Sample records for controls bacterial genes

  1. A maize resistance gene functions against bacterial streak disease in rice

    PubMed Central

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

    2005-01-01

    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, which causes bacterial streak disease. Bacterial streak is an important disease of rice in Asia, and no simply inherited sources of resistance have been identified in rice. Although X. o. pv. oryzicola does not cause disease on maize, we identified a maize gene, Rxo1, that conditions a resistance reaction to a diverse collection of pathogen strains. Surprisingly, Rxo1 also controls resistance to the unrelated pathogen Burkholderia andropogonis, which causes bacterial stripe of sorghum and maize. The same gene thus controls resistance reactions to both pathogens and nonpathogens of maize. Rxo1 has a nucleotide-binding site-leucine-rich repeat structure, similar to many previously identified R genes. Most importantly, Rxo1 functions after transfer as a transgene to rice, demonstrating the feasibility of nonhost R gene transfer between cereals and providing a valuable tool for controlling bacterial streak disease. PMID:16230639

  2. A maize resistance gene functions against bacterial streak disease in rice.

    PubMed

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

    2005-10-25

    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, which causes bacterial streak disease. Bacterial streak is an important disease of rice in Asia, and no simply inherited sources of resistance have been identified in rice. Although X. o. pv. oryzicola does not cause disease on maize, we identified a maize gene, Rxo1, that conditions a resistance reaction to a diverse collection of pathogen strains. Surprisingly, Rxo1 also controls resistance to the unrelated pathogen Burkholderia andropogonis, which causes bacterial stripe of sorghum and maize. The same gene thus controls resistance reactions to both pathogens and nonpathogens of maize. Rxo1 has a nucleotide-binding site-leucine-rich repeat structure, similar to many previously identified R genes. Most importantly, Rxo1 functions after transfer as a transgene to rice, demonstrating the feasibility of nonhost R gene transfer between cereals and providing a valuable tool for controlling bacterial streak disease.

  3. Bacterial avirulence genes.

    PubMed

    Leach, J E; White, F F

    1996-01-01

    Although more than 30 bacterial avirulence genes have been cloned and characterized, the function of the gene products in the elictitation of resistance is unknown in all cases but one. The product of avrD from Pseudomonas syringae pv. glycinea likely functions indirectly to elicit resistance in soybean, that is, evidence suggests the gene product is an enzyme involved in elicitor production. In most if not all cases, bacterial avirulence gene function is dependent on interactions with the hypersensitive response and pathogenicity (hrp) genes. Many hrp genes are similar to genes involved in delivery of pathogenicity factors in mammalian bacterial pathogens. Thus, analogies between mammalian and plant pathogens may provide needed clues to elucidate how virulence gene products control induction of resistance.

  4. Impact of bacterial biocontrol agents on aflatoxin biosynthetic genes, aflD and aflR expression, and phenotypic aflatoxin B₁ production by Aspergillus flavus under different environmental and nutritional regimes.

    PubMed

    Al-Saad, Labeed A; Al-Badran, Adnan I; Al-Jumayli, Sami A; Magan, Naresh; Rodríguez, Alicia

    2016-01-18

    The objectives of this study were to examine the efficacy of four bacterial antagonists against Aspergillus flavus using 50:50 ratio of bacterial cells/conidia for the control of aflatoxin B1 (AFB1) production on two different nutritional matrices, nutrient and maize-based media at different water availabilities (0.98, 0.94 water activity (aw) on nutrient medium; 0.995, 0.98 aw on maize meal agar medium) at 35°C. The indicators of efficacy used were the relative expression of one structural and regulatory gene in the biosynthetic pathway (aflD and aflR respectively) and the production of AFB1. These studies showed that some of the bacterial species could significantly inhibit the relative expression of the aflD and aflR genes at both 0.98 and 0.94 aw on nutrient agar. On maize-based media some of the bacterial antagonists reduced the activity of both genes at 0.94 aw and some at 0.995 aw. However, the results for AFB1 production were not consistent with the effects on gene expression. Some bacterial species stimulated AFB1 production on both nutrient and maize-based media regardless of aw. However, some bacterial treatments did inhibit AFB1 production significantly when compared to the control. Overall, this study suggests that temporal studies are required on the biosynthetic genes under different environmental and nutritional conditions to evaluate the potential of antagonists to control AFB1. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Genome engineering and gene expression control for bacterial strain development.

    PubMed

    Song, Chan Woo; Lee, Joungmin; Lee, Sang Yup

    2015-01-01

    In recent years, a number of techniques and tools have been developed for genome engineering and gene expression control to achieve desired phenotypes of various bacteria. Here we review and discuss the recent advances in bacterial genome manipulation and gene expression control techniques, and their actual uses with accompanying examples. Genome engineering has been commonly performed based on homologous recombination. During such genome manipulation, the counterselection systems employing SacB or nucleases have mainly been used for the efficient selection of desired engineered strains. The recombineering technology enables simple and more rapid manipulation of the bacterial genome. The group II intron-mediated genome engineering technology is another option for some bacteria that are difficult to be engineered by homologous recombination. Due to the increasing demands on high-throughput screening of bacterial strains having the desired phenotypes, several multiplex genome engineering techniques have recently been developed and validated in some bacteria. Another approach to achieve desired bacterial phenotypes is the repression of target gene expression without the modification of genome sequences. This can be performed by expressing antisense RNA, small regulatory RNA, or CRISPR RNA to repress target gene expression at the transcriptional or translational level. All of these techniques allow efficient and rapid development and screening of bacterial strains having desired phenotypes, and more advanced techniques are expected to be seen. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Application of Chemical Genomics to Plant-Bacteria Communication: A High-Throughput System to Identify Novel Molecules Modulating the Induction of Bacterial Virulence Genes by Plant Signals.

    PubMed

    Vandelle, Elodie; Puttilli, Maria Rita; Chini, Andrea; Devescovi, Giulia; Venturi, Vittorio; Polverari, Annalisa

    2017-01-01

    The life cycle of bacterial phytopathogens consists of a benign epiphytic phase, during which the bacteria grow in the soil or on the plant surface, and a virulent endophytic phase involving the penetration of host defenses and the colonization of plant tissues. Innovative strategies are urgently required to integrate copper treatments that control the epiphytic phase with complementary tools that control the virulent endophytic phase, thus reducing the quantity of chemicals applied to economically and ecologically acceptable levels. Such strategies include targeted treatments that weaken bacterial pathogens, particularly those inhibiting early infection steps rather than tackling established infections. This chapter describes a reporter gene-based chemical genomic high-throughput screen for the induction of bacterial virulence by plant molecules. Specifically, we describe a chemical genomic screening method to identify agonist and antagonist molecules for the induction of targeted bacterial virulence genes by plant extracts, focusing on the experimental controls required to avoid false positives and thus ensuring the results are reliable and reproducible.

  7. Bacterial community and arsenic functional genes diversity in arsenic contaminated soils from different geographic locations

    PubMed Central

    Gu, Yunfu; D. Van Nostrand, Joy; Wu, Liyou; He, Zhili; Qin, Yujia; Zhao, Fang-Jie; Zhou, Jizhong

    2017-01-01

    To understand how soil microbial communities and arsenic (As) functional genes respond to soil arsenic (As) contamination, five soils contaminated with As at different levels were collected from diverse geographic locations, incubated for 54 days under flooded conditions, and examined by both MiSeq sequencing of 16S rRNA gene amplicons and functional gene microarray (GeoChip 4.0). The results showed that both bacterial community structure and As functional gene structure differed among geographical locations. The diversity of As functional genes correlated positively with the diversity of 16S rRNA genes (P< 0.05). Higher diversities of As functional genes and 16S rRNA genes were observed in the soils with higher available As. Soil pH, phosphate-extractable As, and amorphous Fe content were the most important factors in shaping the bacterial community structure and As transformation functional genes. Geographic location was also important in controlling both the bacterial community and As transformation functional potential. These findings provide insights into the variation of As transformation functional genes in soils contaminated with different levels of As at different geographic locations, and the impact of environmental As contamination on the soil bacterial community. PMID:28475654

  8. A comparative study of RNA and DNA as internal gene expression controls early in the developmental cycle of Chlamydia pneumoniae.

    PubMed

    Engström, Patrik; Bailey, Leslie; Onskog, Thomas; Bergström, Sven; Johansson, Jörgen

    2010-03-01

    Many microbial pathogens invade and proliferate within host cells and the molecular mechanism underlying this behavior is currently being revealed for several bacterial species. Testing clinically relevant antibacterial compounds and elucidating their effects on gene expression requires adequate controls, especially when studying genetically intractable organisms such as Chlamydia spp., for which various gene fusions cannot be constructed. Until now, relative mRNA levels in Chlamydia have been measured using different internal gene expression controls, including 16S rRNA, mRNAs, and DNA. Here, we compared the advantages and disadvantages of various internal expression controls during the early phase of Chlamydia pneumoniae development. The relative abundance of target mRNAs varied using the different internal control RNAs. This was partly due to variation in the transcript stability of the RNA species. Also, seven out of nine of the analyzed RNAs increased fivefold or more between 2 and 14 h postinfection, while the amount of DNA and number of cells remained essentially unaltered. Our results suggest that RNA should not be used as a gene expression control during the early phase of Chlamydia development, and that intrinsic bacterial DNA is preferable for that purpose because it is stable, abundant, and its relative amount is generally correlated with bacterial numbers.

  9. Induction of plant defense gene expression by plant activators and Pseudomonas syringae pv. tomato in greenhouse-grown tomatoes.

    PubMed

    Herman, M A B; Davidson, J K; Smart, C D

    2008-11-01

    Plant activators provide an appealing management option for bacterial diseases of greenhouse-grown tomatoes. Two types of plant activators, one that induces systemic acquired resistance (SAR) and a second that activates induced systemic resistance (ISR), were evaluated for control of Pseudomonas syringae pv. tomato and effect on plant defense gene activation. Benzothiadiazole (BTH, SAR-inducing compound) effectively reduced bacterial speck incidence and severity, both alone and in combination with the ISR-inducing product. Application of BTH also led to elevated activation of salicylic acid and ethylene-mediated responses, based on real-time polymerase chain reaction analysis of marker gene expression levels. In contrast, the ISR-inducing product (made up of plant growth-promoting rhizobacteria) inconsistently modified defense gene expression and did not provide disease control to the same level as did BTH. No antagonism was observed by combining the two activators as control of bacterial speck was similar to or better than BTH alone.

  10. Determination of internal controls for quantitative real time RT-PCR analysis of the effect of Edwardsiella tarda infection on gene expression in turbot (Scophthalmus maximus).

    PubMed

    Dang, Wei; Sun, Li

    2011-02-01

    In recent years, quantitative real time reverse transcriptase-PCR (qRT-PCR) has been used frequently in the study of gene expression in turbot (Scophthalmus maximus) in relation to bacterial infection. However, no investigations on appropriate qRT-PCR reference genes have been documented. In this report, we determined the potential of eight housekeeping genes, i.e. β-actin (ACTB), ribosomal protein L17 (RPL17), α-tubulin (TUBA), elongation factor-1-α(EF1A), β-2-Microglobulin (B2M), RNA polymerase II subunit D (RPSD), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and 18S ribosomal RNA (18S rRNA), as internal standards for qRT-PCR analysis of gene expression in turbot as a function of bacterial infection. For this purpose, the expression of the eight housekeeping genes in seven turbot tissues was determined by qRT-PCR before and after bacterial challenge, and the data were analyzed with the geNorm and NormFinder algorisms. The results showed that the expression of all the examined genes exhibited tissue-dependent variations both before and after bacterial challenge. Before bacterial challenge, geNorm and NormFinder identified RPSD as the gene that showed least tissue specific expression. At 12 h post-bacterial infection, geNorm ranked ACTB/GAPDH, 18S rRNA/ACTB, ACTB/GAPDH, 18S rRNA/ACTB, RPL17/TUBA, RPSD/GAPDH, and RPSD/B2M, respectively, as the most stably expressed genes in liver, spleen, kidney, gill, heart, muscle, and brain. Comparable ranking orders were produced by NormFinder. Similar results were obtained at 24 h post-bacterial infection. Taken together, these results indicate that RPSD is the most stable gene across tissue types under normal physiological conditions and that, during bacterial infection, ACTB might be used as an internal standard for the normalization of gene expression in immune relevant organs; however, no single gene or single pair of genes in the examined set of housekeeping genes can serve as a universal reference across all tissue types under the condition of bacterial infection. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. RNA interference of tubulin genes has lethal effects in Mythimna separate.

    PubMed

    Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji

    2018-05-23

    RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.

  12. Genetic analysis of a bacterial genetic exchange element: The gene transfer agent of Rhodobacter capsulatus

    PubMed Central

    Lang, Andrew S.; Beatty, J. T.

    2000-01-01

    An unusual system of genetic exchange exists in the purple nonsulfur bacterium Rhodobacter capsulatus. DNA transmission is mediated by a small bacteriophage-like particle called the gene transfer agent (GTA) that transfers random 4.5-kb segments of the producing cell's genome to recipient cells, where allelic replacement occurs. This paper presents the results of gene cloning, analysis, and mutagenesis experiments that show that GTA resembles a defective prophage related to bacteriophages from diverse genera of bacteria, which has been adopted by R. capsulatus for genetic exchange. A pair of cellular proteins, CckA and CtrA, appear to constitute part of a sensor kinase/response regulator signaling pathway that is required for expression of GTA structural genes. This signaling pathway controls growth-phase-dependent regulation of GTA gene messages, yielding maximal gene expression in the stationary phase. We suggest that GTA is an ancient prophage remnant that has evolved in concert with the bacterial genome, resulting in a genetic exchange process controlled by the bacterial cell. PMID:10639170

  13. Temporal changes in soil bacterial and archaeal communities with different fertilizers in tea orchards.

    PubMed

    Wang, Hua; Yang, Shao-hui; Yang, Jing-ping; Lv, Ya-min; Zhao, Xing; Pang, Ji-liang

    2014-11-01

    It is important to understand the effects of temporal changes in microbial communities in the acidic soils of tea orchards with different fertilizers. A field experiment involving organic fertilizer (OF), chemical fertilizer (CF), and unfertilized control (CK) treatments was arranged to analyze the temporal changes in the bacterial and archaeal communities at bimonthly intervals based on the 16S ribosomal RNA (rRNA) gene using terminal restriction fragment length polymorphism (T-RFLP) profiling. The abundances of total bacteria, total archaea, and selected functional genes (bacterial and archaeal amoA, bacterial narG, nirK, nirS, and nosZ) were determined by quantitative polymerase chain reaction (qPCR). The results indicate that the structures of bacterial and archaeal communities varied significantly with time and fertilization based on changes in the relative abundance of dominant T-RFs. The abundancy of the detected genes changed with time. The total bacteria, total archaea, and archaeal amoA were less abundant in July. The bacterial amoA and denitrifying genes were less abundant in September, except the nirK gene. The OF treatment increased the abundance of the observed genes, while the CF treatment had little influence on them. The soil temperature significantly affected the bacterial and archaeal community structures. The soil moisture was significantly correlated with the abundance of denitrifying genes. Of the soil chemical properties, soil organic carbon was the most important factor and was significantly correlated with the abundance of the detected genes, except the nirK gene. Overall, this study demonstrated the effects of both temporal alteration and organic fertilizer on the structures of microbial communities and the abundance of genes involved in the nitrogen cycle.

  14. Temporal changes in soil bacterial and archaeal communities with different fertilizers in tea orchards* #

    PubMed Central

    Wang, Hua; Yang, Shao-hui; Yang, Jing-ping; Lv, Ya-min; Zhao, Xing; Pang, Ji-liang

    2014-01-01

    It is important to understand the effects of temporal changes in microbial communities in the acidic soils of tea orchards with different fertilizers. A field experiment involving organic fertilizer (OF), chemical fertilizer (CF), and unfertilized control (CK) treatments was arranged to analyze the temporal changes in the bacterial and archaeal communities at bimonthly intervals based on the 16S ribosomal RNA (rRNA) gene using terminal restriction fragment length polymorphism (T-RFLP) profiling. The abundances of total bacteria, total archaea, and selected functional genes (bacterial and archaeal amoA, bacterial narG, nirK, nirS, and nosZ) were determined by quantitative polymerase chain reaction (qPCR). The results indicate that the structures of bacterial and archaeal communities varied significantly with time and fertilization based on changes in the relative abundance of dominant T-RFs. The abundancy of the detected genes changed with time. The total bacteria, total archaea, and archaeal amoA were less abundant in July. The bacterial amoA and denitrifying genes were less abundant in September, except the nirK gene. The OF treatment increased the abundance of the observed genes, while the CF treatment had little influence on them. The soil temperature significantly affected the bacterial and archaeal community structures. The soil moisture was significantly correlated with the abundance of denitrifying genes. Of the soil chemical properties, soil organic carbon was the most important factor and was significantly correlated with the abundance of the detected genes, except the nirK gene. Overall, this study demonstrated the effects of both temporal alteration and organic fertilizer on the structures of microbial communities and the abundance of genes involved in the nitrogen cycle. PMID:25367788

  15. CRISPR Perturbation of Gene Expression Alters Bacterial Fitness under Stress and Reveals Underlying Epistatic Constraints.

    PubMed

    Otoupal, Peter B; Erickson, Keesha E; Escalas-Bordoy, Antoni; Chatterjee, Anushree

    2017-01-20

    The evolution of antibiotic resistance has engendered an impending global health crisis that necessitates a greater understanding of how resistance emerges. The impact of nongenetic factors and how they influence the evolution of resistance is a largely unexplored area of research. Here we present a novel application of CRISPR-Cas9 technology for investigating how gene expression governs the adaptive pathways available to bacteria during the evolution of resistance. We examine the impact of gene expression changes on bacterial adaptation by constructing a library of deactivated CRISPR-Cas9 synthetic devices to tune the expression of a set of stress-response genes in Escherichia coli. We show that artificially inducing perturbations in gene expression imparts significant synthetic control over fitness and growth during stress exposure. We present evidence that these impacts are reversible; strains with synthetically perturbed gene expression regained wild-type growth phenotypes upon stress removal, while maintaining divergent growth characteristics under stress. Furthermore, we demonstrate a prevailing trend toward negative epistatic interactions when multiple gene perturbations are combined simultaneously, thereby posing an intrinsic constraint on gene expression underlying adaptive trajectories. Together, these results emphasize how CRISPR-Cas9 can be employed to engineer gene expression changes that shape bacterial adaptation, and present a novel approach to synthetically control the evolution of antimicrobial resistance.

  16. Emerging contaminants and nutrients synergistically affect the spread of class 1 integron-integrase (intI1) and sul1 genes within stable streambed bacterial communities.

    PubMed

    Subirats, Jèssica; Timoner, Xisca; Sànchez-Melsió, Alexandre; Balcázar, José Luis; Acuña, Vicenç; Sabater, Sergi; Borrego, Carles M

    2018-07-01

    Wastewater effluents increase the nutrient load of receiving streams while introducing a myriad of anthropogenic chemical pollutants that challenge the resident aquatic (micro)biota. Disentangling the effects of both kind of stressors and their potential interaction on the dissemination of antibiotic resistance genes in bacterial communities requires highly controlled manipulative experiments. In this work, we investigated the effects of a combined regime of nutrients (at low, medium and high concentrations) and a mixture of emerging contaminants (ciprofloxacin, erythromycin, sulfamethoxazole, diclofenac, and methylparaben) on the bacterial composition, abundance and antibiotic resistance profile of biofilms grown in artificial streams. In particular, we investigated the effect of this combined stress on genes encoding resistance to ciprofloxacin (qnrS), erythromycin (ermB), sulfamethoxazole (sul1 and sul2) as well as the class 1 integron-integrase gene (intI1). Only genes conferring resistance to sulfonamides (sul1 and sul2) and intI1 gene were detected in all treatments during the study period. Besides, bacterial communities exposed to emerging contaminants showed higher copy numbers of sul1 and intI1 genes than those not exposed, whereas nutrient amendments did not affect their abundance. However, bacterial communities exposed to both emerging contaminants and a high nutrient concentration (1, 25 and 1 mg L -1 of phosphate, nitrate and ammonium, respectively) showed the highest increase on the abundance of sul1 and intI1 genes thus suggesting a factors synergistic effect of both stressors. Since none of the treatments caused a significant change on the composition of bacterial communities, the enrichment of sul1 and intI1 genes within the community was caused by their dissemination under the combined pressure exerted by nutrients and emerging contaminants. To the best of our knowledge, this is the first study demonstrating the contribution of nutrients on the maintenance and spread of antibiotic resistance genes in streambed biofilms under controlled conditions. Our results also highlight that nutrients could enhance the effect of emerging contaminants on the dissemination of antibiotic resistance. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. High throughput 16SrRNA gene sequencing reveals the correlation between Propionibacterium acnes and sarcoidosis.

    PubMed

    Zhao, Meng-Meng; Du, Shan-Shan; Li, Qiu-Hong; Chen, Tao; Qiu, Hui; Wu, Qin; Chen, Shan-Shan; Zhou, Ying; Zhang, Yuan; Hu, Yang; Su, Yi-Liang; Shen, Li; Zhang, Fen; Weng, Dong; Li, Hui-Ping

    2017-02-01

    This study aims to use high throughput 16SrRNA gene sequencing to examine the bacterial profile of lymph node biopsy samples of patients with sarcoidosis and to further verify the association between Propionibacterium acnes (P. acnes) and sarcoidosis. A total of 36 mediastinal lymph node biopsy specimens were collected from 17 cases of sarcoidosis, 8 tuberculosis (TB group), and 11 non-infectious lung diseases (control group). The V4 region of the bacterial 16SrRNA gene in the specimens was amplified and sequenced using the high throughput sequencing platform MiSeq, and bacterial profile was established. The data analysis software QIIME and Metastats were used to compare bacterial relative abundance in the three patient groups. Overall, 545 genera were identified; 38 showed significantly lower and 29 had significantly higher relative abundance in the sarcoidosis group than in the TB and control groups (P < 0.01). P. acnes 16SrRNA was exclusively found in all the 17 samples of the sarcoidosis group, whereas was not detected in the TB and control groups. The relative abundance of P. acnes in the sarcoidosis group (0.16% ± 0. 11%) was significantly higher than that in the TB (Metastats analysis: P = 0.0010, q = 0.0044) and control groups (Metastats analysis: P = 0.0010, q = 0.0038). The relative abundance of P. granulosum was only 0.0022% ± 0. 0044% in the sarcoidosis group. P. granulosum 16SrRNA was not detected in the other two groups. High throughput 16SrRNA gene sequencing appears to be a useful tool to investigate the bacterial profile of sarcoidosis specimens. The results suggest that P. acnes may be involved in sarcoidosis development.

  18. The Bacterial Mobile Resistome Transfer Network Connecting the Animal and Human Microbiomes

    PubMed Central

    Hu, Yongfei; Yang, Xi; Li, Jing; Lv, Na; Liu, Fei; Wu, Jun; Lin, Ivan Y. C.; Wu, Na; Gao, George F.

    2016-01-01

    ABSTRACT Horizontally acquired antibiotic resistance genes (ARGs) in bacteria are highly mobile and have been ranked as principal risk resistance determinants. However, the transfer network of the mobile resistome and the forces driving mobile ARG transfer are largely unknown. Here, we present the whole profile of the mobile resistome in 23,425 bacterial genomes and explore the effects of phylogeny and ecology on the recent transfer (≥99% nucleotide identity) of mobile ARGs. We found that mobile ARGs are mainly present in four bacterial phyla and are significantly enriched in Proteobacteria. The recent mobile ARG transfer network, which comprises 703 bacterial species and 16,859 species pairs, is shaped by the bacterial phylogeny, while an ecological barrier also exists, especially when interrogating bacteria colonizing different human body sites. Phylogeny is still a driving force for the transfer of mobile ARGs between farm animals and the human gut, and, interestingly, the mobile ARGs that are shared between the human and animal gut microbiomes are also harbored by diverse human pathogens. Taking these results together, we suggest that phylogeny and ecology are complementary in shaping the bacterial mobile resistome and exert synergistic effects on the development of antibiotic resistance in human pathogens. IMPORTANCE The development of antibiotic resistance threatens our modern medical achievements. The dissemination of antibiotic resistance can be largely attributed to the transfer of bacterial mobile antibiotic resistance genes (ARGs). Revealing the transfer network of these genes in bacteria and the forces driving the gene flow is of great importance for controlling and predicting the emergence of antibiotic resistance in the clinic. Here, by analyzing tens of thousands of bacterial genomes and millions of human and animal gut bacterial genes, we reveal that the transfer of mobile ARGs is mainly controlled by bacterial phylogeny but under ecological constraints. We also found that dozens of ARGs are transferred between the human and animal gut and human pathogens. This work demonstrates the whole profile of mobile ARGs and their transfer network in bacteria and provides further insight into the evolution and spread of antibiotic resistance in nature. PMID:27613679

  19. The Bacterial Mobile Resistome Transfer Network Connecting the Animal and Human Microbiomes.

    PubMed

    Hu, Yongfei; Yang, Xi; Li, Jing; Lv, Na; Liu, Fei; Wu, Jun; Lin, Ivan Y C; Wu, Na; Weimer, Bart C; Gao, George F; Liu, Yulan; Zhu, Baoli

    2016-11-15

    Horizontally acquired antibiotic resistance genes (ARGs) in bacteria are highly mobile and have been ranked as principal risk resistance determinants. However, the transfer network of the mobile resistome and the forces driving mobile ARG transfer are largely unknown. Here, we present the whole profile of the mobile resistome in 23,425 bacterial genomes and explore the effects of phylogeny and ecology on the recent transfer (≥99% nucleotide identity) of mobile ARGs. We found that mobile ARGs are mainly present in four bacterial phyla and are significantly enriched in Proteobacteria The recent mobile ARG transfer network, which comprises 703 bacterial species and 16,859 species pairs, is shaped by the bacterial phylogeny, while an ecological barrier also exists, especially when interrogating bacteria colonizing different human body sites. Phylogeny is still a driving force for the transfer of mobile ARGs between farm animals and the human gut, and, interestingly, the mobile ARGs that are shared between the human and animal gut microbiomes are also harbored by diverse human pathogens. Taking these results together, we suggest that phylogeny and ecology are complementary in shaping the bacterial mobile resistome and exert synergistic effects on the development of antibiotic resistance in human pathogens. The development of antibiotic resistance threatens our modern medical achievements. The dissemination of antibiotic resistance can be largely attributed to the transfer of bacterial mobile antibiotic resistance genes (ARGs). Revealing the transfer network of these genes in bacteria and the forces driving the gene flow is of great importance for controlling and predicting the emergence of antibiotic resistance in the clinic. Here, by analyzing tens of thousands of bacterial genomes and millions of human and animal gut bacterial genes, we reveal that the transfer of mobile ARGs is mainly controlled by bacterial phylogeny but under ecological constraints. We also found that dozens of ARGs are transferred between the human and animal gut and human pathogens. This work demonstrates the whole profile of mobile ARGs and their transfer network in bacteria and provides further insight into the evolution and spread of antibiotic resistance in nature. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  20. Fiber supplementation influences phylogenetic structure and functional capacity of the human intestinal microbiome: follow-up of a randomized controlled trial.

    PubMed

    Holscher, Hannah D; Caporaso, J Gregory; Hooda, Seema; Brulc, Jennifer M; Fahey, George C; Swanson, Kelly S

    2015-01-01

    In our published randomized, double-blind, placebo-controlled, 3-period crossover trial, healthy adult men (n = 21) consumed bars containing no supplemental fiber (placebo; NFC), polydextrose (21 g/d), and soluble corn fiber (SCF; 21 g/d) for 21 d each. Fecal specimens were collected between days 16 and 21 for fermentative end-product analysis and 16S ribosomal RNA bacterial gene amplification for bacterial taxa identification. Fiber supplementation decreased fecal putrefaction compounds and shifted abundances of several bacterial taxa. The objective was to perform whole-genome shotgun 454 pyrosequencing on the same fecal specimens collected in that clinical trial to obtain comprehensive fecal bacterial genome sequencing coverage and explore the full range of bacterial genetic information in the fecal microbiome, thereby using a systematic approach to study the impact of dietary fiber supplementation on fecal metabolites, bacterial taxa, and bacterial metagenomes. Fecal samples were subjected to whole-genome shotgun 454 pyrosequencing to identify both fecal bacterial populations present and their functional genetic capacity. Whole-genome shotgun sequencing results revealed that fiber consumption shifted the Bacteroidetes:Firmicutes ratio, increasing the relative abundance of Bacteroidetes 12 ± 2% and 13 ± 2% with polydextrose and SCF, respectively, compared with NFC. Bivariate correlations showed a positive correlation between the Bacteroidetes:Firmicutes ratio and total dietary fiber intake but not body mass index. Principal coordinates analysis of Bray-Curtis distances indicated that bacterial gene composition was more similar in participants consuming fibers (polydextrose and SCF combined) in comparison with NFC. Shifts in bacterial gene abundances after polydextrose and SCF supplementation included genes associated with carbohydrate, amino acid, and lipid metabolism, as well as metabolism of cofactors and vitamins. This study conveys novel information about the impact of dietary fiber supplementation on the phylogenetic structure and functional capacity of the fecal microbiome of healthy adults. © 2015 American Society for Nutrition.

  1. Changes in rhizosphere bacterial gene expression following glyphosate treatment.

    PubMed

    Newman, Molli M; Lorenz, Nicola; Hoilett, Nigel; Lee, Nathan R; Dick, Richard P; Liles, Mark R; Ramsier, Cliff; Kloepper, Joseph W

    2016-05-15

    In commercial agriculture, populations and interactions of rhizosphere microflora are potentially affected by the use of specific agrichemicals, possibly by affecting gene expression in these organisms. To investigate this, we examined changes in bacterial gene expression within the rhizosphere of glyphosate-tolerant corn (Zea mays) and soybean (Glycine max) in response to long-term glyphosate (PowerMAX™, Monsanto Company, MO, USA) treatment. A long-term glyphosate application study was carried out using rhizoboxes under greenhouse conditions with soil previously having no history of glyphosate exposure. Rhizosphere soil was collected from the rhizoboxes after four growing periods. Soil microbial community composition was analyzed using microbial phospholipid fatty acid (PLFA) analysis. Total RNA was extracted from rhizosphere soil, and samples were analyzed using RNA-Seq analysis. A total of 20-28 million bacterial sequences were obtained for each sample. Transcript abundance was compared between control and glyphosate-treated samples using edgeR. Overall rhizosphere bacterial metatranscriptomes were dominated by transcripts related to RNA and carbohydrate metabolism. We identified 67 differentially expressed bacterial transcripts from the rhizosphere. Transcripts downregulated following glyphosate treatment involved carbohydrate and amino acid metabolism, and upregulated transcripts involved protein metabolism and respiration. Additionally, bacterial transcripts involving nutrients, including iron, nitrogen, phosphorus, and potassium, were also affected by long-term glyphosate application. Overall, most bacterial and all fungal PLFA biomarkers decreased after glyphosate treatment compared to the control. These results demonstrate that long-term glyphosate use can affect rhizosphere bacterial activities and potentially shift bacterial community composition favoring more glyphosate-tolerant bacteria. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Identification and Antimicrobial Resistance of Bacteria Isolated from Probiotic Products Used in Shrimp Culture.

    PubMed

    Noor Uddin, Gazi Md; Larsen, Marianne Halberg; Christensen, Henrik; Aarestrup, Frank M; Phu, Tran Minh; Dalsgaard, Anders

    2015-01-01

    Probiotics are increasingly used in aquaculture to control diseases and improve feed digestion and pond water quality; however, little is known about the antimicrobial resistance properties of such probiotic bacteria and to what extent they may contribute to the development of bacterial resistance in aquaculture ponds. Concerns have been raised that the declared information on probiotic product labels are incorrect and information on bacterial composition are often missing. We therefore evaluated seven probiotics commonly used in Vietnamese shrimp culture for their bacterial species content, phenotypic antimicrobial resistance and associated transferable resistance genes. The bacterial species was established by 16S rRNA sequence analysis of 125 representative bacterial isolates. MIC testing was done for a range of antimicrobials and whole genome sequencing of six multiple antimicrobial resistant Bacillus spp. used to identify resistance genes and genetic elements associated with horizontal gene transfer. Thirteen bacterial species declared on the probiotic products could not be identified and 11 non-declared Bacillus spp. were identified. Although our culture-based isolation and identification may have missed a few bacterial species present in the tested products this would represent minor bias, but future studies may apply culture independent identification methods like pyro sequencing. Only 6/60 isolates were resistant to more than four antimicrobials and whole genome sequencing showed that they contained macrolide (ermD), tetracycline (tetL), phenicol (fexA) and trimethoprim (dfrD, dfrG and dfrK) resistance genes, but not known structures associated with horizontal gene transfer. Probiotic bacterial strains used in Vietnamese shrimp culture seem to contribute with very limited types and numbers of resistance genes compared to the naturally occurring bacterial species in aquaculture environments. Approval procedures of probiotic products must be strengthened through scientific-based efficacy trials and product labels should allow identification of individual bacterial strains and inform the farmer on specific purpose, dosage and correct application measures.

  3. Genomic analysis reveals the major driving forces of bacterial life in the rhizosphere

    PubMed Central

    Matilla, Miguel A; Espinosa-Urgel, Manuel; Rodríguez-Herva, José J; Ramos, Juan L; Ramos-González, María Isabel

    2007-01-01

    Background Mutualistic interactions less well known than those between rhizobia and legumes are commonly found between plants and bacteria, frequently pseudomonads, which colonize roots and adjacent soil areas (the rhizosphere). Results A global analysis of Pseudomonas putida genes expressed during their interaction with maize roots revealed how a bacterial population adjusts its genetic program to this lifestyle. Differentially expressed genes were identified by comparing rhizosphere-colonizing populations with three distinct controls covering a variety of nutrients, growth phases and life styles (planktonic and sessile). Ninety rhizosphere up-regulated (rup) genes, which were induced relative to all three controls, were identified, whereas there was no repressed gene in common between the experiments. Genes involved in amino acid uptake and metabolism of aromatic compounds were preferentially expressed in the rhizosphere, which reflects the availability of particular nutrients in root exudates. The induction of efflux pumps and enzymes for glutathione metabolism indicates that adaptation to adverse conditions and stress (oxidative) response are crucial for bacterial life in this environment. The finding of a GGDEF/EAL domain response regulator among the induced genes suggests a role for the turnover of the secondary messenger c-diGMP in root colonization. Several mutants in rup genes showed reduced fitness in competitive root colonization. Conclusion Our results show the importance of two selective forces of different nature to colonize the rhizosphere: stress adaptation and availability of particular nutrients. We also identify new traits conferring bacterial survival in this niche and open a way to the characterization of specific signalling and regulatory processes governing the plant-Pseudomonas association. PMID:17784941

  4. A novel ion-beam-mutation effect application in identification of gene involved in bacterial antagonism to fungal infection of ornamental crops

    NASA Astrophysics Data System (ADS)

    Mahadtanapuk, S.; Teraarusiri, W.; Nanakorn, W.; Yu, L. D.; Thongkumkoon, P.; Anuntalabhochai, S.

    2014-05-01

    This work is on a novel application of ion beam effect on biological mutation. Bacillus licheniformis (B. licheniformis) is a common soil bacterium with an antagonistic effect on Curcuma alismatifolia Gagnep. and Chrysanthemum indicum Linn. In an attempt to control fungal diseases of local crops by utilizing B. licheniformis, we carried out gene analysis of the bacterium to understand the bacterial antagonistic mechanism. The bacterial cells were bombarded to induce mutations using nitrogen ion beam. After ion bombardment, DNA analysis revealed that the modified polymorphism fragment present in the wild type was missing in a bacterial mutant which lost the antifungal activity. The fragments conserved in the wild type but lost in the mutant bacteria was identified to code for the thioredoxin reductase (TrxR) gene. The gene analysis showed that the TrxR gene from B. licheniformis had the expression of the antagonism to fungi in a synchronous time evolution with the fungus inhibition when the bacteria were co-cultivated with the fungi. The collective results indicate the TrxR gene responsible for the antagonism of bacteria B. licheniformis to fungal infection.

  5. Messing with Bacterial Quorum Sensing

    PubMed Central

    González, Juan E.; Keshavan, Neela D.

    2006-01-01

    Quorum sensing is widely recognized as an efficient mechanism to regulate expression of specific genes responsible for communal behavior in bacteria. Several bacterial phenotypes essential for the successful establishment of symbiotic, pathogenic, or commensal relationships with eukaryotic hosts, including motility, exopolysaccharide production, biofilm formation, and toxin production, are often regulated by quorum sensing. Interestingly, eukaryotes produce quorum-sensing-interfering (QSI) compounds that have a positive or negative influence on the bacterial signaling network. This eukaryotic interference could result in further fine-tuning of bacterial quorum sensing. Furthermore, recent work involving the synthesis of structural homologs to the various quorum-sensing signal molecules has resulted in the development of additional QSI compounds that could be used to control pathogenic bacteria. The creation of transgenic plants that express bacterial quorum-sensing genes is yet another strategy to interfere with bacterial behavior. Further investigation on the manipulation of quorum-sensing systems could provide us with powerful tools against harmful bacteria. PMID:17158701

  6. Characterization of regulatory pathways in Xylella fastidiosa: genes and phenotypes controlled by algU.

    PubMed

    Shi, Xiang Yang; Dumenyo, C Korsi; Hernandez-Martinez, Rufina; Azad, Hamid; Cooksey, Donald A

    2007-11-01

    Many virulence genes in plant bacterial pathogens are coordinately regulated by "global" regulatory genes. Conducting DNA microarray analysis of bacterial mutants of such genes, compared with the wild type, can help to refine the list of genes that may contribute to virulence in bacterial pathogens. The regulatory gene algU, with roles in stress response and regulation of the biosynthesis of the exopolysaccharide alginate in Pseudomonas aeruginosa and many other bacteria, has been extensively studied. The role of algU in Xylella fastidiosa, the cause of Pierce's disease of grapevines, was analyzed by mutation and whole-genome microarray analysis to define its involvement in aggregation, biofilm formation, and virulence. In this study, an algU::nptII mutant had reduced cell-cell aggregation, attachment, and biofilm formation and lower virulence in grapevines. Microarray analysis showed that 42 genes had significantly lower expression in the algU::nptII mutant than in the wild type. Among these are several genes that could contribute to cell aggregation and biofilm formation, as well as other physiological processes such as virulence, competition, and survival.

  7. SPARTA: Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis.

    PubMed

    Johnson, Benjamin K; Scholz, Matthew B; Teal, Tracy K; Abramovitch, Robert B

    2016-02-04

    Many tools exist in the analysis of bacterial RNA sequencing (RNA-seq) transcriptional profiling experiments to identify differentially expressed genes between experimental conditions. Generally, the workflow includes quality control of reads, mapping to a reference, counting transcript abundance, and statistical tests for differentially expressed genes. In spite of the numerous tools developed for each component of an RNA-seq analysis workflow, easy-to-use bacterially oriented workflow applications to combine multiple tools and automate the process are lacking. With many tools to choose from for each step, the task of identifying a specific tool, adapting the input/output options to the specific use-case, and integrating the tools into a coherent analysis pipeline is not a trivial endeavor, particularly for microbiologists with limited bioinformatics experience. To make bacterial RNA-seq data analysis more accessible, we developed a Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis (SPARTA). SPARTA is a reference-based bacterial RNA-seq analysis workflow application for single-end Illumina reads. SPARTA is turnkey software that simplifies the process of analyzing RNA-seq data sets, making bacterial RNA-seq analysis a routine process that can be undertaken on a personal computer or in the classroom. The easy-to-install, complete workflow processes whole transcriptome shotgun sequencing data files by trimming reads and removing adapters, mapping reads to a reference, counting gene features, calculating differential gene expression, and, importantly, checking for potential batch effects within the data set. SPARTA outputs quality analysis reports, gene feature counts and differential gene expression tables and scatterplots. SPARTA provides an easy-to-use bacterial RNA-seq transcriptional profiling workflow to identify differentially expressed genes between experimental conditions. This software will enable microbiologists with limited bioinformatics experience to analyze their data and integrate next generation sequencing (NGS) technologies into the classroom. The SPARTA software and tutorial are available at sparta.readthedocs.org.

  8. Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Coelomocytes of Sea Cucumber (Apostichopus japonicus) after Vibrio splendidus Challenge.

    PubMed

    Gao, Qiong; Liao, Meijie; Wang, Yingeng; Li, Bin; Zhang, Zheng; Rong, Xiaojun; Chen, Guiping; Wang, Lan

    2015-07-17

    Vibrio splendidus is identified as one of the major pathogenic factors for the skin ulceration syndrome in sea cucumber (Apostichopus japonicus), which has vastly limited the development of the sea cucumber culture industry. In order to screen the immune genes involving Vibrio splendidus challenge in sea cucumber and explore the molecular mechanism of this process, the related transcriptome and gene expression profiling of resistant and susceptible biotypes of sea cucumber with Vibrio splendidus challenge were collected for analysis. A total of 319,455,942 trimmed reads were obtained, which were assembled into 186,658 contigs. After that, 89,891 representative contigs (without isoform) were clustered. The analysis of the gene expression profiling identified 358 differentially expression genes (DEGs) in the bacterial-resistant group, and 102 DEGs in the bacterial-susceptible group, compared with that in control group. According to the reported references and annotation information from BLAST, GO and KEGG, 30 putative bacterial-resistant genes and 19 putative bacterial-susceptible genes were identified from DEGs. The qRT-PCR results were consistent with the RNA-Seq results. Furthermore, many DGEs were involved in immune signaling related pathways, such as Endocytosis, Lysosome, MAPK, Chemokine and the ERBB signaling pathway.

  9. Transcriptome Analysis and Discovery of Genes Involved in Immune Pathways from Coelomocytes of Sea Cucumber (Apostichopus japonicus) after Vibrio splendidus Challenge

    PubMed Central

    Gao, Qiong; Liao, Meijie; Wang, Yingeng; Li, Bin; Zhang, Zheng; Rong, Xiaojun; Chen, Guiping; Wang, Lan

    2015-01-01

    Vibrio splendidus is identified as one of the major pathogenic factors for the skin ulceration syndrome in sea cucumber (Apostichopus japonicus), which has vastly limited the development of the sea cucumber culture industry. In order to screen the immune genes involving Vibrio splendidus challenge in sea cucumber and explore the molecular mechanism of this process, the related transcriptome and gene expression profiling of resistant and susceptible biotypes of sea cucumber with Vibrio splendidus challenge were collected for analysis. A total of 319,455,942 trimmed reads were obtained, which were assembled into 186,658 contigs. After that, 89,891 representative contigs (without isoform) were clustered. The analysis of the gene expression profiling identified 358 differentially expression genes (DEGs) in the bacterial-resistant group, and 102 DEGs in the bacterial-susceptible group, compared with that in control group. According to the reported references and annotation information from BLAST, GO and KEGG, 30 putative bacterial-resistant genes and 19 putative bacterial-susceptible genes were identified from DEGs. The qRT-PCR results were consistent with the RNA-Seq results. Furthermore, many DGEs were involved in immune signaling related pathways, such as Endocytosis, Lysosome, MAPK, Chemokine and the ERBB signaling pathway. PMID:26193268

  10. Combined prime-boost vaccination against tick-borne encephalitis (TBE) using a recombinant vaccinia virus and a bacterial plasmid both expressing TBE virus non-structural NS1 protein

    PubMed Central

    Aleshin, SE; Timofeev, AV; Khoretonenko, MV; Zakharova, LG; Pashvykina, GV; Stephenson, JR; Shneider, AM; Altstein, AD

    2005-01-01

    Background Heterologous prime-boost immunization protocols using different gene expression systems have proven to be successful tools in protecting against various diseases in experimental animal models. The main reason for using this approach is to exploit the ability of expression cassettes to prime or boost the immune system in different ways during vaccination procedures. The purpose of the project was to study the ability of recombinant vaccinia virus (VV) and bacterial plasmid, both carrying the NS1 gene from tick-borne encephalitis (TBE) virus under the control of different promoters, to protect mice against lethal challenge using a heterologous prime-boost vaccination protocol. Results The heterologous prime-boost vaccination protocol, using a VV recombinant and bacterial plasmid, both containing the NS1 TBE virus protein gene under the control of different promoters, achieved a high level of protection in mice against lethal challenge with a highly pathogenic TBE virus strain. No signs of pronounced TBE infection were detected in the surviving animals. Conclusion Heterologous prime-boost vaccination protocols using recombinant VV and bacterial plasmids could be used for the development of flavivirus vaccines. PMID:16076390

  11. Intestinal microbiota and innate immunity-related gene alteration in cirrhotic rats with liver transplantation.

    PubMed

    Xie, Y R; Liu, S L; Liu, X; Luo, Z B; Zhu, B; Li, Z F; Li, L J; He, Y; Jiang, L; Li, H; Ruan, B

    2011-12-01

    The present study investigated the alteration of intestinal microbiota, innate immunity-related genes, and bacterial translocation in rats with cirrhosis and liver transplantation. Specific pathogen-free Sprague-Dawley rats were randomized into 4 groups: (1) normal controls (N); (2) liver cirrhosis (LC); (3) normal control groups with liver transplantation (LTN); and (4) liver cirrhosis with liver transplantation (LTC). We examined plasma endotoxin, bacterial tacslocation, denaturing gradient gel electrophoresis (DGGE) profile of intestinal mucosa-associated bacteria, abundance of key bacterial populations, and expression of innate immunity-related gene. The LTC and LC group, showed higher endotoxin levels (1.08±0.73 EU/mL and 0.74±0.70 EU/mL, respectively) than the N group (0.27±0.13 EU/mL; P<.05). the incidence of bacterial translocation (BT) to liver and mesenteric lymph nodes (MLN), and the number of total bacteria were increased significantly in the LTC and LC groups compared with the N group (P<.05). The counts of Lactobacilli and Bacteroides were lower, whereas Enterobacteria were higher in the LC than the N group (P<.05). Mucins (MUC2, MUC3) and Toll-like receptors (TLR2, TLR4) messenger RNA (mRNA) expression were significantly higher in the LC and LTC groups than the N group (P<.05). The marked difference between the groups in the overall structure of the bacterial community was also generated by DGGE profiles. Liver cirrhosis disturbs intestinal microbiota and innate immunity-related genes, which contributes to endotoxemia and bacterial translocation. These had not completely recovered in cirrhotic rats until 1 month after orthotopic liver transplantation. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Ectopic activation of the rice NLR heteropair RGA4/RGA5 confers resistance to bacterial blight and bacterial leaf streak diseases.

    PubMed

    Hutin, Mathilde; Césari, Stella; Chalvon, Véronique; Michel, Corinne; Tran, Tuan Tu; Boch, Jens; Koebnik, Ralf; Szurek, Boris; Kroj, Thomas

    2016-10-01

    Bacterial blight (BB) and bacterial leaf streak (BLS) are important diseases in Oryza sativa caused by Xanthomonas oryzae pv. oryzae (Xoo) and Xanthomonas oryzae pv. oryzicola (Xoc), respectively. In both bacteria, transcription activator-like (TAL) effectors are major virulence determinants that act by transactivating host genes downstream of effector-binding elements (EBEs) bound in a sequence-specific manner. Resistance to Xoo is mostly related to the action of TAL effectors, either by polymorphisms that prevent the induction of susceptibility (S) genes or by executor (R) genes with EBEs embedded in their promoter, and that induce cell death and resistance. For Xoc, no resistance sources are known in rice. Here, we investigated whether the recognition of effectors by nucleotide binding and leucine-rich repeat domain immune receptors (NLRs), the most widespread resistance mechanism in plants, is also able to stop BB and BLS. In one instance, transgenic rice lines harboring the AVR1-CO39 effector gene from the rice blast fungus Magnaporthe oryzae, under the control of an inducible promoter, were challenged with transgenic Xoo and Xoc strains carrying a TAL effector designed to transactivate the inducible promoter. This induced AVR1-CO39 expression and triggered BB and BLS resistance when the corresponding Pi-CO39 resistance locus was present. In a second example, the transactivation of an auto-active NLR by Xoo-delivered designer TAL effectors resulted in BB resistance, demonstrating that NLR-triggered immune responses efficiently control Xoo. This forms the foundation for future BB and BLS disease control strategies, whereupon endogenous TAL effectors will target synthetic promoter regions of Avr or NLR executor genes. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  13. Premature terminator analysis sheds light on a hidden world of bacterial transcriptional attenuation.

    PubMed

    Naville, Magali; Gautheret, Daniel

    2010-01-01

    Bacterial transcription attenuation occurs through a variety of cis-regulatory elements that control gene expression in response to a wide range of signals. The signal-sensing structures in attenuators are so diverse and rapidly evolving that only a small fraction have been properly annotated and characterized to date. Here we apply a broad-spectrum detection tool in order to achieve a more complete view of the transcriptional attenuation complement of key bacterial species. Our protocol seeks gene families with an unusual frequency of 5' terminators found across multiple species. Many of the detected attenuators are part of annotated elements, such as riboswitches or T-boxes, which often operate through transcriptional attenuation. However, a significant fraction of candidates were not previously characterized in spite of their unmistakable footprint. We further characterized some of these new elements using sequence and secondary structure analysis. We also present elements that may control the expression of several non-homologous genes, suggesting co-transcription and response to common signals. An important class of such elements, which we called mobile attenuators, is provided by 3' terminators of insertion sequences or prophages that may be exapted as 5' regulators when inserted directly upstream of a cellular gene. We show here that attenuators involve a complex landscape of signal-detection structures spanning the entire bacterial domain. We discuss possible scenarios through which these diverse 5' regulatory structures may arise or evolve.

  14. Genetic information transfer promotes cooperation in bacteria

    PubMed Central

    Dimitriu, Tatiana; Lotton, Chantal; Bénard-Capelle, Julien; Misevic, Dusan; Brown, Sam P.; Lindner, Ariel B.; Taddei, François

    2014-01-01

    Many bacterial species are social, producing costly secreted “public good” molecules that enhance the growth of neighboring cells. The genes coding for these cooperative traits are often propagated via mobile genetic elements and can be virulence factors from a biomedical perspective. Here, we present an experimental framework that links genetic information exchange and the selection of cooperative traits. Using simulations and experiments based on a synthetic bacterial system to control public good secretion and plasmid conjugation, we demonstrate that horizontal gene transfer can favor cooperation. In a well-mixed environment, horizontal transfer brings a direct infectious advantage to any gene, regardless of its cooperation properties. However, in a structured population transfer selects specifically for cooperation by increasing the assortment among cooperative alleles. Conjugation allows cooperative alleles to overcome rarity thresholds and invade bacterial populations structured purely by stochastic dilution effects. Our results provide an explanation for the prevalence of cooperative genes on mobile elements, and suggest a previously unidentified benefit of horizontal gene transfer for bacteria. PMID:25024219

  15. Sibling rivalry: related bacterial small RNAs and their redundant and non-redundant roles

    PubMed Central

    Caswell, Clayton C.; Oglesby-Sherrouse, Amanda G.; Murphy, Erin R.

    2014-01-01

    Small RNA molecules (sRNAs) are now recognized as key regulators controlling bacterial gene expression, as sRNAs provide a quick and efficient means of positively or negatively altering the expression of specific genes. To date, numerous sRNAs have been identified and characterized in a myriad of bacterial species, but more recently, a theme in bacterial sRNAs has emerged: the presence of more than one highly related sRNAs produced by a given bacterium, here termed sibling sRNAs. Sibling sRNAs are those that are highly similar at the nucleotide level, and while it might be expected that sibling sRNAs exert identical regulatory functions on the expression of target genes based on their high degree of relatedness, emerging evidence is demonstrating that this is not always the case. Indeed, there are several examples of bacterial sibling sRNAs with non-redundant regulatory functions, but there are also instances of apparent regulatory redundancy between sibling sRNAs. This review provides a comprehensive overview of the current knowledge of bacterial sibling sRNAs, and also discusses important questions about the significance and evolutionary implications of this emerging class of regulators. PMID:25389522

  16. Sibling rivalry: related bacterial small RNAs and their redundant and non-redundant roles.

    PubMed

    Caswell, Clayton C; Oglesby-Sherrouse, Amanda G; Murphy, Erin R

    2014-01-01

    Small RNA molecules (sRNAs) are now recognized as key regulators controlling bacterial gene expression, as sRNAs provide a quick and efficient means of positively or negatively altering the expression of specific genes. To date, numerous sRNAs have been identified and characterized in a myriad of bacterial species, but more recently, a theme in bacterial sRNAs has emerged: the presence of more than one highly related sRNAs produced by a given bacterium, here termed sibling sRNAs. Sibling sRNAs are those that are highly similar at the nucleotide level, and while it might be expected that sibling sRNAs exert identical regulatory functions on the expression of target genes based on their high degree of relatedness, emerging evidence is demonstrating that this is not always the case. Indeed, there are several examples of bacterial sibling sRNAs with non-redundant regulatory functions, but there are also instances of apparent regulatory redundancy between sibling sRNAs. This review provides a comprehensive overview of the current knowledge of bacterial sibling sRNAs, and also discusses important questions about the significance and evolutionary implications of this emerging class of regulators.

  17. Bacterial responses to antibiotics and their combinations.

    PubMed

    Mitosch, Karin; Bollenbach, Tobias

    2014-12-01

    Antibiotics affect bacterial cell physiology at many levels. Rather than just compensating for the direct cellular defects caused by the drug, bacteria respond to antibiotics by changing their morphology, macromolecular composition, metabolism, gene expression and possibly even their mutation rate. Inevitably, these processes affect each other, resulting in a complex response with changes in the expression of numerous genes. Genome-wide approaches can thus help in gaining a comprehensive understanding of bacterial responses to antibiotics. In addition, a combination of experimental and theoretical approaches is needed for identifying general principles that underlie these responses. Here, we review recent progress in our understanding of bacterial responses to antibiotics and their combinations, focusing on effects at the levels of growth rate and gene expression. We concentrate on studies performed in controlled laboratory conditions, which combine promising experimental techniques with quantitative data analysis and mathematical modeling. While these basic research approaches are not immediately applicable in the clinic, uncovering the principles and mechanisms underlying bacterial responses to antibiotics may, in the long term, contribute to the development of new treatment strategies to cope with and prevent the rise of resistant pathogenic bacteria.

  18. Suitability of partial 16S ribosomal RNA gene sequence analysis for the identification of dangerous bacterial pathogens.

    PubMed

    Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F

    2007-03-01

    In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.

  19. Widespread genetic switches and toxicity resistance proteins for fluoride.

    PubMed

    Baker, Jenny L; Sudarsan, Narasimhan; Weinberg, Zasha; Roth, Adam; Stockbridge, Randy B; Breaker, Ronald R

    2012-01-13

    Most riboswitches are metabolite-binding RNA structures located in bacterial messenger RNAs where they control gene expression. We have discovered a riboswitch class in many bacterial and archaeal species whose members are selectively triggered by fluoride but reject other small anions, including chloride. These fluoride riboswitches activate expression of genes that encode putative fluoride transporters, enzymes that are known to be inhibited by fluoride, and additional proteins of unknown function. Our findings indicate that most organisms are naturally exposed to toxic levels of fluoride and that many species use fluoride-sensing RNAs to control the expression of proteins that alleviate the deleterious effects of this anion.

  20. Widespread Genetic Switches and Toxicity Resistance Proteins for Fluoride

    PubMed Central

    Weinberg, Zasha; Roth, Adam; Stockbridge, Randy B.; Breaker, Ronald R.

    2014-01-01

    Most riboswitches are metabolite-binding RNA structures located in bacterial messenger RNAs where they control gene expression. We have discovered a riboswitch class in many bacterial and archaeal species whose members are selectively triggered by fluoride but reject other small anions, including chloride. These fluoride riboswitches activate expression of genes that encode putative fluoride transporters, enzymes that are known to be inhibited by fluoride, and additional proteins of unknown function. Our findings indicate that most organisms are naturally exposed to toxic levels of fluoride and that many species use fluoride-sensing RNAs to control the expression of proteins that alleviate the deleterious effects of this anion. PMID:22194412

  1. Expression of the cloned ColE1 kil gene in normal and Kilr Escherichia coli.

    PubMed Central

    Altieri, M; Suit, J L; Fan, M L; Luria, S E

    1986-01-01

    The kil gene of the ColE1 plasmid was cloned under control of the lac promoter. Its expression under this promoter gave rise to the same pattern of bacterial cell damage and lethality as that which accompanies induction of the kil gene in the colicin operon by mitomycin C. This confirms that cell damage after induction is solely due to expression of kil and is independent of the cea or imm gene products. Escherichia coli derivatives resistant to the lethal effects of kil gene expression under either the normal or the lac promoter were isolated and found to fall into several classes, some of which were altered in sensitivity to agents that affect the bacterial envelope. PMID:2946661

  2. The Extent of Genome Flux and Its Role in the Differentiation of Bacterial Lineages

    PubMed Central

    Nowell, Reuben W.; Green, Sarah; Laue, Bridget E.; Sharp, Paul M.

    2014-01-01

    Horizontal gene transfer (HGT) and gene loss are key processes in bacterial evolution. However, the role of gene gain and loss in the emergence and maintenance of ecologically differentiated bacterial populations remains an open question. Here, we use whole-genome sequence data to quantify gene gain and loss for 27 lineages of the plant-associated bacterium Pseudomonas syringae. We apply an extensive error-control procedure that accounts for errors in draft genome data and greatly improves the accuracy of patterns of gene occurrence among these genomes. We demonstrate a history of extensive genome fluctuation for this species and show that individual lineages could have acquired thousands of genes in the same period in which a 1% amino acid divergence accrues in the core genome. Elucidating the dynamics of genome fluctuation reveals the rapid turnover of gained genes, such that the majority of recently gained genes are quickly lost. Despite high observed rates of fluctuation, a phylogeny inferred from patterns of gene occurrence is similar to a phylogeny based on amino acid replacements within the core genome. Furthermore, the core genome phylogeny suggests that P. syringae should be considered a number of distinct species, with levels of divergence at least equivalent to those between recognized bacterial species. Gained genes are transferred from a variety of sources, reflecting the depth and diversity of the potential gene pool available via HGT. Overall, our results provide further insights into the evolutionary dynamics of genome fluctuation and implicate HGT as a major factor contributing to the diversification of P. syringae lineages. PMID:24923323

  3. Insight into the effects of different cropping systems on soil bacterial community and tobacco bacterial wilt rate.

    PubMed

    Niu, Jiaojiao; Chao, Jin; Xiao, Yunhua; Chen, Wu; Zhang, Chao; Liu, Xueduan; Rang, Zhongwen; Yin, Huaqun; Dai, Linjian

    2017-01-01

    Rotation is an effective strategy to control crop disease and improve plant health. However, the effects of crop rotation on soil bacterial community composition and structure, and crop health remain unclear. In this study, using 16S rRNA gene sequencing, we explored the soil bacterial communities under four different cropping systems, continuous tobacco cropping (control group), tobacco-maize rotation, tobacco-lily rotation, and tobacco-turnip rotation. Results of detrended correspondence analysis and dissimilarity tests showed that soil bacterial community composition and structure changed significantly among the four groups, such that Acidobacteria and Actinobacteria were more abundant in the maize rotation group (16.6 and 11.5%, respectively) than in the control (8.5 and 7.1%, respectively). Compared with the control group (57.78%), maize and lily were effective rotation crops in controlling tobacco bacterial wilt (about 23.54 and 48.67%). On the other hand, tobacco bacterial wilt rate was increased in the turnip rotation (59.62%) relative to the control. Further study revealed that the abundances of several bacterial populations were directly correlated with tobacco bacterial wilt. For example, Acidobacteria and Actinobacteria were significantly negatively correlated to the tobacco bacterial wilt rate, so they may be probiotic bacteria. Canonical correspondence analysis showed that soil pH and calcium content were key factors in determining soil bacterial communities. In conclusion, our study revealed the composition and structure of bacterial communities under four different cropping systems and may unveil molecular mechanisms for the interactions between soil microorganisms and crop health. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Capturing Early Changes in the Marine Bacterial Community as a Result of Crude Oil Pollution in a Mesocosm Experiment

    PubMed Central

    Krolicka, Adriana; Boccadoro, Catherine; Nilsen, Mari Mæland; Baussant, Thierry

    2017-01-01

    The results of marine bacterial community succession from a short-term study of seawater incubations at 4°C to North Sea crude oil are presented herein. Oil was used alone (O) or in combination with a dispersant (OD). Marine bacterial communities resulting from these incubations were characterized by a fingerprinting analysis and pyrosequencing of the 16S rRNA gene with the aim of 1) revealing differences in bacterial communities between the control, O treatment, and OD treatment and 2) identifying the operational taxonomic units (OTUs) of early responders in order to define the bacterial gene markers of oil pollution for in situ monitoring. After an incubation for 1 d, the distribution of the individual ribotypes of bacterial communities in control and oil-treated (O and OD) tanks differed. Differences related to the structures of bacterial communities were observed at later stages of the incubation. Among the early responders identified (Pseudoalteromonas, Sulfitobacter, Vibrio, Pseudomonas, Glaciecola, Neptunomonas, Methylophaga, and Pseudofulvibacter), genera that utilize a disintegrated biomass or hydrocarbons as well as biosurfactant producers were detected. None of these genera included obligate hydrocarbonoclastic bacteria (OHCB). After an incubation for 1 d, the abundances of Glaciecola and Pseudofulvibacter were approximately 30-fold higher in the OD and O tanks than in the control tank. OTUs assigned to the Glaciecola genus were represented more in the OD tank, while those of Pseudofulvibacter were represented more in the O tank. We also found that 2 to 3% of the structural community shift originated from the bacterial community in the oil itself, with Polaribacter being a dominant bacterium. PMID:29187706

  5. Capturing Early Changes in the Marine Bacterial Community as a Result of Crude Oil Pollution in a Mesocosm Experiment.

    PubMed

    Krolicka, Adriana; Boccadoro, Catherine; Nilsen, Mari Mæland; Baussant, Thierry

    2017-12-27

    The results of marine bacterial community succession from a short-term study of seawater incubations at 4°C to North Sea crude oil are presented herein. Oil was used alone (O) or in combination with a dispersant (OD). Marine bacterial communities resulting from these incubations were characterized by a fingerprinting analysis and pyrosequencing of the 16S rRNA gene with the aim of 1) revealing differences in bacterial communities between the control, O treatment, and OD treatment and 2) identifying the operational taxonomic units (OTUs) of early responders in order to define the bacterial gene markers of oil pollution for in situ monitoring.After an incubation for 1 d, the distribution of the individual ribotypes of bacterial communities in control and oil-treated (O and OD) tanks differed. Differences related to the structures of bacterial communities were observed at later stages of the incubation. Among the early responders identified (Pseudoalteromonas, Sulfitobacter, Vibrio, Pseudomonas, Glaciecola, Neptunomonas, Methylophaga, and Pseudofulvibacter), genera that utilize a disintegrated biomass or hydrocarbons as well as biosurfactant producers were detected. None of these genera included obligate hydrocarbonoclastic bacteria (OHCB). After an incubation for 1 d, the abundances of Glaciecola and Pseudofulvibacter were approximately 30-fold higher in the OD and O tanks than in the control tank. OTUs assigned to the Glaciecola genus were represented more in the OD tank, while those of Pseudofulvibacter were represented more in the O tank. We also found that 2 to 3% of the structural community shift originated from the bacterial community in the oil itself, with Polaribacter being a dominant bacterium.

  6. Lubiprostone ameliorates the cystic fibrosis mouse intestinal phenotype.

    PubMed

    De Lisle, Robert C; Mueller, Racquel; Roach, Eileen

    2010-09-15

    Cystic fibrosis (CF) is caused by mutations in the CFTR gene that impair the function of CFTR, a cAMP-regulated anion channel. In the small intestine loss of CFTR function creates a dehydrated, acidic luminal environment which is believed to cause an accumulation of mucus, a phenotype characteristic of CF. CF mice have small intestinal bacterial overgrowth, an altered innate immune response, and impaired intestinal transit. We investigated whether lubiprostone, which can activate the CLC2 Cl- channel, would improve the intestinal phenotype in CF mice. Cftr(tm1UNC) (CF) and wildtype (WT) littermate mice on the C57BL/6J background were used. Lubiprostone (10 μg/kg-day) was administered by gavage for two weeks. Mucus accumulation was estimated from crypt lumen widths in periodic acid-Schiff base, Alcian blue stained sections. Luminal bacterial load was measured by qPCR for the bacterial 16S gene. Gastric emptying and small intestinal transit in fasted mice were assessed using gavaged rhodamine dextran. Gene expression was evaluated by Affymetrix Mouse430 2.0 microarray and qRT-PCR. Crypt width in control CF mice was 700% that of WT mice (P < 0.001). Lubiprostone did not affect WT crypt width but, unexpectedly, increased CF crypt width 22% (P = 0.001). Lubiprostone increased bacterial load in WT mice to 490% of WT control levels (P = 0.008). Conversely, lubiprostone decreased bacterial overgrowth in CF mice by 60% (P = 0.005). Lubiprostone increased gastric emptying at 20 min postgavage in both WT (P < 0.001) and CF mice (P < 0.001). Lubiprostone enhanced small intestinal transit in WT mice (P = 0.024) but not in CF mice (P = 0.377). Among other innate immune markers, expression of mast cell genes was elevated 4-to 40-fold in the CF intestine as compared to WT, and lubiprostone treatment of CF mice decreased expression to WT control levels. These results indicate that lubiprostone has some benefits for the CF intestinal phenotype, especially on bacterial overgrowth and the innate immune response. The unexpected observation of increased mucus accumulation in the crypts of lubiprostone-treated CF mice suggests the possibility that lubiprostone increases mucus secretion.

  7. Lubiprostone ameliorates the cystic fibrosis mouse intestinal phenotype

    PubMed Central

    2010-01-01

    Background Cystic fibrosis (CF) is caused by mutations in the CFTR gene that impair the function of CFTR, a cAMP-regulated anion channel. In the small intestine loss of CFTR function creates a dehydrated, acidic luminal environment which is believed to cause an accumulation of mucus, a phenotype characteristic of CF. CF mice have small intestinal bacterial overgrowth, an altered innate immune response, and impaired intestinal transit. We investigated whether lubiprostone, which can activate the CLC2 Cl- channel, would improve the intestinal phenotype in CF mice. Methods Cftrtm1UNC (CF) and wildtype (WT) littermate mice on the C57BL/6J background were used. Lubiprostone (10 μg/kg-day) was administered by gavage for two weeks. Mucus accumulation was estimated from crypt lumen widths in periodic acid-Schiff base, Alcian blue stained sections. Luminal bacterial load was measured by qPCR for the bacterial 16S gene. Gastric emptying and small intestinal transit in fasted mice were assessed using gavaged rhodamine dextran. Gene expression was evaluated by Affymetrix Mouse430 2.0 microarray and qRT-PCR. Results Crypt width in control CF mice was 700% that of WT mice (P < 0.001). Lubiprostone did not affect WT crypt width but, unexpectedly, increased CF crypt width 22% (P = 0.001). Lubiprostone increased bacterial load in WT mice to 490% of WT control levels (P = 0.008). Conversely, lubiprostone decreased bacterial overgrowth in CF mice by 60% (P = 0.005). Lubiprostone increased gastric emptying at 20 min postgavage in both WT (P < 0.001) and CF mice (P < 0.001). Lubiprostone enhanced small intestinal transit in WT mice (P = 0.024) but not in CF mice (P = 0.377). Among other innate immune markers, expression of mast cell genes was elevated 4-to 40-fold in the CF intestine as compared to WT, and lubiprostone treatment of CF mice decreased expression to WT control levels. Conclusions These results indicate that lubiprostone has some benefits for the CF intestinal phenotype, especially on bacterial overgrowth and the innate immune response. The unexpected observation of increased mucus accumulation in the crypts of lubiprostone-treated CF mice suggests the possibility that lubiprostone increases mucus secretion. PMID:20843337

  8. The urinary microbiome in women with mixed urinary incontinence compared to similarly aged controls.

    PubMed

    Komesu, Yuko M; Richter, Holly E; Carper, Benjamin; Dinwiddie, Darrell L; Lukacz, Emily S; Siddiqui, Nazema Y; Sung, Vivian W; Zyczynski, Halina M; Ridgeway, Beri; Rogers, Rebecca G; Arya, Lily A; Mazloomdoost, Donna; Gantz, Marie G

    2018-06-16

    Previous studies have suggested that women with urinary incontinence have an altered urinary microbiome. We hypothesized that the microbiome in women with mixed urinary incontinence (MUI) differed from controls and tested this hypothesis using bacterial gene sequencing techniques. This multicenter study compared the urinary microbiome in women with MUI and similarly aged controls. Catheterized urine samples were obtained; v4-6 regions of the 16S rRNA gene were sequenced to identify bacteria. Bacterial predominance (> 50% of an individual's genera) was compared between MUI and controls. Bacterial sequences were categorized into "community types" using Dirichlet multinomial mixture (DMM) methods. Generalized linear mixed models predicted MUI/control status based on clinical characteristics and community type. Post-hoc analyses were performed in women < 51 and ≥ 51 years. Sample size estimates required 200 samples to detect a 20% difference in Lactobacillus predominance with P < 0.05. Of 212 samples, 97.6% were analyzed (123 MUI/84 controls, mean age 53 ± 11 years). Overall Lactobacillus predominance did not differ between MUI and controls (45/123 = 36.6% vs. 36/84 = 42.9%, P = 0.36). DMM analyses revealed six community types; communities differed by age (P = 0.001). A High-Lactobacillus (89.2% Lactobacillus) community had a greater proportion of controls (19/84 = 22.6%, MUI 11/123 = 8.9%). Overall, bacterial community types did not differ in MUI and controls. However, post-hoc analysis of women < 51 years found that bacterial community types distinguished MUI from controls (P = 0.041); Moderate-Lactobacillus (aOR 7.78, CI 1.85-32.62) and Mixed (aOR 7.10, CI 1.32-38.10) community types were associated with MUI. Community types did not differentiate MUI and controls in women ≥ 51 years (P = 0.94). Women with MUI and controls did not differ in overall Lactobacillus predominance. In younger women, urinary bacterial community types differentiated MUI from controls.

  9. Distinct antimicrobial peptide expression determines host species-specific bacterial associations

    PubMed Central

    Franzenburg, Sören; Walter, Jonas; Künzel, Sven; Wang, Jun; Baines, John F.; Bosch, Thomas C. G.; Fraune, Sebastian

    2013-01-01

    Animals are colonized by coevolved bacterial communities, which contribute to the host’s health. This commensal microbiota is often highly specific to its host-species, inferring strong selective pressures on the associated microbes. Several factors, including diet, mucus composition, and the immune system have been proposed as putative determinants of host-associated bacterial communities. Here we report that species-specific antimicrobial peptides account for different bacterial communities associated with closely related species of the cnidarian Hydra. Gene family extensions for potent antimicrobial peptides, the arminins, were detected in four Hydra species, with each species possessing a unique composition and expression profile of arminins. For functional analysis, we inoculated arminin-deficient and control polyps with bacterial consortia characteristic for different Hydra species and compared their selective preferences by 454 pyrosequencing of the bacterial microbiota. In contrast to control polyps, arminin-deficient polyps displayed decreased potential to select for bacterial communities resembling their native microbiota. This finding indicates that species-specific antimicrobial peptides shape species-specific bacterial associations. PMID:24003149

  10. Vizantin inhibits bacterial adhesion without affecting bacterial growth and causes Streptococcus mutans biofilm to detach by altering its internal architecture.

    PubMed

    Takenaka, Shoji; Oda, Masataka; Domon, Hisanori; Ohsumi, Tatsuya; Suzuki, Yuki; Ohshima, Hayato; Yamamoto, Hirofumi; Terao, Yutaka; Noiri, Yuichiro

    2016-11-11

    An ideal antibiofilm strategy is to control both in the quality and quantity of biofilm while maintaining the benefits derived from resident microflora. Vizantin, a recently developed immunostimulating compound, has also been found to have antibiofilm property. This study evaluated the influence on biofilm formation of Streptococcus mutans in the presence of sulfated vizantin and biofilm development following bacterial adhesion on a hydroxyapatite disc coated with sulfated vizantin. Supplementation with sulfated vizantin up to 50 μM did not affect either bacterial growth or biofilm formation, whereas 50 μM sulfated vizantin caused the biofilm to readily detach from the surface. Sulfated vizantin at the concentration of 50 μM upregulated the expression of the gtfB and gtfC genes, but downregulated the expression of the gtfD gene, suggesting altered architecture in the biofilm. Biofilm development on the surface coated with sulfated vizantin was inhibited depending on the concentration, suggesting prevention from bacterial adhesion. Among eight genes related to bacterial adherence in S. mutans, expression of gtfB and gtfC was significantly upregulated, whereas the expression of gtfD, GbpA and GbpC was downregulated according to the concentration of vizantin, especially with 50 μM vizantin by 0.8-, 0.4-, and 0.4-fold, respectively. These findings suggest that sulfated vizantin may cause structural degradation as a result of changing gene regulation related to bacterial adhesion and glucan production of S. mutans. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Prevalence of antibiotic resistance genes in bacterial communities associated with Cladophora glomerata mats along the nearshore of Lake Ontario.

    PubMed

    Ibsen, Michael; Fernando, Dinesh M; Kumar, Ayush; Kirkwood, Andrea E

    2017-05-01

    The alga Cladophora glomerata can erupt in nuisance blooms throughout the lower Great Lakes. Since bacterial abundance increases with the emergence and decay of Cladophora, we investigated the prevalence of antibiotic resistance (ABR) in Cladophora-associated bacterial communities up-gradient and down-gradient from a large sewage treatment plant (STP) on Lake Ontario. Although STPs are well-known sources of ABR, we also expected detectable ABR from up-gradient wetland communities, since they receive surface run-off from urban and agricultural sources. Statistically significant differences in aquatic bacterial abundance and ABR were found between down-gradient beach samples and up-gradient coastal wetland samples (ANOVA, Holm-Sidak test, p < 0.05). Decaying and free-floating Cladophora sampled near the STP had the highest bacterial densities overall, including on ampicillin- and vancomycin-treated plates. However, quantitative polymerase chain reaction analysis of the ABR genes ampC, tetA, tetB, and vanA from environmental communities showed a different pattern. Some of the highest ABR gene levels occurred at the 2 coastal wetland sites (vanA). Overall, bacterial ABR profiles from environmental samples were distinguishable between living and decaying Cladophora, inferring that Cladophora may control bacterial ABR depending on its life-cycle stage. Our results also show how spatially and temporally dynamic ABR is in nearshore aquatic bacteria, which warrants further research.

  12. Transcriptional response of Musca domestica larvae to bacterial infection.

    PubMed

    Tang, Ting; Li, Xiang; Yang, Xue; Yu, Xue; Wang, Jianhui; Liu, Fengsong; Huang, Dawei

    2014-01-01

    The house fly Musca domestica, a cosmopolitan dipteran insect, is a significant vector for human and animal bacterial pathogens, but little is known about its immune response to these pathogens. To address this issue, we inoculated the larvae with a mixture of Escherichia coli and Staphylococcus aureus and profiled the transcriptome 6, 24, and 48 h thereafter. Many genes known to controlling innate immunity in insects were induced following infection, including genes encoding pattern recognition proteins (PGRPs), various components of the Toll and IMD signaling pathways and of the proPO-activating and redox systems, and multiple antimicrobial peptides. Interestingly, we also uncovered a large set of novel immune response genes including two broad-spectrum antimicrobial peptides (muscin and domesticin), which might have evolved to adapt to house-fly's unique ecological environments. Finally, genes mediating oxidative phosphorylation were repressed at 48 h post-infection, suggesting disruption of energy homeostasis and mitochondrial function at the late stages of infection. Collectively, our data reveal dynamic changes in gene expression following bacterial infection in the house fly, paving the way for future in-depth analysis of M. domestica's immune system.

  13. Genetic Variation in the β2-Adrenocepter Gene Is Associated with Susceptibility to Bacterial Meningitis in Adults

    PubMed Central

    Adriani, Kirsten S.; Brouwer, Matthijs C.; Baas, Frank; Zwinderman, Aeilko H.; van der Ende, Arie; van de Beek, Diederik

    2012-01-01

    Recently, the biased β2-adrenoceptor/β-arrestin pathway was shown to play a pivotal role in crossing of the blood brain barrier by Neisseria meningitidis. We hypothesized that genetic variation in the β2-adrenoceptor gene (ADRB2) may influence susceptibility to bacterial meningitis. In a prospective genetic association study we genotyped 542 patients with CSF culture proven community acquired bacterial meningitis and 376 matched controls for 2 functional single nucleotide polymorphisms in the β2-adrenoceptor gene (ADRB2). Furthermore, we analyzed if the use of non-selective beta-blockers, which bind to the β2-adrenoceptor, influenced the risk of bacterial meningitis. We identified a functional polymorphism in ADRB2 (rs1042714) to be associated with an increased risk for bacterial meningitis (Odds ratio [OR] 1.35, 95% confidence interval [CI] 1.04–1.76; p = 0.026). The association remained significant after correction for age and was more prominent in patients with pneumococcal meningitis (OR 1.52, 95% CI 1.12–2.07; p = 0.007). For meningococcal meningitis the difference in genotype frequencies between patients and controls was similar to that in pneumococcal meningitis, but this was not statistically significant (OR 1.43, 95% CI 0.60–3.38; p = 0.72). Patients with bacterial meningitis had a lower frequency of non-selective beta-blockers use compared to the age matched population (0.9% vs. 1.8%), although this did not reach statistical significance (OR 1.96 [95% CI 0.88–4.39]; p = 0.09). In conclusion, we identified an association between a genetic variant in the β2-adrenoceptor and increased susceptibility to bacterial meningitis. The potential benefit of pharmacological treatment targeting the β2-adrenoceptor to prevent bacterial meningitis in the general population or patients with bacteraemia should be further studied in both experimental studies and observational cohorts. PMID:22624056

  14. Ribosome reinitiation at leader peptides increases translation of bacterial proteins.

    PubMed

    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A

    2016-04-16

    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.

  15. Cytotoxic Effect Associated with Overexpression of QNR Proteins in Escherichia coli.

    PubMed

    Machuca, Jesús; Diaz de Alba, Paula; Recacha, Esther; Pascual, Álvaro; Rodriguez-Martinez, José Manuel

    2017-10-01

    The objective was to evaluate the cytotoxic effect associated with overexpression of multiple Qnr-like plasmid-mediated quinolone resistance (PMQR) mechanisms in Escherichia coli. Coding regions of different PMQR genes (qnrA1, qnrB1, qnrC, qnrD1, qnrS1, and qepA2) and efsqnr were cloned into pET29a(+) vector and overexpressed in E. coli BL21. E. coli BL21 with and without an empty pET29a(+) vector were used as controls. The cytotoxic effect associated with PMQR mechanism overexpression was determined by transmission electron microscopy and viability assays. Overexpressed qnr genes produced loss of bacterial viability in the range of 77-97% compared with the controls, comparable with loss of viability associated with EfsQnr overexpression (97%). No loss of viability was observed in E. coli overexpressing QepA2. In transmission electron microscopy assays, signs of cytotoxicity were observed in E. coli cells overexpressing EfsQnr and Qnr proteins (30-45% of the bacterial population showed morphological changes). Morphological changes were observed in less than 5% of bacterial populations from the control strains and E. coli overexpressing QepA2. Overexpression of qnr genes produces a cytotoxic cellular and structural effect in E. coli, the magnitude of which varies depending on the family of Qnr proteins.

  16. Does a drop in the bucket make a splash? Assessing the impact of antibiotic use on plants.

    PubMed

    McManus, Patricia S

    2014-06-01

    Antibiotics are applied to plants to prevent bacterial diseases, although the diversity of antibiotics and total amounts used are dwarfed by antibiotic use in animal agriculture. Nevertheless, the release of antibiotics into the open environment during crop treatment draws scrutiny for its potential impact on the global pool of resistance genes. The main use of antibiotics on plants is application of streptomycin to prevent fire blight, a serious disease of apple and pear trees. A series of recent studies identified and quantified antibiotic resistance genes and profiled bacterial communities in apple orchard plots that were or were not sprayed with streptomycin. While the specific objectives and methods varied, the results of these studies suggest that streptomycin application for fire blight control does not influence bacterial community structure or increase the abundance of resistance genes in orchards. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Gene Expression of Lytic Endopeptidases AlpA and AlpB from Lysobacter sp. XL1 in Pseudomonads.

    PubMed

    Tsfasman, Irina M; Lapteva, Yulia S; Krasovskaya, Ludmila A; Kudryakova, Irina V; Vasilyeva, Natalia V; Granovsky, Igor E; Stepnaya, Olga A

    2015-01-01

    Development of an efficient expression system for (especially secreted) bacterial lytic enzymes is a complicated task due to the specificity of their action. The substrate for such enzymes is peptidoglycan, the main structural component of bacterial cell walls. For this reason, expression of recombinant lytic proteins is often accompanied with lysis of the producing bacterium. This paper presents data on the construction of an inducible system for expression of the lytic peptidases AlpA and AlpB from Lysobacter sp. XL1 in Pseudomonas fluorescens Q2-87, which provides for the successful secretion of these proteins into the culture liquid. In this system, the endopeptidase gene under control of the T7lac promoter was integrated into the bacterial chromosome, as well as the Escherichia coli lactose operon repressor protein gene. The T7 pol gene under lac promoter control, which encodes the phage T7 RNA polymerase, is maintained in Pseudomonas cells on the plasmids. Media and cultivation conditions for the recombinant strains were selected to enable the production of AlpA and AlpB by a simple purification protocol. Production of recombinant lytic enzymes should contribute to the development of new-generation antimicrobial drugs whose application will not be accompanied by selection of resistant microorganisms. © 2015 S. Karger AG, Basel.

  18. A Host-Produced Autoinducer-2 Mimic Activates Bacterial Quorum Sensing.

    PubMed

    Ismail, Anisa S; Valastyan, Julie S; Bassler, Bonnie L

    2016-04-13

    Host-microbial symbioses are vital to health; nonetheless, little is known about the role crosskingdom signaling plays in these relationships. In a process called quorum sensing, bacteria communicate with one another using extracellular signal molecules called autoinducers. One autoinducer, AI-2, is proposed to promote interspecies bacterial communication, including in the mammalian gut. We show that mammalian epithelia produce an AI-2 mimic activity in response to bacteria or tight-junction disruption. This AI-2 mimic is detected by the bacterial AI-2 receptor, LuxP/LsrB, and can activate quorum-sensing-controlled gene expression, including in the enteric pathogen Salmonella typhimurium. AI-2 mimic activity is induced when epithelia are directly or indirectly exposed to bacteria, suggesting that a secreted bacterial component(s) stimulates its production. Mutagenesis revealed genes required for bacteria to both detect and stimulate production of the AI-2 mimic. These findings uncover a potential role for the mammalian AI-2 mimic in fostering crosskingdom signaling and host-bacterial symbioses. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Tailoring the Immune Response via Customization of Pathogen Gene Expression.

    PubMed

    Runco, Lisa M; Stauft, Charles B; Coleman, J Robert

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.

  20. Tailoring the Immune Response via Customization of Pathogen Gene Expression

    PubMed Central

    Runco, Lisa M.; Stauft, Charles B.

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development. PMID:24719769

  1. Seeing red; the development of pON.mCherry, a broad-host range constitutive expression plasmid for Gram-negative bacteria.

    PubMed

    Gebhardt, Michael J; Jacobson, Rachael K; Shuman, Howard A

    2017-01-01

    The development of plasmid-mediated gene expression control in bacteria revolutionized the field of bacteriology. Many of these expression control systems rely on the addition of small molecules, generally metabolites or non-metabolized analogs thereof, to the growth medium to induce expression of the genes of interest. The paradigmatic example of an expression control system is the lac system from Escherichia coli, which typically relies on the Ptac promoter and the Lac repressor, LacI. In many cases, however, constitutive gene expression is desired, and other experimental approaches require the coordinated control of multiple genes. While multiple systems have been developed for use in E. coli and its close relatives, the utility and/or functionality of these tools does not always translate to other species. For example, for the Gram-negative pathogen, Legionella pneumophila, a causative agent of Legionnaires' Disease, the aforementioned Ptac system represents the only well-established expression control system. In order to enhance the tools available to study bacterial gene expression in L. pneumophila, we developed a plasmid, pON.mCherry, which confers constitutive gene expression from a mutagenized LacI binding site. We demonstrate that pON.mCherry neither interferes with other plasmids harboring an intact LacI-Ptac expression system nor alters the growth of Legionella species during intracellular growth. Furthermore, the broad-host range plasmid backbone of pON.mCherry allows constitutive gene expression in a wide variety of Gram-negative bacterial species, making pON.mCherry a useful tool for the greater research community.

  2. Quantitative real time RT-PCR study of pathogen-induced gene expression in rock bream (Oplegnathus fasciatus): internal controls for data normalization.

    PubMed

    Zhang, Bao-cun; Sun, Li; Xiao, Zhi-zhong; Hu, Yong-hua

    2014-06-01

    Rock bream Oplegnathus fasciatus is an important economic fish species. In this study, we evaluated the appropriateness of six housekeeping genes as internal controls for quantitative real-time PCR (RT-qPCR) analysis of gene expression in rock bream before and after pathogen infection. The expression of the selected genes in eight tissues infected with Vibrio alginolyticus or megalocytivirus was determined by RT-qPCR, and the PCR data were analyzed with geNorm and NormFinder algorithms. The results showed that before pathogen infection, mediator of RNA polymerase II transcription subunit 8 and β-actin were ranked as the most stable genes across the examined tissues. After bacterial or viral infection, the stabilities of the housekeeping genes varied to significant extents in tissue-dependent manners, and no single pair of genes was identified as suitable references for all tissues for either of the pathogen stimuli. In addition, for the majority of tissues, the most stable genes during bacterial infection differed from those during viral infection. Nevertheless, optimum reference genes were identified for each tissue under different conditions. Taken together, these results indicate that tissue type and the nature of the infectious agent used in the study can all influence the choice of normalization factors, and that the optimum reference genes identified in this study will provide a useful guidance for the selection of internal controls in future RT-PCR study of gene expression in rock bream. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Importance of stress-response genes to the survival of airborne Escherichia coli under different levels of relative humidity.

    PubMed

    Ng, Tsz Wai; Chan, Wing Lam; Lai, Ka Man

    2017-12-01

    Other than the needs for infection control to investigate the survival and inactivation of airborne bacterial pathogens, there has been a growing interest in exploring bacterial communities in the air and the effect of environmental variables on them. However, the innate biological mechanism influencing the bacterial viability is still unclear. In this study, a mutant-based approach, using Escherichia coli as a model, was used to prove the concept that common stress-response genes are important for airborne survival of bacteria. Mutants with a single gene knockout that are known to respond to general stress (rpoS) and oxidative stress (oxyR, soxR) were selected in the study. Low relative humidity (RH), 30-40% was more detrimental to the bacteria than high RH, >90%. The log reduction of ∆rpoS was always higher than that of the parental strain at all RH levels but the ∆oxyR had a higher log reduction than the parental strain at intermediate RH only. ∆soxR had the same viability compared to the parental strain at all RH levels. The results hint that although different types and levels of stress are produced under different RH conditions, stress-response genes always play a role in the bacterial viability. This study is the first reporting the association between stress-response genes and viability of airborne bacteria.

  4. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

    PubMed

    Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

    2018-04-01

    Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. {open_quotes}Horizontal{close_quotes} gene transfer from a transgenic potato line to a bacterial pathogen (Erwinia chrysanthemi) occurs - if at all - at an extremely low frequency

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schlueter, K.; Fuetterer, J.; Potrykus, I.

    1995-10-01

    The frequency of possible {open_quotes}horizontal{close_quotes} gene transfer between a plant and a tightly associated bacterial pathogen was studied in a model system consisting of transgenic Solanum tuberosum, containing a {beta}-lactamase gene linked to a pBR322 origin of replication, and Erwinia chrysanthemi. This experimental system offers optimal conditions for the detection of possible horizontal gene transfer events, even when they occur at very low frequency. Horizontal gene transfer was not detected under conditions mimicking a {open_quotes}natural{close_quotes} infection. The gradual, stepwise alteration of artificial, positive control conditions to idealized natural conditions, however, allowed the characterization of factors that affected gene transfer, andmore » revealed a gradual decrease of the gene transfer frequency from 6.3 x 10{sup -2} under optimal control conditions to a calculated 2.0 x 10{sub -17} under idealized natural conditions. These data, in combination with other published studies, argue that horizontal gene transfer is so rare as to be essentially irrelevant to any realistic assessment of the risk involved in release experiments involving transgenic plants. 22 refs., 3 figs., 2 tabs.« less

  6. Sugar Lego: gene composition of bacterial carbohydrate metabolism genomic loci.

    PubMed

    Kaznadzey, Anna; Shelyakin, Pavel; Gelfand, Mikhail S

    2017-11-25

    Bacterial carbohydrate metabolism is extremely diverse, since carbohydrates serve as a major energy source and are involved in a variety of cellular processes. Bacterial genes belonging to same metabolic pathway are often co-localized in the chromosome, but it is not a strict rule. Gene co-localization in linked to co-evolution and co-regulation. This study focuses on a large-scale analysis of bacterial genomic loci related to the carbohydrate metabolism. We demonstrate that only 53% of 148,000 studied genes from over six hundred bacterial genomes are co-localized in bacterial genomes with other carbohydrate metabolism genes, which points to a significant role of singleton genes. Co-localized genes form cassettes, ranging in size from two to fifteen genes. Two major factors influencing the cassette-forming tendency are gene function and bacterial phylogeny. We have obtained a comprehensive picture of co-localization preferences of genes for nineteen major carbohydrate metabolism functional classes, over two hundred gene orthologous clusters, and thirty bacterial classes, and characterized the cassette variety in size and content among different species, highlighting a significant role of short cassettes. The preference towards co-localization of carbohydrate metabolism genes varies between 40 and 76% for bacterial taxa. Analysis of frequently co-localized genes yielded forty-five significant pairwise links between genes belonging to different functional classes. The number of such links per class range from zero to eight, demonstrating varying preferences of respective genes towards a specific chromosomal neighborhood. Genes from eleven functional classes tend to co-localize with genes from the same class, indicating an important role of clustering of genes with similar functions. At that, in most cases such co-localization does not originate from local duplication events. Overall, we describe a complex web formed by evolutionary relationships of bacterial carbohydrate metabolism genes, manifested as co-localization patterns. This article was reviewed by Daria V. Dibrova (A.N. Belozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University, Moscow, Russia), nominated by Armen Mulkidjanian (University of Osnabrück, Germany), Igor Rogozin (NCBI, NLM, NIH, USA) and Yuri Wolf (NCBI, NLM, NIH, USA).

  7. Interaction of two photoreceptors in the regulation of bacterial photosynthesis genes

    PubMed Central

    Metz, Sebastian; Haberzettl, Kerstin; Frühwirth, Sebastian; Teich, Kristin; Hasewinkel, Christian; Klug, Gabriele

    2012-01-01

    The expression of photosynthesis genes in the facultatively photosynthetic bacterium Rhodobacter sphaeroides is controlled by the oxygen tension and by light quantity. Two photoreceptor proteins, AppA and CryB, have been identified in the past, which are involved in this regulation. AppA senses light by its N-terminal BLUF domain, its C-terminal part binds heme and is redox-responsive. Through its interaction to the transcriptional repressor PpsR the AppA photoreceptor controls expression of photosynthesis genes. The cryptochrome-like protein CryB was shown to affect regulation of photosynthesis genes, but the underlying signal chain remained unknown. Here we show that CryB interacts with the C-terminal domain of AppA and modulates the binding of AppA to the transcriptional repressor PpsR in a light-dependent manner. Consequently, binding of the transcription factor PpsR to its DNA target is affected by CryB. In agreement with this, all genes of the PpsR regulon showed altered expression levels in a CryB deletion strain after blue-light illumination. These results elucidate for the first time how a bacterial cryptochrome affects gene expression. PMID:22434878

  8. Interaction of two photoreceptors in the regulation of bacterial photosynthesis genes.

    PubMed

    Metz, Sebastian; Haberzettl, Kerstin; Frühwirth, Sebastian; Teich, Kristin; Hasewinkel, Christian; Klug, Gabriele

    2012-07-01

    The expression of photosynthesis genes in the facultatively photosynthetic bacterium Rhodobacter sphaeroides is controlled by the oxygen tension and by light quantity. Two photoreceptor proteins, AppA and CryB, have been identified in the past, which are involved in this regulation. AppA senses light by its N-terminal BLUF domain, its C-terminal part binds heme and is redox-responsive. Through its interaction to the transcriptional repressor PpsR the AppA photoreceptor controls expression of photosynthesis genes. The cryptochrome-like protein CryB was shown to affect regulation of photosynthesis genes, but the underlying signal chain remained unknown. Here we show that CryB interacts with the C-terminal domain of AppA and modulates the binding of AppA to the transcriptional repressor PpsR in a light-dependent manner. Consequently, binding of the transcription factor PpsR to its DNA target is affected by CryB. In agreement with this, all genes of the PpsR regulon showed altered expression levels in a CryB deletion strain after blue-light illumination. These results elucidate for the first time how a bacterial cryptochrome affects gene expression.

  9. Metagenomic and metatranscriptomic analysis of saliva reveals disease-associated microbiota in patients with periodontitis and dental caries.

    PubMed

    Belstrøm, Daniel; Constancias, Florentin; Liu, Yang; Yang, Liang; Drautz-Moses, Daniela I; Schuster, Stephan C; Kohli, Gurjeet Singh; Jakobsen, Tim Holm; Holmstrup, Palle; Givskov, Michael

    2017-01-01

    The taxonomic composition of the salivary microbiota has been reported to differentiate between oral health and disease. However, information on bacterial activity and gene expression of the salivary microbiota is limited. The purpose of this study was to perform metagenomic and metatranscriptomic characterization of the salivary microbiota and test the hypothesis that salivary microbial presence and activity could be an indicator of the oral health status. Stimulated saliva samples were collected from 30 individuals (periodontitis: n  = 10, dental caries: n  = 10, oral health: n  = 10). Salivary microbiota was characterized using metagenomics and metatranscriptomics in order to compare community composition and the gene expression between the three groups. Streptococcus was the predominant bacterial genus constituting approx. 25 and 50% of all DNA and RNA reads, respectively. A significant disease-associated higher relative abundance of traditional periodontal pathogens such as Porphyromonas gingivalis and Filifactor alocis and salivary microbial activity of F . alocis was associated with periodontitis. Significantly higher relative abundance of caries-associated bacteria such as Streptococcus mutans and Lactobacillus fermentum was identified in saliva from patients with dental caries. Multiple genes involved in carbohydrate metabolism were significantly more expressed in healthy controls compared to periodontitis patients. Using metagenomics and metatranscriptomics we show that relative abundance of specific oral bacterial species and bacterial gene expression in saliva associates with periodontitis and dental caries. Further longitudinal studies are warranted to evaluate if screening of salivary microbial activity of specific oral bacterial species and metabolic gene expression can identify periodontitis and dental caries at preclinical stages.

  10. Bacterial RNA Biology on a Genome Scale.

    PubMed

    Hör, Jens; Gorski, Stanislaw A; Vogel, Jörg

    2018-06-07

    Bacteria are an exceedingly diverse group of organisms whose molecular exploration is experiencing a renaissance. While the classical view of bacterial gene expression was relatively simple, the emerging view is more complex, encompassing extensive post-transcriptional control involving riboswitches, RNA thermometers, and regulatory small RNAs (sRNAs) associated with the RNA-binding proteins CsrA, Hfq, and ProQ, as well as CRISPR/Cas systems that are programmed by RNAs. Moreover, increasing interest in members of the human microbiota and environmental microbial communities has highlighted the importance of understudied bacterial species with largely unknown transcriptome structures and RNA-based control mechanisms. Collectively, this creates a need for global RNA biology approaches that can rapidly and comprehensively analyze the RNA composition of a bacterium of interest. We review such approaches with a focus on RNA-seq as a versatile tool to investigate the different layers of gene expression in which RNA is made, processed, regulated, modified, translated, and turned over. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Bacterial α2-macroglobulins: colonization factors acquired by horizontal gene transfer from the metazoan genome?

    PubMed Central

    Budd, Aidan; Blandin, Stephanie; Levashina, Elena A; Gibson, Toby J

    2004-01-01

    Background Invasive bacteria are known to have captured and adapted eukaryotic host genes. They also readily acquire colonizing genes from other bacteria by horizontal gene transfer. Closely related species such as Helicobacter pylori and Helicobacter hepaticus, which exploit different host tissues, share almost none of their colonization genes. The protease inhibitor α2-macroglobulin provides a major metazoan defense against invasive bacteria, trapping attacking proteases required by parasites for successful invasion. Results Database searches with metazoan α2-macroglobulin sequences revealed homologous sequences in bacterial proteomes. The bacterial α2-macroglobulin phylogenetic distribution is patchy and violates the vertical descent model. Bacterial α2-macroglobulin genes are found in diverse clades, including purple bacteria (proteobacteria), fusobacteria, spirochetes, bacteroidetes, deinococcids, cyanobacteria, planctomycetes and thermotogae. Most bacterial species with bacterial α2-macroglobulin genes exploit higher eukaryotes (multicellular plants and animals) as hosts. Both pathogenically invasive and saprophytically colonizing species possess bacterial α2-macroglobulins, indicating that bacterial α2-macroglobulin is a colonization rather than a virulence factor. Conclusions Metazoan α2-macroglobulins inhibit proteases of pathogens. The bacterial homologs may function in reverse to block host antimicrobial defenses. α2-macroglobulin was probably acquired one or more times from metazoan hosts and has then spread widely through other colonizing bacterial species by more than 10 independent horizontal gene transfers. yfhM-like bacterial α2-macroglobulin genes are often found tightly linked with pbpC, encoding an atypical peptidoglycan transglycosylase, PBP1C, that does not function in vegetative peptidoglycan synthesis. We suggest that YfhM and PBP1C are coupled together as a periplasmic defense and repair system. Bacterial α2-macroglobulins might provide useful targets for enhancing vaccine efficacy in combating infections. PMID:15186489

  12. An efficient method for visualization and growth of fluorescent Xanthomonas oryzae pv. oryzae in planta

    PubMed Central

    Han, Sang-Wook; Park, Chang-Jin; Lee, Sang-Won; Ronald, Pamela C

    2008-01-01

    Background Xanthomonas oryzae pv. oryzae, the causal agent of bacterial blight disease, is a serious pathogen of rice. Here we describe a fluorescent marker system to study virulence and pathogenicity of X. oryzae pv. oryzae. Results A fluorescent X. oryzae pv. oryzae Philippine race 6 strain expressing green fluorescent protein (GFP) (PXO99GFP) was generated using the gfp gene under the control of the neomycin promoter in the vector, pPneo-gfp. The PXO99GFPstrain displayed identical virulence and avirulence properties as the wild type control strain, PXO99. Using fluorescent microscopy, bacterial multiplication and colonization were directly observed in rice xylem vessels. Accurate and rapid determination of bacterial growth was assessed using fluoremetry and an Enzyme-Linked ImmunoSorbant Assay (ELISA). Conclusion Our results indicate that the fluorescent marker system is useful for assessing bacterial infection and monitoring bacterial multiplication in planta. PMID:18826644

  13. Spot 42 Small RNA Regulates Arabinose-Inducible araBAD Promoter Activity by Repressing Synthesis of the High-Affinity Low-Capacity Arabinose Transporter

    PubMed Central

    Chen, Jiandong

    2016-01-01

    ABSTRACT The l-arabinose-inducible araBAD promoter (PBAD) enables tightly controlled and tunable expression of genes of interest in a broad range of bacterial species. It has been used successfully to study bacterial sRNA regulation, where PBAD drives expression of target mRNA translational fusions. Here we report that in Escherichia coli, Spot 42 sRNA regulates PBAD promoter activity by affecting arabinose uptake. We demonstrate that Spot 42 sRNA represses araF, a gene encoding the AraF subunit of the high-affinity low-capacity arabinose transporter AraFGH, through direct base-pairing interactions. We further show that endogenous Spot 42 sRNA is sufficient to repress araF expression under various growth conditions. Finally, we demonstrate this posttranscriptional repression has a biological consequence, decreasing the induction of PBAD at low levels of arabinose. This problem can be circumvented using strategies reported previously for avoiding all-or-none induction behavior, such as through constitutive expression of the low-affinity high-capacity arabinose transporter AraE or induction with a higher concentration of inducers. This work adds araF to the set of Spot 42-regulated genes, in agreement with previous studies suggesting that Spot 42, itself negatively regulated by the cyclic AMP (cAMP) receptor protein-cAMP complex, reinforces the catabolite repression network. IMPORTANCE The bacterial arabinose-inducible system is widely used for titratable control of gene expression. We demonstrate here that a posttranscriptional mechanism mediated by Spot 42 sRNA contributes to the functionality of the PBAD system at subsaturating inducer concentrations by affecting inducer uptake. Our finding extends the inputs into the known transcriptional control for the PBAD system and has implications for improving its usage for tunable gene expression. PMID:27849174

  14. Growth-rate dependent global effects on gene expression in bacteria

    PubMed Central

    Klumpp, Stefan; Zhang, Zhongge; Hwa, Terence

    2010-01-01

    Summary Bacterial gene expression depends not only on specific regulations but also directly on bacterial growth, because important global parameters such as the abundance of RNA polymerases and ribosomes are all growth-rate dependent. Understanding these global effects is necessary for a quantitative understanding of gene regulation and for the robust design of synthetic genetic circuits. The observed growth-rate dependence of constitutive gene expression can be explained by a simple model using the measured growth-rate dependence of the relevant cellular parameters. More complex growth dependences for genetic circuits involving activators, repressors and feedback control were analyzed, and salient features were verified experimentally using synthetic circuits. The results suggest a novel feedback mechanism mediated by general growth-dependent effects and not requiring explicit gene regulation, if the expressed protein affects cell growth. This mechanism can lead to growth bistability and promote the acquisition of important physiological functions such as antibiotic resistance and tolerance (persistence). PMID:20064380

  15. Predicting effects of structural stress in a genome-reduced model bacterial metabolism

    NASA Astrophysics Data System (ADS)

    Güell, Oriol; Sagués, Francesc; Serrano, M. Ángeles

    2012-08-01

    Mycoplasma pneumoniae is a human pathogen recently proposed as a genome-reduced model for bacterial systems biology. Here, we study the response of its metabolic network to different forms of structural stress, including removal of individual and pairs of reactions and knockout of genes and clusters of co-expressed genes. Our results reveal a network architecture as robust as that of other model bacteria regarding multiple failures, although less robust against individual reaction inactivation. Interestingly, metabolite motifs associated to reactions can predict the propagation of inactivation cascades and damage amplification effects arising in double knockouts. We also detect a significant correlation between gene essentiality and damages produced by single gene knockouts, and find that genes controlling high-damage reactions tend to be expressed independently of each other, a functional switch mechanism that, simultaneously, acts as a genetic firewall to protect metabolism. Prediction of failure propagation is crucial for metabolic engineering or disease treatment.

  16. Computational design of a Zn2+ receptor that controls bacterial gene expression

    NASA Astrophysics Data System (ADS)

    Dwyer, M. A.; Looger, L. L.; Hellinga, H. W.

    2003-09-01

    The control of cellular physiology and gene expression in response to extracellular signals is a basic property of living systems. We have constructed a synthetic bacterial signal transduction pathway in which gene expression is controlled by extracellular Zn2+. In this system a computationally designed Zn2+-binding periplasmic receptor senses the extracellular solute and triggers a two-component signal transduction pathway via a chimeric transmembrane protein, resulting in transcriptional up-regulation of a -galactosidase reporter gene. The Zn2+-binding site in the designed receptor is based on a four-coordinate, tetrahedral primary coordination sphere consisting of histidines and glutamates. In addition, mutations were introduced in a secondary coordination sphere to satisfy the residual hydrogen-bonding potential of the histidines coordinated to the metal. The importance of the secondary shell interactions is demonstrated by their effect on metal affinity and selectivity, as well as protein stability. Three designed protein sequences, comprising two distinct metal-binding positions, were all shown to bind Zn2+ and to function in the cell-based assay, indicating the generality of the design methodology. These experiments demonstrate that biological systems can be manipulated with computationally designed proteins that have drastically altered ligand-binding specificities, thereby extending the repertoire of genetic control by extracellular signals.

  17. ATP-dependent RecG Helicase Is Required for the Transcriptional Regulator OxyR Function in Pseudomonas species*

    PubMed Central

    Yeom, Jinki; Lee, Yunho; Park, Woojun

    2012-01-01

    The oxyR gene appears to reside in an operon with the recG helicase gene in many bacteria, including pathogenic Pseudomonas aeruginosa and Pseudomonas putida. Analysis of P. putida transcriptomes shows that many OxyR-controlled genes are regulated by the ATP-dependent RecG helicase and that RecG alone modulates the expression of many genes. We found that purified RecG binds to the promoters of many OxyR-controlled genes and that expression of these genes was not induced under conditions of oxidative stress in recG mutants of P. aeruginosa, P. putida, and Escherichia coli. In vitro data revealed that promoters containing palindromic sequences are essential for RecG binding and that single-strand binding proteins and ATP are also needed for RecG to promote transcription, whereas a magnesium ion has the opposite effect. The OxyR tetramer preferentially binds to promoters after RecG has generated linear DNA in the presence of ATP; otherwise, the OxyR dimer has higher affinity. This study provides new insights into the mechanism of bacterial transcription by demonstrating that RecG might be required for the induction of the OxyR regulon by unwinding palindromic DNA for transcription. This work describes a novel bacterial transcriptional function by RecG helicase with OxyR and may provide new targets for controlling Pseudomonas species pathogen. PMID:22621928

  18. A gene-targeted approach to investigate the intestinal butyrate-producing bacterial community

    PubMed Central

    2013-01-01

    Background Butyrate, which is produced by the human microbiome, is essential for a well-functioning colon. Bacteria that produce butyrate are phylogenetically diverse, which hinders their accurate detection based on conventional phylogenetic markers. As a result, reliable information on this important bacterial group is often lacking in microbiome research. Results In this study we describe a gene-targeted approach for 454 pyrotag sequencing and quantitative polymerase chain reaction for the final genes in the two primary bacterial butyrate synthesis pathways, butyryl-CoA:acetate CoA-transferase (but) and butyrate kinase (buk). We monitored the establishment and early succession of butyrate-producing communities in four patients with ulcerative colitis who underwent a colectomy with ileal pouch anal anastomosis and compared it with three control samples from healthy colons. All patients established an abundant butyrate-producing community (approximately 5% to 26% of the total community) in the pouch within the 2-month study, but patterns were distinctive among individuals. Only one patient harbored a community profile similar to the healthy controls, in which there was a predominance of but genes that are similar to reference genes from Acidaminococcus sp., Eubacterium sp., Faecalibacterium prausnitzii and Roseburia sp., and an almost complete absence of buk genes. Two patients were greatly enriched in buk genes similar to those of Clostridium butyricum and C. perfringens, whereas a fourth patient displayed abundant communities containing both genes. Most butyrate producers identified in previous studies were detected and the general patterns of taxa found were supported by 16S rRNA gene pyrotag analysis, but the gene-targeted approach provided more detail about the potential butyrate-producing members of the community. Conclusions The presented approach provides quantitative and genotypic insights into butyrate-producing communities and facilitates a more specific functional characterization of the intestinal microbiome. Furthermore, our analysis refines but and buk reference annotations found in central databases. PMID:24451334

  19. Human gut bacterial communities are altered by addition of cruciferous vegetables to a controlled fruit- and vegetable-free diet.

    PubMed

    Li, Fei; Hullar, Meredith A J; Schwarz, Yvonne; Lampe, Johanna W

    2009-09-01

    In the human gut, commensal bacteria metabolize food components that typically serve as energy sources. These components have the potential to influence gut bacterial community composition. Cruciferous vegetables, such as broccoli and cabbage, contain distinctive compounds that can be utilized by gut bacteria. For example, glucosinolates can be hydrolyzed by certain bacteria, and dietary fibers can be fermented by a range of species. We hypothesized that cruciferous vegetable consumption would alter growth of certain bacteria, thereby altering bacterial community composition. We tested this hypothesis in a randomized, crossover, controlled feeding study. Fecal samples were collected from 17 participants at the end of 2 14-d intake periods: a low-phytochemical, low-fiber basal diet (i.e. refined grains without fruits or vegetables) and a high ("double") cruciferous vegetable diet [basal diet + 14 g cruciferous vegetables/(kg body weightd)]. Fecal bacterial composition was analyzed by the terminal restriction fragment length polymorphism (tRFLP) method using the bacterial 16S ribosomal RNA gene and nucleotide sequencing. Using blocked multi-response permutation procedures analysis, we found that overall bacterial community composition differed between the 2 consumption periods (delta = 0.603; P = 0.011). The bacterial community response to cruciferous vegetables was individual-specific, as revealed by nonmetric multidimensional scaling ordination analysis. Specific tRFLP fragments that characterized each of the diets were identified using indicator species analysis. Putative species corresponding to these fragments were identified through gene sequencing as Eubacterium hallii, Phascolarctobacterium faecium, Burkholderiales spp., Alistipes putredinis, and Eggerthella spp. In conclusion, human gut bacterial community composition was altered by cruciferous vegetable consumption, which could ultimately influence gut metabolism of bioactive food components and host exposure to these compounds.

  20. Bacterial community dynamics during bioremediation of diesel oil-contaminated Antarctic soil.

    PubMed

    Vázquez, S; Nogales, B; Ruberto, L; Hernández, E; Christie-Oleza, J; Lo Balbo, A; Bosch, R; Lalucat, J; Mac Cormack, W

    2009-05-01

    The effect of nutrient and inocula amendment in a bioremediation field trial using a nutrient-poor Antarctic soil chronically contaminated with hydrocarbons was tested. The analysis of the effects that the treatments caused in bacterial numbers and hydrocarbon removal was combined with the elucidation of the changes occurring on the bacterial community, by 16S rDNA-based terminal restriction fragment length polymorphism (T-RFLP) typing, and the detection of some of the genes involved in the catabolism of hydrocarbons. All treatments caused a significant increase in the number of bacteria able to grow on hydrocarbons and a significant decrease in the soil hydrocarbon content, as compared to the control. However, there were no significant differences between treatments. Comparison of the soil T-RFLP profiles indicated that there were changes in the structure and composition of bacterial communities during the bioremediation trial, although the communities in treated plots were highly similar irrespective of the treatment applied, and they had a similar temporal dynamics. These results showed that nutrient addition was the main factor contributing to the outcome of the bioremediation experiment. This was supported by the lack of evidence of the establishment of inoculated consortia in soils, since their characteristic electrophoretic peaks were only detectable in soil profiles at the beginning of the experiment. Genetic potential for naphthalene degradation, evidenced by detection of nahAc gene, was observed in all soil plots including the control. In treated plots, an increase in the detection of catechol degradation genes (nahH and catA) and in a key gene of denitrification (nosZ) was observed as well. These results indicate that treatments favored the degradation of aromatic hydrocarbons and probably stimulated denitrification, at least transiently. This mesocosm study shows that recovery of chronically contaminated Antarctic soils can be successfully accelerated using biostimulation with nutrients, and that this causes a change in the indigenous bacterial communities and in the genetic potential for hydrocarbon degradation.

  1. The Composition and Spatial Patterns of Bacterial Virulence Factors and Antibiotic Resistance Genes in 19 Wastewater Treatment Plants

    PubMed Central

    Zhang, Bing; Xia, Yu; Wen, Xianghua; Wang, Xiaohui; Yang, Yunfeng; Zhou, Jizhong; Zhang, Yu

    2016-01-01

    Bacterial pathogenicity and antibiotic resistance are of concern for environmental safety and public health. Accumulating evidence suggests that wastewater treatment plants (WWTPs) are as an important sink and source of pathogens and antibiotic resistance genes (ARGs). Virulence genes (encoding virulence factors) are good indicators for bacterial pathogenic potentials. To achieve a comprehensive understanding of bacterial pathogenic potentials and antibiotic resistance in WWTPs, bacterial virulence genes and ARGs in 19 WWTPs covering a majority of latitudinal zones of China were surveyed by using GeoChip 4.2. A total of 1610 genes covering 13 virulence factors and 1903 genes belonging to 11 ARG families were detected respectively. The bacterial virulence genes exhibited significant spatial distribution patterns of a latitudinal biodiversity gradient and a distance-decay relationship across China. Moreover, virulence genes tended to coexist with ARGs as shown by their strongly positive associations. In addition, key environmental factors shaping the overall virulence gene structure were identified. This study profiles the occurrence, composition and distribution of virulence genes and ARGs in current WWTPs in China, and uncovers spatial patterns and important environmental variables shaping their structure, which may provide the basis for further studies of bacterial virulence factors and antibiotic resistance in WWTPs. PMID:27907117

  2. Activity of Uncleaved Caspase-8 Controls Anti-bacterial Immune Defense and TLR-Induced Cytokine Production Independent of Cell Death.

    PubMed

    Philip, Naomi H; DeLaney, Alexandra; Peterson, Lance W; Santos-Marrero, Melanie; Grier, Jennifer T; Sun, Yan; Wynosky-Dolfi, Meghan A; Zwack, Erin E; Hu, Baofeng; Olsen, Tayla M; Rongvaux, Anthony; Pope, Scott D; López, Carolina B; Oberst, Andrew; Beiting, Daniel P; Henao-Mejia, Jorge; Brodsky, Igor E

    2016-10-01

    Caspases regulate cell death programs in response to environmental stresses, including infection and inflammation, and are therefore critical for the proper operation of the mammalian immune system. Caspase-8 is necessary for optimal production of inflammatory cytokines and host defense against infection by multiple pathogens including Yersinia, but whether this is due to death of infected cells or an intrinsic role of caspase-8 in TLR-induced gene expression is unknown. Caspase-8 activation at death signaling complexes results in its autoprocessing and subsequent cleavage and activation of its downstream apoptotic targets. Whether caspase-8 activity is also important for inflammatory gene expression during bacterial infection has not been investigated. Here, we report that caspase-8 plays an essential cell-intrinsic role in innate inflammatory cytokine production in vivo during Yersinia infection. Unexpectedly, we found that caspase-8 enzymatic activity regulates gene expression in response to bacterial infection as well as TLR signaling independently of apoptosis. Using newly-generated mice in which caspase-8 autoprocessing is ablated (Casp8DA/DA), we now demonstrate that caspase-8 enzymatic activity, but not autoprocessing, mediates induction of inflammatory cytokines by bacterial infection and a wide variety of TLR stimuli. Because unprocessed caspase-8 functions in an enzymatic complex with its homolog cFLIP, our findings implicate the caspase-8/cFLIP heterodimer in control of inflammatory cytokines during microbial infection, and provide new insight into regulation of antibacterial immune defense.

  3. The germin-like protein OsGLP2-1 enhances resistance to fungal blast and bacterial blight in rice.

    PubMed

    Liu, Qing; Yang, Jianyuan; Yan, Shijuan; Zhang, Shaohong; Zhao, Junliang; Wang, Wenjuan; Yang, Tifeng; Wang, Xiaofei; Mao, Xingxue; Dong, Jingfang; Zhu, Xiaoyuan; Liu, Bin

    2016-11-01

    This is the first report that GLP gene (OsGLP2-1) is involved in panicle blast and bacterial blight resistance in rice. In addition to its resistance to blast and bacterial blight, OsGLP2-1 has also been reported to co-localize with a QTLs for sheath blight resistance in rice. These suggest that the disease resistance provided by OsGLP2-1 is quantitative and broad spectrum. Its good resistance to these major diseases in rice makes it to be a promising target in rice breeding. Rice (Oryza sativa) blast caused by Magnaporthe oryzae and bacterial blight caused by Xanthomonas oryzae pv. oryzae are the two most destructive rice diseases worldwide. Germin-like protein (GLP) gene family is one of the important defense gene families which have been reported to be involved in disease resistance in plants. Although GLP proteins have been demonstrated to positively regulate leaf blast resistance in rice, their involvement in resistance to panicle blast and bacterial blight, has not been reported. In this study, we reported that one of the rice GLP genes, OsGLP2-1, was significantly induced by blast fungus. Overexpression of OsGLP2-1 quantitatively enhanced resistance to leaf blast, panicle blast and bacterial blight. The temporal and spatial expression analysis revealed that OsGLP2-1is highly expressed in leaves and panicles and sub-localized in the cell wall. Compared with empty vector transformed (control) plants, the OsGLP2-1 overexpressing plants exhibited higher levels of H 2 O 2 both before and after pathogen inoculation. Moreover, OsGLP2-1 was significantly induced by jasmonic acid (JA). Overexpression of OsGLP2-1 induced three well-characterized defense-related genes which are associated in JA-dependent pathway after pathogen infection. Higher endogenous level of JA was also identified in OsGLP2-1 overexpressing plants than in control plants both before and after pathogen inoculation. Together, these results suggest that OsGLP2-1 functions as a positive regulator to modulate disease resistance. Its good quantitative resistance to the two major diseases in rice makes it to be a promising target in rice breeding.

  4. Biodegradation of atrazine by three transgenic grasses and alfalfa expressing a modified bacterial atrazine chlorohydrolase gene

    USDA-ARS?s Scientific Manuscript database

    The widespread use of atrazine and other s-triazine herbicides to control weeds in agricultural production fields has impacted surface and ground water in the United States and elsewhere. We previously reported the cloning, sequencing, and expression of six genes involved in the atrazine biodegradat...

  5. Fate of tetracycline, sulfonamide and fluoroquinolone resistance genes and the changes in bacterial diversity during composting of swine manure.

    PubMed

    Selvam, Ammaiyappan; Xu, Delin; Zhao, Zhenyong; Wong, Jonathan W C

    2012-12-01

    This study monitored the abundance of antibiotic resistant genes (ARGs) and the bacterial diversity during composting of swine manure spiked with chlortetracycline, sulfadiazine and ciprofloxacin at two different levels and a control without antibiotics. Resistance genes of tetracycline (tetQ, tetW, tetC, tetG, tetZ and tetY), sulfonamide (sul1, sul2, dfrA1 and dfrA7) and fluoroquinolone (gyrA and parC) represented 0.02-1.91%, 0.67-10.28% and 0.00005-0.0002%, respectively, of the total 16S rDNA copies in the initial composting mass. After 28-42 days of composting, these ARGs, except parC, were undetectable in the composting mass indicating that composting is a potential method of manure management. Polymerase chain reaction-denaturing gradient gel electrophoresis analysis of bacterial 16S rDNA of the composting mass indicated that the addition of antibiotics up to 100, 20 and 20mg/kg of chlortetracycline, sulfadiazine and ciprofloxacin, respectively, elicited only a transient perturbation and the bacterial diversity was restored in due course of composting. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. High density growth of T7 expression strains with auto-induction option

    DOEpatents

    Studier, F. William

    2013-03-19

    A method for promoting and suppressing auto-induction of transcription of a cloned gene 1 of bacteriophage T7 in cultures of bacterial cells grown batchwise is disclosed. The transcription is under the control of a promoter whose activity can be induced by an exogenous inducer whose ability to induce said promoter is dependent on the metabolic state of said bacterial cells.

  7. Riboregulation of bacterial and archaeal transposition.

    PubMed

    Ellis, Michael J; Haniford, David B

    2016-05-01

    The coexistence of transposons with their hosts depends largely on transposition levels being tightly regulated to limit the mutagenic burden associated with frequent transposition. For 'DNA-based' (class II) bacterial transposons there is growing evidence that regulation through small noncoding RNAs and/or the RNA-binding protein Hfq are prominent mechanisms of defense against transposition. Recent transcriptomics analyses have identified many new cases of antisense RNAs (asRNA) that potentially could regulate the expression of transposon-encoded genes giving the impression that asRNA regulation of DNA-based transposons is much more frequent than previously thought. Hfq is a highly conserved bacterial protein that plays a central role in posttranscriptional gene regulation and stress response pathways in many bacteria. Three different mechanisms for Hfq-directed control of bacterial transposons have been identified to date highlighting the versatility of this protein as a regulator of bacterial transposons. There is also evidence emerging that some DNA-based transposons encode RNAs that could regulate expression of host genes. In the case of IS200, which appears to have lost its ability to transpose, contributing a regulatory RNA to its host could account for the persistence of this mobile element in a wide range of bacterial species. It remains to be seen how prevalent these transposon-encoded RNA regulators are, but given the relatively large amount of intragenic transcription in bacterial genomes, it would not be surprising if new examples are forthcoming. WIREs RNA 2016, 7:382-398. doi: 10.1002/wrna.1341 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.

  8. Effects of Copper Addition on Copper Resistance, Antibiotic Resistance Genes, and intl1 during Swine Manure Composting

    PubMed Central

    Yin, Yanan; Gu, Jie; Wang, Xiaojuan; Song, Wen; Zhang, Kaiyu; Sun, Wei; Zhang, Xin; Zhang, Yajun; Li, Haichao

    2017-01-01

    Copper is one of the most abundant heavy metals present in swine manure. In this study, a laboratory-scale aerobic composting system was amended with Cu at three levels (0, 200, and 2000 mg kg-1, i.e., control, Cu200, and Cu2000 treatments, respectively) to determine its effect on the fate of copper resistance genes [copper resistance genes (CRGs): pcoA, cusA, copA, and tcrB], antibiotic resistance genes [antibiotic resistance genes (ARGs): erm(A) and erm(B)], and intl1. The results showed that the absolute abundances of pcoA, tcrB, erm(A), erm(B), and intl1 were reduced, whereas those of copA and cusA increased after swine manure composting. Redundancy analysis showed that temperature significantly affected the variations in CRGs, ARGs, and intl1. The decreases in CRGs, ARGs, and intI1 were positively correlated with the exchangeable Cu levels. The bacterial community could be grouped according to the composting time under different treatments, where the high concentration of copper had a more persistent effect on the bacterial community. Network analysis determined that the co-occurrence of CRGs, ARGs, and intI1, and the bacterial community were the main contributors to the changes in CRGs, ARG, and intl1. Thus, temperature, copper, and changes in the bacterial community composition had important effects on the variations in CRGs, ARGs, and intl1 during manure composting in the presence of added copper. PMID:28316595

  9. Phenotypic Signatures Arising from Unbalanced Bacterial Growth

    PubMed Central

    Tan, Cheemeng; Smith, Robert Phillip; Tsai, Ming-Chi; Schwartz, Russell; You, Lingchong

    2014-01-01

    Fluctuations in the growth rate of a bacterial culture during unbalanced growth are generally considered undesirable in quantitative studies of bacterial physiology. Under well-controlled experimental conditions, however, these fluctuations are not random but instead reflect the interplay between intra-cellular networks underlying bacterial growth and the growth environment. Therefore, these fluctuations could be considered quantitative phenotypes of the bacteria under a specific growth condition. Here, we present a method to identify “phenotypic signatures” by time-frequency analysis of unbalanced growth curves measured with high temporal resolution. The signatures are then applied to differentiate amongst different bacterial strains or the same strain under different growth conditions, and to identify the essential architecture of the gene network underlying the observed growth dynamics. Our method has implications for both basic understanding of bacterial physiology and for the classification of bacterial strains. PMID:25101949

  10. Phenotypic signatures arising from unbalanced bacterial growth.

    PubMed

    Tan, Cheemeng; Smith, Robert Phillip; Tsai, Ming-Chi; Schwartz, Russell; You, Lingchong

    2014-08-01

    Fluctuations in the growth rate of a bacterial culture during unbalanced growth are generally considered undesirable in quantitative studies of bacterial physiology. Under well-controlled experimental conditions, however, these fluctuations are not random but instead reflect the interplay between intra-cellular networks underlying bacterial growth and the growth environment. Therefore, these fluctuations could be considered quantitative phenotypes of the bacteria under a specific growth condition. Here, we present a method to identify "phenotypic signatures" by time-frequency analysis of unbalanced growth curves measured with high temporal resolution. The signatures are then applied to differentiate amongst different bacterial strains or the same strain under different growth conditions, and to identify the essential architecture of the gene network underlying the observed growth dynamics. Our method has implications for both basic understanding of bacterial physiology and for the classification of bacterial strains.

  11. Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato

    PubMed Central

    Tai, Thomas H.; Dahlbeck, Douglas; Clark, Eszter T.; Gajiwala, Paresh; Pasion, Romela; Whalen, Maureen C.; Stall, Robert E.; Staskawicz, Brian J.

    1999-01-01

    The Bs2 resistance gene of pepper specifically recognizes and confers resistance to strains of Xanthomonas campestris pv. vesicatoria that contain the corresponding bacterial avirulence gene, avrBs2. The involvement of avrBs2 in pathogen fitness and its prevalence in many X. campestris pathovars suggests that the Bs2 gene may be durable in the field and provide resistance when introduced into other plant species. Employing a positional cloning strategy, the Bs2 locus was isolated and the gene was identified by coexpression with avrBs2 in an Agrobacterium-mediated transient assay. A single candidate gene, predicted to encode motifs characteristic of the nucleotide binding site–leucine-rich repeat class of resistance genes, was identified. This gene specifically controlled the hypersensitive response when transiently expressed in susceptible pepper and tomato lines and in a nonhost species, Nicotiana benthamiana, and was designated as Bs2. Functional expression of Bs2 in stable transgenic tomatoes supports its use as a source of resistance in other Solanaceous plant species. PMID:10570214

  12. Expression of the Bs2 pepper gene confers resistance to bacterial spot disease in tomato.

    PubMed

    Tai, T H; Dahlbeck, D; Clark, E T; Gajiwala, P; Pasion, R; Whalen, M C; Stall, R E; Staskawicz, B J

    1999-11-23

    The Bs2 resistance gene of pepper specifically recognizes and confers resistance to strains of Xanthomonas campestris pv. vesicatoria that contain the corresponding bacterial avirulence gene, avrBs2. The involvement of avrBs2 in pathogen fitness and its prevalence in many X. campestris pathovars suggests that the Bs2 gene may be durable in the field and provide resistance when introduced into other plant species. Employing a positional cloning strategy, the Bs2 locus was isolated and the gene was identified by coexpression with avrBs2 in an Agrobacterium-mediated transient assay. A single candidate gene, predicted to encode motifs characteristic of the nucleotide binding site-leucine-rich repeat class of resistance genes, was identified. This gene specifically controlled the hypersensitive response when transiently expressed in susceptible pepper and tomato lines and in a nonhost species, Nicotiana benthamiana, and was designated as Bs2. Functional expression of Bs2 in stable transgenic tomatoes supports its use as a source of resistance in other Solanaceous plant species.

  13. RNA search engines empower the bacterial intranet.

    PubMed

    Dendooven, Tom; Luisi, Ben F

    2017-08-15

    RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. © 2017 The Author(s).

  14. RNA search engines empower the bacterial intranet

    PubMed Central

    Dendooven, Tom

    2017-01-01

    RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. PMID:28710287

  15. Growth of ammonia-oxidizing archaea in soil microcosms is inhibited by acetylene.

    PubMed

    Offre, Pierre; Prosser, James I; Nicol, Graeme W

    2009-10-01

    Autotrophic ammonia-oxidizing bacteria were considered to be responsible for the majority of ammonia oxidation in soil until the recent discovery of the autotrophic ammonia-oxidizing archaea. To assess the relative contributions of bacterial and archaeal ammonia oxidizers to soil ammonia oxidation, their growth was analysed during active nitrification in soil microcosms incubated for 30 days at 30 degrees C, and the effect of an inhibitor of ammonia oxidation (acetylene) on their growth and soil nitrification kinetics was determined. Denaturing gradient gel electrophoresis (DGGE) analysis of bacterial ammonia oxidizer 16S rRNA genes did not detect any change in their community composition during incubation, and quantitative PCR (qPCR) analysis of bacterial amoA genes indicated a small decrease in abundance in control and acetylene-containing microcosms. DGGE fingerprints of archaeal amoA and 16S rRNA genes demonstrated changes in the relative abundance of specific crenarchaeal phylotypes during active nitrification. Growth was also indicated by increases in crenarchaeal amoA gene copy number, determined by qPCR. In microcosms containing acetylene, nitrification and growth of the crenarchaeal phylotypes were suppressed, suggesting that these crenarchaea are ammonia oxidizers. Growth of only archaeal but not bacterial ammonia oxidizers occurred in microcosms with active nitrification, indicating that ammonia oxidation was mostly due to archaea in the conditions of the present study.

  16. Mobilization of Carbapenemase-Mediated Resistance in Enterobacteriaceae.

    PubMed

    Mathers, Amy

    2016-06-01

    There has been a dramatic increase in the last decade in the number of carbapenem-resistant Enterobacteriaceae, often leaving patients and their providers with few treatment options and resultant poor outcomes when an infection develops. The majority of the carbapenem resistance is mediated by bacterial acquisition of one of three carbapenemases (Klebsiella pneumoniae carbapenemase [KPC], oxacillinase-48-like [OXA-48], and the New Delhi metallo-β-lactamase [NDM]). Each of these enzymes has a unique global epidemiology and microbiology. The genes which encode the most globally widespread carbapenemases are typically carried on mobile pieces of DNA which can be freely exchanged between bacterial strains and species via horizontal gene transfer. Unfortunately, most of the antimicrobial surveillance systems target specific strains or species and therefore are not well equipped for examining genes of drug resistance. Examination of not only the carbapenemase gene itself but also the genetic context which can predispose a gene to mobilize within a diversity of species and environments will likely be central to understanding the factors contributing to the global dissemination of carbapenem resistance. Using the three most prevalent carbapenemase genes as examples, this chapter highlights the potential impact the associated genetic mobile elements have on the epidemiology and microbiology for each carbapenemase. Understanding how a carbapenemase gene mobilizes through a bacterial population will be critical for detection methods and ultimately inform infection control practices. Understanding gene mobilization and tracking will require novel approaches to surveillance, which will be required to slow the spread of this emerging resistance.

  17. Lateral organ boundaries 1 is a disease susceptibility gene for citrus bacterial canker disease

    PubMed Central

    Hu, Yang; Zhang, Junli; Jia, Hongge; Sosso, Davide; Li, Ting; Frommer, Wolf B.; Yang, Bing; White, Frank F.; Wang, Nian; Jones, Jeffrey B.

    2014-01-01

    Citrus bacterial canker (CBC) disease occurs worldwide and incurs considerable costs both from control measures and yield losses. Bacteria that cause CBC require one of six known type III transcription activator-like (TAL) effector genes for the characteristic pustule formation at the site of infection. Here, we show that Xanthomonas citri subspecies citri strain Xcc306, with the type III TAL effector gene pthA4 or with the distinct yet biologically equivalent gene pthAw from strain XccAw, induces two host genes, CsLOB1 and CsSWEET1, in a TAL effector-dependent manner. CsLOB1 is a member of the Lateral Organ Boundaries (LOB) gene family of transcription factors, and CsSWEET1 is a homolog of the SWEET sugar transporter and rice disease susceptibility gene. Both TAL effectors drive expression of CsLOB1 and CsSWEET1 promoter reporter gene fusions when coexpressed in citrus or Nicotiana benthamiana. Artificially designed TAL effectors directed to sequences in the CsLOB1 promoter region, but not the CsSWEET1 promoter, promoted pustule formation and higher bacterial leaf populations. Three additional distinct TAL effector genes, pthA*, pthB, and pthC, also direct pustule formation and expression of CsLOB1. Unlike pthA4 and pthAw, pthB and pthC do not promote the expression of CsSWEET1. CsLOB1 expression was associated with the expression of genes associated with cell expansion. The results indicate that CBC-inciting species of Xanthomonas exploit a single host disease susceptibility gene by altering the expression of an otherwise developmentally regulated gene using any one of a diverse set of TAL effector genes in the pathogen populations. PMID:24474801

  18. Lateral organ boundaries 1 is a disease susceptibility gene for citrus bacterial canker disease.

    PubMed

    Hu, Yang; Zhang, Junli; Jia, Hongge; Sosso, Davide; Li, Ting; Frommer, Wolf B; Yang, Bing; White, Frank F; Wang, Nian; Jones, Jeffrey B

    2014-01-28

    Citrus bacterial canker (CBC) disease occurs worldwide and incurs considerable costs both from control measures and yield losses. Bacteria that cause CBC require one of six known type III transcription activator-like (TAL) effector genes for the characteristic pustule formation at the site of infection. Here, we show that Xanthomonas citri subspecies citri strain Xcc306, with the type III TAL effector gene pthA4 or with the distinct yet biologically equivalent gene pthAw from strain XccA(w), induces two host genes, CsLOB1 and CsSWEET1, in a TAL effector-dependent manner. CsLOB1 is a member of the Lateral Organ Boundaries (LOB) gene family of transcription factors, and CsSWEET1 is a homolog of the SWEET sugar transporter and rice disease susceptibility gene. Both TAL effectors drive expression of CsLOB1 and CsSWEET1 promoter reporter gene fusions when coexpressed in citrus or Nicotiana benthamiana. Artificially designed TAL effectors directed to sequences in the CsLOB1 promoter region, but not the CsSWEET1 promoter, promoted pustule formation and higher bacterial leaf populations. Three additional distinct TAL effector genes, pthA*, pthB, and pthC, also direct pustule formation and expression of CsLOB1. Unlike pthA4 and pthAw, pthB and pthC do not promote the expression of CsSWEET1. CsLOB1 expression was associated with the expression of genes associated with cell expansion. The results indicate that CBC-inciting species of Xanthomonas exploit a single host disease susceptibility gene by altering the expression of an otherwise developmentally regulated gene using any one of a diverse set of TAL effector genes in the pathogen populations.

  19. The impact of persistent bacterial bronchitis on the pulmonary microbiome of children

    PubMed Central

    Bingle, Lynne; Cookson, William O. C. M.; Everard, Mark L.; Moffatt, Miriam F.

    2017-01-01

    Introduction Persistent bacterial bronchitis (PBB) is a leading cause of chronic wet cough in young children. This study aimed to characterise the respiratory bacterial microbiota of healthy children and to assess the impact of the changes associated with the development of PBB. Blind, protected brushings were obtained from 20 healthy controls and 24 children with PBB, with an additional directed sample obtained from PBB patients. DNA was extracted, quantified using a 16S rRNA gene quantitative PCR assay prior to microbial community analysis by 16S rRNA gene sequencing. Results No significant difference in bacterial diversity or community composition (R2 = 0.01, P = 0.36) was observed between paired blind and non-blind brushes, showing that blind brushings are a valid means of accessing the airway microbiota. This has important implications for collecting lower respiratory samples from healthy children. A significant decrease in bacterial diversity (P < 0.001) and change in community composition (R2 = 0.08, P = 0.004) was observed among controls, in comparison with patients. Bacterial communities within patients with PBB were dominated by Proteobacteria, and indicator species analysis showed that Haemophilus and Neisseria were significantly associated with the patient group. In 15 (52.9%) cases the dominant organism by sequencing was not identified by standard routine clinical culture. Conclusion The bacteria present in the lungs of patients with PBB were less diverse in terms of richness and evenness. The results validate the clinical diagnosis, and suggest that more attention to bacterial communities in children with chronic cough may lead to more rapid recognition of this condition with earlier treatment and reduction in disease burden. PMID:29281698

  20. Riboswitches in eubacteria sense the second messenger c-di-AMP

    PubMed Central

    Nelson, James W.; Sudarsan, Narasimhan; Furukawa, Kazuhiro; Weinberg, Zasha; Wang, Joy X.; Breaker, Ronald R.

    2013-01-01

    Cyclic di-adenosine monophosphate (c-di-AMP) is a recently discovered bacterial second messenger implicated in the control of cell wall metabolism, osmotic stress responses, and sporulation. However, the mechanisms by which c-di-AMP triggers these physiological responses have remained largely unknown. Intriguingly, a candidate riboswitch class called ydaO associates with numerous genes involved in these same processes. Although a representative ydaO motif RNA recently was reported to weakly bind ATP, we report that numerous members of this noncoding RNA class selectively respond to c-di-AMP with sub-nanomolar affinity. Our findings resolve the mystery regarding the primary ligand for this extremely common riboswitch class and expose a major portion of the super-regulon of genes that are controlled by the widespread bacterial second messenger c-di-AMP. PMID:24141192

  1. Two poplar-associated bacterial isolates induce additive favorable responses in a constructed plant-microbiome system

    DOE PAGES

    Jawdy, Sara S.; Gunter, Lee E.; Engle, Nancy L.; ...

    2016-04-26

    Here, the biological function of the plant-microbiome system is the result of contributions from the host plant and microbiome members. In this work we study the function of a simplified community consisting of Pseudomonas and Burkholderia bacterial strains isolated from Populus hosts and inoculated on axenic Populus cutting in controlled laboratory conditions. Inoculation individually with either bacterial isolate increased root growth relative to uninoculated controls. Root area, photosynthetic efficiency, gene expression and metabolite expression data in individual and dual inoculated treatments indicate that the effects of these bacteria are unique and additive, suggesting that the function of a microbiome communitymore » may be predicted from the additive functions of the individual members.« less

  2. Suppressing tawny crazy ant (Nylanderia fulva) by RNAi technology.

    PubMed

    Meng, Jia; Lei, Jiaxin; Davitt, Andrew; Holt, Jocelyn R; Huang, Jian; Gold, Roger; Vargo, Edward L; Tarone, Aaron M; Zhu-Salzman, Keyan

    2018-05-22

    The tawny crazy ant (Nylanderia fulva) is a new invasive pest in the United States. At present, its management mainly relies on the use of synthetic insecticides, which are generally ineffective at producing lasting control of the pest, necessitating alternative environmentally friendly measures. In this study, we evaluated the feasibility of gene silencing to control this ant species. Six housekeeping genes encoding actin (NfActin), coatomer subunit β (NfCOPβ), arginine kinase (NfArgK), and V-type proton ATPase subunits A (NfvATPaseA), B (NfvATPaseB) and E (NfvATPaseE) were cloned. Phylogenetic analysis revealed high sequence similarity to homologs from other ant species, particularly the Florida carpenter ant (Camponotus floridanus). To silence these genes, vector L4440 was used to generate 6 specific RNAi constructs for bacterial expression. Heat-inactivated, dsRNA-expressing Escherichia coli were incorporated into artificial diet. Worker ants exhibited reduced endogenous gene expression after feeding on such diet for 9 days. However, only ingestion of dsRNAs of NfCOPβ (a gene involved in protein trafficking) and NfArgK (a cellular energy reserve regulatory gene in invertebrates) caused modest but significantly higher ant mortality than the control. These results suggest that bacterially expressed dsRNA can be orally delivered to ant cells as a mean to target its vulnerabilities. Improved efficacy is necessary for the RNAi-based approach to be useful in tawny crazy ant management. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  3. Multilevel Regulation of Bacterial Gene Expression with the Combined STAR and Antisense RNA System.

    PubMed

    Lee, Young Je; Kim, Soo-Jung; Moon, Tae Seok

    2018-03-16

    Synthetic small RNA regulators have emerged as a versatile tool to predictably control bacterial gene expression. Owing to their simple design principles, small size, and highly orthogonal behavior, these engineered genetic parts have been incorporated into genetic circuits. However, efforts to achieve more sophisticated cellular functions using RNA regulators have been hindered by our limited ability to integrate different RNA regulators into complex circuits. Here, we present a combined RNA regulatory system in Escherichia coli that uses small transcription activating RNA (STAR) and antisense RNA (asRNA) to activate or deactivate target gene expression in a programmable manner. Specifically, we demonstrated that the activated target output by the STAR system can be deactivated by expressing two different types of asRNAs: one binds to and sequesters the STAR regulator, affecting the transcription process, while the other binds to the target mRNA, affecting the translation process. We improved deactivation efficiencies (up to 96%) by optimizing each type of asRNA and then integrating the two optimized asRNAs into a single circuit. Furthermore, we demonstrated that the combined STAR and asRNA system can control gene expression in a reversible way and can regulate expression of a gene in the genome. Lastly, we constructed and simultaneously tested two A AND NOT B logic gates in the same cell to show sophisticated multigene regulation by the combined system. Our approach establishes a methodology for integrating multiple RNA regulators to rationally control multiple genes.

  4. Bacterial gene abundances as indicators of greenhouse gas emission in soils.

    PubMed

    Morales, Sergio E; Cosart, Theodore; Holben, William E

    2010-06-01

    Nitrogen fixing and denitrifying bacteria, respectively, control bulk inputs and outputs of nitrogen in soils, thereby mediating nitrogen-based greenhouse gas emissions in an ecosystem. Molecular techniques were used to evaluate the relative abundances of nitrogen fixing, denitrifying and two numerically dominant ribotypes (based on the > or =97% sequence similarity at the 16S rRNA gene) of bacteria in plots representing 10 agricultural and other land-use practices at the Kellogg biological station long-term ecological research site. Quantification of nitrogen-related functional genes (nitrite reductase, nirS; nitrous oxide reductase, nosZ; and nitrogenase, nifH) as well as two dominant 16S ribotypes (belonging to the phyla Acidobacteria, Thermomicrobia) allowed us to evaluate the hypothesis that microbial community differences are linked to greenhouse gas emissions under different land management practices. Our results suggest that the successional stages of the ecosystem are strongly linked to bacterial functional group abundance, and that the legacy of agricultural practices can be sustained over decades. We also link greenhouse gas emissions with specific compositional responses in the soil bacterial community and assess the use of denitrifying gene abundances as proxies for determining nitrous oxide emissions from soils.

  5. Molecular Characterization of the Onset and Progression of Colitis in Inoculated Interleukin-10 Gene-Deficient Mice: A Role for PPARα

    PubMed Central

    Knoch, Bianca; Barnett, Matthew P. G.; Cooney, Janine; McNabb, Warren C.; Barraclough, Diane; Laing, William; Zhu, Shuotun; Park, Zaneta A.; MacLean, Paul; Knowles, Scott O.; Roy, Nicole C.

    2010-01-01

    The interleukin-10 gene-deficient (Il10 −/−) mouse is a model of human inflammatory bowel disease and Ppara has been identified as one of the key genes involved in regulation of colitis in the bacterially inoculated Il10 −/− model. The aims were to (1) characterize colitis onset and progression using a histopathological, transcriptomic, and proteomic approach and (2) investigate links between PPARα and IL10 using gene network analysis. Bacterial inoculation resulted in severe colitis in Il10 −/− mice from 10 to 12 weeks of age. Innate and adaptive immune responses showed differences in gene expression relating to colitis severity. Actin cytoskeleton dynamics, innate immunity, and apoptosis-linked gene and protein expression data suggested a delayed remodeling process in 12-week-old Il10 −/− mice. Gene expression changes in 12-week-old Il10 −/− mice were related to PPARα signaling likely to control colitis, but how PPARα activation might regulate intestinal IL10 production remains to be determined. PMID:20671959

  6. Molecular breeding of transgenic rice plants expressing a bacterial chlorocatechol dioxygenase gene.

    PubMed

    Shimizu, Masami; Kimura, Tetsuya; Koyama, Takayoshi; Suzuki, Katsuhisa; Ogawa, Naoto; Miyashita, Kiyotaka; Sakka, Kazuo; Ohmiya, Kunio

    2002-08-01

    The cbnA gene encoding the chlorocatechol dioxygenase gene from Ralstonia eutropha NH9 was introduced into rice plants. The cbnA gene was expressed in transgenic rice plants under the control of a modified cauliflower mosaic virus 35S promoter. Western blot analysis using anti-CbnA protein indicated that the cbnA gene was expressed in leaf tissue, roots, culms, and seeds. Transgenic rice calluses expressing the cbnA gene converted 3-chlorocatechol to 2-chloromucote efficiently. Growth and morphology of the transgenic rice plants expressing the cbnA gene were not distinguished from those of control rice plants harboring only a Ti binary vector. It is thus possible to breed transgenic plants that degrade chloroaromatic compounds in soil and surface water.

  7. The Role of Multiple Transcription Factors In Archaeal Gene Expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Charles J. Daniels

    2008-09-23

    Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcaniimore » was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of specific tfb genes and the regulation of nitrogen metabolism and other global cellular responses.« less

  8. Can dead bacterial cells be defined and are genes expressed after cell death?

    PubMed

    Trevors, J T

    2012-07-01

    There is a paucity of knowledge on gene expression in dead bacterial cells. Why would this knowledge be useful? The cells are dead. However, the time duration of gene expression following cell death is often unknown, and possibly in the order of minutes. In addition, it is a challenge to determine if bacterial cells are dead, or viable but non-culturable (VBNC), and what is an agreed upon correct definition of dead bacteria. Cells in the bacterial population or community may die at different rates or times and this complicates both the viability and gene expression analysis. In this article, the definition of dead bacterial cells is discussed and its significance in continued gene expression in cells following death. The definition of living and dead has implications for possible, completely, synthetic bacterial cells that may be capable of growth and division. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Seasonality and resource availability control bacterial and archaeal communities in soils of a temperate beech forest

    PubMed Central

    Rasche, Frank; Knapp, Daniela; Kaiser, Christina; Koranda, Marianne; Kitzler, Barbara; Zechmeister-Boltenstern, Sophie; Richter, Andreas; Sessitsch, Angela

    2011-01-01

    It was hypothesized that seasonality and resource availability altered through tree girdling were major determinants of the phylogenetic composition of the archaeal and bacterial community in a temperate beech forest soil. During a 2-year field experiment, involving girdling of beech trees to intercept the transfer of easily available carbon (C) from the canopy to roots, members of the dominant phylogenetic microbial phyla residing in top soils under girdled versus untreated control trees were monitored at bimonthly intervals through 16S rRNA gene-based terminal restriction fragment length polymorphism profiling and quantitative PCR analysis. Effects on nitrifying and denitrifying groups were assessed by measuring the abundances of nirS and nosZ genes as well as bacterial and archaeal amoA genes. Seasonal dynamics displayed by key phylogenetic and nitrogen (N) cycling functional groups were found to be tightly coupled with seasonal alterations in labile C and N pools as well as with variation in soil temperature and soil moisture. In particular, archaea and acidobacteria were highly responsive to soil nutritional and soil climatic changes associated with seasonality, indicating their high metabolic versatility and capability to adapt to environmental changes. For these phyla, significant interrelations with soil chemical and microbial process data were found suggesting their potential, but poorly described contribution to nitrification or denitrification in temperate forest soils. In conclusion, our extensive approach allowed us to get novel insights into effects of seasonality and resource availability on the microbial community, in particular on hitherto poorly studied bacterial phyla and functional groups. PMID:20882059

  10. Bacterial lineages putatively associated with the dissemination of antibiotic resistance genes in a full-scale urban wastewater treatment plant.

    PubMed

    Narciso-da-Rocha, Carlos; Rocha, Jaqueline; Vaz-Moreira, Ivone; Lira, Felipe; Tamames, Javier; Henriques, Isabel; Martinez, José Luis; Manaia, Célia M

    2018-06-05

    Urban wastewater treatment plants (UWTPs) are reservoirs of antibiotic resistance. Wastewater treatment changes the bacterial community and inevitably impacts the fate of antibiotic resistant bacteria and antibiotic resistance genes (ARGs). Some bacterial groups are major carriers of ARGs and hence, their elimination during wastewater treatment may contribute to increasing resistance removal efficiency. This study, conducted at a full-scale UWTP, evaluated variations in the bacterial community and ARGs loads and explored possible associations among them. With that aim, the bacterial community composition (16S rRNA gene Illumina sequencing) and ARGs abundance (real-time PCR) were characterized in samples of raw wastewater (RWW), secondary effluent (sTWW), after UV disinfection (tTWW), and after a period of 3 days storage to monitoring possible bacterial regrowth (tTWW-RE). Culturable enterobacteria were also enumerated. Secondary treatment was associated with the most dramatic bacterial community variations and coincided with reductions of ~2 log-units in the ARGs abundance. In contrast, no significant changes in the bacterial community composition and ARGs abundance were observed after UV disinfection of sTWW. Nevertheless, after UV treatment, viability losses were indicated ~2 log-units reductions of culturable enterobacteria. The analysed ARGs (qnrS, bla CTX-M , bla OXA-A , bla TEM , bla SHV , sul1, sul2, and intI1) were strongly correlated with taxa more abundant in RWW than in the other types of water, and which associated with humans and animals, such as members of the families Campylobacteraceae, Comamonadaceae, Aeromonadaceae, Moraxellaceae, and Bacteroidaceae. Further knowledge of the dynamics of the bacterial community during wastewater treatment and its relationship with ARGs variations may contribute with information useful for wastewater treatment optimization, aiming at a more effective resistance control. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Effects of polycyclic aromatic hydrocarbons on microbial community structure and PAH ring hydroxylating dioxygenase gene abundance in soil.

    PubMed

    Sawulski, Przemyslaw; Clipson, Nicholas; Doyle, Evelyn

    2014-11-01

    Development of successful bioremediation strategies for environments contaminated with recalcitrant pollutants requires in-depth knowledge of the microorganisms and microbial processes involved in degradation. The response of soil microbial communities to three polycyclic aromatic hydrocarbons, phenanthrene (3-ring), fluoranthene (4-ring) and benzo(a)pyrene (5-ring), was examined. Profiles of bacterial, archaeal and fungal communities were generated using molecular fingerprinting techniques (TRFLP, ARISA) and multivariate statistical tools were employed to interpret the effect of PAHs on community dynamics and composition. The extent and rate of PAH removal was directly related to the chemical structure, with the 5-ring PAH benzo(a)pyrene degraded more slowly than phenathrene or fluoranthene. Bacterial, archaeal and fungal communities were all significantly affected by PAH amendment, time and their interaction. Based on analysis of clone libraries, Actinobacteria appeared to dominate in fluoranthene amended soil, although they also represented a significant portion of the diversity in phenanthrene amended and unamended soils. In addition there appeared to be more γ-Proteobacteria and less Bacteroidetes in soil amended with either PAH compared to the control. The soil bacterial community clearly possessed the potential to degrade PAHs as evidenced by the abundance of PAH ring hydroxylating (PAH-RHDα) genes from both gram negative (GN) and gram positive (GP) bacteria in PAH-amended and control soils. Although the dioxygenase gene from GP bacteria was less abundant in soil than the gene associated with GN bacteria, significant (p < 0.001) increases in the abundance of the GP PAH-RHDα gene were observed during phenanthrene and fluoranthene degradation, whereas there was no significant difference in the abundance of the GN PAH-RHDα gene during the course of the experiment. Few studies to-date have examined the effect of pollutants on more than one microbial community in soil. The current study provides information on the response of soil bacterial, archaeal and fungal communities during the degradation of three priority pollutants and contributes to a knowledge base that can inform the development of effective bioremediation strategies for contaminated sites.

  12. Dynamics of Immune System Gene Expression upon Bacterial Challenge and Wounding in a Social Insect (Bombus terrestris)

    PubMed Central

    Erler, Silvio; Popp, Mario; Lattorff, H. Michael G.

    2011-01-01

    The innate immune system which helps individuals to combat pathogens comprises a set of genes representing four immune system pathways (Toll, Imd, JNK and JAK/STAT). There is a lack of immune genes in social insects (e.g. honeybees) when compared to Diptera. Potentially, this might be compensated by an advanced system of social immunity (synergistic action of several individuals). The bumble bee, Bombus terrestris, is a primitively eusocial species with an annual life cycle and colonies headed by a single queen. We used this key pollinator to study the temporal dynamics of immune system gene expression in response to wounding and bacterial challenge. Antimicrobial peptides (AMP) (abaecin, defensin 1, hymenoptaecin) were strongly up-regulated by wounding and bacterial challenge, the latter showing a higher impact on the gene expression level. Sterile wounding down-regulated TEP A, an effector gene of the JAK/STAT pathway, and bacterial infection influenced genes of the Imd (relish) and JNK pathway (basket). Relish was up-regulated within the first hour after bacterial challenge, but decreased strongly afterwards. AMP expression following wounding and bacterial challenge correlates with the expression pattern of relish whereas correlated expression with dorsal was absent. Although expression of AMPs was high, continuous bacterial growth was observed throughout the experiment. Here we demonstrate for the first time the temporal dynamics of immune system gene expression in a social insect. Wounding and bacterial challenge affected the innate immune system significantly. Induction of AMP expression due to wounding might comprise a pre-adaptation to accompanying bacterial infections. Compared with solitary species this social insect exhibits reduced immune system efficiency, as bacterial growth could not be inhibited. A negative feedback loop regulating the Imd-pathway is suggested. AMPs, the end product of the Imd-pathway, inhibited the up-regulation of the transcription factor relish, which is necessary for effector gene expression. PMID:21479237

  13. A Network Biology Approach to Decipher Stress Response in Bacteria Using Escherichia coli As a Model.

    PubMed

    Nagar, Shashwat Deepali; Aggarwal, Bhavye; Joon, Shikha; Bhatnagar, Rakesh; Bhatnagar, Sonika

    2016-05-01

    The development of drug-resistant pathogenic bacteria poses challenges to global health for their treatment and control. In this context, stress response enables bacterial populations to survive extreme perturbations in the environment but remains poorly understood. Specific modules are activated for unique stressors with few recognized global regulators. The phenomenon of cross-stress protection strongly suggests the presence of central proteins that control the diverse stress responses. In this work, Escherichia coli was used to model the bacterial stress response. A Protein-Protein Interaction Network was generated by integrating differentially expressed genes in eight stress conditions of pH, temperature, and antibiotics with relevant gene ontology terms. Topological analysis identified 24 central proteins. The well-documented role of 16 central proteins in stress indicates central control of the response, while the remaining eight proteins may have a novel role in stress response. Cluster analysis of the generated network implicated RNA binding, flagellar assembly, ABC transporters, and DNA repair as important processes during response to stress. Pathway analysis showed crosstalk of Two Component Systems with metabolic processes, oxidative phosphorylation, and ABC transporters. The results were further validated by analysis of an independent cross-stress protection dataset. This study also reports on the ways in which bacterial stress response can progress to biofilm formation. In conclusion, we suggest that drug targets or pathways disrupting bacterial stress responses can potentially be exploited to combat antibiotic tolerance and multidrug resistance in the future.

  14. Nuclear translocation of Acinetobacter baumannii transposase induces DNA methylation of CpG regions in the promoters of E-cadherin gene.

    PubMed

    Moon, Dong Chan; Choi, Chul Hee; Lee, Su Man; Lee, Jung Hwa; Kim, Seung Il; Kim, Dong Sun; Lee, Je Chul

    2012-01-01

    Nuclear targeting of bacterial proteins has emerged as a pathogenic mechanism whereby bacterial proteins induce host cell pathology. In this study, we examined nuclear targeting of Acinetobacter baumannii transposase (Tnp) and subsequent epigenetic changes in host cells. Tnp of A. baumannii ATCC 17978 possesses nuclear localization signals (NLSs), (225)RKRKRK(230). Transient expression of A. baumannii Tnp fused with green fluorescent protein (GFP) resulted in the nuclear localization of these proteins in COS-7 cells, whereas the truncated Tnp without NLSs fused with GFP were exclusively localized in the cytoplasm. A. baumannii Tnp was found in outer membrane vesicles, which delivered this protein to the nucleus of host cells. Nuclear expression of A. baumannii Tnp fused with GFP in A549 cells induced DNA methylation of CpG regions in the promoters of E-cadherin (CDH1) gene, whereas the cytoplasmic localization of the truncated Tnp without NLSs fused with GFP did not induce DNA methylation. DNA methylation in the promoters of E-cadherin gene induced by nuclear targeting of A. baumannii Tnp resulted in down-regulation of gene expression. In conclusion, our data show that nuclear traffic of A. baumannii Tnp induces DNA methylation of CpG regions in the promoters of E-cadherin gene, which subsequently down-regulates gene expression. This study provides a new insight into the epigenetic control of host genes by bacterial proteins.

  15. Antibiotic resistance genes and intI1 prevalence in a swine wastewater treatment plant and correlation with metal resistance, bacterial community and wastewater parameters.

    PubMed

    Yuan, Qing-Bin; Zhai, Yi-Fan; Mao, Bu-Yun; Hu, Nan

    2018-06-07

    The livestock wastewater treatment plant represents an important reservoir of antibiotic resistance determinants in the environment. The study explored the prevalence of five antibiotic resistance genes (ARGs, including sulI, tetA, qnrD, mphB and mcr-1) and class 1 integron (intI1) in a typical livestock wastewater treatment plant, and analyzed their integrated association with two metal resistance genes (copA and czcA), two pathogens genes (Staphylococcus and Campylobacter), bacterial community and wastewater properties. Results indicated that all investigated genes were detected in the plant. The treatment plant could not completely remove ARGs abundances, with up to 2.2 × 10 4 ~3.7 × 10 8 copies/L of them remaining in the effluent. Mcr-1 was further enriched by 27-fold in the subsequent pond. The correlation analysis showed that mphB significantly correlateed with tetA and intI. Mcr-1 strongly correlated with copA. MphB and intI significantly correlated with czcA. The correlations implied a potential co-selection risk of bacterial resistant to antibiotics and metals. Redundancy analyses indicated that qnrD and mcr-1 strongly correlated with 13 and 14 bacterial genera, respectively. Most ARGs positively correlated to wastewater nutrients, indicating that an efficient reduction of wastewater nutrients would contribute to the antibiotic resistance control. The study will provide useful implications on fates and reductions of ARGs in livestock facilities and receiving environments. Copyright © 2018. Published by Elsevier Inc.

  16. Bacteria, phages and pigs: the effects of in-feed antibiotics on the microbiome at different gut locations.

    PubMed

    Looft, Torey; Allen, Heather K; Cantarel, Brandi L; Levine, Uri Y; Bayles, Darrell O; Alt, David P; Henrissat, Bernard; Stanton, Thaddeus B

    2014-08-01

    Disturbance of the beneficial gut microbial community is a potential collateral effect of antibiotics, which have many uses in animal agriculture (disease treatment or prevention and feed efficiency improvement). Understanding antibiotic effects on bacterial communities at different intestinal locations is essential to realize the full benefits and consequences of in-feed antibiotics. In this study, we defined the lumenal and mucosal bacterial communities from the small intestine (ileum) and large intestine (cecum and colon) plus feces, and characterized the effects of in-feed antibiotics (chlortetracycline, sulfamethazine and penicillin (ASP250)) on these communities. 16S rRNA gene sequence and metagenomic analyses of bacterial membership and functions revealed dramatic differences between small and large intestinal locations, including enrichment of Firmicutes and phage-encoding genes in the ileum. The large intestinal microbiota encoded numerous genes to degrade plant cell wall components, and these genes were lacking in the ileum. The mucosa-associated ileal microbiota harbored greater bacterial diversity than the lumen but similar membership to the mucosa of the large intestine, suggesting that most gut microbes can associate with the mucosa and might serve as an inoculum for the lumen. The collateral effects on the microbiota of antibiotic-fed animals caused divergence from that of control animals, with notable changes being increases in Escherichia coli populations in the ileum, Lachnobacterium spp. in all gut locations, and resistance genes to antibiotics not administered. Characterizing the differential metabolic capacities and response to perturbation at distinct intestinal locations will inform strategies to improve gut health and food safety.

  17. Towards Spectral Library-free MALDI-TOF MS Bacterial Identification.

    PubMed

    Cheng, Ding; Qiao, Liang; Horvatovich, Péter

    2018-05-11

    Bacterial identification is of great importance in clinical diagnosis, environmental monitoring and food safety control. Among various strategies, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has drawn significant interests, and has been clinically used. Nevertheless, current bioinformatics solutions use spectral libraries for the identification of bacterial strains. Spectral library generation requires acquisition of MALDI-TOF spectra from monoculture bacterial colonies, which is time-consuming and not possible for many species and strains. We propose a strategy for bacterial typing by MALDI-TOF using protein sequences from public database, i.e. UniProt. Ten genes were identified to encode proteins most often observed by MALD-TOF from bacteria through 500 times repeated a 10-fold double cross-validation procedure, using 403 MALDI-TOF spectra corresponding to 14 genera, 81 species and 403 strains, and the protein sequences of 1276 species in UniProt. The 10 genes were then used to annotate peaks on MALDI-TOF spectra of bacteria for bacterial identification. With the approach, bacteria can be identified at the genus level by searching against a database containing the protein sequences of 42 genera of bacteria from UniProt. Our approach identified 84.1% of the 403 spectra correctly at the genus level. Source code of the algorithm is available at https://github.com/dipcarbon/BacteriaMSLF.

  18. Bacterial Genome Instability

    PubMed Central

    Darmon, Elise

    2014-01-01

    SUMMARY Bacterial genomes are remarkably stable from one generation to the next but are plastic on an evolutionary time scale, substantially shaped by horizontal gene transfer, genome rearrangement, and the activities of mobile DNA elements. This implies the existence of a delicate balance between the maintenance of genome stability and the tolerance of genome instability. In this review, we describe the specialized genetic elements and the endogenous processes that contribute to genome instability. We then discuss the consequences of genome instability at the physiological level, where cells have harnessed instability to mediate phase and antigenic variation, and at the evolutionary level, where horizontal gene transfer has played an important role. Indeed, this ability to share DNA sequences has played a major part in the evolution of life on Earth. The evolutionary plasticity of bacterial genomes, coupled with the vast numbers of bacteria on the planet, substantially limits our ability to control disease. PMID:24600039

  19. Marine Viruses: Truth or Dare

    NASA Astrophysics Data System (ADS)

    Breitbart, Mya

    2012-01-01

    Over the past two decades, marine virology has progressed from a curiosity to an intensely studied topic of critical importance to oceanography. At concentrations of approximately 10 million viruses per milliliter of surface seawater, viruses are the most abundant biological entities in the oceans. The majority of these viruses are phages (viruses that infect bacteria). Through lysing their bacterial hosts, marine phages control bacterial abundance, affect community composition, and impact global biogeochemical cycles. In addition, phages influence their hosts through selection for resistance, horizontal gene transfer, and manipulation of bacterial metabolism. Recent work has also demonstrated that marine phages are extremely diverse and can carry a variety of auxiliary metabolic genes encoding critical ecological functions. This review is structured as a scientific "truth or dare," revealing several well-established "truths" about marine viruses and presenting a few "dares" for the research community to undertake in future studies.

  20. Association between Toll-like receptor 9 gene polymorphisms and risk of bacterial meningitis in a Chinese population.

    PubMed

    Wang, X H; Shi, H P; Li, F J

    2016-07-25

    We determined whether two common single nucleotide polymorphisms (SNPs) in the Toll-like receptor 9 gene (TLR9) (TLR9+2848 rs352140 and TLR9-1237 rs5743836) influenced susceptibility to bacterial meningitis in a Chinese population. The study comprised 126 patients with bacterial meningitis and 252 control subjects, all of whom were recruited from the Tuberculosis Hospital of Shanxi Province. Genotyping of TLR9+2848 rs352140 and TLR9-1237 rs5743836 was performed by polymerase chain reaction coupled with restriction fragment length polymorphism. Using logistic regression analysis, we found that individuals with the AA genotype were associated with an increased risk of bacterial meningitis compared with those with the GG genotype (OR = 0.43, 95%CI = 0.19-0.95; P = 0.03). In a recessive model, the AA genotype was correlated with an elevated risk of bacterial meningitis compared with the GG+GA genotype (OR = 0.49, 95%CI = 0.22-0.99; P = 0.04). However, no significant differences were observed in the association between the TLR9-1237 rs5743836 polymorphism and the risk of bacterial meningitis in the codominant, dominant, or recessive models. In conclusion, the results of our study suggest an association between the TLR9+2848 polymorphism and a reduced risk of bacterial meningitis in the codominant and recessive models.

  1. Influence of zeolite and superphosphate as additives on antibiotic resistance genes and bacterial communities during factory-scale chicken manure composting.

    PubMed

    Peng, Shuang; Li, Huijie; Song, Dan; Lin, Xiangui; Wang, Yiming

    2018-04-30

    Factory-scale chicken manure composting added with zeolite (F), superphosphate (G), or zeolite and ferrous sulfate (FL) simultaneously, were evaluate for their effects on the behaviors of antibiotic resistance genes (ARGs) and bacterial communities. After composting, ARGs in manure decreased by 67.3% in the control, whereas the reductions were 86.5%, 68.6% and 72.2% in F, G and FL, respectively. ARGs encoding ribosomal protection proteins (tetO, tetB(P), and tetM) were reduced to a greater extent than tetG, tetL, sul1 and sul2. Bacteria pathogens were also effectively removed by composting. Network analysis showed that Firmicutes were the important potential host bacteria for ARGs. The bacterial communities and environmental factors, as well as the intI gene, contributed significantly to the variation of ARGs. The ARGs and integrons were reduced more when zeolite was added than when superphosphate was added; thus, it may be useful for reducing the risks of ARGs in chicken manure. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Applications of CRISPR/Cas System to Bacterial Metabolic Engineering.

    PubMed

    Cho, Suhyung; Shin, Jongoh; Cho, Byung-Kwan

    2018-04-05

    The clustered regularly interspaced short palindromic repeats/CRISPR-associated (CRISPR/Cas) adaptive immune system has been extensively used for gene editing, including gene deletion, insertion, and replacement in bacterial and eukaryotic cells owing to its simple, rapid, and efficient activities in unprecedented resolution. Furthermore, the CRISPR interference (CRISPRi) system including deactivated Cas9 (dCas9) with inactivated endonuclease activity has been further investigated for regulation of the target gene transiently or constitutively, avoiding cell death by disruption of genome. This review discusses the applications of CRISPR/Cas for genome editing in various bacterial systems and their applications. In particular, CRISPR technology has been used for the production of metabolites of high industrial significance, including biochemical, biofuel, and pharmaceutical products/precursors in bacteria. Here, we focus on methods to increase the productivity and yield/titer scan by controlling metabolic flux through individual or combinatorial use of CRISPR/Cas and CRISPRi systems with introduction of synthetic pathway in industrially common bacteria including Escherichia coli . Further, we discuss additional useful applications of the CRISPR/Cas system, including its use in functional genomics.

  3. Dominant petroleum hydrocarbon-degrading bacteria in the Archipelago Sea in South-West Finland (Baltic Sea) belong to different taxonomic groups than hydrocarbon degraders in the oceans.

    PubMed

    Reunamo, Anna; Riemann, Lasse; Leskinen, Piia; Jørgensen, Kirsten S

    2013-07-15

    The natural petroleum hydrocarbon degrading capacity of the Archipelago Sea water in S-W Finland was studied in a microcosm experiment. Pristine and previously oil exposed sites were examined. Bacterial community fingerprinting was performed using terminal restriction fragment length polymorphism (T-RFLP) and samples from selected microcosms were sequenced. The abundance of PAH degradation genes was measured by quantitative PCR. Bacterial communities in diesel exposed microcosms diverged from control microcosms during the experiment. Gram positive PAH degradation genes dominated at both sites in situ, whereas gram negative PAH degrading genes became enriched in diesel microcosms. The dominant bacterial groups after a 14 days of diesel exposure were different depending on the sampling site, belonging to the class Actinobacteria (32%) at a pristine site and Betaproteobacteria (52%) at a previously oil exposed site. The hydrocarbon degrading bacteria in the Baltic Sea differ from those in the oceans, where most hydrocarbon degraders belong to Gammaproteobacteria. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Interaction of Arabidopsis Trihelix-Domain Transcription Factors VFP3 and VFP5 with Agrobacterium Virulence Protein VirF

    PubMed Central

    García-Cano, Elena; Magori, Shimpei; Sun, Qi; Ding, Zehong; Lazarowitz, Sondra G.; Citovsky, Vitaly

    2015-01-01

    Agrobacterium is a natural genetic engineer of plants that exports several virulence proteins into host cells in order to take advantage of the cell machinery to facilitate transformation and support bacterial growth. One of these effectors is the F-box protein VirF, which presumably uses the host ubiquitin/proteasome system (UPS) to uncoat the packaging proteins from the invading bacterial T-DNA. By analogy to several other bacterial effectors, VirF most likely has several functions in the host cell and, therefore, several interacting partners among host proteins. Here we identify one such interactor, an Arabidopsis trihelix-domain transcription factor VFP3, and further show that its very close homolog VFP5 also interacted with VirF. Interestingly, interactions of VirF with either VFP3 or VFP5 did not activate the host UPS, suggesting that VirF might play other UPS-independent roles in bacterial infection. To better understand the potential scope of VFP3 function, we used RNAi to reduce expression of the VFP3 gene. Transcriptome profiling of these VFP3-silenced plants using high-throughput cDNA sequencing (RNA-seq) revealed that VFP3 substantially affected plant gene expression; specifically, 1,118 genes representing approximately 5% of all expressed genes were significantly either up- or down-regulated in the VFP3 RNAi line compared to wild-type Col-0 plants. Among the 507 up-regulated genes were genes implicated in the regulation of transcription, protein degradation, calcium signaling, and hormone metabolism, whereas the 611 down-regulated genes included those involved in redox regulation, light reactions of photosynthesis, and metabolism of lipids, amino acids, and cell wall. Overall, this pattern of changes in gene expression is characteristic of plants under stress. Thus, VFP3 likely plays an important role in controlling plant homeostasis. PMID:26571494

  5. Transcriptome Analysis Revealed Changes of Multiple Genes Involved in Haliotis discus hannai Innate Immunity during Vibrio parahemolyticus Infection.

    PubMed

    Nam, Bo-Hye; Jung, Myunghee; Subramaniyam, Sathiyamoorthy; Yoo, Seung-il; Markkandan, Kesavan; Moon, Ji-Young; Kim, Young-Ok; Kim, Dong-Gyun; An, Cheul Min; Shin, Younhee; Jung, Ho-jin; Park, Jun-hyung

    2016-01-01

    Abalone (Haliotis discus hannai) is one of the most valuable marine aquatic species in Korea, Japan and China. Tremendous exposure to bacterial infection is common in aquaculture environment, especially by Vibrio sp. infections. It's therefore necessary and urgent to understand the mechanism of H. discus hannai host defense against Vibrio parahemolyticus infection. However studies on its immune system are hindered by the lack of genomic resources. In the present study, we sequenced the transcriptome of control and bacterial challenged H. discus hannai tissues. Totally, 138 MB of reference transcriptome were obtained from de novo assembly of 34 GB clean bases from ten different libraries and annotated with the biological terms (GO and KEGG). A total of 10,575 transcripts exhibiting the differentially expression at least one pair of comparison and the functional annotations highlight genes related to immune response, cell adhesion, immune regulators, redox molecules and mitochondrial coding genes. Mostly, these groups of genes were dominated in hemocytes compared to other tissues. This work is a prerequisite for the identification of those physiological traits controlling H. discus hannai ability to survive against Vibrio infection.

  6. Transcriptome Analysis Revealed Changes of Multiple Genes Involved in Haliotis discus hannai Innate Immunity during Vibrio parahemolyticus Infection

    PubMed Central

    Nam, Bo-Hye; Jung, Myunghee; Subramaniyam, Sathiyamoorthy; Yoo, Seung-il; Markkandan, Kesavan; Moon, Ji-Young; Kim, Young-Ok; Kim, Dong-Gyun; An, Cheul Min; Shin, Younhee; Jung, Ho-jin; Park, Jun-hyung

    2016-01-01

    Abalone (Haliotis discus hannai) is one of the most valuable marine aquatic species in Korea, Japan and China. Tremendous exposure to bacterial infection is common in aquaculture environment, especially by Vibrio sp. infections. It’s therefore necessary and urgent to understand the mechanism of H. discus hannai host defense against Vibrio parahemolyticus infection. However studies on its immune system are hindered by the lack of genomic resources. In the present study, we sequenced the transcriptome of control and bacterial challenged H. discus hannai tissues. Totally, 138 MB of reference transcriptome were obtained from de novo assembly of 34 GB clean bases from ten different libraries and annotated with the biological terms (GO and KEGG). A total of 10,575 transcripts exhibiting the differentially expression at least one pair of comparison and the functional annotations highlight genes related to immune response, cell adhesion, immune regulators, redox molecules and mitochondrial coding genes. Mostly, these groups of genes were dominated in hemocytes compared to other tissues. This work is a prerequisite for the identification of those physiological traits controlling H. discus hannai ability to survive against Vibrio infection. PMID:27088873

  7. Dynamics of indigenous bacterial communities associated with crude oil degradation in soil microcosms during nutrient-enhanced bioremediation.

    PubMed

    Chikere, Chioma B; Surridge, Karen; Okpokwasili, Gideon C; Cloete, Thomas E

    2012-03-01

    Bacterial population dynamics were examined during bioremediation of an African soil contaminated with Arabian light crude oil and nutrient enrichment (biostimulation). Polymerase chain reaction followed by denaturing gradient gel electrophoresis (DGGE) were used to generate bacterial community fingerprints of the different treatments employing the 16S ribosomal ribonucleic acid (rRNA) gene as molecular marker. The DGGE patterns of the nutrient-amended soils indicated the presence of distinguishable bands corresponding to the oil-contaminated-nutrient-enriched soils, which were not present in the oil-contaminated and pristine control soils. Further characterization of the dominant DGGE bands after excision, reamplification and sequencing revealed that Corynebacterium spp., Dietzia spp., Rhodococcus erythropolis sp., Nocardioides sp., Low G+C (guanine plus cytosine) Gram positive bacterial clones and several uncultured bacterial clones were the dominant bacterial groups after biostimulation. Prominent Corynebacterium sp. IC10 sequence was detected across all nutrient-amended soils but not in oil-contaminated control soil. Total heterotrophic and hydrocarbon utilizing bacterial counts increased significantly in the nutrient-amended soils 2 weeks post contamination whereas oil-contaminated and pristine control soils remained fairly stable throughout the experimental period. Gas chromatographic analysis of residual hydrocarbons in biostimulated soils showed marked attenuation of contaminants starting from the second to the sixth week after contamination whereas no significant reduction in hydrocarbon peaks were seen in the oil-contaminated control soil throughout the 6-week experimental period. Results obtained indicated that nutrient amendment of oil-contaminated soil selected and enriched the bacterial communities mainly of the Actinobacteria phylogenetic group capable of surviving in toxic contamination with concomitant biodegradation of the hydrocarbons. The present study therefore demonstrated that the soil investigated harbours hydrocarbon-degrading bacterial populations which can be biostimulated to achieve effective bioremediation of oil-contaminated soil.

  8. The best of both worlds: reaping the benefits from mammalian and bacterial therapeutic circuits.

    PubMed

    Bojar, Daniel; Fussenegger, Martin

    2016-10-01

    Synthetic biology has revolutionized the field of biology in the last two decades. By taking apart natural systems and recombining engineered parts in novel constellations, it has not only unlocked a staggering variety of biological control mechanisms but it has also created a panoply of biomedical achievements, such as innovative diagnostics and therapies. The most common mode of action in the field of synthetic biology is mediated by synthetic gene circuits assembled in a systematic and rational manner. This review covers the most recent therapeutic gene circuits implemented in mammalian and bacterial cells designed for the diagnosis and therapy of an extensive array of diseases. Highlighting new tools for therapeutic gene circuits, we describe a future that holds a plethora of potentialities for the medicine of tomorrow. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Edible vaccine protects mice against Escherichia coli heat-labile enterotoxin (LT): potatoes expressing a synthetic LT-B gene.

    PubMed

    Mason, H S; Haq, T A; Clements, J D; Arntzen, C J

    1998-08-01

    The authors have designed and constructed a plant-optimize synthetic gene encoding the Escherichia coli heat-labile enterotoxin B subunit (LT-B), for use in transgenic plants as an edible vaccine against enterotoxigenic E. coli. Expression of the synthetic LT-B gene in potato plants under the control of a constitutive promoter yielded increased accumulation of LT-B in leaves and tubers, as compared to the bacterial LT-B gene. The plant-derived LT-B assembled into native pentameric structures as evidenced by its ability to bind ganglioside. The authors demonstrated immunogenicity by feeding mice the raw tubers and comparing the anti-LT-B serum IgG and faecal IgA to that produced in mice gavaged with bacterial LT-B. Mice were fed three weekly doses of 5 g tuber tissue containing either 20 or 50 micrograms LT-B, or gavaged weekly with 5 micrograms of LT-B from recombinant E. coli. One week after the third dose, mice immunized with potato LT-B had higher levels of serum and mucosal anti-LT-B than those gavaged with bacterial LT-B. Mice were challenged by oral administration of 25 micrograms LT, and protection assessed by comparing the gut/carcass mass ratios. Although none of the mice were completely protected, the higher dose potato vaccine compared favourably with the bacterial vaccine. These findings show that an edible vaccine against E. coli LT-B is feasible.

  10. Clavibacter michiganensis ssp. michiganensis: bacterial canker of tomato, molecular interactions and disease management.

    PubMed

    Nandi, Munmun; Macdonald, Jacqueline; Liu, Peng; Weselowski, Brian; Yuan, Ze-Chun

    2018-03-12

    Bacterial canker disease is considered to be one of the most destructive diseases of tomato (Solanum lycopersicum), and is caused by the seed-borne Gram-positive bacterium Clavibacter michiganensis ssp. michiganensis (Cmm). This vascular pathogen generally invades and proliferates in the xylem through natural openings or wounds, causing wilt and canker symptoms. The incidence of symptomless latent infections and the invasion of tomato seeds by Cmm are widespread. Pathogenicity is mediated by virulence factors and transcriptional regulators encoded by the chromosome and two natural plasmids. The virulence factors include serine proteases, cell wall-degrading enzymes (cellulases, xylanases, pectinases) and others. Mutational analyses of these genes and gene expression profiling (via quantitative reverse transcription-polymerase chain reaction, transcriptomics and proteomics) have begun to shed light on their roles in colonization and virulence, whereas the expression of tomato genes in response to Cmm infection suggests plant factors involved in the defence response. These findings may aid in the generation of target-specific bactericides or new resistant varieties of tomato. Meanwhile, various chemical and biological controls have been researched to control Cmm. This review presents a detailed investigation regarding the pathogen Cmm, bacterial canker infection, molecular interactions between Cmm and tomato, and current perspectives on improved disease management. © 2018 AGRICULTURE AND AGRI-FOOD CANADA. MOLECULAR PLANT PATHOLOGY © 2018 JOHN WILEY & SONS LTD.

  11. Electronic control of gene expression and cell behaviour in Escherichia coli through redox signalling

    NASA Astrophysics Data System (ADS)

    Tschirhart, Tanya; Kim, Eunkyoung; McKay, Ryan; Ueda, Hana; Wu, Hsuan-Chen; Pottash, Alex Eli; Zargar, Amin; Negrete, Alejandro; Shiloach, Joseph; Payne, Gregory F.; Bentley, William E.

    2017-01-01

    The ability to interconvert information between electronic and ionic modalities has transformed our ability to record and actuate biological function. Synthetic biology offers the potential to expand communication `bandwidth' by using biomolecules and providing electrochemical access to redox-based cell signals and behaviours. While engineered cells have transmitted molecular information to electronic devices, the potential for bidirectional communication stands largely untapped. Here we present a simple electrogenetic device that uses redox biomolecules to carry electronic information to engineered bacterial cells in order to control transcription from a simple synthetic gene circuit. Electronic actuation of the native transcriptional regulator SoxR and transcription from the PsoxS promoter allows cell response that is quick, reversible and dependent on the amplitude and frequency of the imposed electronic signals. Further, induction of bacterial motility and population based cell-to-cell communication demonstrates the versatility of our approach and potential to drive intricate biological behaviours.

  12. A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.

    PubMed

    Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

    2017-11-17

    The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.

  13. Mind-controlled transgene expression by a wireless-powered optogenetic designer cell implant.

    PubMed

    Folcher, Marc; Oesterle, Sabine; Zwicky, Katharina; Thekkottil, Thushara; Heymoz, Julie; Hohmann, Muriel; Christen, Matthias; Daoud El-Baba, Marie; Buchmann, Peter; Fussenegger, Martin

    2014-11-11

    Synthetic devices for traceless remote control of gene expression may provide new treatment opportunities in future gene- and cell-based therapies. Here we report the design of a synthetic mind-controlled gene switch that enables human brain activities and mental states to wirelessly programme the transgene expression in human cells. An electroencephalography (EEG)-based brain-computer interface (BCI) processing mental state-specific brain waves programs an inductively linked wireless-powered optogenetic implant containing designer cells engineered for near-infrared (NIR) light-adjustable expression of the human glycoprotein SEAP (secreted alkaline phosphatase). The synthetic optogenetic signalling pathway interfacing the BCI with target gene expression consists of an engineered NIR light-activated bacterial diguanylate cyclase (DGCL) producing the orthogonal second messenger cyclic diguanosine monophosphate (c-di-GMP), which triggers the stimulator of interferon genes (STING)-dependent induction of synthetic interferon-β promoters. Humans generating different mental states (biofeedback control, concentration, meditation) can differentially control SEAP production of the designer cells in culture and of subcutaneous wireless-powered optogenetic implants in mice.

  14. An AlgU-regulated antisense transcript encoded within the Pseudomonas syringae fleQ gene has a positive effect on motility

    USDA-ARS?s Scientific Manuscript database

    Bacterial flagella production is controlled by a multi-tiered regulatory system that coordinates expression of 40-50 subunits and correct assembly of these complicated structures. Flagellar expression is environmentally controlled, presumably to optimize the benefits and liabilities of flagellar ex...

  15. Impact of enrofloxacin on the human intestinal microbiota revealed by comparative molecular analysis.

    PubMed

    Kim, Bong-Soo; Kim, Jong Nam; Yoon, Seok-Hwan; Chun, Jongsik; Cerniglia, Carl E

    2012-06-01

    The indigenous human intestinal microbiota could be disrupted by residues of antibiotics in foods as well as therapeutically administered antibiotics to humans. These disruptions may lead to adverse health outcomes. To observe the possible impact of residues of antibiotics at concentrations below therapeutic levels on human intestinal microbiota, we performed studies using in vitro cultures of fecal suspensions from three individuals with 10 different concentrations (0, 0.1, 0.5, 1, 5, 10, 15, 25, 50 and 150 μg/ml) of the fluoroquinolone, enrofloxacin. The bacterial communities of the control and enrofloxacin dosed fecal samples were analyzed by denaturing gradient gel electrophoresis (DGGE) and pyrosequencing. In addition, changes of functional gene expression were analyzed by a pyrosequencing-based random whole-community mRNA sequencing method. Although each individual had a unique microbial composition, the communities of all individuals were affected by enrofloxacin. The proportions of two phyla, namely, Bacteroidetes and Proteobacteria, were significantly reduced with increasing concentrations of enrofloxacin exposure, while the proportion of Firmicutes increased. Principal Coordinate Analysis (PCoA) using the Fast UniFrac indicated that the community structures of intestinal microbiota were shifted by enrofloxacin. Most of the mRNA transcripts and the anti-microbial drug resistance genes increased with increasing concentrations of enrofloxacin. 16S rRNA gene pyrosequencing of control and enrofloxacin treated fecal suspensions provided valuable information of affected bacterial taxa down to the species level, and the community transcriptomic analyses using mRNA revealed the functional gene expression responses of the changed bacterial communities by enrofloxacin. Published by Elsevier Ltd.

  16. Silencing of ecdysone receptor, insect intestinal mucin and sericotropin genes by bacterially produced double-stranded RNA affects larval growth and development in Plutella xylostella and Helicoverpa armigera.

    PubMed

    Israni, B; Rajam, M V

    2017-04-01

    RNA interference mediated gene silencing, which is triggered by double-stranded RNA (dsRNA), has become a important tool for functional genomics studies in various systems, including insects. Bacterially produced dsRNA employs the use of a bacterial strain lacking in RNaseIII activity and harbouring a vector with dual T7 promoter sites, which allow the production of intact dsRNA molecules. Here, we report an assessment of the functional relevance of the ecdysone receptor, insect intestinal mucin and sericotropin genes through silencing by dsRNA in two lepidopteran insect pests, Helicoverpa armigera and Plutella xylostella, both of which cause serious crop losses. Oral feeding of dsRNA led to significant reduction in transcripts of the target insect genes, which caused significant larval mortality with various moulting anomalies and an overall developmental delay. We also found a significant decrease in reproductive potential in female moths, with a drop in egg laying and compromised egg hatching from treated larvae as compared to controls. dsRNA was stable in the insect gut and was efficiently processed into small interfering RNAs (siRNAs), thus accounting for the phenotypes observed in the present work. The study revealed the importance of these genes in core insect processes, which are essential for insect development and survival. © 2016 The Royal Entomological Society.

  17. Trimeric autotransporter adhesins contribute to Actinobacillus pleuropneumoniae pathogenicity in mice and regulate bacterial gene expression during interactions between bacteria and porcine primary alveolar macrophages.

    PubMed

    Qin, Wanhai; Wang, Lei; Zhai, Ruidong; Ma, Qiuyue; Liu, Jianfang; Bao, Chuntong; Zhang, Hu; Sun, Changjiang; Feng, Xin; Gu, Jingmin; Du, Chongtao; Han, Wenyu; Langford, P R; Lei, Liancheng

    2016-01-01

    Actinobacillus pleuropneumoniae is an important pathogen that causes respiratory disease in pigs. Trimeric autotransporter adhesin (TAA) is a recently discovered bacterial virulence factor that mediates bacterial adhesion and colonization. Two TAA coding genes have been found in the genome of A. pleuropneumoniae strain 5b L20, but whether they contribute to bacterial pathogenicity is unclear. In this study, we used homologous recombination to construct a double-gene deletion mutant, ΔTAA, in which both TAA coding genes were deleted and used it in in vivo and in vitro studies to confirm that TAAs participate in bacterial auto-aggregation, biofilm formation, cell adhesion and virulence in mice. A microarray analysis was used to determine whether TAAs can regulate other A. pleuropneumoniae genes during interactions with porcine primary alveolar macrophages. The results showed that deletion of both TAA coding genes up-regulated 36 genes, including ene1514, hofB and tbpB2, and simultaneously down-regulated 36 genes, including lgt, murF and ftsY. These data illustrate that TAAs help to maintain full bacterial virulence both directly, through their bioactivity, and indirectly by regulating the bacterial type II and IV secretion systems and regulating the synthesis or secretion of virulence factors. This study not only enhances our understanding of the role of TAAs but also has significance for those studying A. pleuropneumoniae pathogenesis.

  18. The changes of bacterial communities and antibiotic resistance genes in microbial fuel cells during long-term oxytetracycline processing.

    PubMed

    Yan, Weifu; Guo, Yunyan; Xiao, Yong; Wang, Shuhua; Ding, Rui; Jiang, Jiaqi; Gang, Haiyin; Wang, Han; Yang, Jun; Zhao, Feng

    2018-05-28

    Microbial fuel cell (MFC) is regarded as a promising alternative for enhancing the removal of antibiotic pollutants. In this study, oxytetracycline served as an electron donor in the anode chamber of MFCs, and after continuous operation for 330 days, the efficiency of removal of 10 mg/L oxytetracycline in MFCs increased to 99.00% in 78 h, whereas removal efficiency of only 58.26% was achieved in microbial controls. Compared to microbial controls, higher ATP concentration and persistent electrical stimulation mainly contributed to bioelectrochemical reactions more rapidly to enhance oxytetracycline removal in MFCs. In addition, the analysis of bacterial communities revealed that Eubacterium spp.-as the main functional bacterial genus responsible for oxytetracycline biodegradation-flourished starting from merely 0.00%-91.69% ± 0.27% (mean ± SD) in MFCs. High-throughput quantitative PCR showed that the normalized copy numbers of total antibiotic resistance genes (ARGs) and mobile genetic elements in MFCs were 1.7364 and 0.0065 copies/cell respectively, which were markedly lower than those in the microbial controls. Furthermore, there was no significant correlation between oxytetracycline concentration in the influent and abundance of ARGs in effluent from MFCs. Nevertheless, Tp614, a transposase gene, was found to be enriched in both MFCs and microbial reactors, suggesting that it may be a common challenge for different biological processes for wastewater treatment. This study therefore showed a lower probability of upregulation and transmission of ARGs in MFCs when compared to a traditional anaerobic microbial treatment. Copyright © 2018. Published by Elsevier Ltd.

  19. Nitric oxide mediates antimicrobial peptide gene expression by activating eicosanoid signaling

    PubMed Central

    Sadekuzzaman, Md.

    2018-01-01

    Nitric oxide (NO) mediates both cellular and humoral immune responses in insects. Its mediation of cellular immune responses uses eicosanoids as a downstream signal. However, the cross-talk with two immune mediators was not known in humoral immune responses. This study focuses on cross-talk between two immune mediators in inducing gene expression of anti-microbial peptides (AMPs) of a lepidopteran insect, Spodoptera exigua. Up-regulation of eight AMPs was observed in S. exigua against bacterial challenge. However, the AMP induction was suppressed by injection of an NO synthase inhibitor, L-NAME, while little expressional change was observed on injecting its enantiomer, D-NAME. The functional association between NO biosynthesis and AMP gene expression was further supported by RNA interference (RNAi) against NO synthase (SeNOS), which suppressed AMP gene expression under the immune challenge. The AMP induction was also mimicked by NO alone because injecting an NO analog, SNAP, without bacterial challenge significantly induced the AMP gene expression. Interestingly, an eicosanoid biosynthesis inhibitor, dexamethasone (DEX), suppressed the NO induction of AMP expression. The inhibitory activity of DEX was reversed by the addition of arachidonic acid, a precursor of eicosanoid biosynthesis. AMP expression of S. exigua was also controlled by the Toll/IMD signal pathway. The RNAi of Toll receptors or Relish suppressed AMP gene expression by suppressing NO levels and subsequently reducing PLA2 enzyme activity. These results suggest that eicosanoids are a downstream signal of NO mediation of AMP expression against bacterial challenge. PMID:29466449

  20. Structural alterations of faecal and mucosa-associated bacterial communities in irritable bowel syndrome.

    PubMed

    Durbán, Ana; Abellán, Juan J; Jiménez-Hernández, Nuria; Salgado, Patricia; Ponce, Marta; Ponce, Julio; Garrigues, Vicente; Latorre, Amparo; Moya, Andrés

    2012-04-01

    Irritable bowel syndrome (IBS) is the most common functional gastrointestinal disorder in western countries. Previous studies on IBS, mostly based on faecal samples, suggest alterations in the intestinal microbiota. However, no consensus has been reached regarding the association between specific bacteria and IBS. We explore the alterations of intestinal bacterial communities in IBS using massive sequencing of amplified 16S rRNA genes. Mucosal biopsies of the ascending and descending colon and faeces from 16 IBS patients and 9 healthy controls were analysed. Strong inter-individual variation was observed in the composition of the bacterial communities in both patients and controls. These communities showed less diversity in IBS cases. There were larger differences in the microbiota composition between biopsies and faeces than between patients and controls. We found a few over-represented and under-represented taxa in IBS cases with respect to controls. The detected alterations varied by site, with no changes being consistent across sample types. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

  1. Bacterial community transcription patterns during a marine phytoplankton bloom.

    PubMed

    Rinta-Kanto, Johanna M; Sun, Shulei; Sharma, Shalabh; Kiene, Ronald P; Moran, Mary Ann

    2012-01-01

    Bacterioplankton consume a large proportion of photosynthetically fixed carbon in the ocean and control its biogeochemical fate. We used an experimental metatranscriptomics approach to compare bacterial activities that route energy and nutrients during a phytoplankton bloom compared with non-bloom conditions. mRNAs were sequenced from duplicate bloom and control microcosms 1 day after a phytoplankton biomass peak, and transcript copies per litre of seawater were calculated using an internal mRNA standard. Transcriptome analysis revealed a potential novel mechanism for enhanced efficiency during carbon-limited growth, mediated through membrane-bound pyrophosphatases [V-type H(+)-translocating; hppA]; bloom bacterioplankton participated less in this metabolic energy scavenging than non-bloom bacterioplankton, with possible implications for differences in growth yields on organic substrates. Bloom bacterioplankton transcribed more copies of genes predicted to increase cell surface adhesiveness, mediated by changes in bacterial signalling molecules related to biofilm formation and motility; these may be important in microbial aggregate formation. Bloom bacterioplankton also transcribed more copies of genes for organic acid utilization, suggesting an increased importance of this compound class in the bioreactive organic matter released during phytoplankton blooms. Transcription patterns were surprisingly faithful within a taxon regardless of treatment, suggesting that phylogeny broadly predicts the ecological roles of bacterial groups across 'boom' and 'bust' environmental backgrounds. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  2. Near-infrared light-controlled systems for gene transcription regulation, protein targeting and spectral multiplexing.

    PubMed

    Redchuk, Taras A; Kaberniuk, Andrii A; Verkhusha, Vladislav V

    2018-05-01

    Near-infrared (NIR, 740-780 nm) optogenetic systems are well-suited to spectral multiplexing with blue-light-controlled tools. Here, we present two protocols, one for regulation of gene transcription and another for control of protein localization, that use a NIR-responsive bacterial phytochrome BphP1-QPAS1 optogenetic pair. In the first protocol, cells are transfected with the optogenetic constructs for independently controlling gene transcription by NIR (BphP1-QPAS1) and blue (LightOn) light. The NIR and blue-light-controlled gene transcription systems show minimal spectral crosstalk and induce a 35- to 40-fold increase in reporter gene expression. In the second protocol, the BphP1-QPAS1 pair is combined with a light-oxygen-voltage-sensing (LOV) domain-based construct into a single optogenetic tool, termed iRIS. This dual-light-controllable protein localization tool allows tridirectional protein translocation among the cytoplasm, nucleus and plasma membrane. Both procedures can be performed within 3-5 d. Use of NIR light-controlled optogenetic systems should advance basic and biomedical research.

  3. The FUN of identifying gene function in bacterial pathogens; insights from Salmonella functional genomics.

    PubMed

    Hammarlöf, Disa L; Canals, Rocío; Hinton, Jay C D

    2013-10-01

    The availability of thousands of genome sequences of bacterial pathogens poses a particular challenge because each genome contains hundreds of genes of unknown function (FUN). How can we easily discover which FUN genes encode important virulence factors? One solution is to combine two different functional genomic approaches. First, transcriptomics identifies bacterial FUN genes that show differential expression during the process of mammalian infection. Second, global mutagenesis identifies individual FUN genes that the pathogen requires to cause disease. The intersection of these datasets can reveal a small set of candidate genes most likely to encode novel virulence attributes. We demonstrate this approach with the Salmonella infection model, and propose that a similar strategy could be used for other bacterial pathogens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. More than the “Killer Trait”: Infection with the Bacterial Endosymbiont Caedibacter taeniospiralis Causes Transcriptomic Modulation in Paramecium Host

    PubMed Central

    Grosser, Katrin; Ramasamy, Pathmanaban; Amirabad, Azim Dehghani; Schulz, Marcel H; Gasparoni, Gilles; Simon, Martin

    2018-01-01

    Abstract Endosymbiosis is a widespread phenomenon and hosts of bacterial endosymbionts can be found all-over the eukaryotic tree of life. Likely, this evolutionary success is connected to the altered phenotype arising from a symbiotic association. The potential variety of symbiont’s contributions to new characteristics or abilities of host organisms are largely unstudied. Addressing this aspect, we focused on an obligate bacterial endosymbiont that confers an intraspecific killer phenotype to its host. The symbiosis between Paramecium tetraurelia and Caedibacter taeniospiralis, living in the host’s cytoplasm, enables the infected paramecia to release Caedibacter symbionts, which can simultaneously produce a peculiar protein structure and a toxin. The ingestion of bacteria that harbor both components leads to the death of symbiont-free congeners. Thus, the symbiosis provides Caedibacter-infected cells a competitive advantage, the “killer trait.” We characterized the adaptive gene expression patterns in symbiont-harboring Paramecium as a second symbiosis-derived aspect next to the killer phenotype. Comparative transcriptomics of infected P. tetraurelia and genetically identical symbiont-free cells confirmed altered gene expression in the symbiont-bearing line. Our results show up-regulation of specific metabolic and heat shock genes whereas down-regulated genes were involved in signaling pathways and cell cycle regulation. Functional analyses to validate the transcriptomics results demonstrated that the symbiont increases host density hence providing a fitness advantage. Comparative transcriptomics shows gene expression modulation of a ciliate caused by its bacterial endosymbiont thus revealing new adaptive advantages of the symbiosis. Caedibacter taeniospiralis apparently increases its host fitness via manipulation of metabolic pathways and cell cycle control. PMID:29390087

  5. Restoration using Azolla imbricata increases nitrogen functional bacterial groups and genes in soil.

    PubMed

    Lu, Xiao-Ming; Lu, Peng-Zhen; Yang, Ke

    2017-05-01

    Microbial groups are major factors that influence soil function. Currently, there is a lack of studies on microbial functional groups. Although soil microorganisms play an important role in the nitrogen cycle, systematic studies of the effects of environmental factors on microbial populations in relation to key metabolic processes in the nitrogen cycle are seldom reported. In this study, we conducted a systematic analysis of the changes in nitrogen functional groups in mandarin orange garden soil treated with Azolla imbricata. The structures of the major functional bacterial groups and the functional gene abundances involved in key processes of the soil nitrogen cycle were analyzed using high-throughput sequencing (HTS) and quantitative real-time PCR, respectively. The results indicated that returning A. imbricata had an important influence on the composition of soil nitrogen functional bacterial communities. Treatment with A. imbricata increased the diversity of the nitrogen functional bacteria. The abundances of nitrogen functional genes were significantly higher in the treated soil compared with the control soil. Both the diversity of the major nitrogen functional bacteria (nifH bacteria, nirK bacteria, and narG bacteria) and the abundances of nitrogen functional genes in the soil showed significant positive correlations with the soil pH, the organic carbon content, available nitrogen, available phosphorus, and NH 4 + -N and NO 3 - -N contents. Treatment with 12.5 kg fresh A. imbricata per mandarin orange tree was effective to improve the quality of the mandarin orange garden soil. This study analyzed the mechanism of the changes in functional bacterial groups and genes involved in key metabolic processes of the nitrogen cycle in soil treated by A. imbricata.

  6. Biotransformation of arsenite and bacterial aox activity in drinking water produced from surface water of floating houses: Arsenic contamination in Cambodia.

    PubMed

    Chang, Jin-Soo

    2015-11-01

    The potential arsenite bioteansformation activity of arsenic was investigated by examining bacterial arsenic arsenite-oxidizing gene such as aoxS, aoxR, aoxA, aoxB, aoxC, and aoxD in high arsenic-contaminated drinking water produced from the surface water of floating houses. There is a biogeochemical cycle of activity involving arsenite oxidase aox system and the ars (arsenic resistance system) gene operon and aoxR leader gene activity in Alcaligenes faecalis SRR-11 and aoxS leader gene activity in Achromobacter xylosoxidans TSL-66. Batch experiments showed that SRR-11 and TSL-66 completely oxidized 1 mM of As (III) to As (V) within 35-40 h. The leaders of aoxS and aoxR are important for gene activity, and their effects in arsenic bioremediation and mobility in natural water has a significant ecological role because it allows arsenite oxidase in bacteria to control the biogeochemical cycle of arsenic-contaminated drinking water produced from surface water of floating houses. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Response of soil bacterial community to repeated applications of carbendazim.

    PubMed

    Wang, Xiuguo; Song, Min; Wang, Yiqi; Gao, Chunming; Zhang, Qun; Chu, Xiaoqiang; Fang, Hua; Yu, Yunlong

    2012-01-01

    The effect of repeated carbendazim applications on functional diversity of culturable microorganisms and bacterial community composition was studied under field conditions. The functional diversity of soil culturable microbial community (Shannon index, H') reduced significantly (P<0.05) after the first introduction of carbendazim at levels of 0.94, 1.88 and 4.70 kg active ingredient (a.i.)ha(-1) and then recovered to that in the control with subsequent applications. An evident (P<0.01) difference in the bacterial community composition was observed after the second carbendazim application by Temperature Gradient Gel Electrophoresis (TGGE) analysis of 16S rRNA genes amplified from treated and control soils, which remained after the third and fourth treatments. Our results indicated that repeated carbendazim applications have a transient harmful effect on functional diversity of soil culturable microbial community and result in an alteration in bacterial community composition largely due to one species within the γ-proteobacterium. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. Discrimination of Spore-Forming Bacilli Using spoIVA

    NASA Technical Reports Server (NTRS)

    Venkateswaran, Kasthuri; LaDuc, Myron; Stuecker, Tara

    2009-01-01

    A method of discriminating between spore-forming and non-spore-forming bacteria is based on a combination of simultaneous sporulation-specific and non-sporulation-specific quantitative polymerase chain reactions (Q-PCRs). The method was invented partly in response to the observation that for the purposes of preventing or reducing biological contamination affecting many human endeavors, ultimately, only the spore-forming portions of bacterial populations are the ones that are problematic (or, at least, more problematic than are the non-spore-forming portions). In some environments, spore-forming bacteria constitute small fractions of the total bacterial populations. The use of sporulation-specific primers in Q-PCR affords the ability to assess the spore-forming fraction of a bacterial population present in an environment of interest. This assessment can provide a more thorough and accurate understanding of the bacterial contamination in the environment, thereby making it possible to focus contamination- testing, contamination-prevention, sterilization, and decontamination resources more economically and efficiently. The method includes the use of sporulation-specific primers in the form of designed, optimized deoxyribonucleic acid (DNA) oligonucleotides specific for the bacterial spoIVA gene (see table). [In "spoIVA," "IV" signifies Roman numeral four and the entire quoted name refers to gene A for the fourth stage of sporulation.] These primers are mixed into a PCR cocktail with a given sample of bacterial cells. A control PCR cocktail into which are mixed universal 16S rRNA primers is also prepared. ["16S rRNA" denotes a ribosomal ribonucleic acid (rRNA) sequence that is common to all organisms.] Following several cycles of heating and cooling according to the PCR protocol to amplify amounts of DNA molecules, the amplification products can be analyzed to determine the types of bacterial cells present within the samples. If the amplification product is strong, relative to the product of a control PCR sequence, then it is concluded that the bacterial population in the sample consists predominantly of spore-forming cells. If the amplification product is weak or nonexistent, then it is concluded that the bacterial population in the sample consists predominantly or entirely of non-spore-forming cells.

  9. Bacterial inosine 5'-monophosphate dehydrogenase ("IMPDH") DNA as a dominant selectable marker in mammals and other eukaryotes

    DOEpatents

    Huberman, Eliezer [Chicago, IL; Baccam, Mekhine J [Woodridge, IL

    2007-02-27

    The present invention relates to a nucleic acid sequence and its corresponding protein sequence useful as a dominant selectable marker in eukaryotes. More specifically the invention relates to a nucleic acid encoding a bacterial IMPDH gene that has been engineered into a eukaryotic expression vectors, thereby permitting bacterial IMPDH expression in mammalian cells. Bacterial IMPDH expression confers resistance to MPA which can be used as dominant selectable marker in eukaryotes including mammals. The invention also relates to expression vectors and cells that express the bacterial IMPDH gene as well as gene therapies and protein synthesis.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jawdy, Sara S.; Gunter, Lee E.; Engle, Nancy L.

    Here, the biological function of the plant-microbiome system is the result of contributions from the host plant and microbiome members. In this work we study the function of a simplified community consisting of Pseudomonas and Burkholderia bacterial strains isolated from Populus hosts and inoculated on axenic Populus cutting in controlled laboratory conditions. Inoculation individually with either bacterial isolate increased root growth relative to uninoculated controls. Root area, photosynthetic efficiency, gene expression and metabolite expression data in individual and dual inoculated treatments indicate that the effects of these bacteria are unique and additive, suggesting that the function of a microbiome communitymore » may be predicted from the additive functions of the individual members.« less

  11. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes.

    PubMed

    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu

    2015-09-24

    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.

  12. Enterobacter aerogenes and Enterobacter cloacae; versatile bacterial pathogens confronting antibiotic treatment.

    PubMed

    Davin-Regli, Anne; Pagès, Jean-Marie

    2015-01-01

    Enterobacter aerogenes and E. cloacae have been reported as important opportunistic and multiresistant bacterial pathogens for humans during the last three decades in hospital wards. These Gram-negative bacteria have been largely described during several outbreaks of hospital-acquired infections in Europe and particularly in France. The dissemination of Enterobacter sp. is associated with the presence of redundant regulatory cascades that efficiently control the membrane permeability ensuring the bacterial protection and the expression of detoxifying enzymes involved in antibiotic degradation/inactivation. In addition, these bacterial species are able to acquire numerous genetic mobile elements that strongly contribute to antibiotic resistance. Moreover, this particular fitness help them to colonize several environments and hosts and rapidly and efficiently adapt their metabolism and physiology to external conditions and environmental stresses. Enterobacter is a versatile bacterium able to promptly respond to the antibiotic treatment in the colonized patient. The balance of the prevalence, E. aerogenes versus E. cloacae, in the reported hospital infections during the last period, questions about the horizontal transmission of mobile elements containing antibiotic resistance genes, e.g., the efficacy of the exchange of resistance genes Klebsiella pneumoniae to Enterobacter sp. It is also important to mention the possible role of antibiotic use in the treatment of bacterial infectious diseases in this E. aerogenes/E. cloacae evolution.

  13. Enterobacter aerogenes and Enterobacter cloacae; versatile bacterial pathogens confronting antibiotic treatment

    PubMed Central

    Davin-Regli, Anne; Pagès, Jean-Marie

    2015-01-01

    Enterobacter aerogenes and E. cloacae have been reported as important opportunistic and multiresistant bacterial pathogens for humans during the last three decades in hospital wards. These Gram-negative bacteria have been largely described during several outbreaks of hospital-acquired infections in Europe and particularly in France. The dissemination of Enterobacter sp. is associated with the presence of redundant regulatory cascades that efficiently control the membrane permeability ensuring the bacterial protection and the expression of detoxifying enzymes involved in antibiotic degradation/inactivation. In addition, these bacterial species are able to acquire numerous genetic mobile elements that strongly contribute to antibiotic resistance. Moreover, this particular fitness help them to colonize several environments and hosts and rapidly and efficiently adapt their metabolism and physiology to external conditions and environmental stresses. Enterobacter is a versatile bacterium able to promptly respond to the antibiotic treatment in the colonized patient. The balance of the prevalence, E. aerogenes versus E. cloacae, in the reported hospital infections during the last period, questions about the horizontal transmission of mobile elements containing antibiotic resistance genes, e.g., the efficacy of the exchange of resistance genes Klebsiella pneumoniae to Enterobacter sp. It is also important to mention the possible role of antibiotic use in the treatment of bacterial infectious diseases in this E. aerogenes/E. cloacae evolution. PMID:26042091

  14. Soil bacterial community and functional shifts in response to altered snowpack in moist acidic tundra of northern Alaska

    NASA Astrophysics Data System (ADS)

    Ricketts, Michael P.; Poretsky, Rachel S.; Welker, Jeffrey M.; Gonzalez-Meler, Miquel A.

    2016-09-01

    Soil microbial communities play a central role in the cycling of carbon (C) in Arctic tundra ecosystems, which contain a large portion of the global C pool. Climate change predictions for Arctic regions include increased temperature and precipitation (i.e. more snow), resulting in increased winter soil insulation, increased soil temperature and moisture, and shifting plant community composition. We utilized an 18-year snow fence study site designed to examine the effects of increased winter precipitation on Arctic tundra soil bacterial communities within the context of expected ecosystem response to climate change. Soil was collected from three pre-established treatment zones representing varying degrees of snow accumulation, where deep snow ˜ 100 % and intermediate snow ˜ 50 % increased snowpack relative to the control, and low snow ˜ 25 % decreased snowpack relative to the control. Soil physical properties (temperature, moisture, active layer thaw depth) were measured, and samples were analysed for C concentration, nitrogen (N) concentration, and pH. Soil microbial community DNA was extracted and the 16S rRNA gene was sequenced to reveal phylogenetic community differences between samples and determine how soil bacterial communities might respond (structurally and functionally) to changes in winter precipitation and soil chemistry. We analysed relative abundance changes of the six most abundant phyla (ranging from 82 to 96 % of total detected phyla per sample) and found four (Acidobacteria, Actinobacteria, Verrucomicrobia, and Chloroflexi) responded to deepened snow. All six phyla correlated with at least one of the soil chemical properties (% C, % N, C : N, pH); however, a single predictor was not identified, suggesting that each bacterial phylum responds differently to soil characteristics. Overall, bacterial community structure (beta diversity) was found to be associated with snow accumulation treatment and all soil chemical properties. Bacterial functional potential was inferred using ancestral state reconstruction to approximate functional gene abundance, revealing a decreased abundance of genes required for soil organic matter (SOM) decomposition in the organic layers of the deep snow accumulation zones. These results suggest that predicted climate change scenarios may result in altered soil bacterial community structure and function, and indicate a reduction in decomposition potential, alleviated temperature limitations on extracellular enzymatic efficiency, or both. The fate of stored C in Arctic soils ultimately depends on the balance between these mechanisms.

  15. Selected lactic acid-producing bacterial isolates with the capacity to reduce Salmonella translocation and virulence gene expression in chickens.

    PubMed

    Yang, Xiaojian; Brisbin, Jennifer; Yu, Hai; Wang, Qi; Yin, Fugui; Zhang, Yonggang; Sabour, Parviz; Sharif, Shayan; Gong, Joshua

    2014-01-01

    Probiotics have been used to control Salmonella colonization/infection in chickens. Yet the mechanisms of probiotic effects are not fully understood. This study has characterized our previously-selected lactic acid-producing bacterial (LAB) isolates for controlling Salmonella infection in chickens, particularly the mechanism underlying the control. In vitro studies were conducted to characterize 14 LAB isolates for their tolerance to low pH (2.0) and high bile salt (0.3-1.5%) and susceptibility to antibiotics. Three chicken infection trials were subsequently carried out to evaluate four of the isolates for reducing the burden of Salmonella enterica serovar Typhimurium in the broiler cecum. Chicks were gavaged with LAB cultures (10(6-7) CFU/chick) or phosphate-buffered saline (PBS) at 1 day of age followed by Salmonella challenge (10(4) CFU/chick) next day. Samples of cecal digesta, spleen, and liver were examined for Salmonella counts on days 1, 3, or 4 post-challenge. Salmonella in the cecum from Trial 3 was also assessed for the expression of ten virulence genes located in its pathogenicity island-1 (SPI-1). These genes play a role in Salmonella intestinal invasion. Tested LAB isolates (individuals or mixed cultures) were unable to lower Salmonella burden in the chicken cecum, but able to attenuate Salmonella infection in the spleen and liver. The LAB treatments also reduced almost all SPI-1 virulence gene expression (9 out of 10) in the chicken cecum, particularly at the low dose. In vitro treatment with the extracellular culture fluid from a LAB culture also down-regulated most SPI-1 virulence gene expression. The possible correlation between attenuation of Salmonella infection in the chicken spleen and liver and reduction of Salmonella SPI-1 virulence gene expression in the chicken cecum by LAB isolates is a new observation. Suppression of Salmonella virulence gene expression in vivo can be one of the strategies for controlling Salmonella infection in chickens.

  16. Rifaximin has minor effects on bacterial composition, inflammation, and bacterial translocation in cirrhosis: A randomized trial.

    PubMed

    Kimer, Nina; Pedersen, Julie S; Tavenier, Juliette; Christensen, Jeffrey E; Busk, Troels M; Hobolth, Lise; Krag, Aleksander; Al-Soud, Waleed Abu; Mortensen, Martin S; Sørensen, Søren J; Møller, Søren; Bendtsen, Flemming

    2018-01-01

    Decompensated cirrhosis is characterized by disturbed hemodynamics, immune dysfunction, and high risk of infections. Translocation of viable bacteria and bacterial products from the gut to the blood is considered a key driver in this process. Intestinal decontamination with rifaximin may reduce bacterial translocation (BT) and decrease inflammation. A randomized, placebo-controlled trial investigated the effects of rifaximin on inflammation and BT in decompensated cirrhosis. Fifty-four out-patients with cirrhosis and ascites were randomized, mean age 56 years (± 8.4), and model for end-stage liver disease score 12 (± 3.9). Patients received rifaximin 550-mg BD (n = 36) or placebo BD (n = 18). Blood and fecal (n = 15) sampling were conducted at baseline and after 4 weeks. Bacterial DNA in blood was determined by real-time qPCR 16S rRNA gene quantification. Bacterial composition in feces was analyzed by 16S rRNA gene sequencing. Circulating markers of inflammation, including tumor necrosis factor alpha, interleukins 6, 10, and 18, stromal cell-derived factor 1-α, transforming growth factor β-1, and high sensitivity C-reactive protein, were unaltered by rifaximin treatment. Rifaximin altered abundance of bacterial taxa in blood marginally, only a decrease in Pseudomonadales was observed. In feces, rifaximin decreased bacterial richness, but effect on particular species was not observed. Subgroup analyses on patients with severely disturbed hemodynamics (n = 34) or activated lipopolysaccharide binding protein (n = 37) revealed no effect of rifaximin. Four weeks of treatment with rifaximin had no impact on the inflammatory state and only minor effects on BT and intestinal bacterial composition in stable, decompensated cirrhosis (NCT01769040). © 2017 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

  17. An ex vivo ruminal ovine model to study the immediate immune response in the context of bacterial lipopolysaccharide.

    PubMed

    Abouhajer, Fathi; El-Ashram, Saeed; Karama, Musafiri; Huang, Shujian; Liu, Jian-Feng

    2018-05-01

    We have set up an ex vivo ovine ruminal model, which can mimic the multicellular process to explore the early steps in Salmonella typhimurium lipopolysaccharide (LPS) stimulation using RNA-seq technology. Ovine ruminal explants were collected for histological and transcriptional analysis and supernatants collected to quantitate lactate dehydrogenase (LDH) enzymes. A total of 8 and 523 genes were significantly over-expressed between LPS-treated and control tissues at 6 and 12 h, respectively. However, six and seven hundred and thirteen genes were substantially repressed between the aforementioned tissues, correspondingly. Key genes up-regulated in response to the addition of LPS were tumor necrosis factor (TNF), interlukin (IL)-1 beta(b), IL-6, IL-8, IL-17B, IL-19, MMP-1, MMP-3, and integrin alpha 2 (ITGA8, 9). This study shows for the first time that galectin-1 is up-regulated in an ex vivo ruminal segment model exposed to bacterial lipopolysaccharide following 6 h of incubation. The ruminal segment model has been shown to be a suitable tool to study the bacterial lipopolysaccharide effects on the ovine ruminal tissues prior to in vivo assessment.

  18. Infection processes of xylem-colonizing pathogenic bacteria: possible explanations for the scarcity of qualitative disease resistance genes against them in crops.

    PubMed

    Bae, Chungyun; Han, Sang Wook; Song, Yu-Rim; Kim, Bo-Young; Lee, Hyung-Jin; Lee, Je-Min; Yeam, Inhwa; Heu, Sunggi; Oh, Chang-Sik

    2015-07-01

    Disease resistance against xylem-colonizing pathogenic bacteria in crops. Plant pathogenic bacteria cause destructive diseases in many commercially important crops. Among these bacteria, eight pathogens, Ralstonia solanacearum, Xanthomonas oryzae pv. oryzae, X. campestris pv. campestris, Erwinia amylovora, Pantoea stewartii subsp. stewartii, Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. actinidiae, and Xylella fastidiosa, infect their host plants through different infection sites and paths and eventually colonize the xylem tissues of their host plants, resulting in wilting symptoms by blocking water flow or necrosis of xylem tissues. Noticeably, only a relatively small number of resistant cultivars in major crops against these vascular bacterial pathogens except X. oryzae pv. oryzae have been found or generated so far, although these pathogens threaten productivity of major crops. In this review, we summarize the lifestyles of major xylem-colonizing bacterial pathogens and then discuss the progress of current research on disease resistance controlled by qualitative disease resistance genes or quantitative trait loci against them. Finally, we propose infection processes of xylem-colonizing bacterial pathogens as one of possible reasons for why so few qualitative disease resistance genes against these pathogens have been developed or identified so far in crops.

  19. Evolutionary genomics: transdomain gene transfers.

    PubMed

    Bordenstein, Seth R

    2007-11-06

    Biologists have until now conceded that bacterial gene transfer to multicellular animals is relatively uncommon in Nature. A new study showing promiscuous insertions of bacterial endosymbiont genes into invertebrate genomes ushers in a shift in this paradigm.

  20. Intercellular and intracellular signalling systems that globally control the expression of virulence genes in plant pathogenic bacteria.

    PubMed

    Ham, Jong Hyun

    2013-04-01

    Plant pathogenic bacteria utilize complex signalling systems to control the expression of virulence genes at the cellular level and within populations. Quorum sensing (QS), an important intercellular communication mechanism, is mediated by different types of small molecules, including N-acyl homoserine lactones (AHLs), fatty acids and small proteins. AHL-mediated signalling systems dependent on the LuxI and LuxR family proteins play critical roles in the virulence of a wide range of Gram-negative plant pathogenic bacteria belonging to the Alphaproteobacteria, Betaproteobacteria and Gammaproteobacteria. Xanthomonas spp. and Xylella fastidiosa, members of the Gammaproteobacteria, however, possess QS systems that are mediated by fatty acid-type diffusible signal factors (DSFs). Recent studies have demonstrated that Ax21, a 194-amino-acid protein in Xanthomonas oryzae pv. oryzae, plays dual functions in activating a rice innate immune pathway through binding to the rice XA21 pattern recognition receptor and in regulating bacterial virulence and biofilm formation as a QS signal molecule. In xanthomonads, DSF-mediated QS systems are connected with the signalling pathways mediated by cyclic diguanosine monophosphate (c-di-GMP), which functions as a second messenger for the control of virulence gene expression in these bacterial pathogens. © 2012 BSPP AND BLACKWELL PUBLISHING LTD.

  1. Molecular exploration of fecal microbiome in quinoa-supplemented obese mice.

    PubMed

    Garcia-Mazcorro, Jose F; Mills, David; Noratto, Giuliana

    2016-07-01

    Diet affects gut microorganisms and dietary interventions can help treat obesity and overweight. Our aim was to investigate the effect of quinoa supplementation on fecal microbial ecology of obese diabetic mice. Obese db/db mice were fed commercial diets with and without quinoa supplementation for eight weeks; non-obese mice consuming non-supplemented diet served as lean-control. Fecal bacterial communities were analyzed using marker gene sequencing of 16S rRNA genes. Over 300 000 good-quality sequences were studied and assigned to 5774 different bacterial species (Operational Taxonomic Units at 97% similarity). Significant differences in bacterial abundances were found among the treatment groups, including some associated specifically with quinoa consumption. Analysis of weighted UniFrac distances revealed a distinctive clustering of lean microbial communities independently from obese-control and quinoa-supplemented mice (Analysis of Similarities, P < 0.01). Predicted functional profiles showed significant differences in 38 metabolic functions but most were due to a difference between lean samples compared to both obese-control and quinoa. Quinoa supplementation was associated with lower butyrate and succinic acid concentrations in cecum that were not necessarily more similar to those concentrations in lean mice. This study provides insight into the complex interactions between nutritional supplements and the gut microbiota thus informing future molecular analysis of the health benefits. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage

    PubMed Central

    2017-01-01

    The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway. PMID:28826208

  3. SigmoID: a user-friendly tool for improving bacterial genome annotation through analysis of transcription control signals

    PubMed Central

    Damienikan, Aliaksandr U.

    2016-01-01

    The majority of bacterial genome annotations are currently automated and based on a ‘gene by gene’ approach. Regulatory signals and operon structures are rarely taken into account which often results in incomplete and even incorrect gene function assignments. Here we present SigmoID, a cross-platform (OS X, Linux and Windows) open-source application aiming at simplifying the identification of transcription regulatory sites (promoters, transcription factor binding sites and terminators) in bacterial genomes and providing assistance in correcting annotations in accordance with regulatory information. SigmoID combines a user-friendly graphical interface to well known command line tools with a genome browser for visualising regulatory elements in genomic context. Integrated access to online databases with regulatory information (RegPrecise and RegulonDB) and web-based search engines speeds up genome analysis and simplifies correction of genome annotation. We demonstrate some features of SigmoID by constructing a series of regulatory protein binding site profiles for two groups of bacteria: Soft Rot Enterobacteriaceae (Pectobacterium and Dickeya spp.) and Pseudomonas spp. Furthermore, we inferred over 900 transcription factor binding sites and alternative sigma factor promoters in the annotated genome of Pectobacterium atrosepticum. These regulatory signals control putative transcription units covering about 40% of the P. atrosepticum chromosome. Reviewing the annotation in cases where it didn’t fit with regulatory information allowed us to correct product and gene names for over 300 loci. PMID:27257541

  4. Evaluation of zraP gene expression characteristics and construction of a lead (Pb) sensing and removal system in a recombinant Escherichia coli.

    PubMed

    Maruthamuthu, Murali Kannan; Ganesh, Irisappan; Ravikumar, Sambandam; Hong, Soon Ho

    2015-03-01

    A ZraP-based lead sensing and removal system was constructed in E. coli. It was regulated by the ZraS/ZraR two-component system. The expression profile of the zraP gene towards extracellular lead was studied via real-time PCR. A dual-function bacterial system was also designed to express GFP and OmpC-lead binding peptide under the control of zraP for the simultaneous sensing and adsorption of environmental lead without additional manipulation. The constructed bacterial system can emit fluorescence and it adsorbed a maximum of 487 µmol lead/g cell DCW. From a study of artificial wastewater, the constructed bacteria adsorbed lead highly selectively (427 µmol lead/g cell DCW) among other metal ions. The newly-constructed dual function bacterial system can be applied for the development of an efficient process for the removal of lead from polluted wastes.

  5. A light-controlled cell lysis system in bacteria.

    PubMed

    Wang, Geyi; Lu, Xin; Zhu, Yisha; Zhang, Wei; Liu, Jiahui; Wu, Yankang; Yu, Liyang; Sun, Dongchang; Cheng, Feng

    2018-05-08

    Intracellular products (e.g., insulin), which are obtained through cell lysis, take up a big share of the biotech industry. It is often time-consuming, laborious, and environment-unfriendly to disrupt bacterial cells with traditional methods. In this study, we developed a molecular device for controlling cell lysis with light. We showed that intracellular expression of a single lysin protein was sufficient for efficient bacterial cell lysis. By placing the lysin-encoding gene under the control of an improved light-controlled system, we successfully controlled cell lysis by switching on/off light: OD 600 of the Escherichia coli cell culture was decreased by twofold when the light-controlled system was activated under dark condition. We anticipate that our work would not only pave the way for cell lysis through a convenient biological way in fermentation industry, but also provide a paradigm for applying the light-controlled system in other fields of biotech industry.

  6. The antimicrobial activity of nanoparticles: present situation and prospects for the future

    PubMed Central

    Wang, Linlin; Hu, Chen; Shao, Longquan

    2017-01-01

    Nanoparticles (NPs) are increasingly used to target bacteria as an alternative to antibiotics. Nanotechnology may be particularly advantageous in treating bacterial infections. Examples include the utilization of NPs in antibacterial coatings for implantable devices and medicinal materials to prevent infection and promote wound healing, in antibiotic delivery systems to treat disease, in bacterial detection systems to generate microbial diagnostics, and in antibacterial vaccines to control bacterial infections. The antibacterial mechanisms of NPs are poorly understood, but the currently accepted mechanisms include oxidative stress induction, metal ion release, and non-oxidative mechanisms. The multiple simultaneous mechanisms of action against microbes would require multiple simultaneous gene mutations in the same bacterial cell for antibacterial resistance to develop; therefore, it is difficult for bacterial cells to become resistant to NPs. In this review, we discuss the antibacterial mechanisms of NPs against bacteria and the factors that are involved. The limitations of current research are also discussed. PMID:28243086

  7. Copy Number Variation of the Beta Defensin Gene Cluster on Chromosome 8p Influences the Bacterial Microbiota within the Nasopharynx of Otitis-Prone Children

    PubMed Central

    Bevins, Charles L.; Hollox, Edward J.; Bakaletz, Lauren O.

    2014-01-01

    As there is increasing evidence that aberrant defensin expression is related to susceptibility for infectious disease and inflammatory disorders, we sought to determine if copy number of the beta-defensin gene cluster located on chromosome 8p23.1 (DEFB107, 106, 105, 104, 103, DEFB4 and SPAG11), that shows copy number variation as a block, was associated with susceptibility to otitis media (OM). The gene DEFB103 within this complex encodes human beta defensin-3 (hBD-3), an antimicrobial peptide (AP) expressed by epithelial cells that line the mammalian airway, important for defense of mucosal surfaces and previously shown to have bactericidal activity in vitro against multiple human pathogens, including the three that predominate in OM. To this end, we conducted a retrospective case-control study of 113 OM prone children and 267 controls aged five to sixty months. We identified the copy number of the above defined beta-defensin gene cluster (DEFB-CN) in each study subject by paralogue ratio assays. The mean DEFB-CN was indistinguishable between subjects classified as OM prone based on a recent history of multiple episodes of OM and control subjects who had no history of OM (4.4±0.96 versus 4.4±1.08, respectively: Odds Ratio [OR]: 1.16 (95% CI: 0.61, 2.20). Despite a lack of direct association, we observed a statistically significant correlation between DEFB-CN and nasopharyngeal bacterial colonization patterns. Collectively, our findings suggested that susceptibility to OM might be mediated by genetic variation among individuals, wherein a DEFB-CN less than 4 exerts a marked influence on the microbiota of the nasopharynx, specifically with regard to colonization by the three predominant bacterial pathogens of OM. PMID:24867293

  8. Vertical Distribution of Bacterial Communities in the Indian Ocean as Revealed by Analyses of 16S rRNA and nasA Genes.

    PubMed

    Jiang, Xuexia; Jiao, Nianzhi

    2016-09-01

    Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis.

  9. Lateral Gene Transfer Dynamics in the Ancient Bacterial Genus Streptomyces

    PubMed Central

    McDonald, Bradon R.

    2017-01-01

    ABSTRACT Lateral gene transfer (LGT) profoundly shapes the evolution of bacterial lineages. LGT across disparate phylogenetic groups and genome content diversity between related organisms suggest a model of bacterial evolution that views LGT as rampant and promiscuous. It has even driven the argument that species concepts and tree-based phylogenetics cannot be applied to bacteria. Here, we show that acquisition and retention of genes through LGT are surprisingly rare in the ubiquitous and biomedically important bacterial genus Streptomyces. Using a molecular clock, we estimate that the Streptomyces bacteria are ~380 million years old, indicating that this bacterial genus is as ancient as land vertebrates. Calibrating LGT rate to this geologic time span, we find that on average only 10 genes per million years were acquired and subsequently maintained. Over that same time span, Streptomyces accumulated thousands of point mutations. By explicitly incorporating evolutionary timescale into our analyses, we provide a dramatically different view on the dynamics of LGT and its impact on bacterial evolution. PMID:28588130

  10. Human microbiomes and their roles in dysbiosis, common diseases, and novel therapeutic approaches.

    PubMed

    Belizário, José E; Napolitano, Mauro

    2015-01-01

    The human body is the residence of a large number of commensal (non-pathogenic) and pathogenic microbial species that have co-evolved with the human genome, adaptive immune system, and diet. With recent advances in DNA-based technologies, we initiated the exploration of bacterial gene functions and their role in human health. The main goal of the human microbiome project is to characterize the abundance, diversity and functionality of the genes present in all microorganisms that permanently live in different sites of the human body. The gut microbiota expresses over 3.3 million bacterial genes, while the human genome expresses only 20 thousand genes. Microbe gene-products exert pivotal functions via the regulation of food digestion and immune system development. Studies are confirming that manipulation of non-pathogenic bacterial strains in the host can stimulate the recovery of the immune response to pathogenic bacteria causing diseases. Different approaches, including the use of nutraceutics (prebiotics and probiotics) as well as phages engineered with CRISPR/Cas systems and quorum sensing systems have been developed as new therapies for controlling dysbiosis (alterations in microbial community) and common diseases (e.g., diabetes and obesity). The designing and production of pharmaceuticals based on our own body's microbiome is an emerging field and is rapidly growing to be fully explored in the near future. This review provides an outlook on recent findings on the human microbiomes, their impact on health and diseases, and on the development of targeted therapies.

  11. Human microbiomes and their roles in dysbiosis, common diseases, and novel therapeutic approaches

    PubMed Central

    Belizário, José E.; Napolitano, Mauro

    2015-01-01

    The human body is the residence of a large number of commensal (non-pathogenic) and pathogenic microbial species that have co-evolved with the human genome, adaptive immune system, and diet. With recent advances in DNA-based technologies, we initiated the exploration of bacterial gene functions and their role in human health. The main goal of the human microbiome project is to characterize the abundance, diversity and functionality of the genes present in all microorganisms that permanently live in different sites of the human body. The gut microbiota expresses over 3.3 million bacterial genes, while the human genome expresses only 20 thousand genes. Microbe gene-products exert pivotal functions via the regulation of food digestion and immune system development. Studies are confirming that manipulation of non-pathogenic bacterial strains in the host can stimulate the recovery of the immune response to pathogenic bacteria causing diseases. Different approaches, including the use of nutraceutics (prebiotics and probiotics) as well as phages engineered with CRISPR/Cas systems and quorum sensing systems have been developed as new therapies for controlling dysbiosis (alterations in microbial community) and common diseases (e.g., diabetes and obesity). The designing and production of pharmaceuticals based on our own body’s microbiome is an emerging field and is rapidly growing to be fully explored in the near future. This review provides an outlook on recent findings on the human microbiomes, their impact on health and diseases, and on the development of targeted therapies. PMID:26500616

  12. Gene and transcript abundances of bacterial type III secretion systems from the rumen microbiome are correlated with methane yield in sheep.

    PubMed

    Kamke, Janine; Soni, Priya; Li, Yang; Ganesh, Siva; Kelly, William J; Leahy, Sinead C; Shi, Weibing; Froula, Jeff; Rubin, Edward M; Attwood, Graeme T

    2017-08-08

    Ruminants are important contributors to global methane emissions via microbial fermentation in their reticulo-rumens. This study is part of a larger program, characterising the rumen microbiomes of sheep which vary naturally in methane yield (g CH 4 /kg DM/day) and aims to define differences in microbial communities, and in gene and transcript abundances that can explain the animal methane phenotype. Rumen microbiome metagenomic and metatranscriptomic data were analysed by Gene Set Enrichment, sparse partial least squares regression and the Wilcoxon Rank Sum test to estimate correlations between specific KEGG bacterial pathways/genes and high methane yield in sheep. KEGG genes enriched in high methane yield sheep were reassembled from raw reads and existing contigs and analysed by MEGAN to predict their phylogenetic origin. Protein coding sequences from Succinivibrio dextrinosolvens strains were analysed using Effective DB to predict bacterial type III secreted proteins. The effect of S. dextrinosolvens strain H5 growth on methane formation by rumen methanogens was explored using co-cultures. Detailed analysis of the rumen microbiomes of high methane yield sheep shows that gene and transcript abundances of bacterial type III secretion system genes are positively correlated with methane yield in sheep. Most of the bacterial type III secretion system genes could not be assigned to a particular bacterial group, but several genes were affiliated with the genus Succinivibrio, and searches of bacterial genome sequences found that strains of S. dextrinosolvens were part of a small group of rumen bacteria that encode this type of secretion system. In co-culture experiments, S. dextrinosolvens strain H5 showed a growth-enhancing effect on a methanogen belonging to the order Methanomassiliicoccales, and inhibition of a representative of the Methanobrevibacter gottschalkii clade. This is the first report of bacterial type III secretion system genes being associated with high methane emissions in ruminants, and identifies these secretions systems as potential new targets for methane mitigation research. The effects of S. dextrinosolvens on the growth of rumen methanogens in co-cultures indicate that bacteria-methanogen interactions are important modulators of methane production in ruminant animals.

  13. Detection and identification of bacteria in clinical samples by 16S rRNA gene sequencing: comparison of two different approaches in clinical practice.

    PubMed

    Jenkins, Claire; Ling, Clare L; Ciesielczuk, Holly L; Lockwood, Julianne; Hopkins, Susan; McHugh, Timothy D; Gillespie, Stephen H; Kibbler, Christopher C

    2012-04-01

    Amplification and sequence analysis of the 16S rRNA gene can be applied to detect and identify bacteria in clinical samples. We examined 75 clinical samples (17 culture-positive, 58 culture-negative) prospectively by two different PCR protocols, amplifying either a single fragment (1343 bp) or two fragments (762/598 bp) of the 16S rRNA gene. The 1343 bp PCR and 762/598 bp PCRs detected and identified the bacterial 16S rRNA gene in 23 (31 %) and 38 (51 %) of the 75 samples, respectively. The 1343 bp PCR identified 19 of 23 (83 %) PCR-positive samples to species level while the 762/598 bp PCR identified 14 of 38 (37 %) bacterial 16S rRNA gene fragments to species level and 24 to the genus level only. Amplification of shorter fragments of the bacterial 16S rRNA gene (762 and 598 bp) resulted in a more sensitive assay; however, analysis of a large fragment (1343 bp) improved species discrimination. Although not statistically significant, the 762/598 bp PCR detected the bacterial 16S rRNA gene in more samples than the 1343 bp PCR, making it more likely to be a more suitable method for the primary detection of the bacterial 16S rRNA gene in the clinical setting. The 1343 bp PCR may be used in combination with the 762/598 bp PCR when identification of the bacterial rRNA gene to species level is required.

  14. Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose-producing strain

    PubMed Central

    Florea, Michael; Hagemann, Henrik; Santosa, Gabriella; Micklem, Chris N.; Spencer-Milnes, Xenia; de Arroyo Garcia, Laura; Paschou, Despoina; Lazenbatt, Christopher; Kong, Deze; Chughtai, Haroon; Jensen, Kirsten; Freemont, Paul S.; Kitney, Richard; Reeve, Benjamin; Ellis, Tom

    2016-01-01

    Bacterial cellulose is a strong and ultrapure form of cellulose produced naturally by several species of the Acetobacteraceae. Its high strength, purity, and biocompatibility make it of great interest to materials science; however, precise control of its biosynthesis has remained a challenge for biotechnology. Here we isolate a strain of Komagataeibacter rhaeticus (K. rhaeticus iGEM) that can produce cellulose at high yields, grow in low-nitrogen conditions, and is highly resistant to toxic chemicals. We achieved external control over its bacterial cellulose production through development of a modular genetic toolkit that enables rational reprogramming of the cell. To further its use as an organism for biotechnology, we sequenced its genome and demonstrate genetic circuits that enable functionalization and patterning of heterologous gene expression within the cellulose matrix. This work lays the foundations for using genetic engineering to produce cellulose-based materials, with numerous applications in basic science, materials engineering, and biotechnology. PMID:27247386

  15. Engineering control of bacterial cellulose production using a genetic toolkit and a new cellulose-producing strain.

    PubMed

    Florea, Michael; Hagemann, Henrik; Santosa, Gabriella; Abbott, James; Micklem, Chris N; Spencer-Milnes, Xenia; de Arroyo Garcia, Laura; Paschou, Despoina; Lazenbatt, Christopher; Kong, Deze; Chughtai, Haroon; Jensen, Kirsten; Freemont, Paul S; Kitney, Richard; Reeve, Benjamin; Ellis, Tom

    2016-06-14

    Bacterial cellulose is a strong and ultrapure form of cellulose produced naturally by several species of the Acetobacteraceae Its high strength, purity, and biocompatibility make it of great interest to materials science; however, precise control of its biosynthesis has remained a challenge for biotechnology. Here we isolate a strain of Komagataeibacter rhaeticus (K. rhaeticus iGEM) that can produce cellulose at high yields, grow in low-nitrogen conditions, and is highly resistant to toxic chemicals. We achieved external control over its bacterial cellulose production through development of a modular genetic toolkit that enables rational reprogramming of the cell. To further its use as an organism for biotechnology, we sequenced its genome and demonstrate genetic circuits that enable functionalization and patterning of heterologous gene expression within the cellulose matrix. This work lays the foundations for using genetic engineering to produce cellulose-based materials, with numerous applications in basic science, materials engineering, and biotechnology.

  16. Effect of copper treatment on the composition and function of the bacterial community in the sponge Haliclona cymaeformis.

    PubMed

    Tian, Ren-Mao; Wang, Yong; Bougouffa, Salim; Gao, Zhao-Ming; Cai, Lin; Zhang, Wei-Peng; Bajic, Vladimir; Qian, Pei-Yuan

    2014-11-04

    Marine sponges are the most primitive metazoan and host symbiotic microorganisms. They are crucial components of the marine ecological system and play an essential role in pelagic processes. Copper pollution is currently a widespread problem and poses a threat to marine organisms. Here, we examined the effects of copper treatment on the composition of the sponge-associated bacterial community and the genetic features that facilitate the survival of enriched bacteria under copper stress. The 16S rRNA gene sequencing results showed that the sponge Haliclona cymaeformis harbored symbiotic sulfur-oxidizing Ectothiorhodospiraceae and photosynthetic Cyanobacteria as dominant species. However, these autotrophic bacteria decreased substantially after treatment with a high copper concentration, which enriched for a heterotrophic-bacterium-dominated community. Metagenomic comparison revealed a varied profile of functional genes and enriched functions, including bacterial motility and chemotaxis, extracellular polysaccharide and capsule synthesis, virulence-associated genes, and genes involved in cell signaling and regulation, suggesting short-period mechanisms of the enriched bacterial community for surviving copper stress in the microenvironment of the sponge. Microscopic observation and comparison revealed dynamic bacterial aggregation within the matrix and lysis of sponge cells. The bacteriophage community was also enriched, and the complete genome of a dominant phage was determined, implying that a lytic phage cycle was stimulated by the high copper concentration. This study demonstrated a copper-induced shift in the composition of functional genes of the sponge-associated bacterial community, revealing the selective effect of copper treatment on the functions of the bacterial community in the microenvironment of the sponge. This study determined the bacterial community structure of the common sponge Haliclona cymaeformis and examined the effect of copper treatment on the community structure and functional gene composition, revealing that copper treatment had a selective effect on the functions of the bacterial community in the sponge. These findings suggest that copper pollution has an ecological impact on the sponge symbiont. The analysis showed that the untreated sponges hosted symbiotic autotrophic bacteria as dominant species, and the high-concentration copper treatment enriched for a heterotrophic bacterial community with enrichment for genes important for bacterial motility, supplementary cellular components, signaling and regulation, and virulence. Microscopic observation showed obvious bacterial aggregation and a reduction of sponge cell numbers in treated sponges, which suggested the formation of aggregates to reduce the copper concentration. The enrichment for functions of directional bacterial movement and supplementary cellular components and the formation of bacterial aggregates and phage enrichment are novel findings in sponge studies. Copyright © 2014 Tian et al.

  17. Transgenic plants producing the bacterial pheromone N-acyl-homoserine lactone exhibit enhanced resistance to the bacterial phytopathogen Erwinia carotovora.

    PubMed

    Mäe, A; Montesano, M; Koiv, V; Palva, E T

    2001-09-01

    Bacterial pheromones, mainly different homoserine lactones, are central to a number of bacterial signaling processes, including those involved in plant pathogenicity. We previously demonstrated that N-oxoacyl-homoserine lactone (OHL) is essential for quorum sensing in the soft-rot phytopathogen Erwinia carotovora. In this pathogen, OHL controls the coordinate activation of genes encoding the main virulence determinants, extracellular plant cell wall degrading enzymes (PCWDEs), in a cell density-dependent manner. We suggest that E. carotovora employ quorum sensing to avoid the premature production of PCWDEs and subsequent activation of plant defense responses. To test whether modulating this sensory system would affect the outcome of a plant-pathogen interaction, we generated transgenic tobacco, producing OHL. This was accomplished by ectopic expression in tobacco of the E. carotovora gene expI, which is responsible for OHL biosynthesis. We show that expI-positive transgenic tobacco lines produced the active pheromone and partially complemented the avirulent phenotype of expI mutants. The OHL-producing tobacco lines exhibited enhanced resistance to infection by wild-type E. carotovora. The results were confirmed by exogenous addition of OHL to wild-type plants, which also resulted in increased resistance to E. carotovora.

  18. Characterization of Batrachochytrium dendrobatidis Inhibiting Bacteria from Amphibian Populations in Costa Rica

    PubMed Central

    Madison, Joseph D.; Berg, Elizabeth A.; Abarca, Juan G.; Whitfield, Steven M.; Gorbatenko, Oxana; Pinto, Adrian; Kerby, Jacob L.

    2017-01-01

    Global amphibian declines and extinction events are occurring at an unprecedented rate. While several factors are responsible for declines and extinction, the fungal pathogen Batrachochytrium dendrobatidis (Bd) has been cited as a major constituent in these events. While the effects of this chytrid fungus have been shown to cause broad scale population declines and extinctions, certain individuals and relict populations have shown resistance. This resistance has been attributed in part to the cutaneous bacterial microbiome. Here, we present the first study characterizing anti-Bd bacterial isolates from amphibian populations in Costa Rica, including the characterization of two strains of Serratia marcescens presenting strong anti-Bd activity. Transcriptome sequencing was utilized for delineation of shifts in gene expression of the two previously uncharacterized strains of S. marcescens grown in three different treatments comprising Bd, heat-killed Bd, and a no Bd control. These results revealed up- and down-regulation of key genes associated with different metabolic and regulatory pathways. This information will be valuable in continued efforts to develop a bacterial-based approach for amphibian protection as well as providing direction for continued mechanistic inquiries of the bacterial anti-Bd response. PMID:28293222

  19. Comparative genomics of transcriptional regulation of methionine metabolism in proteobacteria

    DOE PAGES

    Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; ...

    2014-11-20

    Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ~200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific andmore » genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria.« less

  20. Identification of the bacterial etiology of culture-negative endocarditis by amplification and sequencing of a small ribosomal RNA gene.

    PubMed

    Khulordava, Irakli; Miller, Geraldine; Haas, David; Li, Haijing; McKinsey, Joel; Vanderende, Daniel; Tang, Yi-Wei

    2003-05-01

    We report two cases of culture-negative bacterial endocarditis in which the organisms were identified by amplification and sequencing of the bacterial 16S rRNA gene. These results support an important role for polymerase chain reaction followed by direct sequencing to determine the etiology of culture-negative bacterial endocarditis and to guide appropriate antimicrobial therapy.

  1. Paper Genetic Engineering.

    ERIC Educational Resources Information Center

    MacClintic, Scott D.; Nelson, Genevieve M.

    Bacterial transformation is a commonly used technique in genetic engineering that involves transferring a gene of interest into a bacterial host so that the bacteria can be used to produce large quantities of the gene product. Although several kits are available for performing bacterial transformation in the classroom, students do not always…

  2. Characterization of bacteriophages virulent for Clostridium perfringens and identification of phage lytic enzymes as alternatives to antibiotics for potential control of the bacterium

    USDA-ARS?s Scientific Manuscript database

    There has been a resurgent interest in the use of bacteriophages or their gene products to control bacterial pathogens as alternatives to currently utilized antibiotics. Clostridium perfringens is a Gram-positive, spore-forming anaerobic bacterium that plays a significant role in human food-borne di...

  3. Characterization of bacteriophages virulent for Clostridium perfringens and identification of phage lytic enzymes as alternatives to antibiotics for potential control of the bacterium

    USDA-ARS?s Scientific Manuscript database

    There has been a resurgent interest in the use of bacteriophages or their gene products to control bacterial pathogens as alternatives to currently utilized antibiotics. Clostridium perfringens is a Gram-positive, spore-forming anaerobic bacterium that plays a significant role in human food-borne d...

  4. Characterisation of worldwide Helicobacter pylori strains reveals genetic conservation and essentiality of serine protease HtrA

    PubMed Central

    Tegtmeyer, Nicole; Moodley, Yoshan; Yamaoka, Yoshio; Pernitzsch, Sandy Ramona; Schmidt, Vanessa; Traverso, Francisco Rivas; Schmidt, Thomas P.; Rad, Roland; Yeoh, Khay Guan; Bow, Ho; Torres, Javier; Gerhard, Markus; Schneider, Gisbert; Wessler, Silja

    2015-01-01

    Summary HtrA proteases and chaperones exhibit important roles in periplasmic protein quality control and stress responses. The genetic inactivation of htrA has been described for many bacterial pathogens. However, in some cases such as the gastric pathogen H elicobacter pylori, HtrA is secreted where it cleaves the tumour‐suppressor E‐cadherin interfering with gastric disease development, but the generation of htrA mutants is still lacking. Here, we show that the htrA gene locus is highly conserved in worldwide strains. HtrA presence was confirmed in 992 H . pylori isolates in gastric biopsy material from infected patients. Differential RNA‐sequencing (dRNA‐seq) indicated that htrA is encoded in an operon with two subsequent genes, HP1020 and HP1021. Genetic mutagenesis and complementation studies revealed that HP1020 and HP1021, but not htrA, can be mutated. In addition, we demonstrate that suppression of HtrA proteolytic activity with a newly developed inhibitor is sufficient to effectively kill H . pylori, but not other bacteria. We show that H elicobacter  htrA is an essential bifunctional gene with crucial intracellular and extracellular functions. Thus, we describe here the first microbe in which htrA is an indispensable gene, a situation unique in the bacterial kingdom. HtrA can therefore be considered a promising new target for anti‐bacterial therapy. PMID:26568477

  5. Delivery of gene biotechnologies to plants: Pathogen and pest control

    USDA-ARS?s Scientific Manuscript database

    Treatment of oligonucleotides to plants for host delivered suppression of microbes and insect pests of citrus was successful. FANA_ASO, (2'-deoxy-2'-fluoro-D- arabinonucleic acid)_( antisense oligonucleotides- AUM LifeTech) designed to: Asian citrus psyllid; Citrus plant bacterial pathogen of citru...

  6. Bacterial subfamily of LuxR regulators that respond to plant compounds

    USDA-ARS?s Scientific Manuscript database

    Certain strains of Pseudomonas fluorescens inhabit the rhizosphere where they can suppress plant diseases caused by soilborne pathogens. The expression of genes coding for the biosynthesis of antibiotics is crucial to the biological control properties of these bacteria, but factors influencing the ...

  7. The molecular network governing nodule organogenesis and infection in the model legume Lotus japonicus.

    PubMed

    Madsen, Lene H; Tirichine, Leïla; Jurkiewicz, Anna; Sullivan, John T; Heckmann, Anne B; Bek, Anita S; Ronson, Clive W; James, Euan K; Stougaard, Jens

    2010-04-12

    Bacterial infection of interior tissues of legume root nodules is controlled at the epidermal cell layer and is closely coordinated with progressing organ development. Using spontaneous nodulating Lotus japonicus plant mutants to uncouple nodule organogenesis from infection, we have determined the role of 16 genes in these two developmental processes. We show that host-encoded mechanisms control three alternative entry processes operating in the epidermis, the root cortex and at the single cell level. Single cell infection did not involve the formation of trans-cellular infection threads and was independent of host Nod-factor receptors and bacterial Nod-factor signals. In contrast, Nod-factor perception was required for epidermal root hair infection threads, whereas primary signal transduction genes preceding the secondary Ca2+ oscillations have an indirect role. We provide support for the origin of rhizobial infection through direct intercellular epidermal invasion and subsequent evolution of crack entry and root hair invasions observed in most extant legumes.

  8. Copper control of bacterial nitrous oxide emission and its impact on vitamin B12-dependent metabolism

    PubMed Central

    Sullivan, Matthew J.; Gates, Andrew J.; Appia-Ayme, Corinne; Rowley, Gary; Richardson, David J.

    2013-01-01

    Global agricultural emissions of the greenhouse gas nitrous oxide (N2O) have increased by around 20% over the last 100 y, but regulation of these emissions and their impact on bacterial cellular metabolism are poorly understood. Denitrifying bacteria convert nitrate in soils to inert di-nitrogen gas (N2) via N2O and the biochemistry of this process has been studied extensively in Paracoccus denitrificans. Here we demonstrate that expression of the gene encoding the nitrous oxide reductase (NosZ), which converts N2O to N2, is regulated in response to the extracellular copper concentration. We show that elevated levels of N2O released as a consequence of decreased cellular NosZ activity lead to the bacterium switching from vitamin B12-dependent to vitamin B12-independent biosynthetic pathways, through the transcriptional modulation of genes controlled by vitamin B12 riboswitches. This inhibitory effect of N2O can be rescued by addition of exogenous vitamin B12. PMID:24248380

  9. Simultaneous amplification of two bacterial genes: more reliable method of Helicobacter pylori detection in microbial rich dental plaque samples.

    PubMed

    Chaudhry, Saima; Idrees, Muhammad; Izhar, Mateen; Butt, Arshad Kamal; Khan, Ayyaz Ali

    2011-01-01

    Polymerase Chain reaction (PCR) assay is considered superior to other methods for detection of Helicobacter pylori (H. pylori) in oral cavity; however, it also has limitations when sample under study is microbial rich dental plaque. The type of gene targeted and number of primers used for bacterial detection in dental plaque samples can have a significant effect on the results obtained as there are a number of closely related bacterial species residing in plaque biofilm. Also due to high recombination rate of H. pylori some of the genes might be down regulated or absent. The present study was conducted to determine the frequency of H. pylori colonization of dental plaque by simultaneously amplifying two genes of the bacterium. One hundred dental plaque specimens were collected from dyspeptic patients before their upper gastrointestinal endoscopy and presence of H. pylori was determined through PCR assay using primers targeting two different genes of the bacterium. Eighty-nine of the 100 samples were included in final analysis. With simultaneous amplification of two bacterial genes 51.6% of the dental plaque samples were positive for H. pylori while this prevalence increased to 73% when only one gene amplification was used for bacterial identification. Detection of H. pylori in dental plaque samples is more reliable when two genes of the bacterium are simultaneously amplified as compared to one gene amplification only.

  10. Overlapping Podospora anserina Transcriptional Responses to Bacterial and Fungal Non Self Indicate a Multilayered Innate Immune Response

    PubMed Central

    Lamacchia, Marina; Dyrka, Witold; Breton, Annick; Saupe, Sven J.; Paoletti, Mathieu

    2016-01-01

    Recognition and response to non self is essential to development and survival of all organisms. It can occur between individuals of the same species or between different organisms. Fungi are established models for conspecific non self recognition in the form of vegetative incompatibility (VI), a genetically controlled process initiating a programmed cell death (PCD) leading to the rejection of a fusion cell between genetically different isolates of the same species. In Podospora anserina VI is controlled by members of the hnwd gene family encoding for proteins analogous to NOD Like Receptors (NLR) immune receptors in eukaryotes. It was hypothesized that the hnwd controlled VI reaction was derived from the fungal innate immune response. Here we analyze the P. anserina transcriptional responses to two bacterial species, Serratia fonticola to which P. anserina survives and S. marcescens to which P. anserina succumbs, and compare these to the transcriptional response induced under VI conditions. Transcriptional responses to both bacteria largely overlap, however the number of genes regulated and magnitude of regulation is more important when P. anserina survives. Transcriptional responses to bacteria also overlap with the VI reaction for both up or down regulated gene sets. Genes up regulated tend to be clustered in the genome, and display limited phylogenetic distribution. In all three responses we observed genes related to autophagy to be up-regulated. Autophagy contributes to the fungal survival in all three conditions. Genes encoding for secondary metabolites and histidine kinase signaling are also up regulated in all three conditions. Transcriptional responses also display differences. Genes involved in response to oxidative stress, or encoding small secreted proteins are essentially expressed in response to bacteria, while genes encoding NLR proteins are expressed during VI. Most functions encoded in response to bacteria favor survival of the fungus while most functions up regulated during VI would lead to cell death. These differences are discussed in the frame of a multilayered response to non self in fungi. PMID:27148175

  11. Adsorption of bacterial plasmids in pure mineral mixtures

    NASA Astrophysics Data System (ADS)

    Zhang, L.; Cochran, J. P.; Seaman, J. C.; Parrott, B.

    2017-12-01

    Microorganisms play an important role in controlling the fate and transport of subsurface contaminants through the direct degradation of organic contaminants to the control of chemical redox conditions that impact the speciation and partitioning of inorganic contaminants. Genes that control these processes, including the relative tolerance associated with direct exposure to toxic contaminants, are found within the bacteria's chromosomal DNA and also within distinct, circular DNA elements called plasmids. Plasmids are mobile genetic elements that can be exchanged with other bacterial species through horizontal gene transfer (HGT). The frequency of HGT in soil is influenced by several factors, with the physicochemical characteristics of soil possibly being a primary factor. Thus, the objective for our research was to determine the movement and persistence of bacterial plasmids within soil. Our current study focuses on batch sorption experiments designed to evaluate the partitioning of bacterial plasmids in idealized mineral mixtures that represent the clay mineralogy of highly weathered soils of the Southeastern US. Specifically, we compared plasmid adsorption among pure goethite, kaolinite, and a mixture of goethite and kaolinite. We also determined the adsorption of plasmids on the above minerals over increasing pH (3 to 10). Our results show that adsorption decreased in the following order: goethite > kaolinite > mixture of goethite and kaolinite. We also found that plasmids adsorption was higher at lower pH levels, with pH 3 having the adsorption maximum. However, at pH 3, DNA denaturing may have occurred, leading to aggregation or precipitation of plasmids on the mineral surfaces. Our study was the first steps in determining the influence of soil properties on plasmid adsorption. Our future goals are to determine the adsorption in other pure minerals and in natural soils.

  12. De novo transcriptome assembly and analysis of differential gene expression following peptidoglycan (PGN) challenge in Antheraea pernyi.

    PubMed

    Liu, Yu; Xin, Zhao-Zhe; Zhang, Dai-Zhen; Zhu, Xiao-Yu; Wang, Ying; Chen, Li; Tang, Bo-Ping; Zhou, Chun-Lin; Chai, Xin-Yue; Tian, Ji-Wu; Liu, Qiu-Ning

    2018-06-01

    Antheraea pernyi is not only an important economic insect, it is increasingly employed as a model organism due to a variety of advantages, including ease of rearing and experimental manipulation compared with other Lepidoptera. Peptidoglycan (PGN) is a major component of the bacterial cell wall, and interactions between PGN and A. pernyi cause a series of physiological changes in the insect. In the present study, we constructed cDNA libraries from a A. pernyi PGN-infected group and a control group stimulated with phosphate-buffered saline (PBS). The transcriptome was de novo assembled using the Trinity platform, and 1698 differentially expressed genes (DEGs) were identified, comprising 894 up-regulated and 804 down-regulated genes. To further investigate immune-related DEGs, gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment were performed. GO analysis identified major immune-related GO terms and KEGG enrichment indicated gene responses to three pathways related to the insect immune system. Several homologous genes related to the immune response of the A. pernyi fat body post-PGN infection were identified and categorised. Taken together, the results provide insight into the complex molecular mechanisms of the responses to bacterial infection at the transcriptional level. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. The Yersinia pestis gcvB gene encodes two small regulatory RNA molecules

    PubMed Central

    McArthur, Sarah D; Pulvermacher, Sarah C; Stauffer, George V

    2006-01-01

    Background In recent years it has become clear that small non-coding RNAs function as regulatory elements in bacterial virulence and bacterial stress responses. We tested for the presence of the small non-coding GcvB RNAs in Y. pestis as possible regulators of gene expression in this organism. Results In this study, we report that the Yersinia pestis KIM6 gcvB gene encodes two small RNAs. Transcription of gcvB is activated by the GcvA protein and repressed by the GcvR protein. The gcvB-encoded RNAs are required for repression of the Y. pestis dppA gene, encoding the periplasmic-binding protein component of the dipeptide transport system, showing that the GcvB RNAs have regulatory activity. A deletion of the gcvB gene from the Y. pestis KIM6 chromosome results in a decrease in the generation time of the organism as well as a change in colony morphology. Conclusion The results of this study indicate that the Y. pestis gcvB gene encodes two small non-coding regulatory RNAs that repress dppA expression. A gcvB deletion is pleiotropic, suggesting that the sRNAs are likely involved in controlling genes in addition to dppA. PMID:16768793

  14. Shifts in the community structure and activity of anaerobic ammonium oxidation bacteria along an estuarine salinity gradient

    NASA Astrophysics Data System (ADS)

    Zheng, Yanling; Jiang, Xiaofen; Hou, Lijun; Liu, Min; Lin, Xianbiao; Gao, Juan; Li, Xiaofei; Yin, Guoyu; Yu, Chendi; Wang, Rong

    2016-06-01

    Anaerobic ammonium oxidation (anammox) is a major microbial pathway for nitrogen (N) removal in estuarine and coastal environments. However, understanding of anammox bacterial dynamics and associations with anammox activity remains scarce along estuarine salinity gradient. In this study, the diversity, abundance, and activity of anammox bacteria, and their potential contributions to total N2 production in the sediments along the salinity gradient (0.1-33.8) of the Yangtze estuarine and coastal zone, were studied using 16S rRNA gene clone library, quantitative polymerase chain reaction assay, and isotope-tracing technique. Phylogenetic analysis showed a significant change in anammox bacterial community structure along the salinity gradient (P < 0.01), with the dominant genus shifting from Brocadia in the freshwater region to Scalindua in the open ocean. Anammox bacterial abundance ranged from 3.67 × 105 to 8.22 × 107 copies 16S rRNA gene g-1 and related significantly with salinity (P < 0.05). The anammox activity varied between 0.08 and 6.46 nmol N g-1 h-1 and related closely with anammox bacterial abundance (P < 0.01). Contributions of anammox activity to total N loss were highly variable along the salinity gradient, ranging from 5 to 77% and were significantly negatively correlated with salinity (P < 0.01). Sediment organic matter was also recognized as an important factor in controlling the relative role of anammox to total N2 production in the Yangtze estuarine and coastal zone. Overall, our data demonstrated a biogeographical distribution of anammox bacterial diversity, abundance, and activity along the estuarine salinity gradient and suggested that salinity is a major environmental control on anammox process in the estuarine and coastal ecosystems.

  15. Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

    PubMed

    Lawrence, J

    1999-12-01

    The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

  16. Response of soil bacterial communities to lead and zinc pollution revealed by Illumina MiSeq sequencing investigation.

    PubMed

    Xu, Xihui; Zhang, Zhou; Hu, Shunli; Ruan, Zhepu; Jiang, Jiandong; Chen, Chen; Shen, Zhenguo

    2017-01-01

    Soil provides a critical environment for microbial community development. However, microorganisms may be sensitive to substances such as heavy metals (HMs), which are common soil contaminants. This study investigated bacterial communities using 16S ribosomal RNA (rRNA) gene fragment sequencing in geographic regions with and without HM pollution to elucidate the effects of soil properties and HMs on bacterial communities. No obvious changes in the richness or diversity of bacterial communities were observed between samples from mining and control areas. Significant differences in bacterial richness and diversity were detected between samples from different geographic regions, indicating that the basic soil characteristics were the most important factors affecting bacterial communities other than HMs. However, the abundances of several phyla and genera differed significantly between mining and control samples, suggesting that Zn and Pb pollution may impact the soil bacterial community composition. Moreover, regression analyses showed that the relative abundances of these phyla and genera were correlated significantly with the soil-available Zn and Pb contents. Redundancy analysis indicated that the soil K, ammoniacal nitrogen (NH 4 + -N), total Cu, and available Zn and Cu contents were the most important factors. Our results not only suggested that the soil bacteria were sensitive to HM stresses but also indicated that other soil properties may affect soil microorganisms to a greater extent.

  17. Addition of allochthonous fungi to a historically contaminated soil affects both remediation efficiency and bacterial diversity.

    PubMed

    Federici, Ermanno; Leonardi, Vanessa; Giubilei, Maria A; Quaratino, Daniele; Spaccapelo, Roberta; D'Annibale, Alessandro; Petruccioli, Maurizio

    2007-11-01

    Botryosphaeria rhodina DABAC P82 and Pleurotus pulmonarius CBS 664.97 were tested for their ability to grow and to degrade aromatic hydrocarbons in an aged contaminated soil. To evaluate the impact of indigenous microflora on the overall process, incubations were performed on both fumigated and nonfumigated soils. Fungal colonization by B. rhodina was unexpectedly lower in the fumigated than in the nonfumigated soil while the growth of P. pulmonarius showed an opposite response. Degradation performances and detoxification by both fungi in the nonfumigated soil were markedly higher than those observed in the fumigated one. Heterotrophic bacterial counts in nonfumigated soil augmented with either B. rhodina or P. pulmonarius were significantly higher than those of the corresponding incubation control (6.7 +/- 0.3 x 10(8) and 8.35 +/- 0.6 x 10(8), respectively, vs 9.2 +/- 0.3 x 10(7)). Bacterial communities of both incubation controls and fungal-augmented soil were compared by numerical analysis of denaturing gradient gel electrophoresis profiles of polymerase chain reaction (PCR)-amplified 16S ribosomal RNA (rRNA) genes and cloning and sequencing of PCR-amplified 16S rRNA genes. Besides increasing overall diversity, fungal augmentation led to considerable qualitative differences with respect to the pristine soil.

  18. Effect of nitrate injection on the bacterial community in a water-oil tank system analyzed by PCR-DGGE.

    PubMed

    Jurelevicius, Diogo; von der Weid, Irene; Korenblum, Elisa; Valoni, Erika; Penna, Mônica; Seldin, Lucy

    2008-04-01

    Sulfide production by sulfate-reducing bacteria (SRB) is a major concern for the petroleum industry since it is toxic and corrosive, and causes plugging due to the formation of insoluble iron sulfides (reservoir souring). In this study, PCR followed by denaturing gradient gel electrophoresis (PCR-DGGE) using two sets of primers based on the 16S rRNA gene and on the aps gene (adenosine-5-phosphosulfate reductase) was used to track changes in the total bacterial and SRB communities, respectively, present in the water-oil tank system on an offshore platform in Brazil in which nitrate treatment was applied for 2 months (15 nitrate injections). PCR-DGGE analysis of the total bacterial community showed the existence of a dominant population in the water-oil tank, and that the appearance and/or the increase of intensity of some bands in the gels were not permanently affected by the introduction of nitrate. On the other hand, the SRB community was stimulated following nitrate treatment. Moreover, sulfide production did not exceed the permissible exposure limit in the water-oil separation tank studied treated with nitrate. Therefore, controlling sulfide production by treating the produced water tank with nitrate could reduce the quantity of chemical biocides required to control microbial activities.

  19. Characterization and in-vivo evaluation of potential probiotics of the bacterial flora within the water column of a healthy shrimp larviculture system

    NASA Astrophysics Data System (ADS)

    Xue, Ming; Liang, Huafang; He, Yaoyao; Wen, Chongqing

    2016-05-01

    A thorough understanding of the normal bacterial flora associated with shrimp larviculture systems contributes to probiotic screening and disease control. The bacterial community of the water column over a commercial Litopenaeus vannamei larval rearing run was characterized with both culture-dependent and culture-independent methods. A total of 27 phylotypes at the species level were isolated and identified based on 16S rDNA sequence analysis. Denaturing gradient gel electrophoresis (DGGE) analysis of the V3-V5 region of 16S rRNA genes showed a dynamic bacterial community with major changes occurred from stages zoea to mysis during the rearing run. The sequences retrieved were affiliated to four phyla, Proteobacteria, Actinobacteria, Bacteroidetes, and Firmicutes, with the family Rhodobacteraceae being the most frequently recovered one. Subsequently, 13 representative strains conferred higher larval survival than the control when evaluated in the in-vivo experiments; in particular, three candidates, assigned to Phaeobacter sp., Arthrobacter sp., and Microbacterium sp., significantly improved larval survival ( P < 0.05). Therefore, the healthy shrimp larviculture system harbored a diverse and favorable bacterial flora, which contribute to larval development and are of great importance in exploiting novel probiotics.

  20. Carbendazim induces a temporary change in soil bacterial community structure.

    PubMed

    Wang, Xiuguo; Song, Min; Gao, Chunming; Dong, Bin; Zhang, Qun; Fang, Hua; Yu, Yunlong

    2009-01-01

    The effect of carbendazim applications on the diversity and structure of a soil bacterial community was studied under field conditions using temperature gradient gel electrophoresis (TGGE) and partial sequence analysis of PCR-amplified 16S rRNA gene. After four successive introductions of carbendazim at a level of 0.94 kg active ingredient (a.i.)/ha, the genetic diversity (expressed as Shannon index, H') decreased from 1.43 in the control to 1.29 in treated soil. This harmful effect seems to increase with the concentration of carbendazim. The value of H' in the soil treated with carbendazim at 4.70 kg a.i./ha was reduced to 1.05 (P < or = 0.05). The structure of soil bacterial community was also affected after four repeated applications of carbendazim at levels of 0.94, 1.88 and 4.70 kg a.i./ha, as seen in the relative intensities of the individual band. However, the bacterial community in carbendazim-treated soil recovered to that in the control 360 d after the first treatment. The results indicated that repeated applications of carbendazim could reduce soil microbial diversity and alter the bacterial community structure temporarily.

  1. Unique core genomes of the bacterial family vibrionaceae: insights into niche adaptation and speciation.

    PubMed

    Kahlke, Tim; Goesmann, Alexander; Hjerde, Erik; Willassen, Nils Peder; Haugen, Peik

    2012-05-10

    The criteria for defining bacterial species and even the concept of bacterial species itself are under debate, and the discussion is apparently intensifying as more genome sequence data is becoming available. However, it is still unclear how the new advances in genomics should be used most efficiently to address this question. In this study we identify genes that are common to any group of genomes in our dataset, to determine whether genes specific to a particular taxon exist and to investigate their potential role in adaptation of bacteria to their specific niche. These genes were named unique core genes. Additionally, we investigate the existence and importance of unique core genes that are found in isolates of phylogenetically non-coherent groups. These groups of isolates, that share a genetic feature without sharing a closest common ancestor, are termed genophyletic groups. The bacterial family Vibrionaceae was used as the model, and we compiled and compared genome sequences of 64 different isolates. Using the software orthoMCL we determined clusters of homologous genes among the investigated genome sequences. We used multilocus sequence analysis to build a host phylogeny and mapped the numbers of unique core genes of all distinct groups of isolates onto the tree. The results show that unique core genes are more likely to be found in monophyletic groups of isolates. Genophyletic groups of isolates, in contrast, are less common especially for large groups of isolate. The subsequent annotation of unique core genes that are present in genophyletic groups indicate a high degree of horizontally transferred genes. Finally, the annotation of the unique core genes of Vibrio cholerae revealed genes involved in aerotaxis and biosynthesis of the iron-chelator vibriobactin. The presented work indicates that genes specific for any taxon inside the bacterial family Vibrionaceae exist. These unique core genes encode conserved metabolic functions that can shed light on the adaptation of a species to its ecological niche. Additionally, our study suggests that unique core genes can be used to aid classification of bacteria and contribute to a bacterial species definition on a genomic level. Furthermore, these genes may be of importance in clinical diagnostics and drug development.

  2. Exploring the potential of the bacterial carotene desaturase CrtI to increase the beta-carotene content in Golden Rice.

    PubMed

    Al-Babili, Salim; Hoa, Tran Thi Cuc; Schaub, Patrick

    2006-01-01

    To increase the beta-carotene (provitamin A) content and thus the nutritional value of Golden Rice, the optimization of the enzymes employed, phytoene synthase (PSY) and the Erwinia uredovora carotene desaturase (CrtI), must be considered. CrtI was chosen for this study because this bacterial enzyme, unlike phytoene synthase, was expressed at barely detectable levels in the endosperm of the Golden Rice events investigated. The low protein amounts observed may be caused by either weak cauliflower mosaic virus 35S promoter activity in the endosperm or by inappropriate codon usage. The protein level of CrtI was increased to explore its potential for enhancing the flux of metabolites through the pathway. For this purpose, a synthetic CrtI gene with a codon usage matching that of rice storage proteins was generated. Rice plants were transformed to express the synthetic gene under the control of the endosperm-specific glutelin B1 promoter. In addition, transgenic plants expressing the original bacterial gene were generated, but the endosperm-specific glutelin B1 promoter was employed instead of the cauliflower mosaic virus 35S promoter. Independent of codon optimization, the use of the endosperm-specific promoter resulted in a large increase in bacterial desaturase production in the T(1) rice grains. However, this did not lead to a significant increase in the carotenoid content, suggesting that the bacterial enzyme is sufficiently active in rice endosperm even at very low levels and is not rate-limiting. The endosperm-specific expression of CrtI did not affect the carotenoid pattern in the leaves, which was observed upon its constitutive expression. Therefore, tissue-specific expression of CrtI represents the better option.

  3. Variation of bacterial communities and expression of Toll-like receptor genes in the rumen of steers differing in susceptibility to subacute ruminal acidosis.

    PubMed

    Chen, Yanhong; Oba, Masahito; Guan, Le Luo

    2012-10-12

    In order to determine differences in the ruminal bacterial community and host Toll-like receptor (TLR) gene expression of beef cattle with different susceptibility to acidosis, rumen papillae and content were collected from acidosis-susceptible (AS, n=3) and acidosis-resistant (AR, n=3) steers. The ruminal bacterial community was characterized using PCR-denaturing gradient gel electrophoresis (PCR-DGGE) and quantitative real time PCR (qRT-PCR) analysis. Global R analysis of bacterial profile similarity revealed that bacterial diversity was significantly different between AR and AS groups for both rumen content (P=0.001) and epithelial (P=0.002) communities. The copy number of total bacterial 16S rRNA genes in content of AS steers was 10-fold higher than that of AR steers, and the copy number of total 16S rRNA genes of epimural bacteria in AR steers was positively correlated with ruminal pH (r=0.59, P=0.04), and negatively correlated with total VFA concentration (r=-0.59, P=0.05). The expressions of host TLR2 and 4 genes were significantly higher in AR steers compared to those in AS steers. These findings enhance our understanding about the ruminal microbial ecology and host gene expression changes that may be useful in the prevention of ruminal acidosis. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Physical-chemical and microbiological changes in Cerrado Soil under differing sugarcane harvest management systems

    PubMed Central

    2012-01-01

    Background Sugarcane cultivation plays an important role in Brazilian economy, and it is expanding fast, mainly due to the increasing demand for ethanol production. In order to understand the impact of sugarcane cultivation and management, we studied sugarcane under different management regimes (pre-harvest burn and mechanical, unburnt harvest, or green cane), next to a control treatment with native vegetation. The soil bacterial community structure (including an evaluation of the diversity of the ammonia oxidizing (amoA) and denitrifying (nirK) genes), greenhouse gas flow and several soil physicochemical properties were evaluated. Results Our results indicate that sugarcane cultivation in this region resulted in changes in several soil properties. Moreover, such changes are reflected in the soil microbiota. No significant influence of soil management on greenhouse gas fluxes was found. However, we did find a relationship between the biological changes and the dynamics of soil nutrients. In particular, the burnt cane and green cane treatments had distinct modifications. There were significant differences in the structure of the total bacterial, the ammonia oxidizing and the denitrifying bacterial communities, being that these groups responded differently to the changes in the soil. A combination of physical and chemical factors was correlated to the changes in the structures of the total bacterial communities of the soil. The changes in the structures of the functional groups follow a different pattern than the physicochemical variables. The latter might indicate a strong influence of interactions among different bacterial groups in the N cycle, emphasizing the importance of biological factors in the structuring of these communities. Conclusion Sugarcane land use significantly impacted the structure of total selected soil bacterial communities and ammonia oxidizing and denitrifier gene diversities in a Cerrado field site in Central Brazil. A high impact of land use was observed in soil under the common burnt cane management. The green cane soil also presented different profiles compared to the control soil, but to at a lesser degree. PMID:22873209

  5. Identification and Genetic Characterization of Ralstonia solanacearum Species Complex Isolates from Cucurbita maxima in China

    PubMed Central

    She, Xiaoman; Yu, Lin; Lan, Guobing; Tang, Yafei; He, Zifu

    2017-01-01

    Ralstonia solanacearum species complex is a devastating phytopathogen with an unusually wide host range, and new host plants are continuously being discovered. In June 2016, a new bacterial wilt on Cucurbita maxima was observed in Guangdong province, China. Initially, in the adult plant stage, several leaves of each plant withered suddenly and drooped; the plant then wilted completely, and the color of their vasculature changed to dark brown, ultimately causing the entire plant to die. Creamy-whitish bacterial masses were observed to ooze from crosscut stems of these diseased plants. To develop control strategies for C. maxima bacterial wilt, the causative pathogenic isolates were identified and characterized. Twenty-four bacterial isolates were obtained from diseased C. maxima plants, and 16S rRNA gene sequencing and pathogenicity analysis results indicated that the pathogen of C. maxima bacterial wilt was Ralstonia solanacearum. The results from DNA-based analysis, host range determination and bacteriological identification confirmed that the 24 isolates belonged to R. solanacearum phylotype I, race 1, and eight of these isolates belonged to biovar 3, while 16 belonged to biovar 4. Based on the results of partial egl gene sequence analysis, the 24 isolates clustered into three egl- sequence type groups, sequevars 17, 45, and 56. Sequevar 56 is a new sequevar which is described for the first time in this paper. An assessment of the resistance of 21 pumpkin cultivars revealed that C. moschata cv. Xiangyu1 is resistant to strain RS378, C. moschata cv. Xiangmi is moderately resistant to strain RS378, and 19 other pumpkin cultivars, including four C. maxima cultivars and 15 C. moschata cultivars, are susceptible to strain RS378. To the best of our knowledge, this is the first report of C. maxima bacterial wilt caused by R. solanacearum race 1 in the world. Our results provide valuable information for the further development of control strategies for C. maxima wilt disease. PMID:29093727

  6. Identification and Genetic Characterization of Ralstonia solanacearum Species Complex Isolates from Cucurbita maxima in China.

    PubMed

    She, Xiaoman; Yu, Lin; Lan, Guobing; Tang, Yafei; He, Zifu

    2017-01-01

    Ralstonia solanacearum species complex is a devastating phytopathogen with an unusually wide host range, and new host plants are continuously being discovered. In June 2016, a new bacterial wilt on Cucurbita maxima was observed in Guangdong province, China. Initially, in the adult plant stage, several leaves of each plant withered suddenly and drooped; the plant then wilted completely, and the color of their vasculature changed to dark brown, ultimately causing the entire plant to die. Creamy-whitish bacterial masses were observed to ooze from crosscut stems of these diseased plants. To develop control strategies for C. maxima bacterial wilt, the causative pathogenic isolates were identified and characterized. Twenty-four bacterial isolates were obtained from diseased C. maxima plants, and 16S rRNA gene sequencing and pathogenicity analysis results indicated that the pathogen of C. maxima bacterial wilt was Ralstonia solanacearum . The results from DNA-based analysis, host range determination and bacteriological identification confirmed that the 24 isolates belonged to R. solanacearum phylotype I, race 1, and eight of these isolates belonged to biovar 3, while 16 belonged to biovar 4. Based on the results of partial egl gene sequence analysis, the 24 isolates clustered into three egl- sequence type groups, sequevars 17, 45, and 56. Sequevar 56 is a new sequevar which is described for the first time in this paper. An assessment of the resistance of 21 pumpkin cultivars revealed that C. moschata cv. Xiangyu1 is resistant to strain RS378, C. moschata cv. Xiangmi is moderately resistant to strain RS378, and 19 other pumpkin cultivars, including four C. maxima cultivars and 15 C. moschata cultivars, are susceptible to strain RS378. To the best of our knowledge, this is the first report of C. maxima bacterial wilt caused by R. solanacearum race 1 in the world. Our results provide valuable information for the further development of control strategies for C. maxima wilt disease.

  7. Code-assisted discovery of TAL effector targets in bacterial leaf streak of rice reveals contrast with bacterial blight and a novel susceptibility gene

    USDA-ARS?s Scientific Manuscript database

    Transcription activator-like (TAL) effectors found in Xanthomonas spp. promote bacterial growth and plant susceptibility by binding specific DNA sequences or, effector-binding elements (EBEs), and inducing host gene expression. In this study, we have found substantially different transcriptional pro...

  8. CONJUGAL GENE TRANSFER IN THE RHIZOSPHERE OF WATER GRASS (ECHINOCHLORA CRUSGALLI): INFLUENCE OF ROOT EXUDATE AND BACTERIAL ACTIVITY

    EPA Science Inventory

    The premise that genetic exchange is primarily localized in niches characterized by dense bacterial populations and high availability of growth substrates was tested by relating conjugal gene transfer of an RP4 derivative to availability of root exudates and bacterial metabolic a...

  9. Evaluating bacterial gene-finding HMM structures as probabilistic logic programs.

    PubMed

    Mørk, Søren; Holmes, Ian

    2012-03-01

    Probabilistic logic programming offers a powerful way to describe and evaluate structured statistical models. To investigate the practicality of probabilistic logic programming for structure learning in bioinformatics, we undertook a simplified bacterial gene-finding benchmark in PRISM, a probabilistic dialect of Prolog. We evaluate Hidden Markov Model structures for bacterial protein-coding gene potential, including a simple null model structure, three structures based on existing bacterial gene finders and two novel model structures. We test standard versions as well as ADPH length modeling and three-state versions of the five model structures. The models are all represented as probabilistic logic programs and evaluated using the PRISM machine learning system in terms of statistical information criteria and gene-finding prediction accuracy, in two bacterial genomes. Neither of our implementations of the two currently most used model structures are best performing in terms of statistical information criteria or prediction performances, suggesting that better-fitting models might be achievable. The source code of all PRISM models, data and additional scripts are freely available for download at: http://github.com/somork/codonhmm. Supplementary data are available at Bioinformatics online.

  10. Duplication and amplification of antibiotic resistance genes enable increased resistance in isolates of multidrug-resistant Salmonella Typhimurium

    USDA-ARS?s Scientific Manuscript database

    During normal bacterial DNA replication, gene duplication and amplification (GDA) events occur randomly at a low frequency in the genome throughout a population. In the absence of selection, GDA events that increase the number of copies of a bacterial gene (or a set of genes) are lost. Antibiotic ...

  11. Lateral Gene Transfer Dynamics in the Ancient Bacterial Genus Streptomyces

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McDonald, Bradon R.; Currie, Cameron R.

    Lateral gene transfer (LGT) profoundly shapes the evolution of bacterial lineages. LGT across disparate phylogenetic groups and genome content diversity between related organisms suggest a model of bacterial evolution that views LGT as rampant and promiscuous. It has even driven the argument that species concepts and tree-based phylogenetics cannot be applied to bacteria. For this paper, we show that acquisition and retention of genes through LGT are surprisingly rare in the ubiquitous and biomedically important bacterial genusStreptomyces. Using a molecular clock, we estimate that theStreptomycesbacteria are ~380 million years old, indicating that this bacterial genus is as ancient as landmore » vertebrates. Calibrating LGT rate to this geologic time span, we find that on average only 10 genes per million years were acquired and subsequently maintained. Over that same time span,Streptomycesaccumulated thousands of point mutations. By explicitly incorporating evolutionary timescale into our analyses, we provide a dramatically different view on the dynamics of LGT and its impact on bacterial evolution.Tree-based phylogenetics and the use of species as units of diversity lie at the foundation of modern biology. In bacteria, these pillars of evolutionary theory have been called into question due to the observation of thousands of lateral gene transfer (LGT) events within and between lineages. Here, we show that acquisition and retention of genes through LGT are exceedingly rare in the bacterial genusStreptomyces, with merely one gene acquired inStreptomyceslineages every 100,000 years. These findings stand in contrast to the current assumption of rampant genetic exchange, which has become the dominant hypothesis used to explain bacterial diversity. Our results support a more nuanced understanding of genetic exchange, with LGT impacting evolution over short timescales but playing a significant role over long timescales. Deeper understanding of LGT provides new insight into the evolutionary history of life on Earth, as the vast majority of this history is microbial.« less

  12. Lateral Gene Transfer Dynamics in the Ancient Bacterial Genus Streptomyces

    DOE PAGES

    McDonald, Bradon R.; Currie, Cameron R.

    2017-06-06

    Lateral gene transfer (LGT) profoundly shapes the evolution of bacterial lineages. LGT across disparate phylogenetic groups and genome content diversity between related organisms suggest a model of bacterial evolution that views LGT as rampant and promiscuous. It has even driven the argument that species concepts and tree-based phylogenetics cannot be applied to bacteria. For this paper, we show that acquisition and retention of genes through LGT are surprisingly rare in the ubiquitous and biomedically important bacterial genusStreptomyces. Using a molecular clock, we estimate that theStreptomycesbacteria are ~380 million years old, indicating that this bacterial genus is as ancient as landmore » vertebrates. Calibrating LGT rate to this geologic time span, we find that on average only 10 genes per million years were acquired and subsequently maintained. Over that same time span,Streptomycesaccumulated thousands of point mutations. By explicitly incorporating evolutionary timescale into our analyses, we provide a dramatically different view on the dynamics of LGT and its impact on bacterial evolution.Tree-based phylogenetics and the use of species as units of diversity lie at the foundation of modern biology. In bacteria, these pillars of evolutionary theory have been called into question due to the observation of thousands of lateral gene transfer (LGT) events within and between lineages. Here, we show that acquisition and retention of genes through LGT are exceedingly rare in the bacterial genusStreptomyces, with merely one gene acquired inStreptomyceslineages every 100,000 years. These findings stand in contrast to the current assumption of rampant genetic exchange, which has become the dominant hypothesis used to explain bacterial diversity. Our results support a more nuanced understanding of genetic exchange, with LGT impacting evolution over short timescales but playing a significant role over long timescales. Deeper understanding of LGT provides new insight into the evolutionary history of life on Earth, as the vast majority of this history is microbial.« less

  13. Lateral Gene Transfer Dynamics in the Ancient Bacterial Genus Streptomyces.

    PubMed

    McDonald, Bradon R; Currie, Cameron R

    2017-06-06

    Lateral gene transfer (LGT) profoundly shapes the evolution of bacterial lineages. LGT across disparate phylogenetic groups and genome content diversity between related organisms suggest a model of bacterial evolution that views LGT as rampant and promiscuous. It has even driven the argument that species concepts and tree-based phylogenetics cannot be applied to bacteria. Here, we show that acquisition and retention of genes through LGT are surprisingly rare in the ubiquitous and biomedically important bacterial genus Streptomyces Using a molecular clock, we estimate that the Streptomyces bacteria are ~380 million years old, indicating that this bacterial genus is as ancient as land vertebrates. Calibrating LGT rate to this geologic time span, we find that on average only 10 genes per million years were acquired and subsequently maintained. Over that same time span, Streptomyces accumulated thousands of point mutations. By explicitly incorporating evolutionary timescale into our analyses, we provide a dramatically different view on the dynamics of LGT and its impact on bacterial evolution. IMPORTANCE Tree-based phylogenetics and the use of species as units of diversity lie at the foundation of modern biology. In bacteria, these pillars of evolutionary theory have been called into question due to the observation of thousands of lateral gene transfer (LGT) events within and between lineages. Here, we show that acquisition and retention of genes through LGT are exceedingly rare in the bacterial genus Streptomyces , with merely one gene acquired in Streptomyces lineages every 100,000 years. These findings stand in contrast to the current assumption of rampant genetic exchange, which has become the dominant hypothesis used to explain bacterial diversity. Our results support a more nuanced understanding of genetic exchange, with LGT impacting evolution over short timescales but playing a significant role over long timescales. Deeper understanding of LGT provides new insight into the evolutionary history of life on Earth, as the vast majority of this history is microbial. Copyright © 2017 McDonald and Currie.

  14. Impact of Substratum Surface on Microbial Community Structure and Treatment Performance in Biological Aerated Filters

    PubMed Central

    Kim, Lavane; Pagaling, Eulyn; Zuo, Yi Y.

    2014-01-01

    The impact of substratum surface property change on biofilm community structure was investigated using laboratory biological aerated filter (BAF) reactors and molecular microbial community analysis. Two substratum surfaces that differed in surface properties were created via surface coating and used to develop biofilms in test (modified surface) and control (original surface) BAF reactors. Microbial community analysis by 16S rRNA gene-based PCR-denaturing gradient gel electrophoresis (DGGE) showed that the surface property change consistently resulted in distinct profiles of microbial populations during replicate reactor start-ups. Pyrosequencing of the bar-coded 16S rRNA gene amplicons surveyed more than 90% of the microbial diversity in the microbial communities and identified 72 unique bacterial species within 19 bacterial orders. Among the 19 orders of bacteria detected, Burkholderiales and Rhodocyclales of the Betaproteobacteria class were numerically dominant and accounted for 90.5 to 97.4% of the sequence reads, and their relative abundances in the test and control BAF reactors were different in consistent patterns during the two reactor start-ups. Three of the five dominant bacterial species also showed consistent relative abundance changes between the test and control BAF reactors. The different biofilm microbial communities led to different treatment efficiencies, with consistently higher total organic carbon (TOC) removal in the test reactor than in the control reactor. Further understanding of how surface properties affect biofilm microbial communities and functional performance would enable the rational design of new generations of substrata for the improvement of biofilm-based biological treatment processes. PMID:24141134

  15. Regulation of transcription by eukaryotic-like serine-threonine kinases and phosphatases in Gram-positive bacterial pathogens

    PubMed Central

    Wright, David P; Ulijasz, Andrew T

    2014-01-01

    Bacterial eukaryotic-like serine threonine kinases (eSTKs) and serine threonine phosphatases (eSTPs) have emerged as important signaling elements that are indispensable for pathogenesis. Differing considerably from their histidine kinase counterparts, few eSTK genes are encoded within the average bacterial genome, and their targets are pleiotropic in nature instead of exclusive. The growing list of important eSTK/P substrates includes proteins involved in translation, cell division, peptidoglycan synthesis, antibiotic tolerance, resistance to innate immunity and control of virulence factors. Recently it has come to light that eSTK/Ps also directly modulate transcriptional machinery in many microbial pathogens. This novel form of regulation is now emerging as an additional means by which bacteria can alter their transcriptomes in response to host-specific environmental stimuli. Here we focus on the ability of eSTKs and eSTPs in Gram-positive bacterial pathogens to directly modulate transcription, the known mechanistic outcomes of these modifications, and their roles as an added layer of complexity in controlling targeted RNA synthesis to enhance virulence potential. PMID:25603430

  16. Dynamics of Bacterial Communities in Two Unpolluted Soils after Spiking with Phenanthrene: Soil Type Specific and Common Responders

    PubMed Central

    Ding, Guo-Chun; Heuer, Holger; Smalla, Kornelia

    2012-01-01

    Considering their key role for ecosystem processes, it is important to understand the response of microbial communities in unpolluted soils to pollution with polycyclic aromatic hydrocarbons (PAH). Phenanthrene, a model compound for PAH, was spiked to a Cambisol and a Luvisol soil. Total community DNA from phenanthrene-spiked and control soils collected on days 0, 21, and 63 were analyzed based on PCR-amplified 16S rRNA gene fragments. Denaturing gradient gel electrophoresis (DGGE) fingerprints of bacterial communities increasingly deviated with time between spiked and control soils. In taxon specific DGGE, significant responses of Alphaproteobacteria and Actinobacteria became only detectable after 63 days, while significant effects on Betaproteobacteria were detectable in both soils after 21 days. Comparison of the taxonomic distribution of bacteria in spiked and control soils on day 63 as revealed by pyrosequencing indicated soil type specific negative effects of phenanthrene on several taxa, many of them belonging to the Gamma-, Beta-, or Deltaproteobacteria. Bacterial richness and evenness decreased in spiked soils. Despite the significant differences in the bacterial community structure between both soils on day 0, similar genera increased in relative abundance after PAH spiking, especially Sphingomonas and Polaromonas. However, this did not result in an increased overall similarity of the bacterial communities in both soils. PMID:22934091

  17. Orally Delivered Scorpion Antimicrobial Peptides Exhibit Activity against Pea Aphid (Acyrthosiphon pisum) and Its Bacterial Symbionts.

    PubMed

    Luna-Ramirez, Karen; Skaljac, Marisa; Grotmann, Jens; Kirfel, Phillipp; Vilcinskas, Andreas

    2017-08-24

    Aphids are severe agricultural pests that damage crops by feeding on phloem sap and vectoring plant pathogens. Chemical insecticides provide an important aphid control strategy, but alternative and sustainable control measures are required to avoid rapidly emerging resistance, environmental contamination, and the risk to humans and beneficial organisms. Aphids are dependent on bacterial symbionts, which enable them to survive on phloem sap lacking essential nutrients, as well as conferring environmental stress tolerance and resistance to parasites. The evolution of aphids has been accompanied by the loss of many immunity-related genes, such as those encoding antibacterial peptides, which are prevalent in other insects, probably because any harm to the bacterial symbionts would inevitably affect the aphids themselves. This suggests that antimicrobial peptides (AMPs) could replace or at least complement conventional insecticides for aphid control. We fed the pea aphids ( Acyrthosiphon pisum ) with AMPs from the venom glands of scorpions. The AMPs reduced aphid survival, delayed their reproduction, displayed in vitro activity against aphid bacterial symbionts, and reduced the number of symbionts in vivo. Remarkably, we found that some of the scorpion AMPs compromised the aphid bacteriome, a specialized organ that harbours bacterial symbionts. Our data suggest that scorpion AMPs holds the potential to be developed as bio-insecticides, and are promising candidates for the engineering of aphid-resistant crops.

  18. Orally Delivered Scorpion Antimicrobial Peptides Exhibit Activity against Pea Aphid (Acyrthosiphon pisum) and Its Bacterial Symbionts

    PubMed Central

    Luna-Ramirez, Karen; Skaljac, Marisa; Grotmann, Jens; Kirfel, Phillipp; Vilcinskas, Andreas

    2017-01-01

    Aphids are severe agricultural pests that damage crops by feeding on phloem sap and vectoring plant pathogens. Chemical insecticides provide an important aphid control strategy, but alternative and sustainable control measures are required to avoid rapidly emerging resistance, environmental contamination, and the risk to humans and beneficial organisms. Aphids are dependent on bacterial symbionts, which enable them to survive on phloem sap lacking essential nutrients, as well as conferring environmental stress tolerance and resistance to parasites. The evolution of aphids has been accompanied by the loss of many immunity-related genes, such as those encoding antibacterial peptides, which are prevalent in other insects, probably because any harm to the bacterial symbionts would inevitably affect the aphids themselves. This suggests that antimicrobial peptides (AMPs) could replace or at least complement conventional insecticides for aphid control. We fed the pea aphids (Acyrthosiphon pisum) with AMPs from the venom glands of scorpions. The AMPs reduced aphid survival, delayed their reproduction, displayed in vitro activity against aphid bacterial symbionts, and reduced the number of symbionts in vivo. Remarkably, we found that some of the scorpion AMPs compromised the aphid bacteriome, a specialized organ that harbours bacterial symbionts. Our data suggest that scorpion AMPs holds the potential to be developed as bio-insecticides, and are promising candidates for the engineering of aphid-resistant crops. PMID:28837113

  19. Molecular responses in root-associative rhizospheric bacteria to variations in plant exudates

    NASA Astrophysics Data System (ADS)

    Abdoun, Hamid; McMillan, Mary; Pereg, Lily

    2015-04-01

    Plant exudates are a major factor in the interface of plant-soil-microbe interactions and it is well documented that the microbial community structure in the rhizosphere is largely influenced by the particular exudates excreted by various plants. Azospirillum brasilense is a plant growth promoting rhizobacterium that is known to interact with a large number of plants, including important food crops. The regulatory gene flcA has an important role in this interaction as it controls morphological differentiation of the bacterium that is essential for attachment to root surfaces. Being a response regulatory gene, flcA mediates the response of the bacterial cell to signals from the surrounding rhizosphere. This makes this regulatory gene a good candidate for analysis of the response of bacteria to rhizospheric alterations, in this case, variations in root exudates. We will report on our studies on the response of Azospirillum, an ecologically, scientifically and agriculturally important bacterial genus, to variations in the rhizosphere.

  20. Genetic networks controlled by the bacterial replication initiator and transcription factor DnaA in Bacillus subtilis.

    PubMed

    Washington, Tracy A; Smith, Janet L; Grossman, Alan D

    2017-10-01

    DnaA is the widely conserved bacterial AAA+ ATPase that functions as both the replication initiator and a transcription factor. In many organisms, DnaA controls expression of its own gene and likely several others during growth and in response to replication stress. To evaluate the effects of DnaA on gene expression, separate from its role in replication initiation, we analyzed changes in mRNA levels in Bacillus subtilis cells with and without dnaA, using engineered strains in which dnaA is not essential. We found that dnaA was required for many of the changes in gene expression in response to replication stress. We also found that dnaA indirectly affected expression of several regulons during growth, including those controlled by the transcription factors Spo0A, AbrB, PhoP, SinR, RemA, Rok and YvrH. These effects were largely mediated by the effects of DnaA on expression of sda. DnaA activates transcription of sda, and Sda inhibits histidine protein kinases required for activation of the transcription factor Spo0A. We also found that loss of dnaA caused a decrease in the development of genetic competence. Together, our results indicate that DnaA plays an important role in modulating cell physiology, separate from its role in replication initiation. © 2017 John Wiley & Sons Ltd.

  1. Stannous Fluoride Effects on Gene Expression of Streptococcus mutans and Actinomyces viscosus.

    PubMed

    Shi, Y; Li, R; White, D J; Biesbrock, A R

    2018-02-01

    A genome-wide transcriptional analysis was performed to elucidate the bacterial cellular response of Streptococcus mutans and Actinomyces viscosus to NaF and SnF 2 . The minimal inhibitory concentration (MIC) and minimal bactericidal concentration (MBC) of SnF 2 were predetermined before microarray study. Gene expression profiling microarray experiments were carried out in the absence (control) and presence (experimental) of 10 ppm and 100 ppm Sn 2+ (in the form of SnF 2 ) and fluoride controls for 10-min exposures (4 biological replicates/treatment). These Sn 2+ levels and treatment time were chosen because they have been shown to slow bacterial growth of S. mutans (10 ppm) and A. viscosus (100 ppm) without affecting cell viability. All data generated by microarray experiments were analyzed with bioinformatics tools by applying the following criteria: 1) a q value should be ≤0.05, and 2) an absolute fold change in transcript level should be ≥1.5. Microarray results showed SnF 2 significantly inhibited several genes encoding enzymes of the galactose pathway upon a 10-min exposure versus a negative control: lacA and lacB (A and B subunits of the galactose-6-P isomerase), lacC (tagatose-6-P kinase), lacD (tagatose-1,6-bP adolase), galK (galactokinase), galT (galactose-1-phosphate uridylyltransferase), and galE (UDP-glucose 4-epimerase). A gene fruK encoding fructose-1-phosphate kinase in the fructose pathway was also significantly inhibited. Several genes encoding fructose/mannose-specific enzyme IIABC components in the phosphotransferase system (PTS) were also downregulated, as was ldh encoding lactate dehydrogenase, a key enzyme involved in lactic acid synthesis. SnF 2 downregulated the transcription of most key enzyme genes involved in the galactose pathway and also suppressed several key genes involved in the PTS, which transports sugars into the cell in the first step of glycolysis.

  2. Volatile arsenic species released from Escherichia coli expressing the AsIII S-adenosylmethionine methyltransferase gene.

    PubMed

    Yuan, Chungang; Lu, Xiufen; Qin, Jie; Rosen, Barry P; Le, X Chris

    2008-05-01

    Biological systems, ranging from bacteria and fungi to humans, can methylate arsenic. Recent studies have suggested that the AsIII S-adenosylmethionine methyltransferase (arsM) gene in bacteria was responsible for the removal of arsenic as the volatile arsines from the bacteria. However, there has been no direct measure of the arsines released from bacteria cultures. We describe here an integrated system incorporating the bacterial incubation and volatile arsenic species analysis, and we demonstrate its application to the identification of the volatile arsines produced in bacterial cultures. The headspace of the bacterial cultures was purged with helium, and the volatile arsenic species were trapped in a chromatographic column immersed in liquid nitrogen. The cryogenically trapped arsines [AsH3, (CH3)AsH2, (CH3)2AsH, and (CH3)3As] were separated by gas chromatography and were detected by inductively coupled plasma mass spectrometry. A hydride generation system was coupled to the bacterial culture system, allowing for spiking standards and for generating calibration arsines necessary for quantitative analysis. Both bacteria containing the arsM gene or its variant arsMC2 gene were able to produce 400-500 ng of trimethylarsine. No trimethylarsine was detectable in bacteria lacking the arsM gene (containing the vector plasmid as negative control). These results confirm that arsM is responsible for releasing arsenic as volatile species from the arsenic-resistant bacteria. Our results also show traces of AsH3, CH3AsH2, and (CH3)2AsH in cultures of bacteria expressing arsM. The method detection limits for AsH3, CH3AsH2, (CH3)2AsH, and (CH3)3As were 0.5, 0.5, 0.7, and 0.6 pg, respectively. The ability to quantify trace levels of these volatile arsenic species makes it possible to study the biotransformation and biochemical roles of the evolution of these volatile arsenic species by biological systems.

  3. Transcriptome landscape of a bacterial pathogen under plant immunity.

    PubMed

    Nobori, Tatsuya; Velásquez, André C; Wu, Jingni; Kvitko, Brian H; Kremer, James M; Wang, Yiming; He, Sheng Yang; Tsuda, Kenichi

    2018-03-27

    Plant pathogens can cause serious diseases that impact global agriculture. The plant innate immunity, when fully activated, can halt pathogen growth in plants. Despite extensive studies into the molecular and genetic bases of plant immunity against pathogens, the influence of plant immunity in global pathogen metabolism to restrict pathogen growth is poorly understood. Here, we developed RNA sequencing pipelines for analyzing bacterial transcriptomes in planta and determined high-resolution transcriptome patterns of the foliar bacterial pathogen Pseudomonas syringae in Arabidopsis thaliana with a total of 27 combinations of plant immunity mutants and bacterial strains. Bacterial transcriptomes were analyzed at 6 h post infection to capture early effects of plant immunity on bacterial processes and to avoid secondary effects caused by different bacterial population densities in planta We identified specific "immune-responsive" bacterial genes and processes, including those that are activated in susceptible plants and suppressed by plant immune activation. Expression patterns of immune-responsive bacterial genes at the early time point were tightly linked to later bacterial growth levels in different host genotypes. Moreover, we found that a bacterial iron acquisition pathway is commonly suppressed by multiple plant immune-signaling pathways. Overexpression of a P. syringae sigma factor gene involved in iron regulation and other processes partially countered bacterial growth restriction during the plant immune response triggered by AvrRpt2. Collectively, this study defines the effects of plant immunity on the transcriptome of a bacterial pathogen and sheds light on the enigmatic mechanisms of bacterial growth inhibition during the plant immune response.

  4. Plasmids in Gram negatives: molecular typing of resistance plasmids.

    PubMed

    Carattoli, Alessandra

    2011-12-01

    A plasmid is defined as a double stranded, circular DNA molecule capable of autonomous replication. By definition, plasmids do not carry genes essential for the growth of host cells under non-stressed conditions but they have systems which guarantee their autonomous replication also controlling the copy number and ensuring stable inheritance during cell division. Most of the plasmids confer positively selectable phenotypes by the presence of antimicrobial resistance genes. Plasmids evolve as an integral part of the bacterial genome, providing resistance genes that can be easily exchanged among bacteria of different origin and source by conjugation. A multidisciplinary approach is currently applied to study the acquisition and spread of antimicrobial resistance in clinically relevant bacterial pathogens and the established surveillance can be implemented by replicon typing of plasmids. Particular plasmid families are more frequently detected among Enterobacteriaceae and play a major role in the diffusion of specific resistance genes. For instance, IncFII, IncA/C, IncL/M, IncN and IncI1 plasmids carrying extended-spectrum beta-lactamase genes and acquired AmpC genes are currently considered to be "epidemic resistance plasmids", being worldwide detected in Enterobacteriaceae of different origin and sources. The recognition of successful plasmids is an essential first step to design intervention strategies preventing their spread. Copyright © 2011 Elsevier GmbH. All rights reserved.

  5. Factors Driving Potential Ammonia Oxidation in Canadian Arctic Ecosystems: Does Spatial Scale Matter?

    PubMed Central

    Banerjee, Samiran

    2012-01-01

    Ammonia oxidation is a major process in nitrogen cycling, and it plays a key role in nitrogen limited soil ecosystems such as those in the arctic. Although mm-scale spatial dependency of ammonia oxidizers has been investigated, little is known about the field-scale spatial dependency of aerobic ammonia oxidation processes and ammonia-oxidizing archaeal and bacterial communities, particularly in arctic soils. The purpose of this study was to explore the drivers of ammonia oxidation at the field scale in cryosols (soils with permafrost within 1 m of the surface). We measured aerobic ammonia oxidation potential (both autotrophic and heterotrophic) and functional gene abundance (bacterial amoA and archaeal amoA) in 279 soil samples collected from three arctic ecosystems. The variability associated with quantifying genes was substantially less than the spatial variability observed in these soils, suggesting that molecular methods can be used reliably evaluate spatial dependency in arctic ecosystems. Ammonia-oxidizing archaeal and bacterial communities and aerobic ammonia oxidation were spatially autocorrelated. Gene abundances were spatially structured within 4 m, whereas biochemical processes were structured within 40 m. Ammonia oxidation was driven at small scales (<1m) by moisture and total organic carbon, whereas gene abundance and other edaphic factors drove ammonia oxidation at medium (1 to 10 m) and large (10 to 100 m) scales. In these arctic soils heterotrophs contributed between 29 and 47% of total ammonia oxidation potential. The spatial scale for aerobic ammonia oxidation genes differed from potential ammonia oxidation, suggesting that in arctic ecosystems edaphic, rather than genetic, factors are an important control on ammonia oxidation. PMID:22081570

  6. Diagnosis of Meningococcal Meningitis by Broad-Range Bacterial PCR with Cerebrospinal Fluid

    PubMed Central

    Kotilainen, Pirkko; Jalava, Jari; Meurman, Olli; Lehtonen, Olli-Pekka; Rintala, Esa; Seppälä, Olli-Pekka; Eerola, Erkki; Nikkari, Simo

    1998-01-01

    We used broad-range bacterial PCR combined with DNA sequencing to examine prospectively cerebrospinal fluid (CSF) samples from patients with suspected meningitis. Fifty-six CSF samples from 46 patients were studied during the year 1995. Genes coding for bacterial 16S and/or 23S rRNA genes could be amplified from the CSF samples from five patients with a clinical picture consistent with acute bacterial meningitis. For these patients, the sequenced PCR product shared 98.3 to 100% homology with the Neisseria meningitidis sequence. For one patient, the diagnosis was initially made by PCR alone. Of the remaining 51 CSF samples, for 50 (98.0%) samples the negative PCR findings were in accordance with the negative findings by bacterial culture and Gram staining, as well as with the eventual clinical diagnosis for the patient. However, the PCR test failed to detect the bacterial rRNA gene in one CSF sample, the culture of which yielded Listeria monocytogenes. These results invite new research efforts to be focused on the application of PCR with broad-range bacterial primers to improve the etiologic diagnosis of bacterial meningitis. In a clinical setting, Gram staining and bacterial culture still remain the cornerstones of diagnosis. PMID:9665992

  7. Encyclopedia of bacterial gene circuits whose presence or absence correlate with pathogenicity--a large-scale system analysis of decoded bacterial genomes.

    PubMed

    Shestov, Maksim; Ontañón, Santiago; Tozeren, Aydin

    2015-10-13

    Bacterial infections comprise a global health challenge as the incidences of antibiotic resistance increase. Pathogenic potential of bacteria has been shown to be context dependent, varying in response to environment and even within the strains of the same genus. We used the KEGG repository and extensive literature searches to identify among the 2527 bacterial genomes in the literature those implicated as pathogenic to the host, including those which show pathogenicity in a context dependent manner. Using data on the gene contents of these genomes, we identified sets of genes highly abundant in pathogenic but relatively absent in commensal strains and vice versa. In addition, we carried out genome comparison within a genus for the seventeen largest genera in our genome collection. We projected the resultant lists of ortholog genes onto KEGG bacterial pathways to identify clusters and circuits, which can be linked to either pathogenicity or synergy. Gene circuits relatively abundant in nonpathogenic bacteria often mediated biosynthesis of antibiotics. Other synergy-linked circuits reduced drug-induced toxicity. Pathogen-abundant gene circuits included modules in one-carbon folate, two-component system, type-3 secretion system, and peptidoglycan biosynthesis. Antibiotics-resistant bacterial strains possessed genes modulating phagocytosis, vesicle trafficking, cytoskeletal reorganization, and regulation of the inflammatory response. Our study also identified bacterial genera containing a circuit, elements of which were previously linked to Alzheimer's disease. Present study produces for the first time, a signature, in the form of a robust list of gene circuitry whose presence or absence could potentially define the pathogenicity of a microbiome. Extensive literature search substantiated a bulk majority of the commensal and pathogenic circuitry in our predicted list. Scanning microbiome libraries for these circuitry motifs will provide further insights into the complex and context dependent pathogenicity of bacteria.

  8. Population diversity of bacterial endophytes from jute (Corchorus olitorius) and evaluation of their potential role as bioinoculants.

    PubMed

    Haidar, Badrul; Ferdous, Mahbuba; Fatema, Babry; Ferdous, Ahlan Sabah; Islam, Mohammad Riazul; Khan, Haseena

    2018-03-01

    Endophytes are bacterial or fungal organisms associated with plants in an obligate or facultative manner. In order to maintain a stable symbiosis, many of the endophytes produce compounds that promote plant growth and help them adapt better to the environment. This study was conducted to explore the potential of jute bacterial endophytes for their growth promotion ability in direct and indirect ways. A total of 27 different bacterial species were identified from different varieties of a jute plant (Corchorus olitorius) and different parts of the plant (leaf, root, seed, and seedling) based on 16S rRNA gene sequence. Two of the isolates showed ACC deaminase activity with Staphylococcus pasteuri strain MBL_B3 and Ralstonia solanacearum strain MBL_B6 producing 18.1 and 8.08 μM mg -1  h -1 α-ketobutyrate respectively while eighteen had the ACC deaminase gene (acdS). Fourteen were positive for siderophore activity while Kocuria sp. strain MBL_B19 (133.36 μg/ml) and Bacillus sp. strain MBL_B17 (124.72 μg/ml) showed high IAA production ability. Seven bacterial strains were able to fix nitrogen with only one testing positive for nifH gene. Five isolates exhibited phosphorus utilization ability with Bacillus sp. strain MBL_B17 producing 218.47 μg P/ml. Three bacteria were able to inhibit the growth of a phytopathogen, Macrophomina phaseolina and among them Bacillus subtilis strain MBL_B4 was found to be the most effective, having 82% and 53% of relative inhibition ratio (RIR) and percent growth inhibition (PGI) values respectively. Nine bacteria were tested for their in vivo growth promotion ability and most of these isolates increased seed germination potential and vigour index significantly. Bacillus subtilis strain MBL_B13 showed 26.8% more vigour index than the control in which no bacterial inoculum was used. All inoculants were found to increase the dry weight of jute seedlings in comparison to the control plants and the most increase in fresh weight was found for Staphylococcus saprophyticus strain MBL_B9. Staphylococcus pasteuri strain MBL_B3 exhibited diverse in vitro growth promotion activity and significant growth promoting effect in in vivo pot experiments. These bacterial strains with plant growth enhancing abilities have the potential to be used as bioinoculants. Copyright © 2018 Elsevier GmbH. All rights reserved.

  9. The Functional Implications of Bottom Up and Top Down Controls on Marine Bacteria in Arthur Harbor, a Highly Productive Coastal Setting on the West Antarctic Peninsula

    NASA Astrophysics Data System (ADS)

    Bowman, J. S.; Amaral-Zettler, L. A.; Rich, J. J.; Luria, C.; Ducklow, H. W.

    2016-02-01

    Marine bacteria can be broadly classified into two groups based on their ecology; slow growing oligotrophic specialists and fast growing copiotrophs. These ecological strategies are associated with specific taxonomic and functional groups, making it possible to use 16S rRNA gene amplicon and shotgun metagenomic data to qualitatively, and possibly quantitatively, identify the contribution of each strategy to marine biogeochemical cycles. We leveraged a 5-year (2009 to 2014) time series of 16S rRNA gene amplicon data for Arthur Harbor, located near Palmer Station, Antarctica, to identify trends in the abundance of taxa associated with each ecological strategy. Using emergent self-organizing maps, we identified four recurring "modes" in bacterial community structure based on the relative abundance of the ubiquitous SAR11 clade. A different bacterial genus was dominant in each mode; Pelagibacter, Polaribacter, Roseobacter, and Colwellia. To explore the functional implications of these different modes we applied shotgun metagenomics and functional predictions using the newly available tool PAPRICA, in combination with flow cytometry and estimates of bacterial production. Our annotation and assembly of binned contigs corresponding to the dominant genera illuminate the succession of metabolic functions across the 2013-2014 austral summer and inform the timing of autotrophic and mixotrophic (putatively bacterivorous) phytoplankton blooms. Surprisingly, while the abundance of Pelagibacter 16S rRNA gene reads was negatively correlated with the concentration of chlorophyll a, the ratio of Pelagibacter to Polaribacter and Roseobacter was poorly correlated with the ratio of high nucleic acid (HNA) to low nucleic acid (LNA) bacteria as determined by flow cytometry, and the relative size of the HNA population at times contrasted sharply with chlorophyll a. These findings suggest that the physiological state of bacterial cells and top down controls play a strong role in HNA: LNA dynamics.

  10. Quantity and source of dietary protein influence metabolite production by gut microbiota and rectal mucosa gene expression: a randomized, parallel, double-blind trial in overweight humans.

    PubMed

    Beaumont, Martin; Portune, Kevin Joseph; Steuer, Nils; Lan, Annaïg; Cerrudo, Victor; Audebert, Marc; Dumont, Florent; Mancano, Giulia; Khodorova, Nadezda; Andriamihaja, Mireille; Airinei, Gheorghe; Tomé, Daniel; Benamouzig, Robert; Davila, Anne-Marie; Claus, Sandrine Paule; Sanz, Yolanda; Blachier, François

    2017-10-01

    Background: Although high-protein diets (HPDs) are frequently consumed for body-weight control, little is known about the consequences for gut microbiota composition and metabolic activity and for large intestine mucosal homeostasis. Moreover, the effects of HPDs according to the source of protein need to be considered in this context. Objective: The objective of this study was to evaluate the effects of the quantity and source of dietary protein on microbiota composition, bacterial metabolite production, and consequences for the large intestinal mucosa in humans. Design: A randomized, double-blind, parallel-design trial was conducted in 38 overweight individuals who received a 3-wk isocaloric supplementation with casein, soy protein, or maltodextrin as a control. Fecal and rectal biopsy-associated microbiota composition was analyzed by 16S ribosomal DNA sequencing. Fecal, urinary, and plasma metabolomes were assessed by 1 H-nuclear magnetic resonance. Mucosal transcriptome in rectal biopsies was determined with the use of microarrays. Results: HPDs did not alter the microbiota composition, but induced a shift in bacterial metabolism toward amino acid degradation with different metabolite profiles according to the protein source. Correlation analysis identified new potential bacterial taxa involved in amino acid degradation. Fecal water cytotoxicity was not modified by HPDs, but was associated with a specific microbiota and bacterial metabolite profile. Casein and soy protein HPDs did not induce inflammation, but differentially modified the expression of genes playing key roles in homeostatic processes in rectal mucosa, such as cell cycle or cell death. Conclusions: This human intervention study shows that the quantity and source of dietary proteins act as regulators of gut microbiota metabolite production and host gene expression in the rectal mucosa, raising new questions on the impact of HPDs on the large intestine mucosa homeostasis. This trial was registered at clinicaltrials.gov as NCT02351297. © 2017 American Society for Nutrition.

  11. INFLUENCE OF ROOT EXUDATES AND BACTERIAL METABOLIC ACTIVITY ON APPARENT CONJUGAL GENE TRANSFER FREQUENCIES IN THE RHIZOSPHERE OF WATER GRASS (ECHINOCLORA CRUSGALLI)

    EPA Science Inventory

    The premise that genetic exchange is primarily localized in niches characterized by dense bacterial populations and high availability of growth substrates was tested by relating conjugal gene transfer of an RP4 derivative to availability of root exudates and bacterial metabolic a...

  12. Colonic bacterial composition in Parkinson's disease.

    PubMed

    Keshavarzian, Ali; Green, Stefan J; Engen, Phillip A; Voigt, Robin M; Naqib, Ankur; Forsyth, Christopher B; Mutlu, Ece; Shannon, Kathleen M

    2015-09-01

    We showed that Parkinson's disease (PD) patients have alpha-synuclein (α-Syn) aggregation in their colon with evidence of colonic inflammation. If PD patients have altered colonic microbiota, dysbiosis might be the mechanism of neuroinflammation that leads to α-Syn misfolding and PD pathology. Sixty-six sigmoid mucosal biopsies and 65 fecal samples were collected from 38 PD patients and 34 healthy controls. Mucosal-associated and feces microbiota compositions were characterized using high-throughput ribosomal RNA gene amplicon sequencing. Data were correlated with clinical measures of PD, and a predictive assessment of microbial community functional potential was used to identify microbial functions. The mucosal and fecal microbial community of PD patients was significantly different than control subjects, with the fecal samples showing more marked differences than the sigmoid mucosa. At the taxonomic level of genus, putative, "anti-inflammatory" butyrate-producing bacteria from the genera Blautia, Coprococcus, and Roseburia were significantly more abundant in feces of controls than PD patients. Bacteria from the genus Faecalibacterium were significantly more abundant in the mucosa of controls than PD. Putative, "proinflammatory" Proteobacteria of the genus Ralstonia were significantly more abundant in mucosa of PD than controls. Predictive metagenomics indicated that a large number of genes involved in metabolism were significantly lower in the PD fecal microbiome, whereas genes involved in lipopolysaccharide biosynthesis and type III bacterial secretion systems were significantly higher in PD patients. This report provides evidence that proinflammatory dysbiosis is present in PD patients and could trigger inflammation-induced misfolding of α-Syn and development of PD pathology. © 2015 International Parkinson and Movement Disorder Society.

  13. A novel plant ferredoxin-like protein and the regulator Hor are quorum-sensing targets in the plant pathogen Erwinia carotovora.

    PubMed

    Sjöblom, Solveig; Harjunpää, Heidi; Brader, Günter; Palva, E Tapio

    2008-07-01

    Quorum sensing (QS), a population-density-sensing mechanism, controls the production of the main virulence determinants, the plant cell-wall-degrading enzymes (PCWDEs) of the soft-rot phytopathogen Erwinia carotovora subsp. carotovora. In this study, we used random transposon mutagenesis with a gusA reporter construct to identify two new QS-controlled genes encoding the regulator Hor and a plant ferredoxin-like protein, FerE. The QS control of the identified genes was executed by the QS regulators ExpR1 and ExpR2 and mediated by the global repressor RsmA. Hor was shown to contribute to bacterial virulence at least partly through its control of PCWDE production. Our results showed that FerE contributes to oxidative stress tolerance and in planta fitness of the bacteria and suggest that QS could be central to control of oxidative stress tolerance. The presence of the FerE protein appears to be rather unique in heterotrophic bacteria and suggests an acquisition of the corresponding gene from plant host by horizontal gene transfer.

  14. Filamentous phages of Ralstonia solanacearum: double-edged swords for pathogenic bacteria.

    PubMed

    Yamada, Takashi

    2013-01-01

    Some phages from genus Inovirus use host or bacteriophage-encoded site-specific integrases or recombinases establish a prophage state. During integration or excision, a superinfective form can be produced. The three states (free, prophage, and superinfective) of such phages exert different effects on host bacterial phenotypes. In Ralstonia solanacearum, the causative agent of bacterial wilt disease of crops, the bacterial virulence can be positively or negatively affected by filamentous phages, depending on their state. The presence or absence of a repressor gene in the phage genome may be responsible for the host phenotypic differences (virulent or avirulent) caused by phage infection. This strategy of virulence control may be widespread among filamentous phages that infect pathogenic bacteria of plants.

  15. Inheritance of bacterial spot resistance in Capsicum annuum var. annuum.

    PubMed

    Silva, L R A; Rodrigues, R; Pimenta, S; Correa, J W S; Araújo, M S B; Bento, C S; Sudré, C P

    2017-04-20

    Since 2008, Brazil is the largest consumer of agrochemicals, which increases production costs and risks of agricultural products, environment, and farmers' contamination. Sweet pepper, which is one of the main consumed vegetables in the country, is on top of the list of the most sprayed crops. The bacterial spot, caused by Xanthomonas spp, is one of the most damaging diseases of pepper crops. Genetic resistant consists of a suitable way of disease control, but development of durable resistant cultivars as well as understanding of plant-bacterium interaction is being a challenge for plant breeders and pathologists worldwide. Inheritance of disease resistance is often variable, depending on genetic background of the parents. The knowledge of the genetic base controlling such resistance is the first step in a breeding program aiming to develop new genotypes, bringing together resistance and other superior agronomic traits. This study reports the genetic basis of bacterial spot resistance in Capsicum annuum var. annuum using mean generation analysis from crosses between accessions UENF 2285 (susceptible) and UENF 1381 (resistant). The plants of each generation were grown in a greenhouse and leaflets were inoculated with bacterial strain ENA 4135 at 10 5 CFU/mL in 1.0 cm 2 of the mesophyll. Evaluations were performed using a scoring scale whose grades ranged from 1.0 (resistant) to 5.0 (susceptible), depending on symptom manifestation. Genetic control of bacterial spot has a quantitative aspect, with higher additive effect. The quantitative analysis showed that five genes were the minimum number controlling bacterial spot resistance. Additive effect was higher (6.06) than dominant (3.31) and explained 86.36% of total variation.

  16. Atomic resolution mechanistic studies of ribocil: A highly selective unnatural ligand mimic of the E. coli FMN riboswitch

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Howe, John A.; Xiao, Li; Fischmann, Thierry O.

    2016-08-02

    Bacterial riboswitches are non-coding RNA structural elements that direct gene expression in numerous metabolic pathways. The key regulatory roles of riboswitches, and the urgent need for new classes of antibiotics to treat multi-drug resistant bacteria, has led to efforts to develop small-molecules that mimic natural riboswitch ligands to inhibit metabolic pathways and bacterial growth. Recently, we reported the results of a phenotypic screen targeting the riboflavin biosynthesis pathway in the Gram-negative bacteria Escherichia coli that led to the identification of ribocil, a small molecule inhibitor of the flavin mononucleotide (FMN) riboswitch controlling expression of this biosynthetic pathway. Although ribocil ismore » structurally distinct from FMN, ribocil functions as a potent and highly selective synthetic mimic of the natural ligand to repress riboswitch-mediated ribB gene expression and inhibit bacterial growth both in vitro and in vivo. Herein, we expand our analysis of ribocil; including mode of binding in the FMN binding pocket of the riboswitch, mechanisms of resistance and structure-activity relationship guided efforts to generate more potent analogs.« less

  17. 16S rRNA Gene-Based Metagenomic Analysis of Ozark Cave Bacteria.

    PubMed

    Oliveira, Cássia; Gunderman, Lauren; Coles, Cathryn A; Lochmann, Jason; Parks, Megan; Ballard, Ethan; Glazko, Galina; Rahmatallah, Yasir; Tackett, Alan J; Thomas, David J

    2017-09-01

    The microbial diversity within cave ecosystems is largely unknown. Ozark caves maintain a year-round stable temperature (12-14 °C), but most parts of the caves experience complete darkness. The lack of sunlight and geological isolation from surface-energy inputs generate nutrient-poor conditions that may limit species diversity in such environments. Although microorganisms play a crucial role in sustaining life on Earth and impacting human health, little is known about their diversity, ecology, and evolution in community structures. We used five Ozark region caves as test sites for exploring bacterial diversity and monitoring long-term biodiversity. Illumina MiSeq sequencing of five cave soil samples and a control sample revealed a total of 49 bacterial phyla, with seven major phyla: Proteobacteria, Acidobacteria, Actinobacteria, Firmicutes, Chloroflexi, Bacteroidetes, and Nitrospirae. Variation in bacterial composition was observed among the five caves studied. Sandtown Cave had the lowest richness and most divergent community composition. 16S rRNA gene-based metagenomic analysis of cave-dwelling microbial communities in the Ozark caves revealed that species abundance and diversity are vast and included ecologically, agriculturally, and economically relevant taxa.

  18. The α-Glucan Phosphorylase MalP of Corynebacterium glutamicum Is Subject to Transcriptional Regulation and Competitive Inhibition by ADP-Glucose

    PubMed Central

    Clermont, Lina; Macha, Arthur; Müller, Laura M.; Derya, Sami M.; von Zaluskowski, Philipp; Eck, Alexander; Eikmanns, Bernhard J.

    2015-01-01

    ABSTRACT α-Glucan phosphorylases contribute to degradation of glycogen and maltodextrins formed in the course of maltose metabolism in bacteria. Accordingly, bacterial α-glucan phosphorylases are classified as either glycogen or maltodextrin phosphorylase, GlgP or MalP, respectively. GlgP and MalP enzymes follow the same catalytic mechanism, and thus their substrate spectra overlap; however, they differ in their regulation: GlgP genes are constitutively expressed and the enzymes are controlled on the activity level, whereas expression of MalP genes are transcriptionally controlled in response to the carbon source used for cultivation. We characterize here the modes of control of the α-glucan phosphorylase MalP of the Gram-positive Corynebacterium glutamicum. In accordance to the proposed function of the malP gene product as MalP, we found transcription of malP to be regulated in response to the carbon source. Moreover, malP transcription is shown to depend on the growth phase and to occur independently of the cell glycogen content. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. Since the latter is considered a typical feature of GlgPs, we propose that C. glutamicum MalP acts as both maltodextrin and glycogen phosphorylase and, based on these findings, we question the current system for classification of bacterial α-glucan phosphorylases. IMPORTANCE Bacterial α-glucan phosphorylases have been classified conferring to their purpose as either glycogen or maltodextrin phosphorylases. We found transcription of malP in C. glutamicum to be regulated in response to the carbon source, which is recognized as typical for maltodextrin phosphorylases. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. The latter is considered a typical feature of GlgPs. These findings, taken together, suggest that C. glutamicum MalP is the first α-glucan phosphorylase that does not fit into the current system for classification of bacterial α-glucan phosphorylases and exemplifies the complex mechanisms underlying the control of glycogen content and maltose metabolism in this model organism. PMID:25666133

  19. Drivers of bacterial genomes plasticity and roles they play in pathogen virulence, persistence and drug resistance.

    PubMed

    Patel, Seema

    2016-11-01

    Despite the advent of next-generation sequencing (NGS) technologies, sophisticated data analysis and drug development efforts, bacterial drug resistance persists and is escalating in magnitude. To better control the pathogens, a thorough understanding of their genomic architecture and dynamics is vital. Bacterial genome is extremely complex, a mosaic of numerous co-operating and antagonizing components, altruistic and self-interested entities, behavior of which are predictable and conserved to some extent, yet largely dictated by an array of variables. In this regard, mobile genetic elements (MGE), DNA repair systems, post-segregation killing systems, toxin-antitoxin (TA) systems, restriction-modification (RM) systems etc. are dominant agents and horizontal gene transfer (HGT), gene redundancy, epigenetics, phase and antigenic variation etc. processes shape the genome. By illegitimate recombinations, deletions, insertions, duplications, amplifications, inversions, conversions, translocations, modification of intergenic regions and other alterations, bacterial genome is modified to tackle stressors like drugs, and host immune effectors. Over the years, thousands of studies have investigated this aspect and mammoth amount of insights have been accumulated. This review strives to distillate the existing information, formulate hypotheses and to suggest directions, that might contribute towards improved mitigation of the vicious pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Getting to PTI of bacterial RNAs: Triggering plant innate immunity by extracellular RNAs from bacteria.

    PubMed

    Park, Yong-Soon; Lee, Boyoung; Ryu, Choong-Min

    2016-07-02

    Defense against diverse biotic and abiotic stresses requires the plant to distinguish between self and non-self signaling molecules. Pathogen/microbe-associated molecular patterns (PAMPs/MAMPs) are pivotal for triggering innate immunity in plants. Unlike in animals and humans, the precise roles of nucleic acids in plant innate immunity are unclear. We therefore investigated the effects of infiltration of total Pseudomonas syringae pv. tomato DC3000 (Pto DC3000) RNAs into Arabidopsis plants. The pathogen population was 10-fold lower in bacterial RNAs pre-treated Arabidopsis plants than in the control. Bacterial RNAs purity was confirmed by physical (sonication) and chemical (RNase A and proteinase K digestion) methods. The perception of bacterial RNAs, especially rRNAs, positively regulated mitogen-activated protein kinase (MAPK) and induced a reactive oxygen species burst, callose deposition, salicylic acid (SA) and jasmonic acid (JA) signaling, and defense-related genes. Therefore, bacterial RNAs function as a new MAMP that activates plant innate immunity, providing a new paradigm for plant-microbe interactions.

  1. Interference in Bacterial Quorum Sensing: A Biopharmaceutical Perspective

    PubMed Central

    Rémy, Benjamin; Mion, Sonia; Plener, Laure; Elias, Mikael; Chabrière, Eric; Daudé, David

    2018-01-01

    Numerous bacteria utilize molecular communication systems referred to as quorum sensing (QS) to synchronize the expression of certain genes regulating, among other aspects, the expression of virulence factors and the synthesis of biofilm. To achieve this process, bacteria use signaling molecules, known as autoinducers (AIs), as chemical messengers to share information. Naturally occurring strategies that interfere with bacterial signaling have been extensively studied in recent years, examining their potential to control bacteria. To interfere with QS, bacteria use quorum sensing inhibitors (QSIs) to block the action of AIs and quorum quenching (QQ) enzymes to degrade signaling molecules. Recent studies have shown that these strategies are promising routes to decrease bacterial pathogenicity and decrease biofilms, potentially enhancing bacterial susceptibility to antimicrobial agents including antibiotics and bacteriophages. The efficacy of QSIs and QQ enzymes has been demonstrated in various animal models and are now considered in the development of new medical devices against bacterial infections, including dressings, and catheters for enlarging the therapeutic arsenal against bacteria. PMID:29563876

  2. Dissociation of Innate Immune Responses in Microglia Infected with Listeria monocytogenes

    PubMed Central

    Frande-Cabanes, Elisabet; Fernandez-Prieto, Lorena; Calderon-Gonzalez, Ricardo; Rodríguez-Del Río, Estela; Yañez-Diaz, Sonsoles; López-Fanarraga, Monica; Alvarez-Domínguez, Carmen

    2014-01-01

    Microglia, the innate immune cells of the brain, plays a central role in cerebral listeriosis. Here, we present evidence that microglia control Listeria infection differently than macrophages. Infection of primary microglial cultures and murine cell lines with Listeria resulted in a dual function of the two gene expression programmes involved in early and late immune responses in macrophages. Whereas the bacterial gene hly seems responsible for both transcriptional programmes in macrophages, Listeria induces in microglia only the tumor necrosis factor (TNF)-regulated transcriptional programme. Listeria also represses in microglia the late immune response gathered in two clusters, microbial degradation, and interferon (IFN)-inducible genes. The bacterial gene actA was required in microglia to induce TNF-regulated responses and to repress the late response. Isolation of microglial phagosomes revealed a phagosomal environment unable to destroy Listeria. Microglial phagosomes were also defective in several signaling and trafficking components reported as relevant for Listeria innate immune responses. This transcriptional strategy in microglia induced high levels of TNF-α and monocyte chemotactic protein-1 and low production of other neurotoxic compounds such as nitric oxide, hydrogen peroxide, and Type I IFNs. These cytokines and toxic microglial products are also released by primary microglia, and this cytokine and chemokine cocktail display a low potential to trigger neuronal apoptosis. This overall bacterial strategy strongly suggests that microglia limit Listeria inflammation pattern exclusively through TNF-mediated responses to preserve brain integrity. GLIA 2014;62:233–246 PMID:24311463

  3. Presence of Bacteria in Spontaneous Achilles Tendon Ruptures.

    PubMed

    Rolf, Christer G; Fu, Sai-Chuen; Hopkins, Chelsea; Luan, Ju; Ip, Margaret; Yung, Shu-Hang; Friman, Göran; Qin, Ling; Chan, Kai-Ming

    2017-07-01

    The structural pathology of Achilles tendon (AT) ruptures resembles tendinopathy, but the causes remain unknown. Recently, a number of diseases were found to be attributed to bacterial infections, resulting in low-grade inflammation and progressive matrix disturbance. The authors speculate that spontaneous AT ruptures may also be influenced by the presence of bacteria. Bacteria are present in ruptured ATs but not in healthy tendons. Cross-sectional study; Level of evidence, 3. Patients with spontaneous AT ruptures and patients undergoing anterior cruciate ligament (ACL) reconstruction were recruited for this study. During AT surgical repair, excised tendinopathic tissue was collected, and healthy tendon samples were obtained as controls from hamstring tendon grafts used in ACL reconstruction. Half of every sample was reserved for DNA extraction and the other half for histology. Polymerase chain reaction (PCR) was conducted using 16S rRNA gene universal primers, and the PCR products were sequenced for the identification of bacterial species. A histological examination was performed to compare tendinopathic changes in the case and control samples. Five of 20 AT rupture samples were positive for the presence of bacterial DNA, while none of the 23 hamstring tendon samples were positive. Sterile operating and experimental conditions and tests on samples, controlling for harvesting and processing procedures, ruled out the chance of postoperative bacterial contamination. The species identified predominantly belonged to the Staphylococcus genus. AT rupture samples exhibited histopathological features characteristic of tendinopathy, and most healthy hamstring tendon samples displayed normal tendon features. There were no apparent differences in histopathology between the bacterial DNA-positive and bacterial DNA-negative AT rupture samples. The authors have demonstrated the presence of bacterial DNA in ruptured AT samples. It may suggest the potential involvement of bacteria in spontaneous AT ruptures.

  4. Selected Lactic Acid-Producing Bacterial Isolates with the Capacity to Reduce Salmonella Translocation and Virulence Gene Expression in Chickens

    PubMed Central

    Yang, Xiaojian; Brisbin, Jennifer; Yu, Hai; Wang, Qi; Yin, Fugui; Zhang, Yonggang; Sabour, Parviz; Sharif, Shayan; Gong, Joshua

    2014-01-01

    Background Probiotics have been used to control Salmonella colonization/infection in chickens. Yet the mechanisms of probiotic effects are not fully understood. This study has characterized our previously-selected lactic acid-producing bacterial (LAB) isolates for controlling Salmonella infection in chickens, particularly the mechanism underlying the control. Methodology/Principal Findings In vitro studies were conducted to characterize 14 LAB isolates for their tolerance to low pH (2.0) and high bile salt (0.3–1.5%) and susceptibility to antibiotics. Three chicken infection trials were subsequently carried out to evaluate four of the isolates for reducing the burden of Salmonella enterica serovar Typhimurium in the broiler cecum. Chicks were gavaged with LAB cultures (106–7 CFU/chick) or phosphate-buffered saline (PBS) at 1 day of age followed by Salmonella challenge (104 CFU/chick) next day. Samples of cecal digesta, spleen, and liver were examined for Salmonella counts on days 1, 3, or 4 post-challenge. Salmonella in the cecum from Trial 3 was also assessed for the expression of ten virulence genes located in its pathogenicity island-1 (SPI-1). These genes play a role in Salmonella intestinal invasion. Tested LAB isolates (individuals or mixed cultures) were unable to lower Salmonella burden in the chicken cecum, but able to attenuate Salmonella infection in the spleen and liver. The LAB treatments also reduced almost all SPI-1 virulence gene expression (9 out of 10) in the chicken cecum, particularly at the low dose. In vitro treatment with the extracellular culture fluid from a LAB culture also down-regulated most SPI-1 virulence gene expression. Conclusions/Significance The possible correlation between attenuation of Salmonella infection in the chicken spleen and liver and reduction of Salmonella SPI-1 virulence gene expression in the chicken cecum by LAB isolates is a new observation. Suppression of Salmonella virulence gene expression in vivo can be one of the strategies for controlling Salmonella infection in chickens. PMID:24728092

  5. Distinct Bacterial Communities in Surficial Seafloor Sediments Following the 2010 Deepwater Horizon Blowout.

    PubMed

    Yang, Tingting; Speare, Kelly; McKay, Luke; MacGregor, Barbara J; Joye, Samantha B; Teske, Andreas

    2016-01-01

    A major fraction of the petroleum hydrocarbons discharged during the 2010 Macondo oil spill became associated with and sank to the seafloor as marine snow flocs. This sedimentation pulse induced the development of distinct bacterial communities. Between May 2010 and July 2011, full-length 16S rRNA gene clone libraries demonstrated bacterial community succession in oil-polluted sediment samples near the wellhead area. Libraries from early May 2010, before the sedimentation event, served as the baseline control. Freshly deposited oil-derived marine snow was collected on the surface of sediment cores in September 2010, and was characterized by abundantly detected members of the marine Roseobacter cluster within the Alphaproteobacteria. Samples collected in mid-October 2010 closest to the wellhead contained members of the sulfate-reducing, anaerobic bacterial families Desulfobacteraceae and Desulfobulbaceae within the Deltaproteobacteria, suggesting that the oil-derived sedimentation pulse triggered bacterial oxygen consumption and created patchy anaerobic microniches that favored sulfate-reducing bacteria. Phylotypes of the polycyclic aromatic hydrocarbon-degrading genus Cycloclasticus, previously found both in surface oil slicks and the deep hydrocarbon plume, were also found in oil-derived marine snow flocs sedimenting on the seafloor in September 2010, and in surficial sediments collected in October and November 2010, but not in any of the control samples. Due to the relative recalcitrance and stability of polycyclic aromatic compounds, Cycloclasticus represents the most persistent microbial marker of seafloor hydrocarbon deposition that we could identify in this dataset. The bacterial imprint of the DWH oil spill had diminished in late November 2010, when the bacterial communities in oil-impacted sediment samples collected near the Macondo wellhead began to resemble their pre-spill counterparts and spatial controls. Samples collected in summer of 2011 did not show a consistent bacterial community signature, suggesting that the bacterial community was no longer shaped by the DWH fallout of oil-derived marine snow, but instead by location-specific and seasonal factors.

  6. Distinct Bacterial Communities in Surficial Seafloor Sediments Following the 2010 Deepwater Horizon Blowout

    PubMed Central

    Yang, Tingting; Speare, Kelly; McKay, Luke; MacGregor, Barbara J.; Joye, Samantha B.; Teske, Andreas

    2016-01-01

    A major fraction of the petroleum hydrocarbons discharged during the 2010 Macondo oil spill became associated with and sank to the seafloor as marine snow flocs. This sedimentation pulse induced the development of distinct bacterial communities. Between May 2010 and July 2011, full-length 16S rRNA gene clone libraries demonstrated bacterial community succession in oil-polluted sediment samples near the wellhead area. Libraries from early May 2010, before the sedimentation event, served as the baseline control. Freshly deposited oil-derived marine snow was collected on the surface of sediment cores in September 2010, and was characterized by abundantly detected members of the marine Roseobacter cluster within the Alphaproteobacteria. Samples collected in mid-October 2010 closest to the wellhead contained members of the sulfate-reducing, anaerobic bacterial families Desulfobacteraceae and Desulfobulbaceae within the Deltaproteobacteria, suggesting that the oil-derived sedimentation pulse triggered bacterial oxygen consumption and created patchy anaerobic microniches that favored sulfate-reducing bacteria. Phylotypes of the polycyclic aromatic hydrocarbon-degrading genus Cycloclasticus, previously found both in surface oil slicks and the deep hydrocarbon plume, were also found in oil-derived marine snow flocs sedimenting on the seafloor in September 2010, and in surficial sediments collected in October and November 2010, but not in any of the control samples. Due to the relative recalcitrance and stability of polycyclic aromatic compounds, Cycloclasticus represents the most persistent microbial marker of seafloor hydrocarbon deposition that we could identify in this dataset. The bacterial imprint of the DWH oil spill had diminished in late November 2010, when the bacterial communities in oil-impacted sediment samples collected near the Macondo wellhead began to resemble their pre-spill counterparts and spatial controls. Samples collected in summer of 2011 did not show a consistent bacterial community signature, suggesting that the bacterial community was no longer shaped by the DWH fallout of oil-derived marine snow, but instead by location-specific and seasonal factors. PMID:27679609

  7. Plasmid-mediated resistance to protein biosynthesis inhibitors in staphylococci.

    PubMed

    Schwarz, Stefan; Fessler, Andrea T; Hauschild, Tomasz; Kehrenberg, Corinna; Kadlec, Kristina

    2011-12-01

    Protein biosynthesis inhibitors (PBIs) represent powerful antimicrobial agents for the control of bacterial infections. In staphylococci, numerous resistance genes are known to be involved in resistance to PBIs, most of which mediate resistance to a specific class/subclass of PBIs, though a few genes do confer a multidrug resistance phenotype-up to five classes/subclasses of PBIs. Plasmids play a key role in the dissemination of PBI resistance among staphylococci, as they primarily carry plasmid-borne PBI resistance genes; however, plasmids also can be vectors for transposon-borne PBI resistance genes. Small plasmids that carry single PBI resistance genes are widespread among staphylococci of human and animal origin. Various mechanisms exist by which they can recombine, form cointegrates, or integrate into chromosomal DNA or larger plasmids. We provide an overview of the current knowledge of plasmid-mediated PBI resistance in staphylococci, with particular reference to the currently known PBI resistance genes, their association with mobile genetic elements, and the recombination/integration processes that control their mobility. © 2011 New York Academy of Sciences.

  8. Regulated bioluminescence as a tool for bioremediation process monitoring and control of bacterial cultures

    NASA Technical Reports Server (NTRS)

    Burlage, Robert S.; Heitzer, Armin; Digrazia, Philip M.

    1991-01-01

    An effective on-line monitoring technique for toxic waste bioremediation using bioluminescent microorganisms has shown great potential for the description and optimization of biological processes. The lux genes of the bacterium Vibrio fischeri are used by this species to produce visible light. The lux genes can be genetically fused to the control region of a catabolic gene, with the result that bioluminescence is produced whenever the catabolic gene is induced. Thus the detection of light from a sample indicates that genetic expression from a specific gene is occurring. This technique was used to monitor biodegradation of specific contaminants from waste sites. For these studies, fusions between the lux genes and the operons for naphthalene and toluene/xylene degradation were constructed. Strains carrying one of these fusions respond sensitively and specifically to target substrates. Bioluminescence from these cultures can be rapidly measured in a nondestructive and noninvasive manner. The potential for this technique in this and other biological systems is discussed.

  9. Interplay between the gut microbiota and immune responses of ayu (Plecoglossus altivelis) during Vibrio anguillarum infection.

    PubMed

    Nie, Li; Zhou, Qian-Jin; Qiao, Yan; Chen, Jiong

    2017-09-01

    Gut microbiota plays fundamental roles in protection against pathogen invasion. However, the mechanism and extent of responses of gut microbiota to pathogenic infection are poorly understood. This study investigated the gut bacterial communities and immune responses of ayu (Plecoglossus altivelis) upon exposure to Vibrio anguillarum. The succession of V. anguillarum infection was evidenced by increased expression of immune genes and bacterial loads in ayu tissues, which in turn altered the composition and predicted functions of gut bacterial community. The dynamics of gut bacterial diversity and evenness were temporally stable in control ayu but were reduced in infected subjects, particularly at the late stages of infection. Variations in the gut microbiota were significantly associated with the expression levels of TNF-α (P = 0.019) and IL-1 β (P = 0.013). The profiles of certain gut bacterial taxa were indicative of V. anguillarum infection. Compared with healthy controls, the ayu infected with V. anguillarum possessed less complex, fewer connected, and lower cooperative gut bacterial interspecies interaction, coinciding with significant shifts in keystone species. These findings imply that V. anguillarum infection substantially disrupted the compositions and interspecies interaction of ayu gut bacterial community, thereby altering gut microbial-mediated functions and inducing host immune responses. This study provides an integrated overview on the interaction between the gut microbiota and host immune responses to pathogen infection from an ecological perspective. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

    PubMed Central

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2011-01-01

    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

  11. Transcriptome analysis of grey mullet (Mugil cephalus) after challenge with Lactococcus garvieae.

    PubMed

    Byadgi, Omkar; Chen, Yao-Chung; Barnes, Andrew C; Tsai, Ming-An; Wang, Pei-Chyi; Chen, Shih-Chu

    2016-11-01

    Grey mullet (Mugil cephalus) is an economically important fish species in Taiwan mariculture industry. Moreover, grey mullet are common hosts of a bacterial infection by Lactococcus garvieae. However, until now the information related to the immune system of grey mullet is unclear. Therefore, to understand the molecular basis underlying the host immune response to L. garvieae infection, Illumina HiSeq™ 2000 was used to analyse the head kidney and spleen transcriptome of infected grey mullet. De novo assembly of paired-end reads yielded 55,203 unigenes. Comparative analysis of the expression profiles between bacterial challenge fish and control fish identified a total of 7192 from head kidney and 7280 in spleen differentially expressed genes (P < 0.05), including 4211 upregulated genes and 2981 downregulated genes in head kidney, while in spleen 3598 genes were upregulated and 3682 downregulated. A significant enrichment analysis of these differentially expressed genes (DEG) in spleen and head kidney revealed major immune-related pathways, including complement and coagulation cascades, Toll-like receptor signalling, and antigen processing and presentation. Moreover, selected DEGs were validated using qPCR. Altogether, the results obtained on immune-related genes may allow for a better understanding of immunity in grey mullet to Lactococcus garvieae, carrying out detailed functional analysis of these genes and developing strategies for efficient immune protection against infections in grey mullet. Crown Copyright © 2016. Published by Elsevier Ltd. All rights reserved.

  12. Safe genetically engineered plants

    NASA Astrophysics Data System (ADS)

    Rosellini, D.; Veronesi, F.

    2007-10-01

    The application of genetic engineering to plants has provided genetically modified plants (GMPs, or transgenic plants) that are cultivated worldwide on increasing areas. The most widespread GMPs are herbicide-resistant soybean and canola and insect-resistant corn and cotton. New GMPs that produce vaccines, pharmaceutical or industrial proteins, and fortified food are approaching the market. The techniques employed to introduce foreign genes into plants allow a quite good degree of predictability of the results, and their genome is minimally modified. However, some aspects of GMPs have raised concern: (a) control of the insertion site of the introduced DNA sequences into the plant genome and of its mutagenic effect; (b) presence of selectable marker genes conferring resistance to an antibiotic or an herbicide, linked to the useful gene; (c) insertion of undesired bacterial plasmid sequences; and (d) gene flow from transgenic plants to non-transgenic crops or wild plants. In response to public concerns, genetic engineering techniques are continuously being improved. Techniques to direct foreign gene integration into chosen genomic sites, to avoid the use of selectable genes or to remove them from the cultivated plants, to reduce the transfer of undesired bacterial sequences, and make use of alternative, safer selectable genes, are all fields of active research. In our laboratory, some of these new techniques are applied to alfalfa, an important forage plant. These emerging methods for plant genetic engineering are briefly reviewed in this work.

  13. A Mutator Phenotype Promoting the Emergence of Spontaneous Oxidative Stress-Resistant Mutants in Campylobacter jejuni.

    PubMed

    Dai, Lei; Sahin, Orhan; Tang, Yizhi; Zhang, Qijing

    2017-12-15

    Campylobacter jejuni is a leading cause of foodborne illnesses worldwide. As a microaerophilic organism, C. jejuni must be able to defend against oxidative stress encountered both in the host and in the environment. How Campylobacter utilizes a mutation-based mechanism for adaptation to oxidative stress is still unknown. Here we present a previously undescribed phenotypic and genetic mechanism that promotes the emergence of oxidative stress-resistant mutants. Specifically, we showed that a naturally occurring mutator phenotype, resulting from a loss of function mutation in the DNA repair enzyme MutY, increased oxidative stress resistance (OX R ) in C. jejuni We further demonstrated that MutY malfunction did not directly contribute to the OX R phenotype but increased the spontaneous mutation rate in the peroxide regulator gene perR , which functions as a repressor for multiple genes involved in oxidative stress resistance. Mutations in PerR resulted in loss of its DNA binding function and derepression of PerR-controlled oxidative stress defense genes, thereby conferring an OX R phenotype and facilitating Campylobacter survival under oxidative stress. These findings reveal a new mechanism that promotes the emergence of spontaneous OX R mutants in bacterial organisms. IMPORTANCE Although a mutator phenotype has been shown to promote antibiotic resistance in many bacterial species, little is known about its contribution to the emergence of OX R mutants. This work describes the link between a mutator phenotype and the enhanced emergence of OX R mutants as well as its underlying mechanism involving DNA repair and mutations in PerR. Since DNA repair systems and PerR are well conserved in many bacterial species, especially in Gram positives, the same mechanism may operate in multiple bacterial species. Additionally, we developed a novel method that allows for rapid quantification of spontaneous OX R mutants in a bacterial population. This method represents a technical innovation and may also be applied to other bacterial species. These findings significantly advance our understanding of bacterial mechanisms for survival under oxidative stress. Copyright © 2017 American Society for Microbiology.

  14. Manipulating the banana rhizosphere microbiome for biological control of Panama disease.

    PubMed

    Xue, Chao; Penton, C Ryan; Shen, Zongzhuan; Zhang, Ruifu; Huang, Qiwei; Li, Rong; Ruan, Yunze; Shen, Qirong

    2015-08-05

    Panama disease caused by Fusarium oxysporum f. sp. cubense infection on banana is devastating banana plantations worldwide. Biological control has been proposed to suppress Panama disease, though the stability and survival of bio-control microorganisms in field setting is largely unknown. In order to develop a bio-control strategy for this disease, 16S rRNA gene sequencing was used to assess the microbial community of a disease-suppressive soil. Bacillus was identified as the dominant bacterial group in the suppressive soil. For this reason, B. amyloliquefaciens NJN-6 isolated from the suppressive soil was selected as a potential bio-control agent. A bioorganic fertilizer (BIO), formulated by combining this isolate with compost, was applied in nursery pots to assess the bio-control of Panama disease. Results showed that BIO significantly decreased disease incidence by 68.5%, resulting in a doubled yield. Moreover, bacterial community structure was significantly correlated to disease incidence and yield and Bacillus colonization was negatively correlated with pathogen abundance and disease incidence, but positively correlated to yield. In total, the application of BIO altered the rhizo-bacterial community by establishing beneficial strains that dominated the microbial community and decreased pathogen colonization in the banana rhizosphere, which plays an important role in the management of Panama disease.

  15. Manipulating the banana rhizosphere microbiome for biological control of Panama disease

    PubMed Central

    Xue, Chao; Ryan Penton, C.; Shen, Zongzhuan; Zhang, Ruifu; Huang, Qiwei; Li, Rong; Ruan, Yunze; Shen, Qirong

    2015-01-01

    Panama disease caused by Fusarium oxysporum f. sp. cubense infection on banana is devastating banana plantations worldwide. Biological control has been proposed to suppress Panama disease, though the stability and survival of bio-control microorganisms in field setting is largely unknown. In order to develop a bio-control strategy for this disease, 16S rRNA gene sequencing was used to assess the microbial community of a disease-suppressive soil. Bacillus was identified as the dominant bacterial group in the suppressive soil. For this reason, B. amyloliquefaciens NJN-6 isolated from the suppressive soil was selected as a potential bio-control agent. A bioorganic fertilizer (BIO), formulated by combining this isolate with compost, was applied in nursery pots to assess the bio-control of Panama disease. Results showed that BIO significantly decreased disease incidence by 68.5%, resulting in a doubled yield. Moreover, bacterial community structure was significantly correlated to disease incidence and yield and Bacillus colonization was negatively correlated with pathogen abundance and disease incidence, but positively correlated to yield. In total, the application of BIO altered the rhizo-bacterial community by establishing beneficial strains that dominated the microbial community and decreased pathogen colonization in the banana rhizosphere, which plays an important role in the management of Panama disease. PMID:26242751

  16. Bacterial sex in dental plaque.

    PubMed

    Olsen, Ingar; Tribble, Gena D; Fiehn, Nils-Erik; Wang, Bing-Yan

    2013-01-01

    Genes are transferred between bacteria in dental plaque by transduction, conjugation, and transformation. Membrane vesicles can also provide a mechanism for horizontal gene transfer. DNA transfer is considered bacterial sex, but the transfer is not parallel to processes that we associate with sex in higher organisms. Several examples of bacterial gene transfer in the oral cavity are given in this review. How frequently this occurs in dental plaque is not clear, but evidence suggests that it affects a number of the major genera present. It has been estimated that new sequences in genomes established through horizontal gene transfer can constitute up to 30% of bacterial genomes. Gene transfer can be both inter- and intrageneric, and it can also affect transient organisms. The transferred DNA can be integrated or recombined in the recipient's chromosome or remain as an extrachromosomal inheritable element. This can make dental plaque a reservoir for antimicrobial resistance genes. The ability to transfer DNA is important for bacteria, making them better adapted to the harsh environment of the human mouth, and promoting their survival, virulence, and pathogenicity.

  17. Determination of the Core of a Minimal Bacterial Gene Set†

    PubMed Central

    Gil, Rosario; Silva, Francisco J.; Peretó, Juli; Moya, Andrés

    2004-01-01

    The availability of a large number of complete genome sequences raises the question of how many genes are essential for cellular life. Trying to reconstruct the core of the protein-coding gene set for a hypothetical minimal bacterial cell, we have performed a computational comparative analysis of eight bacterial genomes. Six of the analyzed genomes are very small due to a dramatic genome size reduction process, while the other two, corresponding to free-living relatives, are larger. The available data from several systematic experimental approaches to define all the essential genes in some completely sequenced bacterial genomes were also considered, and a reconstruction of a minimal metabolic machinery necessary to sustain life was carried out. The proposed minimal genome contains 206 protein-coding genes with all the genetic information necessary for self-maintenance and reproduction in the presence of a full complement of essential nutrients and in the absence of environmental stress. The main features of such a minimal gene set, as well as the metabolic functions that must be present in the hypothetical minimal cell, are discussed. PMID:15353568

  18. Protein expression of preferred human codon-optimized Gaussia luciferase genes with an artificial open-reading frame in mammalian and bacterial cells.

    PubMed

    Inouye, Satoshi; Suzuki, Takahiro

    2016-12-01

    The protein expressions of three preferred human codon-optimized Gaussia luciferase genes (pGLuc, EpGLuc, and KpGLuc) were characterized in mammalian and bacterial cells by comparing them with those of wild-type Gaussia luciferase gene (wGLuc) and human codon-optimized Gaussia luciferase gene (hGLuc). Two synthetic genes of EpGLuc and KpGLuc containing the complete preferred human codons have an artificial open-reading frame; however, they had the similar protein expression levels to those of pGLuc and hGLuc in mammalian cells. In bacterial cells, the protein expressions of pGLuc, EpGLuc, and KpGLuc with approximately 65% GC content were the same and showed approximately 60% activities of wGLuc and hGLuc. The artificial open-reading frame in EpGLuc and KpGLuc did not affect the protein expression in mammalian and bacterial cells. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Efficacy of fungal and bacterial antagonists for controlling growth, FUM1 gene expression and fumonisin B1 production by Fusarium verticillioides on maize cobs of different ripening stages.

    PubMed

    Samsudin, Nik Iskandar Putra; Rodriguez, Alicia; Medina, Angel; Magan, Naresh

    2017-04-04

    This study was carried out to examine the efficacy of two biocontrol agents (Clonostachys rosea 016, BCA1; Gram-negative bacterium, BCA5) for control of FUM1 gene expression and fumonisin B 1 (FB 1 ) production by F. verticillioides FV1 on maize cobs of different ripening stages: R 3 , Milk (0.985 a w ); R 4 , Dough (0.976 a w ); R 5 , Dent (0.958 a w ). Initially, temporal studies on FUM1 gene expression and FB 1 production were performed on maize kernels for up to 14days. This revealed that day 10 was optimum for both parameters, and was used in the biocontrol studies. Maize cobs were inoculated with 50:50 mixtures of the pathogen:antagonist inoculum and incubated in environmental chambers to maintain the natural a w conditions for ten days at 25 and 30°C. The growth rates of F. verticillioides FV1, the relative expression of the FUM1 gene and FB 1 production were quantified. It was found that, a w ×temp had significant impacts on growth, FUM1 gene expression and FB 1 production by F. verticillioides FV1 on maize cobs of different maturities. The fungal antagonist (BCA1) significantly reduced FB 1 contamination on maize cobs by >70% at 25°C, and almost 60% at 30°C regardless of maize ripening stage. For the bacterial antagonist (BCA5) however, FB 1 levels on maize cobs were significantly decreased only in some treatments. These results suggest that efficacy of antagonists to control mycotoxin production in ripening maize cobs needs to take account of the ecophysiology of the pathogen and the antagonists, as well as the physiological status of the maize during silking to ensure effective control. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. The chromosomal organization of horizontal gene transfer in bacteria.

    PubMed

    Oliveira, Pedro H; Touchon, Marie; Cury, Jean; Rocha, Eduardo P C

    2017-10-10

    Bacterial adaptation is accelerated by the acquisition of novel traits through horizontal gene transfer, but the integration of these genes affects genome organization. We found that transferred genes are concentrated in only ~1% of the chromosomal regions (hotspots) in 80 bacterial species. This concentration increases with genome size and with the rate of transfer. Hotspots diversify by rapid gene turnover; their chromosomal distribution depends on local contexts (neighboring core genes), and content in mobile genetic elements. Hotspots concentrate most changes in gene repertoires, reduce the trade-off between genome diversification and organization, and should be treasure troves of strain-specific adaptive genes. Most mobile genetic elements and antibiotic resistance genes are in hotspots, but many hotspots lack recognizable mobile genetic elements and exhibit frequent homologous recombination at flanking core genes. Overrepresentation of hotspots with fewer mobile genetic elements in naturally transformable bacteria suggests that homologous recombination and horizontal gene transfer are tightly linked in genome evolution.Horizontal gene transfer (HGT) is an important mechanism for genome evolution and adaptation in bacteria. Here, Oliveira and colleagues find HGT hotspots comprising  ~ 1% of the chromosomal regions in 80 bacterial species.

  1. Involvement of β-carbonic anhydrase (β-CA) genes in bacterial genomic islands and horizontal transfer to protists.

    PubMed

    Zolfaghari Emameh, Reza; Barker, Harlan R; Hytönen, Vesa P; Parkkila, Seppo

    2018-05-25

    Genomic islands (GIs) are a type of mobile genetic element (MGE) that are present in bacterial chromosomes. They consist of a cluster of genes which produce proteins that contribute to a variety of functions, including, but not limited to, regulation of cell metabolism, anti-microbial resistance, pathogenicity, virulence, and resistance to heavy metals. The genes carried in MGEs can be used as a trait reservoir in times of adversity. Transfer of genes using MGEs, occurring outside of reproduction, is called horizontal gene transfer (HGT). Previous literature has shown that numerous HGT events have occurred through endosymbiosis between prokaryotes and eukaryotes.Beta carbonic anhydrase (β-CA) enzymes play a critical role in the biochemical pathways of many prokaryotes and eukaryotes. We have previously suggested horizontal transfer of β-CA genes from plasmids of some prokaryotic endosymbionts to their protozoan hosts. In this study, we set out to identify β-CA genes that might have transferred between prokaryotic and protist species through HGT in GIs. Therefore, we investigated prokaryotic chromosomes containing β-CA-encoding GIs and utilized multiple bioinformatics tools to reveal the distinct movements of β-CA genes among a wide variety of organisms. Our results identify the presence of β-CA genes in GIs of several medically and industrially relevant bacterial species, and phylogenetic analyses reveal multiple cases of likely horizontal transfer of β-CA genes from GIs of ancestral prokaryotes to protists. IMPORTANCE The evolutionary process is mediated by mobile genetic elements (MGEs), such as genomic islands (GIs). A gene or set of genes in the GIs are exchanged between and within various species through horizontal gene transfer (HGT). Based on the crucial role that GIs can play in bacterial survival and proliferation, they were introduced as the environmental- and pathogen-associated factors. Carbonic anhydrases (CAs) are involved in many critical biochemical pathways, such as regulation of pH homeostasis and electrolyte transfer. Among the six evolutionary families of CAs, β-CA gene sequences are present in many bacterial species, which can be horizontally transferred to protists during evolution. This study shows for the first time the involvement of bacterial β-CA gene sequences in the GIs, and suggests their horizontal transfer to protists during evolution. Copyright © 2018 American Society for Microbiology.

  2. Whole-Genome Sequencing and Concordance Between Antimicrobial Susceptibility Genotypes and Phenotypes of Bacterial Isolates Associated with Bovine Respiratory Disease

    PubMed Central

    Owen, Joseph R.; Noyes, Noelle; Young, Amy E.; Prince, Daniel J.; Blanchard, Patricia C.; Lehenbauer, Terry W.; Aly, Sharif S.; Davis, Jessica H.; O’Rourke, Sean M.; Abdo, Zaid; Belk, Keith; Miller, Michael R.; Morley, Paul; Van Eenennaam, Alison L.

    2017-01-01

    Extended laboratory culture and antimicrobial susceptibility testing timelines hinder rapid species identification and susceptibility profiling of bacterial pathogens associated with bovine respiratory disease, the most prevalent cause of cattle mortality in the United States. Whole-genome sequencing offers a culture-independent alternative to current bacterial identification methods, but requires a library of bacterial reference genomes for comparison. To contribute new bacterial genome assemblies and evaluate genetic diversity and variation in antimicrobial resistance genotypes, whole-genome sequencing was performed on bovine respiratory disease–associated bacterial isolates (Histophilus somni, Mycoplasma bovis, Mannheimia haemolytica, and Pasteurella multocida) from dairy and beef cattle. One hundred genomically distinct assemblies were added to the NCBI database, doubling the available genomic sequences for these four species. Computer-based methods identified 11 predicted antimicrobial resistance genes in three species, with none being detected in M. bovis. While computer-based analysis can identify antibiotic resistance genes within whole-genome sequences (genotype), it may not predict the actual antimicrobial resistance observed in a living organism (phenotype). Antimicrobial susceptibility testing on 64 H. somni, M. haemolytica, and P. multocida isolates had an overall concordance rate between genotype and phenotypic resistance to the associated class of antimicrobials of 72.7% (P < 0.001), showing substantial discordance. Concordance rates varied greatly among different antimicrobial, antibiotic resistance gene, and bacterial species combinations. This suggests that antimicrobial susceptibility phenotypes are needed to complement genomically predicted antibiotic resistance gene genotypes to better understand how the presence of antibiotic resistance genes within a given bacterial species could potentially impact optimal bovine respiratory disease treatment and morbidity/mortality outcomes. PMID:28739600

  3. Whole-Genome Sequencing and Concordance Between Antimicrobial Susceptibility Genotypes and Phenotypes of Bacterial Isolates Associated with Bovine Respiratory Disease.

    PubMed

    Owen, Joseph R; Noyes, Noelle; Young, Amy E; Prince, Daniel J; Blanchard, Patricia C; Lehenbauer, Terry W; Aly, Sharif S; Davis, Jessica H; O'Rourke, Sean M; Abdo, Zaid; Belk, Keith; Miller, Michael R; Morley, Paul; Van Eenennaam, Alison L

    2017-09-07

    Extended laboratory culture and antimicrobial susceptibility testing timelines hinder rapid species identification and susceptibility profiling of bacterial pathogens associated with bovine respiratory disease, the most prevalent cause of cattle mortality in the United States. Whole-genome sequencing offers a culture-independent alternative to current bacterial identification methods, but requires a library of bacterial reference genomes for comparison. To contribute new bacterial genome assemblies and evaluate genetic diversity and variation in antimicrobial resistance genotypes, whole-genome sequencing was performed on bovine respiratory disease-associated bacterial isolates ( Histophilus somni , Mycoplasma bovis , Mannheimia haemolytica , and Pasteurella multocida ) from dairy and beef cattle. One hundred genomically distinct assemblies were added to the NCBI database, doubling the available genomic sequences for these four species. Computer-based methods identified 11 predicted antimicrobial resistance genes in three species, with none being detected in M. bovis While computer-based analysis can identify antibiotic resistance genes within whole-genome sequences (genotype), it may not predict the actual antimicrobial resistance observed in a living organism (phenotype). Antimicrobial susceptibility testing on 64 H. somni , M. haemolytica , and P. multocida isolates had an overall concordance rate between genotype and phenotypic resistance to the associated class of antimicrobials of 72.7% ( P < 0.001), showing substantial discordance. Concordance rates varied greatly among different antimicrobial, antibiotic resistance gene, and bacterial species combinations. This suggests that antimicrobial susceptibility phenotypes are needed to complement genomically predicted antibiotic resistance gene genotypes to better understand how the presence of antibiotic resistance genes within a given bacterial species could potentially impact optimal bovine respiratory disease treatment and morbidity/mortality outcomes. Copyright © 2017 Owen et al.

  4. Bacterial communications in implant infections: a target for an intelligence war.

    PubMed

    Costerton, J W; Montanaro, L; Arciola, C R

    2007-09-01

    The status of population density is communicated among bacteria by specific secreted molecules, called pheromones or autoinducers, and the control mechanism is called "quorum-sensing". Quorum-sensing systems regulate the expression of a panel of genes, allowing bacteria to adapt to modified environmental conditions at a high density of population. The two known different quorum systems are described as the LuxR-LuxI system in gram-negative bacteria, which uses an N-acyl-homoserine lactone (AHL) as signal, and the agr system in gram-positive bacteria, which uses a peptide-tiolactone as signal and the RNAIII as effector molecules. Both in gram-negative and in gram-positive bacteria, quorum-sensing systems regulate the expression of adhesion mechanisms (biofilm and adhesins) and virulence factors (toxins and exoenzymes) depending on population cell density. In gram-negative Pseudomonas aeruginosa, analogs of signaling molecules such as furanone analogs, are effective in attenuating bacterial virulence and controlling bacterial infections. In grampositive Staphylococcus aureus, the quorum-sensing RNAIII-inhibiting peptide (RIP), tested in vitro and in animal infection models, has been proved to inhibit virulence and prevent infections. Attenuation of bacterial virulence by quorum-sensing inhibitors, rather than by bactericidal or bacteriostatic drugs, is a highly attractive concept because these antibacterial agents are less likely to induce the development of bacterial resistance.

  5. Evaluating the consistency of gene sets used in the analysis of bacterial gene expression data.

    PubMed

    Tintle, Nathan L; Sitarik, Alexandra; Boerema, Benjamin; Young, Kylie; Best, Aaron A; Dejongh, Matthew

    2012-08-08

    Statistical analyses of whole genome expression data require functional information about genes in order to yield meaningful biological conclusions. The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) are common sources of functionally grouped gene sets. For bacteria, the SEED and MicrobesOnline provide alternative, complementary sources of gene sets. To date, no comprehensive evaluation of the data obtained from these resources has been performed. We define a series of gene set consistency metrics directly related to the most common classes of statistical analyses for gene expression data, and then perform a comprehensive analysis of 3581 Affymetrix® gene expression arrays across 17 diverse bacteria. We find that gene sets obtained from GO and KEGG demonstrate lower consistency than those obtained from the SEED and MicrobesOnline, regardless of gene set size. Despite the widespread use of GO and KEGG gene sets in bacterial gene expression data analysis, the SEED and MicrobesOnline provide more consistent sets for a wide variety of statistical analyses. Increased use of the SEED and MicrobesOnline gene sets in the analysis of bacterial gene expression data may improve statistical power and utility of expression data.

  6. Techniques for Large-Scale Bacterial Genome Manipulation and Characterization of the Mutants with Respect to In Silico Metabolic Reconstructions.

    PubMed

    diCenzo, George C; Finan, Turlough M

    2018-01-01

    The rate at which all genes within a bacterial genome can be identified far exceeds the ability to characterize these genes. To assist in associating genes with cellular functions, a large-scale bacterial genome deletion approach can be employed to rapidly screen tens to thousands of genes for desired phenotypes. Here, we provide a detailed protocol for the generation of deletions of large segments of bacterial genomes that relies on the activity of a site-specific recombinase. In this procedure, two recombinase recognition target sequences are introduced into known positions of a bacterial genome through single cross-over plasmid integration. Subsequent expression of the site-specific recombinase mediates recombination between the two target sequences, resulting in the excision of the intervening region and its loss from the genome. We further illustrate how this deletion system can be readily adapted to function as a large-scale in vivo cloning procedure, in which the region excised from the genome is captured as a replicative plasmid. We next provide a procedure for the metabolic analysis of bacterial large-scale genome deletion mutants using the Biolog Phenotype MicroArray™ system. Finally, a pipeline is described, and a sample Matlab script is provided, for the integration of the obtained data with a draft metabolic reconstruction for the refinement of the reactions and gene-protein-reaction relationships in a metabolic reconstruction.

  7. The plant pathogenic fungus Gaeumannomyces graminis var. tritici improves bacterial growth and triggers early gene regulations in the biocontrol strain Pseudomonas fluorescens Pf29Arp.

    PubMed

    Barret, M; Frey-Klett, P; Boutin, M; Guillerm-Erckelboudt, A-Y; Martin, F; Guillot, L; Sarniguet, A

    2009-01-01

    In soil, some antagonistic rhizobacteria contribute to reduce root diseases caused by phytopathogenic fungi. Direct modes of action of these bacteria have been largely explored; however, commensal interaction also takes place between these microorganisms and little is known about the influence of filamentous fungi on bacteria. An in vitro confrontation bioassay between the pathogenic fungus Gaeumannomyces graminis var. tritici (Ggt) and the biocontrol bacterial strain Pseudomonas fluorescens Pf29Arp was set up to analyse bacterial transcriptional changes induced by the fungal mycelium at three time-points of the interaction before cell contact and up until contact. For this, a Pf29Arp shotgun DNA microarray was constructed. Specifity of Ggt effect was assessed in comparison with one of two other filamentous fungi, Laccaria bicolor and Magnaporthe grisea. During a commensal interaction, Ggt increased the growth rate of Pf29Arp. Before contact, Ggt induced bacterial genes involved in mycelium colonization. At contact, genes encoding protein of stress response and a patatin-like protein were up-regulated. Among all the bacterial genes identified, xseB was specifically up-regulated at contact by Ggt but down-regulated by the other fungi. Data showed that the bacterium sensed the presence of the fungus early, but the main gene alteration occurred during bacterial-fungal cell contact.

  8. Gene silencing using the recessive rice bacterial blight resistance gene xa13 as a new paradigm in plant breeding.

    PubMed

    Li, Changyan; Wei, Jing; Lin, Yongjun; Chen, Hao

    2012-05-01

    Resistant germplasm resources are valuable for developing resistant varieties in agricultural production. However, recessive resistance genes are usually overlooked in hybrid breeding. Compared with dominant traits, however, they may confer resistance to different pathogenic races or pest biotypes with different mechanisms of action. The recessive rice bacterial blight resistance gene xa13, also involved in pollen development, has been cloned and its resistance mechanism has been recently characterized. This report describes the conversion of bacterial blight resistance mediated by the recessive xa13 gene into a dominant trait to facilitate its use in a breeding program. This was achieved by knockdown of the corresponding dominant allele Xa13 in transgenic rice using recently developed artificial microRNA technology. Tissue-specific promoters were used to exclude most of the expression of artificial microRNA in the anther to ensure that Xa13 functioned normally during pollen development. A battery of highly bacterial blight resistant transgenic plants with normal seed setting rates were acquired, indicating that highly specific gene silencing had been achieved. Our success with xa13 provides a paradigm that can be adapted to other recessive resistance genes.

  9. Bacterial reference genes for gene expression studies by RT-qPCR: survey and analysis.

    PubMed

    Rocha, Danilo J P; Santos, Carolina S; Pacheco, Luis G C

    2015-09-01

    The appropriate choice of reference genes is essential for accurate normalization of gene expression data obtained by the method of reverse transcription quantitative real-time PCR (RT-qPCR). In 2009, a guideline called the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) highlighted the importance of the selection and validation of more than one suitable reference gene for obtaining reliable RT-qPCR results. Herein, we searched the recent literature in order to identify the bacterial reference genes that have been most commonly validated in gene expression studies by RT-qPCR (in the first 5 years following publication of the MIQE guidelines). Through a combination of different search parameters with the text mining tool MedlineRanker, we identified 145 unique bacterial genes that were recently tested as candidate reference genes. Of these, 45 genes were experimentally validated and, in most of the cases, their expression stabilities were verified using the software tools geNorm and NormFinder. It is noteworthy that only 10 of these reference genes had been validated in two or more of the studies evaluated. An enrichment analysis using Gene Ontology classifications demonstrated that genes belonging to the functional categories of DNA Replication (GO: 0006260) and Transcription (GO: 0006351) rendered a proportionally higher number of validated reference genes. Three genes in the former functional class were also among the top five most stable genes identified through an analysis of gene expression data obtained from the Pathosystems Resource Integration Center. These results may provide a guideline for the initial selection of candidate reference genes for RT-qPCR studies in several different bacterial species.

  10. Expression of the Nitric Oxide Synthase 2 Gene Is Not Essential for Early Control of Mycobacterium tuberculosis in the Murine Lung

    PubMed Central

    Cooper, Andrea M.; Pearl, John E.; Brooks, Jason V.; Ehlers, Stefan; Orme, Ian M.

    2000-01-01

    The interleukin-12 and gamma interferon (IFN-γ) pathway of macrophage activation plays a pivotal role in controlling tuberculosis. In the murine model, the generation of supplementary nitric oxide by the induction of the nitric oxide synthase 2 (NOS2) gene product is considered the principal antimicrobial mechanism of IFN-γ-activated macrophages. Using a low-dose aerosol-mediated infection model in the mouse, we have investigated the role of nitric oxide in controlling Mycobacterium tuberculosis in the lung. In contrast to the consequences of a systemic infection, a low dose of bacteria introduced directly into the lungs of mice lacking the NOS2 gene is controlled almost as well as in intact animals. This is in contrast to the rapid progression of disease in mice lacking IFN-γ or a key member of the IFN signaling pathway, interferon regulatory factor 1. Thus while IFN-γ is pivotal in early control of bacterial growth in the lung, this control does not completely depend upon the expression of the NOS2 gene. The absence of inducible nitric oxide in the lung does, however, result in increased polymorphonuclear cell involvement and eventual necrosis in the pulmonary granulomas of the infected mice lacking the NOS2 gene. PMID:11083808

  11. Effects of bacterial inoculants on the indigenous microbiome and secondary metabolites of chamomile plants

    PubMed Central

    Schmidt, Ruth; Köberl, Martina; Mostafa, Amr; Ramadan, Elshahat M.; Monschein, Marlene; Jensen, Kenneth B.; Bauer, Rudolf; Berg, Gabriele

    2014-01-01

    Plant-associated bacteria fulfill important functions for plant growth and health. However, our knowledge about the impact of bacterial treatments on the host's microbiome and physiology is limited. The present study was conducted to assess the impact of bacterial inoculants on the microbiome of chamomile plants Chamomilla recutita (L.) Rauschert grown in a field under organic management in Egypt. Chamomile seedlings were inoculated with three indigenous Gram-positive strains (Streptomyces subrutilus Wbn2-11, Bacillus subtilis Co1-6, Paenibacillus polymyxa Mc5Re-14) from Egypt and three European Gram-negative strains (Pseudomonas fluorescens L13-6-12, Stenotrophomonas rhizophila P69, Serratia plymuthica 3Re4-18) already known for their beneficial plant-microbe interaction. Molecular fingerprints of 16S rRNA gene as well as real-time PCR analyses did not show statistically significant differences for all applied bacterial antagonists compared to the control. In contrast, a pyrosequencing analysis of the 16S rRNA gene libraries revealed significant differences in the community structure of bacteria between the treatments. These differences could be clearly shown by a shift within the community structure and corresponding beta-diversity indices. Moreover, B. subtilis Co1-6 and P. polymyxa Mc5Re-14 showed an enhancement of the bioactive secondary metabolite apigenin-7-O-glucoside. This indicates a possible new function of bacterial inoculants: to interact with the plant microbiome as well as to influence the plant metabolome. PMID:24600444

  12. Variable effects of oxytetracycline on antibiotic resistance gene abundance and the bacterial community during aerobic composting of cow manure.

    PubMed

    Qian, Xun; Sun, Wei; Gu, Jie; Wang, Xiao-Juan; Sun, Jia-Jun; Yin, Ya-Nan; Duan, Man-Li

    2016-09-05

    Livestock manure is often subjected to aerobic composting but little is known about the variation in antibiotic resistance genes (ARGs) during the composting process under different concentrations of antibiotics. This study compared the effects of three concentrations of oxytetracycline (OTC; 10, 60, and 200mg/kg) on ARGs and the succession of the bacterial community during composting. Very similar trends were observed in the relative abundances (RAs) of each ARG among the OTC treatments and the control during composting. After composting, the RAs of tetC, tetX, sul1, sul2, and intI1 increased 2-43 times, whereas those of tetQ, tetM, and tetW declined by 44-99%. OTC addition significantly increased the absolute abundances and RAs of tetC and intI1, while 200mg/kg OTC also enhanced those of tetM, tetQ, and drfA7. The bacterial community could be grouped according to the composting time under different treatments. The highest concentration of OTC had a more persistent effect on the bacterial community. In the present study, the succession of the bacterial community appeared to have a greater influence on the variation of ARGs during composting than the presence of antibiotics. Aerobic composting was not effective in reducing most of the ARGs, and thus the compost product should be considered as an important reservoir for ARGs. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. [Arms racing between human beings and pathogens: NDM-1 and superbugs].

    PubMed

    Sun, Mingwei; Zheng, Beiwen; Gao, George F; Zhu, Baoli

    2010-11-01

    Throughout human history, pandemic bacterial diseases such as the plague and tuberculosis have posed an enormous threat to human beings. The discovery of antibiotics has provided us with powerful arsenal for the defense against bacterial infections. However, bacteria are acquiring more and more resistance genes to shield off antibiotics through mutation and horizontal gene transfer. Therefore, novel antibiotics must be produced and the arms race between bacterial pathogens and antibiotics is becoming increasingly intense. Recently, researchers have found that plasmids carrying a new metallo-beta-lactamase gene, blaNDM-1, and many other antibiotics resistance genes can easily spread through bacterial populations and confer recipient stains resistance to nearly all of the current antibiotics. It is a threat to the human health and a great challenge for our medical science, which we are facing. We need to find new ways to fight and win this arms racing.

  14. Immune subversion by chromatin manipulation: a 'new face' of host-bacterial pathogen interaction.

    PubMed

    Arbibe, Laurence

    2008-08-01

    Bacterial pathogens have evolved various strategies to avoid immune surveillance, depending of their in vivo'lifestyle'. The identification of few bacterial effectors capable to enter the nucleus and modifying chromatin structure in host raises the fascinating questions of how pathogens modulate chromatin structure and why. Chromatin is a dynamic structure that maintains the stability and accessibility of the host DNA genome to the transcription machinery. This review describes the various strategies used by pathogens to interface with host chromatin. In some cases, chromatin injury can be a strategy to take control of major cellular functions, such as the cell cycle. In other cases, manipulation of chromatin structure at specific genomic locations by modulating epigenetic information provides a way for the pathogen to impose its own transcriptional signature onto host cells. This emerging field should strongly influence our understanding of chromatin regulation at interphase nucleus and may provide invaluable openings to the control of immune gene expression in inflammatory and infectious diseases.

  15. A mixed incoherent feed-forward loop contributes to the regulation of bacterial photosynthesis genes.

    PubMed

    Mank, Nils N; Berghoff, Bork A; Klug, Gabriele

    2013-03-01

    Living cells use a variety of regulatory network motifs for accurate gene expression in response to changes in their environment or during differentiation processes. In Rhodobacter sphaeroides, a complex regulatory network controls expression of photosynthesis genes to guarantee optimal energy supply on one hand and to avoid photooxidative stress on the other hand. Recently, we identified a mixed incoherent feed-forward loop comprising the transcription factor PrrA, the sRNA PcrZ and photosynthesis target genes as part of this regulatory network. This point-of-view provides a comparison to other described feed-forward loops and discusses the physiological relevance of PcrZ in more detail.

  16. A mixed incoherent feed-forward loop contributes to the regulation of bacterial photosynthesis genes

    PubMed Central

    Mank, Nils N.; Berghoff, Bork A.; Klug, Gabriele

    2013-01-01

    Living cells use a variety of regulatory network motifs for accurate gene expression in response to changes in their environment or during differentiation processes. In Rhodobacter sphaeroides, a complex regulatory network controls expression of photosynthesis genes to guarantee optimal energy supply on one hand and to avoid photooxidative stress on the other hand. Recently, we identified a mixed incoherent feed-forward loop comprising the transcription factor PrrA, the sRNA PcrZ and photosynthesis target genes as part of this regulatory network. This point-of-view provides a comparison to other described feed-forward loops and discusses the physiological relevance of PcrZ in more detail. PMID:23392242

  17. Genetic basis and importance of metal resistant genes in bacteria for bioremediation of contaminated environments with toxic metal pollutants.

    PubMed

    Das, Surajit; Dash, Hirak R; Chakraborty, Jaya

    2016-04-01

    Metal pollution is one of the most persistent and complex environmental issues, causing threat to the ecosystem and human health. On exposure to several toxic metals such as arsenic, cadmium, chromium, copper, lead, and mercury, several bacteria has evolved with many metal-resistant genes as a means of their adaptation. These genes can be further exploited for bioremediation of the metal-contaminated environments. Many operon-clustered metal-resistant genes such as cadB, chrA, copAB, pbrA, merA, and NiCoT have been reported in bacterial systems for cadmium, chromium, copper, lead, mercury, and nickel resistance and detoxification, respectively. The field of environmental bioremediation has been ameliorated by exploiting diverse bacterial detoxification genes. Genetic engineering integrated with bioremediation assists in manipulation of bacterial genome which can enhance toxic metal detoxification that is not usually performed by normal bacteria. These techniques include genetic engineering with single genes or operons, pathway construction, and alternations of the sequences of existing genes. However, numerous facets of bacterial novel metal-resistant genes are yet to be explored for application in microbial bioremediation practices. This review describes the role of bacteria and their adaptive mechanisms for toxic metal detoxification and restoration of contaminated sites.

  18. Essentiality, conservation, evolutionary pressure and codon bias in bacterial genomes.

    PubMed

    Dilucca, Maddalena; Cimini, Giulio; Giansanti, Andrea

    2018-07-15

    Essential genes constitute the core of genes which cannot be mutated too much nor lost along the evolutionary history of a species. Natural selection is expected to be stricter on essential genes and on conserved (highly shared) genes, than on genes that are either nonessential or peculiar to a single or a few species. In order to further assess this expectation, we study here how essentiality of a gene is connected with its degree of conservation among several unrelated bacterial species, each one characterised by its own codon usage bias. Confirming previous results on E. coli, we show the existence of a universal exponential relation between gene essentiality and conservation in bacteria. Moreover, we show that, within each bacterial genome, there are at least two groups of functionally distinct genes, characterised by different levels of conservation and codon bias: i) a core of essential genes, mainly related to cellular information processing; ii) a set of less conserved nonessential genes with prevalent functions related to metabolism. In particular, the genes in the first group are more retained among species, are subject to a stronger purifying conservative selection and display a more limited repertoire of synonymous codons. The core of essential genes is close to the minimal bacterial genome, which is in the focus of recent studies in synthetic biology, though we confirm that orthologs of genes that are essential in one species are not necessarily essential in other species. We also list a set of highly shared genes which, reasonably, could constitute a reservoir of targets for new anti-microbial drugs. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Rapid detection of Mannheimia haemolytica in lung tissues of sheep and from bacterial culture.

    PubMed

    Kumar, Jyoti; Dixit, Shivendra Kumar; Kumar, Rajiv

    2015-09-01

    This study was aimed to detect Mannheimia haemolytica in lung tissues of sheep and from a bacterial culture. M. haemolytica is one of the most important and well-established etiological agents of pneumonia in sheep and other ruminants throughout the world. Accurate diagnosis of M. haemolytica primarily relies on bacteriological examination, biochemical characteristics and, biotyping and serotyping of the isolates. In an effort to facilitate rapid M. haemolytica detection, polymerase chain reaction assay targeting Pasteurella haemolytica serotype-1 specific antigens (PHSSA), Rpt2 and 12S ribosomal RNA (rRNA) genes were used to detect M. haemolytica directly from lung tissues and from bacterial culture. A total of 12 archived lung tissues from sheep that died of pneumonia on an organized farm were used. A multiplex polymerase chain reaction (mPCR) based on two-amplicons targeted PHSSA and Rpt2 genes of M. haemolytica were used for identification of M. haemolytica isolates in culture from the lung samples. All the 12 lung tissue samples were tested for the presence M. haemolytica by PHSSA and Rpt2 genes based PCR and its confirmation by sequencing of the amplicons. All the 12 lung tissue samples tested for the presence of PHSSA and Rpt2 genes of M. haemolytica by mPCR were found to be positive. Amplification of 12S rRNA gene fragment as internal amplification control was obtained with each mPCR reaction performed from DNA extracted directly from lung tissue samples. All the M. haemolytica were also positive for mPCR. No amplified DNA bands were observed for negative control reactions. All the three nucleotide sequences were deposited in NCBI GenBank (Accession No. KJ534629, KJ534630 and KJ534631). Sequencing of the amplified products revealed the identity of 99-100%, with published sequence of PHSSA and Rpt2 genes of M. haemolytica available in the NCBI database. Sheep specific mitochondrial 12S rRNA gene sequence also revealed the identity of 98% with published sequences in the NCBI database. The present study emphasized the PCR as a valuable tool for rapid detection of M. haemolytica in clinical samples from animals. In addition, it offers the opportunity to perform large-scale epidemiological studies regarding the role of M. haemolytica in clinical cases of pneumonia and other disease manifestations in sheep and other ruminants, thereby providing the basis for effective preventive strategies.

  20. Effect of Copper Treatment on the Composition and Function of the Bacterial Community in the Sponge Haliclona cymaeformis

    PubMed Central

    Tian, Ren-Mao; Wang, Yong; Bougouffa, Salim; Gao, Zhao-Ming; Cai, Lin; Zhang, Wei-Peng; Bajic, Vladimir

    2014-01-01

    ABSTRACT Marine sponges are the most primitive metazoan and host symbiotic microorganisms. They are crucial components of the marine ecological system and play an essential role in pelagic processes. Copper pollution is currently a widespread problem and poses a threat to marine organisms. Here, we examined the effects of copper treatment on the composition of the sponge-associated bacterial community and the genetic features that facilitate the survival of enriched bacteria under copper stress. The 16S rRNA gene sequencing results showed that the sponge Haliclona cymaeformis harbored symbiotic sulfur-oxidizing Ectothiorhodospiraceae and photosynthetic Cyanobacteria as dominant species. However, these autotrophic bacteria decreased substantially after treatment with a high copper concentration, which enriched for a heterotrophic-bacterium-dominated community. Metagenomic comparison revealed a varied profile of functional genes and enriched functions, including bacterial motility and chemotaxis, extracellular polysaccharide and capsule synthesis, virulence-associated genes, and genes involved in cell signaling and regulation, suggesting short-period mechanisms of the enriched bacterial community for surviving copper stress in the microenvironment of the sponge. Microscopic observation and comparison revealed dynamic bacterial aggregation within the matrix and lysis of sponge cells. The bacteriophage community was also enriched, and the complete genome of a dominant phage was determined, implying that a lytic phage cycle was stimulated by the high copper concentration. This study demonstrated a copper-induced shift in the composition of functional genes of the sponge-associated bacterial community, revealing the selective effect of copper treatment on the functions of the bacterial community in the microenvironment of the sponge. PMID:25370493

  1. Preparation of RNA from bacteria infected with bacteriophages: a case study from the marine unicellular Synechococcus sp. WH7803 infected by phage S-PM2.

    PubMed

    Shan, Jinyu; Clokie, Martha

    2009-01-01

    Bacteriophages manipulate bacterial gene expression in order to express their own genes or influence bacterial metabolism. Gene expression can be studied using real-time PCR or microarrays. Either technique requires the prior isolation of high quality RNA uncontaminated by the presence of genomic DNA. We outline the considerations necessary when working with bacteriophage infected bacterial cells. We also give an example of a protocol for extraction and quantification of high quality RNA from infected bacterial cells, using the marine cyanobacterium WH7803 and the phage S-PM2 as a case study. This protocol can be modified to extract RNA from the host/bacteriophage of interest.

  2. A BAC-bacterial recombination method to generate physically linked multiple gene reporter DNA constructs.

    PubMed

    Maye, Peter; Stover, Mary Louise; Liu, Yaling; Rowe, David W; Gong, Shiaochin; Lichtler, Alexander C

    2009-03-13

    Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP) reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1) subclone genes of interest into BAC linking vectors, (2) insert desired reporter genes into respective genes and (3) link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.

  3. Evolution of Salmonella-Host Cell Interactions through a Dynamic Bacterial Genome

    PubMed Central

    Ilyas, Bushra; Tsai, Caressa N.; Coombes, Brian K.

    2017-01-01

    Salmonella Typhimurium has a broad arsenal of genes that are tightly regulated and coordinated to facilitate adaptation to the various host environments it colonizes. The genome of Salmonella Typhimurium has undergone multiple gene acquisition events and has accrued changes in non-coding DNA that have undergone selection by regulatory evolution. Together, at least 17 horizontally acquired pathogenicity islands (SPIs), prophage-associated genes, and changes in core genome regulation contribute to the virulence program of Salmonella. Here, we review the latest understanding of these elements and their contributions to pathogenesis, emphasizing the regulatory circuitry that controls niche-specific gene expression. In addition to an overview of the importance of SPI-1 and SPI-2 to host invasion and colonization, we describe the recently characterized contributions of other SPIs, including the antibacterial activity of SPI-6 and adhesion and invasion mediated by SPI-4. We further discuss how these fitness traits have been integrated into the regulatory circuitry of the bacterial cell through cis-regulatory evolution and by a careful balance of silencing and counter-silencing by regulatory proteins. Detailed understanding of regulatory evolution within Salmonella is uncovering novel aspects of infection biology that relate to host-pathogen interactions and evasion of host immunity. PMID:29034217

  4. Biocontrol of tomato wilt disease by Bacillus subtilis isolates from natural environments depends on conserved genes mediating biofilm formation

    PubMed Central

    Liu, Hongxia; Kolter, Roberto; Losick, Richard; Guo, Jian-hua

    2014-01-01

    Summary Bacillus subtilis and other Bacilli have long been used as biological control agents against plant bacterial diseases but the mechanisms by which the bacteria confer protection are not well understood. Our goal in this study was to isolate strains of B. subtilis that exhibit high levels of biocontrol efficacy from natural environments and to investigate the mechanisms by which these strains confer plant protection. We screened a total of sixty isolates collected from various locations across China and obtained six strains that exhibited above 50% biocontrol efficacy on tomato plants against the plant pathogen Ralstonia solanacearum under greenhouse conditions. These wild strains were able to form robust biofilms both in defined medium and on tomato plant roots and exhibited strong antagonistic activities against various plant pathogens in plate assays. We show that plant protection by those strains depended on widely conserved genes required for biofilm formation, including regulatory genes and genes for matrix production. We provide evidence suggesting that matrix production is critical for bacterial colonization on plant root surfaces. Finally, we have established a model system for studies of B. subtilis-tomato plant interactions in protection against a plant pathogen. PMID:22934631

  5. Arabidopsis CYP86A2 represses Pseudomonas syringae type III genes and is required for cuticle development

    PubMed Central

    Xiao, Fangming; Mark Goodwin, S; Xiao, Yanmei; Sun, Zhaoyu; Baker, Douglas; Tang, Xiaoyan; Jenks, Matthew A; Zhou, Jian-Min

    2004-01-01

    Pseudomonas syringae relies on type III secretion system to deliver effector proteins into the host cell for parasitism. Type III genes are induced in planta, but host factors affecting the induction are poorly understood. Here we report on the identification of an Arabidopsis mutant, att1 (for aberrant induction of type three genes), that greatly enhances the expression of bacterial type III genes avrPto and hrpL. att1 plants display enhanced disease severity to a virulent strain of P. syringae, suggesting a role of ATT1 in disease resistance. ATT1 encodes CYP86A2, a cytochrome P450 monooxygenase catalyzing fatty acid oxidation. The cutin content is reduced to 30% in att1, indicating that CYP86A2 plays a major role in the biosynthesis of extracellular lipids. att1 has a loose cuticle membrane ultrastructure and shows increased permeability to water vapor, demonstrating the importance of the cuticle membrane in controlling water loss. The enhanced avrPto-luc expression is specific to att1, but not another cuticle mutant, wax2. The results suggest that certain cutin-related fatty acids synthesized by CYP86A2 may repress bacterial type III gene expression in the intercellular spaces. PMID:15241470

  6. Effects of Azospirillum brasilense with genetically modified auxin biosynthesis gene ipdC upon the diversity of the indigenous microbiota of the wheat rhizosphere.

    PubMed

    Baudoin, Ezékiel; Lerner, Anat; Mirza, M Sajjad; El Zemrany, Hamdy; Prigent-Combaret, Claire; Jurkevich, Edouard; Spaepen, Stijn; Vanderleyden, Jos; Nazaret, Sylvie; Okon, Yaacov; Moënne-Loccoz, Yvan

    2010-04-01

    The phytostimulatory properties of Azospirillum inoculants, which entail production of the phytohormone indole-3-acetic acid (IAA), can be enhanced by genetic means. However, it is not known whether this could affect their interactions with indigenous soil microbes. Here, wheat seeds were inoculated with the wild-type strain Azospirillum brasilense Sp245 or one of three genetically modified (GM) derivatives and grown for one month. The GM derivatives contained a plasmid vector harboring the indole-3-pyruvate/phenylpyruvate decarboxylase gene ipdC (IAA production) controlled either by the constitutive promoter PnptII or the root exudate-responsive promoter PsbpA, or by an empty vector (GM control). All inoculants displayed equal rhizosphere population densities. Only inoculation with either ipdC construct increased shoot biomass compared with the non-inoculated control. At one month after inoculation, automated ribosomal intergenic spacer analysis (ARISA) revealed that the effect of the PsbpA construct on bacterial community structure differed from that of the GM control, which was confirmed by 16S rDNA-based denaturing gradient gel electrophoresis (DGGE). The fungal community was sensitive to inoculation with the PsbpA construct and especially the GM control, based on ARISA data. Overall, fungal and bacterial communities displayed distinct responses to inoculation of GM A. brasilense phytostimulators, whose effects could differ from those of the wild-type.

  7. Peroxiredoxin 5 modulates immune response in Drosophila

    PubMed Central

    Radyuk, Svetlana N.; Michalak, Katarzyna; Klichko, Vladimir I.; Benes, Judith; Orr, William C.

    2010-01-01

    Background Peroxiredoxins are redox-sensing enzymes with multiple cellular functions. Previously, we reported on the potent antioxidant function of Drosophila peroxiredoxin 5 (dPrx5). Studies with mammalian and human cells suggest that peroxiredoxins can modulate immune-related signaling. Methods Survivorship studies and bacteriological analysis were used to determine resistance of flies to fungal and bacterial infections. RT-PCR and immunoblot analyses determined expression of dPrx5 and immunity factors in response to bacterial challenge. Double mutants for dprx5 gene and genes comprising the Imd/Relish and dTak1/Basket branches of the immune signaling pathways were used in epistatic analysis. Results The dprx5 mutant flies were more resistant to bacterial infection than controls, while flies overexpressing dPrx5 were more susceptible. The enhanced resistance to bacteria was accompanied by rapid induction of the Imd-dependent antimicrobial peptides, phosphorylation of the JNK kinase Basket and altered transcriptional profiling of the transient response genes, puckered, ets21C and relish, while the opposite effects were observed in flies over-expressing dPrx5. Epistatic analysis of double mutants, using attacin D and Puckered as read outs of activation of the Imd and JNK pathways, implicated dPrx5 function in the control of the dTak1-JNK arm of immune signaling. Conclusions Differential effects on fly survivorship suggested a trade-off between the antioxidant and immune functions of dPrx5. Molecular and epistatic analyses identified dPrx5 as a negative regulator in the dTak1-JNK arm of immune signaling. General significance Our findings suggest that peroxiredoxins play an important modulatory role in the Drosophila immune response. PMID:20600624

  8. The Airway Microbiome in Severe Asthma: Associations with Disease Features and Severity

    PubMed Central

    Huang, Yvonne J.; Nariya, Snehal; Harris, Jeffrey M.; Lynch, Susan V.; Choy, David F.; Arron, Joseph R.; Boushey, Homer

    2015-01-01

    Background Asthma is heterogeneous, and airway dysbiosis is associated with clinical features in mild-moderate asthma. Whether similar relationships exist among patients with severe asthma is unknown. Objective To evaluate relationships between the bronchial microbiome and features of severe asthma. Methods Bronchial brushings from 40 participants in the BOBCAT study (Bronchoscopic Exploratory Research Study of Biomarkers in Corticosteroid-refractory Asthma) were evaluated using 16S rRNA-based methods. Relationships to clinical and inflammatory features were analyzed among microbiome-profiled subjects. Secondarily, bacterial compositional profiles were compared between severe asthmatics, and previously studied healthy controls (n=7), and mild-moderate asthma subjects (n=41). Results In severe asthma, bronchial bacterial composition was associated with several disease-related features, including body-mass index (BMI; Bray-Curtis distance PERMANOVA, p < 0.05), changes in Asthma Control Questionnaire (ACQ) scores (p < 0.01), sputum total leukocytes (p = 0.06) and bronchial biopsy eosinophils (per mm2; p = 0.07). Bacterial communities associated with worsening ACQ and sputum total leukocytes (predominantly Proteobacteria) differed markedly from those associated with BMI (Bacteroidetes/Firmicutes). In contrast, improving/stable ACQ and bronchial epithelial gene expression of FKBP5, an indicator of steroid responsiveness, correlated with Actinobacteria. Mostly negative correlations were observed between biopsy eosinophils and Proteobacteria. No taxa were associated with a T-helper type 2-related epithelial gene expression signature, but expression of Th17-related genes was associated with Proteobacteria. Severe asthma subjects, compared to healthy controls or mild-moderate asthmatics, were significantly enriched in Actinobacteria, although the largest differences observed involved a Klebsiella genus member (7.8 fold-increase in severe asthma, padj < 0.001) Conclusions Specific microbiota are associated with and may modulate inflammatory processes in severe asthma and related phenotypes. Airway dysbiosis in severe asthma appears to differ from that observed in milder asthma in the setting of inhaled corticosteroid use. PMID:26220531

  9. The role of a groundwater bacterial community in the degradation of the herbicide terbuthylazine.

    PubMed

    Caracciolo, Anna Barra; Fajardo, Carmen; Grenni, Paola; Saccà, Maria Ludovica; Amalfitano, Stefano; Ciccoli, Roberto; Martin, Margarita; Gibello, Alicia

    2010-01-01

    A bacterial community in an aquifer contaminated by s-triazines was studied. Groundwater microcosms were treated with terbuthylazine at a concentration of 100 microg L(-1) and degradation of the herbicide was assessed. The bacterial community structure (abundance and phylogenetic composition) and function (carbon production and cell viability) were analysed. The bacterial community was able to degrade the terbuthylazine; in particular, Betaproteobacteria were involved in the herbicide biotransformation. Identification of some bacterial isolates by PCR amplification of the 16S rRNA gene revealed the presence of two Betaproteobacteria species able to degrade the herbicide: Advenella incenata and Janthinobacterium lividum. PCR detection of the genes encoding s-triazine-degrading enzymes indicated the presence of the atzA and atzB genes in A. incenata and the atzB and atzC genes in J. lividum. The nucleotide sequences of the PCR fragments of the atz genes from these strains were 100% identical to the homologous genes of the Pseudomonas sp. strain ADP. In conclusion, the results show the potential for the use of a natural attenuation strategy in the treatment of aquifers polluted with the terbuthylazine. The two bacteria isolated could facilitate the implementation of effective bioremediation protocols, especially in the case of the significant amounts of herbicide that can be found in groundwater as a result of accidental spills.

  10. Cytochrome cd1-containing nitrite reductase encoding gene nirS as a new functional biomarker for detection of anaerobic ammonium oxidizing (Anammox) bacteria.

    PubMed

    Li, Meng; Ford, Tim; Li, Xiaoyan; Gu, Ji-Dong

    2011-04-15

    A newly designed primer set (AnnirS), together with a previously published primer set (ScnirS), was used to detect anammox bacterial nirS genes from sediments collected from three marine environments. Phylogenetic analysis demonstrated that all retrieved sequences were clearly different from typical denitrifiers' nirS, but do group together with the known anammox bacterial nirS. Sequences targeted by ScnirS are closely related to Scalindua nirS genes recovered from the Peruvian oxygen minimum zone (OMZ), whereas sequences targeted by AnnirS are more closely affiliated with the nirS of Candidatus 'Kuenenia stuttgartiensis' and even form a new phylogenetic nirS clade, which might be related to other genera of the anammox bacteria. Analysis demonstrated that retrieved sequences had higher sequence identities (>60%) with known anammox bacterial nirS genes than with denitrifiers' nirS, on both nucleotide and amino acid levels. Compared to the 16S rRNA and hydrazine oxidoreductase (hzo) genes, the anammox bacterial nirS not only showed consistent phylogenetic relationships but also demonstrated more reliable quantification of anammox bacteria because of the single copy of the nirS gene in the anammox bacterial genome and the specificity of PCR primers for different genera of anammox bacteria, thus providing a suitable functional biomarker for investigation of anammox bacteria.

  11. Dynamics of Different Bacterial Communities Are Capable of Generating Sustainable Electricity from Microbial Fuel Cells with Organic Waste

    PubMed Central

    Yamamoto, Shuji; Suzuki, Kei; Araki, Yoko; Mochihara, Hiroki; Hosokawa, Tetsuya; Kubota, Hiroko; Chiba, Yusuke; Rubaba, Owen; Tashiro, Yosuke; Futamata, Hiroyuki

    2014-01-01

    The relationship between the bacterial communities in anolyte and anode biofilms and the electrochemical properties of microbial fuel cells (MFCs) was investigated when a complex organic waste-decomposing solution was continuously supplied to MFCs as an electron donor. The current density increased gradually and was maintained at approximately 100 to 150 mA m−2. Polarization curve analyses revealed that the maximum power density was 7.4 W m−3 with an internal resistance of 110 Ω. Bacterial community structures in the organic waste-decomposing solution and MFCs differed from each other. Clonal analyses targeting 16S rRNA genes indicated that bacterial communities in the biofilms on MFCs developed to specific communities dominated by novel Geobacter. Multidimensional scaling analyses based on DGGE profiles revealed that bacterial communities in the organic waste-decomposing solution fluctuated and had no dynamic equilibrium. Bacterial communities on the anolyte in MFCs had a dynamic equilibrium with fluctuations, while those of the biofilm converged to the Geobacter-dominated structure. These bacterial community dynamics of MFCs differed from those of control-MFCs under open circuit conditions. These results suggested that bacterial communities in the anolyte and biofilm have a gentle symbiotic system through electron flow, which resulted in the advance of current density from complex organic waste. PMID:24789988

  12. Dynamics of different bacterial communities are capable of generating sustainable electricity from microbial fuel cells with organic waste.

    PubMed

    Yamamoto, Shuji; Suzuki, Kei; Araki, Yoko; Mochihara, Hiroki; Hosokawa, Tetsuya; Kubota, Hiroko; Chiba, Yusuke; Rubaba, Owen; Tashiro, Yosuke; Futamata, Hiroyuki

    2014-01-01

    The relationship between the bacterial communities in anolyte and anode biofilms and the electrochemical properties of microbial fuel cells (MFCs) was investigated when a complex organic waste-decomposing solution was continuously supplied to MFCs as an electron donor. The current density increased gradually and was maintained at approximately 100 to 150 mA m(-2). Polarization curve analyses revealed that the maximum power density was 7.4 W m(-3) with an internal resistance of 110 Ω. Bacterial community structures in the organic waste-decomposing solution and MFCs differed from each other. Clonal analyses targeting 16S rRNA genes indicated that bacterial communities in the biofilms on MFCs developed to specific communities dominated by novel Geobacter. Multidimensional scaling analyses based on DGGE profiles revealed that bacterial communities in the organic waste-decomposing solution fluctuated and had no dynamic equilibrium. Bacterial communities on the anolyte in MFCs had a dynamic equilibrium with fluctuations, while those of the biofilm converged to the Geobacter-dominated structure. These bacterial community dynamics of MFCs differed from those of control-MFCs under open circuit conditions. These results suggested that bacterial communities in the anolyte and biofilm have a gentle symbiotic system through electron flow, which resulted in the advance of current density from complex organic waste.

  13. Parallel Histories of Horizontal Gene Transfer Facilitated Extreme Reduction of Endosymbiont Genomes in Sap-Feeding Insects

    PubMed Central

    Sloan, Daniel B.; Nakabachi, Atsushi; Richards, Stephen; Qu, Jiaxin; Murali, Shwetha Canchi; Gibbs, Richard A.; Moran, Nancy A.

    2014-01-01

    Bacteria confined to intracellular environments experience extensive genome reduction. In extreme cases, insect endosymbionts have evolved genomes that are so gene-poor that they blur the distinction between bacteria and endosymbiotically derived organelles such as mitochondria and plastids. To understand the host’s role in this extreme gene loss, we analyzed gene content and expression in the nuclear genome of the psyllid Pachypsylla venusta, a sap-feeding insect that harbors an ancient endosymbiont (Carsonella) with one of the most reduced bacterial genomes ever identified. Carsonella retains many genes required for synthesis of essential amino acids that are scarce in plant sap, but most of these biosynthetic pathways have been disrupted by gene loss. Host genes that are upregulated in psyllid cells housing Carsonella appear to compensate for endosymbiont gene losses, resulting in highly integrated metabolic pathways that mirror those observed in other sap-feeding insects. The host contribution to these pathways is mediated by a combination of native eukaryotic genes and bacterial genes that were horizontally transferred from multiple donor lineages early in the evolution of psyllids, including one gene that appears to have been directly acquired from Carsonella. By comparing the psyllid genome to a recent analysis of mealybugs, we found that a remarkably similar set of functional pathways have been shaped by independent transfers of bacterial genes to the two hosts. These results show that horizontal gene transfer is an important and recurring mechanism driving coevolution between insects and their bacterial endosymbionts and highlight interesting similarities and contrasts with the evolutionary history of mitochondria and plastids. PMID:24398322

  14. Proteomic analysis reveals novel extracellular virulence-associated proteins and functions regulated by the diffusible signal factor (DSF) in Xanthomonas oryzae pv. oryzicola.

    PubMed

    Qian, Guoliang; Zhou, Yijing; Zhao, Yancun; Song, Zhiwei; Wang, Suyan; Fan, Jiaqin; Hu, Baishi; Venturi, Vittorio; Liu, Fengquan

    2013-07-05

    Quorum sensing (QS) in Xanthomonas oryzae pv. oryzicola (Xoc), the causal agent of bacterial leaf streak, is mediated by the diffusible signal factor (DSF). DSF-mediating QS has been shown to control virulence and a set of virulence-related functions; however, the expression profiles and functions of extracellular proteins controlled by DSF signal remain largely unclear. In the present study, 33 DSF-regulated extracellular proteins, whose functions include small-protein mediating QS, oxidative adaptation, macromolecule metabolism, cell structure, biosynthesis of small molecules, intermediary metabolism, cellular process, protein catabolism, and hypothetical function, were identified by proteomics in Xoc. Of these, 15 protein encoding genes were in-frame deleted, and 4 of them, including three genes encoding type II secretion system (T2SS)-dependent proteins and one gene encoding an Ax21 (activator of XA21-mediated immunity)-like protein (a novel small-protein type QS signal) were determined to be required for full virulence in Xoc. The contributions of these four genes to important virulence-associated functions, including bacterial colonization, extracellular polysaccharide, cell motility, biofilm formation, and antioxidative ability, are presented. To our knowledge, our analysis is the first complete list of DSF-regulated extracellular proteins and functions in a Xanthomonas species. Our results show that DSF-type QS played critical roles in regulation of T2SS and Ax21-mediating QS, which sheds light on the role of DSF signaling in Xanthomonas.

  15. Identification of Pseudomonas syringae pathogens of Arabidopsis and a bacterial locus determining avirulence on both Arabidopsis and soybean.

    PubMed

    Whalen, M C; Innes, R W; Bent, A F; Staskawicz, B J

    1991-01-01

    To develop a model system for molecular genetic analysis of plant-pathogen interactions, we studied the interaction between Arabidopsis thaliana and the bacterial pathogen Pseudomonas syringae pv tomato (Pst). Pst strains were found to be virulent or avirulent on specific Arabidopsis ecotypes, and single ecotypes were resistant to some Pst strains and susceptible to others. In many plant-pathogen interactions, disease resistance is controlled by the simultaneous presence of single plant resistance genes and single pathogen avirulence genes. Therefore, we tested whether avirulence genes in Pst controlled induction of resistance in Arabidopsis. Cosmids that determine avirulence were isolated from Pst genomic libraries, and the Pst avirulence locus avrRpt2 was defined. This allowed us to construct pathogens that differed only by the presence or absence of a single putative avirulence gene. We found that Arabidopsis ecotype Col-0 was susceptible to Pst strain DC3000 but resistant to the same strain carrying avrRpt2, suggesting that a single locus in Col-0 determines resistance. As a first step toward genetically mapping the postulated resistance locus, an ecotype susceptible to infection by DC3000 carrying avrRpt2 was identified. The avrRpt2 locus from Pst was also moved into virulent strains of the soybean pathogen P. syringae pv glycinea to test whether this locus could determine avirulence on soybean. The resulting strains induced a resistant response in a cultivar-specific manner, suggesting that similar resistance mechanisms may function in Arabidopsis and soybean.

  16. Bacterial DNA indicated as an important inducer of fish cathelicidins.

    PubMed

    Maier, Valerie Helene; Schmitt, Clemens Nikolaus Zeno; Gudmundsdottir, Sigridur; Gudmundsson, Gudmundur Hrafn

    2008-04-01

    Cathelicidins are antimicrobial peptides indicated as important in the control of the natural microflora as well as in the fight against bacterial invasion in mammals. Little is known about cathelicidins in fish and here the Chinook salmon (Oncorhynchus tshawytscha) embryo cell line (CHSE-214) was used as a model system to study the expression of cathelicidins due to fish pathogenic bacteria. The cDNA of cathelicidin from CHSE-214 cells (csCath) was cloned and shown to be closely related to gene 2 of both rainbow trout and Atlantic salmon. The deducted amino acid sequence showed highest sequence identity to rtCath2 with 95% and 72% for the cathelin and the antibacterial part, respectively. Cathelicidin gene expression was studied and various Gram positive and Gram negative bacteria caused the upregulation of the gene (csCath). Bacterial DNA and protein were shown important for the induction of cathelicidin expression in these cells. LPS (Escherichia coli) also causes the upregulation of cathelicidins, but digestion of the LPS with DNase I before incubation of the cells, totally abolished the upregulation of cathelicidin and suggests DNA contamination in the LPS to be the trigger for this effect. These results could explain the limited responsiveness of fish cells towards pure LPS and confirm previous suggestions that fish cells are less sensitive to LPS than mammalian cells.

  17. Transport of Magnesium by a Bacterial Nramp-Related Gene

    PubMed Central

    Rodionov, Dmitry A.; Freedman, Benjamin G.; Senger, Ryan S.; Winkler, Wade C.

    2014-01-01

    Magnesium is an essential divalent metal that serves many cellular functions. While most divalent cations are maintained at relatively low intracellular concentrations, magnesium is maintained at a higher level (∼0.5–2.0 mM). Three families of transport proteins were previously identified for magnesium import: CorA, MgtE, and MgtA/MgtB P-type ATPases. In the current study, we find that expression of a bacterial protein unrelated to these transporters can fully restore growth to a bacterial mutant that lacks known magnesium transporters, suggesting it is a new importer for magnesium. We demonstrate that this transport activity is likely to be specific rather than resulting from substrate promiscuity because the proteins are incapable of manganese import. This magnesium transport protein is distantly related to the Nramp family of proteins, which have been shown to transport divalent cations but have never been shown to recognize magnesium. We also find gene expression of the new magnesium transporter to be controlled by a magnesium-sensing riboswitch. Importantly, we find additional examples of riboswitch-regulated homologues, suggesting that they are a frequent occurrence in bacteria. Therefore, our aggregate data discover a new and perhaps broadly important path for magnesium import and highlight how identification of riboswitch RNAs can help shed light on new, and sometimes unexpected, functions of their downstream genes. PMID:24968120

  18. Metagenomic Characterization of Antibiotic Resistance Genes in Full-Scale Reclaimed Water Distribution Systems and Corresponding Potable Systems.

    PubMed

    Garner, Emily; Chen, Chaoqi; Xia, Kang; Bowers, Jolene; Engelthaler, David M; McLain, Jean; Edwards, Marc A; Pruden, Amy

    2018-06-05

    Water reclamation provides a valuable resource for meeting nonpotable water demands. However, little is known about the potential for wastewater reuse to disseminate antibiotic resistance genes (ARGs). Here, samples were collected seasonally in 2014-2015 from four U.S. utilities' reclaimed and potable water distribution systems before treatment, after treatment, and at five points of use (POU). Shotgun metagenomic sequencing was used to profile the resistome (i.e., full contingent of ARGs) of a subset ( n = 38) of samples. Four ARGs ( qnrA, bla TEM , vanA, sul1) were quantified by quantitative polymerase chain reaction. Bacterial community composition (via 16S rRNA gene amplicon sequencing), horizontal gene transfer (via quantification of intI1 integrase and plasmid genes), and selection pressure (via detection of metals and antibiotics) were investigated as potential factors governing the presence of ARGs. Certain ARGs were elevated in all ( sul1; p ≤ 0.0011) or some ( bla TEM , qnrA; p ≤ 0.0145) reclaimed POU samples compared to corresponding potable samples. Bacterial community composition was weakly correlated with ARGs (Adonis, R 2 = 0.1424-0.1734) and associations were noted between 193 ARGs and plasmid-associated genes. This study establishes that reclaimed water could convey greater abundances of certain ARGs than potable waters and provides observations regarding factors that likely control ARG occurrence in reclaimed water systems.

  19. Pyramiding transgenes for multiple resistance in rice against bacterial blight, yellow stem borer and sheath blight.

    PubMed

    Datta, K; Baisakh, N; Thet, K Maung; Tu, J; Datta, S K

    2002-12-01

    Here we describe the development of transgene-pyramided stable elite rice lines resistant to disease and insect pests by conventional crossing of two transgenic parental lines transformed independently with different genes. The Xa21 gene (resistance to bacterial blight), the Bt fusion gene (for insect resistance) and the chitinase gene (for tolerance of sheath blight) were combined in a single rice line by reciprocal crossing of two transgenic homozygous IR72 lines. F4 plant lines carrying all the genes of interest stably were identified using molecular methods. The identified lines, when exposed to infection caused by Xanthomonas oryzae pv oryzae, showed resistance to bacterial blight. Neonate larval mortality rates of yellow stem borer ( Scirpophaga incertulas) in an insect bioassay of the same identified lines were 100%. The identified line pyramided with different genes to protect against yield loss showed high tolerance of sheath blight disease caused by Rhizoctonia solani.

  20. The Transcriptional Response of Drosophila melanogaster to Infection with the Sigma Virus (Rhabdoviridae)

    PubMed Central

    Baines, John F.; Roller, Julia; Saminadin-Peter, Sarah S.; Parsch, John; Jiggins, Francis M.

    2009-01-01

    Background Bacterial and fungal infections induce a potent immune response in Drosophila melanogaster, but it is unclear whether viral infections induce an antiviral immune response. Using microarrays, we examined the changes in gene expression in Drosophila that occur in response to infection with the sigma virus, a negative-stranded RNA virus (Rhabdoviridae) that occurs in wild populations of D. melanogaster. Principal Findings We detected many changes in gene expression in infected flies, but found no evidence for the activation of the Toll, IMD or Jak-STAT pathways, which control immune responses against bacteria and fungi. We identified a number of functional categories of genes, including serine proteases, ribosomal proteins and chorion proteins that were overrepresented among the differentially expressed genes. We also found that the sigma virus alters the expression of many more genes in males than in females. Conclusions These data suggest that either Drosophila do not mount an immune response against the sigma virus, or that the immune response is not controlled by known immune pathways. If the latter is true, the genes that we identified as differentially expressed after infection are promising candidates for controlling the host's response to the sigma virus. PMID:19718442

  1. The transcriptional response of Drosophila melanogaster to infection with the sigma virus (Rhabdoviridae).

    PubMed

    Carpenter, Jennifer; Hutter, Stephan; Baines, John F; Roller, Julia; Saminadin-Peter, Sarah S; Parsch, John; Jiggins, Francis M

    2009-08-31

    Bacterial and fungal infections induce a potent immune response in Drosophila melanogaster, but it is unclear whether viral infections induce an antiviral immune response. Using microarrays, we examined the changes in gene expression in Drosophila that occur in response to infection with the sigma virus, a negative-stranded RNA virus (Rhabdoviridae) that occurs in wild populations of D. melanogaster. We detected many changes in gene expression in infected flies, but found no evidence for the activation of the Toll, IMD or Jak-STAT pathways, which control immune responses against bacteria and fungi. We identified a number of functional categories of genes, including serine proteases, ribosomal proteins and chorion proteins that were overrepresented among the differentially expressed genes. We also found that the sigma virus alters the expression of many more genes in males than in females. These data suggest that either Drosophila do not mount an immune response against the sigma virus, or that the immune response is not controlled by known immune pathways. If the latter is true, the genes that we identified as differentially expressed after infection are promising candidates for controlling the host's response to the sigma virus.

  2. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing.

    PubMed

    Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  3. Genetic Diversity of Bacterial Communities and Gene Transfer Agents in Northern South China Sea

    PubMed Central

    Sun, Fu-Lin; Wang, You-Shao; Wu, Mei-Lin; Jiang, Zhao-Yu; Sun, Cui-Ci; Cheng, Hao

    2014-01-01

    Pyrosequencing of the 16S ribosomal RNA gene (rDNA) amplicons was performed to investigate the unique distribution of bacterial communities in northern South China Sea (nSCS) and evaluate community structure and spatial differences of bacterial diversity. Cyanobacteria, Proteobacteria, Actinobacteria, and Bacteroidetes constitute the majority of bacteria. The taxonomic description of bacterial communities revealed that more Chroococcales, SAR11 clade, Acidimicrobiales, Rhodobacterales, and Flavobacteriales are present in the nSCS waters than other bacterial groups. Rhodobacterales were less abundant in tropical water (nSCS) than in temperate and cold waters. Furthermore, the diversity of Rhodobacterales based on the gene transfer agent (GTA) major capsid gene (g5) was investigated. Four g5 gene clone libraries were constructed from samples representing different regions and yielded diverse sequences. Fourteen g5 clusters could be identified among 197 nSCS clones. These clusters were also related to known g5 sequences derived from genome-sequenced Rhodobacterales. The composition of g5 sequences in surface water varied with the g5 sequences in the sampling sites; this result indicated that the Rhodobacterales population could be highly diverse in nSCS. Phylogenetic tree analysis result indicated distinguishable diversity patterns among tropical (nSCS), temperate, and cold waters, thereby supporting the niche adaptation of specific Rhodobacterales members in unique environments. PMID:25364820

  4. Exploring the Abundance and Diversity of Bacterial Communities and Quantifying Antibiotic-Related Genes Along an Elevational Gradient in Taibai Mountain, China.

    PubMed

    Peng, Chu; Wang, He; Jiang, Yingying; Yang, Jinhua; Lai, Hangxian; Wei, Xiaomin

    2018-05-10

    Thus far, no studies have investigated the soil microbial diversity over an elevational gradient in Taibai Mountain, the central massif of the Qinling Mountain Range. Here, we used Illumina sequencing and quantitative PCR of the 16S rRNA gene to assess the diversity and abundance of bacterial communities along an elevational gradient in representative vegetation soils in Taibai Mountain. We identified the soil, climate, and vegetation factors driving the variations in soil bacterial community structure by Pearson correlation and redundancy analysis. We also evaluated the potential for antibiotic discovery by quantitative PCR of the PKS-I, PKS-II, and NRPS genes from Actinobacteria. The results showed that soil bacterial alpha diversity increased first and then decreased with an elevational rise in both the northern and southern slopes of Taibai Mountain. The bacterial abundance was significantly correlated with soil organic matter and nitrate nitrogen. The average relative abundance of Actinobacteria in Taibai Mountain was markedly higher than those in other mountain forest soils. The absolute abundance of PKS and NPRS gene was significantly higher in the tested soils compared with the gene copy numbers reported in tropical urban soils. Taibai Mountain is rich in actinomycete resources and has great potential for antibiotic excavation.

  5. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    PubMed Central

    Naveed, Muhammad; Mubeen, Samavia; khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935

  6. Diurnal cycling of rhizosphere bacterial communities is associated with shifts in carbon metabolism

    DOE PAGES

    Staley, Christopher; Ferrieri, Abigail P.; Tfaily, Malak M.; ...

    2017-06-24

    The circadian clock regulates plant metabolic functions and is an important component in plant health and productivity. Rhizosphere bacteria play critical roles in plant growth, health, and development and are shaped primarily by soil communities. Using Illumina next-generation sequencing and high-resolution mass spectrometry, we characterized bacterial communities of wild-type (Col-0) Arabidopsis thaliana and an acyclic line (OX34) ectopically expressing the circadian clock-associated cca1 transcription factor, relative to a soil control, to determine how cycling dynamics affected the microbial community. Microbial communities associated with Brachypodium distachyon (BD21) were also evaluated.Significantly different bacterial community structures ( P = 0.031) were observed inmore » the rhizosphere of wild-type plants between light and dark cycle samples. Furthermore, 13% of the community showed cycling, with abundances of several families, including Burkholderiaceae, Rhodospirillaceae, Planctomycetaceae, and Gaiellaceae, exhibiting fluctuation in abundances relative to the light cycle. However, limited-to-no cycling was observed in the acyclic CCAox34 line or in soil controls. Significant cycling was also observed, to a lesser extent, in Brachypodium. Functional gene inference revealed that genes involved in carbohydrate metabolism were likely more abundant in near-dawn, dark samples. Additionally, the composition of organic matter in the rhizosphere showed a significant variation between dark and light cycles.The results of this study suggest that the rhizosphere bacterial community is regulated, to some extent, by the circadian clock and is likely influenced by, and exerts influences, on plant metabolism and productivity. The timing of bacterial cycling in relation to that of Arabidopsis further suggests that diurnal dynamics influence plant-microbe carbon metabolism and exchange. Equally important, our results suggest that previous studies done without relevance to time of day may need to be reevaluated with regard to the impact of diurnal cycles on the rhizosphere microbial community.« less

  7. Diurnal cycling of rhizosphere bacterial communities is associated with shifts in carbon metabolism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Staley, Christopher; Ferrieri, Abigail P.; Tfaily, Malak M.

    The circadian clock regulates plant metabolic functions and is an important component in plant health and productivity. Rhizosphere bacteria play critical roles in plant growth, health, and development and are shaped primarily by soil communities. Using Illumina next-generation sequencing and high-resolution mass spectrometry, we characterized bacterial communities of wild-type (Col-0) Arabidopsis thaliana and an acyclic line (OX34) ectopically expressing the circadian clock-associated cca1 transcription factor, relative to a soil control, to determine how cycling dynamics affected the microbial community. Microbial communities associated with Brachypodium distachyon (BD21) were also evaluated.Significantly different bacterial community structures ( P = 0.031) were observed inmore » the rhizosphere of wild-type plants between light and dark cycle samples. Furthermore, 13% of the community showed cycling, with abundances of several families, including Burkholderiaceae, Rhodospirillaceae, Planctomycetaceae, and Gaiellaceae, exhibiting fluctuation in abundances relative to the light cycle. However, limited-to-no cycling was observed in the acyclic CCAox34 line or in soil controls. Significant cycling was also observed, to a lesser extent, in Brachypodium. Functional gene inference revealed that genes involved in carbohydrate metabolism were likely more abundant in near-dawn, dark samples. Additionally, the composition of organic matter in the rhizosphere showed a significant variation between dark and light cycles.The results of this study suggest that the rhizosphere bacterial community is regulated, to some extent, by the circadian clock and is likely influenced by, and exerts influences, on plant metabolism and productivity. The timing of bacterial cycling in relation to that of Arabidopsis further suggests that diurnal dynamics influence plant-microbe carbon metabolism and exchange. Equally important, our results suggest that previous studies done without relevance to time of day may need to be reevaluated with regard to the impact of diurnal cycles on the rhizosphere microbial community.« less

  8. Predicting effects of climate change on the composition and function of soil microbial communities

    NASA Astrophysics Data System (ADS)

    Dubinsky, E.; Brodie, E.; Myint, C.; Ackerly, D.; van Nostrand, J.; Bird, J.; Zhou, J.; Andersen, G.; Firestone, M.

    2008-12-01

    Complex soil microbial communities regulate critical ecosystem processes that will be altered by climate change. A critical step towards predicting the impacts of climate change on terrestrial ecosystems is to determine the primary controllers of soil microbial community composition and function, and subsequently evaluate climate change scenarios that alter these controllers. We surveyed complex soil bacterial and archaeal communities across a range of climatic and edaphic conditions to identify critical controllers of soil microbial community composition in the field and then tested the resulting predictions using a 2-year manipulation of precipitation and temperature using mesocosms of California annual grasslands. Community DNA extracted from field soils sampled from six different ecosystems was assayed for bacterial and archaeal communities using high-density phylogenetic microarrays as well as functional gene arrays. Correlations among the relative abundances of thousands of microbial taxa and edaphic factors such as soil moisture and nutrient content provided a basis for predicting community responses to changing soil conditions. Communities of soil bacteria and archaea were strongly structured by single environmental predictors, particularly variables related to soil water. Bacteria in the Actinomycetales and Bacilli consistently demonstrated a strong negative response to increasing soil moisture, while taxa in a greater variety of lineages responded positively to increasing soil moisture. In the climate change experiment, overall bacterial community structure was impacted significantly by total precipitation but not by plant species. Changes in soil moisture due to decreased rainfall resulted in significant and predictable alterations in community structure. Over 70% of the bacterial taxa in common with the cross-ecosystem study responded as predicted to altered precipitation, with the most conserved response from Actinobacteria. The functional consequences of these predictable changes in community composition were measured with functional arrays that detect genes involved in the metabolism of carbon, nitrogen and other elements. The response of soil microbial communities to altered precipitation can be predicted from the distribution of microbial taxa across moisture gradients.

  9. Extracellular Enzyme Activity Profile in a Chemically Enhanced Water Accommodated Fraction of Surrogate Oil: Toward Understanding Microbial Activities After the Deepwater Horizon Oil Spill

    PubMed Central

    Kamalanathan, Manoj; Xu, Chen; Schwehr, Kathy; Bretherton, Laura; Beaver, Morgan; Doyle, Shawn M.; Genzer, Jennifer; Hillhouse, Jessica; Sylvan, Jason B.; Santschi, Peter; Quigg, Antonietta

    2018-01-01

    Extracellular enzymes and extracellular polymeric substances (EPS) play a key role in overall microbial activity, growth and survival in the ocean. EPS, being amphiphilic in nature, can act as biological surfactant in an oil spill situation. Extracellular enzymes help microbes to digest and utilize fractions of organic matter, including EPS, which can stimulate growth and enhance microbial activity. These natural processes might have been altered during the 2010 Deepwater Horizon oil spill due to the presence of hydrocarbon and dispersant. This study aims to investigate the role of bacterial extracellular enzymes during exposure to hydrocarbons and dispersant. Mesocosm studies were conducted using a water accommodated fraction of oil mixed with the chemical dispersant, Corexit (CEWAF) in seawater collected from two different locations in the Gulf of Mexico and corresponding controls (no additions). Activities of five extracellular enzymes typically found in the EPS secreted by the microbial community – α- and β-glucosidase, lipase, alkaline phosphatase, leucine amino-peptidase – were measured using fluorogenic substrates in three different layers of the mesocosm tanks (surface, water column and bottom). Enhanced EPS production and extracellular enzyme activities were observed in the CEWAF treatment compared to the Control. Higher bacterial and micro-aggregate counts were also observed in the CEWAF treatment compared to Controls. Bacterial genera in the order Alteromonadaceae were the most abundant bacterial 16S rRNA amplicons recovered. Genomes of Alteromonadaceae commonly have alkaline phosphatase and leucine aminopeptidase, therefore they may contribute significantly to the measured enzyme activities. Only Alteromonadaceae and Pseudomonadaceae among bacteria detected here have higher percentage of genes for lipase. Piscirickettsiaceae was abundant; genomes from this order commonly have genes for leucine aminopeptidase. Overall, this study provides insights into the alteration to the microbial processes such as EPS and extracellular enzyme production, and to the microbial community, when exposed to the mixture of oil and dispersant. PMID:29740422

  10. The association of DNA damage response and nucleotide level modulation with the antibacterial mechanism of the anti-folate drug trimethoprim.

    PubMed

    Sangurdekar, Dipen P; Zhang, Zhigang; Khodursky, Arkady B

    2011-11-28

    Trimethoprim is a widely prescribed antibiotic for a variety of bacterial infections. It belongs to a class of anti-metabolites - antifolates - which includes drugs used against malarial parasites and in cancer therapy. However, spread of bacterial resistance to the drug has severely hampered its clinical use and has necessitated further investigations into its mechanism of action and treatment regimen. Trimethoprim selectively starves bacterial cells for tetrahydrofolate, a vital cofactor necessary for the synthesis of several metabolites. The outcome (bacteriostatic or bactericidal) of such starvation, however, depends on the availability of folate-dependent metabolites in the growth medium. To characterize this dependency, we investigated in detail the regulatory and structural components of Escherichia coli cellular response to trimethoprim in controlled growth and supplementation conditions. We surveyed transcriptional responses to trimethoprim treatment during bacteriostatic and bactericidal conditions and analyzed associated gene sets/pathways. Concurrent starvation of all folate dependent metabolites caused growth arrest, and this was accompanied by induction of general stress and stringent responses. Three gene sets were significantly associated with the bactericidal effect of TMP in different media including LB: genes of the SOS regulon, genes of the pyrimidine nucleotide biosynthetic pathway and members of the multiple antibiotic resistance (mar) regulon controlled by the MarR repressor. However, the SOS response was identified as the only universal transcriptional signature associated with the loss of viability by direct thymine starvation or by folate stress. We also used genome-wide gene knock-out screen to uncover means of sensitization of bacteria to the drug. We observed that among a number of candidate genes and pathways, the effect of knock-outs in the deoxyribose nucleotide salvage pathway, encoded by the deoCABD operon and under the control of the DeoR repressor, was most informative. Transcriptional induction of DNA damage response is an essential feature of the bactericidal effect of trimethoprim. Either the observation of the transcriptional response or DNA damage itself, or both, is made possible by thymine starvation when other folate-dependent metabolites are not limited. The effect of DNA damage by the drug takes place prior to its bactericidal effect, at the beginning of the lag stage of the treatment. Mutations in the deoxyribose nucleotide salvage pathway can affect duration of the lag as well as the rate of killing. This information can be used to postulate certain mechanistic differences between direct thymine starvation in thymidylate synthase deficient mutants and thymine starvation by anti-folate inhibitors. © 2011 Sangurdekar et al; licensee BioMed Central Ltd.

  11. Elevated Air Humidity Changes Soil Bacterial Community Structure in the Silver Birch Stand.

    PubMed

    Truu, Marika; Ostonen, Ivika; Preem, Jens-Konrad; Lõhmus, Krista; Nõlvak, Hiie; Ligi, Teele; Rosenvald, Katrin; Parts, Kaarin; Kupper, Priit; Truu, Jaak

    2017-01-01

    Soil microbes play a fundamental role in forest ecosystems and respond rapidly to changes in the environment. Simultaneously with the temperature increase the climate change scenarios also predict an intensified hydrological cycle for the Baltic Sea runoff region. The aim of this study was to assess the effect of elevated air humidity on the top soil microbial community structure of a silver birch ( Betula pendula Roth.) stand by using a free air humidity manipulation facility (FAHM). The bacterial community structures of bulk soil and birch rhizosphere were analyzed using high-throughput sequencing of bacteria-specific16S rRNA gene fragments and quantification of denitrification related genes. The increased air humidity altered both bulk soil and rhizosphere bacterial community structures, and changes in the bacterial communities initiated by elevated air humidity were related to modified soil abiotic and biotic variables. Network analysis revealed that variation in soil bacterial community structural units is explained by altered abiotic conditions such as increased pH value in bulk soil, while in rhizosphere the change in absorptive root morphology had a higher effect. Among root morphological traits, the absorptive root diameter was strongest related to the bacterial community structure. The changes in bacterial community structures under elevated air humidity are associated with shifts in C, N, and P turnover as well as mineral weathering processes in soil. Increased air humidity decreased the nir and nosZ gene abundance in the rhizosphere bacterial community. The potential contribution of the denitrification to the N 2 O emission was not affected by the elevated air humidity in birch stand soil. In addition, the study revealed a strong link between the bacterial community structure, abundance of denitrification related genes, and birch absorptive root morphology in the ecosystem system adaptation to elevated air humidity.

  12. Elevated Air Humidity Changes Soil Bacterial Community Structure in the Silver Birch Stand

    PubMed Central

    Truu, Marika; Ostonen, Ivika; Preem, Jens-Konrad; Lõhmus, Krista; Nõlvak, Hiie; Ligi, Teele; Rosenvald, Katrin; Parts, Kaarin; Kupper, Priit; Truu, Jaak

    2017-01-01

    Soil microbes play a fundamental role in forest ecosystems and respond rapidly to changes in the environment. Simultaneously with the temperature increase the climate change scenarios also predict an intensified hydrological cycle for the Baltic Sea runoff region. The aim of this study was to assess the effect of elevated air humidity on the top soil microbial community structure of a silver birch (Betula pendula Roth.) stand by using a free air humidity manipulation facility (FAHM). The bacterial community structures of bulk soil and birch rhizosphere were analyzed using high-throughput sequencing of bacteria-specific16S rRNA gene fragments and quantification of denitrification related genes. The increased air humidity altered both bulk soil and rhizosphere bacterial community structures, and changes in the bacterial communities initiated by elevated air humidity were related to modified soil abiotic and biotic variables. Network analysis revealed that variation in soil bacterial community structural units is explained by altered abiotic conditions such as increased pH value in bulk soil, while in rhizosphere the change in absorptive root morphology had a higher effect. Among root morphological traits, the absorptive root diameter was strongest related to the bacterial community structure. The changes in bacterial community structures under elevated air humidity are associated with shifts in C, N, and P turnover as well as mineral weathering processes in soil. Increased air humidity decreased the nir and nosZ gene abundance in the rhizosphere bacterial community. The potential contribution of the denitrification to the N2O emission was not affected by the elevated air humidity in birch stand soil. In addition, the study revealed a strong link between the bacterial community structure, abundance of denitrification related genes, and birch absorptive root morphology in the ecosystem system adaptation to elevated air humidity. PMID:28421053

  13. Statistical Analysis of Hurst Exponents of Essential/Nonessential Genes in 33 Bacterial Genomes

    PubMed Central

    Liu, Xiao; Wang, Baojin; Xu, Luo

    2015-01-01

    Methods for identifying essential genes currently depend predominantly on biochemical experiments. However, there is demand for improved computational methods for determining gene essentiality. In this study, we used the Hurst exponent, a characteristic parameter to describe long-range correlation in DNA, and analyzed its distribution in 33 bacterial genomes. In most genomes (31 out of 33) the significance levels of the Hurst exponents of the essential genes were significantly higher than for the corresponding full-gene-set, whereas the significance levels of the Hurst exponents of the nonessential genes remained unchanged or increased only slightly. All of the Hurst exponents of essential genes followed a normal distribution, with one exception. We therefore propose that the distribution feature of Hurst exponents of essential genes can be used as a classification index for essential gene prediction in bacteria. For computer-aided design in the field of synthetic biology, this feature can build a restraint for pre- or post-design checking of bacterial essential genes. Moreover, considering the relationship between gene essentiality and evolution, the Hurst exponents could be used as a descriptive parameter related to evolutionary level, or be added to the annotation of each gene. PMID:26067107

  14. Genome wide analysis of the complete GlnR nitrogen-response regulon in Mycobacterium smegmatis

    PubMed Central

    2013-01-01

    Background Nitrogen is an essential element for bacterial growth and an important component of biological macromolecules. Consequently, responding to nitrogen limitation is critical for bacterial survival and involves the interplay of signalling pathways and transcriptional regulation of nitrogen assimilation and scavenging genes. In the soil dwelling saprophyte Mycobacterium smegmatis the OmpR-type response regulator GlnR is thought to mediate the transcriptomic response to nitrogen limitation. However, to date only ten genes have been shown to be in the GlnR regulon, a vastly reduced number compared to other organisms. Results We investigated the role of GlnR in the nitrogen limitation response and determined the entire GlnR regulon, by combining expression profiling of M. smegmatis wild type and glnR deletion mutant, with GlnR-specific chromatin immunoprecipitation and high throughput sequencing. We identify 53 GlnR binding sites during nitrogen limitation that control the expression of over 100 genes, demonstrating that GlnR is the regulator controlling the assimilation and utilisation of nitrogen. We also determine a consensus GlnR binding motif and identify key residues within the motif that are required for specific GlnR binding. Conclusions We have demonstrated that GlnR is the global nitrogen response regulator in M. smegmatis, directly regulating the expression of more than 100 genes. GlnR controls key nitrogen stress survival processes including primary nitrogen metabolism pathways, the ability to utilise nitrate and urea as alternative nitrogen sources, and the potential to use cellular components to provide a source of ammonium. These studies further our understanding of how mycobacteria survive nutrient limiting conditions. PMID:23642041

  15. The positioning logic and copy number control of genes in bacteria under stress

    NASA Astrophysics Data System (ADS)

    Zhang, Qiucen; Austin, Robert; Vyawahare, Saurabh; Lau, Alexandra

    2013-03-01

    Escherichia coli (E. coli) cells when challenged with sublethal concentrations of the genotoxic antibiotic ciprofloxacin cease to divide and form long filaments which contain multiple bacterial chromosomes. These filaments are individual mesoscopic environmental niches which provide protection for a community of chromosomes (as opposed to cells) under mutagenic stress and can provide an evolutionary fitness advantage within the niche. We use comparative genomic hybridization to show that the mesoscopic niche evolves within 20 minutes of ciprofloxacin exposure via replication of multiple copies of genes expressing ATP dependent transporters. We show that this rapid genomic amplification is done in a time efficient manner via placement of the genes encoding the pumps near the origin of replication on the bacterial chromosome. The de-amplification of multiple copies back to the wild type number is a function of the duration is a function of the ciprofloxacin exposure duration: the longer the exposure, the slower the removal of the multiple copies. The project described was supported by the National Science Foundation and the National Cancer Institute

  16. Psychrophile spoilers dominate the bacterial microbiome in musculature samples of slaughter pigs.

    PubMed

    Mann, Evelyne; Wetzels, Stefanie U; Pinior, Beate; Metzler-Zebeli, Barbara U; Wagner, Martin; Schmitz-Esser, Stephan

    2016-07-01

    The aim of this study was to disentangle the microbial diversity on porcine musculature. The hypervariable V1-V2 region of the 16S rRNA gene was amplified from DNA samples of clinically healthy slaughter pigs (n=8). Pyrosequencing yielded 37,000 quality-controlled reads and a diverse microbiome with 54-159 OTUs per sample was detected. Interestingly, 6 out of 8 samples were strongly dominated by 1-2 highly abundant OTUs (best hits of highly abundant OTUs: Serratia proteamaculans, Pseudomonas syringae, Aeromonas allosaccharophila, Brochothrix thermosphacta, Acidiphilium cryptum and Escherichia coli). In 1g musculature scraping, 3.20E+06 16S rRNA gene copies and 4.45E+01 Enterobacteriaceae rRNA gene copies were detected with qPCR. We conclude that i.) next-generation sequencing technologies help encompass the full content of complex, bacterial contamination, ii.) psychrophile spoilers dominated the microbiota and iii.) E. coli is an effective marker species for pork contamination, as it was one of very few abundant species being present in all samples. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. High-throughput quantitative luminescence assay of the growth in planta of Pseudomonas syringae chromosomally tagged with Photorhabdus luminescens luxCDABE.

    PubMed

    Fan, Jun; Crooks, Casey; Lamb, Chris

    2008-01-01

    Bioluminescent strains of the Arabidopsis thaliana pathogens Pseudomonas syringae pathovar (pv.) tomato and pv. maculicola were made by insertion of the luxCDABE operon from Photorhabdus luminescens into the P. syringae chromosome under the control of a constitutive promoter. Stable integration of luxCDABE did not affect bacterial fitness, growth in planta or disease outcome. Luminescence accurately and reliably reported bacterial growth in infected Arabidopsis leaves both with a fixed inoculum followed over time and with varying inocula assayed at a single time point. Furthermore, the bioluminescence assay could detect a small (1.3-fold) difference in bacterial growth between different plant genotypes with a precision comparable to that of the standard plate assay. Luminescence of luxCDABE-tagged P. syringae allows rapid and convenient quantification of bacterial growth without the tissue extraction, serial dilution, plating and manual scoring involved in standard assays of bacterial growth by colony formation in plate culture of samples from infected tissue. The utility of the bioluminescence assay was illustrated by surveying the 500-fold variation in growth of the universally virulent P. syringae pv. maculicola ES4326 among more than 100 Arabidopsis ecotypes and identification of two quantitative trait loci accounting for 48% and 16%, respectively, of the variance of basal resistance to P. syringae pv. tomato DC3000 in the Col-0 x Fl-1 F(2) population. Luminescence assay of bacteria chromosomally tagged with luxCDABE should greatly facilitate the genetic dissection of quantitative differences in gene-for-gene, basal and acquired disease resistance and other aspects of plant interactions with bacterial pathogens requiring high-throughput assays or large-scale quantitative screens.

  18. Small protein-mediated quorum sensing in a gram-negative bacterium: novel targets for control of infectious disease.

    PubMed

    Ronald, Pamela C

    2011-12-01

    Control of Gram-negative bacterial infections of plants and animals remains a major challenge because conventional approaches are often not sufficient to eradicate these infections. One major reason for their persistence seems to be the capability of the bacteria to grow within biofilms that protect them from adverse environmental factors. Quorum sensing (QS) plays an important role in the formation of biofilms. In QS, small molecules serve as signals to recognize bacterial cell population size, leading to changes in expression of specific genes when a signal has accumulated to some threshold concentration. The small protein Ax21 (Activator of XA21-mediated immunity), serves as a QS factor that regulates biofilm formation and virulence in the Gram-negative bacterium, Xanthomonas oryzae pv. oryzae. Knowledge of small protein-mediated QS in Gram-negative bacteria can be used to develop new methods to control persistent Gram-negative infections. © Discovery Medicine

  19. Bacterial diversity in permanently cold and alkaline ikaite columns from Greenland.

    PubMed

    Schmidt, Mariane; Priemé, Anders; Stougaard, Peter

    2006-12-01

    Bacterial diversity in alkaline (pH 10.4) and permanently cold (4 degrees C) ikaite tufa columns from the Ikka Fjord, SW Greenland, was investigated using growth characterization of cultured bacterial isolates with Terminal-restriction fragment length polymorphism (T-RFLP) and sequence analysis of bacterial 16S rRNA gene fragments. More than 200 bacterial isolates were characterized with respect to pH and temperature tolerance, and it was shown that the majority were cold-active alkaliphiles. T-RFLP analysis revealed distinct bacterial communities in different fractions of three ikaite columns, and, along with sequence analysis, it showed the presence of rich and diverse bacterial communities. Rarefaction analysis showed that the 109 sequenced clones in the 16S rRNA gene library represented between 25 and 65% of the predicted species richness in the three ikaite columns investigated. Phylogenetic analysis of the 16S rRNA gene sequences revealed many sequences with similarity to alkaliphilic or psychrophilic bacteria, and showed that 33% of the cloned sequences and 33% of the cultured bacteria showed less than 97% sequence identity to known sequences in databases, and may therefore represent yet unknown species.

  20. Relationship of the luminous bacterial symbiont of the Caribbean flashlight fish, Kryptophanaron alfredi (family Anomalopidae) to other luminous bacteria based on bacterial luciferase (luxA) genes.

    PubMed

    Haygood, M G

    1990-01-01

    Flashlight fishes (family Anomalopidae) have light organs that contain luminous bacterial symbionts. Although the symbionts have not yet been successfully cultured, the luciferase genes have been cloned directly from the light organ of the Caribbean species, Kryptophanaron alfredi. The goal of this project was to evaluate the relationship of the symbiont to free-living luminous bacteria by comparison of genes coding for bacterial luciferase (lux genes). Hybridization of a lux AB probe from the Kryptophanaron alfredi symbiont to DNAs from 9 strains (8 species) of luminous bacteria showed that none of the strains tested had lux genes highly similar to the symbiont. The most similar were a group consisting of Vibrio harveyi, Vibrio splendidus and Vibrio orientalis. The nucleotide sequence of the luciferase alpha subunit gene luxA) of the Kryptophanaron alfredi symbiont was determined in order to do a more detailed comparison with published luxA sequences from Vibrio harveyi, Vibrio fischeri and Photobacterium leiognathi. The hybridization results, sequence comparisons and the mol% G + C of the Kryptophanaron alfredi symbiont luxA gene suggest that the symbiont may be considered as a new species of luminous Vibrio related to Vibrio harveyi.

  1. LPS-induced expression of CD14 in the TRIF pathway is epigenetically regulated by sulforaphane in porcine pulmonary alveolar macrophages.

    PubMed

    Yang, Qin; Pröll, Maren J; Salilew-Wondim, Dessie; Zhang, Rui; Tesfaye, Dawit; Fan, Huitao; Cinar, Mehmet U; Große-Brinkhaus, Christine; Tholen, Ernst; Islam, Mohammad A; Hölker, Michael; Schellander, Karl; Uddin, Muhammad J; Neuhoff, Christiane

    2016-11-01

    Pulmonary alveolar macrophages (AMs) are important in defense against bacterial lung inflammation. Cluster of differentiation 14 (CD14) is involved in recognizing bacterial lipopolysaccharide (LPS) through MyD88-dependent and TRIF pathways of innate immunity. Sulforaphane (SFN) shows anti-inflammatory activity and suppresses DNA methylation. To identify CD14 epigenetic changes by SFN in the LPS-induced TRIF pathway, an AMs model was investigated in vitro. CD14 gene expression was induced by 5 µg/ml LPS at the time point of 12 h and suppressed by 5 µM SFN. After 12 h of LPS stimulation, gene expression was significantly up-regulated, including TRIF, TRAF6, NF-κB, TRAF3, IRF7, TNF-α, IL-1β, IL-6, and IFN-β. LPS-induced TRAM, TRIF, RIPK1, TRAF3, TNF-α, IL-1β and IFN-β were suppressed by 5 µM SFN. Similarly, DNMT3a expression was increased by LPS but significantly down-regulated by 5 µM SFN. It showed positive correlation of CD14 gene body methylation with in LPS-stimulated AMs, and this methylation status was inhibited by SFN. This study suggests that SFN suppresses CD14 activation in bacterial inflammation through epigenetic regulation of CD14 gene body methylation associated with DNMT3a. The results provide insights into SFN-mediated epigenetic down-regulation of CD14 in LPS-induced TRIF pathway inflammation and may lead to new methods for controlling LPS-induced inflammation in pigs.

  2. Adaptation of genetically monomorphic bacteria: evolution of copper resistance through multiple horizontal gene transfers of complex and versatile mobile genetic elements.

    PubMed

    Richard, D; Ravigné, V; Rieux, A; Facon, B; Boyer, C; Boyer, K; Grygiel, P; Javegny, S; Terville, M; Canteros, B I; Robène, I; Vernière, C; Chabirand, A; Pruvost, O; Lefeuvre, P

    2017-04-01

    Copper-based antimicrobial compounds are widely used to control plant bacterial pathogens. Pathogens have adapted in response to this selective pressure. Xanthomonas citri pv. citri, a major citrus pathogen causing Asiatic citrus canker, was first reported to carry plasmid-encoded copper resistance in Argentina. This phenotype was conferred by the copLAB gene system. The emergence of resistant strains has since been reported in Réunion and Martinique. Using microsatellite-based genotyping and copLAB PCR, we demonstrated that the genetic structure of the copper-resistant strains from these three regions was made up of two distant clusters and varied for the detection of copLAB amplicons. In order to investigate this pattern more closely, we sequenced six copper-resistant X. citri pv. citri strains from Argentina, Martinique and Réunion, together with reference copper-resistant Xanthomonas and Stenotrophomonas strains using long-read sequencing technology. Genes involved in copper resistance were found to be strain dependent with the novel identification in X. citri pv. citri of copABCD and a cus heavy metal efflux resistance-nodulation-division system. The genes providing the adaptive trait were part of a mobile genetic element similar to Tn3-like transposons and included in a conjugative plasmid. This indicates the system's great versatility. The mining of all available bacterial genomes suggested that, within the bacterial community, the spread of copper resistance associated with mobile elements and their plasmid environments was primarily restricted to the Xanthomonadaceae family. © 2017 John Wiley & Sons Ltd.

  3. [Bacterial diversity within different sections of summer sea-ice samples from the Prydz Bay, Antarctica].

    PubMed

    Ma, Jifei; Du, Zongjun; Luo, Wei; Yu, Yong; Zeng, Yixin; Chen, Bo; Li, Huirong

    2013-02-04

    In order to assess bacterial abundance and diversity within three different sections of summer sea-ice samples collected from the Prydz Bay, Antarctica. Fluorescence in situ hybridization was applied to determine the proportions of Bacteria in sea-ice. Bacterial community composition within sea ice was analyzed by 16S rRNA gene clone library construction. Correlation analysis was performed between the physicochemical parameters and the bacterial diversity and abundance within sea ice. The result of fluorescence in situ hybridization shows that bacteria were abundant in the bottom section, and the concentration of total organic carbon, total organic nitrogen and phosphate may be the main factors for bacterial abundance. In bacterial 16S rRNA gene libraries of sea-ice, nearly complete 16S rRNA gene sequences were grouped into three distinct lineages of Bacteria (gamma-Proteobacteria, alpha-Proteobacteria and Bacteroidetes). Most clone sequences were related to cultured bacterial isolates from the marine environment, arctic and Antarctic sea-ice with high similarity. The member of Bacteroidetes was not detected in the bottom section of sea-ice. The bacterial communities within sea-ice were little heterogeneous at the genus-level between different sections, and the concentration of NH4+ may cause this distribution. The number of bacteria was abundant in the bottom section of sea-ice. Gamma-proteobacteria was the dominant bacterial lineage in sea-ice.

  4. MicroRNA-155 regulates host immune response to postviral bacterial pneumonia via IL-23/IL-17 pathway.

    PubMed

    Podsiad, Amy; Standiford, Theodore J; Ballinger, Megan N; Eakin, Richard; Park, Pauline; Kunkel, Steven L; Moore, Bethany B; Bhan, Urvashi

    2016-03-01

    Postinfluenza bacterial pneumonia is associated with significant mortality and morbidity. MicroRNAs (miRNAs) are small, noncoding RNAs that regulate gene expression posttranscriptionally. miR-155 has recently emerged as a crucial regulator of innate immunity and inflammatory responses and is induced in macrophages during infection. We hypothesized upregulation of miR-155 inhibits IL-17 and increases susceptibility to secondary bacterial pneumonia. Mice were challenged with 100 plaque-forming units H1N1 intranasally and were infected with 10(7) colony-forming units of MRSA intratracheally at day 5 postviral challenge. Lungs were harvested 24 h later, and expression of miR-155, IL-17, and IL-23 was measured by real-time RT-PCR. Induction of miR-155 was 3.6-fold higher in dual-infected lungs compared with single infection. miR-155(-/-) mice were protected with significantly lower (4-fold) bacterial burden and no differences in viral load, associated with robust induction of IL-23 and IL-17 (2.2- and 4.8-fold, respectively) postsequential challenge with virus and bacteria, compared with WT mice. Treatment with miR-155 antagomir improved lung bacterial clearance by 4.2-fold compared with control antagomir postsequential infection with virus and bacteria. Moreover, lung macrophages collected from patients with postviral bacterial pneumonia also had upregulation of miR-155 expression compared with healthy controls, consistent with observations in our murine model. This is the first demonstration that cellular miRNAs regulate postinfluenza immune response to subsequent bacterial challenge by suppressing the IL-17 pathway in the lung. Our findings suggest that antagonizing certain microRNA might serve as a potential therapeutic strategy against secondary bacterial infection. Copyright © 2016 the American Physiological Society.

  5. Interactions among rsmX ncRNAs and Rsm RNA-binding proteins in the plant pathogen Pseudomonas syringae DC3000

    USDA-ARS?s Scientific Manuscript database

    In response to changing environmental stimuli, many bacterial species utilize the Csr/Rsm system of posttranscriptional gene expression regulation to control metabolism, motility, biofilm formation, and quorum sensing. Most Csr/Rsm RNA binding proteins are thought to bind near the 5’ end of mRNA tra...

  6. A rapid seedling resistance assay identifies wild tomato lines that are resistant to Psuedomonas syringe pv. tomato race 1

    USDA-ARS?s Scientific Manuscript database

    Bacterial speck caused by Pseudomonas syringae has historically been controlled by the Pto/Prf gene cluster. Emerging strains like P. syringae pv. tomato race 1 overcome resistance conferred by Pto/Prf, and can cause serious crop loss under appropriate environmental conditions. We developed a rapid ...

  7. Bacterial gene transfer by natural genetic transformation in the environment.

    PubMed Central

    Lorenz, M G; Wackernagel, W

    1994-01-01

    Natural genetic transformation is the active uptake of free DNA by bacterial cells and the heritable incorporation of its genetic information. Since the famous discovery of transformation in Streptococcus pneumoniae by Griffith in 1928 and the demonstration of DNA as the transforming principle by Avery and coworkers in 1944, cellular processes involved in transformation have been studied extensively by in vitro experimentation with a few transformable species. Only more recently has it been considered that transformation may be a powerful mechanism of horizontal gene transfer in natural bacterial populations. In this review the current understanding of the biology of transformation is summarized to provide the platform on which aspects of bacterial transformation in water, soil, and sediments and the habitat of pathogens are discussed. Direct and indirect evidence for gene transfer routes by transformation within species and between different species will be presented, along with data suggesting that plasmids as well as chromosomal DNA are subject to genetic exchange via transformation. Experiments exploring the prerequisites for transformation in the environment, including the production and persistence of free DNA and factors important for the uptake of DNA by cells, will be compiled, as well as possible natural barriers to transformation. The efficiency of gene transfer by transformation in bacterial habitats is possibly genetically adjusted to submaximal levels. The fact that natural transformation has been detected among bacteria from all trophic and taxonomic groups including archaebacteria suggests that transformability evolved early in phylogeny. Probable functions of DNA uptake other than gene acquisition will be discussed. The body of information presently available suggests that transformation has a great impact on bacterial population dynamics as well as on bacterial evolution and speciation. PMID:7968924

  8. Combination of culture-independent and culture-dependent molecular methods for the determination of bacterial community of iru, a fermented Parkia biglobosa seeds.

    PubMed

    Adewumi, Gbenga A; Oguntoyinbo, Folarin A; Keisam, Santosh; Romi, Wahengbam; Jeyaram, Kumaraswamy

    2012-01-01

    In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE) revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the 16 iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, S. saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA) combined with 16S-23S rRNA gene internal transcribed spacer (ITS) PCR amplification, restriction analysis (ITS-PCR-RFLP), and randomly amplified polymorphic DNA (RAPD-PCR). This further discriminated B. subtilis and its variants from food-borne pathogens such as B. cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP) for iru production to achieve product consistency, safety quality, and improved shelf life.

  9. Campylobacter jejuni dsb gene expression is regulated by iron in a Fur-dependent manner and by a translational coupling mechanism

    PubMed Central

    2011-01-01

    Background Many bacterial extracytoplasmic proteins are stabilized by intramolecular disulfide bridges that are formed post-translationally between their cysteine residues. This protein modification plays an important role in bacterial pathogenesis, and is facilitated by the Dsb (disulfide bond) family of the redox proteins. These proteins function in two parallel pathways in the periplasmic space: an oxidation pathway and an isomerization pathway. The Dsb oxidative pathway in Campylobacter jejuni is more complex than the one in the laboratory E. coli K-12 strain. Results In the C. jejuni 81-176 genome, the dsb genes of the oxidative pathway are arranged in three transcriptional units: dsbA2-dsbB-astA, dsbA1 and dba-dsbI. Their transcription responds to an environmental stimulus - iron availability - and is regulated in a Fur-dependent manner. Fur involvement in dsb gene regulation was proven by a reporter gene study in a C. jejuni wild type strain and its isogenic fur mutant. An electrophoretic mobility shift assay (EMSA) confirmed that analyzed genes are members of the Fur regulon but each of them is regulated by a disparate mechanism, and both the iron-free and the iron-complexed Fur are able to bind in vitro to the C. jejuni promoter regions. This study led to identification of a new iron- and Fur-regulated promoter that drives dsbA1 gene expression in an indirect way. Moreover, the present work documents that synthesis of DsbI oxidoreductase is controlled by the mechanism of translational coupling. The importance of a secondary dba-dsbI mRNA structure for dsbI mRNA translation was verified by estimating individual dsbI gene expression from its own promoter. Conclusions The present work shows that iron concentration is a significant factor in dsb gene transcription. These results support the concept that iron concentration - also through its influence on dsb gene expression - might control the abundance of extracytoplasmic proteins during different stages of infection. Our work further shows that synthesis of the DsbI membrane oxidoreductase is controlled by a translational coupling mechanism. The dba expression is not only essential for the translation of the downstream dsbI gene, but also Dba protein that is produced might regulate the activity and/or stability of DsbI. PMID:21787430

  10. Campylobacter jejuni dsb gene expression is regulated by iron in a Fur-dependent manner and by a translational coupling mechanism.

    PubMed

    Grabowska, Anna D; Wandel, Michał P; Łasica, Anna M; Nesteruk, Monika; Roszczenko, Paula; Wyszyńska, Agnieszka; Godlewska, Renata; Jagusztyn-Krynicka, Elzbieta K

    2011-07-25

    Many bacterial extracytoplasmic proteins are stabilized by intramolecular disulfide bridges that are formed post-translationally between their cysteine residues. This protein modification plays an important role in bacterial pathogenesis, and is facilitated by the Dsb (disulfide bond) family of the redox proteins. These proteins function in two parallel pathways in the periplasmic space: an oxidation pathway and an isomerization pathway. The Dsb oxidative pathway in Campylobacter jejuni is more complex than the one in the laboratory E. coli K-12 strain. In the C. jejuni 81-176 genome, the dsb genes of the oxidative pathway are arranged in three transcriptional units: dsbA2-dsbB-astA, dsbA1 and dba-dsbI. Their transcription responds to an environmental stimulus - iron availability - and is regulated in a Fur-dependent manner. Fur involvement in dsb gene regulation was proven by a reporter gene study in a C. jejuni wild type strain and its isogenic fur mutant. An electrophoretic mobility shift assay (EMSA) confirmed that analyzed genes are members of the Fur regulon but each of them is regulated by a disparate mechanism, and both the iron-free and the iron-complexed Fur are able to bind in vitro to the C. jejuni promoter regions. This study led to identification of a new iron- and Fur-regulated promoter that drives dsbA1 gene expression in an indirect way. Moreover, the present work documents that synthesis of DsbI oxidoreductase is controlled by the mechanism of translational coupling. The importance of a secondary dba-dsbI mRNA structure for dsbI mRNA translation was verified by estimating individual dsbI gene expression from its own promoter. The present work shows that iron concentration is a significant factor in dsb gene transcription. These results support the concept that iron concentration - also through its influence on dsb gene expression - might control the abundance of extracytoplasmic proteins during different stages of infection. Our work further shows that synthesis of the DsbI membrane oxidoreductase is controlled by a translational coupling mechanism. The dba expression is not only essential for the translation of the downstream dsbI gene, but also Dba protein that is produced might regulate the activity and/or stability of DsbI.

  11. Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

    NASA Astrophysics Data System (ADS)

    Igoshin, Oleg

    2011-03-01

    Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

  12. VRprofile: gene-cluster-detection-based profiling of virulence and antibiotic resistance traits encoded within genome sequences of pathogenic bacteria.

    PubMed

    Li, Jun; Tai, Cui; Deng, Zixin; Zhong, Weihong; He, Yongqun; Ou, Hong-Yu

    2017-01-10

    VRprofile is a Web server that facilitates rapid investigation of virulence and antibiotic resistance genes, as well as extends these trait transfer-related genetic contexts, in newly sequenced pathogenic bacterial genomes. The used backend database MobilomeDB was firstly built on sets of known gene cluster loci of bacterial type III/IV/VI/VII secretion systems and mobile genetic elements, including integrative and conjugative elements, prophages, class I integrons, IS elements and pathogenicity/antibiotic resistance islands. VRprofile is thus able to co-localize the homologs of these conserved gene clusters using HMMer or BLASTp searches. With the integration of the homologous gene cluster search module with a sequence composition module, VRprofile has exhibited better performance for island-like region predictions than the other widely used methods. In addition, VRprofile also provides an integrated Web interface for aligning and visualizing identified gene clusters with MobilomeDB-archived gene clusters, or a variety set of bacterial genomes. VRprofile might contribute to meet the increasing demands of re-annotations of bacterial variable regions, and aid in the real-time definitions of disease-relevant gene clusters in pathogenic bacteria of interest. VRprofile is freely available at http://bioinfo-mml.sjtu.edu.cn/VRprofile. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Features of CRISPR-Cas Regulation Key to Highly Efficient and Temporally-Specific crRNA Production.

    PubMed

    Rodic, Andjela; Blagojevic, Bojana; Djordjevic, Magdalena; Severinov, Konstantin; Djordjevic, Marko

    2017-01-01

    Bacterial immune systems, such as CRISPR-Cas or restriction-modification (R-M) systems, affect bacterial pathogenicity and antibiotic resistance by modulating horizontal gene flow. A model system for CRISPR-Cas regulation, the Type I-E system from Escherichia coli , is silent under standard laboratory conditions and experimentally observing the dynamics of CRISPR-Cas activation is challenging. Two characteristic features of CRISPR-Cas regulation in E. coli are cooperative transcription repression of cas gene and CRISPR array promoters, and fast non-specific degradation of full length CRISPR transcripts (pre-crRNA). In this work, we use computational modeling to understand how these features affect the system expression dynamics. Signaling which leads to CRISPR-Cas activation is currently unknown, so to bypass this step, we here propose a conceptual setup for cas expression activation, where cas genes are put under transcription control typical for a restriction-modification (R-M) system and then introduced into a cell. Known transcription regulation of an R-M system is used as a proxy for currently unknown CRISPR-Cas transcription control, as both systems are characterized by high cooperativity, which is likely related to similar dynamical constraints of their function. We find that the two characteristic CRISPR-Cas control features are responsible for its temporally-specific dynamical response, so that the system makes a steep (switch-like) transition from OFF to ON state with a time-delay controlled by pre-crRNA degradation rate. We furthermore find that cooperative transcription regulation qualitatively leads to a cross-over to a regime where, at higher pre-crRNA processing rates, crRNA generation approaches the limit of an infinitely abrupt system induction. We propose that these dynamical properties are associated with rapid expression of CRISPR-Cas components and efficient protection of bacterial cells against foreign DNA. In terms of synthetic applications, the setup proposed here should allow highly efficient expression of small RNAs in a narrow time interval, with a specified time-delay with respect to the signal onset.

  14. Influence of Biopreparations on the Bacterial Community of Oily Waste

    NASA Astrophysics Data System (ADS)

    Biktasheva, L. R.; Galitskaya, P. Yu; Selivanovskaya, S. Yu

    2018-01-01

    Oil pollution is reported to be one the most serious environmental problems nowadays. Therefore, methods of remediation of oily polluted soils and oily wastes are of great importance. Bioremediation being a perspective method of sanitation of oil pollutions, includes biostimulation of the polluted sites’ indigenous microflora, and in some cases additional introduction of active strains able to decompose hydrocarbon. The efficacy of introducing such biopreparations depends on the interactions between the introduced microbes and the indigenous ones. In this study, the influence of bacterial consortium (Rhodococcus jialingiae, Stenotrophomonas rhizophila and Pseudomonas gessardii) introduction on the bioremediation of an oily waste sampled from a refinery situated in the Mari El region (Russia) was estimated. Single and multiple inoculations of the consortium in addition to moistening and aeration were compared with a control sample, which included only aeration and moistening of the waste. It was shown, that two of the three introduced strains (Rh. jialingiae and Ps.gessardii) gene copy numbers were higher in the inoculated variants than in the control sample and with their initial counts, which meant that these strains survived and included into the bacterial community of the wastes. At the same time, bacterial counts were significantly lower, and the physiological profile of waste microflora slightly altered in the inoculated remediation variants as compared with the control sample. Interestingly, no difference in the degradation rates of hydrocarbons was revealed in the inoculated remediation variants and the control sample.

  15. Significant alteration of soil bacterial communities and organic carbon decomposition by different long-term fertilization management conditions of extremely low-productivity arable soil in South China.

    PubMed

    Xun, Weibing; Zhao, Jun; Xue, Chao; Zhang, Guishan; Ran, Wei; Wang, Boren; Shen, Qirong; Zhang, Ruifu

    2016-06-01

    Different fertilization managements of red soil, a kind of Ferralic Cambisol, strongly affected the soil properties and associated microbial communities. The association of the soil microbial community and functionality with long-term fertilization management in the unique low-productivity red soil ecosystem is important for both soil microbial ecology and agricultural production. Here, 454 pyrosequencing analysis of 16S recombinant ribonucleic acid genes and GeoChip4-NimbleGen-based functional gene analysis were used to study the soil bacterial community composition and functional genes involved in soil organic carbon degradation. Long-term nitrogen-containing chemical fertilization-induced soil acidification and fertility decline and significantly altered the soil bacterial community, whereas long-term organic fertilization and fallow management improved the soil quality and maintained the bacterial diversity. Short-term quicklime remediation of the acidified soils did not change the bacterial communities. Organic fertilization and fallow management supported eutrophic ecosystems, in which copiotrophic taxa increased in relative abundance and have a higher intensity of labile-C-degrading genes. However, long-term nitrogen-containing chemical fertilization treatments supported oligotrophic ecosystems, in which oligotrophic taxa increased in relative abundance and have a higher intensity of recalcitrant-C-degrading genes but a lower intensity of labile-C-degrading genes. Quicklime application increased the relative abundance of copiotrophic taxa and crop production, although these effects were utterly inadequate. This study provides insights into the interaction of soil bacterial communities, soil functionality and long-term fertilization management in the red soil ecosystem; these insights are important for improving the fertility of unique low-productivity red soil. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  16. Symbiotic implications of type III protein secretion machinery in Rhizobium.

    PubMed

    Viprey, V; Del Greco, A; Golinowski, W; Broughton, W J; Perret, X

    1998-06-01

    The symbiotic plasmid of Rhizobium sp. NGR234 carries a cluster of genes that encodes components of a bacterial type III secretion system (TTSS). In both animal and plant pathogens, the TTSS is an essential component of pathogenicity. Here, we show that secretion of at least two proteins (y4xL and NolX) is controlled by the TTSS of NGR234 and occurs after the induction with flavonoids. Polar mutations in two TTSS genes, rhcN and the nod-box controlled regulator of transcription y4xl, block the secretion of both proteins and strongly affect the ability of NGR234 to nodulate a variety of tropical legumes including Pachyrhizus tuberosus and Tephrosia vogelii.

  17. Association of RNA Biosignatures With Bacterial Infections in Febrile Infants Aged 60 Days or Younger.

    PubMed

    Mahajan, Prashant; Kuppermann, Nathan; Mejias, Asuncion; Suarez, Nicolas; Chaussabel, Damien; Casper, T Charles; Smith, Bennett; Alpern, Elizabeth R; Anders, Jennifer; Atabaki, Shireen M; Bennett, Jonathan E; Blumberg, Stephen; Bonsu, Bema; Borgialli, Dominic; Brayer, Anne; Browne, Lorin; Cohen, Daniel M; Crain, Ellen F; Cruz, Andrea T; Dayan, Peter S; Gattu, Rajender; Greenberg, Richard; Hoyle, John D; Jaffe, David M; Levine, Deborah A; Lillis, Kathleen; Linakis, James G; Muenzer, Jared; Nigrovic, Lise E; Powell, Elizabeth C; Rogers, Alexander J; Roosevelt, Genie; Ruddy, Richard M; Saunders, Mary; Tunik, Michael G; Tzimenatos, Leah; Vitale, Melissa; Dean, J Michael; Ramilo, Octavio

    Young febrile infants are at substantial risk of serious bacterial infections; however, the current culture-based diagnosis has limitations. Analysis of host expression patterns ("RNA biosignatures") in response to infections may provide an alternative diagnostic approach. To assess whether RNA biosignatures can distinguish febrile infants aged 60 days or younger with and without serious bacterial infections. Prospective observational study involving a convenience sample of febrile infants 60 days or younger evaluated for fever (temperature >38° C) in 22 emergency departments from December 2008 to December 2010 who underwent laboratory evaluations including blood cultures. A random sample of infants with and without bacterial infections was selected for RNA biosignature analysis. Afebrile healthy infants served as controls. Blood samples were collected for cultures and RNA biosignatures. Bioinformatics tools were applied to define RNA biosignatures to classify febrile infants by infection type. RNA biosignatures compared with cultures for discriminating febrile infants with and without bacterial infections and infants with bacteremia from those without bacterial infections. Bacterial infection confirmed by culture. Performance of RNA biosignatures was compared with routine laboratory screening tests and Yale Observation Scale (YOS) scores. Of 1883 febrile infants (median age, 37 days; 55.7% boys), RNA biosignatures were measured in 279 randomly selected infants (89 with bacterial infections-including 32 with bacteremia and 15 with urinary tract infections-and 190 without bacterial infections), and 19 afebrile healthy infants. Sixty-six classifier genes were identified that distinguished infants with and without bacterial infections in the test set with 87% (95% CI, 73%-95%) sensitivity and 89% (95% CI, 81%-93%) specificity. Ten classifier genes distinguished infants with bacteremia from those without bacterial infections in the test set with 94% (95% CI, 70%-100%) sensitivity and 95% (95% CI, 88%-98%) specificity. The incremental C statistic for the RNA biosignatures over the YOS score was 0.37 (95% CI, 0.30-0.43). In this preliminary study, RNA biosignatures were defined to distinguish febrile infants aged 60 days or younger with vs without bacterial infections. Further research with larger populations is needed to refine and validate the estimates of test accuracy and to assess the clinical utility of RNA biosignatures in practice.

  18. Association of RNA Biosignatures With Bacterial Infections in Febrile Infants Aged 60 Days or Younger

    PubMed Central

    Mahajan, Prashant; Kuppermann, Nathan; Mejias, Asuncion; Suarez, Nicolas; Chaussabel, Damien; Casper, T. Charles; Smith, Bennett; Alpern, Elizabeth R.; Anders, Jennifer; Atabaki, Shireen M.; Bennett, Jonathan E.; Blumberg, Stephen; Bonsu, Bema; Borgialli, Dominic; Brayer, Anne; Browne, Lorin; Cohen, Daniel M.; Crain, Ellen F.; Cruz, Andrea T.; Dayan, Peter S.; Gattu, Rajender; Greenberg, Richard; Hoyle, John D.; Jaffe, David M.; Levine, Deborah A.; Lillis, Kathleen; Linakis, James G.; Muenzer, Jared; Nigrovic, Lise E.; Powell, Elizabeth C.; Rogers, Alexander J.; Roosevelt, Genie; Ruddy, Richard M.; Saunders, Mary; Tunik, Michael G.; Tzimenatos, Leah; Vitale, Melissa; Dean, J. Michael; Ramilo, Octavio

    2016-01-01

    IMPORTANCE Young febrile infants are at substantial risk of serious bacterial infections; however, the current culture-based diagnosis has limitations. Analysis of host expression patterns (“RNA biosignatures”) in response to infections may provide an alternative diagnostic approach. OBJECTIVE To assess whether RNA biosignatures can distinguish febrile infants aged 60 days or younger with and without serious bacterial infections. DESIGN, SETTING, AND PARTICIPANTS Prospective observational study involving a convenience sample of febrile infants 60 days or younger evaluated for fever (temperature >38° C) in 22 emergency departments from December 2008 to December 2010 who underwent laboratory evaluations including blood cultures. A random sample of infants with and without bacterial infections was selected for RNA biosignature analysis. Afebrile healthy infants served as controls. Blood samples were collected for cultures and RNA biosignatures. Bioinformatics tools were applied to define RNA biosignatures to classify febrile infants by infection type. EXPOSURE RNA biosignatures compared with cultures for discriminating febrile infants with and without bacterial infections and infants with bacteremia from those without bacterial infections. MAIN OUTCOMES AND MEASURES Bacterial infection confirmed by culture. Performance of RNA biosignatures was compared with routine laboratory screening tests and Yale Observation Scale (YOS) scores. RESULTS Of 1883 febrile infants (median age, 37 days; 55.7%boys), RNA biosignatures were measured in 279 randomly selected infants (89 with bacterial infections—including 32 with bacteremia and 15 with urinary tract infections—and 190 without bacterial infections), and 19 afebrile healthy infants. Sixty-six classifier genes were identified that distinguished infants with and without bacterial infections in the test set with 87%(95%CI, 73%-95%) sensitivity and 89% (95%CI, 81%-93%) specificity. Ten classifier genes distinguished infants with bacteremia from those without bacterial infections in the test set with 94%(95%CI, 70%-100%) sensitivity and 95%(95%CI, 88%-98%) specificity. The incremental C statistic for the RNA biosignatures over the YOS score was 0.37 (95%CI, 0.30–0.43). CONCLUSIONS AND RELEVANCE In this preliminary study, RNA biosignatures were defined to distinguish febrile infants aged 60 days or younger with vs without bacterial infections. Further research with larger populations is needed to refine and validate the estimates of test accuracy and to assess the clinical utility of RNA biosignatures in practice. PMID:27552618

  19. A Green-Light-Responsive System for the Control of Transgene Expression in Mammalian and Plant Cells.

    PubMed

    Chatelle, Claire; Ochoa-Fernandez, Rocio; Engesser, Raphael; Schneider, Nils; Beyer, Hannes M; Jones, Alex R; Timmer, Jens; Zurbriggen, Matias D; Weber, Wilfried

    2018-05-18

    The ever-increasing complexity of synthetic gene networks and applications of synthetic biology requires precise and orthogonal gene expression systems. Of particular interest are systems responsive to light as they enable the control of gene expression dynamics with unprecedented resolution in space and time. While broadly used in mammalian backgrounds, however, optogenetic approaches in plant cells are still limited due to interference of the activating light with endogenous photoreceptors. Here, we describe the development of the first synthetic light-responsive system for the targeted control of gene expression in mammalian and plant cells that responds to the green range of the light spectrum in which plant photoreceptors have minimal activity. We first engineered a system based on the light-sensitive bacterial transcription factor CarH and its cognate DNA operator sequence CarO from Thermus thermophilus to control gene expression in mammalian cells. The system was functional in various mammalian cell lines, showing high induction (up to 350-fold) along with low leakiness, as well as high reversibility. We quantitatively described the systems characteristics by the development and experimental validation of a mathematical model. Finally, we transferred the system into A. thaliana protoplasts and demonstrated gene repression in response to green light. We expect that this system will provide new opportunities in applications based on synthetic gene networks and will open up perspectives for optogenetic studies in mammalian and plant cells.

  20. The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

    PubMed

    Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

    As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

  1. 16S rRNA Gene-Based Metagenomic Analysis of Ozark Cave Bacteria

    PubMed Central

    Oliveira, Cássia; Gunderman, Lauren; Coles, Cathryn A.; Lochmann, Jason; Parks, Megan; Ballard, Ethan; Glazko, Galina; Rahmatallah, Yasir; Tackett, Alan J.; Thomas, David J.

    2018-01-01

    The microbial diversity within cave ecosystems is largely unknown. Ozark caves maintain a year-round stable temperature (12–14 °C), but most parts of the caves experience complete darkness. The lack of sunlight and geological isolation from surface-energy inputs generate nutrient-poor conditions that may limit species diversity in such environments. Although microorganisms play a crucial role in sustaining life on Earth and impacting human health, little is known about their diversity, ecology, and evolution in community structures. We used five Ozark region caves as test sites for exploring bacterial diversity and monitoring long-term biodiversity. Illumina MiSeq sequencing of five cave soil samples and a control sample revealed a total of 49 bacterial phyla, with seven major phyla: Proteobacteria, Acidobacteria, Actinobacteria, Firmicutes, Chloroflexi, Bacteroidetes, and Nitrospirae. Variation in bacterial composition was observed among the five caves studied. Sandtown Cave had the lowest richness and most divergent community composition. 16S rRNA gene-based metagenomic analysis of cave-dwelling microbial communities in the Ozark caves revealed that species abundance and diversity are vast and included ecologically, agriculturally, and economically relevant taxa. PMID:29551950

  2. Transcriptional response of honey bee larvae infected with the bacterial pathogen Paenibacillus larvae.

    PubMed

    Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D

    2013-01-01

    American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis.

  3. Identification of normalization factors for quantitative real-time RT-PCR analysis of gene expression in Pacific abalone Haliotis discus hannai

    NASA Astrophysics Data System (ADS)

    Qiu, Reng; Sun, Boguang; Fang, Shasha; Sun, Li; Liu, Xiao

    2013-03-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is widely used in studies of gene expression. In most of these studies, housekeeping genes are used as internal references without validation. To identify appropriate reference genes for qRT-PCR in Pacific abalone Haliotis discus hannai, we examined the transcription stability of six housekeeping genes in abalone tissues in the presence and absence of bacterial infection. For this purpose, abalone were infected with the bacterial pathogen Vibrio anguillarum for 12 h and 48 h. The mRNA levels of the housekeeping genes in five tissues (digestive glands, foot muscle, gill, hemocyte, and mantle) were determined by qRT-PCR. The PCR data was subsequently analyzed with the geNorm and NormFinder algorithms. The results show that in the absence of bacterial infection, elongation factor-1-alpha and beta-actin were the most stably expressed genes in all tissues, and thus are suitable as cross-tissue type normalization factors. However, we did not identify any universal reference genes post infection because the most stable genes varied between tissue types. Furthermore, for most tissues, the optimal reference genes identified by both algorithms at 12 h and 48 h post-infection differed. These results indicate that bacterial infection induced significant changes in the expression of abalone housekeeping genes in a manner that is dependent on tissue type and duration of infection. As a result, different normalization factors must be used for different tissues at different infection points.

  4. Freshwater Recirculating Aquaculture System Operations Drive Biofilter Bacterial Community Shifts around a Stable Nitrifying Consortium of Ammonia-Oxidizing Archaea and Comammox Nitrospira

    PubMed Central

    Bartelme, Ryan P.; McLellan, Sandra L.; Newton, Ryan J.

    2017-01-01

    Recirculating aquaculture systems (RAS) are unique engineered ecosystems that minimize environmental perturbation by reducing nutrient pollution discharge. RAS typically employ a biofilter to control ammonia levels produced as a byproduct of fish protein catabolism. Nitrosomonas (ammonia-oxidizing), Nitrospira, and Nitrobacter (nitrite-oxidizing) species are thought to be the primary nitrifiers present in RAS biofilters. We explored this assertion by characterizing the biofilter bacterial and archaeal community of a commercial scale freshwater RAS that has been in operation for >15 years. We found the biofilter community harbored a diverse array of bacterial taxa (>1000 genus-level taxon assignments) dominated by Chitinophagaceae (~12%) and Acidobacteria (~9%). The bacterial community exhibited significant composition shifts with changes in biofilter depth and in conjunction with operational changes across a fish rearing cycle. Archaea also were abundant, and were comprised solely of a low diversity assemblage of Thaumarchaeota (>95%), thought to be ammonia-oxidizing archaea (AOA) from the presence of AOA ammonia monooxygenase genes. Nitrosomonas were present at all depths and time points. However, their abundance was >3 orders of magnitude less than AOA and exhibited significant depth-time variability not observed for AOA. Phylogenetic analysis of the nitrite oxidoreductase beta subunit (nxrB) gene indicated two distinct Nitrospira populations were present, while Nitrobacter were not detected. Subsequent identification of Nitrospira ammonia monooxygenase alpha subunit genes in conjunction with the phylogenetic placement and quantification of the nxrB genotypes suggests complete ammonia-oxidizing (comammox) and nitrite-oxidizing Nitrospira populations co-exist with relatively equivalent and stable abundances in this system. It appears RAS biofilters harbor complex microbial communities whose composition can be affected directly by typical system operations while supporting multiple ammonia oxidation lifestyles within the nitrifying consortium. PMID:28194147

  5. Restructuring of the Aquatic Bacterial Community by Hydric Dynamics Associated with Superstorm Sandy

    PubMed Central

    Ulrich, Nikea; Rosenberger, Abigail; Brislawn, Colin; Wright, Justin; Kessler, Collin; Toole, David; Solomon, Caroline; Strutt, Steven; McClure, Erin

    2016-01-01

    ABSTRACT Bacterial community composition and longitudinal fluctuations were monitored in a riverine system during and after Superstorm Sandy to better characterize inter- and intracommunity responses associated with the disturbance associated with a 100-year storm event. High-throughput sequencing of the 16S rRNA gene was used to assess microbial community structure within water samples from Muddy Creek Run, a second-order stream in Huntingdon, PA, at 12 different time points during the storm event (29 October to 3 November 2012) and under seasonally matched baseline conditions. High-throughput sequencing of the 16S rRNA gene was used to track changes in bacterial community structure and divergence during and after Superstorm Sandy. Bacterial community dynamics were correlated to measured physicochemical parameters and fecal indicator bacteria (FIB) concentrations. Bioinformatics analyses of 2.1 million 16S rRNA gene sequences revealed a significant increase in bacterial diversity in samples taken during peak discharge of the storm. Beta-diversity analyses revealed longitudinal shifts in the bacterial community structure. Successional changes were observed, in which Betaproteobacteria and Gammaproteobacteria decreased in 16S rRNA gene relative abundance, while the relative abundance of members of the Firmicutes increased. Furthermore, 16S rRNA gene sequences matching pathogenic bacteria, including strains of Legionella, Campylobacter, Arcobacter, and Helicobacter, as well as bacteria of fecal origin (e.g., Bacteroides), exhibited an increase in abundance after peak discharge of the storm. This study revealed a significant restructuring of in-stream bacterial community structure associated with hydric dynamics of a storm event. IMPORTANCE In order to better understand the microbial risks associated with freshwater environments during a storm event, a more comprehensive understanding of the variations in aquatic bacterial diversity is warranted. This study investigated the bacterial communities during and after Superstorm Sandy to provide fine time point resolution of dynamic changes in bacterial composition. This study adds to the current literature by revealing the variation in bacterial community structure during the course of a storm. This study employed high-throughput DNA sequencing, which generated a deep analysis of inter- and intracommunity responses during a significant storm event. This study has highlighted the utility of applying high-throughput sequencing for water quality monitoring purposes, as this approach enabled a more comprehensive investigation of the bacterial community structure. Altogether, these data suggest a drastic restructuring of the stream bacterial community during a storm event and highlight the potential of high-throughput sequencing approaches for assessing the microbiological quality of our environment. PMID:27060115

  6. Multiple conversion between the genes encoding bacterial class-I release factors

    PubMed Central

    Ishikawa, Sohta A.; Kamikawa, Ryoma; Inagaki, Yuji

    2015-01-01

    Bacteria require two class-I release factors, RF1 and RF2, that recognize stop codons and promote peptide release from the ribosome. RF1 and RF2 were most likely established through gene duplication followed by altering their stop codon specificities in the common ancestor of extant bacteria. This scenario expects that the two RF gene families have taken independent evolutionary trajectories after the ancestral gene duplication event. However, we here report two independent cases of conversion between RF1 and RF2 genes (RF1-RF2 gene conversion), which were severely examined by procedures incorporating the maximum-likelihood phylogenetic method. In both cases, RF1-RF2 gene conversion was predicted to occur in the region encoding nearly entire domain 3, of which functions are common between RF paralogues. Nevertheless, the ‘direction’ of gene conversion appeared to be opposite from one another—from RF2 gene to RF1 gene in one case, while from RF1 gene to RF2 gene in the other. The two cases of RF1-RF2 gene conversion prompt us to propose two novel aspects in the evolution of bacterial class-I release factors: (i) domain 3 is interchangeable between RF paralogues, and (ii) RF1-RF2 gene conversion have occurred frequently in bacterial genome evolution. PMID:26257102

  7. Cell Density Control of Staphylococcal Virulence Mediated by an Octapeptide Pheromone

    NASA Astrophysics Data System (ADS)

    Ji, Guangyong; Beavis, Ronald C.; Novick, Richard P.

    1995-12-01

    Some bacterial pathogens elaborate and secrete virulence factors in response to environmental signals, others in response to a specific host product, and still others in response to no discernible cue. In this study, we have demonstrated that the synthesis of Staphylococcus aureus virulence factors is controlled by a density-sensing system that utilizes an octapeptide produced by the organism itself. The octapeptide activates expression of the agr locus, a global regulator of the virulence response. This response involves the reciprocal regulation of genes encoding surface proteins and those encoding secreted virulence factors. As cells enter the postexponential phase, surface protein genes are repressed by agr and secretory protein genes are subsequently activated. The intracellular agr effector is a regulatory RNA, RNAIII, whose transcription is activated by an agr-encoded signal transduction system for which the octapeptide is the ligand.

  8. Bacterial magnetic particles improve testes-mediated transgene efficiency in mice.

    PubMed

    Wang, Chao; Sun, Guanghong; Wang, Ye; Kong, Nana; Chi, Yafei; Yang, Leilei; Xin, Qiliang; Teng, Zhen; Wang, Xu; Wen, Yujun; Li, Ying; Xia, Guoliang

    2017-11-01

    Nano-scaled materials have been proved to be ideal DNA carriers for transgene. Bacterial magnetic particles (BMPs) help to reduce the toxicity of polyethylenimine (PEI), an efficient gene-transferring agent, and assist tissue transgene ex vivo. Here, the effectiveness of the BMP-PEI complex-conjugated foreign DNAs (BPDs) in promoting testes-mediated gene transfer (TMGT) in mouse was compared with that of liposome-conjugated foreign DNAs. The results proved that through testes injection, the clusters of BPDs successfully reached the cytoplasm and the nuclear of spermatogenesis cell, and expressed in testes of transgene founder mice. Additionally, the ratio of founder mice obtained from BPDs (88%) is about 3 times higher than the control (25%) (p < 0.05). Interestingly, the motility of sperms recovered from epididymis of the founder mice from BPD group were significantly improved, as compared with the control (p < 0.01). Based on classic breeding, the ratio of transgene mice within the first filial was significantly higher in BPDs compared with the control (73.8% versus 11.6%, p < 0.05). TMGT in this study did not produce visible histological changes in the testis. In conclusion, nano-scaled BPDs could be an alternative strategy for efficiently producing transgene mice in vivo.

  9. Response of Nitrifier and Denitrifier Abundance and Microbial Community Structure to Experimental Warming in an Agricultural Ecosystem

    PubMed Central

    Waghmode, Tatoba R.; Chen, Shuaimin; Li, Jiazhen; Sun, Ruibo; Liu, Binbin; Hu, Chunsheng

    2018-01-01

    Soil microbial community plays an important role in terrestrial carbon and nitrogen cycling. However, the response of the soil nitrifier and denitrifier communities to climate warming is poorly understood. A long-term field warming experiment has been conducted for 8 years at Luancheng Experimental Farm Station on the North China Plain; we used this field to examine how soil microbial community structure, nitrifier, and denitrifier abundance respond to warming under regular irrigation (RI) and high irrigation (HI) at different soil depths (0–5, 5–10, and 10–20 cm). Nitrifier, denitrifier, and the total bacterial abundance were assessed by quantitative polymerase chain reaction of the functional genes and 16S rRNA gene, respectively. Bacterial community structure was studied through high throughput sequencing of the 16S rRNA gene. Under RI, warming significantly (P < 0.05) increased the potential nitrification rate and nitrate concentration and decreased the soil moisture. In most of the samples, warming increased the ammonia-oxidizing bacteria abundance but decreased the ammonia-oxidizing archaea (AOA) and denitrifier (nirK, nirS, and nosZ genes) abundance. Under HI, there was a highly increased AOA and 16S rRNA gene abundance and a slightly higher denitrifier abundance compared with RI. Warming decreased the bacterial diversity and species richness, and the microbial community structure differed greatly between the warmed and control plots. The decrease in bacterial diversity was higher in RI than HI and at the 0–5 cm depths than at the 5–10 and 10–20 cm soil depths. Warming led to an increase in the relative abundance of Actinobacteria, Bacteroidetes, and TM7 but a decrease in Acidobacteria, Alphaproteobacteria, Deltaproteobacteria, Nitrospira, and Planctomycetes. The greater shift in microbial community structure was observed only in RI at the 0–5 cm soil depth. This study provides new insight into our understanding of the nitrifier and denitrifier activity and microbial community response to climate warming in agricultural ecosystems. PMID:29593703

  10. Volatile Arsenic Species Released from Escherichia coli Expressing the AsIII S-adenosylmethionine Methyltransferase Gene

    PubMed Central

    YUAN, CHUNGANG; LU, XIUFEN; QIN, JIE; ROSEN, BARRY P.; LE, X. CHRIS

    2015-01-01

    Biological systems, ranging from bacteria and fungi to humans, can methylate arsenic. Recent studies have suggested that the AsIII S-adenosylmethionine methyltransferase (arsM) gene in bacteria was responsible for the removal of arsenic as the volatile arsines from the bacteria. However, there has been no direct measure of the arsines released from bacteria cultures. We describe here an integrated system incorporating the bacterial incubation and volatile arsenic species analysis, and we demonstrate its application to the identification of the volatile arsines produced in bacterial cultures. The headspace of the bacterial cultures was purged with helium, and the volatile arsenic species were trapped in a chromatographic column immersed in liquid nitrogen. The cryogenically trapped arsines [AsH3, (CH3)AsH2, (CH3)2AsH, and (CH3)3As] were separated by gas chromatography and were detected by inductively coupled plasma mass spectrometry. A hydride generation system was coupled to the bacterial culture system, allowing for spiking standards and for generating calibration arsines necessary for quantitative analysis. Both bacteria containing the arsM gene or its variant arsMC2 gene were able to produce 400–500 ng of trimethylarsine. No trimethylarsine was detectable in bacteria lacking the arsM gene (containing the vector plasmid as negative control). These results confirm that arsM is responsible for releasing arsenic as volatile species from the arsenic-resistant bacteria. Our results also show traces of AsH3, CH3AsH2, and (CH3)2AsH in cultures of bacteria expressing arsM. The method detection limits for AsH3, CH3AsH2, (CH3)2AsH, and (CH3)3As were 0.5, 0.5, 0.7, and 0.6 pg, respectively. The ability to quantify trace levels of these volatile arsenic species makes it possible to study the biotransformation and biochemical roles of the evolution of these volatile arsenic species by biological systems. PMID:18522094

  11. Pesticide Side Effects in an Agricultural Soil Ecosystem as Measured by amoA Expression Quantification and Bacterial Diversity Changes

    PubMed Central

    Feld, Louise; Hjelmsø, Mathis Hjort; Nielsen, Morten Schostag; Jacobsen, Anne Dorthe; Rønn, Regin; Ekelund, Flemming; Krogh, Paul Henning; Strobel, Bjarne Westergaard; Jacobsen, Carsten Suhr

    2015-01-01

    Background and Methods Assessing the effects of pesticide hazards on microbiological processes in the soil is currently based on analyses that provide limited insight into the ongoing processes. This study proposes a more comprehensive approach. The side effects of pesticides may appear as changes in the expression of specific microbial genes or as changes in diversity. To assess the impact of pesticides on gene expression, we focused on the amoA gene, which is involved in ammonia oxidation. We prepared soil microcosms and exposed them to dazomet, mancozeb or no pesticide. We hypothesized that the amount of amoA transcript decreases upon pesticide application, and to test this hypothesis, we used reverse-transcription qPCR. We also hypothesized that bacterial diversity is affected by pesticides. This hypothesis was investigated via 454 sequencing and diversity analysis of the 16S ribosomal RNA and RNA genes, representing the active and total soil bacterial communities, respectively. Results and Conclusion Treatment with dazomet reduced both the bacterial and archaeal amoA transcript numbers by more than two log units and produced long-term effects for more than 28 days. Mancozeb also inhibited the numbers of amoA transcripts, but only transiently. The bacterial and archaeal amoA transcripts were both sensitive bioindicators of pesticide side effects. Additionally, the numbers of bacterial amoA transcripts correlated with nitrate production in N-amended microcosms. Dazomet reduced the total bacterial numbers by one log unit, but the population size was restored after twelve days. The diversity of the active soil bacteria also seemed to be re-established after twelve days. However, the total bacterial diversity as reflected in the 16S ribosomal RNA gene sequences was largely dominated by Firmicutes and Proteobacteria at day twelve, likely reflecting a halt in the growth of early opportunists and the re-establishment of a more diverse population. We observed no effects of mancozeb on diversity. PMID:25938467

  12. Reduced toll-like receptor 4 and substance P gene expression is associated with airway bacterial colonization in children.

    PubMed

    Grissell, Terry V; Chang, Anne B; Gibson, Peter G

    2007-04-01

    Neuro-immune interactions are increasingly relevant to human health and disease. The neuropeptide Substance P also has antibacterial activity and bears similarities to the innate immune antibacterial defensins. This suggests possible co-regulation of neuropeptide and innate immune mediators. In this study, non-bronchoscopic bronchoalveolar lavage (BAL) was performed on 69 children. BAL was examined for cellular profile, microbiology (bacteria, virus) and gene expression for TLRs 2, 3, 4; chemokine receptors (CCR3, CCR5, CXCR1); neurotrophins and neurokinin genes (TAC1, TAC3, CGRP, NGF). In children with bacterial colonization (n=10) there was an airway inflammatory response with increased BAL neutrophils, IL-8 protein, and CXCR1 expression. Substance P (TAC1) and TLR4 RNA expression were reduced in children with bacterial colonization. TLR3 mRNA was increased in 7.2% (n=5) children with rhinovirus, and there was a non-significant trend to increased TLR2. There is evidence for co-regulation of neurokinin (TAC1) and TLR4 gene expression in airway cells from children with airway bacterial colonization and their reduced expression may be associated with an impaired bacterial clearance. (c) 2007 Wiley-Liss, Inc.

  13. A virus vector based on Canine Herpesvirus for vaccine applications in canids.

    PubMed

    Strive, T; Hardy, C M; Wright, J; Reubel, G H

    2007-01-31

    Canine Herpesvirus (CHV) is being developed as a virus vector for the vaccination of European red foxes. However, initial studies using recombinant CHV vaccines in foxes revealed viral attenuation and lack of antibody response to inserted foreign antigens. These findings were attributed both to inactivation of the thymidine kinase (TK) gene and excess foreign genetic material in the recombinant viral genome. In this study, we report an improved CHV-bacterial artificial chromosome (BAC) vector system designed to overcome attenuation in foxes. A non-essential region was identified in the CHV genome as an alternative insertion site for foreign genes. Replacement of a guanine/cytosine (GC)-rich intergenic region between UL21 and UL22 of CHV with a marker gene did not change growth behaviour in vitro, showing that this region is not essential for virus growth in cell culture. We subsequently produced a CHV-BAC vector with an intact TK gene in which the bacterial genes and the antigen expression cassette were inserted into this GC-rich locus. Unlike earlier constructs, the new CHV-BAC allowed self-excision of the bacterial genes via homologous recombination after transfection of BACs into cell culture. The BAC-CHV system was used to produce a recombinant virus that constitutively expressed porcine zona pellucida subunit C protein between the UL21 and UL22 genes of CHV. Complete self-excision of the bacterial genes from CHV was achieved within one round of replication whilst retaining antigen gene expression.

  14. Changes in bacterial community metabolism and composition during the degradation of dissolved organic matter from the jellyfish Aurelia aurita in a Mediterranean coastal lagoon.

    PubMed

    Blanchet, Marine; Pringault, Olivier; Bouvy, Marc; Catala, Philippe; Oriol, Louise; Caparros, Jocelyne; Ortega-Retuerta, Eva; Intertaglia, Laurent; West, Nyree; Agis, Martin; Got, Patrice; Joux, Fabien

    2015-09-01

    Spatial increases and temporal shifts in outbreaks of gelatinous plankton have been observed over the past several decades in many estuarine and coastal ecosystems. The effects of these blooms on marine ecosystem functioning and particularly on the dynamics of the heterotrophic bacteria are still unclear. The response of the bacterial community from a Mediterranean coastal lagoon to the addition of dissolved organic matter (DOM) from the jellyfish Aurelia aurita, corresponding to an enrichment of dissolved organic carbon (DOC) by 1.4, was assessed for 22 days in microcosms (8 l). The high bioavailability of this material led to (i) a rapid mineralization of the DOC and dissolved organic nitrogen from the jellyfish and (ii) the accumulation of high concentrations of ammonium and orthophosphate in the water column. DOM from jellyfish greatly stimulated heterotrophic prokaryotic production and respiration rates during the first 2 days; then, these activities showed a continuous decay until reaching those measured in the control microcosms (lagoon water only) at the end of the experiment. Bacterial growth efficiency remained below 20%, indicating that most of the DOM was respired and a minor part was channeled to biomass production. Changes in bacterial diversity were assessed by tag pyrosequencing of partial bacterial 16S rRNA genes, DNA fingerprints, and a cultivation approach. While bacterial diversity in control microcosms showed little changes during the experiment, the addition of DOM from the jellyfish induced a rapid growth of Pseudoalteromonas and Vibrio species that were isolated. After 9 days, the bacterial community was dominated by Bacteroidetes, which appeared more adapted to metabolize high-molecular-weight DOM. At the end of the experiment, the bacterial community shifted toward a higher proportion of Alphaproteobacteria. Resilience of the bacterial community after the addition of DOM from the jellyfish was higher for metabolic functions than diversity, suggesting that jellyfish blooms can induce durable changes in the bacterial community structure in coastal lagoons.

  15. Whole-genome sequencing of Bacillus subtilis XF-1 reveals mechanisms for biological control and multiple beneficial properties in plants.

    PubMed

    Guo, Shengye; Li, Xingyu; He, Pengfei; Ho, Honhing; Wu, Yixin; He, Yueqiu

    2015-06-01

    Bacillus subtilis XF-1 is a gram-positive, plant-associated bacterium that stimulates plant growth and produces secondary metabolites that suppress soil-borne plant pathogens. In particular, it is especially highly efficient at controlling the clubroot disease of cruciferous crops. Its 4,061,186-bp genome contains an estimated 3853 protein-coding sequences and the 1155 genes of XF-1 are present in most genome-sequenced Bacillus strains: 3757 genes in B. subtilis 168, and 1164 in B. amyloliquefaciens FZB42. Analysis using the Cluster of Orthologous Groups database of proteins shows that 60 genes control bacterial mobility, 221 genes are related to cell wall and membrane biosynthesis, and more than 112 are genes associated with secondary metabolites. In addition, the genes contributed to the strain's plant colonization, bio-control and stimulation of plant growth. Sequencing of the genome is a fundamental step for developing a desired strain to serve as an efficient biological control agent and plant growth stimulator. Similar to other members of the taxon, XF-1 has a genome that contains giant gene clusters for the non-ribosomal synthesis of antifungal lipopeptides (surfactin and fengycin), the polyketides (macrolactin and bacillaene), the siderophore bacillibactin, and the dipeptide bacilysin. There are two synthesis pathways for volatile growth-promoting compounds. The expression of biosynthesized antibiotic peptides in XF-1 was revealed by matrix-assisted laser desorption/ionization-time of flight mass spectrometry.

  16. Direct modulation of T-box riboswitch-controlled transcription by protein synthesis inhibitors

    PubMed Central

    Stamatopoulou, Vassiliki; Apostolidi, Maria; Li, Shuang; Lamprinou, Katerina; Papakyriakou, Athanasios

    2017-01-01

    Abstract Recently, it was discovered that exposure to mainstream antibiotics activate numerous bacterial riboregulators that control antibiotic resistance genes including metabolite-binding riboswitches and other transcription attenuators. However, the effects of commonly used antibiotics, many of which exhibit RNA-binding properties, on the widespread T-box riboswitches, remain unknown. In Staphylococcus aureus, a species-specific glyS T-box controls the supply of glycine for both ribosomal translation and cell wall synthesis, making it a promising target for next-generation antimicrobials. Here, we report that specific protein synthesis inhibitors could either significantly increase T-box-mediated transcription antitermination, while other compounds could suppress it, both in vitro and in vivo. In-line probing of the full-length T-box combined with molecular modelling and docking analyses suggest that the antibiotics that promote transcription antitermination stabilize the T-box:tRNA complex through binding specific positions on stem I and the Staphylococcal-specific stem Sa. By contrast, the antibiotics that attenuate T-box transcription bind to other positions on stem I and do not interact with stem Sa. Taken together, our results reveal that the transcription of essential genes controlled by T-box riboswitches can be directly modulated by commonly used protein synthesis inhibitors. These findings accentuate the regulatory complexities of bacterial response to antimicrobials that involve multiple riboregulators. PMID:28973457

  17. Direct modulation of T-box riboswitch-controlled transcription by protein synthesis inhibitors.

    PubMed

    Stamatopoulou, Vassiliki; Apostolidi, Maria; Li, Shuang; Lamprinou, Katerina; Papakyriakou, Athanasios; Zhang, Jinwei; Stathopoulos, Constantinos

    2017-09-29

    Recently, it was discovered that exposure to mainstream antibiotics activate numerous bacterial riboregulators that control antibiotic resistance genes including metabolite-binding riboswitches and other transcription attenuators. However, the effects of commonly used antibiotics, many of which exhibit RNA-binding properties, on the widespread T-box riboswitches, remain unknown. In Staphylococcus aureus, a species-specific glyS T-box controls the supply of glycine for both ribosomal translation and cell wall synthesis, making it a promising target for next-generation antimicrobials. Here, we report that specific protein synthesis inhibitors could either significantly increase T-box-mediated transcription antitermination, while other compounds could suppress it, both in vitro and in vivo. In-line probing of the full-length T-box combined with molecular modelling and docking analyses suggest that the antibiotics that promote transcription antitermination stabilize the T-box:tRNA complex through binding specific positions on stem I and the Staphylococcal-specific stem Sa. By contrast, the antibiotics that attenuate T-box transcription bind to other positions on stem I and do not interact with stem Sa. Taken together, our results reveal that the transcription of essential genes controlled by T-box riboswitches can be directly modulated by commonly used protein synthesis inhibitors. These findings accentuate the regulatory complexities of bacterial response to antimicrobials that involve multiple riboregulators. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Combining Shigella Tn-seq data with gold-standard E. coli gene deletion data suggests rare transitions between essential and non-essential gene functionality.

    PubMed

    Freed, Nikki E; Bumann, Dirk; Silander, Olin K

    2016-09-06

    Gene essentiality - whether or not a gene is necessary for cell growth - is a fundamental component of gene function. It is not well established how quickly gene essentiality can change, as few studies have compared empirical measures of essentiality between closely related organisms. Here we present the results of a Tn-seq experiment designed to detect essential protein coding genes in the bacterial pathogen Shigella flexneri 2a 2457T on a genome-wide scale. Superficial analysis of this data suggested that 481 protein-coding genes in this Shigella strain are critical for robust cellular growth on rich media. Comparison of this set of genes with a gold-standard data set of essential genes in the closely related Escherichia coli K12 BW25113 revealed that an excessive number of genes appeared essential in Shigella but non-essential in E. coli. Importantly, and in converse to this comparison, we found no genes that were essential in E. coli and non-essential in Shigella, implying that many genes were artefactually inferred as essential in Shigella. Controlling for such artefacts resulted in a much smaller set of discrepant genes. Among these, we identified three sets of functionally related genes, two of which have previously been implicated as critical for Shigella growth, but which are dispensable for E. coli growth. The data presented here highlight the small number of protein coding genes for which we have strong evidence that their essentiality status differs between the closely related bacterial taxa E. coli and Shigella. A set of genes involved in acetate utilization provides a canonical example. These results leave open the possibility of developing strain-specific antibiotic treatments targeting such differentially essential genes, but suggest that such opportunities may be rare in closely related bacteria.

  19. Bacterial communities in soil samples from the Mingyong Glacier of southwestern China.

    PubMed

    Li, Haoyu; Taj, Muhammad Kamran; Ji, Xiuling; Zhang, Qi; Lin, Liangbing; Zhou, Zhimei; Wei, Yunlin

    2017-05-01

    The present study was an effort to determine the bacterial diversity of soils in Mingyong Glacier located at the Meili Snow Mountains of southwestern China. Mingyong Glacier has different climatic zones within a very narrow area, and bacterial community diversity in this low temperature area remains largely unknown. In this study, soil samples were collected from four different climatic zones: M11A (dry warm valley), M14 (forest), M15 (grass land), and M16 (glacier zones). Phylogenetic analysis based on 16S rRNA gene V6 hypervariable region showed high bacterial abundance in the glacier. The number of Operational Taxonomic Units ranged from 2.24×10 3 to 5.56×10 3 in soil samples. Statistical analysis of 16S rRNA gene clone libraries results showed that bacterial diversity in zones M11A,M14 and M16 are higher than in zone M15. The bacterial community structures are clearly distinguishable, and phylogenetic analysis showed that the predominant phyla were Proteobacteria, Deinococcus-Thermus, Firmicutes, Actinobacteria, and Nitrospirae in Mingyong Glacier. Seventy-nine different orders from four zones have been isolated. Bacterial diversity and distribution of bacterial communities related to the anthropogenic perturbations in zone (M15) were confirmed by diversity index analysis, and the diversity index of other three zones was satisfactory through this analysis software. The results suggest that bacterial diversity and distribution analyses using bacterial 16S rRNA gene V6 hypervariable region were successful, and bacterial communities in this area not only had the same bacterial phyla compared to other glaciers but also had their own rare species.

  20. Effect of physical sediments reworking on hydrocarbon degradation and bacterial community structure in marine coastal sediments.

    PubMed

    Duran, Robert; Bonin, Patricia; Jezequel, Ronan; Dubosc, Karine; Gassie, Claire; Terrisse, Fanny; Abella, Justine; Cagnon, Christine; Militon, Cecile; Michotey, Valérie; Gilbert, Franck; Cuny, Philippe; Cravo-Laureau, Cristiana

    2015-10-01

    The present study aimed to examine whether the physical reworking of sediments by harrowing would be suitable for favouring the hydrocarbon degradation in coastal marine sediments. Mudflat sediments were maintained in mesocosms under conditions as closer as possible to those prevailing in natural environments with tidal cycles. Sediments were contaminated with Ural blend crude oil, and in half of them, harrowing treatment was applied in order to mimic physical reworking of surface sediments. Hydrocarbon distribution within the sediment and its removal was followed during 286 days. The harrowing treatment allowed hydrocarbon compounds to penetrate the first 6 cm of the sediments, and biodegradation indexes (such as n-C18/phytane) indicated that biodegradation started 90 days before that observed in untreated control mesocosms. However, the harrowing treatment had a severe impact on benthic organisms reducing drastically the macrofaunal abundance and diversity. In the harrowing-treated mesocosms, the bacterial abundance, determined by 16S rRNA gene Q-PCR, was slightly increased; and terminal restriction fragment length polymorphism (T-RFLP) analyses of 16S rRNA genes showed distinct and specific bacterial community structure. Co-occurrence network and canonical correspondence analyses (CCA) based on T-RFLP data indicated the main correlations between bacterial operational taxonomic units (OTUs) as well as the associations between OTUs and hydrocarbon compound contents further supported by clustered correlation (ClusCor) analysis. The analyses highlighted the OTUs constituting the network structural bases involved in hydrocarbon degradation. Negative correlations indicated the possible shifts in bacterial communities that occurred during the ecological succession.

  1. Eye-specification genes in the bacterial light organ of the bobtail squid Euprymna scolopes, and their expression in response to symbiont cues

    PubMed Central

    Peyer, Suzanne M.; Pankey, M. Sabrina; Oakley, Todd H.; McFall-Ngai, Margaret J.

    2014-01-01

    The squid Euprymna scolopes has evolved independent sets of tissues capable of light detection, including a complex eye and a photophore or ‘light organ’, which houses the luminous bacterial symbiont Vibrio fischeri. As the eye and light organ originate from different embryonic tissues, we examined whether the eye-specification genes, pax6, eya, six, and dac, are shared by these two organs, and if so, whether they are regulated in the light organ by symbiosis. We obtained sequences of the four genes with PCR, confirmed orthology with phylogenetic analysis, and determined that each was expressed in the eye and light organ. With in situ hybridization (ISH), we localized the gene transcripts in developing embryos, comparing the patterns of expression in the two organs. The four transcripts localized to similar tissues, including those associated with the visual system ~1/4 into embryogenesis (Naef stage 18) and the light organ ~3/4 into embryogenesis (Naef stage 26). We used ISH and quantitative real-time PCR to examine transcript expression and differential regulation in postembryonic light organs in response to the following colonization conditions: wild-type, luminescent V. fischeri; a mutant strain defective in light production; and as a control, no symbiont. In ISH experiments light organs showed down regulation of the pax6, eya, and six transcripts in response to wild-type V. fischeri. Mutant strains also induced down regulation of the pax6 and eya transcripts, but not of the six transcript. Thus, luminescence was required for down regulation of the six transcript. We discuss these results in the context of symbiont-induced light-organ development. Our study indicates that the eye-specification genes are expressed in light-interacting tissues independent of their embryonic origin and are capable of responding to bacterial cues. These results offer evidence for evolutionary tinkering or the recruitment of eye development genes for use in a light-sensing photophore. PMID:24157521

  2. Phytoremediation of Ionic and Methyl Mercury Pollution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meagher, Richard B.

    Phytoremediation is defined as the use of plants to extract, resist, detoxify, and/or sequester toxic environmental pollutants. The long-term goal of the proposed research is to develop and test highly productive, field-adapted plant species that have been engineered for the phytoremediation of mercury. A variety of different genes, which should enable plants to clean mercury polluted sites are being tested as tools for mercury phytoremediation, first in model laboratory plants and then in potential field species. Several of these genes have already been shown to enhance mercury phytoremediation. Mercury pollution is a serious, world-wide problem affecting the health of humanmore » and wildlife populations. Environmentally, the most serious mercury threat is the production of methylmercury (CH3Hg+) by native bacteria at mercury contaminated wetland sites. Methylmercury is inherently more toxic than metallic (Hg(0)) or ionic (Hg(II)) mercury, and because methylmercury is prolifically biomagnified up the food chain, it poses the most immediate danger to animal populations. We have successfully engineered two model plants, Arabidopsis and tobacco, to use the bacterial merB gene to convert methylmercury to less toxic ionic mercury and to use the bacterial merA gene to further detoxify ionic mercury to the least toxic form of mercury, metallic mercury. Plants expressing both MerA and MerB proteins detoxify methylmercury in two steps to the metallic form. These plants germinate, grow, and set seed at normal growth rates on levels of methylmercury or ionic mercury that are lethal to normal plants. Our newest efforts involve engineering plants with several additional bacterial and plant genes that allow for higher levels of mercury resistance and mercury hyperaccumulation. The potential for these plants to hyperaccumulate mercury was further advanced by developing constitutive, aboveground, and root-specific gene expression systems. Our current strategy is to engineer plants to control the chemical speciation, electrochemical state, transport, and aboveground binding of mercury in order to manage this toxicant.« less

  3. Bacterial community structure in the drinking water microbiome is governed by filtration processes.

    PubMed

    Pinto, Ameet J; Xi, Chuanwu; Raskin, Lutgarde

    2012-08-21

    The bacterial community structure of a drinking water microbiome was characterized over three seasons using 16S rRNA gene based pyrosequencing of samples obtained from source water (a mix of a groundwater and a surface water), different points in a drinking water plant operated to treat this source water, and in the associated drinking water distribution system. Even though the source water was shown to seed the drinking water microbiome, treatment process operations limit the source water's influence on the distribution system bacterial community. Rather, in this plant, filtration by dual media rapid sand filters played a primary role in shaping the distribution system bacterial community over seasonal time scales as the filters harbored a stable bacterial community that seeded the water treatment processes past filtration. Bacterial taxa that colonized the filter and sloughed off in the filter effluent were able to persist in the distribution system despite disinfection of finished water by chloramination and filter backwashing with chloraminated backwash water. Thus, filter colonization presents a possible ecological survival strategy for bacterial communities in drinking water systems, which presents an opportunity to control the drinking water microbiome by manipulating the filter microbial community. Grouping bacterial taxa based on their association with the filter helped to elucidate relationships between the abundance of bacterial groups and water quality parameters and showed that pH was the strongest regulator of the bacterial community in the sampled drinking water system.

  4. Perturbations of gut microbiome genes in infants with atopic dermatitis according to feeding type.

    PubMed

    Lee, Min-Jung; Kang, Mi-Jin; Lee, So-Yeon; Lee, Eun; Kim, Kangjin; Won, Sungho; Suh, Dong In; Kim, Kyung Won; Sheen, Youn Ho; Ahn, Kangmo; Kim, Bong-Soo; Hong, Soo-Jong

    2018-04-01

    Perturbations of the infant gut microbiota can shape development of the immune system and link to the risk of allergic diseases. We sought to understand the role of the gut microbiome in patients with atopic dermatitis (AD). The metagenome of the infant gut microbiome was analyzed according to feeding types. Composition of the gut microbiota was analyzed in fecal samples from 129 infants (6 months old) by using pyrosequencing, including 66 healthy infants and 63 infants with AD. The functional profile of the gut microbiome was analyzed by means of whole-metagenome sequencing (20 control subjects and 20 patients with AD). In addition, the total number of bacteria in the feces was determined by using real-time PCR. The gut microbiome of 6-month-old infants was different based on feeding types, and 2 microbiota groups (Bifidobacterium species-dominated and Escherichia/Veillonella species-dominated groups) were found in breast-fed and mixed-fed infants. Bacterial cell amounts in the feces were lower in infants with AD than in control infants. Although no specific taxa directly correlated with AD in 16S rRNA gene results, whole-metagenome analysis revealed differences in functional genes related to immune development. The reduction in genes for oxidative phosphorylation, phosphatidylinositol 3-kinase-Akt signaling, estrogen signaling, nucleotide-binding domain-like receptor signaling, and antigen processing and presentation induced by reduced colonization of mucin-degrading bacteria (Akkermansia muciniphila, Ruminococcus gnavus, and Lachnospiraceae bacterium 2_1_58FAA) was significantly associated with stunted immune development in the AD group compared with the control group (P < .05). Alterations in the gut microbiome can be associated with AD because of different bacterial genes that can modulate host immune cell function. Copyright © 2018 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  5. Bacteriophages as Weapons Against Bacterial Biofilms in the Food Industry.

    PubMed

    Gutiérrez, Diana; Rodríguez-Rubio, Lorena; Martínez, Beatriz; Rodríguez, Ana; García, Pilar

    2016-01-01

    Microbiological contamination in the food industry is often attributed to the presence of biofilms in processing plants. Bacterial biofilms are complex communities of bacteria attached to a surface and surrounded by an extracellular polymeric material. Their extreme resistance to cleaning and disinfecting processes is related to a unique organization, which implies a differential bacterial growth and gene expression inside the biofilm. The impact of biofilms on health, and the economic consequences, has promoted the development of different approaches to control or remove biofilm formation. Recently, successful results in phage therapy have boosted new research in bacteriophages and phage lytic proteins for biofilm eradication. In this regard, this review examines the environmental factors that determine biofilm development in food-processing equipment. In addition, future perspectives for the use of bacteriophage-derived tools as disinfectants are discussed.

  6. Bacteriophages as Weapons Against Bacterial Biofilms in the Food Industry

    PubMed Central

    Gutiérrez, Diana; Rodríguez-Rubio, Lorena; Martínez, Beatriz; Rodríguez, Ana; García, Pilar

    2016-01-01

    Microbiological contamination in the food industry is often attributed to the presence of biofilms in processing plants. Bacterial biofilms are complex communities of bacteria attached to a surface and surrounded by an extracellular polymeric material. Their extreme resistance to cleaning and disinfecting processes is related to a unique organization, which implies a differential bacterial growth and gene expression inside the biofilm. The impact of biofilms on health, and the economic consequences, has promoted the development of different approaches to control or remove biofilm formation. Recently, successful results in phage therapy have boosted new research in bacteriophages and phage lytic proteins for biofilm eradication. In this regard, this review examines the environmental factors that determine biofilm development in food-processing equipment. In addition, future perspectives for the use of bacteriophage-derived tools as disinfectants are discussed. PMID:27375566

  7. Designer cells programming quorum-sensing interference with microbes.

    PubMed

    Sedlmayer, Ferdinand; Hell, Dennis; Müller, Marius; Ausländer, David; Fussenegger, Martin

    2018-05-08

    Quorum sensing is a promising target for next-generation anti-infectives designed to address evolving bacterial drug resistance. The autoinducer-2 (AI-2) is a key quorum-sensing signal molecule which regulates bacterial group behaviors and is recognized by many Gram-negative and Gram-positive bacteria. Here we report a synthetic mammalian cell-based microbial-control device that detects microbial chemotactic formyl peptides through a formyl peptide sensor (FPS) and responds by releasing AI-2. The microbial-control device was designed by rewiring an artificial receptor-based signaling cascade to a modular biosynthetic AI-2 production platform. Mammalian cells equipped with the microbial-control gene circuit detect formyl peptides secreted from various microbes with high sensitivity and respond with robust AI-2 production, resulting in control of quorum sensing-related behavior of pathogenic Vibrio harveyi and attenuation of biofilm formation by the human pathogen Candida albicans. The ability to manipulate mixed microbial populations through fine-tuning of AI-2 levels may provide opportunities for future anti-infective strategies.

  8. Whole-body transcriptome of selectively bred, resistant-, control-, and susceptible-line rainbow trout following experimental challenge with Flavobacterium psychrophilum

    PubMed Central

    Marancik, David; Gao, Guangtu; Paneru, Bam; Ma, Hao; Hernandez, Alvaro G.; Salem, Mohamed; Yao, Jianbo; Palti, Yniv; Wiens, Gregory D.

    2014-01-01

    Genetic improvement for enhanced disease resistance in fish is an increasingly utilized approach to mitigate endemic infectious disease in aquaculture. In domesticated salmonid populations, large phenotypic variation in disease resistance has been identified but the genetic basis for altered responsiveness remains unclear. We previously reported three generations of selection and phenotypic validation of a bacterial cold water disease (BCWD) resistant line of rainbow trout, designated ARS-Fp-R. This line has higher survival after infection by either standardized laboratory challenge or natural challenge as compared to two reference lines, designated ARS-Fp-C (control) and ARS-Fp-S (susceptible). In this study, we utilized 1.1 g fry from the three genetic lines and performed RNA-seq to measure transcript abundance from the whole body of naive and Flavobacterium psychrophilum infected fish at day 1 (early time-point) and at day 5 post-challenge (onset of mortality). Sequences from 24 libraries were mapped onto the rainbow trout genome reference transcriptome of 46,585 predicted protein coding mRNAs that included 2633 putative immune-relevant gene transcripts. A total of 1884 genes (4.0% genome) exhibited differential transcript abundance between infected and mock-challenged fish (FDR < 0.05) that included chemokines, complement components, tnf receptor superfamily members, interleukins, nod-like receptor family members, and genes involved in metabolism and wound healing. The largest number of differentially expressed genes occurred on day 5 post-infection between naive and challenged ARS-Fp-S line fish correlating with high bacterial load. After excluding the effect of infection, we identified 21 differentially expressed genes between the three genetic lines. In summary, these data indicate global transcriptome differences between genetic lines of naive animals as well as differentially regulated transcriptional responses to infection. PMID:25620978

  9. Isolation of Pseudobutyrivibrio ruminis and Pseudobutyrivibrio xylanivorans from rumen of Creole goats fed native forage diet.

    PubMed

    Grilli, D J; Cerón, M E; Paez, S; Egea, V; Schnittger, L; Cravero, S; Escudero, M Sosa; Allegretti, L; Arenas, G N

    2013-09-01

    We isolated and identified functional groups of bacteria in the rumen of Creole goats involved in ruminal fermentation of native forage shrubs. The functional bacterial groups were evaluated by comparing the total viable, total anaerobic, cellulolytic, hemicellulolytic, and amylolytic bacterial counts in the samples taken from fistulated goats fed native forage diet (Atriplex lampa and Prosopis flexuosa). Alfalfa hay and corn were used as control diet. The roll tubes method increased the possibility of isolating and 16S rDNA gene sequencing allowed definitive identification of bacterial species involved in the ruminal fermentation. The starch and fiber contents of the diets influenced the number of total anaerobic bacteria and fibrolytic and amylolytic functional groups. Pseudobutyrivibrio ruminis and Pseudobutyrivibrio xylanivorans were the main species isolated and identified. The identification of bacterial strains involved in the rumen fermentation helps to explain the ability of these animals to digest fiber plant cell wall contained in native forage species.

  10. Exploring abundance, diversity and variation of a widespread antibiotic resistance gene in wastewater treatment plants.

    PubMed

    Wei, Ziyan; Feng, Kai; Li, Shuzhen; Zhang, Yu; Chen, Hongrui; Yin, Huaqun; Xu, Meiying; Deng, Ye

    2018-05-09

    An updated sul1 gene sequence database was constructed and new degenerate primers were designed to better investigate the abundance, diversity, and variation of a ubiquitous antibiotic resistance gene, sul1, with PCR-based methods in activated sludge from wastewater treatment plants (WWTPs). The newly designed degenerate primers showed high specificity and higher coverage in both in-silico evaluations and activated sludge samples compared to previous sul1 primers. Using the new primers, the abundance and diversity of sul1 gene, together with 16S rRNA gene, in activated sludge from five WWTPs in summer and winter were determined by quantitative PCR and MiSeq sequencing. The sul1 gene was found to be prevalent and displayed a comparable abundance (0.081 copies per bacterial cell in average) to the total bacteria across all samples. However, compared to the significant seasonal and geographical divergences in the quantity and diversity of bacterial communities in WWTPs, there were no significant seasonal or geographical variations of representative clusters of sul1 gene in most cases. Additionally, the representative sul1 clusters showed fairly close phylogeny and there was no obvious correlation between sul1 gene and the dominant bacterial genera, as well as the int1 gene, suggesting that bacterial hosts of sul1 gene is not stable, the sul1 gene may be carried by mobile genetic elements, sometimes integrated with class 1 integrons and sometimes not. Thus mobile genetic elements likely play a greater role than specific microbial taxa in determining the composition of sul1 gene in WWTPs. Copyright © 2018. Published by Elsevier Ltd.

  11. Effect of Periodontal Pathogens on the Metatranscriptome of a Healthy Multispecies Biofilm Model

    PubMed Central

    Duran-Pinedo, Ana

    2012-01-01

    Oral bacterial biofilms are highly complex microbial communities with up to 700 different bacterial taxa. We report here the use of metatranscriptomic analysis to study patterns of community gene expression in a multispecies biofilm model composed of species found in healthy oral biofilms (Actinomyces naeslundii, Lactobacillus casei, Streptococcus mitis, Veillonella parvula, and Fusobacterium nucleatum) and the same biofilm plus the periodontopathogens Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans. The presence of the periodontopathogens altered patterns in gene expression, and data indicate that transcription of protein-encoding genes and small noncoding RNAs is stimulated. In the healthy biofilm hypothetical proteins, transporters and transcriptional regulators were upregulated while chaperones and cell division proteins were downregulated. However, when the pathogens were present, chaperones were highly upregulated, probably due to increased levels of stress. We also observed a significant upregulation of ABC transport systems and putative transposases. Changes in Clusters of Orthologous Groups functional categories as well as gene set enrichment analysis based on Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways showed that in the absence of pathogens, only sets of proteins related to transport and secondary metabolism were upregulated, while in the presence of pathogens, proteins related to growth and division as well as a large portion of transcription factors were upregulated. Finally, we identified several small noncoding RNAs whose predicted targets were genes differentially expressed in the open reading frame libraries. These results show the importance of pathogens controlling gene expression of a healthy oral community and the usefulness of metatranscriptomic techniques to study gene expression profiles in complex microbial community models. PMID:22328675

  12. Genomic Location of the Major Ribosomal Protein Gene Locus Determines Vibrio cholerae Global Growth and Infectivity

    PubMed Central

    Soler-Bistué, Alfonso; Mondotte, Juan A.; Bland, Michael Jason; Val, Marie-Eve; Saleh, María-Carla; Mazel, Didier

    2015-01-01

    The effects on cell physiology of gene order within the bacterial chromosome are poorly understood. In silico approaches have shown that genes involved in transcription and translation processes, in particular ribosomal protein (RP) genes, localize near the replication origin (oriC) in fast-growing bacteria suggesting that such a positional bias is an evolutionarily conserved growth-optimization strategy. Such genomic localization could either provide a higher dosage of these genes during fast growth or facilitate the assembly of ribosomes and transcription foci by keeping physically close the many components of these macromolecular machines. To explore this, we used novel recombineering tools to create a set of Vibrio cholerae strains in which S10-spec-α (S10), a locus bearing half of the ribosomal protein genes, was systematically relocated to alternative genomic positions. We show that the relative distance of S10 to the origin of replication tightly correlated with a reduction of S10 dosage, mRNA abundance and growth rate within these otherwise isogenic strains. Furthermore, this was accompanied by a significant reduction in the host-invasion capacity in Drosophila melanogaster. Both phenotypes were rescued in strains bearing two S10 copies highly distal to oriC, demonstrating that replication-dependent gene dosage reduction is the main mechanism behind these alterations. Hence, S10 positioning connects genome structure to cell physiology in Vibrio cholerae. Our results show experimentally for the first time that genomic positioning of genes involved in the flux of genetic information conditions global growth control and hence bacterial physiology and potentially its evolution. PMID:25875621

  13. Improved Escherichia coli Bactofection and Cytotoxicity by Heterologous Expression of Bacteriophage ΦX174 Lysis Gene E.

    PubMed

    Chung, Tai-Chun; Jones, Charles H; Gollakota, Akhila; Kamal Ahmadi, Mahmoud; Rane, Snehal; Zhang, Guojian; Pfeifer, Blaine A

    2015-05-04

    Bactofection offers a gene delivery option particularly useful in the context of immune modulation. The bacterial host naturally attracts recognition and cellular uptake by antigen presenting cells (APCs) as the initial step in triggering an immune response. Moreover, depending on the bacterial vector, molecular biology tools are available to influence and/or overcome additional steps and barriers to effective antigen presentation. In this work, molecular engineering was applied using Escherichia coli as a bactofection vector. In particular, the bacteriophage ΦX174 lysis E (LyE) gene was designed for variable expression across strains containing different levels of lysteriolysin O (LLO). The objective was to generate a bacterial vector with improved attenuation and delivery characteristics. The resulting strains exhibited enhanced gene and protein release and inducible cellular death. In addition, the new vectors demonstrated improved gene delivery and cytotoxicity profiles to RAW264.7 macrophage APCs.

  14. Phylogeny Inference of Closely Related Bacterial Genomes: Combining the Features of Both Overlapping Genes and Collinear Genomic Regions

    PubMed Central

    Zhang, Yan-Cong; Lin, Kui

    2015-01-01

    Overlapping genes (OGs) represent one type of widespread genomic feature in bacterial genomes and have been used as rare genomic markers in phylogeny inference of closely related bacterial species. However, the inference may experience a decrease in performance for phylogenomic analysis of too closely or too distantly related genomes. Another drawback of OGs as phylogenetic markers is that they usually take little account of the effects of genomic rearrangement on the similarity estimation, such as intra-chromosome/genome translocations, horizontal gene transfer, and gene losses. To explore such effects on the accuracy of phylogeny reconstruction, we combine phylogenetic signals of OGs with collinear genomic regions, here called locally collinear blocks (LCBs). By putting these together, we refine our previous metric of pairwise similarity between two closely related bacterial genomes. As a case study, we used this new method to reconstruct the phylogenies of 88 Enterobacteriale genomes of the class Gammaproteobacteria. Our results demonstrated that the topological accuracy of the inferred phylogeny was improved when both OGs and LCBs were simultaneously considered, suggesting that combining these two phylogenetic markers may reduce, to some extent, the influence of gene loss on phylogeny inference. Such phylogenomic studies, we believe, will help us to explore a more effective approach to increasing the robustness of phylogeny reconstruction of closely related bacterial organisms. PMID:26715828

  15. Census of solo LuxR genes in prokaryotic genomes

    PubMed Central

    Hudaiberdiev, Sanjarbek; Choudhary, Kumari S.; Vera Alvarez, Roberto; Gelencsér, Zsolt; Ligeti, Balázs; Lamba, Doriano; Pongor, Sándor

    2015-01-01

    luxR genes encode transcriptional regulators that control acyl homoserine lactone-based quorum sensing (AHL QS) in Gram negative bacteria. On the bacterial chromosome, luxR genes are usually found next or near to a luxI gene encoding the AHL signal synthase. Recently, a number of luxR genes were described that have no luxI genes in their vicinity on the chromosome. These so-called solo luxR genes may either respond to internal AHL signals produced by a non-adjacent luxI in the chromosome, or can respond to exogenous signals. Here we present a survey of solo luxR genes found in complete and draft bacterial genomes in the NCBI databases using HMMs. We found that 2698 of the 3550 luxR genes found are solos, which is an unexpectedly high number even if some of the hits may be false positives. We also found that solo LuxR sequences form distinct clusters that are different from the clusters of LuxR sequences that are part of the known luxR-luxI topological arrangements. We also found a number of cases that we termed twin luxR topologies, in which two adjacent luxR genes were in tandem or divergent orientation. Many of the luxR solo clusters were devoid of the sequence motifs characteristic of AHL binding LuxR proteins so there is room to speculate that the solos may be involved in sensing hitherto unknown signals. It was noted that only some of the LuxR clades are rich in conserved cysteine residues. Molecular modeling suggests that some of the cysteines may be involved in disulfide formation, which makes us speculate that some LuxR proteins, including some of the solos may be involved in redox regulation. PMID:25815274

  16. Census of solo LuxR genes in prokaryotic genomes.

    PubMed

    Hudaiberdiev, Sanjarbek; Choudhary, Kumari S; Vera Alvarez, Roberto; Gelencsér, Zsolt; Ligeti, Balázs; Lamba, Doriano; Pongor, Sándor

    2015-01-01

    luxR genes encode transcriptional regulators that control acyl homoserine lactone-based quorum sensing (AHL QS) in Gram negative bacteria. On the bacterial chromosome, luxR genes are usually found next or near to a luxI gene encoding the AHL signal synthase. Recently, a number of luxR genes were described that have no luxI genes in their vicinity on the chromosome. These so-called solo luxR genes may either respond to internal AHL signals produced by a non-adjacent luxI in the chromosome, or can respond to exogenous signals. Here we present a survey of solo luxR genes found in complete and draft bacterial genomes in the NCBI databases using HMMs. We found that 2698 of the 3550 luxR genes found are solos, which is an unexpectedly high number even if some of the hits may be false positives. We also found that solo LuxR sequences form distinct clusters that are different from the clusters of LuxR sequences that are part of the known luxR-luxI topological arrangements. We also found a number of cases that we termed twin luxR topologies, in which two adjacent luxR genes were in tandem or divergent orientation. Many of the luxR solo clusters were devoid of the sequence motifs characteristic of AHL binding LuxR proteins so there is room to speculate that the solos may be involved in sensing hitherto unknown signals. It was noted that only some of the LuxR clades are rich in conserved cysteine residues. Molecular modeling suggests that some of the cysteines may be involved in disulfide formation, which makes us speculate that some LuxR proteins, including some of the solos may be involved in redox regulation.

  17. Transcriptomic Analyses Elucidate Adaptive Differences of Closely Related Strains of Pseudomonas aeruginosa in Fuel

    PubMed Central

    Gunasekera, Thusitha S.; Bowen, Loryn L.; Zhou, Carol E.; Howard-Byerly, Susan C.; Foley, William S.; Striebich, Richard C.; Dugan, Larry C.

    2017-01-01

    ABSTRACT Pseudomonas aeruginosa can utilize hydrocarbons, but different strains have various degrees of adaptation despite their highly conserved genome. P. aeruginosa ATCC 33988 is highly adapted to hydrocarbons, while P. aeruginosa strain PAO1, a human pathogen, is less adapted and degrades jet fuel at a lower rate than does ATCC 33988. We investigated fuel-specific transcriptomic differences between these strains in order to ascertain the underlying mechanisms utilized by the adapted strain to proliferate in fuel. During growth in fuel, the genes related to alkane degradation, heat shock response, membrane proteins, efflux pumps, and several novel genes were upregulated in ATCC 33988. Overexpression of alk genes in PAO1 provided some improvement in growth, but it was not as robust as that of ATCC 33988, suggesting the role of other genes in adaptation. Expression of the function unknown gene PA5359 from ATCC 33988 in PAO1 increased the growth in fuel. Bioinformatic analysis revealed that PA5359 is a predicted lipoprotein with a conserved Yx(FWY)xxD motif, which is shared among bacterial adhesins. Overexpression of the putative resistance-nodulation-division (RND) efflux pump PA3521 to PA3523 increased the growth of the ATCC 33988 strain, suggesting a possible role in fuel tolerance. Interestingly, the PAO1 strain cannot utilize n-C8 and n-C10. The expression of green fluorescent protein (GFP) under the control of alkB promoters confirmed that alk gene promoter polymorphism affects the expression of alk genes. Promoter fusion assays further confirmed that the regulation of alk genes was different in the two strains. Protein sequence analysis showed low amino acid differences for many of the upregulated genes, further supporting transcriptional control as the main mechanism for enhanced adaptation. IMPORTANCE These results support that specific signal transduction, gene regulation, and coordination of multiple biological responses are required to improve the survival, growth, and metabolism of fuel in adapted strains. This study provides new insight into the mechanistic differences between strains and helpful information that may be applied in the improvement of bacterial strains for resistance to biotic and abiotic factors encountered during bioremediation and industrial biotechnological processes. PMID:28314727

  18. Comparative Genomic Analyses of the Bacterial Phosphotransferase System

    PubMed Central

    Barabote, Ravi D.; Saier, Milton H.

    2005-01-01

    We report analyses of 202 fully sequenced genomes for homologues of known protein constituents of the bacterial phosphoenolpyruvate-dependent phosphotransferase system (PTS). These included 174 bacterial, 19 archaeal, and 9 eukaryotic genomes. Homologues of PTS proteins were not identified in archaea or eukaryotes, showing that the horizontal transfer of genes encoding PTS proteins has not occurred between the three domains of life. Of the 174 bacterial genomes (136 bacterial species) analyzed, 30 diverse species have no PTS homologues, and 29 species have cytoplasmic PTS phosphoryl transfer protein homologues but lack recognizable PTS permeases. These soluble homologues presumably function in regulation. The remaining 77 species possess all PTS proteins required for the transport and phosphorylation of at least one sugar via the PTS. Up to 3.2% of the genes in a bacterium encode PTS proteins. These homologues were analyzed for family association, range of protein types, domain organization, and organismal distribution. Different strains of a single bacterial species often possess strikingly different complements of PTS proteins. Types of PTS protein domain fusions were analyzed, showing that certain types of domain fusions are common, while others are rare or prohibited. Select PTS proteins were analyzed from different phylogenetic standpoints, showing that PTS protein phylogeny often differs from organismal phylogeny. The results document the frequent gain and loss of PTS protein-encoding genes and suggest that the lateral transfer of these genes within the bacterial domain has played an important role in bacterial evolution. Our studies provide insight into the development of complex multicomponent enzyme systems and lead to predictions regarding the types of protein-protein interactions that promote efficient PTS-mediated phosphoryl transfer. PMID:16339738

  19. High level bacterial contamination of secondary school students' mobile phones.

    PubMed

    Kõljalg, Siiri; Mändar, Rando; Sõber, Tiina; Rööp, Tiiu; Mändar, Reet

    2017-06-01

    While contamination of mobile phones in the hospital has been found to be common in several studies, little information about bacterial abundance on phones used in the community is available. Our aim was to quantitatively determine the bacterial contamination of secondary school students' mobile phones. Altogether 27 mobile phones were studied. The contact plate method and microbial identification using MALDI-TOF mass spectrometer were used for culture studies. Quantitative PCR reaction for detection of universal 16S rRNA, Enterococcus faecalis 16S rRNA and Escherichia coli allantoin permease were performed, and the presence of tetracycline ( tet A, tet B, tet M), erythromycin ( erm B) and sulphonamide ( sul 1) resistance genes was assessed. We found a high median bacterial count on secondary school students' mobile phones (10.5 CFU/cm 2 ) and a median of 17,032 bacterial 16S rRNA gene copies per phone. Potentially pathogenic microbes ( Staphylococcus aureus , Acinetobacter spp. , Pseudomonas spp., Bacillus cereus and Neisseria flavescens ) were found among dominant microbes more often on phones with higher percentage of E. faecalis in total bacterial 16S rRNA. No differences in contamination level or dominating bacterial species between phone owner's gender and between phone types (touch screen/keypad) were found. No antibiotic resistance genes were detected on mobile phone surfaces. Quantitative study methods revealed high level bacterial contamination of secondary school students' mobile phones.

  20. High level bacterial contamination of secondary school students’ mobile phones

    PubMed Central

    Kõljalg, Siiri; Mändar, Rando; Sõber, Tiina; Rööp, Tiiu; Mändar, Reet

    2017-01-01

    Introduction While contamination of mobile phones in the hospital has been found to be common in several studies, little information about bacterial abundance on phones used in the community is available. Our aim was to quantitatively determine the bacterial contamination of secondary school students’ mobile phones. Methods Altogether 27 mobile phones were studied. The contact plate method and microbial identification using MALDI-TOF mass spectrometer were used for culture studies. Quantitative PCR reaction for detection of universal 16S rRNA, Enterococcus faecalis 16S rRNA and Escherichia coli allantoin permease were performed, and the presence of tetracycline (tetA, tetB, tetM), erythromycin (ermB) and sulphonamide (sul1) resistance genes was assessed. Results We found a high median bacterial count on secondary school students’ mobile phones (10.5 CFU/cm2) and a median of 17,032 bacterial 16S rRNA gene copies per phone. Potentially pathogenic microbes (Staphylococcus aureus, Acinetobacter spp., Pseudomonas spp., Bacillus cereus and Neisseria flavescens) were found among dominant microbes more often on phones with higher percentage of E. faecalis in total bacterial 16S rRNA. No differences in contamination level or dominating bacterial species between phone owner’s gender and between phone types (touch screen/keypad) were found. No antibiotic resistance genes were detected on mobile phone surfaces. Conclusion Quantitative study methods revealed high level bacterial contamination of secondary school students’ mobile phones. PMID:28626737

  1. Bacterial identification and subtyping using DNA microarray and DNA sequencing.

    PubMed

    Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D

    2012-01-01

    The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.

  2. A real-time control system of gene expression using ligand-bound nucleic acid aptamer for metabolic engineering.

    PubMed

    Wang, Jing; Cui, Xun; Yang, Le; Zhang, Zhe; Lv, Liping; Wang, Haoyuan; Zhao, Zhenmin; Guan, Ningzi; Dong, Lichun; Chen, Rachel

    2017-07-01

    Artificial control of bio-functions through regulating gene expression is one of the most important and attractive technologies to build novel living systems that are useful in the areas of chemical synthesis, nanotechnology, pharmacology, cell biology. Here, we present a novel real-time control system of gene regulation that includes an enhancement element by introducing duplex DNA aptamers upstream promoter and a repression element by introducing a RNA aptamer upstream ribosome binding site. With the presence of ligands corresponding to the DNA aptamers, the expression of the target gene can be potentially enhanced at the transcriptional level by strengthening the recognition capability of RNAP to the recognition region and speeding up the separation efficiency of the unwinding region due to the induced DNA bubble around the thrombin-bound aptamers; while with the presence of RNA aptamer ligand, the gene expression can be repressed at the translational level by weakening the recognition capability of ribosome to RBS due to the shielding of RBS by the formed aptamer-ligand complex upstream RBS. The effectiveness and potential utility of the developed gene regulation system were demonstrated by regulating the expression of ecaA gene in the cell-free systems. The realistic metabolic engineering application of the system has also tested by regulating the expression of mgtC gene and thrombin cDNA in Escherichia coli JD1021 for controlling metabolic flux and improving thrombin production, verifying that the real-time control system of gene regulation is able to realize the dynamic regulation of gene expression with potential applications in bacterial physiology studies and metabolic engineering. Copyright © 2017. Published by Elsevier Inc.

  3. Organization and PprB-dependent control of the Pseudomonas aeruginosa tad Locus, involved in Flp pilus biology.

    PubMed

    Bernard, Christophe S; Bordi, Christophe; Termine, Elise; Filloux, Alain; de Bentzmann, Sophie

    2009-03-01

    Bacterial attachment to the substratum involves several cell surface organelles, including various types of pili. The Pseudomonas aeruginosa Tad machine assembles type IVb pili, which are required for adhesion to abiotic surfaces and to eukaryotic cells. Type IVb pili consist of a major subunit, the Flp pilin, processed by the FppA prepilin peptidase. In this study, we investigated the regulatory mechanism of the tad locus. We showed that the flp gene is expressed late in the stationary growth phase in aerobic conditions. We also showed that the tad locus was composed of five independent transcriptional units. We used transcriptional fusions to show that tad gene expression was positively controlled by the PprB response regulator. We subsequently showed that PprB bound to the promoter regions, directly controlling the expression of these genes. We then evaluated the contribution of two genes, tadF and rcpC, to type IVb pilus assembly. The deletion of these two genes had no effect on Flp production, pilus assembly, or Flp-mediated adhesion to abiotic surfaces in our conditions. However, our results suggest that the putative RcpC protein modifies the Flp pilin, thereby promoting Flp-dependent adhesion to eukaryotic cells.

  4. Diversity of pufM genes, involved in aerobic anoxygenic photosynthesis, in the bacterial communities associated with colonial ascidians.

    PubMed

    Martínez-García, Manuel; Díaz-Valdés, Marta; Antón, Josefa

    2010-03-01

    Ascidians are invertebrate filter feeders widely distributed in benthic marine environments. A total of 14 different ascidian species were collected from the Western Mediterranean and their bacterial communities were analyzed by denaturing gradient gel electrophoresis (DGGE) of 16S rRNA gene. Results showed that ascidian tissues harbored Bacteria belonging to Gamma- and Alphaproteobacteria classes, some of them phylogenetically related to known aerobic anoxygenic phototrophs (AAPs), such as Roseobacter sp. In addition, hierarchical cluster analysis of DGGE patterns showed a large variability in the bacterial diversity among the different ascidians analyzed, which indicates that they would harbor different bacterial communities. Furthermore, pufM genes, involved in aerobic anoxygenic photosynthesis in marine and freshwater systems, were widely detected within the ascidians analyzed, because nine out of 14 species had pufM genes inside their tissues. The pufM gene was only detected in those specimens that inhabited shallow waters (<77 m of depth). Most pufM gene sequences were very closely related to that of uncultured marine bacteria. Thus, our results suggest that the association of ascidians with bacteria related to AAPs could be a general phenomenon and that ascidian-associated microbiota could use the light that penetrates through the tunic tissue as an energy source.

  5. Systematic bacterialization of yeast genes identifies a near-universally swappable pathway

    PubMed Central

    Kachroo, Aashiq H; Laurent, Jon M; Akhmetov, Azat; Szilagyi-Jones, Madelyn; McWhite, Claire D; Zhao, Alice; Marcotte, Edward M

    2017-01-01

    Eukaryotes and prokaryotes last shared a common ancestor ~2 billion years ago, and while many present-day genes in these lineages predate this divergence, the extent to which these genes still perform their ancestral functions is largely unknown. To test principles governing retention of ancient function, we asked if prokaryotic genes could replace their essential eukaryotic orthologs. We systematically replaced essential genes in yeast by their 1:1 orthologs from Escherichia coli. After accounting for mitochondrial localization and alternative start codons, 31 out of 51 bacterial genes tested (61%) could complement a lethal growth defect and replace their yeast orthologs with minimal effects on growth rate. Replaceability was determined on a pathway-by-pathway basis; codon usage, abundance, and sequence similarity contributed predictive power. The heme biosynthesis pathway was particularly amenable to inter-kingdom exchange, with each yeast enzyme replaceable by its bacterial, human, or plant ortholog, suggesting it as a near-universally swappable pathway. DOI: http://dx.doi.org/10.7554/eLife.25093.001 PMID:28661399

  6. Bacterial community composition in the water column of a lake formed by a former uranium open pit mine.

    PubMed

    Edberg, Frida; Andersson, Anders F; Holmström, Sara J M

    2012-11-01

    Mining of pyrite minerals is a major environmental issue involving both biological and geochemical processes. Here we present a study of an artificial lake of a former uranium open pit mine with the aim to connect the chemistry and bacterial community composition (454-pyrosequencing of 16S rRNA genes) in the stratified water column. A shift in the water chemistry from oxic conditions in the epilimnion to anoxic, alkaline, and metal and sulfide-rich conditions in the hypolimnion was corresponded by a strong shift in the bacterial community, with few shared operational taxonomic units (OTU) between the water layers. The epilimnetic bacterial community of the lake (~20 years old) showed similarities to other temperate freshwater lakes, while the hypolimnetic bacterial community showed similarity to extreme chemical environments. The epilimnetic bacterial community had dominance of Actinobacteria and Betaproteobacteria. The hypolimnion displayed a higher bacterial diversity and was dominated by the phototrophic green sulphur bacterium of the genus Chlorobium (ca. 40 % of the total community). Deltaproteobacteria were only represented in the hypolimnion and the most abundant OTUs were affiliated with ferric iron and sulfate reducers of the genus Geobacter and Desulfobulbus, respectively. The chemistry is clearly controlling, especially the hypolimnetic, bacterial community but the community composition also indicates that the bacteria are involved in metal cycling in the lake.

  7. pH is the primary determinant of the bacterial community structure in agricultural soils impacted by polycyclic aromatic hydrocarbon pollution

    PubMed Central

    Wu, Yucheng; Zeng, Jun; Zhu, Qinghe; Zhang, Zhenfa; Lin, Xiangui

    2017-01-01

    Acidification and pollution are two major threats to agricultural ecosystems; however, microbial community responses to co-existed soil acidification and pollution remain less explored. In this study, arable soils of broad pH (4.26–8.43) and polycyclic aromatic hydrocarbon (PAH) gradients (0.18–20.68 mg kg−1) were collected from vegetable farmlands. Bacterial community characteristics including abundance, diversity and composition were revealed by quantitative PCR and high-throughput sequencing. The bacterial 16S rRNA gene copies significantly correlated with soil carbon and nitrogen contents, suggesting the control of nutrients accessibility on bacterial abundance. The bacterial diversity was strongly related to soil pH, with higher diversity in neutral samples and lower in acidic samples. Soil pH was also identified by an ordination analysis as important factor shaping bacterial community composition. The relative abundances of some dominant phyla varied along the pH gradient, and the enrichment of a few phylotypes suggested their adaptation to low pH condition. In contrast, at the current pollution level, PAH showed marginal effects on soil bacterial community. Overall, these findings suggest pH was the primary determinant of bacterial community in these arable soils, indicative of a more substantial influence of acidification than PAH pollution on bacteria driven ecological processes. PMID:28051171

  8. pH is the primary determinant of the bacterial community structure in agricultural soils impacted by polycyclic aromatic hydrocarbon pollution

    NASA Astrophysics Data System (ADS)

    Wu, Yucheng; Zeng, Jun; Zhu, Qinghe; Zhang, Zhenfa; Lin, Xiangui

    2017-01-01

    Acidification and pollution are two major threats to agricultural ecosystems; however, microbial community responses to co-existed soil acidification and pollution remain less explored. In this study, arable soils of broad pH (4.26-8.43) and polycyclic aromatic hydrocarbon (PAH) gradients (0.18-20.68 mg kg-1) were collected from vegetable farmlands. Bacterial community characteristics including abundance, diversity and composition were revealed by quantitative PCR and high-throughput sequencing. The bacterial 16S rRNA gene copies significantly correlated with soil carbon and nitrogen contents, suggesting the control of nutrients accessibility on bacterial abundance. The bacterial diversity was strongly related to soil pH, with higher diversity in neutral samples and lower in acidic samples. Soil pH was also identified by an ordination analysis as important factor shaping bacterial community composition. The relative abundances of some dominant phyla varied along the pH gradient, and the enrichment of a few phylotypes suggested their adaptation to low pH condition. In contrast, at the current pollution level, PAH showed marginal effects on soil bacterial community. Overall, these findings suggest pH was the primary determinant of bacterial community in these arable soils, indicative of a more substantial influence of acidification than PAH pollution on bacteria driven ecological processes.

  9. Bacterial population dynamics during the ensiling of Medicago sativa (alfalfa) and subsequent exposure to air.

    PubMed

    McGarvey, J A; Franco, R B; Palumbo, J D; Hnasko, R; Stanker, L; Mitloehner, F M

    2013-06-01

    To describe, at high resolution, the bacterial population dynamics and chemical transformations during the ensiling of alfalfa and subsequent exposure to air. Samples of alfalfa, ensiled alfalfa and silage exposed to air were collected and their bacterial population structures compared using 16S rRNA gene libraries containing approximately 1900 sequences each. Cultural and chemical analyses were also performed to complement the 16S gene sequence data. Sequence analysis revealed significant differences (P < 0·05) in the bacterial populations at each time point. The alfalfa-derived library contained mostly sequences associated with the Gammaproteobacteria (including the genera: Enterobacter, Erwinia and Pantoea); the ensiled material contained mostly sequences associated with the lactic acid bacteria (LAB) (including the genera: Lactobacillus, Pediococcus and Lactococcus). Exposure to air resulted in even greater percentages of LAB, especially among the genus Lactobacillus, and a significant drop in bacterial diversity. In-depth 16S rRNA gene sequence analysis revealed significant bacterial population structure changes during ensiling and again during exposure to air. This in-depth description of the bacterial population dynamics that occurred during ensiling and simulated feed out expands our knowledge of these processes. © 2013 The Society for Applied Microbiology No claim to US Government works.

  10. In vivo regulation of the heme oxygenase-1 gene in humanized transgenic mice

    PubMed Central

    Kim, Junghyun; Zarjou, Abolfazl; Traylor, Amie M.; Bolisetty, Subhashini; Jaimes, Edgar A.; Hull, Travis D.; George, James F.; Mikhail, Fady M.; Agarwal, Anupam

    2012-01-01

    Heme oxygenase-1 (HO-1) catalyzes the rate-limiting step in heme degradation producing equimolar amounts of carbon monoxide, iron, and biliverdin. Induction of HO-1 is a beneficial response to tissue injury in diverse animal models of diseases including acute kidney injury. In vitro analysis has shown that the human HO-1 gene is transcriptionally regulated by changes in chromatin conformation but whether such control occurs in vivo is not known. To enable such analysis, we generated transgenic mice, harboring an 87-kb bacterial artificial chromosome expressing human HO-1 mRNA and protein and bred these mice with HO-1 knockout mice to generate humanized BAC transgenic mice. This successfully rescued the phenotype of the knockout mice including reduced birth rates, tissue iron overload, splenomegaly, anemia, leukocytosis, dendritic cell abnormalities and survival after acute kidney injury induced by rhabdomyolysis or cisplatin nephrotoxicity. Transcription factors such as USF1/2, JunB, Sp1, and CTCF were found to associate with regulatory regions of the human HO-1 gene in the kidney following rhabdomyolysis. Chromosome Conformation Capture and ChIP-loop assays confirmed this in the formation of chromatin looping in vivo. Thus, these bacterial artificial chromosome humanized HO-1 mice are a valuable model to study the human HO-1 gene providing insight to the in vivo architecture of the gene in acute kidney injury and other diseases. PMID:22495295

  11. Antibiotic Combinations That Enable One-Step, Targeted Mutagenesis of Chromosomal Genes.

    PubMed

    Lee, Wonsik; Do, Truc; Zhang, Ge; Kahne, Daniel; Meredith, Timothy C; Walker, Suzanne

    2018-06-08

    Targeted modification of bacterial chromosomes is necessary to understand new drug targets, investigate virulence factors, elucidate cell physiology, and validate results of -omics-based approaches. For some bacteria, reverse genetics remains a major bottleneck to progress in research. Here, we describe a compound-centric strategy that combines new negative selection markers with known positive selection markers to achieve simple, efficient one-step genome engineering of bacterial chromosomes. The method was inspired by the observation that certain nonessential metabolic pathways contain essential late steps, suggesting that antibiotics targeting a late step can be used to select for the absence of genes that control flux into the pathway. Guided by this hypothesis, we have identified antibiotic/counterselectable markers to accelerate reverse engineering of two increasingly antibiotic-resistant pathogens, Staphylococcus aureus and Acinetobacter baumannii. For S. aureus, we used wall teichoic acid biosynthesis inhibitors to select for the absence of tarO and for A. baumannii, we used colistin to select for the absence of lpxC. We have obtained desired gene deletions, gene fusions, and promoter swaps in a single plating step with perfect efficiency. Our method can also be adapted to generate markerless deletions of genes using FLP recombinase. The tools described here will accelerate research on two important pathogens, and the concept we outline can be readily adapted to any organism for which a suitable target pathway can be identified.

  12. Transcriptional Control of the Lateral-Flagellar Genes of Bradyrhizobium diazoefficiens.

    PubMed

    Mongiardini, Elías J; Quelas, J Ignacio; Dardis, Carolina; Althabegoiti, M Julia; Lodeiro, Aníbal R

    2017-08-01

    Bradyrhizobium diazoefficiens , a soybean N 2 -fixing symbiont, possesses a dual flagellar system comprising a constitutive subpolar flagellum and inducible lateral flagella. Here, we analyzed the genomic organization and biosynthetic regulation of the lateral-flagellar genes. We found that these genes are located in a single genomic cluster, organized in two monocistronic transcriptional units and three operons, one possibly containing an internal transcription start site. Among the monocistronic units is blr6846, homologous to the class IB master regulators of flagellum synthesis in Brucella melitensis and Ensifer meliloti and required for the expression of all the lateral-flagellar genes except lafA2 , whose locus encodes a single lateral flagellin. We therefore named blr6846 lafR ( la teral- f lagellar r egulator). Despite its similarity to two-component response regulators and its possession of a phosphorylatable Asp residue, lafR behaved as an orphan response regulator by not requiring phosphorylation at this site. Among the genes induced by lafR is flbT L , a class III regulator. We observed different requirements for FlbT L in the synthesis of each flagellin subunit. Although the accumulation of lafA1 , but not lafA2 , transcripts required FlbT L , the production of both flagellin polypeptides required FlbT L Moreover, the regulation cascade of this lateral-flagellar regulon appeared to be not as strictly ordered as those found in other bacterial species. IMPORTANCE Bacterial motility seems essential for the free-living style in the environment, and therefore these microorganisms allocate a great deal of their energetic resources to the biosynthesis and functioning of flagella. Despite energetic costs, some bacterial species possess dual flagellar systems, one of which is a primary system normally polar or subpolar, and the other is a secondary, lateral system that is produced only under special circumstances. Bradyrhizobium diazoefficiens , an N 2 -fixing symbiont of soybean plants, possesses dual flagellar systems, including the lateral system that contributes to swimming in wet soil and competition for nodulation and is expressed under high energy availability, as well as under requirement for high torque by the flagella. The structural organization and transcriptional regulation of the 41 genes that comprise this secondary flagellar system seem adapted to adjust bacterial energy expenditures for motility to the soil's environmental dynamics. Copyright © 2017 American Society for Microbiology.

  13. A novel firmicute protein family related to the actinobacterial resuscitation-promoting factors by non-orthologous domain displacement.

    PubMed

    Ravagnani, Adriana; Finan, Christopher L; Young, Michael

    2005-03-17

    In Micrococcus luteus growth and resuscitation from starvation-induced dormancy is controlled by the production of a secreted growth factor. This autocrine resuscitation-promoting factor (Rpf) is the founder member of a family of proteins found throughout and confined to the actinobacteria (high G + C Gram-positive bacteria). The aim of this work was to search for and characterise a cognate gene family in the firmicutes (low G + C Gram-positive bacteria) and obtain information about how they may control bacterial growth and resuscitation. In silico analysis of the accessory domains of the Rpf proteins permitted their classification into several subfamilies. The RpfB subfamily is related to a group of firmicute proteins of unknown function, represented by YabE of Bacillus subtilis. The actinobacterial RpfB and firmicute YabE proteins have very similar domain structures and genomic contexts, except that in YabE, the actinobacterial Rpf domain is replaced by another domain, which we have called Sps. Although totally unrelated in both sequence and secondary structure, the Rpf and Sps domains fulfil the same function. We propose that these proteins have undergone "non-orthologous domain displacement", a phenomenon akin to "non-orthologous gene displacement" that has been described previously. Proteins containing the Sps domain are widely distributed throughout the firmicutes and they too fall into a number of distinct subfamilies. Comparative analysis of the accessory domains in the Rpf and Sps proteins, together with their weak similarity to lytic transglycosylases, provide clear evidence that they are muralytic enzymes. The results indicate that the firmicute Sps proteins and the actinobacterial Rpf proteins are cognate and that they control bacterial culturability via enzymatic modification of the bacterial cell envelope.

  14. Bacteriophage-like Particles Associated with the Gene Transfer Agent of Methanococcus Voltale PS

    NASA Technical Reports Server (NTRS)

    Bertani, G.; Eiserling, F.; Pushkin, A.; Gingery, M.

    1999-01-01

    The methanogenic archaebacterium Methanococus voltae (strain PS) is known to produce a filterable, DNase resistant agent (called VTA, for voltae transfer agent), which carries very small fragments (4,400 base pairs) of bacterial DNA and is able to transduce bacterial genes between derivatives of the strain.

  15. Identification and expression profiles of multiple genes in Nile tilapia in response to bacterial infections

    USDA-ARS?s Scientific Manuscript database

    To understand the molecular mechanisms involved in response of Nile tilapia (Oreochromis niloticus) to bacterial infection, suppression subtractive cDNA hybridization technique was used to identify upregulated genes in the posterior kidney of Nile tilapia at 6h post infection with Aeromonas hydrophi...

  16. A tandem duplication of a 5-bp sequence in the rcsB gene confers biofilm-producing phenotype in Escherichia coli O157:H7 strain 86-24

    USDA-ARS?s Scientific Manuscript database

    Biofilm formation, which is an important bacterial survival and virulence attribute, is controlled by intricate regulatory networks. Enterohemorrhagic Escherichia coli O157:H7 is an important foodborne pathogen because infections with this agent could lead to hemorrhagic colitis, kidney dysfunction,...

  17. Bacterial Degradation of Benzoate

    PubMed Central

    Valderrama, J. Andrés; Durante-Rodríguez, Gonzalo; Blázquez, Blas; García, José Luis; Carmona, Manuel; Díaz, Eduardo

    2012-01-01

    We have studied for the first time the transcriptional regulatory circuit that controls the expression of the box genes encoding the aerobic hybrid pathway used to assimilate benzoate via coenzyme A (CoA) derivatives in bacteria. The promoters responsible for the expression of the box cluster in the β-proteobacterium Azoarcus sp., their cognate transcriptional repressor, the BoxR protein, and the inducer molecule (benzoyl-CoA) have been characterized. The BoxR protein shows a significant sequence identity to the BzdR transcriptional repressor that controls the bzd genes involved in the anaerobic degradation of benzoate. Because the boxR gene is present in all box clusters so far identified in bacteria, the BoxR/benzoyl-CoA regulatory system appears to be a widespread strategy to control this aerobic hybrid pathway. Interestingly, the paralogous BoxR and BzdR regulators act synergistically to control the expression of the box and bzd genes. This cross-regulation between anaerobic and aerobic pathways for the catabolism of aromatic compounds has never been shown before, and it may reflect a biological strategy to increase the cell fitness in organisms that survive in environments subject to changing oxygen concentrations. PMID:22303008

  18. High-level fluorescence labeling of gram-positive pathogens.

    PubMed

    Aymanns, Simone; Mauerer, Stefanie; van Zandbergen, Ger; Wolz, Christiane; Spellerberg, Barbara

    2011-01-01

    Fluorescence labeling of bacterial pathogens has a broad range of interesting applications including the observation of living bacteria within host cells. We constructed a novel vector based on the E. coli streptococcal shuttle plasmid pAT28 that can propagate in numerous bacterial species from different genera. The plasmid harbors a promoterless copy of the green fluorescent variant gene egfp under the control of the CAMP-factor gene (cfb) promoter of Streptococcus agalactiae and was designated pBSU101. Upon transfer of the plasmid into streptococci, the bacteria show a distinct and easily detectable fluorescence using a standard fluorescence microscope and quantification by FACS-analysis demonstrated values that were 10-50 times increased over the respective controls. To assess the suitability of the construct for high efficiency fluorescence labeling in different gram-positive pathogens, numerous species were transformed. We successfully labeled Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. equisimilis, Enterococcus faecalis, Enterococcus faecium, Streptococcus mutans, Streptococcus anginosus and Staphylococcus aureus strains utilizing the EGFP reporter plasmid pBSU101. In all of these species the presence of the cfb promoter construct resulted in high-level EGFP expression that could be further increased by growing the streptococcal and enterococcal cultures under high oxygen conditions through continuous aeration.

  19. A brief multi-disciplinary review on antimicrobial resistance in medicine and its linkage to the global environmental microbiota

    PubMed Central

    Cantas, L.; Shah, Syed Q. A.; Cavaco, L. M.; Manaia, C. M.; Walsh, F.; Popowska, M.; Garelick, H.; Bürgmann, H.; Sørum, H.

    2013-01-01

    The discovery and introduction of antimicrobial agents to clinical medicine was one of the greatest medical triumphs of the 20th century that revolutionized the treatment of bacterial infections. However, the gradual emergence of populations of antimicrobial-resistant pathogenic bacteria resulting from use, misuse, and abuse of antimicrobials has today become a major global health concern. Antimicrobial resistance (AMR) genes have been suggested to originate from environmental bacteria, as clinically relevant resistance genes have been detected on the chromosome of environmental bacteria. As only a few new antimicrobials have been developed in the last decade, the further evolution of resistance poses a serious threat to public health. Urgent measures are required not only to minimize the use of antimicrobials for prophylactic and therapeutic purposes but also to look for alternative strategies for the control of bacterial infections. This review examines the global picture of antimicrobial resistance, factors that favor its spread, strategies, and limitations for its control and the need for continuous training of all stake-holders i.e., medical, veterinary, public health, and other relevant professionals as well as human consumers, in the appropriate use of antimicrobial drugs. PMID:23675371

  20. Reduced Set of Virulence Genes Allows High Accuracy Prediction of Bacterial Pathogenicity in Humans

    PubMed Central

    Iraola, Gregorio; Vazquez, Gustavo; Spangenberg, Lucía; Naya, Hugo

    2012-01-01

    Although there have been great advances in understanding bacterial pathogenesis, there is still a lack of integrative information about what makes a bacterium a human pathogen. The advent of high-throughput sequencing technologies has dramatically increased the amount of completed bacterial genomes, for both known human pathogenic and non-pathogenic strains; this information is now available to investigate genetic features that determine pathogenic phenotypes in bacteria. In this work we determined presence/absence patterns of different virulence-related genes among more than finished bacterial genomes from both human pathogenic and non-pathogenic strains, belonging to different taxonomic groups (i.e: Actinobacteria, Gammaproteobacteria, Firmicutes, etc.). An accuracy of 95% using a cross-fold validation scheme with in-fold feature selection is obtained when classifying human pathogens and non-pathogens. A reduced subset of highly informative genes () is presented and applied to an external validation set. The statistical model was implemented in the BacFier v1.0 software (freely available at ), that displays not only the prediction (pathogen/non-pathogen) and an associated probability for pathogenicity, but also the presence/absence vector for the analyzed genes, so it is possible to decipher the subset of virulence genes responsible for the classification on the analyzed genome. Furthermore, we discuss the biological relevance for bacterial pathogenesis of the core set of genes, corresponding to eight functional categories, all with evident and documented association with the phenotypes of interest. Also, we analyze which functional categories of virulence genes were more distinctive for pathogenicity in each taxonomic group, which seems to be a completely new kind of information and could lead to important evolutionary conclusions. PMID:22916122

  1. Defining the Estimated Core Genome of Bacterial Populations Using a Bayesian Decision Model

    PubMed Central

    van Tonder, Andries J.; Mistry, Shilan; Bray, James E.; Hill, Dorothea M. C.; Cody, Alison J.; Farmer, Chris L.; Klugman, Keith P.; von Gottberg, Anne; Bentley, Stephen D.; Parkhill, Julian; Jolley, Keith A.; Maiden, Martin C. J.; Brueggemann, Angela B.

    2014-01-01

    The bacterial core genome is of intense interest and the volume of whole genome sequence data in the public domain available to investigate it has increased dramatically. The aim of our study was to develop a model to estimate the bacterial core genome from next-generation whole genome sequencing data and use this model to identify novel genes associated with important biological functions. Five bacterial datasets were analysed, comprising 2096 genomes in total. We developed a Bayesian decision model to estimate the number of core genes, calculated pairwise evolutionary distances (p-distances) based on nucleotide sequence diversity, and plotted the median p-distance for each core gene relative to its genome location. We designed visually-informative genome diagrams to depict areas of interest in genomes. Case studies demonstrated how the model could identify areas for further study, e.g. 25% of the core genes with higher sequence diversity in the Campylobacter jejuni and Neisseria meningitidis genomes encoded hypothetical proteins. The core gene with the highest p-distance value in C. jejuni was annotated in the reference genome as a putative hydrolase, but further work revealed that it shared sequence homology with beta-lactamase/metallo-beta-lactamases (enzymes that provide resistance to a range of broad-spectrum antibiotics) and thioredoxin reductase genes (which reduce oxidative stress and are essential for DNA replication) in other C. jejuni genomes. Our Bayesian model of estimating the core genome is principled, easy to use and can be applied to large genome datasets. This study also highlighted the lack of knowledge currently available for many core genes in bacterial genomes of significant global public health importance. PMID:25144616

  2. Dynamics of transcriptomic response to infection by the nematode Heterorhabditis bacteriophora and its bacterial symbiont Photorhabdus temperata in Heliothis virescens larvae.

    PubMed

    An, R; Suri, K S; Jurat-Fuentes, J L; Grewal, P S

    2017-10-01

    Entomopathogenic nematodes in the Heterorhabditis genus and their symbiotic Photorhabdus bacteria are important biocontrol agents of insect pests and models for the study of microbe-host interactions. In this work, we used larvae of the tobacco budworm (Heliothis virescens) as a model to study its defensive mechanisms against Heterorhabditis bacteriophora nematodes carrying symbiotic Photorhabdus temperata. We first determined time points of initial nematode entry and release of bacteria into the haemolymph to perform transcriptional analysis of insect gene expression during these steps in the infective process. RNA-Sequencing analyses were then performed to profile differential gene expression in the insect during nematode invasion, bacterial release and final steps of infection, relative to the untreated controls. Our results support the theory that insect immune response genes are induced upon nematode invasion, but the majority of these genes are suppressed upon the release of bacteria by the nematodes into the haemolymph. Overall, these findings provide information on the dynamics of the insect's response to a progressing infection by this entomopathogenic nematode-bacteria complex and facilitate development of Hel. virescens as a pest model for future functional studies of the key insect defence factors. © 2017 The Royal Entomological Society.

  3. HuMiChip: Development of a Functional Gene Array for the Study of Human Microbiomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tu, Q.; Deng, Ye; Lin, Lu

    Microbiomes play very important roles in terms of nutrition, health and disease by interacting with their hosts. Based on sequence data currently available in public domains, we have developed a functional gene array to monitor both organismal and functional gene profiles of normal microbiota in human and mouse hosts, and such an array is called human and mouse microbiota array, HMM-Chip. First, seed sequences were identified from KEGG databases, and used to construct a seed database (seedDB) containing 136 gene families in 19 metabolic pathways closely related to human and mouse microbiomes. Second, a mother database (motherDB) was constructed withmore » 81 genomes of bacterial strains with 54 from gut and 27 from oral environments, and 16 metagenomes, and used for selection of genes and probe design. Gene prediction was performed by Glimmer3 for bacterial genomes, and by the Metagene program for metagenomes. In total, 228,240 and 801,599 genes were identified for bacterial genomes and metagenomes, respectively. Then the motherDB was searched against the seedDB using the HMMer program, and gene sequences in the motherDB that were highly homologous with seed sequences in the seedDB were used for probe design by the CommOligo software. Different degrees of specific probes, including gene-specific, inclusive and exclusive group-specific probes were selected. All candidate probes were checked against the motherDB and NCBI databases for specificity. Finally, 7,763 probes covering 91.2percent (12,601 out of 13,814) HMMer confirmed sequences from 75 bacterial genomes and 16 metagenomes were selected. This developed HMM-Chip is able to detect the diversity and abundance of functional genes, the gene expression of microbial communities, and potentially, the interactions of microorganisms and their hosts.« less

  4. Distinguishing the Signals of Gingivitis and Periodontitis in Supragingival Plaque: a Cross-Sectional Cohort Study in Malawi.

    PubMed

    Shaw, Liam; Harjunmaa, Ulla; Doyle, Ronan; Mulewa, Simeon; Charlie, Davie; Maleta, Ken; Callard, Robin; Walker, A Sarah; Balloux, Francois; Ashorn, Per; Klein, Nigel

    2016-10-01

    Periodontal disease ranges from gingival inflammation (gingivitis) to the inflammation and loss of tooth-supporting tissues (periodontitis). Previous research has focused mainly on subgingival plaque, but supragingival plaque composition is also known to be associated with disease. Quantitative modeling of bacterial abundances across the natural range of periodontal severities can distinguish which features of disease are associated with particular changes in composition. We assessed a cross-sectional cohort of 962 Malawian women for periodontal disease and used 16S rRNA gene amplicon sequencing (V5 to V7 region) to characterize the bacterial compositions of supragingival plaque samples. Associations between bacterial relative abundances and gingivitis/periodontitis were investigated by using negative binomial models, adjusting for epidemiological factors. We also examined bacterial cooccurrence networks to assess community structure. The main differences in supragingival plaque compositions were associated more with gingivitis than periodontitis, including higher bacterial diversity and a greater abundance of particular species. However, even after controlling for gingivitis, the presence of subgingival periodontitis was associated with an altered supragingival plaque. A small number of species were associated with periodontitis but not gingivitis, including members of Prevotella, Treponema, and Selenomonas, supporting a more complex disease model than a linear progression following gingivitis. Cooccurrence networks of periodontitis-associated taxa clustered according to periodontitis across all gingivitis severities. Species including Filifactor alocis and Fusobacterium nucleatum were central to this network, which supports their role in the coaggregation of periodontal biofilms during disease progression. Our findings confirm that periodontitis cannot be considered simply an advanced stage of gingivitis even when only considering supragingival plaque. Periodontal disease is a major public health problem associated with oral bacteria. While earlier studies focused on a small number of periodontal pathogens, it is now accepted that the whole bacterial community may be important. However, previous high-throughput marker gene sequencing studies of supragingival plaque have largely focused on high-income populations with good oral hygiene without including a range of periodontal disease severities. Our study includes a large number of low-income participants with poor oral hygiene and a wide range of severities, and we were therefore able to quantitatively model bacterial abundances as functions of both gingivitis and periodontitis. A signal associated with periodontitis remains after controlling for gingivitis severity, which supports the concept that, even when only considering supragingival plaque, periodontitis is not simply an advanced stage of gingivitis. This suggests the future possibility of diagnosing periodontitis based on bacterial occurrences in supragingival plaque. Copyright © 2016 Shaw et al.

  5. Distinguishing the Signals of Gingivitis and Periodontitis in Supragingival Plaque: a Cross-Sectional Cohort Study in Malawi

    PubMed Central

    Harjunmaa, Ulla; Doyle, Ronan; Mulewa, Simeon; Charlie, Davie; Maleta, Ken; Callard, Robin; Walker, A. Sarah; Balloux, Francois; Ashorn, Per; Klein, Nigel

    2016-01-01

    ABSTRACT Periodontal disease ranges from gingival inflammation (gingivitis) to the inflammation and loss of tooth-supporting tissues (periodontitis). Previous research has focused mainly on subgingival plaque, but supragingival plaque composition is also known to be associated with disease. Quantitative modeling of bacterial abundances across the natural range of periodontal severities can distinguish which features of disease are associated with particular changes in composition. We assessed a cross-sectional cohort of 962 Malawian women for periodontal disease and used 16S rRNA gene amplicon sequencing (V5 to V7 region) to characterize the bacterial compositions of supragingival plaque samples. Associations between bacterial relative abundances and gingivitis/periodontitis were investigated by using negative binomial models, adjusting for epidemiological factors. We also examined bacterial cooccurrence networks to assess community structure. The main differences in supragingival plaque compositions were associated more with gingivitis than periodontitis, including higher bacterial diversity and a greater abundance of particular species. However, even after controlling for gingivitis, the presence of subgingival periodontitis was associated with an altered supragingival plaque. A small number of species were associated with periodontitis but not gingivitis, including members of Prevotella, Treponema, and Selenomonas, supporting a more complex disease model than a linear progression following gingivitis. Cooccurrence networks of periodontitis-associated taxa clustered according to periodontitis across all gingivitis severities. Species including Filifactor alocis and Fusobacterium nucleatum were central to this network, which supports their role in the coaggregation of periodontal biofilms during disease progression. Our findings confirm that periodontitis cannot be considered simply an advanced stage of gingivitis even when only considering supragingival plaque. IMPORTANCE Periodontal disease is a major public health problem associated with oral bacteria. While earlier studies focused on a small number of periodontal pathogens, it is now accepted that the whole bacterial community may be important. However, previous high-throughput marker gene sequencing studies of supragingival plaque have largely focused on high-income populations with good oral hygiene without including a range of periodontal disease severities. Our study includes a large number of low-income participants with poor oral hygiene and a wide range of severities, and we were therefore able to quantitatively model bacterial abundances as functions of both gingivitis and periodontitis. A signal associated with periodontitis remains after controlling for gingivitis severity, which supports the concept that, even when only considering supragingival plaque, periodontitis is not simply an advanced stage of gingivitis. This suggests the future possibility of diagnosing periodontitis based on bacterial occurrences in supragingival plaque. PMID:27520811

  6. Genomics-enabled analysis of the emergent disease cotton bacterial blight

    PubMed Central

    Phillips, Anne Z.; Burke, Jillian; Bunn, J. Imani; Allen, Tom W.; Wheeler, Terry

    2017-01-01

    Cotton bacterial blight (CBB), an important disease of (Gossypium hirsutum) in the early 20th century, had been controlled by resistant germplasm for over half a century. Recently, CBB re-emerged as an agronomic problem in the United States. Here, we report analysis of cotton variety planting statistics that indicate a steady increase in the percentage of susceptible cotton varieties grown each year since 2009. Phylogenetic analysis revealed that strains from the current outbreak cluster with race 18 Xanthomonas citri pv. malvacearum (Xcm) strains. Illumina based draft genomes were generated for thirteen Xcm isolates and analyzed along with 4 previously published Xcm genomes. These genomes encode 24 conserved and nine variable type three effectors. Strains in the race 18 clade contain 3 to 5 more effectors than other Xcm strains. SMRT sequencing of two geographically and temporally diverse strains of Xcm yielded circular chromosomes and accompanying plasmids. These genomes encode eight and thirteen distinct transcription activator-like effector genes. RNA-sequencing revealed 52 genes induced within two cotton cultivars by both tested Xcm strains. This gene list includes a homeologous pair of genes, with homology to the known susceptibility gene, MLO. In contrast, the two strains of Xcm induce different clade III SWEET sugar transporters. Subsequent genome wide analysis revealed patterns in the overall expression of homeologous gene pairs in cotton after inoculation by Xcm. These data reveal important insights into the Xcm-G. hirsutum disease complex and strategies for future development of resistant cultivars. PMID:28910288

  7. The SaeRS Two-Component System Controls Survival of Staphylococcus aureus in Human Blood through Regulation of Coagulase

    PubMed Central

    Guo, Haiyong; Hall, Jeffrey W.; Yang, Junshu; Ji, Yinduo

    2017-01-01

    The SaeRS two-component system plays important roles in regulation of key virulence factors and pathogenicity. In this study, however, we found that the deletion mutation of saeRS enhanced bacterial survival in human blood, whereas complementation of the mutant with SaeRS returned survival to wild-type levels. Moreover, these phenomena were observed in different MRSA genetic background isolates, including HA-MRSA WCUH29, CA-MRSA 923, and MW2. To elucidate which gene(s) regulated by SaeRS contribute to the effect, we conducted a series of complementation studies with selected known SaeRS target genes in trans. We found coagulase complementation abolished the enhanced survival of the SaeRS mutant in human blood. The coa and saeRS deletion mutants exhibited a similar survival phenotype in blood. Intriguingly, heterologous expression of coagulase decreased survival of S. epidermidis in human blood. Further, the addition of recombinant coagulase to blood significantly decreased the survival of S. aureus. Further, analysis revealed staphylococcal resistance to killing by hydrogen peroxide was partially dependent on the presence or absence of coagulase. Furthermore, complementation with coagulase, but not SaeRS, returned saeRS/coa double mutant survival in blood to wild-type levels. These data indicate SaeRS modulates bacterial survival in blood in coagulase-dependent manner. Our results provide new insights into the role of staphylococcal SaeRS and coagulase on bacterial survival in human blood. PMID:28611950

  8. Chloroplast parameters differ in wild type and transgenic poplars overexpressing gsh1 in the cytosol.

    PubMed

    Ivanova, L A; Ronzhina, D A; Ivanov, L A; Stroukova, L V; Peuke, A D; Rennenberg, H

    2009-07-01

    Poplar mutants overexpressing the bacterial genes gsh1 or gsh2 encoding the enzymes of glutathione biosynthesis are among the best-characterised transgenic plants. However, this characterisation originates exclusively from laboratory studies, and the performance of these mutants under field conditions is largely unknown. Here, we report a field experiment in which the wild-type poplar hybrid Populus tremula x P. alba and a transgenic line overexpressing the bacterial gene gsh1 encoding gamma-glutamylcysteine synthetase in the cytosol were grown for 3 years at a relatively clean (control) field site and a field site contaminated with heavy metals. Aboveground biomass accumulation was slightly smaller in transgenic compared to wild-type plants; soil contamination significantly decreased biomass accumulation in both wild-type and transgenic plants by more than 40%. Chloroplasts parameters, i.e., maximal diameter, projection area and perimeter, surface area and volume, surface/volume ratio and a two-dimensional form coefficient, were found to depend on plant type, leaf tissue and soil contamination. The greatest differences between wild and transgenic poplars were observed at the control site. Under these conditions, chloroplast sizes in palisade tissue of transgenic poplar significantly exceeded those of the wild type. In contrast to the wild type, palisade chloroplast volume exceeded that of spongy chloroplasts in transgenic poplars at both field sites. Chlorophyll content per chloroplast was the same in wild and transgenic poplars. Apparently, the increase in chloroplast volume was not connected to changes in the photosynthetic centres. Chloroplasts of transgenic poplar at the control site were more elongated in palisade cells and close to spherical in spongy mesophyll chloroplasts. At the contaminated site, palisade and spongy cell chloroplasts of leaves from transgenic trees and the wild type were the same shape. Transgenic poplars also had a smaller chloroplast surface/volume ratio, both at the control and the contaminated site. Chloroplast number per cell did not differ between wild and transgenic poplars at the control site. Soil contamination led to suppression of chloroplast replication in wild-type plants. From these results, we assume that overexpressing the bacterial gsh1 gene in the cytosol interacts with processes in the chloroplast and that sequestration of heavy metal phytochelatin complexes into the vacuole may partially counteract this interaction in plants grown at heavy metal-contaminated field sites. Further experiments are required to test these assumptions.

  9. Genome-wide identification of bacterial plant colonization genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cole, Benjamin J.; Feltcher, Meghan E.; Waters, Robert J.

    Diverse soil-resident bacteria can contribute to plant growth and health, but the molecular mechanisms enabling them to effectively colonize their plant hosts remain poorly understood. We used randomly barcoded transposon mutagenesis sequencing (RB-TnSeq) in Pseudomonas simiae, a model root-colonizing bacterium, to establish a genome-wide map of bacterial genes required for colonization of the Arabidopsis thaliana root system. We identified 115 genes (2% of all P. simiae genes) with functions that are required for maximal competitive colonization of the root system. Among the genes we identified were some with obvious colonization-related roles in motility and carbon metabolism, as well as 44more » other genes that had no or vague functional predictions. Independent validation assays of individual genes confirmed colonization functions for 20 of 22 (91%) cases tested. To further characterize genes identified by our screen, we compared the functional contributions of P. simiae genes to growth in 90 distinct in vitro conditions by RB-TnSeq, highlighting specific metabolic functions associated with root colonization genes. Here, our analysis of bacterial genes by sequence-driven saturation mutagenesis revealed a genome-wide map of the genetic determinants of plant root colonization and offers a starting point for targeted improvement of the colonization capabilities of plant-beneficial microbes.« less

  10. Genome-wide identification of bacterial plant colonization genes

    DOE PAGES

    Cole, Benjamin J.; Feltcher, Meghan E.; Waters, Robert J.; ...

    2017-09-22

    Diverse soil-resident bacteria can contribute to plant growth and health, but the molecular mechanisms enabling them to effectively colonize their plant hosts remain poorly understood. We used randomly barcoded transposon mutagenesis sequencing (RB-TnSeq) in Pseudomonas simiae, a model root-colonizing bacterium, to establish a genome-wide map of bacterial genes required for colonization of the Arabidopsis thaliana root system. We identified 115 genes (2% of all P. simiae genes) with functions that are required for maximal competitive colonization of the root system. Among the genes we identified were some with obvious colonization-related roles in motility and carbon metabolism, as well as 44more » other genes that had no or vague functional predictions. Independent validation assays of individual genes confirmed colonization functions for 20 of 22 (91%) cases tested. To further characterize genes identified by our screen, we compared the functional contributions of P. simiae genes to growth in 90 distinct in vitro conditions by RB-TnSeq, highlighting specific metabolic functions associated with root colonization genes. Here, our analysis of bacterial genes by sequence-driven saturation mutagenesis revealed a genome-wide map of the genetic determinants of plant root colonization and offers a starting point for targeted improvement of the colonization capabilities of plant-beneficial microbes.« less

  11. The layout of a bacterial genome.

    PubMed

    Képès, François; Jester, Brian C; Lepage, Thibaut; Rafiei, Nafiseh; Rosu, Bianca; Junier, Ivan

    2012-07-16

    Recently the mismatch between our newly acquired capacity to synthetize DNA at genome scale, and our low capacity to design ab initio a functional genome has become conspicuous. This essay gathers a variety of constraints that globally shape natural genomes, with a focus on eubacteria. These constraints originate from chromosome replication (leading/lagging strand asymmetry; gene dosage gradient from origin to terminus; collisions with the transcription complexes), from biased codon usage, from noise control in gene expression, and from genome layout for co-functional genes. On the basis of this analysis, lessons are drawn for full genome design. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  12. Phytoplankton-bacterial interactions mediate micronutrient colimitation at the coastal Antarctic sea ice edge.

    PubMed

    Bertrand, Erin M; McCrow, John P; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B; Delmont, Tom O; Post, Anton F; Sipler, Rachel E; Spackeen, Jenna L; Xu, Kai; Bronk, Deborah A; Hutchins, David A; Allen, Andrew E

    2015-08-11

    Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton-bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton-bacterial interactions in both positive and negative feedback loops.

  13. Phytoplankton–bacterial interactions mediate micronutrient colimitation at the coastal Antarctic sea ice edge

    PubMed Central

    Bertrand, Erin M.; McCrow, John P.; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B.; Delmont, Tom O.; Post, Anton F.; Sipler, Rachel E.; Spackeen, Jenna L.; Xu, Kai; Bronk, Deborah A.; Hutchins, David A.; Allen, Andrew E.

    2015-01-01

    Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton–bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton–bacterial interactions in both positive and negative feedback loops. PMID:26221022

  14. Interactions between Bacteria and Bile Salts in the Gastrointestinal and Hepatobiliary Tracts

    PubMed Central

    Urdaneta, Verónica; Casadesús, Josep

    2017-01-01

    Bile salts and bacteria have intricate relationships. The composition of the intestinal pool of bile salts is shaped by bacterial metabolism. In turn, bile salts play a role in intestinal homeostasis by controlling the size and the composition of the intestinal microbiota. As a consequence, alteration of the microbiome–bile salt homeostasis can play a role in hepatic and gastrointestinal pathological conditions. Intestinal bacteria use bile salts as environmental signals and in certain cases as nutrients and electron acceptors. However, bile salts are antibacterial compounds that disrupt bacterial membranes, denature proteins, chelate iron and calcium, cause oxidative damage to DNA, and control the expression of eukaryotic genes involved in host defense and immunity. Bacterial species adapted to the mammalian gut are able to endure the antibacterial activities of bile salts by multiple physiological adjustments that include remodeling of the cell envelope and activation of efflux systems and stress responses. Resistance to bile salts permits that certain bile-resistant pathogens can colonize the hepatobiliary tract, and an outstanding example is the chronic infection of the gall bladder by Salmonella enterica. A better understanding of the interactions between bacteria and bile salts may inspire novel therapeutic strategies for gastrointestinal and hepatobiliary diseases that involve microbiome alteration, as well as novel schemes against bacterial infections. PMID:29043249

  15. Chemical Approaches to Control Gene Expression

    PubMed Central

    Gottesfeld, Joel M.; Turner, James M.; Dervan, Peter B.

    2000-01-01

    A current goal in molecular medicine is the development of new strategies to interfere with gene expression in living cells in the hope that novel therapies for human disease will result from these efforts. This review focuses on small-molecule or chemical approaches to manipulate gene expression by modulating either transcription of messenger RNA-coding genes or protein translation. The molecules under study include natural products, designed ligands, and compounds identified through functional screens of combinatorial libraries. The cellular targets for these molecules include DNA, messenger RNA, and the protein components of the transcription, RNA processing, and translational machinery. Studies with model systems have shown promise in the inhibition of both cellular and viral gene transcription and mRNA utilization. Moreover, strategies for both repression and activation of gene transcription have been described. These studies offer promise for treatment of diseases of pathogenic (viral, bacterial, etc.) and cellular origin (cancer, genetic diseases, etc.). PMID:11097426

  16. RAV transcription factors are essential for disease resistance against cassava bacterial blight via activation of melatonin biosynthesis genes.

    PubMed

    Wei, Yunxie; Chang, Yanli; Zeng, Hongqiu; Liu, Guoyin; He, Chaozu; Shi, Haitao

    2018-01-01

    With 1 AP2 domain and 1 B3 domain, 7 MeRAVs in apetala2/ethylene response factor (AP2/ERF) gene family have been identified in cassava. However, the in vivo roles of these remain unknown. Gene expression assays showed that the transcripts of MeRAVs were commonly regulated after Xanthomonas axonopodis pv manihotis (Xam) and MeRAVs were specifically located in plant cell nuclei. Through virus-induced gene silencing (VIGS) in cassava, we found that MeRAV1 and MeRAV2 are essential for plant disease resistance against cassava bacterial blight, as shown by the bacterial propagation of Xam in plant leaves. Through VIGS in cassava leaves and overexpression in cassava leave protoplasts, we found that MeRAV1 and MeRAV2 positively regulated melatonin biosynthesis genes and the endogenous melatonin level. Further investigation showed that MeRAV1 and MeRAV2 are direct transcriptional activators of 3 melatonin biosynthesis genes in cassava, as evidenced by chromatin immunoprecipitation-PCR in cassava leaf protoplasts and electrophoretic mobility shift assay. Moreover, cassava melatonin biosynthesis genes also positively regulated plant disease resistance. Taken together, this study identified MeRAV1 and MeRAV2 as common and upstream transcription factors of melatonin synthesis genes in cassava and revealed a model of MeRAV1 and MeRAV2-melatonin biosynthesis genes-melatonin level in plant disease resistance against cassava bacterial blight. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Concurrent host-pathogen gene expression in the lungs of pigs challenged with Actinobacillus pleuropneumoniae.

    PubMed

    Brogaard, Louise; Klitgaard, Kirstine; Heegaard, Peter M H; Hansen, Mette Sif; Jensen, Tim Kåre; Skovgaard, Kerstin

    2015-05-28

    Actinobacillus pleuropneumoniae causes pleuropneumonia in pigs, a disease which is associated with high morbidity and mortality, as well as impaired animal welfare. To obtain in-depth understanding of this infection, the interplay between virulence factors of the pathogen and defense mechanisms of the porcine host needs to be elucidated. However, research has traditionally focused on either bacteriology or immunology; an unbiased picture of the transcriptional responses can be obtained by investigating both organisms in the same biological sample. Host and pathogen responses in pigs experimentally infected with A. pleuropneumoniae were analyzed by high-throughput RT-qPCR. This approach allowed concurrent analysis of selected genes encoding proteins known or hypothesized to be important in the acute phase of this infection. The expression of 17 bacterial and 31 porcine genes was quantified in lung samples obtained within the first 48 hours of infection. This provided novel insight into the early time course of bacterial genes involved in synthesis of pathogen-associated molecular patterns (lipopolysaccharide, peptidoglycan, lipoprotein) and genes involved in pattern recognition (TLR4, CD14, MD2, LBP, MYD88) in response to A. pleuropneumoniae. Significant up-regulation of proinflammatory cytokines such as IL1B, IL6, and IL8 was observed, correlating with protein levels, infection status and histopathological findings. Host genes encoding proteins involved in iron metabolism, as well as bacterial genes encoding exotoxins, proteins involved in adhesion, and iron acquisition were found to be differentially expressed according to disease progression. By applying laser capture microdissection, porcine expression of selected genes could be confirmed in the immediate surroundings of the invading pathogen. Microbial pathogenesis is the product of interactions between host and pathogen. Our results demonstrate the applicability of high-throughput RT-qPCR for the elucidation of dual-organism gene expression analysis during infection. We showed differential expression of 12 bacterial and 24 porcine genes during infection and significant correlation of porcine and bacterial gene expression. This is the first study investigating the concurrent transcriptional response of both bacteria and host at the site of infection during porcine respiratory infection.

  18. Drivers shaping the diversity and biogeography of total and active bacterial communities in the South China Sea

    PubMed Central

    Zhang, Yao; Zhao, Zihao; Dai, Minhan; Jiao, Nianzhi; Herndl, Gerhard J

    2014-01-01

    To test the hypothesis that different drivers shape the diversity and biogeography of the total and active bacterial community, we examined the bacterial community composition along two transects, one from the inner Pearl River estuary to the open waters of the South China Sea (SCS) and the other from the Luzon Strait to the SCS basin, using 454 pyrosequencing of the 16S rRNA and 16S rRNA gene (V1-3 regions) and thereby characterizing the active and total bacterial community, respectively. The diversity and biogeographic patterns differed substantially between the active and total bacterial communities. Although the composition of both the total and active bacterial community was strongly correlated with environmental factors and weakly correlated with geographic distance, the active bacterial community displayed higher environmental sensitivity than the total community and particularly a greater distance effect largely caused by the active assemblage from deep waters. The 16S rRNA vs. rDNA relationships indicated that the active bacteria were low in relative abundance in the SCS. This might be due to a high competition between active bacterial taxa as indicated by our community network models. Based on these analyses, we speculate that high competition could cause some dispersal limitation of the active bacterial community resulting in a distinct distance-decay relationship. Altogether, our results indicated that the biogeographic distribution of bacteria in the SCS is the result of both environmental control and distance decay. PMID:24684298

  19. Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis.

    PubMed

    Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y

    2000-07-01

    The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the patients with primary biliary cirrhosis at an advanced stage.

  20. Targeting Trypsin-Inflammation Axis for Pancreatitis Therapy in a Humanized Pancreatitis Model

    DTIC Science & Technology

    2016-10-01

    PRSS1 gene) causing hereditary pancreatitis is now well established. We developed a transgenic mouse using a Bacterial Artificial Chromosome harboring...trypsinogen gene (PRSS1 gene) causing hereditary pancreatitis is now well established. We developed a transgenic mouse using a Bacterial Artificial... Breeding and expansion of the R122H mouse colony: Period: February 2016-present. After rederivation, the colony of R122H has been expanded at the

  1. Detection of a mixed infection in a culture-negative brain abscess by broad-spectrum bacterial 16S rRNA gene PCR.

    PubMed

    Keller, Peter M; Rampini, Silvana K; Bloemberg, Guido V

    2010-06-01

    We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis.

  2. RNA- and protein-mediated control of Listeria monocytogenes virulence gene expression

    PubMed Central

    Lebreton, Alice; Cossart, Pascale

    2017-01-01

    ABSTRACT The model opportunistic pathogen Listeria monocytogenes has been the object of extensive research, aiming at understanding its ability to colonize diverse environmental niches and animal hosts. Bacterial transcriptomes in various conditions reflect this efficient adaptability. We review here our current knowledge of the mechanisms allowing L. monocytogenes to respond to environmental changes and trigger pathogenicity, with a special focus on RNA-mediated control of gene expression. We highlight how these studies have brought novel concepts in prokaryotic gene regulation, such as the ‘excludon’ where the 5′-UTR of a messenger also acts as an antisense regulator of an operon transcribed in opposite orientation, or the notion that riboswitches can regulate non-coding RNAs to integrate complex metabolic stimuli into regulatory networks. Overall, the Listeria model exemplifies that fine RNA tuners act together with master regulatory proteins to orchestrate appropriate transcriptional programmes. PMID:27217337

  3. Genetic and epigenetic control of gene expression by CRISPR–Cas systems

    PubMed Central

    Lo, Albert; Qi, Lei

    2017-01-01

    The discovery and adaption of bacterial clustered regularly interspaced short palindromic repeats (CRISPR)–CRISPR-associated (Cas) systems has revolutionized the way researchers edit genomes. Engineering of catalytically inactivated Cas variants (nuclease-deficient or nuclease-deactivated [dCas]) combined with transcriptional repressors, activators, or epigenetic modifiers enable sequence-specific regulation of gene expression and chromatin state. These CRISPR–Cas-based technologies have contributed to the rapid development of disease models and functional genomics screening approaches, which can facilitate genetic target identification and drug discovery. In this short review, we will cover recent advances of CRISPR–dCas9 systems and their use for transcriptional repression and activation, epigenome editing, and engineered synthetic circuits for complex control of the mammalian genome. PMID:28649363

  4. The biocontrol agent Pseudomonas chlororaphis PA23 primes Brassica napus defenses through distinct gene networks.

    PubMed

    Duke, Kelly A; Becker, Michael G; Girard, Ian J; Millar, Jenna L; Dilantha Fernando, W G; Belmonte, Mark F; de Kievit, Teresa R

    2017-06-19

    The biological control agent Pseudomonas chlororaphis PA23 is capable of protecting Brassica napus (canola) from the necrotrophic fungus Sclerotinia sclerotiorum via direct antagonism. While we have elucidated bacterial genes and gene products responsible biocontrol, little is known about how the host plant responds to bacterial priming on the leaf surface, including global changes in gene activity in the presence and absence of S. sclerotiorum. Application of PA23 to the aerial surfaces of canola plants reduced the number of S. sclerotiorum lesion-forming petals by 91.1%. RNA sequencing of the host pathogen interface showed that pretreatment with PA23 reduced the number of genes upregulated in response to S. sclerotiorum by 16-fold. By itself, PA23 activated unique defense networks indicative of defense priming. Genes encoding MAMP-triggered immunity receptors detecting flagellin and peptidoglycan were downregulated in PA23 only-treated plants, consistent with post-stimulus desensitization. Downstream, we observed reactive oxygen species (ROS) production involving low levels of H 2 O 2 and overexpression of genes associated with glycerol-3-phosphate (G3P)-mediated systemic acquired resistance (SAR). Leaf chloroplasts exhibited increased thylakoid membrane structures and chlorophyll content, while lipid metabolic processes were upregulated. In addition to directly antagonizing S. sclerotiorum, PA23 primes the plant defense response through induction of unique local and systemic defense networks. This study provides novel insight into the effects of biocontrol agents applied to the plant phyllosphere. Understanding these interactions will aid in the development of biocontrol systems as an alternative to chemical pesticides for protection of important crop systems.

  5. Identification and transcriptional profile of multiple genes in the posterior kidney of Nile tilapia at 6h post bacterial infections

    USDA-ARS?s Scientific Manuscript database

    To understand the molecular mechanisms involved in response of Nile tilapia (Oreochromis niloticus) to bacterial infection, suppression subtractive cDNA hybridization technique was used to identify upregulated genes in the posterior kidney of Nile tilapia at 6h post infection with Aeromonas hydrophi...

  6. Geo-Chip analysis reveals reduced functional diversity of the bacterial community at a dumping site for dredged Elbe sediment.

    PubMed

    Störmer, Rebecca; Wichels, Antje; Gerdts, Gunnar

    2013-12-15

    The dumping of dredged sediments represents a major stressor for coastal ecosystems. The impact on the ecosystem function is determined by its complexity not easy to assess. In the present study, we evaluated the potential of bacterial community analyses to act as ecological indicators in environmental monitoring programmes. We investigated the functional structure of bacterial communities, applying functional gene arrays (GeoChip4.2). The relationship between functional genes and environmental factors was analysed using distance-based multivariate multiple regression. Apparently, both the function and structure of the bacterial communities are impacted by dumping activities. The bacterial community at the dumping centre displayed a significant reduction of its entire functional diversity compared with that found at a reference site. DDX compounds separated bacterial communities of the dumping site from those of un-impacted sites. Thus, bacterial community analyses show great potential as ecological indicators in environmental monitoring. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. The dual oxidase gene BdDuox regulates the intestinal bacterial community homeostasis of Bactrocera dorsalis

    PubMed Central

    Yao, Zhichao; Wang, Ailin; Li, Yushan; Cai, Zhaohui; Lemaitre, Bruno; Zhang, Hongyu

    2016-01-01

    The guts of metazoans are in permanent contact with the microbial realm that includes beneficial symbionts, nonsymbionts, food-borne microbes and life-threatening pathogens. However, little is known concerning how host immunity affects gut bacterial community. Here, we analyze the role of a dual oxidase gene (BdDuox) in regulating the intestinal bacterial community homeostasis of the oriental fruit fly Bactrocera dorsalis. The results showed that knockdown of BdDuox led to an increased bacterial load, and to a decrease in the relative abundance of Enterobacteriaceae and Leuconostocaceae bacterial symbionts in the gut. The resulting dysbiosis, in turn, stimulates an immune response by activating BdDuox and promoting reactive oxygen species (ROS) production that regulates the composition and structure of the gut bacterial community to normal status by repressing the overgrowth of minor pathobionts. Our results suggest that BdDuox plays a pivotal role in regulating the homeostasis of the gut bacterial community in B. dorsalis. PMID:26565723

  8. A comparison of microbial communities in deep-sea polymetallic nodules and the surrounding sediments in the Pacific Ocean

    NASA Astrophysics Data System (ADS)

    Wu, Yue-Hong; Liao, Li; Wang, Chun-Sheng; Ma, Wei-Lin; Meng, Fan-Xu; Wu, Min; Xu, Xue-Wei

    2013-09-01

    Deep-sea polymetallic nodules, rich in metals such as Fe, Mn, and Ni, are potential resources for future exploitation. Early culturing and microscopy studies suggest that polymetallic nodules are at least partially biogenic. To understand the microbial communities in this environment, we compared microbial community composition and diversity inside nodules and in the surrounding sediments. Three sampling sites in the Pacific Ocean containing polymetallic nodules were used for culture-independent investigations of microbial diversity. A total of 1013 near full-length bacterial 16S rRNA gene sequences and 640 archaeal 16S rRNA gene sequences with ~650 bp from nodules and the surrounding sediments were analyzed. Bacteria showed higher diversity than archaea. Interestingly, sediments contained more diverse bacterial communities than nodules, while the opposite was detected for archaea. Bacterial communities tend to be mostly unique to sediments or nodules, with only 13.3% of sequences shared. The most abundant bacterial groups detected only in nodules were Pseudoalteromonas and Alteromonas, which were predicted to play a role in building matrix outside cells to induce or control mineralization. However, archaeal communities were mostly shared between sediments and nodules, including the most abundant OTU containing 290 sequences from marine group I Thaumarchaeota. PcoA analysis indicated that microhabitat (i.e., nodule or sediment) seemed to be a major factor influencing microbial community composition, rather than sampling locations or distances between locations.

  9. Characterization of Microbial Communities in Gas Industry Pipelines

    PubMed Central

    Zhu, Xiang Y.; Lubeck, John; Kilbane, John J.

    2003-01-01

    Culture-independent techniques, denaturing gradient gel electrophoresis (DGGE) analysis, and random cloning of 16S rRNA gene sequences amplified from community DNA were used to determine the diversity of microbial communities in gas industry pipelines. Samples obtained from natural gas pipelines were used directly for DNA extraction, inoculated into sulfate-reducing bacterium medium, or used to inoculate a reactor that simulated a natural gas pipeline environment. The variable V2-V3 (average size, 384 bp) and V3-V6 (average size, 648 bp) regions of bacterial and archaeal 16S rRNA genes, respectively, were amplified from genomic DNA isolated from nine natural gas pipeline samples and analyzed. A total of 106 bacterial 16S rDNA sequences were derived from DGGE bands, and these formed three major clusters: beta and gamma subdivisions of Proteobacteria and gram-positive bacteria. The most frequently encountered bacterial species was Comamonas denitrificans, which was not previously reported to be associated with microbial communities found in gas pipelines or with microbially influenced corrosion. The 31 archaeal 16S rDNA sequences obtained in this study were all related to those of methanogens and phylogenetically fall into three clusters: order I, Methanobacteriales; order III, Methanomicrobiales; and order IV, Methanosarcinales. Further microbial ecology studies are needed to better understand the relationship among bacterial and archaeal groups and the involvement of these groups in the process of microbially influenced corrosion in order to develop improved ways of monitoring and controlling microbially influenced corrosion. PMID:12957923

  10. Dramatic Increases of Soil Microbial Functional Gene Diversity at the Treeline Ecotone of Changbai Mountain.

    PubMed

    Shen, Congcong; Shi, Yu; Ni, Yingying; Deng, Ye; Van Nostrand, Joy D; He, Zhili; Zhou, Jizhong; Chu, Haiyan

    2016-01-01

    The elevational and latitudinal diversity patterns of microbial taxa have attracted great attention in the past decade. Recently, the distribution of functional attributes has been in the spotlight. Here, we report a study profiling soil microbial communities along an elevation gradient (500-2200 m) on Changbai Mountain. Using a comprehensive functional gene microarray (GeoChip 5.0), we found that microbial functional gene richness exhibited a dramatic increase at the treeline ecotone, but the bacterial taxonomic and phylogenetic diversity based on 16S rRNA gene sequencing did not exhibit such a similar trend. However, the β-diversity (compositional dissimilarity among sites) pattern for both bacterial taxa and functional genes was similar, showing significant elevational distance-decay patterns which presented increased dissimilarity with elevation. The bacterial taxonomic diversity/structure was strongly influenced by soil pH, while the functional gene diversity/structure was significantly correlated with soil dissolved organic carbon (DOC). This finding highlights that soil DOC may be a good predictor in determining the elevational distribution of microbial functional genes. The finding of significant shifts in functional gene diversity at the treeline ecotone could also provide valuable information for predicting the responses of microbial functions to climate change.

  11. Stable zymomonas mobilis xylose and arabinose fermenting strains

    DOEpatents

    Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW

    2008-04-08

    The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.

  12. Presence or Absence of mlr Genes and Nutrient Concentrations Co-Determine the Microcystin Biodegradation Efficiency of a Natural Bacterial Community

    PubMed Central

    Lezcano, María Ángeles; Morón-López, Jesús; Agha, Ramsy; López-Heras, Isabel; Nozal, Leonor; Quesada, Antonio; El-Shehawy, Rehab

    2016-01-01

    The microcystin biodegradation potential of a natural bacterial community coexisting with a toxic cyanobacterial bloom was investigated in a water reservoir from central Spain. The biodegradation capacity was confirmed in all samples during the bloom and an increase of mlrA gene copies was found with increasing microcystin concentrations. Among the 24 microcystin degrading strains isolated from the bacterial community, only 28% showed presence of mlrA gene, strongly supporting the existence and abundance of alternative microcystin degradation pathways in nature. In vitro degradation assays with both mlr+ and mlr− bacterial genotypes (with presence and absence of the complete mlr gene cluster, respectively) were performed with four isolated strains (Sphingopyxis sp. IM-1, IM-2 and IM-3; Paucibacter toxinivorans IM-4) and two bacterial degraders from the culture collection (Sphingosinicella microcystinivorans Y2; Paucibacter toxinivorans 2C20). Differences in microcystin degradation efficiencies between genotypes were found under different total organic carbon and total nitrogen concentrations. While mlr+ strains significantly improved microcystin degradation rates when exposed to other carbon and nitrogen sources, mlr− strains showed lower degradation efficiencies. This suggests that the presence of alternative carbon and nitrogen sources possibly competes with microcystins and impairs putative non-mlr microcystin degradation pathways. Considering the abundance of the mlr− bacterial population and the increasing frequency of eutrophic conditions in aquatic systems, further research on the diversity of this population and the characterization and conditions affecting non-mlr degradation pathways deserves special attention. PMID:27827872

  13. Pseudomonas cremoricolorata Strain ND07 Produces N-acyl Homoserine Lactones as Quorum Sensing Molecules

    PubMed Central

    Yunos, Nina Yusrina Muhamad; Tan, Wen-Si; Koh, Chong-Lek; Sam, Choon-Kook; Mohamad, Nur Izzati; Tan, Pui-Wan; Adrian, Tan-Guan-Sheng; Yin, Wai-Fong; Chan, Kok-Gan

    2014-01-01

    Quorum sensing (QS) is a bacterial cell-to-cell communication system controlling QS-mediated genes which is synchronized with the population density. The regulation of specific gene activity is dependent on the signaling molecules produced, namely N-acyl homoserine lactones (AHLs). We report here the identification and characterization of AHLs produced by bacterial strain ND07 isolated from a Malaysian fresh water sample. Molecular identification showed that strain ND07 is clustered closely to Pseudomonas cremoricolorata. Spent culture supernatant extract of P. cremoricolorata strain ND07 activated the AHL biosensor Chromobacterium violaceum CV026. Using high resolution triple quadrupole liquid chromatography-mass spectrometry, it was confirmed that P. cremoricolorata strain ND07 produced N-octanoyl-l-homoserine lactone (C8-HSL) and N-decanoyl-l-homoserine lactone (C10-HSL). To the best of our knowledge, this is the first documentation on the production of C10-HSL in P. cremoricolorata strain ND07. PMID:24984061

  14. Allelic variation contributes to bacterial host specificity

    DOE PAGES

    Yue, Min; Han, Xiangan; Masi, Leon De; ...

    2015-10-30

    Understanding the molecular parameters that regulate cross-species transmission and host adaptation of potential pathogens is crucial to control emerging infectious disease. Although microbial pathotype diversity is conventionally associated with gene gain or loss, the role of pathoadaptive nonsynonymous single-nucleotide polymorphisms (nsSNPs) has not been systematically evaluated. Here, our genome-wide analysis of core genes within Salmonella enterica serovar Typhimurium genomes reveals a high degree of allelic variation in surface-exposed molecules, including adhesins that promote host colonization. Subsequent multinomial logistic regression, MultiPhen and Random Forest analyses of known/suspected adhesins from 580 independent Typhimurium isolates identifies distinct host-specific nsSNP signatures. Moreover, population andmore » functional analyses of host-associated nsSNPs for FimH, the type 1 fimbrial adhesin, highlights the role of key allelic residues in host-specific adherence in vitro. In conclusion, together, our data provide the first concrete evidence that functional differences between allelic variants of bacterial proteins likely contribute to pathoadaption to diverse hosts.« less

  15. Adaptability of non-genetic diversity in bacterial chemotaxis

    PubMed Central

    Frankel, Nicholas W; Pontius, William; Dufour, Yann S; Long, Junjiajia; Hernandez-Nunez, Luis; Emonet, Thierry

    2014-01-01

    Bacterial chemotaxis systems are as diverse as the environments that bacteria inhabit, but how much environmental variation can cells tolerate with a single system? Diversification of a single chemotaxis system could serve as an alternative, or even evolutionary stepping-stone, to switching between multiple systems. We hypothesized that mutations in gene regulation could lead to heritable control of chemotactic diversity. By simulating foraging and colonization of E. coli using a single-cell chemotaxis model, we found that different environments selected for different behaviors. The resulting trade-offs show that populations facing diverse environments would ideally diversify behaviors when time for navigation is limited. We show that advantageous diversity can arise from changes in the distribution of protein levels among individuals, which could occur through mutations in gene regulation. We propose experiments to test our prediction that chemotactic diversity in a clonal population could be a selectable trait that enables adaptation to environmental variability. DOI: http://dx.doi.org/10.7554/eLife.03526.001 PMID:25279698

  16. A new aerobic chemolithoautotrophic arsenic oxidizing microorganism isolated from a high Andean watershed.

    PubMed

    Anguita, Javiera M; Rojas, Claudia; Pastén, Pablo A; Vargas, Ignacio T

    2018-02-01

    Biological arsenic oxidation has been suggested as a key biogeochemical process that controls the mobilization and fate of this metalloid in aqueous environments. To the best of our knowledge, only four aerobic chemolithoautotrophic arsenite-oxidizing (CAO) bacteria have been shown to grow via direct arsenic oxidation and to have the essential genes for chemolithoautotrophic arsenite oxidation. In this study, a new CAO bacterium was isolated from a high Andean watershed evidencing natural dissolved arsenic attenuation. The bacterial isolate, designated TS-1, is closely related to the Ancylobacter genus, in the Alphaproteobacteria class. Results showed that TS-1 has genes for arsenite oxidation and carbon fixation. The dependence of bacterial growth from arsenite oxidation was demonstrated. In addition, a mathematical model was suggested and the kinetic parameters were obtained by simultaneously fitting the biomass growth, arsenite depletion curves, and arsenate production. This research increases the knowledge of chemolithoautotrophic arsenic oxidizing microorganisms and its potential role as a driver for natural arsenic attenuation.

  17. Proteomic analysis of the bacterial cell cycle

    PubMed Central

    Grünenfelder, Björn; Rummel, Gabriele; Vohradsky, Jiri; Röder, Daniel; Langen, Hanno; Jenal, Urs

    2001-01-01

    A global approach was used to analyze protein synthesis and stability during the cell cycle of the bacterium Caulobacter crescentus. Approximately one-fourth (979) of the estimated C. crescentus gene products were detected by two-dimensional gel electrophoresis, 144 of which showed differential cell cycle expression patterns. Eighty-one of these proteins were identified by mass spectrometry and were assigned to a wide variety of functional groups. Pattern analysis revealed that coexpression groups were functionally clustered. A total of 48 proteins were rapidly degraded in the course of one cell cycle. More than half of these unstable proteins were also found to be synthesized in a cell cycle-dependent manner, establishing a strong correlation between rapid protein turnover and the periodicity of the bacterial cell cycle. This is, to our knowledge, the first evidence for a global role of proteolysis in bacterial cell cycle control. PMID:11287652

  18. Characterization and detection of a widely distributed gene cluster that predicts anaerobic choline utilization by human gut bacteria.

    PubMed

    Martínez-del Campo, Ana; Bodea, Smaranda; Hamer, Hilary A; Marks, Jonathan A; Haiser, Henry J; Turnbaugh, Peter J; Balskus, Emily P

    2015-04-14

    Elucidation of the molecular mechanisms underlying the human gut microbiota's effects on health and disease has been complicated by difficulties in linking metabolic functions associated with the gut community as a whole to individual microorganisms and activities. Anaerobic microbial choline metabolism, a disease-associated metabolic pathway, exemplifies this challenge, as the specific human gut microorganisms responsible for this transformation have not yet been clearly identified. In this study, we established the link between a bacterial gene cluster, the choline utilization (cut) cluster, and anaerobic choline metabolism in human gut isolates by combining transcriptional, biochemical, bioinformatic, and cultivation-based approaches. Quantitative reverse transcription-PCR analysis and in vitro biochemical characterization of two cut gene products linked the entire cluster to growth on choline and supported a model for this pathway. Analyses of sequenced bacterial genomes revealed that the cut cluster is present in many human gut bacteria, is predictive of choline utilization in sequenced isolates, and is widely but discontinuously distributed across multiple bacterial phyla. Given that bacterial phylogeny is a poor marker for choline utilization, we were prompted to develop a degenerate PCR-based method for detecting the key functional gene choline TMA-lyase (cutC) in genomic and metagenomic DNA. Using this tool, we found that new choline-metabolizing gut isolates universally possessed cutC. We also demonstrated that this gene is widespread in stool metagenomic data sets. Overall, this work represents a crucial step toward understanding anaerobic choline metabolism in the human gut microbiota and underscores the importance of examining this microbial community from a function-oriented perspective. Anaerobic choline utilization is a bacterial metabolic activity that occurs in the human gut and is linked to multiple diseases. While bacterial genes responsible for choline fermentation (the cut gene cluster) have been recently identified, there has been no characterization of these genes in human gut isolates and microbial communities. In this work, we use multiple approaches to demonstrate that the pathway encoded by the cut genes is present and functional in a diverse range of human gut bacteria and is also widespread in stool metagenomes. We also developed a PCR-based strategy to detect a key functional gene (cutC) involved in this pathway and applied it to characterize newly isolated choline-utilizing strains. Both our analyses of the cut gene cluster and this molecular tool will aid efforts to further understand the role of choline metabolism in the human gut microbiota and its link to disease. Copyright © 2015 Martínez-del Campo et al.

  19. Abundances and profiles of antibiotic resistance genes as well as co-occurrences with human bacterial pathogens in ship ballast tank sediments from a shipyard in Jiangsu Province, China.

    PubMed

    Lv, Baoyi; Cui, Yuxue; Tian, Wen; Li, Jing; Xie, Bing; Yin, Fang

    2018-08-15

    Ship ballasting operations may transfer harmful aquatic organisms across global ocean. This study aims to reveal the occurrences and abundances of antibiotic resistance genes (ARGs) and human bacterial pathogens (HBPs) in ballast tank sediments. Nine samples were collected and respectively analyzed by real-time quantitative PCR and high-throughput sequencing technologies. Ten ARGs (aadA1, blaCTX-M, blaTEM, ermB, mefA, strB, sul1, sul2, tetM, and tetQ) and the Class-I integron gene (intI1) were highly prevalent (10 5 -10 9 gene copies/g) in ballast tank sediments. The sul1 was the most abundant ARG with the concentration of 10 8 -10 9 copies/g and intI1 was much more abundant than the ARGs in ballast tank sediments. The strong positive correlations between intI1 and ARGs (blaCTX-M, sul1, sul2 and tetM) indicated the potential spread of ARGs via horizontal gene transfer. In ballast tank sediments, 44 bacterial species were identified as HBPs and accounted for 0.13-21.46% of the total bacterial population although the three indicator pathogenic microbes (Vibrio cholerae, Escherichia coli, and Enterococci) proposed by the International Maritime Organization were not detected. Pseudomonas pseudoalcaligenes, Enterococcus hirae, Shigella sonnei and Bacillus anthracis were the dominant pathogens in ballast tank sediments. Zn and P in sediments had positive effects on the ARGs. Network analysis results indicated that sul1 and sul2 genes existed in several bacterial pathogens. Ballast tank sediments could be regarded as a carrier for the migration of ARGs. It is important to manage ballast tank sediments reasonably in order to prevent the dissemination of ARGs and bacterial pathogens. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. Long-Term Warming Alters Carbohydrate Degradation Potential in Temperate Forest Soils

    DOE PAGES

    Pold, Grace; Billings, Andrew F.; Blanchard, Jeff L.; ...

    2016-09-02

    As Earth's climate warms, soil carbon pools and the microbial communities that process them may change, altering the way in which carbon is recycled in soil. In this study, we used a combination of metagenomics and bacterial cultivation to evaluate the hypothesis that experimentally raising soil temperatures by 5°C for 5, 8, or 20 years increased the potential for temperate forest soil microbial communities to degrade carbohydrates. Warming decreased the proportion of carbohydrate-degrading genes in the organic horizon derived from eukaryotes and increased the fraction of genes in the mineral soil associated with Actinobacteria in all studies. Genes associated withmore » carbohydrate degradation increased in the organic horizon after 5 years of warming but had decreased in the organic horizon after warming the soil continuously for 20 years. However, a greater proportion of the 295 bacteria from 6 phyla (10 classes, 14 orders, and 34 families) isolated from heated plots in the 20-year experiment were able to depolymerize cellulose and xylan than bacterial isolates from control soils. Together, these findings indicate that the enrichment of bacteria capable of degrading carbohydrates could be important for accelerated carbon cycling in a warmer world.« less

  1. Slime-producing Staphylococcus epidermidis and S. aureus in acute bacterial conjunctivitis in soft contact lens wearers.

    PubMed

    Catalanotti, Piergiorgio; Lanza, Michele; Del Prete, Antonio; Lucido, Maria; Catania, Maria Rosaria; Gallè, Francesca; Boggia, Daniela; Perfetto, Brunella; Rossano, Fabio

    2005-10-01

    In recent years, an increase in ocular pathologies related to soft contact lens has been observed. The most common infectious agents were Staphylococcus spp. Some strains produce an extracellular polysaccharidic slime that can cause severe infections. Polysaccharide synthesis is under genetic control and involves a specific intercellular adhesion (ica) locus, in particular, icaA and icaD genes. Conjunctival swabs from 97 patients with presumably bacterial bilateral conjunctivitis, wearers of soft contact lenses were examined. We determined the ability of staphylococci to produce slime, relating it to the presence of icaA and icaD genes. We also investigated the antibiotic susceptibility and Pulsed Field Gel Electrophoresis (PFGE) patterns of the clinical isolates. We found that 74.1% of the S. epidermidis strains and 61.1% of the S. aureus strains isolated were slime producers and showed icaA and icaD genes. Both S. epidermidis and S. aureus slime-producing strains exhibited more surface hydrophobicity than non-producing slime strains. The PFGE patterns overlapped in S. epidermidis strains with high hydrophobicity. The similar PFGE patterns were not related to biofilm production. We found scarce matching among the Staphylococcus spp. studied, slime production, surface hydrophobicity and antibiotic susceptibility.

  2. Dissection of Host Susceptibility to Bacterial Infections and Its Toxins.

    PubMed

    Nashef, Aysar; Agbaria, Mahmoud; Shusterman, Ariel; Lorè, Nicola Ivan; Bragonzi, Alessandra; Wiess, Ervin; Houri-Haddad, Yael; Iraqi, Fuad A

    2017-01-01

    Infection is one of the leading causes of human mortality and morbidity. Exposure to microbial agents is obviously required. However, also non-microbial environmental and host factors play a key role in the onset, development and outcome of infectious disease, resulting in large of clinical variability between individuals in a population infected with the same microbe. Controlled and standardized investigations of the genetics of susceptibility to infectious disease are almost impossible to perform in humans whereas mouse models allow application of powerful genomic techniques to identify and validate causative genes underlying human diseases with complex etiologies. Most of current animal models used in complex traits diseases genetic mapping have limited genetic diversity. This limitation impedes the ability to create incorporated network using genetic interactions, epigenetics, environmental factors, microbiota, and other phenotypes. A novel mouse genetic reference population for high-resolution mapping and subsequently identifying genes underlying the QTL, namely the Collaborative Cross (CC) mouse genetic reference population (GRP) was recently developed. In this chapter, we discuss a variety of approaches using CC mice for mapping genes underlying quantitative trait loci (QTL) to dissect the host response to polygenic traits, including infectious disease caused by bacterial agents and its toxins.

  3. Development of A Flexible System for the Simultaneous Conversion of Biomass to Industrial Chemicals and the Production of Industrial Biocatalysts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gao, Johnway; Hooker, Brian S.; Skeen, R S.

    2002-01-01

    A flexible system was developed for the simultaneous conversion of biomass to industrial chemicals and the production of industrial biocatalysts. In particular, the expression of a bacterial enzyme, beta-glucuronidase (GUS), was investigated using a genetically modified starch-degrading Saccharomyces strain in suspension cultures in starch media. Different sources of starch including corn and waste potato starch were used for yeast biomass accumulation and GUS expression studies under controls of inducible and constitutive promoters. A thermostable bacterial cellulase, Acidothermus cellulolyticus E1 endoglucanase gene was also cloned into an episomal plasmid expression vector and expressed in the starch-degrading Saccharomyces strain.

  4. Recent Developments in Copper and Zinc Homeostasis in Bacterial Pathogens

    PubMed Central

    Braymer, Joseph J.; Giedroc, David P.

    2014-01-01

    Copper and zinc homeostasis systems in pathogenic bacteria are required to resist host efforts to manipulate the availability and toxicity of these metal ions. Central to this microbial adaptive response is the involvement of metal-trafficking and -sensing proteins that ultimately exercise control of metal speciation in the cell. Cu- and Zn-specific metalloregulatory proteins regulate the transcription of metal-responsive genes while metallochaperones and related proteins ensure that these metals are appropriately buffered by the intracellular milieu and delivered to correct intracellular targets. In this review, we summarize recent findings on how bacterial pathogens mount a metal-specific response to derail host efforts to win the “fight over metals.” PMID:24463765

  5. Evolution of aminoacyl-tRNA synthetases--analysis of unique domain architectures and phylogenetic trees reveals a complex history of horizontal gene transfer events.

    PubMed

    Wolf, Y I; Aravind, L; Grishin, N V; Koonin, E V

    1999-08-01

    Phylogenetic analysis of aminoacyl-tRNA synthetases (aaRSs) of all 20 specificities from completely sequenced bacterial, archaeal, and eukaryotic genomes reveals a complex evolutionary picture. Detailed examination of the domain architecture of aaRSs using sequence profile searches delineated a network of partially conserved domains that is even more elaborate than previously suspected. Several unexpected evolutionary connections were identified, including the apparent origin of the beta-subunit of bacterial GlyRS from the HD superfamily of hydrolases, a domain shared by bacterial AspRS and the B subunit of archaeal glutamyl-tRNA amidotransferases, and another previously undetected domain that is conserved in a subset of ThrRS, guanosine polyphosphate hydrolases and synthetases, and a family of GTPases. Comparison of domain architectures and multiple alignments resulted in the delineation of synapomorphies-shared derived characters, such as extra domains or inserts-for most of the aaRSs specificities. These synapomorphies partition sets of aaRSs with the same specificity into two or more distinct and apparently monophyletic groups. In conjunction with cluster analysis and a modification of the midpoint-rooting procedure, this partitioning was used to infer the likely root position in phylogenetic trees. The topologies of the resulting rooted trees for most of the aaRSs specificities are compatible with the evolutionary "standard model" whereby the earliest radiation event separated bacteria from the common ancestor of archaea and eukaryotes as opposed to the two other possible evolutionary scenarios for the three major divisions of life. For almost all aaRSs specificities, however, this simple scheme is confounded by displacement of some of the bacterial aaRSs by their eukaryotic or, less frequently, archaeal counterparts. Displacement of ancestral eukaryotic aaRS genes by bacterial ones, presumably of mitochondrial origin, was observed for three aaRSs. In contrast, there was no convincing evidence of displacement of archaeal aaRSs by bacterial ones. Displacement of aaRS genes by eukaryotic counterparts is most common among parasitic and symbiotic bacteria, particularly the spirochaetes, in which 10 of the 19 aaRSs seem to have been displaced by the respective eukaryotic genes and two by the archaeal counterpart. Unlike the primary radiation events between the three main divisions of life, that were readily traceable through the phylogenetic analysis of aaRSs, no consistent large-scale bacterial phylogeny could be established. In part, this may be due to additional gene displacement events among bacterial lineages. Argument is presented that, although lineage-specific gene loss might have contributed to the evolution of some of the aaRSs, this is not a viable alternative to horizontal gene transfer as the principal evolutionary phenomenon in this gene class.

  6. Addition of transcription activator-like effector binding sites to a pathogen strain-specific rice bacterial blight resistance gene makes it effective against additional strains and against bacterial leaf streak.

    PubMed

    Hummel, Aaron W; Doyle, Erin L; Bogdanove, Adam J

    2012-09-01

    Xanthomonas transcription activator-like (TAL) effectors promote disease in plants by binding to and activating host susceptibility genes. Plants counter with TAL effector-activated executor resistance genes, which cause host cell death and block disease progression. We asked whether the functional specificity of an executor gene could be broadened by adding different TAL effector binding elements (EBEs) to it. We added six EBEs to the rice Xa27 gene, which confers resistance to strains of the bacterial blight pathogen Xanthomonas oryzae pv. oryzae (Xoo) that deliver the TAL effector AvrXa27. The EBEs correspond to three other effectors from Xoo strain PXO99(A) and three from strain BLS256 of the bacterial leaf streak pathogen Xanthomonas oryzae pv. oryzicola (Xoc). Stable integration into rice produced healthy lines exhibiting gene activation by each TAL effector, and resistance to PXO99(A) , a PXO99(A) derivative lacking AvrXa27, and BLS256, as well as two other Xoo and 10 Xoc strains virulent toward wildtype Xa27 plants. Transcripts initiated primarily at a common site. Sequences in the EBEs were found to occur nonrandomly in rice promoters, suggesting an overlap with endogenous regulatory sequences. Thus, executor gene specificity can be broadened by adding EBEs, but caution is warranted because of the possible coincident introduction of endogenous regulatory elements. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  7. Plasmid-Mediated Bioaugmentation for the Bioremediation of Contaminated Soils

    PubMed Central

    Garbisu, Carlos; Garaiyurrebaso, Olatz; Epelde, Lur; Grohmann, Elisabeth; Alkorta, Itziar

    2017-01-01

    Bioaugmentation, or the inoculation of microorganisms (e.g., bacteria harboring the required catabolic genes) into soil to enhance the rate of contaminant degradation, has great potential for the bioremediation of soils contaminated with organic compounds. Regrettably, cell bioaugmentation frequently turns into an unsuccessful initiative, owing to the rapid decrease of bacterial viability and abundance after inoculation, as well as the limited dispersal of the inoculated bacteria in the soil matrix. Genes that encode the degradation of organic compounds are often located on plasmids and, consequently, they can be spread by horizontal gene transfer into well-established, ecologically competitive, indigenous bacterial populations. Plasmid-mediated bioaugmentation aims to stimulate the spread of contaminant degradation genes among indigenous soil bacteria by the introduction of plasmids, located in donor cells, harboring such genes. But the acquisition of plasmids by recipient cells can affect the host’s fitness, a crucial aspect for the success of plasmid-mediated bioaugmentation. Besides, environmental factors (e.g., soil moisture, temperature, organic matter content) can play important roles for the transfer efficiency of catabolic plasmids, the expression of horizontally acquired genes and, finally, the contaminant degradation activity. For plasmid-mediated bioaugmentation to be reproducible, much more research is needed for a better selection of donor bacterial strains and accompanying plasmids, together with an in-depth understanding of indigenous soil bacterial populations and the environmental conditions that affect plasmid acquisition and the expression and functioning of the catabolic genes of interest. PMID:29062312

  8. Culturable bacterial endophytes isolated from Mangrove tree (Rhizophora apiculata Blume) enhance seedling growth in Rice.

    PubMed

    Deivanai, Subramanian; Bindusara, Amitraghata Santhanam; Prabhakaran, Guruswamy; Bhore, Subhash Janardhan

    2014-07-01

    Endophytic bacteria do have several potential applications in medicine and in other various sectors of biotechnology including agriculture. Bacterial endophytes need to be explored for their potential applications in agricultural biotechnology. One of the potential applications of bacterial endophytes in agricultural is to enhance the growth of the agricultural crops. Hence, this study was undertaken to explore the plant growth promoting potential application of bacterial endophytes. The objective of this study was to examine the effect of endophytic bacteria from mangrove tree (Rhizophora apiculata Blume) for their efficacy in promoting seedling growth in rice. Eight endophytic bacterial isolates (EBIs) isolated from twig and petiole tissues of the mangrove were identified based on their 16S ribosomal ribonucleic acid (rRNA) gene sequence homology. Separately, surface sterilized paddy seeds were treated with cell-free broth and cell suspension of the EBIs. Rice seedlings were analyzed by various bioassays and data was recorded. The gene sequences of the isolates were closely related to two genera namely, Bacillus and Pantoea. Inoculation of EBIs from R. apiculata with rice seeds resulted in accelerated root and shoot growth with significant increase in chlorophyll content. Among the isolates, Pantoea ananatis (1MSE1) and Bacillus amyloliquefaciens (3MPE1) had shown predominance of activity. Endophytic invasion was recognized by the non-host by rapid accumulation of reactive oxygen species (ROS) and was counteracted by the production of hydrogen peroxide (H2O2) and lipid peroxide. The results demonstrated that EBIs from mangrove tree can increase the fitness of the rice seedlings under controlled conditions. These research findings could be useful to enhance the seedling growth and could serve as foundation in further research on enhancing the growth of the rice crop using endophytic bacteria.

  9. Mechanistic study on antibacterial action of zinc oxide nanoparticles synthesized using green route.

    PubMed

    Happy Agarwal; Soumya Menon; Venkat Kumar, S; Rajeshkumar, S

    2018-04-25

    A large array of diseases caused by bacterial pathogens and origination of multidrug resistance in their gene provokes the need of developing new vectors or novel drug molecules for effective drug delivery and thus, better treatment of disease. The nanoparticle has emerged as a novel drug molecule in last decade and has been used in various industrial fields like cosmetics, healthcare, agricultural, pharmaceuticals due to their high optical, electronic, medicinal properties. Use of nanoparticles as an antibacterial agent remain in current studies with metal nanoparticles like silver, gold, copper, iron and metal oxide nanoparticles like zinc oxide, copper oxide, titanium oxide and iron oxide nanoparticles. The high anti-bacterial activity of nanoparticles is due to their large surface area to volume ratio which allows binding of a large number of ligands on nanoparticle surface and hence, its complexation with receptors present on the bacterial surface. Green synthesis of Zinc Oxide Nanoparticle (ZnO NP) and its anti-bacterial application has been particularly discussed in the review literature. The present study highlights differential nanoparticle attachment to gram + and gram - bacterial surface and different mechanism adopted by nanoparticle for bacterial control. Pharmacokinetics and applications of ZnO NP are also discussed briefly. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Diversity of Bacterial Communities on Four Frequently Used Surfaces in a Large Brazilian Teaching Hospital

    PubMed Central

    Pereira da Fonseca, Tairacan Augusto; Pessôa, Rodrigo; Felix, Alvina Clara; Sanabani, Sabri Saeed

    2016-01-01

    Frequently used hand-touch surfaces in hospital settings have been implicated as a vehicle of microbial transmission. In this study, we aimed to investigate the overall bacterial population on four frequently used surfaces using a culture-independent Illumina massively parallel sequencing approach of the 16S rRNA genes. Surface samples were collected from four sites, namely elevator buttons (EB), bank machine keyboard buttons (BMKB), restroom surfaces, and the employee biometric time clock system (EBTCS), in a large public and teaching hospital in São Paulo. Taxonomical composition revealed the abundance of Firmicutes phyla, followed by Actinobacteria and Proteobacteria, with a total of 926 bacterial families and 2832 bacterial genera. Moreover, our analysis revealed the presence of some potential pathogenic bacterial genera, including Salmonella enterica, Klebsiella pneumoniae, and Staphylococcus aureus. The presence of these pathogens in frequently used surfaces enhances the risk of exposure to any susceptible individuals. Some of the factors that may contribute to the richness of bacterial diversity on these surfaces are poor personal hygiene and ineffective routine schedules of cleaning, sanitizing, and disinfecting. Strict standards of infection control in hospitals and increased public education about hand hygiene are recommended to decrease the risk of transmission in hospitals among patients. PMID:26805866

  11. Airborne bacterial assemblage in a zero carbon building: A case study.

    PubMed

    Leung, M H Y; Tong, X; Tong, J C K; Lee, P K H

    2018-01-01

    Currently, there is little information pertaining to the airborne bacterial communities of green buildings. In this case study, the air bacterial community of a zero carbon building (ZCB) in Hong Kong was characterized by targeting the bacterial 16S rRNA gene. Bacteria associated with the outdoor environment dominated the indoor airborne bacterial assemblage, with a modest contribution from bacteria associated with human skin. Differences in overall community diversity, membership, and composition associated with short (day-to-day) and long-term temporal properties were detected, which may have been driven by specific environmental genera and taxa. Furthermore, time-decay relationships in community membership (based on unweighted UniFrac distances) and composition (based on weighted UniFrac distances) differed depending on the season and sampling location. A Bayesian source-tracking approach further supported the importance of adjacent outdoor air bacterial assemblage in sourcing the ZCB indoor bioaerosol. Despite the unique building attributes, the ZCB microbial assemblage detected and its temporal characteristics were not dissimilar to that of conventional built environments investigated previously. Future controlled experiments and microbial assemblage investigations of other ZCBs will undoubtedly uncover additional knowledge related to how airborne bacteria in green buildings may be influenced by their distinctive architectural attributes. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Soil-borne bacterial structure and diversity does not reflect community activity in Pampa biome.

    PubMed

    Lupatini, Manoeli; Suleiman, Afnan Khalil Ahmad; Jacques, Rodrigo Josemar Seminoti; Antoniolli, Zaida Inês; Kuramae, Eiko Eurya; de Oliveira Camargo, Flávio Anastácio; Roesch, Luiz Fernando Würdig

    2013-01-01

    The Pampa biome is considered one of the main hotspots of the world's biodiversity and it is estimated that half of its original vegetation was removed and converted to agricultural land and tree plantations. Although an increasing amount of knowledge is being assembled regarding the response of soil bacterial communities to land use change, to the associated plant community and to soil properties, our understanding about how these interactions affect the microbial community from the Brazilian Pampa is still poor and incomplete. In this study, we hypothesized that the same soil type from the same geographic region but under distinct land use present dissimilar soil bacterial communities. To test this hypothesis, we assessed the soil bacterial communities from four land-uses within the same soil type by 454-pyrosequencing of 16S rRNA gene and by soil microbial activity analyzes. We found that the same soil type under different land uses harbor similar (but not equal) bacterial communities and the differences were controlled by many microbial taxa. No differences regarding diversity and richness between natural areas and areas under anthropogenic disturbance were detected. However, the measures of microbial activity did not converge with the 16S rRNA data supporting the idea that the coupling between functioning and composition of bacterial communities is not necessarily correlated.

  13. Bacterial diversity in water injection systems of Brazilian offshore oil platforms.

    PubMed

    Korenblum, Elisa; Valoni, Erika; Penna, Mônica; Seldin, Lucy

    2010-01-01

    Biogenic souring and microbial-influenced corrosion is a common scenario in water-flooded petroleum reservoirs. Water injection systems are continuously treated to control bacterial contamination, but some bacteria that cause souring and corrosion can persist even after different treatments have been applied. Our aim was to increase our knowledge of the bacterial communities that persist in the water injection systems of three offshore oil platforms in Brazil. To achieve this goal, we used a culture-independent molecular approach (16S ribosomal RNA gene clone libraries) to analyze seawater samples that had been subjected to different treatments. Phylogenetic analyses revealed that the bacterial communities from the different platforms were taxonomically different. A predominance of bacterial clones affiliated with Gammaproteobacteria, mostly belonging to the genus Marinobacter (60.7%), were observed in the platform A samples. Clones from platform B were mainly related to the genera Colwellia (37.9%) and Achromobacter (24.6%), whereas clones obtained from platform C were all related to unclassified bacteria. Canonical correspondence analyses showed that different treatments such as chlorination, deoxygenation, and biocide addition did not significantly influence the bacterial diversity in the platforms studied. Our results demonstrated that the injection water used in secondary oil recovery procedures contained potentially hazardous bacteria, which may ultimately cause souring and corrosion.

  14. Bacterial Adaptation of Respiration from Oxic to Microoxic and Anoxic Conditions: Redox Control

    PubMed Central

    Bueno, Emilio; Mesa, Socorro; Bedmar, Eulogio J.; Richardson, David J.

    2012-01-01

    Abstract Under a shortage of oxygen, bacterial growth can be faced mainly by two ATP-generating mechanisms: (i) by synthesis of specific high-affinity terminal oxidases that allow bacteria to use traces of oxygen or (ii) by utilizing other substrates as final electron acceptors such as nitrate, which can be reduced to dinitrogen gas through denitrification or to ammonium. This bacterial respiratory shift from oxic to microoxic and anoxic conditions requires a regulatory strategy which ensures that cells can sense and respond to changes in oxygen tension and to the availability of other electron acceptors. Bacteria can sense oxygen by direct interaction of this molecule with a membrane protein receptor (e.g., FixL) or by interaction with a cytoplasmic transcriptional factor (e.g., Fnr). A third type of oxygen perception is based on sensing changes in redox state of molecules within the cell. Redox-responsive regulatory systems (e.g., ArcBA, RegBA/PrrBA, RoxSR, RegSR, ActSR, ResDE, and Rex) integrate the response to multiple signals (e.g., ubiquinone, menaquinone, redox active cysteine, electron transport to terminal oxidases, and NAD/NADH) and activate or repress target genes to coordinate the adaptation of bacterial respiration from oxic to anoxic conditions. Here, we provide a compilation of the current knowledge about proteins and regulatory networks involved in the redox control of the respiratory adaptation of different bacterial species to microxic and anoxic environments. Antioxid. Redox Signal. 16, 819–852. PMID:22098259

  15. Detection of a Mixed Infection in a Culture-Negative Brain Abscess by Broad-Spectrum Bacterial 16S rRNA Gene PCR ▿ †

    PubMed Central

    Keller, Peter M.; Rampini, Silvana K.; Bloemberg, Guido V.

    2010-01-01

    We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis. PMID:20392909

  16. Dynamic changes in the structure of microbial communities in Baltic Sea coastal seawater microcosms modified by crude oil, shale oil or diesel fuel.

    PubMed

    Viggor, Signe; Juhanson, Jaanis; Jõesaar, Merike; Mitt, Mario; Truu, Jaak; Vedler, Eve; Heinaru, Ain

    2013-08-25

    The coastal waters of the Baltic Sea are constantly threatened by oil spills, due to the extensive transportation of oil products across the sea. To characterise the hydrocarbon-degrading bacterial community of this marine area, microcosm experiments on diesel fuel, crude oil and shale oil were performed. Analysis of these microcosms, using alkane monooxygenase (alkB) and 16S rRNA marker genes in PCR-DGGE experiments, demonstrated that substrate type and concentration strongly influence species composition and the occurrence of alkB genes in respective oil degrading bacterial communities. Gammaproteobacteria (particularly the genus Pseudomonas) and Alphaproteobacteria were dominant in all microcosms treated with oils. All alkB genes carried by bacterial isolates (40 strains), and 8 of the 11 major DGGE bands from the microcosms, had more than 95% sequence identity with the alkB genes of Pseudomonas fluorescens. However, the closest relatives of the majority of sequences (54 sequences from 79) of the alkB gene library from initially collected seawater DNA were Actinobacteria. alkB gene expression, induced by hexadecane, was recorded in isolated bacterial strains. Thus, complementary culture dependent and independent methods provided a more accurate picture about the complex seawater microbial communities of the Baltic Sea. Copyright © 2013 Elsevier GmbH. All rights reserved.

  17. Bacterial genospecies that are not ecologically coherent: population genomics of Rhizobium leguminosarum

    PubMed Central

    Kumar, Nitin; Lad, Ganesh; Giuntini, Elisa; Kaye, Maria E.; Udomwong, Piyachat; Shamsani, N. Jannah; Young, J. Peter W.; Bailly, Xavier

    2015-01-01

    Biological species may remain distinct because of genetic isolation or ecological adaptation, but these two aspects do not always coincide. To establish the nature of the species boundary within a local bacterial population, we characterized a sympatric population of the bacterium Rhizobium leguminosarum by genomic sequencing of 72 isolates. Although all strains have 16S rRNA typical of R. leguminosarum, they fall into five genospecies by the criterion of average nucleotide identity (ANI). Many genes, on plasmids as well as the chromosome, support this division: recombination of core genes has been largely within genospecies. Nevertheless, variation in ecological properties, including symbiotic host range and carbon-source utilization, cuts across these genospecies, so that none of these phenotypes is diagnostic of genospecies. This phenotypic variation is conferred by mobile genes. The genospecies meet the Mayr criteria for biological species in respect of their core genes, but do not correspond to coherent ecological groups, so periodic selection may not be effective in purging variation within them. The population structure is incompatible with traditional ‘polyphasic taxonomy′ that requires bacterial species to have both phylogenetic coherence and distinctive phenotypes. More generally, genomics has revealed that many bacterial species share adaptive modules by horizontal gene transfer, and we envisage a more consistent taxonomic framework that explicitly recognizes this. Significant phenotypes should be recognized as ‘biovars' within species that are defined by core gene phylogeny. PMID:25589577

  18. Systematic Identification of Genes Required for Expression of Androgen Receptor Splice Variants

    DTIC Science & Technology

    2016-08-01

    engineering tool has been developed from bacterial Clustered Regularly Interspaced Short Palindromic Repeats ( CRISPR )/ CRISPR ‐Associated System (Cas...regulation of AR splice variant through CRISPR /Cas screening system. 15. SUBJECT TERMS CRISPR /Cas, Androgen receptor, castration resistance, biomarker 16...control (non-targeting) gRNAs available from Addgene (http://www.addgene.org/ CRISPR /libraries/). Generation of AR3 reporter: We used molecular cloning

  19. Bacterial CRISPR: Accomplishments and Prospects

    PubMed Central

    Peters, Jason M.; Silvis, Melanie R.; Zhao, Dehua; Hawkins, John S.; Gross, Carol A.; Qi, Lei S.

    2015-01-01

    In this review we briefly describe the development of CRISPR tools for genome editing and control of transcription in bacteria. We focus on the Type II CRISPR/Cas9 system, provide specific examples for use of the system, and highlight the advantages and disadvantages of CRISPR versus other techniques. We suggest potential strategies for combining CRISPR tools with high-throughput approaches to elucidate gene function in bacteria. PMID:26363124

  20. Defense Islands in Bacterial and Archaeal Genomes and Prediction of Novel Defense Systems ▿†‡

    PubMed Central

    Makarova, Kira S.; Wolf, Yuri I.; Snir, Sagi; Koonin, Eugene V.

    2011-01-01

    The arms race between cellular life forms and viruses is a major driving force of evolution. A substantial fraction of bacterial and archaeal genomes is dedicated to antivirus defense. We analyzed the distribution of defense genes and typical mobilome components (such as viral and transposon genes) in bacterial and archaeal genomes and demonstrated statistically significant clustering of antivirus defense systems and mobile genes and elements in genomic islands. The defense islands are enriched in putative operons and contain numerous overrepresented gene families. A detailed sequence analysis of the proteins encoded by genes in these families shows that many of them are diverged variants of known defense system components, whereas others show features, such as characteristic operonic organization, that are suggestive of novel defense systems. Thus, genomic islands provide abundant material for the experimental study of bacterial and archaeal antivirus defense. Except for the CRISPR-Cas systems, different classes of defense systems, in particular toxin-antitoxin and restriction-modification systems, show nonrandom clustering in defense islands. It remains unclear to what extent these associations reflect functional cooperation between different defense systems and to what extent the islands are genomic “sinks” that accumulate diverse nonessential genes, particularly those acquired via horizontal gene transfer. The characteristics of defense islands resemble those of mobilome islands. Defense and mobilome genes are nonrandomly associated in islands, suggesting nonadaptive evolution of the islands via a preferential attachment-like mechanism underpinned by the addictive properties of defense systems such as toxins-antitoxins and an important role of horizontal mobility in the evolution of these islands. PMID:21908672

  1. Defense islands in bacterial and archaeal genomes and prediction of novel defense systems.

    PubMed

    Makarova, Kira S; Wolf, Yuri I; Snir, Sagi; Koonin, Eugene V

    2011-11-01

    The arms race between cellular life forms and viruses is a major driving force of evolution. A substantial fraction of bacterial and archaeal genomes is dedicated to antivirus defense. We analyzed the distribution of defense genes and typical mobilome components (such as viral and transposon genes) in bacterial and archaeal genomes and demonstrated statistically significant clustering of antivirus defense systems and mobile genes and elements in genomic islands. The defense islands are enriched in putative operons and contain numerous overrepresented gene families. A detailed sequence analysis of the proteins encoded by genes in these families shows that many of them are diverged variants of known defense system components, whereas others show features, such as characteristic operonic organization, that are suggestive of novel defense systems. Thus, genomic islands provide abundant material for the experimental study of bacterial and archaeal antivirus defense. Except for the CRISPR-Cas systems, different classes of defense systems, in particular toxin-antitoxin and restriction-modification systems, show nonrandom clustering in defense islands. It remains unclear to what extent these associations reflect functional cooperation between different defense systems and to what extent the islands are genomic "sinks" that accumulate diverse nonessential genes, particularly those acquired via horizontal gene transfer. The characteristics of defense islands resemble those of mobilome islands. Defense and mobilome genes are nonrandomly associated in islands, suggesting nonadaptive evolution of the islands via a preferential attachment-like mechanism underpinned by the addictive properties of defense systems such as toxins-antitoxins and an important role of horizontal mobility in the evolution of these islands.

  2. The airway microbiome in patients with severe asthma: Associations with disease features and severity.

    PubMed

    Huang, Yvonne J; Nariya, Snehal; Harris, Jeffrey M; Lynch, Susan V; Choy, David F; Arron, Joseph R; Boushey, Homer

    2015-10-01

    Asthma is heterogeneous, and airway dysbiosis is associated with clinical features in patients with mild-to-moderate asthma. Whether similar relationships exist among patients with severe asthma is unknown. We sought to evaluate relationships between the bronchial microbiome and features of severe asthma. Bronchial brushings from 40 participants in the Bronchoscopic Exploratory Research Study of Biomarkers in Corticosteroid-refractory Asthma (BOBCAT) study were evaluated by using 16S ribosomal RNA-based methods. Relationships to clinical and inflammatory features were analyzed among microbiome-profiled subjects. Secondarily, bacterial compositional profiles were compared between patients with severe asthma and previously studied healthy control subjects (n = 7) and patients with mild-to-moderate asthma (n = 41). In patients with severe asthma, bronchial bacterial composition was associated with several disease-related features, including body mass index (P < .05, Bray-Curtis distance-based permutational multivariate analysis of variance; PERMANOVA), changes in Asthma Control Questionnaire (ACQ) scores (P < .01), sputum total leukocyte values (P = .06), and bronchial biopsy eosinophil values (per square millimeter, P = .07). Bacterial communities associated with worsening ACQ scores and sputum total leukocyte values (predominantly Proteobacteria) differed markedly from those associated with body mass index (Bacteroidetes/Firmicutes). In contrast, improving/stable ACQ scores and bronchial epithelial gene expression of FK506 binding protein (FKBP5), an indicator of steroid responsiveness, correlated with Actinobacteria. Mostly negative correlations were observed between biopsy eosinophil values and Proteobacteria. No taxa were associated with a TH2-related epithelial gene expression signature, but expression of TH17-related genes was associated with Proteobacteria. Patients with severe asthma compared with healthy control subjects or patients with mild-to-moderate asthma were significantly enriched in Actinobacteria, although the largest differences observed involved a Klebsiella genus member (7.8-fold increase in patients with severe asthma, adjusted P < .001). Specific microbiota are associated with and may modulate inflammatory processes in patients with severe asthma and related phenotypes. Airway dysbiosis in patients with severe asthma appears to differ from that observed in those with milder asthma in the setting of inhaled corticosteroid use. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Plagiarized bacterial genes in the human book of life.

    PubMed

    Ponting, C P

    2001-05-01

    The initial analysis of the human genome draft sequence reveals that our 'book of life' is multi-authored. A small but significant proportion of our genes owes their heritage not to antecedent eukaryotes but instead to bacteria. The publicly funded Human Genome Project study indicates that about 0.5% of all human genes were copied into the genome from bacterial sources. Detailed sequence analyses point to these 'horizontal gene transfer' events having occurred relatively recently. So how did the human 'book of life' evolve to be a chimaera, part animal and part bacterium? And what was the probable evolutionary impact of such gene plagiarism?

  4. The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science

    PubMed Central

    Ames, Nancy J.; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R.

    2017-01-01

    Background As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and health care practitioners to analyze these microbial communities and their role in health and disease.16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. Objectives The objectives of this review are to: (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Discussion Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists—individuals uniquely positioned to utilize these techniques in future studies in clinical settings. PMID:28252578

  5. Chromosomal targeting by CRISPR-Cas systems can contribute to genome plasticity in bacteria

    PubMed Central

    Dy, Ron L; Pitman, Andrew R; Fineran, Peter C

    2013-01-01

    The clustered regularly interspaced short palindromic repeats (CRISPR) and their associated (Cas) proteins form adaptive immune systems in bacteria to combat phage and other foreign genetic elements. Typically, short spacer sequences are acquired from the invader DNA and incorporated into CRISPR arrays in the bacterial genome. Small RNAs are generated that contain these spacer sequences and enable sequence-specific destruction of the foreign nucleic acids. Occasionally, spacers are acquired from the chromosome, which instead leads to targeting of the host genome. Chromosomal targeting is highly toxic to the bacterium, providing a strong selective pressure for a variety of evolutionary routes that enable host cell survival. Mutations that inactivate the CRISPR-Cas functionality, such as within the cas genes, CRISPR repeat, protospacer adjacent motifs (PAM), and target sequence, mediate escape from toxicity. This self-targeting might provide some explanation for the incomplete distribution of CRISPR-Cas systems in less than half of sequenced bacterial genomes. More importantly, self-genome targeting can cause large-scale genomic alterations, including remodeling or deletion of pathogenicity islands and other non-mobile chromosomal regions. While control of horizontal gene transfer is perceived as their main function, our recent work illuminates an alternative role of CRISPR-Cas systems in causing host genomic changes and influencing bacterial evolution. PMID:24251073

  6. BμG@Sbase—a microbial gene expression and comparative genomic database

    PubMed Central

    Witney, Adam A.; Waldron, Denise E.; Brooks, Lucy A.; Tyler, Richard H.; Withers, Michael; Stoker, Neil G.; Wren, Brendan W.; Butcher, Philip D.; Hinds, Jason

    2012-01-01

    The reducing cost of high-throughput functional genomic technologies is creating a deluge of high volume, complex data, placing the burden on bioinformatics resources and tool development. The Bacterial Microarray Group at St George's (BμG@S) has been at the forefront of bacterial microarray design and analysis for over a decade and while serving as a hub of a global network of microbial research groups has developed BμG@Sbase, a microbial gene expression and comparative genomic database. BμG@Sbase (http://bugs.sgul.ac.uk/bugsbase/) is a web-browsable, expertly curated, MIAME-compliant database that stores comprehensive experimental annotation and multiple raw and analysed data formats. Consistent annotation is enabled through a structured set of web forms, which guide the user through the process following a set of best practices and controlled vocabulary. The database currently contains 86 expertly curated publicly available data sets (with a further 124 not yet published) and full annotation information for 59 bacterial microarray designs. The data can be browsed and queried using an explorer-like interface; integrating intuitive tree diagrams to present complex experimental details clearly and concisely. Furthermore the modular design of the database will provide a robust platform for integrating other data types beyond microarrays into a more Systems analysis based future. PMID:21948792

  7. BμG@Sbase--a microbial gene expression and comparative genomic database.

    PubMed

    Witney, Adam A; Waldron, Denise E; Brooks, Lucy A; Tyler, Richard H; Withers, Michael; Stoker, Neil G; Wren, Brendan W; Butcher, Philip D; Hinds, Jason

    2012-01-01

    The reducing cost of high-throughput functional genomic technologies is creating a deluge of high volume, complex data, placing the burden on bioinformatics resources and tool development. The Bacterial Microarray Group at St George's (BμG@S) has been at the forefront of bacterial microarray design and analysis for over a decade and while serving as a hub of a global network of microbial research groups has developed BμG@Sbase, a microbial gene expression and comparative genomic database. BμG@Sbase (http://bugs.sgul.ac.uk/bugsbase/) is a web-browsable, expertly curated, MIAME-compliant database that stores comprehensive experimental annotation and multiple raw and analysed data formats. Consistent annotation is enabled through a structured set of web forms, which guide the user through the process following a set of best practices and controlled vocabulary. The database currently contains 86 expertly curated publicly available data sets (with a further 124 not yet published) and full annotation information for 59 bacterial microarray designs. The data can be browsed and queried using an explorer-like interface; integrating intuitive tree diagrams to present complex experimental details clearly and concisely. Furthermore the modular design of the database will provide a robust platform for integrating other data types beyond microarrays into a more Systems analysis based future.

  8. The overexpression of RXam1, a cassava gene coding for an RLK, confers disease resistance to Xanthomonas axonopodis pv. manihotis.

    PubMed

    Díaz Tatis, Paula A; Herrera Corzo, Mariana; Ochoa Cabezas, Juan C; Medina Cipagauta, Adriana; Prías, Mónica A; Verdier, Valerie; Chavarriaga Aguirre, Paul; López Carrascal, Camilo E

    2018-04-01

    The overexpression of RXam1 leads to a reduction in bacterial growth of XamCIO136, suggesting that RXam1 might be implicated in strain-specific resistance. Cassava bacterial blight (CBB) caused by Xanthomonas axonopodis pv. manihotis (Xam) is a prevalent disease in all regions, where cassava is cultivated. CBB is a foliar and vascular disease usually controlled through host resistance. Previous studies have found QTLs explaining resistance to several Xam strains. Interestingly, one QTL called XM5 that explained 13% of resistance to XamCIO136 was associated with a similar fragment of the rice Xa21-resistance gene called PCR250. In this study, we aimed to further identify and characterize this fragment and its role in resistance to CBB. Screening and hybridization of a BAC library using the molecular marker PCR250 as a probe led to the identification of a receptor-like kinase similar to Xa21 and were called RXam1 (Resistance to Xam 1). Here, we report the functional characterization of susceptible cassava plants overexpressing RXam1. Our results indicated that the overexpression of RXam1 leads to a reduction in bacterial growth of XamCIO136. This suggests that RXAM1 might be implicated in strain-specific resistance to XamCIO136.

  9. Whole Genome Sequence Analysis of Pig Respiratory Bacterial Pathogens with Elevated Minimum Inhibitory Concentrations for Macrolides.

    PubMed

    Dayao, Denise Ann Estarez; Seddon, Jennifer M; Gibson, Justine S; Blackall, Patrick J; Turni, Conny

    2016-10-01

    Macrolides are often used to treat and control bacterial pathogens causing respiratory disease in pigs. This study analyzed the whole genome sequences of one clinical isolate of Actinobacillus pleuropneumoniae, Haemophilus parasuis, Pasteurella multocida, and Bordetella bronchiseptica, all isolated from Australian pigs to identify the mechanism underlying the elevated minimum inhibitory concentrations (MICs) for erythromycin, tilmicosin, or tulathromycin. The H. parasuis assembled genome had a nucleotide transition at position 2059 (A to G) in the six copies of the 23S rRNA gene. This mutation has previously been associated with macrolide resistance but this is the first reported mechanism associated with elevated macrolide MICs in H. parasuis. There was no known macrolide resistance mechanism identified in the other three bacterial genomes. However, strA and sul2, aminoglycoside and sulfonamide resistance genes, respectively, were detected in one contiguous sequence (contig 1) of A. pleuropneumoniae assembled genome. This contig was identical to plasmids previously identified in Pasteurellaceae. This study has provided one possible explanation of elevated MICs to macrolides in H. parasuis. Further studies are necessary to clarify the mechanism causing the unexplained macrolide resistance in other Australian pig respiratory pathogens including the role of efflux systems, which were detected in all analyzed genomes.

  10. Effect of bacterial antagonists on lettuce: active biocontrol of Rhizoctonia solani and negligible, short-term effects on nontarget microorganisms.

    PubMed

    Scherwinski, Katja; Grosch, Rita; Berg, Gabriele

    2008-04-01

    The aim of this study was to assess the biocontrol efficacy against Rhizoctonia solani of three bacterial antagonists introduced into naturally Rhizoctonia-infested lettuce fields and to analyse their impact on the indigenous plant-associated bacteria and fungi. Lettuce seedlings were inoculated with bacterial suspensions of two endophytic strains, Serratia plymuthica 3Re4-18 and Pseudomonas trivialis 3Re2-7, and with the rhizobacterium Pseudomonas fluorescens L13-6-12 7 days before and 5 days after planting in the field. Similar statistically significant biocontrol effects were observed for all applied bacterial antagonists compared with the uninoculated control. Single-strand conformation polymorphism analysis of 16S rRNA gene or ITS1 fragments revealed a highly diverse rhizosphere and a less diverse endophytic microbial community for lettuce. Representatives of several bacterial (Alpha-, Beta- and Gammaproteobacteria, Firmicutes, Bacteriodetes), fungal (Ascomycetes, Basidiomycetes) and protist (Oomycetes) groups were present inside or on lettuce plants. Surprisingly, given that lettuce is a vegetable that is eaten raw, species of genera such as Flavobacterium, Burkholderia, Staphylococcus, Cladosporium and Aspergillus, which contain potentially human pathogenic strains, were identified. Analysis of the indigenous bacterial and endophytic fungal populations revealed only negligible, short-term effects resulting from the bacterial treatments, and that they were more influenced by field site, plant growth stage and microenvironment.

  11. In silico Prediction, in vitro Antibacterial Spectrum, and Physicochemical Properties of a Putative Bacteriocin Produced by Lactobacillus rhamnosus Strain L156.4

    PubMed Central

    Oliveira, Letícia de C.; Silveira, Aline M. M.; Monteiro, Andréa de S.; dos Santos, Vera L.; Nicoli, Jacques R.; Azevedo, Vasco A. de C.; Soares, Siomar de C.; Dias-Souza, Marcus V.; Nardi, Regina M. D.

    2017-01-01

    A bacteriocinogenic Lactobacillus rhamnosus L156.4 strain isolated from the feces of NIH mice was identified by 16S rRNA gene sequencing and MALDI-TOF mass spectrometry. The entire genome was sequenced using Illumina, annotated in the PGAAP, and RAST servers, and deposited. Conserved genes associated with bacteriocin synthesis were predicted using BAGEL3, leading to the identification of an open reading frame (ORF) that shows homology with the L. rhamnosus GG (ATCC 53103) prebacteriocin gene. The encoded protein contains a conserved protein motif associated a structural gene of the Enterocin A superfamily. We found ORFs related to the prebacteriocin, immunity protein, ABC transporter proteins, and regulatory genes with 100% identity to those of L. rhamnosus HN001. In this study, we provide evidence of a putative bacteriocin produced by L. rhamnosus L156.4 that was further confirmed by in vitro assays. The antibacterial activity of the substances produced by this strain was evaluated using the deferred agar-spot and spot-on-the lawn assays, and a wide antimicrobial activity spectrum against human and foodborne pathogens was observed. The physicochemical characterization of the putative bacteriocin indicated that it was sensitive to proteolytic enzymes, heat stable and maintained its antibacterial activity in a pH ranging from 3 to 9. The activity against Lactobacillus fermentum, which was used as an indicator strain, was detected during bacterial logarithmic growth phase, and a positive correlation was confirmed between bacterial growth and production of the putative bacteriocin. After a partial purification from cell-free supernatant by salt precipitation, the putative bacteriocin migrated as a diffuse band of approximately 1.0–3.0 kDa by SDS-PAGE. Additional studies are being conducted to explore its use in the food industry for controlling bacterial growth and for probiotic applications. PMID:28579977

  12. Alignment-free detection of horizontal gene transfer between closely related bacterial genomes.

    PubMed

    Domazet-Lošo, Mirjana; Haubold, Bernhard

    2011-09-01

    Bacterial epidemics are often caused by strains that have acquired their increased virulence through horizontal gene transfer. Due to this association with disease, the detection of horizontal gene transfer continues to receive attention from microbiologists and bioinformaticians alike. Most software for detecting transfer events is based on alignments of sets of genes or of entire genomes. But despite great advances in the design of algorithms and computer programs, genome alignment remains computationally challenging. We have therefore developed an alignment-free algorithm for rapidly detecting horizontal gene transfer between closely related bacterial genomes. Our implementation of this algorithm is called alfy for "ALignment Free local homologY" and is freely available from http://guanine.evolbio.mpg.de/alfy/. In this comment we demonstrate the application of alfy to the genomes of Staphylococcus aureus. We also argue that-contrary to popular belief and in spite of increasing computer speed-algorithmic optimization is becoming more, not less, important if genome data continues to accumulate at the present rate.

  13. QTLs for Resistance to Major Rice Diseases Exacerbated by Global Warming: Brown Spot, Bacterial Seedling Rot, and Bacterial Grain Rot.

    PubMed

    Mizobuchi, Ritsuko; Fukuoka, Shuichi; Tsushima, Seiya; Yano, Masahiro; Sato, Hiroyuki

    2016-12-01

    In rice (Oryza sativa L.), damage from diseases such as brown spot, caused by Bipolaris oryzae, and bacterial seedling rot and bacterial grain rot, caused by Burkholderia glumae, has increased under global warming because the optimal temperature ranges for growth of these pathogens are relatively high (around 30 °C). Therefore, the need for cultivars carrying genes for resistance to these diseases is increasing to ensure sustainable rice production. In contrast to the situation for other important rice diseases such as blast and bacterial blight, no genes for complete resistance to brown spot, bacterial seedling rot or bacterial grain rot have yet been discovered. Thus, rice breeders have to use partial resistance, which is largely influenced by environmental conditions. Recent progress in molecular genetics and improvement of evaluation methods for disease resistance have facilitated detection of quantitative trait loci (QTLs) associated with resistance. In this review, we summarize the results of worldwide screening for cultivars with resistance to brown spot, bacterial seedling rot and bacterial grain rot and we discuss the identification of QTLs conferring resistance to these diseases in order to provide useful information for rice breeding programs.

  14. Peptide Conjugated Phosphorodiamidate Morpholino Oligomers Increase Survival of Mice Challenged with Ames Bacillus anthracis

    PubMed Central

    Geller, Bruce L.; Mellbye, Brett; Lane, Douglas; Iversen, Patrick L.; Bavari, Sina

    2012-01-01

    Targeting bacterial essential genes using antisense phosphorodiamidate morpholino oligomers (PMOs) represents an important strategy in the development of novel antibacterial therapeutics. PMOs are neutral DNA analogues that inhibit gene expression in a sequence-specific manner. In this study, several cationic, membrane-penetrating peptides were conjugated to PMOs (PPMOs) that target 2 bacterial essential genes: acyl carrier protein (acpP) and gyrase A (gyrA). These were tested for their ability to inhibit growth of Bacillus anthracis, a gram-positive spore-forming bacterium and causative agent of anthrax. PPMOs targeted upstream of both target gene start codons and conjugated with the bacterium-permeating peptide (RFF)3R were found to be most effective in inhibiting bacterial growth in vitro. Both of the gene-targeted PPMOs protected macrophages from B. anthracis induced cell death. Subsequent, in vivo testing of the PPMOs resulted in increased survival of mice challenged with the virulent Ames strain of B. anthracis. Together, these studies suggest that PPMOs targeting essential genes have the potential of being used as antisense antibiotics to treat B. anthracis infections. PMID:22978365

  15. Nonculture molecular techniques for diagnosis of bacterial disease in animals: a diagnostic laboratory perspective.

    PubMed

    Cai, H Y; Caswell, J L; Prescott, J F

    2014-03-01

    The past decade has seen remarkable technical advances in infectious disease diagnosis, and the pace of innovation is likely to continue. Many of these techniques are well suited to pathogen identification directly from pathologic or clinical samples, which is the focus of this review. Polymerase chain reaction (PCR) and gene sequencing are now routinely performed on frozen or fixed tissues for diagnosis of bacterial infections of animals. These assays are most useful for pathogens that are difficult to culture or identify phenotypically, when propagation poses a biosafety hazard, or when suitable fresh tissue is not available. Multiplex PCR assays, DNA microarrays, in situ hybridization, massive parallel DNA sequencing, microbiome profiling, molecular typing of pathogens, identification of antimicrobial resistance genes, and mass spectrometry are additional emerging technologies for the diagnosis of bacterial infections from pathologic and clinical samples in animals. These technical advances come, however, with 2 caveats. First, in the age of molecular diagnosis, quality control has become more important than ever to identify and control for the presence of inhibitors, cross-contamination, inadequate templates from diagnostic specimens, and other causes of erroneous microbial identifications. Second, the attraction of these technologic advances can obscure the reality that medical diagnoses cannot be made on the basis of molecular testing alone but instead through integrated consideration of clinical, pathologic, and laboratory findings. Proper validation of the method is required. It is critical that veterinary diagnosticians understand not only the value but also the limitations of these technical advances for routine diagnosis of infectious disease.

  16. Natural mutations in a Staphylococcus aureus virulence regulator attenuate cytotoxicity but permit bacteremia and abscess formation

    PubMed Central

    Das, Sudip; Lindemann, Claudia; Young, Bernadette C.; Muller, Julius; Österreich, Babett; Ternette, Nicola; Winkler, Ann-Cathrin; Paprotka, Kerstin; Reinhardt, Richard; Allen, Elizabeth; Flaxman, Amy; Yamaguchi, Yuko; Rollier, Christine S.; van Diemen, Pauline; Blättner, Sebastian; Remmele, Christian W.; Selle, Martina; Dittrich, Marcus; Müller, Tobias; Vogel, Jörg; Ohlsen, Knut; Crook, Derrick W.; Massey, Ruth; Wilson, Daniel J.; Rudel, Thomas; Wyllie, David H.; Fraunholz, Martin J.

    2016-01-01

    Staphylococcus aureus is a major bacterial pathogen, which causes severe blood and tissue infections that frequently emerge by autoinfection with asymptomatically carried nose and skin populations. However, recent studies report that bloodstream isolates differ systematically from those found in the nose and skin, exhibiting reduced toxicity toward leukocytes. In two patients, an attenuated toxicity bloodstream infection evolved from an asymptomatically carried high-toxicity nasal strain by loss-of-function mutations in the gene encoding the transcription factor repressor of surface proteins (rsp). Here, we report that rsp knockout mutants lead to global transcriptional and proteomic reprofiling, and they exhibit the greatest signal in a genome-wide screen for genes influencing S. aureus survival in human cells. This effect is likely to be mediated in part via SSR42, a long-noncoding RNA. We show that rsp controls SSR42 expression, is induced by hydrogen peroxide, and is required for normal cytotoxicity and hemolytic activity. Rsp inactivation in laboratory- and bacteremia-derived mutants attenuates toxin production, but up-regulates other immune subversion proteins and reduces lethality during experimental infection. Crucially, inactivation of rsp preserves bacterial dissemination, because it affects neither formation of deep abscesses in mice nor survival in human blood. Thus, we have identified a spontaneously evolving, attenuated-cytotoxicity, nonhemolytic S. aureus phenotype, controlled by a pleiotropic transcriptional regulator/noncoding RNA virulence regulatory system, capable of causing S. aureus bloodstream infections. Such a phenotype could promote deep infection with limited early clinical manifestations, raising concerns that bacterial evolution within the human body may contribute to severe infection. PMID:27185949

  17. Dynamics of fecal indicator bacteria, bacterial pathogen genes, and organic wastewater contaminants in the Little Calumet River: Portage Burns Waterway, Indiana

    USGS Publications Warehouse

    Haack, Sheridan K.; Duris, Joseph W.

    2013-01-01

    Little information exists on the co-occurrence of fecal indicator bacteria (FIB), bacterial pathogens, and organic wastewater-associated chemicals (OWCs) within Great Lakes tributaries. Fifteen watershed sites and one beach site adjacent to the Little Calumet River–Portage Burns Waterway (LCRPBW) on Lake Michigan were tested on four dates for pH, dissolved oxygen, specific conductance, chloride, color, ammonia- and nitrate-nitrogen, soluble phosphorus, sulfate, turbidity, and atrazine; for concentrations of FIB; and for genes indicating the presence of human-pathogenic enterococci (ENT) and of Shiga-toxin producing Escherichia coli (EC) from various animal sources. Nineteen samples were also tested for 60 OWCs. Half of the watershed samples met EC recreational water quality standards; none met ENT standards. Human-wastewater-associated OWC detections were correlated with human-influence indicators such as population/km2, chloride concentrations, and the presence of WWTP effluents, but EC and ENT concentrations were not. Bacterial pathogen genes indicated rural human and several potential animal sources. OWCs of human or ecosystem health concern (musk fragrances AHTN and HHCB, alkylphenols, carbamazepine) and 3 bacterial pathogen genes were detected at the mouth of the LCRPBW, but no such OWCs and only 1 pathogen gene were detected at the beach. The LCRPBW has significant potential to deliver FIB, potential bacterial pathogens, and OWCs of human or ecosystem health concern to the nearshore of Lake Michigan, under conditions enhancing nearshore transport of the river plume. Nearshore mixing of lake and river water, and the lack of relationship between OWCs and FIB or pathogen genes, pose numerous challenges for watershed and nearshore assessment and remediation.

  18. Serratia marcescens outbreak in a neonatal intensive care unit (NICU): new insights from next-generation sequencing applications.

    PubMed

    Martineau, Christine; Li, Xuejing; Lalancette, Cindy; Perreault, Thérèse; Fournier, Eric; Tremblay, Julien; Gonzales, Milagros; Yergeau, Étienne; Quach, Caroline

    2018-06-13

    Serratia marcescens is an environmental bacterium commonly associated with outbreaks in neonatal intensive care units (NICU). Investigation of S. marcescens outbreaks requires efficient recovery and typing of clinical and environmental isolates. In this study, we described how the use of next-generation sequencing applications, such as bacterial whole-genome sequencing (WGS) and bacterial community profiling, could improve S. marcescens outbreak investigation. Phylogenomic links and potential antibiotic resistance genes and plasmids in S. marcescens isolates were investigated using WGS, while bacterial communities and relative abundances of Serratia in environmental samples were assessed using sequencing of bacterial phylogenetic marker genes (16S rRNA and gyrB genes). Typing results obtained using WGS for the ten S. marcescens isolates recovered during a NICU outbreak investigation were highly consistent with those from pulse-field gel electrophoresis (PFGE), the current gold standard typing method for this bacterium. WGS also allowed for the identification of genes associated with antibiotic resistance in all isolates, while no plasmid was detected. Sequencing of the 16S rRNA and gyrB genes both showed higher relative abundances of Serratia in environmental sampling sites that were in close contact with infected babies. Much lower relative abundances of Serratia were observed following disinfection of a room, indicating that the protocol used was efficient. Variations in the bacterial community composition and structure following room disinfection and between sampling sites were also identified through 16S rRNA gene sequencing. Globally, results from this study highlight the potential for next-generation sequencing tools to improve and facilitate outbreak investigation. Copyright © 2018 American Society for Microbiology.

  19. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID:25611823

  20. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  1. Draft Genome Sequence of Chryseobacterium sp. JV274 Isolated from Maize Rhizosphere

    PubMed Central

    Vacheron, Jordan; Dubost, Audrey; Chapulliot, David; Prigent-Combaret, Claire

    2017-01-01

    ABSTRACT We report the draft genome sequence of Chryseobacterium sp. JV274. This strain was isolated from the rhizosphere of maize during a greenhouse experiment. JV274 harbors genes involved in flexirubin production (darA and darB genes), bacterial competition (type VI secretion system), and gliding (bacterial motility; type IX secretion system). PMID:28408666

  2. Fight or flight? - Flight increases immune gene expression but does not help to fight an infection.

    PubMed

    Woestmann, L; Kvist, J; Saastamoinen, M

    2017-03-01

    Flight represents a key trait in most insects, being energetically extremely demanding, yet often necessary for foraging and reproduction. Additionally, dispersal via flight is especially important for species living in fragmented landscapes. Even though, based on life-history theory, a negative relationship may be expected between flight and immunity, a number of previous studies have indicated flight to induce an increased immune response. In this study, we assessed whether induced immunity (i.e. immune gene expression) in response to 15-min forced flight treatment impacts individual survival of bacterial infection in the Glanville fritillary butterfly (Melitaea cinxia). We were able to confirm previous findings of flight-induced immune gene expression, but still observed substantially stronger effects on both gene expression levels and life span due to bacterial infection compared to flight treatment. Even though gene expression levels of some immunity-related genes were elevated due to flight, these individuals did not show increased survival of bacterial infection, indicating that flight-induced immune activation does not completely protect them from the negative effects of bacterial infection. Finally, an interaction between flight and immune treatment indicated a potential trade-off: flight treatment increased immune gene expression in naïve individuals only, whereas in infected individuals no increase in immune gene expression was induced by flight. Our results suggest that the up-regulation of immune genes upon flight is based on a general stress response rather than reflecting an adaptive response to cope with potential infections during flight or in new habitats. © 2016 The Authors. Journal of Evolutionary Biology Published by John Wiley & Sons ltd on behalf of European Society for Evolutionary Biology.

  3. Patterns and architecture of genomic islands in marine bacteria

    PubMed Central

    2012-01-01

    Background Genomic Islands (GIs) have key roles since they modulate the structure and size of bacterial genomes displaying a diverse set of laterally transferred genes. Despite their importance, GIs in marine bacterial genomes have not been explored systematically to uncover possible trends and to analyze their putative ecological significance. Results We carried out a comprehensive analysis of GIs in 70 selected marine bacterial genomes detected with IslandViewer to explore the distribution, patterns and functional gene content in these genomic regions. We detected 438 GIs containing a total of 8152 genes. GI number per genome was strongly and positively correlated with the total GI size. In 50% of the genomes analyzed the GIs accounted for approximately 3% of the genome length, with a maximum of 12%. Interestingly, we found transposases particularly enriched within Alphaproteobacteria GIs, and site-specific recombinases in Gammaproteobacteria GIs. We described specific Homologous Recombination GIs (HR-GIs) in several genera of marine Bacteroidetes and in Shewanella strains among others. In these HR-GIs, we recurrently found conserved genes such as the β-subunit of DNA-directed RNA polymerase, regulatory sigma factors, the elongation factor Tu and ribosomal protein genes typically associated with the core genome. Conclusions Our results indicate that horizontal gene transfer mediated by phages, plasmids and other mobile genetic elements, and HR by site-specific recombinases play important roles in the mobility of clusters of genes between taxa and within closely related genomes, modulating the flexible pool of the genome. Our findings suggest that GIs may increase bacterial fitness under environmental changing conditions by acquiring novel foreign genes and/or modifying gene transcription and/or transduction. PMID:22839777

  4. The Human Transcriptome During Nontyphoid Salmonella and HIV Coinfection Reveals Attenuated NFκB-Mediated Inflammation and Persistent Cell Cycle Disruption

    PubMed Central

    Schreiber, Fernanda; Lynn, David J.; Houston, Angela; Peters, Joanna; Mwafulirwa, Gershom; Finlay, Brett B.; Brinkman, Fiona S. L.; Hancock, Robert E. W.; Heyderman, Robert S.; Dougan, Gordon

    2011-01-01

    Background. Invasive nontyphoid Salmonella (iNTS) disease is common and severe in adults with human immunodeficiency virus (HIV) infection in Africa. We previously observed that ex vivo macrophages from HIV-infected subjects challenged with Salmonella Typhimurium exhibit dysregulated proinflammatory cytokine responses. Methods. We studied the transcriptional response in whole blood from HIV-positive patients during acute and convalescent iNTS disease compared to other invasive bacterial diseases, and to HIV-positive and -negative controls. Results. During iNTS disease, there was a remarkable lack of a coordinated inflammatory or innate immune signaling response. Few interferon γ (IFNγ)--induced genes or Toll-like receptor/transcription factor nuclear factor κB (TLR/NFκB) gene pathways were upregulated in expression. Ex vivo lipopolysacharide (LPS) or flagellin stimulation of whole blood, however, showed that convalescent iNTS subjects and controls were competent to mount prominent TLR/NFκB-associated patterns of mRNA expression. In contrast, HIV-positive patients with other invasive bacterial infections (Escherichia coli and Streptococcus pneumoniae) displayed a pronounced proinflammatory innate immune transcriptional response. There was also upregulated mRNA expression in cell cycle, DNA replication, translation and repair, and viral replication pathways during iNTS. These patterns persisted for up to 2 months into convalescence. Conclusions. Attenuation of NFκB-mediated inflammation and dysregulation of cell cycle and DNA-function gene pathway expression are key features of the interplay between iNTS and HIV. PMID:21917897

  5. Genetically Engineered Virulent Phage Banks in the Detection and Control of Emergent Pathogenic Bacteria

    PubMed Central

    Blois, Hélène; Iris, François

    2010-01-01

    Natural outbreaks of multidrug-resistant microorganisms can cause widespread devastation, and several can be used or engineered as agents of bioterrorism. From a biosecurity standpoint, the capacity to detect and then efficiently control, within hours, the spread and the potential pathological effects of an emergent outbreak, for which there may be no effective antibiotics or vaccines, become key challenges that must be met. We turned to phage engineering as a potentially highly flexible and effective means to both detect and eradicate threats originating from emergent (uncharacterized) bacterial strains. To this end, we developed technologies allowing us to (1) concurrently modify multiple regions within the coding sequence of a gene while conserving intact the remainder of the gene, (2) reversibly interrupt the lytic cycle of an obligate virulent phage (T4) within its host, (3) carry out efficient insertion, by homologous recombination, of any number of engineered genes into the deactivated genomes of a T4 wild-type phage population, and (4) reactivate the lytic cycle, leading to the production of engineered infective virulent recombinant progeny. This allows the production of very large, genetically engineered lytic phage banks containing, in an E. coli host, a very wide spectrum of variants for any chosen phage-associated function, including phage host-range. Screening of such a bank should allow the rapid isolation of recombinant T4 particles capable of detecting (ie, diagnosing), infecting, and destroying hosts belonging to gram-negative bacterial species far removed from the original E. coli host. PMID:20569057

  6. Genomic features of bacterial adaptation to plants

    PubMed Central

    Levy, Asaf; Gonzalez, Isai Salas; Mittelviefhaus, Maximilian; Clingenpeel, Scott; Paredes, Sur Herrera; Miao, Jiamin; Wang, Kunru; Devescovi, Giulia; Stillman, Kyra; Monteiro, Freddy; Alvarez, Bryan Rangel; Lundberg, Derek S.; Lu, Tse-Yuan; Lebeis, Sarah; Jin, Zhao; McDonald, Meredith; Klein, Andrew P.; Feltcher, Meghan E.; del Rio, Tijana Glavina; Grant, Sarah R.; Doty, Sharon L.; Ley, Ruth E.; Zhao, Bingyu; Venturi, Vittorio; Pelletier, Dale A.; Vorholt, Julia A.; Tringe, Susannah G.; Woyke, Tanja; Dangl, Jeffery L.

    2017-01-01

    Plants intimately associate with diverse bacteria. Plant-associated (PA) bacteria have ostensibly evolved genes enabling adaptation to the plant environment. However, the identities of such genes are mostly unknown and their functions are poorly characterized. We sequenced 484 genomes of bacterial isolates from roots of Brassicaceae, poplar, and maize. We then compared 3837 bacterial genomes to identify thousands of PA gene clusters. Genomes of PA bacteria encode more carbohydrate metabolism functions and fewer mobile elements than related non-plant associated genomes. We experimentally validated candidates from two sets of PA genes, one involved in plant colonization, the other serving in microbe-microbe competition between PA bacteria. We also identified 64 PA protein domains that potentially mimic plant domains; some are shared with PA fungi and oomycetes. This work expands the genome-based understanding of plant-microbe interactions and provides leads for efficient and sustainable agriculture through microbiome engineering. PMID:29255260

  7. Yeast Kluyveromyces lactis as host for expression of the bacterial lipase: cloning and adaptation of the new lipase gene from Serratia sp.

    PubMed

    Šiekštelė, Rimantas; Veteikytė, Aušra; Tvaska, Bronius; Matijošytė, Inga

    2015-10-01

    Many microbial lipases have been successfully expressed in yeasts, but not in industrially attractive Kluyveromyces lactis, which among other benefits can be cultivated on a medium supplemented with whey--cheap and easily available industrial waste. A new bacterial lipase from Serratia sp. was isolated and for the first time expressed into the yeast Kluyveromyces lactis by heterologous protein expression system based on a strong promoter of Kluyveromyces marxianus triosephosphate isomerase gene and signal peptide of Kluyveromyces marxianus endopolygalacturonase gene. In addition, the bacterial lipase gene was synthesized de novo by taking into account a codon usage bias optimal for K. lactis and was expressed into the yeast K. lactis also. Both resulting strains were characterized by high output level of the target protein secreted extracellularly. Secreted lipases were characterized for activity and stability.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wagner, Maggie R.; Lundberg, Derek S.; del Rio, Tijana G.

    Bacteria living on and in leaves and roots influence many aspects of plant health, so the extent of a plant's genetic control over its microbiota is of great interest to crop breeders and evolutionary biologists. Laboratory-based studies, because they poorly simulate true environmental heterogeneity, may misestimate or totally miss the influence of certain host genes on the microbiome. Here we report a large-scale field experiment to disentangle the effects of genotype, environment, age and year of harvest on bacterial communities associated with leaves and roots of Boechera stricta (Brassicaceae), a perennial wild mustard. Host genetic control of the microbiome ismore » evident in leaves but not roots, and varies substantially among sites. Microbiome composition also shifts as plants age. Furthermore, a large proportion of leaf bacterial groups are shared with roots, suggesting inoculation from soil. Our results demonstrate how genotype-by-environment interactions contribute to the complexity of microbiome assembly in natural environments.« less

  9. Physicochemical control of bacterial and protist community composition and diversity in Antarctic sea ice.

    PubMed

    Torstensson, Anders; Dinasquet, Julie; Chierici, Melissa; Fransson, Agneta; Riemann, Lasse; Wulff, Angela

    2015-10-01

    Due to climate change, sea ice experiences changes in terms of extent and physical properties. In order to understand how sea ice microbial communities are affected by changes in physicochemical properties of the ice, we used 454-sequencing of 16S and 18S rRNA genes to examine environmental control of microbial diversity and composition in Antarctic sea ice. We observed a high diversity and richness of bacteria, which were strongly negatively correlated with temperature and positively with brine salinity. We suggest that bacterial diversity in sea ice is mainly controlled by physicochemical properties of the ice, such as temperature and salinity, and that sea ice bacterial communities are sensitive to seasonal and environmental changes. For the first time in Antarctic interior sea ice, we observed a strong eukaryotic dominance of the dinoflagellate phylotype SL163A10, comprising 63% of the total sequences. This phylotype is known to be kleptoplastic and could be a significant primary producer in sea ice. We conclude that mixotrophic flagellates may play a greater role in the sea ice microbial ecosystem than previously believed, and not only during the polar night but also during summer when potential food sources are abundant. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  10. Active bacterial community structure along vertical redox gradients in Baltic Sea sediment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jansson, Janet; Edlund, Anna; Hardeman, Fredrik

    Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities weremore » most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.« less

  11. Seasonal changes in bacterial communities associated with healthy and diseased Porites coral in southern Taiwan.

    PubMed

    Lin, Chorng-Horng; Chuang, Chih-Hsiang; Twan, Wen-Hung; Chiou, Shu-Fen; Wong, Tit-Yee; Liu, Jong-Kang; Kao, Chyuan-Yao; Kuo, Jimmy

    2016-12-01

    We compared the bacterial communities associated with healthy scleractinian coral Porites sp. with those associated with coral infected with pink spot syndrome harvested during summer and winter from waters off the coast of southern Taiwan. Members of the bacterial community associated with the coral were characterized by means of denaturing gradient gel electrophoresis (DGGE) of a short region of the 16S rRNA gene and clone library analysis. Of 5 different areas of the 16S rRNA gene, we demonstrated that the V3 hypervariable region is most suited to represent the coral-associated bacterial community. The DNA sequences of 26 distinct bands extracted from DGGE gels and 269 sequences of the 16S rRNA gene from clone libraries were determined. We found that the communities present in diseased coral were more heterogeneous than the bacterial communities of uninfected coral. In addition, bacterial communities associated with coral harvested in the summer were more diverse than those associated with coral collected in winter, regardless of the health status of the coral. Our study suggested that the compositions of coral-associated bacteria communities are complex, and the population of bacteria varies greatly between seasons and in coral of differing health status.

  12. Bacterial community succession during in situ uranium bioremediation: spatial similarities along controlled flow paths.

    PubMed

    Hwang, Chiachi; Wu, Weimin; Gentry, Terry J; Carley, Jack; Corbin, Gail A; Carroll, Sue L; Watson, David B; Jardine, Phil M; Zhou, Jizhong; Criddle, Craig S; Fields, Matthew W

    2009-01-01

    Bacterial community succession was investigated in a field-scale subsurface reactor formed by a series of wells that received weekly ethanol additions to re-circulating groundwater. Ethanol additions stimulated denitrification, metal reduction, sulfate reduction and U(VI) reduction to sparingly soluble U(IV). Clone libraries of SSU rRNA gene sequences from groundwater samples enabled tracking of spatial and temporal changes over a 1.5-year period. Analyses showed that the communities changed in a manner consistent with geochemical variations that occurred along temporal and spatial scales. Canonical correspondence analysis revealed that the levels of nitrate, uranium, sulfide, sulfate and ethanol were strongly correlated with particular bacterial populations. As sulfate and U(VI) levels declined, sequences representative of sulfate reducers and metal reducers were detected at high levels. Ultimately, sequences associated with sulfate-reducing populations predominated, and sulfate levels declined as U(VI) remained at low levels. When engineering controls were compared with the population variation through canonical ordination, changes could be related to dissolved oxygen control and ethanol addition. The data also indicated that the indigenous populations responded differently to stimulation for bioreduction; however, the two biostimulated communities became more similar after different transitions in an idiosyncratic manner. The strong associations between particular environmental variables and certain populations provide insight into the establishment of practical and successful remediation strategies in radionuclide-contaminated environments with respect to engineering controls and microbial ecology.

  13. Gut microbiota in Parkinson disease in a northern German cohort.

    PubMed

    Hopfner, Franziska; Künstner, Axel; Müller, Stefanie H; Künzel, Sven; Zeuner, Kirsten E; Margraf, Nils G; Deuschl, Günther; Baines, John F; Kuhlenbäumer, Gregor

    2017-07-15

    Pathologic and epidemiologic studies suggest that Parkinson disease (PD) may in some cases start in the enteric nervous system and spread via the vagal nerve to the brainstem. Mounting evidence suggests that the gut microbiome plays an important role in the communication between gut and brain and that alteration of the gut microbiome is involved in the pathogenesis of numerous diseases, including Parkinson disease. The aim of this study was to determine whether Parkinson disease is associated with qualitative or quantitative changes in the gut microbiome. We analyzed the gut microbiome in 29 PD cases and 29 age-matched controls by next-generation-sequencing of the 16S rRNA gene and compared diversity indices and bacterial abundances between cases and controls. Alpha diversity measures and the abundance of major phyla did not differ between cases and controls. Beta diversity analyses and analysis on the bacterial family level revealed significant differences between cases and controls for four bacterial families. In keeping with recently published studies, Lactobacillaceae were more abundant in cases. Barnesiellaceae and Enterococcacea were also more abundant in cases in this study but not in other studies. Larger studies, accounting for drug effects and further functional investigations of the gut microbiome are necessary to delineate the role of the gut microbiome in the pathogenesis of PD. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Features of the bronchial bacterial microbiome associated with atopy, asthma, and responsiveness to inhaled corticosteroid treatment.

    PubMed

    Durack, Juliana; Lynch, Susan V; Nariya, Snehal; Bhakta, Nirav R; Beigelman, Avraham; Castro, Mario; Dyer, Anne-Marie; Israel, Elliot; Kraft, Monica; Martin, Richard J; Mauger, David T; Rosenberg, Sharon R; Sharp-King, Tonya; White, Steven R; Woodruff, Prescott G; Avila, Pedro C; Denlinger, Loren C; Holguin, Fernando; Lazarus, Stephen C; Lugogo, Njira; Moore, Wendy C; Peters, Stephen P; Que, Loretta; Smith, Lewis J; Sorkness, Christine A; Wechsler, Michael E; Wenzel, Sally E; Boushey, Homer A; Huang, Yvonne J

    2017-07-01

    Compositional differences in the bronchial bacterial microbiota have been associated with asthma, but it remains unclear whether the findings are attributable to asthma, to aeroallergen sensitization, or to inhaled corticosteroid treatment. We sought to compare the bronchial bacterial microbiota in adults with steroid-naive atopic asthma, subjects with atopy but no asthma, and nonatopic healthy control subjects and to determine relationships of the bronchial microbiota to phenotypic features of asthma. Bacterial communities in protected bronchial brushings from 42 atopic asthmatic subjects, 21 subjects with atopy but no asthma, and 21 healthy control subjects were profiled by using 16S rRNA gene sequencing. Bacterial composition and community-level functions inferred from sequence profiles were analyzed for between-group differences. Associations with clinical and inflammatory variables were examined, including markers of type 2-related inflammation and change in airway hyperresponsiveness after 6 weeks of fluticasone treatment. The bronchial microbiome differed significantly among the 3 groups. Asthmatic subjects were uniquely enriched in members of the Haemophilus, Neisseria, Fusobacterium, and Porphyromonas species and the Sphingomonodaceae family and depleted in members of the Mogibacteriaceae family and Lactobacillales order. Asthma-associated differences in predicted bacterial functions included involvement of amino acid and short-chain fatty acid metabolism pathways. Subjects with type 2-high asthma harbored significantly lower bronchial bacterial burden. Distinct changes in specific microbiota members were seen after fluticasone treatment. Steroid responsiveness was linked to differences in baseline compositional and functional features of the bacterial microbiome. Even in subjects with mild steroid-naive asthma, differences in the bronchial microbiome are associated with immunologic and clinical features of the disease. The specific differences identified suggest possible microbiome targets for future approaches to asthma treatment or prevention. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  15. A Glycine Riboswitch in Streptococcus pyogenes Controls Expression of a Sodium:Alanine Symporter Family Protein Gene.

    PubMed

    Khani, Afsaneh; Popp, Nicole; Kreikemeyer, Bernd; Patenge, Nadja

    2018-01-01

    Regulatory RNAs play important roles in the control of bacterial gene expression. In this study, we investigated gene expression regulation by a putative glycine riboswitch located in the 5'-untranslated region of a sodium:alanine symporter family (SAF) protein gene in the group A Streptococcus pyogenes serotype M49 strain 591. Glycine-dependent gene expression mediated by riboswitch activity was studied using a luciferase reporter gene system. Maximal reporter gene expression was observed in the absence of glycine and in the presence of low glycine concentrations. Differences in glycine-dependent gene expression were not based on differential promoter activity. Expression of the SAF protein gene and the downstream putative cation efflux protein gene was investigated in wild-type bacteria by RT-qPCR transcript analyses. During growth in the presence of glycine (≥1 mM), expression of the genes were downregulated. Northern blot analyses revealed premature transcription termination in the presence of high glycine concentrations. Growth in the presence of 0.1 mM glycine led to the production of a full-length transcript. Furthermore, stability of the SAF protein gene transcript was drastically reduced in the presence of glycine. We conclude that the putative glycine riboswitch in S. pyogenes serotype M49 strain 591 represses expression of the SAF protein gene and the downstream putative cation efflux protein gene in the presence of high glycine concentrations. Sequence and secondary structure comparisons indicated that the streptococcal riboswitch belongs to the class of tandem aptamer glycine riboswitches.

  16. Isocitrate Lyase Is Essential for Pathogenicity of the Fungus Leptosphaeria maculans to Canola (Brassica napus)

    PubMed Central

    Idnurm, Alexander; Howlett, Barbara J.

    2002-01-01

    A pathogenicity gene has been identified in Leptosphaeria maculans, the ascomycetous fungus that causes blackleg disease of canola (Brassica napus). This gene encodes isocitrate lyase, a component of the glyoxylate cycle, and is essential for the successful colonization of B. napus. It was identified by a reverse genetics approach whereby a plasmid conferring hygromycin resistance was inserted randomly into the L. maculans genome. Twelve of 516 transformants tested had reduced pathogenicity on cotyledons of B. juncea and B. napus, and 1 of these 12 had a deletion of the isocitrate lyase gene, as well as an insertion of the hygromycin resistance gene. This mutant was unable to grow on fatty acids, including monolaurate, and the isocitrate lyase transcript was not detected. When the wild-type gene was reintroduced into the mutant, growth on monolaurate was restored and pathogenicity was partially restored. L. maculans isocitrate lyase is produced during infection of B. napus cotyledons, while the plant homologue is not. When 2.5% glucose was added to the inoculum of the isocitrate lyase mutant, lesions of sizes similar to those caused by wild-type isolate M1 developed on B. napus cotyledons. These findings suggest that the glyoxylate pathway is essential for disease development by this plant-pathogenic fungus, as has been shown recently for a fungal and bacterial pathogen of animals and a bacterial pathogen of plants. Involvement of the glyoxylate pathway in pathogenesis in animals and plants presents potential drug targets for control of diseases. PMID:12455691

  17. The Bacterial Communities of Full-Scale Biologically Active, Granular Activated Carbon Filters Are Stable and Diverse and Potentially Contain Novel Ammonia-Oxidizing Microorganisms

    PubMed Central

    Hope Wilkinson, Katheryn; Strait, Jacqueline M.; Hozalski, Raymond M.; Sadowksy, Michael J.; Hamilton, Matthew J.

    2015-01-01

    The bacterial community composition of the full-scale biologically active, granular activated carbon (BAC) filters operated at the St. Paul Regional Water Services (SPRWS) was investigated using Illumina MiSeq analysis of PCR-amplified 16S rRNA gene fragments. These bacterial communities were consistently diverse (Shannon index, >4.4; richness estimates, >1,500 unique operational taxonomic units [OTUs]) throughout the duration of the 12-month study period. In addition, only modest shifts in the quantities of individual bacterial populations were observed; of the 15 most prominent OTUs, the most highly variable population (a Variovorax sp.) modulated less than 13-fold over time and less than 8-fold from filter to filter. The most prominent population in the profiles was a Nitrospira sp., representing 13 to 21% of the community. Interestingly, very few of the known ammonia-oxidizing bacteria (AOB; <0.07%) and no ammonia-oxidizing Archaea were detected in the profiles. Quantitative PCR of amoA genes, however, suggested that AOB were prominent in the bacterial communities (amoA/16S rRNA gene ratio, 1 to 10%). We conclude, therefore, that the BAC filters at the SPRWS potentially contained significant numbers of unidentified and novel ammonia-oxidizing microorganisms that possess amoA genes similar to those of previously described AOB. PMID:26209671

  18. High-Resolution Melt Analysis for Rapid Comparison of Bacterial Community Compositions

    PubMed Central

    Hjelmsø, Mathis Hjort; Hansen, Lars Hestbjerg; Bælum, Jacob; Feld, Louise; Holben, William E.

    2014-01-01

    In the study of bacterial community composition, 16S rRNA gene amplicon sequencing is today among the preferred methods of analysis. The cost of nucleotide sequence analysis, including requisite computational and bioinformatic steps, however, takes up a large part of many research budgets. High-resolution melt (HRM) analysis is the study of the melt behavior of specific PCR products. Here we describe a novel high-throughput approach in which we used HRM analysis targeting the 16S rRNA gene to rapidly screen multiple complex samples for differences in bacterial community composition. We hypothesized that HRM analysis of amplified 16S rRNA genes from a soil ecosystem could be used as a screening tool to identify changes in bacterial community structure. This hypothesis was tested using a soil microcosm setup exposed to a total of six treatments representing different combinations of pesticide and fertilization treatments. The HRM analysis identified a shift in the bacterial community composition in two of the treatments, both including the soil fumigant Basamid GR. These results were confirmed with both denaturing gradient gel electrophoresis (DGGE) analysis and 454-based 16S rRNA gene amplicon sequencing. HRM analysis was shown to be a fast, high-throughput technique that can serve as an effective alternative to gel-based screening methods to monitor microbial community composition. PMID:24610853

  19. The Effects of a Probiotic Yeast on the Bacterial Diversity and Population Structure in the Rumen of Cattle

    PubMed Central

    Pinloche, Eric; McEwan, Neil; Marden, Jean-Philippe; Bayourthe, Corinne; Auclair, Eric; Newbold, C. Jamie

    2013-01-01

    It has been suggested that the ability of live yeast to improve milk yield and weight gain in cattle is because the yeast stimulates bacterial activity within the rumen. However it remains unclear if this is a general stimulation of all species or a specific stimulation of certain species. Here we characterised the change in the bacterial population within the rumen of cattle fed supplemental live yeast. Three cannulated lactating cows received a daily ration (24 kg/d) of corn silage (61% of DM), concentrates (30% of DM), dehydrated alfalfa (9% of DM) and a minerals and vitamins mix (1% of DM). The effect of yeast (BIOSAF SC 47, Lesaffre Feed Additives, France; 0.5 or 5 g/d) was compared to a control (no additive) in a 3×3 Latin square design. The variation in the rumen bacterial community between treatments was assessed using Serial Analysis of V1 Ribosomal Sequence Tag (SARST-V1) and 454 pyrosequencing based on analysis of the 16S rRNA gene. Compared to the control diet supplementation of probiotic yeast maintained a healthy fermentation in the rumen of lactating cattle (higher VFA concentration [high yeast dose only], higher rumen pH, and lower Eh and lactate). These improvements were accompanied with a shift in the main fibrolytic group (Fibrobacter and Ruminococcus) and lactate utilising bacteria (Megasphaera and Selenomonas). In addition we have shown that the analysis of short V1 region of 16s rRNA gene (50–60 bp) could give as much phylogenetic information as a longer read (454 pyrosequencing of 250 bp). This study also highlights the difficulty of drawing conclusions on composition and diversity of complex microbiota because of the variation caused by the use of different methods (sequencing technology and/or analysis). PMID:23844101

  20. Microbiome and Culture Based Analysis of Chronic Rhinosinusitis Compared to Healthy Sinus Mucosa.

    PubMed

    Koeller, Kerstin; Herlemann, Daniel P R; Schuldt, Tobias; Ovari, Attila; Guder, Ellen; Podbielski, Andreas; Kreikemeyer, Bernd; Olzowy, Bernhard

    2018-01-01

    The role of bacteria in chronic rhinosinusitis (CRS) is still not well understood. Whole microbiome analysis adds new aspects to our current understanding that is mainly based on isolated bacteria. It is still unclear how the results of microbiome analysis and the classical culture based approaches interrelate. To address this, middle meatus swabs and tissue samples were obtained during sinus surgery in 5 patients with CRS with nasal polyps (CRSwNP), 5 patients with diffuse CRS without nasal polyps (CRSsNP), 5 patients with unilateral purulent maxillary CRS (upm CRS) and 3 patients with healthy sinus mucosa. Swabs were cultured, and associated bacteria were identified. Additionally, parts of each tissue sample also underwent culture approaches, and in parallel DNA was extracted for 16S rRNA gene amplicon-based microbiome analysis. From tissue samples 4.2 ± 1.2 distinct species per patient were cultured, from swabs 5.4 ± 1.6. The most frequently cultured species from the swabs were Propionibacterium acnes, Staphylococcus epidermidis, Corynebacterium spp. and Staphylococcus aureus . The 16S-RNA gene analysis revealed no clear differentiation of the bacterial community of healthy compared to CRS samples of unilateral purulent maxillary CRS and CRSwNP. However, the bacterial community of CRSsNP differed significantly from the healthy controls. In the CRSsNP samples Flavobacterium, Pseudomonas, Pedobacter, Porphyromonas, Stenotrophomonas , and Brevundimonas were significantly enriched compared to the healthy controls. Species isolated from culture did not generally correspond with the most abundant genera in microbiome analysis. Only Fusobacteria, Parvimonas , and Prevotella found in 2 unilateral purulent maxillary CRS samples by the cultivation dependent approach were also found in the cultivation independent approach in high abundance, suggesting a classic infectious pathogenesis of odontogenic origin in these two specific cases. Alterations of the bacterial community might be a more crucial factor for the development of CRSsNP compared to CRSwNP. Further studies are needed to investigate the relation between bacterial community characteristics and the development of CRSsNP.

Top