Topology of modified helical gears and Tooth Contact Analysis (TCA) program
NASA Technical Reports Server (NTRS)
Litvin, Faydor L.; Zhang, Jiao
1989-01-01
The contents of this report covers: (1) development of optimal geometries for crowned helical gears; (2) a method for their generation; (3) tooth contact analysis (TCA) computer programs for the analysis of meshing and bearing contact of the crowned helical gears; and (4) modelling and simulation of gear shaft deflection. The developed method for synthesis was used to determine the optimal geometry for a crowned helical pinion surface and was directed to localize the bearing contact and guarantee favorable shape and a low level of transmission errors. Two new methods for generation of the crowned helical pinion surface are proposed. One is based on the application of a tool with a surface of revolution that slightly deviates from a regular cone surface. The tool can be used as a grinding wheel or as a shaver. The other is based on a crowning pinion tooth surface with predesigned transmission errors. The pinion tooth surface can be generated by a computer-controlled automatic grinding machine. The TCA program simulates the meshing and bearing contact of the misaligned gears. The transmission errors are also determined. The gear shaft deformation was modelled and investigated. It was found that the deflection of gear shafts has the same effect as gear misalignment.
Generation of helical gears with new surfaces topology by application of CNC machines
NASA Technical Reports Server (NTRS)
Litvin, F. L.; Chen, N. X.; Hsiao, C. L.; Handschuh, Robert F.
1993-01-01
Analysis of helical involute gears by tooth contact analysis shows that such gears are very sensitive to angular misalignment that leads to edge contact and the potential for high vibration. A new topology of tooth surfaces of helical gears that enables a favorable bearing contact and a reduced level of vibration is described. Methods for grinding of the helical gears with the new topology are proposed. A TCA (tooth contact analysis) program for simulation of meshing and contact of helical gears with the new topology has been developed. Numerical examples that illustrate the proposed ideas are discussed.
Generation of helical gears with new surfaces, topology by application of CNC machines
NASA Technical Reports Server (NTRS)
Litvin, F. L.; Chen, N. X.; Hsiao, C. L.; Handschuh, R. F.
1993-01-01
Analysis of helical involute gears by tooth contact analysis shows that such gears are very sensitive to angular misalignment that leads to edge contact and the potential for high vibration. A new topology of tooth surfaces of helical gears that enables a favorable bearing contact and a reduced level of vibration is described. Methods for grinding of the helical gears with the new topology are proposed. A TCA (tooth contact analysis) program for simulation of meshing and contact of helical gears with the new topology has been developed. Numerical examples that illustrate the proposed ideas are discussed.
Computerized Design and Analysis of Face-Milled, Uniform Tooth Height Spiral Bevel Gear Drives
NASA Technical Reports Server (NTRS)
Litvin, Faydor L.; Wang, Anngwo; Handschuh, R. F.
1996-01-01
Face-milled spiral bevel gears with uniform tooth height are considered. An approach is proposed for the design of low noise and localized bearing contact of such gears. The approach is based on the mismatch of contacting surfaces and permits two types of bearing contact either directed longitudinally or across the surface to be obtained. A Tooth Contact Analysis (TCA) computer program was developed. This analysis was used to determine the influence of misalignment on meshing and contact of the spiral bevel gears. A numerical example that illustrates the developed theory is provided.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schnabel, Manuel; Klein, Talysa; Lee, Benjamin G
The rear side metallization of Si solar cells comes with a number of inherent losses and trade-offs: a larger metallized area fraction improves fill factor at the expense of open-circuit voltage, depositing directly on textured Si leads to low contact resistivity at the expense of short-circuit current, and some metallization processes create defects in Si. To mitigate many of these losses we have developed a novel approach for rear side metallization of Si solar cells, utilizing a transparent conducting adhesive (TCA) to metallize Si without exposing the wafer to the metal deposition process. The TCA consists of an insulating adhesivemore » loaded with conductive microspheres. This approach leads to virtually no loss in implied open-circuit voltage upon metallization. Electrical measurements showed that contact resistivities of 3-9 ..omega.. cm2 were achieved, and an analysis of the transit resistance per microsphere showed that less than 1 ..omega.. cm2 should be achievable with higher microsphere loading of the TCA.« less
NASA Technical Reports Server (NTRS)
Litvin, Faydor L.; Fuentes, Alfonso; Hawkins, J. M.; Handschuh, Robert F.
2001-01-01
A new type of face gear drive for application in transmissions, particularly in helicopters, has been developed. The new geometry differs from the existing geometry by application of asymmetric profiles and double-crowned pinion of the face gear mesh. The paper describes the computerized design, simulation of meshing and contact, and stress analysis by finite element method. Special purpose computer codes have been developed to conduct the analysis. The analysis of this new type of face gear is illustrated with a numerical example.
NASA Technical Reports Server (NTRS)
Litvin, F. L.; Handschuh, R. F.; Zhang, J.
1988-01-01
A method for generation of crowned pinion tooth surfaces using a surface of revolution is developed. The crowned pinion meshes with a regular involute gear and has a prescribed parabolic type of transmission errors when the gears operate in the aligned mode. When the gears are misaligned the transmission error remains parabolic with the maximum level still remaining very small (less than 0.34 arc second for the numerical examples). Tooth Contact Analysis (TCA) is used to simulate the conditions of meshing, determine the transmission error, and the bearing contact.
Generation of a crowned pinion tooth surface by a surface of revolution
NASA Technical Reports Server (NTRS)
Litvin, F. L.; Zhang, J.; Handschuh, R. F.
1988-01-01
A method of generating crowned pinion tooth surfaces using a surface of revolution is developed. The crowned pinion meshes with a regular involute gear and has a prescribed parabolic type of transmission errors when the gears operate in the aligned mode. When the gears are misaligned the transmission error remains parabolic with the maximum level still remaining very small (less than 0.34 arc sec for the numerical examples). Tooth contact analysis (TCA) is used to simulate the conditions of meshing, determine the transmission error, and determine the bearing contact.
NASA Technical Reports Server (NTRS)
Litvin, Faydor L.; Feng, Pin-Hao; Lagutin, Sergei A.
2000-01-01
In this report, we propose a new geometry for low-noise, increased-strength helical gears of the Novikov-Wildhaber type. Contact stresses are reduced as a result of their convex-concave gear tooth surfaces. The gear tooth surfaces are crowned in the profile direction to localize bearing contact and in the longitudinal direction to obtain a parabolic function of transmission errors. Such a function results in the reduction of noise and vibrations. Methods for the generation of the proposed gear tooth surfaces by grinding and hobbing are considered, and a tooth contact analysis (TCA) computer program to simulate meshing and contact is applied. The report also investigates the influence of misalignment on transmission errors and shift of bearing contact. Numerical examples to illustrate the developed approaches are proposed. The proposed geometry was patented by Ford/UIC (Serial Number 09-340-824, pending) on June 28, 1999.
Taxicab Correspondence Analysis of Contingency Tables with One Heavyweight Column
ERIC Educational Resources Information Center
Choulakian, V.
2008-01-01
The aim of this paper is to study the analysis of contingency tables with one heavyweight column or one heavyweight entry by taxicab correspondence analysis (TCA). Given that the mathematics of TCA is simpler than the mathematics of correspondence analysis (CA), the influence of one heavyweight column on the outputs of TCA is studied explicitly…
Kaku, Yoshio; Ookawara, Susumu; Miyazawa, Haruhisa; Ito, Kiyonori; Ueda, Yuichirou; Hirai, Keiji; Hoshino, Taro; Mori, Honami; Yoshida, Izumi; Morishita, Yoshiyuki; Tabei, Kaoru
2016-02-01
The following conventional calcium correction formula (Payne) is broadly applied for serum calcium estimation: corrected total calcium (TCa) (mg/dL) = TCa (mg/dL) + (4 - albumin (g/dL)); however, it is inapplicable to chronic kidney disease (CKD) patients. A total of 2503 venous samples were collected from 942 all-stage CKD patients, and levels of TCa (mg/dL), ionized calcium ([iCa(2+) ] mmol/L), phosphate (mg/dL), albumin (g/dL), and pH, and other clinical parameters were measured. We assumed corrected TCa (the gold standard) to be equal to eight times the iCa(2+) value (measured corrected TCa). Then, we performed stepwise multiple linear regression analysis by using the clinical parameters and derived a simple formula for corrected TCa approximation. The following formula was devised from multiple linear regression analysis: Approximated corrected TCa (mg/dL) = TCa + 0.25 × (4 - albumin) + 4 × (7.4 - p H) + 0.1 × (6 - phosphate) + 0.3. Receiver operating characteristic curves analysis illustrated that area under the curve of approximated corrected TCa for detection of measured corrected TCa ≥ 8.4 mg/dL and ≤ 10.4 mg/dL were 0.994 and 0.919, respectively. The intraclass correlation coefficient demonstrated superior agreement using this new formula compared to other formulas (new formula: 0.826, Payne: 0.537, Jain: 0.312, Portale: 0.582, Ferrari: 0.362). In CKD patients, TCa correction should include not only albumin but also pH and phosphate. The approximated corrected TCa from this formula demonstrates superior agreement with the measured corrected TCa in comparison to other formulas. © 2016 International Society for Apheresis, Japanese Society for Apheresis, and Japanese Society for Dialysis Therapy.
Muskens, Ivo S; Briceno, Vanessa; Ouwehand, Tom L; Castlen, Joseph P; Gormley, William B; Aglio, Linda S; Zamanipoor Najafabadi, Amir H; van Furth, Wouter R; Smith, Timothy R; Mekary, Rania A; Broekman, Marike L D
2018-01-01
In the past decade, the endonasal transsphenoidal approach (eTSA) has become an alternative to the microsurgical transcranial approach (mTCA) for tuberculum sellae meningiomas (TSMs) and olfactory groove meningiomas (OGMs). The aim of this meta-analysis was to evaluate which approach offered the best surgical outcomes. A systematic review of the literature from 2004 and meta-analysis were conducted in accordance with the PRISMA guidelines. Pooled incidence was calculated for gross total resection (GTR), visual improvement, cerebrospinal fluid (CSF) leak, intraoperative arterial injury, and mortality, comparing eTSA and mTCA, with p-interaction values. Of 1684 studies, 64 case series were included in the meta-analysis. Using the fixed-effects model, the GTR rate was significantly higher among mTCA patients for OGM (eTSA: 70.9% vs. mTCA: 88.5%, p-interaction < 0.01), but not significantly higher for TSM (eTSA: 83.0% vs. mTCA: 85.8%, p-interaction = 0.34). Despite considerable heterogeneity, visual improvement was higher for eTSA than mTCA for TSM (p-interaction < 0.01), but not for OGM (p-interaction = 0.33). CSF leak was significantly higher among eTSA patients for both OGM (eTSA: 25.1% vs. mTCA: 10.5%, p-interaction < 0.01) and TSM (eTSA: 19.3%, vs. mTCA: 5.81%, p-interaction < 0.01). Intraoperative arterial injury was higher among eTSA (4.89%) than mTCA patients (1.86%) for TSM (p-interaction = 0.03), but not for OGM resection (p-interaction = 0.10). Mortality was not significantly different between eTSA and mTCA patients for both TSM (p-interaction = 0.14) and OGM resection (p-interaction = 0.88). Random-effect models yielded similar results. In this meta-analysis, eTSA was not shown to be superior to mTCA for resection of both OGMs and TSMs.
Vestner, Jochen; Fritsch, Stefanie; Rauhut, Doris
2010-02-15
The aim of this research work was focused on the replacement of the time-consuming soaking of cork stoppers which is mainly used as screening method for cork lots in connection with sensory analysis and/or analytical methods to detect releasable 2,4,6-trichloroanisole (TCA) of natural cork stoppers. Releasable TCA from whole cork stoppers was analysed with the application of a microwave assisted extraction method (MAE) in combination with stir bar sorptive extraction (SBSE). The soaking of corks (SOAK) was used as a reference method to optimise MAE parameters. Cork lots of different quality and TCA contamination levels were used to adapt MAE. Pre-tests indicated that an MAE at 40 degrees C for 120 min with 90 min of cooling time are suitable conditions to avoid an over-extraction of TCA of low and medium tainted cork stoppers in comparison to SOAK. These MAE parameters allow the measuring of almost the same amounts of releasable TCA as with the application of the soaking procedure in the relevant range (<25 ng L(-1) releasable TCA from one cork) to evaluate the TCA level of cork stoppers. Stable isotope dilution assay (SIDA) was applied to optimise quantification of the released TCA with deuterium-labelled TCA (TCA-d(5)) using a time-saving GC-MS technique in single ion monitoring (SIM) mode. The developed MAE method allows the measuring of releasable TCA from the whole cork stopper under improved conditions and in connection with a low use of solvent and a higher sample throughput. Copyright 2009 Elsevier B.V. All rights reserved.
Lu, Wanlu; Lu, Libing; Feng, Yun; Chen, Jiao; Li, Yan; Kong, Xiangli; Chen, Sixiu; Li, Xiaoyu; Chen, Qianming; Zhang, Ping
2013-05-01
The association between inflammation and cancer provides a new target for tumor biotherapy. The inflammatory cells and molecules within the tumor microenvironment have decisive dual roles in antitumor immunity and immune evasion. In the present study, phytohemagglutinin (PHA) was used to stimulate peripheral blood mononuclear cells (PBMCs) to simulate the tumor inflammatory microenvironment. The effect of immune cells and inflammatory cytokines on the surface expression of programmed cell death-1 ligand 1 (PD-L1) and tumor immune evasion was investigated using flow cytometry (FCM) and an in vivo xenotransplantation model. Based on the data, PHA-activated, but not resting, immune cells were able to promote the surface expression of PD-L1 in Tca8113 oral squamous carcinoma cells via the secretion of inflammatory cytokines, but not by cell-cell contact. The majority of the inflammatory cytokines had no significant effect on the proliferation, cell cycle progression and apoptosis of the Tca8113 cells, although they each induced the expression of PD-L1 in a dose-dependent manner. In total, 99% of the Tca8113 cells expressed PD-L1 following treatment with the supernatant of PHA-stimulated PBMCs. The PHA-supernatant pretreated Tca8113 cells unusually induced Tca8113 antigen-specific CD8 + T cell apoptosis in vitro and the evasion of antigen-specific T cell attraction in a nude mouse tumor-bearing model. These results indicate a new mechanism for the promotion of tumor immune evasion by the tumor inflammatory microenvironment.
LU, WANLU; LU, LIBING; FENG, YUN; CHEN, JIAO; LI, YAN; KONG, XIANGLI; CHEN, SIXIU; LI, XIAOYU; CHEN, QIANMING; ZHANG, PING
2013-01-01
The association between inflammation and cancer provides a new target for tumor biotherapy. The inflammatory cells and molecules within the tumor microenvironment have decisive dual roles in antitumor immunity and immune evasion. In the present study, phytohemagglutinin (PHA) was used to stimulate peripheral blood mononuclear cells (PBMCs) to simulate the tumor inflammatory microenvironment. The effect of immune cells and inflammatory cytokines on the surface expression of programmed cell death-1 ligand 1 (PD-L1) and tumor immune evasion was investigated using flow cytometry (FCM) and an in vivo xenotransplantation model. Based on the data, PHA-activated, but not resting, immune cells were able to promote the surface expression of PD-L1 in Tca8113 oral squamous carcinoma cells via the secretion of inflammatory cytokines, but not by cell-cell contact. The majority of the inflammatory cytokines had no significant effect on the proliferation, cell cycle progression and apoptosis of the Tca8113 cells, although they each induced the expression of PD-L1 in a dose-dependent manner. In total, 99% of the Tca8113 cells expressed PD-L1 following treatment with the supernatant of PHA-stimulated PBMCs. The PHA-supernatant pretreated Tca8113 cells unusually induced Tca8113 antigen-specific CD8+ T cell apoptosis in vitro and the evasion of antigen-specific T cell attraction in a nude mouse tumor-bearing model. These results indicate a new mechanism for the promotion of tumor immune evasion by the tumor inflammatory microenvironment PMID:23761816
NASA Astrophysics Data System (ADS)
Soliman, Saied M.; Kassem, Taher S.; Badr, Ahmed M. A.; Abu Youssef, Morsy A.; Assem, Rania
2014-09-01
The new [Ag(3AQ)2(TCA)]; (3AQ = 3-aminoquinoline and TCA = Trichloroacetate) complex is synthesized and characterized using elemental analysis, FTIR, NMR and mass spectroscopy. The molecular geometry, vibrational frequencies, gauge-including atomic orbital (GIAO) 1H chemical shift values of the free and coordinated 3AQ in the ground state have been calculated by using DFT/B3LYP method. The TD-DFT results of the [Ag(3AQ)2(TCA)] complex showed a π-π* transition band at 240.3-242.6 nm (f = 0.1334-0.1348) which has longer wavelength and lower absorption intensity than that for the free 3AQ (233.2 nm, f = 0.3958). Dipole moment, polarizability and HOMO-LUMO gap values predicted better nonlinear optical properties (NLO) for the [Ag(3AQ)2(TCA)] than the 3AQ ligand. NBO analysis has been used to predict the most accurate Lewis structure of the studied molecules. The energies of the different intramolecular charge transfer (ICT) interactions within the studied molecules were estimated using second order perturbation theory.
Heart rate variability in children with tricyclic antidepressant intoxication.
Dinleyici, Ener Cagri; Kilic, Zubeyir; Sahin, Sabiha; Tutuncu-Toker, Rabia; Eren, Makbule; Yargic, Zeynel Abidin; Kosger, Pelin; Ucar, Birsen
2013-01-01
The aim of this study was to evaluate HRV in children requiring intensive care unit stays due to TCA poisoning between March 2009 and July 2010. In the time-domain nonspectral evaluation, the SDNN (P < 0.001), SDNNi (P < 0.05), RMSDD (P < 0.01), and pNN50 (P < 0.01) were found to be significantly lower in the TCA intoxication group. The spectral analysis of the data recorded during the first 5 minutes after intensive care unit admission showed that the values of the nLF (P < 0.05) and the LF/HF ratio (P = 0.001) were significantly higher in the TCA intoxication group, while the nHF (P = 0.001) values were significantly lower. The frequency-domain spectral analysis of the data recorded during the last 5 minutes showed a lower nHF (P = 0.001) in the TCA intoxication group than in the controls, and the LF/HF ratio was significantly higher (P < 0.05) in the intoxication group. The LF/HF ratio was higher in the seven children with seizures (P < 0.001). These findings provided us with a starting point for the value of HRV analysis in determining the risk of arrhythmia and convulsion in TCA poisoning patients. HRV can be used as a noninvasive testing method in determining the treatment and prognosis of TCA poisoning patients.
Tonic-Clonic Activity at Subarachnoid Hemorrhage Onset: Impact on Complications and Outcome
De Marchis, Gian Marco; Pugin, Deborah; Lantigua, Hector; Zammit, Christopher; Tadi, Prasanna; Schmidt, J. Michael; Falo, M. Cristina; Agarwal, Sachin; Mayer, Stephan A.; Claassen, Jan
2013-01-01
Objective Tonic-clonic activity (TCA) at onset complicates 3% to 21% of cases of subarachnoid hemorrhage (SAH). The impact of onset TCA on in-hospital complications, including seizures, remains unclear. One study associated onset TCA with poor clinical outcome at 6 weeks after SAH, but to our knowledge no other studies have confirmed this relationship. This study aims to assess the impact of onset TCA on in-hospital complications, poor functional outcome, mortality, and epilepsy at 3 months. Methods Analysis of a prospective study cohort of 1479 SAH patients admitted to Columbia University Medical Center between 1996 and 2012. TCA within 6 hours of hemorrhage onset was identified based on accounts of emergency care providers or family witnesses. Results TCA at onset was described in 170 patients (11%). Patients with onset TCA were younger (P = 0.002), presented more often with poor clinical grade (55% vs. 26%, P<0.001) and had larger amounts of cisternal, intraventricular, and intracerebral blood than those without onset TCA (all, P<0.001). After adjusting for known confounders, onset TCA was significantly associated with in-hospital seizures (OR 3.80, 95%-CI: 2.43–5.96, P<0.001), in-hospital pneumonia (OR 1.56, 95%-CI: 1.06–2.31, p = 0.02), and delayed cerebral ischemia (OR 1.77, 95%-CI: 1.21–2.58, P = 0.003). At 3 months, however, onset TCA was not associated with poor functional outcome, mortality, and epilepsy after adjusting for age, admission clinical grade, and cisternal blood volume. Conclusions Onset TCA is not a rare event as it complicates 11% of cases of SAH. New and clinically relevant findings are the association of onset TCA with in-hospital seizures, pneumonia and delayed cerebral ischemia. Despite the increased risk of in-hospital complications, onset TCA is not associated with disability, mortality, and epilepsy at 3 months. PMID:23951155
Garcia, Ana R; Lopes, Luís F; Brito de Barros, Ricardo; Ilharco, Laura M
2015-01-14
Attenuated total reflection infrared spectroscopy (ATR-IR) proved to be a promising detection technique for 2,4,6-trichloroanisole (TCA), which confers organoleptic defects to bottled alcoholic beverages, allowing the proposal of a criterion for cork plank acceptance when meant for stopper production. By analysis of a significant number of samples, it was proved that the presence of TCA, even in very low concentrations, imparts subtle changes to the cork spectra, namely, the growth of two new bands at ∼1417 (νC═C of TCA ring) and 1314 cm–1 (a shifted νCC of TCA) and an increase in the relative intensities of the bands at ∼1039 cm–1 (δCO of polysaccharides) and ∼813 cm–1 (τCH of suberin), the latter by overlapping with intense bands of TCA. These relative intensities were evaluated in comparison to a fingerprint of suberin (νasC–O–C), at 1161 cm–1. On the basis of those spectral variables, a multivariate statistics linear analysis (LDA) was performed to obtain a discriminant function that allows classifying the samples according to whether they contain or not TCA. The methodology proposed consists of a demanding acceptance criterion for cork planks destined for stopper production (with the guarantee of nonexistence of TCA) that results from combining the quantitative results with the absence of the two TCA correlated bands. ATR infrared spectroscopy is a nondestructive and easy to apply technique, both on cork planks and on stoppers, and has proven more restrictive than other techniques used in the cork industry that analyze the cleaning solutions. At the level of proof of concept, the method here proposed is appealing for high-value stopper applications.
Descriptive Quantitative Analysis of Rearfoot Alignment Radiographic Parameters.
Meyr, Andrew J; Wagoner, Matthew R
2015-01-01
Although the radiographic parameters of the transverse talocalcaneal angle (tTCA), calcaneocuboid angle (CCA), talar head uncovering (THU), calcaneal inclination angle (CIA), talar declination angle (TDA), lateral talar-first metatarsal angle (lTFA), and lateral talocalcaneal angle (lTCA) form the basis of the preoperative evaluation and procedure selection for pes planovalgus deformity, the so-called normal values of these measurements are not well-established. The objectives of the present study were to retrospectively evaluate the descriptive statistics of these radiographic parameters (tTCA, CCA, THU, CIA, TDA, lTFA, and lTCA) in a large population, and, second, to determine an objective basis for defining "normal" versus "abnormal" measurements. As a secondary outcome, the relationship of these variables to the body mass index was assessed. Anteroposterior and lateral foot radiographs from 250 consecutive patients without a history of previous foot and ankle surgery and/or trauma were evaluated. The results revealed a mean measurement of 24.12°, 13.20°, 74.32%, 16.41°, 26.64°, 8.37°, and 43.41° for the tTCA, CCA, THU, CIA, TDA, lTFA, and lTCA, respectively. These were generally in line with the reported historical normal values. Descriptive statistical analysis demonstrated that the tTCA, THU, and TDA met the standards to be considered normally distributed but that the CCA, CIA, lTFA, and lTCA demonstrated data characteristics of both parametric and nonparametric distributions. Furthermore, only the CIA (R = -0.2428) and lTCA (R = -0.2449) demonstrated substantial correlation with the body mass index. No differentiations in deformity progression were observed when the radiographic parameters were plotted against each other to lead to a quantitative basis for defining "normal" versus "abnormal" measurements. Copyright © 2015 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.
Lee, Hooi Xian; Ahmad, Fisal; Saad, Bahruddin; Ismail, Mohd Nazri
2017-11-26
Date fruits are well known to be very nutritious. Nevertheless, the protein contents of the fruit, particularly the seed and flesh, are still understudied, largely due to their difficult physical characteristics. This study was conducted to compare three different protein extraction methods which were the trichloroacetic acid (TCA)-acetone (TCA-A), phenol (Phe), and TCA-acetone-phenol (TCA-A-Phe), and to perform proteomic analysis on date palm seed and flesh. Phe extraction method showed the highest protein yields for both seed (8.26 mg/g) and flesh (1.57 mg/g). Through sodium dodecyl sulfate-polyacrylamide gel electrophoresis, Phe, and TCA-A-Phe extraction methods were shown to be efficient in removing interfering compounds and gave well-resolved bands over a wide range of molecular weights. Following liquid chromatography-tandem mass spectrometry analysis, about 50-64% of extracted proteins were identified with known functions including those involved in glycolysis, Krebs cycle, defense, and storage. Phe protein extraction method was proven to be the optimal method for date flesh and seed.
Fu, Yanfen; Li, Yi; Lidstrom, Mary
2017-07-01
Methanotrophs are a group of bacteria that use methane as sole carbon and energy source. Type I methanotrophs are gamma-proteobacterial methanotrophs using the ribulose monophosphate cycle (RuMP) cycle for methane assimilation. In order to facilitate metabolic engineering in the industrially promising Type I methanotroph Methylomicrobium buryatense 5GB1, flux analysis of cellular metabolism is needed and 13 C tracer analysis is a foundational tool for such work. This biological system has a single-carbon input and a special network topology that together pose challenges to the current well-established methodology for 13 C tracer analysis using a multi-carbon input such as glucose, and to date, no 13 C tracer analysis of flux in a Type I methanotroph has been reported. In this study, we showed that by monitoring labeling patterns of several key intermediate metabolites in core metabolism, it is possible to quantitate the relative flux ratios for important branch points, such as the malate node. In addition, it is possible to assess the operation of the TCA cycle, which has been thought to be incomplete in Type I methanotrophs. Surprisingly, our analysis provides direct evidence of a complete, oxidative TCA cycle operating in M. buryatense 5GB1 using methane as sole carbon and energy substrate, contributing about 45% of the total flux for de novo malate production. Combined with mutant analysis, this method was able to identify fumA (METBUDRAFT_1453/MBURv2__60244) as the primary fumarase involved in the oxidative TCA cycle, among 2 predicted fumarases, supported by 13 C tracer analysis on both fumA and fumC single knockouts. Interrupting the oxidative TCA cycle leads to a severe growth defect, suggesting that the oxidative TCA cycle functions to not only provide precursors for de novo biomass synthesis, but also to provide reducing power to the system. This information provides new opportunities for metabolic engineering of M. buryatense for the production of industrially relevant products. Copyright © 2017 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Hu, Zhiyong; Zhao, Meng; Su, Jian; Xu, Shasha; Hu, Lei; Liu, Hui; Zhang, Qiong; Zhang, Jun; Wu, Jieying; Tian, Yupeng
2018-02-01
Three novel coordination polymers, [Zn(μ2-HTCA)(Phen)]n (1), {[Cd(μ3-HTCA)(Phen)]·2H2O}n (2), [Mn(μ2-HTCA)(Phen)(H2O)]n (3) were prepared by hydrothermal synthesis from the 4, 4', 4''-nitrilotribenzoicacid (H3TCA) and 1, 10-phenanthroline monohydrate (Phen) with different transition metal salts, which were characterized by elemental analysis, IR spectra, powder and single-crystal X-ray diffraction and thermogravimetric analysis. The photophysical properties of the complexes were investigated by solid-state diffuse reflectance spectra, photoluminescent properties, lifetime and quantum yield. For these complexes, it was found that the band gaps follow the order: 3 < 2 < 1 < 2.80 eV, fluorescence intensity order: 1 > H3TCA > 2 > 3; quantum yield order: H3TCA > 1 > 2 > 3; while the lifetime order: 1 > 2 > H3TCA > 3.
Hanson, Mark L; Sibley, Paul K; Ellis, David A; Fineberg, Neil A; Mabury, Scott A; Solomon, Keith R; Muir, Derek C
2002-03-01
Trichloroacetic acid (TCA) has been detected in rain, snow, and river samples throughout the world. It may enter into natural water systems via herbicide use, as a by-product of water disinfection, from emissions of spent bleach liquor of kraft pulp mills, and as a natural fungal product. This compound is phytotoxic and likely to accumulate in aquatic environments. A study to assess the fate of TCA in semi-natural aquatic environments and the toxicity of TCA to rooted aquatic macrophytes was conducted. The experiment involved exposing three replicate 12000 l aquatic microcosms at the University of Guelph Microcosm Facility to 0.05, 0.5, 3, and 10 mg/l of TCA for 35 days in a one-way analysis of variance design. Each microcosm was stocked with 14 individual 5 cm apical shoots of Myriophyllum spicatum and M. sibiricum. The plants were sampled at regular intervals and assessed for the somatic endpoints of plant length, root growth, number of nodes and wet and dry mass and the biochemical endpoints of chlorophyll-a and chlorophyll-b, carotenoid content, and citric acid levels. TCA half-lives in the microcosms ranged from 190 to 296 h depending on the initial concentration of TCA. Myriophyllum spp. results indicate that while there were some statistically significant differences from controls, there were no biologically significant effects of TCA for any of the endpoints examined. These data suggest that TCA does not pose a significant risk to these macrophytes up to 10 mg/l, which typically exceeds environmentally relevant concentrations by several orders of magnitude.
Bakthavatchalam, Yamuna Devi; Sudarsanam, Thambu David; Babu, Priyanka; Munuswamy, Elakkiya; Muthuirulandi Sethuvel, Dhiviya Prabaa; Devanga Ragupathi, Naveen Kumar; Veeraraghavan, Balaji
2017-07-24
Staphylococcus haemolyticus is a coagulase-negative staphylococcus that is frequently isolated from blood cultures. Here, we report a case of methicillin-susceptible S. haemolyticus that is resistant to teicoplanin (TEC) and heteroresistant to vancomycin (VAN). The isolate was susceptible to cefoxitin and resistant to TEC by Etest. Population analysis profile-area under the curve analysis confirmed the presence of a VAN heteroresistant subpopulation. Next-generation sequencing analysis of the genome revealed the presence of blaZ and msr(A), which encode cross-resistance to macrolide, lincosamide, and streptogramin B, and the quinolone resistance-conferring gene norA. In addition, several amino acid substitutions were observed in the TEC resistance operon tcaRAB, including I3N, I390N, and L450I in tcaA and L44V, G52V, and S87P in tcaR, as well as in the transpeptidase encoding gene walK (D336Y, R375L, and V404A) and L315 and P316 in graS. We hypothesized that this combination of mutations could confer TEC resistance and reduced VAN susceptibility.
The Army Study Program Fiscal Year 1992 Report
1991-11-25
Investigation Command (ATTN: CIRM-M-S) 2 US Army Military District of Washington (ATTN: ANRM-RE) 2 US Army Health Services Command (ATTN: HSCM-R) 2 US Army...0 QA AM40 SURVEILLANCE TASK COST ANALYSIS (TCA) 1 9003 9004 AMC MEA AMQEI01C 0 SUPPLY AND SERVICES TASK COST ANALYSIS (TCA) ( 1 9003 9004 AMC MEA 4...CONFLICT MODEL DEVELOPMENT 1 9110 9210 TRADOC T/OAC ATRCLMOC1 P COMBAT SERVICE SUPPORT FORCE DESIGN ANALYSIS 2 9110 9212 TRADOC T/LEE ATRCLMOC2 P
Kumar, Raekha; Lorenc, Ava; Robinson, Nicola; Blair, Mitch
2011-09-01
Traditional and complementary healthcare approaches (TCA) are widely used for children, often because of perceived safety. Honey is a traditional remedy for upper respiratory tract symptoms in infants. Health officials currently advise limiting honey use because of the risk of botulism. This paper discusses honey as a traditional healthcare approach for children in a multi-ethnic community, and parents' and primary healthcare practitioners' (PHPs) perceptions of its safety. As part of a larger study exploring beliefs about TCA, this paper focuses on perceived safety and use of honey, using data extracted for detailed analysis. Eleven parent focus groups (n= 92) and 30 interviews with PHPs were conducted. Qualitative data analysis used the Framework approach. London Boroughs of Brent and Harrow TCA, particularly home remedies, dietary and religious approaches were popular for children. Honey was a particularly common TCA, reportedly used by 27 (29%) parents for their children. Honey was believed to be traditional, acceptable, accessible, natural and safe. It was most commonly used for respiratory tract symptoms and administered with hot water and lemon juice. PHPs were more concerned about the safety of TCA than parents. Almost half (40%) of PHPs mentioned the use of honey for children, few perceived it as a 'treatment' or were concerned about botulism. Others were aware of the risks and some reported challenges in communicating risk to parents. TCA are commonly used for children, honey in particular for respiratory tract symptoms. Parents and some PHPs appear unaware of the risk of botulism from honey use in infants. Healthcare practitioners should ask routinely about the use of honey and other TCA, and consider different parental belief systems in ethnically diverse populations. Further research is required on the use and efficacy of honey for infants, to raise awareness of its benefits and risks. © 2010 Blackwell Publishing Ltd.
Influence of Posterior Corneal Astigmatism on Total Corneal Astigmatism in Eyes With Keratoconus.
Savini, Giacomo; Næser, Kristian; Schiano-Lomoriello, Domenico; Mularoni, Alessandro
2016-11-01
To measure posterior corneal astigmatism (PCA) and investigate its influence on total corneal astigmatism (TCA) in eyes with keratoconus. Keratometric astigmatism (KA), PCA, and TCA were investigated by means of a dual Scheimpflug analyzer in patients with keratoconus. Vector analysis was carried out with the Næser polar value method. We enrolled 119 eyes. PCA magnitude averaged 0.77 ± 0.43 diopters (D) and exceeded 0.50, 1.00, and 2.00 D in 73.9%, 21.8%, and 16.8% of eyes, respectively. PCA averaged 0.95 ± 0.48, 0.55 ± 0.28, and 0.70 ± 0.35 D in eyes with with-the-rule (WTR), against-the-rule (ATR), and oblique astigmatism. The steepest posterior meridian was oriented vertically (between 61 and 119 degrees) in 55.5% of eyes, thus generating ATR astigmatism. The difference between the location of the steepest meridian of KA and that of TCA was >10 degrees in 8.4% of eyes. On average, KA overestimated TCA in eyes with WTR astigmatism by 0.16 D and underestimated TCA in eyes with ATR astigmatism by 0.22 D. The PCA power oriented along the steeper anterior corneal meridian averaged -0.83 ± 0.40, -0.40 ± 0.37, and -0.53 ± 0.43 D for WTR, ATR, and obliquely astigmatic eyes, respectively. Linear regression disclosed a statistically significant correlation (P < 0.0001, r = 0.16) between the meridional powers of TCA and PCA. In eyes with keratoconus, PCA displays large, variable values and is correlated to TCA. The influence of PCA on TCA cannot be disregarded when planning astigmatism correction by toric intraocular lenses.
Feizi, Sepehr; Delfazayebaher, Siamak; Ownagh, Vahid; Sadeghpour, Fatemeh
To evaluate the agreement between total corneal astigmatism calculated by vector summation of anterior and posterior corneal astigmatism (TCA Vec ) and total corneal astigmatism measured by ray tracing (TCA Ray ). This study enrolled a total of 204 right eyes of 204 normal subjects. The eyes were measured using a Galilei double Scheimpflug analyzer. The measured parameters included simulated keratometric astigmatism using the keratometric index, anterior corneal astigmatism using the corneal refractive index, posterior corneal astigmatism, and TCA Ray . TCA Vec was derived by vector summation of the astigmatism on the anterior and posterior corneal surfaces. The magnitudes and axes of TCA Vec and TCA Ray were compared. The Pearson correlation coefficient and Bland-Altman plots were used to assess the relationship and agreement between TCA Vec and TCA Ray , respectively. The mean TCA Vec and TCA Ray magnitudes were 0.76±0.57D and 1.00±0.78D, respectively (P<0.001). The mean axis orientations were 85.12±30.26° and 89.67±36.76°, respectively (P=0.02). Strong correlations were found between the TCA Vec and TCA Ray magnitudes (r=0.96, P<0.001). Moderate associations were observed between the TCA Vec and TCA Ray axes (r=0.75, P<0.001). Bland-Altman plots produced the 95% limits of agreement for the TCA Vec and TCA Ray magnitudes from -0.33 to 0.82D. The 95% limits of agreement between the TCA Vec and TCA Ray axes was -43.0 to 52.1°. The magnitudes and axes of astigmatisms measured by the vector summation and ray tracing methods cannot be used interchangeably. There was a systematic error between the TCA Vec and TCA Ray magnitudes. Copyright © 2017 Spanish General Council of Optometry. Published by Elsevier España, S.L.U. All rights reserved.
Kelemen, S.R.; Walters, C.C.; Kwiatek, P.J.; Afeworki, M.; Sansone, M.; Freund, H.; Pottorf, R.J.; Machel, H.G.; Zhang, T.; Ellis, G.S.; Tang, Y.; Peters, K.E.
2008-01-01
Insoluble solid bitumens are organic residues that can form by the thermal chemical alteration (TCA) or thermochemical sulfate reduction (TSR) of migrated petroleum. TCA may actually encompass several low temperature processes, such as biodegradation and asphaltene precipitation, followed by thermal alteration. TSR is an abiotic redox reaction where petroleum is oxidized by sulfate. It is difficult to distinguish solid bitumens associated with TCA of petroleum from those associated with TSR when both processes occur at relatively high temperature. The focus of the present work was to characterize solid bitumen samples associated with TCA or TSR using X-ray photoelectron spectroscopy (XPS). XPS is a surface analysis conducted on either isolated or in situ (>25 ??m diameter) solid bitumen that can provide the relative abundance and chemical speciation of carbon, organic and inorganic heteroatoms (NSO). In this study, naturally occurring solid bitumens from three locations, Nisku Fm. Brazeau River area (TSR-related), LaBarge Field Madison Fm. (TSR-related), and the Alaskan Brooks range (TCA-related), are compared to organic solids generated during laboratory simulation of the TSR and TCA processes. The abundance and chemical nature of organic nitrogen and sulfur in solid bitumens can be understood in terms of the nature of (1) petroleum precursor molecules, (2) the concentration of nitrogen by way of thermal stress and (3) the mode of sulfur incorporation. TCA solid bitumens originate from polar materials that are initially rich in sulfur and nitrogen. Aromaticity and nitrogen increase as thermal stress cleaves aliphatic moieties and condensation reactions take place. Organic sulfur in TCA organic solids remains fairly constant with increasing maturation (3.5 to ???17 sulfur per 100 carbons) into aromatic structures and to the low levels of nitrogen in their hydrocarbon precursors. Hence, XPS results provide organic chemical composition information that helps to distinguish whether solid bitumen, either in situ or removed and concentrated from the rock matrix, was formed via the TCA or TRS process. ?? 2008 Elsevier Ltd.
ZHU, BINGYAN; SHANG, BOYANG; LI, YI; ZHEN, YONGSU
2016-01-01
Previous studies have shown that trans-cinnamic acid (tCA) has a broad spectrum of biological activities, and exhibits antioxidant, anti-inflammatory and anticancer properties. In addition, tCA and a variety of its analogs have been detected as gut microbe-derived metabolites exerting various biological effects in the colon. The aim of this study was to assess the antitumor activity of tCA in vitro and in vivo, in particular its therapeutic efficacy against colon cancer xenografts in athymic mice. Furthermore, it aimed to examine the effects of tCA on histone deacetylases (HDACs) and to identify the underlying molecular mechanisms. Using an MTT assay, tCA was observed to inhibit the proliferation of several cancer cell lines, and the half maximal inhibitory concentration (IC50) in HT29 colon carcinoma cells was ~1 mM. Western blot analysis demonstrated that tCA upregulated the expression of acetyl-H3 and acetyl-H4 proteins, which was consistent with the effects of the HDAC inhibitor, trichostatin A (TSA). Furthermore, expression of Bcl-2 (a marker of cell proliferation) was reduced, and apoptosis was induced. Apoptosis was shown by the activation of cleavage of poly ADP ribose polymerase and the increased expression of Bax. Apoptosis was also confirmed using APC Annexin V and SYTOX Green Nucleic Acid Stain. In addition, the tCA-induced inhibition of the expression of HDAC markers and activation of apoptosis in tumor tissues were further confirmed by immunohistochemistry. Intragastric administration of tCA at doses of 1.0 and 1.5 mmol/kg body weight suppressed the growth of HT29 human colon carcinoma xenografts in athymic mice at well-tolerated doses. No toxic changes were found in the heart, lung, liver, kidney, colon or bone marrow following histopathological examination. This study indicated that tCA is effective against colon cancer xenograft in nude mice. The antitumor mechanism of tCA was mediated, at least in part, by inhibition of HDACs in cancer cells. As an endogenous microbial metabolite predominantly produced in the colon, tCA is an agent of interest for further evaluation. PMID:27035417
NASA Astrophysics Data System (ADS)
Ren, Zhong; Liu, Guodong; Zeng, Lvming; Huang, Zhen; Zeng, Wenping
2010-10-01
The tongue coating diagnosis is an important part in tongue diagnosis of traditional Chinese medicine (TCM).The change of the thickness and color of the tongue coating can reflect the pathological state for the patient. By observing the tongue coating, a Chinese doctor can determine the nature or severity of disease. Because some limitations existed in the tongue diagnosis method of TCM and the method based on the digital image processing, a novel tongue coating analyzer(TCA) based on the concave grating monochrometer and virtual instrument is developed in this paper. This analyzer consists of the light source system, check cavity, optical fiber probe, concave grating monochrometer, spectrum detector system based on CCD and data acquisition (DAQ) card, signal processing circuit system, computer and data analysis software based on LabVIEW, etc. Experimental results show that the novel TCA's spectral range can reach 300-1000 nm, its wavelength resolution can reach 1nm, and this TCA uses the back-split-light technology and multi-channel parallel analysis. Compared with the TCA based on the image processing technology, this TCA has many advantages, such as, compact volume, simpler algorithm, faster processing speed, higher accuracy, cheaper cost and real-time handle data and display the result, etc. Therefore, it has the greatly potential values in the fields of the tongue coating diagnosis for TCM.
NASA Technical Reports Server (NTRS)
Frakes, P.
2016-01-01
Question was raised: are we seeing more late-notice events in recent months? Two definitions oflate-notice used to compare data: Event has at least one data point between TCA-4 days and TCA-2 days where the Pcwas below 1E-7, OR there were no data points in that timeframe. Event has at least one data point between TCA-2days and TCA where the Pc was at least 1E-4Event has at least one data point between TCA-4 days and TCA-2 dayswhere the Pc was below 1E-5, OR there were no data points in that timeframe. Event has at least one data pointbetween TCA-2 days and TCA where the Pc was at least 1E-4. The case studies that were examined all fall within criteriafor both definitions Terra vs 38192; TCA 24 JUN 2015Aura vs 89477; TCA 29 AUG 2015Terra vs 37131; TCA 19 DEC2015GPM vs 28685; TCA 5 SEP 2015.
Zhou, Wen; Stojanovic, Aleksandar; Utheim, Tor Paaske
2016-01-01
The aim of the study is to raise the awareness of the influence of coma-like higher-order aberrations (HOAs) on power and orientation of refractive astigmatism (RA) and to explore how to account for that influence in the planning of topography-guided refractive surgery in eyes with coma-like-aberrations-dominant corneal optics. Eleven eyes with coma-like-aberrations-dominant corneal optics and with low lenticular astigmatism (LA) were selected for astigmatism analysis and for treatment simulations with topography-guided custom ablation. Vector analysis was used to evaluate the contribution of coma-like corneal HOAs to RA. Two different strategies were used for simulated treatments aiming to regularize irregular corneal optics: With both strategies correction of anterior corneal surface irregularities (corneal HOAs) were intended. Correction of total corneal astigmatism (TCA) and RA was intended as well with strategies 1 and 2, respectively. Axis of discrepant astigmatism (RA minus TCA minus LA) correlated strongly with axis of coma. Vertical coma influenced RA by canceling the effect of the with-the-rule astigmatism and increasing the effect of the against-the-rule astigmatism. After simulated correction of anterior corneal HOAs along with TCA and RA (strategies 1 and 2), only a small amount of anterior corneal astigmatism (ACA) and no TCA remained after strategy 1, while considerable amount of ACA and TCA remained after strategy 2. Coma-like corneal aberrations seem to contribute a considerable astigmatic component to RA in eyes with coma-like-aberrations dominant corneal optics. If topography-guided ablation is programmed to correct the corneal HOAs and RA, the astigmatic component caused by the coma-like corneal HOAs will be treated twice and will result in induced astigmatism. Disregarding RA and treating TCA along with the corneal HOAs is recommended instead.
Hao, Ruijie; Adoligbe, Camus; Jiang, Bijie; Zhao, Xianlin; Gui, Linsheng; Qu, Kaixing; Wu, Sen; Zan, Linsen
2015-01-01
Longissimus dorsi muscle (LD) proteomics provides a novel opportunity to reveal the molecular mechanism behind intramuscular fat deposition. Unfortunately, the vast amounts of lipids and nucleic acids in this tissue hampered LD proteomics analysis. Trichloroacetic acid (TCA)/acetone precipitation is a widely used method to remove contaminants from protein samples. However, the high speed centrifugation employed in this method produces hard precipitates, which restrict contaminant elimination and protein re-dissolution. To address the problem, the centrifugation precipitates were first grinded with a glass tissue grinder and then washed with 90% acetone (TCA/acetone-G-W) in the present study. According to our result, the treatment for solid precipitate facilitated non-protein contaminant removal and protein re-dissolution, ultimately improving two-dimensional gel electrophoresis (2-DE) analysis. Additionally, we also evaluated the effect of sample drying on 2-DE profile as well as protein yield. It was found that 30 min air-drying did not result in significant protein loss, but reduced horizontal streaking and smearing on 2-DE gel compared to 10 min. In summary, we developed an optimized TCA/acetone precipitation method for protein extraction of LD, in which the modifications improved the effectiveness of TCA/acetone method.
Hao, Ruijie; Adoligbe, Camus; Jiang, Bijie; Zhao, Xianlin; Gui, Linsheng; Qu, Kaixing; Wu, Sen; Zan, Linsen
2015-01-01
Longissimus dorsi muscle (LD) proteomics provides a novel opportunity to reveal the molecular mechanism behind intramuscular fat deposition. Unfortunately, the vast amounts of lipids and nucleic acids in this tissue hampered LD proteomics analysis. Trichloroacetic acid (TCA)/acetone precipitation is a widely used method to remove contaminants from protein samples. However, the high speed centrifugation employed in this method produces hard precipitates, which restrict contaminant elimination and protein re-dissolution. To address the problem, the centrifugation precipitates were first grinded with a glass tissue grinder and then washed with 90% acetone (TCA/acetone-G-W) in the present study. According to our result, the treatment for solid precipitate facilitated non-protein contaminant removal and protein re-dissolution, ultimately improving two-dimensional gel electrophoresis (2-DE) analysis. Additionally, we also evaluated the effect of sample drying on 2-DE profile as well as protein yield. It was found that 30 min air-drying did not result in significant protein loss, but reduced horizontal streaking and smearing on 2-DE gel compared to 10 min. In summary, we developed an optimized TCA/acetone precipitation method for protein extraction of LD, in which the modifications improved the effectiveness of TCA/acetone method. PMID:25893432
Couoh, Lourdes R
2017-08-01
This analysis seeks to determine whether differences between real and estimated chronological age (CA) with biological age (BA) in skeletal individuals reflect variability in aging. A total of 87 individuals of two samples, ranging from 20 to 94 years old, were analyzed. One, partially documented, belongs to a Mexican skeletal collection dating to the 20th century; the other is an assemblage of prehispanic individuals from different archaeological sites. In all specimens, the tooth annulation method (TCA) was applied to estimate CA, while-excluding individuals older than 80 years-auricular surface (AS) and pubic symphysis (PS) methods were used to estimate BA. Statistical analyses were conducted to identify correlations and significance of the differences between CA vs. TCA, CA vs. AS/PS, TCA vs. AS/PS. Sex of individuals was assessed for its influence in aging. The use of TCA to estimate CA was successful for most individuals. A strong correlation was found between CA vs. TCA, CA vs. AS/PS, TCA vs. AS/PS and their differences were significant but variation in these were found when assessed by separate age groups. Sex did not influence such differences. TCA can be used to estimate CA and its differences with BA, being less than 10 years, are similar to those found in living populations. Differences between CA and BA are due to intra-population variability, which could be the consequence of individual differences in aging. More research is needed to have confidence that under- and overestimations of BA are indicators of aging variability at the level of the individual. © 2017 Wiley Periodicals, Inc.
Hanson, Mark L; Sibley, Paul K; Mabury, Scott A; Solomon, Keith R; Muir, Derek C G
2002-02-21
Trichloroacetic acid (TCA) and trifluoroacetic acid (TFA) have been detected together in environmental water samples throughout the world. TCA may enter into aquatic systems via rainout as the degradation product of chlorinated solvents, herbicide use, as a by-product of water disinfection and from emissions of spent bleach liquor of kraft pulp mills. Sources of TFA include degradation of hydrofluorocarbons (HFCs) refrigerants and pesticides. These substances are phytotoxic and widely distributed in aquatic environments. A study to assess the risk of a binary mixture of TCA and TFA to macrophytes in aquatic microcosms was conducted as part of a larger study on haloacetic acids. M. spicatum and M. sibiricum were exposed to 0.1, 1, 3 and 10 mg/l of both TCA and TFA (neutralized with sodium hydroxide) in replicate (n = 3) 12000 l aquatic microcosms for 49 days in an one-way analysis of variance design. Each microcosm was stocked with 14 individual apical shoots per species. The plants were sampled at regular intervals and assessed for the somatic endpoints of plant length, root growth, number of nodes and wet and dry mass and the biochemical endpoints of chlorophyll-a, chlorophyll-b, carotenoid content and citric acid levels. Results indicate that there were statistically significant effects of the TCA/TFA mixture on certain pigment concentrations immediately after the start of exposure (2-7 days), but the plants showed no signs of stress thereafter. These data suggest that TCA/TFA mixtures at environmentally relevant concentrations do not pose a significant risk to these aquatic macrophytes.
Pizarro, Ricardo; Nair, Veena; Meier, Timothy; Holdsworth, Ryan; Tunnell, Evelyn; Rutecki, Paul; Sillay, Karl; Meyerand, Mary E; Prabhakaran, Vivek
2016-08-01
Seizure localization includes neuroimaging like electroencephalogram, and magnetic resonance imaging (MRI) with limited ability to characterize the epileptogenic network. Temporal clustering analysis (TCA) characterizes epileptogenic network congruent with interictal epileptiform discharges by clustering together voxels with transient signals. We generated epileptogenic areas for 12 of 13 epilepsy patients with TCA, congruent with different areas of seizure onset. Resting functional MRI (fMRI) scans are noninvasive, and can be acquired quickly, in patients with different levels of severity and function. Analyzing resting fMRI data using TCA is quick and can complement clinical methods to characterize the epileptogenic network.
Wang, Ning; Wu, Xiaolin; Ku, Lixia; Chen, Yanhui; Wang, Wei
2016-01-01
Leaf morphology is closely related to the growth and development of maize (Zea mays L.) plants and final kernel production. As an important part of the maize leaf, the midrib holds leaf blades in the aerial position for maximum sunlight capture. Leaf midribs of adult plants contain substantial sclerenchyma cells with heavily thickened and lignified secondary walls and have a high amount of phenolics, making protein extraction and proteome analysis difficult in leaf midrib tissue. In the present study, three protein-extraction methods that are commonly used in plant proteomics, i.e., phenol extraction, TCA/acetone extraction, and TCA/acetone/phenol extraction, were qualitatively and quantitatively evaluated based on 2DE maps and MS/MS analysis using the midribs of the 10th newly expanded leaves of maize plants. Microscopy revealed the existence of substantial amounts of sclerenchyma underneath maize midrib epidermises (particularly abaxial epidermises). The spot-number order obtained via 2DE mapping was as follows: phenol extraction (655) > TCA/acetone extraction (589) > TCA/acetone/phenol extraction (545). MS/MS analysis identified a total of 17 spots that exhibited 2-fold changes in abundance among the three methods (using phenol extraction as a control). Sixteen of the proteins identified were hydrophilic, with GRAVY values ranging from -0.026 to -0.487. For all three methods, we were able to obtain high-quality protein samples and good 2DE maps for the maize leaf midrib. However, phenol extraction produced a better 2DE map with greater resolution between spots, and TCA/acetone extraction produced higher protein yields. Thus, this paper includes a discussion regarding the possible reasons for differential protein extraction among the three methods. This study provides useful information that can be used to select suitable protein extraction methods for the proteome analysis of recalcitrant plant tissues that are rich in sclerenchyma cells.
Wang, Bailiang; Liu, Huihua; Zhang, Binjun; Han, Yuemei; Shen, Chenghui; Lin, Quankui; Chen, Hao
2016-05-01
Infection associated with medical devices is one of the most frequent complications of modern medical biomaterials. Bacteria have a strong ability to attach on solid surfaces, forming colonies and subsequently biofilms. In this work, a novel antibacterial bulk material was prepared through combining poly(dimethyl siloxane) (PDMS) with either hydrophobic or hydrophilic antibiotics (0.1-0.2 wt%). Scanning electron microscopy, water contact angle and UV-vis spectrophotometer were used to measure the changes of surface topography, wettability and optical transmission. For both gentamicin sulfate (GS) and triclosan (TCA), the optical transmission of the PDMS-GS and PDMS-TCA blend films was higher than 90%. Drug release studies showed initial rapid release and later sustained release of GS or TCA under aqueous physiological conditions. The blend films demonstrated excellent bactericidal and sufficient biofilm inhibition functions against Gram-positive bacteria (Staphylococcus aureus, S. aureus) measured by LIVE/DEAD bacterial viability kit staining method. Kirby-Bauer method showed that there was obvious zone of inhibition (7.5-12.5mm). Cytocompatibility assessment against human lens epithelial cells (HLECs) revealed that the PDMS-GS blend films had good cytocompatibility. However, the PDMS-TCA blend films showed certain cytotoxicity against HLECs. The PDMS-0.2 wt% GS blend films were compared to native PDMS in the rabbit subcutaneous S. aureus infection model. The blend films yielded a significantly lower degree of infection than native PDMS at day 7. The achievement of the PDMS-drug bulk materials with high light transmittance, excellent bactericidal function and good cytocompatibility can potentially be widely used as bio-optical materials. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Haruna, Kabiru; Saleh, Tawfik A.; Al Thagfi, Jameel; Al-Saadi, Abdulaziz A.
2016-10-01
A comparative electronic and spectroscopic analysis of 2,4,6-trichloroaniline (TCA) and 2,4,6-tribromoaniline (TBA) was carried out by theoretical and experimental techniques. The NH2 inversion barrier in TCA and TBA molecules was predicted to be three times less than that in aniline and 2,4,6-trifluoroaniline. The size of the halogen substituents in the ortho positions is shown by density functional theory to play an important role in determining the electronic and structural properties of the amino group in the investigated haloaniline derivatives. A thorough interpretation of the infrared and Raman spectra has been performed on the basis of the observed and calculated infrared and Raman spectra as well as calculated potential energy distribution values. In addition, the SERS spectra for both trihaloanilines were successfully collected up to a concentration of 10-6 M using aged hydroxylamine-reduced silver colloid as an active substrate for TCA and TBA. SERS intensities of several peaks were found to linearly change with concentration allowing quantitative analyses of TCA and TBA. A relatively stronger interaction in the case of TBA-silver colloids is predicted compared to the TCA analogue.
Palau, Jordi; Jamin, Pierre; Badin, Alice; Vanhecke, Nicolas; Haerens, Bruno; Brouyère, Serge; Hunkeler, Daniel
2016-04-01
Compound-specific isotope analysis (CSIA) is a powerful tool to track contaminant fate in groundwater. However, the application of CSIA to chlorinated ethanes has received little attention so far. These compounds are toxic and prevalent groundwater contaminants of environmental concern. The high susceptibility of chlorinated ethanes like 1,1,1-trichloroethane (1,1,1-TCA) to be transformed via different competing pathways (biotic and abiotic) complicates the assessment of their fate in the subsurface. In this study, the use of a dual C-Cl isotope approach to identify the active degradation pathways of 1,1,1-TCA is evaluated for the first time in an aerobic aquifer impacted by 1,1,1-TCA and trichloroethylene (TCE) with concentrations of up to 20 mg/L and 3.4 mg/L, respectively. The reaction-specific dual carbon-chlorine (C-Cl) isotope trends determined in a recent laboratory study illustrated the potential of a dual isotope approach to identify contaminant degradation pathways of 1,1,1-TCA. Compared to the dual isotope slopes (Δδ(13)C/Δδ(37)Cl) previously determined in the laboratory for dehydrohalogenation/hydrolysis (DH/HY, 0.33 ± 0.04) and oxidation by persulfate (∞), the slope determined from field samples (0.6 ± 0.2, r(2) = 0.75) is closer to the one observed for DH/HY, pointing to DH/HY as the predominant degradation pathway of 1,1,1-TCA in the aquifer. The observed deviation could be explained by a minor contribution of additional degradation processes. This result, along with the little degradation of TCE determined from isotope measurements, confirmed that 1,1,1-TCA is the main source of the 1,1-dichlorethylene (1,1-DCE) detected in the aquifer with concentrations of up to 10 mg/L. This study demonstrates that a dual C-Cl isotope approach can strongly improve the qualitative and quantitative assessment of 1,1,1-TCA degradation processes in the field. Copyright © 2016 Elsevier Ltd. All rights reserved.
Lipotoxicity in steatohepatitis occurs despite an increase in tricarboxylic acid cycle activity
Patterson, Rainey E.; Kalavalapalli, Srilaxmi; Williams, Caroline M.; Nautiyal, Manisha; Mathew, Justin T.; Martinez, Janie; Reinhard, Mary K.; McDougall, Danielle J.; Rocca, James R.; Yost, Richard A.; Cusi, Kenneth; Garrett, Timothy J.
2016-01-01
The hepatic tricarboxylic acid (TCA) cycle is central to integrating macronutrient metabolism and is closely coupled to cellular respiration, free radical generation, and inflammation. Oxidative flux through the TCA cycle is induced during hepatic insulin resistance, in mice and humans with simple steatosis, reflecting early compensatory remodeling of mitochondrial energetics. We hypothesized that progressive severity of hepatic insulin resistance and the onset of nonalcoholic steatohepatitis (NASH) would impair oxidative flux through the hepatic TCA cycle. Mice (C57/BL6) were fed a high-trans-fat high-fructose diet (TFD) for 8 wk to induce simple steatosis and NASH by 24 wk. In vivo fasting hepatic mitochondrial fluxes were determined by 13C-nuclear magnetic resonance (NMR)-based isotopomer analysis. Hepatic metabolic intermediates were quantified using mass spectrometry-based targeted metabolomics. Hepatic triglyceride accumulation and insulin resistance preceded alterations in mitochondrial metabolism, since TCA cycle fluxes remained normal during simple steatosis. However, mice with NASH had a twofold induction (P < 0.05) of mitochondrial fluxes (μmol/min) through the TCA cycle (2.6 ± 0.5 vs. 5.4 ± 0.6), anaplerosis (9.1 ± 1.2 vs. 16.9 ± 2.2), and pyruvate cycling (4.9 ± 1.0 vs. 11.1 ± 1.9) compared with their age-matched controls. Induction of the TCA cycle activity during NASH was concurrent with blunted ketogenesis and accumulation of hepatic diacylglycerols (DAGs), ceramides (Cer), and long-chain acylcarnitines, suggesting inefficient oxidation and disposal of excess free fatty acids (FFA). Sustained induction of mitochondrial TCA cycle failed to prevent accretion of “lipotoxic” metabolites in the liver and could hasten inflammation and the metabolic transition to NASH. PMID:26814015
Hohnholt, Michaela C; Blumrich, Eva-Maria; Waagepetersen, Helle S; Dringen, Ralf
2017-11-01
Metformin is an antidiabetic drug that is used daily by millions of patients worldwide. Metformin is able to cross the blood-brain barrier and has recently been shown to increase glucose consumption and lactate release in cultured astrocytes. However, potential effects of metformin on mitochondrial tricarboxylic acid (TCA) cycle metabolism in astrocytes are unknown. We investigated this by mapping 13 C labeling in TCA cycle intermediates and corresponding amino acids after incubation of primary rat astrocytes with [U- 13 C]glucose. The presence of metformin did not compromise the viability of cultured astrocytes during 4 hr of incubation, but almost doubled cellular glucose consumption and lactate release. Compared with control cells, the presence of metformin dramatically lowered the molecular 13 C carbon labeling (MCL) of the cellular TCA cycle intermediates citrate, α-ketoglutarate, succinate, fumarate, and malate, as well as the MCL of the TCA cycle intermediate-derived amino acids glutamate, glutamine, and aspartate. In addition to the total molecular 13 C labeling, analysis of the individual isotopomers of TCA cycle intermediates confirmed a severe decline in labeling and a significant lowering in TCA cycling ratio in metformin-treated astrocytes. Finally, the oxygen consumption of mitochondria isolated from metformin-treated astrocytes was drastically reduced in the presence of complex I substrates, but not of complex II substrates. These data demonstrate that exposure to metformin strongly impairs complex I-mediated mitochondrial respiration in astrocytes, which is likely to cause the observed decrease in labeling of mitochondrial TCA cycle intermediates and the stimulation of glycolytic lactate production. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Genetic investigation of tricarboxylic acid metabolism during the Plasmodium falciparum life cycle.
Ke, Hangjun; Lewis, Ian A; Morrisey, Joanne M; McLean, Kyle J; Ganesan, Suresh M; Painter, Heather J; Mather, Michael W; Jacobs-Lorena, Marcelo; Llinás, Manuel; Vaidya, Akhil B
2015-04-07
New antimalarial drugs are urgently needed to control drug-resistant forms of the malaria parasite Plasmodium falciparum. Mitochondrial electron transport is the target of both existing and new antimalarials. Herein, we describe 11 genetic knockout (KO) lines that delete six of the eight mitochondrial tricarboxylic acid (TCA) cycle enzymes. Although all TCA KOs grew normally in asexual blood stages, these metabolic deficiencies halted life-cycle progression in later stages. Specifically, aconitase KO parasites arrested as late gametocytes, whereas α-ketoglutarate-dehydrogenase-deficient parasites failed to develop oocysts in the mosquitoes. Mass spectrometry analysis of (13)C-isotope-labeled TCA mutant parasites showed that P. falciparum has significant flexibility in TCA metabolism. This flexibility manifested itself through changes in pathway fluxes and through altered exchange of substrates between cytosolic and mitochondrial pools. Our findings suggest that mitochondrial metabolic plasticity is essential for parasite development. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Supersonic Aftbody Closure Wind-Tunnel Testing, Data Analysis, and Computational Results
NASA Technical Reports Server (NTRS)
Allen, Jerry; Martin, Grant; Kubiatko, Paul
1999-01-01
This paper reports on the model, test, and results from the Langley Supersonic Aftbody Closure wind tunnel test. This project is an experimental evaluation of the 1.5% Technology Concept Aircraft (TCA) aftbody closure model (Model 23) in the Langley Unitary Plan Wind Tunnel. The baseline TCA design is the result of a multidisciplinary, multipoint optimization process and was developed using linear design and analysis methods, supplemented with Euler and Navier-Stokes numerical methods. After a thorough design review, it was decided to use an upswept blade attached to the forebody as the mounting system. Structural concerns dictated that a wingtip support system would not be feasible. Only the aftbody part of the model is metric. The metric break was chosen to be at the fuselage station where prior aft-sting supported models had been truncated. Model 23 is thus a modified version of Model 20. The wing strongback, flap parts, and nacelles from Model 20 were used, whereas new aftbodies, a common forebody, and some new tails were fabricated. In summary, significant differences in longitudinal and direction stability and control characteristics between the ABF and ABB aftbody geometries were measured. Correcting the experimental data obtained for the TCA configuration with the flared aftbody to the representative of the baseline TCA closed aftbody will result in a significant reduction in longitudinal stability, a moderate reduction in stabilizer effectiveness and directional stability, and a moderate to significant reduction in rudder effectiveness. These reductions in the stability and control effectiveness levels of the baseline TCA closed aftbody are attributed to the reduction in carry-over area.
Bai, Xiuzhi; Zhang, Ting; Qu, Zhipeng; Li, Haipu; Yang, Zhaoguang
2017-09-01
In this study, the distribution of 2,4,6-trichloroanisole (2,4,6-TCA) in two water supply reservoirs and four associated drinking water treatment plants (DWTPs) were investigated. The 2,4,6-TCA concentrations were in the range of 1.53-2.36 ng L -1 in water supply reservoirs and 0.76-6.58 ng L -1 at DWTPs. To determine the contribution of filamentous fungi to 2,4,6-TCA in a full-scale treatment process, the concentrations of 2,4,6-TCA in raw water, settled water, post-filtration water, and finished water were measured. The results showed that 2,4,6-TCA levels continuously increased until chlorination, suggesting that 2,4,6-TCA could form without a chlorination reaction and fungi might be the major contributor to the 2,4,6-TCA formation. Meanwhile, twenty-nine fungal strains were isolated and identified by morphological and molecular biological methods. Of the seventeen isolated fungal species, eleven showed the capability to convert 2,4,6-trichlorophenol (2,4,6-TCP) to 2,4,6-TCA. The highest level of 2,4,6-TCA formation was carried out by Aspergillus versicolor voucher BJ1-3: 40.5% of the original 2,4,6-TCP was converted to 2,4,6-TCA. There was a significant variation in the capability of different species to generate 2,4,6-TCA. The results from the proportions of cell-free, cell-attached, and cell-bound 2,4,6-TCA suggested that 2,4,6-TCA generated by fungi was mainly distributed in their extracellular environment. In addition to 2,4,6-TCA, five putative volatile by-products were also identified by gas chromatography and mass spectrometry. These findings increase our understanding on the mechanisms involved in the formation of 2,4,6-TCA and provide insights into managing and controlling 2,4,6-TCA-related problems in drinking water. Copyright © 2017 Elsevier Ltd. All rights reserved.
TCA High Lift Preliminary Assessment
NASA Technical Reports Server (NTRS)
Wyatt, G. H.; Polito, R. C.; Yeh, D. T.; Elzey, M. E.; Tran, J. T.; Meredith, Paul T.
1999-01-01
This paper presents a TCA (Technology Concept Airplane) High lift Preliminary Assessment. The topics discussed are: 1) Model Description; 2) Data Repeatability; 3) Effect of Inboard L.E. (Leading Edge) Flap Span; 4) Comparison of 14'x22' TCA-1 With NTF (National Transonic Facility) Modified Ref. H; 5) Comparison of 14'x22' and NTF Ref. H Results; 6) Effect of Outboard Sealed Slat on TCA; 7) TCA Full Scale Build-ups; 8) Full Scale L/D Comparisons; 9) TCA Full Scale; and 10) Touchdown Lift Curves. This paper is in viewgraph form.
Computerized Design and Generation of Low-Noise Gears with Localized Bearing Contact
NASA Technical Reports Server (NTRS)
Litvin, Faydor L.; Chen, Ningxin; Chen, Jui-Sheng; Lu, Jian; Handschuh, Robert F.
1995-01-01
The results of research projects directed at the reduction of noise caused by misalignment of the following gear drives: double-circular arc helical gears, modified involute helical gears, face-milled spiral bevel gears, and face-milled formate cut hypoid gears are presented. Misalignment in these types of gear drives causes periodic, almost linear discontinuous functions of transmission errors. The period of such functions is the cycle of meshing when one pair of teeth is changed for the next. Due to the discontinuity of such functions of transmission errors high vibration and noise are inevitable. A predesigned parabolic function of transmission errors that is able to absorb linear discontinuous functions of transmission errors and change the resulting function of transmission errors into a continuous one is proposed. The proposed idea was successfully tested using spiral bevel gears and the noise was reduced a substantial amount in comparison with the existing design. The idea of a predesigned parabolic function is applied for the reduction of noise of helical and hypoid gears. The effectiveness of the proposed approach has been investigated by developed TCA (tooth contact analysis) programs. The bearing contact for the mentioned gears is localized. Conditions that avoid edge contact for the gear drives have been determined. Manufacturing of helical gears with new topology by hobs and grinding worms has been investigated.
Cilia, M.; Fish, T.; Yang, X.; Mclaughlin, M.; Thannhauser, T. W.
2009-01-01
Protein extraction methods can vary widely in reproducibility and in representation of the total proteome, yet there are limited data comparing protein isolation methods. The methodical comparison of protein isolation methods is the first critical step for proteomic studies. To address this, we compared three methods for isolation, purification, and solubilization of insect proteins. The aphid Schizaphis graminum, an agricultural pest, was the source of insect tissue. Proteins were extracted using TCA in acetone (TCA-acetone), phenol, or multi-detergents in a chaotrope solution. Extracted proteins were solubilized in a multiple chaotrope solution and examined using 1-D and 2-D electrophoresis and compared directly using 2-D Difference Gel Electrophoresis (2-D DIGE). Mass spectrometry was used to identify proteins from each extraction type. We were unable to ascribe the differences in the proteins extracted to particular physical characteristics, cell location, or biological function. The TCA-acetone extraction yielded the greatest amount of protein from aphid tissues. Each extraction method isolated a unique subset of the aphid proteome. The TCA-acetone method was explored further for its quantitative reliability using 2-D DIGE. Principal component analysis showed that little of the variation in the data was a result of technical issues, thus demonstrating that the TCA-acetone extraction is a reliable method for preparing aphid proteins for a quantitative proteomics experiment. These data suggest that although the TCA-acetone method is a suitable method for quantitative aphid proteomics, a combination of extraction approaches is recommended for increasing proteome coverage when using gel-based separation techniques. PMID:19721822
Vaganan, M Mayil; Sarumathi, S; Nandakumar, A; Ravi, I; Mustaffa, M M
2015-02-01
Four protocols viz., the trichloroacetic acid-acetone (TCA), phenol-ammonium acetate (PAA), phenol/SDS-ammonium acetate (PSA) and trisbase-acetone (TBA) were evaluated with modifications for protein extraction from banana (Grand Naine) roots, considered as recalcitrant tissues for proteomic analysis. The two-dimensional electrophoresis (2-DE) separated proteins were compared based on protein yield, number of resolved proteins, sum of spot quantity, average spot intensity and proteins resolved in 4-7 pI range. The PAA protocol yielded more proteins (0.89 mg/g of tissues) and protein spots (584) in 2-DE gel than TCA and other protocols. Also, the PAA protocol was superior in terms of sum of total spot quantity and average spot intensity than TCA and other protocols, suggesting phenol as extractant and ammonium acetate as precipitant of proteins were the most suitable for banana rooteomics analysis by 2-DE. In addition, 1:3 ratios of root tissue to extraction buffer and overnight protein precipitation were most efficient to obtain maximum protein yield.
Tian, Cihui; Asghar, Sajid; Wu, Yifan; Chen, Zhipeng; Jin, Xin; Yin, Lining; Huang, Lin; Ping, Qineng; Xiao, Yanyu
2017-01-01
The expression of multiple receptors on intestinal epithelial cells enables an actively targeted carrier to significantly enhance the oral delivery of payloads. Conjugating the receptors' ligands on the surfaces of a particulate-delivery system allows site-specific targeting. Here, we used taurocholic acid (TCA) as a ligand for uptake of nanostructured lipid carriers (NLCs) mediated by a bile-acid transporter to improve oral bioavailability of curcumin (Cur). First, synthesis of TCA-polyethylene glycol 100-monostearate (S100-TCA) was carried out. Then, the physical and chemical properties of S100-TCA-modified Cur-loaded NLCs (Cur-TCA NLCs) with varying levels of S100-TCA modifications were investigated. Small particle size (<150 nm), high drug encapsulation (>90%), drug loading (about 3%), negative ζ-potential (-7 to -3 mV), and sustained release were obtained. In situ intestinal perfusion studies demonstrated improved absorption rate and permeability coefficient of Cur-TCA NLCs. Depending on the degree of modification, Cur-TCA NLCs displayed about a five- to 15-fold higher area under the curve in rats after oral administration than unmodified Cur NLCs, which established that the addition of S100-TCA to the NLCs boosted absorption of Cur. Further investigations of TCA NLCs might reveal a bright future for effective oral delivery of poorly bioavailable drugs.
Total Copper Analyzer for Rapid In Situ Characterization of Effluent Discharges
2006-10-03
acidification , digestion, and measurement of copper with a specialized jalpaite copper ion-selective electrode (Cu-ISE). The preprocessed sensor data...analysis. This is in contrast to the temperature conditions at SBWWTP, where the TCA was deployed in a plastic hut on open grounds. The daily range...GFAA Spectroscopy” (U.S. EPA, 1992). In order to accomplish this goal, the TCA includes in-line automatic acidification , fast digestion of the
van Heugten, A J P; de Boer, W; de Vries, W S; Markesteijn, C M A; Vromans, H
2018-02-05
A stability indicating high performance liquid chromatography method has been developed for the determination of triamcinolone acetonide (TCA) and its main degradation products in ointment formulations. The method, based on extensive stress testing using metal salts, azobisisobutyronitrile, acid, base and peroxide, showed that TCA undergoes oxidative degradation. All degradation products were identified using HPLC mass spectrometry. Separation and quantification was achieved using an Altima C18 RP18 HP column (250×4.6mm 2 , with 5μm particles) using a mobile phase consisting of acetonitrile and water buffered at pH 7 using 10mM phosphate buffer. A gradient mode was operated at a flow rate of 1.5ml/min and detection was at 241nm. The method showed linearity for TCA and Impurity C in 0.02-125% of the workload, both square roots of the correlation coefficients were larger than 0.9999. Repeatability and intermediate precision were performed by six consecutive injections of both 1.25% and 125% of the work load for both TCA and Impurity C divided equally over two days. RSD were 0.6% and 0.7% for TCA and 0.5% and 0.1% for Impurity C respectively. Accuracy was determined as well, the average recoveries were 99.5% (±0.1%, n=3) for TCA and 96.9% (±1.3%, n=3) for impurity C respectively from spiked ointment samples. The robustness was also evaluated by variations of column (old vs new), mobile phase pH and filter retention. The applicability of the method was evaluated by analysis of a commercial ointment formulation. Interestingly, the extensive stress tests were able to predict all degradation products of TCA in a long term stability ointment sample. Copyright © 2017 Elsevier B.V. All rights reserved.
Carbon isotope fractionation of 1,1,1-trichloroethane during base-catalyzed persulfate treatment.
Marchesi, Massimo; Thomson, Neil R; Aravena, Ramon; Sra, Kanwartej S; Otero, Neus; Soler, Albert
2013-09-15
The extent of carbon isotope fractionation during degradation of 1,1,1-trichloroethane (1,1,1-TCA) by a base-catalyzed persulfate (S₂O₈(2-)) treatment system was investigated. Significant destruction of 1,1,1-TCA was observed at a pH of ∼12. An increase in the NaOH:S₂O₈(2-) molar ratio from 0.2:1 to 8:1 enhanced the reaction rate of 1,1,1-TCA by a factor of ∼5 to yield complete (>99.9%) destruction. An average carbon isotope enrichment fractionation factor which was independent of the NaOH:S₂O₈(2-) molar ratio of -7.0 ± 0.2‰ was obtained. This significant carbon isotope fractionation and the lack of dependence on changes in the NaOH:S₂O₈(2-) molar ratio demonstrates that carbon isotope analysis can potentially be used in situ as a performance assessment tool to estimate the degradation effectiveness of 1,1,1-TCA by a base-catalyzed persulfate system. Copyright © 2013 Elsevier B.V. All rights reserved.
Task-level control for autonomous robots
NASA Technical Reports Server (NTRS)
Simmons, Reid
1994-01-01
Task-level control refers to the integration and coordination of planning, perception, and real-time control to achieve given high-level goals. Autonomous mobile robots need task-level control to effectively achieve complex tasks in uncertain, dynamic environments. This paper describes the Task Control Architecture (TCA), an implemented system that provides commonly needed constructs for task-level control. Facilities provided by TCA include distributed communication, task decomposition and sequencing, resource management, monitoring and exception handling. TCA supports a design methodology in which robot systems are developed incrementally, starting first with deliberative plans that work in nominal situations, and then layering them with reactive behaviors that monitor plan execution and handle exceptions. To further support this approach, design and analysis tools are under development to provide ways of graphically viewing the system and validating its behavior.
Prak, Sina; Gunata, Ziya; Guiraud, Joseph-Pierre; Schorr-Galindo, Sabine
2007-05-01
Cork taint is mainly due to 2,4,6-trichloroanisole (TCA) produced through the activity of undesirable fungal strains. We observed that CFU mould number in TCA-containing stoppers was not quantitatively different to that of the stoppers not containing TCA (ca. 10(5)CFU/g). In contrast more fungi diversity was observed in TCA-containing stoppers. Penicillium spp (Penicillium chrysogenum, Penicillium glabrum), Aspergillus spp (Aspergillus niger and Aspergillus oryzae), Chrysonilia sitophila, Mucor racemosus, Paecilomyces sp. and Trichoderma viride were found in TCA-containing stoppers, while C. sitophila and Penicillium sp. were the main fungi in the stoppers devoid of TCA. Conidia were numerous close to the lenticels and present from the lateral surface through to the centre of the stoppers. Strains of Aspergillus, Mucor, Paecilomyces, Penicillium and Trichoderma isolated from TCA-containing stoppers were able to convert 2,4,6-trichlorophenol (TCP) in TCA in resting cell or growing conditions. The best yields of conversion were obtained by green fungi Paecilomyces sp. and P. chrysogenum, 17% and 20%, respectively. Chysonilia sitophila and Penicillium sp. did not produce TCA from TCP in our conditions.
Liu, Wenlan; Sun, Zhirong; Qu, Jixu; Yang, Chunning; Zhang, Xiaomin; Wei, Xinxin
2017-01-01
The aim of the present study was to investigate the correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis. Root respiration was determined using a biological oxygen analyzer. Respiration-related enzymes including glucose-6-phosphate dehydrogenase plus 6-phosphogluconate dehydrogenase, phosphohexose isomerase and succinate dehydrogenase, and respiratory pathways were evaluated. Biomass was determined by a drying-weighing method. In addition, the percentage of glycyrrhizic acid was detected using high-performance liquid chromatography. The association between root respiration and the levels of biomass and glycyrrhizic acid was investigated. The glycolysis pathway (EMP), tricarboxylic acid cycle (TCA) and pentose phosphate (PPP) pathway acted concurrently in the roots of G. uralensis. Grey correlation analysis showed that TCA had the strongest correlation (correlation coefficient, 0.8003) with biomass. Starch and acetyl coenzyme A had the closest association with above-ground biomass, while soluble sugar correlated less strongly with above-ground biomass. Grey correlation analysis between biochemical pathways and the intermediates showed that pyruvic acid had the strongest correlation with EMP, while acetyl coenzyme A correlated most strongly with TCA. Among the intermediates and pathways, pyruvic acid and EMP exhibited the greatest correlation with glycyrrhizic acid, while acetyl coenzyme A and TCA correlated with glycyrrhizic acid less closely. The results of this study may aid the cultivation of G. uralensis. However, these results require verification in further studies. PMID:28962162
Liu, Wenlan; Sun, Zhirong; Qu, Jixu; Yang, Chunning; Zhang, Xiaomin; Wei, Xinxin
2017-09-01
The aim of the present study was to investigate the correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis . Root respiration was determined using a biological oxygen analyzer. Respiration-related enzymes including glucose-6-phosphate dehydrogenase plus 6-phosphogluconate dehydrogenase, phosphohexose isomerase and succinate dehydrogenase, and respiratory pathways were evaluated. Biomass was determined by a drying-weighing method. In addition, the percentage of glycyrrhizic acid was detected using high-performance liquid chromatography. The association between root respiration and the levels of biomass and glycyrrhizic acid was investigated. The glycolysis pathway (EMP), tricarboxylic acid cycle (TCA) and pentose phosphate (PPP) pathway acted concurrently in the roots of G. uralensis . Grey correlation analysis showed that TCA had the strongest correlation (correlation coefficient, 0.8003) with biomass. Starch and acetyl coenzyme A had the closest association with above-ground biomass, while soluble sugar correlated less strongly with above-ground biomass. Grey correlation analysis between biochemical pathways and the intermediates showed that pyruvic acid had the strongest correlation with EMP, while acetyl coenzyme A correlated most strongly with TCA. Among the intermediates and pathways, pyruvic acid and EMP exhibited the greatest correlation with glycyrrhizic acid, while acetyl coenzyme A and TCA correlated with glycyrrhizic acid less closely. The results of this study may aid the cultivation of G. uralensis . However, these results require verification in further studies.
NASA Technical Reports Server (NTRS)
Ghaffari, Farhad
1999-01-01
Unstructured grid Euler computations, performed at supersonic cruise speed, are presented for a High Speed Civil Transport (HSCT) configuration, designated as the Technology Concept Airplane (TCA) within the High Speed Research (HSR) Program. The numerical results are obtained for the complete TCA cruise configuration which includes the wing, fuselage, empennage, diverters, and flow through nacelles at M (sub infinity) = 2.4 for a range of angles-of-attack and sideslip. Although all the present computations are performed for the complete TCA configuration, appropriate assumptions derived from the fundamental supersonic aerodynamic principles have been made to extract aerodynamic predictions to complement the experimental data obtained from a 1.675%-scaled truncated (aft fuselage/empennage components removed) TCA model. The validity of the computational results, derived from the latter assumptions, are thoroughly addressed and discussed in detail. The computed surface and off-surface flow characteristics are analyzed and the pressure coefficient contours on the wing lower surface are shown to correlate reasonably well with the available pressure sensitive paint results, particularly, for the complex flow structures around the nacelles. The predicted longitudinal and lateral/directional performance characteristics for the truncated TCA configuration are shown to correlate very well with the corresponding wind-tunnel data across the examined range of angles-of-attack and sideslip. The complementary computational results for the longitudinal and lateral/directional performance characteristics for the complete TCA configuration are also presented along with the aerodynamic effects due to empennage components. Results are also presented to assess the computational method performance, solution sensitivity to grid refinement, and solution convergence characteristics.
Park, Gaeun; Lim, Tae-gyu; Kwon, Jung Yeon; Song, Da Som; Jeong, Eun Hee; Lee, Charles C.; Son, Joe Eun; Seo, Sang Gwon; Lee, Eunjung; Kim, Jong Rhan; Lee, Chang Yong; Park, Jun Seong; Lee, Ki Won
2015-01-01
Japanese red pine (Pinus densiflora) is widely present in China, Japan, and Korea. Its green pine leaves have traditionally been used as a food as well as a coloring agent. After being shed, pine leaves change their color from green to brown within two years, and although the brown pine leaves are abundantly available, their value has not been closely assessed. In this study, we investigated the potential anti-photoaging properties of brown pine leaves for skin. Brown pine leaf extract (BPLE) inhibited UVB-induced matrix metalloproteinase-1 (MMP-1) expression to a greater extent than pine leaf extract (PLE) in human keratinocytes and a human skin equivalent model. HPLC analysis revealed that the quantity of trans-communic acid (TCA) and dehydroabietic acid (DAA) significantly increases when the pine leaf color changes from green to brown. BPLE and TCA elicited reductions in UVB-induced MMP-1 mRNA expression and activator protein-1 (AP-1) transactivation by reducing DNA binding activity of phospho-c-Jun, c-fos and Fra-1. BPLE and TCA also inhibited UVB-induced Akt phosphorylation, but not mitogen activated protein kinase (MAPK), known regulators of AP-1 transactivation. We additionally found that BPLE and TCA inhibited phosphoinositide 3-kinase (PI3K), the upstream kinase of Akt, in vitro. In summary, both BPLE and its active component TCA exhibit protective effects against UVB-induced skin aging. Taken together, these findings underline the potential for BPLE and TCA to be utilized as anti-wrinkling agents and cosmetic ingredients, as they suppress UVB-induced MMP-1 expression. PMID:26066652
Weger, H G; Turpin, D H
1989-02-01
Mass spectrometric analysis shows that assimilation of inorganic nitrogen (NH(4) (+), NO(2) (-), NO(3) (-)) by N-limited cells of Selenastrum minutum (Naeg.) Collins results in a stimulation of tricarboxylic acid cycle (TCA cycle) CO(2) release in both the light and dark. In a previous study we have shown that TCA cycle reductant generated during NH(4) (+) assimilation is oxidized via the cytochrome electron transport chain, resulting in an increase in respiratory O(2) consumption during photosynthesis (HG Weger, DG Birch, IR Elrifi, DH Turpin [1988] Plant Physiol 86: 688-692). NO(3) (-) and NO(2) (-) assimilation resulted in a larger stimulation of TCA cycle CO(2) release than did NH(4) (+), but a much smaller stimulation of mitochondrial O(2) consumption. NH(4) (+) assimilation was the same in the light and dark and insensitive to DCMU, but was 82% inhibited by anaerobiosis in both the light and dark. NO(3) (-) and NO(2) (-) assimilation rates were maximal in the light, but assimilation could proceed at substantial rates in the light in the presence of DCMU and in the dark. Unlike NH(4) (+), NO(3) (-) and NO(2) (-) assimilation were relatively insensitive to anaerobiosis. These results indicated that operation of the mitochondrial electron transport chain was not required to maintain TCA cycle activity during NO(3) (-) and NO(2) (-) assimilation, suggesting an alternative sink for TCA cycle generated reductant. Evaluation of changes in gross O(2) consumption during NO(3) (-) and NO(2) (-) assimilation suggest that TCA cycle reductant was exported to the chloroplast during photosynthesis and used to support NO(3) (-) and NO(2) (-) reduction.
Mitochondrial Respiration Can Support NO3− and NO2− Reduction during Photosynthesis 1
Weger, Harold G.; Turpin, David H.
1989-01-01
Mass spectrometric analysis shows that assimilation of inorganic nitrogen (NH4+, NO2−, NO3−) by N-limited cells of Selenastrum minutum (Naeg.) Collins results in a stimulation of tricarboxylic acid cycle (TCA cycle) CO2 release in both the light and dark. In a previous study we have shown that TCA cycle reductant generated during NH4+ assimilation is oxidized via the cytochrome electron transport chain, resulting in an increase in respiratory O2 consumption during photosynthesis (HG Weger, DG Birch, IR Elrifi, DH Turpin [1988] Plant Physiol 86: 688-692). NO3− and NO2− assimilation resulted in a larger stimulation of TCA cycle CO2 release than did NH4+, but a much smaller stimulation of mitochondrial O2 consumption. NH4+ assimilation was the same in the light and dark and insensitive to DCMU, but was 82% inhibited by anaerobiosis in both the light and dark. NO3− and NO2− assimilation rates were maximal in the light, but assimilation could proceed at substantial rates in the light in the presence of DCMU and in the dark. Unlike NH4+, NO3− and NO2− assimilation were relatively insensitive to anaerobiosis. These results indicated that operation of the mitochondrial electron transport chain was not required to maintain TCA cycle activity during NO3− and NO2− assimilation, suggesting an alternative sink for TCA cycle generated reductant. Evaluation of changes in gross O2 consumption during NO3− and NO2− assimilation suggest that TCA cycle reductant was exported to the chloroplast during photosynthesis and used to support NO3− and NO2− reduction. PMID:16666557
Fang, Jie; Zhang, Yiping; Huang, Lijuan; Jia, Xinying; Zhang, Qi; Zhang, Xu; Tang, Gongli; Liu, Wen
2008-01-01
Tetrocarcin A (TCA), produced by Micromonospora chalcea NRRL 11289, is a spirotetronate antibiotic with potent antitumor activity and versatile modes of action. In this study, the biosynthetic gene cluster of TCA was cloned and localized to a 108-kb contiguous DNA region. In silico sequence analysis revealed 36 putative genes that constitute this cluster (including 11 for unusual sugar biosynthesis, 13 for aglycone formation, and 4 for glycosylations) and allowed us to propose the biosynthetic pathway of TCA. The formation of d-tetronitrose, l-amicetose, and l-digitoxose may begin with d-glucose-1-phosphate, share early enzymatic steps, and branch into different pathways by competitive actions of specific enzymes. Tetronolide biosynthesis involves the incorporation of a 3-C unit with a polyketide intermediate to form the characteristic spirotetronate moiety and trans-decalin system. Further substitution of tetronolide with five deoxysugars (one being a deoxynitrosugar) was likely due to the activities of four glycosyltransferases. In vitro characterization of the first enzymatic step by utilization of 1,3-biphosphoglycerate as the substrate and in vivo cross-complementation of the bifunctional fused gene tcaD3 (with the functions of chlD3 and chlD4) to ΔchlD3 and ΔchlD4 in chlorothricin biosynthesis supported the highly conserved tetronate biosynthetic strategy in the spirotetronate family. Deletion of a large DNA fragment encoding polyketide synthases resulted in a non-TCA-producing strain, providing a clear background for the identification of novel analogs. These findings provide insights into spirotetronate biosynthesis and demonstrate that combinatorial-biosynthesis methods can be applied to the TCA biosynthetic machinery to generate structural diversity. PMID:18586939
Metabolism: Part II. The Tricarboxylic Acid (TCA), Citric Acid, or Krebs Cycle.
ERIC Educational Resources Information Center
Bodner, George M.
1986-01-01
Differentiates the tricarboxylic acid (TCA) cycle (or Krebs cycle) from glycolysis, and describes the bridge between the two as being the conversion of pyruvate into acetyl coenzyme A. Discusses the eight steps in the TCA cycle, the results of isotopic labeling experiments, and the net effects of the TCA cycle. (TW)
Effects of tretinoin pretreatment on TCA chemical peel in guinea pig skin.
Kim, I. H.; Kim, H. K.; Kye, Y. C.
1996-01-01
This study was done to characterize the structural changes in the tretinoin pretreatment on trichloroacetic acid(TCA) chemical peel. In guinea pigs, the right halves pretreated with tretinoin and the left halves treated nothing were compared in their structural changes after TCA chemical peel. Epidermal thickness in the tretinoin pretreated group was almost the same in the first and second week. But epidermis of the TCA group increased continuously. In the first week, mitotic figures in the epidermis were more increased in the TCA group, but those in hair follicles were more increased in the tretinoin pretreated group. In the second week, mitotic figures in the epidermis were almost same in both group, but in hair follicles of the tretinoin pretreated group, mitotic figures were much more increased. In alcian blue staining, glycosaminoglycan was stained much more strongly in dermis of the TCA group in first week, but was more strongly stained in the tretinoin pretreated group in second week. On electron microscopic findings, the fibroblasts in upper dermis were larger and had plentier cytoplasm with more organelles in the tretinoin pretreated group. Conclusively, tretinoin pretreatment on TCA chemical peel sustained the effects of TCA longer and showed synergistic effects of TCA and induced enhanced wound healing. PMID:8878803
In vitro anticancer effects of insect tea in TCA8113 cells.
Qian, Yu; Li, Gui-Jie; Wang, Rui; Zhou, Ya-Lin; Sun, Peng; Zhao, Xin
2014-01-01
Insect tea is widely used a traditional drink or traditional Chinese medicine in China. This study was conducted with an aim to determine the in vitro anticancer effect of Insect tea in cancer cells. The anticancer effects of Insect tea were evaluated in human tongue carcinoma TCA8113 cells using 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT) assay, flow cytometry analysis, nuclear staining with 4,6-diamidino-2-phenylindole (DAPI), reverse transcription-polymerase chain reaction (RT-PCR) analysis, and western bolt assay. At 200 μg/mL, Insect tea inhibited the growth of TCA8113 cells by 80.7%, which was higher than the inhibition caused by 100 μg/mL Insect tea but lower than that of 200 μg/mL green tea. Compared to the control cancer cells, Insect tea significantly (P<0.05) induced apoptosis as determined by DAPI staining and flow cytometry analysis results. Insect tea significantly induced apoptosis in cancer cells by upregulating BAX, CASP3, CASP9 and downregulating BCL2. Genes encoding nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), inducible nitric oxide synthase (iNOS), and cyclooxygenase-2 (COX-2) were significantly downregulated by Insect tea, demonstrating its anti-inflammatory properties. Insect tea also exerted a great anti-metastasis effect on cancer cells as demonstrated by decreased expression of matrix metalloproteinase (MMP) genes and increased expression of tissue inhibitors of metalloproteinases (TIMPs). The results showed that Insect tea has good in vitro anticancer effects in TCA8113 cells, like green tea.
Feeley, Iain; Hegarty, Aidan; Hickey, Anne; Glynn, Aaron
2016-08-01
Mechanical guides in total knee arthroplasty are divided into intramedullary and extramedullary systems, designed to give accurate reference, to enable the surgeon to perform a tibial cut which is perpendicular to the mechanical axis. We conducted a systematic review and meta-analysis of levels 1 and 2 published data which directly compares the two methods of alignment, with outcomes of interest being the mean tibial component angle to the mechanical axis and the number of outliers from the optimal range. The PRISMA (preferred reporting items for systematic reviews and meta-analysis) guidance was followed. A search was conducted of online databases Medline PubMed; EMBASE; ISI Web of Science, and the Cochrane library, using the Boolean search string ([intramedullary OR extramedullary] AND knee AND [arthroplasty OR replacement]). Numerical data pertaining to tibial component alignment (TCA), the mechanical tibiofemoral angle, the tibial slope, and the number of outliers from optimal TCA were collated, and used to establish pooled results. No constraints on the search in terms of year of publication or language were instituted. Intrastudy bias was assessed using the Jadad score for randomized controlled trials and the Newcastle Ottawa score for prospective cohort studies. A total of 1,896 titles were reviewed. Following abstract review and full review of relevant articles, 10 publications were included for analysis, of which 8 were suitable to include for meta-analysis. No trials showed a significant difference in the mean TCA. Two trials showed an increased number of outliers in the extramedullary group and two studies showed an increased number of outliers in the intramedullary group. Pooled data from studies which included these outcomes showed no advantage for either system in limiting the number of outliers from the optimal TCA (relative risk, 0.99; 95% confidence interval [CI], 0.87-1.14; p = 0.004), and no significant difference in mean TCA (standardized mean difference, -0.07; 95% CI, -0.22 to 0.08; p = 0.000). Based on our results, no advantage can be attributed to the type of mechanical guide used in obtaining an adequate tibial cut. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.
Veyrat-Durebex, Charlotte; Corcia, Philippe; Piver, Eric; Devos, David; Dangoumau, Audrey; Gouel, Flore; Vourc'h, Patrick; Emond, Patrick; Laumonnier, Frédéric; Nadal-Desbarats, Lydie; Gordon, Paul H; Andres, Christian R; Blasco, Hélène
2016-12-01
This study aims to develop a cellular metabolomics model that reproduces the pathophysiological conditions found in amyotrophic lateral sclerosis in order to improve knowledge of disease physiology. We used a co-culture model combining the motor neuron-like cell line NSC-34 and the astrocyte clone C8-D1A, with each over-expressing wild-type or G93C mutant human SOD1, to examine amyotrophic lateral sclerosis (ALS) physiology. We focused on the effects of mutant human SOD1 as well as oxidative stress induced by menadione on intracellular metabolism using a metabolomics approach through gas chromatography coupled with mass spectrometry (GC-MS) analysis. Preliminary non-supervised analysis by Principal Component Analysis (PCA) revealed that cell type, genetic environment, and time of culture influenced the metabolomics profiles. Supervised analysis using orthogonal partial least squares discriminant analysis (OPLS-DA) on data from intracellular metabolomics profiles of SOD1 G93C co-cultures produced metabolites involved in glutamate metabolism and the tricarboxylic acid cycle (TCA) cycle. This study revealed the feasibility of using a metabolomics approach in a cellular model of ALS. We identified potential disruption of the TCA cycle and glutamate metabolism under oxidative stress, which is consistent with prior research in the disease. Analysis of metabolic alterations in an in vitro model is a novel approach to investigation of disease physiology.
Fontana, Ariel R; Patil, Sangram H; Banerjee, Kaushik; Altamirano, Jorgelina C
2010-04-28
A fast and effective microextraction technique is proposed for preconcentration of 2,4,6-trichloroanisole (2,4,6-TCA) from wine samples prior gas chromatography tandem mass spectrometric (GC-MS/MS) analysis. The proposed technique is based on ultrasonication (US) for favoring the emulsification phenomenon during the extraction stage. Several variables influencing the relative response of the target analyte were studied and optimized. Under optimal experimental conditions, 2,4,6-TCA was quantitatively extracted achieving enhancement factors (EF) > or = 400 and limits of detection (LODs) 0.6-0.7 ng L(-1) with relative standard deviations (RSDs) < or = 11.3%, when 10 ng L(-1) 2,4,6-TCA standard-wine sample blend was analyzed. The calibration graphs for white and red wine were linear within the range of 5-1000 ng L(-1), and estimation coefficients (r(2)) were > or = 0.9995. Validation of the methodology was carried out by standard addition method at two concentrations (10 and 50 ng L(-1)) achieving recoveries >80% indicating satisfactory robustness of the method. The methodology was successfully applied for determination of 2,4,6-TCA in different wine samples.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Lu; Zhang, Sheng; Qu, Xiaoni
Lanthanide MOFs, [Eu(TCA)(NDC)·H{sub 2}O]{sub n} (1) and [Tb(TCA)(NDC)·H{sub 2}O]{sub n} (2), have been prepared with the mixed aromatic carboxylate ligands, namely, 4,4′,4″-tricarboxytriphenylamine (H{sub 3}TCA) and 1,4-naphthalenedicarboxylate (H{sub 2}NDC). Single-crystal X-ray diffraction analysis reveals that isomorphic 1 and 2 present pillar-layered 3D framework that Eu/Tb(III) bond with carboxylate in various coordination fashions. Optical investigation indicates that the as-prepared compounds feature characteristic luminescence emission bands of Eu/Tb ions in the visible regions at room temperature. Moreover, compound 2 shows a relatively longer luminescence lifetime (τ=0.342 ms) and significantly enhanced quantum yield (Φ{sub overall}=11%) comparing with those of 1 (τ=0.335 ms, Φ{sub overall}=0.06%).more » - Graphical abstract: Synoptic: Two Ln-MOFs (Ln=Eu{sup III}, Tb{sup III}) with mixed polycarboxylate ligands present different luminescent properties. - Highlights: • Two Eu/Tb-MOFs with H{sub 3}TCA and H{sub 2}NDC ligands have been obtained. • The ancillary ligand is employed to decrease water molecule coordinate numbers. • 2displays superior quantum yield and lifetime than those of 1.« less
Gauthier, J; Schutkowski, H
2013-02-01
The analysis of human skeletal remains is frequently impeded by the lack of adequately preserved morphological markers on which to base age estimation, particularly in archeological contexts. Therefore, histological methods such as tooth cementum annulation analysis can be useful for extracting reliable age estimates from poorly preserved skeletons, if they produce results corresponding to morphologically based, multifactorial assessments. In order to test this presumption, this study compares tooth cementum annulation (TCA) with macroscopic age estimation results incorporating the Brooks-Suchey pubic symphysis and the Buckberry-Chamberlain revised auricular surface methods, as well as Brothwell's guidelines for analyzing dental attrition. Undecalcified, polished, and unstained transverse thin sections viewed using standard light microscopy, with decentered phase contrast microscopy in cases of poorly delineated cementum annulations, were used for TCA counts. Age estimates were applied independently on the late medieval archeological Box Lane cemetery assemblage from Pontefract, England, to analyze their measure of correspondence and to assess whether data produced by a single histological technique are comparable to information pooled from multiple morphological age markers. Spearman's rank correlation tests resulted in a significant association between TCA and morphological age estimates. Further studies using larger samples of known age material would help to improve our understanding of TCA age estimation performance relative to macroscopic age assessment as well as continued refinement and standardization of cementum sectioning, which is suggested to impact annulation visibility. Copyright © 2012 Elsevier GmbH. All rights reserved.
Effects of ocular transverse chromatic aberration on peripheral word identification.
Yang, Shun-Nan; Tai, Yu-chi; Laukkanen, Hannu; Sheedy, James E
2011-11-01
Transverse chromatic aberration (TCA) smears the retinal image of peripheral stimuli. We previously found that TCA significantly reduces the ability to recognize letters presented in the near fovea by degrading image quality and exacerbating crowding effect from adjacent letters. The present study examined whether TCA has a significant effect on near foveal and peripheral word identification, and whether within-word orthographic facilitation interacts with TCA effect to affect word identification. Subjects were briefly presented a 6- to 7-letter word of high or low frequency in each trial. Target words were generated with weak or strong horizontal color fringe to attenuate the TCA in the right periphery and exacerbate it in the left. The center of the target word was 1°, 2°, 4°, and 6° to the left or right of a fixation point. Subject's eye position was monitored with an eye-tracker to ensure proper fixation before target presentation. They were required to report the identity of the target word as soon and accurately as possible. Results show significant effect of color fringe on the latency and accuracy of word recognition, indicating existing TCA effect. Observed TCA effect was more salient in the right periphery, and was affected by word frequency more there. Individuals' subjective preference of color-fringed text was correlated to the TCA effect in the near periphery. Our results suggest that TCA significantly affects peripheral word identification, especially when it is located in the right periphery. Contextual facilitation such as word frequency interacts with TCA to influence the accuracy and latency of word recognition. Copyright © 2011 Elsevier Ltd. All rights reserved.
Noordam, Raymond; Sitlani, Colleen M; Avery, Christy L; Stewart, James D; Gogarten, Stephanie M; Wiggins, Kerri L; Trompet, Stella; Warren, Helen R; Sun, Fangui; Evans, Daniel S; Li, Xiaohui; Li, Jin; Smith, Albert V; Bis, Joshua C; Brody, Jennifer A; Busch, Evan L; Caulfield, Mark J; Chen, Yii-Der I; Cummings, Steven R; Cupples, L Adrienne; Duan, Qing; Franco, Oscar H; Méndez-Giráldez, Rául; Harris, Tamara B; Heckbert, Susan R; van Heemst, Diana; Hofman, Albert; Floyd, James S; Kors, Jan A; Launer, Lenore J; Li, Yun; Li-Gao, Ruifang; Lange, Leslie A; Lin, Henry J; de Mutsert, Renée; Napier, Melanie D; Newton-Cheh, Christopher; Poulter, Neil; Reiner, Alexander P; Rice, Kenneth M; Roach, Jeffrey; Rodriguez, Carlos J; Rosendaal, Frits R; Sattar, Naveed; Sever, Peter; Seyerle, Amanda A; Slagboom, P Eline; Soliman, Elsayed Z; Sotoodehnia, Nona; Stott, David J; Stürmer, Til; Taylor, Kent D; Thornton, Timothy A; Uitterlinden, André G; Wilhelmsen, Kirk C; Wilson, James G; Gudnason, Vilmundur; Jukema, J Wouter; Laurie, Cathy C; Liu, Yongmei; Mook-Kanamori, Dennis O; Munroe, Patricia B; Rotter, Jerome I; Vasan, Ramachandran S; Psaty, Bruce M; Stricker, Bruno H; Whitsel, Eric A
2017-01-01
Background Increased heart rate and a prolonged QT interval are important risk factors for cardiovascular morbidity and mortality, and can be influenced by the use of various medications, including tri/tetracyclic antidepressants (TCAs). We aim to identify genetic loci that modify the association between TCA use and RR and QT intervals. Methods and Results We conducted race/ethnic-specific genome-wide interaction analyses (with HapMap Phase II imputed reference panel imputation) of TCAs and resting RR and QT intervals in cohorts of European (n=45,706; n=1,417 TCA users), African (n=10,235; n=296 TCA users) and Hispanic/Latino (n=13,808; n=147 TCA users) ancestry, adjusted for clinical covariates. Among the populations of European ancestry, two genome-wide significant loci were identified for RR interval: rs6737205 in BRE (β = 56.3, Pinteraction = 3.9e−9) and rs9830388 in UBE2E2 (β = 25.2, Pinteraction = 1.7e−8). In Hispanic/Latino cohorts, rs2291477 in TGFBR3 significantly modified the association between TCAs and QT intervals (β = 9.3, Pinteraction = 2.55e−8). In the meta-analyses of the other ethnicities, these loci either were excluded from the meta-analyses (as part of quality control), or their effects did not reach the level of nominal statistical significance (Pinteraction > 0.05). No new variants were identified in these ethnicities. No additional loci were identified after inverse-variance-weighted meta-analysis of the three ancestries. Conclusion Among Europeans, TCA interactions with variants in BRE and UBE2E2, were identified in relation to RR intervals. Among Hispanic/Latinos, variants in TGFBR3 modified the relation between TCAs and QT intervals. Future studies are required to confirm our results. PMID:28039329
Localized Glaucomatous Change Detection within the Proper Orthogonal Decomposition Framework
Balasubramanian, Madhusudhanan; Kriegman, David J.; Bowd, Christopher; Holst, Michael; Weinreb, Robert N.; Sample, Pamela A.; Zangwill, Linda M.
2012-01-01
Purpose. To detect localized glaucomatous structural changes using proper orthogonal decomposition (POD) framework with false-positive control that minimizes confirmatory follow-ups, and to compare the results to topographic change analysis (TCA). Methods. We included 167 participants (246 eyes) with ≥4 Heidelberg Retina Tomograph (HRT)-II exams from the Diagnostic Innovations in Glaucoma Study; 36 eyes progressed by stereo-photographs or visual fields. All other patient eyes (n = 210) were non-progressing. Specificities were evaluated using 21 normal eyes. Significance of change at each HRT superpixel between each follow-up and its nearest baseline (obtained using POD) was estimated using mixed-effects ANOVA. Locations with significant reduction in retinal height (red pixels) were determined using Bonferroni, Lehmann-Romano k-family-wise error rate (k-FWER), and Benjamini-Hochberg false discovery rate (FDR) type I error control procedures. Observed positive rate (OPR) in each follow-up was calculated as a ratio of number of red pixels within disk to disk size. Progression by POD was defined as one or more follow-ups with OPR greater than the anticipated false-positive rate. TCA was evaluated using the recently proposed liberal, moderate, and conservative progression criteria. Results. Sensitivity in progressors, specificity in normals, and specificity in non-progressors, respectively, were POD-Bonferroni = 100%, 0%, and 0%; POD k-FWER = 78%, 86%, and 43%; POD-FDR = 78%, 86%, and 43%; POD k-FWER with retinal height change ≥50 μm = 61%, 95%, and 60%; TCA-liberal = 86%, 62%, and 21%; TCA-moderate = 53%, 100%, and 70%; and TCA-conservative = 17%, 100%, and 84%. Conclusions. With a stronger control of type I errors, k-FWER in POD framework minimized confirmatory follow-ups while providing diagnostic accuracy comparable to TCA. Thus, POD with k-FWER shows promise to reduce the number of confirmatory follow-ups required for clinical care and studies evaluating new glaucoma treatments. (ClinicalTrials.gov number, NCT00221897.) PMID:22491406
Sunny, Nishanth E; Kalavalapalli, Srilaxmi; Bril, Fernando; Garrett, Timothy J; Nautiyal, Manisha; Mathew, Justin T; Williams, Caroline M; Cusi, Kenneth
2015-08-15
Elevated plasma branched-chain amino acids (BCAA) in the setting of insulin resistance have been relevant in predicting type 2 diabetes mellitus (T2DM) onset, but their role in the etiology of hepatic insulin resistance remains uncertain. We determined the link between BCAA and dysfunctional hepatic tricarboxylic acid (TCA) cycle, which is a central feature of hepatic insulin resistance and nonalcoholic fatty liver disease (NAFLD). Plasma metabolites under basal fasting and euglycemic hyperinsulinemic clamps (insulin stimulation) were measured in 94 human subjects with varying degrees of insulin sensitivity to identify their relationships with insulin resistance. Furthermore, the impact of elevated BCAA on hepatic TCA cycle was determined in a diet-induced mouse model of NAFLD, utilizing targeted metabolomics and nuclear magnetic resonance (NMR)-based metabolic flux analysis. Insulin stimulation revealed robust relationships between human plasma BCAA and indices of insulin resistance, indicating chronic metabolic overload from BCAA. Human plasma BCAA and long-chain acylcarnitines also showed a positive correlation, suggesting modulation of mitochondrial metabolism by BCAA. Concurrently, mice with NAFLD failed to optimally induce hepatic mTORC1, plasma ketones, and hepatic long-chain acylcarnitines, following acute elevation of plasma BCAA. Furthermore, elevated BCAA failed to induce multiple fluxes through hepatic TCA cycle in mice with NAFLD. Our data suggest that BCAA are essential to mediate efficient channeling of carbon substrates for oxidation through mitochondrial TCA cycle. Impairment of BCAA-mediated upregulation of the TCA cycle could be a significant contributor to mitochondrial dysfunction in NAFLD.
Kalavalapalli, Srilaxmi; Bril, Fernando; Garrett, Timothy J.; Nautiyal, Manisha; Mathew, Justin T.; Williams, Caroline M.; Cusi, Kenneth
2015-01-01
Elevated plasma branched-chain amino acids (BCAA) in the setting of insulin resistance have been relevant in predicting type 2 diabetes mellitus (T2DM) onset, but their role in the etiology of hepatic insulin resistance remains uncertain. We determined the link between BCAA and dysfunctional hepatic tricarboxylic acid (TCA) cycle, which is a central feature of hepatic insulin resistance and nonalcoholic fatty liver disease (NAFLD). Plasma metabolites under basal fasting and euglycemic hyperinsulinemic clamps (insulin stimulation) were measured in 94 human subjects with varying degrees of insulin sensitivity to identify their relationships with insulin resistance. Furthermore, the impact of elevated BCAA on hepatic TCA cycle was determined in a diet-induced mouse model of NAFLD, utilizing targeted metabolomics and nuclear magnetic resonance (NMR)-based metabolic flux analysis. Insulin stimulation revealed robust relationships between human plasma BCAA and indices of insulin resistance, indicating chronic metabolic overload from BCAA. Human plasma BCAA and long-chain acylcarnitines also showed a positive correlation, suggesting modulation of mitochondrial metabolism by BCAA. Concurrently, mice with NAFLD failed to optimally induce hepatic mTORC1, plasma ketones, and hepatic long-chain acylcarnitines, following acute elevation of plasma BCAA. Furthermore, elevated BCAA failed to induce multiple fluxes through hepatic TCA cycle in mice with NAFLD. Our data suggest that BCAA are essential to mediate efficient channeling of carbon substrates for oxidation through mitochondrial TCA cycle. Impairment of BCAA-mediated upregulation of the TCA cycle could be a significant contributor to mitochondrial dysfunction in NAFLD. PMID:26058864
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaiser, Brooke LD; Wunschel, David S.; Sydor, Michael A.
2015-08-07
Proteomic analysis of bacterial samples provides valuable information about cellular responses and functions under different environmental pressures. Proteomic analysis is dependent upon efficient extraction of proteins from bacterial samples without introducing bias toward extraction of particular protein classes. While no single method can recover 100% of the bacterial proteins, selected protocols can improve overall protein isolation, peptide recovery, or enrich for certain classes of proteins. The method presented here is technically simple and does not require specialized equipment such as a mechanical disrupter. Our data reveal that for particularly challenging samples, such as B. anthracis Sterne spores, trichloroacetic acid extractionmore » improved the number of proteins identified within a sample compared to bead beating (714 vs 660, respectively). Further, TCA extraction enriched for 103 known spore specific proteins whereas bead beating resulted in 49 unique proteins. Analysis of C. botulinum samples grown to 5 days, composed of vegetative biomass and spores, showed a similar trend with improved protein yields and identification using our method compared to bead beating. Interestingly, easily lysed samples, such as B. anthracis vegetative cells, were equally as effectively processed via TCA and bead beating, but TCA extraction remains the easiest and most cost effective option. As with all assays, supplemental methods such as implementation of an alternative preparation method may provide additional insight to the protein biology of the bacteria being studied.« less
The reductive degradation of 1,1,1-trichloroethane by Fe(0) in a soil slurry system.
Wu, Xiaoliang; Lu, Shuguang; Qiu, Zhaofu; Sui, Qian; Lin, Kuangfei; Du, Xiaoming; Luo, Qishi
2014-01-01
Most studies on the treatment of chlorinated contaminants by Fe(0) focus on aqueous system tests. However, few is known about the effectiveness of these tests for degrading chlorinated contaminants such as 1,1,1-trichloroethane (TCA) in soil. In this work, the reductive degradation performance of 1,1,1-TCA by Fe(0) was thoroughly investigated in a soil slurry system. The effects of various factors including acid-washed iron, the initial 1,1,1-TCA concentration, Fe(0) dosage, slurry pH, and common constituents in groundwater and soil such as Cl(-), HCO3 (-), SO4 (2-), and NO3 (-) anions and humic acid (HA) were evaluated. The experimental results showed that 1,1,1-TCA could be effectively degraded in 12 h for an initial Fe(0) dosage of 10 g L(-1) and a soil/water mass ratio of 1:5. The soil slurry experiments showed two-stage degradation kinetics: a slow reaction in the first stage and a fast reductive degradation of 1,1,1-TCA in the second stage. The reductive degradation of 1,1,1-TCA was expedited as the mass concentration of Fe(0) increased. In addition, high pHs adversely affected the degradation of 1,1,1-TCA over a pH range of 5.4-8.0 and the reductive degradation efficiency decreased with increasing slurry pH. The initial 1,1,1-TCA concentration and the presence of Cl(-) and SO4(2-) anions had negligible effects. HCO3(-) anions had a accelerative effect on 1,1,1-TCA removal, and both NO3(-) and HA had inhibitory effects. A Cl(-) mass balance showed that the amount of Cl(-) ions released into the soil slurry system during the 1,1,1-TCA degradation increased with increasing reaction time, suggesting that the main degradation mechanism of 1,1,1-TCA by Fe(0) in a soil slurry system was reductive dechlorination with 1,1-DCA as the main intermediate. In conclusion, this study provides a theoretical basis for the practical application of the remediation of contaminated sites containing chlorinated solvent.
Capitanio, Daniele; Fania, Chiara; Torretta, Enrica; Viganò, Agnese; Moriggi, Manuela; Bravatà, Valentina; Caretti, Anna; Levett, Denny Z H; Grocott, Michael P W; Samaja, Michele; Cerretelli, Paolo; Gelfi, Cecilia
2017-08-29
In mammals, hypoxic stress management is under the control of the Hypoxia Inducible Factors, whose activity depends on the stabilization of their labile α subunit. In particular, the skeletal muscle appears to be able to react to changes in substrates and O 2 delivery by tuning its metabolism. The present study provides a comprehensive overview of skeletal muscle metabolic adaptation to hypoxia in mice and in human subjects exposed for 7/9 and 19 days to high altitude levels. The investigation was carried out combining proteomics, qRT-PCR mRNA transcripts analysis, and enzyme activities assessment in rodents, and protein detection by antigen antibody reactions in humans and rodents. Results indicate that the skeletal muscle react to a decreased O 2 delivery by rewiring the TCA cycle. The first TCA rewiring occurs in mice in 2-day hypoxia and is mediated by cytosolic malate whereas in 10-day hypoxia the rewiring is mediated by Idh1 and Fasn, supported by glutamine and HIF-2α increments. The combination of these specific anaplerotic steps can support energy demand despite HIFs degradation. These results were confirmed in human subjects, demonstrating that the TCA double rewiring represents an essential factor for the maintenance of muscle homeostasis during adaptation to hypoxia.
NASA Astrophysics Data System (ADS)
Soliman, Saied M.; Kassem, Taher S.; Badr, Ahmed M. A.; Abou Youssef, Morsy A.; Assem, Rania
2014-09-01
A new [Ag(E3Q)2(TCA)] complex; (E3Q = Ethyl 3-quinolinecarboxylate and TCA = Trichloroacetate) has been synthesized and characterized using elemental analysis, FTIR, NMR and mass spectroscopy. The molecular geometry and spectroscopic properties of the complex as well as the free ligand have been calculated using the hybrid B3LYP method. The calculations predicted a distorted tetrahedral arrangement around Ag(I) ion. The vibrational spectra of the studied compounds have been assigned using potential energy distribution (PED). TD-DFT method was used to predict the electronic absorption spectra. The most intense absorption band showed a bathochromic shift and lowering of intensity in case of the complex (233.7 nm, f = 0.5604) compared to E3Q (λmax = 228.0 nm, f = 0.9072). The calculated 1H NMR chemical shifts using GIAO method showed good correlations with the experimental data. The computed dipole moment, polarizability and HOMO-LUMO energy gap were used to predict the nonlinear optical (NLO) properties. It is found that Ag(I) enhances the NLO activity. The natural bond orbital (NBO) analyses were used to elucidate the intramolecular charge transfer interactions causing stabilization for the investigated systems.
Domain adaptation via transfer component analysis.
Pan, Sinno Jialin; Tsang, Ivor W; Kwok, James T; Yang, Qiang
2011-02-01
Domain adaptation allows knowledge from a source domain to be transferred to a different but related target domain. Intuitively, discovering a good feature representation across domains is crucial. In this paper, we first propose to find such a representation through a new learning method, transfer component analysis (TCA), for domain adaptation. TCA tries to learn some transfer components across domains in a reproducing kernel Hilbert space using maximum mean miscrepancy. In the subspace spanned by these transfer components, data properties are preserved and data distributions in different domains are close to each other. As a result, with the new representations in this subspace, we can apply standard machine learning methods to train classifiers or regression models in the source domain for use in the target domain. Furthermore, in order to uncover the knowledge hidden in the relations between the data labels from the source and target domains, we extend TCA in a semisupervised learning setting, which encodes label information into transfer components learning. We call this extension semisupervised TCA. The main contribution of our work is that we propose a novel dimensionality reduction framework for reducing the distance between domains in a latent space for domain adaptation. We propose both unsupervised and semisupervised feature extraction approaches, which can dramatically reduce the distance between domain distributions by projecting data onto the learned transfer components. Finally, our approach can handle large datasets and naturally lead to out-of-sample generalization. The effectiveness and efficiency of our approach are verified by experiments on five toy datasets and two real-world applications: cross-domain indoor WiFi localization and cross-domain text classification.
Tao, Li; Zhang, Yulong; Fan, Shuru; Nobile, Clarissa J.; Guan, Guobo; Huang, Guanghua
2017-01-01
Morphological transitions and metabolic regulation are critical for the human fungal pathogen Candida albicans to adapt to the changing host environment. In this study, we generated a library of central metabolic pathway mutants in the tricarboxylic acid (TCA) cycle, and investigated the functional consequences of these gene deletions on C. albicans biology. Inactivation of the TCA cycle impairs the ability of C. albicans to utilize non-fermentable carbon sources and dramatically attenuates cell growth rates under several culture conditions. By integrating the Ras1-cAMP signaling pathway and the heat shock factor-type transcription regulator Sfl2, we found that the TCA cycle plays fundamental roles in the regulation of CO2 sensing and hyphal development. The TCA cycle and cAMP signaling pathways coordinately regulate hyphal growth through the molecular linkers ATP and CO2. Inactivation of the TCA cycle leads to lowered intracellular ATP and cAMP levels and thus affects the activation of the Ras1-regulated cAMP signaling pathway. In turn, the Ras1-cAMP signaling pathway controls the TCA cycle through both Efg1- and Sfl2-mediated transcriptional regulation in response to elevated CO2 levels. The protein kinase A (PKA) catalytic subunit Tpk1, but not Tpk2, may play a major role in this regulation. Sfl2 specifically binds to several TCA cycle and hypha-associated genes under high CO2 conditions. Global transcriptional profiling experiments indicate that Sfl2 is indeed required for the gene expression changes occurring in response to these elevated CO2 levels. Our study reveals the regulatory role of the TCA cycle in CO2 sensing and hyphal development and establishes a novel link between the TCA cycle and Ras1-cAMP signaling pathways. PMID:28787458
Abdel Meguid, Azza Mahfouz; Elaziz Ahmed Attallah, Dalia Abd; Omar, Howida
2015-12-01
Treatment options for acne include chemical peeling. Trichloroacetic acid (TCA) has been used for treating acne. The ability of TCA to diminish corneocyte cohesion and keratinocyte plugging addresses this mode of treatment. Salicylic acid is an excellent keratolytic agent. It is believed to function through solubilization of intercellular cement, thereby reducing corneocyte adhesion. Comparing the therapeutic efficacy of TCA 25% peels with those of salicylic acid 30% in patients with acne vulgaris. Twenty patients, Fitzpatrick skin Types III to V with facial acne, were enrolled. Twenty-five percent of TCA was applied to the right half of the face and 30% salicylic acid to the left half at 2-week interval for 2 months. Total improvement was more frequent with salicylic acid peeling (95%) versus (85%) with TCA. Total comedones improvement was more frequent with TCA peeling (80%) versus (70%) with salicylic acid. Improvement of inflammatory lesions was more frequent among the side treated with salicylic acid (85%) versus (80%) with TCA peeling. However, the results did not reach the statistical significance level. Trichloroacetic acid is more superior in treating comedonal lesions, whereas salicylic is more superior in treating inflammatory lesions, without significant different between their results.
Chatonnet, Pascal; Fleury, Antoine; Boutou, Stéphane
2010-12-08
This study identifies a previously isolated bacterium as Rhizobium excellensis, a new species of proteobacteria able to form a large quantity of 2-methoxy-3,5-dimethylpyrazine (MDMP). R. excellensis actively synthesizes MDMP from L-alanine and L-leucine and, to a lesser extent, from L-phenylalanine and L-valine. MDMP is a volatile, strong-smelling substance detected in wines with cork stoppers that have an unpleasant "corky", "herbaceous" (potato, green hazelnut), or "dusty" odor that is very different from the typical "fungal" nose of a "corked" wine that is generally due to 2,4,6-trichloroanisole (TCA). The contamination of cork by MDMP is not correlated with the presence of TCA. It appears possible that R. excellensis is the microorganism mainly responsible for the presence of this molecule in cork bark. However, other observations suggest that MDMP might taint wine through other ways. Oak wood can also be contaminated and affect wines with which it comes into contact. Nevertheless, because 93% of the MDMP content in wood is destroyed after 10 min at 220 °C, sufficiently toasted oak barrels or alternatives probably do not represent a major source of MDMP in most of the cases. Due to MDMP's relatively low detection threshold estimated at 2.1 ng/L, its presence in about 40% of the untreated natural cork stoppers sampled at concentrations above 10 ng/cork suggests that this compound, if extracted from the stoppers, may pose a risk for wine producers.
Santa, Cátia; Anjo, Sandra I; Manadas, Bruno
2016-07-01
Proteomic approaches are extremely valuable in many fields of research, where mass spectrometry methods have gained an increasing interest, especially because of the ability to perform quantitative analysis. Nonetheless, sample preparation prior to mass spectrometry analysis is of the utmost importance. In this work, two protein precipitation approaches, widely used for cleaning and concentrating protein samples, were tested and compared in very diluted samples solubilized in a strong buffer (containing SDS). The amount of protein recovered after acetone and TCA/acetone precipitation was assessed, as well as the protein identification and relative quantification by SWATH-MS yields were compared with the results from the same sample without precipitation. From this study, it was possible to conclude that in the case of diluted samples in denaturing buffers, the use of cold acetone as precipitation protocol is more favourable than the use of TCA/acetone in terms of reproducibility in protein recovery and number of identified and quantified proteins. Furthermore, the reproducibility in relative quantification of the proteins is even higher in samples precipitated with acetone compared with the original sample. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Papinutto, N.; Schlaeger, R.; Panara, V.; Caverzasi, E.; Ahn, S.; Johnson, K.J.; Zhu, A.H.; Stern, W.A.; Laub, G.; Hauser, S.L.; Henry, R.G.
2018-01-01
PURPOSE In-vivo assessment of spinal cord gray matter (GM) and white matter (WM) could become pivotal to study various neurological diseases, but it is challenging because of insufficient GM/WM contrast provided by conventional MRI. Here we present and assess a procedure for measurement of spinal cord total cross-sectional area (TCA) and GM areas based on phase sensitive inversion recovery imaging (PSIR). MATERIALS AND METHODS We acquired 2D PSIR images at 3T at each disc level of the spinal axis on 10 healthy subjects and measured TCA, cord diameters, WM and GM area, and GM area/TCA ratio. We secondly investigated 32 healthy subjects at 4 selected levels (C2–C3, C3–C4, T8–T9, T9–T10, total acquisition time <8 minutes) and generated normative reference values of TCA and GM areas. We assessed test-retest, intra- and inter-operator reliability of the acquisition strategy and measurement steps. RESULTS The measurement procedure based on 2D PSIR imaging allowed TCA and GM area assessments along the entire spinal cord axis. The tests we performed revealed high test-retest/intra-operator reliability (mean coefficient of variation (COV) at C2–C3: TCA=0.41%, GM area=2.75%) and inter-operator reliability of the measurements (mean COV on the 4 levels: TCA=0.44%, GM area= 4.20%; mean intra-class correlation coefficient: TCA=0.998, GM area=0.906). CONCLUSION 2D PSIR allows reliable in-vivo assessment of spinal cord TCA, GM and WM areas in clinically feasible acquisition times. The area measurements presented here are in agreement with previous MRI and post-mortem studies. PMID:25483607
Wen, Li-Lian; Chen, Jia-Xian; Fang, Jia-Yi; Li, Ang; Zhao, He-Ping
2017-01-01
Chlorinated compounds were generally present in the environment due to widespread use in the industry. A short-term study was performed to evaluate the effects of 1,1,1- trichloroethane (TCA) and triclocarban (TCC) on trichloroethene (TCE) removal in a reactor fed with lactate as the sole electron donor. Both TCA and TCC inhibited TCE reduction, but the TCC had a more pronounced effect compared to TCA. The TCE-reducing culture, which had never been exposed to TCA before, reductively dechlorinated TCA to 1,1-dichloroethane (DCA). Below 15 μM, TCA had little effect on the transformation of TCE to cis -dichloroethene (DCE); however, the reduction of cis -DCE and vinyl chloride (VC) were more sensitive to TCA, and ethene production was completely inhibited when the concentration of TCA was above 15 μM. In cultures amended with TCC, the reduction of TCE was severely affected, even at concentrations as low as 0.3 μM; all the cultures stalled at VC, and no ethene was detected. The cultures that fully transformed TCE to ethene contained 5.2-8.1% Dehalococcoides . Geobacter and Desulfovibrio , the bacteria capable of partially reducing TCE to DCE, were detected in all cultures, but both represented a larger proportion of the community in TCC-amended cultures. All cultures were dominated by Clostridium _sensu_stricto_7, a genus that belongs to Firmicutes with proportions ranging from 40.9% (in a high TCC (15 μM) culture) to 88.2%. Methanobacteria was detected at levels of 1.1-12.7%, except in cultures added with 15 and 30 μM TCA, in which they only accounted for ∼0.4%. This study implies further environmental factors needed to be considered in the successful bioremediation of TCE in contaminated sites.
Trichloroacetic acid in the environment.
McCulloch, A
2002-05-01
Suppositions that the trichloroacetic acid (TCA, CCl3C(O)OH) found in nature was a consequence solely of the use of chlorinated hydrocarbon solvents prompted this critical review of the literature on its environmental fluxes and occurrences. TCA is widely distributed in forest soils (where it was rarely used as an herbicide) and measurements suggest a soil flux of 160 000 tonnes yr(-1) in European forests alone. TCA is also produced during oxidative water treatment and the global flux could amount to 55 000 tonnes yr(-1) (from pulp and paper manufacture, potable water and cooling water treatments). By contrast, the yields of TCA from chlorinated hydrocarbon solvents are small: from tetrachloroethene 13 600 tonnes yr(-1) and from 1,1,1-trichloroethane 4300 tonnes yr(-1) on a global basis, at the atmospheric burdens and removal rates typical of the late 1990s. TCA is ubiquitous in rainwater and snow. Its concentrations are highly variable and the variations cannot be connected with location or date. However, there is no significant difference between the concentrations found in Chile and in eastern Canada (by the same analysts), or between Malawi and western Canada, or between Antarctica and Switzerland, nor any significant difference globally between the concentrations in cloud, rain and snow (although local enhancement in fog water has been shown). TCA is present in old ice and firn. At the deepest levels, the firn was deposited early in the 19th century, well before the possibility of contamination by industrial production of reactive chlorine, implying a non-industrial background. This proposition is supported by plume measurements from pulp mills in Finland. TCA is ubiquitous in soils; concentrations are very variable but there are some indications that soils under coniferous trees contain higher amounts. The concentrations of TCA found in plant tissue are region-specific and may also be plant-specific, to the extent that conifers seem to contain more than other species. TCA is removed from the environment naturally. There is abundant evidence that soil microorganisms dehalogenate TCA and it is lost from within spruce needles with a half-life of 10 days. There is also recent evidence of an abiotic aqueous decarboxylation mechanism with a half-life of 22 days. The supposedly widespread effects of TCA in conifer needles are not shown in controlled experiments. At concentrations in the needles of Scots pine similar to those observed in needles in forest trees, changes consequent on TCA treatment of field laboratory specimens were almost all insignificant.
2013-08-01
CCT G-30; KLK2 F: 50- TGG CTG TGT ACA GTC ATG GA-30; KLK2 R: 50- CCT GTG TCT TCA GGC TCA AA-30; TMPRSS2 F: 50-AGG TGC ATC CGG CTC AGT A-30; TMPRSS2 R...50-GGG TCA AGG TGA TGC ACA GT-30; PCDH11 F: 50-GCG TTT CTG ACT GTG GCT ATC-30; PCDH11 R: 50-GGA AGG GGA ATG GAA TTT TG-30; UGT2B15 F: 50-TCA AATc-Jun...GAPDH F: 50-CTG ACT TCA ACA GCG ACA CC-30; GAPDH R: 50-CCC TGT TGC TGT AGC CAA AT-30; AR F: 50- GTG GAA GCT GCA AGG TCT TC-30; AR R 50-CGA AGA CGA
Qi, Fei; Xu, Bingbing; Chen, Zhonglin; Ma, Jun; Sun, Dezhi; Zhang, Liqiu; Wu, Fengchang
2009-08-30
A kind of inexpensive and environmental friendly mineral, the raw bauxite has been used successfully as a catalyst combined with ozonation in the degradation of 2,4,6-trichloroanisole (TCA). The catalyst was characterized by using various analytical techniques. X-ray powder diffraction (XRD) characterization showed that the raw bauxite containing boehmite (gamma-AlOOH), kaolinite (Al(2)Si(2)O(5)(OH)(4)) and quartz (SiO(2)), and gamma-AlOOH was the major composition. The catalytic ozonation removal effectiveness of TCA was investigated under various physicochemical conditions. Both the adsorption and the single ozonation were not effective for the degradation of TCA, and the presence of the raw bauxite in ozonation enhanced the TCA removal effectiveness. Both the hydroxyl radicals (OH) scavenging experiment and R(ct) characterization confirmed that the generation of OH was accounted for the enhancement of the degradation of TCA. The generation of OH was inhibited faintly by the presence of both natural organic matters (NOMs) and alkalinity in the natural water during catalyzed ozonation with the raw bauxite. The increasing of both the bauxite dosage and the ozone dosage enhanced the removal effectiveness of TCA. The raw bauxite was an efficient green catalyst for TCA degradation in drinking water.
A novel rapid access testicular cancer clinic: prospective evaluation after one year.
Carey, K; Davis, N F; Elamin, S; Ahern, P; Brady, C M; Sweeney, P
2016-02-01
Our institution has recently developed a rapid access outpatient clinic to investigate men with testicular lumps and/or pain suspicious for testicular cancer (TCa). To present our experience after 12 months. All referrals to the rapid access testicular clinic (RATC) clinic were prospectively analysed from 01/01/2013 to 01/01/2014. The primary outcome variable was incidence of TCa in the referred patient cohort. Secondary outcome variables were waiting times prior to clinical review and waiting times prior to radical orchidectomy in patients diagnosed with TCa. Seventy-four new patients were referred to the RATC during the 1-year period and the mean age was 34 (range 15-81 years). TCa was the most common diagnosis and was found in 18 (25 %) patients. Patients diagnosed with TCa underwent radical orchidectomy, a median of 3 (range 1-5) days after their initial GP referral. Patients requiring surgical intervention for benign scrotal pathology underwent their procedure a median of 32 (range 3-61) days after their initial referral. Of the 18 patients diagnosed with TCa, 9 (50 %) were diagnosed with a seminomatous germ cell tumour on histopathology. The RATC is a new initiative in Ireland that provides expedient and definitive treatment of patients with newly diagnosed TCa. Early treatment will ultimately improve long-term prognosis in this patient cohort.
Moon, Eunjung; Park, Hye Min; Lee, Choong Hwan; Do, Seon-Gil; Park, Jong-Moon; Han, Na-Young; Do, Moon Ho; Lee, Jong Ha; Lee, Hookeun; Kim, Sun Yeou
2015-03-18
Photodamage is extrinsically induced by overexposure to ultraviolet (UV) radiation, and it increases the risk of various skin disorders. Therefore, discovery of novel biomarkers of photodamage is important. In this study, using LC-MS/MS analysis of epidermis from UVB-irradiated hairless mice, we identified 57 proteins whose levels changed after UVB exposure, and selected 7 proteins related to the tricarboxylic acid (TCA) cycle through pathway analysis. Dihydrolipoyl dehydrogenase (DLD) was the only TCA cycle-associated protein that showed a decreased expression after the UVB exposure. We also performed targeted analysis to detect intermediates and products of the TCA cycle using GC-TOF-MS. Interestingly, malic acid and fumaric acid levels significantly decreased in the UVB-treated group. Our results demonstrate that DLD and its associated metabolites, malic acid and fumaric acid, may be candidate biomarkers of UVB-induced skin photoaging. Additionally, we showed that Aloe vera, a natural skin moisturizer, regulated DLD, malic acid and fumaric acid levels in UVB-exposed epidermis. Our strategy to integrate the proteome and targeted metabolite to detect novel UVB targets will lead to a better understanding of skin photoaging and photodamage. Our study also supports that A. vera exerts significant anti-photodamage activity via regulation of DLD, a novel UVB target, in the epidermis. This study is the first example of an integration of proteomic and metabolite analysis techniques to find new biomarker candidates for the regulation of the UVB-induced skin photoaging. DLD, malic acid, and fumaric acid can be used for development of cosmeceuticals and nutraceuticals regulating the change of skin metabolism induced by the UVB overexposure. Moreover, this is also the first attempt to investigate the role of the TCA cycle in photodamaged epidermis. Our integration of the proteomic and targeted metabolite analyses will lead to a better understanding of the unidentified photobiological results from UVB-irradiated models and can elicit new diagnostic and treatment strategies based on altered metabolism. Copyright © 2015. Published by Elsevier B.V.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wan, Ni; DeLorenzo, Drew M.; He, Lian
Synechocystis sp. strain PCC 6803 has been widely used as a photo-biorefinery chassis. Based on its genome annotation, this species contains a complete TCA cycle, an Embden-Meyerhof-Parnas pathway (EMPP), an oxidative pentose phosphate pathway (OPPP), and an Entner–Doudoroff pathway (EDP). To evaluate how Synechocystis 6803 catabolizes glucose under heterotrophic conditions, we performed 13C metabolic flux analysis, metabolite pool size analysis, gene knockouts, and heterologous expressions. The results revealed a cyclic mode of flux through the OPPP. Small, but non-zero, fluxes were observed through the TCA cycle and the malic shunt. Independent knockouts of 6-phosphogluconate dehydrogenase (gnd) and malic enzyme (me)more » corroborated these results, as neither mutant could grow under dark heterotrophic conditions. Our data also indicate that Synechocystis 6803 metabolism relies upon oxidative phosphorylation to generate ATP from NADPH under dark or insufficient light conditions. The pool sizes of intermediates in the TCA cycle, particularly acetyl-CoA, were found to be several fold lower in Synechocystis 6803 (compared to E. coli metabolite pool sizes), while its sugar phosphate intermediates were several-fold higher. Moreover, negligible flux was detected through the native, or heterologous, EDP in the wild type or Δgnd strains under heterotrophic conditions. Comparing photoautotrophic, photomixotrophic, and heterotrophic conditions, the Calvin cycle, OPPP, and EMPP in Synechocystis 6803 possess the ability to regulate their fluxes under various growth conditions (plastic), whereas its TCA cycle always maintains at low levels (rigid). This work also demonstrates how genetic profiles do not always reflect actual metabolic flux through native or heterologous pathways. Biotechnol. Bioeng. 2017;114: 1593–1602. © 2017 Wiley Periodicals, Inc.« less
The emerging role and targetability of the TCA cycle in cancer metabolism.
Anderson, Nicole M; Mucka, Patrick; Kern, Joseph G; Feng, Hui
2018-02-01
The tricarboxylic acid (TCA) cycle is a central route for oxidative phosphorylation in cells, and fulfills their bioenergetic, biosynthetic, and redox balance requirements. Despite early dogma that cancer cells bypass the TCA cycle and primarily utilize aerobic glycolysis, emerging evidence demonstrates that certain cancer cells, especially those with deregulated oncogene and tumor suppressor expression, rely heavily on the TCA cycle for energy production and macromolecule synthesis. As the field progresses, the importance of aberrant TCA cycle function in tumorigenesis and the potentials of applying small molecule inhibitors to perturb the enhanced cycle function for cancer treatment start to evolve. In this review, we summarize current knowledge about the fuels feeding the cycle, effects of oncogenes and tumor suppressors on fuel and cycle usage, common genetic alterations and deregulation of cycle enzymes, and potential therapeutic opportunities for targeting the TCA cycle in cancer cells. With the application of advanced technology and in vivo model organism studies, it is our hope that studies of this previously overlooked biochemical hub will provide fresh insights into cancer metabolism and tumorigenesis, subsequently revealing vulnerabilities for therapeutic interventions in various cancer types.
Min, Yoo Hong; Kim, Wootae; Kim, Ja-Eun
2016-01-01
Mitotic progression is crucial for the maintenance of chromosomal stability. A proper progression is ensured by the activities of multiple kinases. One of these enzymes, the serine/threonine kinase Aurora A, is required for proper mitosis through the regulation of centrosome and spindle assembly. In this study, we functionally characterized a newly developed Aurora kinase A inhibitor, TC-A2317. In human lung cancer cells, TC-A2317 slowed proliferation by causing aberrant formation of centrosome and microtubule spindles and prolonging the duration of mitosis. Abnormal mitotic progression led to accumulation of cells containing micronuclei or multinuclei. Furthermore, TC-A2317–treated cells underwent apoptosis, autophagy or senescence depending on cell type. In addition, TC-A2317 inactivated the spindle assembly checkpoint triggered by paclitaxel, thereby exacerbating mitotic catastrophe. Consistent with this, the expression level of Aurora A in tumors was inversely correlated with survival in lung cancer patients. Collectively, these data suggest that inhibition of Aurora kinase A using TC-A2317 is a promising target for anti-cancer therapeutics. PMID:27713168
Danish, Muhammad; Gu, Xiaogang; Lu, Shuguang; Naqvi, Muhammad
2016-07-01
Chlorinated organic solvents (COSs) are extensively detected in contaminated soil and groundwater that pose long-term threats to human life and environment. In order to degrade COSs effectively, a novel catalytic composite of natural zeolite-supported nano zero valent iron (Z-nZVI) was synthesized in this study. The performance of Z-nZVI-catalyzed sodium percarbonate (SPC) in a heterogeneous Fenton-like system was investigated for the degradation of COSs such as 1,1,1-trichloroethane (1,1,1-TCA) and trichloroethylene (TCE). The surface characteristics and morphology of the Z-nZVI composite were tested using scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Total pore volume, specific surface area, and pore size of the natural zeolite and the Z-nZVI composite were measured using Brunauer-Emmett-Teller (BET) method. SEM and TEM analysis showed significant elimination of aggregation and well dispersion of iron nano particles on the framework of natural zeolite. The BET N2 measurement analysis indicated that the surface area of the Z-nZVI composite was 72.3 m(2)/g, much larger than that of the natural zeolite (0.61 m(2)/g). For the contaminant analysis, the samples were extracted with n-hexane and analyzed through gas chromatograph. The degradation of 1,1,1-TCA and TCE in the Z-nZVI-catalyzed percarbonate system were 48 and 39 % respectively, while strong augmentation was observed up to 83 and 99 %, respectively, by adding the reducing agent (RA), hydroxyl amine (NH2OH•HCl). Probe tests validated the presence of OH(●) and O2 (●-) which were responsible for 1,1,1-TCA and TCE degradation, whereas both free radicals were strengthened with the addition of RA. In conclusion, the Z-nZVI/SPC oxidation with reducing agent shows potential technique for degradation of groundwater contaminated by 1,1,1-TCA and TCE.
General Overview of the ODC Elimination Effort of the RSRM Program
NASA Technical Reports Server (NTRS)
Evans, Kurt; Golde, Rick; McCool, Alex (Technical Monitor)
2001-01-01
The purpose of the ODC Elimination Program of the Space Shuttle RSRM Program is to eliminate the usage of 1, 1, 1 trichloroethane (TCA) in all RSRM (Reusable Solid Rocket Motor) manufacturing processes. This program consists of the following phases and objectives: Phase 0 - Convert to greaseless shipping of metal components. Phase 1 - Eliminate TCA vapor degreasing and usage in propellant cleaning operations. Phase 2 - Eliminate TCA usage for hand cleaning operations. Each phase reduces peak TCA consumption (about 1.4 million pounds in 1989) by about 29, 61, and 10 percent, respectively. Phase 0 was completed in 1992, Phase 1 in 1997, and Phase 2 is in progress (about 75% complete). TCA replacement objectives are accomplished by are a series of subscale, full-scale, and static testing outlined by the NASA-funded, ODC Elimination Program.
Gonzalez-Leon, A; Merdink, J L; Bull, R J; Schultz, I R
1999-12-15
Dichloroacetate (DCA) and trichloroacetate (TCA) are prominent by-products of chlorination of drinking water. Both chemicals have been shown to be hepatic carcinogens in mice. Prior work has demonstrated that DCA inhibits its own metabolism in rats and humans. This study focuses on the effect of prior administration of DCA or TCA in drinking water on the pharmacokinetics of a subsequent challenge dose of DCA or TCA in male B6C3F1 mice. Mice were provided with DCA or TCA in their drinking water at 2 g/l for 14 days and then challenged with a 100 mg/kg i.v. (non-labeled) or gavage (14C-labeled) dose of DCA or TCA. The challenge dose was administered after 16 h fasting and removal of the haloacetate pre-treatment. The haloacetate blood concentration-time profile and the disposition of 14C were characterized and compared with controls. The effect of pre-treatment on the in vitro metabolism of DCA in hepatic S9 was also evaluated. Pre-treatment with DCA caused a significant increase in the blood concentration-time profiles of the challenge dose of DCA. No effect on the blood concentration-time profile of DCA was observed after pre-treatment with TCA. Pre-treatment with TCA had no effect on subsequent doses of DCA. Pre-treatment with DCA did not have a significant effect on the formation of 14CO2 from radiolabeled DCA. In vitro experiments with liver S9 from DCA-pre-treated mice demonstrated that DCA inhibits it own metabolism. These results indicate that DCA metabolism in mice is also susceptible to inhibition by prior treatment with DCA, however the impact on clearance is less marked in mice than in F344 rats. In contrast, the metabolism and pharmacokinetics of TCA is not affected by pre-treatment with either DCA or TCA.
Wen, Li-Lian; Chen, Jia-Xian; Fang, Jia-Yi; Li, Ang; Zhao, He-Ping
2017-01-01
Chlorinated compounds were generally present in the environment due to widespread use in the industry. A short-term study was performed to evaluate the effects of 1,1,1- trichloroethane (TCA) and triclocarban (TCC) on trichloroethene (TCE) removal in a reactor fed with lactate as the sole electron donor. Both TCA and TCC inhibited TCE reduction, but the TCC had a more pronounced effect compared to TCA. The TCE-reducing culture, which had never been exposed to TCA before, reductively dechlorinated TCA to 1,1-dichloroethane (DCA). Below 15 μM, TCA had little effect on the transformation of TCE to cis-dichloroethene (DCE); however, the reduction of cis-DCE and vinyl chloride (VC) were more sensitive to TCA, and ethene production was completely inhibited when the concentration of TCA was above 15 μM. In cultures amended with TCC, the reduction of TCE was severely affected, even at concentrations as low as 0.3 μM; all the cultures stalled at VC, and no ethene was detected. The cultures that fully transformed TCE to ethene contained 5.2–8.1% Dehalococcoides. Geobacter and Desulfovibrio, the bacteria capable of partially reducing TCE to DCE, were detected in all cultures, but both represented a larger proportion of the community in TCC-amended cultures. All cultures were dominated by Clostridium_sensu_stricto_7, a genus that belongs to Firmicutes with proportions ranging from 40.9% (in a high TCC (15 μM) culture) to 88.2%. Methanobacteria was detected at levels of 1.1–12.7%, except in cultures added with 15 and 30 μM TCA, in which they only accounted for ∼0.4%. This study implies further environmental factors needed to be considered in the successful bioremediation of TCE in contaminated sites. PMID:28824572
Shetty, Sathwik Raviraj; Ruiz-Treviño, Armando S; Omay, Sacit Bulent; Almeida, Joao Paulo; Liang, Buqing; Chen, Yu-Ning; Singh, Harminder; Schwartz, Theodore H
2017-10-01
To review current management strategies for olfactory groove meningioma (OGM)s and the recent literature comparing endoscopic endonasal (EEA) with traditional transcranial (TCA) approaches. A PubMed search of the recent literature (2011-2016) was performed to examine outcomes following EEA and TCA for OGM. The extent of resection, visual outcome, postoperative complications and recurrence rates were analyzed using percentages and proportions, the Fischer exact test and the Student's t-test using Graphpad PRISM 7.0Aa (San Diego, CA) software. There were 444 patients in the TCA group with a mean diameter of 4.61 (±1.17) cm and 101 patients in the EEA group with a mean diameter of 3.55 (± 0.58) cm (p = 0.0589). GTR was achieved in 90.9% (404/444) in the TCA group and 70.2% (71/101) in the EEA group (p < 0.0001). Of the patients with preoperative visual disturbances, 80.7% (21/26) of patients in the EEA cohort had an improvement in vision compared to 12.83%(29/226) in the TCA group (p < 0.0001). Olfaction was lost in 61% of TCA and in 100% of EEA patients. CSF leaks and meningitis occurred in 25.7% and 4.95% of EEA patients and 6.3% and 1.12% of TCA patients, respectively (p < 0.0001; p = 0.023). Our updated literature review demonstrates that despite more experience with endoscopic resection and skull base reconstruction, the literature still supports TCA over EEA with respect to the extent of resection and complications. EEA may be an option in selected cases where visual improvement is the main goal of surgery and postoperative anosmia is acceptable to the patient or in medium-sized tumors with existing preoperative anosmia. Nevertheless, based on our results, it seems more prudent at this time to use TCA for the majority of OGMs.
Chan, Jeannine; Oshiro, Tyler; Thomas, Sarah; Higa, Allyson; Black, Stephen; Todorovic, Aleksandar; Elbarbry, Fawzy
2016-01-01
Human exposure to trans-cinnamic aldehyde [t-CA; cinnamaldehyde; cinnamal; (E)-3-phenylprop-2-enal] is common through diet and through the use of cinnamon powder for diabetes and to provide flavor and scent in commercial products. We evaluated the likelihood of t-CA to influence metabolism by inhibition of P450 enzymes. IC50 values from recombinant enzymes indicated that an interaction is most probable for CYP2A6 (IC50 = 6.1 µM). t-CA was 10.5-fold more selective for human CYP2A6 than for CYP2E1; IC50 values for P450s 1A2, 2B6, 2C9, 2C19, 2D6, and 3A4 were 15.8-fold higher or more. t-CA is a type I ligand for CYP2A6 (KS = 14.9 µM). Inhibition of CYP2A6 by t-CA was metabolism-dependent; inhibition required NADPH and increased with time. Glutathione lessened the extent of inhibition modestly and statistically significantly. The carbon monoxide binding spectrum was dramatically diminished after exposure to NADPH and t-CA, suggesting degradation of the heme or CYP2A6 apoprotein. Using a static model and mechanism-based inhibition parameters (KI = 18.0 µM; kinact = 0.056 minute−1), changes in the area under the concentration-time curve (AUC) for nicotine and letrozole were predicted in the presence of t-CA (0.1 and 1 µM). The AUC fold-change ranged from 1.1 to 3.6. In summary, t-CA is a potential source of pharmacokinetic variability for CYP2A6 substrates due to metabolism-dependent inhibition, especially in scenarios when exposure to t-CA is elevated due to high dietary exposure, or when cinnamon is used as a treatment of specific disease states (e.g., diabetes). PMID:26851241
Evaluation results of xTCA equipment for HEP experiments at CERN
NASA Astrophysics Data System (ADS)
Di Cosmo, M.; Bobillier, V.; Haas, S.; Joos, M.; Mico, S.; Vasey, F.; Vichoudis, P.
2013-12-01
The MicroTCA and AdvancedTCA industry standards are candidate modular electronic platforms for the upgrade of the current generation of high energy physics experiments. The PH-ESE group at CERN launched in 2011 the xTCA evaluation project with the aim of performing technical evaluations and eventually providing support for commercially available components. Different devices from different vendors have been acquired, evaluated and interoperability tests have been performed. This paper presents the test procedures and facilities that have been developed and focuses on the evaluation results including electrical, thermal and interoperability aspects.
Human factors in aviation: Terminal control area boundary conflicts
NASA Technical Reports Server (NTRS)
Monan, William P.
1989-01-01
Air-to-air conflicts in the vicinity of Terminal Control Area (TCA) boundaries were studied to obtain a better understanding of the causal dynamics of these events with particular focus on human factor issues. The study dataset consisted of 381 Instrument Flight Rules/Visual Flight Rules (IFR/VFR) traffic conflicts in airspace layers above TCA ceiling and below TCA floors; 213 reports of incursions in TCA terminal airspace by VFR aircraft, of which 123 resulted in conflicts; and an additional set of reports describing problems with Air Traffic Control (ATC) services in and around TCAs. Results and conclusions are detailed.
Evans, M V; Chiu, W A; Okino, M S; Caldwell, J C
2009-05-01
Trichloroethylene (TCE) is a lipophilic solvent rapidly absorbed and metabolized via oxidation and conjugation to a variety of metabolites that cause toxicity to several internal targets. Increases in liver weight (hepatomegaly) have been reported to occur quickly in rodents after TCE exposure, with liver tumor induction reported in mice after long-term exposure. An integrated dataset for gavage and inhalation TCE exposure and oral data for exposure to two of its oxidative metabolites (TCA and DCA) was used, in combination with an updated and more accurate physiologically-based pharmacokinetic (PBPK) model, to examine the question as to whether the presence of TCA in the liver is responsible for TCE-induced hepatomegaly in mice. The updated PBPK model was used to help discern the quantitative contribution of metabolites to this effect. The update of the model was based on a detailed evaluation of predictions from previously published models and additional preliminary analyses based on gas uptake inhalation data in mice. The parameters of the updated model were calibrated using Bayesian methods with an expanded pharmacokinetic database consisting of oral, inhalation, and iv studies of TCE administration as well as studies of TCE metabolites in mice. The dose-response relationships for hepatomegaly derived from the multi-study database showed that the proportionality of dose to response for TCE- and DCA-induced hepatomegaly is not observed for administered doses of TCA in the studied range. The updated PBPK model was used to make a quantitative comparison of internal dose of metabolized and administered TCA. While the internal dose of TCA predicted by modeling of TCE exposure (i.e., mg TCA/kg-d) showed a linear relationship with hepatomegaly, the slope of the relationship was much greater than that for directly administered TCA. Thus, the degree of hepatomegaly induced per unit of TCA produced through TCE oxidation is greater than that expected per unit of TCA administered directly, which is inconsistent with the hypothesis that TCA alone accounts for TCE-induced hepatomegaly. In addition, TCE-induced hepatomegaly showed a much more consistent relationship with PBPK model predictions of total oxidative metabolism than with predictions of TCE area-under-the-curve in blood, consistent with toxicity being induced by oxidative metabolites rather than the parent compound. Therefore, these results strongly suggest that oxidative metabolites in addition to TCA are necessary contributors to TCE-induced liver weight changes in mice.
Suarez-Almazor, Maria E.; Looney, Carol; Liu, YanFang; Cox, Vanessa; Pietz, Kenneth; Marcus, Donald M.; Street, Richard L.
2012-01-01
Objectives There is conflicting evidence on the efficacy of Traditional Chinese Acupuncture (TCA), and the role of placebo effects elicited by acupuncturists’ behavior has not been elucidated. We conducted a 3-month randomized clinical trial in patients with knee osteoarthritis to compare the efficacy of TCA to sham acupuncture, and examine the effects of acupuncturists’ communication style. Methods Acupuncturists were trained to interact in one of two communication styles: ‘high’ or ‘neutral’ expectations. Patients were randomized to one of 3 groups: waiting list, ‘high’ or ‘neutral’, and nested within style, TCA or sham acupuncture over 6 weeks. Sham acupuncture was performed in non-meridian points, with shallow needles and minimal stimulation. Primary outcome measures were: Joint-specific Multidimensional Assessment of Pain (J-MAP), Western Ontario McMaster Osteoarthritis Index (WOMAC), and satisfaction. Results 455 patients who received treatment (TCA or sham) and 72 controls were included. No statistically significant differences were observed between TCA or sham acupuncture, but both groups had significant reductions in J-MAP and WOMAC pain compared to the waiting group (-1.1, -1.0, and -0.1, p<0.001; -13.7, -14, -1.7, p<0.001). Statistically significant differences were observed in J-MAP pain reduction and satisfaction, favoring the ‘high’ expectations group. Fifty-two percent and 43% in the TCA and sham groups thought they had received TCA (kappa=0.05), suggesting successful blinding. Conclusion TCA was not superior to sham acupuncture. However, acupuncturists’ style had significant effects on pain reduction and satisfaction, suggesting that the analgesic benefits of acupuncture can be partially mediated through placebo effects related to the acupuncturist's behavior. PMID:20506122
Recio, Eliseo; Alvarez-Rodríguez, María Luisa; Rumbero, Angel; Garzón, Enrique; Coque, Juan José R
2011-12-14
A chemical method for the efficient destruction of 2,4,6-trichloroanisole (TCA) and pentachloroanisole (PCA) in aqueous solutions by using hydrogen peroxide as an oxidant catalyzed by molybdate ions in alkaline conditions was developed. Under optimal conditions, more than 80.0% TCA and 75.8% PCA were degraded within the first 60 min of reaction. Chloroanisoles destruction was followed by a concomitant release of up to 2.9 chloride ions per TCA molecule and 4.6 chloride ions per PCA molecule, indicating an almost complete dehalogenation of chloroanisoles. This method was modified to be adapted to chloroanisoles removal from the surface of cork materials including natural cork stoppers (86.0% decrease in releasable TCA content), agglomerated corks (78.2%), and granulated cork (51.3%). This method has proved to be efficient and inexpensive with practical application in the cork industry to lower TCA levels in cork materials.
Evaluation of assumptions in soil moisture triple collocation analysis
USDA-ARS?s Scientific Manuscript database
Triple collocation analysis (TCA) enables estimation of error variances for three or more products that retrieve or estimate the same geophysical variable using mutually-independent methods. Several statistical assumptions regarding the statistical nature of errors (e.g., mutual independence and ort...
Mortan, Siti Hatijah; Martín-González, Lucía; Vicent, Teresa; Caminal, Gloria; Nijenhuis, Ivonne; Adrian, Lorenz; Marco-Urrea, Ernest
2017-06-05
1,1,2-Trichloroethane (1,1,2-TCA) is a non-flammable organic solvent and common environmental contaminant in groundwater. Organohalide-respiring bacteria are key microorganisms to remediate 1,1,2-TCA because they can gain metabolic energy during its dechlorination under anaerobic conditions. However, all current isolates produce hazardous end products such as vinyl chloride, monochloroethane or 1,2-dichloroethane that accumulate in the medium. Here, we constructed a syntrophic co-culture of Dehalogenimonas and Dehalococcoides mccartyi strains to achieve complete detoxification of 1,1,2-TCA to ethene. In this co-culture, Dehalogenimonas transformed 1,1,2-TCA via dihaloelimination to vinyl chloride, whereas Dehalococcoides reduced vinyl chloride via hydrogenolysis to ethene. Molasses, pyruvate, and lactate supported full dechlorination of 1,1,2-TCA in serum bottle co-cultures. Scale up of the cultivation to a 5-L bioreactor operating for 76d in fed-batch mode was successful with pyruvate as substrate. This synthetic combination of bacteria with known complementary metabolic capabilities demonstrates the potential environmental relevance of microbial cooperation to detoxify 1,1,2-TCA. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Park, Jungwoo; Yoo, Ji Wang; Seo, Hee Won; Lee, Youngkwan; Suhr, Jonghwan; Moon, Hyungpil; Koo, Ja Choon; Ryeol Choi, Hyouk; Hunt, Robert; Kim, Kwang Jin; Kim, Soo Hyun; Nam, Jae-Do
2017-03-01
As a new class of thermally activated actuators based on polymeric fibers, we investigated polyethylene terephthalate (PET) yarns for the development of a twisted-coiled polymer fiber actuator (TCA). The PET yarn TCA exhibited the maximum linear actuation up to 8.9% by external heating at above the glass transition temperature, 160 °C-180 °C. The payload of the actuator was successfully correlated with the preload and training-load conditions by an empirical equation. Furthermore, the PET-based TCA was electrically driven by Joule heating after the PET surface was metallization with silver. For the fast and precise control of PET yarn TCA, electroless silver plating was conducted to form electrical conductive layers on the PET fiber surface. The silver plated PET-based TCA was tested by Joule heating and the tensile actuation was increased up to 12.1% (6 V) due to the enhanced surface hardness and slippage of PET fibers. Overall, silver plating of the polymeric yarn provided a fast actuation speed and enhanced actuation performance of the TCA actuator by Joule heating, providing a great potential for being used in artificial muscle for biomimetic machines including robots, industrial actuators and powered exoskeletons.
Inuo, G; Akao, N; Kohsaka, H; Saito, I; Miyasaka, N; Fujita, K
1995-02-01
The proliferative response of human peripheral blood mononuclear cells (PBMC) from healthy donors to Toxocara canis adult worm antigens (TcA) was examined. PBMC from all donors examined (n = 7) strongly responded to TcA in a dose-dependent fashion after six days of culture, irrespective of their serological reactivity. In contrast, cord blood mononuclear cells did not react to TcA. The proliferation of PBMC in response to TcA was completely inhibited by anti-HLA-DR antibody. Purified CD4+ T cells reconstituted with autologous irradiated antigen presenting cells (APC) vigorously proliferated in response to TcA, but this was abrogated by pretreatment of APC with paraformaldehyde. Significant IL-2, IL-3, IL-4, IL-5 and IFN-gamma mRNA expression was detected in PBMC stimulated with TcA, with expression peaking at 72 h after stimulation. IL-1 beta, IL-6, IL-10 and GM-CSF mRNA expression was also upregulated, peaking at 24 h after stimulation. Taken together, these results suggest that adult T. canis-derived antigens have the ability to activate human PBMC as conventional antigens, possibly due to their cross-reactivity, which may be involved in the host defence against helminth infection.
Weissflog, Ludwig; Krüger, Gert; Elansky, Nikolai; Putz, Erich; Pfennigsdorff, Andrea; Seyfarth, Klaus Ullrich; Nüchter, Matthias; Lange, Christian; Kotte, Karsten
2003-07-01
Trichloroacetic acid (TCA, CCl(3)COOH) is a phytotoxic chemical. Although TCA salts and derivates were once used as herbicides to combat perennial grasses and weeds, they have since been banned because of their indiscriminate herbicidal effects on woody plant species. However, TCA can also be formed in the atmosphere. For instance, the high-volatile C(2)-chlorohydrocarbons tetrachloroethene (TECE, C(2)Cl(4)) and 1,1,1-trichloroethane (TCE, CCl(3)CH(3)) can react under oxidative conditions in the atmosphere to form TCA and other substances. The ongoing industrialisation of Southeast Asia, South Africa and South America means that use of TECE as solvents in the metal and textile industries of these regions in the southern hemisphere can be expected to rise. The increasing emissions of this substance--together with the rise in the atmospheric oxidation potential caused by urban activities, slash and burn agriculture and forest fires in the southern hemisphere--could lead to a greater input/formation of TCA in the vegetation located in the lee of these emission sources. By means of biomonitoring studies, the input/formation of TCA in vegetation was detected at various locations in South America, North America, Africa, and Europe.
Freitas, R S; Gutfilen, B; da Fonseca, L M; Bernardo-Filho, M
1996-01-01
Secure determination of the binding of 99mTc-radiopharmaceuticals to plasma (P) and blood cell (BC) constituents can help to understand the biodistribution of radiophamaceuticals. The reported precipitation studies of blood with radiopharmaceuticals have shown that the results can not be easily compared between studies. We decided to determine the "gold standard" concentration of trichloroacetic acid (TCA) to evaluate the binding to blood elements for several radiopharmaceuticals used in routine nuclear medicine. We have studied phytic (99mTc-PHY), diethylenetriaminepentaacetic (99mTc-DTPA), glucoheptonic (99mTc-GHA) and dimercaptosuccinic (99mTc-DMSA) acids. Blood was incubated with radiopharmaceuticals, centrifuged and P and BC separated. Samples of P and BC were also precipitated with TCA concentrations (20.0, 10.0, 5.0, 1.0, 0.5 and 0.1 percent) and soluble (SF) and insoluble fractions (IF) were isolated. The percent radioactivity (percent rad) in IF-P depends on TCA concentration. It varied from 36.4 to 65.0 (99mTc-PHY), from 17.9 to 32.0 (99mTc-DTPA), from 11.5 to 38.8 (99mTc-GHA) and from 52.8 to 66.2 (99mTc-DMSA). The results for the binding of 99mTc-PHY to IF-P show that there was no differences in the percent rad when TCA concentrations of 0.1 to 1.0 percent were used. For 99mTc-DTPA, 5.0 percent is the best TCA concentration. For 99mTc-GHA, low values of percent rad bound to IF-P is found with TCA concentrations of 0.1, 0.5 and 1.0. Interestingly, with 99mTc-DMSA, high values of bound radioactivity are not dependent on TCA concentrations (0.1 to 10.0). Radioactivity in IF-BC depends on TCA concentration and it varied for 99mTc-PHY (80.1 to 54.1) and for 99mTc-GHA (85.5 to 61.7). With 99mTc-DTPA and with 99mTc-DMSA the percent rad in IF-BC seems independent of TCA concentration. We suggest that the evaluation of the binding of the various 99mTc-radiopharmaceuticals to blood constituents, using only one TCA concentration, should be avoided.
Miltenburg, Cynthia L; Duffield, Todd F; Bienzle, Dorothee; Scholtz, Elizabeth L; LeBlanc, Stephen J
2016-08-01
Prophylactic Ca supplementation immediately after calving is a common strategy to prevent clinical and subclinical hypocalcemia in parturient dairy cows. The objective of this study was to evaluate the effect of prophylactic administration of an injected Ca supplement on blood Ca concentration at 24 and 48h after treatment, incidence risk of clinical disease and culling, milk production in early lactation, and probability of pregnancy at first insemination. Cows without signs of visible milk fever (n=984) from 7 farms were blocked by parity and randomly assigned to receive either Ca gluconate (35% wt/vol) in combination with Ca glucoheptonate (10% wt/vol; TheraCalcium, Vétoquinol Canada Inc., Lavaltrie, Quebec) or a placebo (medication vehicle solution with no Ca) at first contact with each cow after calving and again 12 to 24h later. Each dose was 120mL injected subcutaneously over 2 sites. Total serum Ca concentration (tCa) was measured from coccygeal blood samples before (time 0) and 24 and 48h after first treatment in a subsample of cows (n=129). Blood β-hydroxybutyrate concentrations were measured from all cows twice between 3 and 16d in milk at weekly visits and cows were evaluated for vaginal discharge once between 28 and 42d in milk. Disease events, production data from the first 3 Dairy Herd Improvement milk tests, reproduction, and culling data were collected from each herd. For cows that had received 1 injection of Ca before the blood sample at 24h (n=95), tCa was significantly higher in the treated cows: mean ± standard error, 2.03±0.03 versus 1.90±0.03mmol/L, accounting for tCa at time of enrollment and a treatment by tCa at enrollment interaction. At 48h, no significant difference was found in tCa between treatment and control (mean ± SE, 2.12±0.02 and 2.10±0.03mmol/L, respectively). Cows treated with the Ca product were significantly less likely to have received intravenous, subcutaneous, or oral supplemental Ca for exhibiting clinical signs of hypocalcemia than control cows (5.0 vs. 8.4%). No effect was found of treatment on retained placenta, metritis, hyperketonemia, prevalence of purulent vaginal discharge, culling from the herd, early lactation production, probability of pregnancy to first artificial insemination, or time to pregnancy. With this subcutaneous prophylactic Ca treatment regimen, blood Ca levels were temporarily increased at 24h after treatment, but no effect was observed of supplemental Ca on the risk of disease or culling, milk production, or reproductive performance. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Generation of gear tooth surfaces by application of CNC machines
NASA Technical Reports Server (NTRS)
Litvin, F. L.; Chen, N. X.
1994-01-01
This study will demonstrate the importance of application of computer numerically controlled (CNC) machines in generation of gear tooth surfaces with new topology. This topology decreases gear vibration and will extend the gear capacity and service life. A preliminary investigation by a tooth contact analysis (TCA) program has shown that gear tooth surfaces in line contact (for instance, involute helical gears with parallel axes, worm gear drives with cylindrical worms, etc.) are very sensitive to angular errors of misalignment that cause edge contact and an unfavorable shape of transmission errors and vibration. The new topology of gear tooth surfaces is based on the localization of bearing contact, and the synthesis of a predesigned parabolic function of transmission errors that is able to absorb a piecewise linear function of transmission errors caused by gear misalignment. The report will describe the following topics: description of kinematics of CNC machines with six degrees of freedom that can be applied for generation of gear tooth surfaces with new topology. A new method for grinding of gear tooth surfaces by a cone surface or surface of revolution based on application of CNC machines is described. This method provides an optimal approximation of the ground surface to the given one. This method is especially beneficial when undeveloped ruled surfaces are to be ground. Execution of motions of the CNC machine is also described. The solution to this problem can be applied as well for the transfer of machine tool settings from a conventional generator to the CNC machine. The developed theory required the derivation of a modified equation of meshing based on application of the concept of space curves, space curves represented on surfaces, geodesic curvature, surface torsion, etc. Condensed information on these topics of differential geometry is provided as well.
Hirasawa, Takashi; Saito, Masaki; Yoshikawa, Katsunori; Furusawa, Chikara; Shmizu, Hiroshi
2018-05-01
Corynebacterium glutamicum is known for its ability to produce glutamic acid and has been utilized for the fermentative production of various amino acids. Glutamic acid production in C. glutamicum is induced by penicillin. In this study, the transcriptome and metabolome of C. glutamicum is analyzed to understand the mechanism of penicillin-induced glutamic acid production. Transcriptomic analysis with DNA microarray revealed that expression of some glycolysis- and TCA cycle-related genes, which include those encoding the enzymes involved in conversion of glucose to 2-oxoglutaric acid, is upregulated after penicillin addition. Meanwhile, expression of some TCA cycle-related genes, encoding the enzymes for conversion of 2-oxoglutaric acid to oxaloacetic acid, and the anaplerotic reactions decreased. In addition, expression of NCgl1221 and odhI, encoding proteins involved in glutamic acid excretion and inhibition of the 2-oxoglutarate dehydrogenase, respectively, is upregulated. Functional category enrichment analysis of genes upregulated and downregulated after penicillin addition revealed that genes for signal transduction systems are enriched among upregulated genes, whereas those for energy production and carbohydrate and amino acid metabolisms are enriched among the downregulated genes. As for the metabolomic analysis using capillary electrophoresis time-of-flight mass spectrometry, the intracellular content of most metabolites of the glycolysis and the TCA cycle decreased dramatically after penicillin addition. Overall, these results indicate that the cellular metabolism and glutamic acid excretion are mainly optimized at the transcription level during penicillin-induced glutamic acid production by C. glutamicum. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Koontz, Laura
2014-01-01
Trichloroacetic acid (TCA) precipitation of proteins is commonly used to concentrate protein samples or remove contaminants, including salts and detergents, prior to downstream applications such as SDS-PAGE or 2D-gels. TCA precipitation denatures the protein, so it should not be used if the protein must remain in its folded state (e.g., if you want to measure a biochemical activity of the protein). © 2014 Elsevier Inc. All rights reserved.
In vivo detection of brain Krebs cycle intermediate by hyperpolarized magnetic resonance.
Mishkovsky, Mor; Comment, Arnaud; Gruetter, Rolf
2012-12-01
The Krebs (or tricarboxylic acid (TCA)) cycle has a central role in the regulation of brain energy regulation and metabolism, yet brain TCA cycle intermediates have never been directly detected in vivo. This study reports the first direct in vivo observation of a TCA cycle intermediate in intact brain, namely, 2-oxoglutarate, a key biomolecule connecting metabolism to neuronal activity. Our observation reveals important information about in vivo biochemical processes hitherto considered undetectable. In particular, it provides direct evidence that transport across the inner mitochondria membrane is rate limiting in the brain. The hyperpolarized magnetic resonance protocol designed for this study opens the way to direct and real-time studies of TCA cycle kinetics.
Fumarate Reductase Activity Maintains an Energized Membrane in Anaerobic Mycobacterium tuberculosis
Watanabe, Shinya; Zimmermann, Michael; Goodwin, Michael B.; Sauer, Uwe; Barry, Clifton E.; Boshoff, Helena I.
2011-01-01
Oxygen depletion of Mycobacterium tuberculosis engages the DosR regulon that coordinates an overall down-regulation of metabolism while up-regulating specific genes involved in respiration and central metabolism. We have developed a chemostat model of M. tuberculosis where growth rate was a function of dissolved oxygen concentration to analyze metabolic adaptation to hypoxia. A drop in dissolved oxygen concentration from 50 mmHg to 0.42 mmHg led to a 2.3 fold decrease in intracellular ATP levels with an almost 70-fold increase in the ratio of NADH/NAD+. This suggests that re-oxidation of this co-factor becomes limiting in the absence of a terminal electron acceptor. Upon oxygen limitation genes involved in the reverse TCA cycle were upregulated and this upregulation was associated with a significant accumulation of succinate in the extracellular milieu. We confirmed that this succinate was produced by a reversal of the TCA cycle towards the non-oxidative direction with net CO2 incorporation by analysis of the isotopomers of secreted succinate after feeding stable isotope (13C) labeled precursors. This showed that the resulting succinate retained both carbons lost during oxidative operation of the TCA cycle. Metabolomic analyses of all glycolytic and TCA cycle intermediates from 13C-glucose fed cells under aerobic and anaerobic conditions showed a clear reversal of isotope labeling patterns accompanying the switch from normoxic to anoxic conditions. M. tuberculosis encodes three potential succinate-producing enzymes including a canonical fumarate reductase which was highly upregulated under hypoxia. Knockout of frd, however, failed to reduce succinate accumulation and gene expression studies revealed a compensatory upregulation of two homologous enzymes. These major realignments of central metabolism are consistent with a model of oxygen-induced stasis in which an energized membrane is maintained by coupling the reductive branch of the TCA cycle to succinate secretion. This fermentative process may offer unique targets for the treatment of latent tuberculosis. PMID:21998585
Using corona discharge-ion mobility spectrometry for detection of 2,4,6-Trichloroanisole.
Lichvanová, Zuzana; Ilbeigi, Vahideh; Sabo, Martin; Tabrizchi, Mahmoud; Matejčík, Stefan
2014-09-01
In this work possible application of the corona discharge-ion mobility spectrometer (CD-IMS) for detection of 2,4,6-Trichloroanisole (TCA) has been investigated. We applied CD-IMS interfaced with orthogonal acceleration time of flight mass spectrometer (CD-IMS-oaTOF) to study the ion processes within the CD-IMS technique. The CD-IMS instrument was operated in two modes, (i) standard and (ii) reverse flow modes resulting in different chemical ionisation schemes by NO3(-)(HNO3)n (n=0,1,2) and O2(-)(H2O)n (n=0,1,2), respectively. The O2(-)(H2O)n ionisation was associated with formation of Cl(-) and (TCA-CH3)(-) ions from TCA. The NO3(-)(HNO3)n ionisation, resulted in formation of NO3(-)(HNO3)(TCA-Cl) adduct ions. Limit of detection (LOD) for TCA was determined in gas (100 ppb) and solid phases (150 ng). Copyright © 2014 Elsevier B.V. All rights reserved.
ODC-Free Solvent Implementation for Phenolics Cleaning
NASA Technical Reports Server (NTRS)
Wurth, Laura; Biegert, Lydia; Lamont, DT; McCool, Alex (Technical Monitor)
2001-01-01
During phenolic liner manufacture, resin-impregnated (pre-preg) bias tape of silica, glass, or carbon cloth is tape-wrapped, cured, machined, and then wiped with 1,1,1 tri-chloroethane (TCA) to remove contaminants that may have been introduced during machining and handling. Following the TCA wipe, the machined surface is given a resin wet-coat and over-wrapped with more prepreg and cured. A TCA replacement solvent for these wiping operations must effectively remove both surface contaminants, and sub-surface oils and greases while not compromising the integrity of this interface. Selection of a TCA replacement solvent for phenolic over-wrap interface cleaning began with sub-scale compatibility tests with cured phenolics. Additional compatibility tests included assessment of solvent retention in machined phenolic surfaces. Results from these tests showed that, while the candidate solvent did not degrade the cured phenolics, it was retained in higher concentrations than TCA in phenolic surfaces. This effect was most pronounced with glass and silica cloth phenolics with steep ply angles relative to the wiped surfaces.
TLNS3D/CDISC Multipoint Design of the TCA Concept
NASA Technical Reports Server (NTRS)
Campbell, Richard L.; Mann, Michael J.
1999-01-01
This paper presents the work done to date by the authors on developing an efficient approach to multipoint design and applying it to the design of the HSR TCA (High Speed Research Technology Concept Aircraft) configuration. While the title indicates that this exploratory study has been performed using the TLNS3DMB flow solver and the CDISC (Constrained Direct Iterative Surface Curvature) design method, the CDISC method could have been used with any flow solver, and the multipoint design approach does not require the use of CDISC. The goal of the study was to develop a multipoint design method that could achieve a design in about the same time as 10 analysis runs.
Tcherkez, Guillaume; Mahé, Aline; Gauthier, Paul; Mauve, Caroline; Gout, Elizabeth; Bligny, Richard; Cornic, Gabriel; Hodges, Michael
2009-01-01
While the possible importance of the tricarboxylic acid (TCA) cycle reactions for leaf photosynthesis operation has been recognized, many uncertainties remain on whether TCA cycle biochemistry is similar in the light compared with the dark. It is widely accepted that leaf day respiration and the metabolic commitment to TCA decarboxylation are down-regulated in illuminated leaves. However, the metabolic basis (i.e. the limiting steps involved in such a down-regulation) is not well known. Here, we investigated the in vivo metabolic fluxes of individual reactions of the TCA cycle by developing two isotopic methods, 13C tracing and fluxomics and the use of H/D isotope effects, with Xanthium strumarium leaves. We provide evidence that the TCA “cycle” does not work in the forward direction like a proper cycle but, rather, operates in both the reverse and forward directions to produce fumarate and glutamate, respectively. Such a functional division of the cycle plausibly reflects the compromise between two contrasted forces: (1) the feedback inhibition by NADH and ATP on TCA enzymes in the light, and (2) the need to provide pH-buffering organic acids and carbon skeletons for nitrate absorption and assimilation. PMID:19675152
NASA Astrophysics Data System (ADS)
Weissflog, Ludwig; Pfennigsdorff, Andrea; Martinez-Pastur, Guillermo; Puliafito, Enrique; Figueroa, Dante; Elansky, Nikolai; Nikonov, Vyasheslav; Putz, Erich; Krüger, Gert; Kellner, Klaus
Trichloroacetic acid (TCA; CCl 3COOH) is a phytotoxic chemical. Although TCA salts and derivatives were once deployed as herbicides against perennial grasses and weeds, their use has since been banned because of their indiscriminate herbicidal effects on woody plant species. However, TCA can also be formed in the atmosphere. For instance, high-volatile C 2-chlorohydrocarbons tetrachloroethene (TECE, C 2Cl 4) and 1,1,1-trichloroethane (TCE, CCl 3CH 3) can react to TCA and other substances under oxidative conditions here. Owing to further industrialisation of Southeast Asia, South Africa and South America, a rise can be expected in the use of TECE as solvents in the metal and textile industries of these regions in the southern hemisphere (SH). The increasing emissions of this substance—together with the rise in the atmospheric oxidation potential caused by urban activities, slash and burn agriculture and forest fires in the SH—will result in the increased input/formation of TCA in the vegetation located on the lee side of these emission sources. By means of biomonitoring studies, inputs/formation of TCA related to the climatic conditions were detected at various locations in South America, Africa, and Europe.
Central metabolism controls transcription of a virulence gene regulator in Vibrio cholerae
Minato, Yusuke; Fassio, Sara R.; Wolfe, Alan J.
2013-01-01
ToxT is the central regulatory protein involved in activation of the main virulence genes in Vibrio cholerae. We have identified transposon insertions in central metabolism genes, whose disruption increases toxT transcription. These disrupted genes encode the primary respiration-linked sodium pump (NADH : ubiquinone oxidoreductase or NQR) and certain tricarboxylic acid (TCA) cycle enzymes. Observations made following stimulation of respiration in the nqr mutant or chemical inhibition of NQR activity in the TCA cycle mutants led to the hypothesis that NQR affects toxT transcription via the TCA cycle. That toxT transcription increased when the growth medium was supplemented with citrate, but decreased with oxaloacetate, focused our attention on the TCA cycle substrate acetyl-CoA and its non-TCA cycle metabolism. Indeed, both the nqr and the TCA cycle mutants increased acetate excretion. A similar correlation between acetate excretion and toxT transcription was observed in a tolC mutant and upon amino acid (NRES) supplementation. As acetate and its tendency to decrease pH exerted no strong effect on toxT transcription, and because disruption of the major acetate excretion pathway increased toxT transcription, we propose that toxT transcription is regulated by either acetyl-CoA or some close derivative. PMID:23429745
Rickard, Annette C; Vassallo, James; Nutbeam, Tim; Lyttle, Mark D; Maconochie, Ian K; Enki, Doyo G; Smith, Jason E
2018-04-28
Paediatric traumatic cardiac arrest (TCA) is associated with low survival and poor outcomes. The mechanisms that underlie TCA are different from medical cardiac arrest; the approach to treatment of TCA may therefore also need to differ to optimise outcomes. The aim of this study was to explore the opinion of subject matter experts regarding the diagnosis and treatment of paediatric TCA, and to reach consensus on how best to manage this group of patients. An online Delphi study was conducted over three rounds, with the aim of achieving consensus (defined as 70% agreement) on statements related to the diagnosis and management of paediatric TCA. Participants were invited from paediatric and adult emergency medicine, paediatric anaesthetics, paediatric ICU and paediatric surgery, as well as Paediatric Major Trauma Centre leads and representatives from the Resuscitation Council UK. Statements were informed by literature reviews and were based on elements of APLS resuscitation algorithms as well as some concepts used in the management of adult TCA; they ranged from confirmation of cardiac arrest to the indications for thoracotomy. 73 experts completed all three rounds between June and November 2016. Consensus was reached on 14 statements regarding the diagnosis and management of paediatric TCA; oxygenation and ventilatory support, along with rapid volume replacement with warmed blood, improve survival. The duration of cardiac arrest and the lack of a response to intervention, along with cardiac standstill on ultrasound, help to guide the decision to terminate resuscitation. This study has given a consensus-based framework to guide protocol development in the management of paediatric TCA, though further work is required in other key areas including its acceptability to clinicians. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Lipogenesis and Redox Balance in Nitrogen-Fixing Pea Bacteroids.
Terpolilli, Jason J; Masakapalli, Shyam K; Karunakaran, Ramakrishnan; Webb, Isabel U C; Green, Rob; Watmough, Nicholas J; Kruger, Nicholas J; Ratcliffe, R George; Poole, Philip S
2016-10-15
Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the tricarboxylic acid (TCA) cycle to generate NAD(P)H for reduction of N2 Metabolic flux analysis of laboratory-grown Rhizobium leguminosarum showed that the flux from [(13)C]succinate was consistent with respiration of an obligate aerobe growing on a TCA cycle intermediate as the sole carbon source. However, the instability of fragile pea bacteroids prevented their steady-state labeling under N2-fixing conditions. Therefore, comparative metabolomic profiling was used to compare free-living R. leguminosarum with pea bacteroids. While the TCA cycle was shown to be essential for maximal rates of N2 fixation, levels of pyruvate (5.5-fold reduced), acetyl coenzyme A (acetyl-CoA; 50-fold reduced), free coenzyme A (33-fold reduced), and citrate (4.5-fold reduced) were much lower in bacteroids. Instead of completely oxidizing acetyl-CoA, pea bacteroids channel it into both lipid and the lipid-like polymer poly-β-hydroxybutyrate (PHB), the latter via a type III PHB synthase that is active only in bacteroids. Lipogenesis may be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Direct reduction by NAD(P)H of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance the production of NAD(P)H from oxidation of acetyl-CoA in the TCA cycle with its storage in PHB and lipids. Biological nitrogen fixation by symbiotic bacteria (rhizobia) in legume root nodules is an energy-expensive process. Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the TCA cycle to generate NAD(P)H for reduction of N2 However, direct reduction of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance oxidation of plant-derived dicarboxylates in the TCA cycle with lipid synthesis. Pea bacteroids channel acetyl-CoA into both lipid and the lipid-like polymer poly-β-hydroxybutyrate, the latter via a type II PHB synthase. Lipogenesis is likely to be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Lipogenesis and Redox Balance in Nitrogen-Fixing Pea Bacteroids
Terpolilli, Jason J.; Masakapalli, Shyam K.; Karunakaran, Ramakrishnan; Webb, Isabel U. C.; Green, Rob; Watmough, Nicholas J.; Kruger, Nicholas J.; Ratcliffe, R. George
2016-01-01
ABSTRACT Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the tricarboxylic acid (TCA) cycle to generate NAD(P)H for reduction of N2. Metabolic flux analysis of laboratory-grown Rhizobium leguminosarum showed that the flux from [13C]succinate was consistent with respiration of an obligate aerobe growing on a TCA cycle intermediate as the sole carbon source. However, the instability of fragile pea bacteroids prevented their steady-state labeling under N2-fixing conditions. Therefore, comparative metabolomic profiling was used to compare free-living R. leguminosarum with pea bacteroids. While the TCA cycle was shown to be essential for maximal rates of N2 fixation, levels of pyruvate (5.5-fold reduced), acetyl coenzyme A (acetyl-CoA; 50-fold reduced), free coenzyme A (33-fold reduced), and citrate (4.5-fold reduced) were much lower in bacteroids. Instead of completely oxidizing acetyl-CoA, pea bacteroids channel it into both lipid and the lipid-like polymer poly-β-hydroxybutyrate (PHB), the latter via a type III PHB synthase that is active only in bacteroids. Lipogenesis may be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Direct reduction by NAD(P)H of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance the production of NAD(P)H from oxidation of acetyl-CoA in the TCA cycle with its storage in PHB and lipids. IMPORTANCE Biological nitrogen fixation by symbiotic bacteria (rhizobia) in legume root nodules is an energy-expensive process. Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the TCA cycle to generate NAD(P)H for reduction of N2. However, direct reduction of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance oxidation of plant-derived dicarboxylates in the TCA cycle with lipid synthesis. Pea bacteroids channel acetyl-CoA into both lipid and the lipid-like polymer poly-β-hydroxybutyrate, the latter via a type II PHB synthase. Lipogenesis is likely to be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. PMID:27501983
Ragavan, Mukundan; Kirpich, Alexander; Fu, Xiaorong; Burgess, Shawn C; McIntyre, Lauren M; Merritt, Matthew E
2017-06-01
The heart oxidizes fatty acids, carbohydrates, and ketone bodies inside the tricarboxylic acid (TCA) cycle to generate the reducing equivalents needed for ATP production. Competition between these substrates makes it difficult to estimate the extent of pyruvate oxidation. Previously, hyperpolarized pyruvate detected propionate-mediated activation of carbohydrate oxidation, even in the presence of acetate. In this report, the optimal concentration of propionate for the activation of glucose oxidation was measured in mouse hearts perfused in Langendorff mode. This study was performed with a more physiologically relevant perfusate than the previous work. Increasing concentrations of propionate did not cause adverse effects on myocardial metabolism, as evidenced by unchanged O 2 consumption, TCA cycle flux, and developed pressures. Propionate at 1 mM was sufficient to achieve significant increases in pyruvate dehydrogenase flux (3×), and anaplerosis (6×), as measured by isotopomer analysis. These results further demonstrate the potential of propionate as an aid for the correct estimation of total carbohydrate oxidative capacity in the heart. However, liquid chromotography/mass spectroscopy-based metabolomics detected large changes (~30-fold) in malate and fumarate pool sizes. This observation leads to a key observation regarding mass balance in the TCA cycle; flux through a portion of the cycle can be drastically elevated without changing the O 2 consumption. Copyright © 2017 the American Physiological Society.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jezynski, Tomasz; /DESY; Larsen, Raymond
ATCA/{mu}TCA platforms are attractive because of the modern serial link architecture, high availability features and many packaging options. Less-demanding availability applications can be met economically by scaling back speed and redundancy. The ATCA specification was originally targeted for the Telecom industry but has gained recently a much wider user audience. The purpose of this paper is to report on present hardware and software R and D efforts where ATCA and {mu}TCA are planned, already being used or in development using selected examples for accelerator and detectors in the Physics community. It will present also the status of a proposal formore » physics extensions to ATCA/{mu}TCA specifications to promote inter-operability of laboratory and industry designs for physics.« less
In vivo detection of brain Krebs cycle intermediate by hyperpolarized magnetic resonance
Mishkovsky, Mor; Comment, Arnaud; Gruetter, Rolf
2012-01-01
The Krebs (or tricarboxylic acid (TCA)) cycle has a central role in the regulation of brain energy regulation and metabolism, yet brain TCA cycle intermediates have never been directly detected in vivo. This study reports the first direct in vivo observation of a TCA cycle intermediate in intact brain, namely, 2-oxoglutarate, a key biomolecule connecting metabolism to neuronal activity. Our observation reveals important information about in vivo biochemical processes hitherto considered undetectable. In particular, it provides direct evidence that transport across the inner mitochondria membrane is rate limiting in the brain. The hyperpolarized magnetic resonance protocol designed for this study opens the way to direct and real-time studies of TCA cycle kinetics. PMID:22990416
Influence of trichloroacetic acid peeling on the skin stress response system.
Kimura, Ayako; Kanazawa, Nobuo; Li, Hong-Jin; Yonei, Nozomi; Yamamoto, Yuki; Furukawa, Fukumi
2011-08-01
Although trichloroacetic acid (TCA) peeling is widely applied for cosmetic treatment of photodamaged skin, the entire biological mechanisms have yet to be determined. The skin stress response system (SSRS) involves corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC) products that are locally-generated in response to locally-provided stressors or pro-inflammatory cytokines. This system would restrict tissue damage and restore local homeostasis. To determine the influence of TCA peeling on the SSRS in vitro and in vivo, expressions of POMC, melanocortin receptor 1 (MC1R), CRH and CRH receptor 1 (CRHR1) mRNA were examined by reverse transcription polymerase chain reaction in Pam212 murine keratinocytes, murine plantar and healthy human abdominal skin specimens after TCA treatment. In addition, their protein expressions as well as those of POMC-derived peptides were examined immunohistochemically. After TCA treatment, transient upregulation of POMC and MC1R mRNA expressions was observed in both murine and human skin, as well as in Pam212. Enhanced POMC protein, recovery of once-impaired MC1R protein, and no enhancement of POMC-derived peptide productions were revealed immunohistochemically in both murine and human epidermis. In contrast, neither expression levels of CRH and CRHR1 mRNA nor epidermal protein were enhanced after TCA application in murine and human skin, except for induction of human CRH mRNA expression. These results suggest that TCA activates the SSRS by inducing POMC and MC1R productions of keratinocytes in the CRH-independent manner, and that the biological effects of POMC itself are responsible for the TCA-induced epidermal SSRS activation. © 2010 Japanese Dermatological Association.
Dascalu, A M; Cherecheanu, A P; Stana, D; Voinea, L; Ciuluvica, R; Savlovschi, C; Serban, D
2014-01-01
to investigate the sensitivity and specificity of the stereometric parameters change analysis vs. Topographic Change Analysis in early detection of glaucoma progression. 81 patients with POAG were monitored for 4 years (GAT monthly, SAP at every 6 months, optic disc photographs and HRT3 yearly). The exclusion criteria were other optic disc or retinal pathology; topographic standard deviation (TSD>30; inter-test variation of reference height>25 μm. The criterion for structural progression was the following: at least 20 adjacent super-pixels with a clinically significant decrease in height (>5%). 16 patients of the total 81 presented structural progression on TCA. The most useful stereometric parameters for the early detection of glaucoma progression were the following: Rim Area change (sensitivity 100%, specificity 74.2% for a "cut-off " value of -0.05), C/D Area change (sensitivity 85.7%, specificity 71.5% for a "cut off " value of 0.02), C/D linear change (sensitivity 85.7%, specificity 71.5% for a "cut-off " value of 0.02), Rim Volume change (sensitivity 71.4%, specificity 88.8% for a "cut-off " value of -0.04). RNFL Thickness change (<0) was highly sensitive (82%), but less specific for glaucoma progression (45,2%). Changes of the other stereometric parameters have a limited diagnostic value for the early detection of glaucoma progression. TCA is a valuable tool for the assessment of the structural progression in glaucoma patients and its inter-test variability is low. On long-term, the quantitative analysis according to stereometric parameters change is also very important. The most relevant parameters to detect progression are RA, C/D Area, Linear C/D and RV.
Lu, Qiang; Zhu, Rui-Li; Yang, Jie; Li, Hui; Liu, Yong-Di; Lu, Shu-Guang; Luo, Qi-Shi; Lin, Kuang-Fei
2015-01-01
Natural attenuation is an effective and feasible technology for controlling groundwater contamination. This study investigated the potential effectiveness and mechanisms of natural attenuation of 1,1,1-trichloroethane (TCA) contaminants in shallow groundwater in Shanghai by using a column simulation experiment, reactive transport model, and 16S rRNA gene clone library. The results indicated that the majority of the contaminant mass was present at 2–6 m in depth, the contaminated area was approximately 1000 m × 1000 m, and natural attenuation processes were occurring at the site. The effluent breakthrough curves from the column experiments demonstrated that the effectiveness of TCA natural attenuation in the groundwater accorded with the advection-dispersion-reaction equation. The kinetic parameter of adsorption and biotic dehydrochlorination of TCA was 0.068 m3/kg and 0.0045 d–1. The contamination plume was predicted to diminish and the maximum concentration of TCA decreased to 280 μg/L. The bacterial community during TCA degradation in groundwater belonged to Trichococcus, Geobacteraceae, Geobacter, Mucilaginibacter, and Arthrobacter. PMID:26379629
NASA Astrophysics Data System (ADS)
Zhang, Mei; Wang, Zhao-Qi; Wang, Yan; Zuo, Tong
2010-10-01
The aim of this research is to study the properties of the transverse chromatic aberration (TCA) after the LASIK refractive surgery based on the individual eye model involving the angle between visual axis and optical axis. According to the measurements of the corneal surfaces, the optical axis lengths and the wavefront aberrations, the individual eye models before and after LASIK refractive surgery are constructed for 15 eyes by using ZEMAX optic design software, while the angle between the visual axis and optical axis is calculated from the data of the anterior corneal surface. The constructed eye models are then used to investigate the variation of the TCA after the surgery. The statistical distributions of the magnitude of the foveal TCA for 15 eyes over the visible spectrum are provided. Finally, we investigate the influence of the TCA on the visual quality and compare the results with previous research. The TCA is an indispensable criterion to evaluate the performance of the refractive surgery. This research is very meaningful for the studies of not only foveal vision but also the peripheral vision.
Tarasov, Andrii; Rauhut, Doris; Jung, Rainer
2017-12-01
Analytical methods of haloanisoles and halophenols quantification in cork matrix are summarized in the current review. Sample-preparation and sample-treatment techniques have been compared and discussed from the perspective of their efficiency, time- and extractant-optimization, easiness of performance. Primary interest of these analyses usually addresses to 2,4,6-trichloroanisole (TCA), which is a major wine contaminant among haloanisoles. Two concepts of TCA determination are described in the review: releasable TCA and total TCA analyses. Chromatographic, bioanalytical and sensorial methods were compared according to their application in the cork industry and in scientific investigations. Finally, it was shown that modern analytical techniques are able to provide required sensitivity, selectivity and repeatability for haloanisoles and halophenols determination. Copyright © 2017 Elsevier B.V. All rights reserved.
Comparative study of 15% TCA peel versus 35% glycolic acid peel for the treatment of melasma
Puri, Neerja
2012-01-01
Background: Chemical peels are the mainstay of a cosmetic practitioner's armamentarium because they can be used to treat some skin disorders and can provide aesthetic benefit. Objectives: To compare 15% TCA peel and 35% glycolic acid peel for the treatment of melasma. Material and Methods: We selected 30 participants of melasma aged between 20 and 50 years from the dermatology outpatient department and treated equal numbers with 15% TCA and 35% glycolic acid. Results: Subjective response as graded by the patient showed good or very good response in 70% participants in the glycolic acid group and 64% in the TCA group. Conclusions: There was statistically insignificant difference in the efficacy between the two groups for the treatment of melasma. PMID:23130283
Qin, Qing; Ma, Peng-Fei; Kuang, Xiao-Cong; Gao, Ming-Xing; Mo, De-Huan; Xia, Shuang; Jin, Ning; Xia, Jun-Jie; Qi, Zhong-Quan; Lin, Cui-Wu
2013-12-05
Multidrug resistance (MDR) is a key element in the failure of chemotherapies, and development of agents to overcome MDR is crucial to improving cancer treatments. The overexpression of glutathione-S-transferases (GSTs) is one of the major mechanisms of MDR. Because some agents used in traditional Chinese medicine have strong antitumor effects coupled with low toxicity; we investigated the ability of N,N-bis(2-chloroethyl)docos-13-enamide (compound J), the synthesized analog of a highly unsaturated fatty acid from Isatis tinctoria L., to reverse the MDR induced by adriamycin (ADM) in TCA8113/ADM cells. We found that compound J significantly increased the cytotoxicity of ADM in TCA8113/ADM cells, with a reversal fold of 2.461. Analysis of the mechanisms through which compound J reversed MDR indicated that compound J significantly decreased the activity of GSTs and enhanced the depletion of GSH in TCA8113/ADM cells, but did not affect the P-glycoprotein (P-gp) efflux. Taken together, our data suggested that compound J was an excellent candidate for reversing MDR in cancer therapy. © 2013 Published by Elsevier B.V.
Ammonium Assimilation Requires Mitochondrial Respiration in the Light 1
Weger, Harold G.; Birch, Douglas G.; Elrifi, Ivor R.; Turpin, David H.
1988-01-01
Mass spectrometric analysis of O2 and CO2 exchange in the green alga Selenastrum minutum (Naeg. Collins) provides evidence for the occurrence of mitochondrial respiration in light. Stimulation of amino acid synthesis by the addition of NH4Cl resulted in nearly a 250% increase in the rate of TCA cycle CO2 efflux in both light and dark. Ammonium addition caused a similar increase in cyanide sensitive O2 consumption in both light and dark. Anaerobiosis inhibited the CO2 release caused by NH4Cl. These results indicated that the cytochrome pathway of the mitochondrial electron transport chain was operative and responsible for the oxidation of a large portion of the NADH generated during the ammonium induced increase in TCA cycle activity. In the presence of DCMU, ammonium addition also stimulated net O2 consumption in the light. This implied that the Mehler reaction did not play a significant role in O2 consumption under our conditions. These results show that both the TCA cycle and the mitochondrial electron transport chain are capable of operation in the light and that an important role of mitochondrial respiration in photosynthesizing cells is the provision of carbon skeletons for biosynthetic reactions. PMID:16665971
Dwell Time and Surface Parameter Effects on Removal of Silicone Oil From D6ac Steel Using TCA
NASA Technical Reports Server (NTRS)
Boothe, R. E.
2003-01-01
This study was conducted to evaluate the impact of dwell time, surface roughness, and the surface activation state on 1,1,1-trichloroethane's (TCA's) effectiveness for removing silicone oil from D6ac steel. Silicone-contaminated test articles were washed with TCA solvent, and then the surfaces were analyzed for residue, using Fourier transform infrared spectroscopy. The predominant factor affecting the ability to remove the silicone oil was surface roughness.
Nazar, Bruno Palazzo; Bernardes, Camila; Peachey, Gemma; Sergeant, Joseph; Mattos, Paulo; Treasure, Janet
2016-12-01
There has been interest in whether people with Attention-Deficit/Hyperactivity Disorder (ADHD) are at higher risk of developing an Eating Disorder (ED). The aim of this study was estimate the size of this association with a meta-analysis of studies. We retrieved studies following PRISMA guidelines from a broad range of databases. Twelve studies fitted our primary aim in investigating ED in ADHD populations (ADHD = 4,013/Controls = 29,404), and five exploring ADHD in ED populations (ED = 1,044/Controls = 11,292). The pooled odds ratio of diagnosing any ED in ADHD was increased significantly, 3.82 (95% CI:2.34-6.24). A similar level of risk was found across all ED syndromes [Anorexia Nervosa = 4.28 (95% CI:2.24-8.16); Bulimia Nervosa = 5.71 (95% CI: 3.56-9.16) and Binge Eating Disorder = 4.13 (95% CI:3-5.67)]. The risk was significantly higher if ADHD was diagnosed using a clinical interview [5.89 (95% CI:4.32-8.04)] rather than a self-report instrument [2.23 (95% CI:1.23-4.03)]. The pooled odds ratio of diagnosing ADHD in participants with ED was significantly increased, 2.57 (95% CI:1.30-5.11). Subgroup analysis of cohorts with binge eating only yielded a risk of 5.77 (95% CI:2.35-14.18). None of the variables examined in meta-regression procedures explained the variance in effect size between studies. People with ADHD have a higher risk of comorbidity with an ED and people with an ED also have higher levels of comorbidity with ADHD. Future studies should address if patients with this comorbidity have a different prognosis, course and treatment response when compared to patients with either disorder alone. Ha habido interés en saber si la gente con Trastorno por Déficit de Atención e Hiperactividad (TDAH) están en mayor riesgo de desarrollar un Trastorno de la Conducta Alimentaria (TCA). El objetivo de este estudio fue estimar el tamaño de esta asociación con un meta-análisis de los estudios. Métodos: Recuperamos estudios de una amplia gama base de datos, que siguen los lineamientos PRISMA. Resultados: Doce estudios encajaron con nuestro objetivo primario de investigar los TCA en poblaciones con TDAH (TDAH = 4,013/Controles = 29,404), y 5 exploraron TDAH en poblaciones con TCA (TCA = 1,044/Controles = 11,292). El odds ratio (OR) agrupado de diagnosticar cualquier TCA en el TDAH se incrementó significativamente, 3.82 (95% CI:2.34-6.24). Un nivel de riesgo similar fue encontrado en todos los síndromes de TCA [Anorexia Nervosa = 4.28 (95% CI:2.24-8.16); Bulimia Nervosa = 5.71 (95% CI:3.56-9.16) y Trastorno por Atracón = 4.13 (95% CI: 3-5.67)]. El riesgo fue significativamente mayor si el TDAH fue diagnosticado utilizando una entrevista clínica [5.89 (95% CI:4.32-8.04)] en lugar de un instrumento de auto-reporte [2.23 (95% CI:1.23-4.03)]. El odds ratio (OR) agrupado de diagnosticar TDAH en participantes con TCA fue significativamente incrementado, 2.57 (95% CI:1.30-5.11). El análisis de los subgrupos de cohort con atracones solamente produjo un riesgo de 5.77 (95% CI:2.35-14.18). Ninguna de las variables examinadas en los procedimientos de meta-regresión explicaron la varianza en el tamaño del efecto entre los estudios. Discusión: La gente con TDAH tiene un mayor riesgo de comorbilidad con un TCA y la gente con un TCA también tiene niveles altos de comorbilidad con TDAH. Los estudios futuros deberán abordar si los pacientes con esta comorbilidad tienen diferente pronóstico, curso y respuesta a tratamiento cuando son comparados con pacientes que solamente tienen uno de los trastornos. © 2016 Wiley Periodicals, Inc. (Int J Eat Disord 2016) © 2016 Wiley Periodicals, Inc. (Int J Eat Disord 2016; 49:1045-1057). © 2016 Wiley Periodicals, Inc.
Alternative Fuels in Epilepsy and Amyotrophic Lateral Sclerosis.
Tefera, Tesfaye W; Tan, Kah Ni; McDonald, Tanya S; Borges, Karin
2017-06-01
This review summarises the recent findings on metabolic treatments for epilepsy and Amyotrophic Lateral Sclerosis (ALS) in honour of Professor Ursula Sonnewald. The metabolic impairments in rodent models of these disorders as well as affected patients are being discussed. In both epilepsy and ALS, there are defects in glucose uptake and reduced tricarboxylic acid (TCA) cycling, at least in part due to reduced amounts of C4 TCA cycle intermediates. In addition there are impairments in glycolysis in ALS. A reduction in glucose uptake can be addressed by providing the brain with alternative fuels, such as ketones or medium-chain triglycerides. As anaplerotic fuels, such as the triglyceride of heptanoate, triheptanoin, refill the TCA cycle C4/C5 intermediate pool that is deficient, they are ideal to boost TCA cycling and thus the oxidative metabolism of all fuels.
Yang, Cailing; Yan, Jianguo; Yuan, Guoyan; Zhang, Yinghua; Lu, Derong; Ren, Mingxin; Cui, Weigang
2014-08-01
Icotinib, a selective EGFR tyrosine kinase inhibitor (EGFR-TKI), has been shown to exhibit anti-tumor activity against several tumor cell lines. However, the exact molecular mechanism of icotinib's anti-tumor effect remains unknown. This study aims to examine the zytotoxic effect of icotinib on Tca8113 cells and its potential molecular mechanism. Icotinib significantly resulted in dose-dependent cell death as determined by MTT assay, accompanied by increased levels of Bax and DNA fragmentation. Icotinib could also induce Reactive Oxygen Species (ROS) generation. Further studies confirmed that scavenging of reactive oxygen species by N-acetyl-L-cysteine (NAC), and pharmacological inhibition of MAPK reversed icotinib-induced apoptosis in Tca8113 cells. Our data provide evidence that icotinib induces apoptosis, possibly via ROS-mediated MAPK pathway in Tca8113 cells.
Doi, Yuki; Shimizu, Motoyuki; Fujita, Tomoya; Nakamura, Akira; Takizawa, Noboru
2014-01-01
We identified the extremely nitrite-tolerant bacterium Achromobacter denitrificans YD35 that can grow in complex medium containing 100 mM nitrite (NO2−) under aerobic conditions. Nitrite induced global proteomic changes and upregulated tricarboxylate (TCA) cycle enzymes as well as antioxidant proteins in YD35. Transposon mutagenesis generated NO2−-hypersensitive mutants of YD35 that had mutations at genes for aconitate hydratase and α-ketoglutarate dehydrogenase in the TCA cycle and a pyruvate dehydrogenase (Pdh) E1 component, indicating the importance of TCA cycle metabolism to NO2− tolerance. A mutant in which the pdh gene cluster was disrupted (Δpdh mutant) could not grow in the presence of 100 mM NO2−. Nitrite decreased the cellular NADH/NAD+ ratio and the cellular ATP level. These defects were more severe in the Δpdh mutant, indicating that Pdh contributes to upregulating cellular NADH and ATP and NO2−-tolerant growth. Exogenous acetate, which generates acetyl coenzyme A and then is metabolized by the TCA cycle, compensated for these defects caused by disruption of the pdh gene cluster and those caused by NO2−. These findings demonstrate a link between NO2− tolerance and pyruvate/acetate metabolism through the TCA cycle. The TCA cycle mechanism in YD35 enhances NADH production, and we consider that this contributes to a novel NO2−-tolerating mechanism in this strain. PMID:24413603
Reduction of halogenated ethanes by green rust.
DOE Office of Scientific and Technical Information (OSTI.GOV)
O'Loughlin, E. J.; Burris, D. R.; Environmental Research
Green rusts, mixed Fe{sup II}/Fe{sup III} hydroxide minerals present in many suboxic environments, have been shown to reduce a number of organic and inorganic contaminants. The reduction of halogenated ethanes was examined in aqueous suspensions of green rust, both alone and with the addition of Ag{sup I} (AgGR) and Cu{sup II} (CuGR). Hexachloroethane (HCA), pentachloroethane (PCA), 1,1,1,2-tetrachloroethane (1,1,1,2-TeCA), 1,1,2,2-tetrachloroethane (1,1,2,2-TeCA), 1,1,1-trichloroethane (1,1,1-TCA), 1,1,2-trichloroethane (1,1,2-TCA), 1,1-dichloroethane (1,1-DCA), and 1,2-dibromoethane were reduced in the presence of green rust alone, AgGR, or CuGR; only 1,2-dichloroethane and chloroethane were nonreactive. The reduction was generally more rapid for more highly substituted ethanes than for ethanesmore » having fewer halogen groups (HCA > PCA > 1,1,1,2-TeCA > 1,1,1-TCA > 1,1,2,2-TeCA > 1,1,2-TCA > 1,1-DCA), and isomers with the more asymmetric distributions of halogen groups were more rapidly reduced than the isomer with greater symmetry (e.g., 1,1,1-TCA > 1,1,2-TCA). The addition of Ag{sup I} or Cu{sup II} to green rust suspensions resulted in a substantial increase in the rate of halogenated ethane reduction as well as significant differences in the product distributions with respect to green rust alone.« less
Vicente, Joaquim A F; Gomes-Santos, Carina S S; Sousa, Ana Paula M; Madeira, Vítor M C
2005-03-01
Potato tubers and turnip roots were used to prepare purified mitochondria for laboratory practical work in the teaching of the citric acid cycle (TCA cycle). Plant mitochondria are particularly advantageous over the animal fractions to demonstrate the TCA cycle enzymatic steps, by using simple techniques to measure O(2) consumption and transmembrane potential (ΔΨ). The several TCA cycle intermediates induce specific enzyme activities, which can be identified by respiratory parameters. Such a strategy is also used to evidence properties of the TCA cycle enzymes: ADP stimulation of isocitrate dehydrogenase and α-ketoglutarate dehydrogenase; activation by citrate of downstream oxidation steps, e.g. succinate dehydrogenase; and regulation of the activity of isocitrate dehydrogenase by citrate action on the citrate/isocitrate carrier. Furthermore, it has been demonstrated that, in the absence of exogenous Mg(2+) , isocitrate-dependent respiration favors the alternative oxidase pathway, as judged by changes of the ADP/O elicited by the inhibitor n-propyl galate. These are some examples of assays related with TCA cycle intermediates we can use in laboratory courses. Copyright © 2005 International Union of Biochemistry and Molecular Biology, Inc.
Safoury, Omar Soliman; Zaki, Nagla Mohamed; El Nabarawy, Eman Ahmad; Farag, Eman Abas
2009-01-01
Background: Melasma is a symmetric progressive hyperpigmentation of the facial skin that occurs in all races but has a predilection for darker skin phenotypes. Depigmenting agents, laser and chemical peeling as classic Jessner's solution, modified Jessner's solution and trichloroacetic acid have been used alone and in combination in the treatment of melasma. Objectives: The aim of the study was to compare the therapeutic effect of combined 15% Trichloroacetic acid (TCA) and modified Jessner's solution with 15% TCA on melasma. Materials and Methods: Twenty married females with melasma (epidermal type), with a mean age of 38.25 years, were included in this study. All were of skin type III or IV. Fifteen percent TCA was applied to the whole face, with the exception of the left malar area to which combined TCA 15% and modified Jessner's solution was applied. Results: Our results revealed statistically highly significant difference between MASI Score (Melasma Area and Severity Index) between the right malar area and the left malar area. Conclusion: Modified Jessner's solution proved to be useful as an adjuvant treatment with TCA in the treatment of melasma, improving the results and minimizing postinflammatory hyperpigmentation. PMID:20049268
Go, Younghoon; Jeong, Ji Yun; Jeoung, Nam Ho; Jeon, Jae-Han; Park, Bo-Yoon; Kang, Hyeon-Ji; Ha, Chae-Myeong; Choi, Young-Keun; Lee, Sun Joo; Ham, Hye Jin; Kim, Byung-Gyu; Park, Keun-Gyu; Park, So Young; Lee, Chul-Ho; Choi, Cheol Soo; Park, Tae-Sik; Lee, W N Paul; Harris, Robert A; Lee, In-Kyu
2016-10-01
Hepatic steatosis is associated with increased insulin resistance and tricarboxylic acid (TCA) cycle flux, but decreased ketogenesis and pyruvate dehydrogenase complex (PDC) flux. This study examined whether hepatic PDC activation by inhibition of pyruvate dehydrogenase kinase 2 (PDK2) ameliorates these metabolic abnormalities. Wild-type mice fed a high-fat diet exhibited hepatic steatosis, insulin resistance, and increased levels of pyruvate, TCA cycle intermediates, and malonyl-CoA but reduced ketogenesis and PDC activity due to PDK2 induction. Hepatic PDC activation by PDK2 inhibition attenuated hepatic steatosis, improved hepatic insulin sensitivity, reduced hepatic glucose production, increased capacity for β-oxidation and ketogenesis, and decreased the capacity for lipogenesis. These results were attributed to altered enzymatic capacities and a reduction in TCA anaplerosis that limited the availability of oxaloacetate for the TCA cycle, which promoted ketogenesis. The current study reports that increasing hepatic PDC activity by inhibition of PDK2 ameliorates hepatic steatosis and insulin sensitivity by regulating TCA cycle anaplerosis and ketogenesis. The findings suggest PDK2 is a potential therapeutic target for nonalcoholic fatty liver disease. © 2016 by the American Diabetes Association.
Tricyclic antidepressants for management of residual symptoms in inflammatory bowel disease.
Iskandar, Heba N; Cassell, Benjamin; Kanuri, Navya; Gyawali, C Prakash; Gutierrez, Alexandra; Dassopoulos, Themistocles; Ciorba, Matthew A; Sayuk, Gregory S
2014-01-01
Tricyclic antidepressants (TCAs) have efficacy in treating irritable bowel syndrome (IBS). Some clinicians use TCAs to treat residual symptoms in inflammatory bowel disease (IBD) patients already on decisive IBD therapy or with quiescent inflammation, although this strategy has not been formally studied. The aim of this study was to examine the efficacy of TCA therapy in IBD patients with residual symptoms, despite controlled inflammation, in a retrospective cohort study. Inclusion required initiation of TCA for persistent gastrointestinal symptoms. IBD patients had inactive or mildly active disease with persistent symptoms despite adequate IBD therapy as determined by their physician. Symptom response was compared with IBS patients. Established Likert scales were used to score baseline symptom severity (0=no symptoms, 3=severe symptoms) and TCA response (0=no improvement; 3=complete satisfaction). Eighty-one IBD [41.3±1.7 y, 56F; 58 Crohn's disease/23 ulcerative colitis (UC)] and 77 IBS (46.2±1.7 y, 60F) patients were initiated on a TCA therapy. Baseline symptom scores (IBD, 2.06±0.03; IBS, 2.12±0.04; P=0.15) and symptom response to TCA therapy (IBD, 1.46±0.09; IBS, 1.30±0.09; P=0.2) were similar in both the groups. At least moderate improvement (Likert score ≥2) on TCA was achieved by comparable proportions of patients (59.3% IBD vs. 46% IBS; P=0.09). Within IBD, response was better with UC than Crohn's disease (1.86±0.13 vs. 1.26±0.11, respectively, P=0.003). In a clinical practice setting, TCA use led to moderate improvement of residual gastrointestinal symptoms in IBD patients for whom escalation of IBD therapy was not planned. UC patients demonstrated higher therapeutic success. IBD symptom responses were similar to IBS patients.
Zhai, Yi; Wang, Yan; Wang, Zhaoqi; Liu, Yongji; Zhang, Lin; He, Yuanqing; Chang, Shengjiang
2014-01-01
An achromatic element eliminating only longitudinal chromatic aberration (LCA) while maintaining transverse chromatic aberration (TCA) is established for the eye model, which involves the angle formed by the visual and optical axis. To investigate the impacts of higher-order aberrations on vision, the actual data of higher-order aberrations of human eyes with three typical levels are introduced into the eye model along visual axis. Moreover, three kinds of individual eye models are established to investigate the impacts of higher-order aberrations, chromatic aberration (LCA+TCA), LCA and TCA on vision under the photopic condition, respectively. Results show that for most human eyes, the impact of chromatic aberration on vision is much stronger than that of higher-order aberrations, and the impact of LCA in chromatic aberration dominates. The impact of TCA is approximately equal to that of normal level higher-order aberrations and it can be ignored when LCA exists.
Yu, Yongjun; Clippinger, Amy J.; Alwine, James C.
2011-01-01
Human cytomegalovirus (HCMV) infection causes dramatic alterations of intermediary metabolism, similar to those found in tumor cells. In infected cells, glucose carbon is not completely broken down by the tricarboxylic acid (TCA) cycle for energy; instead it is used biosynthetically. This process requires increased glucose uptake, increased glycolysis and the diversion of glucose carbon, in the form of citrate, from the TCA cycle for use in HCMV-induced fatty acid biosynthesis. The diversion of citrate from the TCA cycle (cataplerosis) requires induction of enzymes to promote glutaminolysis, the conversion of glutamine to -ketoglutarate in order to maintain the TCA cycle (anaplerosis) and ATP production. Such changes could result in heretofore uncharacterized pathogenesis, potentially implicating HCMV as a subtle co-factor in many maladies, including oncogenesis. Recognition of the effects of HCMV, and other viruses, on host cell metabolism will provide new understanding of viral pathogenesis and novel avenues for antiviral therapy. PMID:21570293
Asparagine plays a critical role in regulating cellular adaptation to glutamine depletion.
Zhang, Ji; Fan, Jing; Venneti, Sriram; Cross, Justin R; Takagi, Toshimitsu; Bhinder, Bhavneet; Djaballah, Hakim; Kanai, Masayuki; Cheng, Emily H; Judkins, Alexander R; Pawel, Bruce; Baggs, Julie; Cherry, Sara; Rabinowitz, Joshua D; Thompson, Craig B
2014-10-23
Many cancer cells consume large quantities of glutamine to maintain TCA cycle anaplerosis and support cell survival. It was therefore surprising when RNAi screening revealed that suppression of citrate synthase (CS), the first TCA cycle enzyme, prevented glutamine-withdrawal-induced apoptosis. CS suppression reduced TCA cycle activity and diverted oxaloacetate, the substrate of CS, into production of the nonessential amino acids aspartate and asparagine. We found that asparagine was necessary and sufficient to suppress glutamine-withdrawal-induced apoptosis without restoring the levels of other nonessential amino acids or TCA cycle intermediates. In complete medium, tumor cells exhibiting high rates of glutamine consumption underwent rapid apoptosis when glutamine-dependent asparagine synthesis was suppressed, and expression of asparagine synthetase was statistically correlated with poor prognosis in human tumors. Coupled with the success of L-asparaginase as a therapy for childhood leukemia, the data suggest that intracellular asparagine is a critical suppressor of apoptosis in many human tumors.
NASA Astrophysics Data System (ADS)
Rynders, Maurice; Lidkea, Bruce; Chisholm, William; Thibos, Larry N.
1995-10-01
Subjective transverse chromatic aberration (sTCA) manifest at the fovea was determined for a population of 85 young adults (19-38 years old) by means of a two-dimensional, two-color, vernier alignment technique. The statistical distribution of sTCA was well fitted by a bivariate Gaussian function with mean values that were not significantly different from zero in either the horizontal or the vertical direction. We conclude from this result that a hypothetical, average eye representing the population mean of human eyes with medium-sized pupils is free of foveal sTCA. However, the absolute magnitude of sTCA for any given individual was often significantly greater than zero and ranged from 0.05 to 2.67 arcmin for the red and the blue lights of a computer monitor (mean wavelengths, 605 and 497 nm, respectively). The statistical distribution of the absolute magnitude of sTCA was well described by a Rayleigh probability distribution with a mean of 0.8 arcmin. A simple device useful for population screening in a clinical setting was also tested and gave concordant results. Assuming that sTCA at the fovea is due to decentering of the pupil with respect to the visual axis, we infer from these results that the pupil is, on average, well centered in human eyes. The average magnitude of pupil decentration in individual eyes is less than 0.5 mm, which corresponds to psi =3 deg for the angle between the achromatic and the visual axes of the eye.
Functional laser speckle imaging of cerebral blood flow under hypothermia
NASA Astrophysics Data System (ADS)
Li, Minheng; Miao, Peng; Zhu, Yisheng; Tong, Shanbao
2011-08-01
Hypothermia can unintentionally occur in daily life, e.g., in cardiovascular surgery or applied as therapeutics in the neurosciences critical care unit. So far, the temperature-induced spatiotemporal responses of the neural function have not been fully understood. In this study, we investigated the functional change in cerebral blood flow (CBF), accompanied with neuronal activation, by laser speckle imaging (LSI) during hypothermia. Laser speckle images from Sprague-Dawley rats (n = 8, male) were acquired under normothermia (37°C) and moderate hypothermia (32°C). For each animal, 10 trials of electrical hindpaw stimulation were delivered under both temperatures. Using registered laser speckle contrast analysis and temporal clustering analysis (TCA), we found a delayed response peak and a prolonged response window under hypothermia. Hypothermia also decreased the activation area and the amplitude of the peak CBF. The combination of LSI and TCA is a high-resolution functional imaging method to investigate the spatiotemporal neurovascular coupling in both normal and pathological brain functions.
Williams, Alex H; Kim, Tony Hyun; Wang, Forea; Vyas, Saurabh; Ryu, Stephen I; Shenoy, Krishna V; Schnitzer, Mark; Kolda, Tamara G; Ganguli, Surya
2018-06-27
Perceptions, thoughts, and actions unfold over millisecond timescales, while learned behaviors can require many days to mature. While recent experimental advances enable large-scale and long-term neural recordings with high temporal fidelity, it remains a formidable challenge to extract unbiased and interpretable descriptions of how rapid single-trial circuit dynamics change slowly over many trials to mediate learning. We demonstrate a simple tensor component analysis (TCA) can meet this challenge by extracting three interconnected, low-dimensional descriptions of neural data: neuron factors, reflecting cell assemblies; temporal factors, reflecting rapid circuit dynamics mediating perceptions, thoughts, and actions within each trial; and trial factors, describing both long-term learning and trial-to-trial changes in cognitive state. We demonstrate the broad applicability of TCA by revealing insights into diverse datasets derived from artificial neural networks, large-scale calcium imaging of rodent prefrontal cortex during maze navigation, and multielectrode recordings of macaque motor cortex during brain machine interface learning. Copyright © 2018 Elsevier Inc. All rights reserved.
Weger, H G; Birch, D G; Elrifi, I R; Turpin, D H
1988-03-01
Mass spectrometric analysis of O(2) and CO(2) exchange in the green alga Selenastrum minutum (Naeg. Collins) provides evidence for the occurrence of mitochondrial respiration in light. Stimulation of amino acid synthesis by the addition of NH(4)Cl resulted in nearly a 250% increase in the rate of TCA cycle CO(2) efflux in both light and dark. Ammonium addition caused a similar increase in cyanide sensitive O(2) consumption in both light and dark. Anaerobiosis inhibited the CO(2) release caused by NH(4)Cl. These results indicated that the cytochrome pathway of the mitochondrial electron transport chain was operative and responsible for the oxidation of a large portion of the NADH generated during the ammonium induced increase in TCA cycle activity. In the presence of DCMU, ammonium addition also stimulated net O(2) consumption in the light. This implied that the Mehler reaction did not play a significant role in O(2) consumption under our conditions. These results show that both the TCA cycle and the mitochondrial electron transport chain are capable of operation in the light and that an important role of mitochondrial respiration in photosynthesizing cells is the provision of carbon skeletons for biosynthetic reactions.
Glycation inhibits trichloroacetic acid (TCA)-induced whey protein precipitation
USDA-ARS?s Scientific Manuscript database
Four different WPI saccharide conjugates were successfully prepared to test whether glycation could inhibit WPI precipitation induced by trichloroacetic acid (TCA). Conjugates molecular weights after glycation were analyzed with SDS-PAGE. No significant secondary structure change due to glycation wa...
IRIS Toxicological Review of Trichloroacetic Acid (TCA) (External Review Draft)
EPA is conducting a peer review and public comment of the scientific basis supporting the human health hazard and dose-response assessment of Trichloroacetic acid (TCA) that when finalized will appear on the Integrated Risk Information System (IRIS) database.
Design of an AdvancedTCA board management controller (IPMC)
NASA Astrophysics Data System (ADS)
Mendez, J.; Bobillier, V.; Haas, S.; Joos, M.; Mico, S.; Vasey, F.
2017-03-01
The AdvancedTCA (ATCA) standard has been selected as the hardware platform for the upgrade of the back-end electronics of the CMS and ATLAS experiments of the Large Hadron Collider (LHC) . In this context, the electronic systems for experiments group at CERN is running a project to evaluate, specify, design and support xTCA equipment. As part of this project, an Intelligent Platform Management Controller (IPMC) for ATCA blades, based on a commercial solution, has been designed to be used on existing and future ATCA blades. This paper reports on the status of this project presenting the hardware and software developments.
Liu, Huawei; Li, Zhiyong; Wang, Chao; Feng, Lin; Huang, Haitao; Liu, Changkui; Li, Fengxia
2016-01-01
As a long noncoding RNA, HOX transcript antisense intergenic RNA (HOTAIR) is highly expressed in many types of tumors. However, its expression and function in oral squamous cell carcinoma (OSCC) cells and tissues remains largely unknown. We herein studied the biological functions of HOTAIR in OSCC Tca8113 cells. Real-time quantitative PCR showed that HOTAIR, p21 and p53 mRNA expressions in doxorubicin (DOX)-treated or γ-ray-irradiated Tca8113 cells were up-regulated. Knockdown of p53 expression inhibited DOX-induced HOTAIR up-regulation, suggesting that DNA damage-induced HOTAIR expression may be associated with p53. Transfection and CCK-8 assays showed that compared with the control group, overexpression of HOTAIR promoted the proliferation of Tca8113 cells, while interfering with its expression played an opposite role. Flow cytometry exhibited that HOTAIR overexpression decreased the rate of DOX-induced apoptosis. When HOTAIR expression was inhibited by siRNA, the proportions of cells in G2/M and S phases increased and decreased respectively. Meanwhile, the rate of DOX-induced apoptosis rose. DNA damage-induced HOTAIR expression facilitated the proliferation of Tca8113 cells and decreased their apoptosis. However, whether the up-regulation depends on p53 still needs in-depth studies. PMID:27904675
Meringer, Markus; Cleaves, H James
2017-12-13
The reverse tricarboxylic acid (rTCA) cycle has been explored from various standpoints as an idealized primordial metabolic cycle. Its simplicity and apparent ubiquity in diverse organisms across the tree of life have been used to argue for its antiquity and its optimality. In 2000 it was proposed that chemoinformatics approaches support some of these views. Specifically, defined queries of the Beilstein database showed that the molecules of the rTCA are heavily represented in such compound databases. We explore here the chemical structure "space," e.g. the set of organic compounds which possesses some minimal set of defining characteristics, of the rTCA cycle's intermediates using an exhaustive structure generation method. The rTCA's chemical space as defined by the original criteria and explored by our method is some six to seven times larger than originally considered. Acknowledging that each assumption in what is a defining criterion making the rTCA cycle special limits possible generative outcomes, there are many unrealized compounds which fulfill these criteria. That these compounds are unrealized could be due to evolutionary frozen accidents or optimization, though this optimization may also be for systems-level reasons, e.g., the way the pathway and its elements interface with other aspects of metabolism.
Luo, Congwei; Jiang, Jin; Ma, Jun; Pang, Suyan; Liu, Yongze; Song, Yang; Guan, Chaoting; Li, Juan; Jin, Yixin; Wu, Daoji
2016-06-01
The transformation efficiency and products of an odorous compound 2,4,6-trichloroanisole (TCA) at the wavelength of 254 nm in the presence of persulfate were investigated for the first time. The effects of water matrix (i.e., natural organic matter (NOM), pH, carbonate/bicarbonate (HCO3(-)/CO3(2-)), and chloride ions (Cl(-))) were evaluated. The second order rate constant of TCA reacting with sulfate radical (SO4(-)) was determined to be (3.72 ± 0.10) × 10(9) M(-1) s(-1). Increasing dosage of persulfate increased the observed pseudo-first-order rate constant for TCA degradation (kobs), and the contribution of SO4(-) to TCA degradation was much higher than that of HO at each experimental condition. Degradation rate of TCA decreased with pH increasing from 4.0 to 9.0, which could be explained by the lower radical scavenging effect of dihydrogen phosphate than hydrogen phosphate in acidic condition (pH < 6). NOM significantly decreased kobs due to the effects of radical scavenging and UV absorption with the former one being dominant. kobs decreased from 2.32 × 10(-3) s(-1) to 0.92 × 10(-3) s(-1) with the CO3(2-)/HCO3(-) concentration increased from 0.5 mM to 10 mM in the UV/persulfate process, while kobs slightly decreased from 2.54 × 10(-3) s(-1) in the absence of Cl(-) to 2.10 × 10(-3) s(-1) in the presence of 10 mM Cl(-). Most of these kinetic results could be described by a steady-state kinetic model. Furthermore, liquid chromatography/electrospray ionization-triple quadrupole mass spectrometry at powerful precursor ion scan approach was used to selectively detect oxidation products of TCA. It was found that 2,4,6-trichorophenol (TCP) was the major oxidation product (i.e., the initial yield of TCP was above 90%). The second order rate constant between TCP and SO4(-) was estimated to be (4.16 ± 0.20) × 10(9) M(-1) s(-1). In addition, three products (i.e., 2,6-dichloro-1,4-benzoquinone and two aromatic ring-opening products) were detected in the reaction of TCP with SO4(-), which also appeared in the oxidation of TCA in the UV/persulfate process. A tentative pathway was proposed, where the initial one-electron oxidation of TCA by SO4(-) and further reactions (e.g., ipso-hydroxylation and aromatic ring-cleavage) of the formed cation intermediate TCA were involved. Copyright © 2016. Published by Elsevier Ltd.
Zar-Kessler, Claire A M; Belkind-Gerson, Jaime; Bender, Suzanne; Kuo, Braden M
2017-07-01
Pediatric functional abdominal pain is often treated with tricyclic antidepressants (TCAs) and selective serotonin reuptake inhibitors (SSRIs). The aim is investigating antidepressant use for treatment efficacy, correlation of response to psychiatric factors, and impact of adverse effects in regard to physicians' prescribing patterns. Retrospective review (2005-2013) children (5-21 years old) with functional abdominal pain treated with SSRI or TCA. Of the 531 cases with functional abdominal pain, 192 initiated SSRIs or TCAs while followed by gastroenterology. Charts reviewed for symptoms, adverse effects, and response: decreased pain or increased daily functioning. Sixty-three of 84 (75%) SSRI patients improved, 56 of 92 (61%) TCA patients improved (P = 0.03). Logistic regression controlling for psychiatric factors: SSRI remained significant over TCA (P = 0.04). Thirty-two of 67 (48%) patients with constipation received TCAs and 26 of 45 (58%) patients with diarrhea received SSRIs (P = 0.64). Three SSRI patients reported gastrointestinal effects, all diarrheal-type symptoms, and 2 TCA patients reported gastrointestinal effects, both constipation, in all it led to discontinuation. Thirteen (29%) of diarrheal-type patients reported adverse effects causing discontinuation as compared to 7 (8%) in the constipation group (P = .01). Twenty-one (25%) SSRI patients reported adverse effects with 5 (6%) mood disturbances. Twenty (22%) TCA patients reported adverse effects, 13 (14%) with mood disturbances (P = .07). Overall, 12 (14%) SSRI patients discontinued medication due to adverse effects, whereas 16 (17%) TCA patients (P = 0.24) did. Patients had significantly greater response to SSRIs than TCAs, remaining significant after controlling for psychiatric factors. Little significance is given to patient's associated gastrointestinal symptoms, frequently resulting in adverse effects and termination of medication.
Woolf, Alan D; Erdman, Andrew R; Nelson, Lewis S; Caravati, E Martin; Cobaugh, Daniel J; Booze, Lisa L; Wax, Paul M; Manoguerra, Anthony S; Scharman, Elizabeth J; Olson, Kent R; Chyka, Peter A; Christianson, Gwenn; Troutman, William G
2007-01-01
A review of U.S. poison center data for 2004 showed over 12,000 exposures to tricyclic antidepressants (TCAs). A guideline that determines the conditions for emergency department referral and prehospital care could potentially optimize patient outcome, avoid unnecessary emergency department visits, reduce healthcare costs, and reduce life disruption for patients and caregivers. An evidence-based expert consensus process was used to create the guideline. Relevant articles were abstracted by a trained physician researcher. The first draft of the guideline was created by the lead author. The entire panel discussed and refined the guideline before distribution to secondary reviewers for comment. The panel then made changes based on the secondary review comments. The objective of this guideline is to assist poison center personnel in the appropriate prehospital triage and management of patients with suspected ingestions of TCAs by 1) describing the manner in which an ingestion of a TCA might be managed, 2) identifying the key decision elements in managing cases of TCA ingestion, 3) providing clear and practical recommendations that reflect the current state of knowledge, and 4) identifying needs for research. This guideline applies to ingestion of TCAs alone. Co-ingestion of additional substances could require different referral and management recommendations depending on their combined toxicities. This guideline is based on the assessment of current scientific and clinical information. The panel recognizes that specific patient care decisions may be at variance with this guideline and are the prerogative of the patient and the health professionals providing care, considering all the circumstances involved. This guideline does not substitute for clinical judgment. Recommendations are in chronological order of likely clinical use. The grade of recommendation is in parentheses. 1) Patients with suspected self-harm or who are the victims of malicious administration of a TCA should be referred to an emergency department immediately (Grade D). 2) Patients with acute TCA ingestions who are less than 6 years of age and other patients without evidence of self-harm should have further evaluation including standard history taking and determination of the presence of co-ingestants (especially other psychopharmaceutical agents) and underlying exacerbating conditions, such as convulsions or cardiac arrhythmias. Ingestion of a TCA in combination with other drugs might warrant referral to an emergency department. The ingestion of a TCA by a patient with significant underlying cardiovascular or neurological disease should cause referral to an emergency department at a lower dose than for other individuals. Because of the potential severity of TCA poisoning, transportation by EMS, with close monitoring of clinical status and vital signs en route, should be considered (Grade D). 3) Patients who are symptomatic (e.g., weak, drowsy, dizzy, tremulous, palpitations) after a TCA ingestion should be referred to an emergency department (Grade B). 4) Ingestion of either of the following amounts (whichever is lower) would warrant consideration of referral to an emergency department: an amount that exceeds the usual maximum single therapeutic dose or an amount equal to or greater than the lowest reported toxic dose. For all TCAs except desipramine, nortriptyline, trimipramine, and protriptyline, this dose is >5 mg/kg. For despiramine it is >2.5 mg/kg; for nortriptyline it is >2.5 mg/kg; for trimipramine it is >2.5 mg/kg; and for protriptyline it is >1 mg/kg. This recommendation applies to both patients who are naïve to the specific TCA and to patients currently taking cyclic antidepressants who take extra doses, in which case the extra doses should be added to the daily dose taken and then compared to the threshold dose for referral to an emergency department (Grades B/C). 5) Do not induce emesis (Grade D). 6) The risk-to-benefit ratio of prehospital activated charcoal for gastrointestinal decontamination in TCA poisoning is unknown. Prehospital activated charcoal administration, if available, should only be carried out by health professionals and only if no contraindications are present. Do not delay transportation in order to administer activated charcoal (Grades B/D). 7) For unintentional poisonings, asymptomatic patients are unlikely to develop symptoms if the interval between the ingestion and the initial call to a poison center is greater than 6 hours. These patients do not need referral to an emergency department facility (Grade C). 8) Follow-up calls to determine the outcome for a TCA ingestions ideally should be made within 4 hours of the initial call to a poison center and then at appropriate intervals thereafter based on the clinical judgment of the poison center staff (Grade D). 9) An ECG or rhythm strip, if available, should be checked during the prehospital assessment of a TCA overdose patient. A wide-complex arrhythmia with a QRS duration longer than 100 msec is an indicator that the patient should be immediately stabilized, given sodium bicarbonate if there is a protocol for its use, and transported to an emergency department (Grade B). 10) Symptomatic patients with TCA poisoning might require prehospital interventions, such as intravenous fluids, cardiovascular agents, and respiratory support, in accordance with standard ACLS guidelines (Grade D). 11) Administration of sodium bicarbonate might be beneficial for patients with severe or life-threatening TCA toxicity if there is a prehospital protocol for its use (Grades B/D). 12) For TCA-associated convulsions, benzodiazepines are recommended (Grade D). 13) Flumazenil is not recommended for patients with TCA poisoning (Grade D).
GENOTOXICITY STUDIES OF SODIUM DICHLOROACETATE AND SODIUM TRICHLOROACETATE
The genotoxic properties of sodium dichloroacetate (DCA) and sodium trichloroacetate (TCA)were evaluated in several short-term in vitro and in vivo assays. Neither compound was mutagenic in tester strain TA102 in the Salmonella mutagenicity assay. Both DCA and TCA were weak induc...
Infrared thermal imaging of the inner canthus of the eye as an estimator of body core temperature.
Teunissen, L P J; Daanen, H A M
2011-01-01
Several studies suggest that the temperature of the inner canthus of the eye (T(ca)), determined with infrared thermal imaging, is an appropriate method for core temperature estimation in mass screening of fever. However, these studies used the error prone tympanic temperature as a reference. Therefore, we compared T(ca) to oesophageal temperature (T(es)) as gold standard in 10 subjects during four conditions: rest, exercise, recovery and passive heating. T(ca) and T(es) differed significantly during all conditions (mean ΔT(es) - T(ca) 1.80 ± 0.89°C) and their relationship was inconsistent between conditions. Also within the rest condition alone, intersubject variability was too large for a reliable estimation of core temperature. This poses doubts on the use of T(ca) as a technique for core temperature estimation, although generalization of these results to fever detection should be verified experimentally using febrile patients.
Age estimation using tooth cementum annulation.
Wittwer-Backofen, Ursula
2012-01-01
In Forensic Anthropology age diagnosis of unidentified bodies significantly helps in the identification process. Among the set of established aging methods in anthropology tooth cementum annulation (TCA) is increasingly used due to its narrow error range which can reach 5 years of age in adult individuals at best. The rhythm of cementum appositions of seasonally different density provides a principal mechanism on which TCA is based. Using histological preparation techniques for hard tissues, transversal tooth root sections are produced which can be analyzed in transmitted light microscopy. Even though no standard TCA preparation protocol exists, several methodological validation studies recommend specific treatments depending on individual conditions of the teeth. Individual age is estimated by adding mean tooth eruption age to the number of microscopically detected dark layers which are separated by bright layers and stand for 1 year of age each. To assure a high reliability of the method, TCA age diagnosis has to be based on several teeth of one individual if possible and needs to be supported by different techniques in forensic cases.
Variations in iron and calcium abundances during solar flares
NASA Astrophysics Data System (ADS)
Antonucci, E.; Martin, R.
1995-07-01
Evidence for variations in iron and calcium abundances during the impulsive phase of solar flares has been obtained by analyzing the Ca XIX and Fe XXV spectra, detected with the Bent Crystal Spectrometer of the Solar Maximum Mission. The plasma thermal conditions have been investigated by considering different temperature indicators: namely, the temperatures TCa and TFe, derived from the intensity ratios of the dielectronic recombination satellites to the resonance line, and the temperature TCaFe, calculated from the ratio of the resonance lines of Ca XIX and Fe XXV, which is also depending on the Fe/Ca abundance ratio. The observed values of TCa and TFe can be ascribed to the specific characteristics of the plasma therma distribution, the corresponding values of TCaFe can be explained by allowing also for variations in the Fe/Ca abundance ratio relative to the photospheric ratio by a factor within 0.2 and 2.4. According to the observed abundance variations, the events analyzed can be divided in Ca-rich and Fe-rich flares.
Influence of chemical peeling on the skin stress response system.
Kimura, Ayako; Kanazawa, Nobuo; Li, Hong-Jin; Yonei, Nozomi; Yamamoto, Yuki; Furukawa, Fukumi
2012-07-01
Skin stress response system (SSRS) involves corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC)-derived peptides, such as adrenocorticotropic hormone (ACTH), a-melanocyte-stimulating hormone (MSH) and b-endorphin that are locally generated in response to locally provided stressors or proinflammatory cytokines. This system would restrict tissue damage and restore local homoeostasis. Trichloroacetic acid (TCA) is one of the most widely used peeling agents and applied for cosmetic treatment of photodamaged skin. However, the biological mechanism responsible for TCA peeling has yet to be fully determined. While our investigation focused on the inflammation and wound healing pathways, in the recent study, we have examined involvement of the SSRS as the third pathway. Mostly depending on our findings that TCA peeling activates the SSRS by inducing the POMC expression of keratinocytes in the CRH-independent manner, together with the results reported by other researchers, we can say that the biological effect of POMC seems to be responsible for the TCA-induced epidermal SSRS activation. © 2012 John Wiley & Sons A/S.
Lock, Edward A; Reed, Celia J; McMillan, JoEllyn M; Oatis, John R; Schnellmann, Rick G
2007-01-01
The industrial solvent trichloroethylene (TCE) and its major metabolites have been shown to cause formic aciduria in male rats. We have examined whether chloral hydrate (CH) and trichloroacetic acid (TCA), known metabolites of TCE, produce an increase in formic acid in vitro in cultures of rat hepatocytes or human renal proximal tubule cells (HRPTC). The metabolism and cytotoxicity of CH was also examined to establish that the cells were metabolically active and not compromised by toxicity. Rat hepatocytes and HRPTC were cultured in serum-free medium and then treated with 0.3–3mM CH for 3 days or 0.03–3mM CH for 10 days respectively and formic acid production, metabolism to trichloroethanol (TCE-OH) and TCA and cytotoxicity determined. No increase in formic acid production in rat hepatocytes or HRPTC exposed to CH was observed over and above that due to chemical degradation, neither was formic acid production observed in rat hepatocytes exposed to TCA. HRPTC metabolised CH to TCE-OH and TCA with a 12-fold greater capacity to form TCE-OH versus TCA. Rat hepatocytes exhibited a 1.6-fold and 3-fold greater capacity than HRPTC to form TCE-OH and TCA respectively. CH and TCA were not cytotoxic to rat hepatocytes at concentrations up to 3mM/day for 3 days. With HRPTC, one sample showed no cytotoxicity to CH at concentrations up to 3mM/day for 10 days, while in another cytotoxicity was seen at 1mM/day for 3 days. In summary, increased formic acid production was not observed in rat hepatocytes or HRPTC exposed to TCE metabolites, suggesting that the in vivo response cannot be modelled in vitro. CH was toxic to HRPTC at millimolar concentrations/day over 10 days, while glutathione derived metabolites of TCE were toxic at micromolar concentrations/day over 10 days (Lock et al., 2006) supporting the view that glutathione derived metabolites are likely to be responsible for nephrotoxicity. PMID:17161896
Yoo, Hong Sik; Cichocki, Joseph A.; Kim, Sungkyoon; Venkatratnam, Abhishek; Iwata, Yasuhiro; Kosyk, Oksana; Bodnar, Wanda; Sweet, Stephen; Knap, Anthony; Wade, Terry; Campbell, Jerry; Clewell, Harvey J.; Melnyk, Stepan B.; Chiu, Weihsueh A.; Rusyn, Ivan
2015-01-01
Exposure to the ubiquitous environmental contaminant trichloroethylene (TCE) is associated with cancer and non-cancer toxicity in both humans and rodents. Peroxisome proliferator-activated receptor-alpha (PPARα) is thought to be playing a role in liver toxicity in rodents through activation of the receptor by the TCE metabolite trichloroacetic acid (TCA). However, most studies using genetically altered mice have not assessed the potential for PPARα to alter TCE toxicokinetics, which may lead to differences in TCA internal doses and hence confound inferences as to the role of PPARα in TCE toxicity. To address this gap, male and female wild type (129S1/SvImJ), Pparα-null, and humanized PPARα (hPPARα) mice were exposed intragastrically to 400 mg/kg TCE in single-dose (2, 5 and 12 h) and repeat-dose (5 days/week, 4 weeks) studies. Interestingly, following either a single- or repeat-dose exposure to TCE, levels of TCA in liver and kidney were lower in Pparα-null and hPPARα mice as compared with those in wild type mice. Levels of trichloroethanol (TCOH) were similar in all strains. TCE-exposed male mice consistently had higher levels of TCA and TCOH in all tissues compared with females. Additionally, in both single- and repeat-dose studies, a similar degree of induction of PPARα-responsive genes was observed in liver and kidney of hPPARα and wild type mice, despite the difference in hepatic and renal TCA levels. Additional sex- and strain-dependent effects were observed in the liver, including hepatocyte proliferation and oxidative stress, which were not dependent on TCA or TCOH levels. These data demonstrate that PPARα status affects the levels of the putative PPARα agonist TCA following TCE exposure. Therefore, interpretations of studies using Pparα-null and hPPARα mice need to consider the potential contribution of genotype-dependent toxicokinetics to observed differences in toxicity, rather than attributing such differences only to receptor-mediated toxicodynamic effects. PMID:26136231
Yoo, Hong Sik; Cichocki, Joseph A; Kim, Sungkyoon; Venkatratnam, Abhishek; Iwata, Yasuhiro; Kosyk, Oksana; Bodnar, Wanda; Sweet, Stephen; Knap, Anthony; Wade, Terry; Campbell, Jerry; Clewell, Harvey J; Melnyk, Stepan B; Chiu, Weihsueh A; Rusyn, Ivan
2015-10-01
Exposure to the ubiquitous environmental contaminant trichloroethylene (TCE) is associated with cancer and non-cancer toxicity in both humans and rodents. Peroxisome proliferator-activated receptor-alpha (PPARα) is thought to be playing a role in liver toxicity in rodents through activation of the receptor by the TCE metabolite trichloroacetic acid (TCA). However, most studies using genetically altered mice have not assessed the potential for PPARα to alter TCE toxicokinetics, which may lead to differences in TCA internal doses and hence confound inferences as to the role of PPARα in TCE toxicity. To address this gap, male and female wild type (129S1/SvImJ), Pparα-null, and humanized PPARα (hPPARα) mice were exposed intragastrically to 400 mg/kg TCE in single-dose (2, 5 and 12 h) and repeat-dose (5 days/week, 4 weeks) studies. Interestingly, following either a single- or repeat-dose exposure to TCE, levels of TCA in liver and kidney were lower in Pparα-null and hPPARα mice as compared with those in wild type mice. Levels of trichloroethanol (TCOH) were similar in all strains. TCE-exposed male mice consistently had higher levels of TCA and TCOH in all tissues compared with females. Additionally, in both single- and repeat-dose studies, a similar degree of induction of PPARα-responsive genes was observed in liver and kidney of hPPARα and wild type mice, despite the difference in hepatic and renal TCA levels. Additional sex- and strain-dependent effects were observed in the liver, including hepatocyte proliferation and oxidative stress, which were not dependent on TCA or TCOH levels. These data demonstrate that PPARα status affects the levels of the putative PPARα agonist TCA following TCE exposure. Therefore, interpretations of studies using Pparα-null and hPPARα mice need to consider the potential contribution of genotype-dependent toxicokinetics to observed differences in toxicity, rather than attributing such differences only to receptor-mediated toxicodynamic effects. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Yildirim, Selda; Gurel, Mehmet Salih; Gungor, Sule; Tekeli, Omur; Canat, Dilek
2016-06-01
Skin aging is a problem which negatively affects the psyche of the person, social relations, as well as work life and health and which compels the patients to find appropriate treatment methods. Numerous treatment methods have been developed in order to delay aging and to reduce the aging effects in addition to having a younger, healthier and more beautiful facial appearance. To compare the efficiency, cosmetic results and possible adverse effects of the peeling treatment with 25% trichloroacetic acid (TCA) and 0.1% retinoic acid for facial rejuvenation in patients presenting with skin aging. Fifty female patients in total presenting with medium and advanced degree skin aging were subject to this study. Two separate treatment groups were formed; the first group underwent chemical skin treatment with 25% TCA while the other group was applied with 0.1% retinoic acid treatment. Following the 4 months' treatment the patients were controlled three times in total for post lesional hypopigmentation, hyperpigmentation, scars, skin irritation and other possible changes per month. The pretreatment and first follow-up visit, and final control images were comparatively evaluated by three observers via specific software. The healing rates of the group subject to retinoic acid were statistically higher (p < 0.05) compared to patients in the TCA group in the final follow-up visit following the treatment according to the first and second observers. On the other hand, according to the third observer, patients applied with retinoic acid presented with higher healing rates compared to those treated with TCA, however; this rate was not statistically significant (p > 0.05). The frequency of TCA- and retinoic acid-associated adverse effects was similar in both groups (p > 0.05). As a result of both treatments, a reduction in the quality of life scores as well as a pronounced recovery (p = 0.001) in the quality of life of those patients with skin aging was observed. The photo aging treatment option with 0.1% retinoic acid is cheaper and more feasible for patients compared to 25% TCA, and it is also as reliable and effective as TCA.
Gurel, Mehmet Salih; Gungor, Sule; Tekeli, Omur; Canat, Dilek
2016-01-01
Introduction Skin aging is a problem which negatively affects the psyche of the person, social relations, as well as work life and health and which compels the patients to find appropriate treatment methods. Numerous treatment methods have been developed in order to delay aging and to reduce the aging effects in addition to having a younger, healthier and more beautiful facial appearance. Aim To compare the efficiency, cosmetic results and possible adverse effects of the peeling treatment with 25% trichloroacetic acid (TCA) and 0.1% retinoic acid for facial rejuvenation in patients presenting with skin aging. Material and methods Fifty female patients in total presenting with medium and advanced degree skin aging were subject to this study. Two separate treatment groups were formed; the first group underwent chemical skin treatment with 25% TCA while the other group was applied with 0.1% retinoic acid treatment. Following the 4 months’ treatment the patients were controlled three times in total for post lesional hypopigmentation, hyperpigmentation, scars, skin irritation and other possible changes per month. The pretreatment and first follow-up visit, and final control images were comparatively evaluated by three observers via specific software. Results The healing rates of the group subject to retinoic acid were statistically higher (p < 0.05) compared to patients in the TCA group in the final follow-up visit following the treatment according to the first and second observers. On the other hand, according to the third observer, patients applied with retinoic acid presented with higher healing rates compared to those treated with TCA, however; this rate was not statistically significant (p > 0.05). The frequency of TCA- and retinoic acid-associated adverse effects was similar in both groups (p > 0.05). As a result of both treatments, a reduction in the quality of life scores as well as a pronounced recovery (p = 0.001) in the quality of life of those patients with skin aging was observed. Conclusions The photo aging treatment option with 0.1% retinoic acid is cheaper and more feasible for patients compared to 25% TCA, and it is also as reliable and effective as TCA. PMID:27512355
Álvarez-Rodríguez, María Luisa; López-Ocaña, Laura; López-Coronado, José Miguel; Rodríguez, Enrique; Martínez, María Jesús; Larriba, Germán; Coque, Juan-José R.
2002-01-01
Cork taint is a musty or moldy off-odor in wine mainly caused by 2,4,6-trichloroanisole (2,4,6-TCA). We examined the role of 14 fungal strains isolated from cork samples in the production of 2,4,6-TCA by O methylation of 2,4,6-trichlorophenol (2,4,6-TCP). The fungal strains isolated belong to the genera Penicillium (four isolates); Trichoderma (two isolates); and Acremonium, Chrysonilia, Cladosporium, Fusarium, Mortierella, Mucor, Paecilomyces, and Verticillium (one isolate each). Eleven of these strains could produce 2,4,6-TCA when they were grown directly on cork in the presence of 2,4,6-TCP. The highest levels of bioconversion were carried out by the Trichoderma and Fusarium strains. One strain of Trichoderma longibrachiatum could also efficiently produce 2,4,6-TCA in liquid medium. However, no detectable levels of 2,4,6-TCA production by this strain could be detected on cork when putative precursors other than 2,4,6-TCP, including several anisoles, dichlorophenols, trichlorophenols, or other highly chlorinated compounds, were tested. Time course expression studies with liquid cultures showed that the formation of 2,4,6-TCA was not affected by a high concentration of glucose (2% or 111 mM) or by ammonium salts at concentrations up to 60 mM. In T. longibrachiatum the O methylation of 2,4,6-TCP was catalyzed by a mycelium-associated S-adenosyl-l-methionine (SAM)-dependent methyltransferase that was strongly induced by 2,4,6-TCP. The reaction was inhibited by S-adenosyl-l-homocysteine, an inhibitor of SAM-dependent methylation, suggesting that SAM is the natural methyl donor. These findings increase our understanding of the mechanism underlying the origin of 2,4,6-TCA on cork, which is poorly understood despite its great economic importance for the wine industry, and they could also help us improve our knowledge about the biodegradation and detoxification processes associated with chlorinated phenols. PMID:12450804
2007-11-01
CCA CAG TGC CCC AGG TTA GAA CGG TCA GCA GAA TAG-2a 62 528 AGC GGC GGG CTG AAG GA GAG GGT AGG GTG GTC ATT GTG TCA TAG-2b 62 401 AGC GGC GGG CTG AAG...GGT AGG GTG GTC ATT GTG TCA TAG-2b 62 401 AGC GGC GGG CTG AAG GAC TC CAG CAC AAC AGG AAC ATT CAG TGG TAB-2c 62 536 AGC GGC GGG CTG AAG GA GGG GGA TTT...Makrigiannakis A, Gray H, Schlienger K, Liebman MN, Rubin SC, Coukos G (2003) Intratumoral T cells, recurrence, and survival in epithelial ovarian
IRIS Toxicological Review of Trichloroacetic Acid (TCA) (Interagency Science Discussion Draft)
EPA is releasing the draft report, Toxicological Review of Trichloroacetic Acid (TCA), that was distributed to Federal agencies and White House Offices for comment during the Science Discussion step of the IRIS Assessment Development ...
Apostolou, Theofylaktos; Pascual, Nuria; Marco, M-Pilar; Moschos, Anastassios; Petropoulos, Anastassios; Kaltsas, Grigoris; Kintzios, Spyridon
2014-07-01
2,4,6-trichloroanisole (TCA), the cork taint molecule, has been the target of several analytical approaches over the few past years. In spite of the development of highly efficient and sensitive tools for its detection, ranging from advanced chromatography to biosensor-based techniques, a practical breakthrough for routine cork screening purposes has not yet been realized, in part due to the requirement of a lengthy extraction of TCA in organic solvents, mostly 12% ethanol and the high detectability required. In the present report, we present a modification of a previously reported biosensor system based on the measurement of the electric response of cultured fibroblast cells membrane-engineered with the pAb78 TCA-specific antibody. Samples were prepared by macerating cork tissue and mixing it directly with the cellular biorecognition elements, without any intervening extraction process. By using this novel approach, we were able to detect TCA in just five minutes at extremely low concentrations (down to 0.2 ppt). The novel biosensor offers a number of practical benefits, including a very considerable reduction in the total assay time by one day, and a full portability, enabling its direct employment for on-site, high throughput screening of cork in the field and production facilities, without requiring any type of supporting infrastructure. Copyright © 2014 Elsevier B.V. All rights reserved.
Hu, D; Luo, W; Fan, L F; Liu, F L; Gu, J; Deng, H M; Zhang, C; Huang, L H; Feng, Q L
2016-04-01
Significant changes usually take place in the internal metabolism of insects during metamorphosis. The glycolysis-tricarboxylic acid (glycolysis-TCA) pathway is important for energy metabolism. To elucidate its dynamics, the mRNA levels of genes involved in this pathway were examined in the midgut of Spodoptera litura during metamorphosis, and the pyruvate content was quantified. The expression patterns of these genes in response to starvation were examined, and the interaction between protein phosphatase 1 (PP1) and phosphofructokinase (PFK) was studied. The results revealed that the expression or activities of most glycolytic enzymes was down-regulated in prepupae and then recovered in some degree in pupae, and all TCA-related genes were remarkably suppressed in both the prepupae and pupae. Pyruvate was enriched in the pupal midgut. Taken together, these results suggest that insects decrease both glycolysis and TCA in prepupae to save energy and then up-regulate glycolysis but down-regulate TCA in pupae to increase the supply of intermediates for construction of new organs. The expression of all these genes were down-regulated by starvation, indicating that non-feeding during metamorphosis may be a regulator of glycolysis-TCA pathway in the midgut. Importantly, interaction between PP1 and PFK was identified and is suggested to be involved in the regulation of glycolysis. © 2015 The Royal Entomological Society.
Dalpizzol, Mariana; Weber, Magda B; Mattiazzi, Anna Paula F; Manzoni, Ana Paula D
2016-03-01
Many therapies involving varying degrees of complexity have been used to treat acne scars, but none is considered the gold standard treatment. A comparative evaluation of 88% phenol and 90% trichloroacetic acid (TCA) applied using the chemical reconstruction of skin scars (CROSS) technique. A nonrandomized, single-blinded self-controlled clinical trial was conducted among patients with ice pick-type and boxcar-type atrophic acne scars. Using 88% phenol on the left hemiface and 90% TCA on the right hemiface was adopted as the standard practice of the CROSS technique. The dermatological quality of life index (DLQI) questionnaire, acne scar grading scale Échelle d´Evaluation Clinique des Cicatrices d'Acne (ECCA), and evaluation of improvement were performed pretreatment and post-treatment. Regarding ECCA, significant differences were found in pretreatment and post-treatment (p < .001). Regarding tolerance to pain, it was found that the discomfort felt with 90% TCA was significantly less than that felt with 88% phenol (p = .020). Regarding the quality of life measured with the DLQI, the results showed that the mean score in post-treatment assessment was significantly lower than that in the pretreatment assessment (p < .05). Hypochromia and enlargement scar were only seen after the use of 90% TCA. This study confirmed the efficacy of both TCA and phenol for treating such scars, with less severe complications from the use of phenol.
Characterization of HgCdTe and Related Materials For Third Generation Infrared Detectors
NASA Astrophysics Data System (ADS)
Vaghayenegar, Majid
Hg1-xCdxTe (MCT) has historically been the primary material used for infrared detectors. Recently, alternative substrates for MCT growth such as Si, as well as alternative infrared materials such as Hg1-xCdxSe, have been explored. This dissertation involves characterization of Hg-based infrared materials for third generation infrared detectors using a wide range of transmission electron microscopy (TEM) techniques. A microstructural study on HgCdTe/CdTe heterostructures grown by MBE on Si (211) substrates showed a thin ZnTe layer grown between CdTe and Si to mediate the large lattice mismatch of 19.5%. Observations showed large dislocation densities at the CdTe/ZnTe/Si (211) interfaces, which dropped off rapidly away from the interface. Growth of a thin HgTe buffer layer between HgCdTe and CdTe layers seemed to improve the HgCdTe layer quality by blocking some defects. A second study investigated the correlation of etch pits and dislocations in as-grown and thermal-cycle-annealed (TCA) HgCdTe (211) films. For as-grown samples, pits with triangular and fish-eye shapes were associated with Frank partial and perfect dislocations, respectively. Skew pits were determined to have a more complex nature. TCA reduced the etch-pit density by 72%. Although TCA processing eliminated the fish-eye pits, dislocations reappeared in shorter segments in the TCA samples. Large pits were observed in both as-grown and TCA samples, but the nature of any defects associated with these pits in the as-grown samples is unclear. Microstructural studies of HgCdSe revealed large dislocation density at ZnTe/Si(211) interfaces, which dropped off markedly with ZnTe thickness. Atomic-resolution STEM images showed that the large lattice mismatch at the ZnTe/Si interface was accommodated through {111}-type stacking faults. A detailed analysis showed that the stacking faults were inclined at angles of 19.5 and 90 degrees at both ZnTe/Si and HgCdSe/ZnTe interfaces. These stacking faults were associated with Shockley and Frank partial dislocations, respectively. Initial attempts to delineate individual dislocations by chemical etching revealed that while the etchants successfully attacked defective areas, many defects in close proximity to the pits were unaffected.
Bromke, Mariusz A.; Giavalisco, Patrick; Willmitzer, Lothar; Hesse, Holger
2013-01-01
This report describes the metabolic and lipidomic profiling of 97 low-molecular weight compounds from the primary metabolism and 124 lipid compounds of the diatom Thalassiosira pseudonana. The metabolic profiles were created for diatoms perturbed for 24 hours with four different treatments: (I) removal of nitrogen, (II) lower iron concentration, (III) addition of sea salt, (IV) addition of carbonate to their growth media. Our results show that as early as 24 hours after nitrogen depletion significant qualitative and quantitative change in lipid composition as well as in the primary metabolism of Thalassiosira pseudonana occurs. So we can observe the accumulation of several storage lipids, namely triacylglycerides, and TCA cycle intermediates, of which citric acid increases more than 10-fold. These changes are positively correlated with expression of TCA enzymes genes. Next to the TCA cycle intermediates and storage lipid changes, we have observed decrease in N-containing lipids and primary metabolites such as amino acids. As a measure of counteracting nitrogen starvation, we have observed elevated expression levels of nitrogen uptake and amino acid biosynthetic genes. This indicates that diatoms can fast and efficiently adapt to changing environment by altering the metabolic fluxes and metabolite abundances. Especially, the accumulation of proline and the decrease of dimethylsulfoniopropionate suggest that the proline is the main osmoprotectant for the diatom in nitrogen rich conditions. PMID:23799147
Araújo, Wagner L.; Nunes-Nesi, Adriano; Osorio, Sonia; Usadel, Björn; Fuentes, Daniela; Nagy, Réka; Balbo, Ilse; Lehmann, Martin; Studart-Witkowski, Claudia; Tohge, Takayuki; Martinoia, Enrico; Jordana, Xavier; DaMatta, Fábio M.; Fernie, Alisdair R.
2011-01-01
Transgenic tomato (Solanum lycopersicum) plants expressing a fragment of the Sl SDH2-2 gene encoding the iron sulfur subunit of the succinate dehydrogenase protein complex in the antisense orientation under the control of the 35S promoter exhibit an enhanced rate of photosynthesis. The rate of the tricarboxylic acid (TCA) cycle was reduced in these transformants, and there were changes in the levels of metabolites associated with the TCA cycle. Furthermore, in comparison to wild-type plants, carbon dioxide assimilation was enhanced by up to 25% in the transgenic plants under ambient conditions, and mature plants were characterized by an increased biomass. Analysis of additional photosynthetic parameters revealed that the rate of transpiration and stomatal conductance were markedly elevated in the transgenic plants. The transformants displayed a strongly enhanced assimilation rate under both ambient and suboptimal environmental conditions, as well as an elevated maximal stomatal aperture. By contrast, when the Sl SDH2-2 gene was repressed by antisense RNA in a guard cell–specific manner, changes in neither stomatal aperture nor photosynthesis were observed. The data obtained are discussed in the context of the role of TCA cycle intermediates both generally with respect to photosynthetic metabolism and specifically with respect to their role in the regulation of stomatal aperture. PMID:21307286
Insa, S; Anticó, E; Ferreira, V
2005-09-30
A reliable solid-phase extraction (SPE) method for the simultaneous determination of 2,4,6-trichloroanisole (TCA) and 2,4,6-tribromoanisole (TBA) in wines has been developed. In the proposed procedure 50 mL of wine are extracted in a 1 mL cartridge filled with 50 mg of LiChrolut EN resins. Most wine volatiles are washed up with 12.5 mL of a water:methanol solution (70%, v/v) containing 1% of NaHCO3. Analytes are further eluted with 0.6 mL of dichloromethane. A 40 microL aliquot of this extract is directly injected into a PTV injector operated in the solvent split mode, and analysed by gas chromatography (GC)-ion trap mass spectrometry using the selected ion storage mode. The solid-phase extraction, including sample volume and rinsing and elution solvents, and the large volume GC injection have been carefully evaluated and optimized. The resulting method is precise (RSD (%) < 6% at 100 ng L(-1)), sensitive (LOD were 0.2 and 0.4 ng/L for TCA and TBA, respectively), robust (the absolute recoveries of both analytes are higher than 80% and consistent wine to wine) and friendly to the GC-MS system (the extract is clean, simple and free from non-volatiles).
NASA Technical Reports Server (NTRS)
Lesley, Michael W.; Davis, Lawrence E.; Moulder, John F.; Carlson, Brad A.
1995-01-01
The role of surface-sensitive chemical analysis (ESCA, AES, and SIMS) in a study to select a process to replace 1, 1, 1-trichloroethane (TCA) vapor degreasing as a steel and aluminum bonding surface preparation method is described. The effort was primarily concerned with spray-in-air cleaning processes involving aqueous alkaline and semi-aqueous cleaners and a contamination sensitive epoxy-to-metal bondline. While all five cleaners tested produced bonding strength results equal to or better than those produced by vapor degreasing, the aqueous alkaline cleaners yielded results which were superior to those produced by the semi-aqueous cleaners. The main reason for the enhanced performance appears to be a silicate layer left behind by the aqueous alkaline cleaners. The silicate layer increases the polarity of the surface and enhances epoxy-to-metal bonding. On the other hand, one of the semi-aqueous cleaners left a nonpolar carbonaceous residue which appeared to have a negative effect on epoxy-to-metal bonding. Differences in cleaning efficiency between cleaners/processes were also identified. These differences in surface chemistry, which were sufficient to affect bonding, were not detected by conventional chemical analysis techniques.
(13)C-metabolic flux analysis in S-adenosyl-L-methionine production by Saccharomyces cerevisiae.
Hayakawa, Kenshi; Kajihata, Shuichi; Matsuda, Fumio; Shimizu, Hiroshi
2015-11-01
S-Adenosyl-L-methionine (SAM) is a major biological methyl group donor, and is used as a nutritional supplement and prescription drug. Yeast is used for the industrial production of SAM owing to its high intracellular SAM concentrations. To determine the regulation mechanisms responsible for such high SAM production, (13)C-metabolic flux analysis ((13)C-MFA) was conducted to compare the flux distributions in the central metabolism between Kyokai no. 6 (high SAM-producing) and S288C (control) strains. (13)C-MFA showed that the levels of tricarboxylic acid (TCA) cycle flux in SAM-overproducing strain were considerably increased compared to those in the S228C strain. Analysis of ATP balance also showed that a larger amount of excess ATP was produced in the Kyokai 6 strain because of increased oxidative phosphorylation. These results suggest that high SAM production in Kyokai 6 strains could be attributed to enhanced ATP regeneration with high TCA cycle fluxes and respiration activity. Thus, maintaining high respiration efficiency during cultivation is important for improving SAM production. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Liu, Min; Peng, Qing-Qing; Chen, Yu-Feng; Tang, Qian; Feng, Qing
2015-06-01
A novel space-resolved solid phase microextraction (SR-SPME) technique was developed to facilitate simultaneously analyte monitoring within heterogeneous samples. Graphene (G) and graphene oxide (GO) were coated separately to the segmented fibers which were successfully used for the solid-phase microextraction of two contaminants with dramatically different volatility: 2,4,6-trichloroanisole (TCA) and dibutyl phthalate (DBP). The space-resolved fiber showed good precision (5.4%, 6.8%), low detection limits (0.3ng/L, 0.3ng/L), and wide linearity (1.0-250.0ng/L, 1.0-250.0ng/L) under the optimized conditions for TCA and DBP, respectively. The method was applied to simultaneous analysis of the two contaminates with satisfactory recoveries, which were 96.96% and 98.20% for wine samples. Copyright © 2014 Elsevier Ltd. All rights reserved.
The role of the mitochondrial pyruvate carrier in substrate regulation
Vacanti, Nathaniel M.; Divakaruni, Ajit S.; Green, Courtney R.; Parker, Seth J.; Henry, Robert R.; Ciaraldi, Theodore P.; Murphy, Anne N.; Metallo, Christian M.
2014-01-01
SUMMARY Pyruvate lies at a central biochemical node connecting carbohydrate, amino acid, and fatty acid metabolism, and the regulation of pyruvate flux into mitochondria represents a critical step in intermediary metabolism impacting numerous diseases. To characterize changes in mitochondrial substrate utilization in the context of compromised mitochondrial pyruvate transport, we applied 13C metabolic flux analysis (MFA) to cells after transcriptional or pharmacological inhibition of the mitochondrial pyruvate carrier (MPC). Despite profound suppression of both glucose and pyruvate oxidation, cell growth, oxygen consumption, and tricarboxylic acid (TCA) metabolism were surprisingly maintained. Oxidative TCA flux was achieved through enhanced reliance on glutaminolysis through malic enzyme and pyruvate dehydrogenase (PDH) as well as fatty acid and branched chain amino acid oxidation. Thus, in contrast to inhibition of complex I or PDH, suppression of pyruvate transport induces a form of metabolic flexibility associated with use of lipids and amino acids as catabolic and anabolic fuels. PMID:25458843
[Metabolic flux analysis of L-serine synthesis by Corynebacterium glutamicum SYPS-062].
Zhang, Xiaomei; Dou, Wenfang; Xu, Hongyu; Xu, Zhenghong
2010-10-01
Corynebacterium glutamicum SYPS-062 was an L-serine producing strain stored at our lab and could produce L-serine directly from sugar. We studied the effects of cofactors in one carbon unit metabolism-folate and VB12 on the cell growth, sucrose consumption and L-serine production by SYPS-062. In the same time, the metabolic flux distribution was determined in different conditions. The supplementation of folate or VB12 enhanced the cell growth, energy synthesis, and finally increased the flux of pentose phosphate pathway (HMP), whereas the carbon flux to L-serine was decreased. The addition of VB12 not only increased the ratio of L-serine synthesis pathway on G3P joint, but also caused the insufficiency of tricarboxylic acid cycle (TCA) flux, which needed more anaplerotic reaction flux to replenish TCA cycle, that was an important limiting factor for the further increasing of the L-serine productivity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ang, C.Y.W.; Luo, Wenhong
1997-01-01
A rapid and sensitive liquid chromatographic (LC) method was developed for the determination of ampicillin residues in raw bovine milk, processed skim milk, and pasteurized, homogenized whole milk with vitamin D. Milk samples were deproteinized with trichloroacetic acid (TCA) and acetonictrile. After centrifugation, the clear supernatant was reacted with formaldehyde and TCA under heat. The major fluorescent derivative of ampicillin was then determined by reversed-phase LC with fluorescence detection. Average recoveries of ampicillin fortified at 5, 10, and 20 ppb (ng/mL) were all >85% with coefficients of variation <10%. Limits of detection ranged from 0.31 to 0.51 ppb and limitsmore » of quantitation, from 0.66 to 1.2 ppb. After appropriate validation, this method should be suitable for rapid analysis of milk for ampicillin residues at the tolerance level of 10 ppb. 16 refs., 4 figs., 3 tabs.« less
Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase.
Selak, Mary A; Armour, Sean M; MacKenzie, Elaine D; Boulahbel, Houda; Watson, David G; Mansfield, Kyle D; Pan, Yi; Simon, M Celeste; Thompson, Craig B; Gottlieb, Eyal
2005-01-01
Several mitochondrial proteins are tumor suppressors. These include succinate dehydrogenase (SDH) and fumarate hydratase, both enzymes of the tricarboxylic acid (TCA) cycle. However, to date, the mechanisms by which defects in the TCA cycle contribute to tumor formation have not been elucidated. Here we describe a mitochondrion-to-cytosol signaling pathway that links mitochondrial dysfunction to oncogenic events: succinate, which accumulates as a result of SDH inhibition, inhibits HIF-alpha prolyl hydroxylases in the cytosol, leading to stabilization and activation of HIF-1alpha. These results suggest a mechanistic link between SDH mutations and HIF-1alpha induction, providing an explanation for the highly vascular tumors that develop in the absence of VHL mutations.
Silva, Ana F; Carvalho, Gilda; Soares, Renata; Coelho, Ana V; Barreto Crespo, M Teresa
2012-08-01
Extracellular polymeric substances (EPS) are keys in biomass aggregation and settleability in wastewater treatment systems. In membrane bioreactors (MBR), EPS are an important factor as they are considered to be largely responsible for membrane fouling. Proteins were shown to be the major component of EPS produced by activated sludge and to be correlated with the properties of the sludge, like settling, hydrophobicity and cell aggregation. Previous EPS proteomic studies of activated sludge revealed several problems, like the interference of other EPS molecules in protein analysis. In this study, a successful strategy was outlined to identify the proteins from soluble and bound EPS extracted from activated sludge of a lab-scale MBR. EPS samples were first subjected to pre-concentration through lyophilisation, centrifugal ultrafiltration or concentration with a dialysis membrane coated by a highly absorbent powder of polyacrylate-polyalcohol, preceded or not by a dialysis step. The highest protein concentration factors were achieved with the highly absorbent powder method without previous dialysis step. Four protein precipitation methods were then tested: acetone, trichloroacetic acid (TCA), perchloric acid and a commercial kit. Protein profiles were compared in 4-12 % sodium dodecyl sulphate polyacrylamide gel electrophoresis gels. Both acetone and TCA should be applied for the highest coverage for soluble EPS proteins, whereas TCA was the best method for bound EPS proteins. All visible bands of selected profiles were subjected to mass spectrometry analysis. A high number of proteins (25-32 for soluble EPS and 17 for bound EPS) were identified. As a conclusion of this study, a workflow is proposed for the successful proteome characterisation of soluble and bound EPS from activated sludge samples.
Liu, Miao; Yang, Xiao-Ning; Zhu, Hui-Xia; Jia, Yuan-Yuan; Jia, Shi-Ru; Piergiovanni, Luciano
2014-01-01
A better understanding of metabolic fluxes is important for manipulating microbial metabolism toward desired end products, or away from undesirable by-products. A mutant strain, Gluconacetobacter xylinus AX2-16, was obtained by combined chemical mutation of the parent strain (G. xylinus CGMCC 2955) using DEC (diethyl sulfate) and LiCl. The highest bacterial cellulose production for this mutant was obtained at about 11.75 g/L, which was an increase of 62% compared with that by the parent strain. In contrast, gluconic acid (the main byproduct) concentration was only 5.71 g/L for mutant strain, which was 55.7% lower than that of parent strain. Metabolic flux analysis indicated that 40.1% of the carbon source was transformed to bacterial cellulose in mutant strain, compared with 24.2% for parent strain. Only 32.7% and 4.0% of the carbon source were converted into gluconic acid and acetic acid in mutant strain, compared with 58.5% and 9.5% of that in parent strain. In addition, a higher flux of tricarboxylic acid (TCA) cycle was obtained in mutant strain (57.0%) compared with parent strain (17.0%). It was also indicated from the flux analysis that more ATP was produced in mutant strain from pentose phosphate pathway (PPP) and TCA cycle. The enzymatic activity of succinate dehydrogenase (SDH), which is one of the key enzymes in TCA cycle, was 1.65-fold higher in mutant strain than that in parent strain at the end of culture. It was further validated by the measurement of ATPase that 3.53–6.41 fold higher enzymatic activity was obtained from mutant strain compared with parent strain. PMID:24901455
Cheng, Zhi-Xue; Yang, Man-Jun; Peng, Bo; Peng, Xuan-Xian; Lin, Xiang-Min; Li, Hui
2018-06-15
The overuse and misuse of antibiotics lead to bacterial antibiotic resistance, challenging human health and intensive cultivation. It is especially required to understand for the mechanism of antibiotic resistance to control antibiotic-resistant pathogens. The present study characterized the differential proteome of levofloxacin-resistant Vibrio alginolyticus with the most advanced iTRAQ quantitative proteomics technology. A total of 160 proteins of differential abundance were identified, where 70 were decreased and 90 were increased. Further analysis demonstrated that crucial metabolic pathways like TCA cycle were significantly down-regulated. qRT-PCR analysis demonstrated the decreased gene expression of glycolysis/gluconeogenesis, the TCA cycle, and fatty acid biosynthesis. Moreover, Na(+)-NQR complex gene expression, membrane potential and the adenylate energy charge ratio were decreased, indicating that the decreased central carbon metabolism is associated to the acquisition of levofloxacin resistance. Therefore, the reduced central carbon and energy metabolisms form a characteristic feature as fitness costs of V. alginolyticus in resistance to levofloxacin. The overuse and misuse of antibiotics lead to bacterial antibiotic resistance, challenging human health and intensive cultivation. Understanding for the antibiotic resistance mechanisms is especially required to control these antibiotic-resistant pathogens. The present study characterized the differential proteome of levofloxacin-resistant Vibrio alginolyticus using the most advanced iTRAQ quantitative proteomics technology. A total of 160 differential abundance of proteins were identified with 70 decreases and 90 increases by liquid chromatography matrix assisted laser desorption ionization mass spectrometry. Most interestingly, crucial metabolic pathways such as the TCA cycle sharply fluctuated. This is the first report that the reduced central carbon and energy metabolisms form a characteristic feature as a mechanism of V. alginolyticus in resistance to levofloxacin. Copyright © 2018 Elsevier B.V. All rights reserved.
Comparative Analysis of the Mitochondrial Physiology of Pancreatic β Cells
Kim, Chul; Patel, Pinal; Gouvin, Lindsey M.; Brown, Melissa L.; Khalil, Ahmed; Henchey, Elizabeth M; Heuck, Alejandro P.; Yadava, Nagendra
2014-01-01
The mitochondrial metabolism of β cells is thought to be highly specialized. Its direct comparison with other cells using isolated mitochondria is limited by the availability of islets/β cells in sufficient quantity. In this study, we have compared mitochondrial metabolism of INS1E/β cells with other cells in intact and permeabilized states. To selectively permeabilize the plasma membrane, we have evaluated the use of perfringolysin-O (PFO) in conjunction with microplate-based respirometry. PFO is a protein that binds membranes based on a threshold level of active cholesterol. Therefore, unless active cholesterol reaches a threshold level in mitochondria, they are expected to remain untouched by PFO. Cytochrome c sensitivity tests showed that in PFO-permeabilized cells, the mitochondrial integrity was completely preserved. Our data show that a time-dependent decline of the oligomycin-insensitive respiration observed in INS1E cells was due to a limitation in substrate supply to the respiratory chain. We predict that it is linked with the β cell-specific metabolism involving metabolites shuttling between the cytoplasm and mitochondria. In permeabilized β cells, the Complex l-dependent respiration was either transient or absent because of the inefficient TCA cycle. The TCA cycle insufficiency was confirmed by analysis of the CO2 evolution. This may be linked with lower levels of NAD+, which is required as a co-factor for CO2 producing reactions of the TCA cycle. β cells showed comparable OxPhos and respiratory capacities that were not affected by the inorganic phosphate (Pi) levels in the respiration medium. They showed lower ADP-stimulation of the respiration on different substrates. We believe that this study will significantly enhance our understanding of the β cell mitochondrial metabolism. PMID:25309834
NASA Astrophysics Data System (ADS)
Vergara, Fredd; Kikuchi, Jun; Breuer, Christian
2016-05-01
Autopolyploidy is a process whereby the chromosome set is multiplied and it is a common phenomenon in angiosperms. Autopolyploidy is thought to be an important evolutionary force that has led to the formation of new plant species. Despite its relevance, the consequences of autopolyploidy in plant metabolism are poorly understood. This study compares the metabolic profiles of natural diploids and artificial autotetraploids of Arabidopsis thaliana Col-0. Different physiological parameters are compared between diploids and autotetraploids using nuclear magnetic resonance (NMR), elemental analysis (carbon:nitrogen balance) and quantitative real-time PCR (qRT-PCR). The main difference between diploid and autotetraploid A. thaliana Col-0 is observed in the concentration of metabolites related to the tricarboxylic acid cycle (TCA) and γ-amino butyric acid (GABA) shunt, as shown by multivariate statistical analysis of NMR spectra. qRT-PCR shows that genes related to the TCA and GABA shunt are also differentially expressed between diploids and autotetraploids following similar trends as their corresponding metabolites. Solid evidence is presented to demonstrate that autopolyploidy influences core plant metabolic processes.
Choi, Sol; Kim, Hyun Uk; Kim, Tae Yong; Lee, Sang Yup
2016-11-01
To address climate change and environmental problems, it is becoming increasingly important to establish biorefineries for the production of chemicals from renewable non-food biomass. Here we report the development of Escherichia coli strains capable of overproducing a four-carbon platform chemical 4-hybroxybutyric acid (4-HB). Because 4-HB production is significantly affected by aeration level, genome-scale metabolic model-based engineering strategies were designed under aerobic and microaerobic conditions with emphasis on oxidative/reductive TCA branches and glyoxylate shunt. Several different metabolic engineering strategies were employed to develop strains suitable for fermentation both under aerobic and microaerobic conditions. It was found that microaerobic condition was more efficient than aerobic condition in achieving higher titer and productivity of 4-HB. The final engineered strain produced 103.4g/L of 4-HB by microaerobic fed-batch fermentation using glycerol. The aeration-dependent optimization strategy of TCA cycle will be useful for developing microbial strains producing other reduced derivative chemicals of TCA cycle intermediates. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
Traveling-cluster approximation for uncorrelated amorphous systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sen, A.K.; Mills, R.; Kaplan, T.
1984-11-15
We have developed a formalism for including cluster effects in the one-electron Green's function for a positionally disordered (liquid or amorphous) system without any correlation among the scattering sites. This method is an extension of the technique known as the traveling-cluster approximation (TCA) originally obtained and applied to a substitutional alloy by Mills and Ratanavararaksa. We have also proved the appropriate fixed-point theorem, which guarantees, for a bounded local potential, that the self-consistent equations always converge upon iteration to a unique, Herglotz solution. To our knowledge, this is the only analytic theory for considering cluster effects. Furthermore, we have performedmore » some computer calculations in the pair TCA, for the model case of delta-function potentials on a one-dimensional random chain. These results have been compared with ''exact calculations'' (which, in principle, take into account all cluster effects) and with the coherent-potential approximation (CPA), which is the single-site TCA. The density of states for the pair TCA clearly shows some improvement over the CPA and yet, apparently, the pair approximation distorts some of the features of the exact results.« less
NASA Technical Reports Server (NTRS)
Danilin, M. Y.; Ko, Malcolm K. W.; Bevilacqua, R. M.; Lyjak, L. V.; Froidevaux, L.; Santee, M. L.; Zawodny, J. M.; Hoppel, K. W.; Richard, E. C.; Spackman, J. R.;
2001-01-01
We compared the version 5 Microwave Limb Sounder (MLS) aboard the Upper Atmosphere Research Satellite (UARS), version 3 Polar Ozone and Aerosol Measurement-III (POAM-111) aboard the French satellite SPOT-IV, version 6.0 Stratospheric Aerosol and Gas Experiment 11 (SAGE-II) aboard the Earth Radiation Budget Satellite, and NASA ER-2 aircraft measurements made in the northern hemisphere in January-February 2000 during the SAGE III Ozone Loss and Validation Experiment (SOLVE). This study addresses one of the key scientific objectives of the SOLVE campaign, namely, to validate multi-platform satellite measurements made in the polar stratosphere during winter. This intercomparison was performed using a traditional correlative analysis (TCA) and a trajectory hunting technique (THT). Launching backward and forward trajectories from the points of measurement, the THT identifies air parcels sampled at least twice within a prescribed match criterion during the course of 5 days. We found that the ozone measurements made by these four instruments agree most of the time within 110% in the stratosphere up to 1400 K (approximately 35 km). The water vapor measurements from POAM-III and the ER-2 Harvard Lyman-alpha hygrometer and JPL laser hygrometer agree to within 10.5 ppmv (or about +/-10%) in the lower stratosphere above 380 K. The MLS and ER-2 ClO measurements agree within their error bars for the TCA. The MLS and ER-2 nitric acid measurements near 17-20 km altitude agree within their uncertainties most of the time with a hint of a positive offset by MLS according to the TCA. We also applied the AER box model constrained by the ER-2 measurements for analysis of the ClO and HN03 measurements using the THT. We found that: (1) the model values of ClO are smaller by about 0.3-0.4 (0.2) ppbv below (above) 400 K than those by MLS and (2) the HN03 comparison shows a positive offset of MLS values by approximately 1 and 1-2 ppbv below 400 K and near 450 K, respectively. It is hard to quantify the HN03 offset in the 400-440 K range because of the high sensitivity of nitric acid to the PSC schemes. Our study shows that, with some limitations (like HN03 comparison under PSC conditions), the THT is a more powerful tool for validation studies than the TCA, making conclusions of the comparison statistically more robust.
Eloqayli, Haytham; Qu, Hong; Unsgård, Geirmund; Sletvold, Olav; Hadidi, Hakam; Sonnewald, Ursula
2002-02-01
This study was performed to analyze the effects of glutamate and the epileptogenic agent pentylenetetrazole (PTZ) on neuronal glucose metabolism. Cerebellar granule neurons were incubated for 2 h in medium containing 3 mM [U-(13)C]glucose, with and without 0.25 mM glutamate and/or 10 mM PTZ. In the presence of PTZ, decreased glucose consumption with unchanged lactate release was observed, indicating decreased glucose oxidation. PTZ also slowed down tricarboxylic acid (TCA) cycle activity as evidenced by the decreased amounts of labeled aspartate and [1,2-(13)C]glutamate. When glutamate was present, glucose consumption was also decreased. However, the amount of glutamate, derived from [U-(13)C]glucose via the first turn of the TCA cycle, was increased. The decreased amount of [1,2-(13)C]glutamate, derived from the second turn in the TCA cycle, and increased amount of aspartate indicated the dilution of label due to the entrance of unlabeled glutamate into TCA cycle. In the presence of glutamate plus PTZ, the effect of PTZ was enhanced by glutamate. Labeled alanine was detected only in the presence of glutamate plus PTZ, which indicated that oxaloacetate was a better amino acid acceptor than pyruvate. Furthermore, there was also evidence for intracellular compartmentation of oxaloacetate metabolism. Glutamate and PTZ caused similar metabolic changes, however, via different mechanisms. Glutamate substituted for glucose as energy substrate in the TCA cycle, whereas, PTZ appeared to decrease mitochondrial activity.
Agrawal, Abinash; Ferguson, William J; Gardner, Bruce O; Christ, John A; Bandstra, Joel Z; Tratnyek, Paul G
2002-10-15
The effect of precipitates on the reactivity of iron metal (Fe0) with 1,1,1-trichloroethane (TCA) was studied in batch systems designed to model groundwaters that contain dissolved carbonate species (i.e., C(IV)). At representative concentrations for high-C(IV) groundwaters (approximately 10(-2) M), the pH in batch reactors containing Fe0 was effectively buffered until most of the aqueous C(IV) precipitated. The precipitate was mainly FeCO3 (siderite) but may also have included some carbonate green rust. Exposure of the Fe0 to dissolved C(IV) accelerated reduction of TCA, and the products formed under these conditions consisted mainly of ethane and ethene, with minor amounts of several butenes. The kinetics of TCA reduction were first-order when C(IV)-enhanced corrosion predominated but showed mixed-order kinetics (zero- and first-order) in experiments performed with passivated Fe0 (i.e., before the onset of pitting corrosion and after repassivation by precipitation of FeCO3). All these data were described by fitting a Michaelis-Menten-type kinetic model and approximating the first-order rate constant as the ratio of the maximum reaction rate (Vm) and the concentration of TCA at half of the maximum rate (K(1/2)). The decrease in Vm/K(1/2) with increasing C(IV) exposure time was fit to a heuristic model assuming proportionality between changes in TCA reduction rate and changes in surface coverage with FeCO3.
Kinetic characterization of bile salt transport by human NTCP (SLC10A1).
Jani, Márton; Beéry, Erzsébet; Heslop, Teresa; Tóth, Beáta; Jagota, Bhavana; Kis, Emese; Kevin Park, B; Krajcsi, Peter; Weaver, Richard J
2018-02-01
The transport of bile acids facilitated by NTCP is an important factor in establishing bile flow. In this study, we examine the kinetics associated with human NTCP-dependent transport of two quantitatively important bile acids comprising the human bile acid pool, chenodeoxycholic acid and glycine-chenodeoxycholate, and secondary bile salt, 3-sulfo-glycolithocholate of potential toxicological significance. The study employed human NTCP overexpressing Chinese Hamster Ovary cells and results compared with taurocholate, a prototypical bile salt commonly used in transporter studies. GCDC and 3S-GLC but not CDCA were transported by NTCP. The efficient uptake of GCDC, TCA and 3S-GLC by NTCP enabled the determination of kinetics. GCDC displayed a lower K M (0.569±0.318μM) than TCA (6.44±3.83μM) and 3S-GLC (3.78±1.17μM). The apparent CL int value for GCDC was 20-fold greater (153±53μl/mg protein/min) than the apparent CL int for TCA (6.92±4.72μl/mg protein/min) and apparent CL int for 3S-GLC (8.05±1.33μl/mg protein/min). These kinetic results provide important complementary data on the substrate selectivity and specificity of NTCP to transport bile acids. NTCP transports GCDC with greater efficiency than TCA and has the same efficacy for 3S-GLC and TCA. Copyright © 2017. Published by Elsevier Ltd.
The NASA Constellation University Institutes Project: Thrust Chamber Assembly Virtual Institute
NASA Technical Reports Server (NTRS)
Tucker, P. Kevin; Rybak, Jeffry A.; Hulka, James R.; Jones, Gregg W.; Nesman, Tomas; West, Jeffrey S.
2006-01-01
This paper documents key aspects of the Constellation University Institutes Project (CUIP) Thrust Chamber Assembly (TCA) Virtual Institute (VI). Specifically, the paper details the TCA VI organizational and functional aspects relative to providing support for Constellation Systems. The TCA VI vision is put forth and discussed in detail. The vision provides the objective and approach for improving thrust chamber assembly design methodologies by replacing the current empirical tools with verified and validated CFD codes. The vision also sets out ignition, performance, thermal environments and combustion stability as focus areas where application of these improved tools is required. Flow physics and a study of the Space Shuttle Main Engine development program are used to conclude that the injector is the key to robust TCA design. Requirements are set out in terms of fidelity, robustness and demonstrated accuracy of the design tool. Lack of demonstrated accuracy is noted as the most significant obstacle to realizing the potential of CFD to be widely used as an injector design tool. A hierarchical decomposition process is outlined to facilitate the validation process. A simulation readiness level tool used to gauge progress toward the goal is described. Finally, there is a description of the current efforts in each focus area. The background of each focus area is discussed. The state of the art in each focus area is noted along with the TCA VI research focus in the area. Brief highlights of work in the area are also included.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Jiong; Lin, Yao; Fan, Li
Oral squamous cell carcinoma (OSCC) is one of the most common types of the head and neck cancer. Chemo resistance of OSCC has been identified as a substantial therapeutic hurdle. In this study, we analyzed the role of miR-203 in the OSCC and its effects on cisplatin-induced cell death in an OSCC cell line, Tca8113. There was a significant decrease of miR-203 expression in OSCC samples, compared with the adjacent normal, non-cancerous tissue. After 3 days cisplatin treatment, the survived Tca8113 cells had a lower expression of miR-203 than that in the untreated control group. In contrast, PIK3CA showed an inversemore » expression in cancer and cisplatin survived Tca8113 cells. Transfection of Tca8113 cells with miR-203 mimics greatly reduced PIK3CA expression and Akt activation. Furthermore, miR-203 repressed PIK3CA expression through targeting the 3′UTR. Restoration of miR-203 not only suppressed cell proliferation, but also sensitized cells to cisplatin induced cell apoptosis. This effect was absent in cells that were simultaneously treated with PIK3CA RNAi. In summary, these findings suggest miR-203 plays an important role in cisplatin resistance in OSCC, and furthermore delivery of miR-203 analogs may serve as an adjuvant therapy for OSCC. - Highlights: • Much lower miR-203 expression in cisplatin resistant Tca8113 cells is discovered. • Delivery of miR-203 can sensitize the Tca8113 cells to cisplatin induced cell death. • MiR-203 can downregulate PIK3CA through the 3′UTR. • The effects of miR-203 on cisplatin sensitivity is mainly through PIK3CA pathway.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kowalski, Greg M., E-mail: greg.kowalski@deakin.edu.au; De Souza, David P.; Burch, Micah L.
Rationale: Defects in muscle glucose metabolism are linked to type 2 diabetes. Mechanistic studies examining these defects rely on the use of high fat-fed rodent models and typically involve the determination of muscle glucose uptake under insulin-stimulated conditions. While insightful, they do not necessarily reflect the physiology of the postprandial state. In addition, most studies do not examine aspects of glucose metabolism beyond the uptake process. Here we present an approach to study rodent muscle glucose and intermediary metabolism under the dynamic and physiologically relevant setting of the oral glucose tolerance test (OGTT). Methods and results: In vivo muscle glucose andmore » intermediary metabolism was investigated following oral administration of [U-{sup 13}C] glucose. Quadriceps muscles were collected 15 and 60 min after glucose administration and metabolite flux profiling was determined by measuring {sup 13}C mass isotopomers in glycolytic and tricarboxylic acid (TCA) cycle intermediates via gas chromatography–mass spectrometry. While no dietary effects were noted in the glycolytic pathway, muscle from mice fed a high fat diet (HFD) exhibited a reduction in labelling in TCA intermediates. Interestingly, this appeared to be independent of alterations in flux through pyruvate dehydrogenase. In addition, our findings suggest that TCA cycle anaplerosis is negligible in muscle during an OGTT. Conclusions: Under the dynamic physiologically relevant conditions of the OGTT, skeletal muscle from HFD fed mice exhibits alterations in glucose metabolism at the level of the TCA cycle. - Highlights: • Dynamic metabolomics was used to investigate muscle glucose metabolism in vivo. • Mitochondrial TCA cycle metabolism is altered in muscle of HFD mice. • This defect was not pyruvate dehydrogenase mediated, as has been previously thought. • Mitochondrial TCA cycle anaplerosis in muscle is virtually absent during the OGTT.« less
USDA-ARS?s Scientific Manuscript database
Methods were employed to evaluate serum biomarkers associated with protein oxidative stress and damage, to determine potential sources of metabolic stress in baby pigs. Protein carbonyls in serum were converted to dinitrophenyl (DNP) derivatives with DNP-hydrazine, precipitated with TCA, extracted i...
Browning, Jeffrey D.; Weis, Brian; Davis, Jeannie; Satapati, Santhosh; Merritt, Matthew; Malloy, Craig R.; Burgess, Shawn C.
2009-01-01
Carbohydrate-restriction is a common weight-loss approach that modifies hepatic metabolism by increasing gluconeogenesis and ketosis. Because little is known regarding the effect of carbohydrate-restriction on the origin of gluconeogenic precursors (gluconeogenesis from glycerol (GNGglycerol) and lactate/amino acids (GNGPEP)) or its consequence to hepatic energy homeostasis, we studied these parameters in a group of overweight/obese subjects undergoing weight-loss via dietary restriction. We used 2H and 13C tracers and nuclear magnetic resonance spectroscopy to measure the sources of hepatic glucose and TCA cycle flux in weight-stable subjects(n=7) and subjects following carbohydrate-(n=7) or calorie-restriction(n=7). The majority of hepatic glucose production in carbohydrate-restricted subjects came from GNGPEP. The contribution of glycerol to gluconeogenesis was similar in all groups despite evidence of increased fat oxidation in carbohydrate-restricted subjects. A strong correlation between TCA cycle flux and GNGPEP was found, though the reliance on TCA cycle energy production for gluconeogenesis was attenuated in subjects undergoing carbohydrate restriction. Together, these data imply that the TCA cycle is the energetic patron of gluconeogenesis. However, the relationship between these two pathways is modified by carbohydrate restriction, suggesting an increased reliance of the hepatocyte on energy generated outside of the TCA cycle when GNGPEP is maximal. In conclusion, carbohydrate-restriction modifies hepatic gluconeogenesis by increasing reliance on substrates like lactate or amino acids but not glycerol. This modification is associated with a reorganization of hepatic energy metabolism suggestive of enhanced hepatic β-oxidation. PMID:18925642
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hara, Takamitsu; Omura-Minamisawa, Motoko; Chao Cheng
Purpose: Bcl-2, an inhibitor of apoptosis frequently shows elevated expression in human tumors, thus resulting in resistance to radiation therapy. Therefore, inhibiting Bcl-2 function may enhance the radiosensitivity of tumor cells. Tetrocarcin A (TC-A) and bcl-2 antisense oligonucleotides exhibit antitumor activity by inhibiting Bcl-2 function and transcription, respectively. We investigated whether these antitumor agents would enhance the cytotoxic effects of radiation in tumor cells overexpressing Bcl-2. Methods and materials: We used HeLa/bcl-2 cells, a stable Bcl-2-expressing cell line derived from wild-type HeLa (HeLa/wt) cells. Cells were incubated with TC-A and bcl-2 antisense oligonucleotides for 24 h after irradiation, and cellmore » viability was then determined. Apoptotic cells were quantified by flow cytometric assay. Results: The HeLa/bcl-2 cells were more resistant to radiation than HeLa/wt cells. At concentrations that are not inherently cytotoxic, both TC-A and bcl-2 antisense oligonucleotides increased the cytotoxic effects of radiation in HeLa/bcl-2 cells, but not in HeLa/wt cells. However, in HeLa/bcl-2 cells, additional treatment with TC-A in combination with radiation did not significantly increase apoptosis. Conclusions: The present results suggest that TC-A and bcl-2 antisense oligonucleotides reduce radioresistance of tumor cells overexpressing Bcl-2. Therefore, a combination of radiotherapy and Bcl-2 inhibitors may prove to be a useful therapeutic approach for treating tumors that overexpress Bcl-2.« less
Jayaprasad, Sandhaya; Subramaniyan, Radhakrishnan; Devgan, Shalini
2016-01-01
Background: Warts are benign proliferations of skin and mucosa caused by the human papillomavirus (HPV). Plane warts are caused by HPV types 3, 10, 28, and 41, occurring mostly in children and young adults. Among the treatment modalities, topical application of trichloroacetic acid (TCA) is age old. Potassium hydroxide (KOH) has a keratolytic effect on virus-infected cells. It is less irritating, less painful, less scar forming, and can be safely used in children too. Hence, it could be a better topical agent in the treatment of plane warts. Aims and Objectives: To compare the safety and efficacy of topical 10% KOH with 30% TCA in the treatment of plane warts. Materials and Methods: Sixty consecutive patients with plane warts were randomly assigned into two arms of thirty patients each; arm A received topical 10% KOH and arm B received topical 30% TCA as a once weekly application until the complete clearance of warts or a maximum period of 12 weeks. Results: Statistically no significant difference (P = 0.07) was found between the objective therapeutic response to 10% KOH and 30% TCA at the end of study (12 weeks). However, subjective response to 10% KOH was better and statistically significant (P = 0.03). There was no recurrence of warts seen on follow-up for 3 months of complete responders in both the arms. Conclusion: 10% KOH is found to be equally effective in the treatment of plane warts compared to 30% TCA with the advantage of faster onset of action and tendency of completely clearing warts with fewer side effects. PMID:27904181
Papinutto, Nico; Schlaeger, Regina; Panara, Valentina; Zhu, Alyssa H; Caverzasi, Eduardo; Stern, William A; Hauser, Stephen L; Henry, Roland G
2015-01-01
The source of inter-subject variability and the influence of age and gender on morphometric characteristics of the spinal cord, such as the total cross-sectional area (TCA), the gray matter (GM) and white matter (WM) areas, currently remain under investigation. Understanding the effect of covariates such as age, gender, brain volumes, and skull- and vertebra-derived metrics on cervical and thoracic spinal cord TCA and GM areas in healthy subjects would be fundamental for exploring compartment specific changes in neurological diseases affecting the spinal cord. Using Magnetic Resonance Imaging at 3T we investigated 32 healthy subjects using a 2D phase sensitive inversion recovery sequence and we measured TCA, GM and WM areas at 4 cervical and thoracic levels of the spinal cord. We assessed age and gender relationships of cord measures and explored associations between cord measures and a) brain volumes and b) skull- and vertebra-derived metrics. Age and gender had a significant effect on TCA, WM and GM areas (with women and elderly having smaller values than men and younger people respectively), but not on the GM area/TCA ratio. The total intracranial volume and C3 vertebra dimensions showed the highest correlations with cord measures. When used in multi-regression models, they reduced cord areas group variability by approximately a third. Age and gender influences on cord measures and normalization strategies here presented might be of use in the study of compartment specific changes in various neurological diseases affecting the spinal cord.
Inflammation and ER Stress Regulate Branched-Chain Amino Acid Uptake and Metabolism in Adipocytes
Burrill, Joel S.; Long, Eric K.; Reilly, Brian; Deng, Yingfeng; Armitage, Ian M.; Scherer, Philipp E.
2015-01-01
Inflammation plays a critical role in the pathology of obesity-linked insulin resistance and is mechanistically linked to the effects of macrophage-derived cytokines on adipocyte energy metabolism, particularly that of the mitochondrial branched-chain amino acid (BCAA) and tricarboxylic acid (TCA) pathways. To address the role of inflammation on energy metabolism in adipocytes, we used high fat-fed C57BL/6J mice and lean controls and measured the down-regulation of genes linked to BCAA and TCA cycle metabolism selectively in visceral but not in subcutaneous adipose tissue, brown fat, liver, or muscle. Using 3T3-L1 cells, TNFα, and other proinflammatory cytokine treatments reduced the expression of the genes linked to BCAA transport and oxidation. Consistent with this, [14C]-leucine uptake and conversion to triglycerides was markedly attenuated in TNFα-treated adipocytes, whereas the conversion to protein was relatively unaffected. Because inflammatory cytokines lead to the induction of endoplasmic reticulum stress, we evaluated the effects of tunicamycin or thapsigargin treatment of 3T3-L1 cells and measured a similar down-regulation in the BCAA/TCA cycle pathway. Moreover, transgenic mice overexpressing X-box binding protein 1 in adipocytes similarly down-regulated genes of BCAA and TCA metabolism in vivo. These results indicate that inflammation and endoplasmic reticulum stress attenuate lipogenesis in visceral adipose depots by down-regulating the BCAA/TCA metabolism pathway and are consistent with a model whereby the accumulation of serum BCAA in the obese insulin-resistant state is linked to adipose inflammation. PMID:25635940
Microbial reductive dehalogenation of trihalomethanes by a Dehalobacter-containing co-culture.
Zhao, Siyan; Rogers, Matthew J; He, Jianzhong
2017-07-01
Trihalomethanes such as chloroform and bromoform, although well-known as a prominent class of disinfection by-products, are ubiquitously distributed in the environment due to widespread industrial usage in the past decades. Chloroform and bromoform are particularly concerning, of high concentrations detected and with long half-lives up to several hundred days in soils and groundwater. In this study, we report a Dehalobacter- and Desulfovibrio-containing co-culture that exhibits dehalogenation of chloroform (~0.61 mM) to dichloromethane and bromoform (~0.67 mM) to dibromomethane within 10-15 days. This co-culture was further found to dechlorinate 1,1,1-trichloroethane (1,1,1-TCA) (~0.65 mM) to 1,1-dichloroethane within 12 days. The Dehalobacter species present in this co-culture, designated Dehalobacter sp. THM1, was found to couple growth with dehalogenation of chloroform, bromoform, and 1,1,1-TCA. Strain THM1 harbors a newly identified reductive dehalogenase (RDase), ThmA, which catalyzes chloroform, bromoform, and 1,1,1-TCA dehalogenation. Additionally, based on the sequences of thmA and other identified chloroform RDase genes, ctrA, cfrA, and tmrA, a pair of chloroform RDase gene-specific primers were designed and successfully applied to investigate the chloroform dechlorinating potential of microbial communities. The comparative analysis of chloroform RDases with tetrachloroethene RDases suggests a possible approach in predicting the substrate specificity of uncharacterized RDases in the future.
Metabolic profiles of exercise in patients with McArdle disease or mitochondrial myopathy
Sharma, Rohit; Tadvalkar, Laura; Clish, Clary B.; Haller, Ronald G.; Mootha, Vamsi K.
2017-01-01
McArdle disease and mitochondrial myopathy impair muscle oxidative phosphorylation (OXPHOS) by distinct mechanisms: the former by restricting oxidative substrate availability caused by blocked glycogen breakdown, the latter because of intrinsic respiratory chain defects. We applied metabolic profiling to systematically interrogate these disorders at rest, when muscle symptoms are typically minimal, and with exercise, when symptoms of premature fatigue and potential muscle injury are unmasked. At rest, patients with mitochondrial disease exhibit elevated lactate and reduced uridine; in McArdle disease purine nucleotide metabolites, including xanthine, hypoxanthine, and inosine are elevated. During exercise, glycolytic intermediates, TCA cycle intermediates, and pantothenate expand dramatically in both mitochondrial disease and control subjects. In contrast, in McArdle disease, these metabolites remain unchanged from rest; but urea cycle intermediates are increased, likely attributable to increased ammonia production as a result of exaggerated purine degradation. Our results establish skeletal muscle glycogen as the source of TCA cycle expansion that normally accompanies exercise and imply that impaired TCA cycle flux is a central mechanism of restricted oxidative capacity in this disorder. Finally, we report that resting levels of long-chain triacylglycerols in mitochondrial myopathy correlate with the severity of OXPHOS dysfunction, as indicated by the level of impaired O2 extraction from arterial blood during peak exercise. Our integrated analysis of exercise and metabolism provides unique insights into the biochemical basis of these muscle oxidative defects, with potential implications for their clinical management. PMID:28716914
Reyes-Rodríguez, Mae Lynn; García, Marissa; Silva, Yormeri; Sala, Margarita; Quaranta, Michela; Bulik, Cynthia M.
2016-01-01
Resumen El objetivo de este estudio fue desarrollar fotonovelas, un tipo de novela gráfica popular en la población latina, para crear conciencia y educar sobre los trastornos de la conducta alimentaria (TCA). Cuatro caricaturas ilustradas y guiones adaptados para adultos y adolescentes de ambos sexos fueron presentados en discusiones focales y en una entrevista de profundidad. Diecisiete latinos adultos (14 mujeres; 3 hombres) y 10 adolescentes (9 féminas; 1 varón) participaron en el estudio. Los participantes encontraron las fotonovelas interesantes y que captaban más la atención que los folletos tradicionales. El uso del espanglish y la clarificación de las diferencias entre los TCA fueron sugeridos por las adolescentes femeninas. Los adultos varones sugirieron cambiar el título, que se enfocara en las consecuencias en la salud de los TCA para que llame la atención en los hombres a leer la historia. Basado en la aceptación encontrada en este estudio, la fotonovela pudiera ser una avenida prometedora para crear conciencia y educar a la comunidad latina sobre los TCA en los Estados Unidos. PMID:27313838
Sulfate-enhanced catalytic destruction of 1,1,1-trichlorethane over Pt(111).
Lee, Adam F; Wilson, Karen
2006-01-19
The catalytic destruction of 1,1,1-trichloroethane (TCA) over model sulfated Pt(111) surfaces has been investigated by fast X-ray photoelectron spectroscopy and mass spectrometry. TCA adsorbs molecularly over SO4 precovered Pt(111) at 100 K, with a saturation coverage of 0.4 monolayer (ML) comparable to that on the bare surface. Surface crowding perturbs both TCA and SO4 species within the mixed adlayer, evidenced by strong, coverage-dependent C 1s and Cl and S 2p core-level shifts. TCA undergoes complete dechlorination above 170 K, accompanied by C-C bond cleavage to form surface CH3, CO, and Cl moieties. These in turn react between 170 and 350 K to evolve gaseous CO2, C2H6, and H2O. Subsequent CH3 dehydrogenation and combustion occurs between 350 and 450 K, again liberating CO2 and water. Combustion is accompanied by SO4 reduction, with the coincident evolution of gas phase SO2 and CO2 suggesting the formation of a CO-SOx surface complex. Reactively formed HCl desorbs in a single state at 400 K. Only trace (<0.06 ML) residual atomic carbon and chlorine remain on the surface by 500 K.
Abdel-Meguid, Azza M; Taha, Emad A; Ismail, Sahar A
2017-05-01
Melasma is a common challenging pigmentary skin disorder especially in dark-skinned females urging them to seek medical help. Many modalities of treatment are available, but none is satisfactory. To compare safety and efficacy of combined trichloroacetic acid (TCA) (20%-25%) and Jessner's solution versus TCA (20%-25%) alone in dark patients with melasma. The study design was a split face, right-left, assessor-blinded, randomized controlled study. Twenty-four adult female patients (skin phototypes IV-V) with bilateral melasma were treated for 6 sessions at 2 weeks intervals. Clinical assessment of the 2 sides of the face with Melasma Area and Severity Index (MASI) score was performed, and photographs were taken before and after the peeling course. Both therapeutic modalities showed significant decrease in MASI score, which was significantly lower on the side treated with both Jessner solution and TCA. There were significant negative correlations between the percentage of improvement of MASI score and both age of the patients and duration of the melasma. Dark skin melasma can be treated with both regimens safely and effectively; however, combined Jessner solution and TCA is more effective.
The Tricarboxylic Acid Cycle, an Ancient Metabolic Network with a Novel Twist
Mailloux, Ryan J.; Bériault, Robin; Lemire, Joseph; Singh, Ranji; Chénier, Daniel R.; Hamel, Robert D.; Appanna, Vasu D.
2007-01-01
The tricarboxylic acid (TCA) cycle is an essential metabolic network in all oxidative organisms and provides precursors for anabolic processes and reducing factors (NADH and FADH2) that drive the generation of energy. Here, we show that this metabolic network is also an integral part of the oxidative defence machinery in living organisms and α-ketoglutarate (KG) is a key participant in the detoxification of reactive oxygen species (ROS). Its utilization as an anti-oxidant can effectively diminish ROS and curtail the formation of NADH, a situation that further impedes the release of ROS via oxidative phosphorylation. Thus, the increased production of KG mediated by NADP-dependent isocitrate dehydrogenase (NADP-ICDH) and its decreased utilization via the TCA cycle confer a unique strategy to modulate the cellular redox environment. Activities of α-ketoglutarate dehydrogenase (KGDH), NAD-dependent isocitrate dehydrogenase (NAD-ICDH), and succinate dehydrogenase (SDH) were sharply diminished in the cellular systems exposed to conditions conducive to oxidative stress. These findings uncover an intricate link between TCA cycle and ROS homeostasis and may help explain the ineffective TCA cycle that characterizes various pathological conditions and ageing. PMID:17668068
Metabolic flux analysis of the halophilic archaeon Haladaptatus paucihalophilus.
Liu, Guangxiu; Zhang, Manxiao; Mo, Tianlu; He, Lian; Zhang, Wei; Yu, Yi; Zhang, Qi; Ding, Wei
2015-11-27
This work reports the (13)C-assisted metabolic flux analysis of Haladaptatus paucihalophilus, a halophilic archaeon possessing an intriguing osmoadaption mechanism. We showed that the carbon flow is through the oxidative tricarboxylic acid (TCA) cycle whereas the reductive TCA cycle is not operative in H. paucihalophilus. In addition, both threonine and the citramalate pathways contribute to isoleucine biosynthesis, whereas lysine is synthesized through the diaminopimelate pathway and not through the α-aminoadipate pathway. Unexpected, the labeling patterns of glycine from the cells grown on [1-(13)C]pyruvate and [2-(13)C]pyruvate suggest that, unlike all the organisms investigated so far, in which glycine is produced exclusively from the serine hydroxymethyltransferase (SHMT) pathway, glycine biosynthesis in H. paucihalophilus involves different pathways including SHMT, threonine aldolase (TA) and the reverse reaction of glycine cleavage system (GCS), demonstrating for the first time that other pathways instead of SHMT can also make a significant contribution to the cellular glycine pool. Transcriptional analysis confirmed that both TA and GCS genes were transcribed in H. paucihalophilus, and the transcriptional level is independent of salt concentrations in the culture media. This study expands our understanding of amino acid biosynthesis and provides valuable insights into the metabolism of halophilic archaea. Copyright © 2015 Elsevier Inc. All rights reserved.
Hudson, C J W; Kim, L S; Hancock, S A; Cunliffe, I A; Wild, J M
2007-05-01
To identify the presence, and origin, of any "dissociating factors" inherent to the techniques for evaluating progression that mask the relationship between structural and functional progression in open-angle glaucoma (OAG). 23 patients (14 with OAG and 9 with ocular hypertension (OHT)) who had received serial Heidelberg Retina Tomograph (HRT II) and Humphrey Field Analyser (HFA) examinations for >or=5 years (mean 78.4 months (SD 9.5), range 60-101 months) were identified. Evidence of progressive disease was retrospectively evaluated in one eye of each patient using the Topographic Change Analysis (TCA) and Glaucoma Progression Analysis (GPA) for the HRT II and HFA, respectively. Six patients were stable by both techniques; four exhibited both structural and functional progression; seven exhibited structural progression, only, and six showed functional progression, only. Three types of dissociating factors were identified. TCA failed to identify progressive structural damage in the presence of advanced optic nerve head damage. GPA failed to identify progressive functional damage at stimulus locations, with sensitivities exhibiting test-retest variability beyond the maximum stimulus luminance of the perimeter, and where a perimetric learning effect was apparent. The three dissociating factors accounted for nine of the 13 patients who exhibited a lack of concordance between structural and functional progressive damage.
Analytic approximation for random muffin-tin alloys
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mills, R.; Gray, L.J.; Kaplan, T.
1983-03-15
The methods introduced in a previous paper under the name of ''traveling-cluster approximation'' (TCA) are applied, in a multiple-scattering approach, to the case of a random muffin-tin substitutional alloy. This permits the iterative part of a self-consistent calculation to be carried out entirely in terms of on-the-energy-shell scattering amplitudes. Off-shell components of the mean resolvent, needed for the calculation of spectral functions, are obtained by standard methods involving single-site scattering wave functions. The single-site TCA is just the usual coherent-potential approximation, expressed in a form particularly suited for iteration. A fixed-point theorem is proved for the general t-matrix TCA, ensuringmore » convergence upon iteration to a unique self-consistent solution with the physically essential Herglotz properties.« less
IRIS Toxicological Review of Trichloroacetic Acid (TCA) ...
EPA is conducting a peer review and public comment of the scientific basis supporting the human health hazard and dose-response assessment of Trichloroacetic acid (TCA) that when finalized will appear on the Integrated Risk Information System (IRIS) database. The draft Toxicological Review of trichloroacetic acid provides scientific support and rationale for the hazard and dose-response assessment pertaining to chronic exposure to trichloroacetic acid.
K.M. Jenkins; S.V. Diehl; C.A. Clausen; F. Green
2011-01-01
Brown-rot fungi produce oxalate in large amounts; however, levels of accumulation and function vary by species. Copper-tolerant fungi, like Antrodia radiculosa, produce and accumulate high levels of oxalate in response to copper. Oxalate biosynthesis in copper-tolerant fungi has been linked to the glyoxylate and tricarboxylic acid (TCA) cycles. Within these two cycles...
MicroTCA-based Global Trigger Upgrade project for the CMS experiment at LHC
NASA Astrophysics Data System (ADS)
Rahbaran, B.; Arnold, B.; Bergauer, H.; Eichberger, M.; Rabady, D.
2011-12-01
The electronics of the first Level Global Trigger (GT) of CMS is the last stage of the Level-1 trigger system [1]. At LHC up to 40 million collisions of proton bunches occur every second, resulting in about 800 million proton collisions. The CMS Level-1 Global Trigger [1], a custom designed electronics system based on FPGA technology and the VMEbus system, performs a quick on-line analysis of each collision every 25 ns and decides whether to reject or to accept it for further analysis. The CMS trigger group of the Institute of High Energy Physics in Vienna (HEPHY) is involved in the Level-1 trigger of the CMS experiment at CERN. As part of the Trigger Upgrade, the Level-1 Global Trigger will be redesigned and implemented in MicroTCA based technology, which allows engineers to detect all possible faults on plug-in boards, in the power supply and in the cooling system. The upgraded Global Trigger will be designed to have the same basic categories of functions as the present GT, but will have more algorithms and more possibilities for combining trigger candidates. Additionally, reconfigurability and testability will be supported based on the next system generation.
Jaweher, Masmoudi; Sonda, Trabelsi; Uta, Ouali; Inès, Feki; Rim, Sallemi; Imene, Baati; Abdelaziz, Jaoua
2014-01-01
Introduction Les objectifs de notre étude ont été d'estimer la prévalence des troubles des conduites alimentaires (TCA) chez les jeunes tunisiens et étudier la relation entre le tempérament cyclothymique et les TCA. Méthodes Nous avons ainsi mené une étude transversale descriptive et analytique. Elle a concerné 107 étudiants de l'Institut de Presse et des Sciences de l'Information de la Manouba, Tunisie. Pour l’évaluation des TCA, nous avons procédé par la passation de l'auto questionnaire EAT 40, dans sa version validée en Tunisie. C'est l'outil le plus utilisé pour le dépistage des TCA dans le monde. Pour l’évaluation du tempérament cyclothymique, nous avons utilisé le TEMPS A dans sa version arabe validée. Une fiche épidémiologique associée a permis de recueillir quelques facteurs sociodémographiques et hygiéno-diététiques. Résultats La prévalence des troubles de conduites alimentaires a été de 24,3%. Le pourcentage des étudiants ayant un score de tempérament cyclothymique ≥14 a été de 37,4%. Une association a été trouvée entre les troubles de conduites alimentaires et le tempérament affectif cyclothymique que ce soit selon l'approche dimensionnelle (p=0,005) ou selon celle catégorielle (p=0,046). Le tempérament cyclothymique multiplie par deux le risque de développer un TCA chez les étudiants de sexe féminin (p=0,04). Conclusion Es TCA sont fréquents chez nos étudiants particulièrement de sexe féminin. De plus, la présence d'un tempérament cyclothymique associé permettrait de suspecter doublement une appartenance au spectre bipolaire et devrait conduire à une attention particulière de la part du clinicien pour définir au mieux les stratégies thérapeutiques. PMID:25404977
Modelling urea-cycle disorder citrullinemia type 1 with disease-specific iPSCs.
Yoshitoshi-Uebayashi, Elena Yukie; Toyoda, Taro; Yasuda, Katsutaro; Kotaka, Maki; Nomoto, Keiko; Okita, Keisuke; Yasuchika, Kentaro; Okamoto, Shinya; Takubo, Noriyuki; Nishikubo, Toshiya; Soga, Tomoyoshi; Uemoto, Shinji; Osafune, Kenji
2017-05-06
Citrullinemia type 1 (CTLN1) is a urea cycle disorder (UCD) caused by mutations of the ASS1 gene, which is responsible for production of the enzyme argininosuccinate synthetase (ASS), and classically presented as life-threatening hyperammonemia in newborns. Therapeutic options are limited, and neurological sequelae may persist. To understand the pathophysiology and find novel treatments, induced pluripotent stem cells (iPSCs) were generated from a CTLN1 patient and differentiated into hepatocyte-like cells (HLCs). CTLN1-HLCs have lower ureagenesis, recapitulating part of the patient's phenotype. l-arginine, an amino acid clinically used for UCD treatment, improved this phenotype in vitro. Metabolome analysis revealed an increase in tricarboxylic acid (TCA) cycle metabolites in CTLN1, suggesting a connection between CTLN1 and the TCA cycle. This CTLN1-iPSC model improves the understanding of CTLN1 pathophysiology and can be used to pursue new therapeutic approaches. Copyright © 2017 Elsevier Inc. All rights reserved.
Biochemical consequences of alginate encapsulation: a NMR study of insulin-secreting cells.
Simpson, Nicholas E; Grant, Samuel C; Gustavsson, Lenita; Peltonen, Vilje-Mia; Blackband, Stephen J; Constantinidis, Ioannis
2006-04-01
In this study we explore the biochemical consequences of alginate encapsulation on betaTC3 cells. (13)C NMR spectroscopy and isotopomer analysis were used to investigate the effects of encapsulation on several enzymatic processes associated with the TCA cycle. Our data show statistically significant differences in various enzymatic fluxes related to the TCA cycle and insulin secretion between monolayer and alginate-encapsulated cultures. The principal cause for these effects was the process of trypsinization. Embedding the trypsinized cells in alginate beads did not have a compounded effect on the enzymatic fluxes of entrapped cells. However, an additional small but statistically significant decrease in insulin secretion was measured in encapsulated cells. Finally, differences in either enzymatic fluxes or glucose consumption as a function of bead diameter were not observed. However, differences in T(2), assessed by (1)H NMR microimaging, were observed as a function of bead diameter, suggesting that smaller beads became more organized with time in culture, while larger beads displayed a looser organization.
Trivedi, Amit Kumar; Malik, Shalie; Rani, Sangeeta; Kumar, Vinod
2015-06-01
Eukaryotic cells produce chemical energy in the form of ATP by oxidative phosphorylation of metabolic fuels via a series of enzyme mediated biochemical reactions. We propose that the rates of these reactions are altered, as per energy needs of the seasonal metabolic states in avian migrants. To investigate this, blackheaded buntings were photoperiodically induced with non-migratory, premigratory, migratory and post-migratory phenotypes. High plasma levels of free fatty acids, citrate (an intermediate that begins the TCA cycle) and malate dehydrogenase (mdh, an enzyme involved at the end of the TCA cycle) confirmed increased availability of metabolic reserves and substrates to the TCA cycle during the premigratory and migratory states, respectively. Further, daily expression pattern of genes coding for enzymes involved in the oxidative decarboxylation of pyruvate to acetyl-CoA (pdc and pdk) and oxidative phosphorylation in the TCA cycle (cs, odgh, sdhd and mdh) was monitored in the hypothalamus and liver. Reciprocal relationship between pdc and pdk expressions conformed with the altered requirements of acetyl-CoA for the TCA cycle in different metabolic states. Except for pdk, all genes had a daily expression pattern, with high mRNA expression during the day in the premigratory/migratory phenotypes, and at night (cs, odhg, sdhd and mdh) in the nonmigratory phenotype. Differences in mRNA expression patterns of pdc, sdhd and mdh, but not of pdk, cs and odgh, between the hypothalamus and liver indicated a tissue dependent metabolism in buntings. These results suggest the adaptation of oxidative phosphorylation pathway(s) at gene levels to the seasonal alternations in metabolism in migratory songbirds. Copyright © 2015 Elsevier Inc. All rights reserved.
Tiwari, Vivek; Ambadipudi, Susmitha; Patel, Anant B
2013-10-01
The (13)C nuclear magnetic resonance (NMR) studies together with the infusion of (13)C-labeled substrates in rats and humans have provided important insight into brain energy metabolism. In the present study, we have extended a three-compartment metabolic model in mouse to investigate glutamatergic and GABAergic tricarboxylic acid (TCA) cycle and neurotransmitter cycle fluxes across different regions of the brain. The (13)C turnover of amino acids from [1,6-(13)C2]glucose was monitored ex vivo using (1)H-[(13)C]-NMR spectroscopy. The astroglial glutamate pool size, one of the important parameters of the model, was estimated by a short infusion of [2-(13)C]acetate. The ratio Vcyc/VTCA was calculated from the steady-state acetate experiment. The (13)C turnover curves of [4-(13)C]/[3-(13)C]glutamate, [4-(13)C]glutamine, [2-(13)C]/[3-(13)C]GABA, and [3-(13)C]aspartate from [1,6-(13)C2]glucose were analyzed using a three-compartment metabolic model to estimate the rates of the TCA cycle and neurotransmitter cycle associated with glutamatergic and GABAergic neurons. The glutamatergic TCA cycle rate was found to be highest in the cerebral cortex (0.91 ± 0.05 μmol/g per minute) and least in the hippocampal region (0.64 ± 0.07 μmol/g per minute) of the mouse brain. In contrast, the GABAergic TCA cycle flux was found to be highest in the thalamus-hypothalamus (0.28 ± 0.01 μmol/g per minute) and least in the cerebral cortex (0.24 ± 0.02 μmol/g per minute). These findings indicate that the energetics of excitatory and inhibitory function is distinct across the mouse brain.
Optimized keratometry and total corneal astigmatism for toric intraocular lens calculation.
Savini, Giacomo; Næser, Kristian; Schiano-Lomoriello, Domenico; Ducoli, Pietro
2017-09-01
To compare keratometric astigmatism (KA) and different modalities of measuring total corneal astigmatism (TCA) for toric intraocular lens (IOL) calculation and optimize corneal measurements to eliminate the residual refractive astigmatism. G.B. Bietti Foundation IRCCS, Rome, Italy. Prospective case series. Patients who had a toric IOL were enrolled. Preoperatively, a Scheimpflug camera (Pentacam HR) was used to measure TCA through ray tracing. Different combinations of measurements at a 3.0 mm diameter, centered on the pupil or the corneal vertex and performed along a ring or within it, were compared. Keratometric astigmatism was measured using the same Scheimpflug camera and a corneal topographer (Keratron). Astigmatism was analyzed with Næser's polar value method. The optimized preoperative corneal astigmatism was back-calculated from the postoperative refractive astigmatism. The study comprised 62 patients (64 eyes). With both devices, KA produced an overcorrection of with-the-rule (WTR) astigmatism by 0.6 diopter (D) and an undercorrection of against-the-rule (ATR) astigmatism by 0.3 D. The lowest meridional error in refractive astigmatism was achieved by the TCA pupil/zone measurement in WTR eyes (0.27 D overcorrection) and the TCA apex/zone measurement in ATR eyes (0.07 D undercorrection). In the whole sample, no measurement allowed more than 43.75% of eyes to yield an absolute error in astigmatism magnitude lower than 0.5 D. Optimized astigmatism values increased the percentage of eyes with this error up to 57.81%, with no difference compared with the Barrett calculator and the Abulafia-Koch calculator. Compared with KA, TCA improved calculations for toric IOLs; however, optimization of corneal astigmatism measurements led to more accurate results. Copyright © 2017 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.
Age-related changes in with-the-rule and oblique corneal astigmatism.
Naeser, Kristian; Savini, Giacomo; Bregnhøj, Jesper Flethøj
2018-01-25
To describe the age-related changes in with-the-rule (WTR) and oblique keratometric astigmatism (KA), posterior corneal astigmatism (PCA) and total corneal astigmatism (TCA). We used a Pentacam HR (high-resolution) rotating Scheimpflug camera to determine the KA, PCA and TCA in the right eyes of 710 patients, aged from 20 to 88 years. The age-related changes along the vertical, horizontal and oblique meridians were analyzed with Naeser's polar value method in a cross-sectional study. In the whole group, all meridional astigmatic powers and polar values were stable in the age groups from 20 to 49 years, followed by a 1.0 dioptre (D) against-the-rule (ATR) change in KA and TCA, and a 0.12 D reduction in against-the-rule PCA. A nasal rotation of the steep meridian in KA and TCA was noted in the 70-88 years old. The PCA averaged approximately 0.25 D ATR in all age groups. Females displayed the same early astigmatic stability as in the whole group, while male eyes demonstrated a linear decay from 1.5 D WTR at 20 years to 0.5 D ATR astigmatism for the oldest patients. Corneal astigmatism is stable until the age of 50 years; thereafter both keratometric and total corneal astigmatism show a 0.25 D ATR change per 10 years. The average 0.25 D ATR PCA compensates the predominant keratometric WTR astigmatism in the younger patients and increases the TCA in the elderly with keratometric ATR astigmatism. The gender-based differences in age-related astigmatism require further studies. © 2018 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Sungkyoon; Kim, David; Pollack, Gary M.
2009-07-01
Trichloroethylene (TCE) is a well-known carcinogen in rodents and concerns exist regarding its potential carcinogenicity in humans. Oxidative metabolites of TCE, such as dichloroacetic acid (DCA) and trichloroacetic acid (TCA), are thought to be hepatotoxic and carcinogenic in mice. The reactive products of glutathione conjugation, such as S-(1,2-dichlorovinyl)-L-cysteine (DCVC), and S-(1,2-dichlorovinyl) glutathione (DCVG), are associated with renal toxicity in rats. Recently, we developed a new analytical method for simultaneous assessment of these TCE metabolites in small-volume biological samples. Since important gaps remain in our understanding of the pharmacokinetics of TCE and its metabolites, we studied a time-course of DCA, TCA,more » DCVG and DCVG formation and elimination after a single oral dose of 2100 mg/kg TCE in male B6C3F1 mice. Based on systemic concentration-time data, we constructed multi-compartment models to explore the kinetic properties of the formation and disposition of TCE metabolites, as well as the source of DCA formation. We conclude that TCE-oxide is the most likely source of DCA. According to the best-fit model, bioavailability of oral TCE was {approx} 74%, and the half-life and clearance of each metabolite in the mouse were as follows: DCA: 0.6 h, 0.081 ml/h; TCA: 12 h, 3.80 ml/h; DCVG: 1.4 h, 16.8 ml/h; DCVC: 1.2 h, 176 ml/h. In B6C3F1 mice, oxidative metabolites are formed in much greater quantities ({approx} 3600 fold difference) than glutathione-conjugative metabolites. In addition, DCA is produced to a very limited extent relative to TCA, while most of DCVG is converted into DCVC. These pharmacokinetic studies provide insight into the kinetic properties of four key biomarkers of TCE toxicity in the mouse, representing novel information that can be used in risk assessment.« less
Elshereksi, Nidal W; Ghazali, Mariyam J; Muchtar, Andanastuti; Azhari, Che H
2017-01-01
This study aimed to fabricate and characterise silanated and titanated nanobarium titanate (NBT) filled poly(methyl methacrylate) (PMMA) denture base composites and to evaluate the behaviour of a titanate coupling agent (TCA) as an alternative coupling agent to silane. The effect of filler surface modification on fracture toughness was also studied. Silanated, titanated and pure NBT at 5% were incorporated in PMMA matrix. Neat PMMA matrix served as a control. NBT was sonicated in MMA prior to mixing with the PMMA. Curing was carried out using a water bath at 75°C for 1.5h and then at 100°C for 30min. NBT was characterised via Fourier transform-infrared spectroscopy (FTIR), Transmission Electron Microscopy (TEM) and Brunauer-Emmett-Teller (BET) analysis before and after surface modification. The porosity and fracture toughness of the PMMA nanocomposites (n=6, for each formulation and test) were also evaluated. NBT was successfully functionalised by the coupling agents. The TCA exhibited the lowest percentage of porosity (0.09%), whereas silane revealed 0.53% porosity. Statistically significant differences in fracture toughness were observed among the fracture toughness values of the tested samples (p<0.05). While the fracture toughness of untreated samples was reduced by 8%, an enhancement of 25% was achieved after titanation. In addition, the fracture toughness of the titanated samples was higher than the silanated ones by 10%. Formation of a monolayer on the surface of TCA enhanced the NBT dispersion, however agglomeration of silanated NBT was observed due to insufficient coverage of NBT surface. Such behaviour led to reducing the porosity level and improving fracture toughness of titanated NBT/PMMA composites. Thus, TCA seemed to be more effective than silane. Minimising the porosity level could have the potential to reduce fungus growth on denture base resin to be hygienically accepTable Such enhancements obtained with Ti-NBT could lead to promotion of the composites' longevity. Copyright © 2016 Elsevier Ltd. All rights reserved.
Leukemia cells demonstrate a different metabolic perturbation provoked by 2-deoxyglucose.
Miwa, Hiroshi; Shikami, Masato; Goto, Mineaki; Mizuno, Shohei; Takahashi, Miyuki; Tsunekawa-Imai, Norikazu; Ishikawa, Takamasa; Mizutani, Motonori; Horio, Tomohiro; Gotou, Mayuko; Yamamoto, Hidesuke; Wakabayashi, Motohiro; Watarai, Masaya; Hanamura, Ichiro; Imamura, Akira; Mihara, Hidetsugu; Nitta, Masakazu
2013-05-01
The shift in energy metabolism from oxidative phosphorylation to glycolysis can serve as a target for the inhibition of cancer growth. Here, we examined the metabolic changes induced by 2-deoxyglucose (2-DG), a glycolysis inhibitor, in leukemia cells by metabolome analysis. NB4 cells mainly utilized glucose as an energy source by glycolysis and oxidative phosphorylation in mitochondria, since metabolites in the glycolytic pathway and in the tricarboxylic acid (TCA) cycle were significantly decreased by 2-DG. In THP-1 cells, metabolites in the TCA cycle were not decreased to the same extent by 2-DG as in NB4 cells, which indicates that THP-1 utilizes energy sources other than glucose. TCA cycle metabolites in THP-1 cells may be derived from acetyl-CoA by fatty acid β-oxidation, which was supported by abundant detection of carnitine and acetylcarnitine in THP-1 cells. 2-DG treatment increased the levels of pentose phosphate pathway (PPP) metabolites and augmented the generation of NADPH by glucose-6-phosphate dehydrogenase. An increase in NADPH and upregulation of glutathione synthetase expression resulted in the increase in the reduced form of glutathione by 2-DG in NB4 cells. We demonstrated that a combination of 2-DG and inhibition of PPP by dehydroepiandrosterone (DHEA) effectively suppressed the growth of NB4 cells. The replenishment of the TCA cycle by fatty acid oxidation by carnitine palmitoyltransferase in THP-1 cells, treated by 2-DG, might be regulated by AMPK, as the combination of 2-DG and inhibition of AMPK by compound C potently suppressed the growth of THP-1 cells. Although 2-DG has been effective in preclinical and clinical studies, this treatment has not been fully explored due to concerns related to potential toxicities such as brain toxicity at high doses. We demonstrated that a combination of 2-DG and DHEA or compound C at a relatively low concentration effectively inhibits the growth of NB4 and THP-1 cells, respectively. These observations may aid in the identification of appropriate combinations of metabolic inhibitors at low concentrations which do not cause toxicities.
Kim, Sungkyoon; Kim, David; Pollack, Gary M.; Collins, Leonard B.; Rusyn, Ivan
2009-01-01
Trichloroethylene (TCE) is a well-known carcinogen in rodents and concerns exist regarding its potential carcinogenicity in humans. Oxidative metabolites of TCE, such as dichloroacetic acid (DCA) and trichloroacetic acid (TCA), are thought to be hepatotoxic and carcinogenic in mice. The reactive products of glutathione conjugation, such as S-(1,2-dichlorovinyl)-L-cysteine (DCVC), and S-(1,2-dichlorovinyl) glutathione (DCVG), are associated with renal toxicity in rats. Recently, we developed a new analytical method for simultaneous assessment of these TCE metabolites in small-volume biological samples. Since important gaps remain in our understanding of the pharmacokinetics of TCE and its metabolites, we studied a time-course of DCA, TCA, DCVG and DCVG formation and elimination after a single oral dose of 2100 mg/kg TCE in male B6C3F1 mice. Based on systemic concentration-time data, we constructed multi-compartment models to explore the kinetic properties of the formation and disposition of TCE metabolites, as well as the source of DCA formation. We conclude that TCE-oxide is the most likely source of DCA. According to the best-fit model, bioavailability of oral TCE was ~74%, and the half-life and clearance of each metabolite in the mouse were as follows: DCA: 0.6 hr, 0.081 ml/hr; TCA: 12 hr, 3.80 ml/hr; DCVG: 1.4 hr, 16.8 ml/hr; DCVC: 1.2 hr, 176 ml/hr. In B6C3F1 mice, oxidative metabolites are formed in much greater quantities (~3600 fold difference) than glutathione-conjugative metabolites. In addition, DCA is produced to a very limited extent relative to TCA, while most of DCVG is converted into DCVC. These pharmacokinetic studies provide insight into the kinetic properties of four key biomarkers of TCE toxicity in the mouse, representing novel information that can be used in risk assessment. PMID:19409406
Garrido-Sanz, Daniel; Manzano, Javier; Martín, Marta; Redondo-Nieto, Miguel; Rivilla, Rafael
2018-01-01
Polychlorinated biphenyls (PCBs) are widespread persistent pollutants that cause several adverse health effects. Aerobic bioremediation of PCBs involves the activity of either one bacterial species or a microbial consortium. Using multiple species will enhance the range of PCB congeners co-metabolized since different PCB-degrading microorganisms exhibit different substrate specificity. We have isolated a bacterial consortium by successive enrichment culture using biphenyl (analog of PCBs) as the sole carbon and energy source. This consortium is able to grow on biphenyl, benzoate, and protocatechuate. Whole-community DNA extracted from the consortium was used to analyze biodiversity by Illumina sequencing of a 16S rRNA gene amplicon library and to determine the metagenome by whole-genome shotgun Illumina sequencing. Biodiversity analysis shows that the consortium consists of 24 operational taxonomic units (≥97% identity). The consortium is dominated by strains belonging to the genus Pseudomonas, but also contains betaproteobacteria and Rhodococcus strains. whole-genome shotgun (WGS) analysis resulted in contigs containing 78.3 Mbp of sequenced DNA, representing around 65% of the expected DNA in the consortium. Bioinformatic analysis of this metagenome has identified the genes encoding the enzymes implicated in three pathways for the conversion of biphenyl to benzoate and five pathways from benzoate to tricarboxylic acid (TCA) cycle intermediates, allowing us to model the whole biodegradation network. By genus assignment of coding sequences, we have also been able to determine that the three biphenyl to benzoate pathways are carried out by Rhodococcus strains. In turn, strains belonging to Pseudomonas and Bordetella are the main responsible of three of the benzoate to TCA pathways while the benzoate conversion into TCA cycle intermediates via benzoyl-CoA and the catechol meta-cleavage pathways are carried out by beta proteobacteria belonging to genera such as Achromobacter and Variovorax. We have isolated a Rhodococcus strain WAY2 from the consortium which contains the genes encoding the three biphenyl to benzoate pathways indicating that this strain is responsible for all the biphenyl to benzoate transformations. The presented results show that metagenomic analysis of consortia allows the identification of bacteria active in biodegradation processes and the assignment of specific reactions and pathways to specific bacterial groups. PMID:29497412
Tu, Wenwen; Lei, Jianping; Ju, Huangxian
2009-01-01
A functional composite of single-walled carbon nanotubes (SWNTs) with hematin, a water-insoluble porphyrin, was first prepared in 1-butyl-3-methylimidazolium hexafluorophosphate ([BMIM][PF(6)]) ionic liquid. The novel composite in ionic liquid was characterized by scanning electron microscopy, ultraviolet absorption spectroscopy, and electrochemical impedance spectroscopy, and showed a pair of direct redox peaks of the Fe(III)/Fe(II) couple. The composite-[BMIM][PF(6)]-modified glassy carbon electrode showed excellent electrocatalytic activity toward the reduction of trichloroacetic acid (TCA) in neutral media due to the synergic effect among SWNTs, [BMIM][PF(6)], and porphyrin, which led to a highly sensitive and stable amperometric biosensor for TCA with a linear range from 9.0x10(-7) to 1.4x10(-4) M. The detection limit was 3.8x10(-7) M at a signal-to-noise ratio of 3. The TCA biosensor had good analytical performance, such as rapid response, good reproducibility, and acceptable accuracy, and could be successfully used for the detection of residual TCA in polluted water. The functional composite in ionic liquid provides a facile way to not only obtain the direct electrochemistry of water-insoluble porphyrin, but also construct novel biosensors for monitoring analytes in real environmental samples.
Optimization of Evans blue quantitation in limited rat tissue samples
Wang, Hwai-Lee; Lai, Ted Weita
2014-01-01
Evans blue dye (EBD) is an inert tracer that measures plasma volume in human subjects and vascular permeability in animal models. Quantitation of EBD can be difficult when dye concentration in the sample is limited, such as when extravasated dye is measured in the blood-brain barrier (BBB) intact brain. The procedure described here used a very small volume (30 µl) per sample replicate, which enabled high-throughput measurements of the EBD concentration based on a standard 96-well plate reader. First, ethanol ensured a consistent optic path length in each well and substantially enhanced the sensitivity of EBD fluorescence spectroscopy. Second, trichloroacetic acid (TCA) removed false-positive EBD measurements as a result of biological solutes and partially extracted EBD into the supernatant. Moreover, a 1:2 volume ratio of 50% TCA ([TCA final] = 33.3%) optimally extracted EBD from the rat plasma protein-EBD complex in vitro and in vivo, and 1:2 and 1:3 weight-volume ratios of 50% TCA optimally extracted extravasated EBD from the rat brain and liver, respectively, in vivo. This procedure is particularly useful in the detection of EBD extravasation into the BBB-intact brain, but it can also be applied to detect dye extravasation into tissues where vascular permeability is less limiting. PMID:25300427
Optimization of Evans blue quantitation in limited rat tissue samples
NASA Astrophysics Data System (ADS)
Wang, Hwai-Lee; Lai, Ted Weita
2014-10-01
Evans blue dye (EBD) is an inert tracer that measures plasma volume in human subjects and vascular permeability in animal models. Quantitation of EBD can be difficult when dye concentration in the sample is limited, such as when extravasated dye is measured in the blood-brain barrier (BBB) intact brain. The procedure described here used a very small volume (30 µl) per sample replicate, which enabled high-throughput measurements of the EBD concentration based on a standard 96-well plate reader. First, ethanol ensured a consistent optic path length in each well and substantially enhanced the sensitivity of EBD fluorescence spectroscopy. Second, trichloroacetic acid (TCA) removed false-positive EBD measurements as a result of biological solutes and partially extracted EBD into the supernatant. Moreover, a 1:2 volume ratio of 50% TCA ([TCA final] = 33.3%) optimally extracted EBD from the rat plasma protein-EBD complex in vitro and in vivo, and 1:2 and 1:3 weight-volume ratios of 50% TCA optimally extracted extravasated EBD from the rat brain and liver, respectively, in vivo. This procedure is particularly useful in the detection of EBD extravasation into the BBB-intact brain, but it can also be applied to detect dye extravasation into tissues where vascular permeability is less limiting.
Pan, Yao; Wei, Xuetao; Hao, Weidong
2015-08-28
Trichloroethylene (TCE) is an occupational and ubiquitous environmental contaminant, and TCE exposure will increase the risk of autoimmune diseases and allergic diseases. T cells play an important role in the pathogenesis of TCE-related immune disorders, but the effect of TCE and its oxidative metabolites, trichloroacetic acid (TCA) and dichloroacetic acid (DCA), on the activation of human T cells is still unknown. In this study, Jurkat cells were pre-treated with TCE, TCA and DCA overnight and then stimulated with phorbol 12-myristate 13-acetate and ionomycin for another 4, 8 and 24 hours. IL-2 secretion was detected by ELISA; the expressions of CD25 and CD69 were tested by flow cytometry; and IFN-γ and IL-2 mRNA expression levels were investigated by real-time PCR. The results showed that TCE and its oxidative metabolites, TCA and DCA, significantly enhanced IL-2 releasing and the expression of T cell activation markers, CD25 and CD69. Consistent with this result, these compounds markedly up-regulated the expression levels of IFN-γ and IL-2 mRNA. Collectively, these findings suggest that TCE and its metabolites, TCA and DCA, might enhance the activation of T cells and disrupt various activities of peripheral T cells.
Pan, Yao; Wei, Xuetao; Hao, Weidong
2015-01-01
Trichloroethylene (TCE) is an occupational and ubiquitous environmental contaminant, and TCE exposure will increase the risk of autoimmune diseases and allergic diseases. T cells play an important role in the pathogenesis of TCE-related immune disorders, but the effect of TCE and its oxidative metabolites, trichloroacetic acid (TCA) and dichloroacetic acid (DCA), on the activation of human T cells is still unknown. In this study, Jurkat cells were pre-treated with TCE, TCA and DCA overnight and then stimulated with phorbol 12-myristate 13-acetate and ionomycin for another 4, 8 and 24 hours. IL-2 secretion was detected by ELISA; the expressions of CD25 and CD69 were tested by flow cytometry; and IFN-γ and IL-2 mRNA expression levels were investigated by real-time PCR. The results showed that TCE and its oxidative metabolites, TCA and DCA, significantly enhanced IL-2 releasing and the expression of T cell activation markers, CD25 and CD69. Consistent with this result, these compounds markedly up-regulated the expression levels of IFN-γ and IL-2 mRNA. Collectively, these findings suggest that TCE and its metabolites, TCA and DCA, might enhance the activation of T cells and disrupt various activities of peripheral T cells. PMID:26343699
Viscous Design of TCA Configuration
NASA Technical Reports Server (NTRS)
Krist, Steven E.; Bauer, Steven X. S.; Campbell, Richard L.
1999-01-01
The goal in this effort is to redesign the baseline TCA configuration for improved performance at both supersonic and transonic cruise. Viscous analyses are conducted with OVERFLOW, a Navier-Stokes code for overset grids, using PEGSUS to compute the interpolations between overset grids. Viscous designs are conducted with OVERDISC, a script which couples OVERFLOW with the Constrained Direct Iterative Surface Curvature (CDISC) inverse design method. The successful execution of any computational fluid dynamics (CFD) based aerodynamic design method for complex configurations requires an efficient method for regenerating the computational grids to account for modifications to the configuration shape. The first section of this presentation deals with the automated regridding procedure used to generate overset grids for the fuselage/wing/diverter/nacelle configurations analysed in this effort. The second section outlines the procedures utilized to conduct OVERDISC inverse designs. The third section briefly covers the work conducted by Dick Campbell, in which a dual-point design at Mach 2.4 and 0.9 was attempted using OVERDISC; the initial configuration from which this design effort was started is an early version of the optimized shape for the TCA configuration developed by the Boeing Commercial Airplane Group (BCAG), which eventually evolved into the NCV design. The final section presents results from application of the Natural Flow Wing design philosophy to the TCA configuration.
Nasri Nasrabadi, Mohammad Reza; Razavi, Seyed Hadi
2010-04-01
In this work, we applied statistical experimental design to a fed-batch process for optimization of tricarboxylic acid cycle (TCA) intermediates in order to achieve high-level production of canthaxanthin from Dietzia natronolimnaea HS-1 cultured in beet molasses. A fractional factorial design (screening test) was first conducted on five TCA cycle intermediates. Out of the five TCA cycle intermediates investigated via screening tests, alfaketoglutarate, oxaloacetate and succinate were selected based on their statistically significant (P<0.05) and positive effects on canthaxanthin production. These significant factors were optimized by means of response surface methodology (RSM) in order to achieve high-level production of canthaxanthin. The experimental results of the RSM were fitted with a second-order polynomial equation by means of a multiple regression technique to identify the relationship between canthaxanthin production and the three TCA cycle intermediates. By means of this statistical design under a fed-batch process, the optimum conditions required to achieve the highest level of canthaxanthin (13172 + or - 25 microg l(-1)) were determined as follows: alfaketoglutarate, 9.69 mM; oxaloacetate, 8.68 mM; succinate, 8.51 mM. Copyright 2009 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Lu, Ming; Zhu, Xiao-Hong; Zhang, Yi; Mateescu, Gheorghe; Chen, Wei
2017-11-01
Quantitative assessment of cerebral glucose consumption rate (CMR glc ) and tricarboxylic acid cycle flux (V TCA ) is crucial for understanding neuroenergetics under physiopathological conditions. In this study, we report a novel in vivo Deuterium ( 2 H) MRS (DMRS) approach for simultaneously measuring and quantifying CMR glc and V TCA in rat brains at 16.4 Tesla. Following a brief infusion of deuterated glucose, dynamic changes of isotope-labeled glucose, glutamate/glutamine (Glx) and water contents in the brain can be robustly monitored from their well-resolved 2 H resonances. Dynamic DMRS glucose and Glx data were employed to determine CMR glc and V TCA concurrently. To test the sensitivity of this method in response to altered glucose metabolism, two brain conditions with different anesthetics were investigated. Increased CMR glc (0.46 vs. 0.28 µmol/g/min) and V TCA (0.96 vs. 0.6 µmol/g/min) were found in rats under morphine as compared to deeper anesthesia using 2% isoflurane. This study demonstrates the feasibility and new utility of the in vivo DMRS approach to assess cerebral glucose metabolic rates at high/ultrahigh field. It provides an alternative MRS tool for in vivo study of metabolic coupling relationship between aerobic and anaerobic glucose metabolisms in brain under physiopathological states.
Wang, Wenbing; Wu, Yanqing; Zhang, Chi
2017-03-01
Anaerobic microorganisms were applied to degrade organic contaminants in groundwater with permeable reactive barriers (PRBs). However, anaerobic microorganisms need to select optimal immobilizing material as carrier. The potential of high-density natural luffa sponge (HDLS) (a new variety of luffa) for the immobilization and protection of anaerobic microorganisms was investigated. The HDLS has a dense structure composed of a complicated interwoven fibrous network. Therefore, the abrasion rate of HDLS (0.0068 g s -1 ) was the smallest among the four carriers [HDLS, ordinary natural luffa sponge (OLS), polyurethane sponge (PS), and gel carrier AQUAPOROUSGEL (APG)]. The results suggest that it also had the greatest water retention (10.26 H 2 O-g dry carrier-g -1 ) and SS retention (0.21 g dry carrier-g -1 ). In comparison to well-established commercialized gel carrier APG, HDLS was of much better mechanical strength, hydrophilicity and stability. Microbial-immobilized HDLS also had the best performance for the remediation of 1,1,1-TCA simulated groundwater. Analysis of the clone libraries from microorganism-immobilized HDLS showed the HDLS could protect microorganisms from the toxicity of 1,1,1-TCA and maintain the stability of microbial community diversity. The mechanism of HDLS immobilizing and protecting microorganisms was proposed as follows. The HDLS had a micron-scale honeycomb structure (30-40 μm) and an irregular ravine structure (4-20 μm), which facilitate the immobilization of anaerobic microorganisms and protect the anaerobic microorganisms.
In vitro inhibition of OATP-mediated uptake of phalloidin using bile acid derivatives
DOE Office of Scientific and Technical Information (OSTI.GOV)
Herraez, Elisa; Macias, Rocio I.R.; Vazquez-Tato, Jose
2009-08-15
Hepatocyte uptake of phalloidin is carried out mainly by OATP1B1. We have used this compound as a prototypic substrate and assayed the ability to inhibit OATP-mediated phalloidin transport of four bile acid derivatives (BALU-1, BALU-2, BALU-3 and BALU-4) that showed positive results in preliminary screening. Using Xenopus laevis oocytes for heterologous expression of transporters, BALUs were found to inhibit taurocholic acid (TCA) transport by OATP1B1 (but not OATP1B3) as well as by rat Oatp1a1, Oatp1a4 and Oatp1b2. The study of their ability to inhibit sodium-dependent bile acid transporters revealed that the four BALUs induced an inhibition of rat Asbt-mediated TCAmore » transport, which was similar to TCA-induced self-inhibition. Regarding human NTCP and rat Ntcp, BALU-1 differs from the other three BALUS in its lack of effect on TCA transport by these proteins. Using HPLC-MS/MS and CHO cells stably expressing OATP1B1 the ability of BALU-1 to inhibit the uptake of phalloidin itself by this transporter was confirmed. Kinetic analysis using X. laevis oocytes revealed that BALU-1-induced inhibition of OATP1B1 was mainly due to a competitive mechanism (Ki = 8 {mu}M). In conclusion, BALU-1 may be useful as a pharmacological tool to inhibit the uptake of compounds mainly taken up by OATP1B1 presumably without impairing bile acid uptake by the major carrier accounting for this process, i.e., NTCP.« less
Hutton, Jennie; Dent, Andrew; Buykx, Penny; Burgess, Stephen; Flander, Louisa; Dietze, Paul
2010-01-01
To describe the characteristics of non-fatal medication-related ambulance attendances in Melbourne. A retrospective analysis of 16 705 patient care records completed by ambulance paramedics in Melbourne where medications had a causal role in the attendance. A single medication only was implicated in 11 765 cases (70% of the total). Of these, 85% involved one of six types of medication: benzodiazepines (52%), paracetamol (15%), selective serotonin re-uptake inhibitors (6.5%), combination paracetamol and opioids (4%), phenothiazines (3.4%) and tricyclic antidepressants (TCA) (3.7%). Cases involving benzodiazepines were significantly (P < 0.001) older (Average = 37 years) than those involving paracetamol (Average = 30 years). Thirty-four per cent of cases involved concurrent alcohol use, and this varied according to drug type (paracetamol 26%, benzodiazepines 40%, selective serotonin re-uptake inhibitors 35%, paracetamol and opioids 35%). An abnormal Glasgow Coma Scale score was found in 19% of cases, again varying according to drug type (paracetamol 10%, TCA 39%, benzodiazepines 21%, paracetamol and opioids 17%, phenothiazines 15%). Ten per cent of cases were not transported to hospital ranging from 3% for TCA to 13% for benzodiazepines. The majority of non-fatal medication events attended by ambulance paramedics involve one of six substances. Benzodiazepines were most commonly implicated and, as management may require only simple supportive treatment, significant numbers are not transported to hospital. The unique clinical population is identified in this study and the ongoing medical and psychiatric treatment of these patients not transported to hospital in the study period needs to be considered.
Design verification test matrix development for the STME thrust chamber assembly
NASA Technical Reports Server (NTRS)
Dexter, Carol E.; Elam, Sandra K.; Sparks, David L.
1993-01-01
This report presents the results of the test matrix development for design verification at the component level for the National Launch System (NLS) space transportation main engine (STME) thrust chamber assembly (TCA) components including the following: injector, combustion chamber, and nozzle. A systematic approach was used in the development of the minimum recommended TCA matrix resulting in a minimum number of hardware units and a minimum number of hot fire tests.
Imaging Prostate Cancer (PCa) Phenotype and Evolution
2016-10-01
inhibit growth of some but not all cell lines. 2. Keywords: Deferiprone, aconitase, metabolism, tricarboxylic acid cycle , magnetic resonance 3...TRAMP C2 and MycCaP cell proliferation, migration, and invasiveness. Determine if knockdown of m-acon and Deferiprone inhibit TCA cycle activity...migration and inhibits TCA cycle (metabolism). Similarly in vivo (Aim 2), we 6 Fig. 2: Effect of DFP on in vivo growth of MycCaP (left) and TRAMP C2
2008-11-01
CTC CCA CAG TGC CCC AGG TTA GAA CGG TCA GCA GAA TAG-2a 62 528 AGC GGC GGG CTG AAG GA GAG GGT AGG GTG GTC ATT GTG TCA TAG-2b 62 401 AGC GGC GGG CTG AAG...64:388–393 66. Zhang L, Conejo-Garcia JR, Katsaros D, Gimotty PA, Massobrio M, Regnani G, Makrigiannakis A, Gray H, Schlienger K, Liebman MN, Rubin SC
Environment impacts the metabolic dependencies of Ras-driven non-small cell lung cancer
Davidson, Shawn M.; Papagiannakopoulos, Thales; Olenchock, Benjamin A.; Heyman, Julia E.; Keibler, Mark A.; Luengo, Alba; Bauer, Matthew R.; Jha, Abhishek K.; O’Brien, James P.; Pierce, Kerry A.; Gui, Dan Y.; Sullivan, Lucas B.; Wasylenko, Thomas M.; Subbaraj, Lakshmipriya; Chin, Christopher R.; Stephanopolous, Gregory; Mott, Bryan T.; Jacks, Tyler; Clish, Clary B.; Vander Heiden, Matthew G.
2016-01-01
SUMMARY Cultured cells convert glucose to lactate and glutamine is the major source of tricarboxylic acid (TCA) cycle carbon, but whether the same metabolic phenotype is found in tumors is less studied. We infused mice with lung cancers with isotope-labeled glucose or glutamine and compared the fate of these nutrients in tumor and normal tissue. As expected, lung tumors exhibit increased lactate production from glucose. However, glutamine utilization by both lung tumors and normal lung was minimal, with lung tumors showing increased glucose contribution to the TCA cycle relative to normal lung tissue. Deletion of enzymes involved in glucose oxidation demonstrates that glucose carbon contribution to the TCA cycle is required for tumor formation. These data suggest that understanding nutrient utilization by tumors can predict metabolic dependencies of cancers in vivo. Furthermore, these data argue that the in vivo environment is an important determinant of the metabolic phenotype of cancer cells. PMID:26853747
Eddhif, Balkis; Guignard, Nadia; Batonneau, Yann; Clarhaut, Jonathan; Papot, Sébastien; Geffroy-Rodier, Claude; Poinot, Pauline
2018-04-01
The data presented here are related to the research paper entitled "Study of a Novel Agent for TCA Precipitated Proteins Washing - Comprehensive Insights into the Role of Ethanol/HCl on Molten Globule State by Multi-Spectroscopic Analyses" (Eddhif et al., submitted for publication) [1]. The suitability of ethanol/HCl for the washing of TCA-precipitated proteins was first investigated on standard solution of HSA, cellulase, ribonuclease and lysozyme. Recoveries were assessed by one-dimensional gel electrophoresis, Bradford assays and UPLC-HRMS. The mechanistic that triggers protein conformational changes at each purification stage was then investigated by Raman spectroscopy and spectrofluorometry. Finally, the efficiency of the method was evaluated on three different complex samples (mouse liver, river biofilm, loamy soil surface). Proteins profiling was assessed by gel electrophoresis and by UPLC-HRMS.
Origin of the Reductive Tricarboxylic Acid (rTCA) Cycle-Type CO2 Fixation: A Perspective
Fujishima, Kosuke
2017-01-01
The reductive tricarboxylic acid (rTCA) cycle is among the most plausible candidates for the first autotrophic metabolism in the earliest life. Extant enzymes fixing CO2 in this cycle contain cofactors at the catalytic centers, but it is unlikely that the protein/cofactor system emerged at once in a prebiotic process. Here, we discuss the feasibility of non-enzymatic cofactor-assisted drive of the rTCA reactions in the primitive Earth environments, particularly focusing on the acetyl-CoA conversion to pyruvate. Based on the energetic and mechanistic aspects of this reaction, we propose that the deep-sea hydrothermal vent environments with active electricity generation in the presence of various sulfide catalysts are a promising setting for it to progress. Our view supports the theory of an autotrophic origin of life from primordial carbon assimilation within a sulfide-rich hydrothermal vent.
Cara Status and Upcoming Enhancements
NASA Technical Reports Server (NTRS)
Newman, Lauri
2015-01-01
RIC Miss Values in Summary TableTabular presentation of miss vector in Summary Section RIC Uncertainty Values in Details SectionNumerical presentation of miss component uncertainty values in Details SectionGreen Events with Potentially Maneuverable Secondary ObjectsAll potentially maneuverable secondary objects will be reported out to 7-days prior to TCA for LEO events and 10-days for NONLEO events, regardless of risk (relates to MOWG Action Item 1309-11) All green events with potentially active secondary objects included in Summary ReportsAllows more time for contacting other OOBlack Box FixSometimes a black square appeared in the summary report where the ASW RIC time history plot should beAppendix Orbit RegimeMission Name MismatchPc 0 Plotting BugAll Pc points less than 1e-10 (zero) are now plotted as 1e-10 (instead of not at all)Maneuver Indication FixManeuver indicator now present even if maneuver was in the past.
Prat, Chantal; Besalú, Emili; Bañeras, Lluís; Anticó, Enriqueta
2011-06-15
The volatile fraction of aqueous cork macerates of tainted and non-tainted agglomerate cork stoppers was analysed by headspace solid-phase microextraction (HS-SPME)/gas chromatography. Twenty compounds containing terpenoids, aliphatic alcohols, lignin-related compounds and others were selected and analysed in individual corks. Cork stoppers were previously classified in six different classes according to sensory descriptions including, 2,4,6-trichloroanisole taint and other frequent, non-characteristic odours found in cork. A multivariate analysis of the chromatographic data of 20 selected chemical compounds using linear discriminant analysis models helped in the differentiation of the a priori made groups. The discriminant model selected five compounds as the best combination. Selected compounds appear in the model in the following order; 2,4,6 TCA, fenchyl alcohol, 1-octen-3-ol, benzyl alcohol and benzothiazole. Unfortunately, not all six a priori differentiated sensory classes were clearly discriminated in the model, probably indicating that no measurable differences exist in the chromatographic data for some categories. The predictive analyses of a refined model in which two sensory classes were fused together resulted in a good classification. Prediction rates of control (non-tainted), TCA, musty-earthy-vegetative, vegetative and chemical descriptions were 100%, 100%, 85%, 67.3% and 100%, respectively, when the modified model was used. The multivariate analysis of chromatographic data will help in the classification of stoppers and provide a perfect complement to sensory analyses. Copyright © 2010 Elsevier Ltd. All rights reserved.
NASA Technical Reports Server (NTRS)
Fikes, John C.
2014-01-01
The objective of this project is to hot fire test an additively manufactured thrust chamber assembly TCA (injector and thrust chamber). GRC will install the additively manufactured Inconel 625 injector, two additively manufactured (SLM) water cooled Cu-Cr thrust chamber barrels and one additively manufactured (SLM) water cooled Cu-Cr thrust chamber nozzle on the test stand in Cell 32 and perform hot fire testing of the integrated TCA.
Bañeras, Lluís; Trias, Rosalia; Godayol, Anna; Cerdán, Laura; Nawrath, Thorben; Schulz, Stefan; Anticó, Enriqueta
2013-06-15
We investigated the pyrazine production of 23 Pseudomonas isolates obtained from cork in order to assess their implications in off-flavour development. Off-flavour development in cork stoppers is a crucial process in maintaining the high quality of some wines. Pyrazine production was analyzed by headspace solid-phase-microextraction (HS-SPME) and gas chromatography coupled with mass spectrometry (GC-MS). Five out of the 23 isolates, i.e. Pseudomonas koreensis TCA20, Pseudomonas palleroniana TCA16, Pseudomonas putida TCA23 and N7, and Pseudomonas stutzeri TRA27a were able to produce branched alkyl-substituted pyrazines. For isolates N7 and TCA16, 14 compounds could be identified as pyrazines. The use of mineral media supplemented with different carbon and nitrogen sources resulted in changes in the pyrazine production capacity. In the two strains the amount of pyrazines produced was higher with glucose and decreased significantly with lactate. In all cases, 2,5-di(1-methylethyl)pyrazine was found to be dominant and independent of amino acid addition, suggesting a completely de novo synthesis. Aroma descriptions of most alkyl substituted pyrazines include mild vegetal aromas, not necessarily undesirable for the cork manufacturing industry. Methoxypyrazines, exhibiting earthy and musty aromas, could not be detected in any of the strains analysed. Copyright © 2012 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Patterson, Bradley M.; Lee, Matthew; Bastow, Trevor P.; Wilson, John T.; Donn, Michael J.; Furness, Andrew; Goodwin, Bryan; Manefield, Mike
2016-05-01
A permeable reactive barrier, consisting of both zero valent iron (ZVI) and a biodegradable organic carbon, was evaluated for the remediation of 1,1,2-trichloroethane (1,1,2-TCA) contaminated groundwater. During an 888 day laboratory column study, degradation rates initially stabilized with a degradation half-life of 4.4 ± 0.4 days. Based on the accumulation of vinyl chloride (VC) and limited production of 1,1-dichloroethene (1,1-DCE) and 1,2-dichloroethane (1,2-DCA), the dominant degradation pathway was likely abiotic dichloroelimination to form VC. Degradation of VC was not observed based on the accumulation of VC and limited ethene production. After a step reduction in the influent concentration of 1,1,2-TCA from 170 ± 20 mg L- 1 to 39 ± 11 mg L- 1, the degradation half-life decreased 5-fold to 0.83 ± 0.17 days. The isotopic enrichment factor of 1,1,2-TCA also changed after the step reduction from - 14.6 ± 0.7‰ to - 0.72 ± 0.12‰, suggesting a possible change in the degradation mechanism from abiotic reductive degradation to biodegradation. Microbiological data suggested a co-culture of Desulfitobacterium and Dehalococcoides was responsible for the biodegradation of 1,1,2-TCA to ethene.
Sato, Kyousuke; Nishina, Yasuzou; Shiga, Kiyoshi; Tanaka, Fumio
2003-01-01
The dynamic natures of two hydrogen-bonding model systems, riboflavin tetrabutylate (RFTB)-trichloroacetic acid (TCA) and RFTB-phenol in benzene, and of electron-transferring flavoprotein (ETF) from pig kidney upon excitation of flavins was investigated by means of steady state and time-resolved fluorescence spectroscopy. In both model systems fluorescence intensities of RFTB decreased as TCA or phenol was added. The spectral characteristics of ETF under steady state excitation were quite similar to those of the RFTB-TCA system, but not to those of the RFTB-phenol system. The observed fluorescence decay curves of ETF fit well with the calculated decay curves with two lifetime components, as in the model systems. Averaged lifetime was 0.9 ns. The time-resolved fluorescence spectrum of ETF shifted toward longer wavelength with time after pulsed excitation, which was also observed in the RFTB-TCA system. In the RFTB-phenol system the emission spectrum did not shift at all with time. These results reveal that the dynamic nature of ETF can be ascribed to aliphatic hydrogen-bonding(s) of the isoalloxazine ring with surrounding amino acid(s). From the fluorescence characteristics of ETF in comparison with the model systems, human ETF and other flavoproteins, it was suggested that ETF from pig kidney does not contain Tyr-16 in the beta subunit, unlike human ETF.
Moubasher, Alaa E A; Youssef, Eman M K; Abou-Taleb, Doaa A E
2014-08-01
Melasma is a common disorder of facial hyperpigmentation that is often resistant to treatment. To evaluate the efficacy of trichloroacetic acid (TCA) peeling in comparison with double frequency Q-switched neodymium-doped:yttrium aluminum garnet (QS-Nd:YAG) laser in the treatment of melasma. Sixty-five adult Egyptian female patients with melasma were enrolled in this study. Wood light was used for determination of the histological type of melasma. The patients were divided into 4 groups according to treatment modalities: peeling with different concentrations of TCA and double frequency QS-Nd:YAG laser. Trichloroacetic acid peeling was performed every 2 weeks up to 8 sessions, whereas laser treatment was performed every month up to 6 sessions. Melasma area and severity index (MASI) score was used before and after treatment for evaluation. Improvement percentage of MASI score was significantly higher among patients treated with TCA 25% (p < .001). Epidermal type of melasma was significantly improved compared with the dermal type (p = .0029). Q-switched neodymium-doped:yttrium aluminum garnet laser showed the highest incidence of postinflammatory hyperpigmentation (53.3%). Trichloroacetic acid peeling is effective in the treatment of melasma, TCA 25% was the most effective concentration. Q-switched neodymium-doped:yttrium aluminum garnet laser is not recommended in the treatment of melasma because it was associated with the highest incidence of complications.
Ding, Ning; Chen, Qian; Zhu, Zhanling; Peng, Ling; Ge, Shunfeng; Jiang, Yuanmao
2017-10-26
In order to define the effects of fruit crop load on the distribution and utilization of carbon and nitrogen in dwarf apple trees, we conducted three crop load levels (High-crop load, 6 fruits per trunk cross-sectional area (cm 2 , TCA)), Medium-crop load (4 fruits cm -2 TCA), Low-crop load (2 fruits cm -2 TCA)) in 2014 and 2015. The results indicated that the 15 N derived from fertilizer (Ndff) values of fruits decreased with the reduction of crop load, but the Ndff values of annual branches, leaves and roots increased. The plant 15 N-urea utilization rates on Medium and Low-crop load were 1.12-1.35 times higher than the High-crop load. With the reduction of crop load, the distribution rate of 13 C and 15 N in fruits was gradually reduced, but in contrast, the distribution of 13 C and 15 N gradually increased in annual branches, leaves and roots. Compared with High-crop load, the Medium and Low-crop load significantly improved fruit quality p < 0.05. Hence, controlling fruit load effectively regulated the distribution of carbon and nitrogen in plants, improved the nitrogen utilization rate and fruit quality. The appropriate crop load level for mature M.26 interstocks apple orchards was deemed to be 4.0 fruits cm -2 TCA.
van Rossum, Harmen M.; Kozak, Barbara U.; Niemeijer, Matthijs S.; Duine, Hendrik J.; Luttik, Marijke A. H.; Boer, Viktor M.; Kötter, Peter; Daran, Jean-Marc G.; van Maris, Antonius J. A.
2016-01-01
Pyruvate and acetyl-coenzyme A, located at the interface between glycolysis and TCA cycle, are important intermediates in yeast metabolism and key precursors for industrially relevant products. Rational engineering of their supply requires knowledge of compensatory reactions that replace predominant pathways when these are inactivated. This study investigates effects of individual and combined mutations that inactivate the mitochondrial pyruvate-dehydrogenase (PDH) complex, extramitochondrial citrate synthase (Cit2) and mitochondrial CoA-transferase (Ach1) in Saccharomyces cerevisiae. Additionally, strains with a constitutively expressed carnitine shuttle were constructed and analyzed. A predominant role of the PDH complex in linking glycolysis and TCA cycle in glucose-grown batch cultures could be functionally replaced by the combined activity of the cytosolic PDH bypass and Cit2. Strongly impaired growth and a high incidence of respiratory deficiency in pda1Δ ach1Δ strains showed that synthesis of intramitochondrial acetyl-CoA as a metabolic precursor requires activity of either the PDH complex or Ach1. Constitutive overexpression of AGP2, HNM1, YAT2, YAT1, CRC1 and CAT2 enabled the carnitine shuttle to efficiently link glycolysis and TCA cycle in l-carnitine-supplemented, glucose-grown batch cultures. Strains in which all known reactions at the glycolysis-TCA cycle interface were inactivated still grew slowly on glucose, indicating additional flexibility at this key metabolic junction. PMID:26895788
Gluconeogenesis from labeled carbon: estimating isotope dilution
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kelleher, J.K.
1986-03-01
To estimate the rate of gluconeogenesis from steady-state incorporation of labeled 3-carbon precursors into glucose, isotope dilution must be considered so that the rate of labeling of glucose can be quantitatively converted to the rate of gluconeogenesis. An expression for the value of this isotope dilution can be derived using mathematical techniques and a model of the tricarboxylic acid (TCA) cycle. The present investigation employs a more complex model than that used in previous studies. This model includes the following pathways that may affect the correction for isotope dilution: 1) flux of 3-carbon precursor to the oxaloacetate pool via acetyl-CoAmore » and the TCA cycle; 2) flux of 4- or 5-carbon compounds into the TCA cycle; 3) reversible flux between oxaloacetate (OAA) and pyruvate and between OAA and fumarate; 4) incomplete equilibrium between OAA pools; and 5) isotope dilution of 3-carbon tracers between the experimentally measured pool and the precursor for the TCA-cycle OAA pool. Experimental tests are outlined which investigators can use to determine whether these pathways are significant in a specific steady-state system. The study indicated that flux through these five pathways can significantly affect the correction for isotope dilution. To correct for the effects of these pathways an alternative method for calculating isotope dilution is proposed using citrate to relate the specific activities of acetyl-CoA and OAA.« less
Demonstration of the Gore Module for Passive Ground Water Sampling
2014-06-01
ix ACRONYMS AND ABBREVIATIONS % RSD percent relative standard deviation 12DCA 1,2-dichloroethane 112TCA 1,1,2-trichloroethane 1122TetCA...Analysis of Variance ROD Record of Decision RSD relative standard deviation SBR Southern Bush River SVOC semi-volatile organic compound...replicate samples had a relative standard deviation ( RSD ) that was 20% or less. For the remaining analytes (PCE, cDCE, and chloroform), at least 70
Glaubitz, Ulrike; Li, Xia; Schaedel, Sandra; Erban, Alexander; Sulpice, Ronan; Kopka, Joachim; Hincha, Dirk K; Zuther, Ellen
2017-01-01
Transcript and metabolite profiling were performed on leaves from six rice cultivars under high night temperature (HNT) condition. Six genes were identified as central for HNT response encoding proteins involved in transcription regulation, signal transduction, protein-protein interactions, jasmonate response and the biosynthesis of secondary metabolites. Sensitive cultivars showed specific changes in transcript abundance including abiotic stress responses, changes of cell wall-related genes, of ABA signaling and secondary metabolism. Additionally, metabolite profiles revealed a highly activated TCA cycle under HNT and concomitantly increased levels in pathways branching off that could be corroborated by enzyme activity measurements. Integrated data analysis using clustering based on one-dimensional self-organizing maps identified two profiles highly correlated with HNT sensitivity. The sensitivity profile included genes of the functional bins abiotic stress, hormone metabolism, cell wall, signaling, redox state, transcription factors, secondary metabolites and defence genes. In the tolerance profile, similar bins were affected with slight differences in hormone metabolism and transcription factor responses. Metabolites of the two profiles revealed involvement of GABA signaling, thus providing a link to the TCA cycle status in sensitive cultivars and of myo-inositol as precursor for inositol phosphates linking jasmonate signaling to the HNT response specifically in tolerant cultivars. © 2016 John Wiley & Sons Ltd.
Wang, Li; Cheung, Man Kit; Liu, Rulong; Wong, Chong Kim; Kwan, Hoi Shan; Hwang, Jiang-Shiou
2017-04-01
Shallow-water hydrothermal vents (HTVs) are an ecologically important habitat with a geographic origin similar to that of deep-sea HTVs. Studies on shallow-water HTVs have not only facilitated understanding of the influences of vents on local ecosystems but also helped to extend the knowledge on deep-sea vents. In this study, the diversity of bacterial communities in the sediments of shallow-water HTVs off Kueishan Island, Taiwan, was investigated by examining the 16S ribosomal RNA gene as well as key functional genes involved in chemoautotrophic carbon fixation (aclB, cbbL and cbbM). In the vent area, Sulfurovum and Sulfurimonas of Epsilonproteobacteria appeared to dominate the benthic bacterial community. Results of aclB gene analysis also suggested involvement of these bacteria in carbon fixation using the reductive tricarboxylic acid (rTCA) cycle. Analysis of the cbbM gene showed that Alphaproteobacterial members such as the purple non-sulfur bacteria were the major chemoautotrophic bacteria involving in carbon fixation via the Calvin-Benson-Bassham (CBB) cycle. However, they only accounted for <2% of the total bacterial community in the vent area. These findings suggest that the rTCA cycle is the major chemoautotrophic carbon fixation pathway in sediments of the shallow-water HTVs off Kueishan Island.
Mukherjee, Joy; Ow, Saw Yen; Noirel, Josselin; Biggs, Catherine A
2011-02-01
Cell surface physicochemical characterization techniques were combined with quantitative changes in protein expression, to investigate the biological and biophysical changes of Escherichia coli MG1655 cells when grown as a biofilm (BIO). The overall surface charge of BIO cells was found to be less negative, highlighting the need for a lower electrophoretic mobility for attachment to occur. Comparison of the chemical functional groups on the cell surface showed similar profiles, with the absorbance intensity higher for proteins and carbohydrates in the BIO cells. Quantitative proteomic analysis demonstrated that 3 proteins were significantly increased, and 9 proteins significantly decreased in abundance, in cells grown as a BIO compared to their planktonic counterparts, with 7 of these total 12 proteins unique to this study. Proteins showing significant increased or decreased abundance include proteins involved in acid resistance, DNA protection and binding and ABC transporters. Further predictive analysis of the metabolic pathways showed an increased abundance of the amino acid metabolism and tricarboxylic acid (TCA) cycle, with a decrease in expression within the pentose phosphate and glycolysis pathways. It is therefore hypothesized that cells grown as a BIO are still energetically viable potentially using amino acids as an indirect carbon backbone source into the TCA cycle. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rates of bone loss among women initiating antidepressant medication use in midlife.
Diem, Susan J; Ruppert, Kristine; Cauley, Jane A; Lian, YinJuan; Bromberger, Joyce T; Finkelstein, Joel S; Greendale, Gail A; Solomon, Daniel H
2013-11-01
Concern has been raised that medications that block serotonin reuptake may affect bone metabolism, resulting in bone loss. The aim of the study was to compare annual bone mineral density (BMD) changes among new users of selective serotonin reuptake inhibitors (SSRIs), new users of tricyclic antidepressants (TCAs), and nonusers of antidepressant medications. We conducted a prospective cohort study at five clinical centers in the United States. The study included 1972 community-dwelling women, aged 42 years and older, enrolled in the Study of Women's Health Across the Nation (SWAN). The use of antidepressant medications was assessed by interview and verified from medication containers at annual visits. Subjects were categorized as nonusers (no SSRI or TCA use at any examination), SSRI users (initiated SSRI use after the baseline SWAN visit), or TCA users (initiated TCA use after the baseline visit), using a computerized dictionary to categorize type of medication. BMD at the lumbar spine, total hip, and femoral neck was measured using dual-energy x-ray absorptiometry at annual visits. BMD was compared among 311 new users of SSRIs, 71 new users of TCAs, and 1590 nonusers. After adjustment for potential confounders, including age, race, body mass index, menopausal status, and hormone therapy use, mean lumbar spine BMD decreased on average 0.68% per year in nonusers, 0.63% per year in SSRI users (P = .37 for comparison to nonusers), and 0.40% per year in TCA users (P = .16 for comparison to nonusers). At the total hip and femoral neck, there was also no evidence that SSRI or TCA users had an increased rate of bone loss compared with nonusers. Results were similar in subgroups of women stratified by the Center for Epidemiologic Studies Depression Scale (<16 vs ≥16). In this cohort of middle-aged women, use of SSRIs and TCAs was not associated with an increased rate of bone loss at the spine, total hip, or femoral neck.
[Life-style in eating behavior disorders].
Calvo Viñuela, I; Aroca Palencia, J; Armero Fuster, M; Díaz Gómez, J; Rico Hernández, M A
2002-01-01
To identify the eating habits and lifestyles of patients with eating behaviour disorders (TCA in its Spanish acronym) who attended our out-patients' clinic at the "La Paz" Teaching Hospital for the first time. A questionnaire was drafted to which patients responded freely and anthropometric data were assessed. The sample comprised 94 patients who were subsequently distributed into two groups: the first group contained 43 offspring of working mothers (HMTF) and the second 46 offspring of mothers who did not work outside the home (HMNTF in its Spanish acronym). In the case of the 5 remaining patients, their mothers had deceased. The results from the group as a whole showed the following lifestyles for Monday-Friday: 34.4% eat alone, 72% watch television while they eat and 68.1% use restrictive behaviour in their eating habits. When assessing the existence of a friend with TCA, the results were significantly higher among those under the age of 20 years (53.7%) versus those older than 20 (26.9%) (p < 0.05). No differences were found in the habits and nutritional status of HMTF and HMNTF since 8.2% of the first had severe caloric malnutrition versus 2.3% in the second group. While 12.2% of the HMTF group eat outside the home on weekdays and 44.9% of them eat alone, 20.5% of the HMNTF group eat outside the home on weekdays and 22.7% of them eat alone. The age of onset of TCA was significantly earlier among the HMTF group (16.6 years) than in the HMNTF group (19.0 years) (p < 0.05). A large number of subjects had a friend with TCA in their close environment and this situation was more frequent among the youngest ones in the group. Some mistaken ideas regarding food have favoured unhealthy eating: in our group a large majority of people eat while watching TV. The development of TCA occurs earlier in connection with a particular family structure: where the mother works outside the home.
NCV Flow Diagnostic Test Results
NASA Technical Reports Server (NTRS)
Cappuccio, Mina
1999-01-01
There were two objectives for this test. First, was to assess the reasons why there is approximately 1.5 drag counts (cts) discrepancy between measured and computed drag improvement of the Non-linear Cruise Validation (NCV) over the Technology Concept Airplane (TCA) wing body (WB) configurations. The Navier-Stokes (N-S) pre-test predictions from Boeing Commercial Airplane Group (BCAG) show 4.5 drag cts of improvement for NCV over TCA at a lift coefficient (CL) of 0. I at Mach 2.4. The pre-test predictions from Boeing Phantom Works - Long Beach, BPW-LB, show 3.75 drag cts of improvement. BCAG used OVERFLOW and BPW-LB used CFL3D. The first test entry to validate the improvement was held at the NASA Langley Research Center (LARC) UPV;T, test number 1687. The experimental results showed that the drag improvement was only 2.6 cts, not accounting for laminar run and trip drag. This is approximately 1.5 cts less than predicted computationally. In addition to the low Reynolds Number (RN) test, there was a high RN test in the Boeing Supersonic Wind Tunnel (BSWT) of NCV and TCA. BSV@T test 647 showed that the drag improvement of NCV over TCA was also 2.6 cts, but this did account for laminar run and trip drag. Every effort needed to be done to assess if the improvement measured in LaRC UPWT and BSWT was correct. The second objective, once the first objective was met, was to assess the performance increment of NCV over TCA accounting for the associated laminar run and trip drag corrections in LaRC UPWT. We know that the configurations tested have laminar flow on portions of the wing and have trip drag due to the mechanisms used to force the flow to go from laminar to turbulent aft of the transition location.
Mediterranean dryland Mosaic: The effect of scale on core area metrics
NASA Astrophysics Data System (ADS)
Alhamad, Mohammad Noor; Alrababah, Mohammad
2014-05-01
Quantifying landscape spatial pattern is essential to understanding the relationship between landscape structure and ecological functions and process. Many landscape metrics have been developed to quantify spatial heterogeneity. Landscape metrics have been employed to measure the impact of humans on landscapes. We examined the response of four core areas metrics to a large range of grain sizes in Mediterranean dryland landscapes. The investigated metrics were (1) mean core area (CORE-MN), (2) area weighted mean core area (CORE-AM) , (3) total core area (TCA) and (4) core area percentage of landscape (CPLAND) within six land use types (urban, agriculture, olive orchids, forestry, shrubland and rangeland). Agriculture areas showed the highest value for minimum TCA (2779.4 ha) within the tested grain sizes, followed by rangeland (1778.3 ha) and Forest (1488.5 ha). On the other hand, shrubland showed the lowest TCA (8.0 ha). The minimum CPLAND values were ranged from 0.002 for shrubland to 0.682 for agriculture land use. The maximum CORE-MN among the tested land use type at all levels of grain sizes was exhibited by agriculture land use type (519.759 ha). The core area metrics showed three types of behavior in response to changing grain size in all landuse types. CORE-MN showed predictable relationship, best explained by non-linear responses to changing grain size (R2=0.99). Both TCA and CPLAND exhibited domain of scale effect in response to changing grain size. The threshold behavior for TCA and CPLAND was at the 4 x 4 grain size (about 1.3 ha). However, CORE-AM exhibited erratic behavior. The unique domain of scale-like behavior may be attributed to the unique characteristics of dryland Mediterranean landscapes; where both natural processes and ancient human activities play a great role in shaping the apparent pattern of the landscape
Lei, Cheng; Sun, Yuqing; Khan, Eakalak; Chen, Season S; Tsang, Daniel C W; Graham, Nigel J D; Ok, Yong Sik; Yang, Xin; Lin, Daohui; Feng, Yujie; Li, Xiang-Dong
2018-04-01
With the increasing application of hydraulic fracturing, it is urgent to develop an effective and economically feasible method to treat the large volumes of fracturing wastewater. In this study, bare and entrapped nanoscale zero-valent iron (nZVI) were introduced for the removal of carbon tetrachloride (CT) and 1,1,2-trichloroethane (TCA) in model high-salinity fracturing wastewater. With increasing ionic strength (I) from Day-1 (I = 0.35 M) to Day-90 (I = 4.10 M) wastewaters, bare nZVI presented significantly lower removal efficiency of CT (from 53.5% to 38.7%) and 1,1,2-TCA (from 71.1% to 21.7%) and underwent more serious Fe dissolution from 1.31 ± 1.19% in Day-1 to 5.79 ± 0.32% in Day-90 wastewater. Particle aggregation induced by high ionic strength was primarily responsible for the lowered performance of nZVI due to less available reactive sites on nZVI surface. The immobilization of nZVI in alginate with/without polyvinyl alcohol provided resistance to particle aggregation and contributed to the superior performance of entrapped nZVI in Day-90 wastewater for 1,1,2-TCA removal (62.6-72.3%), which also mitigated Fe dissolution (4.00-4.69%). Both adsorption (by polymer matrix) and reduction (by immobilized nZVI) were involved in the 1,1,2-TCA removal by entrapped nZVI. However, after 1-month immersion in synthetic fracturing wastewater, a marked drop in the reactivity of entrapped nZVI for 1,1,2-TCA removal from Day-90 wastewater was observed with significant release of Na and total organic carbon. In summary, bare nZVI was sensitive to the nature of the fracturing wastewater, while the use of environmentally benign entrapped nZVI was more promising for wastewater treatment. Copyright © 2017 Elsevier Ltd. All rights reserved.
Uddin, Md Jamal; Groenwold, Rolf H H; de Boer, Anthonius; Gardarsdottir, Helga; Martin, Elisa; Candore, Gianmario; Belitser, Svetlana V; Hoes, Arno W; Roes, Kit C B; Klungel, Olaf H
2016-03-01
Instrumental variable (IV) analysis can control for unmeasured confounding, yet it has not been widely used in pharmacoepidemiology. We aimed to assess the performance of IV analysis using different IVs in multiple databases in a study of antidepressant use and hip fracture. Information on adults with at least one prescription of a selective serotonin reuptake inhibitor (SSRI) or tricyclic antidepressant (TCA) during 2001-2009 was extracted from the THIN (UK), BIFAP (Spain), and Mondriaan (Netherlands) databases. IVs were created using the proportion of SSRI prescriptions per practice or using the one, five, or ten previous prescriptions by a physician. Data were analysed using conventional Cox regression and two-stage IV models. In the conventional analysis, SSRI (vs. TCA) was associated with an increased risk of hip fracture, which was consistently found across databases: the adjusted hazard ratio (HR) was approximately 1.35 for time-fixed and 1.50 to 2.49 for time-varying SSRI use, while the IV analysis based on the IVs that appeared to satisfy the IV assumptions showed conflicting results, e.g. the adjusted HRs ranged from 0.55 to 2.75 for time-fixed exposure. IVs for time-varying exposure violated at least one IV assumption and were therefore invalid. This multiple database study shows that the performance of IV analysis varied across the databases for time-fixed and time-varying exposures and strongly depends on the definition of IVs. It remains challenging to obtain valid IVs in pharmacoepidemiological studies, particularly for time-varying exposure, and IV analysis should therefore be interpreted cautiously. Copyright © 2016 John Wiley & Sons, Ltd.
Zhang, Huiqing; Guo, Xu; Dai, Jingyao; Wu, Yousheng; Ge, Naijian; Yang, Yefa; Ji, Jiansong; Zhang, Hongxin
2014-11-01
Metabolic reprogramming is an important hallmark of cancer cells, including the alterations of activity and expression in tricarboxylic acid (TCA) cycle key enzymes. Previous studies have reported the associations between tumor formation and three core enzymes involved in the TCA cycle. However, the association between functional single nucleotide polymorphisms (SNPs) in one of TCA cycle key gene isocitrate dehydrogenase (IDH) and the overall survival of hepatocellular carcinoma (HCC) patients treated with transcatheter arterial chemoembolization (TACE) has never been investigated. Five functional SNPs in IDH1 and IDH2 genes were genotyped using the Sequenom iPLEX genotyping system in a cohort of 419 unresectable Chinese HCC patients treated with TACE. Multivariate Cox proportional hazards model and Kaplan-Meier curve were used for the prognosis analysis. We found that SNPs rs12478635 in IDH1 and rs11632348 in IDH2 gene exhibited significant associations with death risk in HCC patients in the dominant model (HR 1.33; 95 % CI 1.02-1.73; P = 0.037) and in recessive model (HR 1.87; 95 % CI 1.27-2.75; P = 0.001), respectively. Moreover, we observed a cumulative effect of these two SNPs on HCC overall survival, indicating a significant trend of death risk increase with increasing number of unfavorable genotypes (P for trend = 0.001). Additionally, our data suggest that unfavorable genotypes of two SNPs may be used as an independent prognostic marker in those with advanced stage and patients with serum AFP <200 μg/L. Our results for the first time suggest that IDH gene polymorphisms may serve as an independent prognostic marker for HCC patients treated with TACE.
Glutamate metabolism in HIV-1 infected macrophages: Role of HIV-1 Vpr.
Datta, Prasun K; Deshmane, Satish; Khalili, Kamel; Merali, Salim; Gordon, John C; Fecchio, Chiara; Barrero, Carlos A
2016-09-01
HIV-1 infected macrophages play a significant role in the neuropathogenesis of AIDS. HIV-1 viral protein R (Vpr) not only facilitates HIV-1 infection but also contribute to long-lived persistence in macrophages. Our previous studies using SILAC-based proteomic analysis showed that the expression of critical metabolic enzymes in the glycolytic pathway and tricarboxylic acid (TCA) cycle were altered in response to Vpr expression in macrophages. We hypothesized that Vpr-induced modulation of glycolysis and TCA cycle regulates glutamate metabolism and release in HIV-1 infected macrophages. We assessed the amount of specific metabolites induced by Vpr and HIV-1 in macrophages at the intracellular and extracellular level in a time-dependent manner utilizing multiple reaction monitoring (MRM) targeted metabolomics. In addition, stable isotope-labeled glucose and an MRM targeted metabolomics assay were used to evaluate the de novo synthesis and release of glutamate in Vpr overexpressing macrophages and HIV-1 infected macrophages, throughout the metabolic flux of glycolytic pathway and TCA cycle activation. The metabolic flux studies demonstrated an increase in glucose uptake, glutamate release and accumulation of α-ketoglutarate (α-KG) and glutamine in the extracellular milieu in Vpr expressing and HIV-1 infected macrophages. Interestingly, glutamate pools and other intracellular intermediates (glucose-6-phosphate (G6P), fructose-6-phosphate (F6P), citrate, malate, α-KG, and glutamine) showed a decreased trend except for fumarate, in contrast to the glutamine accumulation observed in the extracellular space in Vpr overexpressing macrophages. Our studies demonstrate that dysregulation of mitochondrial glutamate metabolism induced by Vpr in HIV-1 infected macrophages commonly seen, may contribute to neurodegeneration via excitotoxic mechanisms in the context of NeuroAIDS.
Glutamate metabolism in HIV-1 infected macrophages: Role of HIV-1 Vpr
Datta, Prasun K.; Deshmane, Satish; Khalili, Kamel; Merali, Salim; Gordon, John C.; Fecchio, Chiara; Barrero, Carlos A.
2016-01-01
ABSTRACT HIV-1 infected macrophages play a significant role in the neuropathogenesis of AIDS. HIV-1 viral protein R (Vpr) not only facilitates HIV-1 infection but also contribute to long-lived persistence in macrophages. Our previous studies using SILAC-based proteomic analysis showed that the expression of critical metabolic enzymes in the glycolytic pathway and tricarboxylic acid (TCA) cycle were altered in response to Vpr expression in macrophages. We hypothesized that Vpr-induced modulation of glycolysis and TCA cycle regulates glutamate metabolism and release in HIV-1 infected macrophages. We assessed the amount of specific metabolites induced by Vpr and HIV-1 in macrophages at the intracellular and extracellular level in a time-dependent manner utilizing multiple reaction monitoring (MRM) targeted metabolomics. In addition, stable isotope-labeled glucose and an MRM targeted metabolomics assay were used to evaluate the de novo synthesis and release of glutamate in Vpr overexpressing macrophages and HIV-1 infected macrophages, throughout the metabolic flux of glycolytic pathway and TCA cycle activation. The metabolic flux studies demonstrated an increase in glucose uptake, glutamate release and accumulation of α-ketoglutarate (α-KG) and glutamine in the extracellular milieu in Vpr expressing and HIV-1 infected macrophages. Interestingly, glutamate pools and other intracellular intermediates (glucose-6-phosphate (G6P), fructose-6-phosphate (F6P), citrate, malate, α-KG, and glutamine) showed a decreased trend except for fumarate, in contrast to the glutamine accumulation observed in the extracellular space in Vpr overexpressing macrophages. Our studies demonstrate that dysregulation of mitochondrial glutamate metabolism induced by Vpr in HIV-1 infected macrophages commonly seen, may contribute to neurodegeneration via excitotoxic mechanisms in the context of NeuroAIDS. PMID:27245560
NASA Astrophysics Data System (ADS)
Guzman, Marcelo I.; Martin, Scot T.
2008-10-01
The carboxylic acids produced by the reductive tricarboxylic acid (rTCA) cycle are possibly a biosynthetic core of initial life, although several steps such as the reductive kinetics of oxaloacetate (OAA) to malate (MA) are problematic by conventional chemical routes. In this context, we studied the kinetics of this reaction as promoted by ZnS mineral photoelectrochemistry. The quantum efficiency φMA of MA production from the photoelectrochemical reduction of OAA followed φMA=0.13 [OAA] (2.1×10-3+[OAA])-1 and was independent of temperature (5 to 50°C). To evaluate the importance of this forward rate under a prebiotic scenario, we also studied the temperature-dependent rate of the backward thermal decarboxylation of OAA to pyruvate (PA), which followed an Arrhenius behavior as log (k-2)=11.74 4956/T, where k-2 is in units of s-1. These measured rates were employed in conjunction with the indirectly estimated carboxylation rate of PA to OAA to assess the possible importance of mineral photoelectrochemistry in the conversion of OAA to MA under several scenarios of prebiotic conditions on early Earth. As an example, our analysis shows that there is 90% efficiency with a forward velocity of 3 yr/cycle for the OAA→MA step of the rTCA cycle at 280 K. Efficiency and velocity both decrease for increasing temperature. These results suggest high viability for mineral photoelectrochemistry as an enzyme-free engine to drive the rTCA cycle through the early aeons of early Earth, at least for the investigated OAA→MA step.
The TCA cycle is not required for selection or survival of multidrug-resistant Salmonella
Ricci, Vito; Loman, Nick; Pallen, Mark; Ivens, Alasdair; Fookes, Maria; Langridge, Gemma C.; Wain, John; Piddock, Laura J. V.
2012-01-01
Objectives The initial aim of this study was to use a systems biology approach to analyse a ciprofloxacin-selected multidrug-resistant (MDR) Salmonella enterica serotype Typhimurium, L664. Methods The whole genome sequence and transcriptome of L664 were analysed. Site-directed mutagenesis to recreate each mutation was carried out, followed by phenotypic characterization and mutation frequency analysis. As a mutation in the TCA cycle was detected we tested the controversial hypothesis regarding the bacterial response to bactericidal antibiotics, put forward by Kohanski et al. (Cell 2007; 130: 797–810 and Mol Cell 2010; 37: 311–20), that exposure of bacteria to agents such as ciprofloxacin produces reactive oxygen species (ROS), which transiently increase the mutation rate giving rise to MDR bacteria. Results L664 contained a mutation in ramR that conferred MDR. A mutation in tctA affected the TCA cycle and conferred the inability to grow on minimal agar. The virulence of L664 was not attenuated. Ciprofloxacin exposure produced ROS in L664 and SL1344 (tctA::aph), but it was reduced and occurred later. There were no significant differences in the rates of killing or mutations per generation to antibiotic resistance between the strains. Conclusions Whilst we confirm production of ROS in response to ciprofloxacin, we have no data to support the hypothesis that this leads to selection of MDR strains. Our results indicate that the mutations in tctA and glgA were random as they did not pre-exist in the parental strain, and that the mutation in tctA did not provide a survival advantage or disadvantage in the presence of antibiotic. PMID:22186876
Khurshed, Mohammed; Molenaar, Remco J; Lenting, Krissie; Leenders, William P; van Noorden, Cornelis J F
2017-07-25
Hotspot mutations in isocitrate dehydrogenase 1 (IDH1) initiate low-grade glioma and secondary glioblastoma and induce a neomorphic activity that converts α-ketoglutarate (α-KG) to the oncometabolite D-2-hydroxyglutarate (D-2-HG). It causes metabolic rewiring that is not fully understood. We investigated the effects of IDH1 mutations (IDH1MUT) on expression of genes that encode for metabolic enzymes by data mining The Cancer Genome Atlas. We analyzed 112 IDH1 wild-type (IDH1WT) versus 399 IDH1MUT low-grade glioma and 157 IDH1WT versus 9 IDH1MUT glioblastoma samples. In both glioma types, IDH1WT was associated with high expression levels of genes encoding enzymes that are involved in glycolysis and acetate anaplerosis, whereas IDH1MUT glioma overexpress genes encoding enzymes that are involved in the oxidative tricarboxylic acid (TCA) cycle. In vitro, we observed that IDH1MUT cancer cells have a higher basal respiration compared to IDH1WT cancer cells and inhibition of the IDH1MUT shifts the metabolism by decreasing oxygen consumption and increasing glycolysis. Our findings indicate that IDH1WT glioma have a typical Warburg phenotype whereas in IDH1MUT glioma the TCA cycle, rather than glycolytic lactate production, is the predominant metabolic pathway. Our data further suggest that the TCA in IDH1MUT glioma is driven by lactate and glutamate anaplerosis to facilitate production of α-KG, and ultimately D-2-HG. This metabolic rewiring may be a basis for novel therapies for IDH1MUT and IDH1WT glioma.
Rezaei, Mohammad N; Aslankoohi, Elham; Verstrepen, Kevin J; Courtin, Christophe M
2015-07-02
Succinic acid produced by yeast during bread dough fermentation can significantly affect the rheological properties of the dough. By introducing mutations in the model S288C yeast strain, we show that the oxidative pathway of the TCA cycle and the glyoxylate shunt contribute significantly to succinic acid production during dough fermentation. More specifically, deletion of ACO1 and double deletion of ACO1 and ICL1 resulted in a 36 and 77% decrease in succinic acid levels in fermented dough, respectively. Similarly, double deletion of IDH1 and IDP1 decreased succinic acid production by 85%, while also affecting the fermentation rate. By contrast, double deletion of SDH1 and SDH2 resulted in a two-fold higher succinic acid accumulation compared to the wild-type. Deletion of fumarate reductase activity (FRD1 and OSM1) in the reductive pathway of the TCA cycle did not affect the fermentation rate and succinic acid production. The changes in the levels of succinic acid produced by mutants Δidh1Δidp1 (low level) and Δsdh1Δsdh2 (high level) in fermented dough only resulted in small pH differences, reflecting the buffering capacity of dough at a pH of around 5.1. Moreover, Rheofermentometer analysis using these mutants revealed no difference in maximum dough height and gas retention capacity with the dough prepared with S288C. The impact of the changed succinic acid profile on the organoleptic or antimicrobial properties of bread remains to be demonstrated. Copyright © 2015 Elsevier B.V. All rights reserved.
Velimirovic, Milica; Tosco, Tiziana; Uyttebroek, Maarten; Luna, Michela; Gastone, Francesca; De Boer, Cjestmir; Klaas, Norbert; Sapion, Hans; Eisenmann, Heinrich; Larsson, Per-Olof; Braun, Juergen; Sethi, Rajandrea; Bastiaens, Leen
2014-08-01
A pilot injection test with guar gum stabilized microscale zerovalent iron (mZVI) particles was performed at test site V (Belgium) where different chlorinated aliphatic hydrocarbons (CAHs) were present as pollutants in the subsurface. One hundred kilograms of 56μm-diameter mZVI (~70gL(-1)) was suspended in 1.5m(3) of guar gum (~7gL(-1)) solution and injected into the test area. In order to deliver the guar gum stabilized mZVI slurry, one direct push bottom-up injection (Geoprobe) was performed with injections at 5 depths between 10.5 and 8.5m bgs. The direct push technique was preferred above others (e.g. injection at low flow rate via screened wells) because of the limited hydraulic conductivity of the aquifer, and to the large size of the mZVI particles. A final heterogeneous distribution of the mZVI in the porous medium was observed explicable by preferential flow paths created during the high pressure injection. The maximum observed delivery distance was 2.5m. A significant decrease in 1,1,1-TCA concentrations was observed in close vicinity of spots where the highest concentration of mZVI was observed. Carbon stable isotope analysis (CSIA) yielded information on the success of the abiotic degradation of 1,1,1-TCA and indicated a heterogeneous spatio-temporal pattern of degradation. Finally, the obtained results show that mZVI slurries stabilized by guar gum can be prepared at pilot scale and directly injected into low permeable aquifers, indicating a significant removal of 1,1,1-TCA. Copyright © 2014 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Velimirovic, Milica; Tosco, Tiziana; Uyttebroek, Maarten; Luna, Michela; Gastone, Francesca; De Boer, Cjestmir; Klaas, Norbert; Sapion, Hans; Eisenmann, Heinrich; Larsson, Per-Olof; Braun, Juergen; Sethi, Rajandrea; Bastiaens, Leen
2014-08-01
A pilot injection test with guar gum stabilized microscale zerovalent iron (mZVI) particles was performed at test site V (Belgium) where different chlorinated aliphatic hydrocarbons (CAHs) were present as pollutants in the subsurface. One hundred kilograms of 56 μm-diameter mZVI (~ 70 g L- 1) was suspended in 1.5 m3 of guar gum (~ 7 g L- 1) solution and injected into the test area. In order to deliver the guar gum stabilized mZVI slurry, one direct push bottom-up injection (Geoprobe) was performed with injections at 5 depths between 10.5 and 8.5 m bgs. The direct push technique was preferred above others (e.g. injection at low flow rate via screened wells) because of the limited hydraulic conductivity of the aquifer, and to the large size of the mZVI particles. A final heterogeneous distribution of the mZVI in the porous medium was observed explicable by preferential flow paths created during the high pressure injection. The maximum observed delivery distance was 2.5 m. A significant decrease in 1,1,1-TCA concentrations was observed in close vicinity of spots where the highest concentration of mZVI was observed. Carbon stable isotope analysis (CSIA) yielded information on the success of the abiotic degradation of 1,1,1-TCA and indicated a heterogeneous spatio-temporal pattern of degradation. Finally, the obtained results show that mZVI slurries stabilized by guar gum can be prepared at pilot scale and directly injected into low permeable aquifers, indicating a significant removal of 1,1,1-TCA.
Ethanol-Induced Changes in Trichloroethylene Toxicity
1988-09-30
DCA or TCA. METHODS Chei .Ls. [l-14C]palmitoyl-CoA was purchased from New England Nuclear Products (Boston, MA); clofibrate , dichloroacetic acid (DCA...CLASSIFICATION OF _*NIS PAGE All other 04itions are obsolete. UCASFE UNLSSFE 0 . ( 1(A0~, AYOS-Th ච-1 173 .6. Aid (D,’Al and Trichlo’u,:eti: Acid ...published in 1231gj1gg 94 A221i2d EhabgnSggg 21:45-54 1088. Copy of manuscript "Dichloroacetic acid (DCA) and Trichloroacetic Acid (TCA) induced DNA
IRIS Toxicological Review of Trichloroacetic Acid (TCA) ...
EPA is releasing the draft report, Toxicological Review of Trichloroacetic Acid (TCA), that was distributed to Federal agencies and White House Offices for comment during the Science Discussion step of the IRIS Assessment Development Process. Comments received from other Federal agencies and White House Offices are provided below with external peer review panel comments. The draft Toxicological Review of Trichloroacetic Acid provides scientific support and rationale for the hazard identification and dose-response assessment pertaining to chronic exposure to trichloroacetic acid.
Li, C; Li, Q; Cai, Y; He, Y; Lan, X; Wang, W; Liu, J; Wang, S; Zhu, G; Fan, J; Zhou, Y; Sun, R
2016-09-01
Oral squamous cell carcinoma (OSCC) is the most common cancer of the head and neck and is associated with a high rate of lymph node metastasis. The initial step in the metastasis and transition of tumors is epithelial-mesenchymal transition (EMT)-induced angiogenesis, which can be mediated by angiopoietin 2 (ANG2), a key regulatory factor in angiogenesis. In the present study, immunohistochemistry and real-time quantitative reverse transcriptase (qRT-PCR) were used to measure the expression of ANG2 in OSCC tissues. Plasmids encoding ANG2 mRNA were used for increased ANG2 expression in the OSCC cell line TCA8113. The short interfering RNA (siRNA)-targeting ANG2 mRNA sequences were used to inhibit ANG2 expression in TCA8113 cells. Subsequently, transwell assays were performed to examine the effects of ANG2 on TCA8113 cell migration and invasion. Furthermore, in vivo assays were performed to assess the effect of ANG2 on tumor growth. Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assays and immunohistochemistry were used to examine cell apoptosis and angiogenesis in tumor tissues, respectively. Finally, western blot analysis was performed to evaluate tumor formation-related proteins in OSCC tissues. We found that protein expression of ANG2 was remarkably upregulated in OSCC tissues. Overexpression of ANG2 increased the migration and invasion of TCA8113 cells by regulating EMT. Further investigations showed that overexpression of ANG2 increased tumor growth in nude mice, and angiogenesis of OSCC tissues increased in the presence of ANG2 overexpression. Overexpression of ANG2 also reduced cell apoptosis in tumor tissue cells. Finally, we found that overexpression of ANG2 resulted in changes in the expression of tumor formation-related proteins including vimentin, E-cadherin, Bim, PUMA, Bcl-2, Bax, Cyclin D1, PCNA and CD31. Our findings show that ANG2 has an important role in the migration and invasion of OSCC. More importantly, further investigations suggested that overexpression of ANG2 might increase OSCC metastasis by promoting angiogenesis in nude mice. This stimulatory effect could be achieved by inducing abnormal EMT and by reducing apoptosis and increasing proliferation of cells.
PEPCK Coordinates the Regulation of Central Carbon Metabolism to Promote Cancer Cell Growth.
Montal, Emily D; Dewi, Ruby; Bhalla, Kavita; Ou, Lihui; Hwang, Bor Jang; Ropell, Ashley E; Gordon, Chris; Liu, Wan-Ju; DeBerardinis, Ralph J; Sudderth, Jessica; Twaddel, William; Boros, Laszlo G; Shroyer, Kenneth R; Duraisamy, Sekhar; Drapkin, Ronny; Powers, R Scott; Rohde, Jason M; Boxer, Matthew B; Wong, Kwok-Kin; Girnun, Geoffrey D
2015-11-19
Phosphoenolpyruvate carboxykinase (PEPCK) is well known for its role in gluconeogenesis. However, PEPCK is also a key regulator of TCA cycle flux. The TCA cycle integrates glucose, amino acid, and lipid metabolism depending on cellular needs. In addition, biosynthetic pathways crucial to tumor growth require the TCA cycle for the processing of glucose and glutamine derived carbons. We show here an unexpected role for PEPCK in promoting cancer cell proliferation in vitro and in vivo by increasing glucose and glutamine utilization toward anabolic metabolism. Unexpectedly, PEPCK also increased the synthesis of ribose from non-carbohydrate sources, such as glutamine, a phenomenon not previously described. Finally, we show that the effects of PEPCK on glucose metabolism and cell proliferation are in part mediated via activation of mTORC1. Taken together, these data demonstrate a role for PEPCK that links metabolic flux and anabolic pathways to cancer cell proliferation. Copyright © 2015 Elsevier Inc. All rights reserved.
Acquadro, Catherine; Patrick, Donald L; Eremenco, Sonya; Martin, Mona L; Kuliś, Dagmara; Correia, Helena; Conway, Katrin
2017-01-01
This paper presents emerging Good Practices for Translatability Assessment (TA) of Patient-Reported Outcome (PRO) Measures. The ISOQOL Translation and Cultural Adaptation Special Interest Group (TCA-SIG) undertook the review of several TA approaches, with the collaboration of organizations who are involved in conducting TA, and members of the TCA-SIG. The effort led to agreement by the writing group on Good Practices for 1) the terminology to be used in referring to translatability process, 2) the best definition of TA, 3) the methodology that is recommended at each step of the process, 4) the persons involved in TA, 5) the timing of assessment, 6) the review criteria for TA, and 7) the recommendations to be made at the end of the TA process. With input from the TCA-SIG membership and in consultation with experts in the field, these emerging good practices can guide the future use of TA in the development of PROs.
Glutamate and asparagine cataplerosis underlie glutamine addiction in melanoma
Ratnikov, Boris; Aza-Blanc, Pedro; Ronai, Ze'ev A.; Smith, Jeffrey W.; Osterman, Andrei L.; Scott, David A.
2015-01-01
Glutamine dependence is a prominent feature of cancer metabolism, and here we show that melanoma cells, irrespective of their oncogenic background, depend on glutamine for growth. A quantitative audit of how carbon from glutamine is used showed that TCA-cycle-derived glutamate is, in most melanoma cells, the major glutamine-derived cataplerotic output and product of glutaminolysis. In the absence of glutamine, TCA cycle metabolites were liable to depletion through aminotransferase-mediated α-ketoglutarate-to-glutamate conversion and glutamate secretion. Aspartate was an essential cataplerotic output, as melanoma cells demonstrated a limited capacity to salvage external aspartate. Also, the absence of asparagine increased the glutamine requirement, pointing to vulnerability in the aspartate-asparagine biosynthetic pathway within melanoma metabolism. In contrast to melanoma cells, melanocytes could grow in the absence of glutamine. Melanocytes use more glutamine for protein synthesis rather than secreting it as glutamate and are less prone to loss of glutamate and TCA cycle metabolites when starved of glutamine. PMID:25749035
Concurrent planning and execution for a walking robot
NASA Astrophysics Data System (ADS)
Simmons, Reid
1990-07-01
The Planetary Rover project is developing the Ambler, a novel legged robot, and an autonomous software system for walking the Ambler over rough terrain. As part of the project, we have developed a system that integrates perception, planning, and real-time control to navigate a single leg of the robot through complex obstacle courses. The system is integrated using the Task Control Architecture (TCA), a general-purpose set of utilities for building and controlling distributed mobile robot systems. The walking system, as originally implemented, utilized a sequential sense-plan-act control cycle. This report describes efforts to improve the performance of the system by concurrently planning and executing steps. Concurrency was achieved by modifying the existing sequential system to utilize TCA features such as resource management, monitors, temporal constraints, and hierarchical task trees. Performance was increased in excess of 30 percent with only a relatively modest effort to convert and test the system. The results lend support to the utility of using TCA to develop complex mobile robot systems.
Glucose-independent glutamine metabolism via TCA cycling for proliferation and survival in B-cells
Le, Anne; Lane, Andrew N.; Hamaker, Max; Bose, Sminu; Gouw, Arvin; Barbi, Joseph; Tsukamoto, Takashi; Rojas, Camilio J.; Slusher, Barbara S.; Zhang, Haixia; Zimmerman, Lisa J.; Liebler, Daniel C.; Slebos, Robbert J.C.; Lorkiewicz, Pawel K.; Higashi, Richard M.; Fan, Teresa W. M.; Dang, Chi V.
2012-01-01
Summary Because MYC plays a causal role in many human cancers, including those with hypoxic and nutrient-poor tumor microenvironments, we have determined the metabolic responses of a MYC-inducible human Burkitt lymphoma model P493 cell line to aerobic and hypoxic conditions, and to glucose deprivation, using Stable Isotope Resolved Metabolomics. Using [U-13C]-glucose as the tracer, both glucose consumption and lactate production were increased by MYC expression and hypoxia. Using [U-13C,15N]-glutamine as the tracer, glutamine import and metabolism through the TCA cycle persisted under hypoxia, and glutamine contributed significantly to citrate carbons. Under glucose deprivation, glutamine-derived fumarate, malate, and citrate were significantly increased. Their 13C labeling patterns demonstrate an alternative energy-generating glutaminolysis pathway involving a glucose-independent TCA cycle. The essential role of glutamine metabolism in cell survival and proliferation under hypoxia and glucose deficiency, makes them susceptible to the glutaminase inhibitor BPTES, and hence could be targeted for cancer therapy. PMID:22225880
Transparent Conductive Adhesives for Tandem Solar Cells Using Polymer-Particle Composites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Klein, Talysa; Lee, Benjamin G; Schnabel, Manuel
2018-02-14
Transparent conductive adhesives (TCAs) can enable conductivity between two substrates, which is useful for a wide range of electronic devices. Here, we have developed a TCA composed of a polymer-particle blend with ethylene-vinyl acetate as the transparent adhesive and metal-coated flexible poly(methyl methacrylate) microspheres as the conductive particles that can provide conductivity and adhesion regardless of the surface texture. This TCA layer was designed to be nearly transparent, conductive in only the out-of-plane direction, and of practical adhesive strength to hold the substrates together. The series resistance was measured at 0.3 and 0.8 O cm2 for 8 and 0.2% particlemore » coverage, respectively, while remaining over 92% was transparent in both cases. For applications in photovoltaic devices, such as mechanically stacked multijunction III-V/Si cells, a TCA with 1% particle coverage will have less than 0.5% power loss due to the resistance and less than 1% shading loss to the bottom cell.« less
El-Domyati, Moetaz; Abdel-Wahab, Hossam; Hossam, Aliaa
2018-02-01
Minimally invasive procedures provide effective, safe, relatively long-lasting, and natural results without large damage to the skin. A combination treatment is considered an approach that includes at least 2 different and unrelated modalities. This study aims to evaluate the use and effectiveness of some combined minimally invasive procedures for management of acne scarring. Twenty-four volunteers with postacne atrophic scars were randomly divided into 3 equal groups according to performed procedure on each side of the face (microneedling by dermaroller alone or combined with platelet-rich plasma [PRP] or trichloroacetic acid [TCA] 15% peeling) and received 6 bi-weekly sessions of treatment. Photography and punch biopsies were taken before and after 3 months of treatment for clinical, histological, and histometrical evaluation. Combined treatment of dermaroller and PRP or dermaroller and TCA 15% showed significant improvement when compared with dermaroller alone (P = .015 and .011 respectively). Epidermal thickness showed statistically significant increase in studied groups, mainly after dermaroller and TCA 15%. Moreover, the 3 studied groups showed more organized collagen bundles and newly formed collagen formation and markedly decreased abnormal elastic fibers. Based on the clinical, histometrical, and histochemical assessment, inspite that most volunteers showed significant improvement after treatment, however, the combined use of dermaroller and TCA 15% was more effective in postacne atrophic scars than the use of dermaroller and PRP or dermaroller only. © 2017 Wiley Periodicals, Inc.
Hong, Seung-Phil; Han, Seung-Seog; Choi, Seok-Joo; Kim, Myoung-Shin; Won, Chong-Hyun; Lee, Mi-Woo; Choi, Jee-Ho; Moon, Kee-Chan; Kim, Youn Jin; Chang, Sung-Eun
2012-04-01
Fractional photothermolysis (FP) therapy and chemical peels have been reported to be effective in patients with recalcitrant melasma. However, there is little information to compare the efficacy of single treatment session in Asian women. The aim of this study was to examine the efficacy, long-lasting outcomes and safety of a single session of 1550-nm erbium-doped FP in Asian patients, compared with trichloroacetic acid (TCA) peel with a medium depth. Eighteen Korean women (Fitzpatrick skin type III or IV) with moderate-to-severe bilateral melasma were randomly treated with a single session of 1550-nm FP on one cheek, and with a 15% TCA peel on the other cheek. Outcome measures included an objective melasma area severity index and subjective patient-rated overall improvement at 4 and 12 weeks after treatment. Melasma lesions were significantly improved 4 weeks after either treatment, but melasma recurred at 12 weeks. Post-inflammatory hyperpigmentation developed in 28% of patients at 4 weeks but resolved in all but one patient by 12 weeks. There was no difference between FP treatment and TCA peeling with respect to any outcome measure. FP laser and TCA peel treatments were equally effective and safe when used to treat moderate-to-severe melasma, but neither treatment was long-lasting. We suggest that multiple or periodic maintenance treatments and/or supplemental procedures may be required for the successful treatment of melasma in Asian women.
Gottardi, Manuela; Grün, Peter; Bode, Helge B; Hoffmann, Thomas; Schwab, Wilfried; Oreb, Mislav; Boles, Eckhard
2017-12-01
Trans-cinnamic acid (tCA) and hydrocinnamyl alcohol (HcinOH) are valuable aromatic compounds with applications in the flavour, fragrance and cosmetic industry. They can be produced with recombinant yeasts from sugars via phenylalanine after expression of a phenylalanine ammonia lyase (PAL) and an aryl carboxylic acid reductase. Here, we show that in Saccharomyces cerevisiae a PAL enzyme from the bacterium Photorhabdus luminescens was superior to a previously used plant PAL enzyme for the production of tCA. Moreover, after expression of a UDP-glucose:cinnamate glucosyltransferase (FaGT2) from Fragaria x ananassa, tCA could be converted to cinnamoyl-D-glucose which is expected to be less toxic to the yeast cells. Production of tCA and HcinOH from glucose could be increased by eliminating feedback-regulated steps of aromatic amino acid biosynthesis and diminishing the decarboxylation step of the competing Ehrlich pathway. Finally, an unknown by-product resulting from further metabolisation of a carboligation product of cinnamaldehyde (cinALD) with activated acetaldehyde, mediated by pyruvate decarboxylases, could be identified as cinnamyl methyl ketone providing a new route for the biosynthesis of precursors, such as (2S,3R) 5-phenylpent-4-ene-2,3-diol, necessary for the chemical synthesis of specific biologically active drugs such as daunomycin. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Elucidating the role of copper in CHO cell energy metabolism using (13)C metabolic flux analysis.
Nargund, Shilpa; Qiu, Jinshu; Goudar, Chetan T
2015-01-01
(13)C-metabolic flux analysis was used to understand copper deficiency-related restructuring of energy metabolism, which leads to excessive lactate production in recombinant protein-producing CHO cells. Stationary-phase labeling experiments with U-(13)C glucose were conducted on CHO cells grown under high and limiting copper in 3 L fed-batch bioreactors. The resultant labeling patterns of soluble metabolites were measured by GC-MS and used to estimate metabolic fluxes in the central carbon metabolism pathways using OpenFlux. Fluxes were evaluated 300 times from stoichiometrically feasible random guess values and their confidence intervals calculated by Monte Carlo simulations. Results from metabolic flux analysis exhibited significant carbon redistribution throughout the metabolic network in cells under Cu deficiency. Specifically, glycolytic fluxes increased (25%-79% relative to glucose uptake) whereas fluxes through the TCA and pentose phosphate pathway (PPP) were lower (15%-23% and 74%, respectively) compared with the Cu-containing condition. Furthermore, under Cu deficiency, 33% of the flux entering TCA via the pyruvate node was redirected to lactate and malate production. Based on these results, we hypothesize that Cu deficiency disrupts the electron transport chain causing ATP deficiency, redox imbalance, and oxidative stress, which in turn drive copper-deficient CHO cells to produce energy via aerobic glycolysis, which is associated with excessive lactate production, rather than the more efficient route of oxidative phosphorylation. © 2015 American Institute of Chemical Engineers.
Isomerization of α-pinene in the terpentin oil with TCA/Natural Zeolite using microwave irradiation
NASA Astrophysics Data System (ADS)
Wijayati, N.; Supartono; Kusumastuti, E.
2018-04-01
The catalytic potensial of trichloroacetic acid (TCA)//Natural Zeolite in the isomerization of α-pinene in the terpentin oil was investigated. The purpose of this study is to investigate the influence of the power of microvawe on activity and selectivity of catalyst. The main product were champhene, terpinene, limonene, p-cymene, and terpinolene. The highest selectivity was 28.26% with a conversion of 23.25%, whereas the higher conversion was 98.99% with selectivity of 16.90% at room temperature using power of microwave 640 W.
Occupational Health Risks Among Trichloroethylene-Exposed Workers in a Clock Manufacturing Factory
Singthong, Siriporn; Pakkong, Pannee; Choosang, Kantima; Wongsanit, Sarinya
2015-01-01
Trichloroethylene (TCE) is an important volatile organic compound once widely used in industry throughout the world. Occupational exposure to TCE can cause a number of health hazards such as allergic reactions and genetic damage. The purpose of this study was to evaluate occupational exposure to TCE, by analysis of the air in the breathing zone and of urine from workers employed in a clock manufacturing factory. A subjective symptom survey was conducted by using a self-administered questionnaire to evaluate the health hazards. Micronucleus (MN) frequency, based on the cytokinesis-block micronucleus assay (CBMN) in peripheral blood lymphocytes, (PBLs) was used as a biomarker for chromosome damage. A total of 244 participants, including 171 workers occupationally exposed to TCE and 73 non-exposed control employees, working mainly in office jobs in the same factory, were enrolled in this study. Analyses of airborne TCE concentrations in the workplace, and of urinary trichloroacetic acid (TCA) of the workers and controls, were performed by Gas Chromatography-Electron Capture Detector (GC-ECD) using the modified headspace technique. The average concentration of TCE in the workplace breathing zone was 27.83 ± 6.02 ppm. The average level of urinary TCA of the exposed workers and controls was 14.84 ± 1.62, 2.95 ± 0.28 mg/L. The frequency of MN/1000BN was 7.029 ± 0.39, significantly higher than for those in the control group (3.57 ± 0.31, p = 0.001). According to multiple linear regression analysis, the results indicated that urinary TCA levels correlated with the increased MN in exposed workers (r = 0.285, p < 0.001). The prevalence rate of subjective symptoms in the exposed group was 9.61-11.76 times higher than the rate of the non-exposed group (p < 0.001). It was found that skin (29.6%) and respiratory symptoms (21.1%) were the most frequent among the exposed workers. In conclusion, these results indicate that increased micronucleus frequency is associated with occupational trichloroethylene exposure. The use of TCE in the factory is threatening workers’ health. PMID:25560356
Occupational health risks among trichloroethylene-exposed workers in a clock manufacturing factory.
Singthong, Siriporn; Pakkong, Pannee; Choosang, Kantima; Wongsanit, Sarinya
2014-08-22
Trichloroethylene (TCE) is an important volatile organic compound once widely used in industry throughout the world. Occupational exposure to TCE can cause a number of health hazards such as allergic reactions and genetic damage. The purpose of this study was to evaluate occupational exposure to TCE, by analysis of the air in the breathing zone and of urine from workers employed in a clock manufacturing factory. A subjective symptom survey was conducted by using a self-administered questionnaire to evaluate the health hazards. Micronucleus (MN) frequency, based on the cytokinesis-block micronucleus assay (CBMN) in peripheral blood lymphocytes, (PBLs) was used as a biomarker for chromosome damage. A total of 244 participants, including 171 workers occupationally exposed to TCE and 73 non-exposed control employees, working mainly in office jobs in the same factory, were enrolled in this study. Analyses of airborne TCE concentrations in the workplace, and of urinary trichloroacetic acid (TCA) of the workers and controls, were performed by Gas Chromatography-Electron Capture Detector (GC-ECD) using the modified headspace technique. The average concentration of TCE in the workplace breathing zone was 27.83 ± 6.02 ppm. The average level of urinary TCA of the exposed workers and controls was 14.84 ± 1.62, 2.95 ± 0.28 mg/L. The frequency of MN/1000BN was 7.029 ± 0.39, significantly higher than for those in the control group (3.57 ± 0.31, p = 0.001). According to multiple linear regression analysis, the results indicated that urinary TCA levels correlated with the increased MN in exposed workers (r = 0.285, p < 0.001). The prevalence rate of subjective symptoms in the exposed group was 9.61-11.76 times higher than the rate of the non-exposed group (p < 0.001). It was found that skin (29.6%) and respiratory symptoms (21.1%) were the most frequent among the exposed workers. In conclusion, these results indicate that increased micronucleus frequency is associated with occupational trichloroethylene exposure. The use of TCE in the factory is threatening workers' health.
Jeong, J; Bong, J; Kim, G D; Joo, S T; Lee, H-J; Baik, M
2013-10-01
Castration increases intramuscular fat (IMF) deposition, improving beef quality in cattle. The present study was performed to determine the global transcriptome changes following castration of bulls and to identify genes associated with IMF deposition in the longissimus dorsi (LM) of Korean cattle. A customized bovine CombiMatrix oligonucleotide microarray was constructed, and transcriptome changes following castration were determined by microarray hybridization. Transcriptome comparison between bulls and steers indicated that 428 of 8,407 genes were differentially expressed in the LM by greater than two fold (P < 0.05). Gene expression profiling indicated alterations in several pathways, including adipogenesis, fatty acid oxidation, tricarboxylic acid (TCA) cycle, and oxidative phosphorylation (OP), following castration. Castration upregulated transcription of adipogenic perilipin 2 (PLIN2) and visfatin, lipogenic fatty acid synthase, fatty acid esterification 1-acylglycerol-3-phosphate O-acyltransferase 5, and many fatty acid oxidation-related genes. Many TCA cycle and OP genes were also transcriptionally upregulated. Correlation analysis indicated that the IMF content in the LM was highly correlated with mRNA levels of PLIN2 (r = 0.70, P < 0.001), adenosine triphosphatase (ATPase), H(+)-transporting, lysosomal 42 kDa, V1 subunit C1 (ATP6V1C1: r = 0.66, P < 0.001), and cytochrome c oxidase assembly homolog 11 (COX11: r = 0.72, P < 0.001) genes in a pooled animal group of steers plus bulls, and significant correlations in the steer-alone group were maintained in the 3 genes, PLIN2 (r = 0.47, P < 0.05), ATP6V1C1 (r = 0.50, P < 0.05), and COX11 (r = 0.60, P < 0.01). In conclusion, our study provided evidence that castration shifts transcription of lipid metabolism genes, favoring IMF deposition by increasing adipogenesis, lipogenesis, and triglyceride synthesis. This study also indicated that castration increases transcription of genes involved in fatty acid oxidation and subsequent energy production (TCA and OP genes). Our microarray analysis provided novel information that castration alters the transcriptome associated with lipid/energy metabolism, favoring IMF deposition in the LM.
Rodrigues, Silas Pessini; Ventura, José Aires; Zingali, R B; Fernandes, P M B
2009-01-01
A variety of sample preparation protocols for plant proteomic analysis using two-dimensional gel electrophoresis (2-DE) have been reported. However, they usually have to be adapted and further optimised for the analysis of plant species not previously studied. This work aimed to evaluate different sample preparation protocols for analysing Carica papaya L. leaf proteins through 2-DE. Four sample preparation methods were tested: (1) phenol extraction and methanol-ammonium acetate precipitation; (2) no precipitation fractionation; and the traditional trichloroacetic acid-acetone precipitation either (3) with or (4) without protein fractionation. The samples were analysed for their compatibility with SDS-PAGE (1-DE) and 2-DE. Fifteen selected protein spots were trypsinised and analysed by matrix-assisted laser desorption/ionisation time-of-flight tandem mass spectrometry (MALDI-TOF-MS/MS), followed by a protein search using the NCBInr database to accurately identify all proteins. Methods number 3 and 4 resulted in large quantities of protein with good 1-DE separation and were chosen for 2-DE analysis. However, only the TCA method without fractionation (no. 4) proved to be useful. Spot number and resolution advances were achieved, which included having an additional solubilisation step in the conventional TCA method. Moreover, most of the theoretical and experimental protein molecular weight and pI data had similar values, suggesting good focusing and, most importantly, limited protein degradation. The described sample preparation method allows the proteomic analysis of papaya leaves by 2-DE and mass spectrometry (MALDI-TOF-MS/MS). The methods presented can be a starting point for the optimisation of sample preparation protocols for other plant species.
1987-03-01
statistics for storm water quality variables and fractions of phosphorus, solids, and carbon are presented in Tables 7 and 8, respectively. The correlation...matrix and factor analysis (same method as used for baseflow) of storm water quality variables suggested three groups: Group I - TMG, TCA, TNA, TSI...models to predict storm water quality . The 11 static and 3 dynamic storm variables were used as potential dependent variables. All independent and
Metabolite profiling of human colon carcinoma--deregulation of TCA cycle and amino acid turnover.
Denkert, Carsten; Budczies, Jan; Weichert, Wilko; Wohlgemuth, Gert; Scholz, Martin; Kind, Tobias; Niesporek, Silvia; Noske, Aurelia; Buckendahl, Anna; Dietel, Manfred; Fiehn, Oliver
2008-09-18
Apart from genetic alterations, development and progression of colorectal cancer has been linked to influences from nutritional intake, hyperalimentation, and cellular metabolic changes that may be the basis for new diagnostic and therapeutic approaches. However, in contrast to genomics and proteomics, comprehensive metabolomic investigations of alterations in malignant tumors have rarely been conducted. In this study we investigated a set of paired samples of normal colon tissue and colorectal cancer tissue with gas-chromatography time-of-flight mass-spectrometry, which resulted in robust detection of a total of 206 metabolites. Metabolic phenotypes of colon cancer and normal tissues were different at a Bonferroni corrected significance level of p=0.00170 and p=0.00005 for the first two components of an unsupervised PCA analysis. Subsequent supervised analysis found 82 metabolites to be significantly different at p<0.01. Metabolites were connected to abnormalities in metabolic pathways by a new approach that calculates the distance of each pair of metabolites in the KEGG database interaction lattice. Intermediates of the TCA cycle and lipids were found down-regulated in cancer, whereas urea cycle metabolites, purines, pyrimidines and amino acids were generally found at higher levels compared to normal colon mucosa. This study demonstrates that metabolic profiling facilitates biochemical phenotyping of normal and neoplastic colon tissue at high significance levels and points to GC-TOF-based metabolomics as a new method for molecular pathology investigations.
Wedel, Vicki L; Wescott, Daniel J
2016-12-01
The Missouri River in Callaway County, Missouri, flooded in 1993, necessitating salvage excavations at old Shiloh Cemetery, which yielded 11 mostly complete skeletons of African American adolescents and 7 other individuals who died during the mid to late 1800s. The skeletons exhibit evidence of stress normal for the period but no indications of cause of death. The individuals' unusual age distribution and proximity to one another raise the question of how they died. It is possible these individuals died from trauma or chronic or acute disease. Among the possible causes of death is one of the epidemics that swept across Missouri during the 1800s. In this study we counted tooth cementum annulations (TCA) to verify the skeletal age-at-death estimates and conducted dental cementum increment analysis (DCIA) to determine the season of death as a first step in understanding the history of the cemetery. TCA results confirmed that the 11 African-American individuals examined were teenagers. DCIA demonstrated that all of the individuals died between April and September. The burials, therefore, represent a section of a mixed-race cemetery, which included African American teenagers who died during the same season. Future research will attempt to identify whether this burial cohort died of chronic or acute disease, possibly of an epidemic of infectious disease. Copyright © 2015 Elsevier Inc. All rights reserved.
Lu, Qiang; Luo, Qi Shi; Li, Hui; Liu, Yong Di; Gu, Ji Dong; Lin, Kuang Fei; Fei Lin, Kuang
2015-01-01
CAHs, as a cleaning solvent, widely contaminated shallow groundwater with the development of manufacturing in China's Yangtze River Delta. This study focused on the distribution of CAHs, and correlations between CAHs and environmental variables in a shallow groundwater in Shanghai, using kriging interpolation and multifactorial analysis. The results showed that the overall CAHs plume area (above DIV) was approximately 9,000 m(2) and located in the 2-4 m underground, DNAPL was accumulated at an area of approximately 1,400 m(2) and located in the 6-8m sandy silt layer on the top of the muddy silty clay. Heatmap of PPC for CAHs and environmental variables showed that the correlation between "Fe(2+)" and most CAHs such as "1,1,1-TCA", "1,1-DCA", "1,1-DCE" and "%TCA" were significantly positive (p<0.001), but "%CA" and/or "%VC" was not, and "Cl-" was significantly positive correlated with "1,1-DCA" and "1,1-DCE" (p<0.001). The PCA demonstrated that the relative proportions of CAHs in groundwater were mostly controlled by the sources and the natural attenuation. In conclusion, the combination of geographical and chemometrics was helpful to establishing an aerial perspective of CAHs and identifying reasons for the accumulation of toxic dechlorination intermediates, and could become a useful tool for characterizing contaminated sites in general.
Rates of Bone Loss Among Women Initiating Antidepressant Medication Use in Midlife
Ruppert, Kristine; Cauley, Jane A.; Lian, YinJuan; Bromberger, Joyce T.; Finkelstein, Joel S.; Greendale, Gail A.; Solomon, Daniel H.
2013-01-01
Context: Concern has been raised that medications that block serotonin reuptake may affect bone metabolism, resulting in bone loss. Objective: The aim of the study was to compare annual bone mineral density (BMD) changes among new users of selective serotonin reuptake inhibitors (SSRIs), new users of tricyclic antidepressants (TCAs), and nonusers of antidepressant medications. Design and Setting: We conducted a prospective cohort study at five clinical centers in the United States. Participants: The study included 1972 community-dwelling women, aged 42 years and older, enrolled in the Study of Women's Health Across the Nation (SWAN). Exposure: The use of antidepressant medications was assessed by interview and verified from medication containers at annual visits. Subjects were categorized as nonusers (no SSRI or TCA use at any examination), SSRI users (initiated SSRI use after the baseline SWAN visit), or TCA users (initiated TCA use after the baseline visit), using a computerized dictionary to categorize type of medication. Main Outcome Measures: BMD at the lumbar spine, total hip, and femoral neck was measured using dual-energy x-ray absorptiometry at annual visits. Results: BMD was compared among 311 new users of SSRIs, 71 new users of TCAs, and 1590 nonusers. After adjustment for potential confounders, including age, race, body mass index, menopausal status, and hormone therapy use, mean lumbar spine BMD decreased on average 0.68% per year in nonusers, 0.63% per year in SSRI users (P = .37 for comparison to nonusers), and 0.40% per year in TCA users (P = .16 for comparison to nonusers). At the total hip and femoral neck, there was also no evidence that SSRI or TCA users had an increased rate of bone loss compared with nonusers. Results were similar in subgroups of women stratified by the Center for Epidemiologic Studies Depression Scale (<16 vs ≥16). Conclusions: In this cohort of middle-aged women, use of SSRIs and TCAs was not associated with an increased rate of bone loss at the spine, total hip, or femoral neck. PMID:24001746
NASA Astrophysics Data System (ADS)
K, Deepak; Roy, Amit; Anjaneyulu, P.; Kandaiah, Sakthivel; Pinjare, Sampatrao L.
2017-10-01
The charge transport mechanism in copper ions containing 1,3,5-Triazine-2,4,6-trithiolate (CuTCA) based polymer device in sandwich (Ag/CuTCA/Cu) geometry is studied. The current-voltage (I-V) characteristics of the metallopolymer CuTCA device have shown a transition in the charge transport mechanism from Ohmic to Space-charge limited conduction when temperature and voltage are varied. The carriers in CuTCA devices exhibit hopping transport, in which carriers hop from one site to the other. The hole mobility in this polymer device is found to be dependent on electric field E ( μpα√{E } ) and temperature, which suggests that the polymer has inherent disorder. The electric-field coefficient γ and zero-field mobility μ0 are temperature dependent. The values of mobility and activation energies are estimated from temperature (90-140 K) dependent charge transport studies and found to be in the range of 1 × 10-11-8 × 10-12 m2/(V s) and 16.5 meV, respectively. Temperature dependent electric-field coefficient γ is in the order of 17.8 × 10-4 (m/V)1/2, and the value of zero-field mobility μ0 is in the order of 1.2 × 10-11 m2/(V s) at 140 K. A constant phase element (Q) is used to model the device parameters, which are extracted using the Impedance spectroscopy technique. The bandgap of the polymer is estimated to be 2.6 eV from UV-Vis reflectance spectra.
PEPCK-M expression in mouse liver potentiates, not replaces, PEPCK-C mediated gluconeogenesis
Méndez-Lucas, Andrés; Duarte, João; Sunny, Nishanth E.; Satapati, Santhosh; He, TianTeng; Fu, Xiaorong; Bermúdez, Jordi; Burgess, Shawn C.; Perales, Jose C.
2013-01-01
Background & Aims Hepatic gluconeogenesis helps maintain systemic energy homeostasis by compensating for discontinuities in nutrient supply. Liver specific deletion of cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) abolishes gluconeogenesis from mitochondrial substrates, deregulates lipid metabolism and affects TCA cycle. While, mouse liver almost exclusively expresses PEPCK-C, humans equally present a mitochondrial isozyme (PEPCK-M). Despite clear relevance to human physiology, the role of PEPCK-M and its gluconeogenic potential remain unknown. Here, we test the significance of PEPCK-M in gluconeogenesis and TCA cycle function in liver-specific PEPCK-C knockout and WT mice. Methods The effects of the overexpression of PEPCK-M were examined by a combination of tracer studies and molecular biology techniques. Partial PEPCK-C re-expression was used as a positive control. Metabolic fluxes were evaluated in isolated livers by NMR using 2H and 13C tracers. Gluconeogenic potential, together with metabolic profiling, were investigated in vivo and in primary hepatocytes. Results PEPCK-M expression partially rescued defects in lipid metabolism, gluconeogenesis and TCA cycle function impaired by PEPCK-C deletion, while ~10% re-expression of PEPCK-C normalized most parameters. When PEPCK-M was expressed in the presence of PEPCK-C, the mitochondrial isozyme amplified total gluconeogenic capacity, suggesting autonomous regulation of oxaloacetate to phosphoenolpyruvate fluxes by the individual isoforms. Conclusions We conclude that PEPCK-M has gluconeogenic potential per se, and cooperates with PEPCK-C to adjust gluconeogenic/TCA flux to changes in substrate or energy availability, hinting at a role in the regulation of glucose and lipid metabolism in human liver. PMID:23466304
Rainer, Peter P; Primessnig, Uwe; Harenkamp, Sandra; Doleschal, Bernhard; Wallner, Markus; Fauler, Guenter; Stojakovic, Tatjana; Wachter, Rolf; Yates, Ameli; Groschner, Klaus; Trauner, Michael; Pieske, Burkert M; von Lewinski, Dirk
2013-11-01
High bile acid serum concentrations have been implicated in cardiac disease, particularly in arrhythmias. Most data originate from in vitro studies and animal models. We tested the hypotheses that (1) high bile acid concentrations are arrhythmogenic in adult human myocardium, (2) serum bile acid concentrations and composition are altered in patients with atrial fibrillation (AF) and (3) the therapeutically used ursodeoxycholic acid has different effects than other potentially toxic bile acids. Multicellular human atrial preparations ('trabeculae') were exposed to primary bile acids and the incidence of arrhythmic events was assessed. Bile acid concentrations were measured in serum samples from 250 patients and their association with AF and ECG parameters analysed. Additionally, we conducted electrophysiological studies in murine myocytes. Taurocholic acid (TCA) concentration-dependently induced arrhythmias in atrial trabeculae (14/28 at 300 µM TCA, p<0.01) while ursodeoxycholic acid did not. Patients with AF had significantly decreased serum levels of ursodeoxycholic acid conjugates and increased levels of non-ursodeoxycholic bile acids. In isolated myocytes, TCA depolarised the resting membrane potential, enhanced Na(+)/Ca(2+) exchanger (NCX) tail current density and induced afterdepolarisations. Inhibition of NCX prevented arrhythmias in atrial trabeculae. High TCA concentrations induce arrhythmias in adult human atria while ursodeoxycholic acid does not. AF is associated with higher serum levels of non-ursodeoxycholic bile acid conjugates and low levels of ursodeoxycholic acid conjugates. These data suggest that higher levels of toxic (arrhythmogenic) and low levels of protective bile acids create a milieu with a decreased arrhythmic threshold and thus may facilitate arrhythmic events.
Carrasco-Pozo, Catalina
2017-01-01
Abstract Temporal lobe epilepsy is a common form of adult epilepsy and shows high resistance to treatment. Increasing evidence has suggested that metabolic dysfunction contributes to the development of seizures, with previous studies indicating impairments in brain glucose metabolism. Here we aim to elucidate which pathways involved in glucose metabolism are impaired, by tracing the hippocampal metabolism of injected [U-13C]glucose (i.p.) during the chronic stage of the pilocarpine-status epilepticus mouse model of epilepsy. The enrichment of 13C in the intermediates of glycolysis and the TCA cycle were quantified in hippocampal extracts using liquid chromatography–tandem mass spectroscopy, along with the measurement of the activities of enzymes in each pathway. We show that there is reduced incorporation of 13C in the intermediates of glycolysis, with the percentage enrichment of all downstream intermediates being highly correlated with those of glucose 6-phosphate. Furthermore, the activities of all enzymes in this pathway including hexokinase and phosphofructokinase were unaltered, suggesting that glucose uptake is reduced in this model without further impairments in glycolysis itself. The key findings were 33% and 55% losses in the activities of pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase, respectively, along with reduced 13C enrichment in TCA cycle intermediates. This lower 13C enrichment is best explained in part by the reduced enrichment in glycolytic intermediates, whereas the reduction of key TCA cycle enzyme activity indicates that TCA cycling is also impaired in the hippocampal formation. Together, these data suggest that multitarget approaches may be necessary to restore metabolism in the epileptic brain. PMID:28303258
Pyruvate cycle increases aminoglycoside efficacy and provides respiratory energy in bacteria.
Su, Yu-Bin; Peng, Bo; Li, Hui; Cheng, Zhi-Xue; Zhang, Tian-Tuo; Zhu, Jia-Xin; Li, Dan; Li, Min-Yi; Ye, Jin-Zhou; Du, Chao-Chao; Zhang, Song; Zhao, Xian-Liang; Yang, Man-Jun; Peng, Xuan-Xian
2018-02-13
The emergence and ongoing spread of multidrug-resistant bacteria puts humans and other species at risk for potentially lethal infections. Thus, novel antibiotics or alternative approaches are needed to target drug-resistant bacteria, and metabolic modulation has been documented to improve antibiotic efficacy, but the relevant metabolic mechanisms require more studies. Here, we show that glutamate potentiates aminoglycoside antibiotics, resulting in improved elimination of antibiotic-resistant pathogens. When exploring the metabolic flux of glutamate, it was found that the enzymes that link the phosphoenolpyruvate (PEP)-pyruvate-AcCoA pathway to the TCA cycle were key players in this increased efficacy. Together, the PEP-pyruvate-AcCoA pathway and TCA cycle can be considered the pyruvate cycle (P cycle). Our results show that inhibition or gene depletion of the enzymes in the P cycle shut down the TCA cycle even in the presence of excess carbon sources, and that the P cycle operates routinely as a general mechanism for energy production and regulation in Escherichia coli and Edwardsiella tarda These findings address metabolic mechanisms of metabolite-induced potentiation and fundamental questions about bacterial biochemistry and energy metabolism.
A Hybrid Demand Response Simulator Version 1.0
DOE Office of Scientific and Technical Information (OSTI.GOV)
2012-05-02
A hybrid demand response simulator is developed to test different control algorithms for centralized and distributed demand response (DR) programs in a small distribution power grid. The HDRS is designed to model a wide variety of DR services such as peak having, load shifting, arbitrage, spinning reserves, load following, regulation, emergency load shedding, etc. The HDRS does not model the dynamic behaviors of the loads, rather, it simulates the load scheduling and dispatch process. The load models include TCAs (water heaters, air conditioners, refrigerators, freezers, etc) and non-TCAs (lighting, washer, dishwasher, etc.) The ambient temperature changes, thermal resistance, capacitance, andmore » the unit control logics can be modeled for TCA loads. The use patterns of the non-TCA can be modeled by probability of use and probabilistic durations. Some of the communication network characteristics, such as delays and errors, can also be modeled. Most importantly, because the simulator is modular and greatly simplified the thermal models for TCA loads, it is very easy and fast to be used to test and validate different control algorithms in a simulated environment.« less
Effect of ocular transverse chromatic aberration on detection acuity for peripheral vision.
Cheney, Frank; Thibos, Larry; Bradley, Arthur
2015-01-01
We examined the effect of transverse chromatic aberration (TCA) on detection acuity for white-light interference fringes seen in Maxwellian view at various orientations and locations in the visual field. A circular patch (3.5° diameter, 3.2 log Trolands) of nominally high-contrast fringes was produced on the retina by a commercial instrument (the Lotmar Visometer, Haag Streit) mounted on a gimbal for controlled positioning of the stimulus in the visual field from 0° to 35° eccentricity. Detection acuity for white light fringes for all meridians and eccentricities ≥15° was maximum when fringes were oriented parallel to the visual meridian line. This meridional effect disappeared when a narrow-band filter was used to eliminate TCA. The meridional effect also disappeared when the interferometric stimulator was displaced laterally to align the instrument with the eye's local achromatic axis. Modelling confirmed that TCA is the major factor responsible for white-light meridional bias, with minor contribution arising from higher-order monochromatic aberrations and neural factors. © 2014 The Authors Ophthalmic & Physiological Optics © 2014 The College of Optometrists.
YANG, CAILING; YAN, JIANGUO; YUAN, GUOYAN; ZHANG, YINGHUA; LU, DERONG; REN, MINGXIN; CUI, WEIGANG
2014-01-01
Icotinib is an epidermal growth factor receptor tyrosine kinase inhibitor, which has been revealed to inhibit proliferation in tumor cells. However, the effect of icotinib on cancer cell metastasis remains to be explained. This study examines the effect of icotinib on the migration and invasion of squamous cells of tongue carcinoma (Tca8113 cells) in vitro. The results of the Boyden chamber invasion assay demonstrated that icotinib reduced cell invasion, suppressed the protein levels of matrix metalloproteinases (MMPs), MMP-2 and MMP-9, and increased the expression of tissue inhibitor of metalloproteinase-1. In addition, icotinib was found to significantly decrease the protein levels of nuclear factor κB (NF-κB) p65, which suggested that icotinib inhibits NF-κB activity. Furthermore, treatment with the NF-κB inhibitor, pyrrolidine dithiocarbamate, suppressed cell invasion and MMP-2 expression. These results suggested that icotinib inhibits the invasion of Tca8113 cells by downregulating MMP via the inactivation of the NF-κB signaling pathways. PMID:25120710
Yang, Cailing; Yan, Jianguo; Yuan, Guoyan; Zhang, Yinghua; Lu, Derong; Ren, Mingxin; Cui, Weigang
2014-09-01
Icotinib is an epidermal growth factor receptor tyrosine kinase inhibitor, which has been revealed to inhibit proliferation in tumor cells. However, the effect of icotinib on cancer cell metastasis remains to be explained. This study examines the effect of icotinib on the migration and invasion of squamous cells of tongue carcinoma (Tca8113 cells) in vitro . The results of the Boyden chamber invasion assay demonstrated that icotinib reduced cell invasion, suppressed the protein levels of matrix metalloproteinases (MMPs), MMP-2 and MMP-9, and increased the expression of tissue inhibitor of metalloproteinase-1. In addition, icotinib was found to significantly decrease the protein levels of nuclear factor κB (NF-κB) p65, which suggested that icotinib inhibits NF-κB activity. Furthermore, treatment with the NF-κB inhibitor, pyrrolidine dithiocarbamate, suppressed cell invasion and MMP-2 expression. These results suggested that icotinib inhibits the invasion of Tca8113 cells by downregulating MMP via the inactivation of the NF-κB signaling pathways.
MECHANISMS INVOLVED IN TRICHLOROETHYLENE INDUCED LIVER CANCER: IMPORTANCE TO ENVIRONMENTAL CLEANUP
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bull, Richard J.; Thrall, Brain D.
2001-12-31
Trichloroethylene (TCE) is a common contaminant of groundwater as a result of poor disposal practices of the past. As a consequence, this solvent is the focus of many clean-up operations of uncontrolled hazardous waste sites. TCE is carcinogenic in both mice and rats, but at different sites, the liver and kidney, respectively (NCI 1976; NTP 1988; NTP 1990). Liver tumor induction in mice has been the tumor most critical from the standpoint of environmental regulation (Bull 2000). Under the proposed cancer risk guidelines of the Environmental Protection Agency (EPA 1996), identifying the dose-response behavior of key events involved in carcinogenicmore » responses can be used for developing alternative risk assessments. A major difficulty in developing alternative approaches for TCE is the fact that three of its metabolites are capable of inducing liver cancer in mice (Bull et al. 1990; Daniel et al. 1992; DeAngelo et al. 1999; Pereria 1996). Two of these metabolites have distinct modes of action, dichloroacetate (DCA) and trichloroacetate (TCA). The third metabolite, chloral hydrate, is probably active as a result of its conversion to one or both of these two metabolites. Ordinarily, the first approach to assigning causality to a metabolite in tumorigenesis would be an attempt to measure its concentration in the body and associate that with tumorigenic concentrations observed when the compound is itself administered. This can be done with relative ease with TCA. However, it has been more difficult with DCA since blood levels of this metabolite after exposure to carcinogenic doses of DCA fall rapidly below detection limits (Kato-Weinstein et al. 1998; Merdink et al. 1998). Mutations in the ras protooncogene have been used to determine if distinct patterns of DNAsequence alterations can provide indications of the type of DNA damage that might be produced by carcinogens. The presence of ras mutations in chemically-induced tumors was suggested as a means o f determining whether a chemical was genotoxic (Wiseman et al. 1986). However, the 7 discovery that spontaneous tumors also contain this oncogene indicated that this assumption may not be correct (Fox and Watanabe 1985). Several non-genotoxic carcinogens have been shown to produce tumors with a H-ras mutation frequency considerably below those that result spontaneously (Maronpot et al. 1995). Among these chemicals are a class called peroxisome proliferators, of which TCA and TCE are members. DCA and TCE were found to induce tumors with similar H-ras mutation spectra (Anna et al. 1994), whereas only limited data have been available on TCA (Fereira-Gonzalez et al. 1995). Thus, a major focus of this research was to evaluate whether the pattern and frequency of H-ras mutations in TCE-induced tumors could be explained by the same parameters in tumors induced by the metabolites TCA or DCA. The present project was organized around three interrelated objectives: The first objective addressed the pharmacokinetic questions regarding the formation and elimination of DCA and TCA in mice administered TCE and whether levels of these metabolites may account for the tumors induced by TCE. The second objective was to investigate potential molecular mechanisms by which TCA and DCA may, in the absence of directly causing mutations, promote the clonal growth and expansion of precancerous cell populations within mouse liver. The third objective was to investigate whether the genotype of tumors induced by TCA and DCA can be used to establish the relative roles of these metabolites in TCE-induced cancer. In particular, the focus of the latter studies was to compare the incidence and spectra of mutations in the H-ras gene (codon 61) to determine if the reported similarities in the genotype of DCA- and TCE-induced tumors have a causal relationship.« less
Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production.
Carinhas, Nuno; Pais, Daniel A M; Koshkin, Alexey; Fernandes, Paulo; Coroadinha, Ana S; Carrondo, Manuel J T; Alves, Paula M; Teixeira, Ana P
2016-03-23
Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-(13)C]glucose and [U-(13)C]glutamine, we apply for the first time (13)C-Metabolic flux analysis ((13)C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells metabolism during growth and CAV2 production. MDCK cells displayed a marked glycolytic and ammoniagenic metabolism, and (13)C data revealed a large fraction of glutamine-derived labelling in TCA cycle intermediates, emphasizing the role of glutamine anaplerosis. (13)C-MFA demonstrated the importance of pyruvate cycling in balancing glycolytic and TCA cycle activities, as well as occurrence of reductive alphaketoglutarate (AKG) carboxylation. By turn, CAV2 infection significantly upregulated fluxes through most central metabolism, including glycolysis, pentose-phosphate pathway, glutamine anaplerosis and, more prominently, reductive AKG carboxylation and cytosolic acetyl-coenzyme A formation, suggestive of increased lipogenesis. Based on these results, we suggest culture supplementation strategies to stimulate nucleic acid and lipid biosynthesis for improved canine adenoviral vector production.
Ramirez-Malule, Howard; Junne, Stefan; Nicolás Cruz-Bournazou, Mariano; Neubauer, Peter; Ríos-Estepa, Rigoberto
2018-05-01
Clavulanic acid (CA) is produced by Streptomyces clavuligerus (S. clavuligerus) as a secondary metabolite. Knowledge about the carbon flux distribution along the various routes that supply CA precursors would certainly provide insights about metabolic performance. In order to evaluate metabolic patterns and the possible accumulation of tricarboxylic acid (TCA) cycle intermediates during CA biosynthesis, batch and subsequent continuous cultures with steadily declining feed rates were performed with glycerol as the main substrate. The data were used to in silico explore the metabolic capabilities and the accumulation of metabolic intermediates in S. clavuligerus. While clavulanic acid accumulated at glycerol excess, it steadily decreased at declining dilution rates; CA synthesis stopped when glycerol became the limiting substrate. A strong association of succinate, oxaloacetate, malate, and acetate accumulation with CA production in S. clavuligerus was observed, and flux balance analysis (FBA) was used to describe the carbon flux distribution in the network. This combined experimental and numerical approach also identified bottlenecks during the synthesis of CA in a batch and subsequent continuous cultivation and demonstrated the importance of this type of methodologies for a more advanced understanding of metabolism; this potentially derives valuable insights for future successful metabolic engineering studies in S. clavuligerus.
Choi, Yong-Min; Kim, Han-Kyul; Shim, Wooyoung; Anwar, Muhammad Ayaz; Kwon, Ji-Woong; Kwon, Hyuk-Kwon; Kim, Hyung Joong; Jeong, Hyobin; Kim, Hwan Myung; Hwang, Daehee; Kim, Hyung Sik; Choi, Sangdun
2015-01-01
The chemotherapeutic use of cisplatin is limited by its severe side effects. In this study, by conducting different omics data analyses, we demonstrated that cisplatin induces cell death in a proximal tubular cell line by suppressing glycolysis- and tricarboxylic acid (TCA)/mitochondria-related genes. Furthermore, analysis of the urine from cisplatin-treated rats revealed the lower expression levels of enzymes involved in glycolysis, TCA cycle, and genes related to mitochondrial stability and confirmed the cisplatin-related metabolic abnormalities. Additionally, an increase in the level of p53, which directly inhibits glycolysis, has been observed. Inhibition of p53 restored glycolysis and significantly reduced the rate of cell death at 24 h and 48 h due to p53 inhibition. The foremost reason of cisplatin-related cytotoxicity has been correlated to the generation of mitochondrial reactive oxygen species (ROS) that influence multiple pathways. Abnormalities in these pathways resulted in the collapse of mitochondrial energy production, which in turn sensitized the cells to death. The quenching of ROS led to the amelioration of the affected pathways. Considering these observations, it can be concluded that there is a significant correlation between cisplatin and metabolic dysfunctions involving mROS as the major player.
NASA Technical Reports Server (NTRS)
Keen, Jill M.; DeWeese, Darrell C.; Key, Leigh W.
1997-01-01
At Kennedy Space Center (KSC), Thiokol Corporation provides the engineering to assemble and prepare the Space Shuttle Reusable Solid Rocket Motor (RSRM) for launch. This requires hand cleaning over 86 surfaces including metals, adhesives, rubber and electrical insulations, various painted surfaces and thermal protective materials. Due to the phase-out of certain ozone depleting chemical (ODC) solvents, all RSRM hand wipe operations being performed at KSC using l,l,1-trichloroethane (TCA) were eliminated. This presentation summarizes the approach used and the data gathered in the effort to eliminate TCA from KSC hand wipe operations.
Hernández-Alonso, Pablo; Cañueto, Daniel; Giardina, Simona; Salas-Salvadó, Jordi; Cañellas, Nicolau; Correig, Xavier; Bulló, Mònica
2017-07-01
The specific nutritional composition of nuts could affect different metabolic pathways involved in a broad range of metabolic diseases. We therefore investigated whether chronic consumption of pistachio nuts modifies the urine metabolome in prediabetic subjects. We designed a randomized crossover clinical trial in 39 prediabetic subjects. They consumed a pistachio-supplemented diet (PD, 50% carbohydrates, 33% fat, including 57 g/d of pistachios daily) and a control diet (CD, 55% carbohydrates, 30% fat) for 4 months each, separated by a 2-week wash-out. Nuclear magnetic resonance (NRM) was performed to determine changes in 24-h urine metabolites. Significant changes in urine metabolites according to the different intervention periods were found in uni- and multivariate analysis. Score plot of the first two components of the multilevel partial least squares discriminant analysis (ML-PLS-DA) showed a clear separation of the intervention periods. Three metabolites related with gut microbiota metabolism (i.e., hippurate, p-cresol sulfate and dimethylamine) were found decreased in PD compared with CD (P<.05). Moreover, cis-aconitate [intermediate of the tricarboxylic acid (TCA)] was also found decreased following PD compared with CD. Intragroup analysis showed that creatinine levels were significantly increased in PD (P=.023), whereas trimethylamine N-oxide (TMAO) was found significantly reduced following PD (P=.034). Our results suggest that chronic pistachio consumption may modulate some urinary metabolites related to gut microbiota metabolism and the TCA cycle; all associated with metabolic derangements associated with insulin resistance and Type 2 diabetes. Copyright © 2017 Elsevier Inc. All rights reserved.
2013-01-01
Background Understanding the process of amino acid fermentation as a comprehensive system is a challenging task. Previously, we developed a literature-based dynamic simulation model, which included transcriptional regulation, transcription, translation, and enzymatic reactions related to glycolysis, the pentose phosphate pathway, the tricarboxylic acid (TCA) cycle, and the anaplerotic pathway of Escherichia coli. During simulation, cell growth was defined such as to reproduce the experimental cell growth profile of fed-batch cultivation in jar fermenters. However, to confirm the biological appropriateness of our model, sensitivity analysis and experimental validation were required. Results We constructed an l-glutamic acid fermentation simulation model by removing sucAB, a gene encoding α-ketoglutarate dehydrogenase. We then performed systematic sensitivity analysis for l-glutamic acid production; the results of this process corresponded with previous experimental data regarding l-glutamic acid fermentation. Furthermore, it allowed us to predicted the possibility that accumulation of 3-phosphoglycerate in the cell would regulate the carbon flux into the TCA cycle and lead to an increase in the yield of l-glutamic acid via fermentation. We validated this hypothesis through a fermentation experiment involving a model l-glutamic acid-production strain, E. coli MG1655 ΔsucA in which the phosphoglycerate kinase gene had been amplified to cause accumulation of 3-phosphoglycerate. The observed increase in l-glutamic acid production verified the biologically meaningful predictive power of our dynamic metabolic simulation model. Conclusions In this study, dynamic simulation using a literature-based model was shown to be useful for elucidating the precise mechanisms involved in fermentation processes inside the cell. Further exhaustive sensitivity analysis will facilitate identification of novel factors involved in the metabolic regulation of amino acid fermentation. PMID:24053676
Nishio, Yousuke; Ogishima, Soichi; Ichikawa, Masao; Yamada, Yohei; Usuda, Yoshihiro; Masuda, Tadashi; Tanaka, Hiroshi
2013-09-22
Understanding the process of amino acid fermentation as a comprehensive system is a challenging task. Previously, we developed a literature-based dynamic simulation model, which included transcriptional regulation, transcription, translation, and enzymatic reactions related to glycolysis, the pentose phosphate pathway, the tricarboxylic acid (TCA) cycle, and the anaplerotic pathway of Escherichia coli. During simulation, cell growth was defined such as to reproduce the experimental cell growth profile of fed-batch cultivation in jar fermenters. However, to confirm the biological appropriateness of our model, sensitivity analysis and experimental validation were required. We constructed an L-glutamic acid fermentation simulation model by removing sucAB, a gene encoding α-ketoglutarate dehydrogenase. We then performed systematic sensitivity analysis for L-glutamic acid production; the results of this process corresponded with previous experimental data regarding L-glutamic acid fermentation. Furthermore, it allowed us to predicted the possibility that accumulation of 3-phosphoglycerate in the cell would regulate the carbon flux into the TCA cycle and lead to an increase in the yield of L-glutamic acid via fermentation. We validated this hypothesis through a fermentation experiment involving a model L-glutamic acid-production strain, E. coli MG1655 ΔsucA in which the phosphoglycerate kinase gene had been amplified to cause accumulation of 3-phosphoglycerate. The observed increase in L-glutamic acid production verified the biologically meaningful predictive power of our dynamic metabolic simulation model. In this study, dynamic simulation using a literature-based model was shown to be useful for elucidating the precise mechanisms involved in fermentation processes inside the cell. Further exhaustive sensitivity analysis will facilitate identification of novel factors involved in the metabolic regulation of amino acid fermentation.
Hinder, Lucy M; Vivekanandan-Giri, Anuradha; McLean, Lisa L; Pennathur, Subramaniam; Feldman, Eva L
2013-01-01
Diabetic neuropathy (DN) is the most common complication of diabetes and is characterized by distal-to-proximal loss of peripheral nerve axons. The idea of tissue-specific pathological alterations in energy metabolism in diabetic complications-prone tissues is emerging. Altered nerve metabolism in type 1 diabetes models is observed; however, therapeutic strategies based on these models offer limited efficacy to type 2 diabetic patients with DN. Therefore, understanding how peripheral nerves metabolically adapt to the unique type 2 diabetic environment is critical to develop disease-modifying treatments. In the current study, we utilized targeted liquid chromatography-tandem mass spectrometry (LC/MS/MS) to characterize the glycolytic and tricarboxylic acid (TCA) cycle metabolomes in sural nerve, sciatic nerve, and dorsal root ganglia (DRG) from male type 2 diabetic mice (BKS.Cg-m+/+Lepr(db); db/db) and controls (db/+). We report depletion of glycolytic intermediates in diabetic sural nerve and sciatic nerve (glucose-6-phosphate, fructose-6-phosphate, fructose-1,6-bisphosphate (sural nerve only), 3-phosphoglycerate, 2-phosphoglycerate, phosphoenolpyruvate, and lactate), with no significant changes in DRG. Citrate and isocitrate TCA cycle intermediates were decreased in sural nerve, sciatic nerve, and DRG from diabetic mice. Utilizing LC/electrospray ionization/MS/MS and HPLC methods, we also observed increased protein and lipid oxidation (nitrotyrosine; hydroxyoctadecadienoic acids) in db/db tissue, with a proximal-to-distal increase in oxidative stress, with associated decreased aconitase enzyme activity. We propose a preliminary model, whereby the greater change in metabolomic profile, increase in oxidative stress, and decrease in TCA cycle enzyme activity may cause distal peripheral nerves to rely on truncated TCA cycle metabolism in the type 2 diabetes environment.
Tefera, Tesfaye W; Borges, Karin
2018-01-01
Although alterations in energy metabolism are known in ALS, the specific mechanisms leading to energy deficit are not understood. We measured metabolite levels derived from injected [1- 13 C]glucose and [1,2- 13 C]acetate (i.p.) in cerebral cortex and spinal cord extracts of wild type and hSOD1 G93A mice at onset and mid disease stages using high-pressure liquid chromatography, 1 H and 13 C nuclear magnetic resonance spectroscopy. Levels of spinal and cortical CNS total lactate, [3- 13 C]lactate, total alanine and [3- 13 C]alanine, but not cortical glucose and [1- 13 C]glucose, were reduced mostly at mid stage indicating impaired glycolysis. The [1- 13 C]glucose-derived [4- 13 C]glutamate, [4- 13 C]glutamine and [2- 13 C]GABA amounts were diminished at mid stage in cortex and both time points in spinal cord, suggesting decreased [3- 13 C]pyruvate entry into the TCA cycle. Lack of changes in [1,2- 13 C]acetate-derived [4,5- 13 C]glutamate, [4,5- 13 C]glutamine and [1,2- 13 C]GABA levels indicate unchanged astrocytic 13 C-acetate metabolism. Reduced levels of leucine, isoleucine and valine in CNS suggest compensatory breakdown to refill TCA cycle intermediate levels. Unlabelled, [2- 13 C] and [4- 13 C]GABA concentrations were decreased in spinal cord indicating that impaired glucose metabolism contributes to hyperexcitability and supporting the use of treatments which increase GABA amounts. In conclusion, CNS glucose metabolism is compromised, while astrocytic TCA cycling appears to be normal in the hSOD1 G93A mouse model at symptomatic disease stages.
Distribution of the anterior, posterior, and total corneal astigmatism in healthy eyes.
Feizi, Sepehr; Naderan, Mohammad; Ownagh, Vahid; Sadeghpour, Fatemeh
2018-04-01
To evaluate the magnitude and axis orientation of the anterior, posterior, and total corneal astigmatism in normal healthy eyes of an Iranian population. In a prospective cross-sectional study, ophthalmic and anterior segment parameters of 153 healthy eyes of 153 subjects were evaluated by Galilei dual Scheimpflug analyzer. The magnitude and axis orientation [with-the-rule (WTR), against-the-rule (ATR), and oblique] of the anterior, posterior, and total corneal astigmatism measurements (ACA, PCA, and TCA) were compared according to the age, sex, and other ophthalmic parameters. The mean ± SD age of the study population was 30 ± 5.9 years. The mean magnitude was 1.09 ± 0.76 diopters (D) for ACA, 0.30 ± 0.13 D for PCA, and 1.08 ± 0.77 D for TCA. Males had a significantly higher magnitude of PCA than females (p = 0.041). Most eyes had a WTR anterior astigmatism and an ATR posterior astigmatism. The WTR astigmatism had a higher mean magnitude compared to the ATR and oblique astigmatism in all the astigmatism groups, with a significant difference in the ACA and TCA groups (p < 0.05). PCA magnitude exceeded 0.50 D in only 7.8% of the subjects. ACA, PCA, and TCA were significantly correlated with each other and also had a significant correlation with the anterior and posterior maximum corneal elevation measurements (p < 0.001). The results of this study although are limited due to the small number of participants and confined to our demographics, provided information regarding a population that was not described before and may be helpful in obtaining optimum results in astigmatism correction in refractive surgery or designing new intraocular lenses.
Lamp, Jessica; Keyser, Britta; Koeller, David M; Ullrich, Kurt; Braulke, Thomas; Mühlhausen, Chris
2011-05-20
The inherited neurodegenerative disorder glutaric aciduria type 1 (GA1) results from mutations in the gene for the mitochondrial matrix enzyme glutaryl-CoA dehydrogenase (GCDH), which leads to elevations of the dicarboxylates glutaric acid (GA) and 3-hydroxyglutaric acid (3OHGA) in brain and blood. The characteristic clinical presentation of GA1 is a sudden onset of dystonia during catabolic situations, resulting from acute striatal injury. The underlying mechanisms are poorly understood, but the high levels of GA and 3OHGA that accumulate during catabolic illnesses are believed to play a primary role. Both GA and 3OHGA are known to be substrates for Na(+)-coupled dicarboxylate transporters, which are required for the anaplerotic transfer of the tricarboxylic acid cycle (TCA) intermediate succinate between astrocytes and neurons. We hypothesized that GA and 3OHGA inhibit the transfer of succinate from astrocytes to neurons, leading to reduced TCA cycle activity and cellular injury. Here, we show that both GA and 3OHGA inhibit the uptake of [(14)C]succinate by Na(+)-coupled dicarboxylate transporters in cultured astrocytic and neuronal cells of wild-type and Gcdh(-/-) mice. In addition, we demonstrate that the efflux of [(14)C]succinate from Gcdh(-/-) astrocytic cells mediated by a not yet identified transporter is strongly reduced. This is the first experimental evidence that GA and 3OHGA interfere with two essential anaplerotic transport processes: astrocytic efflux and neuronal uptake of TCA cycle intermediates, which occur between neurons and astrocytes. These results suggest that elevated levels of GA and 3OHGA may lead to neuronal injury and cell death via disruption of TCA cycle activity. © 2011 by The American Society for Biochemistry and Molecular Biology, Inc.
NASA Technical Reports Server (NTRS)
Casiano, M. J.; Kenny, R. J.; Protz, C. S.; Garcia, C. P.; Simpson, S. P.; Elmore, J. L.; Fischbach, S. R.; Giacomoni, C. B.; Hulka, J. R.
2016-01-01
The Combustion Stability Tool Development (CSTD) project, funded by the Air Force Space and Missile Systems Center, began in March 2015 supporting a renewed interest in the development of a liquid oxygen/hydrocarbon, oxygen-rich combustion engine. The project encompasses the design, assembly, and hot-fire testing of the NASA Marshall Space Flight Center 40-klbf Integrated Test Rig (MITR). The test rig models a staged-combustion configuration by combining an oxygen-rich preburner (ORPB), to generate hot gas, with a thrust chamber assembly (TCA) using gas-centered swirl coaxial injector elements. There are five separately designed interchangeable injectors in the TCA that each contain 19- or 27- injector elements. A companion paper in this JANNAF conference describes the design characteristics, rationale, and fabrication issues for all the injectors. The data acquired from a heavily instrumented rig encompasses several injectors, several operating points, and stability bomb tests. Another companion paper in this JANNAF conference describes this test program in detail. In this paper, dynamic data from the hot-fire testing is characterized and used to identify the responses in the ORPB and TCA. A brief review of damping metrics are discussed and applied as a measure of stability margin for damped acoustic modes. Chug and longitudinal combustion stability models and predictions are described which includes new dynamic models for compressible flow through an orifice and a modification to incorporate a third feed line for inclusion of the fuel-film coolant. Flow-acoustics finite element modeling is used to investigate the anticipated TCA acoustics, the effects of injector element length on stability margin, and the potential use of an ORPB orifice trip ring for improving longitudinal stability margin.
Wei, Bangdong; Shin, Sooan; LaPorte, David; Wolfe, Alan J.; Romeo, Tony
2000-01-01
The csrA gene encodes a small RNA-binding protein, which acts as a global regulator in Escherichia coli and other bacteria (T. Romeo, Mol. Microbiol. 29:1321–1330, 1998). Its key regulatory role in central carbon metabolism, both as an activator of glycolysis and as a potent repressor of glycogen biosynthesis and gluconeogenesis, prompted us to examine the involvement of csrA in acetate metabolism and the tricarboxylic acid (TCA) cycle. We found that growth of csrA rpoS mutant strains was very poor on acetate as a sole carbon source. Surprisingly, growth also was inhibited specifically by the addition of modest amounts of acetate to rich media (e.g., tryptone broth). Cultures grown in the presence of ≥25 mM acetate consisted substantially of glycogen biosynthesis (glg) mutants, which were no longer inhibited by acetate. Several classes of glg mutations were mapped to known and novel loci. Several hypotheses were examined to provide further insight into the effects of acetate on growth and metabolism in these strains. We determined that csrA positively regulates acs (acetyl-coenzyme A synthetase; Acs) expression and isocitrate lyase activity without affecting key TCA cycle enzymes or phosphotransacetylase. TCA cycle intermediates or pyruvate, but not glucose, galactose, or glycerol, restored growth and prevented the glg mutations in the presence of acetate. Furthermore, amino acid uptake was inhibited by acetate specifically in the csrA rpoS strain. We conclude that central carbon flux imbalance, inhibition of amino acid uptake, and a deficiency in acetate metabolism apparently are combined to cause metabolic stress by depleting the TCA cycle. PMID:10692369
The impact of stress systems and lifestyle on dyslipidemia and obesity in anxiety and depression.
van Reedt Dortland, Arianne K B; Vreeburg, Sophie A; Giltay, Erik J; Licht, Carmilla M M; Vogelzangs, Nicole; van Veen, Tineke; de Geus, Eco J C; Penninx, Brenda W J H; Zitman, Frans G
2013-02-01
Dyslipidemia and obesity have been observed in persons with severe anxiety or depression, and in tricyclic antidepressant (TCA) users. This likely contributes to the higher risk of cardiovascular disease (CVD) in anxiety and depressive disorders. We aimed to elucidate whether biological stress systems or lifestyle factors underlie these associations. If so, they may be useful targets for CVD prevention and intervention. Within 2850 Netherlands Study of Depression and Anxiety (NESDA) participants, we evaluated the explaining impact of biological stress systems (i.e., the hypothalamic-pituitary-adrenal [HPA] axis, autonomic nervous system [ANS] and inflammation) and lifestyle factors (i.e., tobacco and alcohol use, and physical activity) on adverse associations of anxiety and depression severity and TCA use with high and low-density lipoprotein cholesterol, triglycerides, body mass index and waist circumference. Through linear regression analyses, percentual change (%Δ) in β was determined and considered significant when %Δ>10. The inflammatory marker C-reactive protein had the most consistent impact (explaining 14-53% of the associations of anxiety and depression severity and TCA use with lipid and obesity levels), followed by tobacco use (explaining 34-43% of the associations with lipids). The ANS mediated all associations with TCA use (explaining 32-61%). The HPA axis measures did not explain any of the associations. Increased dyslipidemia and (abdominal) obesity risk in patients with more severe anxiety disorders and depression may be partly explained by chronic low-grade inflammation and smoking. TCAs may increase metabolic risk through enhanced sympathetic and decreased parasympathetic ANS activity. That the HPA axis had no impact in our sample may reflect the possibility that the HPA axis only plays a role in acute stress situations rather than under basal conditions. Copyright © 2012 Elsevier Ltd. All rights reserved.
Stiffness control of a nylon twisted coiled actuator for use in mechatronic rehabilitation devices.
Edmonds, Brandon P R; Trejos, Ana Luisa
2017-07-01
Mechatronic rehabilitation devices, especially wearables, have been researched extensively and proven to be promising additions to physical therapy, but most designs utilize traditional actuators providing unnatural, robot-like movements. Therefore, many researchers have focused on the development of actuators that mimic biological properties to provide patients with improved results, safety, and comfort. Recently, a twisted-coiled actuator (TCA) made from nylon thread has been found to possess many of these important properties when heated, such as variable stiffness, flexibility, and high power density. So far, TCAs have been characterized in controlled environments to define their fundamental properties under simple loading configurations. However, for an actuator like this to be implemented in a biomimetic design such as an exoskeleton, it needs to be characterized and controlled as a biological muscle. One major control law that natural muscles exhibit is stiffness control, allowing humans to passively avoid injury from external forces, or move the limbs in a controlled or high impact motion. This type of control is created by the antagonistic muscle arrangement. In this paper, an antagonistic apparatus was developed to model the TCAs from a biological standpoint, the stiffness was characterized with respect to the TCA temperature, and a fully functional stiffness and position controller was implemented with an incorporated TCA thermal model. The stiffness was found to have a linear relationship to the TCA temperatures (R 2 =0.95). The controller performed with a stiffness accuracy of 98.95% and a position accuracy of 92.7%. A final trial with varying continuous position input and varying stepped stiffness input exhibited position control with R 2 =0.9638.
Preventive effect of chemical peeling on ultraviolet induced skin tumor formation.
Abdel-Daim, Mohamed; Funasaka, Yoko; Kamo, Tsuneyoshi; Ooe, Masahiko; Matsunaka, Hiroshi; Yanagita, Emmy; Itoh, Tomoo; Nishigori, Chikako
2010-10-01
Chemical peeling is one of the dermatological treatments available for certain cutaneous diseases and conditions or improvement of cosmetic appearance of photoaged skin. We assessed the photochemopreventive effect of several clinically used chemical peeling agents on the ultraviolet (UV)-irradiated skin of hairless mice. Chemical peeling was done using 35% glycolic acid dissolved in distilled water, 30% salicylic acid in ethanol, 10% or 35% trichloroacetic acid (TCA) in distilled water at the right back of UV-irradiated hairless mice every 2 weeks in case of glycolic acid, salicylic acid, and 10% TCA and every 4 weeks in case of 35% TCA for totally 18 weeks after the establishment of photoaged mice by irradiation with UVA+B range light three times a week for 10 weeks at a total dose of 420 J/cm(2) at UVA and 9.6 J/cm(2) at UVB. Tumor formation was assessed every week. Skin specimens were taken from treated and non-treated area for evaluation under microscopy, evaluation of P53 expression, and mRNA expression of cyclooxygenase (COX)-2. Serum level of prostaglandin E(2) was also evaluated. All types of chemical peeling reduced tumor formation in treated mice, mostly in the treated area but also non-treated area. Peeling suppressed clonal retention of p53 positive abnormal cells and reduced mRNA expression of COX-2 in treated skin. Further, serum prostaglandin E(2) level was decreased in chemical peeling treated mice. These results indicate that chemical peeling with glycolic acid, salicylic acid, and TCA could serve tumor prevention by removing photodamaged cells. Copyright © 2010 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Guérin, Charles-Antoine; Grilli, Stéphan T.; Moran, Patrick; Grilli, Annette R.; Insua, Tania L.
2018-05-01
The authors recently proposed a new method for detecting tsunamis using high-frequency (HF) radar observations, referred to as "time-correlation algorithm" (TCA; Grilli et al. Pure Appl Geophys 173(12):3895-3934, 2016a, 174(1): 3003-3028, 2017). Unlike standard algorithms that detect surface current patterns, the TCA is based on analyzing space-time correlations of radar signal time series in pairs of radar cells, which does not require inverting radial surface currents. This was done by calculating a contrast function, which quantifies the change in pattern of the mean correlation between pairs of neighboring cells upon tsunami arrival, with respect to a reference correlation computed in the recent past. In earlier work, the TCA was successfully validated based on realistic numerical simulations of both the radar signal and tsunami wave trains. Here, this algorithm is adapted to apply to actual data from a HF radar installed in Tofino, BC, for three test cases: (1) a simulated far-field tsunami generated in the Semidi Subduction Zone in the Aleutian Arc; (2) a simulated near-field tsunami from a submarine mass failure on the continental slope off of Tofino; and (3) an event believed to be a meteotsunami, which occurred on October 14th, 2016, off of the Pacific West Coast and was measured by the radar. In the first two cases, the synthetic tsunami signal is superimposed onto the radar signal by way of a current memory term; in the third case, the tsunami signature is present within the radar data. In light of these test cases, we develop a detection methodology based on the TCA, using a correlation contrast function, and show that in all three cases the algorithm is able to trigger a timely early warning.
Mori, H; Rafiq, K; Kobara, H; Fujihara, S; Nishiyama, N; Kobayashi, M; Himoto, T; Haba, R; Hagiike, M; Izuishi, K; Okano, K; Suzuki, Y; Masaki, T
2012-07-01
Endoscopic submucosal dissection (ESD) of large gastric lesions results in an extensive artificial ulcer that can lead to marked gastric deformity. The aim of the current study was to evaluate therapeutic efficacy in the prevention of gastric deformity of local triamcinolone acetonide (TCA) injection into the extensive artificial ulcer following ESD. A total of 45 patients who were diagnosed with early gastric cancer were enrolled. Patients were randomly assigned by the sealed-envelope randomization method to either local TCA injections (n = 21) or sham-control (n = 20) groups. Two clips were placed at the two maximum outer edges of the artificial ulcer after the lesion had been resected (Day 0). Local TCA injections were performed on postoperative Day 5 and Day 12. The distance between the two clips was measured by endoscopic measuring forceps on Days 5, 12, 30, and 60. Granulation formation and gastric deformity were evaluated by visual analog scale (VAS) on Days 30 and 60. Local TCA injection did not alter clip-to-clip distance on postoperative Day 60, and formation of flat granulation tissue over the ulcer was followed by regenerative mucosa without any gastric deformity. The sham-control group showed significant shortening of clip-to-clip distance compared with the local steroid-injected group and protruded forms of granulation tissue with mucosal convergence. Histological evaluation revealed prominent growth of neovessels, swelling, and marked increases in endothelial cells in the local steroid-injected group compared with the sham-control group. Local steroid injection into the floor of a post-ESD artificial ulcer promotes the formation of granulation tissue at an early stage of the healing process leading to regeneration of gastric mucosa without mucosal convergence or gastric deformity. © Georg Thieme Verlag KG Stuttgart · New York.
Bai, Xiuzhi; Zhang, Ting; Wang, Chaoyi; Zong, Dongliang; Li, Haipu; Yang, Zhaoguang
2017-01-01
Taste and odor (T&O) problems in surface water supplies attract growing environmental and ecological concerns. In this study, 10 T&O compounds, 2-methylisoborneol (2-MIB), geosmin, β-ionone, 2-isopropyl-3-methoxypyrazine (IPMP), 2-isobutyl-3-methoxypyrazine (IBMP), 2,4,6-trichloroanisole (2,4,6-TCA), 2,3,6-trichloroanisole (2,3,6-TCA), 2,3,4-trichloroanisole (2,3,4-TCA), 2,4,6-tribromoanisole (2,4,6-TBA), and trans-2,cis-6-nonadienal (NDE) were investigated in 13 water supply reservoirs and 2 water treatment plants (WTPs) in S City of China. 2-MIB, geosmin, and β-ionone were detected in most of the reservoirs and WTPs. The highest concentrations in reservoirs reached 196.0 ng L -1 for 2-MIB, 11.4 ng L -1 for geosmin, and 39.7 ng L -1 for β-ionone. Canonical correspondence analysis (CCA) was used to examine the relationship between the 3 T&O compounds and environmental parameters of the reservoirs. The results showed that TP was strongly positively correlated with 2-MIB in wet season and negatively correlated in dry season. It was suggested that controlling nutrient (TP, TN/TP, and NH 3 -N) inputs was required for better management of drinking water reservoirs. Furthermore, the maximum concentrations in raw water of WTPs was kept at 82.1 ng L -1 for 2-MIB, 5.6 ng L -1 for geosmin, and 66.1 ng L -1 for β-ionone. β-Ionone could not be detected in the post-filtration and finished water of two WTPs, and both 2-MIB and geosmin significantly decreased in the water of XWTP. It was indicated that T&O compounds could be removed partly or completely by the filtration of conventional treatment processes.
Seifert, Erin L; Fiehn, Oliver; Bezaire, Véronic; Bickel, David R; Wohlgemuth, Gert; Adams, Sean H; Harper, Mary-Ellen
2010-03-24
Incomplete or limited long-chain fatty acid (LCFA) combustion in skeletal muscle has been associated with insulin resistance. Signals that are responsive to shifts in LCFA beta-oxidation rate or degree of intramitochondrial catabolism are hypothesized to regulate second messenger systems downstream of the insulin receptor. Recent evidence supports a causal link between mitochondrial LCFA combustion in skeletal muscle and insulin resistance. We have used unbiased metabolite profiling of mouse muscle mitochondria with the aim of identifying candidate metabolites within or effluxed from mitochondria and that are shifted with LCFA combustion rate. Large-scale unbiased metabolomics analysis was performed using GC/TOF-MS on buffer and mitochondrial matrix fractions obtained prior to and after 20 min of palmitate catabolism (n = 7 mice/condition). Three palmitate concentrations (2, 9 and 19 microM; corresponding to low, intermediate and high oxidation rates) and 9 microM palmitate plus tricarboxylic acid (TCA) cycle and electron transport chain inhibitors were each tested and compared to zero palmitate control incubations. Paired comparisons of the 0 and 20 min samples were made by Student's t-test. False discovery rate were estimated and Type I error rates assigned. Major metabolite groups were organic acids, amines and amino acids, free fatty acids and sugar phosphates. Palmitate oxidation was associated with unique profiles of metabolites, a subset of which correlated to palmitate oxidation rate. In particular, palmitate oxidation rate was associated with distinct changes in the levels of TCA cycle intermediates within and effluxed from mitochondria. This proof-of-principle study establishes that large-scale metabolomics methods can be applied to organelle-level models to discover metabolite patterns reflective of LCFA combustion, which may lead to identification of molecules linking muscle fat metabolism and insulin signaling. Our results suggest that future studies should focus on the fate of effluxed TCA cycle intermediates and on mechanisms ensuring their replenishment during LCFA metabolism in skeletal muscle.
Seifert, Erin L.; Fiehn, Oliver; Bezaire, Véronic; Bickel, David R.; Wohlgemuth, Gert; Adams, Sean H.; Harper, Mary-Ellen
2010-01-01
Background/Aim Incomplete or limited long-chain fatty acid (LCFA) combustion in skeletal muscle has been associated with insulin resistance. Signals that are responsive to shifts in LCFA β-oxidation rate or degree of intramitochondrial catabolism are hypothesized to regulate second messenger systems downstream of the insulin receptor. Recent evidence supports a causal link between mitochondrial LCFA combustion in skeletal muscle and insulin resistance. We have used unbiased metabolite profiling of mouse muscle mitochondria with the aim of identifying candidate metabolites within or effluxed from mitochondria and that are shifted with LCFA combustion rate. Methodology/Principal Findings Large-scale unbiased metabolomics analysis was performed using GC/TOF-MS on buffer and mitochondrial matrix fractions obtained prior to and after 20 min of palmitate catabolism (n = 7 mice/condition). Three palmitate concentrations (2, 9 and 19 µM; corresponding to low, intermediate and high oxidation rates) and 9 µM palmitate plus tricarboxylic acid (TCA) cycle and electron transport chain inhibitors were each tested and compared to zero palmitate control incubations. Paired comparisons of the 0 and 20 min samples were made by Student's t-test. False discovery rate were estimated and Type I error rates assigned. Major metabolite groups were organic acids, amines and amino acids, free fatty acids and sugar phosphates. Palmitate oxidation was associated with unique profiles of metabolites, a subset of which correlated to palmitate oxidation rate. In particular, palmitate oxidation rate was associated with distinct changes in the levels of TCA cycle intermediates within and effluxed from mitochondria. Conclusions/Significance This proof-of-principle study establishes that large-scale metabolomics methods can be applied to organelle-level models to discover metabolite patterns reflective of LCFA combustion, which may lead to identification of molecules linking muscle fat metabolism and insulin signaling. Our results suggest that future studies should focus on the fate of effluxed TCA cycle intermediates and on mechanisms ensuring their replenishment during LCFA metabolism in skeletal muscle. PMID:20352092
Liu, Jingjing; Xie, Zhipeng; Shin, Hyun-Dong; Li, Jianghua; Du, Guocheng; Chen, Jian; Liu, Long
2017-07-10
Aspergillus oryzae finds wide application in the food, feed, and wine industries, and is an excellent cell factory platform for production of organic acids. In this work, we achieved the overproduction of L-malate by rewiring the reductive tricarboxylic acid (rTCA) pathway and L-malate transport pathway of A. oryzae NRRL 3488. First, overexpression of native pyruvate carboxylase and malate dehydrogenase in the rTCA pathway improved the L-malate titer from 26.1gL -1 to 42.3gL -1 in shake flask culture. Then, the oxaloacetate anaplerotic reaction was constructed by heterologous expression of phosphoenolpyruvate carboxykinase and phosphoenolpyruvate carboxylase from Escherichia coli, increasing the L-malate titer to 58.5gL -1 . Next, the export of L-malate from the cytoplasm to the external medium was strengthened by overexpression of a C4-dicarboxylate transporter gene from A. oryzae and an L-malate permease gene from Schizosaccharomyces pombe, improving the L-malate titer from 58.5gL -1 to 89.5gL -1 . Lastly, guided by transcription analysis of the expression profile of key genes related to L-malate synthesis, the 6-phosphofructokinase encoded by the pfk gene was identified as a potential limiting step for L-malate synthesis. Overexpression of pfk with the strong sodM promoter increased the L-malate titer to 93.2gL -1 . The final engineered A. oryzae strain produced 165gL -1 L-malate with a productivity of 1.38gL -1 h -1 in 3-L fed-batch culture. Overall, we constructed an efficient L-malate producer by rewiring the rTCA pathway and L-malate transport pathway of A. oryzae NRRL 3488, and the engineering strategy adopted here may be useful for the construction of A. oryzae cell factories to produce other organic acids. Copyright © 2017 Elsevier B.V. All rights reserved.
Luís, Inês M.; Alexandre, Bruno M.; Oliveira, M. Margarida
2016-01-01
Often plant tissues are recalcitrant and, due to that, methods relying on protein precipitation, such as TCA/acetone precipitation and phenol extraction, are usually the methods of choice for protein extraction in plant proteomic studies. However, the addition of precipitation steps to protein extraction methods may negatively impact protein recovery, due to problems associated with protein re-solubilization. Moreover, we show that when working with non-recalcitrant plant tissues, such as young maize leaves, protein extraction methods with precipitation steps compromise the maintenance of some labile post-translational modifications (PTMs), such as phosphorylation. Therefore, a critical issue when studying PTMs in plant proteins is to ensure that the protein extraction method is the most appropriate, both at qualitative and quantitative levels. In this work, we compared five methods for protein extraction of the C4-photosynthesis related proteins, in the tip of fully expanded third-leaves. These included: TCA/Acetone Precipitation; Phenol Extraction; TCA/Acetone Precipitation followed by Phenol Extraction; direct extraction in Lysis Buffer (a urea-based buffer); and direct extraction in Lysis Buffer followed by Cleanup with a commercial kit. Protein extraction in Lysis Buffer performed better in comparison to the other methods. It gave one of the highest protein yields, good coverage of the extracted proteome and phosphoproteome, high reproducibility, and little protein degradation. This was also the easiest and fastest method, warranting minimal sample handling. We also show that this method is adequate for the successful extraction of key enzymes of the C4-photosynthetic metabolism, such as PEPC, PPDK, PEPCK, and NADP-ME. This was confirmed by MALDI-TOF/TOF MS analysis of excised spots of 2DE analyses of the extracted protein pools. Staining for phosphorylated proteins in 2DE revealed the presence of several phosphorylated isoforms of PEPC, PPDK, and PEPCK. PMID:27727304
Park, Hee-Sook; Lee, So Min; Jeong, Nam-Joo; Kim, Soon-Hee; Lee, Kyoung-Won; Lee, Ju-A
2017-01-01
Shaofu Zhuyu decoction (SFZYD, also known as Sobokchugeo-tang), a classical prescription drug in traditional East Asian medicine, has been used to treat blood stasis syndrome (BSS). Hepatic steatosis is the result of excess caloric intake, and its pathogenesis involves internal retention of phlegm and dampness, blood stasis, and liver Qi stagnation. To evaluate the effects of treatment with SFZYD on obesity-induced inflammation and hepatic steatosis, we fed male C57BL/6N mice a high fat diet (HFD) for 8 weeks and then treated them with SFZYD by oral gavage for an additional 4 weeks. The results of histological and biochemical examinations indicated that SFZYD treatment ameliorates systemic inflammation and hepatic steatosis. A partial least squares-discriminant analysis (PLS-DA) scores plot of serum metabolites showed that HFD mice began to produce metabolites similar to those of normal chow (NC) mice after SFZYD administration. We noted significant alterations in the levels of twenty-seven metabolites, alterations indicating that SFZYD regulates the TCA cycle, the pentose phosphate pathway and aromatic amino acid metabolism. Increases in the levels of TCA cycle intermediate metabolites, such as 2-oxoglutaric acid, isocitric acid, and malic acid, in the serum of obese mice were significantly reversed after SFZYD treatment. In addition to inducing changes in the above metabolites, treatment with SFZYD also recovered the expression of genes related to hepatic mitochondrial dysfunction, including Ucp2, Cpt1α, and Ppargc1α, as well as the expression of genes involved in lipid metabolism and inflammation, without affecting glucose uptake or insulin signaling. Taken together, these findings suggest that treatment with SFZYD ameliorated obesity-induced systemic inflammation and hepatic steatosis by regulating inflammatory cytokine and adipokine levels in the circulation and various tissues. Moreover, treatment with SFZYD also reversed alterations in the levels of metabolites of the TCA cycle, the pentose phosphate pathway and aromatic amino acid metabolism. PMID:28570676
Effects of visceral adiposity on glycerol pathways in gluconeogenesis.
Neeland, Ian J; Hughes, Connor; Ayers, Colby R; Malloy, Craig R; Jin, Eunsook S
2017-02-01
To determine the feasibility of using oral 13 C labeled glycerol to assess effects of visceral adiposity on gluconeogenic pathways in obese humans. Obese (BMI ≥30kg/m 2 ) participants without type 2 diabetes underwent visceral adipose tissue (VAT) assessment and stratification by median VAT into high VAT-fasting (n=3), low VAT-fasting (n=4), and high VAT-refed (n=2) groups. Participants ingested [U- 13 C 3 ] glycerol and blood samples were subsequently analyzed at multiple time points over 3h by NMR spectroscopy. The fractions of plasma glucose (enrichment) derived from [U- 13 C 3 ] glycerol via hepatic gluconeogenesis, pentose phosphate pathway (PPP), and tricarboxylic acid (TCA) cycle were assessed using 13 C NMR analysis of glucose. Mixed linear models were used to compare 13 C enrichment in glucose between groups. Mean age, BMI, and baseline glucose were 49years, 40.1kg/m 2 , and 98mg/dl, respectively. Up to 20% of glycerol was metabolized in the TCA cycle prior to gluconeogenesis and PPP activity was minor (<1% of total glucose) in all participants. There was a 21% decrease in 13 C enrichment in plasma glucose in the high VAT-fasting compared with low VAT-fasting group (p=0.03), suggesting dilution by endogenous glycerol. High VAT-refed participants had 37% less 13 C enrichment in glucose compared with high VAT-fasting (p=0.02). There was a trend toward lower [1,2- 13 C 2 ] (via PPP) and [5,6- 13 C 2 ]/[4,5,6- 13 C 3 ] (via TCA cycle) glucose in high VAT versus low VAT groups. We applied a simple method to detect gluconeogenesis from glycerol in obese humans. Our findings provide preliminary evidence that excess visceral fat disrupts multiple pathways in hepatic gluconeogenesis from glycerol. Copyright © 2016 Elsevier Inc. All rights reserved.
Effects of Visceral Adiposity on Glycerol Pathways in Gluconeogenesis
Neeland, Ian J.; Hughes, Connor; Ayers, Colby R.; Malloy, Craig R.; Jin, Eunsook S.
2016-01-01
Objective To determine the feasibility of using oral 13C labeled glycerol at assess effects of visceral adiposity on gluconeogenic pathways in obese humans. Research Design and Methods Obese (BMI ≥30 kg/m2) participants without type 2 diabetes underwent visceral adipose tissue (VAT) assessment and stratification by median VAT into high VAT-fasting (n=3), low VAT-fasting (n=4), and high VAT-refed (n=2) groups. Participants ingested [U-13C3] glycerol and blood samples were subsequently analyzed at multiple time points over 3 hours by NMR spectroscopy. The fractions of plasma glucose (enrichment) derived from [U-13C3] glycerol via hepatic gluconeogenesis, pentose phosphate pathway (PPP), and tricarboxylic acid (TCA) cycle were assessed using 13C NMR analysis of glucose. Mixed linear models were used to compare 13C enrichment in glucose between groups. Results Mean age, BMI, and baseline glucose were 49 years, 40.1 kg/m2, and 98 mg/dl, respectively. Up to 20% of glycerol was metabolized in the TCA cycle prior to gluconeogenesis and PPP activity was minor (<1% of total glucose) in all participants. There was a 21% decrease in 13C enrichment in plasma glucose in the high VAT-fasting compared with low VAT-fasting group (p=0.03), suggesting dilution by endogenous glycerol. High VAT-refed participants had 37% less 13C enrichment in glucose compared with high VAT-fasting (p=0.02). There was a trend toward lower [1,2-13C2] (via PPP) and [5,6-13C2]/[4,5,6-13C3] (via TCA cycle) glucose in high VAT versus low VAT groups. Conclusions We applied a simple method to detect gluconeogenesis from glycerol in obese humans. Our findings provide preliminary evidence that excess visceral fat disrupts multiple pathways in hepatic gluconeogenesis from glycerol. PMID:28081781
NASA Technical Reports Server (NTRS)
Ballard, Richard O.
2007-01-01
In 2005-06, the Prometheus program funded a number of tasks at the NASA-Marshall Space Flight Center (MSFC) to support development of a Nuclear Thermal Propulsion (NTP) system for future manned exploration missions. These tasks include the following: 1. NTP Design Develop Test & Evaluate (DDT&E) Planning 2. NTP Mission & Systems Analysis / Stage Concepts & Engine Requirements 3. NTP Engine System Trade Space Analysis and Studies 4. NTP Engine Ground Test Facility Assessment 5. Non-Nuclear Environmental Simulator (NTREES) 6. Non-Nuclear Materials Fabrication & Evaluation 7. Multi-Physics TCA Modeling. This presentation is a overview of these tasks and their accomplishments
KCNQ1 Haplotypes Associate with Type 2 Diabetes in Malaysian Chinese Subjects
Saif-Ali, Riyadh; Ismail, Ikram S.; Al-Hamodi, Zaid; Al-Mekhlafi, Hesham M.; Siang, Lee C.; Alabsi, Aied M.; Muniandy, Sekaran
2011-01-01
The aim of this study was to investigate the association of single nucleotide polymorphisms (SNPs) and haplotypes of potassium voltage-gated channel, KQT-like subfamily, member 1 (KCNQ1) with type 2 diabetes (T2D) in Malaysian Chinese subjects. The KCNQ1 SNPs rs2237892, rs2283228 and rs2237895 were genotyped in 300 T2D patients and 230 control subjects without diabetes and metabolic syndrome. Two logistic regression models of analysis were applied, the first adjusted for age and gender while the second adjusted for age, gender and body mass index. The additive genetic analysis showed that adjusting for body mass index (BMI) even strengthened association of rs2237892, rs2283228 and rs2237895 with T2D (OR = 2.0, P = 5.1 × 10−5; OR = 1.9, P = 5.2 × 10−5; OR = 1.9, P = 7.8 × 10−5, respectively). The haplotype TCA containing the allele of rs2237892 (T), rs2283228 (C) and rs2237895 (A) was highly protective against T2D (Second model; OR = 0.17, P = 3.7 × 10−11). The KCNQ1 rs2237892 (TT), and the protective haplotype (TCA) were associated with higher beta-cell function (HOMA-B) in normal subjects (P = 0.0002; 0.014, respectively). This study found that KCNQ1 SNPs was associated with T2D susceptibility in Malaysian Chinese subjects. In addition, certain KCNQ1 haplotypes were strongly associated with T2D. PMID:22016621
Leke, Renata; Bak, Lasse K; Anker, Malene; Melø, Torun M; Sørensen, Michael; Keiding, Susanne; Vilstrup, Hendrik; Ott, Peter; Portela, Luis V; Sonnewald, Ursula; Schousboe, Arne; Waagepetersen, Helle S
2011-04-01
Cerebral hyperammonemia is believed to play a pivotal role in the development of hepatic encephalopathy (HE), a debilitating condition arising due to acute or chronic liver disease. In the brain, ammonia is thought to be detoxified via the activity of glutamine synthetase, an astrocytic enzyme. Moreover, it has been suggested that cerebral tricarboxylic acid (TCA) cycle metabolism is inhibited and glycolysis enhanced during hyperammonemia. The aim of this study was to characterize the ammonia-detoxifying mechanisms as well as the effects of ammonia on energy-generating metabolic pathways in a mouse neuronal-astrocytic co-culture model of the GABAergic system. We found that 5 mM ammonium chloride affected energy metabolism by increasing the neuronal TCA cycle activity and switching the astrocytic TCA cycle toward synthesis of substrate for glutamine synthesis. Furthermore, ammonia exposure enhanced the synthesis and release of alanine. Collectively, our results demonstrate that (1) formation of glutamine is seminal for detoxification of ammonia; (2) neuronal oxidative metabolism is increased in the presence of ammonia; and (3) synthesis and release of alanine is likely to be important for ammonia detoxification as a supplement to formation of glutamine.
Dillehay, Jacob L; Bowman, Kimberly S; Yan, Jun; Rainey, Fred A; Moe, William M
2014-04-01
When chlorinated alkanes are present as soil or groundwater pollutants, they often occur in mixtures. This study evaluated substrate interactions during the anaerobic reductive dehalogenation of chlorinated alkanes by the type strains of two Dehalogenimonas species, D. lykanthroporepellens and D. alkenigignens. Four contaminant mixtures comprised of combinations of the chlorinated solvents 1,2-dichloroethane (1,2-DCA), 1,2-dichloropropane (1,2-DCP), and 1,1,2-trichloroethane (1,1,2-TCA) were assessed for each species. Chlorinated solvent depletion and daughter product formation determined as a function of time following inoculation into anaerobic media revealed preferential dechlorination of 1,1,2-TCA over both 1,2-DCA and 1,2-DCP for both species. 1,2-DCA in particular was not dechlorinated until 1,1,2-TCA reached low concentrations. In contrast, both species concurrently dechlorinated 1,2-DCA and 1,2-DCP over a comparably large concentration range. This is the first report of substrate interactions during chlorinated alkane dehalogenation by pure cultures, and the results provide insights into the chlorinated alkane transformation processes that may be expected for contaminant mixtures in environments where Dehalogenimonas spp. are present.
Sulfate radicals enable a non-enzymatic Krebs cycle precursor
Keller, Markus A.; Kampjut, Domen; Harrison, Stuart A.; Ralser, Markus
2017-01-01
The evolutionary origins of the tricarboxylic acid cycle (TCA), or Krebs cycle, are so far unclear. Despite a few years ago, the existence of a simple non-enzymatic Krebs-cycle catalyst has been dismissed ‘as an appeal to magic’, citrate and other intermediates have meanwhile been discovered on a carbonaceous meteorite and do interconvert non-enzymatically. To identify the non-enzymatic Krebs cycle catalyst, we used combinatorial, quantitative high-throughput metabolomics to systematically screen iron and sulfate reaction milieus that orient on Archean sediment constituents. TCA cycle intermediates are found stable in water and in the presence of most iron and sulfate species, including simple iron-sulfate minerals. However, we report that TCA intermediates undergo 24 interconversion reactions in the presence of sulfate radicals that form from peroxydisulfate. The non-enzymatic reactions critically cover a topology as present in the Krebs cycle, the glyoxylate shunt and the succinic semialdehyde pathways. Assembled in a chemical network, the reactions achieve more than ninety percent carbon recovery. Our results show that a non-enzymatic precursor for the Krebs cycle is biologically sensible, efficient, and forms spontaneously in the presence of sulfate radicals. PMID:28584880
Tavsan, Zehra; Ayar Kayali, Hulya
2015-05-01
The efficiency of optimal metabolic function by microorganism depends on various parameters, especially essential metal supplementation. In the present study, the effects of iron and copper metals on metabolism were investigated by determination of glycolysis and tricarboxylic acid (TCA) cycle metabolites' levels with respect to the metal concentrations and incubation period in Trichoderma harzianum. The pyruvate and citrate levels of T. harzianum increased up to 15 mg/L of copper via redirection of carbon flux though glycolysis by suppression of pentose phosphate pathway (PPP). However, the α-ketoglutarate levels decreased at concentration higher than 5 mg/L of copper to overcome damage of oxidative stress. The fumarate levels correlated with the α-ketoglutarate levels because of substrate limitation. Besides, in T. harzianum cells grown in various concentrations of iron-containing medium, the intracellular pyruvate, citrate, and α-ketoglutarate levels showed positive correlation with iron concentration due to modifying of expression of glycolysis and TCA cycle enzymes via a mechanism involving cofactor or allosteric regulation. However, as a result of consuming of prior substrates required for fumarate production, its levels rose up to 10 mg/L.
Leheta, Tahra Mohamed; Abdel Hay, Rania Mounir; El Garem, Yehia Farouk
2014-04-01
Deep peeling using phenol and percutaneous collagen induction (PCI) are used in treating acne scars. To compare deep peeling using phenol and PCI combined with trichloroacetic acid (TCA) 20% in treating atrophic acne scars. 24 patients with post-acne atrophic scars were randomly divided into two groups; group 1 was subjected to one session of deep peeling using phenol, and group 2 was subjected to four sessions of PCI combined with TCA 20%. As a secondary outcome measure, side effects were recorded and patients were asked to assess their % of improvement by a questionnaire completed 8 months after the procedure. Scar severity scores improved by a mean of 75.12% (p < 0.001) in group 1 and a mean of 69.43% (p < 0.001) in group 2. Comparing the degree of improvement in different types of scars, within the same group after treatment, revealed a significant highest degree of improvement in the rolling type (p = 0.005) in group 2. Deep peeling using phenol and PCI with TCA 20% were effective in treating post-acne atrophic scars.
Gonser, P; Kaestner, S; Jaminet, P; Kaye, K
2017-11-01
A histological evaluation of peeling-induced skin changes in subcutaneous undermined preauricular facial skin flaps of nine patients was performed. There were three treatment groups: Trichloroacetic acid (TCA) 25%, TCA 40% and phenol/croton oil; one group served as control. Two independent evaluators determined the epidermal and dermal thickness and the depth of necrosis (micrometre). The percentual tissue damage due to the peeling was calculated, and a one-sample t-test for statistical significance was performed. On the basis of the histomorphological changes, peeling depth was classified as superficial, superficial-partial, deep-partial and full thickness chemical burn. The histological results revealed a progression of wound depth for different peeling agents without full thickness necrosis. TCA peels of up to 40% can be safely applied on subcutaneous undermined facial skin flaps without impairing the vascular patency, producing a predictable chemical burn, whereas deep peels such as phenol/croton oil peels should not be applied on subcutaneous undermined skin so as to not produce skin slough or necrosis by impairing vascular patency. Copyright © 2017 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.
Finite element and analytical models for twisted and coiled actuator
NASA Astrophysics Data System (ADS)
Tang, Xintian; Liu, Yingxiang; Li, Kai; Chen, Weishan; Zhao, Jianguo
2018-01-01
Twisted and coiled actuator (TCA) is a class of recently discovered artificial muscle, which is usually made by twisting and coiling polymer fibers into spring-like structures. It has been widely studied since discovery due to its impressive output characteristics and bright prospects. However, its mathematical models describing the actuation in response to the temperature are still not fully developed. It is known that the large tensile stroke is resulted from the untwisting of the twisted fiber when heated. Thus, the recovered torque during untwisting is a key parameter in the mathematical model. This paper presents a simplified model for the recovered torque of TCA. Finite element method is used for evaluating the thermal stress of the twisted fiber. Based on the results of the finite element analyses, the constitutive equations of twisted fibers are simplified to develop an analytic model of the recovered torque. Finally, the model of the recovered torque is used to predict the deformation of TCA under varying temperatures and validated against experimental results. This work will enhance our understanding of the deformation mechanism of TCAs, which will pave the way for the closed-loop position control.
Davuluri, Gangarao; Allawy, Allawy; Thapaliya, Samjhana; Rennison, Julie H.; Singh, Dharmvir; Kumar, Avinash; Sandlers, Yana; Van Wagoner, David R.; Flask, Chris A.; Hoppel, Charles; Kasumov, Takhar
2016-01-01
Key points Hyperammonaemia occurs in hepatic, cardiac and pulmonary diseases with increased muscle concentration of ammonia.We found that ammonia results in reduced skeletal muscle mitochondrial respiration, electron transport chain complex I dysfunction, as well as lower NAD+/NADH ratio and ATP content.During hyperammonaemia, leak of electrons from complex III results in oxidative modification of proteins and lipids.Tricarboxylic acid cycle intermediates are decreased during hyperammonaemia, and providing a cell‐permeable ester of αKG reversed the lower TCA cycle intermediate concentrations and increased ATP content.Our observations have high clinical relevance given the potential for novel approaches to reverse skeletal muscle ammonia toxicity by targeting the TCA cycle intermediates and mitochondrial ROS. Abstract Ammonia is a cytotoxic metabolite that is removed primarily by hepatic ureagenesis in humans. Hyperammonaemia occurs in advanced hepatic, cardiac and pulmonary disease, and in urea cycle enzyme deficiencies. Increased skeletal muscle ammonia uptake and metabolism are the major mechanism of non‐hepatic ammonia disposal. Non‐hepatic ammonia disposal occurs in the mitochondria via glutamate synthesis from α‐ketoglutarate resulting in cataplerosis. We show skeletal muscle mitochondrial dysfunction during hyperammonaemia in a comprehensive array of human, rodent and cellular models. ATP synthesis, oxygen consumption, generation of reactive oxygen species with oxidative stress, and tricarboxylic acid (TCA) cycle intermediates were quantified. ATP content was lower in the skeletal muscle from cirrhotic patients, hyperammonaemic portacaval anastomosis rat, and C2C12 myotubes compared to appropriate controls. Hyperammonaemia in C2C12 myotubes resulted in impaired intact cell respiration, reduced complex I/NADH oxidase activity and electron leak occurring at complex III of the electron transport chain. Consistently, lower NAD+/NADH ratio was observed during hyperammonaemia with reduced TCA cycle intermediates compared to controls. Generation of reactive oxygen species resulted in increased content of skeletal muscle carbonylated proteins and thiobarbituric acid reactive substances during hyperammonaemia. A cell‐permeable ester of α‐ketoglutarate reversed the low TCA cycle intermediates and ATP content in myotubes during hyperammonaemia. However, the mitochondrial antioxidant MitoTEMPO did not reverse the lower ATP content during hyperammonaemia. We provide for the first time evidence that skeletal muscle hyperammonaemia results in mitochondrial dysfunction and oxidative stress. Use of anaplerotic substrates to reverse ammonia‐induced mitochondrial dysfunction is a novel therapeutic approach. PMID:27558544
Heffern, Kevin; Tierney, Keith; Gallagher, Evan P
2018-05-28
Studies have shown that olfactory-mediated behaviors that are critical to survival can be disrupted by exposure to certain metals. Polluted waterways often contain elevated levels of metals, yet only a subset have been characterized for their potential to cause olfactory toxicity. A larval zebrafish behavioral assay was developed to characterize concentration-response curves for zinc (Zn), hexavalent chromium (Cr), and arsenate (As) olfaction inhibition. Cadmium (Cd), an established olfactory toxicant, was used as a positive control. As expected, following a 24-hour exposure to Cd, we observed a reduced response to taurocholic acid (TCA), a substrate for ciliated olfactory sensory neurons (OSNs), thus validating the behavioral assay. Zn exposure similarly decreased the olfactory response toward TCA, (IC 50 : 36 μg/L and 76 μg/L, for Cd and Zn, respectively). The response towards a secondary odorant L-cysteine (Cys), a substrate for ciliated and microvillous OSNs, was significantly altered by both Cd and Zn exposure, although the response to Cys was not completely removed in Zn treated larvae, suggesting preferential toxicity towards ciliated OSNs. No significant changes in olfactory responses were observed following Cr and As exposures. Exposures to binary mixtures of Cd and Zn indicated that Zn had a protective effect against Cd toxicity at low Zn concentrations. QuantiGene (QDP) RNA analysis revealed Cd to be a potent inducer of metallothionein 2 (mt2) mRNA in zebrafish larvae, and Zn to be a weak mt2 inducer, suggesting a protective role of mt2 in Cd and Zn olfactory injury. By contrast, QDP analysis of eight other genes important in mitigating the effects of oxidative stress suggested an antioxidant response to Cd, but not Zn, As, and Cr suggesting that oxidative stress was not a primary mechanism of Zn-induced olfactory dysfunction. In summary, our study indicates that Zn inhibits zebrafish olfaction at environmental concentrations and may potentially mitigate Cd induced olfactory dysfunction when present in mixtures. The zebrafish behavioral trough assay incorporating the odorants L-cysteine and TCA is an effective assay to assess the effects of metals on olfactory function. Copyright © 2018 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tang, Shuiquan; Wang, Po Hsiang; Higgins, Steven A.
Here we report that the genomes of two closely related Dehalobacter strains (strain CF and strain DCA) were assembled from the metagenome of an anaerobic enrichment culture that reductively dechlorinates chloroform (CF), 1,1,1-trichloroethane (1,1,1-TCA) and 1,1-dichloroethane (1,1-DCA). The 3.1 Mbp genomes of strain CF (that dechlorinates CF and 1,1,1-TCA) and strain DCA (that dechlorinates 1,1-DCA) each contain 17 putative reductive dehalogenase homologous (rdh) genes. These two genomes were systematically compared to three other available organohalide-respiring Dehalobacter genomes (Dehalobacter restrictus strain PER-K23, Dehalobacter sp. strain E1 and Dehalobacter sp. strain UNSWDHB), and to the genomes of Dehalococcoides mccartyi strain 195 andmore » Desulfitobacterium hafniense strain Y51. This analysis compared 42 different metabolic and physiological categories. The genomes of strains CF and DCA share 90% overall average nucleotide identity and >99.8% identity over a 2.9 Mbp alignment that excludes large insertions, indicating that these genomes differentiated from a close common ancestor. This differentiation was likely driven by selection pressures around two orthologous reductive dehalogenase genes, cfrA and dcrA, that code for the enzymes that reduce CF or 1,1,1-TCA and 1,1-DCA. The many reductive dehalogenase genes found in the five Dehalobacter genomes cluster into two small conserved regions and were often associated with Crp/Fnr transcriptional regulators. Specialization is on-going on a strain-specific basis, as some strains but not others have lost essential genes in the Wood-Ljungdahl (strain E1) and corrinoid biosynthesis pathways (strains E1 and PER-K23). The gene encoding phosphoserine phosphatase, which catalyzes the last step of serine biosynthesis, is missing from all five Dehalobacter genomes, yet D. restrictus can grow without serine, suggesting an alternative or unrecognized biosynthesis route exists. In contrast to D. mccartyi, a complete heme biosynthesis pathway is present in the five Dehalobacter genomes. This pathway corresponds to a newly described alternative heme biosynthesis route first identified in Archaea. Ultimately, this analysis of organohalide-respiring Firmicutes and Chloroflexi reveals profound evolutionary differences despite very similar niche-specific metabolism and function.« less
Tang, Shuiquan; Wang, Po Hsiang; Higgins, Steven A.; ...
2016-02-12
Here we report that the genomes of two closely related Dehalobacter strains (strain CF and strain DCA) were assembled from the metagenome of an anaerobic enrichment culture that reductively dechlorinates chloroform (CF), 1,1,1-trichloroethane (1,1,1-TCA) and 1,1-dichloroethane (1,1-DCA). The 3.1 Mbp genomes of strain CF (that dechlorinates CF and 1,1,1-TCA) and strain DCA (that dechlorinates 1,1-DCA) each contain 17 putative reductive dehalogenase homologous (rdh) genes. These two genomes were systematically compared to three other available organohalide-respiring Dehalobacter genomes (Dehalobacter restrictus strain PER-K23, Dehalobacter sp. strain E1 and Dehalobacter sp. strain UNSWDHB), and to the genomes of Dehalococcoides mccartyi strain 195 andmore » Desulfitobacterium hafniense strain Y51. This analysis compared 42 different metabolic and physiological categories. The genomes of strains CF and DCA share 90% overall average nucleotide identity and >99.8% identity over a 2.9 Mbp alignment that excludes large insertions, indicating that these genomes differentiated from a close common ancestor. This differentiation was likely driven by selection pressures around two orthologous reductive dehalogenase genes, cfrA and dcrA, that code for the enzymes that reduce CF or 1,1,1-TCA and 1,1-DCA. The many reductive dehalogenase genes found in the five Dehalobacter genomes cluster into two small conserved regions and were often associated with Crp/Fnr transcriptional regulators. Specialization is on-going on a strain-specific basis, as some strains but not others have lost essential genes in the Wood-Ljungdahl (strain E1) and corrinoid biosynthesis pathways (strains E1 and PER-K23). The gene encoding phosphoserine phosphatase, which catalyzes the last step of serine biosynthesis, is missing from all five Dehalobacter genomes, yet D. restrictus can grow without serine, suggesting an alternative or unrecognized biosynthesis route exists. In contrast to D. mccartyi, a complete heme biosynthesis pathway is present in the five Dehalobacter genomes. This pathway corresponds to a newly described alternative heme biosynthesis route first identified in Archaea. Ultimately, this analysis of organohalide-respiring Firmicutes and Chloroflexi reveals profound evolutionary differences despite very similar niche-specific metabolism and function.« less
Yang, Liu; Yu, Qing-Tao; Ge, Ya-Zhong; Zhang, Wen-Song; Fan, Yong; Ma, Chung-Wah; Liu, Qun; Qi, Lian-Wen
2016-01-01
Ginseng occupies a prominent position in the list of best-selling natural products worldwide. Asian ginseng (Panax ginseng) and American ginseng (Panax quinquefolius) show different properties and medicinal applications in pharmacology, even though the main active constituents of them are both thought to be ginsenosides. Metabolomics is a promising method to profile entire endogenous metabolites and monitor their fluctuations related to exogenous stimulus. Herein, an untargeted metabolomics approach was applied to study the overall urine metabolic differences between Asian ginseng and American ginseng in mice. Metabolomics analyses were performed using gas chromatography-mass spectrometry (GC-MS) together with multivariate statistical data analysis. A total of 21 metabolites related to D-glutamine and D-glutamate metabolism, glutathione metabolism, TCA cycle and glyoxylate and dicarboxylate metabolism, differed significantly under the Asian ginseng treatment; 34 metabolites mainly associated with glyoxylate and dicarboxylate metabolism, TCA cycle and taurine and hypotaurine metabolism, were significantly altered after American ginseng treatment. Urinary metabolomics reveal that Asian ginseng and American ginseng can benefit organism physiological and biological functions via regulating multiple metabolic pathways. The important pathways identified from Asian ginseng and American ginseng can also help to explore new therapeutic effects or action targets so as to broad application of these two ginsengs. PMID:27991533
Overexpression of the human DEK oncogene reprograms cellular metabolism and promotes glycolysis
Watanabe, Miki; Muraleedharan, Ranjithmenon; Lambert, Paul F.; Lane, Andrew N.; Romick-Rosendale, Lindsey E.; Wells, Susanne I.
2017-01-01
The DEK oncogene is overexpressed in many human malignancies including at early tumor stages. Our reported in vitro and in vivo models of squamous cell carcinoma have demonstrated that DEK contributes functionally to cellular and tumor survival and to proliferation. However, the underlying molecular mechanisms remain poorly understood. Based on recent RNA sequencing experiments, DEK expression was necessary for the transcription of several metabolic enzymes involved in anabolic pathways. This identified a possible mechanism whereby DEK may drive cellular metabolism to enable cell proliferation. Functional metabolic Seahorse analysis demonstrated increased baseline and maximum extracellular acidification rates, a readout of glycolysis, in DEK-overexpressing keratinocytes and squamous cell carcinoma cells. DEK overexpression also increased the maximum rate of oxygen consumption and therefore increased the potential for oxidative phosphorylation (OxPhos). To detect small metabolites that participate in glycolysis and the tricarboxylic acid cycle (TCA) that supplies substrate for OxPhos, we carried out NMR-based metabolomics studies. We found that high levels of DEK significantly reprogrammed cellular metabolism and altered the abundances of amino acids, TCA cycle intermediates and the glycolytic end products lactate, alanine and NAD+. Taken together, these data support a scenario whereby overexpression of the human DEK oncogene reprograms keratinocyte metabolism to fulfill energy and macromolecule demands required to enable and sustain cancer cell growth. PMID:28558019
Overexpression of the human DEK oncogene reprograms cellular metabolism and promotes glycolysis.
Matrka, Marie C; Watanabe, Miki; Muraleedharan, Ranjithmenon; Lambert, Paul F; Lane, Andrew N; Romick-Rosendale, Lindsey E; Wells, Susanne I
2017-01-01
The DEK oncogene is overexpressed in many human malignancies including at early tumor stages. Our reported in vitro and in vivo models of squamous cell carcinoma have demonstrated that DEK contributes functionally to cellular and tumor survival and to proliferation. However, the underlying molecular mechanisms remain poorly understood. Based on recent RNA sequencing experiments, DEK expression was necessary for the transcription of several metabolic enzymes involved in anabolic pathways. This identified a possible mechanism whereby DEK may drive cellular metabolism to enable cell proliferation. Functional metabolic Seahorse analysis demonstrated increased baseline and maximum extracellular acidification rates, a readout of glycolysis, in DEK-overexpressing keratinocytes and squamous cell carcinoma cells. DEK overexpression also increased the maximum rate of oxygen consumption and therefore increased the potential for oxidative phosphorylation (OxPhos). To detect small metabolites that participate in glycolysis and the tricarboxylic acid cycle (TCA) that supplies substrate for OxPhos, we carried out NMR-based metabolomics studies. We found that high levels of DEK significantly reprogrammed cellular metabolism and altered the abundances of amino acids, TCA cycle intermediates and the glycolytic end products lactate, alanine and NAD+. Taken together, these data support a scenario whereby overexpression of the human DEK oncogene reprograms keratinocyte metabolism to fulfill energy and macromolecule demands required to enable and sustain cancer cell growth.
Zhang, Hong-Tao; Zhan, Xiao-Bei; Zheng, Zhi-Yong; Wu, Jian-Rong; Yu, Xiao-Bin; Jiang, Yun; Lin, Chi-Chung
2011-07-01
Expression at the mRNA level of ten selected genes in Agrobacterium sp. ATCC 31749 under various dissolved oxygen (DO) levels during curdlan fermentation related to electron transfer chain (ETC), tricarboxylic acid (TCA) cycle, peptidoglycan/lipopolysaccharide biosynthesis, and uridine diphosphate (UDP)-glucose biosynthesis were determined by qRT-PCR. Experiments were performed at DO levels of 30%, 50%, and 75%, as well as under low-oxygen conditions. The effect of high cell density on transcriptional response of the above genes under low oxygen was also studied. Besides cytochrome d (cyd A), the transcription levels of all the other genes were increased at higher DO and reached maximum at 50% DO. Under 75% DO, the transcriptional levels of all the genes were repressed. In addition, transcription levels of icd, sdh, cyo A, and fix N genes did not exhibit significant fluctuation with high cell density culture under low oxygen. These results suggested a mechanism for DO regulation of curdlan synthesis through regulation of transcriptional levels of ETCs, TCA, and UDP-glucose synthesis genes during curdlan fermentation. To our knowledge, this is the first report that DO concentration apparently regulates curdlan biosynthesis in Agrobacterium sp. ATCC 31749 providing essential lead for the optimization of the fermentation at the industrial scale.
Qattan, Amal T.; Radulovic, Marko; Crawford, Mark; Godovac-Zimmermann, Jasminka
2014-01-01
Concurrent proteomics analysis of the nuclei and mitochondria of MCF7 breast cancer cells identified 985 proteins (40% of all detected proteins) present in both organelles. Numerous proteins from all five complexes involved in oxidative phosphorylation (e.g., NDUFA5, NDUFB10, NDUFS1, NDUF2, SDHA, UQRB, UQRC2, UQCRH, COX5A, COX5B, MT-CO2, ATP5A1, ATP5B, ATP5H, etc.), from the TCA-cycle (DLST, IDH2, IDH3A, OGDH, SUCLAG2, etc.), and from glycolysis (ALDOA, ENO1, FBP1, GPI, PGK1, TALDO1, etc.) were distributed to both the nucleus and mitochondria. In contrast, proteins involved in nuclear/mitochondrial RNA processing/translation and Ras/Rab signaling showed different partitioning patterns. The identity of the OxPhos, TCA-cycle, and glycolysis proteins distributed to both the nucleus and mitochondria provides evidence for spatio-functional integration of these processes over the two different subcellular organelles. We suggest that there are unrecognized aspects of functional coordination between the nucleus and mitochondria, that integration of core functional processes via wide subcellular distribution of constituent proteins is a common characteristic of cells, and that subcellular spatial integration of function may be a vital aspect of cancer. PMID:23051583
Shim, Wooyoung; Anwar, Muhammad Ayaz; Kwon, Ji-Woong; Kwon, Hyuk-Kwon; Kim, Hyung Joong; Jeong, Hyobin; Kim, Hwan Myung; Hwang, Daehee; Kim, Hyung Sik; Choi, Sangdun
2015-01-01
The chemotherapeutic use of cisplatin is limited by its severe side effects. In this study, by conducting different omics data analyses, we demonstrated that cisplatin induces cell death in a proximal tubular cell line by suppressing glycolysis- and tricarboxylic acid (TCA)/mitochondria-related genes. Furthermore, analysis of the urine from cisplatin-treated rats revealed the lower expression levels of enzymes involved in glycolysis, TCA cycle, and genes related to mitochondrial stability and confirmed the cisplatin-related metabolic abnormalities. Additionally, an increase in the level of p53, which directly inhibits glycolysis, has been observed. Inhibition of p53 restored glycolysis and significantly reduced the rate of cell death at 24 h and 48 h due to p53 inhibition. The foremost reason of cisplatin-related cytotoxicity has been correlated to the generation of mitochondrial reactive oxygen species (ROS) that influence multiple pathways. Abnormalities in these pathways resulted in the collapse of mitochondrial energy production, which in turn sensitized the cells to death. The quenching of ROS led to the amelioration of the affected pathways. Considering these observations, it can be concluded that there is a significant correlation between cisplatin and metabolic dysfunctions involving mROS as the major player. PMID:26247588
Voll, Lars Matthias; Horst, Robin Jonathan; Voitsik, Anna-Maria; Zajic, Doreen; Samans, Birgit; Pons-Kühnemann, Jörn; Doehlemann, Gunther; Münch, Steffen; Wahl, Ramon; Molitor, Alexandra; Hofmann, Jörg; Schmiedl, Alfred; Waller, Frank; Deising, Holger Bruno; Kahmann, Regine; Kämper, Jörg; Kogel, Karl-Heinz; Sonnewald, Uwe
2011-01-01
During compatible interactions with their host plants, biotrophic plant–pathogens subvert host metabolism to ensure the sustained provision of nutrient assimilates by the colonized host cells. To investigate, whether common motifs can be revealed in the response of primary carbon and nitrogen metabolism toward colonization with biotrophic fungi in cereal leaves, we have conducted a combined metabolome and transcriptome study of three quite divergent pathosystems, the barley powdery mildew fungus (Blumeria graminis f.sp. hordei), the corn smut fungus Ustilago maydis, and the maize anthracnose fungus Colletotrichum graminicola, the latter being a hemibiotroph that only exhibits an initial biotrophic phase during its establishment. Based on the analysis of 42 water-soluble metabolites, we were able to separate early biotrophic from late biotrophic interactions by hierarchical cluster analysis and principal component analysis, irrespective of the plant host. Interestingly, the corresponding transcriptome dataset could not discriminate between these stages of biotrophy, irrespective, of whether transcript data for genes of central metabolism or the entire transcriptome dataset was used. Strong differences in the transcriptional regulation of photosynthesis, glycolysis, the TCA cycle, lipid biosynthesis, and cell wall metabolism were observed between the pathosystems. However, increased contents of Gln, Asn, and glucose as well as diminished contents of PEP and 3-PGA were common to early post-penetration stages of all interactions. On the transcriptional level, genes of the TCA cycle, nucleotide energy metabolism and amino acid biosynthesis exhibited consistent trends among the compared biotrophic interactions, identifying the requirement for metabolic energy and the rearrangement of amino acid pools as common transcriptional motifs during early biotrophy. Both metabolome and transcript data were employed to generate models of leaf primary metabolism during early biotrophy for the three investigated interactions. PMID:22645534
Studies of Secondary Melanoma on C57BL/6J Mouse Liver Using 1H NMR Metabolomics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feng, Ju; Isern, Nancy G.; Burton, Sarah D.
2013-10-31
NMR metabolomics, consisting of solid state high resolution (hr) magic angle spinning (MAS) 1H NMR (1H hr-MAS), liquid state high resolution 1H-NMR, and principal components analysis (PCA) has been used to study secondary metastatic B16-F10 melanoma in C57BL/6J mouse liver . The melanoma group can be differentiated from its control group by PCA analysis of the absolute concentrations or by the absolute peak intensities of metabolites from either 1H hr-MAS NMR data on intact liver tissues or liquid state 1H-NMR spectra on liver tissue extracts. In particular, we found that the absolute concentrations of alanine, glutamate, creatine, creatinine, fumarate andmore » cholesterol are elevated in the melanoma group as compared to controls, while the absolute concentrations of succinate, glycine, glucose, and the family of linear lipids including long chain fatty acids, total choline and acylglycerol are decreased. The ratio of glycerophosphocholine to phosphocholine is increased by about 1.5 fold in the melanoma group, while the absolute concentration of total choline is actually lower in melanoma mice. These results suggest the following picture in secondary melanoma metastasis: Linear lipid levels are decreased by beta oxidation in the melanoma group, which contributes to an increase in the synthesis of cholesterol, and also provides an energy source input for TCA cycle. These findings suggest a link between lipid oxidation, the TCA cycle and the hypoxia-inducible factors (HIF) signal pathway in tumor metastases. Thus this study indicates that the metabolic profile derived from NMR analysis can provide a valuable bio-signature of malignancy and cell hypoxia in metastatic melanoma.« less
Shimada, Tomohiro; Tanaka, Kan
2016-10-01
Regulation of central carbon metabolism has long been an important research subject in every organism. While the dynamics of metabolic flows during changes in available carbon sources have been estimated based on changes in metabolism-related gene expression, as well as on changes in the metabolome, the flux change itself has scarcely been measured because of technical difficulty, which has made conclusions elusive in many cases. Here, we used a monitoring system employing Vibrio fischeri luciferase to probe the intracellular metabolic condition in Escherichia coli Using a batch culture provided with a limited amount of glucose, we performed a time course analysis, where the predominant carbon source shifts from glucose to acetate, and identified a series of sequential peaks in the luciferase activity (peaks 1 to 4). Two major peaks, peaks 1 and 3, were considered to correspond to the glucose and acetate consuming phases, respectively, based on the glucose, acetate, and dissolved oxygen concentrations in the medium. The pattern of these peaks was changed by the addition of a different carbon source or by an increasing concentration of glucose, which was consistent with the present model. Genetically, mutations involved in glycolysis or the tricarboxylic acid (TCA) cycle/gluconeogenesis specifically affected peak 1 or peak 3, respectively, as expected from the corresponding metabolic phase. Intriguingly, mutants for the acetate excretion pathway showed a phenotype of extended peak 2 and delayed transition to the TCA cycle/gluconeogenesis phase, which suggests that peak 2 represents the metabolic transition phase. These results indicate that the bacterial luciferase monitoring system is useful to understand the real-time dynamics of metabolism in living bacterial cells. Intracellular metabolic flows dynamically change during shifts in available carbon sources. However, because of technical difficulty, the flux change has scarcely been measured in living cells. Here, we used a Vibrio fischeri luciferase monitoring system to probe the intracellular metabolic condition in Escherichia coli Using a limited amount of glucose batch culture, a series of sequential peaks (peaks 1 to 4) in the luciferase activity was observed. Changes in the pattern of these peaks by the addition of extra carbon sources and in mutant strains involved in glycolysis or the TCA cycle/gluconeogenesis gene assigned the metabolic phase corresponding to peak 1 as the glycolysis phase and peak 3 as the TCA cycle/gluconeogenesis phase. Intriguingly, the acetate excretion pathway engaged in peak 2 represents the metabolic transition phase. These results indicate that the bacterial luciferase monitoring system is useful to understand the real-time dynamics of metabolism in living bacterial cells. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Jucker, B M; Cline, G W; Barucci, N; Shulman, G I
1999-01-01
To examine the effects of safflower oil versus fish oil feeding on in vivo intramuscular glucose metabolism and relative pyruvate dehydrogenase (PDH) versus tricarboxylic acid (TCA) cycle flux, rats were pair-fed on diets consisting of 1) 59% safflower oil, 2) 59% menhaden fish oil, or 3) 59% carbohydrate (control) in calories. Rates of glycolysis and glycogen synthesis were assessed by monitoring [1-(13)C]glucose label incorporation into [1-(13)C]glycogen, [3-(13)C]lactate, and [3-(13)C]alanine in the hindlimb of awake rats via 13C nuclear magnetic resonance (NMR) spectroscopy during a euglycemic (approximately 6 mmol/l) hyperinsulinemic (approximately 180 microU/ml) clamp. A steady-state isotopic analysis of lactate, alanine, and glutamate was used to determine the relative PDH versus TCA cycle flux present in muscle under these conditions. The safflower oil-fed rats were insulin resistant compared with control and fish oil-fed rats, as reflected by a markedly reduced glucose infusion rate (Ginf) during the clamp (21.4 +/- 2.3 vs. 31.6 +/- 2.8 and 31.7 +/- 1.9 mg x kg(-1) x min(-1) in safflower oil versus control and fish oil groups, respectively, P < 0.006). This decrease in insulin-stimulated glucose disposal in the safflower oil group was associated with a lower rate of glycolysis (21.7 +/- 2.2 nmol x g(-1) x min(-1)) versus control (62.1 +/- 10.3 nmol x g(-1) x min(-1), P < 0.001) and versus fish oil (45.7 +/- 6.7 nmol x g(-1) x min(-1), P < 0.04), as no change in glycogen synthesis (103 +/- 15, 133 +/- 19, and 125 +/- 14 nmol x g(-1) x min(-1) in safflower oil, fish oil, and control, respectively) was detected. The intramuscular triglyceride (TG) content was increased in the safflower oil group (7.3 +/- 0.8 micromol/g) compared with the control group (5.2 +/- 0.8 micromol/g, P < 0.05) and the fish oil group (3.6 +/- 1.1 micromol/g, P < 0.01). Conversely, the percent PDH versus TCA cycle flux was decreased in the safflower oil (43 +/- 8%) versus the control (73 +/- 8%, P < 0.01) and fish oil (64 +/- 6%, P < 0.05) groups. These data suggest that the reduced insulin-stimulated glucose disposal attributed to safflower oil feeding was a consequence of reduced glycolytic flux associated with an increase in relative free fatty acid/ketone oxidation versus TCA cycle flux, whereas fish oil feeding did not alter glucose metabolism and may in part be protective of insulin-stimulated glucose disposal by limiting intramuscular TG deposition.
Collagen Matrix Density Drives the Metabolic Shift in Breast Cancer Cells.
Morris, Brett A; Burkel, Brian; Ponik, Suzanne M; Fan, Jing; Condeelis, John S; Aguirre-Ghiso, Julio A; Castracane, James; Denu, John M; Keely, Patricia J
2016-11-01
Increased breast density attributed to collagen I deposition is associated with a 4-6 fold increased risk of developing breast cancer. Here, we assessed cellular metabolic reprogramming of mammary carcinoma cells in response to increased collagen matrix density using an in vitro 3D model. Our initial observations demonstrated changes in functional metabolism in both normal mammary epithelial cells and mammary carcinoma cells in response to changes in matrix density. Further, mammary carcinoma cells grown in high density collagen matrices displayed decreased oxygen consumption and glucose metabolism via the tricarboxylic acid (TCA) cycle compared to cells cultured in low density matrices. Despite decreased glucose entry into the TCA cycle, levels of glucose uptake, cell viability, and ROS were not different between high and low density matrices. Interestingly, under high density conditions the contribution of glutamine as a fuel source to drive the TCA cycle was significantly enhanced. These alterations in functional metabolism mirrored significant changes in the expression of metabolic genes involved in glycolysis, oxidative phosphorylation, and the serine synthesis pathway. This study highlights the broad importance of the collagen microenvironment to cellular expression profiles, and shows that changes in density of the collagen microenvironment can modulate metabolic shifts of cancer cells. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Shao, Yaping; Ye, Guozhu; Ren, Shancheng; Piao, Hai-Long; Zhao, Xinjie; Lu, Xin; Wang, Fubo; Ma, Wang; Li, Jia; Yin, Peiyuan; Xia, Tian; Xu, Chuanliang; Yu, Jane J; Sun, Yinghao; Xu, Guowang
2018-07-15
Genetic alterations drive metabolic reprograming to meet increased biosynthetic precursor and energy demands for cancer cell proliferation and survival in unfavorable environments. A systematic study of gene-metabolite regulatory networks and metabolic dysregulation should reveal the molecular mechanisms underlying prostate cancer (PCa) pathogenesis. Herein, we performed gas chromatography-mass spectrometry (GC-MS)-based metabolomics and RNA-seq analyses in prostate tumors and matched adjacent normal tissues (ANTs) to elucidate the molecular alterations and potential underlying regulatory mechanisms in PCa. Significant accumulation of metabolic intermediates and enrichment of genes in the tricarboxylic acid (TCA) cycle were observed in tumor tissues, indicating TCA cycle hyperactivation in PCa tissues. In addition, the levels of fumarate and malate were highly correlated with the Gleason score, tumor stage and expression of genes encoding related enzymes and were significantly related to the expression of genes involved in branched chain amino acid degradation. Using an integrated omics approach, we further revealed the potential anaplerotic routes from pyruvate, glutamine catabolism and branched chain amino acid (BCAA) degradation contributing to replenishing metabolites for TCA cycle. Integrated omics techniques enable the performance of network-based analyses to gain a comprehensive and in-depth understanding of PCa pathophysiology and may facilitate the development of new and effective therapeutic strategies. © 2018 UICC.
Elimination of High-Frequency Combustion Instability in the Fastrac Engine Thrust Chamber
NASA Technical Reports Server (NTRS)
Rocker, Marvin; Nesman, Thomas E.
1998-01-01
NASA's Marshall Space Flight Center(MSFC) has been tasked with developing a 60,000 pound thrust, pump-fed, LOX/RP-1 engine under the Advanced Space Transportation Program(ASTP). This government-led design has been designated the Fastrac engine. The X-34 vehicle will use the Fastrac engine as the main propulsion system. The X-34 will be a suborbital vehicle developed by the Orbital Sciences Corporation. The X-34 vehicle will be launched from an L-1011 airliner. After launch, the X-34 vehicle will be able to climb to altitudes up to 250,000 feet and reach speeds up to Mach 8, over a mission range of 500 miles. The overall length, wingspan, and gross takeoff weight of the X-34 vehicle are 58.3 feet, 27.7 feet and 45,000 pounds, respectively. This report summarizes the plan of achieving a Fastrac thrust chamber assembly(TCA) stable bomb test that meets the JANNAF standards, the Fastrac TCA design, and the combustion instabilities exhibited by the Fastrac TCA during testing at MSFC's test stand 116 as determined from high-frequency fluctuating pressure measurements. This report also summarizes the characterization of the combustion instabilities from the pressure measurements and the steps taken to eliminate the instabilities.
The clinical utility of tricyclic antidepressant blood levels: a review of the literature.
Van Brunt, N
1983-01-01
An effort has been made to summarize clinical selection criteria for therapeutic drug monitoring for the tricyclic antidepressants (TCAs). A clear understanding of this would increase the number of patients who benefit from TCA blood-level determinations. Depression has been defined in terms of the old and new nomenclature in an attempt to clarify the ambiguities that necessarily exist in such an all-encompassing classification of disease. The biogenic amine hypothesis of depression is briefly reviewed, followed by the effect of pharmacokinetic parameters on the establishment of steady-state blood levels. The protein binding of the TCAs and the resulting effect on free versus total drug levels is discussed. Pharmaceuticals and other factors known to affect TCA blood levels are mentioned. Following a discussion of anticholinergic side effects and cardiotoxicity, therapeutic ranges for various TCAs are reviewed as to our current level of understanding. The remainder of the paper explores patient selection criteria for future clinical studies attempting to establish a drug level-effect relationship. Recent case histories are supplied throughout the text to illustrate the various subjects addressed. They also instruct the clinician and the laboratory scientist as to the potential use of TCA blood-level monitoring in the treatment of depression.
Effect of different types of therapeutic trauma on vitiligo lesions.
El Mofty, Medhat; Esmat, Samia; Hunter, Nahla; Mashaly, Heba M; Dorgham, Dina; Shaker, Olfat; Ibrahim, Sarah
2017-03-01
New treatment modalities for vitiligo acting by changing certain cytokines and metalloproteinases are newly emerging. The aim of this work is to To assess the efficacy of trichloroacetic acid (TCA) chemical peel, dermapen, and fractional CO 2 laser in treatment of stable non-segmental vitiligo and to detect their effects on IL-17 and MMP-9 levels. Thirty patients with stable vitiligo were recruited in a randomized controlled study. They were randomly categorized into three equal groups. Group 1: TCA peel, Group 2: dermapen machine, and Group 3: Fractional CO 2 laser. Skin biopsies were taken from treated areas and from control areas for which MMP-9 and IL-17 tissue levels were measured using ELISA. The 30 vitiligo patients had low basal tissue MMP-9 levels and high baseline IL-17 tissue levels. As regards the three different used modalities, all of them caused rise in MMP-9 as well as IL-17 levels and almost their levels were much more elevated with repetition of the previously mentioned traumatic procedures. TCA 25% peel proved to be the most effective modality both clinically and laboratory and it can be used prior or with other conventional therapies in the treatment of vitiligo. © 2016 Wiley Periodicals, Inc.
An integrated model of cardiac mitochondrial energy metabolism and calcium dynamics.
Cortassa, Sonia; Aon, Miguel A; Marbán, Eduardo; Winslow, Raimond L; O'Rourke, Brian
2003-04-01
We present an integrated thermokinetic model describing control of cardiac mitochondrial bioenergetics. The model describes the tricarboxylic acid (TCA) cycle, oxidative phosphorylation, and mitochondrial Ca(2+) handling. The kinetic component of the model includes effectors of the TCA cycle enzymes regulating production of NADH and FADH(2), which in turn are used by the electron transport chain to establish a proton motive force (Delta mu(H)), driving the F(1)F(0)-ATPase. In addition, mitochondrial matrix Ca(2+), determined by Ca(2+) uniporter and Na(+)/Ca(2+) exchanger activities, regulates activity of the TCA cycle enzymes isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase. The model is described by twelve ordinary differential equations for the time rate of change of mitochondrial membrane potential (Delta Psi(m)), and matrix concentrations of Ca(2+), NADH, ADP, and TCA cycle intermediates. The model is used to predict the response of mitochondria to changes in substrate delivery, metabolic inhibition, the rate of adenine nucleotide exchange, and Ca(2+). The model is able to reproduce, qualitatively and semiquantitatively, experimental data concerning mitochondrial bioenergetics, Ca(2+) dynamics, and respiratory control. Significant increases in oxygen consumption (V(O(2))), proton efflux, NADH, and ATP synthesis, in response to an increase in cytoplasmic Ca(2+), are obtained when the Ca(2+)-sensitive dehydrogenases are the main rate-controlling steps of respiratory flux. These responses diminished when control is shifted downstream (e.g., the respiratory chain or adenine nucleotide translocator). The time-dependent behavior of the model, under conditions simulating an increase in workload, closely reproduces experimentally observed mitochondrial NADH dynamics in heart trabeculae subjected to changes in pacing frequency. The steady-state and time-dependent behavior of the model support the hypothesis that mitochondrial matrix Ca(2+) plays an important role in matching energy supply with demand in cardiac myocytes.
An Integrated Model of Cardiac Mitochondrial Energy Metabolism and Calcium Dynamics
Cortassa, Sonia; Aon, Miguel A.; Marbán, Eduardo; Winslow, Raimond L.; O'Rourke, Brian
2003-01-01
We present an integrated thermokinetic model describing control of cardiac mitochondrial bioenergetics. The model describes the tricarboxylic acid (TCA) cycle, oxidative phosphorylation, and mitochondrial Ca2+ handling. The kinetic component of the model includes effectors of the TCA cycle enzymes regulating production of NADH and FADH2, which in turn are used by the electron transport chain to establish a proton motive force (ΔμH), driving the F1F0-ATPase. In addition, mitochondrial matrix Ca2+, determined by Ca2+ uniporter and Na+/Ca2+ exchanger activities, regulates activity of the TCA cycle enzymes isocitrate dehydrogenase and α-ketoglutarate dehydrogenase. The model is described by twelve ordinary differential equations for the time rate of change of mitochondrial membrane potential (ΔΨm), and matrix concentrations of Ca2+, NADH, ADP, and TCA cycle intermediates. The model is used to predict the response of mitochondria to changes in substrate delivery, metabolic inhibition, the rate of adenine nucleotide exchange, and Ca2+. The model is able to reproduce, qualitatively and semiquantitatively, experimental data concerning mitochondrial bioenergetics, Ca2+ dynamics, and respiratory control. Significant increases in oxygen consumption (VO2), proton efflux, NADH, and ATP synthesis, in response to an increase in cytoplasmic Ca2+, are obtained when the Ca2+-sensitive dehydrogenases are the main rate-controlling steps of respiratory flux. These responses diminished when control is shifted downstream (e.g., the respiratory chain or adenine nucleotide translocator). The time-dependent behavior of the model, under conditions simulating an increase in workload, closely reproduces experimentally observed mitochondrial NADH dynamics in heart trabeculae subjected to changes in pacing frequency. The steady-state and time-dependent behavior of the model support the hypothesis that mitochondrial matrix Ca2+ plays an important role in matching energy supply with demand in cardiac myocytes. PMID:12668482
Gao, Yu-tao; Wu, Ling-ying; Zhang, Wei; Zhao, Dan; Li, Ning; Tian, Hai-mei; Wang, Xiao-bing; Li, Mo; Sun, Yang-chun; Li, Nan; Li, Xiao-guang
2013-05-01
To investigate the efficacy of adenosine triphosphate (ATP)-tumor chemosensitivity assay (TCA) directed chemotherapy in patients with recurrent epithelial ovarian cancer. From August 2010 to June 2012, recurrent epithelial ovarian cancer patients were prospectively enrollmented in Cancer Hospital, Peking Union Medical College,Chinese Academy of Medical Sciences.The entry criteria are as follows: (1) Histologically proven to be epithelial ovarian cancer. (2) Patients of recurrent ovarian cancer with bidimensionally measurable tumor, or ascitic or pleural fluid for testing. (3) Karnofsky performance status > 60. (4) A life expectancy of at least more than 6 months.According to patients desires, they were assigned into two groups: assay-directed therapy group and physician's-choice therapy group, patients' clinical and pathological characteristics, response rate to chemotherapy and progression-free survival (PFS) were compared between two groups. A total of 113 patients with recurrent epithelial ovarian cancer were prospectively enrollmented to assay-directed chemotherapy (n = 56) or physician's-choice chemotherapy (n = 57).There was no difference in median age,types of recurrence, surgical-pathological stage, pathological type, tumor grade, times of recurrence, residual disease at secondary cytoreductive surgery between assay-directed group and physician's-choice group. The overall response rate (ORR) and median PFS in the ATP-TCA group was 66% (37/56) and 7 months, while the ORR in the control group was 46% (26/57, P = 0.037), the median PFS was 4 months (P = 0.040). For platinum-resistant patients, the ORR between ATP-TCA directed chemotherapy 59% (16/27) and control group 25% (7/28) were significantly different (P = 0.010), and the median PFS between two groups were also significantly different (5 months and 2 months, respectively, P = 0.003). ATP-TCA directed chemotherapy could improve ORR and PFS in patients with recurrent epithelial ovarian cancer, especially in platinum-resistant patients.
NASA Astrophysics Data System (ADS)
Blanford, William James; Pecoraro, Michael Philip; Heinrichs, Rebecca; Boving, Thomas Bernhard
2018-01-01
In a field study, aqueous cyclodextrin (CD) was investigated for its ability to extract chlorinated volatile organic compounds (cVOC), such as trichloroethylene (TCE), 1,1,1-trichloroethane (TCA), and dichloroethene (DCE) through in-situ flushing of a sandy aquifer. After cessation of aquifer flushing, a plume of CD was left. Changes in CD, cVOC, and inorganic terminal electron acceptors (TEAs) (DO, nitrate, sulfate, iron) were monitored in four rounds of wellwater sampling (20, 210, 342, and 425 days after cessation of active pumping). Post-CD flushing VOC levels rebounded (850% for TCE, 190% for TCA, and 53% for DCE) between the first two sampling rounds, apparently due to rate-limited desorption from aquifer media and dissolution from remaining NAPL. However, substantial reduction in the mass of TCE (6.3 to 0.11 mol: 98%) and TCA (2.8 to 0.73 mol: 74%) in groundwater was observed between 210 and 425 days. DCE should primarily be produced from the degradation of TCE and is expected to subsequently degrade to chloroethene. Since DCE levels decreased only slightly (0.23 to 0.17 mol: 26%), its degradation rate should be similar to that produced from the decaying TCE. Cyclodextrin was monitored starting from day 210. The mass of residual CD (as measured by Total Organic Carbon) decreased from 150 mol (day 210) to 66 (day 425) (56% decrease). The naturally anaerobic zone within the aquifer where residual CD mass decreased coincided with a loss of other major potential TEAs: nitrate (97% loss), sulfate (31%) and iron (31%). In other studies, TCE and 1,1,1-TCA have been found to be more energetically favorable TEAs than sulfate and iron and their degradation via reductive dechlorination has been found to be enhanced by the fermentation of carbohydrates. Such processes can explain these observations, but more investigation is needed to evaluate whether residual levels of CD can facilitate the anaerobic degradation of chlorinated VOCs.
Yu, Dongke; Zhang, Han; Lionarons, Daniel A.; Boyer, James L.
2017-01-01
The Na+-dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na+-dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea. The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [3H]TCA uptake assay revealed that skSlc10a1 functioned as a Na+-dependent transporter, but with low affinity for TCA (Km = 92.4 µM) and scymnol sulfate (Ki = 31 µM), compared with hNTCP (TCA, Km = 5.4 µM; Scymnol sulfate, Ki = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na+-dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. PMID:28077388
Bradley, Matthew J; Bonds, Brandon W; Chang, Luke; Yang, Shiming; Hu, Peter; Li, Hsiao-Chi; Brenner, Megan L; Scalea, Thomas M; Stein, Deborah M
2016-11-01
Open chest cardiac massage (OCCM) is a commonly performed procedure after traumatic cardiac arrest (TCA). OCCM has been reported to be superior to closed chest compressions (CCC) in animal models and in non-TCA. The purpose of this study is to prospectively compare OCCM versus CCC in TCA using end-tidal carbon dioxide (ETCO2), the criterion standard for determining the effectiveness of chest compressions and detection of return of spontaneous circulation (ROSC), as the surrogate for cardiac output and marker for adequacy of resuscitation. This prospective observational study enrolled patients over a 9-month period directly presenting to a level 1 trauma center after TCA. Continuous high-resolution ETCO2 measurements were collected every 6 seconds for periods of CCC and OCCM, respectively. Patients receiving CCC only were compared with patients receiving CCC followed by OCCM. Student's t tests were used to compare ETCO2 within and between groups. Thirty-three patients were enrolled (16 OCCM, 17 CCC-only). Mean time of CCC before OCCM was 66 seconds. Within the OCCM group, final, peak, mean, and median ETCO2 levels significantly increased when comparing the initial CCC period to the OCCM interval. Using a time-matched comparison, significant increases were observed in the final and peak but not mean and median values when comparing the first minute of CCC to the remaining time in the CCC-only group. However, when periods of OCCM were compared with equivalent periods of CCC-only, there were no differences in the initial, final, peak, mean, or median ETCO2 values. Correspondingly, no difference in rates of ROSC was observed between groups (OCCM 23.5% vs. CCC 38.9%; p = 0.53). Although we could not control for confounders, we found no significant improvement in ETCO2 or ROSC with OCCM. With newer endovascular techniques for aortic occlusion, thoracotomy solely for performing OCCM provides no benefit over CCC. Therapeutic study, level III.
Physiological and Proteomic Analysis of Escherichia coli Iron-Limited Chemostat Growth
Folsom, James Patrick; Parker, Albert E.
2014-01-01
Iron bioavailability is a major limiter of bacterial growth in mammalian host tissue and thus represents an important area of study. Escherichia coli K-12 metabolism was studied at four levels of iron limitation in chemostats using physiological and proteomic analyses. The data documented an E. coli acclimation gradient where progressively more severe iron scarcity resulted in a larger percentage of substrate carbon being directed into an overflow metabolism accompanied by a decrease in biomass yield on glucose. Acetate was the primary secreted organic by-product for moderate levels of iron limitation, but as stress increased, the metabolism shifted to secrete primarily lactate (∼70% of catabolized glucose carbon). Proteomic analysis reinforced the physiological data and quantified relative increases in glycolysis enzyme abundance and decreases in tricarboxylic acid (TCA) cycle enzyme abundance with increasing iron limitation stress. The combined data indicated that E. coli responds to limiting iron by investing the scarce resource in essential enzymes, at the cost of catabolic efficiency (i.e., downregulating high-ATP-yielding pathways containing enzymes with large iron requirements, like the TCA cycle). Acclimation to iron-limited growth was contrasted experimentally with acclimation to glucose-limited growth to identify both general and nutrient-specific acclimation strategies. While the iron-limited cultures maximized biomass yields on iron and increased expression of iron acquisition strategies, the glucose-limited cultures maximized biomass yields on glucose and increased expression of carbon acquisition strategies. This study quantified ecologically competitive acclimations to nutrient limitations, yielding knowledge essential for understanding medically relevant bacterial responses to host and to developing intervention strategies. PMID:24837288
Li, Huihui; An, Yanpeng; Zhang, Lulu; Lei, Hehua; Zhang, Limin; Wang, Yulan; Tang, Huiru
2013-12-06
Inflammation is closely associated with pathogenesis of various metabolic disorders, cardiovascular diseases, and cancers. To understand the systems responses to localized inflammation, we analyzed the dynamic metabolic changes in rat plasma and urine associated with the carrageenan-induced self-limiting pleurisy using NMR spectroscopy in conjunction with multivariate data analysis. Fatty acids in plasma were also analyzed using GC-FID/MS with the data from clinical chemistry and histopathology as complementary information. We found that in the acute phase of inflammation rats with pleurisy had significantly lower levels in serum albumin, fatty acids, and lipoproteins but higher globulin level and larger quantity of pleural exudate than controls. The carrageenan-induced inflammation was accompanied by significant metabolic alterations involving TCA cycle, glycolysis, biosyntheses of acute phase proteins, and metabolisms of amino acids, fatty acids, ketone bodies, and choline in acute phase. The resolution process of pleurisy was heterogeneous, and two subgroups were observed for the inflammatory rats at day-6 post treatment with different metabolic features together with the quantity of pleural exudate and weights of thymus and spleen. The metabolic differences between these subgroups were reflected in the levels of albumin and acute-phase proteins, the degree of returning to normality for multiple metabolic pathways including glycolysis, TCA cycle, gut microbiota functions, and metabolisms of lipids, choline and vitamin B3. These findings provided some essential details for the dynamic metabolic changes associated with the carrageenan-induced self-limiting inflammation and demonstrated the combined NMR and GC-FID/MS analysis as a powerful approach for understanding biochemical aspects of inflammation.
Hatazawa, Yukino; Minami, Kimiko; Yoshimura, Ryoji; Onishi, Takumi; Manio, Mark Christian; Inoue, Kazuo; Sawada, Naoki; Suzuki, Osamu; Miura, Shinji; Kamei, Yasutomi
2016-12-09
The expression of the transcriptional coactivator PGC1α is increased in skeletal muscles during exercise. Previously, we showed that increased PGC1α leads to prolonged exercise performance (the duration for which running can be continued) and, at the same time, increases the expression of branched-chain amino acid (BCAA) metabolism-related enzymes and genes that are involved in supplying substrates for the TCA cycle. We recently created mice with PGC1α knockout specifically in the skeletal muscles (PGC1α KO mice), which show decreased mitochondrial content. In this study, global gene expression (microarray) analysis was performed in the skeletal muscles of PGC1α KO mice compared with that of wild-type control mice. As a result, decreased expression of genes involved in the TCA cycle, oxidative phosphorylation, and BCAA metabolism were observed. Compared with previously obtained microarray data on PGC1α-overexpressing transgenic mice, each gene showed the completely opposite direction of expression change. Bioinformatic analysis of the promoter region of genes with decreased expression in PGC1α KO mice predicted the involvement of several transcription factors, including a nuclear receptor, ERR, in their regulation. As PGC1α KO microarray data in this study show opposing findings to the PGC1α transgenic data, a loss-of-function experiment, as well as a gain-of-function experiment, revealed PGC1α's function in the oxidative energy metabolism of skeletal muscles. Copyright © 2016 Elsevier Inc. All rights reserved.
Tennessen, Jason M; Bertagnolli, Nicolas M; Evans, Janelle; Sieber, Matt H; Cox, James; Thummel, Carl S
2014-03-12
Rapidly proliferating cells such as cancer cells and embryonic stem cells rely on a specialized metabolic program known as aerobic glycolysis, which supports biomass production from carbohydrates. The fruit fly Drosophila melanogaster also utilizes aerobic glycolysis to support the rapid growth that occurs during larval development. Here we use singular value decomposition analysis of modENCODE RNA-seq data combined with GC-MS-based metabolomic analysis to analyze the changes in gene expression and metabolism that occur during Drosophila embryogenesis, spanning the onset of aerobic glycolysis. Unexpectedly, we find that the most common pattern of co-expressed genes in embryos includes the global switch to glycolytic gene expression that occurs midway through embryogenesis. In contrast to the canonical aerobic glycolytic pathway, however, which is accompanied by reduced mitochondrial oxidative metabolism, the expression of genes involved in the tricarboxylic cycle (TCA cycle) and the electron transport chain are also upregulated at this time. Mitochondrial activity, however, appears to be attenuated, as embryos exhibit a block in the TCA cycle that results in elevated levels of citrate, isocitrate, and α-ketoglutarate. We also find that genes involved in lipid breakdown and β-oxidation are upregulated prior to the transcriptional initiation of glycolysis, but are downregulated before the onset of larval development, revealing coordinated use of lipids and carbohydrates during development. These observations demonstrate the efficient use of nutrient stores to support embryonic development, define sequential metabolic transitions during this stage, and demonstrate striking similarities between the metabolic state of late-stage fly embryos and tumor cells. Copyright © 2014 Tennessen et al.
NASA Astrophysics Data System (ADS)
Lorah, Michelle M.; Voytek, Mary A.
2004-05-01
The biodegradation pathways of 1,1,2,2-tetrachloroethane (TeCA) and 1,1,2-trichloroethane (112TCA) and the associated microbial communities in anaerobic wetland sediments were evaluated using concurrent geochemical and genetic analyses over time in laboratory microcosm experiments. Experimental results were compared to in situ porewater data in the wetland to better understand the factors controlling daughter product distributions in a chlorinated solvent plume discharging to a freshwater tidal wetland at Aberdeen Proving Ground, Maryland. Microcosms constructed with wetland sediment from two sites showed little difference in the initial degradation steps of TeCA, which included simultaneous hydrogenolysis to 112TCA and dichloroelimination to 1,2-dichloroethene (12DCE). The microcosms from the two sites showed a substantial difference, however, in the relative dominance of subsequent dichloroelimination of 112TCA. A greater dominance of 112TCA dichloroelimination in microcosms constructed with sediment that was initially iron-reducing and subsequently simultaneously iron-reducing and methanogenic caused approximately twice as much vinyl chloride (VC) production as microcosms constructed with sediment that was methanogenic only throughout the incubation. The microcosms with higher VC production also showed substantially more rapid VC degradation. Field measurements of redox-sensitive constituents, TeCA, and its anaerobic degradation products along flowpaths in the wetland porewater also showed greater production and degradation of VC with concurrent methanogenesis and iron reduction. Molecular fingerprinting indicated that bacterial species [represented by a peak at a fragment size of 198 base pairs (bp) by MnlI digest] are associated with VC production from 112TCA dichloroelimination, whereas methanogens (190 and 307 bp) from the Methanococcales or Methanobacteriales family are associated with VC production from 12DCE hydrogenolysis. Acetate-utilizing methanogens (acetotrophs) appear to be involved in the biodegradation of VC. The relative abundance of Methanosarcinaceae, the only methanogen group with acetotrophic members, doubled in microcosms in which degradation of VC was observed. In addition, molecular analyses using primers specific for known dehalorespiring bacteria in the Dehalococcoides and Desulfuromonas groups showed the presence of these bacteria in microcosm slurry from the site that showed the highest VC production and degradation. Determination of biogeochemical controls and microbial consortia involved in TeCA degradation is leading to a better understanding of the heterogeneity in biodegradation rates and daughter product distribution in the wetland, improving capabilities for developing remediation and monitoring plans.
Lorah, Michelle M.; Voytek, Mary A.
2004-01-01
The biodegradation pathways of 1,1,2,2-tetrachloroethane (TeCA) and 1,1,2-trichloroethane (112TCA) and the associated microbial communities in anaerobic wetland sediments were evaluated using concurrent geochemical and genetic analyses over time in laboratory microcosm experiments. Experimental results were compared to in situ porewater data in the wetland to better understand the factors controlling daughter product distributions in a chlorinated solvent plume discharging to a freshwater tidal wetland at Aberdeen Proving Ground, Maryland. Microcosms constructed with wetland sediment from two sites showed little difference in the initial degradation steps of TeCA, which included simultaneous hydrogenolysis to 112TCA and dichloroelimination to 1,2-dichloroethene (12DCE). The microcosms from the two sites showed a substantial difference, however, in the relative dominance of subsequent dichloroelimination of 112TCA. A greater dominance of 112TCA dichloroelimination in microcosms constructed with sediment that was initially iron-reducing and subsequently simultaneously iron-reducing and methanogenic caused approximately twice as much vinyl chloride (VC) production as microcosms constructed with sediment that was methanogenic only throughout the incubation. The microcosms with higher VC production also showed substantially more rapid VC degradation. Field measurements of redox-sensitive constituents, TeCA, and its anaerobic degradation products along flowpaths in the wetland porewater also showed greater production and degradation of VC with concurrent methanogenesis and iron reduction.Molecular fingerprinting indicated that bacterial species [represented by a peak at a fragment size of 198 base pairs (bp) by MnlI digest] are associated with VC production from 112TCA dichloroelimination, whereas methanogens (190 and 307 bp) from the Methanococcales or Methanobacteriales family are associated with VC production from 12DCE hydrogenolysis. Acetate-utilizing methanogens (acetotrophs) appear to be involved in the biodegradation of VC. The relative abundance of Methanosarcinaceae, the only methanogen group with acetotrophic members, doubled in microcosms in which degradation of VC was observed. In addition, molecular analyses using primers specific for known dehalorespiring bacteria in the Dehalococcoides and Desulfuromonas groups showed the presence of these bacteria in microcosm slurry from the site that showed the highest VC production and degradation. Determination of biogeochemical controls and microbial consortia involved in TeCA degradation is leading to a better understanding of the heterogeneity in biodegradation rates and daughter product distribution in the wetland, improving capabilities for developing remediation and monitoring plans.
Lorah, M.M.; Voytek, M.A.
2004-01-01
The biodegradation pathways of 1,1,2,2-tetrachloroethane (TeCA) and 1,1,2-trichloroethane (112TCA) and the associated microbial communities in anaerobic wetland sediments were evaluated using concurrent geochemical and genetic analyses over time in laboratory microcosm experiments. Experimental results were compared to in situ porewater data in the wetland to better understand the factors controlling daughter product distributions in a chlorinated solvent plume discharging to a freshwater tidal wetland at Aberdeen Proving Ground, Maryland. Microcosms constructed with wetland sediment from two sites showed little difference in the initial degradation steps of TeCA, which included simultaneous hydrogenolysis to 112TCA and dichloroelimination to 1,2-dichloroethene (12DCE). The microcosms from the two sites showed a substantial difference, however, in the relative dominance of subsequent dichloroelimination of 112TCA. A greater dominance of 112TCA dichloroelimination in microcosms constructed with sediment that was initially iron-reducing and subsequently simultaneously iron-reducing and methanogenic caused approximately twice as much vinyl chloride (VC) production as microcosms constructed with sediment that was methanogenic only throughout the incubation. The microcosms with higher VC production also showed substantially more rapid VC degradation. Field measurements of redox-sensitive constituents, TeCA, and its anaerobic degradation products along flowpaths in the wetland porewater also showed greater production and degradation of VC with concurrent methanogenesis and iron reduction. Molecular fingerprinting indicated that bacterial species [represented by a peak at a fragment size of 198 base pairs (bp) by MnlI digest] are associated with VC production from 112TCA dichloroelimination, whereas methanogens (190 and 307 bp) from the Methanococcales or Methanobacteriales family are associated with VC production from 12DCE hydrogenolysis. Acetate-utilizing methanogens (acetotrophs) appear to be involved in the biodegradation of VC. The relative abundance of Methanosarcinaceae, the only methanogen group with acetotrophic members, doubled in microcosms in which degradation of VC was observed. In addition, molecular analyses using primers specific for known dehalorespiring bacteria in the Dehalococcoides and Desulfuromonas groups showed the presence of these bacteria in microcosm slurry from the site that showed the highest VC production and degradation. Determination of biogeochemical controls and microbial consortia involved in TeCA degradation is leading to a better understanding of the heterogeneity in biodegradation rates and daughter product distribution in the wetland, improving capabilities for developing remediation and monitoring plans.
Use of calcitriol to maintain postpartum blood calcium and improve immune function in dairy cows.
Vieira-Neto, A; Lima, I R P; Lopes, F; Lopera, C; Zimpel, R; Sinedino, L D P; Jeong, K C; Galvão, K; Thatcher, W W; Nelson, C D; Santos, J E P
2017-07-01
Our objectives were to determine the effects of an injectable formulation of calcitriol on mineral metabolism and immune function in postpartum Holstein cows that received an acidogenic diet prepartum to minimize hypocalcemia. In experiment 1, cows within 6 h of calving received calcitriol (0, 200, or 300 μg) to determine the dose needed to increase plasma concentrations of Ca; 300 μg was sufficient to sustain Ca for at least 3 d. In experiment 2, multiparous cows were assigned randomly to receive only vehicle (control, n = 25) or 300 μg of calcitriol (n = 25) subcutaneously within the first 6 h after calving. Blood was sampled before treatment and 12 h later, then daily until 15 d in milk (DIM), and analyzed for concentrations of ionized Ca (iCa), total Ca (tCa), total Mg (tMg), and total P (tP), metabolites, and hormones. Urine was sampled in the first 7 DIM and analyzed for concentrations of tCa, tMg, and creatinine. Neutrophil function was evaluated in the first week postpartum. Dry matter intake and production performance were evaluated for the first 36 DIM. Calcitriol administration increased concentrations of calcitriol in plasma within 12 h of application from 51 to 427 pg/mL, which returned to baseline within 5 d. Concentrations of iCa and tCa increased 24 h after treatment with calcitriol. Concentrations of iCa (control = 1.08 vs. calcitriol = 1.20 mM), tCa (control = 2.23 vs. calcitriol = 2.33 mM), and tP (control = 1.47 vs. calcitriol = 1.81 mM) remained elevated in cows treated with calcitriol until 3, 5, and 7 DIM, respectively, whereas concentration of tMg (control = 0.76 vs. calcitriol = 0.67 mM) was less in calcitriol cows than control cows until 3 DIM. Concentrations of parathyroid hormone decreased in calcitriol cows compared with control cows (control = 441 vs. calcitriol = 336 pg/mL). Calcitriol tended to increase plasma concentrations of β-hydroxybutyrate and serotonin, but concentrations of glucose, nonesterified fatty acids, and C-telopeptide of type I collagen in plasma did not differ between treatments. Cows treated with calcitriol excreted more urinary tCa (control = 0.5 vs. calcitriol = 2.1 g/d) and tMg (control = 4.5 vs. calcitriol = 5.0 g/d) in the first 7 and 2 DIM, respectively, than control cows. Compared with control, calcitriol improved the proportion of neutrophils with oxidative burst (control = 31.9 vs. calcitriol = 40.6%), mean fluorescence intensity for oxidative burst (control = 90,900 vs. calcitriol = 99,746), and mean fluorescence intensity for phagocytosis (control = 23,887 vs. calcitriol = 28,080). Dry matter intake, yields of milk, and milk components did not differ between treatments. Administration of 300 μg of calcitriol at calving was safe and effective in increasing blood concentration of iCa and plasma concentrations of calcitriol, tCa, and tP for the first 6 d after treatment, and improved measures of innate immune function in early-lactation Holstein cows. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Two-Temperature Vapor Lock and High-Temperature Driveability Performance of 1982 Passenger Vehicles.
1984-12-01
Wigd Starting -.*- - Air TcA TcB Air TcA TcB AirT ------- sec RSt# 1 498. 106 144 114 106 169 114 1060 SNP 2 453 99 134 112 99 172 111 990 SNN 0 3 ...sec RSt# 1 500 81 115 101 83 159 88 820 SNP 1 2 39 82 124 104 93 163 90 825 SN 2 3 2 68 102 76 68 112 66 680 SC 1 0 .L i 0 0 0 -- -- KEY-OFF...83 121 99 85 142 99 840 SNP 2 91 85 131 103 86 161 101 855 SN 3 405 66 101 73 68 123 72 680 SC 0 0 0 , ......------ IDLE SOAK ACCELERATIONS
The Influence of Intrinsic and Extrinsic Factors on Neurogenesis
2008-07-31
ACG AAT TGA GCA ATA ACG GTG ATG GCG ATA GTA AGA ACA GTT C 49 Table II-2. Sequence information and physical characteristics of...CTC TGA GCT AGT 550 50 24 60.15 3’mAT-O GTG ACA CTA GCA GAC CAG ATT CCT 550 50 24 61.08 5’mAT-N GCC TCT GAG CTA GTA TGT GTC ATC 274 50 24 59.46 3...8217mAT-N CCA TCA CCT TCT CCT TTC TAG GTC 274 50 24 61.64 5’rAT-O TTT AGC TCA GTG GTA GAG CGC 257 52 21 56 3’rAT-O GTT TCT GCC CTT TCC AAC TGC 257 52 21
Wu, Fang; Zheng, Hua; Yang, Zheng-Teng; Cheng, Bang; Wu, Jin-Xia; Liu, Xu-Wen; Tang, Chao-Ling; Lu, Shi-Yin; Chen, Zhao-Ni; Song, Fang-Ming; Ruan, Jun-Xiang; Zhang, Hong-Ye; Liang, Yong-Hong; Song, Hui; Su, Zhi-Heng
2017-06-05
Chronic liver injury has been shown to cause liver fibrosis due to the sustained pathophysiological wound healing response of the liver, and eventually progresses to cirrhosis. The total alkaloids of Corydalis saxicola Bunting (TACS), a collection of important bioactive ingredients derived from the traditional Chinese folk medicine Corydalis saxicola Bunting (CS), have been reported to have protective effects on the liver. However, the underlying molecular mechanisms need further elucidation. In this study, the urinary metabonomics and the biochemical changes in rats with carbon tetrachloride (CCl 4 )-induced chronic liver injury due to treatment TACS or administration of the positive control drug-bifendate were studied via proton nuclear magnetic resonance ( 1 H NMR) analysis. Partial least squares-discriminate analysis (PLS-DA) suggested that metabolic perturbation caused by CCl 4 damage was recovered with TACS and bifendate treatment. A total of seven metabolites including 2-oxoglutarate, citrate, dimethylamine, taurine, phenylacetylglycine, creatinine and hippurate were considered as potential biomarkers involved in the development of CCl 4 -induced chronic liver injury. According to pathway analysis using identified metabolites and correlation network construction, the tricarboxylic acid (TCA) cycle, gut microbiota metabolism and taurine and hypotaurine metabolism were recognized as the most affected metabolic pathways associated with CCl 4 chronic hepatotoxicity. Notably, the changes in 2-oxoglutarate, citrate, taurine and hippurate during the process of CCl 4 -induced chronic liver injury were significantly restored by TACS treatment, which suggested that TACS synergistically mediated the regulation of multiple metabolic pathways including the TCA cycle, gut microbiota metabolism and taurine and hypotaurine metabolism. This study could bring valuable insight to evaluating the efficacy of TACS intervention therapy, help deepen the understanding of the hepatoprotective mechanisms of TACS and enable optimal diagnosis of chronic liver injury. Copyright © 2017 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hatazawa, Yukino; Research Fellow of Japan Society for the Promotion of Science, Tokyo; Minami, Kimiko
The expression of the transcriptional coactivator PGC1α is increased in skeletal muscles during exercise. Previously, we showed that increased PGC1α leads to prolonged exercise performance (the duration for which running can be continued) and, at the same time, increases the expression of branched-chain amino acid (BCAA) metabolism-related enzymes and genes that are involved in supplying substrates for the TCA cycle. We recently created mice with PGC1α knockout specifically in the skeletal muscles (PGC1α KO mice), which show decreased mitochondrial content. In this study, global gene expression (microarray) analysis was performed in the skeletal muscles of PGC1α KO mice compared withmore » that of wild-type control mice. As a result, decreased expression of genes involved in the TCA cycle, oxidative phosphorylation, and BCAA metabolism were observed. Compared with previously obtained microarray data on PGC1α-overexpressing transgenic mice, each gene showed the completely opposite direction of expression change. Bioinformatic analysis of the promoter region of genes with decreased expression in PGC1α KO mice predicted the involvement of several transcription factors, including a nuclear receptor, ERR, in their regulation. As PGC1α KO microarray data in this study show opposing findings to the PGC1α transgenic data, a loss-of-function experiment, as well as a gain-of-function experiment, revealed PGC1α’s function in the oxidative energy metabolism of skeletal muscles. - Highlights: • Microarray analysis was performed in the skeletal muscle of PGC1α KO mice. • Expression of genes in the oxidative energy metabolism was decreased. • Bioinformatic analysis of promoter region of the genes predicted involvement of ERR. • PGC1α KO microarray data in this study show the mirror image of transgenic data.« less
Gao, Shu-Hong; Fan, Lu; Peng, Lai; Guo, Jianhua; Agulló-Barceló, Míriam; Yuan, Zhiguo; Bond, Philip L
2016-05-17
Free nitrous acid (FNA) has recently been demonstrated as an antimicrobial agent on a range of micro-organisms, especially in wastewater-treatment systems. However, the antimicrobial mechanism of FNA is largely unknown. Here, we report that the antimicrobial effects of FNA are multitargeted. The response of a model denitrifier, Pseudomnas aeruginosa PAO1 (PAO1), common in wastewater treatment, was investigated in the absence and presence of inhibitory level of FNA (0.1 mg N/L) under anaerobic denitrifying conditions. This was achieved through coupling gene expression analysis, by RNA sequencing, and with a suite of physiological analyses. Various transcripts exhibited significant changes in abundance in the presence of FNA. Respiration was likely inhibited because denitrification activity was severely depleted, and decreased transcript levels of most denitrification genes occurred. As a consequence, the tricarboxylic acid (TCA) cycle was inhibited due to the lowered cellular redox state in the FNA-exposed cultures. Meanwhile, during FNA exposure, PAO1 rerouted its carbon metabolic pathway from the TCA cycle to pyruvate fermentation with acetate as the end product as a possible survival mechanism. Additionally, protein synthesis was significantly decreased, and ribosome preservation was evident. These findings improve our understanding of PAO1 in response to FNA and contribute toward the potential application for use of FNA as an antimicrobial agent.
Baker, Peter R; Boyle, Kristen E; Koves, Timothy R; Ilkayeva, Olga R; Muoio, Deborah M; Houmard, Joseph A; Friedman, Jacob E
2015-05-01
Investigate the effects of obesity and high-fat diet (HFD) exposure on fatty acid oxidation and TCA cycle intermediates and amino acids in skeletal muscle to better characterize energy metabolism. Plasma and skeletal muscle metabolomic profiles were measured from lean and obese males before and after a 5-day HFD in the 4 h postprandial condition. At both time points, plasma short-chain acylcarnitine species (SCAC) were higher in the obese subjects, while the amino acids glycine, histidine, methionine, and citrulline were lower in skeletal muscle of obese subjects. Skeletal muscle medium-chain acylcarnitines (MCAC) C6, C8, C10:2, C10:1, C10, and C12:1 increased in obese subjects, but decreased in lean subjects, from pre- to post-HFD. Plasma content of C10:1 was also decreased in the lean but increased in the obese subjects from pre- to post-HFD. CD36 increased from pre- to post-HFD in obese but not lean subjects. Lower skeletal muscle amino acid content and accumulation of plasma SCAC in obese subjects could reflect increased anaplerosis for TCA cycle intermediates, while accumulation of MCAC suggests limitations in β-oxidation. These measures may be important markers of or contributors to dysregulated metabolism observed in skeletal muscle of obese humans. © 2015 The Obesity Society.
Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko
2018-05-24
Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
13C-labelled microdialysis studies of cerebral metabolism in TBI patients☆
Carpenter, Keri L.H.; Jalloh, Ibrahim; Gallagher, Clare N.; Grice, Peter; Howe, Duncan J.; Mason, Andrew; Timofeev, Ivan; Helmy, Adel; Murphy, Michael P.; Menon, David K.; Kirkpatrick, Peter J.; Carpenter, T. Adrian; Sutherland, Garnette R.; Pickard, John D.; Hutchinson, Peter J.
2014-01-01
Human brain chemistry is incompletely understood and better methodologies are needed. Traumatic brain injury (TBI) causes metabolic perturbations, one result of which includes increased brain lactate levels. Attention has largely focussed on glycolysis, whereby glucose is converted to pyruvate and lactate, and is proposed to act as an energy source by feeding into neurons’ tricarboxylic acid (TCA) cycle, generating ATP. Also reportedly upregulated by TBI is the pentose phosphate pathway (PPP) that does not generate ATP but produces various molecules that are putatively neuroprotective, antioxidant and reparative, in addition to lactate among the end products. We have developed a novel combination of 13C-labelled cerebral microdialysis both to deliver 13C-labelled substrates into brains of TBI patients and recover the 13C-labelled metabolites, with high-resolution 13C NMR analysis of the microdialysates. This methodology has enabled us to achieve the first direct demonstration in humans that the brain can utilise lactate via the TCA cycle. We are currently using this methodology to make the first direct comparison of glycolysis and the PPP in human brain. In this article, we consider the application of 13C-labelled cerebral microdialysis for studying brain energy metabolism in patients. We set this methodology within the context of metabolic pathways in the brain, and 13C research modalities addressing them. PMID:24361470
NASA Astrophysics Data System (ADS)
Issaoui, Noureddine; Ghalla, Houcine; Muthu, S.; Flakus, H. T.; Oujia, Brahim
2015-02-01
In this work, the molecular structure, harmonic vibrational frequencies, UV, NBO and AIM of 3-thiophenecarboxilic acid (abbreviated as 3-TCA) monomer and dimer has been investigated. The FT-IR and FT-Raman spectra were recorded. The ground-state molecular geometry and vibrational frequencies have been calculated by using the Hartree-Fock (HF) and density functional theory (DFT)/B3LYP methods and 6-311++G(d,p) as a basis set. The fundamental vibrations were assigned on the basis of the total energy distribution (TED) of the vibrational modes, calculated with VEDA program. Comparison of the observed fundamental vibrational frequencies of 3-TCA with calculated results by HF and DFT methods indicates that B3LYP is better to HF method for molecular vibrational problems. The difference between the observed and scaled wavenumber values is very small. The theoretically predicted FT-IR and FT-Raman spectra of the title compound have been constructed. A study on the Mulliken atomic charges, the electronic properties were performed by time-dependent DFT (TD-DFT) approach, frontier molecular orbitals (HOMO-LUMO), molecular electrostatic potential (MEP) and thermodynamic properties have been performed. The electric dipole moment (μ) and the first hyperpolarizability (β) values of the investigated molecule have been also computed.
Issaoui, Noureddine; Ghalla, Houcine; Muthu, S; Flakus, H T; Oujia, Brahim
2015-02-05
In this work, the molecular structure, harmonic vibrational frequencies, UV, NBO and AIM of 3-thiophenecarboxilic acid (abbreviated as 3-TCA) monomer and dimer has been investigated. The FT-IR and FT-Raman spectra were recorded. The ground-state molecular geometry and vibrational frequencies have been calculated by using the Hartree-Fock (HF) and density functional theory (DFT)/B3LYP methods and 6-311++G(d,p) as a basis set. The fundamental vibrations were assigned on the basis of the total energy distribution (TED) of the vibrational modes, calculated with VEDA program. Comparison of the observed fundamental vibrational frequencies of 3-TCA with calculated results by HF and DFT methods indicates that B3LYP is better to HF method for molecular vibrational problems. The difference between the observed and scaled wavenumber values is very small. The theoretically predicted FT-IR and FT-Raman spectra of the title compound have been constructed. A study on the Mulliken atomic charges, the electronic properties were performed by time-dependent DFT (TD-DFT) approach, frontier molecular orbitals (HOMO-LUMO), molecular electrostatic potential (MEP) and thermodynamic properties have been performed. The electric dipole moment (μ) and the first hyperpolarizability (β) values of the investigated molecule have been also computed. Copyright © 2014 Elsevier B.V. All rights reserved.
Ghaly, J; Smith, A L
1994-06-01
A new era has arrived for the Biomedical Engineering Department at the Royal Women's Hospital in Melbourne. We have developed a system to qualitatively test for intermittent or unconfirmed faults, associated with Bear Cub ventilators. Where previous testing has been inadequate, computer logging is now used to interface the RT200 Timeter Calibration Analyser (TCA) to obtain a real time display of data, which can be stored and graphed. Using Quick Basic version 4.5, it was possible to establish communication between the TCA and an IBM compatible computer, such that meaningful displays of machine performance were produced. From the parameters measured it has been possible to obtain data on Peak Pressure, Inspiratory to Expiratory ratio (I:E ratio) Peak Flow and Rate. Monitoring is not limited to these parameters, though these were selected for our particular needs. These parameters are plotted in two ways: 1. Compressed average versus time, up to 24 hours on one screen 2. Raw data, 36 minutes displayed on each screen. The compressed data gives an overview which allows easy identification of intermittent faults. The uncompressed data confirms that the averaged signal is a realistic representation of the situation. One of the major benefits of this type of data analysis, is that ventilator performance may be monitored over a long period of time without requiring the presence of a service technician. It also allows individual ventilator performance to be graphically compared to other ventilators.
Krznar, Petra; Hörl, Manuel; Ammar, Zeinab; Montessuit, Sylvie; Pierredon, Sandra; Zamboni, Nicola; Martinou, Jean-Claude
2016-01-01
Mitochondrial import of pyruvate by the mitochondrial pyruvate carrier (MPC) is a central step which links cytosolic and mitochondrial intermediary metabolism. To investigate the role of the MPC in mammalian physiology and development, we generated a mouse strain with complete loss of MPC1 expression. This resulted in embryonic lethality at around E13.5. Mouse embryonic fibroblasts (MEFs) derived from mutant mice displayed defective pyruvate-driven respiration as well as perturbed metabolic profiles, and both defects could be restored by reexpression of MPC1. Labeling experiments using 13C-labeled glucose and glutamine demonstrated that MPC deficiency causes increased glutaminolysis and reduced contribution of glucose-derived pyruvate to the TCA cycle. Morphological defects were observed in mutant embryonic brains, together with major alterations of their metabolome including lactic acidosis, diminished TCA cycle intermediates, energy deficit and a perturbed balance of neurotransmitters. Strikingly, these changes were reversed when the pregnant dams were fed a ketogenic diet, which provides acetyl-CoA directly to the TCA cycle and bypasses the need for a functional MPC. This allowed the normal gestation and development of MPC deficient pups, even though they all died within a few minutes post-delivery. This study establishes the MPC as a key player in regulating the metabolic state necessary for embryonic development, neurotransmitter balance and post-natal survival. PMID:27176894
Brekke, Eva M F; Walls, Anne B; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula
2012-09-01
The brain is highly susceptible to oxidative injury, and the pentose phosphate pathway (PPP) has been shown to be affected by pathological conditions, such as Alzheimer's disease and traumatic brain injury. While this pathway has been investigated in the intact brain and in astrocytes, little is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-(13)C]glucose or [3-(13)C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism of (13)C-labeled glucose via the PPP does not appear to contribute to the production of releasable lactate, it contributes to labeling of tricarboxylic acid (TCA) cycle intermediates and related amino acids. Based on glutamate isotopomers, it was calculated that PPP activity accounts for ~6% of glucose metabolism in cortical neurons and ~4% in cerebellar neurons. This is the first demonstration that pyruvate generated from glucose via the PPP contributes to the synthesis of acetyl CoA for oxidation in the TCA cycle. Moreover, the fact that (13)C labeling from glucose is incorporated into glutamate proves that both the oxidative and the nonoxidative stages of the PPP are active in neurons.
Santos, Sónia Sá; Gibson, Gary E; Cooper, Arthur J L; Denton, Travis T; Thompson, Charles M; Bunik, Victoria I; Alves, Paula M; Sonnewald, Ursula
2006-02-15
Diminished activity of the alpha-ketoglutarate dehydrogenase complex (KGDHC), an important component of the tricarboxylic acid (TCA) cycle, occurs in several neurological diseases. The effect of specific KGDHC inhibitors [phosphonoethyl ester of succinyl phosphonate (PESP) and the carboxy ethyl ester of succinyl phosphonate (CESP)] on [1-13C]glucose and [U-13C]glutamate metabolism in intact cerebellar granule neurons was investigated. Both inhibitors decreased formation of [4-13C]glutamate from [1-13C]glucose, a reduction in label in glutamate derived from [1-13C]glucose/[U-13C]glutamate through a second turn of the TCA cycle and a decline in the amounts of gamma-aminobutyric acid (GABA), aspartate, and alanine. PESP decreased formation of [U-13C]aspartate and total glutathione, whereas CESP decreased concentrations of valine and leucine. The findings are consistent with decreased KGDHC activity; increased alpha-ketoglutarate formation; increased transamination of alpha-ketoglutarate with valine, leucine, and GABA; and new equilibrium position of the aspartate aminotransferase reaction. Overall, the findings also suggest that some carbon derived from alpha-ketoglutarate may bypass the block in the TCA cycle at KGDHC by means of the GABA shunt and/or conversion of valine to succinate. The results suggest the potential of succinyl phosphonate esters for modeling the biochemical and pathophysiological consequences of reduced KGDHC activity in brain diseases.
Falade, Titilayo D O; Chrysanthopoulos, Panagiotis K; Hodson, Mark P; Sultanbawa, Yasmina; Fletcher, Mary; Darnell, Ross; Korie, Sam; Fox, Glen
2018-05-07
Aflatoxin contamination is associated with the development of aflatoxigenic fungi such as Aspergillus flavus and A. parasiticus on food grains. This study was aimed at investigating metabolites produced during fungal development on maize and their correlation with aflatoxin levels. Maize cobs were harvested at R3 (milk), R4 (dough), and R5 (dent) stages of maturity. Individual kernels were inoculated in petri dishes with four doses of fungal spores. Fungal colonisation, metabolite profile, and aflatoxin levels were examined. Grain colonisation decreased with kernel maturity: milk-, dough-, and dent-stage kernels by approximately 100%, 60%, and 30% respectively. Aflatoxin levels increased with dose at dough and dent stages. Polar metabolites including alanine, proline, serine, valine, inositol, iso-leucine, sucrose, fructose, trehalose, turanose, mannitol, glycerol, arabitol, inositol, myo-inositol, and some intermediates of the tricarboxylic acid cycle (TCA—also known as citric acid or Krebs cycle) were important for dose classification. Important non-polar metabolites included arachidic, palmitic, stearic, 3,4-xylylic, and margaric acids. Aflatoxin levels correlated with levels of several polar metabolites. The strongest positive and negative correlations were with arabitol ( R = 0.48) and turanose and ( R = −0.53), respectively. Several metabolites were interconnected with the TCA; interconnections of the metabolites with the TCA cycle varied depending upon the grain maturity.
Glial dysfunction in abstinent methamphetamine abusers
Sailasuta, Napapon; Abulseoud, Osama; Harris, Kent C; Ross, Brian D
2010-01-01
Persistent neurochemical abnormalities in frontal brain structures are believed to result from methamphetamine use. We developed a localized 13C magnetic resonance spectroscopy (MRS) assay on a conventional MR scanner, to quantify selectively glial metabolic flux rate in frontal brain of normal subjects and a cohort of recovering abstinent methamphetamine abusers. Steady-state bicarbonate concentrations were similar, between 11 and 15 mmol/L in mixed gray-white matter of frontal brain of normal volunteers and recovering methamphetamine-abusing subjects (P>0.1). However, glial 13C-bicarbonate production rate from [1-13C]acetate, equating with glial tricarboxylic acid (TCA) cycle rate, was significantly reduced in frontal brain of abstinent methamphetamine-addicted women (methamphetamine 0.04 μmol/g per min (N=5) versus controls 0.11 μmol/g per min (N=5), P=0.001). This is equivalent to 36% of the normal glial TCA cycle rate. Severe reduction in glial TCA cycle rate that normally comprises 10% of total cerebral metabolic rate may impact operation of the neuronal glial glutamate cycle and result in accumulation of frontal brain glutamate, as observed in these recovering methamphetamine abusers. Although these are the first studies to define directly an abnormality in glial metabolism in human methamphetamine abuse, sequential studies using analogous 13C MRS methods may determine ‘cause and effect' between glial failure and neuronal injury. PMID:20040926
Freezability of water buffalo spermatozoa is improved with the addition of catalase in cryodiluent.
Ali, L; Hassan Andrabi, S M; Ahmed, H; Hussain Shah, A A
Catalase enzyme is usually distributed in mammalian seminal plasma, where it decomposes hydrogen peroxide into water and oxygen and enhances sperm survivability. To evaluate the effect of catalase (0, 100, 200 or 300 IU/ml) added in tris-citric acid (TCA) based extender on motion characteristics, viability and DNA integrity of bubaline spermatozoa at post dilution (PD) and post thawing (PT) stages of cryopreservation. Collection of semen was done in four Nili-Ravi bulls with an artificial vagina (42 degree C). Qualified semen samples from each bull were further subdivided into four aliquots for dilution with the experimental TCA extender containing either 0.0 (T1), 100 IU (T2), 200 IU (T3) or 300 IU (T4) catalase (activity12660 U/mg). At PT, mean computer progressive motility, average path velocity, straight line velocity, curvilinear velocity, visual motility and DNA integrity were higher (P < 0.05) in catalase fortified treatment groups as compared with control. Regarding plasma membrane integrity and supra-vital plasma membrane integrity, at PT the mean values were higher (P < 0.05) in T4 as compared with control. At PD and PT, mean acrosomal integrity of buffalo bull spermatozoa was higher (P < 0.05) in T4 group as compared with control. Addition of catalase at a concentration of 300IU/ml in TCA cryodiluent improved the freezability of water buffalo spermatozoa.
Muoio, Deborah M; Koves, Timothy R
2007-10-01
Dyslipidemia and intramuscular accumulation of fatty acid metabolites are increasingly recognized as core features of obesity and type 2 diabetes. Emerging evidence suggests that normal physiological adaptations to a heavy lipid load depend on the coordinated actions of broad transcriptional regulators such as the peroxisome proliferator activated receptors (PPARs) and PPAR gamma coactivator 1 alpha (PGC1 alpha). The application of transcriptomics and targeted metabolic profiling tools based on mass spectrometry has led to our finding that lipid-induced insulin resistance is a condition in which upregulation of PPAR-targeted genes and high rates of beta-oxidation are not supported by a commensurate upregulation of tricarboxylic acid (TCA) cycle activity. In contrast, exercise training enhances mitochondrial performance, favoring tighter coupling between beta-oxidation and the TCA cycle, and concomitantly restores insulin sensitivity in animals fed a chronic high-fat diet. The exercise-activated transcriptional coactivator, PGC1 alpha, plays a key role in coordinating metabolic flux through these 2 intersecting metabolic pathways, and its suppression by overfeeding may contribute to diet-induced mitochondrial dysfunction. Our emerging model predicts that muscle insulin resistance arises from a mitochondrial disconnect between beta-oxidation and TCA cycle activity. Understanding of this "disconnect" and its molecular basis may lead to new therapeutic approaches to combatting metabolic disease.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Karamooz, Saeed; Breeding, John Eric; Justice, T Alan
As MicroTCA expands into applications beyond the telecommunications industry from which it originated, it faces new challenges in the area of inter-blade communications. The ability to achieve deterministic, low-latency communications between blades is critical to realizing a scalable architecture. In the past, legacy bus architectures accomplished inter-blade communications using dedicated parallel buses across the backplane. Because of limited fabric resources on its backplane, MicroTCA uses the carrier hub (MCH) for this purpose. Unfortunately, MCH products from commercial vendors are limited to standard bus protocols such as PCI Express, Serial Rapid IO and 10/40GbE. While these protocols have exceptional throughput capability,more » they are neither deterministic nor necessarily low-latency. To overcome this limitation, an MCH has been developed based on the Xilinx Virtex-7 690T FPGA. This MCH provides the system architect/developer complete flexibility in both the interface protocol and routing of information between blades. In this paper, we present the application of this configurable MCH concept to the Machine Protection System under development for the Spallation Neutron Sources's proton accelerator. Specifically, we demonstrate the use of the configurable MCH as a 12x4-lane crossbar switch using the Aurora protocol to achieve a deterministic, low-latency data link. In this configuration, the crossbar has an aggregate bandwidth of 48 GB/s.« less
Protein-bound NAD(P)H Lifetime is Sensitive to Multiple Fates of Glucose Carbon.
Sharick, Joe T; Favreau, Peter F; Gillette, Amani A; Sdao, Sophia M; Merrins, Matthew J; Skala, Melissa C
2018-04-03
While NAD(P)H fluorescence lifetime imaging (FLIM) can detect changes in flux through the TCA cycle and electron transport chain (ETC), it remains unclear whether NAD(P)H FLIM is sensitive to other potential fates of glucose. Glucose carbon can be diverted from mitochondria by the pentose phosphate pathway (via glucose 6-phosphate dehydrogenase, G6PDH), lactate production (via lactate dehydrogenase, LDH), and rejection of carbon from the TCA cycle (via pyruvate dehydrogenase kinase, PDK), all of which can be upregulated in cancer cells. Here, we demonstrate that multiphoton NAD(P)H FLIM can be used to quantify the relative concentrations of recombinant LDH and malate dehydrogenase (MDH) in solution. In multiple epithelial cell lines, NAD(P)H FLIM was also sensitive to inhibition of LDH and PDK, as well as the directionality of LDH in cells forced to use pyruvate versus lactate as fuel sources. Among the parameters measurable by FLIM, only the lifetime of protein-bound NAD(P)H (τ 2 ) was sensitive to these changes, in contrast to the optical redox ratio, mean NAD(P)H lifetime, free NAD(P)H lifetime, or the relative amount of free and protein-bound NAD(P)H. NAD(P)H τ 2 offers the ability to non-invasively quantify diversions of carbon away from the TCA cycle/ETC, which may support mechanisms of drug resistance.
You, Le; Berla, Bert; He, Lian; Pakrasi, Himadri B; Tang, Yinjie J
2014-05-01
The central carbon metabolism of cyanobacteria is under debate. For over 50 years, the lack of α-ketoglutarate dehydrogenase has led to the belief that cyanobacteria have an incomplete TCA cycle. Recent in vitro enzymatic experiments suggest that this cycle may in fact be closed. The current study employed (13) C isotopomers to delineate pathways in the cyanobacterium Synechocystis sp. PCC 6803. By tracing the incorporation of supplemented glutamate into the downstream metabolites in the TCA cycle, we observed a direct in vivo transformation of α-ketoglutarate to succinate. Additionally, isotopic tracing of glyoxylate did not show a functional glyoxylate shunt and glyoxylate was used for glycine synthesis. The photomixotrophic carbon metabolism was then profiled with (13) C-MFA under light and carbon-sufficient conditions. We observed that: (i) the in vivo flux through the TCA cycle reactions (α-ketoglutarate → succinate) was minimal (<2%); (ii) the flux ratio of CO2 fixation was six times higher than that of glucose utilization; (iii) the relative flux through the oxidative pentose phosphate pathway was low (<2%); (iv) high flux through malic enzyme served as a main route for pyruvate synthesis. Our results improve the understanding of the versatile metabolism in cyanobacteria and shed light on their application for photo-biorefineries. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Evolution of substrate specificity for the bile salt transporter ASBT (SLC10A2)[S
Lionarons, Daniël A.; Boyer, James L.; Cai, Shi-Ying
2012-01-01
The apical Na+-dependent bile salt transporter (ASBT/SLC10A2) is essential for maintaining the enterohepatic circulation of bile salts. It is not known when Slc10a2 evolved as a bile salt transporter or how it adapted to substantial changes in bile salt structure during evolution. We characterized ASBT orthologs from two primitive vertebrates, the lamprey that utilizes early 5α-bile alcohols and the skate that utilizes structurally different 5β-bile alcohols, and compared substrate specificity with ASBT from humans who utilize modern 5β-bile acids. Everted gut sacs of skate but not the more primitive lamprey transported 3H-taurocholic acid (TCA), a modern 5β-bile acid. However, molecular cloning identified ASBT orthologs from both species. Cell-based assays using recombinant ASBT/Asbt's indicate that lamprey Asbt has high affinity for 5α-bile alcohols, low affinity for 5β-bile alcohols, and lacks affinity for TCA, whereas skate Asbt showed high affinity for 5α- and 5β-bile alcohols but low affinity for TCA. In contrast, human ASBT demonstrated high affinity for all three bile salt types. These findings suggest that ASBT evolved from the earliest vertebrates by gaining affinity for modern bile salts while retaining affinity for older bile salts. Also, our results indicate that the bile salt enterohepatic circulation is conserved throughout vertebrate evolution. PMID:22669917
Wen, Li; Liu, Gai; Zhang, Zai-Jun; Tao, Jun; Wan, Cui-Xiang; Zhu, Ying-Guo
2006-03-01
The proteins of HL type cytoplasmic male sterility rice anther of YTA (CMS) and YTB (maintenance line) were separated by two-dimensional electrophoresis with immobilized ph (3-10 non-linear) gradients as the first dimension and SDS-PAGE as the second. The silver-stained proteins spots were analyzed using Image Master 2D software, there were about 1800 detectable spots on each 2D-gel, and about 85 spots were differential expressed. With direct MALDI-TOF mass spectrometry analysis and protein database searching, 9 protein spots out of 16 were identified. Among those proteins, there were Putative nucleic acid binding protein, glucose-1-phosphate adenylyltransferase (ADP-glucose pyrophosphorylase, AGPase) (EC: 2.7.7.27) large chain, UDP-glucuronic acid decarboxylase, putative calcium-binding protein annexin, putative acetyl-CoA synthetase and putative lipoamide dehydrogenase etc. They were closely associated with metabolism, protein biosynthesis, transcription, signal transduction and so on, all of which are cell activities that are essential to pollen development. Some of the identified proteins, i.e. AGPase, putative lipoamide dehydrogenase and putative acetyl-CoA synthetase were deeply discussed on the relationship to CMS. AGPase catalyzes a very important step in the biosynthesis of alpha 1,4-glucans (glycogen or starch) in bacteria and plants: synthesis of the activated glucosyl donor, ADP-glucose, from glucose-1-phosphate and ATP. The lack of the AGPase in male sterile line might directly result in the reduction of starch, and the synthesis of starch was the most important processes during the development of pollen. In present research, the descent or reduction of putative lipoamide dehydrogenase and putative acetyl-CoA synthetase seemed involved in pollen sterility in rice. The degeneration and formation of various tissues during pollen development may impose high demands for energy and key biosynthetic intermediates. Under such conditions, the TCA cycle needs to operate fully, because the TCA cycle is an important source for many intermediates required for biosynthetic pathways, in addition to performing an oxidative, energy-producing role. Thus, it seemed reasonable to infer that the decrease of putative lipoamide dehydrogenase and putative acetyl-CoA synthetase in anther might prevent the conversion of pyruvate into acetyl-CoA, and as a result, the TCA cycle could no longer operate at a sufficient rate to meet all requirements in anther cells, leading to pollen sterility. This study gave new insights into the mechanism of CMS in rice and demonstrated the power of the proteomic approach in plant biology studies.
Evaluation of an alternative extraction procedure for enterotoxin determination in dairy products.
Meyrand, A; Atrache, V; Bavai, C; Montet, M P; Vernozy-Rozand, C
1999-06-01
A concentration protocol based on trichloroacetic acid precipitation was evaluated and compared with the reference method using dialysis concentration. Different quantities of purified staphylococcal enterotoxins were added to pasteurized Camembert-type cheeses. Detection of enterotoxins in these cheeses was performed using an automated detection system. Raw goat milk Camembert-type cheeses involved in a staphylococcal food poisoning were also tested. Both enterotoxin extraction methods allowed detection of the lowest enterotoxin concentration level used in this study (0.5 ng g-1). Compared with the dialysis concentration method, TCA precipitation of staphylococcal enterotoxins was 'user-friendly' and less time-consuming. These results suggest that TCA precipitation is a rapid (1 h), simple and reliable method of extracting enterotoxin from food which gives excellent recovery from dairy products.
RS-88 Pad Abort Demonstrator Thrust Chamber Assembly Testing at NASA Marshall Space Flight Center
NASA Technical Reports Server (NTRS)
Farr, Rebecca A.; Sanders, Timothy M.
1990-01-01
This paper documents the effort conducted to collect hot-tire dynamic and acoustics environments data during 50,000-lb thrust lox-ethanol hot-fire rocket testing at NASA Marshall Space Flight Center (MSFC) in November-December 2003. This test program was conducted during development testing of the Boeing Rocketdyne RS-88 development engine thrust chamber assembly (TCA) in support of the Orbital Space Plane (OSP) Crew Escape System Propulsion (CESP) Program Pad Abort Demonstrator (PAD). In addition to numerous internal TCA and nozzle measurements, induced acoustics environments data were also collected. Provided here is an overview of test parameters, a discussion of the measurements, test facility systems and test operations, and a quality assessment of the data collected during this test program.
Remedial Investigation Report for Lake City Army Ammunition Plant. Volume 1
1990-06-01
EXPLOSIVE COMPOUNDS 1 3-DNB ɘ 61 ɘ.61 ɘ.61 ɘ.61 ɘ.61 1 73 135-7N6 11 7 ɘ.56 ɘ.56 ɘ.56 ɘ.56 0.7 *J 3.24 ə 30 ə 30 ə,30 ə.30 ə.30 POX ɘ...COMPOUNDS * 5- TNB I37 ɘ.56 ɘ. 56 ɘ 56 ɘ. 56 ɘ,56 HMX 17 4 ə.,30 ə 30 < 1 340 ,30 ə.30 POX IS0 1.67 ɘ.63 ɘ.63 ɘ.63 1 84 OTHERS (ALL NO OR...Torkelson and Rowe 1031 5-209 Evidence suggests that 1,1,2-TCA is embryo toxic to chicken eggs (Elovaara 1979). I,I,2-TCA was found to be weakly mutagenic
NASA Astrophysics Data System (ADS)
Lin, Jyun-Hao; Huang, Shyh-Jer; Su, Yan-Kuin
2014-01-01
A simple thermal cycle annealing (TCA) process was used to improve the quality of GaN grown on a Si substrate. The X-ray diffraction (XRD) and etch pit density (EPD) results revealed that using more process cycles, the defect density cannot be further reduced. However, the performance of GaN-based metal-semiconductor-metal (MSM) photodiodes (PDs) prepared on Si substrates showed significant improvement. With a two-cycle TCA process, it is found that the dark current of the device was only 1.46 × 10-11 A, and the photo-to-dark-current contrast ratio was about 1.33 × 105 at 5 V. Also, the UV/visible rejection ratios can reach as high as 1077.
IRIS Toxicological Review of Trichloroacetic Acid (TCA) ...
On September 24, 2009, the Toxicological Review of Trichloroacetic Acid (TCA) and the charge to external peer reviewers were released for external peer review and public comment. The Toxicological Review and charge were reviewed internally by EPA and by other federal agencies and White House Offices before public release. In the new IRIS process, introduced by the EPA Administrator, all written comments on IRIS assessments submitted by other federal agencies and White House Offices will be made publicly available. Accordingly, interagency comments and the interagency science consultation draft of the IRIS Toxicological Review of Trichloroacetic Acid and the charge to external peer reviewers are posted on this site. The draft Toxicological Review of Trichloroacetic Acid provides scientific support and rationale for the hazard identification and dose-response assessment pertaining to chronic exposure to trichloroacetic acid.
Yin, Xian; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Liu, Long; Chen, Jian
2015-11-01
Organic acids, which are chemically synthesized, are also natural intermediates in the metabolic pathways of microorganisms, among which the tricarboxylic acid (TCA) cycle is the most crucial route existing in almost all living organisms. Organic acids in the TCA cycle include citric acid, α-ketoglutaric acid, succinic acid, fumaric acid, l-malic acid, and oxaloacetate, which are building-block chemicals with wide applications and huge markets. In this review, we summarize the synthesis pathways of these organic acids and review recent advances in metabolic engineering strategies that enhance organic acid production. We also propose further improvements for the production of organic acids with systems and synthetic biology-guided metabolic engineering strategies. Copyright © 2015 Elsevier Inc. All rights reserved.
The role of Pyruvate Dehydrogenase Complex in cardiovascular diseases.
Sun, Wanqing; Liu, Quan; Leng, Jiyan; Zheng, Yang; Li, Ji
2015-01-15
The regulation of mammalian myocardial carbohydrate metabolism is complex; many factors such as arterial substrate and hormone levels, coronary flow, inotropic state and the nutritional status of the tissue play a role in regulating mammalian myocardial carbohydrate metabolism. The Pyruvate Dehydrogenase Complex (PDHc), a mitochondrial matrix multienzyme complex, plays an important role in energy homeostasis in the heart by providing the link between glycolysis and the tricarboxylic acid (TCA) cycle. In TCA cycle, PDHc catalyzes the conversion of pyruvate into acetyl-CoA. This review determines that there is altered cardiac glucose in various pathophysiological states consequently causing PDC to be altered. This review further summarizes evidence for the metabolism mechanism of the heart under normal and pathological conditions including ischemia, diabetes, hypertrophy and heart failure. Copyright © 2014 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
He, Lian; Xiu, Yu; Jones, J. Andrew
Microbial fermentation conditions are dynamic, due to transcriptional induction, nutrient consumption, or changes to incubation conditions. In this paper, 13C-metabolic flux analysis was used to characterize two violacein-producing E. coli strains with vastly different productivities, and to profile their metabolic adjustments resulting from external perturbations during fermentation. The two strains were first grown at 37 °C in stage 1, and then the temperature was transitioned to 20 °C in stage 2 for the optimal expression of the violacein synthesis pathway. After induction, violacein production was minimal in stage 3, but accelerated in stage 4 (early production phase) and 5 (latemore » production phase) in the high producing strain, reaching a final concentration of 1.5 mmol/L. On the contrary, ~0.02 mmol/L of violacein was obtained from the low producing strain. To have a snapshot of the temporal metabolic changes in each stage, we performed 13C-MFA via isotopomer analysis of fast-turnover free metabolites. The results indicate strikingly stable flux ratios in the central metabolism throughout the early growth stages. In the late stages, however, the high producer rewired its flux distribution significantly, which featured an upregulated pentose phosphate pathway and TCA cycle, reflux from acetate utilization, negligible anabolic fluxes, and elevated maintenance loss, to compensate for nutrient depletion and drainage of some building blocks due to violacein overproduction. The low producer with stronger promoters shifted its relative fluxes in stage 5 by enhancing the flux through the TCA cycle and acetate overflow, while exhibiting a reduced biomass growth and a minimal flux towards violacein synthesis. Finally, interestingly, the addition of the violacein precursor (tryptophan) in the medium inhibited high producer but enhanced low producer's productivity, leading to hypotheses of unknown pathway regulations (such as metabolite channeling).« less
Singh, Varinder; Singh, Baldev; Joshi, Robin; Jaju, Puneet
2017-01-01
Withania somnifera is a high value medicinal plant which is used against large number of ailments. The medicinal properties of the plant attributes to a wide array of important secondary metabolites. The plant is predominantly infected with leaf spot pathogen Alternaria alternata, which leads to substantial biodeterioration of pharmaceutically important metabolites. To develop an effective strategy to combat this disease, proteomics based approach could be useful. Hence, in the present study, three different protein extraction methods tris-buffer based, phenol based and trichloroacetic acid-acetone (TCA-acetone) based method were comparatively evaluated for two-dimensional electrophoresis (2-DE) analysis of W. somnifera. TCA-acetone method was found to be most effective and was further used to identify differentially expressed proteins in response to fungal infection. Thirty-eight differentially expressed proteins were identified by matrix assisted laser desorption/ionization time of flight-mass spectrometry (MALDI TOF/TOF MS/MS). The known proteins were categorized into eight different groups based on their function and maximum proteins belonged to energy and metabolism, cell structure, stress and defense and RNA/DNA categories. Differential expression of some key proteins were also crosschecked at transcriptomic level by using qRT-PCR and were found to be consistent with the 2-DE data. These outcomes enable us to evaluate modifications that take place at the proteomic level during a compatible host pathogen interaction. The comparative proteome analysis conducted in this paper revealed the involvement of many key proteins in the process of pathogenesis and further investigation of these identified proteins could assist in the discovery of new strategies for the development of pathogen resistance in the plant. PMID:28575108
Qin, Jiayang; Wang, Xiuwen; Wang, Landong; Zhu, Beibei; Zhang, Xiaohua; Yao, Qingshou; Xu, Ping
2015-01-01
Lactate production is enhanced by adding calcium carbonate or sodium hydroxide during fermentation. However, Bacillus coagulans 2-6 can produce more than 180 g/L L-lactic acid when calcium lactate is accumulated, but less than 120 g/L L-lactic acid when sodium lactate is formed. The molecular mechanisms by which B. coagulans responds to calcium lactate and sodium lactate remain unclear. In this study, comparative transcriptomic methods based on high-throughput RNA sequencing were applied to study gene expression changes in B. coagulans 2-6 cultured in non-stress, sodium lactate stress and calcium lactate stress conditions. Gene expression profiling identified 712 and 1213 significantly regulated genes in response to calcium lactate stress and sodium lactate stress, respectively. Gene ontology assignments of the differentially expressed genes were performed. KEGG pathway enrichment analysis revealed that 'ATP-binding cassette transporters' were significantly affected by calcium lactate stress, and 'amino sugar and nucleotide sugar metabolism' was significantly affected by sodium lactate stress. It was also found that lactate fermentation was less affected by calcium lactate stress than by sodium lactate stress. Sodium lactate stress had negative effect on the expression of 'glycolysis/gluconeogenesis' genes but positive effect on the expression of 'citrate cycle (TCA cycle)' genes. However, calcium lactate stress had positive influence on the expression of 'glycolysis/gluconeogenesis' genes and had minor influence on 'citrate cycle (TCA cycle)' genes. Thus, our findings offer new insights into the responses of B. coagulans to different lactate stresses. Notably, our RNA-seq dataset constitute a robust database for investigating the functions of genes induced by lactate stress in the future and identify potential targets for genetic engineering to further improve L-lactic acid production by B. coagulans.
Balasubramanian, Madhusudhanan; Žabić, Stanislav; Bowd, Christopher; Thompson, Hilary W.; Wolenski, Peter; Iyengar, S. Sitharama; Karki, Bijaya B.; Zangwill, Linda M.
2009-01-01
Glaucoma is the second leading cause of blindness worldwide. Often the optic nerve head (ONH) glaucomatous damage and ONH changes occur prior to visual field loss and are observable in vivo. Thus, digital image analysis is a promising choice for detecting the onset and/or progression of glaucoma. In this work, we present a new framework for detecting glaucomatous changes in the ONH of an eye using the method of proper orthogonal decomposition (POD). A baseline topograph subspace was constructed for each eye to describe the structure of the ONH of the eye at a reference/baseline condition using POD. Any glaucomatous changes in the ONH of the eye present during a follow-up exam were estimated by comparing the follow-up ONH topography with its baseline topograph subspace representation. Image correspondence measures of L1 and L2 norms, correlation, and image Euclidean distance (IMED) were used to quantify the ONH changes. An ONH topographic library built from the Louisiana State University Experimental Glaucoma study was used to evaluate the performance of the proposed method. The area under the receiver operating characteristic curves (AUC) were used to compare the diagnostic performance of the POD induced parameters with the parameters of Topographic Change Analysis (TCA) method. The IMED and L2 norm parameters in the POD framework provided the highest AUC of 0.94 at 10° field of imaging and 0.91 at 15° field of imaging compared to the TCA parameters with an AUC of 0.86 and 0.88 respectively. The proposed POD framework captures the instrument measurement variability and inherent structure variability and shows promise for improving our ability to detect glaucomatous change over time in glaucoma management. PMID:19369163
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tang, Yinjie J.; Sapra, Rajat; Joyner, Dominique
2009-01-20
A recently discovered thermophilic bacterium, Geobacillus thermoglucosidasius M10EXG, ferments a range of C5 (e.g., xylose) and C6 sugars (e.g., glucose) and istolerant to high ethanol concentrations (10percent, v/v). We have investigated the central metabolism of this bacterium using both in vitro enzyme assays and 13C-based flux analysis to provide insights into the physiological properties of this extremophile and explore its metabolism for bio-ethanol or other bioprocess applications. Our findings show that glucose metabolism in G. thermoglucosidasius M10EXG proceeds via glycolysis, the pentose phosphate pathway, and the TCA cycle; the Entner?Doudoroff pathway and transhydrogenase activity were not detected. Anaplerotic reactions (includingmore » the glyoxylate shunt, pyruvate carboxylase, and phosphoenolpyruvate carboxykinase) were active, but fluxes through those pathways could not be accuratelydetermined using amino acid labeling. When growth conditions were switched from aerobic to micro-aerobic conditions, fluxes (based on a normalized glucose uptake rate of 100 units (g DCW)-1 h-1) through the TCA cycle and oxidative pentose phosphate pathway were reduced from 64+-3 to 25+-2 and from 30+-2 to 19+-2, respectively. The carbon flux under micro-aerobic growth was directed formate. Under fully anerobic conditions, G. thermoglucosidasius M10EXG used a mixed acid fermentation process and exhibited a maximum ethanol yield of 0.38+-0.07 mol mol-1 glucose. In silico flux balance modeling demonstrates that lactate and acetate production from G. thermoglucosidasius M10EXG reduces the maximum ethanol yieldby approximately threefold, thus indicating that both pathways should be modified to maximize ethanol production.« less
Yin, Shan; Guo, Pan; Hai, Dafu; Xu, Li; Shu, Jiale; Zhang, Wenjin; Khan, Muhammad Idrees; Kurland, Irwin J; Qiu, Yunping; Liu, Yumin
2017-12-01
In this paper, an optimized method based on gas chromatography/time-of-flight mass spectrometry (GC-TOFMS) platform has been developed for the analysis of gut microbial-host related co-metabolites in fecal samples. The optimization was performed with proportion of chloroform (C), methanol (M) and water (W) for the extraction of specific metabolic pathways of interest. Loading Bi-plots from the PLS regression model revealed that high concentration of chloroform emphasized the extraction of short chain fatty acids and TCA intermediates, while the higher concentration of methanol emphasized indole and phenyl derivatives. Low level of organic solution emphasized some TCA intermediates but not for indole and phenyl species. The highest sum of the peak area and the distribution of metabolites corresponded to the extraction of methanol/chloroform/water of 225:75:300 (v/v/v), which was then selected for method validation and utilized in our application. Excellent linearity was obtained with 62 reference standards representing different classes of gut microbial-host related co-metabolites, with correlation coefficients (r 2 ) higher than 0.99. Limit of detections (LODs) and limit of qualifications (LOQs) for these standards were below 0.9 nmol and 1.6 nmol, respectively. The reproducibility and repeatability of the majority of tested metabolites in fecal samples were observed with RSDs lower than 15%. Chinese rhubarb-treated rats had elevated indole and phenyl species, and decreased levels of polyamine such as putrescine, and several amino acids. Our optimized method has revealed host-microbe relationships of potential importance for intestinal microbial metabolite receptors such as pregnane X receptor (PXR) and aryl hydrocarbon receptor (AHR) activity, and for enzymes such as ornithine decarboxylase (ODC). Copyright © 2017 Elsevier B.V. All rights reserved.
... and Post-inflammatory hyperpigmentation - after Tazortene, hydroquinone, and salicylic acid chemical peels Photo courtesy of of P. Grimes ... after treatment with hydroquinone, TCA chemical peel, and salicylic acid chemical peel. Photo courtesy of of P. Grimes ...
Johansen, Maja L; Bak, Lasse K; Schousboe, Arne; Iversen, Peter; Sørensen, Michael; Keiding, Susanne; Vilstrup, Hendrik; Gjedde, Albert; Ott, Peter; Waagepetersen, Helle S
2007-06-01
Cerebral hyperammonemia is a hallmark of hepatic encephalopathy, a debilitating condition arising secondary to liver disease. Pyruvate oxidation including tricarboxylic acid (TCA) cycle metabolism has been suggested to be inhibited by hyperammonemia at the pyruvate and alpha-ketoglutarate dehydrogenase steps. Catabolism of the branched-chain amino acid isoleucine provides both acetyl-CoA and succinyl-CoA, thus by-passing both the pyruvate dehydrogenase and the alpha-ketoglutarate dehydrogenase steps. Potentially, this will enable the TCA cycle to work in the face of ammonium-induced inhibition. In addition, this will provide the alpha-ketoglutarate carbon skeleton for glutamate and glutamine synthesis by glutamate dehydrogenase and glutamine synthetase (astrocytes only), respectively, both reactions fixing ammonium. Cultured cerebellar neurons (primarily glutamatergic) or astrocytes were incubated in the presence of either [U-13C]glucose (2.5 mM) and isoleucine (1 mM) or [U-13C]isoleucine and glucose. Cell cultures were treated with an acute ammonium chloride load of 2 (astrocytes) or 5 mM (neurons and astrocytes) and incorporation of 13C-label into glutamate, aspartate, glutamine and alanine was determined employing mass spectrometry. Labeling from [U-13C]glucose in glutamate and aspartate increased as a result of ammonium-treatment in both neurons and astrocytes, suggesting that the TCA cycle was not inhibited. Labeling in alanine increased in neurons but not in astrocytes, indicating elevated glycolysis in neurons. For both neurons and astrocytes, labeling from [U-13C]isoleucine entered glutamate and aspartate albeit to a lower extent than from [U-13C]glucose. Labeling in glutamate and aspartate from [U-13C]isoleucine was decreased by ammonium treatment in neurons but not in astrocytes, the former probably reflecting increased metabolism of unlabeled glucose. In astrocytes, ammonia treatment resulted in glutamine production and release to the medium, partially supported by catabolism of [U-13C]isoleucine. In conclusion, i) neuronal and astrocytic TCA cycle metabolism was not inhibited by ammonium and ii) isoleucine may provide the carbon skeleton for synthesis of glutamate/glutamine in the detoxification of ammonium.
NASA Astrophysics Data System (ADS)
Rolston, H. M.; Semprini, L.; Thankitkul, S.; Azizian, M.; Hyman, M. R.
2016-12-01
1,4-dioxane (1,4-D) is a frequently observed groundwater contaminant due to its use as a stabilizer in commercial solvent formulations. In situ bioremediation could potentially provide a large cost savings for treatment of mixtures of chlorinated aliphatic hydrocarbons (CAHs) that include 1,4-D. Aerobic cometabolism is a particularly attractive option, as microorganisms can be stimulated in situ using specific primary substrates. Results will be presented that show the model isobutane-metabolizing bacteria, Rhodococcus rhodochrous (ATCC 21198), has the ability to transform 14-D at high rates and transformation capacities to concentrations below the drinking water screening level of 0.67 µg L-1. Resting cell transformation tests showed 1,4-D and a broad range of CAHs can be cometabolized by ATCC 21198. The maximum transformation rate (kmax) and the half-substrate coefficient (Ks) were determined for isobutane (the growth substrate), 1,4-D, 1,1,1-trichloroethane (1,1,1-TCA), 1,1,2-trichloroethane (1,1,2-TCA), 1,1-dichloroethane (1,1-DCA); 1,2-dichloroethane ((1,2-DCA) and 1,1-dichloroethene (1,1-DCE). Of the CAHs tested, 1,1-DCA had the highest kmax, approximately 25% of that for isobutane utilization, while 1,1,1-TCA had the lowest kmax, approximately 2% of isobutane's. 1,4-D was rapidly transformed and had a kmax 25% of that of isobutane. ATCC 21198 effectively transformed mixtures of 1,4-D, 1,1-DCE, 1,2-DCA and 1,1,1-TCA, both in the presence and absence isobutane. Model simulations were performed for the simultaneous cometabolism of 1,4-D and CAH mixtures by ATCC 21198, that included inhibition among the contaminants and isobutane , and terms for a limited transformation capacity. A good match to experimental observations was obtaining using the independently measured rate parameters. Results of model simulations will also be presented using a reactive transport model to evaluate conditions of in situ bioremediation using strain ATCC 21198.
Implications of matrix diffusion on 1,4-dioxane persistence at contaminated groundwater sites.
Adamson, David T; de Blanc, Phillip C; Farhat, Shahla K; Newell, Charles J
2016-08-15
Management of groundwater sites impacted by 1,4-dioxane can be challenging due to its migration potential and perceived recalcitrance. This study examined the extent to which 1,4-dioxane's persistence was subject to diffusion of mass into and out of lower-permeability zones relative to co-released chlorinated solvents. Two different release scenarios were evaluated within a two-layer aquifer system using an analytical modeling approach. The first scenario simulated a 1,4-dioxane and 1,1,1-TCA source zone where spent solvent was released. The period when 1,4-dioxane was actively loading the low-permeability layer within the source zone was estimated to be <3years due to its high effective solubility. While this was approximately an order-of-magnitude shorter than the loading period for 1,1,1-TCA, the mass of 1,4-dioxane stored within the low-permeability zone at the end of the simulation period (26kg) was larger than that predicted for 1,1,1-TCA (17kg). Even 80years after release, the aqueous 1,4-dioxane concentration was still several orders-of-magnitude higher than potentially-applicable criteria. Within the downgradient plume, diffusion contributed to higher concentrations and enhanced penetration of 1,4-dioxane into the low-permeability zones relative to 1,1,1-TCA. In the second scenario, elevated 1,4-dioxane concentrations were predicted at a site impacted by migration of a weak source from an upgradient site. Plume cutoff was beneficial because it could be implemented in time to prevent further loading of the low-permeability zone at the downgradient site. Overall, this study documented that 1,4-dioxane within transmissive portions of the source zone is quickly depleted due to characteristics that favor both diffusion-based storage and groundwater transport, leaving little mass to treat using conventional means. Furthermore, the results highlight the differences between 1,4-dioxane and chlorinated solvent source zones, suggesting that back diffusion of 1,4-dioxane mass may be serving as the dominant long-term "secondary source" at many contaminated sites that must be managed using alternative approaches. Copyright © 2016 Elsevier B.V. All rights reserved.
Nambiar, D; Narayan, V V; Josyula, L K; Porter, J D H; Sathyanarayana, T N; Sheikh, K
2014-11-25
Efforts to engage Traditional, Complementary and Alternative Medical (TCAM) practitioners in the public health workforce have growing relevance for India's path to universal health coverage. We used an action-centred framework to understand how policy prescriptions related to integration were being implemented in three distinct Indian states. Health departments and district-level primary care facilities in the states of Kerala, Meghalaya and Delhi. In each state, two or three districts were chosen that represented a variation in accessibility and distribution across TCAM providers (eg, small or large proportions of local health practitioners, Homoeopaths, Ayurvedic and/or Unani practitioners). Per district, two blocks or geographical units were selected. TCAM and allopathic practitioners, administrators and representatives of the community at the district and state levels were chosen based on publicly available records from state and municipal authorities. A total of 196 interviews were carried out: 74 in Kerala, and 61 each in Delhi and Meghalaya. We sought to understand experiences and meanings associated with integration across stakeholders, as well as barriers and facilitators to implementing policies related to integration of Traditional, Complementary and Alternative (TCA) providers at the systems level. We found that individual and interpersonal attributes tended to facilitate integration, while system features and processes tended to hinder it. Collegiality, recognition of stature, as well as exercise of individual personal initiative among TCA practitioners and of personal experience of TCAM among allopaths enabled integration. The system, on the other hand, was characterised by the fragmentation of jurisdiction and facilities, intersystem isolation, lack of trust in and awareness of TCA systems, and inadequate infrastructure and resources for TCA service delivery. State-tailored strategies that routinise interaction, reward individual and system-level individual integrative efforts, and are fostered by high-level political will are recommended. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Activated Persulfate Treatment of 1,4-Dioxane in the Presence of Chlorinated Solvent Co-contaminants
NASA Astrophysics Data System (ADS)
Boving, T. T.; Eberle, D. E. H.; Ball, R.
2014-12-01
1,4-dioxane is an emerging groundwater contaminant and a likely human carcinogen. Due to its history as a stabilizer in chlorinated solvents, 1,4-dioxane is often found as a co-contaminant at solvent releases sites such as landfills, solvent recycling facilities, vapor decreasing operations, and fire-training areas. Historically, 1,4-dioxane was not routinely analyzed for at solvent release sites. The lack of analyses and the limitations of the analyses that were performed (i.e. high reporting limits) means that the scale of 1,4-dioxane subsurface contamination is still emerging. With the number of known 1,4-dioxane sites increasing, the need for cost effective 1,4-dioxane remediation technologies is rising as well. Remediation strategies that are capable of treating both 1,4-dioxane as well as chlorinated co-contaminants are of particular importance, especially when treating mixed-waste source zones. In the present study, we examined the fate of 1,4-dioxane during the targeted remediation of aqueous phase volatile organic compounds (VOC) using an activated persulfate based ISCO method (OxyZone®). Bench scale laboratory experiments are used to evaluate the treatability of 1,4-dioxane both as a single compound and in the presence of trichloroethene (TCE) and 1,1,1-trichloroethane (1,1,1-TCA). Possible dependencies on oxidant concentration and reaction kinetics were studied. Preliminary results are promising and show that OxyZone® is persistent and long lived, with oxidation of 1,4-dioxane continuing more than 12 days after initial dosage, even at dilute oxidant concentrations. The oxidative destruction of 1,4-dioxane, TCE and 1,1,1-TCA in single compound batch systems followed pseudo first order reaction kinetics. The rate of oxidation for each contaminant increased linearly with increasing persulfate concentration over the range of oxidant concentrations tested. The rate of oxidative destruction, from most easily degraded to least was: TCE > 1,4-Dioxane > 1,1,1-TCA. Experiments examining the destruction of 1,4-dioxane in the presence of TCE and 1,1,1-TCA are ongoing. The final results of this study will be presented.
Qiu, Kaifeng; Huang, Zixian; Huang, Zhiquan; He, Zhichao; You, Siping
2016-06-01
Tongue squamous cell carcinoma (TSCC) is the most common type of head and neck squamous cell carcinoma (HNSCC) in China, and its survival rate remains unsatisfactory. miR-22 has been identified as a tumor suppressor in many human cancers, and high expression of CD147 occurs in many tumors. The aim of the present study was to investigate the expression and function of miR-22 in TSCC and its relationship with the expression of CD147. TCA8113 cells were transiently transfected with a miR-22 mimic/inhibitor. Subsequently, a validation with Real-time RT-PCR was performed to analyze the miR-22 expression level, and a CCK-8 proliferation assay and transwell migration and invasion assays were carried out. Cotransfections using As-miR-22/si-CD147 mRNA or a miR-22/CD147 overexpression vector were applied, and we investigated the biological effects on cotranscribed TCA8113 cells. qRT-PCR confirmed that miR-22 or As-miR-22 were successfully transfected into TCA8113 cells. Suppressing miR-22 resulted in a promotion of cell proliferation and motility and an up-regulation of CD147 in TCA8113 cells in vitro. In contrast, increasing miR-22 inhibited cell proliferation and motility and down-regulated CD147. Furthermore, the reduction or overexpression of CD147 can reverse the promoting or suppressive effects of miR-22, respectively. The down-expression of miR-22 can regulate cell growth and motility in TSCC cells, which indicates that miR-22 acts as a tumor suppressor in TSCC. Additionally, CD147 is subsequently up-regulated when miR-22 inhibited. Taken together, the findings of this research defined a novel relationship between the down-regulation of miR-22 and the up-regulation of CD147 and demonstrated that CD147 is a downstream factor of miR-22. Copyright © 2016 Elsevier Ltd. All rights reserved.
Yu, Dongke; Zhang, Han; Lionarons, Daniel A; Boyer, James L; Cai, Shi-Ying
2017-04-01
The Na + -dependent taurocholate cotransporting polypeptide (NTCP/SLC10A1) is a hepatocyte-specific solute carrier, which plays an important role in maintaining bile salt homeostasis in mammals. The absence of a hepatic Na + -dependent bile salt transport system in marine skate and rainbow trout raises a question regarding the function of the Slc10a1 gene in these species. Here, we have characterized the Slc10a1 gene in the marine skate, Leucoraja erinacea The transcript of skate Slc10a1 (skSlc10a1) encodes 319 amino acids and shares 46% identity to human NTCP (hNTCP) with similar topology to mammalian NTCP. SkSlc10a1 mRNA was mostly confined to the brain and testes with minimal expression in the liver. An FXR-bile salt reporter assay indicated that skSlc10a1 transported taurocholic acid (TCA) and scymnol sulfate, but not as effectively as hNTCP. An [ 3 H]TCA uptake assay revealed that skSlc10a1 functioned as a Na + -dependent transporter, but with low affinity for TCA ( K m = 92.4 µM) and scymnol sulfate ( K i = 31 µM), compared with hNTCP (TCA, K m = 5.4 µM; Scymnol sulfate, K i = 3.5 µM). In contrast, the bile salt concentration in skate plasma was 2 µM, similar to levels seen in mammals. Interestingly, skSlc10a1 demonstrated transport activity for the neurosteroids dehydroepiandrosterone sulfate and estrone-3-sulfate at physiological concentration, similar to hNTCP. Together, our findings indicate that skSlc10a1 is not a physiological bile salt transporter, providing a molecular explanation for the absence of a hepatic Na + -dependent bile salt uptake system in skate. We speculate that Slc10a1 is a neurosteroid transporter in skate that gained its substrate specificity for bile salts later in vertebrate evolution. Copyright © 2017 the American Physiological Society.
Ndong, Landry Biyoghe Bi; Ibondou, Murielle Primaelle; Miao, Zhouwei; Gu, Xiaogang; Lu, Shuguang; Qiu, Zhaofu; Sui, Qian; Mbadinga, Serge Maurice
2014-05-01
Titanium dioxide (TiO2), which is the widely used photo-catalyst, has been synthesized by simple hydrothermal solution containing tetrabutyl titanate and hydrofluoric acid. The synthesized product has been applied to photo-degradation in aqueous phase of chlorinated solvents, namely tetrachloroethene (PCE), trichloroethene (TCE) and 1,1,1-trichloroethane (TCA). The photo-degradation results revealed that the degradation of these harmful chemicals was better in UV/synthesized TiO2 system compared to UV/commercial P25 system and UV only system. The photo-catalytic efficiency of the synthesized TiO2 was 1.4, 1.8 and 3.0 folds higher compared to the commercial P25 for TCA, TCE and PCE degradation, respectively. Moreover, using nitrobenzene (NB) as a probe of hydroxyl radical (·OH), the degradation rate was better over UV/synthesized TiO2, suggesting the high concentration of ·OH generated in UV/synthesized TiO2 system. In addition, ·OH concentration was confirmed by the strong peak displayed in EPR analysis over UV/synthesized TiO2 system. The characterization result using XRD and TEM showed that the synthesized TiO2 was in anatase form and consisted of well-defined sheet-shaped structures having a rectangular outline with a thickness of 4 nm, side length of 50 nm and width of 33 nm and a surface 90.3 m(2)/g. XPS analysis revealed that ≡Ti-F bond was formed on the surface of the synthesized TiO2. The above results on both photocatalytic activity and the surface analysis demonstrated the good applicability of the synthesized TiO2 nano-sheets for the remediation of chlorinated solvent contaminated groundwater. Copyright © 2014 The Research Centre for Eco-Environmental Sciences, Chinese Academy of Sciences. Published by Elsevier B.V. All rights reserved.
Age-Related DNA Methylation Changes and Neoplastic Transformation of the Human Prostate
2011-07-01
Vol. 4 Issue 1 Figure 4. Methylation and expression analysis of the Sprouty1. (A) Representative program traces for Sprouty1. Gray colums represents...5’-ggt acc CCC TCC TGA GCT CAT GGT AAC CT-3’ Fwd 6 (-509) 5’-ggt acc CTT CTG GTT TGG AGC ACA GTG CAA AG-3’ Fwd 5 (-1318) 5’ggt acc AGA AGA CCT...CCC GAG GTG GAT GTT A-3’ Fwd3 (-2025) 5’-ggt acc CTG TCA ATC ACC GGG AGC-3’ Reverse (+8) 5’-gct agc AAT CCG CAC TGA ATA AAT AGT TGA C-3’. For
77 FR 13589 - California Independent System Operator Corporation; Notice of Complaint
Federal Register 2010, 2011, 2012, 2013, 2014
2012-03-07
... revise the standard for a determination of liability or indemnity from an ordinary negligence standard to a gross negligence standard. The Complainant challenges that the TCA would be unjust, unreasonable...
NASA Technical Reports Server (NTRS)
Baughcum, Steven L.; Henderson, Stephen C.
1998-01-01
This report describes the development of a three-dimensional database of aircraft fuel burn and emissions (fuel burned, NOx, CO, and hydrocarbons) from projected fleets of high speed civil transports (HSCTs) on a universal airline network. Inventories for 500 and 1000 HSCT fleets, as well as the concurrent subsonic fleets, were calculated. The HSCT scenarios are calculated using the NASA technology concept airplane (TCA) and update an earlier report. These emissions inventories are available for use by atmospheric scientists conducting the Atmospheric Effects of Stratospheric Aircraft (AESA) modeling studies. Fuel burned and emissions of nitrogen oxides (NOx as NO2), carbon monoxide, and hydrocarbons have been calculated on a 1 degree latitude x 1 degree longitude x 1 kilometer pressure altitude grid and delivered to NASA as electronic files.
Barnes, D C; Owen, M R
2015-07-25
To assess reliability of the mechanical axes stifle angle in dogs positioned for radiography with a neutral stifle (neutral stifle angle (nSA)). To investigate radiographic landmarks for assessment of nSA from a collimated radiographic view. One hundred radiographs were taken of normal stifles belonging to 55 skeletally mature medium and large breed dogs, positioned using a repeatable protocol. Radiographs were widely collimated to include the femoral head and the talus. The angle of Blumensaat's line through the intercondylar fossa relative to the Mechanical Axis of the femur (intercondylar fossa angle, IFA), the angle of inclination of a tibial crest tangent line relative to the Mechanical Axis of the tibia (tibial crest angle, TCA) and the tibial plateau angle (TPA) were recorded. Mean nSA was 133.5°. Mean IFA was 155.5°. TCA had a mean of 6.7°. Estimates for nSA were calculated using mean IFA combined with mean TCA (enSA1), mean TPA (enSA2) and the mechanical axis of the tibia (enSA3). Mean percentage error relative was 2.99 per cent for enSA1, 2.82 per cent for enSA2, 1.67 per cent for enSA3. Blumensaat's line provides a consistent radiological feature for assessment of nSA. Assessment of nSA and correction for values varying from 135° may allow more consistent and accurate measurement of patellar tendon angle for presurgical planning. British Veterinary Association.
Brekke, Eva M F; Walls, Anne B; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula
2012-01-01
The brain is highly susceptible to oxidative injury, and the pentose phosphate pathway (PPP) has been shown to be affected by pathological conditions, such as Alzheimer's disease and traumatic brain injury. While this pathway has been investigated in the intact brain and in astrocytes, little is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-13C]glucose or [3-13C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism of 13C-labeled glucose via the PPP does not appear to contribute to the production of releasable lactate, it contributes to labeling of tricarboxylic acid (TCA) cycle intermediates and related amino acids. Based on glutamate isotopomers, it was calculated that PPP activity accounts for ∼6% of glucose metabolism in cortical neurons and ∼4% in cerebellar neurons. This is the first demonstration that pyruvate generated from glucose via the PPP contributes to the synthesis of acetyl CoA for oxidation in the TCA cycle. Moreover, the fact that 13C labeling from glucose is incorporated into glutamate proves that both the oxidative and the nonoxidative stages of the PPP are active in neurons. PMID:22714050
Huang, Yongshun; Xia, Lihua; Wu, Qifeng; Zeng, Zifang; Huang, Zhenlie; Zhou, Shanyu; Jin, Jiachun; Huang, Hanlin
2015-01-01
We documented previously the entity of trichloroethylene (TCE) hypersensitivity syndrome (THS) in occupational workers. To identify the culprit causative compound, determine the type of hypersensitivity of THS, and establish a screening test for subjects at risk of THS. TCE and its main metabolites chloral hydrate (CH), trichloroethanol (TCOH) and trichloroacetic acid (TCA) were used as allergens at different concentrations in skin patch tests. The study included 19 case subjects diagnosed with occupational THS, 22 control healthy workers exposed to TCE (exposure >12 weeks), and 20 validation new workers exposed to TCE for <12 weeks free of THS. All subjects were followed-up for 12 weeks after the patch test. The highest patch test positive rate in subjects with THS was for CH, followed by TCOH, TCA and TCE. The CH patch test positive rate was 100% irrespective of CH concentrations (15%, 10% and 5%). The TCOH patch test positive rate was concentration-dependent (89.5%, 73.7% and 52.6% for 5%, 0.5% and 0.05%, respectively). Lower patch test positive rates were noted for TCA and TCE. All patch tests (including four allergens) were all negative in each of the 22 control subjects. None of the subjects of the validation group had a positive 15% CH patch test. Chloral hydrate seems to be the culprit causative compound of THS and type IV seems to be the major type of hypersensitivity of THS. The CH patch test could be potentially useful for screening workers at risk of THS.
Smokeless tobacco marketing and sales practices in Appalachian Ohio following federal regulations.
Klein, Elizabeth G; Ferketich, Amy K; Abdel-Rasoul, Mahmoud; Kwan, Mei-Po; Kenda, Loren; Wewers, Mary Ellen
2012-07-01
Smokeless tobacco (ST) use is increasingly prevalent among poor and vulnerable groups, especially rural males. Access to tobacco products, as well as marketing messages, is associated with tobacco usage. In June 2010, the Tobacco Control Act (TCA) marked the beginning of federal regulation of the sale and marketing of tobacco products--including ST. The goal of this study was to describe marketing practices over time and to provide early assessment of the federal regulation in rural tobacco-licensed retail outlets. Observational data were collected from a sample of retail outlets within three Ohio Appalachian counties. From an estimated 300 retail establishments, a stratified random sample was drawn (n = 86). Trained observers surveyed the sales and marketing of tobacco products. Baseline surveys were conducted between November 2009 and May 2010 before the TCA; follow-up surveys were repeated in August 2010. Follow-up surveys were completed for 79 tobacco-licensed retail outlets. The majority of retail outlets were gas stations or convenience stores. Compared with baseline, there was a significant reduction in the frequency of exterior and interior advertisements observed after the TCA (p < .01). Despite the lack of change in the proportion of stores advertising ST, the number of ST brands being advertised doubled between baseline and follow-up. Initial compliance with certain elements of the federal restrictions appears to be high in Appalachian Ohio. The significant increase in ST brands advertised suggests that advertising remains a clear presence in retail outlets in Appalachian Ohio.
Etienne, Audrey; Génard, Michel; Bugaud, Christophe
2015-01-01
Citrate is one of the most important organic acids in many fruits and its concentration plays a critical role in organoleptic properties. The regulation of citrate accumulation throughout fruit development, and the origins of the phenotypic variability of the citrate concentration within fruit species remain to be clarified. In the present study, we developed a process-based model of citrate accumulation based on a simplified representation of the TCA cycle to predict citrate concentration in fruit pulp during the pre- and post-harvest stages. Banana fruit was taken as a reference because it has the particularity of having post-harvest ripening, during which citrate concentration undergoes substantial changes. The model was calibrated and validated on the two stages, using data sets from three contrasting cultivars in terms of citrate accumulation, and incorporated different fruit load, potassium supply, and harvest dates. The model predicted the pre and post-harvest dynamics of citrate concentration with fairly good accuracy for the three cultivars. The model suggested major differences in TCA cycle functioning among cultivars during post-harvest ripening of banana, and pointed to a potential role for NAD-malic enzyme and mitochondrial malate carriers in the genotypic variability of citrate concentration. The sensitivity of citrate accumulation to growth parameters and temperature differed among cultivars during post-harvest ripening. Finally, the model can be used as a conceptual basis to study citrate accumulation in fleshy fruits and may be a powerful tool to improve our understanding of fruit acidity.
Lipid-induced metabolic dysfunction in skeletal muscle.
Muoio, Deborah M; Koves, Timothy R
2007-01-01
Insulin resistance is a hallmark of type 2 diabetes and commonly observed in other energy-stressed settings such as obesity, starvation, inactivity and ageing. Dyslipidaemia and 'lipotoxicity'--tissue accumulation of lipid metabolites-are increasingly recognized as important drivers of insulin resistant states. Mounting evidence suggests that lipid-induced metabolic dysfunction in skeletal muscle is mediated in large part by stress-activated serine kinases that interfere with insulin signal transduction. However, the metabolic and molecular events that connect lipid oversupply to stress kinase activation and glucose intolerance are as yet unclear. Application of transcriptomics and targeted mass spectrometry-based metabolomics tools has led to our finding that insulin resistance is a condition in which muscle mitochondria are persistently burdened with a heavy lipid load. As a result, high rates of beta-oxidation outpace metabolic flux through the TCA cycle, leading to accumulation of incompletely oxidized acyl-carnitine intermediates. In contrast, exercise training enhances mitochondrial performance, favouring tighter coupling between beta-oxidation and the TCA cycle, and concomitantly restores insulin sensitivity in animals fed a chronic high fat diet. The exercise-activated transcriptional co-activator, PGC1alpha, plays a key role in co-ordinating metabolic flux through these two intersecting metabolic pathways, and its suppression by overfeeding may contribute to obesity-associated mitochondrial dysfunction. Our emerging model predicts that muscle insulin resistance arises from mitochondrial lipid stress and a resultant disconnect between beta-oxidation and TCA cycle activity. Understanding this 'disconnect' and its molecular basis may lead to new therapeutic targets for combating metabolic disease.
Smokeless Tobacco Marketing and Sales Practices in Appalachian Ohio Following Federal Regulations
Ferketich, Amy K.; Abdel-Rasoul, Mahmoud; Kwan, Mei-Po; Kenda, Loren; Wewers, Mary Ellen
2012-01-01
Introduction: Smokeless tobacco (ST) use is increasingly prevalent among poor and vulnerable groups, especially rural males. Access to tobacco products, as well as marketing messages, is associated with tobacco usage. In June 2010, the Tobacco Control Act (TCA) marked the beginning of federal regulation of the sale and marketing of tobacco products—including ST. The goal of this study was to describe marketing practices over time and to provide early assessment of the federal regulation in rural tobacco-licensed retail outlets. Methods: Observational data were collected from a sample of retail outlets within three Ohio Appalachian counties. From an estimated 300 retail establishments, a stratified random sample was drawn (n = 86). Trained observers surveyed the sales and marketing of tobacco products. Baseline surveys were conducted between November 2009 and May 2010 before the TCA; follow-up surveys were repeated in August 2010. Results: Follow-up surveys were completed for 79 tobacco-licensed retail outlets. The majority of retail outlets were gas stations or convenience stores. Compared with baseline, there was a significant reduction in the frequency of exterior and interior advertisements observed after the TCA (p < .01). Despite the lack of change in the proportion of stores advertising ST, the number of ST brands being advertised doubled between baseline and follow-up. Conclusion: Initial compliance with certain elements of the federal restrictions appears to be high in Appalachian Ohio. The significant increase in ST brands advertised suggests that advertising remains a clear presence in retail outlets in Appalachian Ohio. PMID:22318692
Zhang, Li-fang; Liu, Ling-sheng; Chu, Xiao-man; Xie, Hao; Cao, Li-juan; Guo, Cen; A, Ji-ye; Cao, Bei; Li, Meng-jie; Wang, Guang-ji; Hao, Hai-ping
2014-01-01
Aim: To investigate the potential interactive effects of a high-fat diet (HFD) and valproic acid (VPA) on hepatic steatosis and hepatotoxicity in rats. Methods: Male SD rats were orally administered VPA (100 or 500 mg·kg−1·d−1) combined with HFD or a standard diet for 8 weeks. Blood and liver samples were analyzed to determine lipid levels and hepatic function biomarkers using commercial kit assays. Low-molecular-weight compounds in serum, urine and bile samples were analyzed using a metabonomic approach based on GC/TOF-MS. Results: HFD alone induced extensive hepatocyte steatosis and edema in rats, while VPA alone did not cause significant liver lesions. VPA significantly aggravated HFD-induced accumulation of liver lipids, and caused additional spotty or piecemeal necrosis, accompanied by moderate infiltration of inflammatory cells in the liver. Metabonomic analysis of serum, urine and bile samples revealed that HFD significantly increased the levels of amino acids, free fatty acids (FFAs) and 3-hydroxy-butanoic acid, whereas VPA markedly decreased the levels of amino acids, FFAs and the intermediate products of the tricarboxylic acid cycle (TCA) compared with the control group. HFD aggravated VPA-induced inhibition on lipid and amino acid metabolism. Conclusion: HFD magnifies VPA-induced impairment of mitochondrial β-oxidation of FFAs and TCA, thereby increases hepatic steatosis and hepatotoxicity. The results suggest the patients receiving VPA treatment should be advised to avoid eating HFD. PMID:24442146
Mujahid, Md; Prasuna, M Lakshmi; Sasikala, Ch; Ramana, Ch Venkata
2015-02-06
Aromatic amines are widely distributed in the environment and are major environmental pollutants. Although degradation of aromatic amines is well studied in bacteria, physiological adaptations and stress response to these toxic compounds is not yet fully understood. In the present study, systemic responses of Rubrivivax benzoatilyticus JA2 to aniline stress were deciphered using metabolite and iTRAQ-labeled protein profiling. Strain JA2 tolerated high concentrations of aniline (30 mM) with trace amounts of aniline being transformed to acetanilide. GC-MS metabolite profiling revealed aniline stress phenotype wherein amino acid, carbohydrate, fatty acid, nitrogen metabolisms, and TCA (tricarboxylic acid cycle) were modulated. Strain JA2 responded to aniline by remodeling the proteome, and cellular functions, such as signaling, transcription, translation, stress tolerance, transport and carbohydrate metabolism, were highly modulated. Key adaptive responses, such as transcription/translational changes, molecular chaperones to control protein folding, and efflux pumps implicated in solvent extrusion, were induced in response to aniline stress. Proteo-metabolomics indicated extensive rewiring of metabolism to aniline. TCA cycle and amino acid catabolism were down-regulated while gluconeogenesis and pentose phosphate pathways were up-regulated, leading to the synthesis of extracellular polymeric substances. Furthermore, increased saturated fatty acid ratios in membranes due to aniline stress suggest membrane adaptation. The present study thus indicates that strain JA2 employs multilayered responses: stress response, toxic compound tolerance, energy conservation, and metabolic rearrangements to aniline.
Metabolic sensor governing bacterial virulence in Staphylococcus aureus.
Ding, Yue; Liu, Xing; Chen, Feifei; Di, Hongxia; Xu, Bin; Zhou, Lu; Deng, Xin; Wu, Min; Yang, Cai-Guang; Lan, Lefu
2014-11-18
An effective metabolism is essential to all living organisms, including the important human pathogen Staphylococcus aureus. To establish successful infection, S. aureus must scavenge nutrients and coordinate its metabolism for proliferation. Meanwhile, it also must produce an array of virulence factors to interfere with host defenses. However, the ways in which S. aureus ties its metabolic state to its virulence regulation remain largely unknown. Here we show that citrate, the first intermediate of the tricarboxylic acid (TCA) cycle, binds to and activates the catabolite control protein E (CcpE) of S. aureus. Using structural and site-directed mutagenesis studies, we demonstrate that two arginine residues (Arg145 and Arg256) within the putative inducer-binding cavity of CcpE are important for its allosteric activation by citrate. Microarray analysis reveals that CcpE tunes the expression of 126 genes that comprise about 4.7% of the S. aureus genome. Intriguingly, although CcpE is a major positive regulator of the TCA-cycle activity, its regulon consists predominantly of genes involved in the pathogenesis of S. aureus. Moreover, inactivation of CcpE results in increased staphyloxanthin production, improved ability to acquire iron, increased resistance to whole-blood-mediated killing, and enhanced bacterial virulence in a mouse model of systemic infection. This study reveals CcpE as an important metabolic sensor that allows S. aureus to sense and adjust its metabolic state and subsequently to coordinate the expression of virulence factors and bacterial virulence.
Mesquita, Rosilene Oliveira; de Almeida Soares, Eduardo; de Barros, Everaldo Gonçalves; Loureiro, Marcelo Ehlers
2012-01-01
The most critical step in any proteomic study is protein extraction and sample preparation. Better solubilization increases the separation and resolution of gels, allowing identification of a higher number of proteins and more accurate quantitation of differences in gene expression. Despite the existence of published results for the optimization of proteomic analyses of soybean seeds, no comparable data are available for proteomic studies of soybean leaf tissue. In this work we have tested the effects of modification of a TCA-acetone method on the resolution of 2-DE gels of leaves and roots of soybean. Better focusing was obtained when both mercaptoethanol and dithiothreitol were used in the extraction buffer simultaneously. Increasing the number of washes of TCA precipitated protein with acetone, using a final wash with 80% ethanol and using sonication to ressuspend the pellet increased the number of detected proteins as well the resolution of the 2-DE gels. Using this approach we have constructed a soybean protein map. The major group of identified proteins corresponded to genes of unknown function. The second and third most abundant groups of proteins were composed of photosynthesis and metabolism related genes. The resulting protocol improved protein solubility and gel resolution allowing the identification of 122 soybean leaf proteins, 72 of which were not detected in other published soybean leaf 2-DE gel datasets, including a transcription factor and several signaling proteins. PMID:22802721
2009-07-07
ISS020-E-017812 (7 July 2009) --- Japan Aerospace Exploration Agency (JAXA) astronaut Koichi Wakata, Expedition 20 flight engineer, works with the Fluid Control Pump Assembly (FCPA) in the Kibo laboratory on the International Space Station.
Song, Jun; Braun, Gordon; Bevis, Eric; Doncaster, Kristen
2006-08-01
Fruit tissues are considered recalcitrant plant tissue for proteomic analysis. Three phenol-free protein extraction procedures for 2-DE were compared and evaluated on apple fruit proteins. Incorporation of hot SDS buffer, extraction with TCA/acetone precipitation was found to be the most effective protocol. The results from SDS-PAGE and 2-DE analysis showed high quality proteins. More than 500 apple polypeptides were separated on a small scale 2-DE gel. The successful protocol was further tested on banana fruit, in which 504 and 386 proteins were detected in peel and flesh tissues, respectively. To demonstrate the quality of the extracted proteins, several protein spots from apple and banana peels were cut from 2-DE gels, analyzed by MS and have been tentatively identified. The protocol described in this study is a simple procedure which could be routinely used in proteomic studies of many types of recalcitrant fruit tissues.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cline, Gary W., E-mail: gary.cline@yale.edu; Department of Surgery, University of Minnesota-Twin Cities, Minneapolis, MN 55455; Pongratz, Rebecca L.
Highlights: Black-Right-Pointing-Pointer We studied media effects on mechanisms of insulin secretion of INS-1 cells. Black-Right-Pointing-Pointer Insulin secretion was higher in DMEM than KRB despite identical ATP synthesis rates. Black-Right-Pointing-Pointer Insulin secretion rates correlated with rates of anaplerosis and TCA cycle. Black-Right-Pointing-Pointer Mitochondria metabolism and substrate cycles augment secretion signal of ATP. -- Abstract: Mechanistic models of glucose stimulated insulin secretion (GSIS) established in minimal media in vitro, may not accurately describe the complexity of coupling metabolism with insulin secretion that occurs in vivo. As a first approximation, we have evaluated metabolic pathways in a typical growth media, DMEM as amore » surrogate in vivo medium, for comparison to metabolic fluxes observed under the typical experimental conditions using the simple salt-buffer of KRB. Changes in metabolism in response to glucose and amino acids and coupling to insulin secretion were measured in INS-1 832/13 cells. Media effects on mitochondrial function and the coupling efficiency of oxidative phosphorylation were determined by fluorometrically measured oxygen consumption rates (OCRs) combined with {sup 31}P NMR measured rates of ATP synthesis. Substrate preferences and pathways into the TCA cycle, and the synthesis of mitochondrial 2nd messengers by anaplerosis were determined by {sup 13}C NMR isotopomer analysis of the fate of [U-{sup 13}C] glucose metabolism. Despite similar incremental increases in insulin secretion, the changes of OCR in response to increasing glucose from 2.5 to 15 mM were blunted in DMEM relative to KRB. Basal and stimulated rates of insulin secretion rates were consistently higher in DMEM, while ATP synthesis rates were identical in both DMEM and KRB, suggesting greater mitochondrial uncoupling in DMEM. The relative rates of anaplerosis, and hence synthesis and export of 2nd messengers from the mitochondria were found to be similar in DMEM to those in KRB. And, the correlation of total PC flux with insulin secretion rates in DMEM was found to be congruous with the correlation in KRB. Together, these results suggest that signaling mechanisms associated with both TCA cycle flux and with anaplerotic flux, but not ATP production, may be responsible for the enhanced rates of insulin secretion in more complex, and physiologically-relevant media.« less
Wan, Wenting; Li, Hongxiang; Xiang, Jiamei; Yi, Fan; Xu, Lijia; Jiang, Baoping; Xiao, Peigen
2018-01-01
Maca ( Lepidium meyenii Walpers) has been used as a dietary supplement and ethnomedicine for centuries. Recently, maca has become a high profile functional food worldwide because of its multiple biological activities. This study is the first explorative research to investigate the prevention and amelioration capacity of the aqueous extract of black maca (AEM) on high-fat, high-fructose diet (HFD)-induced metabolism disorder in golden hamsters and to identify the potential mechanisms involved in these effects. For 20 weeks, 6-week-old male golden hamsters were fed the following respective diets: (1) a standard diet, (2) HFD, (3) HFD supplemented with metformin, or (4) HFD supplemented with three doses of AEM (300, 600, or 1,200 mg/kg). After 20 weeks, the golden hamsters that received daily AEM supplementation presented with the beneficial effects of improved hyperlipidemia, hyperinsulinemia, insulin resistance, and hepatic steatosis in vivo . Based on the hepatic metabolomic analysis results, alterations in metabolites associated with pathological changes were examined. A total of 194 identified metabolites were mapped to 46 relative metabolic pathways, including those of energy metabolism. In addition, via in silico profiling for secondary maca metabolites by a joint pharmacophore- and structure-based approach, a compound-target-disease network was established. The results revealed that 32 bioactive compounds in maca targeted 16 proteins involved in metabolism disorder. Considering the combined metabolomics and virtual screening results, we employed quantitative real-time PCR assays to verify the gene expression of key enzymes in the relevant pathways. AEM promoted glycolysis and inhibited gluconeogenesis via regulating the expression of key genes such as Gck and Pfkm . Moreover, AEM upregulated tricarboxylic acid (TCA) cycle flux by changing the concentrations of intermediates and increasing the mRNA levels of Aco2 , Fh , and Mdh2 . In addition, the lipid-lowering effects of AEM in boththe serum and liver may be partly related to PPARα signaling activation, including enhanced fatty acid β-oxidation and lipogenesis pathway inhibition. Together, our data demonstrated that AEM intervention significantly improved lipid and glucose metabolism disorder by regulating the glycolysis/gluconeogenesis-TCA cycle and by modulating gene expression levels involved in the PPARα signaling pathway.
Bérard, Anick; Zhao, Jin-Ping; Sheehy, Odile
2017-01-01
Objective Antidepressant use during gestation has been associated with risk of major congenital malformations but estimates can lack statistical power or be confounded by maternal depression. We aimed to determine the association between first-trimester exposure to antidepressants and the risk of major congenital malformations in a cohort of depressed/anxious women. Setting and participants Data were obtained from the Quebec Pregnancy Cohort (QPC). All pregnancies with a diagnosis of depression or anxiety, or exposed to antidepressants in the 12 months before pregnancy, and ending with a live-born singleton were included. Outcome measures Antidepressant classes (selective serotonin reuptake inhibitors (SSRI), serotonin–norepinephrine reuptake inhibitors (SNRI), tricyclic antidepressants (TCA) and other antidepressants) and types were individually compared with non-exposure during the first trimester (depressed untreated). Major congenital malformations overall and organ-specific malformations in the first year of life were identified. Results 18 487 pregnant women were included. When looking at the specific types of antidepressant used during the first trimester, only citalopram was increasing the risk of major congenital malformations (adjusted OR, (aOR) 1.36, 95% CI 1.08 to 1.73; 88 exposed cases), although there was a trend towards increased risk for the most frequently used antidepressants. Antidepressants with serotonin reuptake inhibition effect (SSRI, SNRI, amitriptyline (the most used TCA)) increased the risk of certain organ-specific defects: paroxetine increased the risk of cardiac defects (aOR 1.45, 95% CI 1.12 to 1.88), and ventricular/atrial septal defects (aOR 1.39, 95% CI 1.00 to 1.93); citalopram increased the risk of musculoskeletal defects (aOR 1.92, 95% CI 1.40 to 2.62), and craniosynostosis (aOR 3.95, 95% CI 2.08 to 7.52); TCA was associated with eye, ear, face and neck defects (aOR 2.45, 95% CI 1.05 to 5.72), and digestive defects (aOR 2.55, 95% CI 1.40 to 4.66); and venlafaxine was associated with respiratory defects (aOR 2.17, 95% CI 1.07 to 4.38). Conclusions Antidepressants with effects on serotonin reuptake during embryogenesis increased the risk of some organ-specific malformations in a cohort of pregnant women with depression. PMID:28082367
Wan, Wenting; Li, Hongxiang; Xiang, Jiamei; Yi, Fan; Xu, Lijia; Jiang, Baoping; Xiao, Peigen
2018-01-01
Maca (Lepidium meyenii Walpers) has been used as a dietary supplement and ethnomedicine for centuries. Recently, maca has become a high profile functional food worldwide because of its multiple biological activities. This study is the first explorative research to investigate the prevention and amelioration capacity of the aqueous extract of black maca (AEM) on high-fat, high-fructose diet (HFD)-induced metabolism disorder in golden hamsters and to identify the potential mechanisms involved in these effects. For 20 weeks, 6-week-old male golden hamsters were fed the following respective diets: (1) a standard diet, (2) HFD, (3) HFD supplemented with metformin, or (4) HFD supplemented with three doses of AEM (300, 600, or 1,200 mg/kg). After 20 weeks, the golden hamsters that received daily AEM supplementation presented with the beneficial effects of improved hyperlipidemia, hyperinsulinemia, insulin resistance, and hepatic steatosis in vivo. Based on the hepatic metabolomic analysis results, alterations in metabolites associated with pathological changes were examined. A total of 194 identified metabolites were mapped to 46 relative metabolic pathways, including those of energy metabolism. In addition, via in silico profiling for secondary maca metabolites by a joint pharmacophore- and structure-based approach, a compound-target-disease network was established. The results revealed that 32 bioactive compounds in maca targeted 16 proteins involved in metabolism disorder. Considering the combined metabolomics and virtual screening results, we employed quantitative real-time PCR assays to verify the gene expression of key enzymes in the relevant pathways. AEM promoted glycolysis and inhibited gluconeogenesis via regulating the expression of key genes such as Gck and Pfkm. Moreover, AEM upregulated tricarboxylic acid (TCA) cycle flux by changing the concentrations of intermediates and increasing the mRNA levels of Aco2, Fh, and Mdh2. In addition, the lipid-lowering effects of AEM in boththe serum and liver may be partly related to PPARα signaling activation, including enhanced fatty acid β-oxidation and lipogenesis pathway inhibition. Together, our data demonstrated that AEM intervention significantly improved lipid and glucose metabolism disorder by regulating the glycolysis/gluconeogenesis-TCA cycle and by modulating gene expression levels involved in the PPARα signaling pathway. PMID:29681858
Protein-protein interactions and metabolite channelling in the plant tricarboxylic acid cycle
Zhang, Youjun; Beard, Katherine F. M.; Swart, Corné; Bergmann, Susan; Krahnert, Ina; Nikoloski, Zoran; Graf, Alexander; Ratcliffe, R. George; Sweetlove, Lee J.; Fernie, Alisdair R.; Obata, Toshihiro
2017-01-01
Protein complexes of sequential metabolic enzymes, often termed metabolons, may permit direct channelling of metabolites between the enzymes, providing increased control over metabolic pathway fluxes. Experimental evidence supporting their existence in vivo remains fragmentary. In the present study, we test binary interactions of the proteins constituting the plant tricarboxylic acid (TCA) cycle. We integrate (semi-)quantitative results from affinity purification-mass spectrometry, split-luciferase and yeast-two-hybrid assays to generate a single reliability score for assessing protein–protein interactions. By this approach, we identify 158 interactions including those between catalytic subunits of sequential enzymes and between subunits of enzymes mediating non-adjacent reactions. We reveal channelling of citrate and fumarate in isolated potato mitochondria by isotope dilution experiments. These results provide evidence for a functional TCA cycle metabolon in plants, which we discuss in the context of contemporary understanding of this pathway in other kingdoms. PMID:28508886
Stenquist, Monika; Juhlin, Claes; Aström, Gunnar; Friberg, Ulla
2003-04-24
A fourth branchial pouch sinus is a rare congenital anomaly, which in a 13-year-old girl presented clinically as recurrent deep cervical abscesses. The location of the majority of these anomalies is the left side of the neck (90%). Radiological and endoscopic investigations verified the diagnosis. The internal orifice located at the apex of the pyriform sinus could facilitate contamination by infectious pharyngeal secretions and lead to abscess recurrence. Traditionally, the recommended treatment is radical surgery. It can, however, be technically difficult to excise the whole fistula tract. In this patient we used a non-invasive treatment modality; chemocauterization with 40% trichloroacetic acid (TCA). After three treatments the fistula was closed. To date (month no. 15) there has been no abscess recurrence. TCA chemocauterization seems to be a safe first-line treatment for patients with pyriform sinus fistulas.
A new MicroTCA-based waveform digitizer for the Muon g-2 experiment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sweigart, David A.
We present the design of a newmore » $$\\mu$$TCA-based waveform digitizer, which will be deployed in the Muon g-2 experiment at Fermilab and will allow our pileup identification requirement to be met. This digitizer features five independent channels, each with 12-bit, 800-MSPS digitization and a 1-Gbit memory buffer. The data storage and readout along with configuration are handled by six Xilinx Kintex-7 FPGAs. In addition, the digitizer is equipped with a mezzanine card for analog signal conditioning prior to digitization, further widening its range of possible applications. The performance results of this design are also presented, highlighting its $$0.51 \\pm 0.13$$ mV intrinsic noise level and $< 22$ ps intrinsic timing resolution between channels. We believe that its performance, together with its flexible design, could be of interest to future experiments in search of a cost-effective waveform digitizer.« less
Physical properties of ambient and laboratory-generated secondary organic aerosol
NASA Astrophysics Data System (ADS)
O'Brien, Rachel E.; Neu, Alexander; Epstein, Scott A.; MacMillan, Amanda C.; Wang, Bingbing; Kelly, Stephen T.; Nizkorodov, Sergey A.; Laskin, Alexander; Moffet, Ryan C.; Gilles, Mary K.
2014-06-01
The size and thickness of organic aerosol particles collected by impaction in five field campaigns were compared to those of laboratory-generated secondary organic aerosols (SOA). Scanning transmission X-ray microscopy was used to measure the total carbon absorbance (TCA) by individual particles as a function of their projection areas on the substrate. Particles with higher viscosity/surface tension can be identified by a steeper slope on a plot of TCA versus size because they flatten less upon impaction. The slopes of the ambient data are statistically similar indicating a small range of average viscosities/surface tensions across five field campaigns. Steeper slopes were observed for the plots corresponding to ambient particles, while smaller slopes were indicative of the laboratory-generated SOA. This comparison indicates that ambient organic particles have higher viscosities/surface tensions than those typically generated in laboratory SOA studies.
Bal, C; Büyükşekerci, M; Koca, C; Ağış, E R; Erdoğan, S; Baran, P; Gündüzöz, M; Yilmaz, Öh
2016-09-01
In this study, we aimed to investigate disulfide/thiol homeostasis in trichloroethylene (TCE) exposure. The study was carried out in 30 nonsmoker TCE-exposed workers with a variety of occupations. Additionally, 30 healthy nonsmoker volunteers were recruited as the control group. TCE exposure was determined by measuring urinary trichloroacetic acid (TCA) concentration. Median urinary TCA levels of exposed workers (20.5 mg/L) were significantly higher than control subjects (5 mg/L). Thiol and disulfide concentrations were determined using a novel automated method. Disulfide/thiol ratio was significantly higher in the exposed group (p < 0.001). Thiol/disulfide homeostasis was found to be disturbed in TCE-exposed workers. We predict that in TCE-exposed workers this disturbance can be a therapeutic target, and the efficiency of the treatment can easily be monitored by the novel method we used. © The Author(s) 2015.
Keohane, Colleen E; Steele, Andrew D; Fetzer, Christian; Khowsathit, Jittasak; Van Tyne, Daria; Moynié, Lucile; Gilmore, Michael S; Karanicolas, John; Sieber, Stephan A; Wuest, William M
2018-02-07
Natural products have served as an inspiration to scientists both for their complex three-dimensional architecture and exquisite biological activity. Promysalin is one such Pseudomonad secondary metabolite that exhibits narrow-spectrum antibacterial activity, originally isolated from the rhizosphere. We herein utilize affinity-based protein profiling (AfBPP) to identify succinate dehydrogenase (Sdh) as the biological target of the natural product. The target was further validated in silico, in vitro, in vivo, and through the selection, and sequencing, of a resistant mutant. Succinate dehydrogenase plays an essential role in primary metabolism of Pseudomonas aeruginosa as the only enzyme that is involved both in the tricarboxylic acid cycle (TCA) and in respiration via the electron transport chain. These findings add credence to other studies that suggest that the TCA cycle is an understudied target in the development of novel therapeutics to combat P. aeruginosa, a significant pathogen in clinical settings.
SbnG, a Citrate Synthase in Staphylococcus aureus
Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.; Heinrichs, David E.; Murphy, Michael E. P.
2014-01-01
In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. We present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic gene clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. A structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production. PMID:25336653
Kuang, Ye; Han, Xiaoyun; Xu, Mu; Wang, Yue; Zhao, Yuxiang; Yang, Qing
2018-05-31
Chemical injury is partly due to free radical lipid peroxidation, which can induce oxidative stress and produce a large number of reactive oxygen species (ROS). Oxaloacetic acid is an important intermediary in the tricarboxylic acid cycle (TCA cycle) and participates in metabolism and energy production. In our study, we found that oxaloacetate (OA) effectively alleviated liver injury which was induced by hydrogen peroxide (H₂O₂) in vitro and carbon tetrachloride (CCl₄) in vivo. OA scavenged ROS, prevented oxidative damage and maintained the normal structure of mitochondria. We further confirmed that OA increased adenosine triphosphate (ATP) by promoting the TCA production cycle and oxidative phosphorylation (OXPHOS). Finally, OA inhibited the mitogen-activated protein kinase (MAPK) and apoptotic pathways by suppressing tumor necrosis factor-α (TNF-α). Our findings reveal a mechanism for OA ameliorating chemical liver injury and suggest a possible implementation for preventing the chemical liver injury.
Springsteen, Greg; Yerabolu, Jayasudhan Reddy; Nelson, Julia; Rhea, Chandler Joel; Krishnamurthy, Ramanarayanan
2018-01-08
The development of metabolic approaches towards understanding the origins of life, which have focused mainly on the citric acid (TCA) cycle, have languished-primarily due to a lack of experimentally demonstrable and sustainable cycle(s) of reactions. We show here the existence of a protometabolic analog of the TCA involving two linked cycles, which convert glyoxylate into CO 2 and produce aspartic acid in the presence of ammonia. The reactions proceed from either pyruvate, oxaloacetate or malonate in the presence of glyoxylate as the carbon source and hydrogen peroxide as the oxidant under neutral aqueous conditions and at mild temperatures. The reaction pathway demonstrates turnover under controlled conditions. These results indicate that simpler versions of metabolic cycles could have emerged under potential prebiotic conditions, laying the foundation for the appearance of more sophisticated metabolic pathways once control by (polymeric) catalysts became available.
HYBRID SULFUR PROCESS REFERENCE DESIGN AND COST ANALYSIS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gorensek, M.; Summers, W.; Boltrunis, C.
2009-05-12
This report documents a detailed study to determine the expected efficiency and product costs for producing hydrogen via water-splitting using energy from an advanced nuclear reactor. It was determined that the overall efficiency from nuclear heat to hydrogen is high, and the cost of hydrogen is competitive under a high energy cost scenario. It would require over 40% more nuclear energy to generate an equivalent amount of hydrogen using conventional water-cooled nuclear reactors combined with water electrolysis compared to the proposed plant design described herein. There is a great deal of interest worldwide in reducing dependence on fossil fuels, whilemore » also minimizing the impact of the energy sector on global climate change. One potential opportunity to contribute to this effort is to replace the use of fossil fuels for hydrogen production by the use of water-splitting powered by nuclear energy. Hydrogen production is required for fertilizer (e.g. ammonia) production, oil refining, synfuels production, and other important industrial applications. It is typically produced by reacting natural gas, naphtha or coal with steam, which consumes significant amounts of energy and produces carbon dioxide as a byproduct. In the future, hydrogen could also be used as a transportation fuel, replacing petroleum. New processes are being developed that would permit hydrogen to be produced from water using only heat or a combination of heat and electricity produced by advanced, high temperature nuclear reactors. The U.S. Department of Energy (DOE) is developing these processes under a program known as the Nuclear Hydrogen Initiative (NHI). The Republic of South Africa (RSA) also is interested in developing advanced high temperature nuclear reactors and related chemical processes that could produce hydrogen fuel via water-splitting. This report focuses on the analysis of a nuclear hydrogen production system that combines the Pebble Bed Modular Reactor (PBMR), under development by PBMR (Pty.) Ltd. in the RSA, with the Hybrid Sulfur (HyS) Process, under development by the Savannah River National Laboratory (SRNL) in the US as part of the NHI. This work was performed by SRNL, Westinghouse Electric Company, Shaw, PBMR (Pty) Ltd., and Technology Insights under a Technical Consulting Agreement (TCA). Westinghouse Electric, serving as the lead for the PBMR process heat application team, established a cost-shared TCA with SRNL to prepare an updated HyS thermochemical water-splitting process flowsheet, a nuclear hydrogen plant preconceptual design and a cost estimate, including the cost of hydrogen production. SRNL was funded by DOE under the NHI program, and the Westinghouse team was self-funded. The results of this work are presented in this Final Report. Appendices have been attached to provide a detailed source of information in order to document the work under the TCA contract.« less
Serum ionized calcium in dogs with chronic renal failure and metabolic acidosis.
Kogika, Marcia M; Lustoza, Marcio D; Notomi, Marcia K; Wirthl, Vera A B F; Mirandola, Regina M S; Hagiwara, Mitika K
2006-12-01
Chronic renal failure (CRF) is a common disease in dogs, and many metabolic disorders can be observed, including metabolic acidosis and calcium and phosphorus disturbances. Acidosis may change the ionized calcium (i-Ca) fraction, usually increasing its concentration. In this study we evaluated the influence of acidosis on the serum concentration of i-Ca in dogs with CRF and metabolic acidosis. Dogs were studied in 2 groups: group I (control group = 40 clinically normal dogs) and group II (25 dogs with CRF and metabolic acidosis). Serum i-Ca was measured by an ion-selective electrode method; other biochemical analytes were measured using routine methods. The i-Ca concentration was significantly lower in dogs in group II than in group I; 56% of the dogs in group II were hypocalcemic. Hypocalcemia was observed in only 8% of dogs in group II when based on total calcium (t-Ca) concentration. No correlation between pH and i-Ca concentration was observed. A slight but significant correlation was detected between i-Ca and serum phosphorus concentration (r = -.284; P = .022), as well as between serum t-Ca and i-Ca concentration (r = .497; P < .0001). The i-Ca concentration in dogs with CRF and metabolic acidosis varied widely from that of t-Ca, showing the importance of determining the biologically active form of calcium. Metabolic acidosis did not influence the increase in i-Ca concentration, so other factors besides acidosis in CRF might alter the i-Ca fraction, such as hyperphosphatemia and other compounds that may form complexes with calcium.
IL-17A Synergistically Enhances Bile Acid–Induced Inflammation during Obstructive Cholestasis
O'Brien, Kate M.; Allen, Katryn M.; Rockwell, Cheryl E.; Towery, Keara; Luyendyk, James P.; Copple, Bryan L.
2014-01-01
During obstructive cholestasis, increased concentrations of bile acids activate ERK1/2 in hepatocytes, which up-regulates early growth response factor 1, a key regulator of proinflammatory cytokines, such as macrophage inflammatory protein 2 (MIP-2), which, in turn, exacerbates cholestatic liver injury. Recent studies have indicated that IL-17A contributes to hepatic inflammation during obstructive cholestasis, suggesting that bile acids and IL-17A may interact to regulate hepatic inflammatory responses. We treated mice with an IL-17A neutralizing antibody or control IgG and subjected them to bile duct ligation. Neutralization of IL-17A prevented up-regulation of proinflammatory cytokines, hepatic neutrophil accumulation, and liver injury, indicating an important role for IL-17A in neutrophilic inflammation during cholestasis. Treatment of primary mouse hepatocytes with taurocholic acid (TCA) increased the expression of MIP-2. Co-treatment with IL-17A synergistically enhanced up-regulation of MIP-2 by TCA. In contrast to MIP-2, IL-17A did not affect up-regulation of Egr-1 by TCA, indicating that IL-17A does not affect bile acid–induced activation of signaling pathways upstream of early growth response factor 1. In addition, bile acids increased expression of IL-23, a key regulator of IL-17A production in hepatocytes in vitro and in vivo. Collectively, these data identify bile acids as novel triggers of the IL-23/IL-17A axis and suggest that IL-17A promotes hepatic inflammation during cholestasis by synergistically enhancing bile acid–induced production of proinflammatory cytokines by hepatocytes. PMID:24012680
Rolle-Kampczyk, Ulrike Elisabeth; Rehwagen, Martina; Franck, Ulrich; Weiss, Holger; Krumbiegel, Peter; Herbarth, Olf
2006-04-10
The classical way to demonstrate the efficiency of remediation is measuring the reduction of toxic compounds in the environment. Nevertheless, more important is the risk reduction in human health. To determine changing health effects, exposure and bio-effects have to be monitored at time of and during remediation. Kindergarten children from a heavily polluted industrial (n=23) and a control area (n=12) were investigated. The region-specific outdoor and indoor exposure [27 volatile organic compounds (VOC), emphasis on tri- and tetrachloroethylene (TRI, TETRA)], the internal load [(trichloroacetic acid-TCA-as urine metabolites of TRI and TETRA and S-phenyl- and S-benzylmercapturic acid (SPMA and SBMA) as metabolites of benzene and toluene], and biological effect assessment ([(15)N]methacetin test-a non-invasive stable isotope test to determine the unspecific liver detoxification capacity of an individual) were measured twice a year during 2 years of remediation (1997/1998). It could be shown that in- and outdoor levels of TRI and TETRA decreased by 47% in the heavily polluted village, Greppin, while the levels remained much the same in the control village, Roitzsch. This trend was reflected in the decreasing elimination of TCA in the urine (41%) by the Greppin children, with no differences in the TCA elimination in Roitzsch probands. As the remediation efforts decreased the burden of exposure, the children's liver detoxification capacity improved as well. Combining different methods, such as exposure-effect (external and internal loads) and bio-effect monitoring, proved to be useful to assess remediation successes including the improvement in human health.
Cusack, Lara; Rivera, Sam; Lock, Brad; Benboe, Daniel; Brothers, David; Divers, Stephen
2017-12-01
The importance of vitamin D 3 has been documented in multiple reptile species, with deficiencies resulting in alterations in calcium homeostasis, including nutritional secondary hyperparathyroidism. Though vitamin D 3 can be obtained directly from dietary sources or from photobiosynthetic production, species variability in diet and behavior makes exposure to ultraviolet B (UVB) radiation an essential requirement for some diurnal species. The effect of different bulbs to promote synthesis of cholecalciferol (vitamin D 3 ) in the bearded dragon ( Pogona vitticeps) was evaluated. Individual animals ( n = 5 for each group) were exposed to industry standard fluorescent bulbs (UVB), non-UVB producing bulbs (UVBN), and light-emitting diode (LED) UVB (LED) bulbs for a period of 11 mo. Weekly measurements of UV index (UVI) were recorded for each bulb. Plasma vitamin D 3 , 25-hydroxycholecalciferol (25OHD 3 ), ionized calcium (iCa), total calcium (TCa), and phosphorus (P) were measured at time zero and at 4 mo, 8 mo, and 11 mo. Parameters were measured between groups and time points. There were decreases ( P < 0.05) with time for iCa for the LED and UVB groups, for TCa in the UVB group, and for vitamin D 3 in the LED and UVBN groups. There were no significant differences between study groups for vitamin D 3 , iCa, TCa, or P . Overall plasma concentration for 25OHD 3 in the LED group was greater than for the UVB ( P = 0.0347) and the UVBN ( P = 0.0490) groups.
Guo, Yaxiao; Meng, Lei; Zhang, Yanhao; Tang, Wei; Zhang, Wenfen; Xia, Yan; Ban, Fuguo; Wu, Ningpeng; Zhang, Shusheng
2013-12-30
This paper described the preparation and application of a new dimethylethanolamine aminated polychloromethyl styrene nano-latex (DMEAPL) coated capillary column (ccc-DMEAPL) in the determination of four tetracycline antibiotics (TCA) including tetracycline (TC), oxytetracycline (OTC), doxycycline (DC) and chlorotetracycline (CTC) in pig plasma. The ccc-DMEAPL column was characterized with steady EOF values of ca. 1.5-5.2×10(-5)cm(2)/Vs at pH 1.8-6.3. The optimized conditions for field-amplified sample stacking open-tubular capillary electrochromatography (FASS-OT-CEC) were as following: background electrolyte, 10mmol/L Na2HPO4+15mmol/L citric acid (pH 3.2); ccc-DMEAPL, 50μm i.d.×50cm (effective length 41.5cm), separation voltage, 18kV; column temperature, 25°C; UV detection wavelength, 270nm; water-plug injection: 30mbar×10s; sample electrokinetic injection, 10kV×20s. The four TCA were extracted with the solution of 10mmol/L Na2HPO4+15mmol/L citric acid+4g/L EDTA-2Na (pH 3.2). The FASS-OT-CEC method was validated in terms of linearity, sensitivity, selectivity, precision and accuracy. The LODs ranged from 3 to 7ng/mL, the recoveries for the four TCA were all more than 80%. The developed method was successfully applied for the determination of TCs in the actual pig plasma samples. Copyright © 2013 Elsevier B.V. All rights reserved.
The odd-carbon medium-chain fatty triglyceride triheptanoin does not reduce hepatic steatosis.
Comhair, Tine M; Garcia Caraballo, Sonia C; Dejong, Cornelis H C; Lamers, Wouter H; Koehler, S Eleonore
2017-02-01
Non-alcoholic fatty-liver disease (NAFLD) is the hepatic manifestation of the metabolic syndrome. Previously, we showed that a high-protein diet minimized diet-induced development of fatty liver and even reversed pre-existing steatosis. A high-protein diet leads to amino-acid catabolism, which in turn causes anaplerosis of the tricarboxylic-acid (TCA) cycle. Therefore, we hypothesized that anaplerosis of the TCA cycle could be responsible for the high-protein diet-induced improvement of NAFLD by channeling amino acids into the TCA cycle. Next we considered that an efficient anaplerotic agent, the odd-carbon medium-chain triglyceride triheptanoin (TH), might have similar beneficial effects. C57BL/6J mice were fed low-fat (8en%) or high-fat (42en%) oleate-containing diets with or without 15en% TH for 3 weeks. TH treatment enhanced the hepatic capacity for fatty-acid oxidation by a selective increase in hepatic Ppara, Acox, and Cd36 expression, and a decline in plasma acetyl-carnitines. It also induced pyruvate cycling through an increased hepatic PCK1 protein concentration and it increased thermogenesis reflected by an increased Ucp2 mRNA content. TH, however, did not reduce hepatic lipid content. The comparison of the present effects of dietary triheptanoin with a previous study by our group on protein supplementation shows that the beneficial effects of the high-protein diet are not mimicked by TH. This argues against anaplerosis as the sole explanatory mechanism for the anti-steatotic effect of a high-protein diet. Copyright © 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.
Huang, Yongshun; Xia, Lihua; Wu, Qifeng; Zeng, Zifang; Huang, Zhenlie; Zhou, Shanyu; Jin, Jiachun; Huang, Hanlin
2015-01-01
Background We documented previously the entity of trichloroethylene (TCE) hypersensitivity syndrome (THS) in occupational workers. Objectives To identify the culprit causative compound, determine the type of hypersensitivity of THS, and establish a screening test for subjects at risk of THS. Methods TCE and its main metabolites chloral hydrate (CH), trichloroethanol (TCOH) and trichloroacetic acid (TCA) were used as allergens at different concentrations in skin patch tests. The study included 19 case subjects diagnosed with occupational THS, 22 control healthy workers exposed to TCE (exposure >12 weeks), and 20 validation new workers exposed to TCE for <12 weeks free of THS. All subjects were followed-up for 12 weeks after the patch test. Results The highest patch test positive rate in subjects with THS was for CH, followed by TCOH, TCA and TCE. The CH patch test positive rate was 100% irrespective of CH concentrations (15%, 10% and 5%). The TCOH patch test positive rate was concentration-dependent (89.5%, 73.7% and 52.6% for 5%, 0.5% and 0.05%, respectively). Lower patch test positive rates were noted for TCA and TCE. All patch tests (including four allergens) were all negative in each of the 22 control subjects. None of the subjects of the validation group had a positive 15% CH patch test. Conclusions Chloral hydrate seems to be the culprit causative compound of THS and type IV seems to be the major type of hypersensitivity of THS. The CH patch test could be potentially useful for screening workers at risk of THS. PMID:26020924
Novel information theory-based measures for quantifying incongruence among phylogenetic trees.
Salichos, Leonidas; Stamatakis, Alexandros; Rokas, Antonis
2014-05-01
Phylogenies inferred from different data matrices often conflict with each other necessitating the development of measures that quantify this incongruence. Here, we introduce novel measures that use information theory to quantify the degree of conflict or incongruence among all nontrivial bipartitions present in a set of trees. The first measure, internode certainty (IC), calculates the degree of certainty for a given internode by considering the frequency of the bipartition defined by the internode (internal branch) in a given set of trees jointly with that of the most prevalent conflicting bipartition in the same tree set. The second measure, IC All (ICA), calculates the degree of certainty for a given internode by considering the frequency of the bipartition defined by the internode in a given set of trees in conjunction with that of all conflicting bipartitions in the same underlying tree set. Finally, the tree certainty (TC) and TC All (TCA) measures are the sum of IC and ICA values across all internodes of a phylogeny, respectively. IC, ICA, TC, and TCA can be calculated from different types of data that contain nontrivial bipartitions, including from bootstrap replicate trees to gene trees or individual characters. Given a set of phylogenetic trees, the IC and ICA values of a given internode reflect its specific degree of incongruence, and the TC and TCA values describe the global degree of incongruence between trees in the set. All four measures are implemented and freely available in version 8.0.0 and subsequent versions of the widely used program RAxML.
Milk Bottom-Up Proteomics: Method Optimization
Vincent, Delphine; Ezernieks, Vilnis; Elkins, Aaron; Nguyen, Nga; Moate, Peter J.; Cocks, Benjamin G.; Rochfort, Simone
2016-01-01
Milk is a complex fluid whose proteome displays a diverse set of proteins of high abundance such as caseins and medium to low abundance whey proteins such as ß-lactoglobulin, lactoferrin, immunoglobulins, glycoproteins, peptide hormones, and enzymes. A sample preparation method that enables high reproducibility and throughput is key in reliably identifying proteins present or proteins responding to conditions such as a diet, health or genetics. Using skim milk samples from Jersey and Holstein-Friesian cows, we compared three extraction procedures which have not previously been applied to samples of cows' milk. Method A (urea) involved a simple dilution of the milk in a urea-based buffer, method B (TCA/acetone) involved a trichloroacetic acid (TCA)/acetone precipitation, and method C (methanol/chloroform) involved a tri-phasic partition method in chloroform/methanol solution. Protein assays, SDS-PAGE profiling, and trypsin digestion followed by nanoHPLC-electrospray ionization-tandem mass spectrometry (nLC-ESI-MS/MS) analyses were performed to assess their efficiency. Replicates were used at each analytical step (extraction, digestion, injection) to assess reproducibility. Mass spectrometry (MS) data are available via ProteomeXchange with identifier PXD002529. Overall 186 unique accessions, major and minor proteins, were identified with a combination of methods. Method C (methanol/chloroform) yielded the best resolved SDS-patterns and highest protein recovery rates, method A (urea) yielded the greatest number of accessions, and, of the three procedures, method B (TCA/acetone) was the least compatible of all with a wide range of downstream analytical procedures. Our results also highlighted breed differences between the proteins in milk of Jersey and Holstein-Friesian cows. PMID:26793233
Hyder, F; Renken, R; Rothman, D L
1999-12-01
A method for in vivo carbon-edited detection with proton echo-planar spectroscopic imaging (ICED PEPSI) is described. This method is composed of an echo-planar based acquisition implemented with (13)C-(1)H J editing spectroscopy and is intended for high temporal and spatial resolution in vivo spectroscopic imaging of (13)C turnover, from D-[1,6-(13)C]glucose to glutamate and glutamine, in the brain. At a static magnetic field strength of 7 T, both in vitro and in vivo chemical shift imaging data are presented with a spatial resolution of 8 microL (i.e., 1.25 x 1.25 x 5.00 mm(3)) and a maximum spectral bandwidth of 5.2 ppm in (1)H. Chemical shift imaging data acquired every 11 minutes allowed detection of regional [4-(13)CH(2)]glutamate turnover in rat brain. The [4-(13)CH(2)]glutamate turnover curves, which can be converted to tricarboxylic acid cycle fluxes, showed that the tricarboxylic acid cycle flux (V(TCA)) in pure gray and white matter can range from 1.2 +/- 0.2 to 0.5 +/- 0.1 micromol/g/min, respectively, for morphine-anesthetized rats. The mean cortical V(TCA) from 32 voxels of 1.0 +/- 0.3 micromol/g/min (N = 3) is in excellent agreement with previous localized measurements that have demonstrated that V(TCA) can range from 0.9-1.1 micromol/g/min under identical anesthetized conditions. Magn Reson Med 42:997-1003, 1999. Copyright 1999 Wiley-Liss, Inc.
Morris, E Matthew; Meers, Grace M E; Koch, Lauren G; Britton, Steven L; Fletcher, Justin A; Fu, Xiaorong; Shankar, Kartik; Burgess, Shawn C; Ibdah, Jamal A; Rector, R Scott; Thyfault, John P
2016-10-01
Rats selectively bred for high capacity running (HCR) or low capacity running (LCR) display divergence for intrinsic aerobic capacity and hepatic mitochondrial oxidative capacity, both factors associated with susceptibility for nonalcoholic fatty liver disease. Here, we tested if HCR and LCR rats display differences in susceptibility for hepatic steatosis after 16 wk of high-fat diets (HFD) with either 45% or 60% of kcals from fat. HCR rats were protected against HFD-induced hepatic steatosis, whereas only the 60% HFD induced steatosis in LCR rats, as marked by a doubling of liver triglycerides. Hepatic complete fatty acid oxidation (FAO) and mitochondrial respiratory capacity were all lower in LCR compared with HCR rats. LCR rats also displayed lower hepatic complete and incomplete FAO in the presence of etomoxir, suggesting a reduced role for noncarnitine palmitoyltransferase-1-mediated lipid catabolism in LCR versus HCR rats. Hepatic complete FAO and mitochondrial respiration were largely unaffected by either chronic HFD; however, 60% HFD feeding markedly reduced 2-pyruvate oxidation, a marker of tricarboxylic acid (TCA) cycle flux, and mitochondrial complete FAO only in LCR rats. LCR rats displayed lower levels of hepatic long-chain acylcarnitines than HCR rats but maintained similar levels of hepatic acetyl-carnitine levels, further supporting lower rates of β-oxidation, and TCA cycle flux in LCR than HCR rats. Finally, only LCR rats displayed early reductions in TCA cycle genes after the acute initiation of a HFD. In conclusion, intrinsically high aerobic capacity confers protection against HFD-induced hepatic steatosis through elevated hepatic mitochondrial oxidative capacity.
Morris, E. Matthew; Meers, Grace M. E.; Koch, Lauren G.; Britton, Steven L.; Fletcher, Justin A.; Fu, Xiaorong; Shankar, Kartik; Burgess, Shawn C.; Ibdah, Jamal A.; Rector, R. Scott
2016-01-01
Rats selectively bred for high capacity running (HCR) or low capacity running (LCR) display divergence for intrinsic aerobic capacity and hepatic mitochondrial oxidative capacity, both factors associated with susceptibility for nonalcoholic fatty liver disease. Here, we tested if HCR and LCR rats display differences in susceptibility for hepatic steatosis after 16 wk of high-fat diets (HFD) with either 45% or 60% of kcals from fat. HCR rats were protected against HFD-induced hepatic steatosis, whereas only the 60% HFD induced steatosis in LCR rats, as marked by a doubling of liver triglycerides. Hepatic complete fatty acid oxidation (FAO) and mitochondrial respiratory capacity were all lower in LCR compared with HCR rats. LCR rats also displayed lower hepatic complete and incomplete FAO in the presence of etomoxir, suggesting a reduced role for noncarnitine palmitoyltransferase-1-mediated lipid catabolism in LCR versus HCR rats. Hepatic complete FAO and mitochondrial respiration were largely unaffected by either chronic HFD; however, 60% HFD feeding markedly reduced 2-pyruvate oxidation, a marker of tricarboxylic acid (TCA) cycle flux, and mitochondrial complete FAO only in LCR rats. LCR rats displayed lower levels of hepatic long-chain acylcarnitines than HCR rats but maintained similar levels of hepatic acetyl-carnitine levels, further supporting lower rates of β-oxidation, and TCA cycle flux in LCR than HCR rats. Finally, only LCR rats displayed early reductions in TCA cycle genes after the acute initiation of a HFD. In conclusion, intrinsically high aerobic capacity confers protection against HFD-induced hepatic steatosis through elevated hepatic mitochondrial oxidative capacity. PMID:27600823
Forkert, Poh-Gek; Lash, Lawrence; Tardif, Robert; Tanphaichitr, Nongnuj; Vandevoort, Catherine; Moussa, Madeleine
2003-03-01
We have investigated the potential of the male reproductive tract to accumulate trichloroethylene (TCE) and its metabolites, including chloral, trichloroethanol (TCOH), trichloroacetic acid (TCA), and dichloroacetic acid (DCA). Human seminal fluid and urine samples from eight mechanics diagnosed with clinical infertility and exposed to TCE occupationally were analyzed. In in vivo experimental studies, TCE and its metabolites were determined in epididymis and testis of mice exposed to TCE (1000 ppm) by inhalation for 1 to 4 weeks. In other studies, incubations of monkey epididymal microsomes were performed in the presence of TCE and NADPH. Our results showed that seminal fluid from all eight subjects contained TCE, chloral, and TCOH. DCA was present in samples from two subjects, and only one contained TCA. TCA and/or TCOH were also identified in urine samples from only two subjects. TCE, chloral, and TCOH were detected in murine epididymis after inhalation exposure with TCE for 1 to 4 weeks. Levels of TCE and chloral were similar throughout the entire exposure period. TCOH levels were similar at 1 and 2 weeks but increased significantly after 4 weeks of TCE exposure. Chloral was identified in microsomal incubations with TCE in monkey epididymis. CYP2E1, a P450 that metabolizes TCE, was localized in human and monkey epididymal epithelium and testicular Leydig cells. These results indicated that TCE is metabolized in the reproductive tract of the mouse and monkey. Furthermore, TCE and its metabolites accumulated in seminal fluid, and suggested associations between production of TCE metabolites, reproductive toxicity, and impaired fertility.
Li, Yong; Wang, Huixia; Dai, Futao; Li, Pei; Jin, Xin; Huang, Yan; Nie, Zhou; Yao, Shouzhuo
2016-12-15
Citrate synthase (CS) is one of the key metabolic enzymes in the Krebs tricarboxylic acid (TCA) cycle. It regulates energy generation in mitochondrial respiration by catalysing the reaction between oxaloacetic acid (OAA) and acetyl coenzyme A (Ac-CoA) to generate citrate and coenzyme A (CoA). CS has been shown to be a biomarker of neurological diseases and various kinds of cancers. Here, a label-free fluorescent assay has been developed for homogeneously detecting CS and its inhibitor based on the in situ generation of CoA-Au(I) co-ordination polymer (CP) and the fluorescence signal-on by SYBR Green II-stained CoA-Au(I) CP. Because of the unique property of the CoA-Au(I) CP, this CS activity assay method could achieve excellent selectivity and sensitivity, with a linear range from 0.0033 U/μL to 0.264 U/μL and a limit of detection to be 0.00165 U/μL. Meanwhile, this assay method has advantages of being facile and cost effective with quick detection. Moreover, based on this method, a biomimetic logic system was established by rationally exploiting the cascade enzymatic interactions in TCA cycle for chemical information processing. In the TCA cycle-derived logic system, an AND-AND-AND-cascaded gate was rigorously operated step by step in one pot, and is outputted by a label-free fluorescent signal with visualized readout. Copyright © 2016 Elsevier B.V. All rights reserved.
... prescribes you a TCA, take it in the early evening to eliminate unwanted morning drowsiness. For constipation, increase the amount of fiber in your diet. Consider taking Metamucil or a stool softener such as Colace. Pregnancy & Warnings None of the antidepressants in any of ...
VIBRATING PERVAPORATION MODULES: EFFECT OF MODULE DESIGN ON PERFORMANCE
A third commercial-scale vibrating pervaporation membrane module was fabricated and evaluated for the separation of volatile organic compounds (VOCs) from aqueous solutions. Experiments with surrogate solutions of four hydrophobic VOCs (1,1,1-trichloroethane (TCA), trichloroethy...
Song, Bing; Yang, Yong; Wang, Yan-Li; Fan, Xiao-Hui; Huang, Yu-Mei; Ci, Hao-Su; Zuo, Jin-Hua
2015-01-01
To investigate the potential therapeutic effects of adenovirus expressing IFN-λ1 and IFN-λ2 (Ad/hIFN-λ) in treating squamous cell carcinoma of the oral tongue (SCCOT) and to explore the underlying mechanisms. Two SCCOT cell lines HSC-3 and Tca8113 were adopted as study objects. Cell Counting Kit-8 (CCK-8) cell proliferation and viability assay was performed to evaluate the antiproliferative effects of Ad/hIFN-λ and IFN-λ treatments at different dosages. Flow cytometry (FCM) was performed to investigate the apoptosis rate induced by Ad/hIFN-λ. In vivo study was performed through evaluating tumorigenicity and tumor volume on BALB/c nu/nu mice inoculated with HSC-3 cells with or without infection of Ad/hIFN-λ. qPCR was used to screen important apoptosis related genes expression and western blot (WB) was performed to verify the results. WB was also used to test the phosphorylation of STATs protein in the JAK/STAT signaling pathways. Our results indicated an obvious antiproliferative effect of Ad/hIFN-λ in vitro on infected HSC-3 and Tca8113 cells. The antiproliferative effects started to appear at 48 h (day 2) after infection. IFN-λs alone treating HSC-3 and Tca8113 cells also showed a dose-dependent inhibitory manner. Though the antiproliferative effects did not show on 24 h (day 1), early apoptosis rate already increased significantly in cells infected with Ad/hIFN-λ (P<0.05) detected by FCM. The underlying mechanisms of antiproliferative activity rely on the IFN-λ signaling by phosphorylation of STATs protein. Expression of Bax, Bcl-2 and Caspase-3 were promoted by Ad/hIFN-λ leading to higher apoptosis rate. Upper stream of p21 and Rb dephosphorylation explained the Caspase-3 activation. Animal study showed that HSC-3 cells infected with Ad/hIFN-λ significantly promoted the survival rate and decreased mean tumor volume comparing to HSC-3 cells group. Ad/hIFN-λ injection had obvious antiproliferative effects on HSC-3 and Tca8113 cells. Ad/hIFN-λ induced apoptosis in SCCOT cells through increasing Bcl-2, Bax and Caspase-3 expression. Ad/hIFN-λ is a potential therapeutic strategy in treating oral tongue carcinoma.
Raman, Babu; Nandakumar, M P; Muthuvijayan, Vignesh; Marten, Mark R
2005-11-05
Proteome analysis was used to compare global protein expression changes in Escherichia coli fermentation between exponential and glucose-limited fed-batch phase. Two-dimensional gel electrophoresis and MALDI-TOF mass spectrometry were used to separate and identify 49 proteins showing >2-fold difference in expression. Proteins upregulated during exponential phase include ribonucleotide biosynthesis enzymes and ribosomal recycling factor. Proteins upregulated during fed-batch phase include those involved in high-affinity glucose uptake, transport and degradation of alternate carbon sources and TCA cycle, suggesting an enhanced role of the cycle under glucose- and energy-limited conditions. We report the upregulation of several putative proteins (ytfQ, ygiS, ynaF, yggX, yfeX), not identified in any previous study under carbon-limited conditions. Copyright (c) 2005 Wiley Periodicals, Inc.
NASA Technical Reports Server (NTRS)
Vallejo, J.J.; Hejduk, M.D.; Stamey, J. D.
2015-01-01
Satellite conjunction risk typically evaluated through the probability of collision (Pc). Considers both conjunction geometry and uncertainties in both state estimates. Conjunction events initially discovered through Joint Space Operations Center (JSpOC) screenings, usually seven days before Time of Closest Approach (TCA). However, JSpOC continues to track objects and issue conjunction updates. Changes in state estimate and reduced propagation time cause Pc to change as event develops. These changes a combination of potentially predictable development and unpredictable changes in state estimate covariance. Operationally useful datum: the peak Pc. If it can reasonably be inferred that the peak Pc value has passed, then risk assessment can be conducted against this peak value. If this value is below remediation level, then event intensity can be relaxed. Can the peak Pc location be reasonably predicted?
Knoop, Henning; Gründel, Marianne; Zilliges, Yvonne; Lehmann, Robert; Hoffmann, Sabrina; Lockau, Wolfgang; Steuer, Ralf
2013-01-01
Cyanobacteria are versatile unicellular phototrophic microorganisms that are highly abundant in many environments. Owing to their capability to utilize solar energy and atmospheric carbon dioxide for growth, cyanobacteria are increasingly recognized as a prolific resource for the synthesis of valuable chemicals and various biofuels. To fully harness the metabolic capabilities of cyanobacteria necessitates an in-depth understanding of the metabolic interconversions taking place during phototrophic growth, as provided by genome-scale reconstructions of microbial organisms. Here we present an extended reconstruction and analysis of the metabolic network of the unicellular cyanobacterium Synechocystis sp. PCC 6803. Building upon several recent reconstructions of cyanobacterial metabolism, unclear reaction steps are experimentally validated and the functional consequences of unknown or dissenting pathway topologies are discussed. The updated model integrates novel results with respect to the cyanobacterial TCA cycle, an alleged glyoxylate shunt, and the role of photorespiration in cellular growth. Going beyond conventional flux-balance analysis, we extend the computational analysis to diurnal light/dark cycles of cyanobacterial metabolism. PMID:23843751
Imaging Prostate Cancer (PCa) Phenotype and Evolution
2015-10-01
has two isoforms: m-Acon (mitochondrial aconitase) and c-Acon ( cytoplasmic ; additionally functions as iron regulatory protein 1, when the iron levels...migration, and invasiveness. Determine if knockdown of m-acon and Deferiprone inhibit TCA cycle activity, glycolysis and lactate, and increase
DEGREASER SYSTEM POLLUTION PREVENTION EVALUATION
The report gives results of an investigation of the capability of various engineering changes to an existing vapor degreaser to reduce solvent emissions to the atmosphere while remaining within the established U.S. Air Force (USAF) exposure limits for 1,1,1-trichloroethane (TCA).
Intermittent parathyroid hormone administration improves periodontal healing in rats.
Vasconcelos, Daniel Fernando Pereira; Marques, Marcelo Rocha; Benatti, Bruno Braga; Barros, Silvana Pereira; Nociti, Francisco Humberto; Novaes, Pedro Duarte
2014-05-01
Intermittent administration of parathyroid hormone (PTH) promotes new bone formation in patients with osteoporosis and bone fractures. It was shown previously that PTH also reduces periodontitis-related bone loss. The aim of this study is to evaluate the effect of treatment with PTH on periodontal healing in rats. Fenestration defects were created at the buccal surface of the distal root of the mandibular first molars, and both periodontal ligament (PDL) and cementum were removed. Animals were then assigned to two groups (eight animals per group): group 1: control, placebo administration; and group 2: test, human PTH (hPTH) 1-34 administration at a concentration of 40 μg/kg. For both groups, the animals were injected every 2 days, and the animals were sacrificed at 14 and 21 days after surgery. Specimens were harvested and processed for routine decalcified histologic sections. The following parameters were assessed: 1) remaining bone defect extension (RBDE); 2) newly formed bone density (NFBD); 3) total callus area (TCA); 4) osteoclast number (ON) in the callus region; and 5) newly formed dental cementum-like tissue (NFC). Birefringence of root PDL reattachment was also evaluated. Birefringence analysis showed root PDL reattachment for both groups 21 days after treatment. Intermittent hPTH 1-34 administration decreased RBDE (P <0.01) and increased NFBD (P <0.01), TCA (P <0.01), area of NFC (P <0.01), and ON in the callus region (P <0.01). Within the limits of the present study, intermittent administration of hPTH 1-34 led to an enhanced periodontal healing process compared with non-treated animals.
Li, Ke; Buchinger, Tyler J.; Bussy, Ugo; Fissette, Skye D.; Johnson, Nicholas; Li, Weiming
2015-01-01
Many fishes are hypothesized to use bile acids (BAs) as chemical cues, yet quantification of BAs in biological samples and the required methods remain limited. Here, we present an UHPLC–MS/MS method for simultaneous, sensitive, and rapid quantification of 15 BAs, including free, taurine, and glycine conjugated BAs, and application of the method to fecal samples from lake charr (Salvelinus namaycush). The analytes were separated on a C18 column with acetonitrile–water (containing 7.5 mM ammonium acetate and 0.1% formic acid) as mobile phase at a flow rate of 0.25 mL/min for 12 min. BAs were monitored with a negative electrospray triple quadrupole mass spectrometer (Xevo TQ-S™). Calibration curves of 15 BAs were linear over the concentration range of 1.00–5,000 ng/mL. Validation revealed that the method was specific, accurate, and precise. The method was applied to quantitative analysis of feces extract of fry lake charr and the food they were eating. The concentrations of analytes CA, TCDCA, TCA, and CDCA were 242.3, 81.2, 60.7, and 36.2 ng/mg, respectively. However, other taurine conjugated BAs, TUDCA, TDCA, and THDCA, were not detected in feces of lake charr. Interestingly, TCA and TCDCA were detected at high concentrations in food pellets, at 71.9 and 38.2 ng/mg, respectively. Application of the method to feces samples from lake charr supported a role of BAs as chemical cues, and will enhance further investigation of BAs as chemical cues in other fish species.
A Comparison of Oxidative Lactate Metabolism in Traumatically Injured Brain and Control Brain.
Jalloh, Ibrahim; Helmy, Adel; Howe, Duncan J; Shannon, Richard J; Grice, Peter; Mason, Andrew; Gallagher, Clare N; Murphy, Michael P; Pickard, John D; Menon, David K; Carpenter, T Adrian; Hutchinson, Peter J; Carpenter, Keri L H
2018-05-18
Metabolic abnormalities occur after traumatic brain injury (TBI). Glucose is conventionally regarded as the major energy substrate, although lactate can also be an energy source. We compared 3- 13 C lactate metabolism in TBI with "normal" control brain and muscle, measuring 13 C-glutamine enrichment to assess tricarboxylic acid (TCA) cycle metabolism. Microdialysis catheters in brains of nine patients with severe TBI, five non-TBI brain surgical patients, and five resting muscle (non-TBI) patients were perfused (24 h in brain, 8 h in muscle) with 8 mmol/L sodium 3- 13 C lactate. Microdialysate analysis employed ISCUS and nuclear magnetic resonance. In TBI, with 3- 13 C lactate perfusion, microdialysate glucose concentration increased nonsignificantly (mean +11.9%, p = 0.463), with significant increases (p = 0.028) for lactate (+174%), pyruvate (+35.8%), and lactate/pyruvate ratio (+101.8%). Microdialysate 13 C-glutamine fractional enrichments (median, interquartile range) were: for C4 5.1 (0-11.1) % in TBI and 5.7 (4.6-6.8) % in control brain, for C3 0 (0-5.0) % in TBI and 0 (0-0) % in control brain, and for C2 2.9 (0-5.7) % in TBI and 1.8 (0-3.4) % in control brain. 13 C-enrichments were not statistically different between TBI and control brain, showing both metabolize 3- 13 C lactate via TCA cycle, in contrast to muscle. Several patients with TBI exhibited 13 C-glutamine enrichment above the non-TBI control range, suggesting lactate oxidative metabolism as a TBI "emergency option."
NASA Astrophysics Data System (ADS)
Liu, Gang; He, Jing; Luo, Zhiyong; Yang, Wunian; Zhang, Xiping
2015-05-01
It is important to study the effects of pedestrian crossing behaviors on traffic flow for solving the urban traffic jam problem. Based on the Nagel-Schreckenberg (NaSch) traffic cellular automata (TCA) model, a new one-dimensional TCA model is proposed considering the uncertainty conflict behaviors between pedestrians and vehicles at unsignalized mid-block crosswalks and defining the parallel updating rules of motion states of pedestrians and vehicles. The traffic flow is simulated for different vehicle densities and behavior trigger probabilities. The fundamental diagrams show that no matter what the values of vehicle braking probability, pedestrian acceleration crossing probability, pedestrian backing probability and pedestrian generation probability, the system flow shows the "increasing-saturating-decreasing" trend with the increase of vehicle density; when the vehicle braking probability is lower, it is easy to cause an emergency brake of vehicle and result in great fluctuation of saturated flow; the saturated flow decreases slightly with the increase of the pedestrian acceleration crossing probability; when the pedestrian backing probability lies between 0.4 and 0.6, the saturated flow is unstable, which shows the hesitant behavior of pedestrians when making the decision of backing; the maximum flow is sensitive to the pedestrian generation probability and rapidly decreases with increasing the pedestrian generation probability, the maximum flow is approximately equal to zero when the probability is more than 0.5. The simulations prove that the influence of frequent crossing behavior upon vehicle flow is immense; the vehicle flow decreases and gets into serious congestion state rapidly with the increase of the pedestrian generation probability.
Vitamin D Status in Monkey Candidates for Space Flight
NASA Technical Reports Server (NTRS)
Arnaud, S. B.; Wronski, T. J.; Koslovskeya, I.; Dotsenko, R.; Navidi, M.; Wade, Charles E. (Technical Monitor)
1994-01-01
In preparation for the Cosmos 2229 Biosatellite space flight experiments in Rhesus monkeys, we evaluated the status of vitamin D in animals of different origins: candidates for space flight raised in Moscow (IMBP) and animals housed at Ames Research Ctr. (ARC) for pilot studies. Diets at IMBP were natural foods found by analysis to contain 1.4% Ca, 2.8% P and<240 IU D3/kg and at ARC standard monkey chow with 0.9% Ca, 0.5% P and 6600 IU D3/kg. We measured body weights (BW), serum calcium (TCa), total protein (TP), phosphorus (Pi), alkaline phosphatase (AP), 25-hydroxyvitamin D (25D) and 1,25-dihydroxyvitamin D (1,25D) in 16 IMBP and 15 ARC male animals and indices of bone formation in cancellous bone obtained from iliac crest biopsy of 6 IMBP and 13 ARC animals. BW were the same in juveniles at IMBP as ARC although ARC monkeys were born a year later. Mean(1SD) TCa and TP were higher and 25D lower (1819 vs. 93+18 ng/ml,p<.001) in IMBP than ARC animals. 1,25D (174156 vs. 212+77 pg/ml), Pi and AP were similar. In bone, osteoid and osteoblast surfaces averaged 38114% and 33+15% in all, with %vol. of osteoid higher in IMBP than ARC monkeys of the same BW (p<.05) Indices of bone formation were inversely related to 25D, not 1,25D. Of interest are similar 1,25D levels associated with a wide range of substrate and extensive osteoid in bone of D replete animals.
Hung, Chun-Hsien; Kanehara, Kazue; Nakamura, Yuki
2016-09-01
Triacylglycerol (TAG), a major source of biodiesel production, accumulates in nitrogen-starved Chlamydomonas reinhardtii. However, the metabolic pathway of starch-to-TAG conversion remains elusive because an enzyme that affects the starch degradation is unknown. Here, we isolated a new class of mutant bgal1, which expressed an overaccumulation of starch granules and defective photosynthetic growth. The bgal1 was a null mutant of a previously uncharacterized β-galactosidase-like gene (Cre02.g119700), which decreased total β-galactosidase activity 40% of the wild type. Upon nitrogen starvation, the bgal1 mutant showed decreased TAG accumulation mainly due to the reduced flux of de novo TAG biosynthesis evidenced by increased unsaturation of fatty acid composition in TAG and reduced TAG accumulation by additional supplementation of acetate to the culture media. Metabolomic analysis of the bgal1 mutant showed significantly reduced levels of metabolites following the hydrolysis of starch and substrates for TAG accumulation, whereas metabolites in TCA cycle were unaffected. Upon nitrogen starvation, while levels of glucose 6-phosphate, fructose 6-phosphate and acetyl-CoA remained lower, most of the other metabolites in glycolysis were increased but those in the TCA cycle were decreased, supporting TAG accumulation. We suggest that BGAL1 may be involved in the degradation of starch, which affects TAG accumulation in nitrogen-starved C. reinhardtii. This article is part of a Special Issue entitled: Plant Lipid Biology edited by Kent D. Chapman and Ivo Feussner. Copyright © 2016 Elsevier B.V. All rights reserved.
A Pilot Study: Cardiac Parameters in Children Receiving New-Generation Antidepressants.
Uchida, Mai; Spencer, Andrea E; Kenworthy, Tara; Chan, James; Fitzgerald, Maura; Rosales, Ana Maria; Kagan, Elana; Saunders, Alexandra; Biederman, Joseph
2017-06-01
Because of concerns about potential associations between high doses of citalopram and QTc prolongation in adults, this study examined whether such associations are operant in children. We hypothesized that therapeutic doses of nontricyclic antidepressant medications (non-TCAs) prescribed to children would be cardiovascularly safe. The sample consisted of 49 psychiatrically referred children and adolescents 6 to 17 years old of both sexes treated with a non-TCA (citalopram, escitalopram, fluoxetine, paroxetine, sertraline, bupropion, duloxetine, venlafaxine, mirtazapine). To standardize the doses of different antidepressants, we converted doses of individual medicines into "citalopram equivalent doses" (CEDs) based on dosing recommendation for individual antidepressants. Correlation analysis was carried out to compare the continuous and weight-based CED to variables of interest. A QTc grouping was defined as normal, borderline, or abnormal, and CED was compared across QTc groupings using linear regression. An antidepressant dosage group was defined as low or high dose, and a t test compared variables of interest across dosage groups. No significant associations were found between total or weight-corrected CEDs of any antidepressant examined and QTc or any other electrocardiogram or blood pressure parameters. In patients taking citalopram or escitalopram, a significant correlation was found between PR interval and total daily dose, which disappeared when weight-based doses were used or when corrected by age. Although limited by a relatively small sample size, these results suggest that therapeutic doses of non-TCA antidepressants when used in children do not seem to be associated with prolonged QTc interval or other adverse cardiovascular effects.
Andreozzi, Stefano; Chakrabarti, Anirikh; Soh, Keng Cher; Burgard, Anthony; Yang, Tae Hoon; Van Dien, Stephen; Miskovic, Ljubisa; Hatzimanikatis, Vassily
2016-05-01
Rational metabolic engineering methods are increasingly employed in designing the commercially viable processes for the production of chemicals relevant to pharmaceutical, biotechnology, and food and beverage industries. With the growing availability of omics data and of methodologies capable to integrate the available data into models, mathematical modeling and computational analysis are becoming important in designing recombinant cellular organisms and optimizing cell performance with respect to desired criteria. In this contribution, we used the computational framework ORACLE (Optimization and Risk Analysis of Complex Living Entities) to analyze the physiology of recombinant Escherichia coli producing 1,4-butanediol (BDO) and to identify potential strategies for improved production of BDO. The framework allowed us to integrate data across multiple levels and to construct a population of large-scale kinetic models despite the lack of available information about kinetic properties of every enzyme in the metabolic pathways. We analyzed these models and we found that the enzymes that primarily control the fluxes leading to BDO production are part of central glycolysis, the lower branch of tricarboxylic acid (TCA) cycle and the novel BDO production route. Interestingly, among the enzymes between the glucose uptake and the BDO pathway, the enzymes belonging to the lower branch of TCA cycle have been identified as the most important for improving BDO production and yield. We also quantified the effects of changes of the target enzymes on other intracellular states like energy charge, cofactor levels, redox state, cellular growth, and byproduct formation. Independent earlier experiments on this strain confirmed that the computationally obtained conclusions are consistent with the experimentally tested designs, and the findings of the present studies can provide guidance for future work on strain improvement. Overall, these studies demonstrate the potential and effectiveness of ORACLE for the accelerated design of microbial cell factories. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
Qin, Jiayang; Wang, Xiuwen; Wang, Landong; Zhu, Beibei; Zhang, Xiaohua; Yao, Qingshou; Xu, Ping
2015-01-01
Lactate production is enhanced by adding calcium carbonate or sodium hydroxide during fermentation. However, Bacillus coagulans 2-6 can produce more than 180 g/L L-lactic acid when calcium lactate is accumulated, but less than 120 g/L L-lactic acid when sodium lactate is formed. The molecular mechanisms by which B. coagulans responds to calcium lactate and sodium lactate remain unclear. In this study, comparative transcriptomic methods based on high-throughput RNA sequencing were applied to study gene expression changes in B. coagulans 2-6 cultured in non-stress, sodium lactate stress and calcium lactate stress conditions. Gene expression profiling identified 712 and 1213 significantly regulated genes in response to calcium lactate stress and sodium lactate stress, respectively. Gene ontology assignments of the differentially expressed genes were performed. KEGG pathway enrichment analysis revealed that ‘ATP-binding cassette transporters’ were significantly affected by calcium lactate stress, and ‘amino sugar and nucleotide sugar metabolism’ was significantly affected by sodium lactate stress. It was also found that lactate fermentation was less affected by calcium lactate stress than by sodium lactate stress. Sodium lactate stress had negative effect on the expression of ‘glycolysis/gluconeogenesis’ genes but positive effect on the expression of ‘citrate cycle (TCA cycle)’ genes. However, calcium lactate stress had positive influence on the expression of ‘glycolysis/gluconeogenesis’ genes and had minor influence on ‘citrate cycle (TCA cycle)’ genes. Thus, our findings offer new insights into the responses of B. coagulans to different lactate stresses. Notably, our RNA-seq dataset constitute a robust database for investigating the functions of genes induced by lactate stress in the future and identify potential targets for genetic engineering to further improve L-lactic acid production by B. coagulans. PMID:25875592
Liu, Yonggang; Tan, Peng; Liu, Shanshan; Shi, Hang; Feng, Xin; Ma, Qun
2015-01-01
Objective: Calculus bovis have been widely used in Chinese herbology for the treatment of hyperpyrexia, convulsions, and epilepsy. Nowadays, due to the limited source and high market price, the substitutes, artificial and in vitro cultured Calculus bovis, are getting more and more commonly used. The adulteration phenomenon is serious. Therefore, it is crucial to establish a fast and simple method in discriminating the natural, artificial and in vitro cultured Calculus bovis. Bile acids, one of the main active constituents, are taken as an important indicator for evaluating the quality of Calculus bovis and the substitutes. Several techniques have been built to analyze bile acids in Calculus bovis. Whereas, as bile acids are with poor ultraviolet absorbance and high structural similarity, effective technology for identification and quality control is still lacking. Methods: In this study, high-performance liquid chromatography (HPLC) coupled with tandem mass spectrometry (LC/MS/MS) was applied in the analysis of bile acids, which effectively identified natural, artificial and in vitro cultured Calculus bovis and provide a new method for their quality control. Results: Natural, artificial and in vitro cultured Calculus bovis were differentiated by bile acids analysis. A new compound with protonated molecule at m/z 405 was found, which we called 3α, 12α-dihydroxy-7-oxo-5α-cholanic acid. This compound was discovered in in vitro cultured Calculus bovis, but almost not detected in natural and artificial Calculus bovis. A total of 13 constituents was identified. Among them, three bio-markers, including glycocholic acid, glycodeoxycholic acid and taurocholic acid (TCA) were detected in both natural and artificial Calculus bovis, but the density of TCA was different in two kinds of Calculus bovis. In addition, the characteristics of bile acids were illustrated. Conclusions: The HPLC coupled with tandem MS (LC/MS/MS) method was feasible, easy, rapid and accurate in identifying natural, artificial and in vitro cultured Calculus bovis. PMID:25829769
Long-term study of volatile organic compound recovery from ampulated, dry, fortified soils
DOE Office of Scientific and Technical Information (OSTI.GOV)
Minnich, M.M.; Zimmerman, J.H.; Schumacher, B.A.
1997-01-01
Our objective was to evaluate the stability and extractability of volatile organic compounds (VOCs) when fortified on dry soils and stored in sealed ampules. Two desiccator-dried soils were fortified with benzene, toluene, ethylbenzene, o-xylene, 1,1,1-trichloroethane (TCA), trichloroethene (TCE), tetrachloroethene (PCE), and 1,1,2,2-tetrachloroethane (TTCA) at 800 ng each VOC/g soil. The fortified soil was portioned into ampules, sealed, and stored in the dark at 25{degrees}C for up to 56 wk. Replicate ampules were analyzed after 2 d and 2,4,8,13,34, and 56 wk by two extraction procedures modified from the US Environmental Protection Agency`s (USEPA`s) low- and high-level purge-and-trap procedures (SW-846 Methodsmore » 5030/8021). The modified procedure (1-h methanol extraction at 25{degree}C prior to purge-and-trap analysis) yielded significantly higher recoveries of all compounds on both soils as compared with the low-level procedure, with the exception of benzene on the Charleston soil. Moreover, when measured by the high-level procedure, concentrations of benzene, toluene, ethylbenzene, and o-xylene (BTEX) remained relatively unchanged during the 56-wk study. Results indicate that the 1-h, 25{degrees}C methanol extraction was sufficient for extraction of the BTEX compounds from these soils. For the chlorinated compounds, regression analysis demonstrated significant trends of changing concentrations over time. Recoveries of TCA decreased at a rate of 3 and 4 ng/g/week and recoveries of TTCA decreased at rates of 8 and 17 ng/g/week on the Hayesville and Charleston soils, respectively. PCE concentrations did not show any significant concentration changes, while TCE concentrations increased at 6 and 7 ng/g/week for the Hayesville and Charleston soils, respectively. 19 refs., 2 figs., 5 tabs.« less
IRIS Toxicological Review of Trichloroacetic Acid (Tca) (Final Report)
EPA has finalized the Toxicological Review of Trichloroacetic Acid: in support of the Integrated Risk Information System (IRIS). Now final, this assessment may be used by EPA’s program and regional offices to inform decisions to protect human health.
Li, Qun; Degano, Alicia L.; Penati, Judith; Zhuo, Justin; Roe, Charles R.; Ronnett, Gabriele V.
2014-01-01
Rett syndrome (RTT) is an autism spectrum disorder (ASD) caused by mutations in the X-linked MECP2 gene that encodes methyl-CpG binding protein 2 (MeCP2). Symptoms range in severity and include psychomotor disabilities, seizures, ataxia, and intellectual disability. Symptom onset is between 6-18 months of age, a critical period of brain development that is highly energy-dependent. Notably, patients with RTT have evidence of mitochondrial dysfunction, as well as abnormal levels of the adipokines leptin and adiponectin, suggesting overall metabolic imbalance. We hypothesized that one contributor to RTT symptoms is energy deficiency due to defective nutrient substrate utilization by the TCA cycle. This energy deficit would lead to a metabolic imbalance, but would be treatable by providing anaplerotic substrates to the TCA cycle to enhance energy production. We show that dietary therapy with triheptanoin significantly increased longevity and improved motor function and social interaction in male mice hemizygous for Mecp2 knockout. Anaplerotic therapy in Mecp2 knockout mice also improved indicators of impaired substrate utilization, decreased adiposity, increased glucose tolerance and insulin sensitivity, decreased serum leptin and insulin, and improved mitochondrial morphology in skeletal muscle. Untargeted metabolomics of liver and skeletal muscle revealed increases in levels of TCA cycle intermediates with triheptanoin diet, as well as normalizations of glucose and fatty acid biochemical pathways consistent with the improved metabolic phenotype in Mecp2 knockout mice on triheptanoin. These results suggest that an approach using dietary supplementation with anaplerotic substrate is effective in improving symptoms and metabolic health in RTT. PMID:25299635
ODC-Free Solvent Implementation Issues for Vulcanized Rubber and Bond Systems
NASA Technical Reports Server (NTRS)
Hodgson, James R.; McCool, Alex (Technical Monitor)
2001-01-01
Thiokol Propulsion has worked extensively to replace 1,1,1-trichloroethane (TCA) with ozone depleting chemicals (ODC)-free solvents for use in the manufacture of the Reusable Solid Rocket Motor (RSRM) for the Space Shuttle Program. As Thiokol has transitioned from sub-scale to full-scale testing and implementation of these new solvents, issues have been discovered which have required special attention. The original intent of Thiokol's solvent replacement strategy was to replace TCA with a single drop-in solvent for all equivalent applications. We have learned that a single candidate does not exist for replacing TCA. Solvent incompatibility with process materials has caused us to seek for niche solvents and/or processing changes that provide an ODC-free solution for special applications. This paper addresses some of the solvent incompatibilities, which have lead to processes changes and possible niche solvent usage. These incompatibilities were discovered during full-scale testing of ODC-free solvents and relate to vulcanized rubber and bond systems in the RSRM. Specifically, the following items are presented: (1) Cure effects of d-limonene based solvents on Silica Filled Ethylene Propylene Diene Monomer (SF-EPDM) rubber. During full-scale test operations, Thiokol discovered that d-limonene (terpene) based solvents inhibit the cure of EPDM rubber. Subsequent testing showed the same issue with Nitrile Butadiene Rubber (NBR). Also discussed are efforts to minimize uncured rubber exposure to solvents; and (2) Cured bond system sensitivity to ODC-free solvents. During full scale testing it was discovered that a natural rubber to steel vulcanized bond could degrade after prolonged exposure to ODC-free solvents. Follow on testing showed that low vapor pressure and residence time seemed to be most likely cause for failure.
Aulenta, Federico; Potalivo, Monica; Majone, Mauro; Papini, Marco Petrangeli; Tandoi, Valter
2006-06-01
This study investigated the biotransformation pathways of 1,1,2,2-tetrachloroethane (1,1,2,2-TeCA) in the presence of chloroethenes (i.e. tetrachloroethene, PCE; trichloroethene, TCE) in anaerobic microcosms constructed with subsurface soil and groundwater from a contaminated site. When amended with yeast extract, lactate, butyrate, or H2 and acetate, 1,1,2,2-TeCA was initially dechlorinated via both hydrogenolysis to 1,1,2-trichloroethane (1,1,2-TCA) (major pathway) and dichloroelimination to dichloroethenes (DCEs) (minor pathway), with both reactions occurring under sulfidogenic conditions. In the presence of only H2, the hydrogenolysis of 1,1,2,2-TeCA to 1,1,2-TCA apparently required the presence of acetate to occur. Once formed, 1,1,2-TCA was degraded predominantly via dichloroelimination to vinyl chloride (VC). Ultimately, chloroethanes were converted to chloroethenes (mainly VC and DCEs) which persisted in the microcosms for very long periods along with PCE and TCE originally present in the groundwater. Hydrogenolysis of chloroethenes occurred only after highly reducing methanogenic conditions were established. However, substantial conversion to ethene (ETH) was observed only in microcosms amended with yeast extract (200 mg/l), suggesting that groundwater lacked some nutritional factors which were likely provided to dechlorinating microorganisms by this complex organic substrate. Bioaugmentation with an H2-utilizing PCE-dechlorinating Dehalococcoides spp. -containing culture resulted in the conversion of 1,1,2,2-TeCA, PCE and TCE to ETH and VC. No chloroethanes accumulated during degradation suggesting that 1,1,2,2-TeCA was degraded through initial dichloroelimination into DCEs and then typical hydrogenolysis into ETH and VC.
Li, Lin-feng; Zhai, Fang; Shang, Lu-qing; Yin, Zheng; Yuan, Ying-jin
2014-01-01
Identification of efficient key enzymes in biosynthesis pathway and optimization of the fitness between functional modules and chassis are important for improving the production of target compounds. In this study, the taxadiene biosynthesis pathway was firstly constructed in yeast by transforming ts gene and overexpressing erg20 and thmgr. Then, the catalytic capabilities of six different geranylgeranyl diphosphate synthases (GGPPS), the key enzyme in mevalonic acid (MVA) pathway catalyzing famesyl diphosphate (FPP) to geranylgeranyl diphosphate (GGPP), were predicted using enzyme-substrate docking strategy. GGPPSs from Taxus baccata x Taxus cuspidate (GGPPSbc), Erwinia herbicola (GGPPSeh), and S. cerevisiae (GGPPSsc) which ranked 1st, 4th and 6th in docking with FPP were selected for construction. The experimental results were consistent with the computer prediction that the engineered yeast with GGPPSbc exhibited the highest production. In addition, two chassis YSG50 and W303-1A were chosen, and the titer of taxadiene reached 72.8 mg/L in chassis YSG50 with GGPPSbc. Metabolomic study revealed that the contents of tricarboxylic acid cycle (TCA) intermediates and their precursor amino acids in chassis YSG50 was lower than those in W303-1A, indicating less carbon flux was divided into TCA cycle. Furthermore, the levels of TCA intermediates in the taxadiene producing yeasts were lower than those in chassis YSG50. Thus, it may result in more carbon flux in MVA pathway in chassis YSG50, which suggested that YSG50 was more suitable for engineering the taxadiene producing yeast. These results indicated that computer-aided protein modeling directed isoenzyme selection strategy and metabolomic study could guide the rational design of terpenes biosynthetic cells. PMID:25295588
Alteri, Christopher J.; Himpsl, Stephanie D.; Engstrom, Michael D.; Mobley, Harry L. T.
2012-01-01
ABSTRACT Proteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components. PMID:23111869
Detecting β-Casein Variation in Bovine Milk.
Caroli, Anna Maria; Savino, Salvatore; Bulgari, Omar; Monti, Eugenio
2016-01-25
In bovine species, β-casein (β-CN) is characterized by genetic polymorphism. The two most common protein variants are β-CN A² (the original one) and A¹, differing from A² for one amino acid substitution (Pro67 to His67). Several bioactive peptides affecting milk nutritional properties can originate from β-CN. Among them, β-casomorphin-7 (BCM7) ranging from amino acid 60 to 66 can be released more easily from β-CN variants carrying His67 (A¹ type) instead of Pro67 (A² type). Nowadays, "A2 milk" is produced in different countries claiming its potential benefits in human health. The aim of this study was to further develop and apply an isoelectric focusing electrophoresis (IEF) method to bulk and individual milk samples in order to improve its use for β-CN studies. We succeeded in identifying A2 milk samples correctly and quantifying the percentage of A², A¹, and B variants in bulk samples not derived from A2 milk as well as in individual milk samples. The method allows us to quantify the relative proportion of β-CN variants in whole milk without eliminating whey protein by acid or enzymatic precipitation of caseins. The aim of this study was also to study the different behavior of β-CN and β-lactoglobulin (β-LG) in the presence of trichloroacetic acid (TCA). The higher sensitivity of β-CN to TCA allows quantifying β-CN variants after TCA fixation because β-LG is not visible. Monitoring β-CN variation in cattle breeds is important in order to maintain a certain balance between Pro67 and His67 in dairy products. Overall, the debate between A1 and A2 milk needs further investigation.
Yano, Takanori; Yoshida, Nobuyuki; Yu, Fujio; Wakamatsu, Miki; Takagi, Hiroshi
2015-07-01
Rhodococcus erythropolis N9T-4 shows extremely oligotrophic growth requiring atmospheric CO2 and forms its colonies on an inorganic basal medium (BM) without any additional carbon source. Screening of a random mutation library constructed by a unique genome deletion method that we established indicated that the aceA, aceB, and pckG genes encoding isocitrate lyase, malate synthase, and phosphoenolpyruvate carboxykinase, respectively, were requisite for survival on BM plates. The aceA- and aceB deletion mutants and the pckG deletion mutant grew well on BM plates containing L-malate and D-glucose, respectively, suggesting that the glyoxylate (GO) shunt and gluconeogenesis are essential for the oligotrophic growth of N9T-4. Interestingly, most of the enzyme activities in the TCA cycle were observed in the cell-free extract of N9T-4, with perhaps the most important exception being α-ketoglutarate dehydrogenase (KGDH) activity. Instead of the KGDH activity, we detected a remarkable level of α-ketoglutarate decarboxylase (KGD) activity, which is the activity exhibited by the E1 component of the KGDH complex in Mycobacterium tuberculosis. The recombinant KGD of N9T-4 catalyzed the decarboxylation of α-ketoglutarate to form succinic semialdehyde (SSA) in a time-dependent manner. Since N9T-4 also showed a detectable SSA dehydrogenase activity, we concluded that N9T-4 possesses a variant TCA cycle, which uses SSA rather than succinyl-CoA. These results suggest that oligotrophic N9T-4 cells utilize the GO shunt to avoid the loss of carbons as CO2 and to conserve CoA units in the TCA cycle.
Garcia-Lopez, J M; Provost, P J; Rush, J E; Zicker, S C; Burmaster, H; Freeman, L M
2001-01-01
To determine the prevalence of hypomagnesemia and hypocalcemia in horses with surgical colic. 35 horses with surgically managed colic. Serum concentrations of total magnesium (tMg2+) and calcium (tCa2+), as well as ionized magnesium (iMg2+) and calcium (iCa2+) were analyzed before surgery and 1, 3, 5, and 7 days following surgery. A lead-II ECG and pertinent clinical data were also obtained at each time. Preoperative serum tMg2+ and iMg2+ concentrations were below the reference range in 6 (17%) and 19 (54%) horses, respectively. Serum concentrations of tCa2+ and iCa2+ were less than the reference range in 20 (57%) and 30 (86%) horses before surgery. Horses with strangulating lesions of the gastrointestinal tract had significantly lower preoperative serum concentrations of iMg2+ and iCa2+, as well as a higher heart rate than horses with nonstrangulating lesions. Horses that developed postoperative ileus had significantly lower serum concentrations of iMg2+ after surgery. Serum concentrations of magnesium and calcium (total and ionized) correlated significantly with the PR, QRS, QT, and corrected QT (QTc) intervals. Horses that were euthanatized at the time of surgery (n = 7) had significantly lower preoperative serum concentrations of iMg2+, compared with horses that survived. Neither serum magnesium nor calcium concentrations were predictors of hospitalization time or survival. Hypomagnesemia and hypocalcemia were common during the perioperative period, particularly in horses with strangulating intestinal lesions and ileus. Serum concentrations of tMg2+ and tCa2+ were less sensitive than iMg2+ and iCa2+ in detecting horses with hypomagnesemia and hypocalcemia.