthew T; Wiggins, Paul A; Paulsson, Johan; Losick, Richard

2017-10-02

Entry into sporulation in Bacillus subtilis is governed by a phosphorelay in which phosphoryl groups from a histidine kinase are successively transferred via relay proteins to the response regulator Spo0A. Spo0A~P, in turn, sets in motion events that lead to asymmetric division and activation of the cell-specific transcription factor σ F , a hallmark for entry into sporulation. Here, we have used a microfluidics-based platform to investigate the activation of Spo0A and σ F in individual cells held under constant, sporulation-inducing conditions. The principal conclusions were that: (i) activation of σ F occurs with an approximately constant probability after adaptation to conditions of nutrient limitation; (ii) activation of σ F is tightly correlated with, and preceded by, Spo0A~P reaching a high threshold level; (iii) activation of Spo0A takes place abruptly just prior to asymmetric division; and (iv) the primary source of noise in the activation of Spo0A is the phosphorelay. We propose that cells exhibit a constant probability of attaining a high threshold level of Spo0A~P due to fluctuations in the flux of phosphoryl groups through the phosphorelay. © 2017 The Authors.

Motion-plane dependency of the range of dart throw motion and the effects of tendon action due to finger extrinsic muscles during the motion.

PubMed

Mitsukane, Masahiro; Sekiya, Noboru; Kamono, Arinori; Nakabo, Tohru

2018-03-01

[Purpose] To clarify the motion-plane dependency of the range of dart throw motion and the effects of tendon action due to long finger flexors and extensors during the motion. [Subjects and Methods] Forty healthy subjects attended the experiment, and the active range of wrist motion in seven motion planes was measured with an originally designed apparatus. [Results] The reliability of the measurement was acceptable. The range of dart throw motion depended on the motion planes, with a maximum at around the motion plane of 45° from the sagittal plane (45° of pronation). The tendon action of long finger muscles was shown in dart throw motion except in 45° of pronation. [Conclusion] Motion-plane dependency of the range of dart throw motion exists in healthy subjects. The absence of tendon action due to finger extrinsic muscles in dart throw motion at 45° might be one of the causes of the advantage of dart throw motion.

Patient training in respiratory-gated radiotherapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kini, Vijay R.; Vedam, Subrahmanya S.; Keall, Paul J.

2003-03-31

Respiratory gating is used to counter the effects of organ motion during radiotherapy for chest tumors. The effects of variations in patient breathing patterns during a single treatment and from day to day are unknown. We evaluated the feasibility of using patient training tools and their effect on the breathing cycle regularity and reproducibility during respiratory-gated radiotherapy. To monitor respiratory patterns, we used a component of a commercially available respiratory-gated radiotherapy system (Real Time Position Management (RPM) System, Varian Oncology Systems, Palo Alto, CA 94304). This passive marker video tracking system consists of reflective markers placed on the patient's chestmore » or abdomen, which are detected by a wall-mounted video camera. Software installed on a PC interfaced to this camera detects the marker motion digitally and records it. The marker position as a function of time serves as the motion signal that may be used to trigger imaging or treatment. The training tools used were audio prompting and visual feedback, with free breathing as a control. The audio prompting method used instructions to 'breathe in' or 'breathe out' at periodic intervals deduced from patients' own breathing patterns. In the visual feedback method, patients were shown a real-time trace of their abdominal wall motion due to breathing. Using this, they were asked to maintain a constant amplitude of motion. Motion traces of the abdominal wall were recorded for each patient for various maneuvers. Free breathing showed a variable amplitude and frequency. Audio prompting resulted in a reproducible frequency; however, the variability and the magnitude of amplitude increased. Visual feedback gave a better control over the amplitude but showed minor variations in frequency. We concluded that training improves the reproducibility of amplitude and frequency of patient breathing cycles. This may increase the accuracy of respiratory-gated radiation therapy.« less

Voxel-wise motion artifacts in population-level whole-brain connectivity analysis of resting-state FMRI.

PubMed

Spisák, Tamás; Jakab, András; Kis, Sándor A; Opposits, Gábor; Aranyi, Csaba; Berényi, Ervin; Emri, Miklós

2014-01-01

Functional Magnetic Resonance Imaging (fMRI) based brain connectivity analysis maps the functional networks of the brain by estimating the degree of synchronous neuronal activity between brain regions. Recent studies have demonstrated that "resting-state" fMRI-based brain connectivity conclusions may be erroneous when motion artifacts have a differential effect on fMRI BOLD signals for between group comparisons. A potential explanation could be that in-scanner displacement, due to rotational components, is not spatially constant in the whole brain. However, this localized nature of motion artifacts is poorly understood and is rarely considered in brain connectivity studies. In this study, we initially demonstrate the local correspondence between head displacement and the changes in the resting-state fMRI BOLD signal. Than, we investigate how connectivity strength is affected by the population-level variation in the spatial pattern of regional displacement. We introduce Regional Displacement Interaction (RDI), a new covariate parameter set for second-level connectivity analysis and demonstrate its effectiveness in reducing motion related confounds in comparisons of groups with different voxel-vise displacement pattern and preprocessed using various nuisance regression methods. The effect of using RDI as second-level covariate is than demonstrated in autism-related group comparisons. The relationship between the proposed method and some of the prevailing subject-level nuisance regression techniques is evaluated. Our results show that, depending on experimental design, treating in-scanner head motion as a global confound may not be appropriate. The degree of displacement is highly variable among various brain regions, both within and between subjects. These regional differences bias correlation-based measures of brain connectivity. The inclusion of the proposed second-level covariate into the analysis successfully reduces artifactual motion-related group differences and preserves real neuronal differences, as demonstrated by the autism-related comparisons.

The rotation of Titan and Ganymede

NASA Astrophysics Data System (ADS)

Van Hoolst, Tim; Coyette, Alexis; Baland, Rose-Marie; Trinh, Antony

2016-10-01

The rotation rates of Titan and Ganymede, the largest satellites of Saturn and Jupiter, are on average equal to their orbital mean motion. Here we discuss small deviations from the average rotation for both satellites and evaluate the polar motion of Titan induced by its surface fluid layers. We examine different causes at various time scales and assess possible consequences and the potential of using librations and polar motion as probes of the interior structure of the satellites.The rotation rate of Titan and Ganymede cannot be constant on the orbital time scale as a result of the gravitational torque of the central planet acting on the satellites. Titan is moreover expected to show significant polar motion and additional variations in the rotation rate due to angular momentum exchange with the atmosphere, mainly at seasonal periods. Observational evidence for deviations from the synchronous state has been reported several times for Titan but is unfortunately inconclusive. The measurements of the rotation variations are based on determinations of the shift in position of Cassini radar images taken during different flybys. The ESA JUICE (JUpiter ICy moons Explorer) mission will measure the rotation variations of Ganymede during its orbital phase around the satellite starting in 2032.We report on different theoretical aspects of the librations and polar motion. We consider the influence of the rheology of the ice shell and take into account Cassini measurements of the external gravitational field and of the topography of Titan and similar Galileo data about Ganymede. We also evaluate the librations and polar motion induced by Titan's hydrocarbon seas and use the most recent results of Titan's atmosphere dynamics. We finally evaluate the potential of rotation variations to constrain the satellite's interior structure, in particular its ice shell and ocean.

Robust model-based analysis of single-particle tracking experiments with Spot-On

PubMed Central

Grimm, Jonathan B; Lavis, Luke D

2018-01-01

Single-particle tracking (SPT) has become an important method to bridge biochemistry and cell biology since it allows direct observation of protein binding and diffusion dynamics in live cells. However, accurately inferring information from SPT studies is challenging due to biases in both data analysis and experimental design. To address analysis bias, we introduce ‘Spot-On’, an intuitive web-interface. Spot-On implements a kinetic modeling framework that accounts for known biases, including molecules moving out-of-focus, and robustly infers diffusion constants and subpopulations from pooled single-molecule trajectories. To minimize inherent experimental biases, we implement and validate stroboscopic photo-activation SPT (spaSPT), which minimizes motion-blur bias and tracking errors. We validate Spot-On using experimentally realistic simulations and show that Spot-On outperforms other methods. We then apply Spot-On to spaSPT data from live mammalian cells spanning a wide range of nuclear dynamics and demonstrate that Spot-On consistently and robustly infers subpopulation fractions and diffusion constants. PMID:29300163

Robust model-based analysis of single-particle tracking experiments with Spot-On.

PubMed

Hansen, Anders S; Woringer, Maxime; Grimm, Jonathan B; Lavis, Luke D; Tjian, Robert; Darzacq, Xavier

2018-01-04

Single-particle tracking (SPT) has become an important method to bridge biochemistry and cell biology since it allows direct observation of protein binding and diffusion dynamics in live cells. However, accurately inferring information from SPT studies is challenging due to biases in both data analysis and experimental design. To address analysis bias, we introduce 'Spot-On', an intuitive web-interface. Spot-On implements a kinetic modeling framework that accounts for known biases, including molecules moving out-of-focus, and robustly infers diffusion constants and subpopulations from pooled single-molecule trajectories. To minimize inherent experimental biases, we implement and validate stroboscopic photo-activation SPT (spaSPT), which minimizes motion-blur bias and tracking errors. We validate Spot-On using experimentally realistic simulations and show that Spot-On outperforms other methods. We then apply Spot-On to spaSPT data from live mammalian cells spanning a wide range of nuclear dynamics and demonstrate that Spot-On consistently and robustly infers subpopulation fractions and diffusion constants. © 2018, Hansen et al.

Determining Atmospheric Pressure Using a Water Barometer

ERIC Educational Resources Information Center

Lohrengel, C. Frederick, II; Larson, Paul R.

2012-01-01

The atmosphere is an envelope of compressible gases that surrounds Earth. Because of its compressibility and nonuniform heating by the Sun, it is in constant motion. The atmosphere exerts pressure on Earth's surface, but that pressure is in constant flux. This experiment allows students to directly measure atmospheric pressure by measuring the…

Dynamics of heterogeneous oscillator ensembles in terms of collective variables

NASA Astrophysics Data System (ADS)

Pikovsky, Arkady; Rosenblum, Michael

2011-04-01

We consider general heterogeneous ensembles of phase oscillators, sine coupled to arbitrary external fields. Starting with the infinitely large ensembles, we extend the Watanabe-Strogatz theory, valid for identical oscillators, to cover the case of an arbitrary parameter distribution. The obtained equations yield the description of the ensemble dynamics in terms of collective variables and constants of motion. As a particular case of the general setup we consider hierarchically organized ensembles, consisting of a finite number of subpopulations, whereas the number of elements in a subpopulation can be both finite or infinite. Next, we link the Watanabe-Strogatz and Ott-Antonsen theories and demonstrate that the latter one corresponds to a particular choice of constants of motion. The approach is applied to the standard Kuramoto-Sakaguchi model, to its extension for the case of nonlinear coupling, and to the description of two interacting subpopulations, exhibiting a chimera state. With these examples we illustrate that, although the asymptotic dynamics can be found within the framework of the Ott-Antonsen theory, the transients depend on the constants of motion. The most dramatic effect is the dependence of the basins of attraction of different synchronous regimes on the initial configuration of phases.

Water entry and exit of horizontal circular cylinders

NASA Astrophysics Data System (ADS)

Greenhow, M.; Moyo, S.

This paper describes fully nonlinear two-dimensional numerical calculations of the free-surface deformations of initially calm water caused by the forced motion of totally or partially submerged horizontal circular cylinders. The paper considers the following. (i) Totally submerged cylinders moving with constant velocity in vertical, horizontal or combined motions. Results are compared with the small-time asymptotic solution obtained by Tyvand and Milohin 1995. Their results, which are taken to third-order (which is when gravity terms first appear in the expansions), are in excellent agreement with the numerical calculations for small times; beyond this only the numerical method gives accurate results until the free surface breaks or the cylinder emerges from the free surface. Breaking can occur during exit due to strongly negative pressures arising on the cylinder surface, or during the downwards motion causing a free-surface depression which closes up rapidly, forming splashes. Downwards motion is also shown to give rise to high-frequency waves in some cases. (ii) The free-surface deformations, pressures and forces acting on a cylinder in vertical or oblique forced motion during engulfment when it submerges from being initially half-submerged. The initial stages, when the cylinder still pierces the free surface, specify the initial conditions for a separate program for a completely submerged body, thereby allowing complete engulfment to be studied. The free surface closes up violently over the top of the cylinder resulting in jet flow, which, while difficult to handle numerically, has been shown to be insignificant for the bulk flow and the cylinder pressures and forces.

Interrelationship of mid-diastolic mitral valve motion, pulmonary venous flow, and transmitral flow.

PubMed

Keren, G; Meisner, J S; Sherez, J; Yellin, E L; Laniado, S

1986-07-01

This study offers a unifying mechanism of left ventricular filling dynamics to link the unexplained mid-diastolic motion of the mitral valve with an associated increase in transmitral flow, with the phasic character of pulmonary vein flow, and with changes in the atrioventricular pressure difference. M mode echograms of mitral valve motion and Doppler echocardiograms of mitral and pulmonary vein flow velocities were recorded in 12 healthy volunteers (heart rate = 60 +/- 9 beats/min). All echocardiograms showed an undulation in the mitral valve (L motion) at a relatively constant delay from the peak of the diastolic phase of pulmonary vein flow (K phase). In six subjects, the L motion was also associated with a distinct wave of mitral flow (L wave). Measured from the onset of the QRS complex, Q-K was 577 +/- 39 msec; Q-L was 703 +/- 42 msec, and K-L was 125 +/- 16 msec. Multiple measurements within each subject during respiratory variations in RR interval indicated exceptionally small differences in the temporal relationships (mean coefficient of variation 2%). Early rapid flow deceleration is caused by a reversal of the atrioventricular pressure gradient, and the L wave arises from the subsequent reestablishment of a positive gradient due to left atrial filling via the pulmonary veins. The mitral valve moves passively in response to the flowing blood and the associated pressure difference. This interpretation is confirmed by (1) a computational model, and (2) a retrospective analysis of data from patients with mitral stenosis and from conscious dogs instrumented to measure transmitral pressure-flow relationships.

Maximum Range of a Projectile Thrown from Constant-Speed Circular Motion

NASA Astrophysics Data System (ADS)

Poljak, Nikola

2016-11-01

The problem of determining the angle θ at which a point mass launched from ground level with a given speed v0 will reach a maximum distance is a standard exercise in mechanics. There are many possible ways of solving this problem, leading to the well-known answer of θ = π/4, producing a maximum range of D max = v0 2 / g , with g being the free-fall acceleration. Conceptually and calculationally more difficult problems have been suggested to improve student proficiency in projectile motion, with the most famous example being the Tarzan swing problem. The problem of determining the maximum distance of a point mass thrown from constant-speed circular motion is presented and analyzed in detail in this text. The calculational results confirm several conceptually derived conclusions regarding the initial throw position and provide some details on the angles and the way of throwing (underhand or overhand) that produce the maximum throw distance.

Integrability of geodesics in near-horizon extremal geometries: Case of Myers-Perry black holes in arbitrary dimensions

NASA Astrophysics Data System (ADS)

Demirchian, Hovhannes; Nersessian, Armen; Sadeghian, Saeedeh; Sheikh-Jabbari, M. M.

2018-05-01

We investigate dynamics of probe particles moving in the near-horizon limit of extremal Myers-Perry black holes in arbitrary dimensions. Employing ellipsoidal coordinates we show that this problem is integrable and separable, extending the results of the odd dimensional case discussed by Hakobyan et al. [Phys. Lett. B 772, 586 (2017)., 10.1016/j.physletb.2017.07.028]. We find the general solution of the Hamilton-Jacobi equations for these systems and present explicit expressions for the Liouville integrals and discuss Killing tensors and the associated constants of motion. We analyze special cases of the background near-horizon geometry were the system possesses more constants of motion and is hence superintegrable. Finally, we consider a near-horizon extremal vanishing horizon case which happens for Myers-Perry black holes in odd dimensions and show that geodesic equations on this geometry are also separable and work out its integrals of motion.

Impact of motion-associated noise on intrinsic optical signal imaging in humans with optical coherence tomography

PubMed Central

Teussink, Michel M.; Cense, Barry; van Grinsven, Mark J.J.P.; Klevering, B. Jeroen; Hoyng, Carel B.; Theelen, Thomas

2015-01-01

A growing body of evidence suggests that phototransduction can be studied in the human eye in vivo by imaging of fast intrinsic optical signals (IOS). There is consensus concerning the limiting influence of motion-associated imaging noise on the reproducibility of IOS-measurements, especially in those employing spectral-domain optical coherence tomography (SD-OCT). However, no study to date has conducted a comprehensive analysis of this noise in the context of IOS-imaging. In this study, we discuss biophysical correlates of IOS, and we address motion-associated imaging noise by providing correctional post-processing methods. In order to avoid cross-talk of adjacent IOS of opposite signal polarity, cellular resolution and stability of imaging to the level of individual cones is likely needed. The optical Stiles-Crawford effect can be a source of significant IOS-imaging noise if alignment with the peak of the Stiles-Crawford function cannot be maintained. Therefore, complete head stabilization by implementation of a bite-bar may be critical to maintain a constant pupil entry position of the OCT beam. Due to depth-dependent sensitivity fall-off, heartbeat and breathing associated axial movements can cause tissue reflectivity to vary by 29% over time, although known methods can be implemented to null these effects. Substantial variations in reflectivity can be caused by variable illumination due to changes in the beam pupil entry position and angle, which can be reduced by an adaptive algorithm based on slope-fitting of optical attenuation in the choriocapillary lamina. PMID:26137369

Atypical biological motion kinematics are represented by complementary lower-level and top-down processes during imitation learning.

PubMed

Hayes, Spencer J; Dutoy, Chris A; Elliott, Digby; Gowen, Emma; Bennett, Simon J

2016-01-01

Learning a novel movement requires a new set of kinematics to be represented by the sensorimotor system. This is often accomplished through imitation learning where lower-level sensorimotor processes are suggested to represent the biological motion kinematics associated with an observed movement. Top-down factors have the potential to influence this process based on the social context, attention and salience, and the goal of the movement. In order to further examine the potential interaction between lower-level and top-down processes in imitation learning, the aim of this study was to systematically control the mediating effects during an imitation of biological motion protocol. In this protocol, we used non-human agent models that displayed different novel atypical biological motion kinematics, as well as a control model that displayed constant velocity. Importantly the three models had the same movement amplitude and movement time. Also, the motion kinematics were displayed in the presence, or absence, of end-state-targets. Kinematic analyses showed atypical biological motion kinematics were imitated, and that this performance was different from the constant velocity control condition. Although the imitation of atypical biological motion kinematics was not modulated by the end-state-targets, movement time was more accurate in the absence, compared to the presence, of an end-state-target. The fact that end-state targets modulated movement time accuracy, but not biological motion kinematics, indicates imitation learning involves top-down attentional, and lower-level sensorimotor systems, which operate as complementary processes mediated by the environmental context. Copyright © 2015 Elsevier B.V. All rights reserved.

A Study of Brownian Motion Using Light Scattering

ERIC Educational Resources Information Center

Clark, Noel A.; And Others

1970-01-01

Presents an advanced laboratory experiment and lecture demonstration by which the intensity spectrum of light scattered by a suspension of particles in a fluid can be studied. From this spectrum, it is possible to obtain quantitative information about the motion of the particles, including an accurate determination of their diffusion constant.…

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

The large amplitude motions of methylamine from the perspective of the highly correlated ab initio methods

NASA Astrophysics Data System (ADS)

Senent, M. L.

2018-01-01

CCSD(T)-F12 theory in connection with extended basis sets is employed to determine the electronic ground state spectroscopic parameters of methylamine at low temperatures. The geometry, the rotational constants, all the fundamental frequencies, the dipole moment and its components, and the centrifugal distortion constants, are provided. The ground vibrational state rotational constants were found to be A0 = 103067.15 MHz, B0 = 22588.29 MHz, and C0 = 21710.50 MHz and the dipole moment to be 1.4071D. Fermi displacements of the vibrational bands are predicted. The low vibrational energy levels corresponding to the large amplitude motions are determine variationally using a flexible three-dimensional model depending on three variables: the HNH bending, the NH2 wagging and the CH3 torsional coordinates. The computed levels are compared with previous experimental and calculated energies. Methylamine parameters are very sensitive to the level of ab initio calculations.

Constant angular velocity of the wrist during the lifting of a sphere.

PubMed

Chappell, P H; Metcalf, C D; Burridge, J H; Yule, V T; Pickering, R M

2010-05-01

The primary objective of the experiments was to investigate the wrist motion of a person while they were carrying out a prehensile task from a clinical hand function test. A six-camera movement system was used to observe the wrist motion of 10 participants. A very light sphere and a heavy sphere were used in the experiments to study any mass effects. While seated at a table, a participant moved a sphere over a small obstacle using their dominant hand. The participants were observed to move their wrist at a constant angular velocity. This phenomenon has not been reported previously. Theoretically, the muscles of the wrist provide an impulse of force at the start of the rotation while the forearm maintains a constant vertical force on a sphere. Light-heavy mean differences for the velocities, absolute velocities, angles and times taken showed no significant differences (p = 0.05).

Expressions for the precession quantities based upon the IAU /1976/ system of astronomical constants

NASA Technical Reports Server (NTRS)

Lieske, J. H.; Lederle, T.; Fricke, W.; Morando, B.

1977-01-01

The structure of the expressions usually employed in calculating the effects of precession is examined, and a method is outlined for revising the expressions to account for changes in the fundamental astronomical constants. It is shown that the basic set of parameters, upon which depend the lengthy polynomials for computing the mean obliquity of data and the elements of the precession matrix, consists of the mean obliquity, the speed of general precession in longitude at a fixed epoch, and the system of planetary masses. Special attention is given to the motion of the ecliptic pole, formulations for a basic epoch as well as an arbitrary epoch, and ecliptic motion relative to the basic epoch. Numerical precession quantities at epoch J2000.0 (JED 2451545.0) are presented which result from the revision of astronomical constants adopted at the XVI General Assembly of the IAU.

Quantum correlations from a room-temperature optomechanical cavity

NASA Astrophysics Data System (ADS)

Purdy, T. P.; Grutter, K. E.; Srinivasan, K.; Taylor, J. M.

2017-06-01

The act of position measurement alters the motion of an object being measured. This quantum measurement backaction is typically much smaller than the thermal motion of a room-temperature object and thus difficult to observe. By shining laser light through a nanomechanical beam, we measure the beam’s thermally driven vibrations and perturb its motion with optical force fluctuations at a level dictated by the Heisenberg measurement-disturbance uncertainty relation. We demonstrate a cross-correlation technique to distinguish optically driven motion from thermally driven motion, observing this quantum backaction signature up to room temperature. We use the scale of the quantum correlations, which is determined by fundamental constants, to gauge the size of thermal motion, demonstrating a path toward absolute thermometry with quantum mechanically calibrated ticks.

A model for attenuation and scattering in the Earth's crust

NASA Astrophysics Data System (ADS)

Toksöz, M. Nafi; Dainty, Anton M.; Reiter, Edmund; Wu, Ru-Shan

1988-03-01

The mechanisms contributing to the attenuation of earthquake ground motion in the distance range of 10 to 200 km are studied with the aid of laboratory data, coda waves Rg attenuation, strong motion attenuation measurements in the northeast United States and Canada, and theoretical models. The frequency range 1 10 Hz has been studied. The relative contributions to attenuation of anelasticity of crustal rocks (constant Q), fluid flow and scattering are evaluated. Scattering is found to be strong with an albedo B 0=0.8 0.9 and a scattering extinction length of 17 32 km. The albedo is defined as the ratio of the total extinction length to the scattering extinction length. The Rg results indicate that Q increases with depth in the upper kilometer or two of the crust, at least in New England. Coda Q appears to be equivalent to intrinsic (anelastic) Q and indicates that this Q increases with frequency as Q=Q o f n , where n is in the range of 0.2 0.9. The intrinsic attenuation in the crust can be explained by a high constant Q (500≤ Q o≤2000) and a frequency dependent mechanism most likely due to fluid effects in rocks and cracks. A fluid-flow attenuation model gives a frequency dependence ( Q≃ Q o f 0.5) similar to those determined from the analysis of coda waves of regional seismograms. Q is low near the surface and high in the body of the crust.

Anticipating the effects of gravity when intercepting moving objects: differentiating up and down based on nonvisual cues.

PubMed

Senot, Patrice; Zago, Myrka; Lacquaniti, Francesco; McIntyre, Joseph

2005-12-01

Intercepting an object requires a precise estimate of its time of arrival at the interception point (time to contact or "TTC"). It has been proposed that knowledge about gravitational acceleration can be combined with first-order, visual-field information to provide a better estimate of TTC when catching falling objects. In this experiment, we investigated the relative role of visual and nonvisual information on motor-response timing in an interceptive task. Subjects were immersed in a stereoscopic virtual environment and asked to intercept with a virtual racket a ball falling from above or rising from below. The ball moved with different initial velocities and could accelerate, decelerate, or move at a constant speed. Depending on the direction of motion, the acceleration or deceleration of the ball could therefore be congruent or not with the acceleration that would be expected due to the force of gravity acting on the ball. Although the best success rate was observed for balls moving at a constant velocity, we systematically found a cross-effect of ball direction and acceleration on success rate and response timing. Racket motion was triggered on average 25 ms earlier when the ball fell from above than when it rose from below, whatever the ball's true acceleration. As visual-flow information was the same in both cases, this shift indicates an influence of the ball's direction relative to gravity on response timing, consistent with the anticipation of the effects of gravity on the flight of the ball.

Some elementary aspects of non-linear airplane speed stability in constrained flight

NASA Astrophysics Data System (ADS)

Campos, L. M. B. C.; Fonseca, A. A.; Azinheira, J. R. C.

We review the longitudinal motion of an airplane, starting a dive at an arbitrary speed, and flown on a constant glide slope; this non-linear longitudinal speed stability problem is solved analytically (Section 2), to provide groundspeed as a function of time. Three restrictions were made: (i) neglect of the short period mode; (ii) low Mach number flight, i.e. omission of drag due to compressibility; (iii) small altitude change, so that the air density could be taken as constant. The predicted stability curves were compared with flight test data (Section 6), obtained using a CASA 212 Aviocar twin-turboprop transport. The flight data records showed that lateral motion was negligible; the effects of wind were compensated for, and the possible errors were estimated. An extension was made of the stability theory from still air (Section 2), to account for the presence of winds (Section 3); the latter were assumed not to exceed 30% of the groundspeed. The comparison of the theoretical stability curves with flight test data can be automated, as can the identification of the relevant data record. The disturbance intensity can be used as a parameter (Section 5) which indicates the start and end of flight manouever. This parameter is defined (Section 4) as the relative lift change, and for longitudinal flight it can be obtained from the wind velocity, vorticity components and changes of airspeed, angle-of-attack and vertical acceleration. It similarly has applications to perturbations of a horizontal turn.

Numerical modeling of temperature and species distributions in hydrocarbon reservoirs

NASA Astrophysics Data System (ADS)

Bolton, Edward W.; Firoozabadi, Abbas

2014-01-01

We examine bulk fluid motion and diffusion of multicomponent hydrocarbon species in porous media in the context of nonequilibrium thermodynamics, with particular focus on the phenomenology induced by horizontal thermal gradients at the upper and lower horizontal boundaries. The problem is formulated with respect to the barycentric (mass-averaged) frame of reference. Thermally induced convection, with fully time-dependent temperature distributions, can lead to nearly constant hydrocarbon composition, with minor unmixing due to thermal gradients near the horizontal boundaries. Alternately, the composition can be vertically segregated due to gravitational effects. Independent and essentially steady solutions have been found to depend on how the compositions are initialized in space and may have implications for reservoir history. We also examine injection (to represent filling) and extraction (to represent leakage) of hydrocarbons at independent points and find a large distortion of the gas-oil contact for low permeability.

Type of motion and lubricant in wear simulation of polyethylene acetabular cup.

PubMed

Saikko, V; Ahlroos, T

1999-01-01

The wear of ultra-high molecular weight polyethylene, the most commonly used bearing material in prosthetic joints, is often substantial, posing a significant clinical problem. For a long time, there has been a need for simple but still realistic wear test devices for prosthetic joint materials. The wear factors produced by earlier reciprocating and unidirectionally rotating wear test devices for polyethylene are typically two orders of magnitude too low, both in water and in serum lubrication. Wear is negligible even under multidirectional motion in water. A twelve-station, circularly translating pin-on-disc (CTPOD) device and a modification of the established biaxial rocking motion hip joint simulator were built. With these simple and inexpensive devices, and with the established three-axis hip joint simulator, realistic wear simulation was achieved. This was due to serum lubrication and to the fact that the direction of sliding constantly changed relative to the polyethylene specimen. The type and magnitude of load was found to be less important. The CTPOD tests showed that the subsurface brittle region, which results from gamma irradiation sterilization of polyethylene in air, has poor wear resistance. Phospholipid and soy protein lubrication resulted in unrealistic wear. The introduction of devices like CTPOD may boost wear studies, rendering them feasible without heavy investment.

Cell adhesion during bullet motion in capillaries.

PubMed

Takeishi, Naoki; Imai, Yohsuke; Ishida, Shunichi; Omori, Toshihiro; Kamm, Roger D; Ishikawa, Takuji

2016-08-01

A numerical analysis is presented of cell adhesion in capillaries whose diameter is comparable to or smaller than that of the cell. In contrast to a large number of previous efforts on leukocyte and tumor cell rolling, much is still unknown about cell motion in capillaries. The solid and fluid mechanics of a cell in flow was coupled with a slip bond model of ligand-receptor interactions. When the size of a capillary was reduced, the cell always transitioned to "bullet-like" motion, with a consequent decrease in the velocity of the cell. A state diagram was obtained for various values of capillary diameter and receptor density. We found that bullet motion enables firm adhesion of a cell to the capillary wall even for a weak ligand-receptor binding. We also quantified effects of various parameters, including the dissociation rate constant, the spring constant, and the reactive compliance on the characteristics of cell motion. Our results suggest that even under the interaction between P-selectin glycoprotein ligand-1 (PSGL-1) and P-selectin, which is mainly responsible for leukocyte rolling, a cell is able to show firm adhesion in a small capillary. These findings may help in understanding such phenomena as leukocyte plugging and cancer metastasis. Copyright © 2016 the American Physiological Society.

Effects of Air Drag and Lunar Third-Body Perturbations on Motion Near a Reference KAM Torus

DTIC Science & Technology

2011-03-01

body m 1) mass of satellite; 2) order of associated Legendre polynomial n 1) mean motion; 2) degree of associated Legendre polynomial n3 mean motion...physical momentum pi ith physical momentum Pmn associated Legendre polynomial of order m and degree n q̇ physical coordinate derivatives vector, [q̇1...are constants specifying the shape of the gravitational field; and Pmn are associated Legendre polynomials . When m = n = 0, the geopotential function

Isometric deformations of planar quadrilaterals with constant index

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zaputryaeva, E S

We consider isometric deformations (motions) of polygons (so-called carpenter's rule problem) in the case of self-intersecting polygons with the additional condition that the index of the polygon is preserved by the motion. We provide general information about isometric deformations of planar polygons and give a complete solution of the carpenter's problem for quadrilaterals. Bibliography: 17 titles.

Identities in Motion: Rethinking Teacher-Student Identity Negotiation in Multilingual School Contexts

ERIC Educational Resources Information Center

Cummins, Jim

2015-01-01

Recent scholarship within the field of applied linguistics highlights the fact that identities are not static but are fluid, multiple, changeable across time and space, and always constructed in relationship to interactions with others. In other words, identities are constantly in motion. This paper presents a framework for examining the notion of…

Spacecraft detumbling through energy dissipation

NASA Technical Reports Server (NTRS)

Fitz-Coy, Norman; Chatterjee, Anindya

1993-01-01

The attitude motion of a tumbling, rigid, axisymmetric spacecraft is considered. A methodology for detumbling the spacecraft through energy dissipation is presented. The differential equations governing this motion are stiff, and therefore an approximate solution, based on the variation of constants method, is developed and utilized in the analysis of the detumbling strategy. Stability of the detumbling process is also addressed.

An Exact Solvable Model of Rocket Dynamics in Atmosphere

ERIC Educational Resources Information Center

Rodrigues, H.; Pinho, M. O.; Portes, D., Jr.; Santiago, A.

2009-01-01

In basic physics courses at undergraduate level, the dynamics of self-propelled bodies is presented as an example of momentum conservation law applied to systems with time-varying mass. However, is often studied the simple situation of free motion or the motion under the action of a constant gravitational field. In this work, we investigate the…

Comparison of the peak resolution and the stationary phase retention between the satellite and the planetary motions using the coil satellite centrifuge with counter-current chromatographic separation of 4-methylumbelliferyl sugar derivatives.

PubMed

Shinomiya, Kazufusa; Zaima, Kazumasa; Harada, Yukina; Yasue, Miho; Harikai, Naoki; Tokura, Koji; Ito, Yoichiro

2017-01-20

Coil satellite centrifuge (CSC) produces the complex satellite motion consisting of the triplicate rotation of the coiled column around three axes including the sun axis (the angular velocity, ω 1 ), the planet axis (ω 2 ) and the satellite axis (the central axis of the column) (ω 3 ) according to the following formula: ω 1 =ω 2 +ω 3 . Improved peak resolution in the separation of 4-methylumbelliferyl sugar derivatives was achieved using the conventional multilayer coiled columns with ethyl acetate/1-butanol/water (3: 2: 5, v/v) for the lower mobile phase at the combination of the rotation speeds (ω 1 , ω 2 , ω 3 )=(300, 150, 150rpm), and (1:4:5, v/v) for the upper mobile phase at (300:100:200rpm). The effect of the satellite motion on the peak resolution and the stationary phase retention was evaluated by each CSC separation with the different rotation speeds of ω 2 and ω 3 under the constant revolution speed at ω 1 =300rpm. With the lower mobile phase, almost constant peak resolution and stationary phase retention were yielded regardless of the change of ω 2 and ω 3 , while with the upper mobile phase these two values were sensitively varied according to the different combination of ω 2 and ω 3 . For example, when ω 2 =147 or 200rpm is used, no stationary phase was retained in the coiled column while ω 2 =150rpm could retain enough volume of stationary phase for separation. On the other hand, the combined rotation speeds at (ω 1 , ω 2 , ω 3 )=(300, 300, 0rpm) or (300, 0, 300rpm) produced insufficient peak resolution regardless of the choice of the mobile phase apparently due to the lack of rotation speed except at (300, 0, 300rpm) with the upper mobile phase. At lower rotation speed of ω 1 =300rpm, better peak resolution and stationary phase retention were obtained by the satellite motion (ω 3 ) than by the planetary motion (ω 2 ), or ω 3 >ω 2 . The effect of the hydrophobicity of the two-phase solvent systems on the stationary phase retention was further examined using the n-hexane/ethyl acetate/1-butanol/methanol/water system at different volume ratios. In the satellite motion at (ω 1 , ω 2 , ω 3 )=(300, 150, 150rpm), almost constant stationary phase retention was obtained with the lower mobile phase regardless of the hydrophobicity of the solvent system whereas the stationary phase retention varied according to the volume ratio of the two-phase solvent system for the upper mobile phase. However, stable stationary phase retention was observed with either phase used as the mobile phase. In order to analyze the acceleration acting on the coiled column, an acceleration sensor was set on the column holder by displacing the multilayer column. The combination of the rotation speeds at (300, 100, 200rpm) showed double loops in the acceleration track, whereas (300, 150, 150rpm) showed a single loop, and all other combinations showed, complex tracks. The overall results indicate that the satellite motion is seriously affected by the combination of rotation speeds and the hydrophobicity of the two-phase solvent system when the upper phase was used as the mobile phase for separation. Copyright © 2016 Elsevier B.V. All rights reserved.

Comparison of the peak resolution and the stationary phase retention between the satellite and the planetary motions using the coil satellite centrifuge with counter-current chromatographic separation of 4-methylumbelliferyl sugar derivatives

PubMed Central

Shinomiya, Kazufusa; Zaima, Kazumasa; Harada, Yukina; Yasue, Miho; Harikai, Naoki; Tokura, Koji; Ito, Yoichiro

2016-01-01

Coil satellite centrifuge (CSC) produces the complex satellite motion consisting of the triplicate rotation of the coiled column around three axes including the sun axis (the angular velocity, ω1), the planet axis (ω2) and the satellite axis (the central axis of the column) (ω3) according to the following formula: ω1 = ω2 + ω3. Improved peak resolution in the separation of 4-methylumbelliferyl sugar derivatives was achieved using the conventional multilayer coiled columns with ethyl acetate/1-butanol/water (3 : 2 : 5, v/v) for the lower mobile phase at the combination of the rotation speeds (ω1, ω2, ω3) = (300, 150, 150 rpm), and (1 : 4 : 5, v/v) for the upper mobile phase at (300 : 100 : 200 rpm). The effect of the satellite motion on the peak resolution and the stationary phase retention was evaluated by each CSC separation with the different rotation speeds of ω2 and ω3 under the constant revolution speed at ω1 = 300 rpm. With the lower mobile phase, almost constant peak resolution and stationary phase retention were yielded regardless of the change of ω2 and ω3, while with the upper mobile phase these two values were sensitively varied according to the different combination of ω2 and ω3. For example, when ω2 = 147 or 200 rpm is used, no stationary phase was retained in the coiled column while ω2 = 150 rpm could retain enough volume of stationary phase for separation. On the other hand, the combined rotation speeds at (ω1, ω2, ω3) = (300, 300, 0 rpm) or (300, 0, 300 rpm) produced insufficient peak resolution regardless of the choice of the mobile phase apparently due to the lack of rotation speed except at (300, 0, 300 rpm) with the upper mobile phase. At lower rotation speed of ω1 = 300 rpm, better peak resolution and stationary phase retention were obtained by the satellite motion (ω3) than by the planetary motion (ω2), or ω3 > ω2. The effect of the hydrophobicity of the two-phase solvent systems on the stationary phase retention was further examined using the n-hexane/ethyl acetate/1-butanol/methanol/water system at different volume ratios. In the satellite motion at (ω1, ω2, ω3) = (300, 150, 150 rpm), almost constant stationary phase retention was obtained with the lower mobile phase regardless of the hydrophobicity of the solvent system whereas the stationary phase retention varied according to the volume ratio of the two-phase solvent system for the upper mobile phase. However, stable stationary phase retention was observed with either phase used as the mobile phase. In order to analyze the acceleration acting on the coiled column, an acceleration sensor was set on the column holder by displacing the multilayer column. The combination of the rotation speeds at (300, 100, 200 rpm) showed double loops in the acceleration track, whereas (300, 150, 150 rpm) showed a single loop, and all other combinations showed, complex tracks. The overall results indicate that the satellite motion is seriously affected by the combination of rotation speeds and the hydrophobicity of the two-phase solvent system when the upper phase was used as the mobile phase for separation. PMID:28040269

Motion-Corrected 3D Sonic Anemometer for Tethersondes and Other Moving Platforms

NASA Technical Reports Server (NTRS)

Bognar, John

2012-01-01

To date, it has not been possible to apply 3D sonic anemometers on tethersondes or similar atmospheric research platforms due to the motion of the supporting platform. A tethersonde module including both a 3D sonic anemometer and associated motion correction sensors has been developed, enabling motion-corrected 3D winds to be measured from a moving platform such as a tethersonde. Blimps and other similar lifting systems are used to support tethersondes meteorological devices that fly on the tether of a blimp or similar platform. To date, tethersondes have been limited to making basic meteorological measurements (pressure, temperature, humidity, and wind speed and direction). The motion of the tethersonde has precluded the addition of 3D sonic anemometers, which can be used for high-speed flux measurements, thereby limiting what has been achieved to date with tethersondes. The tethersonde modules fly on a tether that can be constantly moving and swaying. This would introduce enormous error into the output of an uncorrected 3D sonic anemometer. The motion correction that is required must be implemented in a low-weight, low-cost manner to be suitable for this application. Until now, flux measurements using 3D sonic anemometers could only be made if the 3D sonic anemometer was located on a rigid, fixed platform such as a tower. This limited the areas in which they could be set up and used. The purpose of the innovation was to enable precise 3D wind and flux measurements to be made using tether - sondes. In brief, a 3D accelerometer and a 3D gyroscope were added to a tethersonde module along with a 3D sonic anemometer. This combination allowed for the necessary package motions to be measured, which were then mathematically combined with the measured winds to yield motion-corrected 3D winds. At the time of this reporting, no tethersonde has been able to make any wind measurement other than a basic wind speed and direction measurement. The addition of a 3D sonic anemometer is unique, as is the addition of the motion-correction sensors.

Early time excited-state structural evolution of pyranine in methanol revealed by femtosecond stimulated Raman spectroscopy.

PubMed

Wang, Yanli; Liu, Weimin; Tang, Longteng; Oscar, Breland; Han, Fangyuan; Fang, Chong

2013-07-25

To understand chemical reactivity of molecules in condensed phase in real time, a structural dynamics technique capable of monitoring molecular conformational motions on their intrinsic time scales, typically on femtoseconds to picoseconds, is needed. We have studied a strong photoacid pyranine (8-hydroxypyrene-1,3,6-trisulfonic acid, HPTS, pK(a)* ≈ 0) in pure methanol and observed that excited-state proton transfer (ESPT) is absent, in sharp contrast with our previous work on HPTS in aqueous solutions wherein ESPT prevails following photoexcitation. Two transient vibrational marker bands at ~1477 (1454) and 1532 (1528) cm(-1) appear in CH3OH (CD3OD), respectively, rising within the instrument response time of ~140 fs and decaying with 390-470 (490-1400) fs and ~200 ps time constants in CH3OH (CD3OD). We attribute the mode onset to small-scale coherent proton motion along the pre-existing H-bonding chain between HPTS and methanol, and the two decay stages to the low-frequency skeletal motion-modulated Franck-Condon relaxation within ~1 ps and subsequent rotational diffusion of H-bonding partners in solution before fluorescence. The early time kinetic isotope effect (KIE) of ~3 upon methanol deuteration argues active proton motions particularly within the first few picoseconds when coherent skeletal motions are underdamped. Pronounced quantum beats are observed for high-frequency modes consisting of strong phenolic COH rocking (1532 cm(-1)) or H-out-of-plane wagging motions (952 cm(-1)) due to anharmonic coupling to coherent low-frequency modes impulsively excited at ca. 96, 120, and 168 cm(-1). The vivid illustration of atomic motions of HPTS in varying H-bonding geometry with neighboring methanol molecules unravels the multidimensional energy relaxation pathways immediately following photoexcitation, and provides compelling evidence that, in lieu of ESPT, the photoacidity of HPTS promptly activates characteristic low-frequency skeletal motions to search phase space mainly concerning the phenolic end and to efficiently dissipate vibrational energy via skeletal deformation and proton shuttling motions within the intermediate, relatively confined excited-state HPTS-methanol complex on a solvent-dependent dynamic potential energy surface.

Contraction of high eccentricity satellite orbits using uniformly regular KS canonical elements with oblate diurnally varying atmosphere.

NASA Astrophysics Data System (ADS)

Raj, Xavier James

2016-07-01

Accurate orbit prediction of an artificial satellite under the influence of air drag is one of the most difficult and untraceable problem in orbital dynamics. The orbital decay of these satellites is mainly controlled by the atmospheric drag effects. The effects of the atmosphere are difficult to determine, since the atmospheric density undergoes large fluctuations. The classical Newtonian equations of motion, which is non linear is not suitable for long-term integration. Many transformations have emerged in the literature to stabilize the equations of motion either to reduce the accumulation of local numerical errors or allowing the use of large integration step sizes, or both in the transformed space. One such transformation is known as KS transformation by Kustaanheimo and Stiefel, who regularized the nonlinear Kepler equations of motion and reduced it into linear differential equations of a harmonic oscillator of constant frequency. The method of KS total energy element equations has been found to be a very powerful method for obtaining numerical as well as analytical solution with respect to any type of perturbing forces, as the equations are less sensitive to round off and truncation errors. The uniformly regular KS canonical equations are a particular canonical form of the KS differential equations, where all the ten KS Canonical elements αi and βi are constant for unperturbed motion. These equations permit the uniform formulation of the basic laws of elliptic, parabolic and hyperbolic motion. Using these equations, developed analytical solution for short term orbit predictions with respect to Earth's zonal harmonic terms J2, J3, J4. Further, these equations were utilized to include the canonical forces and analytical theories with air drag were developed for low eccentricity orbits (e < 0.2) with different atmospheric models. Using uniformly regular KS canonical elements developed analytical theory for high eccentricity (e > 0.2) orbits by assuming the atmosphere to be oblate only. In this paper a new non-singular analytical theory is developed for the motion of high eccentricity satellite orbits with oblate diurnally varying atmosphere in terms of the uniformly regular KS canonical elements. The analytical solutions are generated up to fourth-order terms using a new independent variable and c (a small parameter dependent on the flattening of the atmosphere). Due to symmetry, only two of the nine equations need to be solved analytically to compute the state vector and change in energy at the end of each revolution. The theory is developed on the assumption that density is constant on the surfaces of spheroids of fixed ellipticity ɛ (equal to the Earth's ellipticity, 0.00335) whose axes coincide with the Earth's axis. Numerical experimentation with the analytical solution for a wide range of perigee height, eccentricity, and orbital inclination has been carried out up to 100 revolutions. Comparisons are made with numerically integrated values and found that they match quite well. Effectiveness of the present analytical solutions will be demonstrated by comparing the results with other analytical solutions in the literature.

Accuracy and Tuning of Flow Parsing for Visual Perception of Object Motion During Self-Motion

PubMed Central

Niehorster, Diederick C.

2017-01-01

How do we perceive object motion during self-motion using visual information alone? Previous studies have reported that the visual system can use optic flow to identify and globally subtract the retinal motion component resulting from self-motion to recover scene-relative object motion, a process called flow parsing. In this article, we developed a retinal motion nulling method to directly measure and quantify the magnitude of flow parsing (i.e., flow parsing gain) in various scenarios to examine the accuracy and tuning of flow parsing for the visual perception of object motion during self-motion. We found that flow parsing gains were below unity for all displays in all experiments; and that increasing self-motion and object motion speed did not alter flow parsing gain. We conclude that visual information alone is not sufficient for the accurate perception of scene-relative motion during self-motion. Although flow parsing performs global subtraction, its accuracy also depends on local motion information in the retinal vicinity of the moving object. Furthermore, the flow parsing gain was constant across common self-motion or object motion speeds. These results can be used to inform and validate computational models of flow parsing. PMID:28567272

Lattice constants and expansivities of gas hydrates from 10 K up to the stability limit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hansen, T. C.; Falenty, A.; Kuhs, W. F.

2016-02-07

The lattice constants of hydrogenated and deuterated CH{sub 4}-, CO{sub 2}-, Xe- (clathrate structure type I) and N{sub 2}-hydrates (clathrate structure type II) from 10 K up to the stability limit were established in neutron- and synchrotron diffraction experiments and were used to derive the related thermal expansivities. The following results emerge from this analysis: (1) The differences of expansivities of structure type I and II hydrates are fairly small. (2) Despite the larger guest-size of CO{sub 2} as compared to methane, CO{sub 2}-hydrate has the smaller lattice constants at low temperatures, which is ascribed to the larger attractive guest-hostmore » interaction of the CO{sub 2}-water system. (3) The expansivity of CO{sub 2}-hydrate is larger than for CH{sub 4}-hydrate which leads to larger lattice constants for the former at temperatures above ∼150 K; this is likely due to the higher motional degrees of freedom of the CO{sub 2} guest molecules. (4) The cage occupancies of Xe- and CO{sub 2}-hydrates affect significantly the lattice constants. (5) Similar to ice Ih, the deuterated compounds have generally slightly larger lattice constants which can be ascribed to the somewhat weaker H-bonding. (6) Compared to ice Ih, the high temperature expansivities are about 50% larger; in contrast to ice Ih and the empty hydrate, there is no negative thermal expansion at low temperature. (7) A comparison of the experimental results with lattice dynamical work, with models based on an Einstein oscillator model, and results from inelastic neutron scattering suggest that the contribution of the guest atoms’ vibrational energy to thermal expansion is important, most prominently for CO{sub 2}- and Xe-hydrates.« less

Piezo-based motion stages for heavy duty operation in clean environments

NASA Astrophysics Data System (ADS)

Karasikov, Nir; Peled, Gal; Yasinov, Roman; Gissin, Michael; Feinstein, Alan

2018-02-01

A range of heavy duty, ultra-precise motion stages had been developed for precise positioning in semiconductor manufacturing and metrology, for use in a clean room and high vacuum (HV and UHV) environments, to meet the precision requirements for 7, 5 nm nodes and beyond. These stages are powered by L1B2 direct drive ultrasonic motors, which allows combining long motion range, sub-nanometer positioning accuracy, high stiffness (in the direction of motion), low power consumption and active compensation of thermal and structural drift while holding position. The mechanical design, material selection for clean room and high vacuum preparation techniques are reviewed. Test results in a clean room are reported for a two-axis (X-Y) stage, having a load capacity of 30 kg, a motion range of 450 mm, a positioning accuracy of < 1 nm, a maximum motion speed of > 200 mm/s and a < 2 nm position stability (3 sigma). Long term drift compensation to sub-nm level, against thermal drift, has been validated for more than 10 hours. Heavy duty operation in a high vacuum is exemplified via a single axis stage operating at 5E-7 Torr, having a moving mass of 0.96 kg, oriented against gravity. The stage is operated periodically (up and down) over a travel length of 45 mm. The motion profile has a trapezoidal shape with an acceleration of 1m/s2 and a constant velocity of 100 mm/s. The operational parameters (average absolute position error during constant velocity, motor force, dead zone level) remain stable over more than 370000 passes (experiment duration).

The perception of ego-motion change in environments with varying depth: Interaction of stereo and optic flow.

PubMed

Ott, Florian; Pohl, Ladina; Halfmann, Marc; Hardiess, Gregor; Mallot, Hanspeter A

2016-07-01

When estimating ego-motion in environments (e.g., tunnels, streets) with varying depth, human subjects confuse ego-acceleration with environment narrowing and ego-deceleration with environment widening. Festl, Recktenwald, Yuan, and Mallot (2012) demonstrated that in nonstereoscopic viewing conditions, this happens despite the fact that retinal measurements of acceleration rate-a variable related to tau-dot-should allow veridical perception. Here we address the question of whether additional depth cues (specifically binocular stereo, object occlusion, or constant average object size) help break the confusion between narrowing and acceleration. Using a forced-choice paradigm, the confusion is shown to persist even if unambiguous stereo information is provided. The confusion can also be demonstrated in an adjustment task in which subjects were asked to keep a constant speed in a tunnel with varying diameter: Subjects increased speed in widening sections and decreased speed in narrowing sections even though stereoscopic depth information was provided. If object-based depth information (stereo, occlusion, constant average object size) is added, the confusion between narrowing and acceleration still remains but may be slightly reduced. All experiments are consistent with a simple matched filter algorithm for ego-motion detection, neglecting both parallactic and stereoscopic depth information, but leave open the possibility of cue combination at a later stage.

A novel CT acquisition and analysis technique for breathing motion modeling

NASA Astrophysics Data System (ADS)

Low, Daniel A.; White, Benjamin M.; Lee, Percy P.; Thomas, David H.; Gaudio, Sergio; Jani, Shyam S.; Wu, Xiao; Lamb, James M.

2013-06-01

To report on a novel technique for providing artifact-free quantitative four-dimensional computed tomography (4DCT) image datasets for breathing motion modeling. Commercial clinical 4DCT methods have difficulty managing irregular breathing. The resulting images contain motion-induced artifacts that can distort structures and inaccurately characterize breathing motion. We have developed a novel scanning and analysis method for motion-correlated CT that utilizes standard repeated fast helical acquisitions, a simultaneous breathing surrogate measurement, deformable image registration, and a published breathing motion model. The motion model differs from the CT-measured motion by an average of 0.65 mm, indicating the precision of the motion model. The integral of the divergence of one of the motion model parameters is predicted to be a constant 1.11 and is found in this case to be 1.09, indicating the accuracy of the motion model. The proposed technique shows promise for providing motion-artifact free images at user-selected breathing phases, accurate Hounsfield units, and noise characteristics similar to non-4D CT techniques, at a patient dose similar to or less than current 4DCT techniques.

Aerodynamic forces and flow structures of the leading edge vortex on a flapping wing considering ground effect.

PubMed

Van Truong, Tien; Byun, Doyoung; Kim, Min Jun; Yoon, Kwang Joon; Park, Hoon Cheol

2013-09-01

The aim of this work is to provide an insight into the aerodynamic performance of the beetle during takeoff, which has been estimated in previous investigations. We employed a scaled-up electromechanical model flapping wing to measure the aerodynamic forces and the three-dimensional flow structures on the flapping wing. The ground effect on the unsteady forces and flow structures were also characterized. The dynamically scaled wing model could replicate the general stroke pattern of the beetle's hind wing kinematics during takeoff flight. Two wing kinematic models have been studied to examine the influences of wing kinematics on unsteady aerodynamic forces. In the first model, the angle of attack is asymmetric and varies during the translational motion, which is the flapping motion of the beetle's hind wing. In the second model, the angle of attack is constant during the translational motion. The instantaneous aerodynamic forces were measured for four strokes during the beetle's takeoff by the force sensor attached at the wing base. Flow visualization provided a general picture of the evolution of the three-dimensional leading edge vortex (LEV) on the beetle hind wing model. The LEV is stable during each stroke, and increases radically from the root to the tip, forming a leading-edge spiral vortex. The force measurement results show that the vertical force generated by the hind wing is large enough to lift the beetle. For the beetle hind wing kinematics, the total vertical force production increases 18.4% and 8.6% for the first and second strokes, respectively, due to the ground effect. However, for the model with a constant angle of attack during translation, the vertical force is reduced during the first stroke. During the third and fourth strokes, the ground effect is negligible for both wing kinematic patterns. This finding suggests that the beetle's flapping mechanism induces a ground effect that can efficiently lift its body from the ground during takeoff.

Dynamics of a magnetic active Brownian particle under a uniform magnetic field.

PubMed

Vidal-Urquiza, Glenn C; Córdova-Figueroa, Ubaldo M

2017-11-01

The dynamics of a magnetic active Brownian particle undergoing three-dimensional Brownian motion, both translation and rotation, under the influence of a uniform magnetic field is investigated. The particle self-propels at a constant speed along its magnetic dipole moment, which reorients due to the interplay between Brownian and magnetic torques, quantified by the Langevin parameter α. In this work, the time-dependent active diffusivity and the crossover time (τ^{cross})-from ballistic to diffusive regimes-are calculated through the time-dependent correlation function of the fluctuations of the propulsion direction. The results reveal that, for any value of α, the particle undergoes a directional (or ballistic) propulsive motion at very short times (t≪τ^{cross}). In this regime, the correlation function decreases linearly with time, and the active diffusivity increases with it. It the opposite time limit (t≫τ^{cross}), the particle moves in a purely diffusive regime with a correlation function that decays asymptotically to zero and an active diffusivity that reaches a constant value equal to the long-time active diffusivity of the particle. As expected in the absence of a magnetic field (α=0), the crossover time is equal to the characteristic time scale for rotational diffusion, τ_{rot}. In the presence of a magnetic field (α>0), the correlation function, the active diffusivity, and the crossover time decrease with increasing α. The magnetic field regulates the regimes of propulsion of the particle. Here, the field reduces the period of time at which the active particle undergoes a directional motion. Consequently, the active particle rapidly reaches a diffusive regime at τ^{cross}≪τ_{rot}. In the limit of weak fields (α≪1), the crossover time decreases quadratically with α, while in the limit of strong fields (α≫1) it decays asymptotically as α^{-1}. The results are in excellent agreement with those obtained by Brownian dynamics simulations.

Dynamics of a magnetic active Brownian particle under a uniform magnetic field

NASA Astrophysics Data System (ADS)

Vidal-Urquiza, Glenn C.; Córdova-Figueroa, Ubaldo M.

2017-11-01

The dynamics of a magnetic active Brownian particle undergoing three-dimensional Brownian motion, both translation and rotation, under the influence of a uniform magnetic field is investigated. The particle self-propels at a constant speed along its magnetic dipole moment, which reorients due to the interplay between Brownian and magnetic torques, quantified by the Langevin parameter α . In this work, the time-dependent active diffusivity and the crossover time (τcross)—from ballistic to diffusive regimes—are calculated through the time-dependent correlation function of the fluctuations of the propulsion direction. The results reveal that, for any value of α , the particle undergoes a directional (or ballistic) propulsive motion at very short times (t ≪τcross ). In this regime, the correlation function decreases linearly with time, and the active diffusivity increases with it. It the opposite time limit (t ≫τcross ), the particle moves in a purely diffusive regime with a correlation function that decays asymptotically to zero and an active diffusivity that reaches a constant value equal to the long-time active diffusivity of the particle. As expected in the absence of a magnetic field (α =0 ), the crossover time is equal to the characteristic time scale for rotational diffusion, τrot. In the presence of a magnetic field (α >0 ), the correlation function, the active diffusivity, and the crossover time decrease with increasing α . The magnetic field regulates the regimes of propulsion of the particle. Here, the field reduces the period of time at which the active particle undergoes a directional motion. Consequently, the active particle rapidly reaches a diffusive regime at τcross≪τrot . In the limit of weak fields (α ≪1 ), the crossover time decreases quadratically with α , while in the limit of strong fields (α ≫1 ) it decays asymptotically as α-1. The results are in excellent agreement with those obtained by Brownian dynamics simulations.

Thermally induced magnonic spin current, thermomagnonic torques, and domain-wall dynamics in the presence of Dzyaloshinskii-Moriya interaction

NASA Astrophysics Data System (ADS)

Wang, X.-G.; Chotorlishvili, L.; Guo, G.-H.; Sukhov, A.; Dugaev, V.; Barnaś, J.; Berakdar, J.

2016-09-01

Thermally activated domain-wall (DW) motion in magnetic insulators has been considered theoretically, with a particular focus on the role of Dzyaloshinskii-Moriya interaction (DMI) and thermomagnonic torques. The thermally assisted DW motion is a consequence of the magnonic spin current due to the applied thermal bias. In addition to the exchange magnonic spin current and the exchange adiabatic and the entropic spin transfer torques, we also consider the DMI-induced magnonic spin current, thermomagnonic DMI fieldlike torque, and the DMI entropic torque. Analytical estimations are supported by numerical calculations. We found that the DMI has a substantial influence on the size and the geometry of DWs, and that the DWs become oriented parallel to the long axis of the nanostrip. Increasing the temperature smoothes the DWs. Moreover, the thermally induced magnonic current generates a torque on the DWs, which is responsible for their motion. From our analysis it follows that for a large enough DMI the influence of DMI-induced fieldlike torque is much stronger than that of the DMI and the exchange entropic torques. By manipulating the strength of the DMI constant, one can control the speed of the DW motion, and the direction of the DW motion can be switched, as well. We also found that DMI not only contributes to the total magnonic current, but also it modifies the exchange magnonic spin current, and this modification depends on the orientation of the steady-state magnetization. The observed phenomenon can be utilized in spin caloritronics devices, for example in the DMI based thermal diodes. By switching the magnetization direction, one can rectify the total magnonic spin current.

Aging and domain growth in K1-xLixTaO3 (x<=0.05)

NASA Astrophysics Data System (ADS)

Alberici-Kious, F.; Bouchaud, J.-P.; Cugliandolo, L. F.; Doussineau, P.; Levelut, A.

2000-12-01

We present experimental results on the dielectric constant in orientational glasses K1-xLixTaO3 (KLT) with x<=0.05, together with the detailed (analytic and numerical) study of a model which attributes the observed aging to the motion of the walls of polarization domains. We show that the dielectric constant after a positive temperature jump goes through a maximum as a function of the subsequent time. This observation and those previously reported (aging, cooling rate dependence, etc.) are compared with the predictions of the model, in which the variations of the dielectric constant are attributed to the change of polarization domain wall area. The total area decreases by domain growth and increases by nucleation of new small domains inside the larger ones. These two opposite variations are both hindered by static random fields (equivalent to energy barriers) due to the frozen dipoles borne by the off-center Li+ ions. Many results are well explained by the model with a single energy barrier. However, some effects can only be understood if a broad distribution of energy barriers is assumed. We use the experimental data to determine this distribution and find it to be unimodal with a width comparable to its most probable value.

Second-order sliding mode controller with model reference adaptation for automatic train operation

NASA Astrophysics Data System (ADS)

Ganesan, M.; Ezhilarasi, D.; Benni, Jijo

2017-11-01

In this paper, a new approach to model reference based adaptive second-order sliding mode control together with adaptive state feedback is presented to control the longitudinal dynamic motion of a high speed train for automatic train operation with the objective of minimal jerk travel by the passengers. The nonlinear dynamic model for the longitudinal motion of the train comprises of a locomotive and coach subsystems is constructed using multiple point-mass model by considering the forces acting on the vehicle. An adaptation scheme using Lyapunov criterion is derived to tune the controller gains by considering a linear, stable reference model that ensures the stability of the system in closed loop. The effectiveness of the controller tracking performance is tested under uncertain passenger load, coupler-draft gear parameters, propulsion resistance coefficients variations and environmental disturbances due to side wind and wet rail conditions. The results demonstrate improved tracking performance of the proposed control scheme with a least jerk under maximum parameter uncertainties when compared to constant gain second-order sliding mode control.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pu, Hung-Yi; Asada, Keiichi; Akiyama, Kazunori

A radiatively inefficient accretion flow (RIAF), which is commonly characterized by its sub-Keplerian nature, is a favored accretion model for the supermassive black hole at the Galactic center, Sagittarius A*. To investigate the observable features of an RIAF, we compare the modeled shadow images, visibilities, and spectra of three flow models with dynamics characterized by (i) a Keplerian shell that is rigidly rotating outside the innermost stable circular orbit (ISCO) and infalling with a constant angular momentum inside ISCO, (ii) a sub-Keplerian motion, and (iii) a free-falling motion with zero angular momentum at infinity. At near-millimeter wavelengths, the emission ismore » dominated by the flow within several Schwarzschild radii. The energy shift due to these flow dynamics becomes important and distinguishable, suggesting that the flow dynamics are an important model parameter for interpreting the millimeter/sub-millimeter very long baseline interferometric observations with the forthcoming, fully assembled Event Horizon Telescope (EHT). As an example, we demonstrate that structural variations of Sagittarius A* on event horizon-scales detected in previous EHT observations can be explained by the non-stationary dynamics of an RIAF.« less

Fault detection and isolation in motion monitoring system.

PubMed

Kim, Duk-Jin; Suk, Myoung Hoon; Prabhakaran, B

2012-01-01

Pervasive computing becomes very active research field these days. A watch that can trace human movement to record motion boundary as well as to study of finding social life pattern by one's localized visiting area. Pervasive computing also helps patient monitoring. A daily monitoring system helps longitudinal study of patient monitoring such as Alzheimer's and Parkinson's or obesity monitoring. Due to the nature of monitoring sensor (on-body wireless sensor), however, signal noise or faulty sensors errors can be present at any time. Many research works have addressed these problems any with a large amount of sensor deployment. In this paper, we present the faulty sensor detection and isolation using only two on-body sensors. We have been investigating three different types of sensor errors: the SHORT error, the CONSTANT error, and the NOISY SENSOR error (see more details on section V). Our experimental results show that the success rate of isolating faulty signals are an average of over 91.5% on fault type 1, over 92% on fault type 2, and over 99% on fault type 3 with the fault prior of 30% sensor errors.

Friction and wear of nickel in sulfuric acid

NASA Technical Reports Server (NTRS)

Rengstorff, G. W. P.; Miyoshi, K.; Buckley, D. H.

1984-01-01

Experiments were conducted with elemental nickel sliding on aluminum oxide in aerated sulfuric acid in concentrations ranging from very dilute (10 -4 N, i.e., 5 ppm) to very concentrated (96 percent) acid. Load and reciprocating sliding speeds were kept constant. With the most dilute concentration (10 -4 N) no observable corrosion occurred in or outside the wear area. This was used as the base condition to determine the high contribution of corrosion to total wear loss at acid concentrations between 0.5 percent (0.1 N) and 75 percent. Corrosion reached a maximum rate of 100 millimeters per year at 30 percent acid. At the same time, general corrosion outside the wear area was very low, in agreement with published information. It is clear that friction and wear greatly accelerated corrosion in the wear area. At dilute concentrations of 0.001 and 0.01 N, corrosion in the wear area was low, and general corrosion outside was also low, but local outside regions in the direction of the wear motion experienced some enhanced corrosion, apparently due to fluid motion of the acid.

3-Amino-1,2,4-triazolium ion in [24(3at)]Cl and [24(3at)]2SnCl6·H2O. Comparative X-ray, vibrational and theoretical studies

NASA Astrophysics Data System (ADS)

Daszkiewicz, Marek; Marchewka, Mariusz K.

2012-09-01

Crystal structures of 3-amino-1,2,4-triazolium chloride and bis(3-amino-1,2,4-triazolium) hexachloridostannate monohydrate were determined by means of X-ray single crystal diffraction. The route of protonation of organic molecule and tautomer equilibrium constants for the cationic forms were calculated using B3LYP/6-31G* method. The most stable protonated species is 2,4-H2-3-amino-1,2,4-triazolium ion, 24(3at)+. Very good agreement between theoretical and experimental frequencies was achieved due to very weak interactions existing in studied compounds. Significantly weaker intermolecular interactions are found in [24(3at)]2SnCl6·H2O than in [24(3at)]Cl. The differences in strength of interactions are manifested in red and blue shifts for stretching and bending motions, respectively. PED calculations show that for 24(3at)+ ion the stretching type of motion of two Nringsbnd H bonds is independent, whereas bending is coupled.

Motion of a Charged Particle in a Constant and Uniform Electromagnetic Field

ERIC Educational Resources Information Center

Ladino, L. A.; Rondón, S. H.; Orduz, P.

2015-01-01

This paper focuses on the use of software developed by the authors that allows the visualization of the motion of a charged particle under the influence of magnetic and electric fields in 3D, at a level suitable for introductory physics courses. The software offers the possibility of studying a great number of physical situations that can…

Knowledge on Accelerated Motion as Measured by Implicit and Explicit Tasks in 5 to 16 Year Olds

ERIC Educational Resources Information Center

Ebersbach, Mirjam; Van Dooren, Wim; Verschaffel, Lieven

2011-01-01

The present study aimed at investigating children's and adolescents' understanding of constant and accelerated motions. The main objectives were (1) to investigate whether different task formats would affect the performance and (2) to track developmental changes in this domain. Five to 16 year olds (N = 157) predicted the distances of a moving…

The Influence of Spring Length on the Physical Parameters of Simple Harmonic Motion

ERIC Educational Resources Information Center

Triana, C. A.; Fajardo, F.

2012-01-01

The aim of this work is to analyse the influence of spring length on the simple harmonic motion of a spring-mass system. In particular, we study the effect of changing the spring length on the elastic constant "[kappa]", the angular frequency "[omega]" and the damping factor "[gamma]" of the oscillations. To characterize the behaviour of these…

Real-time monitoring and visualization of the multi-dimensional motion of an anisotropic nanoparticle

NASA Astrophysics Data System (ADS)

Go, Gi-Hyun; Heo, Seungjin; Cho, Jong-Hoi; Yoo, Yang-Seok; Kim, Minkwan; Park, Chung-Hyun; Cho, Yong-Hoon

2017-03-01

As interest in anisotropic particles has increased in various research fields, methods of tracking such particles have become increasingly desirable. Here, we present a new and intuitive method to monitor the Brownian motion of a nanowire, which can construct and visualize multi-dimensional motion of a nanowire confined in an optical trap, using a dual particle tracking system. We measured the isolated angular fluctuations and translational motion of the nanowire in the optical trap, and determined its physical properties, such as stiffness and torque constants, depending on laser power and polarization direction. This has wide implications in nanoscience and nanotechnology with levitated anisotropic nanoparticles.

Altered sensory-motor control of the head as an etiological factor in space-motion sickness

NASA Technical Reports Server (NTRS)

Lackner, J. R.; DiZio, P.

1989-01-01

Mechanical unloading during head movements in weightlessness may be an etiological factor in space-motion sickness. We simulated altered head loading on Earth without affecting vestibular stimulation by having subjects wear a weighted helmet. Eight subjects were exposed to constant velocity rotation about a vertical axis with direction reversals every 60 sec. for eight reversals with the head loaded and eight with the head unloaded. The severity of motion sickness elicited was significantly higher when the head was loaded. This suggests that altered sensory-motor control of the head is also an etiological factor in space-motion sickness.

E-Invariant Quantized Motion of Valence Quarks

NASA Astrophysics Data System (ADS)

Kreymer, E. L.

2018-06-01

In sub-proton space wave processes are impossible. The analog of the Klein-Gordon equation in sub-proton space is elliptical and describes a stationary system with a constant number of particles. For dynamical processes, separation of variables is used and in each quantum of motion of the quark two states are distinguished: a localization state and a translation state with infinite velocity. Alternation of these states describes the motion of a quark. The mathematical expectations of the lifetimes of the localization states and the spatial extents of the translation states for a free quark and for a quark in a centrally symmetric potential are found. The action after one quantum of motion is equal to the Planck constant. The one-sided Laplace transform is used to determine the Green's function. Use of path integrals shows that the quantized trajectory of a quark is a broken line enveloping the classical trajectory of oscillation of the quark. Comparison of the calculated electric charge distribution in a proton with its experimental value gives satisfactory results. A hypothesis is formulated, according to which the three Grand Geometries of space correspond to the three main interactions of elementary particles.

A dynamic-based measurement of a spring constant with a smartphone light sensor

NASA Astrophysics Data System (ADS)

Pili, Unofre

2018-05-01

An accessible smartphone-based experimental set-up for measuring a spring constant is presented. Using the smartphone ambient light sensor as the motion timer that allows for the measurement of the period of oscillations of a vertical spring-mass oscillator we found the spring constant to be 27.3 +/- 0.2 N m-1. This measurement is in a satisfactory agreement with another experimental value, 26.7 +/- 0.1 N m-1, obtained via the traditional static method.

A space-time tensor formulation for continuum mechanics in general curvilinear, moving, and deforming coordinate systems

NASA Technical Reports Server (NTRS)

Avis, L. M.

1976-01-01

Tensor methods are used to express the continuum equations of motion in general curvilinear, moving, and deforming coordinate systems. The space-time tensor formulation is applicable to situations in which, for example, the boundaries move and deform. Placing a coordinate surface on such a boundary simplifies the boundary condition treatment. The space-time tensor formulation is also applicable to coordinate systems with coordinate surfaces defined as surfaces of constant pressure, density, temperature, or any other scalar continuum field function. The vanishing of the function gradient components along the coordinate surfaces may simplify the set of governing equations. In numerical integration of the equations of motion, the freedom of motion of the coordinate surfaces provides a potential for enhanced resolution of the continuum field function. An example problem of an incompressible, inviscid fluid with a top free surface is considered, where the surfaces of constant pressure (including the top free surface) are coordinate surfaces.

Collision detection for spacecraft proximity operations

NASA Technical Reports Server (NTRS)

Vaughan, Robin M.; Bergmann, Edward V.; Walker, Bruce K.

1991-01-01

A new collision detection algorithm has been developed for use when two spacecraft are operating in the same vicinity. The two spacecraft are modeled as unions of convex polyhedra, where the resulting polyhedron many be either convex or nonconvex. The relative motion of the two spacecraft is assumed to be such that one vehicle is moving with constant linear and angular velocity with respect to the other. Contacts between the vertices, faces, and edges of the polyhedra representing the two spacecraft are shown to occur when the value of one or more of a set of functions is zero. The collision detection algorithm is then formulated as a search for the zeros (roots) of these functions. Special properties of the functions for the assumed relative trajectory are exploited to expedite the zero search. The new algorithm is the first algorithm that can solve the collision detection problem exactly for relative motion with constant angular velocity. This is a significant improvement over models of rotational motion used in previous collision detection algorithms.

The equation of motion for a radiating charged particle without self-interaction term

NASA Astrophysics Data System (ADS)

Herrera, L.

1990-03-01

The motion of a radiating charged particle is studied from the point of view of relativistic classical mechanics. Thus, the resulting equation of motion emerges from equating the total rate of change of momentum to the external force, without the introduction of a “self-force” term. Doing so, one is forced to abandon either one, or both, of the following restrictions: (a) the external force is non-dissipative, (b) the proper mass of the particle is constant. By abandoning (a) we obtain the Mo and Papas equation of motion, whereas allowing variations in the proper mass one is led, uniquely, to the Bonnor equation. A new equation of motion is proposed by abandoning both (a) and (b).

Geometric Brownian Motion with Tempered Stable Waiting Times

NASA Astrophysics Data System (ADS)

Gajda, Janusz; Wyłomańska, Agnieszka

2012-08-01

One of the earliest system that was used to asset prices description is Black-Scholes model. It is based on geometric Brownian motion and was used as a tool for pricing various financial instruments. However, when it comes to data description, geometric Brownian motion is not capable to capture many properties of present financial markets. One can name here for instance periods of constant values. Therefore we propose an alternative approach based on subordinated tempered stable geometric Brownian motion which is a combination of the popular geometric Brownian motion and inverse tempered stable subordinator. In this paper we introduce the mentioned process and present its main properties. We propose also the estimation procedure and calibrate the analyzed system to real data.

The effect of transponder motion on the accuracy of the Calypso Electromagnetic localization system.

PubMed

Murphy, Martin J; Eidens, Richard; Vertatschitsch, Edward; Wright, J Nelson

2008-09-01

To determine position and velocity-dependent effects in the overall accuracy of the Calypso Electromagnetic localization system, under conditions that emulate transponder motion during normal free breathing. Three localization transponders were mounted on a remote-controlled turntable that could move the transponders along a circular trajectory at speeds up to 3 cm/s. A stationary calibration established the coordinates of multiple points on each transponder's circular path. Position measurements taken while the transponders were in motion at a constant speed were then compared with the stationary coordinates. No statistically significant changes in the transponder positions in (x,y,z) were detected when the transponders were in motion. The accuracy of the localization system is unaffected by transponder motion.

Exact solutions to the Mo-Papas and Landau-Lifshitz equations

NASA Astrophysics Data System (ADS)

Rivera, R.; Villarroel, D.

2002-10-01

Two exact solutions of the Mo-Papas and Landau-Lifshitz equations for a point charge in classical electrodynamics are presented here. Both equations admit as an exact solution the motion of a charge rotating with constant speed in a circular orbit. These equations also admit as an exact solution the motion of two identical charges rotating with constant speed at the opposite ends of a diameter. These exact solutions allow one to obtain, starting from the equation of motion, a definite formula for the rate of radiation. In both cases the rate of radiation can also be obtained, with independence of the equation of motion, from the well known fields of a point charge, that is, from the Maxwell equations. The rate of radiation obtained from the Mo-Papas equation in the one-charge case coincides with the rate of radiation that comes from the Maxwell equations; but in the two-charge case the results do not coincide. On the other hand, the rate of radiation obtained from the Landau-Lifshitz equation differs from the one that follows from the Maxwell equations in both the one-charge and two-charge cases. This last result does not support a recent statement by Rohrlich in favor of considering the Landau-Lifshitz equation as the correct and exact equation of motion for a point charge in classical electrodynamics.

The Stability and Interfacial Motion of Multi-layer Radial Porous Media and Hele-Shaw Flows

NASA Astrophysics Data System (ADS)

Gin, Craig; Daripa, Prabir

2017-11-01

In this talk, we will discuss viscous fingering instabilities of multi-layer immiscible porous media flows within the Hele-Shaw model in a radial flow geometry. We study the motion of the interfaces for flows with both constant and variable viscosity fluids. We consider the effects of using a variable injection rate on multi-layer flows. We also present a numerical approach to simulating the interface motion within linear theory using the method of eigenfunction expansion. We compare these results with fully non-linear simulations.

Active motion assisted by correlated stochastic torques.

PubMed

Weber, Christian; Radtke, Paul K; Schimansky-Geier, Lutz; Hänggi, Peter

2011-07-01

The stochastic dynamics of an active particle undergoing a constant speed and additionally driven by an overall fluctuating torque is investigated. The random torque forces are expressed by a stochastic differential equation for the angular dynamics of the particle determining the orientation of motion. In addition to a constant torque, the particle is supplemented by random torques, which are modeled as an Ornstein-Uhlenbeck process with given correlation time τ(c). These nonvanishing correlations cause a persistence of the particles' trajectories and a change of the effective spatial diffusion coefficient. We discuss the mean square displacement as a function of the correlation time and the noise intensity and detect a nonmonotonic dependence of the effective diffusion coefficient with respect to both correlation time and noise strength. A maximal diffusion behavior is obtained if the correlated angular noise straightens the curved trajectories, interrupted by small pirouettes, whereby the correlated noise amplifies a straightening of the curved trajectories caused by the constant torque.

Habituation of self-motion perception following unidirectional angular velocity steps.

PubMed

Clément, Gilles; Terlevic, Robert

2016-09-07

We investigated whether the perceived angular velocity following velocity steps of 80°/s in the dark decreased with the repetition of the stimulation in the same direction. The perceptual response to velocity steps in the opposite direction was also compared before and after this unidirectional habituation training. Participants indicated their perceived angular velocity by clicking on a wireless mouse every time they felt that they had rotated by 90°. The prehabituation perceptual response decayed exponentially with a time constant of 23.9 s. After 100 velocity steps in the same direction, this time constant was 12.9 s. The time constant after velocity steps in the opposite direction was 13.4 s, indicating that the habituation of the sensation of rotation is not direction specific. The peak velocity of the perceptual response was not affected by the habituation training. The differences between the habituation characteristics of self-motion perception and eye movements confirm that different velocity storage mechanisms mediate ocular and perceptual responses.

Spacetime encodings. II. Pictures of integrability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brink, Jeandrew

I visually explore the features of geodesic orbits in arbitrary stationary axisymmetric vacuum (SAV) spacetimes that are constructed from a complex Ernst potential. Some of the geometric features of integrable and chaotic orbits are highlighted. The geodesic problem for these SAV spacetimes is rewritten as a 2 degree of freedom problem and the connection between current ideas in dynamical systems and the study of two manifolds sought. The relationship between the Hamilton-Jacobi equations, canonical transformations, constants of motion, and Killing tensors are commented on. Wherever possible I illustrate the concepts by means of examples from general relativity. This investigation ismore » designed to build the readers' intuition about how integrability arises, and to summarize some of the known facts about 2 degree of freedom systems. Evidence is given, in the form of an orbit-crossing structure, that geodesics in SAV spacetimes might admit a fourth constant of motion that is quartic in momentum (by contrast with Kerr spacetime, where Carter's fourth constant is quadratic)« less

Estimation of two-dimensional motion velocity using ultrasonic signals beamformed in Cartesian coordinate for measurement of cardiac dynamics

NASA Astrophysics Data System (ADS)

Kaburaki, Kaori; Mozumi, Michiya; Hasegawa, Hideyuki

2018-07-01

Methods for the estimation of two-dimensional (2D) velocity and displacement of physiological tissues are necessary for quantitative diagnosis. In echocardiography with a phased array probe, the accuracy in the estimation of the lateral motion is lower than that of the axial motion. To improve the accuracy in the estimation of the lateral motion, in the present study, the coordinate system for ultrasonic beamforming was changed from the conventional polar coordinate to the Cartesian coordinate. In a basic experiment, the motion velocity of a phantom, which was moved at a constant speed, was estimated by the conventional and proposed methods. The proposed method reduced the bias error and standard deviation in the estimated motion velocities. In an in vivo measurement, intracardiac blood flow was analyzed by the proposed method.

Hamiltonian modelling of relative motion.

PubMed

Kasdin, N Jeremy; Gurfil, Pini

2004-05-01

This paper presents a Hamiltonian approach to modelling relative spacecraft motion based on derivation of canonical coordinates for the relative state-space dynamics. The Hamiltonian formulation facilitates the modelling of high-order terms and orbital perturbations while allowing us to obtain closed-form solutions to the relative motion problem. First, the Hamiltonian is partitioned into a linear term and a high-order term. The Hamilton-Jacobi equations are solved for the linear part by separation, and new constants for the relative motions are obtained, they are called epicyclic elements. The influence of higher order terms and perturbations, such as the oblateness of the Earth, are incorporated into the analysis by a variation of parameters procedure. Closed-form solutions for J(2-) and J(4-)invariant orbits and for periodic high-order unperturbed relative motion, in terms of the relative motion elements only, are obtained.

XY vs X Mixer in Quantum Alternating Operator Ansatz for Optimization Problems with Constraints

NASA Technical Reports Server (NTRS)

Wang, Zhihui; Rubin, Nicholas; Rieffel, Eleanor G.

2018-01-01

Quantum Approximate Optimization Algorithm, further generalized as Quantum Alternating Operator Ansatz (QAOA), is a family of algorithms for combinatorial optimization problems. It is a leading candidate to run on emerging universal quantum computers to gain insight into quantum heuristics. In constrained optimization, penalties are often introduced so that the ground state of the cost Hamiltonian encodes the solution (a standard practice in quantum annealing). An alternative is to choose a mixing Hamiltonian such that the constraint corresponds to a constant of motion and the quantum evolution stays in the feasible subspace. Better performance of the algorithm is speculated due to a much smaller search space. We consider problems with a constant Hamming weight as the constraint. We also compare different methods of generating the generalized W-state, which serves as a natural initial state for the Hamming-weight constraint. Using graph-coloring as an example, we compare the performance of using XY model as a mixer that preserves the Hamming weight with the performance of adding a penalty term in the cost Hamiltonian.

The Cost of Accumulating Evidence in Perceptual Decision Making

PubMed Central

Drugowitsch, Jan; Moreno-Bote, Rubén; Churchland, Anne K.; Shadlen, Michael N.; Pouget, Alexandre

2012-01-01

Decision making often involves the accumulation of information over time, but acquiring information typically comes at a cost. Little is known about the cost incurred by animals and humans for acquiring additional information from sensory variables, due, for instance, to attentional efforts. Through a novel integration of diffusion models and dynamic programming, we were able to estimate the cost of making additional observations per unit of time from two monkeys and six humans in a reaction time random dot motion discrimination task. Surprisingly, we find that, the cost is neither zero nor constant over time, but for the animals and humans features a brief period in which it is constant but increases thereafter. In addition, we show that our theory accurately matches the observed reaction time distributions for each stimulus condition, the time-dependent choice accuracy both conditional on stimulus strength and independent of it, and choice accuracy and mean reaction times as a function of stimulus strength. The theory also correctly predicts that urgency signals in the brain should be independent of the difficulty, or stimulus strength, at each trial. PMID:22423085

Arrhenius Rate: constant volume burn

DOE Office of Scientific and Technical Information (OSTI.GOV)

Menikoff, Ralph

A constant volume burn occurs for an idealized initial state in which a large volume of reactants at rest is suddenly raised to a high temperature and begins to burn. Due to the uniform spatial state, there is no fluid motion and no heat conduction. This reduces the time evolu tion to an ODE for the reaction progress variable. With an Arrhenius reaction rate, two characteristics of thermal ignition are illustrated: induction time and thermal runaway. The Frank-Kamenetskii approximation then leads to a simple expression for the adiabatic induction time. For a first order reaction, the analytic solution is derivedmore » and used to illustrate the effect of varying the activation temperature; in particular, on the induction time. In general, the ODE can be solved numerically. This is used to illustrate the effect of varying the reaction order. We note that for a first order reaction, the time evolution of the reaction progress variable has an exponential tail. In contrast, for a reaction order less than one, the reaction completes in a nite time. The reaction order also affects the induction time.« less

Non-constant link tension coefficient in the tumbling-snake model subjected to simple shear

NASA Astrophysics Data System (ADS)

Stephanou, Pavlos S.; Kröger, Martin

2017-11-01

The authors of the present study have recently presented evidence that the tumbling-snake model for polymeric systems has the necessary capacity to predict the appearance of pronounced undershoots in the time-dependent shear viscosity as well as an absence of equally pronounced undershoots in the transient two normal stress coefficients. The undershoots were found to appear due to the tumbling behavior of the director u when a rotational Brownian diffusion term is considered within the equation of motion of polymer segments, and a theoretical basis concerning the use of a link tension coefficient given through the nematic order parameter had been provided. The current work elaborates on the quantitative predictions of the tumbling-snake model to demonstrate its capacity to predict undershoots in the time-dependent shear viscosity. These predictions are shown to compare favorably with experimental rheological data for both polymer melts and solutions, help us to clarify the microscopic origin of the observed phenomena, and demonstrate in detail why a constant link tension coefficient has to be abandoned.

Reply to Comment on ‘The motion of an arbitrarily rotating spherical projectile and its application to ball games’

NASA Astrophysics Data System (ADS)

Robinson, Garry; Robinson, Ian

2014-06-01

Jensen (2014 Phys. Scr. 89 067001) presents arguments that the expressions that we have used in our recent paper (Robinson and Robinson 2013 Phys. Scr. 88 018101) for the lift force and possibly the drag force acting on a rotating spherical projectile are dimensionally incorrect and therefore cannot be valid. We acknowledge that the alternative equations suggested by Jensen are dimensionally correct, and may well be borne out by future experimental results. However, we demonstrate that our equations are in fact also dimensionally correct, the key concept being that of having the appropriate dimensions for the multiplying constants, an extensively used practice with experimentally determined laws. After a detailed discussion of the situation, a simple illustrative example of Hooke's law for the restoring force, F, due to a mass attached to a spring displaced by a distance x from its equilibrium position is presented, where the spring constant, k, has such units as to render the equation dimensionally correct. Finally we discuss the implications of some relevant existing experimental results for the lift force.

Apparatus for performing high-temperature fiber push-out testing

NASA Technical Reports Server (NTRS)

Eldridge, Jeffrey I. (Inventor); Ebihara, Ben T. (Inventor)

1994-01-01

The apparatus disclosed in the present invention measures the force at which a fiber resist the motion of an indenter driven at constant speed. This apparatus conducts these test in a vacuum of about 10(exp -6) tort and at temperatures up to 1100 C. Temperature and vacuum environment are maintained while controlling indenter motion, sample position, and providing magnified visual inspection during the test.

Celestial ephemerides in an expanding universe

NASA Astrophysics Data System (ADS)

Kopeikin, Sergei M.

2012-09-01

The post-Newtonian theory of motion of celestial bodies and propagation of light was instrumental in conducting the critical experimental tests of general relativity and in building the astronomical ephemerides of celestial bodies in the Solar System with unparalleled precision. The cornerstone of the theory is the postulate that the Solar System is gravitationally isolated from the rest of the Universe and the background spacetime is asymptotically flat. The present article extends this theoretical concept and formulates the principles of celestial dynamics of particles and light moving in the gravitational field of a localized astronomical system embedded to the expanding Friedmann-Lemaître-Robertson-Walker universe. We formulate the precise mathematical concept of the Newtonian limit of Einstein’s field equations in the conformally flat Friedmann-Lemaître-Robertson-Walker spacetime and analyze the geodesic motion of massive particles and light in this limit. We prove that by doing conformal spacetime transformations, one can reduce the equations of motion of particles and light to the classical form of the Newtonian theory. However, the time arguments in the equations of motion of particles and light differ from each other in terms being proportional to the Hubble constant H. This leads to the important conclusion that the equations of light propagation used currently by space navigation centers for fitting range and Doppler-tracking observations of celestial bodies are missing some terms of the cosmological origin that are proportional to the Hubble constant H. We also analyze the effect of the cosmological expansion on motion of electrons in atoms. We prove that the Hubble expansion does not affect the atomic frequencies and hence does not affect the atomic time scale used in the creation of astronomical ephemerides. We derive the cosmological correction to the light travel time equation and argue that its measurement opens an exciting opportunity to determine the local value of the Hubble constant H in the Solar System independently of cosmological observations.

Liquid Motion in a Rotating Tank Experiment (LME)

NASA Technical Reports Server (NTRS)

Deffenbaugh, D. M.; Dodge, F. T.; Green, S. T.

1998-01-01

The Liquid Motion Experiment (LME), which flew on STS 84 in May 1997, was an investigation of liquid motions in spinning, nutating tanks. LME was designed to quantify the effects of such liquid motions on the stability of spinning spacecraft, which are known to be adversely affected by the energy dissipated by the liquid motions. The LME hardware was essentially a spin table which could be forced to nutate at specified frequencies at a constant cone angle, independently of the spin rate. Cylindrical and spherical test tanks, partially filled with liquids of different viscosities, were located at the periphery of the spin table to simulate a spacecraft with off-axis propellant tanks; one set of tanks contained generic propellant management devices (PMDs). The primary quantitative data from the flight tests were the liquid-induced torques exerted on the tanks about radial and tangential axes through the center of the tank. Visual recordings of the liquid oscillations also provided qualitative information. The flight program incorporated two types of tests: sine sweep tests, in which the spin rate was held constant and the nutation frequency varied over a wide range; and sine dwell test, in which both the spin rate and the nutation frequency were held constant. The sine sweep tests were meant to investigate all the prominent liquid resonant oscillations and the damping of the resonances, and the sine dwell tests were meant to quantify the viscous energy dissipation rate of the liquid oscillations for steady state conditions. The LME flight data were compared to analytical results obtained from two companion IR&D programs at Southwest Research Institute. The comparisons indicated that the models predicted the observed liquid resonances, damping, and energy dissipation rates for many test conditions but not for all. It was concluded that improved models and CFD simulations are needed to resolve the differences. This work is ongoing under a current IR&D program.

Dissociating the detection of intentionality from animacy in the right posterior superior temporal sulcus

PubMed Central

Gao, Tao; Scholl, Brian J.; McCarthy, Gregory

2012-01-01

Certain motion patterns can cause even simple geometric shapes to be perceived as animate. Viewing such displays evokes strong activation in temporoparietal cortex, including areas in and near the (predominantly right) posterior superior temporal sulcus (pSTS). These brain regions are sensitive to socially relevant information, but the nature of the social information represented in pSTS is unclear. For example, previous studies have been unable to explore the perception of shifting intentions, beyond animacy. This is due in part to the ubiquitous use of complex displays that combine several types of social information, with little ability to control lower-level visual cues. Here we address this challenge by manipulating intentionality with parametric precision while holding cues to animacy constant. Human subjects were exposed to a “wavering wolf” display, in which one item (the ‘wolf’) chased continuously, but its goal (i.e. the sheep) frequently switched among other shapes. By contrasting this with three other control displays, we find that the wolf’s changing intentions gave rise to strong selective activation in the right pSTS, compared with (1) a wolf that chases with a single unchanging intention; (2) very similar patterns of motion (and motion change) that are not perceived as goal-directed; and (3) abrupt onsets and offsets of moving objects. These results demonstrate in an especially well controlled manner that right pSTS is involved in social perception, beyond physical properties such as motion energy and salience. More importantly, these results demonstrate for the first time that this region represents perceived intentions, beyond animacy. PMID:23055497

Time-resolved microrheology of actively remodeling actomyosin networks

NASA Astrophysics Data System (ADS)

Silva, Marina Soares e.; Stuhrmann, Björn; Betz, Timo; Koenderink, Gijsje H.

2014-07-01

Living cells constitute an extraordinary state of matter since they are inherently out of thermal equilibrium due to internal metabolic processes. Indeed, measurements of particle motion in the cytoplasm of animal cells have revealed clear signatures of nonthermal fluctuations superposed on passive thermal motion. However, it has been difficult to pinpoint the exact molecular origin of this activity. Here, we employ time-resolved microrheology based on particle tracking to measure nonequilibrium fluctuations produced by myosin motor proteins in a minimal model system composed of purified actin filaments and myosin motors. We show that the motors generate spatially heterogeneous contractile fluctuations, which become less frequent with time as a consequence of motor-driven network remodeling. We analyze the particle tracking data on different length scales, combining particle image velocimetry, an ensemble analysis of the particle trajectories, and finally a kymograph analysis of individual particle trajectories to quantify the length and time scales associated with active particle displacements. All analyses show clear signatures of nonequilibrium activity: the particles exhibit random motion with an enhanced amplitude compared to passive samples, and they exhibit sporadic contractile fluctuations with ballistic motion over large (up to 30 μm) distances. This nonequilibrium activity diminishes with sample age, even though the adenosine triphosphate level is held constant. We propose that network coarsening concentrates motors in large clusters and depletes them from the network, thus reducing the occurrence of contractile fluctuations. Our data provide valuable insight into the physical processes underlying stress generation within motor-driven actin networks and the analysis framework may prove useful for future microrheology studies in cells and model organisms.

3D Orthogonal Woven Triboelectric Nanogenerator for Effective Biomechanical Energy Harvesting and as Self-Powered Active Motion Sensors.

PubMed

Dong, Kai; Deng, Jianan; Zi, Yunlong; Wang, Yi-Cheng; Xu, Cheng; Zou, Haiyang; Ding, Wenbo; Dai, Yejing; Gu, Bohong; Sun, Baozhong; Wang, Zhong Lin

2017-10-01

The development of wearable and large-area energy-harvesting textiles has received intensive attention due to their promising applications in next-generation wearable functional electronics. However, the limited power outputs of conventional textiles have largely hindered their development. Here, in combination with the stainless steel/polyester fiber blended yarn, the polydimethylsiloxane-coated energy-harvesting yarn, and nonconductive binding yarn, a high-power-output textile triboelectric nanogenerator (TENG) with 3D orthogonal woven structure is developed for effective biomechanical energy harvesting and active motion signal tracking. Based on the advanced 3D structural design, the maximum peak power density of 3D textile can reach 263.36 mW m -2 under the tapping frequency of 3 Hz, which is several times more than that of conventional 2D textile TENGs. Besides, its collected power is capable of lighting up a warning indicator, sustainably charging a commercial capacitor, and powering a smart watch. The 3D textile TENG can also be used as a self-powered active motion sensor to constantly monitor the movement signals of human body. Furthermore, a smart dancing blanket is designed to simultaneously convert biomechanical energy and perceive body movement. This work provides a new direction for multifunctional self-powered textiles with potential applications in wearable electronics, home security, and personalized healthcare. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Isentropic Analysis of Convective Motions

NASA Technical Reports Server (NTRS)

Pauluis, Olivier M.; Mrowiec, Agnieszka A.

2013-01-01

This paper analyzes the convective mass transport by sorting air parcels in terms of their equivalent potential temperature to determine an isentropic streamfunction. By averaging the vertical mass flux at a constant value of the equivalent potential temperature, one can compute an isentropic mass transport that filters out reversible oscillatory motions such as gravity waves. This novel approach emphasizes the fact that the vertical energy and entropy transports by convection are due to the combination of ascending air parcels with high energy and entropy and subsiding air parcels with lower energy and entropy. Such conditional averaging can be extended to other dynamic and thermodynamic variables such as vertical velocity, temperature, or relative humidity to obtain a comprehensive description of convective motions. It is also shown how this approach can be used to determine the mean diabatic tendencies from the three-dimensional dynamic and thermodynamic fields. A two-stream approximation that partitions the isentropic circulation into a mean updraft and a mean downdraft is also introduced. This offers a straightforward way to identify the mean properties of rising and subsiding air parcels. The results from the two-stream approximation are compared with two other definitions of the cloud mass flux. It is argued that the isentropic analysis offers a robust definition of the convective mass transport that is not tainted by the need to arbitrarily distinguish between convection and its environment, and that separates the irreversible convective overturning fromoscillations associated with gravity waves.

Geodetic evidence for continuing tectonic activity of the Carboneras fault (SE Spain)

NASA Astrophysics Data System (ADS)

Echeverria, Anna; Khazaradze, Giorgi; Asensio, Eva; Masana, Eulalia

2015-11-01

The Carboneras fault zone (CFZ) is a prominent onshore-offshore strike-slip fault that forms part of the Eastern Betic Shear Zone (EBSZ), located in SE Spain. In this work, we show for the first time, the continuing tectonic activity of the CFZ and quantify its geodetic slip-rates using continuous and campaign GPS observations conducted during the last decade. We find that the left-lateral motion dominates the kinematics of the CFZ, with a strike-slip rate of 1.3 ± 0.2 mm/yr along the N48° direction. The shortening component is significantly lower and poorly constrained. Recent onshore and offshore paleoseismic and geomorphic results across the CFZ suggest a minimum Late Pleistocene to present-day strike-slip rate of 1.1 mm/yr. Considering the similarity of the geologic and geodetic slip rates measured at different points along the fault, the northern segment of the CFZ must have been slipping approximately at a constant rate during the Quaternary. Regarding the eastern Alpujarras fault zone corridor (AFZ), located to the north of the CFZ, our GPS measurements corroborate that this zone is active and exhibits a right-lateral motion. These opposite type strike-slip motion across the AFZ and CFZ is a result of a push-type force due to Nubia and Eurasia plate convergence, which, in turn, causes the westward escape of the block bounded by these two fault zones.

Flight Dynamics of an Aeroshell Using an Attached Inflatable Aerodynamic Decelerator

NASA Technical Reports Server (NTRS)

Cruz, Juan R.; Schoenenberger, Mark; Axdahl, Erik; Wilhite, Alan

2009-01-01

An aeroelastic analysis of the behavior of an entry vehicle utilizing an attached inflatable aerodynamic decelerator during supersonic flight is presented. The analysis consists of a planar, four degree of freedom simulation. The aeroshell and the IAD are assumed to be separate, rigid bodies connected with a spring-damper at an interface point constraining the relative motion of the two bodies. Aerodynamic forces and moments are modeled using modified Newtonian aerodynamics. The analysis includes the contribution of static aerodynamic forces and moments as well as pitch damping. Two cases are considered in the analysis: constant velocity flight and planar free flight. For the constant velocity and free flight cases with neutral pitch damping, configurations with highly-stiff interfaces exhibit statically stable but dynamically unstable aeroshell angle of attack. Moderately stiff interfaces exhibit static and dynamic stability of aeroshell angle of attack due to damping induced by the pitch angle rate lag between the aeroshell and IAD. For the free-flight case, low values of both the interface stiffness and damping cause divergence of the aeroshell angle of attack due to the offset of the IAD drag force with respect to the aeroshell center of mass. The presence of dynamic aerodynamic moments was found to influence the stability characteristics of the vehicle. The effect of gravity on the aeroshell angle of attack stability characteristics was determined to be negligible for the cases investigated.

Integrability of spinning particle motion in higher-dimensional rotating black hole spacetimes.

PubMed

Kubizňák, David; Cariglia, Marco

2012-02-03

We study the motion of a classical spinning particle (with spin degrees of freedom described by a vector of Grassmann variables) in higher-dimensional general rotating black hole spacetimes with a cosmological constant. In all dimensions n we exhibit n bosonic functionally independent integrals of spinning particle motion, corresponding to explicit and hidden symmetries generated from the principal conformal Killing-Yano tensor. Moreover, we demonstrate that in 4-, 5-, 6-, and 7-dimensional black hole spacetimes such integrals are in involution, proving the bosonic part of the motion integrable. We conjecture that the same conclusion remains valid in all higher dimensions. Our result generalizes the result of Page et al. [Phys. Rev. Lett. 98, 061102 (2007)] on complete integrability of geodesic motion in these spacetimes.

Interactions between spacecraft motions and the atmospheric cloud physics laboratory experiments

NASA Technical Reports Server (NTRS)

Anderson, B. J.

1981-01-01

In evaluating the effects of spacecraft motions on atmospheric cloud physics laboratory (ACPL) experimentation, the motions of concern are those which will result in the movement of the fluid or cloud particles within the experiment chambers. Of the various vehicle motions and residual forces which can and will occur, three types appear most likely to damage the experimental results: non-steady rotations through a large angle, long-duration accelerations in a constant direction, and vibrations. During the ACPL ice crystal growth experiments, the crystals are suspended near the end of a long fiber (20 cm long by 200 micron diameter) of glass or similar material. Small vibrations of the supported end of the fiber could cause extensive motions of the ice crystal, if care is not taken to avoid this problem.

Geometry of Lax pairs: Particle motion and Killing-Yano tensors

NASA Astrophysics Data System (ADS)

Cariglia, Marco; Frolov, Valeri P.; Krtouš, Pavel; Kubizňák, David

2013-01-01

A geometric formulation of the Lax pair equation on a curved manifold is studied using the phase-space formalism. The corresponding (covariantly conserved) Lax tensor is defined and the method of generation of constants of motion from it is discussed. It is shown that when the Hamilton equations of motion are used, the conservation of the Lax tensor translates directly to the well-known Lax pair equation, with one matrix identified with components of the Lax tensor and the other matrix constructed from the (metric) connection. A generalization to Clifford objects is also discussed. Nontrivial examples of Lax tensors for geodesic and charged particle motion are found in spacetimes admitting a hidden symmetry of Killing-Yano tensors.

Motional timescale predictions by molecular dynamics simulations: case study using proline and hydroxyproline sidechain dynamics.

PubMed

Aliev, Abil E; Kulke, Martin; Khaneja, Harmeet S; Chudasama, Vijay; Sheppard, Tom D; Lanigan, Rachel M

2014-02-01

We propose a new approach for force field optimizations which aims at reproducing dynamics characteristics using biomolecular MD simulations, in addition to improved prediction of motionally averaged structural properties available from experiment. As the source of experimental data for dynamics fittings, we use (13) C NMR spin-lattice relaxation times T1 of backbone and sidechain carbons, which allow to determine correlation times of both overall molecular and intramolecular motions. For structural fittings, we use motionally averaged experimental values of NMR J couplings. The proline residue and its derivative 4-hydroxyproline with relatively simple cyclic structure and sidechain dynamics were chosen for the assessment of the new approach in this work. Initially, grid search and simplexed MD simulations identified large number of parameter sets which fit equally well experimental J couplings. Using the Arrhenius-type relationship between the force constant and the correlation time, the available MD data for a series of parameter sets were analyzed to predict the value of the force constant that best reproduces experimental timescale of the sidechain dynamics. Verification of the new force-field (termed as AMBER99SB-ILDNP) against NMR J couplings and correlation times showed consistent and significant improvements compared to the original force field in reproducing both structural and dynamics properties. The results suggest that matching experimental timescales of motions together with motionally averaged characteristics is the valid approach for force field parameter optimization. Such a comprehensive approach is not restricted to cyclic residues and can be extended to other amino acid residues, as well as to the backbone. Copyright © 2013 Wiley Periodicals, Inc.

Vortex-induced vibration (VIV) effects of a drilling riser due to vessel motion

NASA Astrophysics Data System (ADS)

Joseph, R. S.; Wang, J.; Ong, M. C.; Jakobsen, J. B.

2017-12-01

A marine riser undergoes oscillatory motion in water due to the vessel motions, known as global dynamic response. This to-and-fro motion of the riser will generate an equivalent flow that can cause Vortex-Induced Vibrations (VIVs), even in the absence of the ocean current. In the present work, full-scale measurement data of a drilling riser operating in the Gulf of Mexico are analysed. The VIV occurrences for the riser are identified from the data and the possible excitation sources are discussed. The oscillatory flow due to vessel motion is compared with the ocean current and its possibility to excite VIV is analysed. The full-scale data analysis provides an insight into the vessel motion-induced VIV of marine risers in the actual field environment.

The Maiden Voyage of a Kinematics Robot

NASA Astrophysics Data System (ADS)

Greenwolfe, Matthew L.

2015-04-01

In a Montessori preschool classroom, students work independently on tasks that absorb their attention in part because the apparatus are carefully designed to make mistakes directly observable and limit exploration to one aspect or dimension. Control of error inheres in the apparatus itself, so that teacher intervention can be minimal.1 Inspired by this example, I created a robotic kinematics apparatus that also shapes the inquiry experience. Students program the robot by drawing kinematic graphs on a computer and then observe its motion. Exploration is at once limited to constant velocity and constant acceleration motion, yet open to complex multi-segment examples difficult to achieve in the lab in other ways. The robot precisely and reliably produces the motion described by the students' graphs, so that the apparatus itself provides immediate visual feedback about whether their understanding is correct as they are free to explore within the hard-coded limits. In particular, the kinematic robot enables hands-on study of multi-segment constant velocity situations, which lays a far stronger foundation for the study of accelerated motion. When correction is anonymous—just between one group of lab partners and their robot—students using the kinematic robot tend to flow right back to work because they view the correction as an integral part of the inquiry learning process. By contrast, when correction occurs by the teacher and/or in public (e.g., returning a graded assignment or pointing out student misconceptions during class), students all too often treat the event as the endpoint to inquiry. Furthermore, quantitative evidence shows a large gain from pre-test to post-test scores using the Test of Understanding Graphs in Kinematics (TUG-K).

Motion of particles adhering to the leading lamella of crawling cells

PubMed Central

1981-01-01

Time-lapsed films of particle motion on the leading lamella of chick heart fibroblasts and mouse peritoneal macrophages were analyzed. The particles were composed of powdered glass or powdered aminated polystyrene and were 0.5-1.0 micrometer in radius. Particle motions were described by steps in position from one frame to the time-lapse movies to the next. The statistics of the step-size distribution of the particles were consistent with a particle in Brownian motion subject to a constant force. From the Brownian movement, we have calculated the two-dimensional diffusion coefficient of different particles. These vary by more than an order of magnitude (10(-11)-10(-10) cm2/s) even for particles composed of the same material and located very close to each other on the surface of the cell. This variation was not correlated with particle size but is interpretable as a result of different numbers of adhesive bonds holding the particles to the cells. The constant component of particle movement can be interpreted as a result of a constant force acting on each particle (0.1-1.0 x 10(-8) dyn). Variations in the fractional coefficient for particles close to each other on the cell surface do not yield corresponding differences in velocity, suggesting that the frictional coefficient and the driving force vary together. This is consistent with the hypothesis that the particles are carried by flow of the membrane as a whole or by flow of some submembrane material. The utility of our methods for monitoring cell motile behavior in biologically interesting situations, such as a chemotactic gradient, is discussed. PMID:7309794

Organ motion due to respiration: the state of the art and applications in interventional radiology and radiation oncology

NASA Astrophysics Data System (ADS)

Cleary, Kevin R.; Mulcahy, Maureen; Piyasena, Rohan; Zhou, Tong; Dieterich, Sonja; Xu, Sheng; Banovac, Filip; Wong, Kenneth H.

2005-04-01

Tracking organ motion due to respiration is important for precision treatments in interventional radiology and radiation oncology, among other areas. In interventional radiology, the ability to track and compensate for organ motion could lead to more precise biopsies for applications such as lung cancer screening. In radiation oncology, image-guided treatment of tumors is becoming technically possible, and the management of organ motion then becomes a major issue. This paper will review the state-of-the-art in respiratory motion and present two related clinical applications. Respiratory motion is an important topic for future work in image-guided surgery and medical robotics. Issues include how organs move due to respiration, how much they move, how the motion can be compensated for, and what clinical applications can benefit from respiratory motion compensation. Technology that can be applied for this purpose is now becoming available, and as that technology evolves, the subject will become an increasingly interesting and clinically valuable topic of research.

Quantum correlations from a room-temperature optomechanical cavity.

PubMed

Purdy, T P; Grutter, K E; Srinivasan, K; Taylor, J M

2017-06-23

The act of position measurement alters the motion of an object being measured. This quantum measurement backaction is typically much smaller than the thermal motion of a room-temperature object and thus difficult to observe. By shining laser light through a nanomechanical beam, we measure the beam's thermally driven vibrations and perturb its motion with optical force fluctuations at a level dictated by the Heisenberg measurement-disturbance uncertainty relation. We demonstrate a cross-correlation technique to distinguish optically driven motion from thermally driven motion, observing this quantum backaction signature up to room temperature. We use the scale of the quantum correlations, which is determined by fundamental constants, to gauge the size of thermal motion, demonstrating a path toward absolute thermometry with quantum mechanically calibrated ticks. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Stunt Barbie--A Laboratory Practicum Combining Constant Velocity and Constant Acceleration

ERIC Educational Resources Information Center

Hertting, Scott

2011-01-01

In preparing to teach the advanced physics course at my high school, I found it useful to work through the end of chapter problems in the book used by the advanced class. A problem on motion in one dimension involved a stunt woman in free fall from a tree limb onto a horse running beneath her. The problem presents a connected learning opportunity…

Child-Langmuir law applicability for a cathode sheath description of glow discharge in hydrogen

NASA Astrophysics Data System (ADS)

Lisovskiy, V. A.; Artushenko, K. P.; Yegorenkov, V. D.

2016-08-01

The present paper reveals that the Child-Langmuir law version with the constant ion mobility has to be applied for the cathode sheath description of the glow discharge in hydrogen. Using the analytical model we demonstrate that even in a high electric field the constant mobility law version rather than that for the constant ion mean free path has to hold in the case of impeded charge exchange and the dominant effect of polarization forces on the ion motion through the cathode sheath.

Gas Phase Conformations and Methyl Internal Rotation for 2-PHENYLETHYL Methyl Ether and its Argon Van Der Waals Complex from Fourier Transform Microwave Spectroscopy

NASA Astrophysics Data System (ADS)

Gurusinghe, Ranil M.; Tubergen, Michael

2015-06-01

A mini-cavity microwave spectrometer was used to record the rotational spectra arising from 2-phenylethyl methyl ether and its weakly bonded argon complex in the frequency range of 10.5 - 22 GHz. Rotational spectra were found for two stable conformations of the monomer: anti-anti and gauche-anti, which are 1.4 kJ mol-1 apart in energy at wB97XD/6-311++G(d,p) level. Doubled rotational transitions, arising from internal motion of the methyl group, were observed for both conformers. The program XIAM was used to fit the rotational constants, centrifugal distortion constants, and barrier to internal rotation to the measured transition frequencies of the A and E internal rotation states. The best global fit values of the rotational constants for the anti-anti conformer are A= 3799.066(3) MHz, B= 577.95180(17) MHz, C= 544.7325(3) MHz and the A state rotational constants of the gauche-anti conformer are A= 2676.1202(7) MHz, B= 760.77250(2) MHz, C= 684.78901(2) MHz. The rotational spectrum of 2-phenylethyl methyl ether - argon complex is consistent with the geometry where argon atom lies above the plane of the benzene moiety of gauche-anti conformer. Tunneling splittings were too small to resolve within experimental accuracy, likely due to an increase in three fold potential barrier when the argon complex is formed. Fitted rotational constants are A= 1061.23373(16) MHz, B= 699.81754(7) MHz, C= 518.33553(7) MHz. The lowest energy solvated ether - water complex with strong intermolecular hydrogen bonding has been identified theoretically. Progress on the assignment of the water complex will also be presented.

Adapting the Euler-Lagrange equation to study one-dimensional motions under the action of a constant force

NASA Astrophysics Data System (ADS)

Dias, Clenilda F.; Araújo, Maria A. S.; Carvalho-Santos, Vagson L.

2018-01-01

The Euler-Lagrange equations (ELE) are very important in the theoretical description of several physical systems. In this work we have used a simplified form of ELE to study one-dimensional motions under the action of a constant force. From the use of the definition of partial derivative, we have proposed two operators, here called mean delta operators, which may be used to solve the ELE in a simplest way. We have applied this simplification to solve three simple mechanical problems in which the particle is under the action of the gravitational field: a free fall body, the Atwood’s machine and the inclined plan. The proposed simplification can be used to introduce the lagrangian formalism in teaching classical mechanics in introductory physics courses.

Optimal dividends in the Brownian motion risk model with interest

NASA Astrophysics Data System (ADS)

Fang, Ying; Wu, Rong

2009-07-01

In this paper, we consider a Brownian motion risk model, and in addition, the surplus earns investment income at a constant force of interest. The objective is to find a dividend policy so as to maximize the expected discounted value of dividend payments. It is well known that optimality is achieved by using a barrier strategy for unrestricted dividend rate. However, ultimate ruin of the company is certain if a barrier strategy is applied. In many circumstances this is not desirable. This consideration leads us to impose a restriction on the dividend stream. We assume that dividends are paid to the shareholders according to admissible strategies whose dividend rate is bounded by a constant. Under this additional constraint, we show that the optimal dividend strategy is formed by a threshold strategy.

Statistical Neurodynamics.

NASA Astrophysics Data System (ADS)

Paine, Gregory Harold

1982-03-01

The primary objective of the thesis is to explore the dynamical properties of small nerve networks by means of the methods of statistical mechanics. To this end, a general formalism is developed and applied to elementary groupings of model neurons which are driven by either constant (steady state) or nonconstant (nonsteady state) forces. Neuronal models described by a system of coupled, nonlinear, first-order, ordinary differential equations are considered. A linearized form of the neuronal equations is studied in detail. A Lagrange function corresponding to the linear neural network is constructed which, through a Legendre transformation, provides a constant of motion. By invoking the Maximum-Entropy Principle with the single integral of motion as a constraint, a probability distribution function for the network in a steady state can be obtained. The formalism is implemented for some simple networks driven by a constant force; accordingly, the analysis focuses on a study of fluctuations about the steady state. In particular, a network composed of N noninteracting neurons, termed Free Thinkers, is considered in detail, with a view to interpretation and numerical estimation of the Lagrange multiplier corresponding to the constant of motion. As an archetypical example of a net of interacting neurons, the classical neural oscillator, consisting of two mutually inhibitory neurons, is investigated. It is further shown that in the case of a network driven by a nonconstant force, the Maximum-Entropy Principle can be applied to determine a probability distribution functional describing the network in a nonsteady state. The above examples are reconsidered with nonconstant driving forces which produce small deviations from the steady state. Numerical studies are performed on simplified models of two physical systems: the starfish central nervous system and the mammalian olfactory bulb. Discussions are given as to how statistical neurodynamics can be used to gain a better understanding of the behavior of these systems.

Multimodal Pilot Behavior in Multi-Axis Tracking Tasks with Time-Varying Motion Cueing Gains

NASA Technical Reports Server (NTRS)

Zaal, P. M. T; Pool, D. M.

2014-01-01

In a large number of motion-base simulators, adaptive motion filters are utilized to maximize the use of the available motion envelope of the motion system. However, not much is known about how the time-varying characteristics of such adaptive filters affect pilots when performing manual aircraft control. This paper presents the results of a study investigating the effects of time-varying motion filter gains on pilot control behavior and performance. An experiment was performed in a motion-base simulator where participants performed a simultaneous roll and pitch tracking task, while the roll and/or pitch motion filter gains changed over time. Results indicate that performance increases over time with increasing motion gains. This increase is a result of a time-varying adaptation of pilots' equalization dynamics, characterized by increased visual and motion response gains and decreased visual lead time constants. Opposite trends are found for decreasing motion filter gains. Even though the trends in both controlled axes are found to be largely the same, effects are less significant in roll. In addition, results indicate minor cross-coupling effects between pitch and roll, where a cueing variation in one axis affects the behavior adopted in the other axis.

Effects of False Tilt Cues on the Training of Manual Roll Control Skills

NASA Technical Reports Server (NTRS)

Zaal, Peter M. T.; Popovici, Alexandru; Zavala, Melinda A.

2015-01-01

This paper describes a transfer-of-training study performed in the NASA Ames Vertica lMotion Simulator. The purpose of the study was to investigate the effect of false tilt cues on training and transfer of training of manual roll control skills. Of specific interest were the skills needed to control unstable roll dynamics of a mid-size transport aircraft close to the stall point. Nineteen general aviation pilots trained on a roll control task with one of three motion conditions: no motion, roll motion only, or reduced coordinated roll motion. All pilots transferred to full coordinated roll motion in the transfer session. A novel multimodal pilot model identification technique was successfully applied to characterize how pilots' use of visual and motion cues changed over the course of training and after transfer. Pilots who trained with uncoordinated roll motion had significantly higher performance during training and after transfer, even though they experienced the false tilt cues. Furthermore, pilot control behavior significantly changed during the two sessions, as indicated by increasing visual and motion gains, and decreasing lead time constants. Pilots training without motion showed higher learning rates after transfer to the full coordinated roll motion case.

Possible influences on color constancy by motion of color targets and by attention-controlled gaze.

PubMed

Wan, Lifang; Shinomori, Keizo

2018-04-01

We investigated the influence of motion on color constancy using a chromatic stimulus presented in various conditions (static, motion, and rotation). Attention to the stimulus and background was also controlled in different gaze modes, constant fixation of the stimulus, and random viewing of the stimulus. Color constancy was examined in six young observers using a haploscopic view of a computer monitor. The target and background were illuminated in simulation by red, green, blue, and yellow, shifted from daylight (D65) by specific color differences along L - M or S - (L + M) axes on the equiluminance plane. The standard pattern (under D65) and test pattern (under the color illuminant) of a 5-deg square were presented side by side, consisting of 1.2-deg square targets with one of 12 colors at each center, surrounded by 230 background ellipses consisting of eight other colors. The central color targets in both patterns flipped between top and bottom locations at the rate of 3 deg/s in the motion condition. The results indicated an average reduction of color constancy over the 12 test colors by motion. The random viewing parameter indicated better color constancy by more attention to the background, although the difference was not significant. Color constancy of the four color illuminations was better to worse in green, red, yellow, and blue, respectively. The reduction of color constancy by motion could be explained by less contribution of the illumination estimation effect on color constancy. In the motion with constant fixation condition, the retina strongly adapted to the mean chromaticity of the background. However, motion resulted in less attention to the color of the background, causing a weaker effect of the illumination estimation. Conversely, in the static state with a random viewing condition, more attention to the background colors caused a stronger illumination estimation effect, and color constancy was improved overall.

Analog-to-digital conversion as a source of drifts in displacements derived from digital recordings of ground acceleration

USGS Publications Warehouse

Boore, D.M.

2003-01-01

Displacements obtained from double integration of digitally recorded ground accelerations often show drifts much larger than those expected for the true ground displacements. These drifts might be due to many things, including dynamic elastic ground tilt, inelastic ground deformation, hysteresis in the instruments, and cross feed due to misalignment of nominally orthogonal sensors. This article shows that even if those effects were not present, the analog-to-digital conversion (ADC) process can produce apparent "pulses" and offsets in the acceleration baseline if the ground motion is slowly varying compared with the quantization level of the digitization. Such slowly varying signals can be produced by constant offsets that do not coincide with a quantization level and by near- and intermediate-field terms in the wave field radiated from earthquakes. Double integration of these apparent pulses and offsets leads to drifts in the displacements similar to those found in processing real recordings. These effects decrease in importance as the resolution of the ADC process increases.

Three-dimensional couette flow of dusty fluid with heat transfer in the presence of magnetic field

NASA Astrophysics Data System (ADS)

Gayathri, R.; Govindarajan, A.; Sasikala, R.

2018-04-01

This paper is focused on the mathematical modelling of three-dimensional couette flow and heat transfer of a dusty fluid between two infinite horizontal parallel porous flat plates in the presence of an induced magnetic field. The problem is formulated using a continuum two-phase model and the resulting equations are solved analytically. The lower plate is stationary while the upper plate is undergoing uniform motion in its plane. These plates are, respectively subjected to transverse exponential injection and its corresponding removal by constant suction. Due to this type of injection velocity, the flow becomes three dimensional. The closed-form expressions for velocity and temperature fields of both the fluid and dust phase are obtained by solving the governing partial differentiation equations using the perturbation method. A selective set of graphical results is presented and discussed to show interesting features of the problem. It is found that the velocity profiles of both fluid and dust particles decrease due to the increase of (magnetic parameter) Hartmann number.

MT Ser, a binary blue subdwarf

NASA Astrophysics Data System (ADS)

Shimanskii, V. V.; Borisov, N. V.; Sakhibullin, N. A.; Sheveleva, D. V.

2008-06-01

We have classified and determined the parameters of the evolved close binary MT Ser. Our moderate-resolution spectra covering various phases of the orbital period were taken with the 6-m telescope of the Special Astrophysical Observatory. The spectra of MT Ser freed from the contribution of the surrounding nebula Abell 41 contained no emission lines due to the reflection effect. The radial velocities measured from lines of different elements showed them to be constant on a time scale corresponding to the orbital period. At the same time, we find effects of broadening for the HeII absorption lines, due to the orbital motion of two hot stars of similar types. As a result, we classify MT Ser as a system with two blue subdwarfs after the common-envelope stage. We estimate the component masses and the distance to the object from the Doppler broadening of the HeII lines. We demonstrate that the age of the ambient nebula, Abell 41, is about 35 000 years.

Giant Permittivity in Epitaxial Ferroelectric Heterostructures

NASA Astrophysics Data System (ADS)

Erbil, A.; Kim, Y.; Gerhardt, R. A.

1996-08-01

A giant permittivity associated with the motion of domain walls is reported in epitaxial hetero- structures having alternating layers of ferroelectric and nonferroelectric oxides. At low frequencies, permittivities as high as 420 000 are found. Real and imaginary parts of the dielectric constant show large dispersion at high frequencies. In dc measurements, a nonlinear resistance is observed with a well-defined threshold field correlated with the dc bias-field dependence of ac permittivities. We interpret the observations as a result of the motion of a pinned domain wall lattice at low electric fields and sliding-mode motion at high electric fields.

Free and controlled motion of a body with a moving internal mass through a fluid in the presence of circulation around the body

NASA Astrophysics Data System (ADS)

Vetchanin, E. V.; Kilin, A. A.

2016-01-01

The free and controlled motion of an arbitrary two-dimensional body with a moving internal mass and constant circulation around the body in an ideal fluid is studied. Bifurcation analysis of the free motion is performed (under the condition of a fixed internal mass). It is shown that the body can be moved to a given point by varying the position of the internal mass. Some problems related to the presence of a nonzero drift of the body with a fixed internal mass are noted.

Global Aspects of Charged Particle Motion in Axially Symmetric Multipole Magnetic Fields

NASA Technical Reports Server (NTRS)

Shebalin, John V.

2003-01-01

The motion of a single charged particle in the space outside of a compact region of steady currents is investigated. The charged particle is assumed to produce negligible electromagnetic radiation, so that its energy is conserved. The source of the magnetic field is represented as a point multipole. After a general description, attention is focused on magnetic fields with axial symmetry. Lagrangian dynamical theory is utilized to identify constants of the motion as well as the equations of motion themselves. The qualitative method of Stonner is used to examine charged particle motion in axisymmetric multipole fields of all orders. Although the equations of motion generally have no analytical solutions and must be integrated numerically to produce a specific orbit, a topological examination of dynamics is possible, and can be used, d la Stonner, to completely describe the global aspects of the motion of a single charged particle in a space with an axisymmetric multipole magnetic field.

Translation and Rotation Trade Off in Human Visual Heading Estimation

NASA Technical Reports Server (NTRS)

Stone, Leland S.; Perrone, John A.; Null, Cynthia H. (Technical Monitor)

1996-01-01

We have previously shown that, during simulated curvilinear motion, humans can make reasonably accurate and precise heading judgments from optic flow without either oculomotor or static-depth cues about rotation. We now systematically investigate the effect of varying the parameters of self-motion. We visually simulated 400 ms of self-motion along curved paths (constant rotation and translation rates, fixed retinocentric heading) towards two planes of random dots at 10.3 m and 22.3 m at mid-trial. Retinocentric heading judgments of 4 observers (2 naive) were measured for 12 different combinations of translation (T between 4 and 16 m/s) and rotation (R either 8 or 16 deg/s). In the range tested, heading bias and uncertainty decrease quasilinearly with T/R, but the bias also appears to depend on R. If depth is held constant, the ratio T/R can account for much of the variation in the accuracy and precision of human visual heading estimation, although further experiments are needed to resolve whether absolute rotation rate, total flow rate, or some other factor can account for the observed -2 deg shift between the bias curves.

Microwave measurements of the tropolone–formic acid doubly hydrogen bonded dimer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pejlovas, Aaron M.; Kukolich, Stephen G.; Serrato, Agapito

2016-01-28

The microwave spectrum was measured for the doubly hydrogen bonded dimer formed between tropolone and formic acid. The predicted symmetry of this dimer was C{sub 2v}(M), and it was expected that the concerted proton tunneling motion would be observed. After measuring 25 a- and b-type rotational transitions, no splittings which could be associated with a concerted double proton tunneling motion were observed. The calculated barrier to the proton tunneling motion is near 15 000 cm{sup −1}, which would likely make the tunneling frequencies too small to observe in the microwave spectra. The rotational and centrifugal distortion constants determined from the measuredmore » transitions were A = 2180.7186(98) MHz, B = 470.873 90(25) MHz, C = 387.689 84(22) MHz, D{sub J} = 0.0100(14) kHz, D{sub JK} = 0.102(28) kHz, and D{sub K} = 13.2(81) kHz. The B3LYP/aug-cc-pVTZ calculated rotational constants were within 1% of the experimentally determined values.« less

Systematic study of polycrystalline flow during tension test of sheet 304 austenitic stainless steel at room temperature

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muñoz-Andrade, Juan D., E-mail: jdma@correo.azc.uam.mx

2013-12-16

By systematic study the mapping of polycrystalline flow of sheet 304 austenitic stainless steel (ASS) during tension test at constant crosshead velocity at room temperature was obtained. The main results establish that the trajectory of crystals in the polycrystalline spatially extended system (PCSES), during irreversible deformation process obey a hyperbolic motion. Where, the ratio between the expansion velocity of the field and the velocity of the field source is not constant and the field lines of such trajectory of crystals become curved, this accelerated motion is called a hyperbolic motion. Such behavior is assisted by dislocations dynamics and self-accommodation processmore » between crystals in the PCSES. Furthermore, by applying the quantum mechanics and relativistic model proposed by Muñoz-Andrade, the activation energy for polycrystalline flow during the tension test of 304 ASS was calculated for each instant in a global form. In conclusion was established that the mapping of the polycrystalline flow is fundamental to describe in an integral way the phenomenology and mechanics of irreversible deformation processes.« less

Systematic study of polycrystalline flow during tension test of sheet 304 austenitic stainless steel at room temperature

NASA Astrophysics Data System (ADS)

Muñoz-Andrade, Juan D.

2013-12-01

By systematic study the mapping of polycrystalline flow of sheet 304 austenitic stainless steel (ASS) during tension test at constant crosshead velocity at room temperature was obtained. The main results establish that the trajectory of crystals in the polycrystalline spatially extended system (PCSES), during irreversible deformation process obey a hyperbolic motion. Where, the ratio between the expansion velocity of the field and the velocity of the field source is not constant and the field lines of such trajectory of crystals become curved, this accelerated motion is called a hyperbolic motion. Such behavior is assisted by dislocations dynamics and self-accommodation process between crystals in the PCSES. Furthermore, by applying the quantum mechanics and relativistic model proposed by Muñoz-Andrade, the activation energy for polycrystalline flow during the tension test of 304 ASS was calculated for each instant in a global form. In conclusion was established that the mapping of the polycrystalline flow is fundamental to describe in an integral way the phenomenology and mechanics of irreversible deformation processes.

Integrability of Spinning Particle Motion in Higher-Dimensional Rotating Black Hole Spacetimes

NASA Astrophysics Data System (ADS)

Kubizňák, David; Cariglia, Marco

2012-02-01

We study the motion of a classical spinning particle (with spin degrees of freedom described by a vector of Grassmann variables) in higher-dimensional general rotating black hole spacetimes with a cosmological constant. In all dimensions n we exhibit n bosonic functionally independent integrals of spinning particle motion, corresponding to explicit and hidden symmetries generated from the principal conformal Killing-Yano tensor. Moreover, we demonstrate that in 4-, 5-, 6-, and 7-dimensional black hole spacetimes such integrals are in involution, proving the bosonic part of the motion integrable. We conjecture that the same conclusion remains valid in all higher dimensions. Our result generalizes the result of Page et al. [Phys. Rev. Lett. 98, 061102 (2007)PRLTAO0031-900710.1103/PhysRevLett.98.061102] on complete integrability of geodesic motion in these spacetimes.

On the origin of size-dependent and size-independent crystal growth: Influence of advection and diffusion

USGS Publications Warehouse

Kile, D.E.; Eberl, D.D.

2003-01-01

Crystal growth experiments were conducted using potassium alum and calcite crystals in aqueous solution under both non-stirred and stirred conditions to elucidate the mechanism for size-dependent (proportionate) and size-independent (constant) crystal growth. Growth by these two laws can be distinguished from each other because the relative size difference among crystals is maintained during proportionate growth, leading to a constant crystal size variance (??2) for a crystal size distribution (CSD) as the mean size increases. The absolute size difference among crystals is maintained during constant growth, resulting in a decrease in size variance. Results of these experiments show that for centimeter-sized alum crystals, proportionate growth occurs in stirred systems, whereas constant growth occurs in non-stirred systems. Accordingly, the mechanism for proportionate growth is hypothesized to be related to the supply of reactants to the crystal surface by advection, whereas constant growth is related to supply by diffusion. Paradoxically, micrometer-sized calcite crystals showed proportionate growth both in stirred and in non-stirred systems. Such growth presumably results from the effects of convection and Brownian motion, which promote an advective environment and hence proportionate growth for minute crystals in non-stirred systems, thereby indicating the importance of solution velocity relative to crystal size. Calcite crystals grown in gels, where fluid motion was minimized, showed evidence for constant, diffusion-controlled growth. Additional investigations of CSDs of naturally occurring crystals indicate that proportionate growth is by far the most common growth law, thereby suggesting that advection, rather than diffusion, is the dominant process for supplying reactants to crystal surfaces.

Stress Management: Tai Chi

MedlinePlus

... in constant motion. Tai chi has many different styles. Each style may subtly emphasize various tai chi principles and methods. There are variations within each style. Some styles may focus on health maintenance, while ...

Is Vestibular Self-Motion Perception Controlled by the Velocity Storage? Insights from Patients with Chronic Degeneration of the Vestibulo-Cerebellum

PubMed Central

Bertolini, Giovanni; Ramat, Stefano; Bockisch, Christopher J.; Marti, Sarah; Straumann, Dominik; Palla, Antonella

2012-01-01

Background The rotational vestibulo-ocular reflex (rVOR) generates compensatory eye movements in response to rotational head accelerations. The velocity-storage mechanism (VSM), which is controlled by the vestibulo-cerebellar nodulus and uvula, determines the rVOR time constant. In healthy subjects, it has been suggested that self-motion perception in response to earth-vertical axis rotations depends on the VSM in a similar way as reflexive eye movements. We aimed at further investigating this hypothesis and speculated that if the rVOR and rotational self-motion perception share a common VSM, alteration in the latter, such as those occurring after a loss of the regulatory control by vestibulo-cerebellar structures, would result in similar reflexive and perceptual response changes. We therefore set out to explore both responses in patients with vestibulo-cerebellar degeneration. Methodology/Principal Findings Reflexive eye movements and perceived rotational velocity were simultaneously recorded in 14 patients with chronic vestibulo-cerebellar degeneration (28–81yrs) and 12 age-matched healthy subjects (30–72yrs) after the sudden deceleration (90°/s2) from constant-velocity (90°/s) rotations about the earth-vertical yaw and pitch axes. rVOR and perceived rotational velocity data were analyzed using a two-exponential model with a direct pathway, representing semicircular canal activity, and an indirect pathway, implementing the VSM. We found that VSM time constants of rVOR and perceived rotational velocity co-varied in cerebellar patients and in healthy controls (Pearson correlation coefficient for yaw 0.95; for pitch 0.93, p<0.01). When constraining model parameters to use the same VSM time constant for rVOR and perceived rotational velocity, moreover, no significant deterioration of the quality of fit was found for both populations (variance-accounted-for >0.8). Conclusions/Significance Our results confirm that self-motion perception in response to rotational velocity-steps may be controlled by the same velocity storage network that controls reflexive eye movements and that no additional, e.g. cortical, mechanisms are required to explain perceptual dynamics. PMID:22719833

Magnetic field twist driven by remote convective motions: Characteristics and twist rates

NASA Technical Reports Server (NTRS)

Wang, Zheng-Zhi; Hassam, A. B.

1987-01-01

It is generally believed that convective motions below the solar photosphere induce a twist in the coronal magnetic field as a result of frozen-in physics. A question of interest is how much twist can one expect from a persistent convective motion, given the fact that dissipative effects will eventually figure. This question is examined by considering a model problem: two conducting plates, with finite resistivity, are set in sheared motion and forced at constant relative speed. A resistive plasma is between the plates and an initially vertical magnetic field connects the plates. The time rate of tilt experienced by the field is obtained as a function of Hartmann number and the resistivity ratio. Both analytical and numerical approaches are considered.

Dynamical properties of nematic liquid crystals subjected to shear flow and magnetic fields: tumbling instability and nonequilibrium fluctuations.

PubMed

Fatriansyah, Jaka Fajar; Orihara, Hiroshi

2013-07-01

We investigate the dynamical properties of monodomain nematic liquid crystals under shear flow and magnetic fields on the basis of the Ericksen-Leslie theory. Stable and unstable states appear depending on the magnetic field and the shear rate. The trajectory of the unstable state shows tumbling motion. The phase diagram of these states is plotted as a function of the three components of the magnetic field at a constant shear rate. The phase diagram changes depending on the viscous properties of different types of nematic liquid crystals. In this nonequilibrium steady state, we calculate the correlation function of director fluctuations and the response function, and discuss the nonequilibrium fluctuations and the modified fluctuation-dissipation relation in connection with nonconservative forces due to shear flow.

Modeling and measuring the visual detection of ecologically relevant motion by an Anolis lizard.

PubMed

Pallus, Adam C; Fleishman, Leo J; Castonguay, Philip M

2010-01-01

Motion in the visual periphery of lizards, and other animals, often causes a shift of visual attention toward the moving object. This behavioral response must be more responsive to relevant motion (predators, prey, conspecifics) than to irrelevant motion (windblown vegetation). Early stages of visual motion detection rely on simple local circuits known as elementary motion detectors (EMDs). We presented a computer model consisting of a grid of correlation-type EMDs, with videos of natural motion patterns, including prey, predators and windblown vegetation. We systematically varied the model parameters and quantified the relative response to the different classes of motion. We carried out behavioral experiments with the lizard Anolis sagrei and determined that their visual response could be modeled with a grid of correlation-type EMDs with a spacing parameter of 0.3 degrees visual angle, and a time constant of 0.1 s. The model with these parameters gave substantially stronger responses to relevant motion patterns than to windblown vegetation under equivalent conditions. However, the model is sensitive to local contrast and viewer-object distance. Therefore, additional neural processing is probably required for the visual system to reliably distinguish relevant from irrelevant motion under a full range of natural conditions.

Atomic motion from the mean square displacement in a monatomic liquid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wallace, Duane C.; De Lorenzi-Venneri, Giulia; Chisolm, Eric D.

V-T theory is constructed in the many-body Hamiltonian formulation, and is being developed as a novel approach to liquid dynamics theory. In this theory the liquid atomic motion consists of two contributions, normal mode vibrations in a single representative potential energy valley, and transits, which carry the system across boundaries between valleys. The mean square displacement time correlation function (the MSD) is a direct measure of the atomic motion, and our goal is to determine if the V-T formalism can produce a physically sensible account of this motion. We employ molecular dynamics (MD) data for a system representing liquid Na,more » and find the motion evolves in three successive time intervals: on the first 'vibrational' interval, the vibrational motion alone gives a highly accurate account of the MD data; on the second 'crossover' interval, the vibrational MSD saturates to a constant while the transit motion builds up from zero; on the third 'random walk' interval, the transit motion produces a purely diffusive random walk of the vibrational equilibrium positions. Furthermore, this motional evolution agrees with, and adds refinement to, the MSD atomic motion as described by current liquid dynamics theories.« less

Atomic motion from the mean square displacement in a monatomic liquid

DOE PAGES

Wallace, Duane C.; De Lorenzi-Venneri, Giulia; Chisolm, Eric D.

2016-04-08

V-T theory is constructed in the many-body Hamiltonian formulation, and is being developed as a novel approach to liquid dynamics theory. In this theory the liquid atomic motion consists of two contributions, normal mode vibrations in a single representative potential energy valley, and transits, which carry the system across boundaries between valleys. The mean square displacement time correlation function (the MSD) is a direct measure of the atomic motion, and our goal is to determine if the V-T formalism can produce a physically sensible account of this motion. We employ molecular dynamics (MD) data for a system representing liquid Na,more » and find the motion evolves in three successive time intervals: on the first 'vibrational' interval, the vibrational motion alone gives a highly accurate account of the MD data; on the second 'crossover' interval, the vibrational MSD saturates to a constant while the transit motion builds up from zero; on the third 'random walk' interval, the transit motion produces a purely diffusive random walk of the vibrational equilibrium positions. Furthermore, this motional evolution agrees with, and adds refinement to, the MSD atomic motion as described by current liquid dynamics theories.« less

Constant volume gas cell optical phase-shifter

DOEpatents

Phillion, Donald W.

2002-01-01

A constant volume gas cell optical phase-shifter, particularly applicable for phase-shifting interferometry, contains a sealed volume of atmospheric gas at a pressure somewhat different than atmospheric. An optical window is present at each end of the cell, and as the length of the cell is changed, the optical path length of a laser beam traversing the cell changes. The cell comprises movable coaxial tubes with seals and a volume equalizing opening. Because the cell is constant volume, the pressure, temperature, and density of the contained gas do not change as the cell changes length. This produces an exactly linear relationship between the change in the length of the gas cell and the change in optical phase of the laser beam traversing it. Because the refractive index difference between the gas inside and the atmosphere outside is very much the same, a large motion must be made to change the optical phase by the small fraction of a wavelength that is required by phase-shifting interferometry for its phase step. This motion can be made to great fractional accuracy.

Superintegrability on N-dimensional spaces of constant curvature from so( N + 1) and its contractions

NASA Astrophysics Data System (ADS)

Herranz, F. J.; Ballesteros, Á.

2008-05-01

The Lie—Poisson algebra so( N + 1) and some of its contractions are used to construct a family of superintegrable Hamiltonians on the N-dimensional spherical, Euclidean, hyperbolic, Minkowskian, and (anti-)de Sitter spaces. We firstly present a Hamiltonian which is a superposition of an arbitrary central potential with N arbitrary centrifugal terms. Such a system is quasi-maximally superintegrable since this is endowed with 2 N — 3 functionally independent constants of motion (plus the Hamiltonian). Secondly, we identify two maximally superintegrable Hamiltonians by choosing a specific central potential and finding at the same time the remaining integral. The former is the generalization of the Smorodinsky—Winternitz system to the above six spaces, while the latter is a generalization of the Kepler—Coulomb potential, for which the Laplace—Runge—Lenz N vector is also given. All the systems and constants of motion are explicitly expressed in a unified form in terms of ambient and polar coordinates as they are parametrized by two contraction parameters (curvature and signature of the metric).

Domain-wall motion at an ultrahigh speed driven by spin-orbit torque in synthetic antiferromagnets.

PubMed

Yu, Ziyang; Zhang, Yue; Zhang, Zhenhua; Cheng, Ming; Lu, Zhihong; Yang, Xiaofei; Shi, Jing; Xiong, Rui

2018-04-27

In this article, we present our numerical investigation about the spin-orbit-torque induced domain-wall (DW) motion in a synthetic antiferromagnetic multilayer nanotrack. This nanotrack was composed by two ferromagnetic (FM) layers with a RKKY inter-layer antiferromagnetic (AFM) exchange coupling. The velocity of DW was well manipulated by varying parameters including inter-layer exchange constant, the Dzyaloshinskii-Moriya interaction (DMI) strength, the current density and the magnetic anisotropy. The DW velocity was found to be strictly related to the orientation of the moments in the two FM layers. When the interlayer exchange constant or the DMI constant were larger than a critical value, there was a large angle between the moments in one FM layer and that in the other one under the current, and the DW was driven to move at an ultrahigh speed (around 10 000 m s -1 ). However, when the DMI or the AFM exchange coupling was weaker than the critical value, the moments in one FM layer were parallel to that in the other one under the current, and the velocity was significantly reduced.

Motional timescale predictions by molecular dynamics simulations: Case study using proline and hydroxyproline sidechain dynamics

PubMed Central

Aliev, Abil E; Kulke, Martin; Khaneja, Harmeet S; Chudasama, Vijay; Sheppard, Tom D; Lanigan, Rachel M

2014-01-01

We propose a new approach for force field optimizations which aims at reproducing dynamics characteristics using biomolecular MD simulations, in addition to improved prediction of motionally averaged structural properties available from experiment. As the source of experimental data for dynamics fittings, we use 13C NMR spin-lattice relaxation times T1 of backbone and sidechain carbons, which allow to determine correlation times of both overall molecular and intramolecular motions. For structural fittings, we use motionally averaged experimental values of NMR J couplings. The proline residue and its derivative 4-hydroxyproline with relatively simple cyclic structure and sidechain dynamics were chosen for the assessment of the new approach in this work. Initially, grid search and simplexed MD simulations identified large number of parameter sets which fit equally well experimental J couplings. Using the Arrhenius-type relationship between the force constant and the correlation time, the available MD data for a series of parameter sets were analyzed to predict the value of the force constant that best reproduces experimental timescale of the sidechain dynamics. Verification of the new force-field (termed as AMBER99SB-ILDNP) against NMR J couplings and correlation times showed consistent and significant improvements compared to the original force field in reproducing both structural and dynamics properties. The results suggest that matching experimental timescales of motions together with motionally averaged characteristics is the valid approach for force field parameter optimization. Such a comprehensive approach is not restricted to cyclic residues and can be extended to other amino acid residues, as well as to the backbone. Proteins 2014; 82:195–215. © 2013 Wiley Periodicals, Inc. PMID:23818175

A new insight on the dynamics of sodium dodecyl sulfate aqueous micellar solutions by dielectric spectroscopy.

PubMed

Lanzi, Leandro; Carlà, Marcello; Lanzi, Leonardo; Gambi, Cecilia M C

2009-02-01

Aqueous sodium dodecyl sulfate micellar solutions were investigated by a recently developed double-differential dielectric spectroscopy technique in the frequency range 100 MHz-3 GHz at 22 degrees C, in the surfactant concentration range 29.8-524 mM, explored for the first time above 104 mM. The micellar contribution to dielectric spectra was analyzed according to three models containing, respectively, a single Debye relaxation, a Cole-Cole relaxation and a double Debye relaxation. The single Debye model is not accurate enough. Both Cole-Cole and double Debye models fit well the experimental dielectric spectra. With the double Debye model, two characteristic relaxation times were identified: the slower one, in the range 400-900 ps, is due to the motion of counterions bound to the micellar surface (lateral motion); the faster one, in the range 100-130 ps, is due to interfacial bound water. Time constants and amplitudes of both processes are in fair agreement with Grosse's theoretical model, except at the largest concentration values, where interactions between micelles increase. For each sample, the volume fraction of bulk water and the effect of bound water as well as the conductivity in the low frequency limit were computed. The bound water increases as the surfactant concentration increases, in quantitative agreement with the micellar properties. The number of water molecules per surfactant molecule was also computed. The conductivity values are in agreement with Kallay's model over the whole surfactant concentration range.

Charge separation and transport of the n=2 instability in C-2 FRC plasmas

NASA Astrophysics Data System (ADS)

Deng, Bihe; Sun, Xuan; Tuszewski, Michel

2012-10-01

Charge separation is critical in the positive feedback loop for gravitational type instabilities to grow [1], such as in the case of the n=2 mode in the C-2 field reversed configuration (FRC) experiment [2]. A fast time response Langmuir probe with minimum perturbation to the plasma is inserted into the edge of the C-2 plasma to measure the plasma floating potential. With the combined plasma wobble motion and spin motion, 2-D scans of the plasma floating potential are obtained, and evidence of charge separation associated with the n=2 instability is observed. The transport due to charge separation is estimated. Charge neutralization can provide an alternative method to stabilize the n=2 mode. An experiment is proposed to test this method with two probes inserted into the plasma from two azimuthally separated ports and an external shorting circuit, to constantly neutralize the charge separation, thus suppress the growth of the n=2 mode. [4pt] [1] R.J. Goldston and P.H. Rutherford, Introduction to Plasma Physics (Institute of Physics Publishing, Bristol, 2000).[0pt] [2]. M.W. Binderbauer et al, Phys. Rev. Lett. 105, 045003 (2010).

Some remarks on recent developments in micropolar continuum theory

NASA Astrophysics Data System (ADS)

Vilchevskaya, E. N.; Müller, W. H.

2018-04-01

This paper considers micropolar media that can undergo structural changes and do not a priori consist of indestructible material particles. Initially the pertinent literature is reviewed. Then the necessary theoretical framework for a continuum of that type is presented. The standard macroscopic equations for mass, linear and angular momentum are complemented by a recently proposed balance for the moment of inertia tensor, which contains a production term. Two examples illustrate the effect of the production. In the first example, we study a continuous stream of matter on a conveyor belt going through a crusher so that the total number of particles will change. In context with this example, it is also clear that the traditional Lagrangian way of describing the motion of solids is no longer adequate and must be replaced by the Eulerian point of view known from fluid mechanics. The second example deals with hollow particles which rotate because of the presence of body couples. Now a transient temperature field is superimposed such that the moment of inertia field changes due to the thermal expansion of particles. This in turn results in rotational motion that is no longer constant but varies in space and time.

Application of two-dimensional unsteady aerodynamic to a free-tip rotor response analysis

NASA Technical Reports Server (NTRS)

Yates, L.; Kumagai, H.

1985-01-01

The free-tip rotor utilizes a rotor blade tip which is structurally decoupled from the blade inboard section. The tip is free to pitch about its own pitch axis to respond to the local flow angularity changes. The tip also experiences the heaving motion due to the flapping of the rotor blade. For an airfoil in any pitching and heaving motion which can be expanded into a Fourier series, the lift and moment calculated by Theodoren's theory is simply the linear combination of the lift and moment calculated for each harmonic. These lift and moment are then used to determine the response of the free-tip rotor. A parametric study is performed to determine the effect of mechanical damping, mechanical spring, sweep, friction, and a constant control moment on the free-tip rotor response characteristics and the resulting azimuthal lift distributions. The results showed that the free-tip has the capability to suppress the oscillatory lift distribution around the azimuth and to eliminate a significant negative life peak on the advancing tip. This result agrees with the result of the previous analysis based on the steady aerodynamics.

SU-G-TeP3-07: On the Development of Mechano-Biological Assessment of Leukemia Cells Using Optical Tweezers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brost, E; Brooks, J; Piepenburg, J

Purpose: Patients with BCR-ABL (Ph +ve) acute lymphoblastic leukemia are at very high risk of relapse and mortality. In line with the NIH mission to understand the physical and biological processes, we seek to report mechano-biological method to assessment and distinguish treated/untreated leukemia cells. Methods: BCR-ABL leukemia cell populations and silica microspheres were trapped in a 100x magnification optical trapping system (λ=660 nm, 70 mW). Light refracted through the trapped sample was collected in the back focal plane by a quadrant detector to measure the positions of individual cells. The sample was driven at a known frequency and amplitude withmore » a flexure translation stage, and the target’s response was recorded. The measured response was calibrated using the known driving parameters, and information about cell movements due to mechano-biological effects was extracted. Two leukemia cell populations were tested: a control group and a group treated with 2 Gy. Results: The mechano-biological movements of 10 microspheres, control cells, and treated cells were tracked over a ∼30 minute window at 1 minute intervals. The microsphere population did not see significant change in mechano-biological movements over the testing interval and remained constant. The control cell population saw a two-fold rise in activity that peaked around 1200 seconds, then dropped off sharply. The treated cell population saw a two-fold rise in activity that peaked at 400 seconds, and dropped off slowly. Conclusion: The investigated technique allows for direct measurement the movements of a trapped object due to mechano-biological effects such as thermal and extracellular motion. When testing microspheres, the mechano-biological activity remained constant over time due to the lack of biological factors. In both the control and treated cell populations, the mechano-biological activity was increased, possibly due to mitochondrial activation. This extra activity decreased over time, possibly due to cellular damage from trapping radiation.« less

Isometric torque-angle relationship and movement-related activity of human elbow flexors: implications for the equilibrium-point hypothesis.

PubMed

Hasan, Z; Enoka, R M

1985-01-01

Since the moment arms for the elbow-flexor muscles are longest at intermediate positions of the elbow and shorter at the extremes of the range of motion, it was expected that the elbow torque would also show a peak at an intermediate angle provided the activity of the flexor muscles remained constant. We measured the isometric elbow torque at different elbow angles while the subject attempted to keep constant the electromyographic activity (EMG) of the brachioradialis muscle. The torque-angle relationship thus obtained exhibited a peak, as expected, but the shape of the relationship varied widely among subjects. This was due in part to differences in the variation of the biceps brachii EMG with elbow angle among the different subjects. The implications of these observations for the equilibrium-point hypothesis of movement were investigated as follows. The subject performed elbow movements in the presence of an external torque (which tended to extend the elbow joint) provided by a weight-and-pulley arrangement. We found in the case of flexion movements that invariably there was a transient increase in flexor EMG, as would seem necessary for initiating the movement. However, the steady-state EMG after the movement could be greater or less than the pre-movement EMG. Specifically, the least flexor EMG was required for equilibrium in the intermediate range of elbow angles, compared to the extremes of the range of motion. The EMG-angle relationship, however, varied with the muscle and the subject. The observation that the directions of change in the transient and the steady-state EMG are independent of each other militates against the generality of the equilibrium-point hypothesis. However, a form of the hypothesis which includes the effects of the stretch reflex is not contradicted by this observation.

Does successful rotator cuff repair improve muscle atrophy and fatty infiltration of the rotator cuff? A retrospective magnetic resonance imaging study performed shortly after surgery as a reference.

PubMed

Hamano, Noritaka; Yamamoto, Atsushi; Shitara, Hitoshi; Ichinose, Tsuyoshi; Shimoyama, Daisuke; Sasaki, Tsuyoshi; Kobayashi, Tsutomu; Kakuta, Yohei; Osawa, Toshihisa; Takagishi, Kenji

2017-06-01

Muscle atrophy and fatty infiltration in the rotator cuff muscles are often observed in patients with chronic rotator cuff tears. The recovery from these conditions has not been clarified. Ninety-four patients were included in this study. The improvement in muscle atrophy and fatty infiltration in successfully repaired rotator cuff tears was evaluated by magnetic resonance imaging at 1 year and 2 years after surgery and was compared with muscle atrophy and fatty infiltration observed on magnetic resonance imaging at 2 weeks after surgery to discount any changes due to the medial retraction of the torn tendon. The patients' muscle strength was evaluated in abduction and external rotation. Muscle atrophy and fatty infiltration of the supraspinatus were significantly improved at 2 years after surgery in comparison to 2 weeks after surgery. The subjects' abduction and external rotation strength was also significantly improved at 2 years after surgery in comparison to the preoperative values. Patients whose occupation ratio was improved had a better abduction range of motion, stronger abduction strength, and higher Constant score. Patients whose fatty infiltration was improved had a better range of motion in flexion and abduction, whereas the improvements of muscle strength and the Constant score were similar in the group that showed an improvement of fatty infiltration and the group that did not. Muscle atrophy and fatty infiltration can improve after rotator cuff repair. The strengths of abduction and external rotation were also improved at 2 years after surgery. Copyright © 2016 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

Conformation analysis and molecular mobility of ethylene and tetrafluoroethylene copolymer using solid-state 19F MAS and 1H --> 19F CP/MAS NMR spectroscopy.

PubMed

Aimi, Keitaro; Ando, Shinji

2004-07-01

The changes in the conformation and molecular mobility accompanied by a phase transition in the crystalline domain were analyzed for ethylene (E) and tetrafluoroethylene (TFE) copolymer, ETFE, using variable-temperature (VT) solid-state 19F magic angle spinning (MAS) and 1H --> 19F cross-polarization (CP)/MAS NMR spectroscopy. The shifts of the signals for fluorines in TFE units to higher frequency and the continuing decrease and increase in the T1rho(F) values suggest that conformational exchange motions exist in the crystalline domain between 42 and 145 degrees C. Quantum chemical calculations of magnetic shielding constants showed that the high-frequency shift of TFE units should be induced by trans to gauche conformational changes at the CH2-CF2 linkage in the E-TFE unit. Although the 19F signals of the crystalline domain are substantially overlapped with those of the amorphous domain at ambient probe temperature (68 degrees C), they were successfully distinguished by using the dipolar filter and spin-lock pulse sequences at 145 degrees C. The dipolar coupling constants for the crystalline domain, which can be estimated by fitting the dipolar oscillation behaviors in the 1H --> 19F CP curve, showed a significant decrease with increasing temperature from 42 to 145 degrees C. This is due to the averaging of 1H-19F dipolar interactions originating from the molecular motion in the crystalline domain. The increase in molecular mobility in the crystalline domain was clearly shown by VT T1rho(F) and 1H --> 19F CP measurements in the phase transition temperature range. Copyright 2004 John Wiley & Sons, Ltd.

Differential processing: towards a unified model of direction and speed perception.

PubMed

Farrell-Whelan, Max; Brooks, Kevin R

2013-11-01

In two experiments, we demonstrate a misperception of the velocity of a random-dot stimulus moving in the presence of a static line oriented obliquely to the direction of dot motion. As shown in previous studies, the perceived direction of the dots is shifted away from the orientation of the static line, with the size of the shift varying as a function of line orientation relative to dot direction (the statically-induced direction illusion, or 'SDI'). In addition, we report a novel effect - that perceived speed also varies as a function of relative line orientation, decreasing systematically as the angle is reduced from 90° to 0°. We propose that these illusions both stem from the differential processing of object-relative and non-object-relative component velocities, with the latter being perceptually underestimated with respect to the former by a constant ratio. Although previous proposals regarding the SDI have not allowed quantitative accounts, we present a unified formal model of perceived velocity (both direction and speed) with the magnitude of this ratio as the only free parameter. The model was successful in accounting for the angular repulsion of motion direction across line orientations, and in predicting the systematic decrease in perceived velocity as the line's angle was reduced. Although fitting for direction and speed produced different best-fit values of the ratio of underestimation of non-object-relative motion compared to object-relative motion (with the ratio for speed being larger than that for direction) this discrepancy may be due to differences in the psychophysical procedures for measuring direction and speed. Copyright © 2013 Elsevier B.V. All rights reserved.

Fluid displacement fronts in porous media: pore scale interfacial jumps, pressure bursts and acoustic emissions

NASA Astrophysics Data System (ADS)

Moebius, Franziska; Or, Dani

2014-05-01

The macroscopically smooth and regular motion of fluid fronts in porous media is composed of numerous rapid pore-scale interfacial jumps and pressure bursts that involve intense interfacial energy release in the form of acoustic emissions. The characteristics of these pore scale events affect residual phase entrapment and transport properties behind the front. We present experimental studies using acoustic emission technique (AE), rapid imaging, and liquid pressure measurements to characterize these processes during drainage and imbibition in simple porous media. Imbibition and drainage produce different AE signatures (AE amplitudes obey a power law). For rapid drainage, AE signals persist long after cessation of front motion reflecting fluid redistribution and interfacial relaxation. Imaging revealed that the velocity of interfacial jumps often exceeds front velocity by more than 50 fold and is highly inertial component (Re>1000). Pore invasion volumes reduced deduced from pressure fluctuations waiting times (for constant withdrawal rates) show remarkable agreement with geometrically-deduced pore volumes. Discrepancies between invaded volumes and geometrical pores increase with increasing capillary numbers due to constraints on evacuation opportunity times and simultaneous invasion events. A mechanistic model for interfacial motions in a pore-throat network was developed to investigate interfacial dynamics focusing on the role of inertia. Results suggest that while pore scale dynamics were sensitive to variations in pore geometry and boundary conditions, inertia exerted only a minor effect on phase entrapment. The study on pore scale invasion events paints a complex picture of rapid and inertial motions and provides new insights on mechanisms at displacement fronts that are essential for improved macroscopic description of multiphase flows in porous media.

Three-dimensional characterization of tethered microspheres by total internal reflection fluorescence microscopy

NASA Technical Reports Server (NTRS)

Blumberg, Seth; Gajraj, Arivalagan; Pennington, Matthew W.; Meiners, Jens-Christian

2005-01-01

Tethered particle microscopy is a powerful tool to study the dynamics of DNA molecules and DNA-protein complexes in single-molecule experiments. We demonstrate that stroboscopic total internal reflection microscopy can be used to characterize the three-dimensional spatiotemporal motion of DNA-tethered particles. By calculating characteristic measures such as symmetry and time constants of the motion, well-formed tethers can be distinguished from defective ones for which the motion is dominated by aberrant surface effects. This improves the reliability of measurements on tether dynamics. For instance, in observations of protein-mediated DNA looping, loop formation is distinguished from adsorption and other nonspecific events.

Numerical simulation of solitary waves on deep water with constant vorticity

NASA Astrophysics Data System (ADS)

Dosaev, A. S.; Shishina, M. I.; Troitskaya, Yu I.

2018-01-01

Characteristics of solitary deep water waves on a flow with constant vorticity are investigated by numerical simulation within the framework of fully nonlinear equations of motion (Euler equations) using the method of surface-tracking conformal coordinates. To ensure that solutions observed are stable, soliton formation as a result of disintegration of an initial pulse-like disturbance is modeled. Evidence is obtained that solitary waves with height above a certain threshold are unstable.

Limited transfer of long-term motion perceptual learning with double training.

PubMed

Liang, Ju; Zhou, Yifeng; Fahle, Manfred; Liu, Zili

2015-01-01

A significant recent development in visual perceptual learning research is the double training technique. With this technique, Xiao, Zhang, Wang, Klein, Levi, and Yu (2008) have found complete transfer in tasks that had previously been shown to be stimulus specific. The significance of this finding is that this technique has since been successful in all tasks tested, including motion direction discrimination. Here, we investigated whether or not this technique could generalize to longer-term learning, using the method of constant stimuli. Our task was learning to discriminate motion directions of random dots. The second leg of training was contrast discrimination along a new average direction of the same moving dots. We found that, although exposure of moving dots along a new direction facilitated motion direction discrimination, this partial transfer was far from complete. We conclude that, although perceptual learning is transferrable under certain conditions, stimulus specificity also remains an inherent characteristic of motion perceptual learning.

Modeling Attitude Dynamics in Simulink: A Study of the Rotational and Translational Motion of a Spacecraft Given Torques and Impulses Generated by RMS Hand Controllers

NASA Technical Reports Server (NTRS)

Mauldin, Rebecca H.

2010-01-01

In order to study and control the attitude of a spacecraft, it is necessary to understand the natural motion of a body in orbit. Assuming a spacecraft to be a rigid body, dynamics describes the complete motion of the vehicle by the translational and rotational motion of the body. The Simulink Attitude Analysis Model applies the equations of rigid body motion to the study of a spacecraft?s attitude in orbit. Using a TCP/IP connection, Matlab reads the values of the Remote Manipulator System (RMS) hand controllers and passes them to Simulink as specified torque and impulse profiles. Simulink then uses the governing kinematic and dynamic equations of a rigid body in low earth orbit (LE0) to plot the attitude response of a spacecraft for five seconds given known applied torques and impulses, and constant principal moments of inertia.

Orbital motions of bubbles in an acoustic field

NASA Astrophysics Data System (ADS)

Shirota, Minori; Yamashita, Ko; Inamura, Takao

2012-09-01

This experimental study aims to clarify the mechanism of orbital motion of two oscillating bubbles in an acoustic field. Trajectory of the orbital motion on the wall of a spherical levitator was observed using a high-speed video camera. Because of a good repeatability in volume oscillation of bubbles, we were also able to observe the radial motion driven at 24 kHz by stroboscopic like imaging technique. The orbital motions of bubbles raging from 0.13 to 0.18 mm were examined with different forcing amplitude and in different viscous oils. As a result, we found that pairs of bubbles revolve along an elliptic orbit around the center of mass of the bubbles. We also found that the two bubbles perform anti-phase radial oscillation. Although this radial oscillation should result in a repulsive secondary Bjerknes force, the bubbles kept a constant separate distance of about 1 mm, which indicates the existence of centripetal primary Bjerknes force.

Adaptation of vestibular signals for self-motion perception

PubMed Central

St George, Rebecca J; Day, Brian L; Fitzpatrick, Richard C

2011-01-01

A fundamental concern of the brain is to establish the spatial relationship between self and the world to allow purposeful action. Response adaptation to unvarying sensory stimuli is a common feature of neural processing, both peripherally and centrally. For the semicircular canals, peripheral adaptation of the canal-cupula system to constant angular-velocity stimuli dominates the picture and masks central adaptation. Here we ask whether galvanic vestibular stimulation circumvents peripheral adaptation and, if so, does it reveal central adaptive processes. Transmastoidal bipolar galvanic stimulation and platform rotation (20 deg s−1) were applied separately and held constant for 2 min while perceived rotation was measured by verbal report. During real rotation, the perception of turn decayed from the onset of constant velocity with a mean time constant of 15.8 s. During galvanic-evoked virtual rotation, the perception of rotation initially rose but then declined towards zero over a period of ∼100 s. For both stimuli, oppositely directed perceptions of similar amplitude were reported when stimulation ceased indicating signal adaptation at some level. From these data the time constants of three independent processes were estimated: (i) the peripheral canal-cupula adaptation with time constant 7.3 s, (ii) the central ‘velocity-storage’ process that extends the afferent signal with time constant 7.7 s, and (iii) a long-term adaptation with time constant 75.9 s. The first two agree with previous data based on constant-velocity stimuli. The third component decayed with the profile of a real constant angular acceleration stimulus, showing that the galvanic stimulus signal bypasses the peripheral transformation so that the brainstem sees the galvanic signal as angular acceleration. An adaptive process involving both peripheral and central processes is indicated. Signals evoked by most natural movements will decay peripherally before adaptation can exert an appreciable effect, making a specific vestibular behavioural role unlikely. This adaptation appears to be a general property of the internal coding of self-motion that receives information from multiple sensory sources and filters out the unvarying components regardless of their origin. In this instance of a pure vestibular sensation, it defines the afferent signal that represents the stationary or zero-rotation state. PMID:20937715

Contrast Sensitivity, First-Order Motion and Initial Ocular Following in Demyelinating Optic Neuropathy

PubMed Central

Rucker, Janet C.; Sheliga, Boris M.; FitzGibbon, Edmond J.; Miles, Frederick A.; Leigh, R. John

2008-01-01

The ocular following response (OFR) is a measure of motion vision elicited at ultra-short latencies by sudden movement of a large visual stimulus. We compared the OFR to vertical sinusoidal gratings (spatial frequency 0.153 cycles/° or 0.458 cycles/°) of each eye in a subject with evidence of left optic nerve demyelination due to multiple sclerosis (MS). The subject showed substantial differences in vision measured with stationary low-contrast Sloan letters (20/63 OD and 20/200 OS at 2.5% contrast) and the Lanthony Desaturated 15-hue color test (Color Confusion Index 1.11 OD and 2.14 OS). Compared with controls, all of the subject's OFR to increasing contrast showed a higher threshold. The OFR of each of the subject's eyes were similar for the 0.153 cycles/° stimulus, and psychophysical measurements of his ability to detect these moving gratings were also similar for each eye. However, with the 0.458 cycles/° stimulus, the subject's OFR was asymmetric and the affected eye showed decreased responses (smaller slope constant as estimated by the Naka-Rushton equation). These results suggest that, in this case, optic neuritis caused a selective deficit that affected parvocellular pathways mediating higher spatial frequencies, lower-contrast, and color vision, but spared the field-holding mechanism underlying the OFR to lower spatial frequencies. The OFR may provide a useful method to study motion vision in individuals with disorders affecting anterior visual pathways. PMID:16649097

Flower tracking in hawkmoths: behavior and energetics.

PubMed

Sprayberry, Jordanna D H; Daniel, Thomas L

2007-01-01

As hovering feeders, hawkmoths cope with flower motions by tracking those motions to maintain contact with the nectary. This study examined the tracking, feeding and energetic performance of Manduca sexta feeding from flowers moving at varied frequencies and in different directions. In general we found that tracking performance decreased as frequency increased; M. sexta tracked flowers moving at 1 Hz best. While feeding rates were highest for stationary flowers, they remained relatively constant for all tested frequencies of flower motion. Calculations of net energy gain showed that energy expenditure to track flowers is minimal compared to energy intake; therefore, patterns of net energy gain mimicked patterns of feeding rate. The direction effects of flower motion were greater than the frequency effects. While M. sexta appeared equally capable of tracking flowers moving in the horizontal and vertical motion axes, they demonstrated poor ability to track flowers moving in the looming axis. Additionally, both feeding rates and net energy gain were lower for looming axis flower motions.

Numerical analysis of cell adhesion in capillary flow

NASA Astrophysics Data System (ADS)

Takeishi, Naoki; Imai, Yohsuke; Ishida, Shunichi; Omori, Toshihiro; Kamm, Roger; Ishikawa, Takuji

2016-11-01

Numerical simulation of cell adhesion was performed for capillaries whose diameter is comparable to or smaller than that of the cell. Despite a lot of works about leukocyte and tumor cell rolling, cell motion in capillaries has remained unclear. The solid and fluid mechanics of a cell in flow was coupled with a slip bond model of ligand-receptor interactions. When the size of a capillary was reduced, the cell always transitioned to "bullet-like" motion, with a consequent decrease in the velocity of the cell. A state diagram is obtained for various values of capillary diameter and receptor density. According to our numerical results, bullet motion enables firm adhesion of a cell to the capillary wall even for a weak ligand-receptor binding. We also quantified effects of various parameters, including the dissociation rate constant, the spring constant, and the reactive compliance on the characteristics of cell motion. Our results suggest that even under the interaction between PSGL-1 and P-selectin, which is mainly responsible for leukocyte rolling, a cell is able to show firm adhesion in a small capillary. These findings may help in understanding such phenomena as leukocyte plugging and cancer metastasis. This research was supported by JSPS KAKENHI Grant Numbers 25000008, 26107703, 14J03967. We also acknowledge support from the Tohoku University Division for International Advanced Research and Education Organization.

Formulas for precession. [motion of mean equator

NASA Technical Reports Server (NTRS)

Kinoshita, H.

1975-01-01

Literal expressions for the precessional motion of the mean equator referred to an arbitrary epoch are constructed. Their numerical representations, based on numerical values recommended at the working meeting of the International Astronomical Union Commission held in Washington in September 1974, are obtained. In constructing the equations of motion, the second-order secular perturbation and the secular perturbation due to the long-periodic terms in the motions of the moon and the sun are taken into account. These perturbations contribute more to the motion of the mean equator than does the term due to the secular perturbation of the orbital eccentricity of the sun.

Life expectancy of modular Ti6Al4V hip implants: influence of stress and environment.

PubMed

Chandra, A; Ryu, J J; Karra, P; Shrotriya, P; Tvergaard, V; Gaisser, M; Weik, T

2011-11-01

Stress dependent electrochemical dissolution is identified as one of the key mechanisms governing surface degradation in fretting and crevice corrosion of biomedical implants. The present study focuses on delineating the roles of mechanical stress and chemical conditions on the life expectancy of modular hip implants. First, material removal on a stressed surface of Ti6Al4V subjected to single asperity contact is investigated experimentally to identify the influence of contact load, in-plane stress and chemical environment on mean wear rates. A range of known stress levels are applied to the specimen while its surface is mechanically stimulated in different non-reactive to oxidizing aqueous environments. Evolution of surface degradation is monitored, and its mechanism is elucidated. This phase allows estimation of Preston Constant which is later used in the analysis. Second phase of the work is semi-analytical and computational, where, based on the estimated Preston constant and other material and process parameters, the scratch propensity (consisting of magnitude of scratch depth and their frequency per unit area) due to micro-motion in modular hip implants is estimated. The third phase views these scratches as initial notches and utilizes a mixed-mode fatigue crack propagation model to estimate the critical crack length for onset of instability. The number of loading cycles needed to reach this critical crack length is then labeled as the expected life of the implant under given mechanical and chemical conditions. Implications of different material and process conditions to life expectancy of orthopedic implants are discussed. It is observed that transverse micro-motion, compared to longitudinal micro-motion, plays a far more critical role in determining the implant life. Patient body weight, as well as proximity of the joint fluid to its iso-electric point play key roles in determining wear rates and associated life expectancies of modular hip implants. Sustained aeration of joint fluid, as well as proper tolerancing of mating surfaces, along with a proper choice of material microstructure may be utilized to extend implant life. Copyright © 2011 Elsevier Ltd. All rights reserved.

Interference Effects of Radiation Emitted from Nuclear Excitons

NASA Astrophysics Data System (ADS)

Potzel, W.; van Bürck, U.; Schindelmann, P.; Hagn, H.; Smirnov, G. V.; Popov, S. L.; Gerdau, E.; Shvyd'Ko, Yu. V.; Jäschke, J.; Rüter, H. D.; Chumakov, A. I.; Rüffer, R.

2003-12-01

Interference effects in nuclear forward scattering of synchrotron radiation (NFSSR) from two spatially separated stainless-steel foils A and B mounted downstream behind each other have been investigated. Target A can be sinusoidally vibrated by high-frequency (MHz) ultrasound (US), target B is moved at a constant Doppler velocity which is large compared to the natural width of the nuclear transition. Due to this large Doppler shift radiative coupling between both targets is disrupted and the nuclear excitons in A and B develop independently in space and time after the SR pulse. As a consequence, the emission from the whole system (A&B) is dominated by the interference of the emissions from A and B. The application of US to target A is a powerful method to change the relative phasing of the emissions and thus to investigate interference effects originating from the two nuclear excitons in detail. Four distinct cases were studied: (a) If target A is kept stationary and only B is moved at large constant velocity v, the interference pattern exhibits a Quantum Beat (QB) whose period is determined by v. (b) If, in addition, target A is sinusoidally vibrated in a piston-like motion by US and the initial US phase Φ0 is locked to the SR pulse, the QB is frequency modulated by the US. The variation of the QB frequency increases with the US modulation index m. (c) In the case that Φ0 is not synchronized to the SR pulse (phase averaging over Φ0) drastic changes of the amplitude and phase reversals of the QB pattern occur in the time regions around odd multiples of half of the US period. (d) If Φ0 is not synchronized to the SR pulse and the US motion is no longer pistonlike, the NFSSR intensity has to be averaged over both Φ0 and m (amplitude) of the US motion. Surprisingly the QB interference pattern does not vanish completely but a short QB signal remains at times of the full US period even at high values of m. All NFSSR patterns investigated are interpreted and quantitatively described by the dynamical theory.

RW Per - Nodal motion changes its amplitude by 1.4 mag

NASA Technical Reports Server (NTRS)

Schaefer, Bradley E.; Fried, Robert E.

1991-01-01

RW Per was found to have large secular changes in its eclipse amplitude. In blue light, for example, the amplitude was 3.2 mag in the early 1900s, 2.2 mag in the late 1960s, and 1.75 mag in 1990. Throughout this time, the brightness at maximum was constant in all colors. It is shown that the only possible explanation is nodal motion, where the inclination varies with a period of roughly 100,000 yr. The nodal motion is caused by a third star, for which the light curve, the colors, and the O - C curve already provide evidence. Thus, RW Per is only the fourth known star with large changes of eclipse amplitude and is only the second example of nodal motion.

Left ventricular filling under elevated left atrial pressure

NASA Astrophysics Data System (ADS)

Gaddam, Manikantam; Samaee, Milad; Santhanakrishnan, Arvind

2017-11-01

Left atrial pressure (LAP) is elevated in diastolic dysfunction, where left ventricular (LV) filling is impaired due to increase in ventricular stiffness. The impact of increasing LAP and LV stiffness on intraventricular filling hemodynamics remains unclear. We conducted particle image velocimetry and hemodynamics measurements in a left heart simulator (LHS) under increasing LAP and LV stiffness at a heart rate of 70 bpm. The LHS consisted of a flexible-walled LV physical model fitted within a fluid-filled chamber. LV wall motion was generated by a piston pump that imparted pressure fluctuations in the chamber. Resistance and compliance elements in the flow loop were adjusted to obtain bulk physiological hemodynamics in the least stiff LV model. Two LV models of increasing stiffness were subsequently tested under unchanged loop settings. LAP was varied between 5-20 mm Hg for each LV model, by adjusting fluid level in a reservoir upstream of the LV. For constant LV stiffness, increasing LAP lowered cardiac output (CO), while ejection fraction (EF) and E/A ratio were increased. For constant LAP, increasing LV stiffness lowered CO and EF, and increased E/A ratio. The implications of these altered hemodynamics on intraventricular filling vortex characteristics will be presented.

On the Use of Biaxial Properties in Modeling Annulus as a Holzapfel–Gasser–Ogden Material

PubMed Central

Momeni Shahraki, Narjes; Fatemi, Ali; Goel, Vijay K.; Agarwal, Anand

2015-01-01

Besides the biology, stresses and strains within the tissue greatly influence the location of damage initiation and mode of failure in an intervertebral disk. Finite element models of a functional spinal unit (FSU) that incorporate reasonably accurate geometry and appropriate material properties are suitable to investigate such issues. Different material models and techniques have been used to model the anisotropic annulus fibrosus, but the abilities of these models to predict damage initiation in the annulus and to explain clinically observed phenomena are unclear. In this study, a hyperelastic anisotropic material model for the annulus with two different sets of material constants, experimentally determined using uniaxial and biaxial loading conditions, were incorporated in a 3D finite element model of a ligamentous FSU. The purpose of the study was to highlight the biomechanical differences (e.g., intradiscal pressure, motion, forces, stresses, strains, etc.) due to the dissimilarity between the two sets of material properties (uniaxial and biaxial). Based on the analyses, the biaxial constants simulations resulted in better agreements with the in vitro and in vivo data, and thus are more suitable for future damage analysis and failure prediction of the annulus under complex multiaxial loading conditions. PMID:26090359

Unusual kinetics of thermal decay of dim-light photoreceptors in vertebrate vision

PubMed Central

Guo, Ying; Sekharan, Sivakumar; Liu, Jian; Batista, Victor S.; Tully, John C.; Yan, Elsa C. Y.

2014-01-01

We present measurements of rate constants for thermal-induced reactions of the 11-cis retinyl chromophore in vertebrate visual pigment rhodopsin, a process that produces noise and limits the sensitivity of vision in dim light. At temperatures of 52.0–64.6 °C, the rate constants fit well to an Arrhenius straight line with, however, an unexpectedly large activation energy of 114 ± 8 kcal/mol, which is much larger than the 60-kcal/mol photoactivation energy at 500 nm. Moreover, we obtain an unprecedentedly large prefactor of 1072±5 s−1, which is roughly 60 orders of magnitude larger than typical frequencies of molecular motions! At lower temperatures, the measured Arrhenius parameters become more normal: Ea = 22 ± 2 kcal/mol and Apref = 109±1 s−1 in the range of 37.0–44.5 °C. We present a theoretical framework and supporting calculations that attribute this unusual temperature-dependent kinetics of rhodopsin to a lowering of the reaction barrier at higher temperatures due to entropy-driven partial breakup of the rigid hydrogen-bonding network that hinders the reaction at lower temperatures. PMID:25002518

Vibrational analysis of vertical axis wind turbine blades

NASA Astrophysics Data System (ADS)

Kapucu, Onur

The goal of this research is to derive a vibration model for a vertical axis wind turbine blade. This model accommodates the affects of varying relative flow angle caused by rotating the blade in the flow field, uses a simple aerodynamic model that assumes constant wind speed and constant rotation rate, and neglects the disturbance of wind due to upstream blade or post. The blade is modeled as elastic Euler-Bernoulli beam under transverse bending and twist deflections. Kinetic and potential energy equations for a rotating blade under deflections are obtained, expressed in terms of assumed modal coordinates and then plugged into Lagrangian equations where the non-conservative forces are the lift and drag forces and moments. An aeroelastic model for lift and drag forces, approximated with third degree polynomials, on the blade are obtained assuming an airfoil under variable angle of attack and airflow magnitudes. A simplified quasi-static airfoil theory is used, in which the lift and drag coefficients are not dependent on the history of the changing angle of attack. Linear terms on the resulting equations of motion will be used to conduct a numerical analysis and simulation, where numeric specifications are modified from the Sandia-17m Darrieus wind turbine by Sandia Laboratories.

Unusual kinetics of thermal decay of dim-light photoreceptors in vertebrate vision.

PubMed

Guo, Ying; Sekharan, Sivakumar; Liu, Jian; Batista, Victor S; Tully, John C; Yan, Elsa C Y

2014-07-22

We present measurements of rate constants for thermal-induced reactions of the 11-cis retinyl chromophore in vertebrate visual pigment rhodopsin, a process that produces noise and limits the sensitivity of vision in dim light. At temperatures of 52.0-64.6 °C, the rate constants fit well to an Arrhenius straight line with, however, an unexpectedly large activation energy of 114 ± 8 kcal/mol, which is much larger than the 60-kcal/mol photoactivation energy at 500 nm. Moreover, we obtain an unprecedentedly large prefactor of 10(72±5) s(-1), which is roughly 60 orders of magnitude larger than typical frequencies of molecular motions! At lower temperatures, the measured Arrhenius parameters become more normal: Ea = 22 ± 2 kcal/mol and Apref = 10(9±1) s(-1) in the range of 37.0-44.5 °C. We present a theoretical framework and supporting calculations that attribute this unusual temperature-dependent kinetics of rhodopsin to a lowering of the reaction barrier at higher temperatures due to entropy-driven partial breakup of the rigid hydrogen-bonding network that hinders the reaction at lower temperatures.

Role of angular momentum and cosmic censorship in (2+1)-dimensional rotating shell collapse

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mann, Robert B.; Oh, John J.; Park, Mu-In

2009-03-15

We study the gravitational collapse problem of rotating shells in three-dimensional Einstein gravity with and without a cosmological constant. Taking the exterior and interior metrics to be those of stationary metrics with asymptotically constant curvature, we solve the equations of motion for the shells from the Darmois-Israel junction conditions in the corotating frame. We study various collapse scenarios with arbitrary angular momentum for a variety of geometric configurations, including anti-de Sitter, de Sitter, and flat spaces. We find that the collapsing shells can form a BTZ black hole, a three-dimensional Kerr-dS spacetime, and an horizonless geometry of point masses undermore » certain initial conditions. For pressureless dust shells, the curvature singularity is not formed due to the angular momentum barrier near the origin. However when the shell pressure is nonvanishing, we find that for all types of shells with polytropic-type equations of state (including the perfect fluid and the generalized Chaplygin gas), collapse to a naked singularity is possible under generic initial conditions. We conclude that in three dimensions angular momentum does not in general guard against violation of cosmic censorship.« less

Visual and Non-Visual Contributions to the Perception of Object Motion during Self-Motion

PubMed Central

Fajen, Brett R.; Matthis, Jonathan S.

2013-01-01

Many locomotor tasks involve interactions with moving objects. When observer (i.e., self-)motion is accompanied by object motion, the optic flow field includes a component due to self-motion and a component due to object motion. For moving observers to perceive the movement of other objects relative to the stationary environment, the visual system could recover the object-motion component – that is, it could factor out the influence of self-motion. In principle, this could be achieved using visual self-motion information, non-visual self-motion information, or a combination of both. In this study, we report evidence that visual information about the speed (Experiment 1) and direction (Experiment 2) of self-motion plays a role in recovering the object-motion component even when non-visual self-motion information is also available. However, the magnitude of the effect was less than one would expect if subjects relied entirely on visual self-motion information. Taken together with previous studies, we conclude that when self-motion is real and actively generated, both visual and non-visual self-motion information contribute to the perception of object motion. We also consider the possible role of this process in visually guided interception and avoidance of moving objects. PMID:23408983

Formulation and Validation of an Efficient Computational Model for a Dilute, Settling Suspension Undergoing Rotational Mixing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sprague, Michael A.; Stickel, Jonathan J.; Sitaraman, Hariswaran

Designing processing equipment for the mixing of settling suspensions is a challenging problem. Achieving low-cost mixing is especially difficult for the application of slowly reacting suspended solids because the cost of impeller power consumption becomes quite high due to the long reaction times (batch mode) or due to large-volume reactors (continuous mode). Further, the usual scale-up metrics for mixing, e.g., constant tip speed and constant power per volume, do not apply well for mixing of suspensions. As an alternative, computational fluid dynamics (CFD) can be useful for analyzing mixing at multiple scales and determining appropriate mixer designs and operating parameters.more » We developed a mixture model to describe the hydrodynamics of a settling cellulose suspension. The suspension motion is represented as a single velocity field in a computationally efficient Eulerian framework. The solids are represented by a scalar volume-fraction field that undergoes transport due to particle diffusion, settling, fluid advection, and shear stress. A settling model and a viscosity model, both functions of volume fraction, were selected to fit experimental settling and viscosity data, respectively. Simulations were performed with the open-source Nek5000 CFD program, which is based on the high-order spectral-finite-element method. Simulations were performed for the cellulose suspension undergoing mixing in a laboratory-scale vane mixer. The settled-bed heights predicted by the simulations were in semi-quantitative agreement with experimental observations. Further, the simulation results were in quantitative agreement with experimentally obtained torque and mixing-rate data, including a characteristic torque bifurcation. In future work, we plan to couple this CFD model with a reaction-kinetics model for the enzymatic digestion of cellulose, allowing us to predict enzymatic digestion performance for various mixing intensities and novel reactor designs.« less

Dynamics and control of tethered antennas/reflectors in orbit

NASA Astrophysics Data System (ADS)

Liu, Liangdong; Bainum, Peter M.

The system linear equations for the motion of a tethered shallow spherical shell in orbit with its symmetry axis nominally following the local vertical are developed. The shell roll, yaw, tether out-of-plane swing motion and elastic vibrations are decoupled from the shell and tether in-plane pitch motions and elastic vibrations. The neutral gravity stability conditions for the special case of a constant length rigid tether are given for in-plane motion and out-of-plant motion. It is proved that the in-plane motion of the system could be asymptotically stable based on Rupp's tension control law, for a variable length tether. However, the system simulation results indicate that the transient responses can be improved significantly, especially for the damping of the tether and shell pitch motion, by an optimal feedback control law for the rigid variable length tether model. It is also seen that the system could be unstable when the effect of tether flexibility is included if the control gains are not chosen carefully. The transient responses for three different tension control laws are compared during typical station keeping operations.

Visual search for motion-form conjunctions: is form discriminated within the motion system?

PubMed

von Mühlenen, A; Müller, H J

2001-06-01

Motion-form conjunction search can be more efficient when the target is moving (a moving 45 degrees tilted line among moving vertical and stationary 45 degrees tilted lines) rather than stationary. This asymmetry may be due to aspects of form being discriminated within a motion system representing only moving items, whereas discrimination of stationary items relies on a static form system (J. Driver & P. McLeod, 1992). Alternatively, it may be due to search exploiting differential motion velocity and direction signals generated by the moving-target and distractor lines. To decide between these alternatives, 4 experiments systematically varied the motion-signal information conveyed by the moving target and distractors while keeping their form difference salient. Moving-target search was found to be facilitated only when differential motion-signal information was available. Thus, there is no need to assume that form is discriminated within the motion system.

G-Jitter Induced Magnetohydrodynamics Flow of Nanofluid with Constant Convective Thermal and Solutal Boundary Conditions

PubMed Central

Uddin, Mohammed J.; Khan, Waqar A.; Ismail, Ahmad Izani Md.

2015-01-01

Taking into account the effect of constant convective thermal and mass boundary conditions, we present numerical solution of the 2-D laminar g-jitter mixed convective boundary layer flow of water-based nanofluids. The governing transport equations are converted into non-similar equations using suitable transformations, before being solved numerically by an implicit finite difference method with quasi-linearization technique. The skin friction decreases with time, buoyancy ratio, and thermophoresis parameters while it increases with frequency, mixed convection and Brownian motion parameters. Heat transfer rate decreases with time, Brownian motion, thermophoresis and diffusion-convection parameters while it increases with the Reynolds number, frequency, mixed convection, buoyancy ratio and conduction-convection parameters. Mass transfer rate decreases with time, frequency, thermophoresis, conduction-convection parameters while it increases with mixed convection, buoyancy ratio, diffusion-convection and Brownian motion parameters. To the best of our knowledge, this is the first paper on this topic and hence the results are new. We believe that the results will be useful in designing and operating thermal fluids systems for space materials processing. Special cases of the results have been compared with published results and an excellent agreement is found. PMID:25933066

Decomposition technique and optimal trajectories for the aeroassisted flight experiment

NASA Technical Reports Server (NTRS)

Miele, A.; Wang, T.; Deaton, A. W.

1990-01-01

An actual geosynchronous Earth orbit-to-low Earth orbit (GEO-to-LEO) transfer is considered with reference to the aeroassisted flight experiment (AFE) spacecraft, and optimal trajectories are determined by minimizing the total characteristic velocity. The optimization is performed with respect to the time history of the controls (angle of attack and angle of bank), the entry path inclination and the flight time being free. Two transfer maneuvers are considered: direct ascent (DA) to LEO and indirect ascent (IA) to LEO via parking Earth orbit (PEO). By taking into account certain assumptions, the complete system can be decoupled into two subsystems: one describing the longitudinal motion and one describing the lateral motion. The angle of attack history, the entry path inclination, and the flight time are determined via the longitudinal motion subsystem. In this subsystem, the difference between the instantaneous bank angle and a constant bank angle is minimized in the least square sense subject to the specified orbital inclination requirement. Both the angles of attack and the angle of bank are shown to be constant. This result has considerable importance in the design of nominal trajectories to be used in the guidance of AFE and aeroassisted orbital transfer (AOT) vehicles.

Coupled large eddy simulation and discrete element model of bedload motion

NASA Astrophysics Data System (ADS)

Furbish, D.; Schmeeckle, M. W.

2011-12-01

We combine a three-dimensional large eddy simulation of turbulence to a three-dimensional discrete element model of turbulence. The large eddy simulation of the turbulent fluid is extended into the bed composed of non-moving particles by adding resistance terms to the Navier-Stokes equations in accordance with the Darcy-Forchheimer law. This allows the turbulent velocity and pressure fluctuations to penetrate the bed of discrete particles, and this addition of a porous zone results in turbulence structures above the bed that are similar to previous experimental and numerical results for hydraulically-rough beds. For example, we reproduce low-speed streaks that are less coherent than those over smooth-beds due to the episodic outflow of fluid from the bed. Local resistance terms are also added to the Navier-Stokes equations to account for the drag of individual moving particles. The interaction of the spherical particles utilizes a standard DEM soft-sphere Hertz model. We use only a simple drag model to calculate the fluid forces on the particles. The model reproduces an exponential distribution of bedload particle velocities that we have found experimentally using high-speed video of a flat bed of moving sand in a recirculating water flume. The exponential distribution of velocity results from the motion of many particles that are nearly constantly in contact with other bed particles and come to rest after short distances, in combination with a relatively few particles that are entrained further above the bed and have velocities approaching that of the fluid. Entrainment and motion "hot spots" are evident that are not perfectly correlated with the local, instantaneous fluid velocity. Zones of the bed that have recently experienced motion are more susceptible to motion because of the local configuration of particle contacts. The paradigm of a characteristic saltation hop length in riverine bedload transport has infused many aspects of geomorphic thought, including even bedrock erosion. In light of our theoretical, experimental, and numerical findings supporting the exponential distribution of bedload particle motion, the idea of a characteristic saltation hop should be scrapped or substantially modified.

SU-E-J-12: An Image-Guided Soft Robotic Patient Positioning System for Maskless Head-And-Neck Cancer Radiotherapy: A Proof-Of-Concept Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ogunmolu, O; Gans, N; Jiang, S

Purpose: We propose a surface-image-guided soft robotic patient positioning system for maskless head-and-neck radiotherapy. The ultimate goal of this project is to utilize a soft robot to realize non-rigid patient positioning and real-time motion compensation. In this proof-of-concept study, we design a position-based visual servoing control system for an air-bladder-based soft robot and investigate its performance in controlling the flexion/extension cranial motion on a mannequin head phantom. Methods: The current system consists of Microsoft Kinect depth camera, an inflatable air bladder (IAB), pressured air source, pneumatic valve actuators, custom-built current regulators, and a National Instruments myRIO microcontroller. The performance ofmore » the designed system was evaluated on a mannequin head, with a ball joint fixed below its neck to simulate torso-induced head motion along flexion/extension direction. The IAB is placed beneath the mannequin head. The Kinect camera captures images of the mannequin head, extracts the face, and measures the position of the head relative to the camera. This distance is sent to the myRIO, which runs control algorithms and sends actuation commands to the valves, inflating and deflating the IAB to induce head motion. Results: For a step input, i.e. regulation of the head to a constant displacement, the maximum error was a 6% overshoot, which the system then reduces to 0% steady-state error. In this initial investigation, the settling time to reach the regulated position was approximately 8 seconds, with 2 seconds of delay between the command start of motion due to capacitance of the pneumatics, for a total of 10 seconds to regulate the error. Conclusion: The surface image-guided soft robotic patient positioning system can achieve accurate mannequin head flexion/extension motion. Given this promising initial Result, the extension of the current one-dimensional soft robot control to multiple IABs for non-rigid positioning control will be pursued.« less

Coherent and Semiclassical States of a Charged Particle in a Constant Electric Field

NASA Astrophysics Data System (ADS)

Adorno, T. C.; Pereira, A. S.

2018-05-01

The method of integrals of motion is used to construct families of generalized coherent states of a nonrelativistic spinless charged particle in a constant electric field. Families of states, differing in the values of their standard deviations at the initial time, are obtained. Depending on the initial values of the standard deviations, and also on the electric field, it turns out to be possible to identify some families with semiclassical states.

Robotic Compliant Motion Control for Aircraft Refueling Applications

DTIC Science & Technology

1988-12-01

J. DUVALL 29 SEP 88 C-26 SUBROUTINE IMPCONST(CONST,MINV, BMAT ) Abstract: This subroutine calculates the 25 constants used by the Fortran subroutine...mass with center of gravity along the joint 6 axis. The desired mass and the damping ( BMAT ) matrices are assumed to be diagonal. Joints angles 4,5...constants. MINV -- A 2x2 matrix containing the elements of the inverse desired mass matrix (diagonal). BMAT -- A 2x2 matrix of damping coefficents (diagonal

Microscopic Interpretation and Generalization of the Bloch-Torrey Equation for Diffusion Magnetic Resonance

PubMed Central

Seroussi, Inbar; Grebenkov, Denis S.; Pasternak, Ofer; Sochen, Nir

2017-01-01

In order to bridge microscopic molecular motion with macroscopic diffusion MR signal in complex structures, we propose a general stochastic model for molecular motion in a magnetic field. The Fokker-Planck equation of this model governs the probability density function describing the diffusion-magnetization propagator. From the propagator we derive a generalized version of the Bloch-Torrey equation and the relation to the random phase approach. This derivation does not require assumptions such as a spatially constant diffusion coefficient, or ad-hoc selection of a propagator. In particular, the boundary conditions that implicitly incorporate the microstructure into the diffusion MR signal can now be included explicitly through a spatially varying diffusion coefficient. While our generalization is reduced to the conventional Bloch-Torrey equation for piecewise constant diffusion coefficients, it also predicts scenarios in which an additional term to the equation is required to fully describe the MR signal. PMID:28242566

Cosmological abundance of the QCD axion coupled to hidden photons

NASA Astrophysics Data System (ADS)

Kitajima, Naoya; Sekiguchi, Toyokazu; Takahashi, Fuminobu

2018-06-01

We study the cosmological evolution of the QCD axion coupled to hidden photons. For a moderately strong coupling, the motion of the axion field leads to an explosive production of hidden photons by tachyonic instability. We use lattice simulations to evaluate the cosmological abundance of the QCD axion. In doing so, we incorporate the backreaction of the produced hidden photons on the axion dynamics, which becomes significant in the non-linear regime. We find that the axion abundance is suppressed by at most O (102) for the decay constant fa =1016GeV, compared to the case without the coupling. For a sufficiently large coupling, the motion of the QCD axion becomes strongly damped, and as a result, the axion abundance is enhanced. Our results show that the cosmological upper bound on the axion decay constant can be relaxed by a few hundred for a certain range of the coupling to hidden photons.

Force effects on rotor of squeeze film damper using Newtonian and non-Newtonian fluid

NASA Astrophysics Data System (ADS)

Dominik, Šedivý; Petr, Ferfecki; Simona, Fialová

2017-09-01

This article presents the evaluation of force effects on rotor of squeeze film damper. Rotor is eccentric placed and its motion is translate-circular. The amplitude of rotor motion is smaller than its initial eccentricity. The force effects are calculated from pressure and viscous forces which were gained by using computational modeling. Two types of fluid were considered as filling of damper. First type of fluid is Newtonian (has constant viscosity) and second type is magnetorheological fluid (does not have constant viscosity). Viscosity of non-Newtonian fluid is given using Bingham rheology model. Yield stress is a function of magnetic induction which is described by many variables. The most important variables of magnetic induction are electric current and gap width which is between rotor and stator. Comparison of application two given types of fluids is shown in results.

Spacetime encodings. IV. The relationship between Weyl curvature and Killing tensors in stationary axisymmetric vacuum spacetimes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brink, Jeandrew

The problem of obtaining an explicit representation for the fourth invariant of geodesic motion (generalized Carter constant) of an arbitrary stationary axisymmetric vacuum spacetime generated from an Ernst potential is considered. The coupling between the nonlocal curvature content of the spacetime as encoded in the Weyl tensor, and the existence of a Killing tensor is explored and a constructive, algebraic test for a fourth-order Killing tensor suggested. The approach used exploits the variables defined for the Baecklund transformations to clarify the relationship between Weyl curvature, constants of geodesic motion, expressed as Killing tensors, and the solution-generation techniques. A new symmetricmore » noncovariant formulation of the Killing equations is given. This formulation transforms the problem of looking for fourth-order Killing tensors in 4D into one of looking for four interlocking two-manifolds admitting fourth-order Killing tensors in 2D.« less

The 2013 Balochistan earthquake: An extraordinary or completely ordinary event?

NASA Astrophysics Data System (ADS)

Zhou, Yu; Elliott, John R.; Parsons, Barry; Walker, Richard T.

2015-08-01

The 2013 Balochistan earthquake, a predominantly strike-slip event, occurred on the arcuate Hoshab fault in the eastern Makran linking an area of mainly left-lateral shear in the east to one of shortening in the west. The difficulty of reconciling predominantly strike-slip motion with this shortening has led to a wide range of unconventional kinematic and dynamic models. Here we determine the vertical component of motion on the fault using a 1 m resolution elevation model derived from postearthquake Pleiades satellite imagery. We find a constant local ratio of vertical to horizontal slip through multiple past earthquakes, suggesting the kinematic style of the Hoshab fault has remained constant throughout the late Quaternary. We also find evidence for active faulting on a series of nearby, subparallel faults, showing that failure in large, distributed and rare earthquakes is the likely method of faulting across the eastern Makran, reconciling geodetic and long-term records of strain accumulation.

Generalised Eisenhart lift of the Toda chain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cariglia, Marco, E-mail: marco@iceb.ufop.br; Gibbons, Gary, E-mail: g.w.gibbons@damtp.cam.ac.uk

The Toda chain of nearest neighbour interacting particles on a line can be described both in terms of geodesic motion on a manifold with one extra dimension, the Eisenhart lift, or in terms of geodesic motion in a symmetric space with several extra dimensions. We examine the relationship between these two realisations and discover that the symmetric space is a generalised, multi-particle Eisenhart lift of the original problem that reduces to the standard Eisenhart lift. Such generalised Eisenhart lift acts as an inverse Kaluza-Klein reduction, promoting coupling constants to momenta in higher dimension. In particular, isometries of the generalised liftmore » metric correspond to energy preserving transformations that mix coordinates and coupling constants. A by-product of the analysis is that the lift of the Toda Lax pair can be used to construct higher rank Killing tensors for both the standard and generalised lift metrics.« less

Motion of kinesin in a viscoelastic medium

NASA Astrophysics Data System (ADS)

Knoops, Gert; Vanderzande, Carlo

2018-05-01

Kinesin is a molecular motor that transports cargo along microtubules. The results of many in vitro experiments on kinesin-1 are described by kinetic models in which one transition corresponds to the forward motion and subsequent binding of the tethered motor head. We argue that in a viscoelastic medium like the cytosol of a cell this step is not Markov and has to be described by a nonexponential waiting time distribution. We introduce a semi-Markov kinetic model for kinesin that takes this effect into account. We calculate, for arbitrary waiting time distributions, the moment generating function of the number of steps made, and determine from this the average velocity and the diffusion constant of the motor. We illustrate our results for the case of a waiting time distribution that is Weibull. We find that for realistic parameter values, viscoelasticity decreases the velocity and the diffusion constant, but increases the randomness (or Fano factor).

On periodic solutions of an Atwood's pendulum

NASA Astrophysics Data System (ADS)

Mittleman, Donald

1987-05-01

An Atwood's pendulum is defined as an Atwood's machine in which one of two masses is allowed to swing as a pendulum while the other remains constrained to move only in the vertical direction. The pendulum motion of the one mass induces a varying tension in the connecting wire; this, in turn, produces motion in the second mass. It is shown that this motion can be made periodic if the ratio of the two masses and the dependency of this ratio on the initial conditions are chosen as prescribed in this report. If this condition is not met, the motion consists of the superposition of two motions. The first is motion in a constant gravitational field where the effective gravity is kg; the factor k is determined explicitly. The second is the periodic motion that is the central theme of this report. During the course of the analysis, the fundamental frequency of the periodic motion is determined. It is shown to be slightly higher than the frequency of a pendulum of comparable length swinging in the Earth's gravitational field; the factor is given explicitly. This work is restricted to the extent that small approximations are introduced initially for trigonometric functions.

Superimposed Code Theoretic Analysis of Deoxyribonucleic Acid (DNA) Codes and DNA Computing

DTIC Science & Technology

2010-01-01

partitioned by font type) of sequences are allowed to be in each position (e.g., Arial = position 0, Comic = position 1, etc. ) and within each collection...movement was modeled by a Brownian motion 3 dimensional random walk. The one dimensional diffusion coefficient D for the ellipsoid shape with 3...temperature, kB is Boltzmann’s constant, and η is the viscosity of the medium. The random walk motion is modeled by assuming the oligo is on a three

The Effects of Towfish Motion on Sidescan Sonar Images: Extension to a Multiple-Beam Device

DTIC Science & Technology

1994-02-01

simulation, the raw simulated sidescan image is formed from pixels G , which are the sum of energies E,", assigned to the nearest range- bin k as noted in...for stable motion at constant velocity V0, are applied to (divided into) the G ,, and the simulated sidescan image is ready to display. Maximal energy...limitation is likely to apply to all multiple-beam sonais of similar construction. The yaw correction was incorporated in the MBEAM model by an

A user-driven treadmill control scheme for simulating overground locomotion.

PubMed

Kim, Jonghyun; Stanley, Christopher J; Curatalo, Lindsey A; Park, Hyung-Soon

2012-01-01

Treadmill-based locomotor training should simulate overground walking as closely as possible for optimal skill transfer. The constant speed of a standard treadmill encourages automaticity rather than engagement and fails to simulate the variable speeds encountered during real-world walking. To address this limitation, this paper proposes a user-driven treadmill velocity control scheme that allows the user to experience natural fluctuations in walking velocity with minimal unwanted inertial force due to acceleration/deceleration of the treadmill belt. A smart estimation limiter in the scheme effectively attenuates the inertial force during velocity changes. The proposed scheme requires measurement of pelvic and swing foot motions, and is developed for a treadmill of typical belt length (1.5 m). The proposed scheme is quantitatively evaluated here with four healthy subjects by comparing it with the most advanced control scheme identified in the literature.

Macroscopic model of scanning force microscope

DOEpatents

Guerra-Vela, Claudio; Zypman, Fredy R.

2004-10-05

A macroscopic version of the Scanning Force Microscope is described. It consists of a cantilever under the influence of external forces, which mimic the tip-sample interactions. The use of this piece of equipment is threefold. First, it serves as direct way to understand the parts and functions of the Scanning Force Microscope, and thus it is effectively used as an instructional tool. Second, due to its large size, it allows for simple measurements of applied forces and parameters that define the state of motion of the system. This information, in turn, serves to compare the interaction forces with the reconstructed ones, which cannot be done directly with the standard microscopic set up. Third, it provides a kinematics method to non-destructively measure elastic constants of materials, such as Young's and shear modules, with special application for brittle materials.

Deceleration of free aqueous droplets skirting across the surface of a pool of the same fluid

NASA Astrophysics Data System (ADS)

Hale, Jacob; Akers, Caleb

2014-11-01

The non-coalescence of a free droplet atop a pool of the same fluid can be greatly enhanced when the drop has an initial horizontal velocity relative to the pool surface. The glancing impact and viscous interaction between the droplet and the pool impart a significant rotation to the droplet causing it to roll and thus entraining air between the two fluids. The translational speed of such a droplet is shown to decrease exponentially in time but with a time constant that increases linearly in time. This complex deceleration of the drop is in part due to the drop's rotational deceleration, visualized with suspended, neutrally buoyant microbeads. The observed motion is described in terms of viscous dissipation of the rotating drop and a viscous shear force between the droplet and bath.

Berry phases for Landau Hamiltonians on deformed tori

NASA Astrophysics Data System (ADS)

Lévay, Péter

1995-06-01

Parametrized families of Landau Hamiltonians are introduced, where the parameter space is the Teichmüller space (topologically the complex upper half plane) corresponding to deformations of tori. The underlying SO(2,1) symmetry of the families enables an explicit calculation of the Berry phases picked up by the eigenstates when the torus is slowly deformed. It is also shown that apart from these phases that are local in origin, there are global non-Abelian ones too, related to the hidden discrete symmetry group Γϑ (the theta group, which is a subgroup of the modular group) of the families. The induced Riemannian structure on the parameter space is the usual Poincare metric on the upper half plane of constant negative curvature. Due to the discrete symmetry Γϑ the geodesic motion restricted to the fundamental domain of this group is chaotic.

First-principles analysis of anharmonic nuclear motion and thermal transport in thermoelectric materials

NASA Astrophysics Data System (ADS)

Tadano, Terumasa; Tsuneyuki, Shinji

2015-12-01

We show a first-principles approach for analyzing anharmonic properties of lattice vibrations in solids. We firstly extract harmonic and anharmonic force constants from accurate first-principles calculations based on the density functional theory. Using the many-body perturbation theory of phonons, we then estimate the phonon scattering probability due to anharmonic phonon-phonon interactions. We show the validity of the approach by computing the lattice thermal conductivity of Si, a typical covalent semiconductor, and selected thermoelectric materials PbTe and Bi2Te3 based on the Boltzmann transport equation. We also show that the phonon lifetime and the lattice thermal conductivity of the high-temperature phase of SrTiO3 can be estimated by employing the perturbation theory on top of the solution of the self-consistent phonon equation.

Three-body interactions and the elastic constants of hcp solid 4He

NASA Astrophysics Data System (ADS)

Barnes, Ashleigh L.; Hinde, Robert J.

2017-09-01

The effect of three-body interactions on the elastic properties of hexagonal close packed solid 4He is investigated using variational path integral (VPI) Monte Carlo simulations. The solid's nonzero elastic constants are calculated, at T = 0 K and for a range of molar volumes from 7.88 cm3/mol to 20.78 cm3/mol, from the bulk modulus and the three pure shear constants C0, C66, and C44. Three-body interactions are accounted for using our recently reported perturbative treatment based on the nonadditive three-body potential of Cencek et al. Previous studies have attempted to account for the effect of three-body interactions on the elastic properties of solid 4He; however, these calculations have treated zero point motions using either the Einstein or Debye approximations, which are insufficient in the molar volume range where solid 4He is characterized as a quantum solid. Our VPI calculations allow for a more accurate treatment of the zero point motions which include atomic correlation. From these calculations, we find that agreement with the experimental bulk modulus is significantly improved when three-body interactions are considered. In addition, three-body interactions result in non-negligible differences in the calculated pure shear constants and nonzero elastic constants, particularly at higher densities, where differences of up to 26.5% are observed when three-body interactions are included. We compare to the available experimental data and find that our results are generally in as good or better agreement with experiment as previous theoretical investigations.

Uniform function constants of motion and their first-order perturbation

NASA Astrophysics Data System (ADS)

Prato, Domingo; Hamity, Victor H.

2005-05-01

The main purpose of this work is to present some uniform function constants of motion rather than the well-known quantities arising from spacetime symmetries. These constants are usually associated with the intrinsic characteristics of the trajectories of a particle in a central potential field. We treat two cases. The first is the Lenz vector which sometimes is found in the literature [1, 2]; the other is associated with the isotropic harmonic oscillator, of relative importance in some simple models of the classical molecular interaction. The first example is applied to describe the perturbation of the trajectories in the Rutherford scattering and the precession of the Keplerian orbit of a planet. In the other case the conserved quantity is a symmetric tensor. We find the eigenvectors and eigenvalues of that tensor while at the same time we obtain the solution to the problem of calculating the rotation rate of the orbits in first order of a perturbation parameter in the potential energy, by performing a simple coordinate transformation in the Cartesian plane. We think that the present work addresses many aspects of mechanics with a didactical interest in other physics or mathematics courses.

Motion of particles in solar and galactic systems by using Neumann boundary condition

NASA Astrophysics Data System (ADS)

Shenavar, Hossein

2016-12-01

A new equation of motion, which is derived previously by imposing Neumann boundary condition on cosmological perturbation equations (Shenavar in Astrophys. Space Sci., 2016a, doi: 10.1007/s10509-016-2676-5), is investigated. By studying the precession of perihelion, it is shown that the new equation of motion suggests a small, though detectable, correction in orbits of solar system objects. Then a system of particles is surveyed to have a better understanding of galactic structures. Also the general form of the force law is introduced by which the rotation curve and mass discrepancy of axisymmetric disks of stars are derived. In addition, it is suggested that the mass discrepancy as a function of centripetal acceleration becomes significant near a constant acceleration 2c1a0 where c1 is the Neumann constant and a0 = 6.59 ×10^{-10} m/s2 is a fundamental acceleration. Furthermore, it is shown that a critical surface density equal to σ0=a0/G, in which G is the Newton gravitational constant, has a significant role in rotation curve and mass discrepancy plots. Also, the specific form of NFW mass density profile at small radii, ρ∝1/r, is explained too. Finally, the present model will be tested by using a sample of 39 LSB galaxies for which we will show that the rotation curve fittings are generally acceptable. The derived mass to light ratios too are found within the plausible bound except for the galaxy F571-8.

The adequate stimulus for mammalian linear vestibular evoked potentials (VsEPs)

PubMed Central

Jones, Timothy A.; Jones, Sherri M.; Vijayakumar, Sarath; Brugeaud, Aurore; Bothwell, Marcella; Chabbert, Christian

2013-01-01

Short latency linear vestibular sensory evoked potentials (VsEPs) provide a means to objectively and directly assess the function of gravity receptors in mammals and birds. The importance of this functional measure is illustrated by its use in studies of the genetic basis of vestibular function and disease. Head motion is the stimulus for the VsEP. In the bird, it has been established that neurons mediating the linear VsEP respond collectively to the rate of change in linear acceleration during head movement (i.e. jerk) rather than peak acceleration. The kinematic element of motion responsible for triggering mammalian VsEPs has not been characterized in detail. Here we tested the hypothesis that jerk is the kinematic component of head motion responsible for VsEP characteristics. VsEP amplitudes and latencies changed systematically when peak acceleration level was held constant and jerk level was varied from ~0.9 to 4.6 g/ms. In contrast, responses remained relatively constant when kinematic jerk was held constant and peak acceleration was varied from ~0.9 to 5.5g in mice and ~0.44 to 2.75g in rats. Thus the mammalian VsEP depends on jerk levels and not peak acceleration. We conclude that kinematic jerk is the adequate stimulus for the mammalian VsEP. This sheds light on the behavior of neurons generating the response. The results also provide the basis for standardizing the reporting of stimulus levels, which is key to ensuring that response characteristics reported in the literature by many laboratories can be effectively compared and interpreted. PMID:21664446

Examples of Complete Solvability of 2D Classical Superintegrable Systems

NASA Astrophysics Data System (ADS)

Chen, Yuxuan; Kalnins, Ernie G.; Li, Qiushi; Miller, Willard, Jr.

2015-11-01

Classical (maximal) superintegrable systems in n dimensions are Hamiltonian systems with 2n-1 independent constants of the motion, globally defined, the maximum number possible. They are very special because they can be solved algebraically. In this paper we show explicitly, mostly through examples of 2nd order superintegrable systems in 2 dimensions, how the trajectories can be determined in detail using rather elementary algebraic, geometric and analytic methods applied to the closed quadratic algebra of symmetries of the system, without resorting to separation of variables techniques or trying to integrate Hamilton's equations. We treat a family of 2nd order degenerate systems: oscillator analogies on Darboux, nonzero constant curvature, and flat spaces, related to one another via contractions, and obeying Kepler's laws. Then we treat two 2nd order nondegenerate systems, an analogy of a caged Coulomb problem on the 2-sphere and its contraction to a Euclidean space caged Coulomb problem. In all cases the symmetry algebra structure provides detailed information about the trajectories, some of which are rather complicated. An interesting example is the occurrence of ''metronome orbits'', trajectories confined to an arc rather than a loop, which are indicated clearly from the structure equations but might be overlooked using more traditional methods. We also treat the Post-Winternitz system, an example of a classical 4th order superintegrable system that cannot be solved using separation of variables. Finally we treat a superintegrable system, related to the addition theorem for elliptic functions, whose constants of the motion are only rational in the momenta. It is a system of special interest because its constants of the motion generate a closed polynomial algebra. This paper contains many new results but we have tried to present most of the materials in a fashion that is easily accessible to nonexperts, in order to provide entrée to superintegrablity theory.

DSN 70-meter antenna X-band gain, phase, and pointing performance, with particular application for Voyager 2 Neptune encounter

NASA Technical Reports Server (NTRS)

Slobin, S. D.; Bathker, D. A.

1988-01-01

The gain, phase, and pointing performance of the Deep Space Network (DSN) 70 m antennas are investigated using theoretical antenna analysis computer programs that consider the gravity induced deformation of the antenna surface and quadripod structure. The microwave effects are calculated for normal subreflector focusing motion and for special fixed-subreflector conditions that may be used during the Voyager 2 Neptune encounter. The frequency stability effects of stepwise lateral and axial subreflector motions are also described. Comparisons with recently measured antenna efficiency and subreflector motion tests are presented. A modification to the existing 70 m antenna pointing squint correction constant is proposed.

The Limiting Velocity in Falling from a Great Height

NASA Technical Reports Server (NTRS)

Wilson, Edwin Bidwell

1919-01-01

The purpose of this report is to give a simple treatment of the problem of calculating the final or limiting velocity of an object falling in vertical motion under gravity in a resisting medium. The equations of motion are easily set up and integrated when the density of the medium is constant and the resistance varies as the square of the velocity. The results show that the fundamental characteristics of the vertical motion under gravity in a resisting medium is the approach to a terminal or limiting velocity, whether the initial downward velocity is less or greater than the limiting velocity. This method can be used to calculate the terminal velocity of a bomb trajectory.

A two-dimensional solution of the FW-H equation for rectilinear motion of sources

NASA Astrophysics Data System (ADS)

Bozorgi, Alireza; Siozos-Rousoulis, Leonidas; Nourbakhsh, Seyyed Ahmad; Ghorbaniasl, Ghader

2017-02-01

In this paper, a subsonic solution of the two-dimensional Ffowcs Williams and Hawkings (FW-H) equation is presented for calculation of noise generated by sources moving with constant velocity in a medium at rest or in a moving medium. The solution is represented in the frequency domain and is valid for observers located far from the noise sources. In order to verify the validity of the derived formula, three test cases are considered, namely a monopole, a dipole, and a quadrupole source in a medium at rest or in motion. The calculated results well coincide with the analytical solutions, validating the applicability of the formula to rectilinear subsonic motion problems.

Heavy enzymes--experimental and computational insights in enzyme dynamics.

PubMed

Swiderek, Katarzyna; Ruiz-Pernía, J Javier; Moliner, Vicent; Tuñón, Iñaki

2014-08-01

The role of protein motions in the chemical step of enzyme-catalyzed reactions is the subject of an open debate in the scientific literature. The systematic use of isotopically substituted enzymes has been revealed as a useful tool to quantify the role of these motions. According to the Born-Oppenheimer approximation, changing the mass of the protein does not change the forces acting on the system but alters the frequencies of the protein motions, which in turn can affect the rate constant. Experimental and theoretical studies carried out in this field are presented in this article and discussed in the framework of Transition State Theory. Copyright © 2014 Elsevier Ltd. All rights reserved.

Driving chiral domain walls in antiferromagnets using rotating magnetic fields

NASA Astrophysics Data System (ADS)

Pan, Keming; Xing, Lingdi; Yuan, H. Y.; Wang, Weiwei

2018-05-01

We show theoretically and numerically that an antiferromagnetic domain wall can be moved by a rotating magnetic field in the presence of Dzyaloshinskii-Moriya interaction (DMI). Two motion modes are found: rigid domain wall motion at low frequency (corresponding to the perfect frequency synchronization) and the oscillating motion at high frequency. In the full synchronized region, the steady velocity of the domain wall is universal, in the sense that it depends only on the frequency of the rotating field and the ratio between DMI strength and exchange constant. The domain wall velocity is independent of the Gilbert damping and the rotating field strength. Moreover, a rotating field in megahertz is sufficient to move the antiferromagnetic domain wall.

Simple Harmonics Motion experiment based on LabVIEW interface for Arduino

NASA Astrophysics Data System (ADS)

Tong-on, Anusorn; Saphet, Parinya; Thepnurat, Meechai

2017-09-01

In this work, we developed an affordable modern innovative physics lab apparatus. The ultrasonic sensor is used to measure the position of a mass attached on a spring as a function of time. The data acquisition system and control device were developed based on LabVIEW interface for Arduino UNO R3. The experiment was designed to explain wave propagation which is modeled by simple harmonic motion. The simple harmonic system (mass and spring) was observed and the motion can be realized using curve fitting to the wave equation in Mathematica. We found that the spring constants provided by Hooke’s law and the wave equation fit are 9.9402 and 9.1706 N/m, respectively.

Dynamics of two-dimensional monolayer water confined in hydrophobic and charged environments.

PubMed

Kumar, Pradeep; Han, Sungho

2012-09-21

We perform molecular dynamics simulations to study the effect of charged surfaces on the intermediate and long time dynamics of water in nanoconfinements. Here, we use the transferable interaction potential with five points (TIP5P) model of a water molecule confined in both hydrophobic and charged surfaces. For a single molecular layer of water between the surfaces, we find that the temperature dependence of the lateral diffusion constant of water up to very high temperatures remains Arrhenius with a high activation energy. In case of charged surfaces, however, the dynamics of water in the intermediate time regime is drastically modified presumably due to the transient coupling of dipoles of water molecules with electric field fluctuations induced by charges on the confining surfaces. Specifically, the lateral mean square displacements display a distinct super-diffusive behavior at intermediate time scale, defined as the time scale between ballistic and diffusive regimes. This change in the intermediate time-scale dynamics in the charged confinement leads to the enhancement of long-time dynamics as reflected in increasing diffusion constant. We introduce a simple model for a possible explanation of the super-diffusive behavior and find it to be in good agreement with our simulation results. Furthermore, we find that confinement and the surface polarity enhance the low frequency vibration in confinement compared to bulk water. By introducing a new effective length scale of coupling between translational and orientational motions, we find that the length scale increases with the increasing strength of the surface polarity. Further, we calculate the correlation between the diffusion constant and the excess entropy and find a disordering effect of polar surfaces on the structure of water. Finally, we find that the empirical relation between the diffusion constant and the excess entropy holds for a monolayer of water in nanoconfinement.

The effective intensity of Coriolis, cross-coupling stimulation is gravitoinertial force dependent - Implications for space motion sickness

NASA Technical Reports Server (NTRS)

Lackner, J. R.; Graybiel, A.

1986-01-01

The effect of gravity on the severity of the Coriolis-induced motion sickness was investigated in ten individuals subjected to high and low G-force phases of parabolic flight maneuvers using constant level Coriolis, cross-coupled angular acceleration stimulation. Using seven levels of severity in the diagnosis of motion sickness, it was found that the subjects were less susceptible at 0 G than at +2 Gz, and that the perceived intensity and provocativeness of Coriolis stimulation decreased in 0 G and increased in +2 Gz relative to the +1 Gz baseline values. The changes in the apparent intensity of Coriolis stimulation occur virtually immediately when the background gravitatioinertial force level is varied. These findings explain why the Skylab astronauts were refractory to motion sickness during Coriolis stimulation in-flight.

Biomedical applications of a commercial capacitance transducer.

DOT National Transportation Integrated Search

1968-03-01

A capacitive displacement transducer with a linear response and constant sensitivity for a frequency range of 0-1,000 Hz is described. Its application to measurement of chest wall motions was verified using static displacements from flat and curved s...

Elastic constants of hcp 4He: Path-integral Monte Carlo results versus experiment

NASA Astrophysics Data System (ADS)

Ardila, Luis Aldemar Peña; Vitiello, Silvio A.; de Koning, Maurice

2011-09-01

The elastic constants of hcp 4He are computed using the path-integral Monte Carlo (PIMC) method. The stiffness coefficients are obtained by imposing different distortions to a periodic cell containing 180 atoms, followed by measurement of the elements of the corresponding stress tensor. For this purpose an appropriate path-integral expression for the stress tensor observable is derived and implemented into the pimc++ package. In addition to allowing the determination of the elastic stiffness constants, this development also opens the way to an explicit atomistic determination of the Peierls stress for dislocation motion using the PIMC technique. A comparison of the results to available experimental data shows an overall good agreement of the density dependence of the elastic constants, with the single exception of C13. Additional calculations for the bcc phase, on the other hand, show good agreement for all elastic constants.

Method and Apparatus for the Portable Identification of Material Thickness and Defects Using Spatially Controlled Heat Application

NASA Technical Reports Server (NTRS)

Cramer, K. Elliott (Inventor); Winfree, William P. (Inventor)

1999-01-01

A method and a portable apparatus for the nondestructive identification of defects in structures. The apparatus comprises a heat source and a thermal imager that move at a constant speed past a test surface of a structure. The thermal imager is off set at a predetermined distance from the heat source. The heat source induces a constant surface temperature. The imager follows the heat source and produces a video image of the thermal characteristics of the test surface. Material defects produce deviations from the constant surface temperature that move at the inverse of the constant speed. Thermal noise produces deviations that move at random speed. Computer averaging of the digitized thermal image data with respect to the constant speed minimizes noise and improves the signal of valid defects. The motion of thermographic equipment coupled with the high signal to noise ratio render it suitable for portable, on site analysis.

Exposure to a Rotating Virtual Environment During Treadmill Locomotion Causes Adaptation in Heading Direction

NASA Technical Reports Server (NTRS)

Ruttley, T; Marshburn, A.; Bloomberg, J. J.; Mulavara, A. P.; Richards, J. T.; Nomura, Y.

2005-01-01

The goal of the present study was to investigate the adaptive effects of variation in the direction of optic flow, experienced during linear treadmill walking, on modifying locomotor trajectory. Subjects (n = 30) walked on a motorized linear treadmill at 4.0 kilometers per hour for 24 minutes while viewing the interior of a 3D virtual scene projected onto a screen 1.5 in in front of them. The virtual scene depicted constant self-motion equivalent to either 1) walking around the perimeter of a room to one s left (Rotating Room group) 2) walking down the center of a hallway (Infinite Hallway group). The scene was static for the first 4 minutes, and then constant rate self-motion was simulated for the remaining 20 minutes. Before and after the treadmill locomotion adaptation period, subjects performed five stepping trials where in each trial they marched in place to the beat of a metronome at 90 steps/min while blindfolded in a quiet room. The subject's final heading direction (deg), final X (for-aft, cm) and final Y (medio-lateral, cm) positions were measured for each trial. During the treadmill locomotion adaptation period subject's 3D torso position was measured. We found that subjects in the Rotating Room group as compared to the Infinite Hallway group: 1) showed significantly greater deviation during post exposure testing in the heading direction and Y position opposite to the direction of optic flow experienced during treadmill walking 2) showed a significant monotonically increasing torso yaw angular rotation bias in the direction of optic flow during the treadmill adaptation exposure period. Subjects in both groups showed greater forward translation (in the +X direction) during the post treadmill stepping task that differed significantly from their pre exposure performance. Subjects in both groups reported no perceptual deviation in position during the stepping tasks. We infer that viewing simulated rotary self-motion during treadmill locomotion causes adaptive modification of sensory-motor integration in the control of position and trajectory during locomotion which functionally reflects adaptive changes in the integration of visual, vestibular, and proprioceptive cues. Such an adaptation in the control of position and heading direction during locomotion due to the congruence of sensory information demonstrates the potential for adaptive transfer between sensorimotor systems and suggests a common neural site for the processing and self-motion perception and concurrent adaptation in motor output. This will result in lack of subjects perception of deviation of position and trajectory during the post treadmill step test while blind folded.

Exposure to a Rotating Virtual Environment During Treadmill Locomotion Causes Adaptation in Heading Direction

NASA Technical Reports Server (NTRS)

Mulavara, A. P.; Richards, J. T.; Marshburn, A.; Nomura, Y.; Bloomberg, J. J.

2005-01-01

The goal of the present study was to investigate the adaptive effects of variation in the direction of optic flow, experienced during linear treadmill walking, on modifying locomotor trajectory. Subjects (n = 30) walked on a motorized linear treadmill at 4.0 km/h for 24 minutes while viewing the interior of a 3D virtual scene projected onto a screen 1.5 m in front of them. The virtual scene depicted constant self-motion equivalent to either 1) walking around the perimeter of a room to one s left (Rotating Room group) 2) walking down the center of a hallway (Infinite Hallway group). The scene was static for the first 4 minutes, and then constant rate self-motion was simulated for the remaining 20 minutes. Before and after the treadmill locomotion adaptation period, subjects performed five stepping trials where in each trial they marched in place to the beat of a metronome at 90 steps/min while blindfolded in a quiet room. The subject s final heading direction (deg), final X (for-aft, cm) and final Y (medio-lateral, cm) positions were measured for each trial. During the treadmill locomotion adaptation period subject s 3D torso position was measured. We found that subjects in the Rotating Room group as compared to the Infinite Hallway group: 1) showed significantly greater deviation during post exposure testing in the heading direction and Y position opposite to the direction of optic flow experienced during treadmill walking 2) showed a significant monotonically increasing torso yaw angular rotation bias in the direction of optic flow during the treadmill adaptation exposure period. Subjects in both groups showed greater forward translation (in the +X direction) during the post treadmill stepping task that differed significantly from their pre exposure performance. Subjects in both groups reported no perceptual deviation in position during the stepping tasks. We infer that 3 viewing simulated rotary self-motion during treadmill locomotion causes adaptive modification of sensory-motor integration in the control of position and trajectory during locomotion which functionally reflects adaptive changes in the integration of visual, vestibular, and proprioceptive cues. Such an adaptation in the control of position and heading direction during locomotion due to the congruence of sensory information demonstrates the potential for adaptive transfer between sensorimotor systems and suggests a common neural site for the processing and self-motion perception and concurrent adaptation in motor output. This will result in lack of subjects perception of deviation of position and trajectory during the post treadmill step test while blind folded.

Study of anisotropy, magnetization reversal and damping in ultrathin Co films on MgO (0 0 1) substrate

NASA Astrophysics Data System (ADS)

Mallik, Srijani; Bedanta, Subhankar

2018-01-01

Ultrathin Co films of 3 nm thickness have been prepared on MgO (0 0 1) substrate in presence or absence of substrate pre-annealing. Uniaxial anisotropy is induced in the samples due to the deposition under oblique angle of incidence. Along with the oblique deposition induced anisotropy, another uniaxial anisotropy contribution has been observed due to pre-annealing. However, no cubic anisotropy has been observed here as compared to the thicker films. Angle dependent ferromagnetic resonance (FMR) measurement confirms the presence of two anisotropies in the pre-annealed sample with ∼18° misalignment with each other. The two anisotropy constants were calculated from both superconducting quantum interference device (SQUID) magnetometry and FMR spectroscopy. The magnetization reversal is governed by nucleation dominated aftereffect followed by domain wall motion for the pre-annealed sample. Branched domains are observed for the sample prepared without pre-annealing which indicates grain disorientation of Co. However, in the thicker (25 nm) Co films ripple domains were observed in contrary to ultrathin (3 nm) films.

Effects of aqueous humor hydrodynamics on human eye heat transfer under external heat sources.

PubMed

Tiang, Kor L; Ooi, Ean H

2016-08-01

The majority of the eye models developed in the late 90s and early 00s considers only heat conduction inside the eye. This assumption is not entirely correct, since the anterior and posterior chambers are filled aqueous humor (AH) that is constantly in motion due to thermally-induced buoyancy. In this paper, a three-dimensional model of the human eye is developed to investigate the effects AH hydrodynamics have on the human eye temperature under exposure to external heat sources. If the effects of AH flow are negligible, then future models can be developed without taking them into account, thus simplifying the modeling process. Two types of external thermal loads are considered; volumetric and surface irradiation. Results showed that heat convection due to AH flow contributes to nearly 95% of the total heat flow inside the anterior chamber. Moreover, the circulation inside the anterior chamber can cause an upward shift of the location of hotspot. This can have significant consequences to our understanding of heat-induced cataractogenesis. Copyright © 2016 IPEM. Published by Elsevier Ltd. All rights reserved.

Theoretical Motions of Hydrofoil Systems

DTIC Science & Technology

1947-06-01

mentioned in the main test. 22 NACA TIT No. 1285 By the use of D ’ Alemberts principle , the" following equations of equilibrium at the center of gravity...spacing-is d ^Bii;a^i§_iiv order; tominimize the.-effepts-of unavo idable.. change s iiic enter-: of, r gravi ty. location. eine ouster ej._ $n...disturbance to hydrofoil system k, empirical constant used to determine value 1 *(WJ* of d (CT) /ÖZ1 fco> k5 empirical constants used to determine

Stellar motion induced by gravitational instabilities in protoplanetary discs

NASA Astrophysics Data System (ADS)

Michael, Scott; Durisen, R. H.

2010-07-01

We test the effect of assumptions about stellar motion on the behaviour of gravitational instabilities (GIs) in protoplanetary discs around solar-type stars by performing two simulations that are identical in all respects except the treatment of the star. In one simulation, the star is assumed to remain fixed at the centre of the inertial reference frame. In the other, stellar motion is handled properly by including an indirect potential in the hydrodynamic equations to model the star's reference frame as one which is accelerated by star/disc interactions. The discs in both simulations orbit a solar mass star, initially extend from 2.3 to 40 au with a ϖ-1/2 surface density profile, and have a total mass of 0.14 Msolar. The γ = 5/3 ideal gas is assumed to cool everywhere with a constant cooling time of two outer rotation periods. The overall behaviour of the disc evolution is similar, except for weakening in various measures of GI activity by about at most tens of per cent for the indirect potential case. Overall conclusions about disc evolution in earlier papers by our group, where the star was always assumed to be fixed in an inertial frame, remain valid. There is no evidence for independent one-armed instabilities, like the Stimulation by the Long-range Interaction of Newtonian Gravity (SLING), in either simulation. On the other hand, the stellar motion about the system centre of mass (COM) in the simulation with the indirect potential is substantial, up to 0.25 au during the burst phase, as GIs initiate, and averaging about 0.9 au during the asymptotic phase, when the GIs reach an overall balance of heating and cooling. These motions appear to be a stellar response to non-linear interactions between discrete global spiral modes in both the burst and asymptotic phases of the evolution, and the star's orbital motion about the COM reflects the orbit periods of disc material near the corotation radii of the dominant spiral waves. This motion is, in principle, large enough to be observable and could be confused with stellar wobble due to the presence of one or more super-Jupiter mass protoplanets orbiting at 10's au. We discuss why the excursions in our simulation are so much larger than those seen in simulations by Rice et al.

Graphene nanoribbon as an elastic damper

NASA Astrophysics Data System (ADS)

Evazzade, Iman; Lobzenko, Ivan P.; Saadatmand, Danial; Korznikova, Elena A.; Zhou, Kun; Liu, Bo; Dmitriev, Sergey V.

2018-05-01

Heterostructures composed of dissimilar two-dimensional nanomaterials can have nontrivial physical and mechanical properties which are potentially useful in many applications. Interestingly, in some cases, it is possible to create heterostructures composed of weakly and strongly stretched domains with the same chemical composition, as has been demonstrated for some polymer chains, DNA, and intermetallic nanowires supporting this effect of two-phase stretching. These materials, at relatively strong tension forces, split into domains with smaller and larger tensile strains. Within this region, average strain increases at constant tensile force due to the growth of the domain with the larger strain, at the expense of the domain with smaller strain. Here, the two-phase stretching phenomenon is described for graphene nanoribbons with the help of molecular dynamics simulations. This unprecedented feature of graphene that is revealed in our study is related to the peculiarities of nucleation and the motion of the domain walls separating the domains of different elastic strain. It turns out that the loading–unloading curves exhibit a hysteresis-like behavior due to the energy dissipation during the domain wall nucleation and motion. Here, we put forward the idea of implementing graphene nanoribbons as elastic dampers, efficiently converting mechanical strain energy into heat during cyclic loading–unloading through elastic extension where domains with larger and smaller strains coexist. Furthermore, in the regime of two-phase stretching, graphene nanoribbon is a heterostructure for which the fraction of domains with larger and smaller strain, and consequently its physical and mechanical properties, can be tuned in a controllable manner by applying elastic strain and/or heat.

Graphene nanoribbon as an elastic damper.

PubMed

Evazzade, Iman; Lobzenko, Ivan P; Saadatmand, Danial; Korznikova, Elena A; Zhou, Kun; Liu, Bo; Dmitriev, Sergey V

2018-05-25

Heterostructures composed of dissimilar two-dimensional nanomaterials can have nontrivial physical and mechanical properties which are potentially useful in many applications. Interestingly, in some cases, it is possible to create heterostructures composed of weakly and strongly stretched domains with the same chemical composition, as has been demonstrated for some polymer chains, DNA, and intermetallic nanowires supporting this effect of two-phase stretching. These materials, at relatively strong tension forces, split into domains with smaller and larger tensile strains. Within this region, average strain increases at constant tensile force due to the growth of the domain with the larger strain, at the expense of the domain with smaller strain. Here, the two-phase stretching phenomenon is described for graphene nanoribbons with the help of molecular dynamics simulations. This unprecedented feature of graphene that is revealed in our study is related to the peculiarities of nucleation and the motion of the domain walls separating the domains of different elastic strain. It turns out that the loading-unloading curves exhibit a hysteresis-like behavior due to the energy dissipation during the domain wall nucleation and motion. Here, we put forward the idea of implementing graphene nanoribbons as elastic dampers, efficiently converting mechanical strain energy into heat during cyclic loading-unloading through elastic extension where domains with larger and smaller strains coexist. Furthermore, in the regime of two-phase stretching, graphene nanoribbon is a heterostructure for which the fraction of domains with larger and smaller strain, and consequently its physical and mechanical properties, can be tuned in a controllable manner by applying elastic strain and/or heat.

On mechanical waves and Doppler shifts from moving boundaries

DOE PAGES

Christov, Ivan C.; Christov, Christo I.

2017-02-01

We investigate the propagation of infinitesimal harmonic mechanical waves emitted from a boundary with variable velocity and arriving at a stationary observer. In the classical Doppler effect, X s(t)=vt is the location of the source with constant velocity v. In the present work, however, we consider a source co-located with a moving boundary x=X s(t), where X s(t) can have an arbitrary functional form. For ‘slowly moving’ boundaries (i.e., ones for which the timescale set by the mechanical motion is large in comparison to the inverse of the frequency of the emitted wave), we present a multiple-scale asymptotic analysis of the moving boundary problem for the linear wave equation. Here, we obtain a closed-form leading-order (with respect to the latter small parameter) solution and show that the variable velocity of the boundary results not only in frequency modulation but also in amplitude modulation of the received signal. Consequently, our results extend the applicability of two basic tenets of the theory of a moving source on a stationary domain, specifically that (i)more » $$.\\atop{x}_s$$ for non-uniform boundary motion can be inserted in place of the constant velocity v in the classical Doppler formula and (ii) that the non-uniform boundary motion introduces variability in the amplitude of the wave. The specific examples of decelerating and oscillatory boundary motion are worked out and illustrated.« less

Elimination of artificial grid distortion and hourglass-type motions by means of Lagrangian subzonal masses and pressures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Caramana, E.J.; Shashkov, M.J.

1997-12-31

The bane of Lagrangian hydrodynamics calculations is premature breakdown of the grid topology that results in severe degradation of accuracy and run termination often long before the assumption of Lagrangian zonal mass ceased to be valid. At short spatial grid scales this is usually referred to by the terms hourglass mode or keystone motion associated in particular with underconstrained grids such as quadrilaterals and hexahedrons in two and three dimensions, respectively. At longer spatial scales relative to the grid spacing there is what is referred to ubiquitously as spurious vorticity, or the long-thin zone problem. In both cases the resultmore » is anomalous grid distortion and tangling that has nothing to do with the actual solution, as would be the case for turbulent flow. In this work the authors show how such motions can be eliminated by the proper use of subzonal Lagrangian masses, and associated densities and pressures. These subzonal masses arise in a natural way from the fact that they require the mass associated with the nodal grid point to be constant in time. This is addition to the usual assumption of constant, Lagrangian zonal mass in staggered grid hydrodynamics scheme. The authors show that with proper discretization of subzonal forces resulting from subzonal pressures, hourglass motion and spurious vorticity can be eliminated for a very large range of problems. Finally the authors are presenting results of calculations of many test problems.« less

The Anharmonic Force Field of Ethylene, C2H4, by Means of Accurate Ab Initio Calculations

NASA Technical Reports Server (NTRS)

Martin, Jan M. L.; Lee, Timothy J.; Taylor, Peter R.; Francois, Jean-Pierre; Langhoff, Stephen R. (Technical Monitor)

1995-01-01

The quartic force field of ethylene, C2H4, has been calculated ab initio using augmented coupled cluster, CCSD(T), methods and correlation consistent basis sets of spdf quality. For the C-12 isotopomers C2H4, C2H3D, H2CCD2, cis-C2H2D2, trans-C2H2D2, C2HD3, and C2D4, all fundamentals could be reproduced to better than 10 per centimeter, except for three cases of severe Fermi type 1 resonance. The problem with these three bands is identified as a systematic overestimate of the Kiij Fermi resonance constants by a factor of two or more; if this is corrected for, the predicted fundamentals come into excellent agreement with experiment. No such systematic overestimate is seen for Fermi type 2 resonances. Our computed harmonic frequencies suggest a thorough revision of the accepted experimentally derived values. Our computed and empirically corrected re geometry differs substantially from experimentally derived values: both the predicted rz geometry and the ground-state rotational constants are, however, in excellent agreement with experiment, suggesting revision of the older values. Anharmonicity constants agree well with experiment for stretches, but differ substantially for stretch-bend interaction constants, due to equality constraints in the experimental analysis that do not hold. Improved criteria for detecting Fermi and Coriolis resonances are proposed and found to work well, contrary to the established method based on harmonic frequency differences that fails to detect several important resonances for C2H4 and its isotopomers. Surprisingly good results are obtained with a small spd basis at the CCSD(T) level. The well-documented strong basis set effect on the v8 out-of-plane motion is present to a much lesser extent when correlation-optimized polarization functions are used. Complete sets of anharmonic, rovibrational coupling, and centrifugal distortion constants for the isotopomers are available as supplementary material to the paper.

[Motion control of moving mirror based on fixed-mirror adjustment in FTIR spectrometer].

PubMed

Li, Zhong-bing; Xu, Xian-ze; Le, Yi; Xu, Feng-qiu; Li, Jun-wei

2012-08-01

The performance of the uniform motion of the moving mirror, which is the only constant motion part in FTIR spectrometer, and the performance of the alignment of the fixed mirror play a key role in FTIR spectrometer, and affect the interference effect and the quality of the spectrogram and may restrict the precision and resolution of the instrument directly. The present article focuses on the research on the uniform motion of the moving mirror and the alignment of the fixed mirror. In order to improve the FTIR spectrometer, the maglev support system was designed for the moving mirror and the phase detection technology was adopted to adjust the tilt angle between the moving mirror and the fixed mirror. This paper also introduces an improved fuzzy PID control algorithm to get the accurate speed of the moving mirror and realize the control strategy from both hardware design and algorithm. The results show that the development of the moving mirror motion control system gets sufficient accuracy and real-time, which can ensure the uniform motion of the moving mirror and the alignment of the fixed mirror.

Certification of a hybrid parameter model of the fully flexible Shuttle Remote Manipulator System

NASA Technical Reports Server (NTRS)

Barhorst, Alan A.

1995-01-01

The development of high fidelity models of mechanical systems with flexible components is in flux. Many working models of these devices assume the elastic motion is small and can be superimposed on the overall rigid body motion. A drawback associated with this type of modeling technique is that it is required to regenerate the linear modal model of the device if the elastic motion is sufficiently far from the base rigid motion. An advantage to this type of modeling is that it uses NASTRAN modal data which is the NASA standard means of modal information exchange. A disadvantage to the linear modeling is that it fails to accurately represent large motion of the system, unless constant modal updates are performed. In this study, which is a continuation of a project started last year, the drawback of the currently used modal snapshot modeling technique is addressed in a rigorous fashion by novel and easily applied means.

Quantifying the accuracy of the tumor motion and area as a function of acceleration factor for the simulation of the dynamic keyhole magnetic resonance imaging method.

PubMed

Lee, Danny; Greer, Peter B; Pollock, Sean; Kim, Taeho; Keall, Paul

2016-05-01

The dynamic keyhole is a new MR image reconstruction method for thoracic and abdominal MR imaging. To date, this method has not been investigated with cancer patient magnetic resonance imaging (MRI) data. The goal of this study was to assess the dynamic keyhole method for the task of lung tumor localization using cine-MR images reconstructed in the presence of respiratory motion. The dynamic keyhole method utilizes a previously acquired a library of peripheral k-space datasets at similar displacement and phase (where phase is simply used to determine whether the breathing is inhale to exhale or exhale to inhale) respiratory bins in conjunction with central k-space datasets (keyhole) acquired. External respiratory signals drive the process of sorting, matching, and combining the two k-space streams for each respiratory bin, thereby achieving faster image acquisition without substantial motion artifacts. This study was the first that investigates the impact of k-space undersampling on lung tumor motion and area assessment across clinically available techniques (zero-filling and conventional keyhole). In this study, the dynamic keyhole, conventional keyhole and zero-filling methods were compared to full k-space dataset acquisition by quantifying (1) the keyhole size required for central k-space datasets for constant image quality across sixty four cine-MRI datasets from nine lung cancer patients, (2) the intensity difference between the original and reconstructed images in a constant keyhole size, and (3) the accuracy of tumor motion and area directly measured by tumor autocontouring. For constant image quality, the dynamic keyhole method, conventional keyhole, and zero-filling methods required 22%, 34%, and 49% of the keyhole size (P < 0.0001), respectively, compared to the full k-space image acquisition method. Compared to the conventional keyhole and zero-filling reconstructed images with the keyhole size utilized in the dynamic keyhole method, an average intensity difference of the dynamic keyhole reconstructed images (P < 0.0001) was minimal, and resulted in the accuracy of tumor motion within 99.6% (P < 0.0001) and the accuracy of tumor area within 98.0% (P < 0.0001) for lung tumor monitoring applications. This study demonstrates that the dynamic keyhole method is a promising technique for clinical applications such as image-guided radiation therapy requiring the MR monitoring of thoracic tumors. Based on the results from this study, the dynamic keyhole method could increase the imaging frequency by up to a factor of five compared with full k-space methods for real-time lung tumor MRI.

Measuring the circular motion of small objects using laser stroboscopic images.

PubMed

Wang, Hairong; Fu, Y; Du, R

2008-01-01

Measuring the circular motion of a small object, including its displacement, speed, and acceleration, is a challenging task. This paper presents a new method for measuring repetitive and/or nonrepetitive, constant speed and/or variable speed circular motion using laser stroboscopic images. Under stroboscopic illumination, each image taken by an ordinary camera records multioutlines of an object in motion; hence, processing the stroboscopic image will be able to extract the motion information. We built an experiment apparatus consisting of a laser as the light source, a stereomicroscope to magnify the image, and a normal complementary metal oxide semiconductor camera to record the image. As the object is in motion, the stroboscopic illumination generates a speckle pattern on the object that can be recorded by the camera and analyzed by a computer. Experimental results indicate that the stroboscopic imaging is stable under various conditions. Moreover, the characteristics of the motion, including the displacement, the velocity, and the acceleration can be calculated based on the width of speckle marks, the illumination intensity, the duty cycle, and the sampling frequency. Compared with the popular high-speed camera method, the presented method may achieve the same measuring accuracy, but with much reduced cost and complexity.

A comparative study of surface waves inversion techniques at strong motion recording sites in Greece

USGS Publications Warehouse

Panagiotis C. Pelekis,; Savvaidis, Alexandros; Kayen, Robert E.; Vlachakis, Vasileios S.; Athanasopoulos, George A.

2015-01-01

Surface wave method was used for the estimation of Vs vs depth profile at 10 strong motion stations in Greece. The dispersion data were obtained by SASW method, utilizing a pair of electromechanical harmonic-wave source (shakers) or a random source (drop weight). In this study, three inversion techniques were used a) a recently proposed Simplified Inversion Method (SIM), b) an inversion technique based on a neighborhood algorithm (NA) which allows the incorporation of a priori information regarding the subsurface structure parameters, and c) Occam's inversion algorithm. For each site constant value of Poisson's ratio was assumed (ν=0.4) since the objective of the current study is the comparison of the three inversion schemes regardless the uncertainties resulting due to the lack of geotechnical data. A penalty function was introduced to quantify the deviations of the derived Vs profiles. The Vs models are compared as of Vs(z), Vs30 and EC8 soil category, in order to show the insignificance of the existing variations. The comparison results showed that the average variation of SIM profiles is 9% and 4.9% comparing with NA and Occam's profiles respectively whilst the average difference of Vs30 values obtained from SIM is 7.4% and 5.0% compared with NA and Occam's.

Execution of saccadic eye movements affects speed perception

PubMed Central

Goettker, Alexander; Braun, Doris I.; Schütz, Alexander C.; Gegenfurtner, Karl R.

2018-01-01

Due to the foveal organization of our visual system we have to constantly move our eyes to gain precise information about our environment. Doing so massively alters the retinal input. This is problematic for the perception of moving objects, because physical motion and retinal motion become decoupled and the brain has to discount the eye movements to recover the speed of moving objects. Two different types of eye movements, pursuit and saccades, are combined for tracking. We investigated how the way we track moving targets can affect the perceived target speed. We found that the execution of corrective saccades during pursuit initiation modifies how fast the target is perceived compared with pure pursuit. When participants executed a forward (catch-up) saccade they perceived the target to be moving faster. When they executed a backward saccade they perceived the target to be moving more slowly. Variations in pursuit velocity without corrective saccades did not affect perceptual judgments. We present a model for these effects, assuming that the eye velocity signal for small corrective saccades gets integrated with the retinal velocity signal during pursuit. In our model, the execution of corrective saccades modulates the integration of these two signals by giving less weight to the retinal information around the time of corrective saccades. PMID:29440494

a Steady Thermal State for the Earth's Interior

NASA Astrophysics Data System (ADS)

Andrault, D.; Monteux, J.; Le Bars, M.; Samuel, H.

2015-12-01

Large amounts of heat are permanently lost at the surface yielding the classic view of the Earth continuously cooling down. Contrary to this conventional depiction, we propose that the temperature profile in the deep Earth has remained almost constant for the last ~3 billion years (Ga) or more. The core-mantle boundary (CMB) temperature reached the mantle solidus of 4100 (+/-300) K after complete crystallization of the magma ocean not more than 1 Ga after the Moon-forming impact. The CMB remains at a similar temperature today; seismological evidences of ultra-low velocity zones suggest partial melting in the D"-layer and, therefore, a current temperature at, or just below, the mantle solidus. Such a steady thermal state of the CMB temperature excludes thermal buoyancy and compositional convection from being the predominant mechanisms to power the geodynamo over geological time. An alternative mechanism to produce motion in the outer core is mechanical forcing by tidal distortion and planetary precession. The conversion of gravitational and rotational energies of the Earth-Moon-Sun system to core motions could have supplied the lowermost mantle with a variable intensity heat source through geological time, due to the regime of core instabilities and/or changes in the astronomical forces. This variable heat source could explain the dramatic volcanic events that occurred in the Earth's history.

Active and passive transport of cargo in a corrugated channel: A lattice model study

NASA Astrophysics Data System (ADS)

Dey, Supravat; Ching, Kevin; Das, Moumita

2018-04-01

Inside cells, cargos such as vesicles and organelles are transported by molecular motors to their correct locations via active motion on cytoskeletal tracks and passive, Brownian diffusion. During the transportation of cargos, motor-cargo complexes (MCCs) navigate the confining and crowded environment of the cytoskeletal network and other macromolecules. Motivated by this, we study a minimal two-state model of motor-driven cargo transport in confinement and predict transport properties that can be tested in experiments. We assume that the motion of the MCC is directly affected by the entropic barrier due to confinement if it is in the passive, unbound state but not in the active, bound state where it moves with a constant bound velocity. We construct a lattice model based on a Fokker Planck description of the two-state system, study it using a kinetic Monte Carlo method and compare our numerical results with analytical expressions for a mean field limit. We find that the effect of confinement strongly depends on the bound velocity and the binding kinetics of the MCC. Confinement effectively reduces the effective diffusivity and average velocity, except when it results in an enhanced average binding rate and thereby leads to a larger average velocity than when unconfined.

Echocardiographic Techniques of Deformation Imaging in the Evaluation of Maternal Cardiovascular System in Patients with Complicated Pregnancies.

PubMed

Visentin, Silvia; Palermo, Chiara; Camerin, Martina; Daliento, Luciano; Muraru, Denisa; Cosmi, Erich; Badano, Luigi P

2017-01-01

Cardiovascular diseases (CVD) represent the leading cause of maternal mortality and morbidity. Knowledge of CVD in women is constantly evolving and data are emerging that female-specific risk factors as complications of pregnancy are conditions associated with an increased risk for the long-term development of CVD. Echocardiography is a safe and effective imaging technique indicated in symptomatic or asymptomatic pregnant women with congenital heart diseases who require close monitoring of cardiac function. Deformation imaging is an echocardiographic technique used to assess myocardial function by measuring the actual deformation of the myocardium through the cardiac cycle. Speckle-tracking echocardiography (STE) is a two-dimensional (2D) technique which has been found to be more accurate than tissue Doppler to assess both left ventricular (LV) and right ventricular (RV) myocardial function. The use of 2D STE however might present some technical issues due to the tomographic nature of the technique and the motion in the three-dimensional space of the myocardial speckles. This has promoted the use of 3D STE to track the motion of the speckles in the 3D space. This review will focus on the clinical value of the new echocardiographic techniques of deformation imaging used to assess the maternal cardiovascular system in complicated pregnancies.

Visual adaptation alters the apparent speed of real-world actions.

PubMed

Mather, George; Sharman, Rebecca J; Parsons, Todd

2017-07-27

The apparent physical speed of an object in the field of view remains constant despite variations in retinal velocity due to viewing conditions (velocity constancy). For example, people and cars appear to move across the field of view at the same objective speed regardless of distance. In this study a series of experiments investigated the visual processes underpinning judgements of objective speed using an adaptation paradigm and video recordings of natural human locomotion. Viewing a video played in slow-motion for 30 seconds caused participants to perceive subsequently viewed clips played at standard speed as too fast, so playback had to be slowed down in order for it to appear natural; conversely after viewing fast-forward videos for 30 seconds, playback had to be speeded up in order to appear natural. The perceived speed of locomotion shifted towards the speed depicted in the adapting video ('re-normalisation'). Results were qualitatively different from those obtained in previously reported studies of retinal velocity adaptation. Adapting videos that were scrambled to remove recognizable human figures or coherent motion caused significant, though smaller shifts in apparent locomotion speed, indicating that both low-level and high-level visual properties of the adapting stimulus contributed to the changes in apparent speed.

SU-F-T-560: Measurement of Dose Blurring Effect Due to Respiratory Motion for Lung Stereotactic Body Radiation Therapy (SBRT) Using Monte Carlo Based Calculation Algorithm

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badkul, R; Pokhrel, D; Jiang, H

2016-06-15

Purpose: Intra-fractional tumor motion due to respiration may potentially compromise dose delivery for SBRT of lung tumors. Even sufficient margins are used to ensure there is no geometric miss of target volume, there is potential dose blurring effect may present due to motion and could impact the tumor coverage if motions are larger. In this study we investigated dose blurring effect of open fields as well as Lung SBRT patients planned using 2 non-coplanar dynamic conformal arcs(NCDCA) and few conformal beams(CB) calculated with Monte Carlo (MC) based algorithm utilizing phantom with 2D-diode array(MapCheck) and ion-chamber. Methods: SBRT lung patients weremore » planned on Brainlab-iPlan system using 4D-CT scan and ITV were contoured on MIP image set and verified on all breathing phase image sets to account for breathing motion and then 5mm margin was applied to generate PTV. Plans were created using two NCDCA and 4-5 CB 6MV photon calculated using XVMC MC-algorithm. 3 SBRT patients plans were transferred to phantom with MapCheck and 0.125cc ion-chamber inserted in the middle of phantom to calculate dose. Also open field 3×3, 5×5 and 10×10 were calculated on this phantom. Phantom was placed on motion platform with varying motion from 5, 10, 20 and 30 mm with duty cycle of 4 second. Measurements were carried out for open fields as well 3 patients plans at static and various degree of motions. MapCheck planar dose and ion-chamber reading were collected and compared with static measurements and computed values to evaluate the dosimetric effect on tumor coverage due to motion. Results: To eliminate complexity of patients plan 3 simple open fields were also measured to see the dose blurring effect with the introduction of motion. All motion measured ionchamber values were normalized to corresponding static value. For open fields 5×5 and 10×10 normalized central axis ion-chamber values were 1.00 for all motions but for 3×3 they were 1 up to 10mm motion and 0.97 and 0.87 for 20 and 30mm motion respectively. For SBRT plans central axis dose values were within 1% upto 10mm motions but decreased to average of 5% for 20mm and 8% for 30mm motion. Mapcheck comparison with static showed penumbra enlargement due to motion blurring at the edges of the field for 3×3,5×5,10×10 pass rates were 88% to 12%, 100% to 43% and 100% to 63% respectively as motion increased from 5 to 30mm. For SBRT plans MapCheck mean pass rate were decreased from 73.8% to 39.5% as motion increased from 5mm to 30mm. Conclusion: Dose blurring effect has been seen in open fields as well as SBRT lung plans using NCDCA with CB which worsens with increasing respiratory motion and decreasing field size(tumor size). To reduce this effect larger margins and appropriate motion reduction techniques should be utilized.« less

On the aerodynamic characteristics of hovering rigid and flexible hawkmoth-like wings

NASA Astrophysics Data System (ADS)

Lua, K. B.; Lai, K. C.; Lim, T. T.; Yeo, K. S.

2010-12-01

Insect wings are subjected to fluid, inertia and gravitational forces during flapping flight. Owing to their limited rigidity, they bent under the influence of these forces. Numerical study by Hamamoto et al. (Adv Robot 21(1-2):1-21, 2007) showed that a flexible wing is able to generate almost as much lift as a rigid wing during flapping. In this paper, we take a closer look at the relationship between wing flexibility (or stiffness) and aerodynamic force generation in flapping hovering flight. The experimental study was conducted in two stages. The first stage consisted of detailed force measurement and flow visualization of a rigid hawkmoth-like wing undergoing hovering hawkmoth flapping motion and simple harmonic flapping motion, with the aim of establishing a benchmark database for the second stage, which involved hawkmoth-like wing of different flexibility performing the same flapping motions. Hawkmoth motion was conducted at Re = 7,254 and reduced frequency of 0.26, while simple harmonic flapping motion at Re = 7,800 and 11,700, and reduced frequency of 0.25. Results show that aerodynamic force generation on the rigid wing is governed primarily by the combined effect of wing acceleration and leading edge vortex generated on the upper surface of the wing, while the remnants of the wake vortices generated from the previous stroke play only a minor role. Our results from the flexible wing study, while generally supportive of the finding by Hamamoto et al. (Adv Robot 21(1-2):1-21, 2007), also reveal the existence of a critical stiffness constant, below which lift coefficient deteriorates significantly. This finding suggests that although using flexible wing in micro air vehicle application may be beneficial in term of lightweight, too much flexibility can lead to deterioration in flapping performance in terms of aerodynamic force generation. The results further show that wings with stiffness constant above the critical value can deliver mean lift coefficient almost the same as a rigid wing when executing hawkmoth motion, but lower than the rigid wing when performing a simple harmonic motion. In all cases studied (7,800 ≤ Re ≤ 11,700), the Reynolds number does not alter the force generation significantly.

Adaptation without parameter change: Dynamic gain control in motion detection

PubMed Central

Borst, Alexander; Flanagin, Virginia L.; Sompolinsky, Haim

2005-01-01

Many sensory systems adapt their input-output relationship to changes in the statistics of the ambient stimulus. Such adaptive behavior has been measured in a motion detection sensitive neuron of the fly visual system, H1. The rapid adaptation of the velocity response gain has been interpreted as evidence of optimal matching of the H1 response to the dynamic range of the stimulus, thereby maximizing its information transmission. Here, we show that correlation-type motion detectors, which are commonly thought to underlie fly motion vision, intrinsically possess adaptive properties. Increasing the amplitude of the velocity fluctuations leads to a decrease of the effective gain and the time constant of the velocity response without any change in the parameters of these detectors. The seemingly complex property of this adaptation turns out to be a straightforward consequence of the multidimensionality of the stimulus and the nonlinear nature of the system. PMID:15833815

Influence of Eccentricity and Angular Velocity on Force Effects on Rotor of Magnetorheological Damper

NASA Astrophysics Data System (ADS)

Šedivý, Dominik; Ferfecki, Petr; Fialová, Simona

2018-06-01

This article presents the evaluation of force effects on squeeze film damper rotor. The rotor is placed eccentrically and its motion is translate-circular. The amplitude of rotor motion is smaller than its initial eccentricity. The force effects are calculated from pressure and viscous forces which were measured by using computational modeling. Damper was filled with magnetorheological fluid. Viscosity of this non-Newtonian fluid is given using Bingham rheology model. Yield stress is not constant and it is a function of magnetic induction which is described by many variables. The most important variables of magnetic induction are electric current and gap width between rotor and stator. The simulations were made in finite volume method based solver. The motion of the inner ring of squeeze film damper was carried out by dynamic mesh. Numerical solution was solved for five different initial eccentricities and angular velocities of rotor motion.

Investigation on Stability in Roll of Square Section Missile at High Angle of Attack

NASA Astrophysics Data System (ADS)

Tao, Yang; Fan, Zhaolin; Wu, Jifei; Wu, Wenhua

An experimental investigation of the stability in roll of a square section missile at high incidence was conducted in FL-23 wind tunnel. Dynamic motions were obtained on a square section missile that is free to rotate about its longitudinal axis. Different dynamic rolling motions were observed depending on the incidence of the model sting. These dynamic regimes include damped oscillations, quasi-limit-cycle wing-rock motion, and constant rolling. A coupling numerical method was established by solving the fluid dynamics equations and the rigid-body dynamics equations synchronously in order to predict the onset and the development of uncommented motions and then explore the unsteady movement characteristics of the aircraft. The study indicates that the aircraft loss stability at high incidence is caused by the asymmetric vertex on the level fin tip liftoff and attach alternately. The computation results are in line with the experiment results.

Comparison of Flight Simulators Based on Human Motion Perception Metrics

NASA Technical Reports Server (NTRS)

Valente Pais, Ana R.; Correia Gracio, Bruno J.; Kelly, Lon C.; Houck, Jacob A.

2015-01-01

In flight simulation, motion filters are used to transform aircraft motion into simulator motion. When looking for the best match between visual and inertial amplitude in a simulator, researchers have found that there is a range of inertial amplitudes, rather than a single inertial value, that is perceived by subjects as optimal. This zone, hereafter referred to as the optimal zone, seems to correlate to the perceptual coherence zones measured in flight simulators. However, no studies were found in which these two zones were compared. This study investigates the relation between the optimal and the coherence zone measurements within and between different simulators. Results show that for the sway axis, the optimal zone lies within the lower part of the coherence zone. In addition, it was found that, whereas the width of the coherence zone depends on the visual amplitude and frequency, the width of the optimal zone remains constant.

A motion-constraint logic for moving-base simulators based on variable filter parameters

NASA Technical Reports Server (NTRS)

Miller, G. K., Jr.

1974-01-01

A motion-constraint logic for moving-base simulators has been developed that is a modification to the linear second-order filters generally employed in conventional constraints. In the modified constraint logic, the filter parameters are not constant but vary with the instantaneous motion-base position to increase the constraint as the system approaches the positional limits. With the modified constraint logic, accelerations larger than originally expected are limited while conventional linear filters would result in automatic shutdown of the motion base. In addition, the modified washout logic has frequency-response characteristics that are an improvement over conventional linear filters with braking for low-frequency pilot inputs. During simulated landing approaches of an externally blown flap short take-off and landing (STOL) transport using decoupled longitudinal controls, the pilots were unable to detect much difference between the modified constraint logic and the logic based on linear filters with braking.

Superintegrability of geodesic motion on the sausage model

NASA Astrophysics Data System (ADS)

Arutyunov, Gleb; Heinze, Martin; Medina-Rincon, Daniel

2017-06-01

Reduction of the η-deformed sigma model on AdS_5× S5 to the two-dimensional squashed sphere (S^2)η can be viewed as a special case of the Fateev sausage model where the coupling constant ν is imaginary. We show that geodesic motion in this model is described by a certain superintegrable mechanical system with four-dimensional phase space. This is done by means of explicitly constructing three integrals of motion which satisfy the sl(2) Poisson algebra relations, albeit being non-polynomial in momenta. Further, we find a canonical transformation which transforms the Hamiltonian of this mechanical system to the one describing the geodesic motion on the usual two-sphere. By inverting this transformation we map geodesics on this auxiliary two-sphere back to the sausage model. This paper is a tribute to the memory of Prof Petr Kulish.

Linear force device

NASA Technical Reports Server (NTRS)

Clancy, John P.

1988-01-01

The object of the invention is to provide a mechanical force actuator which is lightweight and manipulatable and utilizes linear motion for push or pull forces while maintaining a constant overall length. The mechanical force producing mechanism comprises a linear actuator mechanism and a linear motion shaft mounted parallel to one another. The linear motion shaft is connected to a stationary or fixed housing and to a movable housing where the movable housing is mechanically actuated through actuator mechanism by either manual means or motor means. The housings are adapted to releasably receive a variety of jaw or pulling elements adapted for clamping or prying action. The stationary housing is adapted to be pivotally mounted to permit an angular position of the housing to allow the tool to adapt to skewed interfaces. The actuator mechanisms is operated by a gear train to obtain linear motion of the actuator mechanism.

Slewing maneuvers and vibration control of space structures by feedforward/feedback moment-gyro controls

NASA Technical Reports Server (NTRS)

Yang, Li-Farn; Mikulas, Martin M., Jr.; Park, K. C.; Su, Renjeng

1993-01-01

This paper presents a moment-gyro control approach to the maneuver and vibration suppression of a flexible truss arm undergoing a constant slewing motion. The overall slewing motion is triggered by a feedforward input, and a companion feedback controller is employed to augment the feedforward input and subsequently to control vibrations. The feedforward input for the given motion requirement is determined from the combined CMG (Control Momentum Gyro) devices and the desired rigid-body motion. The rigid-body dynamic model has enabled us to identify the attendant CMG momentum saturation constraints. The task for vibration control is carried out in two stages; first in the search of a suitable CMG placement along the beam span for various slewing maneuvers, and subsequently in the development of Liapunov-based control algorithms for CMG spin-stabilization. Both analytical and numerical results are presented to show the effectiveness of the present approach.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elliott, Stephen J.; Ni, Guangjian

The pressure distribution in each of the fluid chambers of the cochlea can be decomposed into a 1D, or plane wave, component and a near field component, which decays rapidly away from the excitation point. The transverse motion of the basilar membrane, BM, for example, generates both a 1D pressure field, which couples into the slow wave, and a local near field pressure, proportional to the BM acceleration, that generates an added mass on the BM due to the fluid motion. When the organ of Corti, OC, undergoes internal motion, due for example to outer hair cell activity, this motionmore » will not itself generate any 1D pressure if the OC is incompressible and the BM is constrained not to move volumetrically, and so will not directly couple into the slow wave. This motion will, however, generate a near field pressure, proportional to the OC acceleration, which will act on the OC and thus increases its effective mass. The near field pressure due to this OC motion will also act on the BM, generating a force on the BM proportional to the acceleration of the OC, and thus create a “coupling mass” effect. By reciprocity, this coupling mass is the same as that acting on the OC due to the motion of the BM. This near field fluid coupling is initially observed in a finite element model of a slice of the cochlea. These simulations suggest a simple analytical formulation for the fluid coupling, using higher order beam modes across the width of the cochlear partition. It is well known that the added mass due to the near field pressure dominates the overall mass of the BM, and thus significantly affects the micromechanical dynamics. This work not only quantifies the added mass of the OC due its own motion in the fluid, and shows that this is important, but also demonstrates that the coupling mass effect between the BM and OC significantly affects the dynamics of simple micromechanical models.« less

Depth information in natural environments derived from optic flow by insect motion detection system: a model analysis

PubMed Central

Schwegmann, Alexander; Lindemann, Jens P.; Egelhaaf, Martin

2014-01-01

Knowing the depth structure of the environment is crucial for moving animals in many behavioral contexts, such as collision avoidance, targeting objects, or spatial navigation. An important source of depth information is motion parallax. This powerful cue is generated on the eyes during translatory self-motion with the retinal images of nearby objects moving faster than those of distant ones. To investigate how the visual motion pathway represents motion-based depth information we analyzed its responses to image sequences recorded in natural cluttered environments with a wide range of depth structures. The analysis was done on the basis of an experimentally validated model of the visual motion pathway of insects, with its core elements being correlation-type elementary motion detectors (EMDs). It is the key result of our analysis that the absolute EMD responses, i.e., the motion energy profile, represent the contrast-weighted nearness of environmental structures during translatory self-motion at a roughly constant velocity. In other words, the output of the EMD array highlights contours of nearby objects. This conclusion is largely independent of the scale over which EMDs are spatially pooled and was corroborated by scrutinizing the motion energy profile after eliminating the depth structure from the natural image sequences. Hence, the well-established dependence of correlation-type EMDs on both velocity and textural properties of motion stimuli appears to be advantageous for representing behaviorally relevant information about the environment in a computationally parsimonious way. PMID:25136314

Apparatus to position a microelectromechanical platform

DOEpatents

Miller, Samuel Lee; Rodgers, Murray Steven

2003-09-23

The present invention comprises a microelectromechanical positioner to achieve substantially translational positioning of a platform without rotational motion, thereby maintaining a constant angular orientation of the platform during movement. A linkage mechanism of the positioner can comprise parallelogram linkages to constrain the rotational motion of the platform. Such linkages further can comprise flexural hinges or other turning joints at the linkage pivots to eliminate the need for rubbing surfaces. A plurality of the linkage mechanisms can be used to enable translational motion of the platform with two degrees of freedom. A variety of means can be used to actuate the positioner. Independent actuation of the anchor links of the linkage mechanisms with rotary electrostatic actuators can be used to provide controlled translational movement of the platform.

Anti-correlated spectral motion in bisphthalocyanines: evidence for vibrational modulation of electronic mixing.

PubMed

Prall, Bradley S; Parkinson, Dilworth Y; Ishikawa, Naoto; Fleming, Graham R

2005-12-08

We exploit a coherently excited nuclear wave packet to study nuclear motion modulation of electronic structure in a metal bridged phthalocyanine dimer, lutetium bisphthalocyanine, which displays two visible absorption bands. We find that the nuclear coordinate influences the energies of the underlying exciton and charge resonance states as well as their interaction; the interplay of the various couplings creates unusual anti-correlated spectral motion in the two bands. Excited state relaxation dynamics are the same regardless of which transition is pumped, with decay time constants of 1.5 and 11 ps. The dynamics are analyzed using a three-state kinetic model after relaxation from one or two additional states faster than the experimental time resolution of 50-100 fs.

An intrinsic approach in the curved n-body problem: The negative curvature case

NASA Astrophysics Data System (ADS)

Diacu, Florin; Pérez-Chavela, Ernesto; Reyes Victoria, J. Guadalupe

We consider the motion of n point particles of positive masses that interact gravitationally on the 2-dimensional hyperbolic sphere, which has negative constant Gaussian curvature. Using the stereographic projection, we derive the equations of motion of this curved n-body problem in the Poincaré disk, where we study the elliptic relative equilibria. Then we obtain the equations of motion in the Poincaré upper half plane in order to analyze the hyperbolic and parabolic relative equilibria. Using techniques of Riemannian geometry, we characterize each of the above classes of periodic orbits. For n=2 and n=3 we recover some previously known results and find new qualitative results about relative equilibria that were not apparent in an extrinsic setting.

Parabolic flight - Loss of sense of orientation

NASA Technical Reports Server (NTRS)

Lackner, J. R.; Graybiel, A.

1979-01-01

On the earth, or in level flight, a blindfolded subject being rotated at constant velocity about his recumbent long body axis experiences illusory orbital motion of his body in the opposite direction. By contrast, during comparable rotation in the free-fall phase of parabolic flight, no body motion is perceived and all sense of external orientation may be lost; when touch and pressure stimulation is applied to the body surface, a sense of orientation is reestablished immediately. The increased gravitoinertial force period of a parabola produces an exaggeration of the orbital motion experienced in level flight. These observations reveal an important influence of touch, pressure, and kinesthetic information on spatial orientation and provide a basis for understanding many of the postural illusions reported by astronauts in space flight.

Celestial mechanics with geometric algebra

NASA Technical Reports Server (NTRS)

Hestenes, D.

1983-01-01

Geometric algebra is introduced as a general tool for Celestial Mechanics. A general method for handling finite rotations and rotational kinematics is presented. The constants of Kepler motion are derived and manipulated in a new way. A new spinor formulation of perturbation theory is developed.

Perception of Visual Speed While Moving

ERIC Educational Resources Information Center

Durgin, Frank H.; Gigone, Krista; Scott, Rebecca

2005-01-01

During self-motion, the world normally appears stationary. In part, this may be due to reductions in visual motion signals during self-motion. In 8 experiments, the authors used magnitude estimation to characterize changes in visual speed perception as a result of biomechanical self-motion alone (treadmill walking), physical translation alone…

The impact of inter-fraction dose variations on biological equivalent dose (BED): the concept of equivalent constant dose.

PubMed

Zavgorodni, S

2004-12-07

Inter-fraction dose fluctuations, which appear as a result of setup errors, organ motion and treatment machine output variations, may influence the radiobiological effect of the treatment even when the total delivered physical dose remains constant. The effect of these inter-fraction dose fluctuations on the biological effective dose (BED) has been investigated. Analytical expressions for the BED accounting for the dose fluctuations have been derived. The concept of biological effective constant dose (BECD) has been introduced. The equivalent constant dose (ECD), representing the constant physical dose that provides the same cell survival fraction as the fluctuating dose, has also been introduced. The dose fluctuations with Gaussian as well as exponential probability density functions were investigated. The values of BECD and ECD calculated analytically were compared with those derived from Monte Carlo modelling. The agreement between Monte Carlo modelled and analytical values was excellent (within 1%) for a range of dose standard deviations (0-100% of the dose) and the number of fractions (2 to 37) used in the comparison. The ECDs have also been calculated for conventional radiotherapy fields. The analytical expression for the BECD shows that BECD increases linearly with the variance of the dose. The effect is relatively small, and in the flat regions of the field it results in less than 1% increase of ECD. In the penumbra region of the 6 MV single radiotherapy beam the ECD exceeded the physical dose by up to 35%, when the standard deviation of combined patient setup/organ motion uncertainty was 5 mm. Equivalently, the ECD field was approximately 2 mm wider than the physical dose field. The difference between ECD and the physical dose is greater for normal tissues than for tumours.

Acute effect of constant torque and angle stretching on range of motion, muscle passive properties, and stretch discomfort perception.

PubMed

Cabido, Christian E T; Bergamini, Juliana C; Andrade, André G P; Lima, Fernando V; Menzel, Hans J; Chagas, Mauro H

2014-04-01

The aim of the present study was to compare the acute effects of constant torque (CT) and constant angle (CA) stretching exercises on the maximum range of motion (ROMmax), passive stiffness (PS), and ROM corresponding to the first sensation of tightness in the posterior thigh (FSTROM). Twenty-three sedentary men (age, 19-33 years) went through 1 familiarization session and afterward proceeded randomly to both CA and CT treatment stretching conditions, on separate days. An isokinetic dynamometer was used to analyze hamstring muscles during passive knee extension. The subjects performed 4 stretches of 30 seconds each with a 15-second interval between them. In the CA stretching, the subject reached a certain ROM (95% of ROMmax), and the angle was kept constant. However, in the CT stretching exercise, the volunteer reached a certain resistance torque (corresponding to 95% of ROMmax) and it was kept constant. The results showed an increase in ROMmax for both CA and CT (p < 0.001), but the increase was greater for CT than for CA (CA vs. CT in poststretching, p = 0.002). Although the PS decreased for both CA and CT (p < 0.001), the decrease was greater for CT than for CA (CA vs. CT in poststretching, p = 0.002). The FSTROM increased for both CA and CT, but the increase for CT was greater than that for CA (CA vs. CT in poststretching, p = 0.003). The greater increase in ROMmax for the CT stretch may be explained by greater changes in the biomechanical properties of the muscle-tendon unit and stretch tolerance, as indicated by the results of PS and FSTROM.

Breathing motion compensated reconstruction for C-arm cone beam CT imaging: initial experience based on animal data

NASA Astrophysics Data System (ADS)

Schäfer, D.; Lin, M.; Rao, P. P.; Loffroy, R.; Liapi, E.; Noordhoek, N.; Eshuis, P.; Radaelli, A.; Grass, M.; Geschwind, J.-F. H.

2012-03-01

C-arm based tomographic 3D imaging is applied in an increasing number of minimal invasive procedures. Due to the limited acquisition speed for a complete projection data set required for tomographic reconstruction, breathing motion is a potential source of artifacts. This is the case for patients who cannot comply breathing commands (e.g. due to anesthesia). Intra-scan motion estimation and compensation is required. Here, a scheme for projection based local breathing motion estimation is combined with an anatomy adapted interpolation strategy and subsequent motion compensated filtered back projection. The breathing motion vector is measured as a displacement vector on the projections of a tomographic short scan acquisition using the diaphragm as a landmark. Scaling of the displacement to the acquisition iso-center and anatomy adapted volumetric motion vector field interpolation delivers a 3D motion vector per voxel. Motion compensated filtered back projection incorporates this motion vector field in the image reconstruction process. This approach is applied in animal experiments on a flat panel C-arm system delivering improved image quality (lower artifact levels, improved tumor delineation) in 3D liver tumor imaging.

Work-energy theorem and friction forces: two experiments

NASA Astrophysics Data System (ADS)

Bonanno, A.; Bozzo, G.; Grandinetti, M.; Sapia, P.

2016-11-01

Several studies have showed the subsistence, even in students enrolled in scientific degree courses, of spontaneous ideas regarding the motion of bodies that conflict with Newton’s laws. One of the causes is related to the intuitive preconceptions that students have about the role of friction as a force. In fact, in real world novices do not recognise friction as a force, and for this reason they may believe that a motion with a constant speed needs as a necessary condition the presence of a constant force in the same direction of the motion. In order to face these ‘intuitive ways of reasoning’, in this paper we propose two sequential experiments that can allow undergraduate students to clarify the role of friction forces through the use of the work-energy theorem. This is a necessary first step on the way to a deeper understanding of Newton’s second law. We have planned our experiments in order to strongly reduce quantitative difficult calculations and to facilitate qualitative comprehension of observed phenomena. Moreover, the proposed activities represent two examples of the recurring methodology used in experimental practices, since they offer the possibility to measure very small physical quantities in an indirect way with a higher accuracy than the direct measurements of the same quantities.

Joint analysis of ESR lineshapes and 1H NMRD profiles of DOTA-Gd derivatives by means of the slow motion theory

NASA Astrophysics Data System (ADS)

Kruk, D.; Kowalewski, J.; Tipikin, D. S.; Freed, J. H.; Mościcki, M.; Mielczarek, A.; Port, M.

2011-01-01

The "Swedish slow motion theory" [Nilsson and Kowalewski, J. Magn. Reson. 146, 345 (2000)] applied so far to Nuclear Magnetic Relaxation Dispersion (NMRD) profiles for solutions of transition metal ion complexes has been extended to ESR spectral analysis, including in addition g-tensor anisotropy effects. The extended theory has been applied to interpret in a consistent way (within one set of parameters) NMRD profiles and ESR spectra at 95 and 237 GHz for two Gd(III) complexes denoted as P760 and P792 (hydrophilic derivatives of DOTA-Gd, with molecular masses of 5.6 and 6.5 kDa, respectively). The goal is to verify the applicability of the commonly used pseudorotational model of the transient zero field splitting (ZFS). According to this model the transient ZFS is described by a tensor of a constant amplitude, defined in its own principal axes system, which changes its orientation with respect to the laboratory frame according to the isotropic diffusion equation with a characteristic time constant (correlation time) reflecting the time scale of the distortional motion. This unified interpretation of the ESR and NMRD leads to reasonable agreement with the experimental data, indicating that the pseudorotational model indeed captures the essential features of the electron spin dynamics.

Three-dimensional models of deformation near strike-slip faults

USGS Publications Warehouse

ten Brink, Uri S.; Katzman, Rafael; Lin, J.

1996-01-01

We use three-dimensional elastic models to help guide the kinematic interpretation of crustal deformation associated with strike-slip faults. Deformation of the brittle upper crust in the vicinity of strike-slip fault systems is modeled with the assumption that upper crustal deformation is driven by the relative plate motion in the upper mantle. The driving motion is represented by displacement that is specified on the bottom of a 15-km-thick elastic upper crust everywhere except in a zone of finite width in the vicinity of the faults, which we term the "shear zone." Stress-free basal boundary conditions are specified within the shear zone. The basal driving displacement is either pure strike slip or strike slip with a small oblique component, and the geometry of the fault system includes a single fault, several parallel faults, and overlapping en echelon faults. We examine the variations in deformation due to changes in the width of the shear zone and due to changes in the shear strength of the faults. In models with weak faults the width of the shear zone has a considerable effect on the surficial extent and amplitude of the vertical and horizontal deformation and on the amount of rotation around horizontal and vertical axes. Strong fault models have more localized deformation at the tip of the faults, and the deformation is partly distributed outside the fault zone. The dimensions of large basins along strike-slip faults, such as the Rukwa and Dead Sea basins, and the absence of uplift around pull-apart basins fit models with weak faults better than models with strong faults. Our models also suggest that the length-to-width ratio of pull-apart basins depends on the width of the shear zone and the shear strength of the faults and is not constant as previously suggested. We show that pure strike-slip motion can produce tectonic features, such as elongate half grabens along a single fault, rotated blocks at the ends of parallel faults, or extension perpendicular to overlapping en echelon faults, which can be misinterpreted to indicate a regional component of extension. Zones of subsidence or uplift can become wider than expected for transform plate boundaries when a minor component of oblique motion is added to a system of parallel strike-slip faults.

Three-dimensional models of deformation near strike-slip faults

USGS Publications Warehouse

ten Brink, Uri S.; Katzman, Rafael; Lin, Jian

1996-01-01

We use three-dimensional elastic models to help guide the kinematic interpretation of crustal deformation associated with strike-slip faults. Deformation of the brittle upper crust in the vicinity of strike-slip fault systems is modeled with the assumption that upper crustal deformation is driven by the relative plate motion in the upper mantle. The driving motion is represented by displacement that is specified on the bottom of a 15-km-thick elastic upper crust everywhere except in a zone of finite width in the vicinity of the faults, which we term the “shear zone.” Stress-free basal boundary conditions are specified within the shear zone. The basal driving displacement is either pure strike slip or strike slip with a small oblique component, and the geometry of the fault system includes a single fault, several parallel faults, and overlapping en echelon faults. We examine the variations in deformation due to changes in the width of the shear zone and due to changes in the shear strength of the faults. In models with weak faults the width of the shear zone has a considerable effect on the surficial extent and amplitude of the vertical and horizontal deformation and on the amount of rotation around horizontal and vertical axes. Strong fault models have more localized deformation at the tip of the faults, and the deformation is partly distributed outside the fault zone. The dimensions of large basins along strike-slip faults, such as the Rukwa and Dead Sea basins, and the absence of uplift around pull-apart basins fit models with weak faults better than models with strong faults. Our models also suggest that the length-to-width ratio of pull-apart basins depends on the width of the shear zone and the shear strength of the faults and is not constant as previously suggested. We show that pure strike-slip motion can produce tectonic features, such as elongate half grabens along a single fault, rotated blocks at the ends of parallel faults, or extension perpendicular to overlapping en echelon faults, which can be misinterpreted to indicate a regional component of extension. Zones of subsidence or uplift can become wider than expected for transform plate boundaries when a minor component of oblique motion is added to a system of parallel strike-slip faults.

Factorizing the motion sensitivity function into equivalent input noise and calculation efficiency.

PubMed

Allard, Rémy; Arleo, Angelo

2017-01-01

The photopic motion sensitivity function of the energy-based motion system is band-pass peaking around 8 Hz. Using an external noise paradigm to factorize the sensitivity into equivalent input noise and calculation efficiency, the present study investigated if the variation in photopic motion sensitivity as a function of the temporal frequency is due to a variation of equivalent input noise (e.g., early temporal filtering) or calculation efficiency (ability to select and integrate motion). For various temporal frequencies, contrast thresholds for a direction discrimination task were measured in presence and absence of noise. Up to 15 Hz, the sensitivity variation was mainly due to a variation of equivalent input noise and little variation in calculation efficiency was observed. The sensitivity fall-off at very high temporal frequencies (from 15 to 30 Hz) was due to a combination of a drop of calculation efficiency and a rise of equivalent input noise. A control experiment in which an artificial temporal integration was applied to the stimulus showed that an early temporal filter (generally assumed to affect equivalent input noise, not calculation efficiency) could impair both the calculation efficiency and equivalent input noise at very high temporal frequencies. We conclude that at the photopic luminance intensity tested, the variation of motion sensitivity as a function of the temporal frequency was mainly due to early temporal filtering, not to the ability to select and integrate motion. More specifically, we conclude that photopic motion sensitivity at high temporal frequencies is limited by internal noise occurring after the transduction process (i.e., neural noise), not by quantal noise resulting from the probabilistic absorption of photons by the photoreceptors as previously suggested.

Analysis and Modeling of a Two-Phase Jet Pump of a Thermal Management System for Aerospace Applications

NASA Technical Reports Server (NTRS)

Sherif, S.A.; Hunt, P. L.; Holladay, J. B.; Lear, W. E.; Steadham, J. M.

1998-01-01

Jet pumps are devices capable of pumping fluids to a higher pressure by inducing the motion of a secondary fluid employing a high speed primary fluid. The main components of a jet pump are a primary nozzle, secondary fluid injectors, a mixing chamber, a throat, and a diffuser. The work described in this paper models the flow of a two-phase primary fluid inducing a secondary liquid (saturated or subcooled) injected into the jet pump mixing chamber. The model is capable of accounting for phase transformations due to compression, expansion, and mixing. The model is also capable of incorporating the effects of the temperature and pressure dependency in the analysis. The approach adopted utilizes an isentropic constant pressure mixing in the mixing chamber and at times employs iterative techniques to determine the flow conditions in the different parts of the jet pump.

A single camera roentgen stereophotogrammetry method for static displacement analysis.

PubMed

Gussekloo, S W; Janssen, B A; George Vosselman, M; Bout, R G

2000-06-01

A new method to quantify motion or deformation of bony structures has been developed, since quantification is often difficult due to overlaying tissue, and the currently used roentgen stereophotogrammetry method requires significant investment. In our method, a single stationary roentgen source is used, as opposed to the usual two, which, in combination with a fixed radiogram cassette holder, forms a camera with constant interior orientation. By rotating the experimental object, it is possible to achieve a sufficient angle between the various viewing directions, enabling photogrammetric calculations. The photogrammetric procedure was performed on digitised radiograms and involved template matching to increase accuracy. Co-ordinates of spherical markers in the head of a bird (Rhea americana), were calculated with an accuracy of 0.12mm. When these co-ordinates were used in a deformation analysis, relocations of about 0.5mm could be accurately determined.

Peristalsis of nonconstant viscosity Jeffrey fluid with nanoparticles

NASA Astrophysics Data System (ADS)

Alvi, N.; Latif, T.; Hussain, Q.; Asghar, S.

Mixed convective peristaltic activity of variable viscosity nanofluids is addressed. Unlike the conventional consideration of constant viscosity; the viscosity is taken as temperature dependent. Constitutive relations for linear viscoelastic Jeffrey fluid are employed and uniform magnetic field is applied in the transverse direction. For nanofluids, the formulation is completed in presence of Brownian motion, thermophoresis, viscous dissipation and Joule heating. Consideration of temperature dependence of viscosity is not a choice but the realistic requirement of the wall temperature and the heat generated due to the viscous dissipation. Well established large wavelength and small Reynolds number approximations are invoked. Non-linear coupled system is analytically solved for the convergent series solutions identifying the interval of convergence explicitly. A comparative study between analytical and numerical solution is made for certainty. Influence of the parameters undertaken for the description of the problem is pointed out and its physics explained.

Revisiting the NVSS number count dipole

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tiwari, Prabhakar; Nusser, Adi, E-mail: ptiwari@physics.technion.ac.il, E-mail: adi@physics.technion.ac.il

We present a realistic modeling of the dipole component of the projected sky distribution of NVSS radio galaxies. The modeling relies on mock catalogs generated within the context of ΛCDM cosmology, in the linear regime of structure formation. After removing the contribution from the solar motion, the mocks show that the remaining observed signal is mostly (70%) due to structures within z ∼< 0.1. The amplitude of the model signal depends on the bias factor b of the NVSS mock galaxies. For sources with flux density, S > 15 mJy, the bias recipe inferred from higher order moments is consistent with the observed dipole signalmore » at 2.12σ. Flux thresholds above 20 mJy yield a disagreement close to the 3σ level. A constant high bias, b = 3 is needed to mitigate the tension to the ∼ 2.3σ level.« less

Free-volume characteristics of epoxies

NASA Technical Reports Server (NTRS)

Singh, Jag J.; Eftekhari, Abe; Shultz, William J.; St.clair, Terry L.

1992-01-01

Positron annihilation spectroscopy was used to measure free-volume characteristics of selected epoxies. Fluorene resins, a new family of high-temperature thermosetting resins, were selected as the test medium. Experimental results indicate that the free-volume cell size V sub f varies with the molecular weight between the cross-links M sub c according to an equation of the form V sub f = AM sub c sup B, where A and B are structural constants. In two of the samples, the concentration of bulky fluorene groups was increased in the network backbone by replacement of some of the conventional bisphenol A epoxy resin with fluorene-derived epoxy resin. This resulted in an increase in their glass transition temperature for a given level of cross-linking. It was found that in these samples, the Doppler broadening of the annihilation peak decreases with the increasing fluorene content, presumably due to enhanced damping of the chain motions.

[Reconstruction of an iatrogenic acromial pseudarthrosis: a case report].

PubMed

Liodakis, E; Kenawey, M; Petri, M; Liodaki, E; Hankemeier, S; Krettek, C; Jagodzinski, M

2011-06-01

Acromial fractures are rare but severe complications which can occur during subacromial decompression. We report a case of acromial pseudarthrosis which was discovered belatedly due to persistent pain after several operations. The pseudarthrosis was successfully treated by osteosynthesis with a distal radius plate and implantation of a monocortical bone graft from the iliac crest. Two years after surgery, the fracture has healed and the patient's pain improved significantly. In the constant score the patient achieved postoperatively 58 points compared to 25 points before surgery and 65 points compared to 25 points preoperatively in the subjective shoulder rating system (SSRS). Postoperatively, the patient had a better range of motion with active abduction/adduction of 50/0/25º (30/0/20° preoperatively), outward rotation/inward rotation of 35/0/45º (30/0/30° preoperatively) and anteversion/retroversion of 60/0/35° (35/0/20° preoperatively).

Wireless power delivery for retinal prostheses.

PubMed

Ng, David C; Williams, Chris E; Allen, Penny J; Bai, Shun; Boyd, Clive S; Meffin, Hamish; Halpern, Mark E; Skafidas, Efstratios

2011-01-01

Delivering power to an implanted device located deep inside the body is not trivial. This problem is made more challenging if the implanted device is in constant motion. This paper describes two methods of transferring power wirelessly by means of magnetic induction coupling. In the first method, a pair of transmit and receive coils is used for power transfer over a large distance (compared to their diameter). In the second method, an intermediate pair of coils is inserted in between transmit and receive coils. Comparison between the power transfer efficiency with and without the intermediate coils shows power transfer efficiency to be 11.5 % and 8.8 %, respectively. The latter method is especially suitable for powering implanted devices in the eye due to immunity to movements of the eye and ease of surgery. Using this method, we have demonstrated wireless power delivery into an animal eye.

Enhancing nanoparticle electrodynamics with gold nanoplate mirrors.

PubMed

Yan, Zijie; Bao, Ying; Manna, Uttam; Shah, Raman A; Scherer, Norbert F

2014-05-14

Mirrors and optical cavities can modify and enhance matter-radiation interactions. Here we report that chemically synthesized Au nanoplates can serve as micrometer-size mirrors that enhance electrodynamic interactions. Because of their plasmonic properties, the Au nanoplates enhance the brightness of scattered light from Ag nanoparticles near the nanoplate surface in dark-field microscopy. More importantly, enhanced optical trapping and optical binding of Ag nanoparticles are demonstrated in interferometric optical traps created from a single laser beam and its reflection from individual Au nanoplates. The enhancement of the interparticle force constant is ≈20-fold more than expected from the increased intensity due to standing wave interference. We show that the additional stability for optical binding arises from the restricted axial thermal motion of the nanoparticles that couples to and reduces the fluctuations in the lateral plane. This new mechanism greatly advances the photonic synthesis of ultrastable nanoparticle arrays and investigation of their properties.

ACCURATE LOW-MASS STELLAR MODELS OF KOI-126

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feiden, Gregory A.; Chaboyer, Brian; Dotter, Aaron, E-mail: gregory.a.feiden@dartmouth.edu

2011-10-10

The recent discovery of an eclipsing hierarchical triple system with two low-mass stars in a close orbit (KOI-126) by Carter et al. appeared to reinforce the evidence that theoretical stellar evolution models are not able to reproduce the observational mass-radius relation for low-mass stars. We present a set of stellar models for the three stars in the KOI-126 system that show excellent agreement with the observed radii. This agreement appears to be due to the equation of state implemented by our code. A significant dispersion in the observed mass-radius relation for fully convective stars is demonstrated; indicative of the influencemore » of physics currently not incorporated in standard stellar evolution models. We also predict apsidal motion constants for the two M dwarf companions. These values should be observationally determined to within 1% by the end of the Kepler mission.« less

Using a Smart-pulley Atwood machine to study rocket motion

NASA Astrophysics Data System (ADS)

Greenwood, M. Stautberg; Bernett, R.; Benavides, M.; Granger, S.; Plass, R.; Walters, S.

1989-10-01

The Atwood machine consisted of a funnel partly filled with water on one side and a fixed mass of 400 g on the other side. The ``rocket'' begins to ascend when the acceleration is momentarily zero. This occurs when the total mass of the rocket is slightly larger than 400 g due to the rocket's thrust. As the wheel of Pasco's Smart pulley rotates, signals are sent to the Apple computer and the software generates tables and graphs of position, speed, and acceleration as a function of time. Also presented is a numerical differentiation scheme that greatly reduces the scatter in the experimental data for the acceleration. The data are compared with theory, assuming that dm/dt is constant. The value of dm/dt necessary to fit the data is compared with that found by measuring the flow rate from the funnel directly. Excellent agreement is obtained for the two values of dm/dt.

On the dynamics of a small body under the influence of a Maxwell ring-type N-body system with a spheroidal central body: Focal curves

NASA Astrophysics Data System (ADS)

Kalvouridis, T.; Fakis, D.

2013-09-01

One of the most interesting aspects which characterize the dynamics of a small body under the influence of a regular polygon formation of N bodies with a spheroidal central primary, is related to the zero-velocity surfaces which, for a given set of the problem's parameters, separate the regions where particle planar motion is permitted from those where this motion is impossible. The non-sphericity of the central primary is here described by adding an inverse cube corrective term to Newton's law of gravitation, when applied both between the central primary and a peripheral one and between this primary and the small body. A similar expression of the potential including a corrective term was proposed by Manev in 1924 in his effort to describe some special physical properties of a body like radiation emission, or to explain some relativistic effects without using the theory of relativity. The version of the problem we deal with, is characterized by three parameters, namely, the number ?=N-1 of the peripheral primaries, the mass parameter (ratio of the central mass m0 to the mass m of a peripheral body) and the oblateness parameter e, which appears in the non-Newtonian term of the force function related to the central primary. Parameter ? takes only positive values, while parameter e can take small real values either positive (oblate body) or negative (prolate body). By using the existing Jacobian-type integral which characterizes the planar motion of the particle in the synodic coordinate system Oxyz located at the mass center O of the system, and by superposing the zerovelocity surfaces C=C(x,y, z=0; ?, e) (where C is the Jacobian constant) drawn for a given configuration ?, we observe that: (i) when e is kept constant and ? varies, then the central parts of all these surfaces ,which evolve around the central primary, intersect along one continuous curve while, (ii) when ? is kept constant and e varies, then, depending on either positive or negative values of e, the central parts of all these surfaces intersect along either one or two common continuous curves respectively. We call these curves focal curves due to their aforementioned property. As it is expected, they display all the symmetry elements of the primaries arrangement in rotations around an axis perpendicular to the xy-plane through an angle 2?/?. We shall prove that in case (i) the focal curve is independent of parameter e, while in case (ii) the focal curves (or curve) are independent of parameter ?. It should be noted that, a similar property concerning the zero-velocity surfaces has been discovered by one of the present authors (Kalvouridis, 2004) during the investigation of the particle dynamics in the Newtonian field of a regular polygon formation of N spherical massive bodies. Another aspect dealt with in the present paper, is the mechanism of the parametric evolution of the focal curves and the effects of this property on the equilibrium locations and the periodic motions of the particle.

Solvent Electrostatic Response: From Simple Solutes to Proteins

NASA Astrophysics Data System (ADS)

Dinpajooh, Mohammadhasan

How water behaves at interfaces is relevant to many scientific and technological applications; however, many subtle phenomena are unknown in aqueous solutions. In this work, interfacial structural transition in hydration shells of a polarizable solute at critical polarizabilities is discovered. The transition is manifested in maximum water response, the reorientation of the water dipoles at the interface, and an increase in the density of dangling OH bonds. This work also addresses the role of polarizability of the active site of proteins in biological catalytic reactions. For proteins, the hydration shell becomes very heterogeneous and involves a relatively large number of water molecules. The molecular dynamics simulations show that the polarizability, along with the atomic charge distribution, needs to be a part of the picture describing how enzymes work. Non Gaussian dynamics in time-resolved linear and nonlinear (correlation) 2D spectra are also analyzed. Additionally, a theoretical formalism is presented to show that when preferential orientations of water dipoles exist at the interface, electrophoretic charges can be produced without free charge carriers, i.e., neutral solutes can move in a constant electric field due to the divergence of polarization at the interface. Furthermore, the concept of interface susceptibility is introduced. It involves the fluctuations of the surface charge density caused by thermal motion and its correlation over the characteristic correlation length with the fluctuations of the solvent charge density. Solvation free energy and interface dielectric constant are formulated accordingly. Unlike previous approaches, the solvation free energy scales quite well in a broad range of ion sizes, namely in the range of 2-14 A. Interface dielectric constant is defined such that the boundary conditions in the Laplace equation describing a micro- or mesoscopic interface are satisfied. The effective dielectric constant of interfacial water is found to be significantly lower than its bulk value. Molecular dynamics simulation results show that the interface dielectric constant for a TIP3P water model changes from nine to four when the effective solute radius is increased from 5 Ato 18 A. The small value of the interface dielectric constant of water has potentially dramatic consequences for hydration.

Whole-Motion Model of Perception during Forward- and Backward-Facing Centrifuge Runs

PubMed Central

Holly, Jan E.; Vrublevskis, Arturs; Carlson, Lindsay E.

2009-01-01

Illusory perceptions of motion and orientation arise during human centrifuge runs without vision. Asymmetries have been found between acceleration and deceleration, and between forward-facing and backward-facing runs. Perceived roll tilt has been studied extensively during upright fixed-carriage centrifuge runs, and other components have been studied to a lesser extent. Certain, but not all, perceptual asymmetries in acceleration-vs-deceleration and forward-vs-backward motion can be explained by existing analyses. The immediate acceleration-deceleration roll-tilt asymmetry can be explained by the three-dimensional physics of the external stimulus; in addition, longer-term data has been modeled in a standard way using physiological time constants. However, the standard modeling approach is shown in the present research to predict forward-vs-backward-facing symmetry in perceived roll tilt, contradicting experimental data, and to predict perceived sideways motion, rather than forward or backward motion, around a curve. The present work develops a different whole-motion-based model taking into account the three-dimensional form of perceived motion and orientation. This model predicts perceived forward or backward motion around a curve, and predicts additional asymmetries such as the forward-backward difference in roll tilt. This model is based upon many of the same principles as the standard model, but includes an additional concept of familiarity of motions as a whole. PMID:19208962

(In)validity of the constant field and constant currents assumptions in theories of ion transport.

PubMed Central

Syganow, A; von Kitzing, E

1999-01-01

Constant electric fields and constant ion currents are often considered in theories of ion transport. Therefore, it is important to understand the validity of these helpful concepts. The constant field assumption requires that the charge density of permeant ions and flexible polar groups is virtually voltage independent. We present analytic relations that indicate the conditions under which the constant field approximation applies. Barrier models are frequently fitted to experimental current-voltage curves to describe ion transport. These models are based on three fundamental characteristics: a constant electric field, negligible concerted motions of ions inside the channel (an ion can enter only an empty site), and concentration-independent energy profiles. An analysis of those fundamental assumptions of barrier models shows that those approximations require large barriers because the electrostatic interaction is strong and has a long range. In the constant currents assumption, the current of each permeating ion species is considered to be constant throughout the channel; thus ion pairing is explicitly ignored. In inhomogeneous steady-state systems, the association rate constant determines the strength of ion pairing. Among permeable ions, however, the ion association rate constants are not small, according to modern diffusion-limited reaction rate theories. A mathematical formulation of a constant currents condition indicates that ion pairing very likely has an effect but does not dominate ion transport. PMID:9929480

Substitution and protonation effects on spin-spin coupling constants in prototypical aromatic rings: C6H6, C5H5N and C5H5P.

PubMed

Del Bene, Janet E; Elguero, José

2006-08-01

Ab initio equation-of-motion coupled cluster calculations have been carried out to evaluate one-, two-, and three-bond 13C-13C, 15N-13C, 31P-13C coupling constants in benzene, pyridine, pyridinium, phosphinine, and phosphininium. The introduction of N or P heteroatoms into the aromatic ring not only changes the magnitudes of the corresponding X-C coupling constants (J, for X = C, N, or P) but also the signs and magnitudes of corresponding reduced coupling constants (K). Protonation of the heteroatoms also produces dramatic changes in coupling constants and, by removing the lone pair of electrons from the sigma-electron framework, leads to the same signs for corresponding reduced coupling constants for benzene, pyridinium, and phosphininium. C-C coupling constants are rather insensitive to the presence of the heteroatoms and protonation. All terms that contribute to the total coupling constant (except for the diamagnetic spin-orbit (DSO) term) must be computed if good agreement with experimental data is to be obtained. Copyright 2006 John Wiley & Sons, Ltd.

Low Cost Beam-Steering Approach for a Series-Fed Array

NASA Technical Reports Server (NTRS)

Host, Nicholas K.; Chen, Chi-Chih; Volakis, John L.; Miranda, Felix A.

2013-01-01

Phased array antennas showcase many advantages over mechanically steered systems. However, they are also more complex and costly. This paper presents a concept which overcomes these detrimental attributes by eliminating all of the phased array backend (including phase shifters). Instead, a propagation constant reconfigurable transmission line in a series fed array arrangement is used to allow phase shifting with one small (less than or equal to 100mil) linear mechanical motion. A novel slotted coplanar stripline design improves on previous transmission lines by demonstrating a greater control of propagation constant, thus allowing practical prototypes to be built. Also, beam steering pattern control is explored. We show that with correct choice of line impedance, pattern control is possible for all scan angles. A 20 element array scanning from -25 deg less than or equal to theta less than or equal to 21 deg. with mostly uniform gain at 13GHz is presented. Measured patterns show a reduced scan range of 12 deg. less than or equal to theta less than or equal to 25 deg. due to a correctable manufacturing error as verified by simulation. Beam squint is measured to be plus or minus 2.5 deg for a 600MHz bandwidth and cross-pol is measured to be at least -15dB.

Aging effect in pattern, motion and cognitive visual evoked potentials.

PubMed

Kuba, Miroslav; Kremláček, Jan; Langrová, Jana; Kubová, Zuzana; Szanyi, Jana; Vít, František

2012-06-01

An electrophysiological study on the effect of aging on the visual pathway and various levels of visual information processing (primary cortex, associate visual motion processing cortex and cognitive cortical areas) was performed. We examined visual evoked potentials (VEPs) to pattern-reversal, motion-onset (translation and radial motion) and visual stimuli with a cognitive task (cognitive VEPs - P300 wave) at luminance of 17 cd/m(2). The most significant age-related change in a group of 150 healthy volunteers (15-85 years of age) was the increase in the P300 wave latency (2 ms per 1 year of age). Delays of the motion-onset VEPs (0.47 ms/year in translation and 0.46 ms/year in radial motion) and the pattern-reversal VEPs (0.26 ms/year) and the reductions of their amplitudes with increasing subject age (primarily in P300) were also found to be significant. The amplitude of the motion-onset VEPs to radial motion remained the most constant parameter with increasing age. Age-related changes were stronger in males. Our results indicate that cognitive VEPs, despite larger variability of their parameters, could be a useful criterion for an objective evaluation of the aging processes within the CNS. Possible differences in aging between the motion-processing system and the form-processing system within the visual pathway might be indicated by the more pronounced delay in the motion-onset VEPs and by their preserved size for radial motion (a biologically significant variant of motion) compared to the changes in pattern-reversal VEPs. Copyright © 2012 Elsevier Ltd. All rights reserved.

Contrast gain control in first- and second-order motion perception.

PubMed

Lu, Z L; Sperling, G

1996-12-01

A novel pedestal-plus-test paradigm is used to determine the nonlinear gain-control properties of the first-order (luminance) and the second-order (texture-contrast) motion systems, that is, how these systems' responses to motion stimuli are reduced by pedestals and other masking stimuli. Motion-direction thresholds were measured for test stimuli consisting of drifting luminance and texture-contrast-modulation stimuli superimposed on pedestals of various amplitudes. (A pedestal is a static sine-wave grating of the same type and same spatial frequency as the moving test grating.) It was found that first-order motion-direction thresholds are unaffected by small pedestals, but at pedestal contrasts above 1-2% (5-10 x pedestal threshold), motion thresholds increase proportionally to pedestal amplitude (a Weber law). For first-order stimuli, pedestal masking is specific to the spatial frequency of the test. On the other hand, motion-direction thresholds for texture-contrast stimuli are independent of pedestal amplitude (no gain control whatever) throughout the accessible pedestal amplitude range (from 0 to 40%). However, when baseline carrier contrast increases (with constant pedestal modulation amplitude), motion thresholds increase, showing that gain control in second-order motion is determined not by the modulator (as in first-order motion) but by the carrier. Note that baseline contrast of the carrier is inherently independent of spatial frequency of the modulator. The drastically different gain-control properties of the two motion systems and prior observations of motion masking and motion saturation are all encompassed in a functional theory. The stimulus inputs to both first- and second-order motion process are normalized by feedforward, shunting gain control. The different properties arise because the modulator is used to control the first-order gain and the carrier is used to control the second-order gain.

Calibration of Subsurface Amplification Factors Using Surface/Borehole Strong-motion Records from the KiK-net

NASA Astrophysics Data System (ADS)

Hayashida, T.; Tajima, F.

2007-12-01

The Real-time Earthquake Information System (REIS, Horiuchi et al., 2005) detects earthquakes and determines event parameters using the Hi-net (High-sensitivity seismograph network Japan) data in Japan. The system also predicts the arrival time and seismic intensity at a given site before ground motions arrive. Here, the seismic intensity is estimated based on the intensity magnitude which is derived from data of the Hi-net. As the Hi-net stations are located in the boreholes, intensity estimation on the ground surface is evaluated using a constant for subsurface amplification. But the estimated intensities based on the conventionally used amplification constants are not always in agreement with those observed at specific sites on the ground surface. The KiK-net (KIBAN Kyoshin network Japan) consists of strong motion instruments. Each station has two sets of accelerometers, one set is installed on the ground surface and the other one is co-located with a Hi-net station in the borehole. We use data recorded at the KiK-net stations to calibrate subsurface site amplification factors between the borehole and the ground surface. We selected data recorded for over 200 events during the period of 1997 to 2006 in Hiroshima prefecture and calculated the ratios of peak velocity amplitudes on the ground surface ( Asurf) to those in the borehole ( Abor). The subsurface amplification varies from station to station showing dependency on the propagation distance as well as on the incident direction of seismic waves. Results suggest that the site amplification factors shall be described as a function of distance and incident direction, and are not constants. Thus, we derived empirical amplification formulas between Asurf and the peak velocity amplitudes on the engineering bedrock ( Abed) as a function of distance in place of the conventionally used amplification constants. Here, the engineering bedrock is defined as the depth where the S- wave velocity is 600 m/s. The estimated intensities show substantial improvement in the accuracy at most stations as compared with those calculated using conventional constants. When the amplification dependence on the incident direction was accounted for, the estimated intensities somewhat improved. This calibration will help an earthquake early warning system such as REIS provide more accurate intensity estimates.

Main Ethiopian Rift Kinematic analogue modeling: Implications for Nubian-Somalian plate motion.

NASA Astrophysics Data System (ADS)

Erbello, A.; Corti, G.; Sani, F.; Agostini, A.; Buccianti, A.; Kidane, T. B.

2016-12-01

In this contribution, analogue modeling is used to provide new insights into the kinematics of the Nubia and Somalia plates responsible for development and evolution of the Main Ethiopian Rift (MER), at the northern termination of the East African Rift. In particular, we performed new crustal-scale, brittle models to analyze the along-strike variations in fault architecture in the MER and their relations with the rift trend, plate motion and the resulting Miocene-recent kinematics of rifting. The models reproduced the overall geometry of the 600km-long MER with its along-strike variation in orientation to test different hypothesis proposed to explain rift evolution. Analysis of model results in terms of statistics of fault length and orientation, as well as deformation architecture, and its comparison with the MER suggests that models of two-phase rifting (with a first phase of NW-SE extension followed by E-W rifting) or constant NW-SE extension, as well as models of constant ENE-WSW rifting are not able to reproduce the fault architecture observed in nature. Model results suggest instead that the rift has likely developed under a constant, post-11 Ma extension oriented roughly ESE-WNW (N97.5°E), consistent with recent plate kinematics models.

Time-to-Passage Judgments in Nonconstant Optical Flow Fields

NASA Technical Reports Server (NTRS)

Kaiser, Mary K.; Hecht, Heiko

1995-01-01

The time until an approaching object will pass an observer (time to passage, or TTP) is optically specified by a global flow field even in the absence of local expansion or size cues. Kaiser and Mowafy have demonstrated that observers are in fact sensitive to this global flow information. The present studies investigate two factors that are usually ignored in work related to TTP: (1) non-constant motion functions and (2) concomitant eye rotation. Non-constant velocities violate an assumption of some TTP derivations, and eye rotations may complicate heading extraction. Such factors have practical significance, for example, in the case of a pilot accelerating an aircraft or executing a roll. In our studies, a flow field of constant-sized stars was presented monocularly on a large screen. TIP judgments had to be made on the basis of one target star. The flow field varied in its acceleration pattern and its roll component. Observers did not appear to utilize acceleration information. In particular, TTP with decelerating motion were consistently underestimated. TTP judgments were fairly robust with respect to roll, even when roll axis and track vector were decoupled. However, substantial decoupling between heading and track vector led to a decrement in performance, in both the presence and the absence of roll.

Visual Target Tracking in the Presence of Unknown Observer Motion

NASA Technical Reports Server (NTRS)

Williams, Stephen; Lu, Thomas

2009-01-01

Much attention has been given to the visual tracking problem due to its obvious uses in military surveillance. However, visual tracking is complicated by the presence of motion of the observer in addition to the target motion, especially when the image changes caused by the observer motion are large compared to those caused by the target motion. Techniques for estimating the motion of the observer based on image registration techniques and Kalman filtering are presented and simulated. With the effects of the observer motion removed, an additional phase is implemented to track individual targets. This tracking method is demonstrated on an image stream from a buoy-mounted or periscope-mounted camera, where large inter-frame displacements are present due to the wave action on the camera. This system has been shown to be effective at tracking and predicting the global position of a planar vehicle (boat) being observed from a single, out-of-plane camera. Finally, the tracking system has been extended to a multi-target scenario.

Navier-Stokes predictions of pitch damping for axisymmetric shell using steady coning motion

NASA Technical Reports Server (NTRS)

Weinacht, Paul; Sturek, Walter B.; Schiff, Lewis B.

1991-01-01

Previous theoretical investigations have proposed that the side force and moment acting on a body of revolution in steady coning motion could be related to the pitch-damping force and moment. In the current research effort, this approach is applied to produce predictions of the pitch damping for axisymmetric shell. The flow fields about these projectiles undergoing steady coning motion are successfully computed using a parabolized Navier-Stokes computational approach which makes use of a rotating coordinate frame. The governing equations are modified to include the centrifugal and Coriolis force terms due to the rotating coordinate frame. From the computed flow field, the side moments due to coning motion, spinning motion, and combined spinning and coning motion are used to determine the pitch-damping coefficients. Computations are performed for two generic shell configurations, a secant-ogive-cylinder and a secant-ogive-cylinder-boattail.

Early arthroscopic release in stiff shoulder

PubMed Central

Sabat, Dhananjaya; Kumar, Vinod

2008-01-01

Purpose: To evaluate the results of early arthroscopic release in the patients of stiff shoulder Methods: Twenty patients of stiff shoulder, who had symptoms for at least three months and failed to improve with steroid injections and physical therapy of 6 weeks duration, underwent arthroscopic release. The average time between onset of symptoms and the time of surgery was 4 months and 2 weeks. The functional outcome was evaluated using ASES and Constant and Murley scoring systems. Results: All the patients showed significant improvement in the range of motion and relief of pain by end of three months following the procedure. At 12 months, mean improvement in ASES score is 38 points and Constant and Murley score is 4O.5 points. All patients returned to work by 3-5 months (average -4.5 months). Conclusion: Early arthroscopic release showed promising results with reliable increase in range of motion, early relief of symptoms and consequent early return to work. So it is highly recommended in properly selected patients. Level of evidence: Level IV PMID:20300309

Superintegrability of the Fock-Darwin system

NASA Astrophysics Data System (ADS)

Drigho-Filho, E.; Kuru, Ş.; Negro, J.; Nieto, L. M.

2017-08-01

The Fock-Darwin system is analyzed from the point of view of its symmetry properties in the quantum and classical frameworks. The quantum Fock-Darwin system is known to have two sets of ladder operators, a fact which guarantees its solvability. We show that for rational values of the quotient of two relevant frequencies, this system is superintegrable, the quantum symmetries being responsible for the degeneracy of the energy levels. These symmetries are of higher order and close a polynomial algebra. In the classical case, the ladder operators are replaced by ladder functions and the symmetries by constants of motion. We also prove that the rational classical system is superintegrable and its trajectories are closed. The constants of motion are also generators of symmetry transformations in the phase space that have been integrated for some special cases. These transformations connect different trajectories with the same energy. The coherent states of the quantum superintegrable system are found and they reproduce the closed trajectories of the classical one.

Real-time motion-based H.263+ frame rate control

NASA Astrophysics Data System (ADS)

Song, Hwangjun; Kim, JongWon; Kuo, C.-C. Jay

1998-12-01

Most existing H.263+ rate control algorithms, e.g. the one adopted in the test model of the near-term (TMN8), focus on the macroblock layer rate control and low latency under the assumptions of with a constant frame rate and through a constant bit rate (CBR) channel. These algorithms do not accommodate the transmission bandwidth fluctuation efficiently, and the resulting video quality can be degraded. In this work, we propose a new H.263+ rate control scheme which supports the variable bit rate (VBR) channel through the adjustment of the encoding frame rate and quantization parameter. A fast algorithm for the encoding frame rate control based on the inherent motion information within a sliding window in the underlying video is developed to efficiently pursue a good tradeoff between spatial and temporal quality. The proposed rate control algorithm also takes the time-varying bandwidth characteristic of the Internet into account and is able to accommodate the change accordingly. Experimental results are provided to demonstrate the superior performance of the proposed scheme.

Notch-Boosted Domain Wall Propagation in Magnetic Nanowires

NASA Astrophysics Data System (ADS)

Wang, Xiang Rong; Yuan, Hauiyang

Magnetic domain wall (DW) motion along a nanowire underpins many proposals of spintronic devices. High DW propagation velocity is obviously important because it determines the device speed. Thus it is interesting to search for effective control knobs of DW dynamics. We report a counter-intuitive finding that notches in an otherwise homogeneous magnetic nanowire can boost current-induced domain wall (DW) propagation. DW motion in notch-modulated wires can be classified into three phases: 1) A DW is pinned around a notch when the current density is below the depinning current density. 2) DW propagation velocity above the depinning current density is boosted by notches when non-adiabatic spin-transfer torque strength is smaller than the Gilbert damping constant. The boost can be many-fold. 3) DW propagation velocity is hindered when non-adiabatic spin-transfer torque strength is larger than the Gilbert damping constant. This work was supported by Hong Kong GRF Grants (Nos. 163011151 and 605413) and the Grant from NNSF of China (No. 11374249).

On the classical and quantum integrability of systems of resonant oscillators

NASA Astrophysics Data System (ADS)

Marino, Massimo

2017-01-01

We study in this paper systems of harmonic oscillators with resonant frequencies. For these systems we present general procedures for the construction of sets of functionally independent constants of motion, which can be used for the definition of generalized actionangle variables, in accordance with the general description of degenerate integrable systems which was presented by Nekhoroshev in a seminal paper in 1972. We then apply to these classical integrable systems the procedure of quantization which has been proposed to the author by Nekhoroshev during his last years of activity at Milan University. This procedure is based on the construction of linear operators by means of the symmetrization of the classical constants of motion mentioned above. For 3 oscillators with resonance 1: 1: 2, by using a computer program we have discovered an exceptional integrable system, which cannot be obtained with the standard methods based on the obvious symmetries of the Hamiltonian function. In this exceptional case, quantum integrability can be realized only by means of a modification of the symmetrization procedure.

An experimental study of the effect of mooring systems on the dynamics of a SPAR buoy-type floating offshore wind turbine

NASA Astrophysics Data System (ADS)

Hong, Sinpyo; Lee, Inwon; Park, Seong Hyeon; Lee, Cheolmin; Chun, Ho-Hwan; Lim, Hee Chang

2015-09-01

An experimental study of the effect of mooring systems on the dynamics of a SPAR buoy-type floating offshore wind turbine is presented. The effects of the Center of Gravity (COG), mooring line spring constant, and fair-lead location on the turbine's motion in response to regular waves are investigated. Experimental results show that for a typical mooring system of a SPAR buoy-type Floating Offshore Wind Turbine (FOWT), the effect of mooring systems on the dynamics of the turbine can be considered negligible. However, the pitch decreases notably as the COG increases. The COG and spring constant of the mooring line have a negligible effect on the fairlead displacement. Numerical simulation and sensitivity analysis show that the wind turbine motion and its sensitivity to changes in the mooring system and COG are very large near resonant frequencies. The test results can be used to validate numerical simulation tools for FOWTs.

On the Small Mass Limit of Quantum Brownian Motion with Inhomogeneous Damping and Diffusion

NASA Astrophysics Data System (ADS)

Lim, Soon Hoe; Wehr, Jan; Lampo, Aniello; García-March, Miguel Ángel; Lewenstein, Maciej

2018-01-01

We study the small mass limit (or: the Smoluchowski-Kramers limit) of a class of quantum Brownian motions with inhomogeneous damping and diffusion. For Ohmic bath spectral density with a Lorentz-Drude cutoff, we derive the Heisenberg-Langevin equations for the particle's observables using a quantum stochastic calculus approach. We set the mass of the particle to equal m = m0 ɛ , the reduced Planck constant to equal \\hbar = ɛ and the cutoff frequency to equal Λ = E_{Λ}/ɛ , where m_0 and E_{Λ} are positive constants, so that the particle's de Broglie wavelength and the largest energy scale of the bath are fixed as ɛ → 0. We study the limit as ɛ → 0 of the rescaled model and derive a limiting equation for the (slow) particle's position variable. We find that the limiting equation contains several drift correction terms, the quantum noise-induced drifts, including terms of purely quantum nature, with no classical counterparts.

Intercepting a moving target: On-line or model-based control?

PubMed

Zhao, Huaiyong; Warren, William H

2017-05-01

When walking to intercept a moving target, people take an interception path that appears to anticipate the target's trajectory. According to the constant bearing strategy, the observer holds the bearing direction of the target constant based on current visual information, consistent with on-line control. Alternatively, the interception path might be based on an internal model of the target's motion, known as model-based control. To investigate these two accounts, participants walked to intercept a moving target in a virtual environment. We degraded the target's visibility by blurring the target to varying degrees in the midst of a trial, in order to influence its perceived speed and position. Reduced levels of visibility progressively impaired interception accuracy and precision; total occlusion impaired performance most and yielded nonadaptive heading adjustments. Thus, performance strongly depended on current visual information and deteriorated qualitatively when it was withdrawn. The results imply that locomotor interception is normally guided by current information rather than an internal model of target motion, consistent with on-line control.

A finite volume Fokker-Planck collision operator in constants-of-motion coordinates

NASA Astrophysics Data System (ADS)

Xiong, Z.; Xu, X. Q.; Cohen, B. I.; Cohen, R.; Dorr, M. R.; Hittinger, J. A.; Kerbel, G.; Nevins, W. M.; Rognlien, T.

2006-04-01

TEMPEST is a 5D gyrokinetic continuum code for edge plasmas. Constants of motion, namely, the total energy E and the magnetic moment μ, are chosen as coordinate s because of their advantage in minimizing numerical diffusion in advection operato rs. Most existing collision operators are written in other coordinates; using them by interpolating is shown to be less satisfactory in maintaining overall numerical accuracy and conservation. Here we develop a Fokker-Planck collision operator directly in (E,μ) space usin g a finite volume approach. The (E, μ) grid is Cartesian, and the turning point boundary represents a straight line cutting through the grid that separates the ph ysical and non-physical zones. The resulting cut-cells are treated by a cell-mergin g technique to ensure a complete particle conservation. A two dimensional fourth or der reconstruction scheme is devised to achieve good numerical accuracy with modest number of grid points. The new collision operator will be benchmarked by numerical examples.

Femtosecond pump-probe photoionization-photofragmentation spectroscopy: photoionization-induced twisting and coherent vibrational motion of azobenzene cation.

PubMed

Ho, Jr-Wei; Chen, Wei-Kan; Cheng, Po-Yuan

2009-10-07

We report studies of ultrafast dynamics of azobenzene cation using femtosecond photoionization-photofragmentation spectroscopy. In our experiments, a femtosecond pump pulse first produces an ensemble of azobenzene cations via photoionization of the neutrals. A delayed probe pulse then brings the evolving ionic system to excited states that ultimately undergo ion fragmentation. The dynamics is followed by monitoring either the parent-ion depletion or fragment-ion formation as a function of the pump-probe delay time. The observed transients for azobenzene cation are characterized by a constant ion depletion modulated by a rapidly damped oscillatory signal with a period of about 1 ps. Theoretical calculations suggest that the oscillation arises from a vibration motion along the twisting inversion coordinate involving displacements in CNNC and phenyl-ring torsions. The oscillation is damped rapidly with a time constant of about 1.2 ps, suggesting that energy dissipation from the active mode to bath modes takes place in this time scale.

Global Plate Motions Relative to the Hotspots since 48 Ma B.P. from Simultaneous Inversion of Hotspot Tracks in the Pacific, Indian, and Atlantic Oceans Constrained to Consistency with Known Relative Plate Motions

NASA Astrophysics Data System (ADS)

Gordon, R. G.; Koivisto, E. A. L.

2016-12-01

A fundamental problem of global tectonics and paleomagnetism is determining what part of apparent polar wander is due to plate motion and what part is due to true polar wander. One approach for separating these is available if global hotspots can be used as a reference frame approximately fixed with respect to the deep mantle. Some other workers have used a hotspot reference based only on tracks in the Atlantic and Indian Oceans, and some have used reference frames with moving hotspots and many adjustable parameters. In sharp contrast to the assumptions made in these other works, our recent results demonstrate that there is no significant motion between the Pacific and Indo-Atlantic hotspots since 48 Ma B.P. (lower bound of zero and upper bound of 8-13 mm/yr [Koivisto et al., 2014]). Corrected methodologies combined with cumulative improvements in the age progression along the hotspot tracks, the geomagnetic reversal time scale, and relative plate reconstructions lead to significantly lower rates of motion between hotspots than found in prior studies. Building on our prior results, here we present a globally self-consistent estimate of plate motions relative to the hotspots for the past 48 million years from inversions to fit simultaneously the tracks of the Hawaiian, Louisville, Tristan da Cunha, Réunion, and Iceland hotspots constrained to consistency with known relative plate motions. Each finite rotation is estimated for an age corresponding to a key magnetic anomaly used in plate reconstructions. The new set of plate reconstructions presented here provides a firm basis for estimating absolute plate motions for the past 48 million years and, in particular, can be used to separate paleomagnetically determined apparent polar wander into the part due to plate motion and the part due to true polar wander. Implications for true polar wander since the age of the Hawaiian-Emperor Bend will be discussed.

The electromagnetic pendulum in quickly changing magnetic field of constant intensity

NASA Astrophysics Data System (ADS)

Rodyukov, F. F.; Shepeljavyi, A. I.

2018-05-01

The Lagrange-Maxwell equations for the pendulum in the form of a conductive frame, which is suspended in a uniform sinusoidal electromagnetic field of constant intensity, are obtained. The procedure for obtaining simplified mathematical models by a traditional method of separating fast and slow motions with subsiquent averaging a fast time is used. It is shown that this traditional approach may lead to inappropriate mathematical models. Suggested ways on how this can be avoided for the case are considered. The main statements by numerical experiments are illustrated.

On the response of superpressure balloons to displacements from equilibrium density level

NASA Technical Reports Server (NTRS)

Levanon, N.; Kushnir, Y.

1976-01-01

The response of a superpressure balloon to an initial displacement from its constant-density floating level is examined. An approximate solution is obtained to the governing vertical equation of motion for constant-density superpressure balloons. This solution is used to filter out neutrally buoyant oscillations in balloon records despite the nonlinear behavior of the balloon. The graph depicting the pressure data after deconvolution between the raw pressure data and the normalized balloon wavelet shows clearly the strong filtering-out of the neutral buoyancy oscillations.

Cold Working and Annealing Effects on the Creep and Rupture Resistance of the Oxide-Dispersion-Strengthened Alloy MA754

DTIC Science & Technology

1983-11-01

boundary sliding. As a result, the steady state creep rate will have the form: Es EDIS ÷ GBS where I DIS = strain rate from dislocation motion and 6GBS...prevent diffusion bonding between the specimen heads and grips. The test apparatus used to perform the tensile tests was an Instron- Satec furnace...testing was done utilizing leveled creep racks (12,000 lb. capacity) modified to produce constant load or constant stress. The furnaces were of the Satec

Time arrow is influenced by the dark energy.

PubMed

Allahverdyan, A E; Gurzadyan, V G

2016-05-01

The arrow of time and the accelerated expansion are two fundamental empirical facts of the universe. We advance the viewpoint that the dark energy (positive cosmological constant) accelerating the expansion of the universe also supports the time asymmetry. It is related to the decay of metastable states under generic perturbations, as we show on example of a microcanonical ensemble. These states will not be metastable without dark energy. The latter also ensures a hyperbolic motion leading to dynamic entropy production with the rate determined by the cosmological constant.

Robotic real-time translational and rotational head motion correction during frameless stereotactic radiosurgery

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Xinmin; Belcher, Andrew H.; Grelewicz, Zachary

Purpose: To develop a control system to correct both translational and rotational head motion deviations in real-time during frameless stereotactic radiosurgery (SRS). Methods: A novel feedback control with a feed-forward algorithm was utilized to correct for the coupling of translation and rotation present in serial kinematic robotic systems. Input parameters for the algorithm include the real-time 6DOF target position, the frame pitch pivot point to target distance constant, and the translational and angular Linac beam off (gating) tolerance constants for patient safety. Testing of the algorithm was done using a 4D (XY Z + pitch) robotic stage, an infrared headmore » position sensing unit and a control computer. The measured head position signal was processed and a resulting command was sent to the interface of a four-axis motor controller, through which four stepper motors were driven to perform motion compensation. Results: The control of the translation of a brain target was decoupled with the control of the rotation. For a phantom study, the corrected position was within a translational displacement of 0.35 mm and a pitch displacement of 0.15° 100% of the time. For a volunteer study, the corrected position was within displacements of 0.4 mm and 0.2° over 98.5% of the time, while it was 10.7% without correction. Conclusions: The authors report a control design approach for both translational and rotational head motion correction. The experiments demonstrated that control performance of the 4D robotic stage meets the submillimeter and subdegree accuracy required by SRS.« less

Decorrelation-based viscosity measurement using phase-sensitive optical coherence tomography (Conference Presentation)

NASA Astrophysics Data System (ADS)

Blackburn, Brecken J.; Gu, Shi; Jenkins, Michael W.; Rollins, Andrew M.

2017-02-01

A robust method to measure viscosity of microquantities of biological samples, such as blood and mucus, could lead to a better understanding and diagnosis of diseases. Microsamples have presented persistent challenges to conventional rheology, which requires bulk quantities of a sample. Alternatively, fluid viscosity can be probed by monitoring microscale motion of particles. Here, we present a decorrelation-based method using M-mode phase-sensitive optical coherence tomography (OCT) to measure particle Brownian motion. This is similar to previous methods using laser speckle decorrelation but with sensitivity to nanometer-scale displacement. This allows for the measurement of decorrelation in less than 1 millisecond and significantly decreases sensitivity to bulk motion, thereby potentially enabling in vivo and in situ applications. From first principles, an analytical method is established using M-mode images obtained from a 47 kHz spectral-domain OCT system. A g(1) first-order autocorrelation is calculated from windows containing several pixels over a time frame of 200-1000 microseconds. Total imaging time is 500 milliseconds for averaging purposes. The autocorrelation coefficient over this short time frame decreases linearly and at a rate proportional to the diffusion constant of the particles, allowing viscosity to be calculated. In verification experiments using phantoms of microbeads in 200 µL glycerol-water mixtures, this method showed insensitivity to 2 mm/s lateral bulk motion and accurate viscosity measurements over a depth of 400 µm. In addition, the method measured a significant decrease of the apparent diffusion constant of soft tissue after formalin fixation, suggesting potential applications in mapping tissue stiffness.

Stress Drop and Its Relationship to Radiated Energy, Ground Motion and Uncertainty

NASA Astrophysics Data System (ADS)

Baltay, A.

2014-12-01

Despite the seemingly diverse circumstances under which crustal earthquakes occur, scale-invariant stress drop and apparent stress, the ratio of radiated seismic energy to moment, is observed. The magnitude-independence of these parameters is central to our understanding of both earthquake physics and strong ground motion genesis. Estimates of stress drop and radiated energy, however, display large amounts of scatter potentially masking any secondary trends in the data. We investigate sources of this uncertainty within the framework of constant stress drop and apparent stress. We first re-visit estimates of energy and stress drop from a variety of earthquake observations and methods, for events ranging from magnitude ~2 to ~9. Using an empirical Green's function (eGf) deconvolution method, which removes the path and site effects, radiated energy and Brune stress drop are estimated for both regional events in the western US and Eastern Honshu, Japan from the HiNet network, as well as teleseismically recorded global great earthquakes [Baltay et al., 2010, 2011, 2014]. In addition to eGf methods, ground-motion based metrics for stress drop are considered, using both KikNet data from Japan [Baltay et al., 2013] and the NGA-West2 data, a very well curated ground-motion database. Both the eGf-based stress drop estimates and those from the NGA-West2 database show a marked decrease in scatter, allowing us to identify deterministic secondary trends in stress drop. We find both an increasing stress drop with depth, as well as a larger stress drop of about 30% on average for mainshock events as compared to on-fault aftershocks. While both of these effects are already included in some ground-motion prediction equations (GMPE), many previous seismological studies have been unable to conclusively uncover these trends because of their considerable scatter. Elucidating these effects in the context of reduced and quantified epistemic uncertainty can help both seismologists and engineers to understand the true aleatory variability of the earthquake source, which may be due to the complex and diverse circumstances under which these earthquake occur and which we are yet unable to model.

Behavior of a Liquid Bridge between Nonparallel Hydrophobic Surfaces.

PubMed

Ataei, Mohammadmehdi; Chen, Huanchen; Amirfazli, Alidad

2017-12-26

When a liquid bridge is formed between two nonparallel identical surfaces, it can move along the surfaces. Literature indicates that the direction of bridge movement is governed by the wettability of surfaces. When the surfaces are hydrophilic, the motion of the bridge is always toward the cusp (intersection of the plane of the two bounding surfaces). On the other hand, the movement is hitherto thought to be always pointing away from the cusp when the surfaces are hydrophobic. In this study, through experiments, numerical simulations, and analytical reasoning, we demonstrate that for hydrophobic surfaces, wettability is not the only factor determining the direction of the motion. A new geometrical parameter, i.e., confinement (cf), was defined as the ratio of the distance of the farthest contact point of the bridge to the cusp, and that of the closest contact point to the cusp. The direction of the motion depends on the amount of confinement (cf). When the distance between the surfaces is large (resulting in a small cf), the bridge tends to move toward the cusp through a pinning/depinning mechanism of contact lines. When the distance between the surfaces is small (large cf), the bridge tends to move away from the cusp. For a specific system, a maximum cf value (cf max ) exists. A sliding behavior (i.e., simultaneous advancing on the wider side and receding on the narrower side) can also be seen when a liquid bridge is compressed such that the cf exceeds the cf max . Contact angle hysteresis (CAH) is identified as an underpinning phenomenon that together with cf fundamentally explains the movement of a trapped liquid between two hydrophobic surfaces. If there is no CAH, however, i.e., the case of ideal hydrophobic surfaces, the cf will be a constant; we show that the bridge slides toward the cusp when it is stretched, while it slides away from the cusp when it is compressed (note sliding motion is different from motion due to pinning/depinning mechanism of contact lines). As such, the displacement is only related to geometrical parameters such as the amount of compression (or stretching) and the dihedral angle between the surfaces.

A Novel Approach for Dynamic Testing of Total Hip Dislocation under Physiological Conditions.

PubMed

Herrmann, Sven; Kluess, Daniel; Kaehler, Michael; Grawe, Robert; Rachholz, Roman; Souffrant, Robert; Zierath, János; Bader, Rainer; Woernle, Christoph

2015-01-01

Constant high rates of dislocation-related complications of total hip replacements (THRs) show that contributing factors like implant position and design, soft tissue condition and dynamics of physiological motions have not yet been fully understood. As in vivo measurements of excessive motions are not possible due to ethical objections, a comprehensive approach is proposed which is capable of testing THR stability under dynamic, reproducible and physiological conditions. The approach is based on a hardware-in-the-loop (HiL) simulation where a robotic physical setup interacts with a computational musculoskeletal model based on inverse dynamics. A major objective of this work was the validation of the HiL test system against in vivo data derived from patients with instrumented THRs. Moreover, the impact of certain test conditions, such as joint lubrication, implant position, load level in terms of body mass and removal of muscle structures, was evaluated within several HiL simulations. The outcomes for a normal sitting down and standing up maneuver revealed good agreement in trend and magnitude compared with in vivo measured hip joint forces. For a deep maneuver with femoral adduction, lubrication was shown to cause less friction torques than under dry conditions. Similarly, it could be demonstrated that less cup anteversion and inclination lead to earlier impingement in flexion motion including pelvic tilt for selected combinations of cup and stem positions. Reducing body mass did not influence impingement-free range of motion and dislocation behavior; however, higher resisting torques were observed under higher loads. Muscle removal emulating a posterior surgical approach indicated alterations in THR loading and the instability process in contrast to a reference case with intact musculature. Based on the presented data, it can be concluded that the HiL test system is able to reproduce comparable joint dynamics as present in THR patients.

A Novel Approach for Dynamic Testing of Total Hip Dislocation under Physiological Conditions

PubMed Central

Herrmann, Sven; Kluess, Daniel; Kaehler, Michael; Grawe, Robert; Rachholz, Roman; Souffrant, Robert; Zierath, János; Bader, Rainer; Woernle, Christoph

2015-01-01

Constant high rates of dislocation-related complications of total hip replacements (THRs) show that contributing factors like implant position and design, soft tissue condition and dynamics of physiological motions have not yet been fully understood. As in vivo measurements of excessive motions are not possible due to ethical objections, a comprehensive approach is proposed which is capable of testing THR stability under dynamic, reproducible and physiological conditions. The approach is based on a hardware-in-the-loop (HiL) simulation where a robotic physical setup interacts with a computational musculoskeletal model based on inverse dynamics. A major objective of this work was the validation of the HiL test system against in vivo data derived from patients with instrumented THRs. Moreover, the impact of certain test conditions, such as joint lubrication, implant position, load level in terms of body mass and removal of muscle structures, was evaluated within several HiL simulations. The outcomes for a normal sitting down and standing up maneuver revealed good agreement in trend and magnitude compared with in vivo measured hip joint forces. For a deep maneuver with femoral adduction, lubrication was shown to cause less friction torques than under dry conditions. Similarly, it could be demonstrated that less cup anteversion and inclination lead to earlier impingement in flexion motion including pelvic tilt for selected combinations of cup and stem positions. Reducing body mass did not influence impingement-free range of motion and dislocation behavior; however, higher resisting torques were observed under higher loads. Muscle removal emulating a posterior surgical approach indicated alterations in THR loading and the instability process in contrast to a reference case with intact musculature. Based on the presented data, it can be concluded that the HiL test system is able to reproduce comparable joint dynamics as present in THR patients. PMID:26717236

Tilt and Translation Motion Perception during Pitch Tilt with Visual Surround Translation

NASA Technical Reports Server (NTRS)

O'Sullivan, Brita M.; Harm, Deborah L.; Reschke, Millard F.; Wood, Scott J.

2006-01-01

The central nervous system must resolve the ambiguity of inertial motion sensory cues in order to derive an accurate representation of spatial orientation. Previous studies suggest that multisensory integration is critical for discriminating linear accelerations arising from tilt and translation head motion. Visual input is especially important at low frequencies where canal input is declining. The NASA Tilt Translation Device (TTD) was designed to recreate postflight orientation disturbances by exposing subjects to matching tilt self motion with conflicting visual surround translation. Previous studies have demonstrated that brief exposures to pitch tilt with foreaft visual surround translation produced changes in compensatory vertical eye movement responses, postural equilibrium, and motion sickness symptoms. Adaptation appeared greatest with visual scene motion leading (versus lagging) the tilt motion, and the adaptation time constant appeared to be approximately 30 min. The purpose of this study was to compare motion perception when the visual surround translation was inphase versus outofphase with pitch tilt. The inphase stimulus presented visual surround motion one would experience if the linear acceleration was due to foreaft self translation within a stationary surround, while the outofphase stimulus had the visual scene motion leading the tilt by 90 deg as previously used. The tilt stimuli in these conditions were asymmetrical, ranging from an upright orientation to 10 deg pitch back. Another objective of the study was to compare motion perception with the inphase stimulus when the tilts were asymmetrical relative to upright (0 to 10 deg back) versus symmetrical (10 deg forward to 10 deg back). Twelve subjects (6M, 6F, 22-55 yrs) were tested during 3 sessions separated by at least one week. During each of the three sessions (out-of-phase asymmetrical, in-phase asymmetrical, inphase symmetrical), subjects were exposed to visual surround translation synchronized with pitch tilt at 0.1 Hz for a total of 30 min. Tilt and translation motion perception was obtained from verbal reports and a joystick mounted on a linear stage. Horizontal vergence and vertical eye movements were obtained with a binocular video system. Responses were also obtained during darkness before and following 15 min and 30 min of visual surround translation. Each of the three stimulus conditions involving visual surround translation elicited a significantly reduced sense of perceived tilt and strong linear vection (perceived translation) compared to pre-exposure tilt stimuli in darkness. This increase in perceived translation with reduction in tilt perception was also present in darkness following 15 and 30 min exposures, provided the tilt stimuli were not interrupted. Although not significant, there was a trend for the inphase asymmetrical stimulus to elicit a stronger sense of both translation and tilt than the out-of-phase asymmetrical stimulus. Surprisingly, the inphase asymmetrical stimulus also tended to elicit a stronger sense of peak-to-peak translation than the inphase symmetrical stimulus, even though the range of linear acceleration during the symmetrical stimulus was twice that of the asymmetrical stimulus. These results are consistent with the hypothesis that the central nervous system resolves the ambiguity of inertial motion sensory cues by integrating inputs from visual, vestibular, and somatosensory systems.

On Inertial Body Tracking in the Presence of Model Calibration Errors

PubMed Central

Miezal, Markus; Taetz, Bertram; Bleser, Gabriele

2016-01-01

In inertial body tracking, the human body is commonly represented as a biomechanical model consisting of rigid segments with known lengths and connecting joints. The model state is then estimated via sensor fusion methods based on data from attached inertial measurement units (IMUs). This requires the relative poses of the IMUs w.r.t. the segments—the IMU-to-segment calibrations, subsequently called I2S calibrations—to be known. Since calibration methods based on static poses, movements and manual measurements are still the most widely used, potentially large human-induced calibration errors have to be expected. This work compares three newly developed/adapted extended Kalman filter (EKF) and optimization-based sensor fusion methods with an existing EKF-based method w.r.t. their segment orientation estimation accuracy in the presence of model calibration errors with and without using magnetometer information. While the existing EKF-based method uses a segment-centered kinematic chain biomechanical model and a constant angular acceleration motion model, the newly developed/adapted methods are all based on a free segments model, where each segment is represented with six degrees of freedom in the global frame. Moreover, these methods differ in the assumed motion model (constant angular acceleration, constant angular velocity, inertial data as control input), the state representation (segment-centered, IMU-centered) and the estimation method (EKF, sliding window optimization). In addition to the free segments representation, the optimization-based method also represents each IMU with six degrees of freedom in the global frame. In the evaluation on simulated and real data from a three segment model (an arm), the optimization-based method showed the smallest mean errors, standard deviations and maximum errors throughout all tests. It also showed the lowest dependency on magnetometer information and motion agility. Moreover, it was insensitive w.r.t. I2S position and segment length errors in the tested ranges. Errors in the I2S orientations were, however, linearly propagated into the estimated segment orientations. In the absence of magnetic disturbances, severe model calibration errors and fast motion changes, the newly developed IMU centered EKF-based method yielded comparable results with lower computational complexity. PMID:27455266

Microscopic theoretical study of frequency dependent dielectric constant of heavy fermion systems

NASA Astrophysics Data System (ADS)

Shadangi, Keshab Chandra; Rout, G. C.

2017-05-01

The dielectric polarization and the dielectric constant plays a vital role in the deciding the properties of the Heavy Fermion Systems. In the present communication we consider the periodic Anderson's Model which consists of conduction electron kinetic energy, localized f-electron kinetic energy and the hybridization between the conduction and localized electrons, besides the Coulomb correlation energy. We calculate dielectric polarization which involves two particle Green's functions which are calculated by using Zubarev's Green's function technique. Using the equations of motion of the fermion electron operators. Finally, the temperature and frequency dependent dielectric constant is calculated from the dielectric polarization function. The charge susceptibility and dielectric constant are computed numerically for different physical parameters like the position (Ef) of the f-electron level with respect to fermi level, the strength of the hybridization (V) between the conduction and localized f-electrons, Coulomb correlation potential temperature and optical phonon wave vector (q). The results will be discussed in a reference to the experimental observations of the dielectric constants.

Ro-vibrational averaging of the isotropic hyperfine coupling constant for the methyl radical

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adam, Ahmad Y.; Jensen, Per, E-mail: jensen@uni-wuppertal.de; Yachmenev, Andrey

2015-12-28

We present the first variational calculation of the isotropic hyperfine coupling constant of the carbon-13 atom in the CH{sub 3} radical for temperatures T = 0, 96, and 300 K. It is based on a newly calculated high level ab initio potential energy surface and hyperfine coupling constant surface of CH{sub 3} in the ground electronic state. The ro-vibrational energy levels, expectation values for the coupling constant, and its temperature dependence were calculated variationally by using the methods implemented in the computer program TROVE. Vibrational energies and vibrational and temperature effects for coupling constant are found to be in verymore » good agreement with the available experimental data. We found, in agreement with previous studies, that the vibrational effects constitute about 44% of the constant’s equilibrium value, originating mainly from the large amplitude out-of-plane bending motion and that the temperature effects play a minor role.« less

Probing antibody internal dynamics with fluorescence anisotropy and molecular dynamics simulations.

PubMed

Kortkhonjia, Ekaterine; Brandman, Relly; Zhou, Joe Zhongxiang; Voelz, Vincent A; Chorny, Ilya; Kabakoff, Bruce; Patapoff, Thomas W; Dill, Ken A; Swartz, Trevor E

2013-01-01

The solution dynamics of antibodies are critical to antibody function. We explore the internal solution dynamics of antibody molecules through the combination of time-resolved fluorescence anisotropy experiments on IgG1 with more than two microseconds of all-atom molecular dynamics (MD) simulations in explicit water, an order of magnitude more than in previous simulations. We analyze the correlated motions with a mutual information entropy quantity, and examine state transition rates in a Markov-state model, to give coarse-grained descriptors of the motions. Our MD simulations show that while there are many strongly correlated motions, antibodies are highly flexible, with F(ab) and F(c) domains constantly forming and breaking contacts, both polar and non-polar. We find that salt bridges break and reform, and not always with the same partners. While the MD simulations in explicit water give the right time scales for the motions, the simulated motions are about 3-fold faster than the experiments. Overall, the picture that emerges is that antibodies do not simply fluctuate around a single state of atomic contacts. Rather, in these large molecules, different atoms come in contact during different motions.

Vection during conflicting multisensory information about the axis, magnitude, and direction of self-motion.

PubMed

Ash, April; Palmisano, Stephen

2012-01-01

We examined the vection induced by consistent and conflicting multisensory information about self-motion. Observers viewed displays simulating constant-velocity self-motion in depth while physically oscillating their heads left-right or back-forth in time with a metronome. Their tracked head movements were either ignored or incorporated directly into the self-motion display (as an added simulated self-acceleration). When this head oscillation was updated into displays, sensory conflict was generated by simulating oscillation along: (i) an orthogonal axis to the head movement; or (ii) the same axis, but in a non-ecological direction. Simulated head oscillation always produced stronger vection than 'no display oscillation'--even when the axis/direction of this display motion was inconsistent with the physical head motion. When head-and-display oscillation occurred along the same axis: (i) consistent (in-phase) horizontal display oscillation produced stronger vection than conflicting (out-of-phase) horizontal display oscillation; however, (ii) consistent and conflicting depth oscillation conditions did not induce significantly different vection. Overall, orthogonal-axis oscillation was found to produce very similar vection to same-axis oscillation. Thus, we conclude that while vection appears to be very robust to sensory conflict, there are situations where sensory consistency improves vection.

Remarkably enhanced current-driven 360° domain wall motion in nanostripe by tuning in-plane biaxial anisotropy.

PubMed

Su, Yuanchang; Weng, Lianghao; Dong, Wenjun; Xi, Bin; Xiong, Rui; Hu, Jingguo

2017-10-17

By micromagnetic simulations, we study the current-driven 360° domain wall (360DW) motion in ferromagnetic nanostripe with an in-plane biaxial anisotropy. We observe the critical annihilation current of 360° domain wall can be enhanced through such a type of anisotropy, the reason of which is the suppression of out-of-plane magnetic moments generated simultaneously with domain-wall motion. In details, We have found that the domain-wall width is only related to K y  - K x , with K x(y) the anisotropy constant in x(y) direction. Taking domain-wall width into consideration, a prior choice is to keep K y  ≈ K x with large enough K. The mode of domain-wall motion has been investigated as well. The traveling-wave-motion region increases with K, while the average DW velocity is almost unchanged. Another noteworthy feature is that a Walker-breakdown-like motion exists before annihilation. In this region, though domain wall moves with an oscillating behavior, the average velocity does not reduce dramatically, but even rise again for a large K.

Lagrangian speckle model and tissue-motion estimation--theory.

PubMed

Maurice, R L; Bertrand, M

1999-07-01

It is known that when a tissue is subjected to movements such as rotation, shearing, scaling, etc., changes in speckle patterns that result act as a noise source, often responsible for most of the displacement-estimate variance. From a modeling point of view, these changes can be thought of as resulting from two mechanisms: one is the motion of the speckles and the other, the alterations of their morphology. In this paper, we propose a new tissue-motion estimator to counteract these speckle decorrelation effects. The estimator is based on a Lagrangian description of the speckle motion. This description allows us to follow local characteristics of the speckle field as if they were a material property. This method leads to an analytical description of the decorrelation in a way which enables the derivation of an appropriate inverse filter for speckle restoration. The filter is appropriate for linear geometrical transformation of the scattering function (LT), i.e., a constant-strain region of interest (ROI). As the LT itself is a parameter of the filter, a tissue-motion estimator can be formulated as a nonlinear minimization problem, seeking the best match between the pre-tissue-motion image and a restored-speckle post-motion image. The method is tested, using simulated radio-frequency (RF) images of tissue undergoing axial shear.

Motion tracking and electromyography-assisted identification of mirror hand contributions to functional near-infrared spectroscopy images acquired during a finger-tapping task performed by children with cerebral palsy.

PubMed

Hervey, Nathan; Khan, Bilal; Shagman, Laura; Tian, Fenghua; Delgado, Mauricio R; Tulchin-Francis, Kirsten; Shierk, Angela; Roberts, Heather; Smith, Linsley; Reid, Dahlia; Clegg, Nancy J; Liu, Hanli; MacFarlane, Duncan; Alexandrakis, George

2014-10-01

Recent studies have demonstrated functional near-infrared spectroscopy (fNIRS) to be a viable and sensitive method for imaging sensorimotor cortex activity in children with cerebral palsy (CP). However, during unilateral finger tapping, children with CP often exhibit unintended motions in the nontapping hand, known as mirror motions, which confuse the interpretation of resulting fNIRS images. This work presents a method for separating some of the mirror motion contributions to fNIRS images and demonstrates its application to fNIRS data from four children with CP performing a finger-tapping task with mirror motions. Finger motion and arm muscle activity were measured simultaneously with fNIRS signals using motion tracking and electromyography (EMG), respectively. Subsequently, subject-specific regressors were created from the motion capture or EMG data and independent component analysis was combined with a general linear model to create an fNIRS image representing activation due to the tapping hand and one image representing activation due to the mirror hand. The proposed method can provide information on how mirror motions contribute to fNIRS images, and in some cases, it helps remove mirror motion contamination from the tapping hand activation images.

Motion tracking and electromyography-assisted identification of mirror hand contributions to functional near-infrared spectroscopy images acquired during a finger-tapping task performed by children with cerebral palsy

PubMed Central

Hervey, Nathan; Khan, Bilal; Shagman, Laura; Tian, Fenghua; Delgado, Mauricio R.; Tulchin-Francis, Kirsten; Shierk, Angela; Roberts, Heather; Smith, Linsley; Reid, Dahlia; Clegg, Nancy J.; Liu, Hanli; MacFarlane, Duncan; Alexandrakis, George

2014-01-01

Abstract. Recent studies have demonstrated functional near-infrared spectroscopy (fNIRS) to be a viable and sensitive method for imaging sensorimotor cortex activity in children with cerebral palsy (CP). However, during unilateral finger tapping, children with CP often exhibit unintended motions in the nontapping hand, known as mirror motions, which confuse the interpretation of resulting fNIRS images. This work presents a method for separating some of the mirror motion contributions to fNIRS images and demonstrates its application to fNIRS data from four children with CP performing a finger-tapping task with mirror motions. Finger motion and arm muscle activity were measured simultaneously with fNIRS signals using motion tracking and electromyography (EMG), respectively. Subsequently, subject-specific regressors were created from the motion capture or EMG data and independent component analysis was combined with a general linear model to create an fNIRS image representing activation due to the tapping hand and one image representing activation due to the mirror hand. The proposed method can provide information on how mirror motions contribute to fNIRS images, and in some cases, it helps remove mirror motion contamination from the tapping hand activation images. PMID:26157980

Designed for Learning

ERIC Educational Resources Information Center

Magney, Tammy; Sorenson, Kim

2011-01-01

All one has to do is look around to see how "natural" learning occurs. At coffee shops, airports, lobbies, libraries and even family kitchens and living rooms, lifelong learners have their laptops open and cell phones in constant motion. They are texting, e-mailing, inquiring, researching, documenting, photographing, preparing and organizing…

Kinematics Card Sort Activity: Insight into Students' Thinking

ERIC Educational Resources Information Center

Berryhill, Erin; Herrington, Deborah; Oliver, Keith

2016-01-01

Kinematics is a topic students are unknowingly aware of well before entering the physics classroom. Students observe motion on a daily basis. They are constantly interpreting and making sense of their observations, unintentionally building their own understanding of kinematics before receiving any formal instruction. Unfortunately, when students…

NMR dipolar constants of motion in liquid crystals: Jeener-Broekaert, double quantum coherence experiments and numerical calculation on a 10-spin cluster.

PubMed

Segnorile, H H; Bonin, C J; González, C E; Acosta, R H; Zamar, R C

2009-10-01

Two proton quasi-equilibrium states were previously observed in nematic liquid crystals, namely the S and W quasi-invariants. Even though the experimental evidence suggested that they originate in a partition of the spin dipolar energy into a strong and a weak part, respectively, from a theoretical viewpoint, the existence of an appropriate energy scale which allows such energy separation remains to be confirmed and a representation of the quasi-invariants is still to be given. We compare the dipolar NMR signals yielded both by the Jeener-Broekaert (JB) experiment as a function of the preparation time and the free evolution of the double quantum coherence (DQC) spectra excited from the S state, with numerical calculations carried out from first principles under different models for the dipolar quasi-invariants, in a 10-spin cluster which represents the 5CB (4(')-pentyl-4-biphenyl-carbonitrile) molecule. The calculated signals qualitatively agree with the experiments and the DQC spectra as a function of the single-quantum detection time are sensible enough to the different models to allow both to probe the physical nature of the initial dipolar-ordered state and to assign a subset of dipolar interactions to each constant of motion, which are compatible with the experiments. As a criterion for selecting a suitable quasi-equilibrium model of the 5CB molecule, we impose on the time evolution operator consistency with the occurrence of two dipolar quasi-invariants, that is, the calculated spectra must be unaffected by truncation of non-secular terms of the weaker dipolar energy. We find that defining the S quasi-invariant as the subset of the dipolar interactions of each proton with its two nearest neighbours yields a realistic characterization of the dipolar constants of motion in 5CB. We conclude that the proton-spin system of the 5CB molecule admits a partition of the dipolar energy into a bilinear strong and a multiple-spin weak contributions therefore providing two orthogonal constants of motion, which can be prepared and observed by means of the JB experiment. This feature, which implies the existence of two timescales of very different nature in the proton-spin dynamics, is ultimately dictated by the topology of the spin distribution in the dipole network and can be expected in other liquid crystals. Knowledge of the nature of the dipolar quasi-invariants will be useful in studies of dipolar-order relaxation, decoherence and multiple quantum NMR experiments where the initial state is a dipolar-ordered one.

Spherical type integrable classical systems in a magnetic field

NASA Astrophysics Data System (ADS)

Marchesiello, A.; Šnobl, L.; Winternitz, P.

2018-04-01

We show that four classes of second order spherical type integrable classical systems in a magnetic field exist in the Euclidean space {E}3 , and construct the Hamiltonian and two second order integrals of motion in involution for each of them. For one of the classes the Hamiltonian depends on four arbitrary functions of one variable. This class contains the magnetic monopole as a special case. Two further classes have Hamiltonians depending on one arbitrary function of one variable and four or six constants, respectively. The magnetic field in these cases is radial. The remaining system corresponds to a constant magnetic field and the Hamiltonian depends on two constants. Questions of superintegrability—i.e. the existence of further integrals—are discussed.

An ultra-fast EOD-based force-clamp detects rapid biomechanical transitions

NASA Astrophysics Data System (ADS)

Woody, Michael S.; Capitanio, Marco; Ostap, E. Michael; Goldman, Yale E.

2017-08-01

We assembled an ultra-fast infrared optical trapping system to detect mechanical events that occur less than a millisecond after a ligand binds to its filamentous substrate, such as myosin undergoing its 5 - 10 nm working stroke after actin binding. The instrument is based on the concept of Capitanio et al.1, in which a polymer bead-actin-bead dumbbell is held in two force-clamped optical traps. A force applied by the traps causes the filament to move at a constant velocity as hydrodynamic drag balances the applied load. When the ligand binds, the filament motion stops within 100 μs as the total force from the optical traps is transferred to the attachment. Subsequent translations signal active motions, such as the magnitude and timing of the motor's working stroke. In our instrument, the beads defining the dumbbell are held in independent force clamps utilizing a field-programmable gate array (FPGA) to update the trap beam positions at 250 kHz. We found that in our setup, acousto-optical deflectors (AODs) steering the beams were unsuitable for this purpose due to a slightly non-linear response in the beam intensity and deflection angle vs. the AOD ultra-sound wavelength, likely caused by low-amplitude standing acoustic waves in the deflectors. These aberrations caused instability in the force feedback loops leading to artefactual 20 nm jumps in position. This type of AOD non-linearity has been reported to be absent in electro-optical deflectors (EODs)2. We demonstrate that replacement of the AODs with EODs improves the performance of our instrument. Combining the superior beam-steering capability of the EODs, force acquisition via back-plane interferometry, and the dual high-speed FPGA-based feedback loops, we smoothly and precisely apply constant loads to study the dynamics of interactions between biological molecules such as actin and myosin.

77 FR 24946 - Central Vermont Public Service Corporation; Notice of Application for Amendment of License and...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-04-26

..., Motions To Intervene, and Protests Take notice that the following hydroelectric application has been filed.... Deadline for filing comments and or motions: Comments and or motions are due within 15 days of the date of... motions filed. The Commission's Rules of Practice and Procedure require all interveners filing documents...

Sunspots and Their Simple Harmonic Motion

ERIC Educational Resources Information Center

Ribeiro, C. I.

2013-01-01

In this paper an example of a simple harmonic motion, the apparent motion of sunspots due to the Sun's rotation, is described, which can be used to teach this subject to high-school students. Using real images of the Sun, students can calculate the star's rotation period with the simple harmonic motion mathematical expression.

78 FR 46810 - Safety Zone; Motion Picture Filming; Chicago River; Chicago, IL

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-02

...-AA00 Safety Zone; Motion Picture Filming; Chicago River; Chicago, IL AGENCY: Coast Guard, DHS. ACTION... portion of the Chicago River due to the filming of a motion picture. These temporary safety zones are..., rigging, and other hazards involved in the filming of a motion picture. DATES: This rule will be enforced...

Nonlinear model of a rotating hub-beams structure: Equations of motion

NASA Astrophysics Data System (ADS)

Warminski, Jerzy

2018-01-01

Dynamics of a rotating structure composed of a rigid hub and flexible beams is presented in the paper. A nonlinear model of a beam takes into account bending, extension and nonlinear curvature. The influence of geometric nonlinearity and nonconstant angular velocity on dynamics of the rotating structure is presented. The exact equations of motion and associated boundary conditions are derived on the basis of the Hamilton's principle. The simplification of the exact nonlinear mathematical model is proposed taking into account the second order approximation. The reduced partial differential equations of motion together with associated boundary conditions can be used to study natural or forced vibrations of a rotating structure considering constant or nonconstant angular speed of a rigid hub and an arbitrary number of flexible blades.

Optically gated beating-heart imaging

PubMed Central

Taylor, Jonathan M.

2014-01-01

The constant motion of the beating heart presents an obstacle to clear optical imaging, especially 3D imaging, in small animals where direct optical imaging would otherwise be possible. Gating techniques exploit the periodic motion of the heart to computationally “freeze” this movement and overcome motion artifacts. Optically gated imaging represents a recent development of this, where image analysis is used to synchronize acquisition with the heartbeat in a completely non-invasive manner. This article will explain the concept of optical gating, discuss a range of different implementation strategies and their strengths and weaknesses. Finally we will illustrate the usefulness of the technique by discussing applications where optical gating has facilitated novel biological findings by allowing 3D in vivo imaging of cardiac myocytes in their natural environment of the beating heart. PMID:25566083

Wind-Tunnel Experiments for Gas Dispersion in an Atmospheric Boundary Layer with Large-Scale Turbulent Motion

NASA Astrophysics Data System (ADS)

Michioka, Takenobu; Sato, Ayumu; Sada, Koichi

2011-10-01

Large-scale turbulent motions enhancing horizontal gas spread in an atmospheric boundary layer are simulated in a wind-tunnel experiment. The large-scale turbulent motions can be generated using an active grid installed at the front of the test section in the wind tunnel, when appropriate parameters for the angular deflection and the rotation speed are chosen. The power spectra of vertical velocity fluctuations are unchanged with and without the active grid because they are strongly affected by the surface. The power spectra of both streamwise and lateral velocity fluctuations with the active grid increase in the low frequency region, and are closer to the empirical relations inferred from field observations. The large-scale turbulent motions do not affect the Reynolds shear stress, but change the balance of the processes involved. The relative contributions of ejections to sweeps are suppressed by large-scale turbulent motions, indicating that the motions behave as sweep events. The lateral gas spread is enhanced by the lateral large-scale turbulent motions generated by the active grid. The large-scale motions, however, do not affect the vertical velocity fluctuations near the surface, resulting in their having a minimal effect on the vertical gas spread. The peak concentration normalized using the root-mean-squared value of concentration fluctuation is remarkably constant over most regions of the plume irrespective of the operation of the active grid.

Dynamics of a camphoric acid boat at the air-water interface

NASA Astrophysics Data System (ADS)

Akella, V. S.; Singh, Dhiraj K.; Mandre, Shreyas; Bandi, M. M.

2018-05-01

We report experiments on an agarose gel tablet loaded with camphoric acid (c-boat) spontaneously set into motion by surface tension gradients on the water surface. We observe three distinct modes of c-boat motion: harmonic mode where the c-boat speed oscillates sinusoidally in time, a steady mode where the c-boat maintains constant speed, and an intermittent mode where the c-boat maintains near-zero speed between sudden jumps in speed. Whereas all three modes have been separately reported before in different systems, controlled release of Camphoric Acid (CA) from the agarose gel matrix allowed the observation of all the three modes in the same system. These three modes are a result of a competition between the driving (surface tension gradients) and drag forces acting on the c-boat. Moreover we suggest that there exist two time scales corresponding to spreading of CA and boat motion and the mismatch of these two time scales give rise to the three modes in boat motion. We reproduced all the modes of motion by varying the air-water interfacial tension using Sodium Dodecyl Sulfate (SDS).

Processing of angular motion and gravity information through an internal model.

PubMed

Laurens, Jean; Straumann, Dominik; Hess, Bernhard J M

2010-09-01

The vestibular organs in the base of the skull provide important information about head orientation and motion in space. Previous studies have suggested that both angular velocity information from the semicircular canals and information about head orientation and translation from the otolith organs are centrally processed in an internal model of head motion, using the principles of optimal estimation. This concept has been successfully applied to model behavioral responses to classical vestibular motion paradigms. This study measured the dynamic of the vestibuloocular reflex during postrotatory tilt, tilt during the optokinetic afternystagmus, and off-vertical axis rotation. The influence of otolith signal on the VOR was systematically varied by using a series of tilt angles. We found that the time constants of responses varied almost identically as a function of gravity in these paradigms. We show that Bayesian modeling could predict the experimental results in an accurate and consistent manner. In contrast to other approaches, the Bayesian model also provides a plausible explanation of why these vestibulooculo motor responses occur as a consequence of an internal process of optimal motion estimation.

Mechanisms underlying the perceived angular velocity of a rigidly rotating object.

PubMed

Caplovitz, G P; Hsieh, P-J; Tse, P U

2006-09-01

The perceived angular velocity of an ellipse undergoing a constant rate of rotation will vary as its aspect ratio is changed. Specifically, a "fat" ellipse with a low aspect ratio will in general be perceived to rotate more slowly than a "thin" ellipse with a higher aspect ratio. Here we investigate this illusory underestimation of angular velocity in the domain where ellipses appear to be rotating rigidly. We characterize the relationship between aspect ratio and perceived angular velocity under luminance and non-luminance-defined conditions. The data are consistent with two hypotheses concerning the construction of rotational motion percepts. The first hypothesis is that perceived angular velocity is determined by low-level component-motion (i.e., motion-energy) signals computed along the ellipse's contour. The second hypothesis is that relative maxima of positive contour curvature are treated as non-component, form-based "trackable features" (TFs) that contribute to the visual system's construction of the motion percept. Our data suggest that perceived angular velocity is driven largely by component signals, but is modulated by the motion signals of trackable features, such as corners and regions of high contour curvature.

Bio-inspired motion detection in an FPGA-based smart camera module.

PubMed

Köhler, T; Röchter, F; Lindemann, J P; Möller, R

2009-03-01

Flying insects, despite their relatively coarse vision and tiny nervous system, are capable of carrying out elegant and fast aerial manoeuvres. Studies of the fly visual system have shown that this is accomplished by the integration of signals from a large number of elementary motion detectors (EMDs) in just a few global flow detector cells. We developed an FPGA-based smart camera module with more than 10,000 single EMDs, which is closely modelled after insect motion-detection circuits with respect to overall architecture, resolution and inter-receptor spacing. Input to the EMD array is provided by a CMOS camera with a high frame rate. Designed as an adaptable solution for different engineering applications and as a testbed for biological models, the EMD detector type and parameters such as the EMD time constants, the motion-detection directions and the angle between correlated receptors are reconfigurable online. This allows a flexible and simultaneous detection of complex motion fields such as translation, rotation and looming, such that various tasks, e.g., obstacle avoidance, height/distance control or speed regulation can be performed by the same compact device.

Global geometry of non-planar 3-body motions

NASA Astrophysics Data System (ADS)

Salehani, Mahdi Khajeh

2011-12-01

The aim of this paper is to study the global geometry of non-planar 3-body motions in the realms of equivariant Differential Geometry and Geometric Mechanics. This work was intended as an attempt at bringing together these two areas, in which geometric methods play the major role, in the study of the 3-body problem. It is shown that the Euler equations of a three-body system with non-planar motion introduce non-holonomic constraints into the Lagrangian formulation of mechanics. Applying the method of undetermined Lagrange multipliers to study the dynamics of three-body motions reduced to the level of moduli space {bar{M}} subject to the non-holonomic constraints yields the generalized Euler-Lagrange equations of non-planar three-body motions in {bar{M}} . As an application of the derived dynamical equations in the level of {bar{M}} , we completely settle the question posed by A. Wintner in his book [The analytical foundations of Celestial Mechanics, Sections 394-396, 435 and 436. Princeton University Press (1941)] on classifying the constant inclination solutions of the three-body problem.

Influence of cardiac and respiratory motion on tomographic reconstructions of the heart: implications for quantitative nuclear cardiology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ter-Pogossian, M.M.; Bergmann, S.R.; Sobel, B.E.

1982-12-01

The potential influence of physiological, periodic motions of the heart due to the cardiac cycle, the respiratory cycle, or both on quantitative image reconstruction by positron emission tomography (PET) has been largely neglected. To define their quantitative impact, cardiac PET was performed in 6 dogs after injection of /sup 11/C-palmitate under disparate conditions including: normal cardiac and respiration cycles and cardiac arrest with and without respiration. Although in vitro assay of myocardial samples demonstrated that palmitate uptake was homogeneous (coefficient of variation . 10.1%), analysis of the reconstructed images demonstrated significant heterogeneity of apparent cardiac distribution of radioactivity due tomore » both intrinsic cardiac and respiratory motion. Image degradation due to respiratory motion was demonstrated in a healthy human volunteer as well, in whom cardiac tomography was performed with Super PETT I during breath-holding and during normal breathing. The results indicate that quantitatively significant degradation of reconstructions of true tracer distribution occurs in cardiac PET due to both intrinsic cardiac and respiratory induced motion of the heart. They suggest that avoidance of or minimization of these influences can be accomplished by gating with respect to both the cardiac cycle and respiration or by employing brief scan times during breath-holding.« less

Investigation of ciliary propulsion of Tetrahymena Pyriformis in viscous solution

NASA Astrophysics Data System (ADS)

Jung, Ilyong; Lyubich, Eva; Valles, James

2014-03-01

Recent experiments by our group showed that the ciliated protist Paramecium Caudatumswims with a constant propulsive force in solutions with viscosities 1 < η/ ηw<7 where ηw is the viscosity of water. Measurements of the geometry of its helical swimming trajectory combined with high speed video of the ciliary motion provided insight into this behavior. Using a phenomenological model we found that the body cilia beating frequency decreases while the beating angle remains roughly constant to produce the constant propulsive force dependence on viscosity. In this talk, we present studies of another ciliated protozoa, Tetrahymena Pyriformis to determine whether the behavior of Paramecium is general. Preliminary results indicate that Tetrahymena Pyriformis also swims with a nearly constant propulsive force with increasing viscosity. Investigations similar to those performed on Paramecium are underway and the latest results will be presented. This work was supported by NSF PHY0750360 and at the NHMFL by NSF DMR-0084173

An approach to the determination of aircraft handling qualities using pilot transfer functions

NASA Technical Reports Server (NTRS)

Adams, J. J.; Hatch, H. G., Jr.

1978-01-01

It was shown that a correlation exists between pilot-aircraft system closed-loop characteristics, determined by using analytical expressions for pilot response along with the analytical expression for the aircraft response, and pilot ratings obtained in many previous flight and simulation studies. Two different levels of preferred pilot response were used. These levels were: (1) a static gain and a second-order lag function with a lag time constant of 0.2 second; and (2) a static gain, a lead time constant of 1 second, and a 0.2-second lag time constant. If a system response with a pitch-angle time constant of 2.6 seconds and a stable oscillatory mode of motion with a period of 2.5 seconds could be achieved with the first-level pilot model, it was shown that the pilot rating will be satisfactory for that vehicle.

Lattice model calculation of elastic and thermodynamic properties at high pressure and temperature. [for alkali halides in NaCl lattice

NASA Technical Reports Server (NTRS)

Demarest, H. H., Jr.

1972-01-01

The elastic constants and the entire frequency spectrum were calculated up to high pressure for the alkali halides in the NaCl lattice, based on an assumed functional form of the inter-atomic potential. The quasiharmonic approximation is used to calculate the vibrational contribution to the pressure and the elastic constants at arbitrary temperature. By explicitly accounting for the effect of thermal and zero point motion, the adjustable parameters in the potential are determined to a high degree of accuracy from the elastic constants and their pressure derivatives measured at zero pressure. The calculated Gruneisen parameter, the elastic constants and their pressure derivatives are in good agreement with experimental results up to about 600 K. The model predicts that for some alkali halides the Grunesen parameter may decrease monotonically with pressure, while for others it may increase with pressure, after an initial decrease.

Neck motion due to the halo-vest in prone and supine positions.

PubMed

Ivancic, Paul C; Telles, Connor J

2010-05-01

An in vitro biomechanical study of the effectiveness of halo-vest fixation. The objective was to evaluate motion of the injured cervical spine with normal halo-vest application and vest loose in the prone and supine positions. Snaking motion of the neck is defined as rotation in opposing directions throughout the cervical spine. Previous clinical studies have suggested snaking neck motion due to the halo-vest may lead to inadequate healing or nonunion. The halo-vest was applied to a Human Model of the Neck, which consisted of a cervical spine specimen mounted to the torso of an anthropometric test dummy and carrying a surrogate head. The model was transitioned from prone, to upright, to supine with the halo-vest applied normally and with the vest loose. Average peak spinal motions were computed in the prone and supine positions and contrasted with the physiologic rotation range, obtained from the intact flexibility test, and statistically compared (P < 0.05) between normal halo-vest application and vest loose. Snaking motion of the neck was observed in the prone and supine positions, consisting of extension at head/C1 and C1/2 and flexion at the inferior spinal levels. The intervertebral rotation peaks generally exceeded the physiologic range throughout the cervical spine due to the loose vest in the prone position. Significant increases in the extension peaks at head/C1 (16.9 degrees vs. 5.7 degrees) and flexion peaks at C4/5 (6.9 degrees vs. 3.6 degrees) and C7-T1 (5.2 degrees vs. 0.7 degrees) were observed in the prone position due to the loose vest, as compared to normal halo-vest application. Axial neck separation was consistently observed in the prone and supine positions. The present results, which document snaking motion of the cervical spine due to the halo-vest, indicate that an inadequately fitting or loose vest may significantly diminish its immobilization capacity leading to delayed healing or nonunion.

Size-dependent Hamaker constants for silver and gold nanoparticles

NASA Astrophysics Data System (ADS)

Pinchuk, Pavlo; Jiang, Ke

2015-08-01

Hamaker-Lifshitz constants are material specific constants that are used to calculate van der Waals interaction forces between small particles in solution. Typically, these constants are size-independent and material specific. According to the Lifshitz theory, the Hamaker-Lifshitz constants can be calculated by taking integrals that include the dielectric permittivity, as a function of frequency, of the interacting particles and the medium around particles. The dielectric permittivity of interacting metal nanoparticles can be calculated using the Drude model, which is based on the assumption of motion of free conducting electrons. For bulk metals, the Drude model does not predict any sizedependence of the dielectric permittivity. However, the conducting electrons in small noble metal nanoparticles (R ~ 10nm) exhibit surface scattering, which changes the complex permittivity function. In this work, we show theoretically that scattering of the free conducting electrons inside silver and gold nanoparticles with the size of 1 - 50 nm leads to size-dependent dielectric permittivity and Hamaker-Lifshitz constants. We calculate numerically the Hamaker-Lifshitz constants for silver and gold nanoparticles with different diameters. The results of the study might be of interests for understanding colloidal stability of metal nanoparticles.