Combined copper/zinc attachment to prion protein

NASA Astrophysics Data System (ADS)

Hodak, Miroslav; Bernholc, Jerry

2013-03-01

Misfolding of prion protein (PrP) is responsible for diseases such as ``mad-cow disease'' in cattle and Creutzfeldt-Jacob in humans. Extensive experimental investigation has established that this protein strongly interacts with copper ions, and this ability has been linked to its still unknown function. Attachment of other metal ions (zinc, iron, manganese) have been demonstrated as well, but none of them could outcompete copper. Recent finding, however, indicates that at intermediate concentrations both copper and zinc ions can attach to the PrP at the octarepeat region, which contains high affinity metal binding sites. Based on this evidence, we have performed density functional theory simulations to investigate the combined Cu/Zn attachment. We consider all previously reported binding modes of copper at the octarepeat region and examine a possibility simultaneous Cu/Zn attachment. We find that this can indeed occur for only one of the known binding sites, when copper changes its coordination mode to allow for attachment of zinc ion. The implications of the simultaneous attachment on neural function remain to be explored.

The Lumenal Loop Met672–Pro707 of Copper-transporting ATPase ATP7A Binds Metals and Facilitates Copper Release from the Intramembrane Sites*

PubMed Central

Barry, Amanda N.; Otoikhian, Adenike; Bhatt, Sujata; Shinde, Ujwal; Tsivkovskii, Ruslan; Blackburn, Ninian J.; Lutsenko, Svetlana

2011-01-01

The copper-transporting ATPase ATP7A has an essential role in human physiology. ATP7A transfers the copper cofactor to metalloenzymes within the secretory pathway; inactivation of ATP7A results in an untreatable neurodegenerative disorder, Menkes disease. Presently, the mechanism of ATP7A-mediated copper release into the secretory pathway is not understood. We demonstrate that the characteristic His/Met-rich segment Met672–Pro707 (HM-loop) that connects the first two transmembrane segments of ATP7A is important for copper release. Mutations within this loop do not prevent the ability of ATP7A to form a phosphorylated intermediate during ATP hydrolysis but inhibit subsequent dephosphorylation, a step associated with copper release. The HM-loop inserted into a scaffold protein forms two structurally distinct binding sites and coordinates copper in a mixed His-Met environment with an ∼2:1 stoichiometry. Binding of either copper or silver, a Cu(I) analog, induces structural changes in the loop. Mutations of 4 Met residues to Ile or two His-His pairs to Ala-Gly decrease affinity for copper. Altogether, the data suggest a two-step process, where copper released from the transport sites binds to the first His(Met)2 site, triggering a structural change and binding to a second 2-coordinate His-His or His-Met site. We also show that copper binding within the HM-loop stabilizes Cu(I) and protects it from oxidation, which may further aid the transfer of copper from ATP7A to acceptor proteins. The mechanism of copper entry into the secretory pathway is discussed. PMID:21646353

3D local structure around copper site of rabbit prion-related protein: Quantitative determination by XANES spectroscopy combined with multiple-scattering calculations

NASA Astrophysics Data System (ADS)

Cui, P. X.; Lian, F. L.; Wang, Y.; Wen, Yi; Chu, W. S.; Zhao, H. F.; Zhang, S.; Li, J.; Lin, D. H.; Wu, Z. Y.

2014-02-01

Prion-related protein (PrP), a cell-surface copper-binding glycoprotein, is considered to be responsible for a number of transmissible spongiform encephalopathies (TSEs). The structural conversion of PrP from the normal cellular isoform (PrPC) to the post-translationally modified form (PrPSc) is thought to be relevant to Cu2+ binding to histidine residues. Rabbits are one of the few mammalian species that appear to be resistant to TSEs, because of the structural characteristics of the rabbit prion protein (RaPrPC) itself. Here we determined the three-dimensional local structure around the C-terminal high-affinity copper-binding sites using X-ray absorption near-edge structure combined with ab initio calculations in the framework of the multiple-scattering (MS) theory. Result shows that two amino acid resides, Gln97 and Met108, and two histidine residues, His95 and His110, are involved in binding this copper(II) ion. It might help us understand the roles of copper in prion conformation conversions, and the molecular mechanisms of prion-involved diseases.

Characterization of calcineurin-dependent response element binding protein and its involvement in copper-metallothionein gene expression in Neurospora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Kalari Satish; Ravi Kumar, B.; Siddavattam, Dayananda

2006-07-07

In continuation of our recent observations indicating the presence of a lone calcineurin-dependent response element (CDRE) in the -3730 bp upstream region of copper-induced metallothionein (CuMT) gene of Neurospora [K.S. Kumar, S. Dayananda, C. Subramanyam, Copper alone, but not oxidative stress, induces copper-metallothionein gene in Neurospora crassa, FEMS Microbiol. Lett. 242 (2005) 45-50], we isolated and characterized the CDRE-binding protein. The cloned upstream region of CuMT gene was used as the template to specifically amplify CDRE element, which was immobilized on CNBr-activated Sepharose 4B for use as the affinity matrix to purify the CDRE binding protein from nuclear extracts obtainedmore » from Neurospora cultures grown in presence of copper. Two-dimensional gel electrophoresis of the affinity purified protein revealed the presence of a single 17 kDa protein, which was identified and characterized by MALDI-TOF. Peptide mass finger printing of tryptic digests and analysis of the 17 kDa protein matched with the regulatory {beta}-subunit of calcineurin (Ca{sup 2+}-calmodulin dependent protein phosphatase). Parallel identification of nuclear localization signals in this protein by in silico analysis suggests a putative role for calcineurin in the regulation of CuMT gene expression.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gough, Mallory, E-mail: m.gough1@lancaster.ac.uk; Blanthorn-Hazell, Sophee, E-mail: s.blanthorn-hazell@lancaster.ac.uk; Delury, Craig, E-mail: c.delury@lancaster.ac.uk

Highlights: • Copper levels are elevated in the tumour microenvironment. • APP mitigates copper-induced growth inhibition of DU145 prostate cancer (PCa) cells. • The APP intracellular domain is a prerequisite; soluble forms have no effect. • The E1 CuBD of APP is also a prerequisite. • APP copper binding potentially mitigates copper-induced PCa cell growth inhibition. - Abstract: Copper plays an important role in the aetiology and growth of tumours and levels of the metal are increased in the serum and tumour tissue of patients affected by a range of cancers including prostate cancer (PCa). The molecular mechanisms that enablemore » cancer cells to proliferate in the presence of elevated copper levels are, therefore, of key importance in our understanding of tumour growth progression. In the current study, we have examined the role played by the amyloid precursor protein (APP) in mitigating copper-induced growth inhibition of the PCa cell line, DU145. A range of APP molecular constructs were stably over-expressed in DU145 cells and their effects on cell proliferation in the presence of copper were monitored. Our results show that endogenous APP expression was induced by sub-toxic copper concentrations in DU145 cells and over-expression of the wild-type protein was able to mitigate copper-induced growth inhibition via a mechanism involving the cytosolic and E1 copper binding domains of the full-length protein. APP likely represents one of a range of copper binding proteins that PCa cells employ in order to ensure efficient proliferation despite elevated concentrations of the metal within the tumour microenvironment. Targeting the expression of such proteins may contribute to therapeutic strategies for the treatment of cancers.« less

Biochemical characterization of P-type copper ATPases

PubMed Central

Inesi, Giuseppe; Pilankatta, Rajendra; Tadini-Buoninsegni, Francesco

2014-01-01

Copper ATPases, in analogy with other members of the P-ATPase superfamily, contain a catalytic headpiece including an aspartate residue reacting with ATP to form a phosphoenzyme intermediate, and transmembrane helices containing cation-binding sites [TMBS (transmembrane metal-binding sites)] for catalytic activation and cation translocation. Following phosphoenzyme formation by utilization of ATP, bound copper undergoes displacement from the TMBS to the lumenal membrane surface, with no H+ exchange. Although PII-type ATPases sustain active transport of alkali/alkali-earth ions (i.e. Na+, Ca2+) against electrochemical gradients across defined membranes, PIB-type ATPases transfer transition metal ions (i.e. Cu+) from delivery to acceptor proteins and, prominently in mammalian cells, undergo trafficking from/to various membrane compartments. A specific component of copper ATPases is the NMBD (N-terminal metal-binding domain), containing up to six copper-binding sites in mammalian (ATP7A and ATP7B) enzymes. Copper occupancy of NMBD sites and interaction with the ATPase headpiece are required for catalytic activation. Furthermore, in the presence of copper, the NMBD allows interaction with protein kinase D, yielding phosphorylation of serine residues, ATP7B trafficking and protection from proteasome degradation. A specific feature of ATP7A is glycosylation and stabilization on plasma membranes. Cisplatin, a platinum-containing anti-cancer drug, binds to copper sites of ATP7A and ATP7B, and undergoes vectorial displacement in analogy with copper. PMID:25242165

[Structure-functional organization of eukaryotic high-affinity copper importer CTR1 determines its ability to transport copper, silver and cisplatin].

PubMed

Skvortsov, A N; Zatulovskiĭ, E A; Puchkova, L V

2012-01-01

It was shown recently, that high affinity Cu(I) importer eukaryotic protein CTR1 can also transport in vitro abiogenic Ag(I) ions and anticancer drug cisplatin. At present there is no rational explanation how CTR1 can transfer platinum group, which is different by coordination properties from highly similar Cu(I) and Ag(I). To understand this phenomenon we analyzed 25 sequences of chordate CTR1 proteins, and found out conserved patterns of organization of N-terminal extracellular part of CTR1 which correspond to initial metal binding. Extracellular copper-binding motifs were qualified by their coordination properties. It was shown that relative position of Met- and His-rich copper-binding motifs in CTR1 predisposes the extracellular CTR1 part to binding of copper, silver and cisplatin. Relation between tissue-specific expression of CTR1 gene, steady-state copper concentration, and silver and platinum accumulation in organs of mice in vivo was analyzed. Significant positive but incomplete correlation exists between these variables. Basing on structural and functional peculiarities of N-terminal part of CTR1 a hypothesis of coupled transport of copper and cisplatin has been suggested, which avoids the disagreement between CTR1-mediated cisplatin transport in vitro, and irreversible binding of platinum to Met-rich peptides.

Regulation of the copper chaperone CCS by XIAP-mediated ubiquitination.

PubMed

Brady, Graham F; Galbán, Stefanie; Liu, Xuwen; Basrur, Venkatesha; Gitlin, Jonathan D; Elenitoba-Johnson, Kojo S J; Wilson, Thomas E; Duckett, Colin S

2010-04-01

In order to balance the cellular requirements for copper with its toxic properties, an elegant set of mechanisms has evolved to regulate and buffer intracellular copper. The X-linked inhibitor of apoptosis (XIAP) protein was recently identified as a copper-binding protein and regulator of copper homeostasis, although the mechanism by which XIAP binds copper in the cytosol is unclear. Here we describe the identification of the copper chaperone for superoxide dismutase (CCS) as a mediator of copper delivery to XIAP in cells. We also find that CCS is a target of the E3 ubiquitin ligase activity of XIAP, although interestingly, ubiquitination of CCS by XIAP was found to lead to enhancement of its chaperone activity toward its physiologic target, superoxide dismutase 1, rather than proteasomal degradation. Collectively, our results reveal novel links among apoptosis, copper metabolism, and redox regulation through the XIAP-CCS complex.

Copper and the Prion Protein: Methods, Structures, Function, and Disease

NASA Astrophysics Data System (ADS)

Millhauser, Glenn L.

2007-05-01

The transmissible spongiform encephalopathies (TSEs) arise from conversion of the membrane-bound prion protein from PrPC to PrPSc. Examples of the TSEs include mad cow disease, chronic wasting disease in deer and elk, scrapie in goats and sheep, and kuru and Creutzfeldt-Jakob disease in humans. Although the precise function of PrPC in healthy tissues is not known, recent research demonstrates that it binds Cu(II) in an unusual and highly conserved region of the protein termed the octarepeat domain. This review describes recent connections between copper and PrPC, with an emphasis on the electron paramagnetic resonance elucidation of the specific copper-binding sites, insights into PrPC function, and emerging connections between copper and prion disease.

Specific labeling of zinc finger proteins using noncanonical amino acids and copper-free click chemistry.

PubMed

Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A; Schroeder, Charles M

2012-09-19

Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays, and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry.

Specific Labeling of Zinc Finger Proteins using Non-canonical Amino Acids and Copper-free Click Chemistry

PubMed Central

Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A.

2012-01-01

Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry. PMID:22871171

An Expanding Range of Functions for the Copper Chaperone/Antioxidant Protein Atox1

PubMed Central

Hatori, Yuta

2013-01-01

Abstract Significance: Antioxidant protein 1 (Atox1 in human cells) is a copper chaperone for the copper export pathway with an essential role in cellular copper distribution. In vitro, Atox1 binds and transfers copper to the copper-transporting ATPases, stimulating their catalytic activity. Inactivation of Atox1 in cells inhibits maturation of secreted cuproenzymes as well as copper export from cells. Recent Advances: Accumulating data suggest that cellular functions of Atox1 are not limited to its copper-trafficking role and may include storage of labile copper, modulation of transcription, and antioxidant defense. The conserved metal binding site of Atox1, CxGC, differs from the metal-binding sites of copper-transporting ATPases and has a physiologically relevant redox potential that equilibrates with the GSH:GSSG pair. Critical Issues: Tight relationship appears to exist between intracellular copper levels and glutathione (GSH) homeostasis. The biochemical properties of Atox1 place it at the intersection of cellular networks that regulate copper distribution and cellular redox balance. Mechanisms through which Atox1 facilitates copper export and contributes to oxidative defense are not fully understood. Future Directions: The current picture of cellular redox homeostasis and copper physiology will be enhanced by further mechanistic studies of functional interactions between the GSH:GSSG pair and copper-trafficking machinery. Antioxid. Redox Signal. 19, 945–957. PMID:23249252

CopM is a novel copper-binding protein involved in copper resistance in Synechocystis sp. PCC 6803.

PubMed

Giner-Lamia, Joaquín; López-Maury, Luis; Florencio, Francisco J

2015-02-01

Copper resistance system in the cyanobacterium Synechocystis sp. PCC 6803 comprises two operons, copMRS and copBAC, which are expressed in response to copper in the media. copBAC codes for a heavy-metal efflux-resistance nodulation and division (HME-RND) system, while copMRS codes for a protein of unknown function, CopM, and a two-component system CopRS, which controls the expression of these two operons. Here, we report that CopM is a periplasmic protein able to bind Cu(I) with high affinity (KD ~3 × 10(-16) ). Mutants lacking copM showed a sensitive copper phenotype similar to mutants affected in copB, but lower than mutants of the two-component system CopRS, suggesting that CopBAC and CopM constitute two independent resistance mechanisms. Moreover, constitutive expression of copM is able to partially suppress the copper sensitivity of the copR mutant strain, pointing out that CopM per se is able to confer copper resistance. Furthermore, constitutive expression of copM was able to reduce total cellular copper content of the copR mutant to the levels determined in the wild-type (WT) strain. Finally, CopM was localized not only in the periplasm but also in the extracellular space, suggesting that CopM can also prevent copper accumulation probably by direct copper binding outside the cell. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

CopM is a novel copper-binding protein involved in copper resistance in Synechocystis sp. PCC 6803

PubMed Central

Giner-Lamia, Joaquín; López-Maury, Luis; Florencio, Francisco J

2015-01-01

Copper resistance system in the cyanobacterium Synechocystis sp. PCC 6803 comprises two operons, copMRS and copBAC, which are expressed in response to copper in the media. copBAC codes for a heavy-metal efflux–resistance nodulation and division (HME-RND) system, while copMRS codes for a protein of unknown function, CopM, and a two-component system CopRS, which controls the expression of these two operons. Here, we report that CopM is a periplasmic protein able to bind Cu(I) with high affinity (KD ∼3 × 10−16). Mutants lacking copM showed a sensitive copper phenotype similar to mutants affected in copB, but lower than mutants of the two-component system CopRS, suggesting that CopBAC and CopM constitute two independent resistance mechanisms. Moreover, constitutive expression of copM is able to partially suppress the copper sensitivity of the copR mutant strain, pointing out that CopM per se is able to confer copper resistance. Furthermore, constitutive expression of copM was able to reduce total cellular copper content of the copR mutant to the levels determined in the wild-type (WT) strain. Finally, CopM was localized not only in the periplasm but also in the extracellular space, suggesting that CopM can also prevent copper accumulation probably by direct copper binding outside the cell. PMID:25545960

Direct Measurement of the Nanomechanical Stability of a Redox Protein Active Site and Its Dependence upon Metal Binding.

PubMed

Giannotti, Marina I; Cabeza de Vaca, Israel; Artés, Juan M; Sanz, Fausto; Guallar, Victor; Gorostiza, Pau

2015-09-10

The structural basis of the low reorganization energy of cupredoxins has long been debated. These proteins reconcile a conformationally heterogeneous and exposed metal-chelating site with the highly rigid copper center required for efficient electron transfer. Here we combine single-molecule mechanical unfolding experiments with statistical analysis and computer simulations to show that the metal-binding region of apo-azurin is mechanically flexible and that high mechanical stability is imparted by copper binding. The unfolding pathway of the metal site depends on the pulling residue and suggests that partial unfolding of the metal-binding site could be facilitated by the physical interaction with certain regions of the redox protein.

Using Tryptophan Mutants To Probe the Structural and Functional Status of BsSCO, a Copper Binding, Cytochrome c Oxidase Assembly Protein from Bacillus subtilis.

PubMed

Hussain, Shina; Andrews, Diann; Hill, Bruce C

2017-12-05

The synthesis of cytochrome c oxidase protein from Bacillus subtilis (i.e., BsSCO) binds copper with picomolar affinity, which increases the protein's melting temperature (i.e., T M ) by 20 °C. Here two native tryptophans (i.e., W36 and W101) are identified as major contributors to BsSCO's structural form, and their contributions to the stability, intrinsic fluorescence, and copper binding properties of BsSCO are explored. Single mutations of tryptophan to phenylalanine decrease the T M by 10 °C and the folding free energy by 3-4 kcal/mol. A more severe change to alanine (i.e., W36A BsSCO) decreases the T M by 20 °C and the stability by 9 kcal/mol. However, these mutants bind copper with high affinity and assemble cytochrome c oxidase in vivo. Replacing phenylalanine at a position near (∼5 Å) the copper binding site with tryptophan (i.e., F42W) increases the T M of apo-BsSCO by 3 °C but diminishes the effect of copper binding. When both native tryptophans are changed to alanine, apo-BsSCO is unfolded in vitro and is not functional in cytochrome c oxidase assembly in vivo. A double-mutant of BsSCO in which W36A is combined with F42W exhibits a form of metastability. Apo-W36A/F42W BsSCO melts at 37 °C, which upon binding of copper shifts to 65 °C. B. subtilis expressing W36A/F42W BsSCO and grown at 37 °C does not assemble cytochrome c oxidase. However, when these cells are cooled to 25 °C, cytochrome c oxidase activity is recovered. Our results illustrate the subtle relationship between the structural stability and functional properties of BsSCO in the assembly of cytochrome c oxidase.

Serial changes in selected serum constituents in low birth weight infants on peripheral parenteral nutrition with different zinc and copper supplements.

PubMed

Lockitch, G; Pendray, M R; Godolphin, W J; Quigley, G

1985-07-01

One hundred and five infants of birth weight 2000 g or less who received peripherally administered parenteral nutrition for periods of three or more weeks, were randomly assigned to groups receiving different amounts of zinc and copper supplement. The blood concentrations of zinc, copper, retinol-binding protein, prealbumin, alkaline phosphatase and aspartate transaminase were followed weekly. Mean serum zinc, retinol-binding protein and prealbumin declined significantly over time while alkaline phosphatase rose. Only the group receiving the highest zinc supplement maintained a mean serum zinc concentration within the normal range at seven weeks. No difference in the protein or enzyme concentrations was found between the different zinc supplement groups. No difference was seen in serum copper or ceruloplasmin between copper dose groups although one intravenous supplement was double that of the other.

Molecular dynamics simulations of apocupredoxins: insights into the formation and stabilization of copper sites under entatic control.

PubMed

Abriata, Luciano A; Vila, Alejandro J; Dal Peraro, Matteo

2014-06-01

Cupredoxins perform copper-mediated long-range electron transfer (ET) in biological systems. Their copper-binding sites have evolved to force copper ions into ET-competent systems with decreased reorganization energy, increased reduction potential, and a distinct electronic structure compared with those of non-ET-competent copper complexes. The entatic or rack-induced state hypothesis explains these special properties in terms of the strain that the protein matrix exerts on the metal ions. This idea is supported by X-ray structures of apocupredoxins displaying "closed" arrangements of the copper ligands like those observed in the holoproteins; however, it implies completely buried copper-binding atoms, conflicting with the notion that they must be exposed for copper loading. On the other hand, a recent work based on NMR showed that the copper-binding regions of apocupredoxins are flexible in solution. We have explored five cupredoxins in their "closed" apo forms through molecular dynamics simulations. We observed that prearranged ligand conformations are not stable as the X-ray data suggest, although they do form part of the dynamic landscape of the apoproteins. This translates into variable flexibility of the copper-binding regions within a rigid fold, accompanied by fluctuations of the hydrogen bonds around the copper ligands. Major conformations with solvent-exposed copper-binding atoms could allow initial binding of the copper ions. An eventual subsequent incursion to the closed state would result in binding of the remaining ligands, trapping the closed conformation thanks to the additional binding energy and the fastening of noncovalent interactions that make up the rack.

Unfolding pathway of CotA-laccase and the role of copper on the prevention of refolding through aggregation of the unfolded state

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fernandes, Andre T.; Lopes, Carlos; Martins, Ligia O.

2012-06-08

Highlights: Black-Right-Pointing-Pointer CotA-laccase unfolds with an intermediate state. Black-Right-Pointing-Pointer Copper stabilizes the native and the intermediate state. Black-Right-Pointing-Pointer Copper binding to the unfolded state prevents refolding through protein aggregation. Black-Right-Pointing-Pointer Copper incorporation in CotA-laccase occurs as a later step during folding. -- Abstract: Copper is a redox-active metal and the main player in electron transfer reactions occurring in multicopper oxidases. The role of copper in the unfolding pathway and refolding of the multicopper oxidase CotA laccase in vitro was solved using double-jump stopped-flow experiments. Unfolding of apo- and holo-CotA was described as a three-state process with accumulation of an intermediatemore » in between the native and unfolded state. Copper stabilizes the native holo-CotA but also the intermediate state showing that copper is still bound to this state. Also, copper binds to unfolded holo-CotA in a non-native coordination promoting CotA aggregation and preventing refolding to the native structure. These results gather information on unfolding/folding pathways of multicopper oxidases and show that copper incorporation in vivo should be a tight controlled process as copper binding to the unfolded state under native conditions promotes protein aggregation.« less

Transport and intracellular distribution of copper in a human hepatoblastoma cell line, HepG2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stockert, R.J.; Grushoff, P.S.; Morell, A.G.

1986-01-01

The uptake of radiocopper by HepG2 cells is a saturable, temperature-dependent and cellular energy-independent process with a Vmax of 7.1 +/- 0.2 pmoles min-1 mg protein-1 and an estimated Km of 3.3 +/- 0.5 microM. The rate of copper uptake is reduced at an equimolar concentration of albumin and is unaffected by zinc at a 10-fold molar excess. Approximately 70% of the newly incorporated radiocopper binds to membranes and organelles, while 30% is recovered in the cytosol. The soluble fraction can be resolved into two copper-binding protein peaks. Incubation of HepG2 with nonisotopic copper results in displacement of radiocopper associatedmore » with the proteins contained in the lower molecular weight peak. Exposure of the cells to cycloheximide inhibits the incorporation of the isotope into this fraction.« less

Molecular Features of the Copper Binding Sites in the Octarepeat Domain of the Prion Protein†

PubMed Central

Burns, Colin S.; Aronoff-Spencer, Eliah; Dunham, Christine M.; Lario, Paula; Avdievich, Nikolai I.; Antholine, William E.; Olmstead, Marilyn M.; Vrielink, Alice; Gerfen, Gary J.; Peisach, Jack; Scott, William G.; Millhauser, Glenn L.

2010-01-01

Recent evidence suggests that the prion protein (PrP) is a copper binding protein. The N-terminal region of human PrP contains four sequential copies of the highly conserved octarepeat sequence PHGGGWGQ spanning residues 60–91. This region selectively binds Cu2+ in vivo. In a previous study using peptide design, EPR, and CD spectroscopy, we showed that the HGGGW segment within each octarepeat comprises the fundamental Cu2+ binding unit [Aronoff-Spencer et al. (2000) Biochemistry 40, 13760–13771]. Here we present the first atomic resolution view of the copper binding site within an octarepeat. The crystal structure of HGGGW in a complex with Cu2+ reveals equatorial coordination by the histidine imidazole, two deprotonated glycine amides, and a glycine carbonyl, along with an axial water bridging to the Trp indole. Companion S-band EPR, X-band ESEEM, and HYSCORE experiments performed on a library of 15N-labeled peptides indicate that the structure of the copper binding site in HGGGW and PHGGGWGQ in solution is consistent with that of the crystal structure. Moreover, EPR performed on PrP(23–28, 57–91) and an 15N-labeled analogue demonstrates that the identified structure is maintained in the full PrP octarepeat domain. It has been shown that copper stimulates PrP endocytosis. The identified Gly–Cu linkage is unstable below pH ≈6.5 and thus suggests a pH-dependent molecular mechanism by which PrP detects Cu2+ in the extracellular matrix or releases PrP-bound Cu2+ within the endosome. The structure also reveals an unusual complementary interaction between copper-structured HGGGW units that may facilitate molecular recognition between prion proteins, thereby suggesting a mechanism for transmembrane signaling and perhaps conversion to the pathogenic form. PMID:11900542

Cu(I)-mediated Allosteric Switching in a Copper-sensing Operon Repressor (CsoR)*

PubMed Central

Chang, Feng-Ming James; Coyne, H. Jerome; Cubillas, Ciro; Vinuesa, Pablo; Fang, Xianyang; Ma, Zhen; Ma, Dejian; Helmann, John D.; García-de los Santos, Alejandro; Wang, Yun-Xing; Dann, Charles E.; Giedroc, David P.

2014-01-01

The copper-sensing operon repressor (CsoR) is representative of a major Cu(I)-sensing family of bacterial metalloregulatory proteins that has evolved to prevent cytoplasmic copper toxicity. It is unknown how Cu(I) binding to tetrameric CsoRs mediates transcriptional derepression of copper resistance genes. A phylogenetic analysis of 227 DUF156 protein members, including biochemically or structurally characterized CsoR/RcnR repressors, reveals that Geobacillus thermodenitrificans (Gt) CsoR characterized here is representative of CsoRs from pathogenic bacilli Listeria monocytogenes and Bacillus anthracis. The 2.56 Å structure of Cu(I)-bound Gt CsoR reveals that Cu(I) binding induces a kink in the α2-helix between two conserved copper-ligating residues and folds an N-terminal tail (residues 12–19) over the Cu(I) binding site. NMR studies of Gt CsoR reveal that this tail is flexible in the apo-state with these dynamics quenched upon Cu(I) binding. Small angle x-ray scattering experiments on an N-terminally truncated Gt CsoR (Δ2–10) reveal that the Cu(I)-bound tetramer is hydrodynamically more compact than is the apo-state. The implications of these findings for the allosteric mechanisms of other CsoR/RcnR repressors are discussed. PMID:24831014

Characterization of the recombinant copper chaperone (CCS) from the plant Glycine (G.) max.

PubMed

Sagasti, Sara; Yruela, Inmaculada; Bernal, Maria; Lujan, Maria A; Frago, Susana; Medina, Milagros; Picorel, Rafael

2011-02-01

The goal of the present work was to characterize the recombinant copper chaperone (CCS) from soybean. Very little is known about plant copper chaperones, which makes this study of current interest, and allows for a comparison with the better known homologues from yeast and humans. To obtain sizeable amounts of pure protein suitable for spectroscopic characterization, we cloned and overexpressed the G. max CCS chaperone in E. coli in the presence of 0.5 mM CuSO(4) and 0.5 mM ZnSO(4) in the broth. A pure protein preparation was obtained by using two IMAC steps and pH gradient chromatography. Most of the proteins were obtained as apo-form, devoid of copper atoms. The chaperone showed a high content (i.e., over 40%) of loops, turns and random coil as determined both by circular dichroism and homology modelling. The homology 3-D structural model suggests the protein might fold in three structural protein domains. The 3-D model along with the primary structure and spectroscopic data may suggest that copper atoms occupy the two metal binding sites, MKCEGC and CTC, within the N-terminal domain I and C-terminal domain III, respectively. But only one Zn-binding site was obtained spectroscopically.

Evidence for involvement of the C-terminal domain in the dimerization of the CopY repressor protein from Enterococcus hirae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pazehoski, Kristina O., E-mail: pazehosk@pitt.edu; Cobine, Paul A., E-mail: pac0006@auburn.edu; Winzor, Donald J.

2011-03-11

Research highlights: {yields} A metal-binding protein domain is directly involved in protein dimerization. {yields} Fusing the metal-binding domain to a monomeric protein induces dimerization. {yields} Frontal size-exclusion chromatography measures the strength of dimer interaction. {yields} Ultracentrifugation studies confirm the influence of metal binding on dimerization. -- Abstract: Metal binding to the C-terminal region of the copper-responsive repressor protein CopY is responsible for homodimerization and the regulation of the copper homeostasis pathway in Enterococcus hirae. Specific involvement of the 38 C-terminal residues of CopY in dimerization is indicated by zonal and frontal (large zone) size-exclusion chromatography studies. The studies demonstrate thatmore » the attachment of these CopY residues to the immunoglobulin-binding domain of streptococcal protein G (GB1) promotes dimerization of the monomeric protein. Although sensitivity of dimerization to removal of metal from the fusion protein is smaller than that found for CopY (as measured by ultracentrifugation studies), the demonstration that an unrelated protein (GB1) can be induced to dimerize by extending its sequence with the C-terminal portion of CopY confirms the involvement of this region in CopY homodimerization.« less

Copper Coordination in the Full-Length, Recombinant Prion Protein†

PubMed Central

Burns, Colin S.; Aronoff-Spencer, Eliah; Legname, Giuseppe; Prusiner, Stanley B.; Antholine, William E.; Gerfen, Gary J.; Peisach, Jack; Millhauser, Glenn L.

2010-01-01

The prion protein (PrP) binds divalent copper at physiologically relevant conditions and is believed to participate in copper regulation or act as a copper-dependent enzyme. Ongoing studies aim at determining the molecular features of the copper binding sites. The emerging consensus is that most copper binds in the octarepeat domain, which is composed of four or more copies of the fundamental sequence PHGGGWGQ. Previous work from our laboratory using PrP-derived peptides, in conjunction with EPR and X-ray crystallography, demonstrated that the HGGGW segment constitutes the fundamental binding unit in the octarepeat domain [Burns et al. (2002) Biochemistry 41, 3991–4001; Aronoff-Spencer et al. (2000) Biochemistry 39, 13760–13771]. Copper coordination arises from the His imidazole and sequential deprotonated glycine amides. In this present work, recombinant, full-length Syrian hamster PrP is investigated using EPR methodologies. Four copper ions are taken up in the octarepeat domain, which supports previous findings. However, quantification studies reveal a fifth binding site in the flexible region between the octarepeats and the PrP globular C-terminal domain. A series of PrP peptide constructs show that this site involves His96 in the PrP(92–96) segment GGGTH. Further examination by X-band EPR, S-band EPR, and electron spin–echo envelope spectroscopy, demonstrates coordination by the His96 imidazole and the glycine preceding the threonine. The copper affinity for this type of binding site is highly pH dependent, and EPR studies here show that recombinant PrP loses its affinity for copper below pH 6.0. These studies seem to provide a complete profile of the copper binding sites in PrP and support the hypothesis that PrP function is related to its ability to bind copper in a pH-dependent fashion. PMID:12779334

Copper attachment to prion protein at a non-octarepeat site

NASA Astrophysics Data System (ADS)

Hodak, Miroslav; Bernholc, Jerry

2011-03-01

Prion protein (PrP) plays a causative role in a group of neurodegenerative diseases, which include ``mad cow disease'' or its human form variant Creutzfeld-Jacob disease. Normal function of PrP remains unknown, but it is now well established that PrP can efficiently bind copper ions and this ability has been linked to its function. The primary binding sites are located in the so-called octarepeat region located between residues 60-91. While these are by now well characterized, the sites located outside these region remain mostly undetermined. In this work, we investigate the properties of Cu binding site located at His 111 using recently developed hybrid Kohn-Sham/orbital-free density functional simulations. Experimental data indicate that copper is coordinated by either four nitrogens or three nitrogens and one oxygen. We investigate both possibilities, comparing their energetics and attachment geometries. Similarities and differences with other binding sites and implications for PrP function will also be discussed.

Cloning of a heavy-metal-binding protein derived from activated-sludge microorganisms.

PubMed

Sano, Daisuke; Myojo, Ken; Omura, Tatsuo

2006-09-01

A gene of the heavy-metal-binding protein (HMBP) was newly isolated from a genetic DNA library of activated-sludge microorganisms. HMBP was produced by transformed Escherichia coli, and the copper-binding ability of HMBP was confirmed. HMBP derived from activated sludge could be available as heavy metal adsorbents in water and wastewater treatments.

Neurokinin B and serum albumin limit copper binding to mammalian gonadotropin releasing hormone.

PubMed

Gul, Ahmad Samir; Tran, Kevin K; Jones, Christopher E

2018-02-26

Gonadotropin releasing hormone (GnRH) triggers secretion of luteinizing hormone and follicle stimulating hormone from gonadotropic cells in the anterior pituitary gland. GnRH is able to bind copper, and both in vitro and in vivo studies have suggested that the copper-GnRH complex is more potent at triggering gonadotropin release than GnRH alone. However, it remains unclear whether copper-GnRH is the active species in vivo. To explore this we have estimated the GnRH-copper affinity and have examined whether GnRH remains copper-bound in the presence of serum albumin and the neuropeptide neurokinin B, both copper-binding proteins that GnRH will encounter in vivo. We show that GnRH has a copper dissociation constant of ∼0.9 × 10 -9  M, however serum albumin and neurokinin B can extract metal from the copper-GnRH complex. It is therefore unlikely that a copper-GnRH complex will survive transit through the pituitary portal circulation and that any effect of copper must occur outside the bloodstream in the absence of neurokinin B. Copyright © 2018 Elsevier Inc. All rights reserved.

Resolving distinct molecular origins for copper effects on PAI-1.

PubMed

Bucci, Joel C; McClintock, Carlee S; Chu, Yuzhuo; Ware, Gregory L; McConnell, Kayla D; Emerson, Joseph P; Peterson, Cynthia B

2017-10-01

Components of the fibrinolytic system are subjected to stringent control to maintain proper hemostasis. Central to this regulation is the serpin plasminogen activator inhibitor-1 (PAI-1), which is responsible for specific and rapid inhibition of fibrinolytic proteases. Active PAI-1 is inherently unstable and readily converts to a latent, inactive form. The binding of vitronectin and other ligands influences stability of active PAI-1. Our laboratory recently observed reciprocal effects on the stability of active PAI-1 in the presence of transition metals, such as copper, depending on the whether vitronectin was also present (Thompson et al. Protein Sci 20:353-365, 2011). To better understand the molecular basis for these copper effects on PAI-1, we have developed a gel-based copper sensitivity assay that can be used to assess the copper concentrations that accelerate the conversion of active PAI-1 to a latent form. The copper sensitivity of wild-type PAI-1 was compared with variants lacking N-terminal histidine residues hypothesized to be involved in copper binding. In these PAI-1 variants, we observed significant differences in copper sensitivity, and these data were corroborated by latency conversion kinetics and thermodynamics of copper binding by isothermal titration calorimetry. These studies identified a copper-binding site involving histidines at positions 2 and 3 that confers a remarkable stabilization of PAI-1 beyond what is observed with vitronectin alone. A second site, independent from the two histidines, binds metal and increases the rate of the latency conversion.

Diabetic cardiomyopathy is associated with defective myocellular copper regulation and both defects are rectified by divalent copper chelation

PubMed Central

2014-01-01

Background Heart disease is the leading cause of death in diabetic patients, and defective copper metabolism may play important roles in the pathogenesis of diabetic cardiomyopathy (DCM). The present study sought to determine how myocardial copper status and key copper-proteins might become impaired by diabetes, and how they respond to treatment with the Cu (II)-selective chelator triethylenetetramine (TETA) in DCM. Methods Experiments were performed in Wistar rats with streptozotocin (STZ)-induced diabetes with or without TETA treatment. Cardiac function was analyzed in isolated-perfused working hearts, and myocardial total copper content measured by particle-induced x-ray emission spectroscopy (PIXE) coupled with Rutherford backscattering spectrometry (RBS). Quantitative expression (mRNA and protein) and/or activity of key proteins that mediate LV-tissue-copper binding and transport, were analyzed by combined RT-qPCR, western blotting, immunofluorescence microscopy, and enzyme activity assays. Statistical analysis was performed using Student’s t-tests or ANOVA and p-values of < 0.05 have been considered significant. Results Left-ventricular (LV) copper levels and function were severely depressed in rats following 16-weeks’ diabetes, but both were unexpectedly normalized 8-weeks after treatment with TETA was instituted. Localized myocardial copper deficiency was accompanied by decreased expression and increased polymerization of the copper-responsive transition-metal-binding metallothionein proteins (MT1/MT2), consistent with impaired anti-oxidant defences and elevated susceptibility to pro-oxidant stress. Levels of the high-affinity copper transporter-1 (CTR1) were depressed in diabetes, consistent with impaired membrane copper uptake, and were not modified by TETA which, contrastingly, renormalized myocardial copper and increased levels and cell-membrane localization of the low-affinity copper transporter-2 (CTR2). Diabetes also lowered indexes of intracellular (IC) copper delivery via the copper chaperone for superoxide dismutase (CCS) to its target cuproenzyme, superoxide dismutase-1 (SOD1): this pathway was rectified by TETA treatment, which normalized SOD1 activity with consequent bolstering of anti-oxidant defenses. Furthermore, diabetes depressed levels of additional intracellular copper-transporting proteins, including antioxidant-protein-1 (ATOX1) and copper-transporting-ATPase-2 (ATP7B), whereas TETA elevated copper-transporting-ATPase-1 (ATP7A). Conclusions Myocardial copper deficiency and defective cellular copper transport/trafficking are revealed as key molecular defects underlying LV impairment in diabetes, and TETA-mediated restoration of copper regulation provides a potential new class of therapeutic molecules for DCM. PMID:24927960

Monitoring Interactions Inside Cells by Advanced Spectroscopies: Overview of Copper Transporters and Cisplatin.

PubMed

Lasorsa, Alessia; Natile, Giovanni; Rosato, Antonio; Tadini-Buoninsegni, Francesco; Arnesano, Fabio

2018-02-12

Resistance, either at the onset of the treatment or developed after an initial positive response, is a major limitation of antitumor therapy. In the case of platinum- based drugs, copper transporters have been found to interfere with drug trafficking by facilitating the import or favoring the platinum export and inactivation. The use of powerful spectroscopic, spectrometric and computational methods has allowed a deep structural insight into the mode of interaction of platinum drugs with the metal-binding domains of the transporter proteins. This review article focuses on the mode in which platinum drugs can compete with copper ion for binding to transport proteins and consequent structural and biological effects. Three types of transporters are discussed in detail: copper transporter 1 (Ctr1), the major responsible for Cu+ uptake; antioxidant-1 copper chaperone (Atox1), responsible for copper transfer within the cytoplasm; and copper ATPases (ATP7A/B), responsible for copper export into specific subcellular compartments and outside the cell. The body of knowledge summarized in this review can help in shaping current chemotherapy to optimize the efficacy of platinum drugs (particularly in relation to resistance) and to mitigate adverse effects on copper metabolism. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Using XAS and SXRF to Study Copper in Wilson Disease at the Molecular and Tissue Level

NASA Astrophysics Data System (ADS)

Ralle, Martina; Blackburn, Ninian J.; Lutsenko, Svetlana

2007-02-01

Wilson disease (WD) is a genetic disorder of copper metabolism associated with severe hepatic, neurological, and psychiatric abnormalities. In WD, the billiary copper excretion is impaired and copper accumulates in tissues, particularly in the liver and the brain. The affected gene, ATP7B, encodes the copper transporting ATPase, Wilson disease protein (WNDP). WNDP has six copper binding sites in the N-terminal portion of the molecule. Each site includes the conserved amino acid sequence MXCXXC, and binds 1 Cu(I) through its 2 cysteine residues. We performed X-ray absorption studies at the Cu Kα-edge on the recombinant N-terminal domain of WNDP (N-WNDP). Copper was bound to N-WNDP either in vivo or in vitro in the presence of different reducing agents. We found that in N-WNDP copper is predominantly coordinated in a linear fashion by two cysteines, with the appearance of a Cu-Cu interaction when all metal binding sites are filled. Increasing amounts of reducing agents containing sulfide or phosphine groups led to binding of the exogenous ligands to copper thereby increasing the coordination number of copper from two to three. To better understand the role of copper in WD, we utilized livers of the 6-weeks-old Atp7b-/- mice (an animal model for WD) in which the copper concentration was 10-20-fold higher compared to that of the control mice. The distribution of copper in hepatocytes was evaluated by synchrotron based X-ray fluorescence microprobe (SXRF). We demonstrate that we can prepare liver slices that retain copper and can detect copper with subcellular resolution. On the same sections μ-XANES (spot size: 5 micron) was used to determine the oxidation state of copper.

Subchronic treatment of rats with aurothioglucose; effects on plasma, hepatic, renal and urinary zinc, copper and metallothionein.

PubMed

McVety, K J; Shaikh, Z A

1987-11-01

Administration of sodium aurothioglucose (10 mg/kg per day) to female rats for up to 8 weeks resulted in no apparent effects on the kidney. Gold accumulated in kidney, liver, spleen, pancreas, skin and blood. Although plasma and hepatic gold levels increased with time, no remarkable change in either copper, zinc or metallothionein (MT) levels was observed. Gel filtration chromatography of plasma showed binding of gold to albumin, whereas copper was associated with albumin, ceruloplasmin and a protein eluting in the void volume of the Sephadex G-150 column. Almost all of the hepatic gold was bound to proteins other than MT. In the kidney, not only gold but also copper and MT increased rapidly, reached a maximum between 2 and 4 weeks and exhibited insignificant change thereafter. Gold-treated animals showed an increase in binding of copper to the very high molecular weight plasma protein, which may be involved in transport of copper to the kidneys. Urinary gold and MT followed a pattern similar to that in the kidney. Renal zinc also increased but returned to normal by week 8. In renal cytosol 57% and 54% of the gold and copper, respectively, were associated with MT. It appears that the elevated levels of copper and zinc, rather than gold, are responsible for the induction of MT synthesis. This then provides a mechanism by which gold and the inducing metals are retained by the kidney.

Copper and Copper Proteins in Parkinson's Disease

PubMed Central

Rivera-Mancia, Susana; Diaz-Ruiz, Araceli; Tristan-Lopez, Luis; Rios, Camilo

2014-01-01

Copper is a transition metal that has been linked to pathological and beneficial effects in neurodegenerative diseases. In Parkinson's disease, free copper is related to increased oxidative stress, alpha-synuclein oligomerization, and Lewy body formation. Decreased copper along with increased iron has been found in substantia nigra and caudate nucleus of Parkinson's disease patients. Copper influences iron content in the brain through ferroxidase ceruloplasmin activity; therefore decreased protein-bound copper in brain may enhance iron accumulation and the associated oxidative stress. The function of other copper-binding proteins such as Cu/Zn-SOD and metallothioneins is also beneficial to prevent neurodegeneration. Copper may regulate neurotransmission since it is released after neuronal stimulus and the metal is able to modulate the function of NMDA and GABA A receptors. Some of the proteins involved in copper transport are the transporters CTR1, ATP7A, and ATP7B and the chaperone ATOX1. There is limited information about the role of those biomolecules in the pathophysiology of Parkinson's disease; for instance, it is known that CTR1 is decreased in substantia nigra pars compacta in Parkinson's disease and that a mutation in ATP7B could be associated with Parkinson's disease. Regarding copper-related therapies, copper supplementation can represent a plausible alternative, while copper chelation may even aggravate the pathology. PMID:24672633

The Prion Protein N1 and N2 Cleavage Fragments Bind to Phosphatidylserine and Phosphatidic Acid; Relevance to Stress-Protection Responses.

PubMed

Haigh, Cathryn L; Tumpach, Carolin; Drew, Simon C; Collins, Steven J

2015-01-01

Internal cleavage of the cellular prion protein generates two well characterised N-terminal fragments, N1 and N2. These fragments have been shown to bind to anionic phospholipids at low pH. We sought to investigate binding with other lipid moieties and queried how such interactions could be relevant to the cellular functions of these fragments. Both N1 and N2 bound phosphatidylserine (PS), as previously reported, and a further interaction with phosphatidic acid (PA) was also identified. The specificity of this interaction required the N-terminus, especially the proline motif within the basic amino acids at the N-terminus, together with the copper-binding region (unrelated to copper saturation). Previously, the fragments have been shown to be protective against cellular stresses. In the current study, serum deprivation was used to induce changes in the cellular lipid environment, including externalisation of plasma membrane PS and increased cellular levels of PA. When copper-saturated, N2 could reverse these changes, but N1 could not, suggesting that direct binding of N2 to cellular lipids may be part of the mechanism by which this peptide signals its protective response.

The Prion Protein N1 and N2 Cleavage Fragments Bind to Phosphatidylserine and Phosphatidic Acid; Relevance to Stress-Protection Responses

PubMed Central

Haigh, Cathryn L.; Tumpach, Carolin; Drew, Simon C.; Collins, Steven J.

2015-01-01

Internal cleavage of the cellular prion protein generates two well characterised N-terminal fragments, N1 and N2. These fragments have been shown to bind to anionic phospholipids at low pH. We sought to investigate binding with other lipid moieties and queried how such interactions could be relevant to the cellular functions of these fragments. Both N1 and N2 bound phosphatidylserine (PS), as previously reported, and a further interaction with phosphatidic acid (PA) was also identified. The specificity of this interaction required the N-terminus, especially the proline motif within the basic amino acids at the N-terminus, together with the copper-binding region (unrelated to copper saturation). Previously, the fragments have been shown to be protective against cellular stresses. In the current study, serum deprivation was used to induce changes in the cellular lipid environment, including externalisation of plasma membrane PS and increased cellular levels of PA. When copper-saturated, N2 could reverse these changes, but N1 could not, suggesting that direct binding of N2 to cellular lipids may be part of the mechanism by which this peptide signals its protective response. PMID:26252007

Metal stabilization of collagen and de novo designed mimetic peptides

PubMed Central

Parmar, Avanish S.; Xu, Fei; Pike, Douglas H.; Belure, Sandeep V.; Hasan, Nida F.; Drzewiecki, Kathryn E.; Shreiber, David I.; Nanda, Vikas

2017-01-01

We explore the design of metal binding sites to modulate triple-helix stability of collagen and collagen-mimetic peptides. Globular proteins commonly utilize metals to connect tertiary structural elements that are well separated in sequence, constraining structure and enhancing stability. It is more challenging to engineer structural metals into fibrous protein scaffolds, which lack the extensive tertiary contacts seen in globular proteins. In the collagen triple helix, the structural adjacency of the carboxy-termini of the three chains makes this region an attractive target for introducing metal binding sites. We engineered His3 sites based on structural modeling constraints into a series of designed homotrimeric and heterotrimeric peptides, assessing the capacity of metal binding to improve stability and in the case of heterotrimers, affect specificity of assembly. Notable enhancements in stability for both homo and heteromeric systems were observed upon addition of zinc(II) and several other metal ions only when all three histidine ligands were present. Metal binding affinities were consistent with the expected Irving-Williams series for imidazole. Unlike other metals tested, copper(II) also bound to peptides lacking histidine ligands. Acetylation of the peptide N-termini prevented copper binding, indicating proline backbone amide metal-coordination at this site. Copper similarly stabilized animal extracted Type I collagen in a metal specific fashion, highlighting the potential importance of metal homeostasis within the extracellular matrix. PMID:26225466

Metal Stabilization of Collagen and de Novo Designed Mimetic Peptides.

PubMed

Parmar, Avanish S; Xu, Fei; Pike, Douglas H; Belure, Sandeep V; Hasan, Nida F; Drzewiecki, Kathryn E; Shreiber, David I; Nanda, Vikas

2015-08-18

We explore the design of metal binding sites to modulate triple-helix stability of collagen and collagen-mimetic peptides. Globular proteins commonly utilize metals to connect tertiary structural elements that are well separated in sequence, constraining structure and enhancing stability. It is more challenging to engineer structural metals into fibrous protein scaffolds, which lack the extensive tertiary contacts seen in globular proteins. In the collagen triple helix, the structural adjacency of the carboxy-termini of the three chains makes this region an attractive target for introducing metal binding sites. We engineered His3 sites based on structural modeling constraints into a series of designed homotrimeric and heterotrimeric peptides, assessing the capacity of metal binding to improve stability and in the case of heterotrimers, affect specificity of assembly. Notable enhancements in stability for both homo- and heteromeric systems were observed upon addition of zinc(II) and several other metal ions only when all three histidine ligands were present. Metal binding affinities were consistent with the expected Irving-Williams series for imidazole. Unlike other metals tested, copper(II) also bound to peptides lacking histidine ligands. Acetylation of the peptide N-termini prevented copper binding, indicating proline backbone amide metal-coordination at this site. Copper similarly stabilized animal extracted Type I collagen in a metal-specific fashion, highlighting the potential importance of metal homeostasis within the extracellular matrix.

Redox-regulated dynamic interplay between Cox19 and the copper-binding protein Cox11 in the intermembrane space of mitochondria facilitates biogenesis of cytochrome c oxidase

PubMed Central

Bode, Manuela; Woellhaf, Michael W.; Bohnert, Maria; van der Laan, Martin; Sommer, Frederik; Jung, Martin; Zimmermann, Richard; Schroda, Michael; Herrmann, Johannes M.

2015-01-01

Members of the twin Cx9C protein family constitute the largest group of proteins in the intermembrane space (IMS) of mitochondria. Despite their conserved nature and their essential role in the biogenesis of the respiratory chain, the molecular function of twin Cx9C proteins is largely unknown. We performed a SILAC-based quantitative proteomic analysis to identify interaction partners of the conserved twin Cx9C protein Cox19. We found that Cox19 interacts in a dynamic manner with Cox11, a copper transfer protein that facilitates metalation of the Cu(B) center of subunit 1 of cytochrome c oxidase. The interaction with Cox11 is critical for the stable accumulation of Cox19 in mitochondria. Cox19 consists of a helical hairpin structure that forms a hydrophobic surface characterized by two highly conserved tyrosine-leucine dipeptides. These residues are essential for Cox19 function and its specific binding to a cysteine-containing sequence in Cox11. Our observations suggest that an oxidative modification of this cysteine residue of Cox11 stimulates Cox19 binding, pointing to a redox-regulated interplay of Cox19 and Cox11 that is critical for copper transfer in the IMS and thus for biogenesis of cytochrome c oxidase. PMID:25926683

A cytosolic copper storage protein provides a second level of copper tolerance in Streptomyces lividans.

PubMed

Straw, Megan L; Chaplin, Amanda K; Hough, Michael A; Paps, Jordi; Bavro, Vassiliy N; Wilson, Michael T; Vijgenboom, Erik; Worrall, Jonathan A R

2018-01-24

Streptomyces lividans has a distinct dependence on the bioavailability of copper for its morphological development. A cytosolic copper resistance system is operative in S. lividans that serves to preclude deleterious copper levels. This system comprises of several CopZ-like copper chaperones and P 1 -type ATPases, predominantly under the transcriptional control of a metalloregulator from the copper sensitive operon repressor (CsoR) family. In the present study, we discover a new layer of cytosolic copper resistance in S. lividans that involves a protein belonging to the newly discovered family of copper storage proteins, which we have named Ccsp (cytosolic copper storage protein). From an evolutionary perspective, we find Ccsp homologues to be widespread in Bacteria and extend through into Archaea and Eukaryota. Under copper stress Ccsp is upregulated and consists of a homotetramer assembly capable of binding up to 80 cuprous ions (20 per protomer). X-ray crystallography reveals 18 cysteines, 3 histidines and 1 aspartate are involved in cuprous ion coordination. Loading of cuprous ions to Ccsp is a cooperative process with a Hill coefficient of 1.9 and a CopZ-like copper chaperone can transfer copper to Ccsp. A Δccsp mutant strain indicates that Ccsp is not required under initial copper stress in S. lividans, but as the CsoR/CopZ/ATPase efflux system becomes saturated, Ccsp facilitates a second level of copper tolerance.

Spectroscopic and Theoretical Study of CuI Binding to His111 in the Human Prion Protein Fragment 106–115

PubMed Central

2016-01-01

The ability of the cellular prion protein (PrPC) to bind copper in vivo points to a physiological role for PrPC in copper transport. Six copper binding sites have been identified in the nonstructured N-terminal region of human PrPC. Among these sites, the His111 site is unique in that it contains a MKHM motif that would confer interesting CuI and CuII binding properties. We have evaluated CuI coordination to the PrP(106–115) fragment of the human PrP protein, using NMR and X-ray absorption spectroscopies and electronic structure calculations. We find that Met109 and Met112 play an important role in anchoring this metal ion. CuI coordination to His111 is pH-dependent: at pH >8, 2N1O1S species are formed with one Met ligand; in the range of pH 5–8, both methionine (Met) residues bind to CuI, forming a 1N1O2S species, where N is from His111 and O is from a backbone carbonyl or a water molecule; at pH <5, only the two Met residues remain coordinated. Thus, even upon drastic changes in the chemical environment, such as those occurring during endocytosis of PrPC (decreased pH and a reducing potential), the two Met residues in the MKHM motif enable PrPC to maintain the bound CuI ions, consistent with a copper transport function for this protein. We also find that the physiologically relevant CuI-1N1O2S species activates dioxygen via an inner-sphere mechanism, likely involving the formation of a copper(II) superoxide complex. In this process, the Met residues are partially oxidized to sulfoxide; this ability to scavenge superoxide may play a role in the proposed antioxidant properties of PrPC. This study provides further insight into the CuI coordination properties of His111 in human PrPC and the molecular mechanism of oxygen activation by this site. PMID:26930130

Transgenic Mice Expressing Yeast CUP1 Exhibit Increased Copper Utilization from Feeds

PubMed Central

Chen, Zhenliang; Liao, Rongrong; Zhang, Xiangzhe; Wang, Qishan; Pan, Yuchun

2014-01-01

Copper is required for structural and catalytic properties of a variety of enzymes participating in many vital biological processes for growth and development. Feeds provide most of the copper as an essential micronutrient consumed by animals, but inorganic copper could not be utilized effectively. In the present study, we aimed to develop transgenic mouse models to test if copper utilization will be increased by providing the animals with an exogenous gene for generation of copper chelatin in saliva. Considering that the S. cerevisiae CUP1 gene encodes a Cys-rich protein that can bind copper as specifically as copper chelatin in yeast, we therefore constructed a transgene plasmid containing the CUP1 gene regulated for specific expression in the salivary glands by a promoter of gene coding pig parotid secretory protein. Transgenic CUP1 was highly expressed in the parotid and submandibular salivary glands and secreted in saliva as a 9-kDa copper-chelating protein. Expression of salivary copper-chelating proteins reduced fecal copper contents by 21.61% and increased body-weight by 12.97%, suggesting that chelating proteins improve the utilization and absorbed efficacy of copper. No negative effects on the health of the transgenic mice were found by blood biochemistry and histology analysis. These results demonstrate that the introduction of the salivary CUP1 transgene into animals offers a possible approach to increase the utilization efficiency of copper and decrease the fecal copper contents. PMID:25265503

Functional assignment to JEV proteins using SVM.

PubMed

Sahoo, Ganesh Chandra; Dikhit, Manas Ranjan; Das, Pradeep

2008-01-01

Identification of different protein functions facilitates a mechanistic understanding of Japanese encephalitis virus (JEV) infection and opens novel means for drug development. Support vector machines (SVM), useful for predicting the functional class of distantly related proteins, is employed to ascribe a possible functional class to Japanese encephalitis virus protein. Our study from SVMProt and available JE virus sequences suggests that structural and nonstructural proteins of JEV genome possibly belong to diverse protein functions, are expected to occur in the life cycle of JE virus. Protein functions common to both structural and non-structural proteins are iron-binding, metal-binding, lipid-binding, copper-binding, transmembrane, outer membrane, channels/Pores - Pore-forming toxins (proteins and peptides) group of proteins. Non-structural proteins perform functions like actin binding, zinc-binding, calcium-binding, hydrolases, Carbon-Oxygen Lyases, P-type ATPase, proteins belonging to major facilitator family (MFS), secreting main terminal branch (MTB) family, phosphotransfer-driven group translocators and ATP-binding cassette (ABC) family group of proteins. Whereas structural proteins besides belonging to same structural group of proteins (capsid, structural, envelope), they also perform functions like nuclear receptor, antibiotic resistance, RNA-binding, DNA-binding, magnesium-binding, isomerase (intra-molecular), oxidoreductase and participate in type II (general) secretory pathway (IISP).

Functional assignment to JEV proteins using SVM

PubMed Central

Sahoo, Ganesh Chandra; Dikhit, Manas Ranjan; Das, Pradeep

2008-01-01

Identification of different protein functions facilitates a mechanistic understanding of Japanese encephalitis virus (JEV) infection and opens novel means for drug development. Support vector machines (SVM), useful for predicting the functional class of distantly related proteins, is employed to ascribe a possible functional class to Japanese encephalitis virus protein. Our study from SVMProt and available JE virus sequences suggests that structural and nonstructural proteins of JEV genome possibly belong to diverse protein functions, are expected to occur in the life cycle of JE virus. Protein functions common to both structural and non-structural proteins are iron-binding, metal-binding, lipid-binding, copper-binding, transmembrane, outer membrane, channels/Pores - Pore-forming toxins (proteins and peptides) group of proteins. Non-structural proteins perform functions like actin binding, zinc-binding, calcium-binding, hydrolases, Carbon-Oxygen Lyases, P-type ATPase, proteins belonging to major facilitator family (MFS), secreting main terminal branch (MTB) family, phosphotransfer-driven group translocators and ATP-binding cassette (ABC) family group of proteins. Whereas structural proteins besides belonging to same structural group of proteins (capsid, structural, envelope), they also perform functions like nuclear receptor, antibiotic resistance, RNA-binding, DNA-binding, magnesium-binding, isomerase (intra-molecular), oxidoreductase and participate in type II (general) secretory pathway (IISP). PMID:19052658

BSA binding and antimicrobial studies of branched polyethyleneimine-copper(II)bipyridine/phenanthroline complexes

NASA Astrophysics Data System (ADS)

Vignesh, Gopalaswamy; Arunachalam, Sankaralingam; Vignesh, Sivanandham; James, Rathinam Arthur

2012-10-01

The interaction of two water soluble branched polyethyleneimine-copper(II) complexes containing bipyridine/phenanthroline with bovine serum albumin (BSA) was studied by, UV-Visible absorption, fluorescence, lifetime measurements and circular dichroism spectroscopic techniques. The polymer-copper(II) complexes strongly quench the intrinsic fluorescence of BSA is the static quenching mechanism through hydrogen bonds and van der Waal's attraction. The distance r, between the BSA and the complexes seems to be less than 2 nm indicating that the energy transfer between the donor and acceptor occurs with high probability. Synchronous fluorescence studies indicate the binding of polymer-copper(II) complexes with BSA mostly changes the polarity around tryptophan residues rather than tyrosine residues. The circular dichroism studies indicate that the binding has induced considerable amount of conformational changes in the protein. The complexes also show some antibacterial and antifungal properties.

The Extracellular Domain of Human High Affinity Copper Transporter (hNdCTR1), Synthesized by E. coli Cells, Chelates Silver and Copper Ions In Vivo

PubMed Central

Sankova, Tatiana P.; Orlov, Iurii A.; Saveliev, Andrey N.; Kirilenko, Demid A.; Babich, Polina S.; Brunkov, Pavel N.; Puchkova, Ludmila V.

2017-01-01

There is much interest in effective copper chelators to correct copper dyshomeostasis in neurodegenerative and oncological diseases. In this study, a recombinant fusion protein for expression in Escherichia coli cells was constructed from glutathione-S-transferase (GST) and the N-terminal domain (ectodomain) of human high affinity copper transporter CTR1 (hNdCTR1), which has three metal-bound motifs. Several biological properties of the GST-hNdCTR1 fusion protein were assessed. It was demonstrated that in cells, the protein was prone to oligomerization, formed inclusion bodies and displayed no toxicity. Treatment of E. coli cells with copper and silver ions reduced cell viability in a dose- and time-dependent manner. Cells expressing GST-hNdCTR1 protein demonstrated resistance to the metal treatments. These cells accumulated silver ions and formed nanoparticles that contained AgCl and metallic silver. In this bacterial population, filamentous bacteria with a length of about 10 µm were often observed. The possibility for the fusion protein carrying extracellular metal binding motifs to integrate into the cell’s copper metabolism and its chelating properties are discussed. PMID:29099786

The Extracellular Domain of Human High Affinity Copper Transporter (hNdCTR1), Synthesized by E. coli Cells, Chelates Silver and Copper Ions In Vivo.

PubMed

Sankova, Tatiana P; Orlov, Iurii A; Saveliev, Andrey N; Kirilenko, Demid A; Babich, Polina S; Brunkov, Pavel N; Puchkova, Ludmila V

2017-11-03

There is much interest in effective copper chelators to correct copper dyshomeostasis in neurodegenerative and oncological diseases. In this study, a recombinant fusion protein for expression in Escherichia coli cells was constructed from glutathione-S-transferase (GST) and the N-terminal domain (ectodomain) of human high affinity copper transporter CTR1 (hNdCTR1), which has three metal-bound motifs. Several biological properties of the GST-hNdCTR1 fusion protein were assessed. It was demonstrated that in cells, the protein was prone to oligomerization, formed inclusion bodies and displayed no toxicity. Treatment of E. coli cells with copper and silver ions reduced cell viability in a dose- and time-dependent manner. Cells expressing GST-hNdCTR1 protein demonstrated resistance to the metal treatments. These cells accumulated silver ions and formed nanoparticles that contained AgCl and metallic silver. In this bacterial population, filamentous bacteria with a length of about 10 µm were often observed. The possibility for the fusion protein carrying extracellular metal binding motifs to integrate into the cell's copper metabolism and its chelating properties are discussed.

Extracellular and circulating redox- and metalloregulated eRNA and eRNP: copper ion-structured RNA cytokines (angiotropin ribokines) and bioaptamer targets imparting RNA chaperone and novel biofunctions to S100-EF-hand and disease-associated proteins.

PubMed

Wissler, Josef H

2004-06-01

Bioassays for cellular differentiation and tissue morphogenesis were used to design methods for isolation of bioactive redox- and metalloregulated nucleic acids and copper ion complexes with proteins from extracellular, circulating, wound, and supernatant fluids of cultured cells. In extracellular biospheres, diversities of nucleic acids were found to be secreted by cells upon activation. They may reflect nucleic acid biolibraries with molecular imprints of cellular history. After removal of protein components, eRNA prototypes exuded by activated cells were sequenced. They are small, endogenous, highly modified and edited, redox- and metalloregulated 5'-end phosphorylated extracellular eRNA (approximately 2-200 bases) with cellular, enzymic, and bioaptamer functions. Fenton-type OH* radical redox reactions may form modified nucleotides in RNA as wobbles eRNA per se, or as copper ion-complex with protein (e.g., S100A12-EF-hand protein, angiotropin-related protein, calgranulin-C, hippocampal neurite differentiation factor) are shown to be bioactive in vivo and in vitro as cytokines (ribokines) and as nonmitogenic angiomorphogens for endothelial cell differentiation in the formation of organoid supracellular capillary structures. As bioaptamers, copper ion-structured eRNA imparts novel biofunctions to proteins that they do not have on their own. The origin of extracellular RNA and intermediate precursors (up to 500 bases) was traced to intracellular parent nucleic acids. Intermediate precursors with and without partial homology were found. This suggests that bioaptamers are not directly retranslatable gene products. Metalloregulated eRNA bioaptamer function was investigated by domains (e.g. 5'...CUG...3' hairpin loop) for folding, bioactivity, and binding of protein with copper, calcium, and alkali metal ion affinity. Vice versa, metalloregulated nucleic acid-binding domains (K3H, R3H) in proteins were identified. Interaction of protein and eRNA docking potentials were visualized by 3D-rapid prototyping of accurate molecular image models based on crystallographic or NMR data. For S100A12-homologous proteins, receptor- and metalloregulated RNA chaperone-shaped protein assemblies were investigated. They suggest insight into signaling cascades as to how eRNA transmits its cytokine (ribokine) bioinformation from the extracellular RNA biosphere into cells. Proteomics of the extracellular RNA biosphere demonstrate the presence of nucleic acid-binding domain homologies in defense-, aging-, and disease-associated neuronal and other proteins as targets for RNA orphans. By structural relationships found to transmissible processes, proteinaceous transfer ("infectivity") and feedback of bioinformation beyond the central dogma of molecular biology are considered in terms of metalloregulated RNA bioaptamer function, nucleic acid-binding domains, and protein conformation.

The non-octarepeat copper binding site of the prion protein is a key regulator of prion conversion

NASA Astrophysics Data System (ADS)

Giachin, Gabriele; Mai, Phuong Thao; Tran, Thanh Hoa; Salzano, Giulia; Benetti, Federico; Migliorati, Valentina; Arcovito, Alessandro; Longa, Stefano Della; Mancini, Giordano; D'Angelo, Paola; Legname, Giuseppe

2015-10-01

The conversion of the prion protein (PrPC) into prions plays a key role in transmissible spongiform encephalopathies. Despite the importance for pathogenesis, the mechanism of prion formation has escaped detailed characterization due to the insoluble nature of prions. PrPC interacts with copper through octarepeat and non-octarepeat binding sites. Copper coordination to the non-octarepeat region has garnered interest due to the possibility that this interaction may impact prion conversion. We used X-ray absorption spectroscopy to study copper coordination at pH 5.5 and 7.0 in human PrPC constructs, either wild-type (WT) or carrying pathological mutations. We show that mutations and pH cause modifications of copper coordination in the non-octarepeat region. In the WT at pH 5.5, copper is anchored to His96 and His111, while at pH 7 it is coordinated by His111. Pathological point mutations alter the copper coordination at acidic conditions where the metal is anchored to His111. By using in vitro approaches, cell-based and computational techniques, we propose a model whereby PrPC coordinating copper with one His in the non-octarepeat region converts to prions at acidic condition. Thus, the non-octarepeat region may act as the long-sought-after prion switch, critical for disease onset and propagation.

COPT6 is a plasma membrane transporter that functions in copper homeostasis in Arabidopsis and is a novel target of SQUAMOSA promoter binding protein-like 7

USDA-ARS?s Scientific Manuscript database

Among the mechanisms controlling copper homeostasis in plants is the regulation of its uptake and tissue partitioning. Here we characterized a newly identified member of the conserved CTR/COPT family of copper transporters in Arabidopsis thaliana, COPT6. We showed that COPT6 resides at the plasma me...

Anaerobic Copper Toxicity and Iron-Sulfur Cluster Biogenesis in Escherichia coli.

PubMed

Tan, Guoqiang; Yang, Jing; Li, Tang; Zhao, Jin; Sun, Shujuan; Li, Xiaokang; Lin, Chuxian; Li, Jianghui; Zhou, Huaibin; Lyu, Jianxin; Ding, Huangen

2017-08-15

While copper is an essential trace element in biology, pollution of groundwater from copper has become a threat to all living organisms. Cellular mechanisms underlying copper toxicity, however, are still not fully understood. Previous studies have shown that iron-sulfur proteins are among the primary targets of copper toxicity in Escherichia coli under aerobic conditions. Here, we report that, under anaerobic conditions, iron-sulfur proteins in E. coli cells are even more susceptible to copper in medium. Whereas addition of 0.2 mM copper(II) chloride to LB (Luria-Bertani) medium has very little or no effect on iron-sulfur proteins in wild-type E. coli cells under aerobic conditions, the same copper treatment largely inactivates iron-sulfur proteins by blocking iron-sulfur cluster biogenesis in the cells under anaerobic conditions. Importantly, proteins that do not have iron-sulfur clusters (e.g., fumarase C and cysteine desulfurase) in E. coli cells are not significantly affected by copper treatment under aerobic or anaerobic conditions, indicating that copper may specifically target iron-sulfur proteins in cells. Additional studies revealed that E. coli cells accumulate more intracellular copper under anaerobic conditions than under aerobic conditions and that the elevated copper content binds to the iron-sulfur cluster assembly proteins IscU and IscA, which effectively inhibits iron-sulfur cluster biogenesis. The results suggest that the copper-mediated inhibition of iron-sulfur proteins does not require oxygen and that iron-sulfur cluster biogenesis is the primary target of anaerobic copper toxicity in cells. IMPORTANCE Copper contamination in groundwater has become a threat to all living organisms. However, cellular mechanisms underlying copper toxicity have not been fully understood up to now. The work described here reveals that iron-sulfur proteins in Escherichia coli cells are much more susceptible to copper in medium under anaerobic conditions than they are under aerobic conditions. Under anaerobic conditions, E. coli cells accumulate excess intracellular copper, which specifically targets iron-sulfur proteins by blocking iron-sulfur cluster biogenesis. Since iron-sulfur proteins are involved in diverse and vital physiological processes, inhibition of iron-sulfur cluster biogenesis by copper disrupts multiple cellular functions and ultimately inhibits cell growth. The results from this study illustrate a new interplay between intracellular copper toxicity and iron-sulfur cluster biogenesis in bacterial cells under anaerobic conditions. Copyright © 2017 American Society for Microbiology.

Anaerobic Copper Toxicity and Iron-Sulfur Cluster Biogenesis in Escherichia coli

PubMed Central

Tan, Guoqiang; Yang, Jing; Li, Tang; Zhao, Jin; Sun, Shujuan; Li, Xiaokang; Lin, Chuxian; Li, Jianghui; Zhou, Huaibin

2017-01-01

ABSTRACT While copper is an essential trace element in biology, pollution of groundwater from copper has become a threat to all living organisms. Cellular mechanisms underlying copper toxicity, however, are still not fully understood. Previous studies have shown that iron-sulfur proteins are among the primary targets of copper toxicity in Escherichia coli under aerobic conditions. Here, we report that, under anaerobic conditions, iron-sulfur proteins in E. coli cells are even more susceptible to copper in medium. Whereas addition of 0.2 mM copper(II) chloride to LB (Luria-Bertani) medium has very little or no effect on iron-sulfur proteins in wild-type E. coli cells under aerobic conditions, the same copper treatment largely inactivates iron-sulfur proteins by blocking iron-sulfur cluster biogenesis in the cells under anaerobic conditions. Importantly, proteins that do not have iron-sulfur clusters (e.g., fumarase C and cysteine desulfurase) in E. coli cells are not significantly affected by copper treatment under aerobic or anaerobic conditions, indicating that copper may specifically target iron-sulfur proteins in cells. Additional studies revealed that E. coli cells accumulate more intracellular copper under anaerobic conditions than under aerobic conditions and that the elevated copper content binds to the iron-sulfur cluster assembly proteins IscU and IscA, which effectively inhibits iron-sulfur cluster biogenesis. The results suggest that the copper-mediated inhibition of iron-sulfur proteins does not require oxygen and that iron-sulfur cluster biogenesis is the primary target of anaerobic copper toxicity in cells. IMPORTANCE Copper contamination in groundwater has become a threat to all living organisms. However, cellular mechanisms underlying copper toxicity have not been fully understood up to now. The work described here reveals that iron-sulfur proteins in Escherichia coli cells are much more susceptible to copper in medium under anaerobic conditions than they are under aerobic conditions. Under anaerobic conditions, E. coli cells accumulate excess intracellular copper, which specifically targets iron-sulfur proteins by blocking iron-sulfur cluster biogenesis. Since iron-sulfur proteins are involved in diverse and vital physiological processes, inhibition of iron-sulfur cluster biogenesis by copper disrupts multiple cellular functions and ultimately inhibits cell growth. The results from this study illustrate a new interplay between intracellular copper toxicity and iron-sulfur cluster biogenesis in bacterial cells under anaerobic conditions. PMID:28576762

Conformational and thermodynamic hallmarks of DNA operator site specificity in the copper sensitive operon repressor from Streptomyces lividans

PubMed Central

Tan, Benedict G.; Vijgenboom, Erik; Worrall, Jonathan A. R.

2014-01-01

Metal ion homeostasis in bacteria relies on metalloregulatory proteins to upregulate metal resistance genes and enable the organism to preclude metal toxicity. The copper sensitive operon repressor (CsoR) family is widely distributed in bacteria and controls the expression of copper efflux systems. CsoR operator sites consist of G-tract containing pseudopalindromes of which the mechanism of operator binding is poorly understood. Here, we use a structurally characterized CsoR from Streptomyces lividans (CsoRSl) together with three specific operator targets to reveal the salient features pertaining to the mechanism of DNA binding. We reveal that CsoRSl binds to its operator site through a 2-fold axis of symmetry centred on a conserved 5′-TAC/GTA-3′ inverted repeat. Operator recognition is stringently dependent not only on electropositive residues but also on a conserved polar glutamine residue. Thermodynamic and circular dichroic signatures of the CsoRSl–DNA interaction suggest selectivity towards the A-DNA-like topology of the G-tracts at the operator site. Such properties are enhanced on protein binding thus enabling the symmetrical binding of two CsoRSl tetramers. Finally, differential binding modes may exist in operator sites having more than one 5′-TAC/GTA-3′ inverted repeat with implications in vivo for a mechanism of modular control. PMID:24121681

Effects of copper ions on the characteristics of egg white gel induced by strong alkali.

PubMed

Shao, Yaoyao; Zhao, Yan; Xu, Mingsheng; Chen, Zhangyi; Wang, Shuzhen; Tu, Yonggang

2017-09-01

This study investigated the effects of copper ions on egg white (EW) gel induced by strong alkali. Changes in gel characteristics were examined through texture profile analysis, scanning electron microscopy (SEM), and chemical methods. The value of gel strength reached its maximum when 0.1% copper ions was added. However, the lowest cohesiveness values were observed at 0.1%. The springiness of gel without copper ions was significantly greater than the gel with copper ions added. SEM results illustrated that the low concentration of copper ions contributes to a dense and uniform gel network, and an open matrix was formed at 0.4%. The free and total sulphhydryl group content in the egg white protein gel significantly decreased with the increased copper. The increase of copper ions left the contents of ionic and hydrogen bonds basically unchanged, hydrophobic interaction presented an increasing trend, and the disulfide bond exhibited a completely opposite change. The change of surface hydrophobicity proved that the main binding force of copper induced gel was hydrophobic interaction. However, copper ions had no effect on the protein component of the gels. Generally, a low level of copper ions facilitates protein-protein association, which is involved in the characteristics of gels. Instead, high ionic strength had a negative effect on gels induced by strong alkali. © 2017 Poultry Science Association Inc.

Understanding how cells allocate metals using metal sensors and metallochaperones.

PubMed

Tottey, Stephen; Harvie, Duncan R; Robinson, Nigel J

2005-10-01

Each metalloprotein must somehow acquire the correct metal. We review the insights into metal specificity in cells provided by studies of ArsR-SmtB DNA binding, metal-responsive transcriptional repressors, and a bacterial copper chaperone. Cyanobacteria are the one bacterial group that have known enzymatic demand for cytoplasmic copper import. The copper chaperone and ATPases that supply cyanobacterial plastocyanin and cytochrome oxidase are reviewed, along with related ATPases for cobalt and zinc. These studies highlight the contributions of protein-protein interactions to metal speciation. Metal sensors and metallochaperones, along with metal transporters and metal-storage proteins, act in concert not only to supply the correct metals but also to withhold the wrong ones.

DNA-modified electrodes fabricated using copper-free click chemistry for enhanced protein detection.

PubMed

Furst, Ariel L; Hill, Michael G; Barton, Jacqueline K

2013-12-31

A method of DNA monolayer formation has been developed using copper-free click chemistry that yields enhanced surface homogeneity and enables variation in the amount of DNA assembled; extremely low-density DNA monolayers, with as little as 5% of the monolayer being DNA, have been formed. These DNA-modified electrodes (DMEs) were characterized visually, with AFM, and electrochemically, and were found to facilitate DNA-mediated reduction of a distally bound redox probe. These low-density monolayers were found to be more homogeneous than traditional thiol-modified DNA monolayers, with greater helix accessibility through an increased surface area-to-volume ratio. Protein binding efficiency of the transcriptional activator TATA-binding protein (TBP) was also investigated on these surfaces and compared to that on DNA monolayers formed with standard thiol-modified DNA. Our low-density monolayers were found to be extremely sensitive to TBP binding, with a signal decrease in excess of 75% for 150 nM protein. This protein was detectable at 4 nM, on the order of its dissociation constant, with our low-density monolayers. The improved DNA helix accessibility and sensitivity of our low-density DNA monolayers to TBP binding reflects the general utility of this method of DNA monolayer formation for DNA-based electrochemical sensor development.

Ab initio Study of Transition metal binding to the Prion Protein

NASA Astrophysics Data System (ADS)

Cox, Daniel L.; Singh, Rajiv R. P.; Pan, Jianping

2004-03-01

Fundamental understanding of the prion protein (PrP) is of critical public health importance in view of mad cow and chronic wasting diseases. In recent years, it has been shown that the normal form (PrP^c) binds copper^1), and the structure of the copper binding domain has been elaborated. Hypotheses about toxicity associated with binding of other metals (notably manganese) have been put forward, Accordingly, using the ab initio SIESTA density functional theory code^2), we calculated the binding energy E_B(M) of M-(PrP) complexes relative to initially uncomplexed M ions, with M=Cu,Ni,Zn,Mn and (PrP)^* the minimal binding domain. The binding energy trend is E_B(Ni)>E_B(Cu)>E_B(Zn)>E_B(Mn), consistent with recent experiments apart from the surprising stability of Ni. We will also present preliminary results for binding of initially complexed M ions. *-Supported by U.S. DOE, Office of Basic Energy Sciences, Division of Materials Research 1) G.S. Jackson et al., Proc. Nat. Acad. Sci. (USA) 98, 8531 (2001). 2) P. Ordejón, et al., Phys. Rev. B53, R10441 (1996); J.M. Soler et al., J. Phys. Cond. Matt. 14, 2745 (2002).

Role of the P-Type ATPases, ATP7A and ATP7B in brain copper homeostasis.

PubMed

Telianidis, Jonathon; Hung, Ya Hui; Materia, Stephanie; Fontaine, Sharon La

2013-01-01

Over the past two decades there have been significant advances in our understanding of copper homeostasis and the pathological consequences of copper dysregulation. Cumulative evidence is revealing a complex regulatory network of proteins and pathways that maintain copper homeostasis. The recognition of copper dysregulation as a key pathological feature in prominent neurodegenerative disorders such as Alzheimer's, Parkinson's, and prion diseases has led to increased research focus on the mechanisms controlling copper homeostasis in the brain. The copper-transporting P-type ATPases (copper-ATPases), ATP7A and ATP7B, are critical components of the copper regulatory network. Our understanding of the biochemistry and cell biology of these complex proteins has grown significantly since their discovery in 1993. They are large polytopic transmembrane proteins with six copper-binding motifs within the cytoplasmic N-terminal domain, eight transmembrane domains, and highly conserved catalytic domains. These proteins catalyze ATP-dependent copper transport across cell membranes for the metallation of many essential cuproenzymes, as well as for the removal of excess cellular copper to prevent copper toxicity. A key functional aspect of these copper transporters is their copper-responsive trafficking between the trans-Golgi network and the cell periphery. ATP7A- and ATP7B-deficiency, due to genetic mutation, underlie the inherited copper transport disorders, Menkes and Wilson diseases, respectively. Their importance in maintaining brain copper homeostasis is underscored by the severe neuropathological deficits in these disorders. Herein we will review and update our current knowledge of these copper transporters in the brain and the central nervous system, their distribution and regulation, their role in normal brain copper homeostasis, and how their absence or dysfunction contributes to disturbances in copper homeostasis and neurodegeneration.

Role of the P-Type ATPases, ATP7A and ATP7B in brain copper homeostasis

PubMed Central

Telianidis, Jonathon; Hung, Ya Hui; Materia, Stephanie; Fontaine, Sharon La

2013-01-01

Over the past two decades there have been significant advances in our understanding of copper homeostasis and the pathological consequences of copper dysregulation. Cumulative evidence is revealing a complex regulatory network of proteins and pathways that maintain copper homeostasis. The recognition of copper dysregulation as a key pathological feature in prominent neurodegenerative disorders such as Alzheimer’s, Parkinson’s, and prion diseases has led to increased research focus on the mechanisms controlling copper homeostasis in the brain. The copper-transporting P-type ATPases (copper-ATPases), ATP7A and ATP7B, are critical components of the copper regulatory network. Our understanding of the biochemistry and cell biology of these complex proteins has grown significantly since their discovery in 1993. They are large polytopic transmembrane proteins with six copper-binding motifs within the cytoplasmic N-terminal domain, eight transmembrane domains, and highly conserved catalytic domains. These proteins catalyze ATP-dependent copper transport across cell membranes for the metallation of many essential cuproenzymes, as well as for the removal of excess cellular copper to prevent copper toxicity. A key functional aspect of these copper transporters is their copper-responsive trafficking between the trans-Golgi network and the cell periphery. ATP7A- and ATP7B-deficiency, due to genetic mutation, underlie the inherited copper transport disorders, Menkes and Wilson diseases, respectively. Their importance in maintaining brain copper homeostasis is underscored by the severe neuropathological deficits in these disorders. Herein we will review and update our current knowledge of these copper transporters in the brain and the central nervous system, their distribution and regulation, their role in normal brain copper homeostasis, and how their absence or dysfunction contributes to disturbances in copper homeostasis and neurodegeneration. PMID:23986700

Direct ROS scavenging activity of CueP from Salmonella enterica serovar Typhimurium.

PubMed

Yoon, Bo-Young; Yeom, Ji-Hyun; Kim, Jin-Sik; Um, Si-Hyeon; Jo, Inseong; Lee, Kangseok; Kim, Yong-Hak; Ha, Nam-Chul

2014-02-01

Salmonella enterica serovar Typhimurium (S. Typhimurium) is an intracellular pathogen that has evolved to survive in the phagosome of macrophages. The periplasmic copper-binding protein CueP was initially known to confer copper resistance to S. Typhimurium. Crystal structure and biochemical studies on CueP revealed a putative copper binding site surrounded by the conserved cysteine and histidine residues. A recent study reported that CueP supplies copper ions to periplasmic Cu, Zn-superoxide dismutase (SodCII) at a low copper concentration and thus enables the sustained SodCII activity in the periplasm. In this study, we investigated the role of CueP in copper resistance at a high copper concentration. We observed that the survival of a cueP-deleted strain of Salmonella in macrophage phagosome was significantly reduced. Subsequent biochemical experiments revealed that CueP specifically mediates the reduction of copper ion using electrons released during the formation of the disulfide bond. We observed that the copper ion-mediated Fenton reaction in the presence of hydrogen peroxide was blocked by CueP. This study provides insight into how CueP confers copper resistance to S. Typhimurium in copper-rich environments such as the phagosome of macrophages.

Occupancy of a C2-C2 type 'zinc-finger' protein domain by copper. Direct observation by electrospray ionization mass spectrometry.

PubMed

Hutchens, T W; Allen, M H; Li, C M; Yip, T T

1992-09-07

The metal ion specificity of most 'zinc-finger' metal binding domains is unknown. The human estrogen receptor protein contains two different C2-C2 type 'zinc-finger' sequences within its DNA-binding domain (ERDBD). Copper inhibits the function of this protein by mechanisms which remain unclear. We have used electrospray ionization mass spectrometry to evaluate directly the 71-residue ERDBD (K180-M250) in the absence and presence of Cu(II) ions. The ERDBD showed a high affinity for Cu and was completely occupied with 4 Cu bound; each Cu ion was evidently bound to only two ligand residues (net loss of only 2 Da per bound Cu). The Cu binding stoichiometry was confirmed by atomic absorption. These results (i) provide the first direct physical evidence for the ability of the estrogen receptor DNA-binding domain to bind Cu and (ii) document a twofold difference in the Zn- and Cu-binding capacity. Differences in the ERDBD domain structure with bound Zn and Cu are predicted. Given the relative intracellular contents of Zn and Cu, our findings demonstrate the need to investigate further the Cu occupancy of this and other zinc-finger domains both in vitro and in vivo.

Dynamics and unfolding pathway of chimeric azurin variants: insights from molecular dynamics simulation.

PubMed

Evoli, Stefania; Guzzi, Rita; Rizzuti, Bruno

2013-10-01

The spectroscopic, thermal, and functional properties of blue copper proteins can be modulated by mutations in the metal binding loop. Molecular dynamics simulation was used to compare the conformational properties of azurin and two chimeric variants, which were obtained by inserting into the azurin scaffold the copper binding loop of amicyanin and plastocyanin, respectively. Simulations at room temperature show that the proteins retain their overall structure and exhibit concerted motions among specific inner regions, as revealed by principal component analysis. Molecular dynamics at high temperature indicates that the first events in the unfolding pathway are structurally similar in the three proteins and unfolding starts from the region of the α-helix that is far from the metal binding loop. The results provide details of the denaturation process that are consistent with experimental data and in close agreement with other computational approaches, suggesting a distinct mechanism of unfolding of azurin and its chimeric variants. Moreover, differences observed in the dynamics of specific regions in the three proteins correlate with their thermal behavior, contributing to the determination of the basic factors that influence the stability.

Copper metallothioneins.

PubMed

Calvo, Jenifer; Jung, Hunmin; Meloni, Gabriele

2017-04-01

Metallothioneins (MTs) are a class of low molecular weight and cysteine-rich metal binding proteins present in all the branches of the tree of life. MTs efficiently bind with high affinity several essential and toxic divalent and monovalent transition metals by forming characteristic polynuclear metal-thiolate clusters within their structure. MTs fulfil multiple biological functions related to their metal binding properties, with essential roles in both Zn(II) and Cu(I) homeostasis as well as metal detoxification. Depending on the organism considered, the primary sequence, and the specific physiological and metabolic status, Cu(I)-bound MT isoforms have been isolated, and their chemistry and biology characterized. Besides the recognized role in the biochemistry of divalent metals, it is becoming evident that unique biological functions in selectively controlling copper levels, its reactivity as well as copper-mediated biochemical processes have evolved in some members of the MT superfamily. Selected examples are reviewed to highlight the peculiar chemical properties and biological functions of copper MTs. © 2016 IUBMB Life, 69(4):236-245, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

Human cytoplasmic copper chaperones Atox1 and CCS exchange copper ions in vitro.

PubMed

Petzoldt, Svenja; Kahra, Dana; Kovermann, Michael; Dingeldein, Artur P G; Niemiec, Moritz S; Ådén, Jörgen; Wittung-Stafshede, Pernilla

2015-06-01

After Ctr1-mediated copper ion (Cu) entry into the human cytoplasm, chaperones Atox1 and CCS deliver Cu to P1B-type ATPases and to superoxide dismutase, respectively, via direct protein-protein interactions. Although the two Cu chaperones are presumed to work along independent pathways, we here assessed cross-reactivity between Atox1 and the first domain of CCS (CCS1) using biochemical and biophysical methods in vitro. By NMR we show that CCS1 is monomeric although it elutes differently from Atox1 in size exclusion chromatography (SEC). This property allows separation of Atox1 and CCS1 by SEC and, combined with the 254/280 nm ratio as an indicator of Cu loading, we demonstrate that Cu can be transferred from one protein to the other. Cu exchange also occurs with full-length CCS and, as expected, the interaction involves the metal binding sites since mutation of Cu-binding cysteine in Atox1 eliminates Cu transfer from CCS1. Cross-reactivity between CCS and Atox1 may aid in regulation of Cu distribution in the cytoplasm.

Impact of copper ligand mutations on a cupredoxin with a green copper center.

PubMed

Roger, Magali; Sciara, Giuliano; Biaso, Frédéric; Lojou, Elisabeth; Wang, Xie; Bauzan, Marielle; Giudici-Orticoni, Marie-Thérèse; Vila, Alejandro J; Ilbert, Marianne

2017-05-01

Mononuclear cupredoxins contain a type 1 copper center with a trigonal or tetragonal geometry usually maintained by four ligands, a cystein, two histidines and a methionine. The recent discovery of new members of this family with unusual properties demonstrates, however, the versatility of this class of proteins. Changes in their ligand set lead to drastic variation in their metal site geometry and in the resulting spectroscopic and redox features. In our work, we report the identification of the copper ligands in the recently discovered cupredoxin AcoP. We show that even though AcoP possesses a classical copper ligand set, it has a highly perturbed copper center. In depth studies of mutant's properties suggest a high degree of constraint existing in the copper center of the wild type protein and even the addition of exogenous ligands does not lead to the reconstitution of the initial copper center. Not only the chemical nature of the axial ligand but also constraints brought by its covalent binding to the protein backbone might be critical to maintain a green copper site with high redox potential. This work illustrates the importance of experimentally dissecting the molecular diversity of cupredoxins to determine the molecular determinants responsible for their copper center geometry and redox potential. Copyright © 2017 Elsevier B.V. All rights reserved.

The Cu(II) affinity of the N-terminus of human copper transporter CTR1: Comparison of human and mouse sequences.

PubMed

Bossak, Karolina; Drew, Simon C; Stefaniak, Ewelina; Płonka, Dawid; Bonna, Arkadiusz; Bal, Wojciech

2018-05-01

Copper Transporter 1 (CTR1) is a homotrimeric membrane protein providing the main route of copper transport into eukaryotic cells from the extracellular milieu. Its N-terminal extracellular domain, rich in His and Met residues, is considered responsible for directing copper into the transmembrane channel. Most of vertebrate CTR1 proteins contain the His residue in position three from N-terminus, creating a well-known Amino Terminal Cu(II)- and Ni(II)-Binding (ATCUN) site. CTR1 from humans, primates and many other species contains the Met-Asp-His (MDH) sequence, while some rodents including mouse have the Met-Asn-His (MNH) N-terminal sequence. CTR1 is thought to collect Cu(II) ions from blood copper transport proteins, including albumin, but previous reports indicated that the affinity of N-terminal peptide/domain of CTR1 is significantly lower than that of albumin, casting serious doubt on this aspect of CTR1 function. Using potentiometry and spectroscopic techniques we demonstrated that MDH-amide, a tripeptide model of human CTR1 N-terminus, binds Cu(II) with K of 1.3 × 10 13  M -1 at pH 7.4, ~13 times stronger than Human Serum Albumin (HSA), and MNH-amide is even stronger, K of 3.2 × 10 14  M -1 at pH 7.4. These results indicate that the N-terminus of CTR1 may serve as intermediate binding site during Cu(II) transfer from blood copper carriers to the transporter. MDH-amide, but not MNH-amide also forms a low abundance complex with non-ATCUN coordination involving the Met amine, His imidazole and Asp carboxylate. This species might assist Cu(II) relay down the peptide chain or its reduction to Cu(I), both steps necessary for the CTR1 function. Copyright © 2018 Elsevier Inc. All rights reserved.

Chronic copper exposure causes spatial memory impairment, selective loss of hippocampal synaptic proteins, and activation of PKR/eIF2α pathway in mice.

PubMed

Ma, Quan; Ying, Ming; Sui, Xiaojing; Zhang, Huimin; Huang, Haiyan; Yang, Linqing; Huang, Xinfeng; Zhuang, Zhixiong; Liu, Jianjun; Yang, Xifei

2015-01-01

Copper is an essential element for human growth and development; however, excessive intake of copper could contribute to neurotoxicity. Here we show that chronic exposure to copper in drinking water impaired spatial memory with simultaneous selective loss of hippocampal pre-synaptic protein synapsin 1, and post-synaptic density protein (PSD)-93/95 in mice. Copper exposure was shown to elevate the levels of nitrotyrosine and 8-hydroxydeoxyguanosine (8-OHdG) in hippocampus, two markers of oxidative stress. Concurrently, we also found that copper exposure activated double stranded RNA-dependent protein kinase (PKR) as evidenced by increased ratio of phosphorylated PKR at Thr451 and total PKR and increased the phosphorylation of its downstream signaling molecule eukaryotic initiation factor 2α (eIF2α) at Ser51 in hippocampus. Consistent with activation of PKR/eIF2α signaling pathway which was shown to mediate synaptic deficit and cognitive impairment, the levels of activating transcription factor 4 (ATF-4), a downstream signaling molecule of eIF2α and a repressor of CREB-mediated gene expression, were significantly increased, while the activity of cAMP response elements binding protein (CREB) was inactivated as suggested by decreased phosphorylation of CREB at Ser133 by copper exposure. In addition, the expression of the pro-apoptotic target molecule C/EBP homology protein (CHOP) of ATF-4 was upregulated and hippocampal neuronal apoptosis was induced by copper exposure. Taken together, we propose that chronic copper exposure might cause spatial memory impairment, selective loss of synaptic proteins, and neuronal apoptosis through the mechanisms involving activation of PKR/eIF2α signaling pathway.

Global response of Acidithiobacillus ferrooxidans ATCC 53993 to high concentrations of copper: A quantitative proteomics approach.

PubMed

Martínez-Bussenius, Cristóbal; Navarro, Claudio A; Orellana, Luis; Paradela, Alberto; Jerez, Carlos A

2016-08-11

Acidithiobacillus ferrooxidans is used in industrial bioleaching of minerals to extract valuable metals. A. ferrooxidans strain ATCC 53993 is much more resistant to copper than other strains of this microorganism and it has been proposed that genes present in an exclusive genomic island (GI) of this strain would contribute to its extreme copper tolerance. ICPL (isotope-coded protein labeling) quantitative proteomics was used to study in detail the response of this bacterium to copper. A high overexpression of RND efflux systems and CusF copper chaperones, both present in the genome and the GI of strain ATCC 53993 was found. Also, changes in the levels of the respiratory system proteins such as AcoP and Rus copper binding proteins and several proteins with other predicted functions suggest that numerous metabolic changes are apparently involved in controlling the effects of the toxic metal on this acidophile. Using quantitative proteomics we overview the adaptation mechanisms that biomining acidophiles use to stand their harsh environment. The overexpression of several genes present in an exclusive genomic island strongly suggests the importance of the proteins coded in this DNA region in the high tolerance of A. ferrooxidans ATCC 53993 to metals. Copyright © 2016 Elsevier B.V. All rights reserved.

Structural effects of Cu(II)-coordination in the octapeptide region of the human prion protein.

PubMed

Riihimäki, Eva-Stina; Martínez, José Manuel; Kloo, Lars

2008-05-14

The copper-binding ability of the prion protein is thought to be central to its function. The structural effects of copper coordination in the octapeptide region of the human prion protein have been investigated by molecular dynamics simulations. Simulations were performed with the apo state, in order to investigate the behavior of the region without copper ions, as well as with the octapeptide region in the presence of copper ions. While the structure of the apo state is greatly influenced by the interaction between the rings in the histidine, tryptophan and proline residues, the region shows evidence of highly ordered coordination sites in the presence of copper ions. The position of the tryptophan indole ring is stabilized by cation-pi interactions. Two stable orientations of the indole ring with respect to the equatorial coordination plane of copper were observed, which showed that the indole ring can reside on both sides of the coordination plane. The interaction with the indole ring was found to occur without a mediating axial water molecule.

Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

PubMed

Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

1992-05-05

Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

Molecular Cloning and Characteristic Features of a Novel Extracellular Tyrosinase from Aspergillus niger PA2.

PubMed

Agarwal, Pragati; Singh, Jyoti; Singh, R P

2017-05-01

Aspergillus niger PA2, a novel strain isolated from waste effluents of food industry, is a potential extracellular tyrosinase producer. Enzyme activity and L-DOPA production were maximum when glucose and peptone were employed as C source and nitrogen source respectively in the medium and enhanced notably when the copper was supplemented, thus depicting the significance of copper in tyrosinase activity. Tyrosinase-encoding gene from the fungus was cloned, and amplification of the tyrosinase gene yielded a 1127-bp DNA fragment and 374 amino acid residue long product that encoded for a predicted protein of 42.3 kDa with an isoelectric point of 4.8. Primary sequence analysis of A. niger PA2 tyrosinase had shown that it had approximately 99% identity with that of A. niger CBS 513.88, which was further confirmed by phylogenetic analysis. The inferred amino acid sequence of A. niger tyrosinase contained two putative copper-binding sites comprising of six histidines, a characteristic feature for type-3 copper proteins, which were highly conserved in all tyrosinases throughout the Aspergillus species. When superimposed onto the tertiary structure of A. oryzae tyrosinase, the conserved residues from both the organisms occupied same spatial positions to provide a di-copper-binding peptide groove.

Spectroscopy of Cu(II)-PcoC and the multicopper oxidase function of PcoA, two essential components of Escherichia coli pco copper resistance operon.

PubMed

Huffman, David L; Huyett, Jennifer; Outten, F Wayne; Doan, Peter E; Finney, Lydia A; Hoffman, Brian M; O'Halloran, Thomas V

2002-08-06

The plasmid-encoded pco copper resistance operon in Escherichia coli consists of seven genes that are expressed from two pco promoters in response to elevated copper; however, little is known about how they mediate resistance to excess environmental copper. Two of the genes encode the soluble periplasmic proteins PcoA and PcoC. We show here that inactivation of PcoC, and PcoA to a lesser extent, causes cells to become more sensitive to copper than wild-type nonresistant strains, consistent with a tightly coupled detoxification pathway. Periplasmic extracts show copper-inducible oxidase activity, attributed to the multicopper oxidase function of PcoA. PcoC, a much smaller protein than PcoA, binds one Cu(II) and exhibits a weak electronic transition characteristic of a type II copper center. ENDOR and ESEEM spectroscopy of Cu(II)-PcoC and the (15)N- and Met-CD(3)-labeled samples are consistent with a tetragonal ligand environment of three nitrogens and one aqua ligand "in the plane". A weakly associated S-Met and aqua are likely axial ligands. At least one N is a histidine and is likely trans to the in-plane aqua ligand. The copper chemistry of PcoC and the oxidase function of PcoA are consistent with the emerging picture of the chromosomally encoded copper homeostasis apparatus in the E. coli cell envelope [Outten, F. W., Huffman, D. L., Hale, J. A., and O'Halloran, T. V. (2001) J. Biol. Chem. 276, 30670-30677]. We propose a model for the plasmid system in which Cu(I)-PcoC functions in this copper efflux pathway as a periplasmic copper binding protein that docks with the multiple repeats of Met-rich domains in PcoA to effect oxidation of Cu(I) to the less toxic Cu(II) form. The solvent accessibility of the Cu(II) in PcoC may allow for metal transfer to other plasmid and chromosomal factors and thus facilitate removal of Cu(II) from the cell envelope.

Effect of dietary copper addition on lipid metabolism in rabbits

PubMed Central

Lei, Liu; Xiaoyi, Sui; Fuchang, Li

2017-01-01

ABSTRACT The present study was conducted to investigate the effect of copper supplementation on lipid metabolism in rabbits. Our study showed dietary copper addition (5-45 mg/kg) increased body mass gain, but decreased fat and liver weights compared with those in the control group (P < 0.05). Copper (45 mg/kg) addition significantly increased the skeletal muscle weight, but inhibited cytoplasmic lipid accumulation in liver, skeletal muscle and adipose tissue (P < 0.05). Compared with the control group, dietary copper addition (45 mg/kg) significantly increased plasma triglyceride levels but decreased very low density lipoprotein levels (P < 0.05). Copper treatment significantly increased gene expression of carnitine palmitoyltransferase (CPT) 1, CPT2 and peroxisome proliferator-activated receptor (PPAR) a in liver (P < 0.05). In skeletal muscle, CPT1, CPT2, fatty acid transport protein, fatty acid-binding protein, and PPARa mRNA as well as phosphorylated AMP-activated protein kinase (AMPK) levels were significantly up-regulated by copper treatment (P < 0.05). Rabbits receiving copper supplementation had higher CPT1, CPT2, PPARa and hormone-sensitive lipase mRNA levels in adipose tissue (P < 0.05). In conclusion, copper promoted skeletal muscle growth and reduced fat accretion. PPARa signaling in liver, skeletal muscle and adipose tissues and AMPK signaling in skeletal muscle tissue were involved in the regulation of lipid metabolism by copper. PMID:28747869

Characterization studies on cadmium-mycophosphatin from the mushroom Agaricus macrosporus.

PubMed Central

Meisch, H U; Schmitt, J A

1986-01-01

A low molecular weight Cd-binding phosphoglycoprotein, cadmium-mycophosphatin, has been isolated from the mushroom Agaricus macrosporus. This protein has a molecular weight of 12,000 dalton and contains no sulfur but a high amount of acid amino acids (Glu, Asp), and carbohydrates (glucose, galactose). Cadmium-mycophosphatin has an isoelectric point less than pH 2, binds cadmium with a dissociation constant of KD = 1.59 X 10 M (pKD = 6.8) and is saturated with 13.5 mole Cd/mole, all Cd-binding sites being equivalent. It is suggested that Cd is bound by phosphoserine groups, similar relations being known from calcium-binding proteins in animals. From A. macrosporus four other low-molecular weight glycoproteins have been isolated which contain sulfur and bind cadmium and copper. The biological significance of these Cd-binding proteins is discussed. PMID:3709455

Hemoglobin and Myoglobin as Reducing Agents in Biological Systems. Redox Reactions of Globins with Copper and Iron Salts and Complexes.

PubMed

Postnikova, G B; Shekhovtsova, E A

2016-12-01

In addition to reversible O2 binding, respiratory proteins of the globin family, hemoglobin (Hb) and myoglobin (Mb), participate in redox reactions with various metal complexes, including biologically significant ones, such as those of copper and iron. HbO 2 and MbO 2 are present in cells in large amounts and, as redox agents, can contribute to maintaining cell redox state and resisting oxidative stress. Divalent copper complexes with high redox potentials (E 0 , 200-600 mV) and high stability constants, such as [Cu(phen) 2 ] 2+ , [Cu(dmphen) 2 ] 2+ , and CuDTA oxidize ferrous heme proteins by the simple outer-sphere electron transfer mechanism through overlapping π-orbitals of the heme and the copper complex. Weaker oxidants, such as Cu2+, CuEDTA, CuNTA, CuCit, CuATP, and CuHis (E 0 ≤ 100-150 mV) react with HbO 2 and MbO 2 through preliminary binding to the protein with substitution of the metal ligands with protein groups and subsequent intramolecular electron transfer in the complex (the site-specific outer-sphere electron transfer mechanism). Oxidation of HbO 2 and MbO 2 by potassium ferricyanide and Fe(3) complexes with NTA, EDTA, CDTA, ATP, 2,3-DPG, citrate, and pyrophosphate PP i proceeds mainly through the simple outer-sphere electron transfer mechanism via the exposed heme edge. According to Marcus theory, the rate of this reaction correlates with the difference in redox potentials of the reagents and their self-exchange rates. For charged reagents, the reaction may be preceded by their nonspecific binding to the protein due to electrostatic interactions. The reactions of LbO 2 with carboxylate Fe complexes, unlike its reactions with ferricyanide, occur via the site-specific outer-sphere electron transfer mechanism, even though the same reagents oxidize structurally similar MbO 2 and cytochrome b 5 via the simple outer-sphere electron transfer mechanism. Of particular biological interest is HbO 2 and MbO 2 transformation into met-forms in the presence of small amounts of metal ions or complexes (catalysis), which, until recently, had been demonstrated only for copper compounds with intermediate redox potentials. The main contribution to the reaction rate comes from copper binding to the "inner" histidines, His97 (0.66 nm from the heme) that forms a hydrogen bond with the heme propionate COO - group, and the distal His64. The affinity of both histidines for copper is much lower than that of the surface histidines residues, and they are inaccessible for modification with chemical reagents. However, it was found recently that the high-potential Fe(3) complex, potassium ferricyanide (400 mV), at a 5 to 20% of molar protein concentration can be an efficient catalyst of MbO 2 oxidation into metMb. The catalytic process includes binding of ferrocyanide anion in the region of the His119 residue due to the presence there of a large positive local electrostatic potential and existence of a "pocket" formed by Lys16, Ala19, Asp20, and Arg118 that is sufficient to accommodate [Fe(CN) 6 ] 4- . Fast, proton-assisted reoxidation of the bound ferrocyanide by oxygen (which is required for completion of the catalytic cycle), unlike slow [Fe(CN) 6 ] 4- oxidation in solution, is provided by the optimal location of neighboring protonated His113 and His116, as it occurs in the enzyme active site.

New copper resistance determinants in the extremophile acidithiobacillus ferrooxidans: a quantitative proteomic analysis.

PubMed

Almárcegui, Rodrigo J; Navarro, Claudio A; Paradela, Alberto; Albar, Juan Pablo; von Bernath, Diego; Jerez, Carlos A

2014-02-07

Acidithiobacillus ferrooxidans is an extremophilic bacterium used in biomining processes to recover metals. The presence in A. ferrooxidans ATCC 23270 of canonical copper resistance determinants does not entirely explain the extremely high copper concentrations this microorganism is able to stand, suggesting the existence of other efficient copper resistance mechanisms. New possible copper resistance determinants were searched by using 2D-PAGE, real time PCR (qRT-PCR) and quantitative proteomics with isotope-coded protein labeling (ICPL). A total of 594 proteins were identified of which 120 had altered levels in cells grown in the presence of copper. Of this group of proteins, 76 were up-regulated and 44 down-regulated. The up-regulation of RND-type Cus systems and different RND-type efflux pumps was observed in response to copper, suggesting that these proteins may be involved in copper resistance. An overexpression of most of the genes involved in histidine synthesis and several of those annotated as encoding for cysteine production was observed in the presence of copper, suggesting a possible direct role for these metal-binding amino acids in detoxification. Furthermore, the up-regulation of putative periplasmic disulfide isomerases was also seen in the presence of copper, suggesting that they restore copper-damaged disulfide bonds to allow cell survival. Finally, the down-regulation of the major outer membrane porin and some ionic transporters was seen in A. ferrooxidans grown in the presence of copper, indicating a general decrease in the influx of the metal and other cations into the cell. Thus, A. ferrooxidans most likely uses additional copper resistance strategies in which cell envelope proteins are key components. This knowledge will not only help to understand the mechanism of copper resistance in this extreme acidophile but may help also to select the best fit members of the biomining community to attain more efficient industrial metal leaching processes.

Structural and Biochemical Characterization of a Copper-Binding Mutant of the Organomercurial Lyase MerB: Insight into the Key Role of the Active Site Aspartic Acid in Hg-Carbon Bond Cleavage and Metal Binding Specificity.

PubMed

Wahba, Haytham M; Lecoq, Lauriane; Stevenson, Michael; Mansour, Ahmed; Cappadocia, Laurent; Lafrance-Vanasse, Julien; Wilkinson, Kevin J; Sygusch, Jurgen; Wilcox, Dean E; Omichinski, James G

2016-02-23

In bacterial resistance to mercury, the organomercurial lyase (MerB) plays a key role in the detoxification pathway through its ability to cleave Hg-carbon bonds. Two cysteines (C96 and C159; Escherichia coli MerB numbering) and an aspartic acid (D99) have been identified as the key catalytic residues, and these three residues are conserved in all but four known MerB variants, where the aspartic acid is replaced with a serine. To understand the role of the active site serine, we characterized the structure and metal binding properties of an E. coli MerB mutant with a serine substituted for D99 (MerB D99S) as well as one of the native MerB variants containing a serine residue in the active site (Bacillus megaterium MerB2). Surprisingly, the MerB D99S protein copurified with a bound metal that was determined to be Cu(II) from UV-vis absorption, inductively coupled plasma mass spectrometry, nuclear magnetic resonance, and electron paramagnetic resonance studies. X-ray structural studies revealed that the Cu(II) is bound to the active site cysteine residues of MerB D99S, but that it is displaced following the addition of either an organomercurial substrate or an ionic mercury product. In contrast, the B. megaterium MerB2 protein does not copurify with copper, but the structure of the B. megaterium MerB2-Hg complex is highly similar to the structure of the MerB D99S-Hg complexes. These results demonstrate that the active site aspartic acid is crucial for both the enzymatic activity and metal binding specificity of MerB proteins and suggest a possible functional relationship between MerB and its only known structural homologue, the copper-binding protein NosL.

Copper coordination in the Glycine receptor by electron spin resonance

NASA Astrophysics Data System (ADS)

Ruthstein, Sharon; Stone, Katherine; Cascio, Michael; Saxena, Sunil

2009-03-01

We describe the use of Electron Spin Resonance (ESR) to identify the coordination environment of copper in the extracellular domain of the protein, as well as the number of copper atoms that bind to Glycine receptor (GlyR). The GlyR channel mediates inhibitory neurotransmission in the central nervous system. It belongs to the superfamily of nicotincoid receptors. These receptors are formed by pentameric arrangement of subunits, each sharing a common topology having a large extracellular domain (ECD) and a transmembrane (TM) domain comprised of four membrane-spanning segments (TM1-TM4). For GlyR, four subunits (1-4) and one subunit have been identified to date, although the homomeric expression of just the α1 subunit of GlyR is sufficient to reconstitute native-like activity. The results are expected to shed light on the role of metals ion in modulating ion permeation in such receptor. In addition, an identification of copper binding sites will allow the measurement of large range distance constraints in the receptor by pulsed ESR. Such structural information on the GlyR in various allosteric states is essential in order to shed light on the gating mechanism of this protein membrane.

Spectroscopic Characterization of a Green Copper Site in a Single-Domain Cupredoxin

PubMed Central

Roger, Magali; Biaso, Frédéric; Castelle, Cindy J.; Bauzan, Marielle; Chaspoul, Florence; Lojou, Elisabeth; Sciara, Giuliano; Caffarri, Stefano; Giudici-Orticoni, Marie-Thérèse; Ilbert, Marianne

2014-01-01

Cupredoxins are widespread copper-binding proteins, mainly involved in electron transfer pathways. They display a typical rigid greek key motif consisting of an eight stranded β-sandwich. A fascinating feature of cupredoxins is the natural diversity of their copper center geometry. These geometry variations give rise to drastic changes in their color, such as blue, green, red or purple. Based on several spectroscopic and structural analyses, a connection between the geometry of their copper-binding site and their color has been proposed. However, little is known about the relationship between such diversity of copper center geometry in cupredoxins and possible implications for function. This has been difficult to assess, as only a few naturally occurring green and red copper sites have been described so far. We report herein the spectrocopic characterization of a novel kind of single domain cupredoxin of green color, involved in a respiratory pathway of the acidophilic organism Acidithiobacillus ferrooxidans. Biochemical and spectroscopic characterization coupled to bioinformatics analysis reveal the existence of some unusual features for this novel member of the green cupredoxin sub-family. This protein has the highest redox potential reported to date for a green-type cupredoxin. It has a constrained green copper site insensitive to pH or temperature variations. It is a green-type cupredoxin found for the first time in a respiratory pathway. These unique properties might be explained by a region of unknown function never found in other cupredoxins, and by an unusual length of the loop between the second and the fourth copper ligands. These discoveries will impact our knowledge on non-engineered green copper sites, whose involvement in respiratory chains seems more widespread than initially thought. PMID:24932914

Spectroscopic characterization of a green copper site in a single-domain cupredoxin.

PubMed

Roger, Magali; Biaso, Frédéric; Castelle, Cindy J; Bauzan, Marielle; Chaspoul, Florence; Lojou, Elisabeth; Sciara, Giuliano; Caffarri, Stefano; Giudici-Orticoni, Marie-Thérèse; Ilbert, Marianne

2014-01-01

Cupredoxins are widespread copper-binding proteins, mainly involved in electron transfer pathways. They display a typical rigid greek key motif consisting of an eight stranded β-sandwich. A fascinating feature of cupredoxins is the natural diversity of their copper center geometry. These geometry variations give rise to drastic changes in their color, such as blue, green, red or purple. Based on several spectroscopic and structural analyses, a connection between the geometry of their copper-binding site and their color has been proposed. However, little is known about the relationship between such diversity of copper center geometry in cupredoxins and possible implications for function. This has been difficult to assess, as only a few naturally occurring green and red copper sites have been described so far. We report herein the spectrocopic characterization of a novel kind of single domain cupredoxin of green color, involved in a respiratory pathway of the acidophilic organism Acidithiobacillus ferrooxidans. Biochemical and spectroscopic characterization coupled to bioinformatics analysis reveal the existence of some unusual features for this novel member of the green cupredoxin sub-family. This protein has the highest redox potential reported to date for a green-type cupredoxin. It has a constrained green copper site insensitive to pH or temperature variations. It is a green-type cupredoxin found for the first time in a respiratory pathway. These unique properties might be explained by a region of unknown function never found in other cupredoxins, and by an unusual length of the loop between the second and the fourth copper ligands. These discoveries will impact our knowledge on non-engineered green copper sites, whose involvement in respiratory chains seems more widespread than initially thought.

Copper Homeostasis as a Therapeutic Target in Amyotrophic Lateral Sclerosis with SOD1 Mutations

PubMed Central

Tokuda, Eiichi; Furukawa, Yoshiaki

2016-01-01

Amyotrophic lateral sclerosis (ALS) is a lethal neurodegenerative disease affecting both upper and lower motor neurons, and currently, there is no cure or effective treatment. Mutations in a gene encoding a ubiquitous antioxidant enzyme, Cu,Zn-superoxide dismutase (SOD1), have been first identified as a cause of familial forms of ALS. It is widely accepted that mutant SOD1 proteins cause the disease through a gain in toxicity but not through a loss of its physiological function. SOD1 is a major copper-binding protein and regulates copper homeostasis in the cell; therefore, a toxicity of mutant SOD1 could arise from the disruption of copper homeostasis. In this review, we will briefly review recent studies implying roles of copper homeostasis in the pathogenesis of SOD1-ALS and highlight the therapeutic interventions focusing on pharmacological as well as genetic regulations of copper homeostasis to modify the pathological process in SOD1-ALS. PMID:27136532

Copper Homeostasis as a Therapeutic Target in Amyotrophic Lateral Sclerosis with SOD1 Mutations.

PubMed

Tokuda, Eiichi; Furukawa, Yoshiaki

2016-04-28

Amyotrophic lateral sclerosis (ALS) is a lethal neurodegenerative disease affecting both upper and lower motor neurons, and currently, there is no cure or effective treatment. Mutations in a gene encoding a ubiquitous antioxidant enzyme, Cu,Zn-superoxide dismutase (SOD1), have been first identified as a cause of familial forms of ALS. It is widely accepted that mutant SOD1 proteins cause the disease through a gain in toxicity but not through a loss of its physiological function. SOD1 is a major copper-binding protein and regulates copper homeostasis in the cell; therefore, a toxicity of mutant SOD1 could arise from the disruption of copper homeostasis. In this review, we will briefly review recent studies implying roles of copper homeostasis in the pathogenesis of SOD1-ALS and highlight the therapeutic interventions focusing on pharmacological as well as genetic regulations of copper homeostasis to modify the pathological process in SOD1-ALS.

The structural flexibility of the human copper chaperone Atox1: Insights from combined pulsed EPR studies and computations.

PubMed

Levy, Ariel R; Turgeman, Meital; Gevorkyan-Aiapetov, Lada; Ruthstein, Sharon

2017-08-01

Metallochaperones are responsible for shuttling metal ions to target proteins. Thus, a metallochaperone's structure must be sufficiently flexible both to hold onto its ion while traversing the cytoplasm and to transfer the ion to or from a partner protein. Here, we sought to shed light on the structure of Atox1, a metallochaperone involved in the human copper regulation system. Atox1 shuttles copper ions from the main copper transporter, Ctr1, to the ATP7b transporter in the Golgi apparatus. Conventional biophysical tools such as X-ray or NMR cannot always target the various conformational states of metallochaperones, owing to a requirement for crystallography or low sensitivity and resolution. Electron paramagnetic resonance (EPR) spectroscopy has recently emerged as a powerful tool for resolving biological reactions and mechanisms in solution. When coupled with computational methods, EPR with site-directed spin labeling and nanoscale distance measurements can provide structural information on a protein or protein complex in solution. We use these methods to show that Atox1 can accommodate at least four different conformations in the apo state (unbound to copper), and two different conformations in the holo state (bound to copper). We also demonstrate that the structure of Atox1 in the holo form is more compact than in the apo form. Our data provide insight regarding the structural mechanisms through which Atox1 can fulfill its dual role of copper binding and transfer. © 2017 The Protein Society.

Copper import in Escherichia coli by the yersiniabactin metallophore system

PubMed Central

Koh, Eun-Ik; Robinson, Anne E.; Bandara, Nilantha; Rogers, Buck E.; Henderson, Jeffrey P.

2017-01-01

Copper plays a dual role as nutrient and toxin during bacterial infections. While uropathogenic Escherichia coli (UPEC) strains can use the copper-binding metallophore yersiniabactin (Ybt) to resist copper toxicity, Ybt also converts bioavailable copper to Cu(II)-Ybt in low copper conditions. Although E. coli have long been considered to lack a copper import pathway, we observed Ybt-mediated copper import in UPEC using canonical Fe(III)-Ybt transport proteins. UPEC removed copper from Cu(II)-Ybt with subsequent re-export of metal-free Ybt to the extracellular space. Copper released through this process became available to an E. coli cuproenzyme (the amine oxidase TynA), linking this import pathway to a nutrient acquisition function. Ybt-expressing E. coli thus engage in nutritional passivation, a strategy of minimizing a metal ion's toxicity while preserving its nutritional availability. Copper acquisition through this process may contribute to the marked virulence defect of Ybt transport-deficient UPEC. PMID:28759019

Quantum Simulations of Solvated Biomolecules Using Hybrid Methods

NASA Astrophysics Data System (ADS)

Hodak, Miroslav

2009-03-01

One of the most important challenges in quantum simulations on biomolecules is efficient and accurate inclusion of the solvent, because the solvent atoms usually outnumber those in the biomolecule of interest. We have developed a hybrid method that allows for explicit quantum-mechanical treatment of the solvent at low computational cost. In this method, Kohn-Sham (KS) density functional theory (DFT) is combined with an orbital-free (OF) DFT. Kohn-Sham (KS) DFT is used to describe the biomolecule and its first solvation shells, while the orbital-free (OF) DFT is employed for the rest of the solvent. The OF part is fully O(N) and capable of handling 10^5 solvent molecules on current parallel supercomputers, while taking only ˜ 10 % of the total time. The compatibility between the KS and OF DFT methods enables seamless integration between the two. In particular, the flow of solvent molecules across the KS/OF interface is allowed and the total energy is conserved. As the first large-scale applications, the hybrid method has been used to investigate the binding of copper ions to proteins involved in prion (PrP) and Parkinson's diseases. Our results for the PrP, which causes mad cow disease when misfolded, resolve a contradiction found in experiments, in which a stronger binding mode is replaced by a weaker one when concentration of copper ions is increased, and show how it can act as a copper buffer. Furthermore, incorporation of copper stabilizes the structure of the full-length PrP, suggesting its protective role in prion diseases. For alpha-synuclein, a Parkinson's disease (PD) protein, we show that Cu binding modifies the protein structurally, making it more susceptible to misfolding -- an initial step in the onset of PD. In collaboration with W. Lu, F. Rose and J. Bernholc.

An Angular Overlap Model for Cu(II) Ion in the AMOEBA Polarizable Force Field

PubMed Central

Xiang, Jin Yu; Ponder, Jay W.

2014-01-01

An extensible polarizable force field for transition metal ion was developed based on AMOEBA and the angular overlap model (AOM) with consistent treatment of electrostatics for all atoms. Parameters were obtained by fitting molecular mechanics (MM) energies to various ab initio gas-phase calculations. The results of parameterization were presented for copper (II) ion ligated to water and model fragments of amino acid residues involved in the copper binding sites of type 1 copper proteins. Molecular dynamics (MD) simulations were performed on aqueous copper (II) ion at various temperatures, as well as plastocyanin (1AG6) and azurin (1DYZ). Results demonstrated that the AMOEBA-AOM significantly improves the accuracy of classical MM in a number of test cases when compared to ab initio calculations. The Jahn-Teller distortion for hexa-aqua copper (II) complex was handled automatically without specifically designating axial and in-plane ligands. Analyses of MD trajectories resulted in a 6-coordination first solvation shell for aqueous copper (II) ion and a 1.8ns average residence time of water molecules. The ensemble average geometries of 1AG6 and 1DYZ copper binding sites were in general agreement with X-ray and previous computational studies. PMID:25045338

Immobilized metal ion affinity electrophoresis. A study with several model proteins containing histidine.

PubMed

Goubran-Botros, H; Nanak, E; Abdul Nour, J; Birkenmeir, G; Vijayalakshmi, M A

1992-04-24

Immobilized metal ion affinity electrophoresis (IMA-Elec) is one among the many methods derived from the immobilized metal ion affinity chromatography. Two approaches for incorporating the metal ligand, were studied. One was in the form of insoluble particulate material based on Sepharose 6B and the other in the form of soluble polymer based on polyethylene glycol (PEG) 5000. Both the polymers coupled with iminodiacetate and metallized with copper or zinc were used as ligands, incorporated into soluble agarose as the electrophoretic gel. Several histidine-containing model proteins were studied with both the systems and their metal binding strengths were determined as the dissociation constants, Kd. The results clearly demonstrated that the mechanism of protein recognition by immobilized copper or zinc via the accessible histidyl residues was maintained in the IMA-Elec system. Proteins with increasing numbers of histidine residues showed increasing binding strength (lower Kd values). While this basic mechanism was conserved, the supporting polymers (Sepharose 6B and the PEG 5000) showed significant differences in the metal binding to the protein. The polysaccharide Sepharose 6B enhanced the binding strength compared with PEG 5000. The optimum electrophoretic parameters were determined to be current intensities up to 20 mA and pH ca. 7.0. At pH greater than 8.0, a significant decrease in the affinity was observed, this decrease being greater with PEG 5000 than Sepharose 6B as supporting material.

Characterization studies on cadmium-mycophosphatin from the mushroom Agaricus macrosporus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meisch, H.U.; Schmitt, J.A.

A low molecular weight Cd-binding phosphoglycoprotein, cadmium-mycophosphatin, has been isolated from the mushroom Agaricus macrosporus. This protein has a molecular weight of 12,000 dalton and contains no sulfur but a high amount of acid amino acids (Glu, Asp), and carbohydrates (glucose, galactose). Cadmium-mycophosphatin has an isoelectric point less than pH 2, binds cadmium with a dissociation constant of K/sub D/ = 1.59 x 10 M (pK/sub D/ = 6.8) and is saturated with 13.5 mole Cd/mole, all Cd-binding sites being equivalent. It is suggested that Cd is bound by phosphoserine groups, similar relations being known from calcium-binding proteins in animals.more » From A. macrosporus four other low-molecular weight glycoproteins have been isolated which contain sulfur and bind cadmium and copper. The biological significance of these Cd-binding proteins is discussed.« less

The N-terminus of the human copper transporter 1 (hCTR1) is localized extracellularly, and interacts with itself.

PubMed Central

Klomp, Adriana E M; Juijn, Jenneke A; van der Gun, Linda T M; van den Berg, Inge E T; Berger, Ruud; Klomp, Leo W J

2003-01-01

We have used indirect immunofluorescense studies and glycosylation-site insertion and deletion mapping to characterize the topology of human copper transporter 1 (hCTR1), the putative human high-affinity copper-import protein. Both approaches indicated that hCTR1 contains three transmembrane domains and that the N-terminus of hCTR1, which contains several putative copper-binding sites, is localized extracellularly, whereas the C-terminus is exposed to the cytosol. Based on previous observations that CTR1 proteins form high-molecular-mass complexes, we investigated directly whether CTR1 proteins interact with themselves. Yeast two-hybrid studies showed that interaction of yeast, mouse, rat and human CTR1 occurs at the sites of their N-terminal domains, and is not dependent on the copper concentration in the growth media. Analysis of deletion constructs indicated that multiple regions in the N-terminus are essential for this self-interaction. In contrast, the N-terminal tail of the presumed low-affinity copper transporter, hCTR2, does not interact with itself. Taken together, these results suggest that CTR1 spans the membrane at least six times, permitting formation of a channel, which is consistent with its proposed role as a copper transporter. PMID:12466020

The delivery of copper for thylakoid import observed by NMR

PubMed Central

Banci, Lucia; Bertini, Ivano; Ciofi-Baffoni, Simone; Kandias, Nikolaos G.; Robinson, Nigel J.; Spyroulias, Georgios A.; Su, Xun-Cheng; Tottey, Stephen; Vanarotti, Murugendra

2006-01-01

The thylakoid compartments of plant chloroplasts are a vital destination for copper. Copper is needed to form holo-plastocyanin, which must shuttle electrons between photosystems to convert light into biologically useful chemical energy. Copper can bind tightly to proteins, so it has been hypothesized that copper partitions onto ligand-exchange pathways to reach intracellular locations without inflicting damage en route. The copper metallochaperone Atx1 of chloroplast-related cyanobacteria (ScAtx1) engages in bacterial two-hybrid interactions with N-terminal domains of copper-transporting ATPases CtaA (cell import) and PacS (thylakoid import). Here we visualize copper delivery. The N-terminal domain PacSN has a ferredoxin-like fold that forms copper-dependent heterodimers with ScAtx1. Removal of copper, by the addition of the cuprous-ion chelator bathocuproine disulfonate, disrupts this heterodimer, as shown from a reduction of the overall tumbling rate of the protein mixture. The NMR spectral changes of the heterodimer versus the separate proteins reveal that loops 1, 3, and 5 (the carboxyl tail) of the ScAtx1 Cu(I) site switch to an apo-like configuration in the heterodimer. NMR data (2JNH couplings in the imidazole ring of 15N ScAtx1 His-61) also show that His-61, bound to copper(I) in [Cu(I)ScAtx1]2, is not coordinated to copper in the heterodimer. A model for the PacSN/Cu(I)/ScAtx1 complex is presented. Contact with PacSN induces change to the ScAtx1 copper-coordination sphere that drives copper release for thylakoid import. These data also elaborate on the mechanism to keep copper(I) out of the ZiaAN ATPase zinc sites. PMID:16707580

Transcuprein is a Macroglobulin Regulated by Copper and Iron Availability

PubMed Central

Liu, Nanmei; Lo, Louis Shi-li; Askary, S. Hassan; Jones, LaTrice; Kidane, Theodros Z.; Nguyen, Trisha Trang Minh; Goforth, Jeremy; Chu, Yu-Hsiang; Vivas, Esther; Tsai, Monta; Westbrook, Terence; Linder, Maria C.

2009-01-01

SUMMARY Transcuprein is a high affinity copper carrier in the plasma involved in the initial distribution of copper entering the blood from the digestive tract. To identify and obtain cDNA for this protein, it was purified from rat plasma by size exclusion and copper chelate affinity chromatography, and amino acid sequences were obtained. These revealed a 190 kDa glycosylated protein identified as the macroglobulin, α1inhibitorIII, the main macroglobulin of rodent blood plasma. Albumin (65 kDa) co-purified in variable amounts and was concluded to be a contaminant (although it transiently can bind the macroglobulin). The main macroglobulin in human blood plasma (α2-macroglobulin), homologous to α1inhibitorIII, also bound copper tightly. Expression of α1I3 (transcuprein) mRNA by the liver was examined in rats with and without copper deficiency, using quantitative PCR and Northern analysis. Protein expression was examined by Western blotting. Deficient rats with 40% less ceruloplasmin oxidase activity and liver copper concentrations expressed about twice as much α1I3 mRNA, but circulating levels of transcuprein did not differ. Iron deficiency, which increased liver copper concentrations 3-fold, reduced transcuprein mRNA expression and 7circulating levels of transcuprein relative to what occurred in rats with normal or excess iron. We conclude that transcupreins are specific macroglobulins that not only carry zinc but also transport copper in the blood; and that their expression can be modulated by copper and iron availability. PMID:17363239

A Purple Cupredoxin from Nitrosopumilus maritimus Containing a Mononuclear Type 1 Copper Center with an Open Binding Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hosseinzadeh, Parisa; Tian, Shiliang; Marshall, Nicholas M.

2016-05-25

Mononuclear cupredoxin proteins usually contain a coordinately saturated type 1 copper (T1Cu) center and function exclusively as electron carriers. Here we report a cupredoxin isolated from the nitrifying archaeon Nitrosopumilus maritimus SCM1, called Nmar1307, that contains a T1Cu center with an open binding site containing water. It displays a deep purple color due to strong absorptions around 413 nm (1880 M –1 cm –1) and 558 nm (2290 M –1 cm –1) in the UV–vis electronic spectrum. EPR studies suggest the protein contains two Cu(II) species of nearly equal population, one nearly axial, with hyperfine constant A∥ = 98 ×more » 10 –4 cm –1, and another more rhombic, with a smaller A∥ value of 69 × 10 –4 cm –1. The X-ray crystal structure at 1.6 Å resolution confirms that it contains a Cu atom coordinated by two His and one Cys in a trigonal plane, with an axial H2O at 2.25 Å. Both UV–vis absorption and EPR spectroscopic studies suggest that the Nmar1307 can oxidize NO to nitrite, an activity that is attributable to the high reduction potential (354 mV vs SHE) of the copper site. These results suggest that mononuclear cupredoxins can have a wide range of structural features, including an open binding site containing water, making this class of proteins even more versatile.« less

Inhibition of cyclin-dependent kinase CDK1 by oxindolimine ligands and corresponding copper and zinc complexes.

PubMed

Miguel, Rodrigo Bernardi; Petersen, Philippe Alexandre Divina; Gonzales-Zubiate, Fernando A; Oliveira, Carla Columbano; Kumar, Naresh; do Nascimento, Rafael Rodrigues; Petrilli, Helena Maria; da Costa Ferreira, Ana Maria

2015-10-01

Oxindolimine-copper(II) and zinc(II) complexes that previously have shown to induce apoptosis, with DNA and mitochondria as main targets, exhibit here significant inhibition of kinase CDK1/cyclin B protein. Copper species are more active than the corresponding zinc, and the free ligand shows to be less active, indicating a major influence of coordination in the process, and a further modulation by the coordinated ligand. Molecular docking and classical molecular dynamics provide a better understanding of the effectiveness and kinase inhibition mechanism by these compounds, showing that the metal complex provides a stronger interaction than the free ligand with the ATP-binding site. The metal ion introduces charge in the oxindole species, giving it a more rigid conformation that then becomes more effective in its interactions with the protein active site. Analogous experiments resulted in no significant effect regarding phosphatase inhibition. These results can explain the cytotoxicity of these metal complexes towards different tumor cells, in addition to its capability of binding to DNA, and decreasing membrane potential of mitochondria.

Heavy metal-binding proteins from metal-stimulated bacteria as a novel adsorbent for metal removal technology.

PubMed

Sano, D; Myojo, K; Omura, T

2006-01-01

Water pollution with toxic heavy metals is of growing concern because heavy metals could bring about serious problems for not only ecosystems in the water environment but also human health. Some metal removal technologies have been in practical use, but much energy and troublesome treatments for chemical wastes are required to operate these conventional technologies. In this study, heavy metal-binding proteins (HMBPs) were obtained from metal-stimulated activated sludge culture with affinity chromatography using copper ion as a ligand. Two-dimensional electrophoresis revealed that a number of proteins in activated sludge culture were recovered as HMBPs for copper ion. N-termini of five HMBPs were determined, and two of them were found to be newly discovered proteins for which no amino acid sequences in protein databases were retrieved at more than 80% identities. Metal-coordinating amino acids occupied 38% of residues in one of the N-terminal sequences of the newly discovered HMBPs. Since these HMBPs were expected to be stable under conditions of water and wastewater treatments, it would be possible to utilize HMBPs as novel adsorbents for heavy metal removal if mass volume of HMBPs can be obtained with protein cloning techniques.

Copper Homeostasis in Escherichia coli and Other Enterobacteriaceae.

PubMed

Rensing, Christopher; Franke, Sylvia

2007-04-01

An interesting model for studying environmental influences shaping microbial evolution is provided by a multitude of copper resistance and copper homeostasis determinants in enteric bacteria. This review describes these determinants and tries to relate their presence to the habitat of the respective organism, as a current hypothesis predicts that the environment should determine an organism's genetic makeup. In Escherichia coli there are four regulons that are induced in the presence of copper. Two, the CueR and the CusR regulons, are described in detail. A central component regulating intracellular copper levels, present in all free-living enteric bacteria whose genomes have so far been sequenced, is a Cu(I)translocating P-type ATPase. The P-type ATPase superfamily is a ubiquitous group of proteins involved in the transport of charged substrates across biological membranes. Whereas some components involved in copper homeostasis can be found in both anaerobes and aerobes, multi-copper oxidases (MCOs) implicated in copper tolerance in E. coli, such as CueO and the plasmid-based PcoA, can be found only in aerobic organisms. Several features indicate that CueO, PcoA, and other related MCOs are specifically adapted to combat copper-mediated oxidative damage. In addition to these well-characterized resistance operons, there are numerous other genes that appear to be involved in copper binding and trafficking that have not been studied in great detail. SilE and its homologue PcoE, for example, are thought to effect the periplasmic binding and sequestration of silver and copper, respectively.

Metal Dyshomeostasis and Inflammation in Alzheimer's and Parkinson's Diseases: Possible Impact of Environmental Exposures

PubMed Central

Myhre, Oddvar; Utkilen, Hans; Duale, Nur; Brunborg, Gunnar; Hofer, Tim

2013-01-01

A dysregulated metal homeostasis is associated with both Alzheimer's (AD) and Parkinson's (PD) diseases; AD patients have decreased cortex and elevated serum copper levels along with extracellular amyloid-beta plaques containing copper, iron, and zinc. For AD, a putative hepcidin-mediated lowering of cortex copper mechanism is suggested. An age-related mild chronic inflammation and/or elevated intracellular iron can trigger hepcidin production followed by its binding to ferroportin which is the only neuronal iron exporter, thereby subjecting it to lysosomal degradation. Subsequently raised neuronal iron levels can induce translation of the ferroportin assisting and copper binding amyloid precursor protein (APP); constitutive APP transmembrane passage lowers the copper pool which is important for many enzymes. Using in silico gene expression analyses, we here show significantly decreased expression of copper-dependent enzymes in AD brain and metallothioneins were upregulated in both diseases. Although few AD exposure risk factors are known, AD-related tauopathies can result from cyanobacterial microcystin and β-methylamino-L-alanine (BMAA) intake. Several environmental exposures may represent risk factors for PD; for this disease neurodegeneration is likely to involve mitochondrial dysfunction, microglial activation, and neuroinflammation. Administration of metal chelators and anti-inflammatory agents could affect disease outcomes. PMID:23710288

Overexpression of amyloid precursor protein increases copper content in HEK293 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suazo, Miriam; Hodar, Christian; Morgan, Carlos

2009-05-15

Amyloid precursor protein (APP) is a transmembrane glycoprotein widely expressed in mammalian tissues and plays a central role in Alzheimer's disease. However, its physiological function remains elusive. Cu{sup 2+} binding and reduction activities have been described in the extracellular APP135-156 region, which might be relevant for cellular copper uptake and homeostasis. Here, we assessed Cu{sup 2+} reduction and {sup 64}Cu uptake in two human HEK293 cell lines overexpressing APP. Our results indicate that Cu{sup 2+} reduction increased and cells accumulated larger levels of copper, maintaining cell viability at supra-physiological levels of Cu{sup 2+} ions. Moreover, wild-type cells exposed to bothmore » Cu{sup 2+} ions and APP135-155 synthetic peptides increased copper reduction and uptake. Complementation of function studies in human APP751 transformed Fre1 defective Saccharomyces cerevisiae cells rescued low Cu{sup 2+} reductase activity and increased {sup 64}Cu uptake. We conclude that Cu{sup 2+} reduction activity of APP facilitates copper uptake and may represent an early step in cellular copper homeostasis.« less

Redox control of copper homeostasis in cyanobacteria.

PubMed

López-Maury, Luis; Giner-Lamia, Joaquín; Florencio, Francisco J

2012-12-01

Copper is essential for all living organisms but is toxic when present in excess. Therefore organisms have developed homeostatic mechanism to tightly regulate its cellular concentration. In a recent study we have shown that CopRS two-component system is essential for copper resistance in the cyanobacterium Synechocystis sp PCC 6803. This two-component regulates expression of a heavy-metal RND type copper efflux system (encoded by copBAC) as well as its own expression (in the copMRS operon) in response to an excess of copper in the media. We have also observed that both operons are induced under condition that reduces the photosynthetic electron flow and this induction depends on the presence of the copper-protein, plastocyanin. These findings, together with CopS localization to the thylakoid membrane and its periplasmic domain being able to bind copper directly, suggest that CopS could be involved in copper detection in both the periplasm and the thylakoid lumen.

Ternary copper(II) complexes with amino acid chains and heterocyclic bases: DNA binding, cytotoxic and cell apoptosis induction properties.

PubMed

Ma, Tieliang; Xu, Jun; Wang, Yuan; Yu, Hao; Yang, Yong; Liu, Yang; Ding, Weiliang; Zhu, Wenjiao; Chen, Ruhua; Ge, Zhijun; Tan, Yongfei; Jia, Lei; Zhu, Taofeng

2015-03-01

Nowadays, chemotherapy is a common means of oncology. However, it is difficult to find excellent chemotherapy drugs. Here we reported three new ternary copper(II) complexes which have potential chemotherapy characteristics with reduced Schiff base ligand and heterocyclic bases (TBHP), [Cu(phen)(TBHP)]H2O (1), [Cu(dpz)(TBHP)]H2O (2) and [Cu(dppz)(TBHP)]H2O (3) (phen=1,10-phenanthroline, dpz=dipyrido [3,2:2',3'-f]quinoxaline, dppz=dipyrido [3,2-a:2',3'-c]phenazine, H2TBHP=2-(3,5-di-tert-butyl-2-hydroxybenzylamino)-2-benzyl-acetic acid). The DNA-binding properties of the complexes were investigated by spectrometric titrations, ethidium bromide displacement experiments and viscosity measurements. The results indicated that the three complexes, especially the complex 13, can strongly bind to calf-thymus DNA (CT-DNA). The intrinsic binding constants Kb of the ternary copper(II) complexes with CT-DNA were 1.37×10(5), 1.81×10(5) and 3.21×10(5) for 1, 2 and 3 respectively. Comparative cytotoxic activities of the copper(II) complexes were also determined by 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The results showed that the ternary copper(II) complexes had significant cytotoxic activity against the human lung cancer (A549), human esophageal cancer (Eca109) and human gastric cancer (SGC7901) cell lines. Cell apoptosis were detected by AnnexinV/PI flow cytometry and by Western blotting with the protein expression of p53, Bax and Bcl-2. All the three copper complexes can effectively induce apoptosis of the three human tumor cells. Copyright © 2014 Elsevier Inc. All rights reserved.

The lumenal loop M672-P707 of the Menkes protein (ATP7A) transfers copper to peptidylglycine monooxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Otoikhian, Adenike; Barry, Amanda N.; Mayfield, Mary

2012-05-14

Copper transfer to cuproproteins located in vesicular compartments of the secretory pathway depends on activity of the copper translocating ATPase (ATP7A or ATP7B) but the mechanism of transfer is largely unexplored. Copper-ATPase ATP7A is unique in having a sequence rich in histidine and methionine residues located on the lumenal side of the membrane. The corresponding fragment binds Cu(I) when expressed as a chimera with a scaffold protein, and mutations or deletions of His and/or Met residues in its sequence inhibit dephosphorylation of the ATPase, a catalytic step associated with copper release. Here we present evidence for a potential role ofmore » this lumenal region of ATP7A in copper transfer to cuproenzymes. Both Cu(II) and Cu(I) forms were investigated since the form in which copper is transferred to acceptor proteins is currently unknown. Analysis of Cu(II) using EPR demonstrated that at Cu:P ratios below 1:1, 15N-substituted protein had Cu(II) bound by 4 His residues, but this coordination changed as the Cu(II) to protein ratio increased towards 2:1. XAS confirmed this coordination via analysis of the intensity of outer-shell scattering from imidazole residues. The Cu(II) complexes could be reduced to their Cu(I) counterparts by ascorbate, but here again, as shown by EXAFS and XANES spectroscopy, the coordination was dependent on copper loading. At low copper Cu(I) was bound by a mixed ligand set of His + Met while at higher ratios His coordination predominated. The copper-loaded loop was able to transfer either Cu(II) or Cu(I) to peptidylglycine monooxygenase in the presence of chelating resin, generating catalytically active enzyme in a process that appeared to involve direct interaction between the two partners. The variation of coordination with copper loading suggests copper-dependent conformational change which in turn could act as a signal for regulating copper release by the ATPase pump.« less

The Lumenal Loop M672-P707 of the Menkes Protein (ATP7A) Transfers Copper to Peptidylglycine Monooxygenase

PubMed Central

Otoikhian, Adenike; Barry, Amanda N.; Mayfield, Mary; Nilges, Mark; Huang, Yiping; Lutsenko, Svetlana; Blackburn, Ninian J.

2012-01-01

Copper transfer to cuproproteins located in vesicular compartments of the secretory pathway depends on activity of the copper translocating ATPase (ATP7A or ATP7B) but the mechanism of transfer is largely unexplored. Copper-ATPase ATP7A is unique in having a sequence rich in histidine and methionine residues located on the lumenal side of the membrane. The corresponding fragment binds Cu(I) when expressed as a chimera with a scaffold protein, and mutations or deletions of His and/or Met residues in its sequence inhibit dephosphorylation of the ATPase, a catalytic step associated with copper release. Here we present evidence for a potential role of this lumenal region of ATP7A in copper transfer to cuproenzymes. Both Cu(II) and Cu(I) forms were investigated since the form in which copper is transferred to acceptor proteins is currently unknown. Analysis of Cu(II) using EPR demonstrated that at Cu:P ratios below 1:1, 15N-substituted protein had Cu(II) bound by 4 His residues, but this coordination changed as the Cu(II) to protein ratio increased towards 2:1. XAS confirmed this coordination via analysis of the intensity of outer-shell scattering from imidazole residues. The Cu(II) complexes could be reduced to their Cu(I) counterparts by ascorbate, but here again, as shown by EXAFS and XANES spectroscopy, the coordination was dependent on copper loading. At low copper Cu(I) was bound by a mixed ligand set of His + Met while at higher ratios His coordination predominated. The copper-loaded loop was able to transfer either Cu(II) or Cu(I) to peptidylglycine monooxygenase in the presence of chelating resin, generating catalytically active enzyme in a process that appeared to involve direct interaction between the two partners. The variation of coordination with copper loading suggests copper-dependent conformational change which in turn could act as a signal for regulating copper release by the ATPase pump. PMID:22577880

A Light Harvesting Complex-Like Protein in Maintenance of Photosynthetic Components in Chlamydomonas1[OPEN

PubMed Central

Zhao, Lei; Cheng, Dongmei; Huang, Xiahe; Chen, Mei; Xing, Jiale; Gao, Liyan; Li, Lingyu; Wang, Yale; Peng, Lianwei; Wang, Yingchun

2017-01-01

Using a genetic approach, we have identified and characterized a novel protein, named Msf1 (Maintenance factor for photosystem I), that is required for the maintenance of specific components of the photosynthetic apparatus in the green alga Chlamydomonas reinhardtii. Msf1 belongs to the superfamily of light-harvesting complex proteins with three transmembrane domains and consensus chlorophyll-binding sites. Loss of Msf1 leads to reduced accumulation of photosystem I and chlorophyll-binding proteins/complexes. Msf1is a component of a thylakoid complex containing key enzymes of the tetrapyrrole biosynthetic pathway, thus revealing a possible link between Msf1 and chlorophyll biosynthesis. Protein interaction assays and greening experiments demonstrate that Msf1 interacts with Copper target homolog1 (CHL27B) and accumulates concomitantly with chlorophyll in Chlamydomonas, implying that chlorophyll stabilizes Msf1. Contrary to other light-harvesting complex-like genes, the expression of Msf1 is not stimulated by high-light stress, but its protein level increases significantly under heat shock, iron and copper limitation, as well as in stationary cells. Based on these results, we propose that Msf1 is required for the maintenance of photosystem I and specific protein-chlorophyll complexes especially under certain stress conditions. PMID:28637830

Copper-zinc superoxide dismutase is activated through a sulfenic acid intermediate at a copper ion entry site.

PubMed

Fetherolf, Morgan M; Boyd, Stefanie D; Taylor, Alexander B; Kim, Hee Jong; Wohlschlegel, James A; Blackburn, Ninian J; Hart, P John; Winge, Dennis R; Winkler, Duane D

2017-07-21

Metallochaperones are a diverse family of trafficking molecules that provide metal ions to protein targets for use as cofactors. The copper chaperone for superoxide dismutase (Ccs1) activates immature copper-zinc superoxide dismutase (Sod1) by delivering copper and facilitating the oxidation of the Sod1 intramolecular disulfide bond. Here, we present structural, spectroscopic, and cell-based data supporting a novel copper-induced mechanism for Sod1 activation. Ccs1 binding exposes an electropositive cavity and proposed "entry site" for copper ion delivery on immature Sod1. Copper-mediated sulfenylation leads to a sulfenic acid intermediate that eventually resolves to form the Sod1 disulfide bond with concomitant release of copper into the Sod1 active site. Sod1 is the predominant disulfide bond-requiring enzyme in the cytoplasm, and this copper-induced mechanism of disulfide bond formation obviates the need for a thiol/disulfide oxidoreductase in that compartment. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

A purple cupredoxin from Nitrosopumilus maritimus containing a mononuclear type 1 copper center with an open binding site

DOE PAGES

Hosseinzadeh, Parisa; Tian, Shiliang; Marshall, Nicholas M.; ...

2016-04-27

Mononuclear cupredoxin proteins usually contain a coordinately saturated type 1 copper (T1Cu) center and function exclusively as electron carriers. Here we report a cupredoxin isolated from the nitrifying archaeon Nitrosopumilus maritimus SCM1, called Nmar1307, that contains a T1Cu center with an open binding site containing water. It displays a deep purple color due to strong absorptions around 413 nm (1880 M –1 cm –1) and 558 nm (2290 M –1 cm –1) in the UV–vis electronic spectrum. EPR studies suggest the protein contains two Cu(II) species of nearly equal population, one nearly axial, with hyperfine constant A ∥ = 98more » × 10 –4 cm –1, and another more rhombic, with a smaller A ∥ value of 69 × 10 –4 cm –1. The X-ray crystal structure at 1.6 Å resolution confirms that it contains a Cu atom coordinated by two His and one Cys in a trigonal plane, with an axial H 2O at 2.25 Å. Both UV–vis absorption and EPR spectroscopic studies suggest that the Nmar1307 can oxidize NO to nitrite, an activity that is attributable to the high reduction potential (354 mV vs SHE) of the copper site. Lastly, these results suggest that mononuclear cupredoxins can have a wide range of structural features, including an open binding site containing water, making this class of proteins even more versatile.« less

Characterization of the role of copCD in copper uptake and the 'copper-switch' in Methylosinus trichosporium OB3b.

PubMed

Gu, Wenyu; Farhan Ul Haque, Muhammad; Semrau, Jeremy D

2017-05-01

Methanotrophs or methane-oxidizing bacteria exhibit a unique 'copper-switch' where expression of two forms of methane monooxygenase (MMO) is controlled by the availability of copper. In the absence of copper, a cytoplasmic or soluble methane monooxygenase (sMMO) is expressed. In the presence of copper, a membrane-bound or particulate methane monooxygenase (pMMO) is expressed. These two forms of MMO have very different properties, and elucidation of the basis of the copper-switch is of significant interest as methanotrophs are becoming increasingly popular for the valorization of methane. Recently, it was suggested via characterization of a mutant of Methylosinus trichosporium OB3b that expresses sMMO in the presence of copper (smmoC mutant) that the copper-switch may be based on copCD. These genes encode for a periplasmic copper-binding protein and an inner membrane protein, respectively, and are used by other bacteria for copper uptake. Specific knockouts of copCD in M. trichosporium OB3b wild type, however, show that these genes are not part of the copper-switch in methanotrophs, nor do they appear to be critical for copper uptake. Rather, it appears that the constitutive expression of sMMO in the smmoC mutant of M. trichosporium OB3b may be due to multiple lesions as smmoC was generated via random chemical mutagenesis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Communication between the N and C Termini Is Required for Copper-stimulated Ser/Thr Phosphorylation of Cu(I)-ATPase (ATP7B)*

PubMed Central

Braiterman, Lelita T.; Gupta, Arnab; Chaerkady, Raghothama; Cole, Robert N.; Hubbard, Ann L.

2015-01-01

The Wilson disease protein ATP7B exhibits copper-dependent trafficking. In high copper, ATP7B exits the trans-Golgi network and moves to the apical domain of hepatocytes where it facilitates elimination of excess copper through the bile. Copper levels also affect ATP7B phosphorylation. ATP7B is basally phosphorylated in low copper and becomes more phosphorylated (“hyperphosphorylated”) in elevated copper. The functional significance of hyperphosphorylation remains unclear. We showed that hyperphosphorylation occurs even when ATP7B is restricted to the trans-Golgi network. We performed comprehensive phosphoproteomics of ATP7B in low versus high copper, which revealed that 24 Ser/Thr residues in ATP7B could be phosphorylated, and only four of these were copper-responsive. Most of the phosphorylated sites were found in the N- and C-terminal cytoplasmic domains. Using truncation and mutagenesis, we showed that inactivation or elimination of all six N-terminal metal binding domains did not block copper-dependent, reversible, apical trafficking but did block hyperphosphorylation in hepatic cells. We showed that nine of 15 Ser/Thr residues in the C-terminal domain were phosphorylated. Inactivation of 13 C-terminal phosphorylation sites reduced basal phosphorylation and eliminated hyperphosphorylation, suggesting that copper binding at the N terminus propagates to the ATP7B C-terminal region. C-terminal mutants with either inactivating or phosphomimetic substitutions showed little effect upon copper-stimulated trafficking, indicating that trafficking does not depend on phosphorylation at these sites. Thus, our studies revealed that copper-dependent conformational changes in the N-terminal region lead to hyperphosphorylation at C-terminal sites, which seem not to affect trafficking and may instead fine-tune copper sequestration. PMID:25666620

Effects of Excess Copper Ions on Decidualization of Human Endometrial Stromal Cells.

PubMed

Li, Ying; Kang, Zhen-Long; Qiao, Na; Hu, Lian-Mei; Ma, Yong-Jiang; Liang, Xiao-Huan; Liu, Ji-Long; Yang, Zeng-Ming

2017-05-01

The aim of this study was to investigate the effects of copper ions on decidualization of human endometrial stromal cells (HESCs) cultured in vitro. Firstly, non-toxic concentrations of copper D-gluconate were screened in HESCs based on cell activity. Then, the effects of non-toxic concentrations of copper ions (0~250 μM) were examined on decidualization of human endometrial stromal cells. Our data demonstrated that the mRNA expressions of insulin-like growth factor binding protein (IGFBP-1), prolactin (PRL), Mn-SOD, and FOXO1were down-regulated during decidualization following the treatments with 100 or 250 μM copper ions. Meanwhile, the amount of malonaldehyde (MDA) in the supernatant of HESCs was increased. These results showed that in vitro decidualization of HESCs was impaired by copper treatment.

Microbial Copper-binding Siderophores at the Host-Pathogen Interface*

PubMed Central

Koh, Eun-Ik; Henderson, Jeffrey P.

2015-01-01

Numerous pathogenic microorganisms secrete small molecule chelators called siderophores defined by their ability to bind extracellular ferric iron, making it bioavailable to microbes. Recently, a siderophore produced by uropathogenic Escherichia coli, yersiniabactin, was found to also bind copper ions during human infections. The ability of yersiniabactin to protect E. coli from copper toxicity and redox-based phagocyte defenses distinguishes it from other E. coli siderophores. Here we compare yersiniabactin to other extracellular copper-binding molecules and review how copper-binding siderophores may confer virulence-associated gains of function during infection pathogenesis. PMID:26055720

Distinct oxidative cleavage and modification of bovine [Cu-Zn]-SOD by an ascorbic acid/Cu(II) system: Identification of novel copper binding site on SOD molecule

PubMed Central

Uehara, Hiroshi; Luo, Shen; Aryal, Baikuntha; Levine, Rodney L.; Rao, V. Ashutosh

2016-01-01

We investigated the combined effect of ascorbate and copper [Asc/Cu(II)] on the integrity of bovine [Cu-Zn]-superoxide dismutase (bSOD1) as a model system to study the metal catalyzed oxidation (MCO) and fragmentation of proteins. We found Asc/Cu(II) mediates specific cleavage of bSOD1 and generates 12.5 and 3.2 kDa fragments in addition to oxidation/carbonylation of the protein. The effect of other tested transition metals, a metal chelator, and hydrogen peroxide on the cleavage and oxidation indicated that binding of copper to a previously unknown site on SOD1 is responsible for the Asc/Cu(II) specific cleavage and oxidation. We utilized tandem mass spectrometry to identify the specific cleavage sites of Asc/Cu(II)-treated bSOD1. Analyses of tryptic- and AspN-peptides have demonstrated the cleavage to occur at Gly31 with peptide bond breakage with Thr30 and Ser32 through diamide and α-amidation pathways, respectively. The three-dimensional structure of bSOD1 reveals the imidazole ring of His19 localized within 5 Angstrom from the α-carbon of Gly31 providing a structural basis that copper ion, most likely coordinated by His19, catalyzes the specific cleavage reaction. PMID:26872685

Distinct oxidative cleavage and modification of bovine [Cu- Zn]-SOD by an ascorbic acid/Cu(II) system: Identification of novel copper binding site on SOD molecule.

PubMed

Uehara, Hiroshi; Luo, Shen; Aryal, Baikuntha; Levine, Rodney L; Rao, V Ashutosh

2016-05-01

We investigated the combined effect of ascorbate and copper [Asc/Cu(II)] on the integrity of bovine [Cu-Zn]-superoxide dismutase (bSOD1) as a model system to study the metal catalyzed oxidation (MCO) and fragmentation of proteins. We found Asc/Cu(II) mediates specific cleavage of bSOD1 and generates 12.5 and 3.2kDa fragments in addition to oxidation/carbonylation of the protein. The effect of other tested transition metals, a metal chelator, and hydrogen peroxide on the cleavage and oxidation indicated that binding of copper to a previously unknown site on SOD1 is responsible for the Asc/Cu(II) specific cleavage and oxidation. We utilized tandem mass spectrometry to identify the specific cleavage sites of Asc/Cu(II)-treated bSOD1. Analyses of tryptic- and AspN-peptides have demonstrated the cleavage to occur at Gly31 with peptide bond breakage with Thr30 and Ser32 through diamide and α-amidation pathways, respectively. The three-dimensional structure of bSOD1 reveals the imidazole ring of His19 localized within 5Å from the α-carbon of Gly31 providing a structural basis that copper ion, most likely coordinated by His19, catalyzes the specific cleavage reaction. Published by Elsevier Inc.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Streltsov, Victor A.; Titmuss, Stephen J.; Epa, V. Chandana

Neurodegeneration observed in Alzheimer disease (AD) is believed to be related to the toxicity from reactive oxygen species (ROS) produced in the brain by the amyloid-{beta} (A{beta}) protein bound primarily to copper ions. The evidence for an oxidative stress role of A{beta}-Cu redox chemistry is still incomplete. Details of the copper binding site in A{beta} may be critical to the etiology of AD. Here we present the structure determined by combining x-ray absorption spectroscopy (XAS) and density functional theory analysis of A{beta} peptides complexed with Cu{sup 2+} in solution under a range of buffer conditions. Phosphate-buffered saline buffer salt (NaCl)more » concentration does not affect the high-affinity copper binding mode but alters the second coordination sphere. The XAS spectra for truncated and full-length A{beta}-Cu{sup 2+} peptides are similar. The novel distorted six-coordinated (3N3O) geometry around copper in the A{beta}-Cu{sup 2+} complexes include three histidines: glutamic, or/and aspartic acid, and axial water. The structure of the high-affinity Cu{sup 2+} binding site is consistent with the hypothesis that the redox activity of the metal ion bound to A{beta} can lead to the formation of dityrosine-linked dimers found in AD.« less

Copper/MYC/CTR1 interplay: a dangerous relationship in hepatocellular carcinoma.

PubMed

Porcu, Cristiana; Antonucci, Laura; Barbaro, Barbara; Illi, Barbara; Nasi, Sergio; Martini, Maurizio; Licata, Anna; Miele, Luca; Grieco, Antonio; Balsano, Clara

2018-02-06

Free serum copper correlates with tumor incidence and progression of human cancers, including hepatocellular carcinoma (HCC). Copper extracellular uptake is provided by the transporter CTR1, whose expression is regulated to avoid excessive intracellular copper entry. Inadequate copper serum concentration is involved in the pathogenesis of Non Alcoholic Fatty Liver Disease (NAFLD), which is becoming a major cause of liver damage progression and HCC incidence. Finally, MYC is over-expressed in most of HCCs and is a critical regulator of cellular growth, tumor invasion and metastasis. The purpose of our study was to understand if higher serum copper concentrations might be involved in the progression of NAFLD-cirrhosis toward-HCC. We investigated whether high exogenous copper levels sensitize liver cells to transformation and if it exists an interplay between copper-related proteins and MYC oncogene. NAFLD-cirrhotic patients were characterized by a statistical significant enhancement of serum copper levels, even more evident in HCC patients. We demonstrated that high extracellular copper concentrations increase cell growth, migration, and invasion of liver cancer cells by modulating MYC/CTR1 axis. We highlighted that MYC binds a specific region of the CTR1 promoter, regulating its transcription. Accordingly, CTR1 and MYC proteins expression were progressively up-regulated in liver tissues from NAFLD-cirrhotic to HCC patients. This work provides novel insights on the molecular mechanisms by which copper may favor the progression from cirrhosis to cancer. The Cu/MYC/CTR1 interplay opens a window to refine HCC diagnosis and design new combined therapies.

Mechanisms of iron and copper-frataxin interactions.

PubMed

Han, T H L; Camadro, J M; Santos, R; Lesuisse, E; El Hage Chahine, J M; Ha-Duong, N T

2017-08-16

Frataxin is a mitochondrial protein whose deficiency is the cause of Friedreich's ataxia, a hereditary neurodegenerative disease. This protein plays a role in iron-sulfur cluster biosynthesis, protection against oxidative stress and iron metabolism. In an attempt to provide a better understanding of the role played by metals in its metabolic functions, the mechanisms of mitochondrial metal binding to frataxin in vitro have been investigated. A purified recombinant yeast frataxin homolog Yfh1 binds two Cu(ii) ions with a K d1 (Cu II ) of 1.3 × 10 -7 M and a K d2 (Cu II ) of 3.1 × 10 -4 M and a single Cu(i) ion with a higher affinity than for Cu(ii) (K d (Cu I ) = 3.2 × 10 -8 M). Mn(ii) forms two complexes with Yfh1 (K d1 (Mn II ) = 4.0 × 10 -8 M; K d2 (Mn II ) = 4.0 × 10 -7 M). Cu and Mn bind Yfh1 with higher affinities than Fe(ii). It is established for the first time that the mechanisms of the interaction of iron and copper with frataxin are comparable and involve three kinetic steps. The first step occurs in the 50-500 ms range and corresponds to a first metal uptake. This is followed by two other kinetic processes that are related to a second metal uptake and/or to a change in the conformation leading to thermodynamic equilibrium. Frataxin deficient Δyfh1 yeast cells exhibited a marked growth defect in the presence of exogenous Cu or Mn. Mitochondria from Δyfh1 strains also accumulated higher amounts of copper, suggesting a functional role of frataxin in vivo in copper homeostasis.

Levels of plasma ceruloplasmin protein are markedly lower following dietary copper deficiency in rodents

PubMed Central

Broderius, Margaret; Mostad, Elise; Wendroth, Krista; Prohaska, Joseph R.

2010-01-01

Ceruloplasmin (Cp) is a multicopper oxidase and the most abundant copper binding protein in vertebrate plasma. Loss of function mutations in humans or experimental deletion in mice result in iron overload consistent with a putative ferroxidase function. Prior work suggested plasma may contain multiple ferroxidases. Studies were conducted in Holtzman rats (Rattus novegicus), albino mice (Mus musculus), Cp -/- mice, and adult humans (Homo sapiens) to investigate the copper-iron interaction. Dietary copper-deficient (CuD) rats and mice were produced using a modified AIN-76A diet. Results confirmed that o-dianisidine is a better substrate than paraphenylene diamine (PPD) for assessing diamine oxidase activity of Cp. Plasma from CuD rat dams and pups, and CuD and Cp -/- mice contained no detectable Cp diamine oxidase activity. Importantly, no ferroxidase activity was detectable for CuD rats, mice, or Cp -/- mice compared to robust activity for copper-adequate (CuA) rodent controls using western membrane assay. Immunoblot protocols detected major reductions (60-90%) in Cp protein in plasma of CuD rodents but no alteration in liver mRNA levels by qRT-PCR. Data are consistent with apo-Cp being less stable than holo-Cp. Further research is needed to explain normal plasma iron in CuD mice. Reduction in Cp is a sensitive biomarker for copper deficiency. PMID:20170749

Response to excess copper in the hyperthermophile Sulfolobus solfataricus strain 98/2

PubMed Central

Villafane, Aramis; Voskoboynik, Yekaterina; Cuebas, Mariola; Ruhl, Ilona; Bini, Elisabetta

2009-01-01

Copper is an essential micronutrient, but toxic in excess. Sulfolobus solfataricus cells have the ability to adapt to fluctuations of copper levels in their external environment. To better understand the molecular mechanism behind the organismal response to copper, the expression of the cluster of genes copRTA, which encodes the copper-responsive transcriptional regulator CopR, the copper-binding protein CopT, and CopA, has been investigated and the whole operon has been shown to be cotranscribed at low levels from the copR promoter under all conditions, whereas increased transcription from the copTA promoter occurs in the presence of excess copper. Furthermore, the expression of the copper-transporting ATPase CopA over a 27-hour interval has been monitored by quantitative real-time RT-PCR and compared to the pattern of cellular copper accumulation, as determined in a parallel analysis by Inductively Coupled Plasma Optical Emission spectrometry (ICP-OES). The results provide the basis for a model of the molecular mechanisms of copper homeostasis in Sulfolobus, which relies on copper efflux and sequestration. PMID:19427833

The Yeast Copper Response Is Regulated by DNA Damage

PubMed Central

Dong, Kangzhen; Addinall, Stephen G.; Lydall, David

2013-01-01

Copper is an essential but potentially toxic redox-active metal, so the levels and distribution of this metal are carefully regulated to ensure that it binds to the correct proteins. Previous studies of copper-dependent transcription in the yeast Saccharomyces cerevisiae have focused on the response of genes to changes in the exogenous levels of copper. We now report that yeast copper genes are regulated in response to the DNA-damaging agents methyl methanesulfonate (MMS) and hydroxyurea by a mechanism(s) that requires the copper-responsive transcription factors Mac1 and AceI, copper superoxide dismutase (Sod1) activity, and the Rad53 checkpoint kinase. Furthermore, in copper-starved yeast, the response of the Rad53 pathway to MMS is compromised due to a loss of Sod1 activity, consistent with the model that yeast imports copper to ensure Sod1 activity and Rad53 signaling. Crucially, the Mac1 transcription factor undergoes changes in its redox state in response to changing levels of copper or MMS. This study has therefore identified a novel regulatory relationship between cellular redox, copper homeostasis, and the DNA damage response in yeast. PMID:23959798

A four-helix bundle stores copper for methane oxidation

PubMed Central

Vita, Nicolas; Platsaki, Semeli; Baslé, Arnaud; Allen, Stephen J.; Paterson, Neil G.; Crombie, Andrew T.; Murrell, J. Colin; Waldron, Kevin J.; Dennison, Christopher

2015-01-01

Methane-oxidising bacteria (methanotrophs) require large quantities of copper for the membrane-bound (particulate) methane monooxygenase (pMMO)1,2. Certain methanotrophs are also able to switch to using the iron-containing soluble MMO (sMMO) to catalyse methane oxidation, with this switchover regulated by copper3,4. MMOs are Nature’s primary biological mechanism for suppressing atmospheric levels of methane, a potent greenhouse gas. Furthermore, methanotrophs and MMOs have enormous potential in bioremediation and for biotransformations producing bulk and fine chemicals, and in bioenergy, particularly considering increased methane availability from renewable sources and hydraulic fracturing of shale rock5,6. We have discovered and characterised a novel copper storage protein (Csp1) from the methanotroph Methylosinus trichosporium OB3b that is exported from the cytosol, and stores copper for pMMO. Csp1 is a tetramer of 4-helix bundles with each monomer binding up to 13 Cu(I) ions in a previously unseen manner via mainly Cys residues that point into the core of the bundle. Csp1 is the first example of a protein that stores a metal within an established protein-folding motif. This work provides a detailed insight into how methanotrophs accumulate copper for the oxidation of methane. Understanding this process is essential if the wide-ranging biotechnological applications of methanotrophs are to be realised. Cytosolic homologues of Csp1 are present in diverse bacteria thus challenging the dogma that such organisms do not use copper in this location. PMID:26308900

A new crystal form of Aspergillus oryzae catechol oxidase and evaluation of copper site structures in coupled binuclear copper enzymes.

PubMed

Penttinen, Leena; Rutanen, Chiara; Saloheimo, Markku; Kruus, Kristiina; Rouvinen, Juha; Hakulinen, Nina

2018-01-01

Coupled binuclear copper (CBC) enzymes have a conserved type 3 copper site that binds molecular oxygen to oxidize various mono- and diphenolic compounds. In this study, we found a new crystal form of catechol oxidase from Aspergillus oryzae (AoCO4) and solved two new structures from two different crystals at 1.8-Å and at 2.5-Å resolutions. These structures showed different copper site forms (met/deoxy and deoxy) and also differed from the copper site observed in the previously solved structure of AoCO4. We also analysed the electron density maps of all of the 56 CBC enzyme structures available in the protein data bank (PDB) and found that many of the published structures have vague copper sites. Some of the copper sites were then re-refined to find a better fit to the observed electron density. General problems in the refinement of metalloproteins and metal centres are discussed.

X-ray structural studies of the fungal laccase from Cerrena maxima.

PubMed

Lyashenko, Andrey V; Bento, Isabel; Zaitsev, Viatcheslav N; Zhukhlistova, Nadezhda E; Zhukova, Yuliya N; Gabdoulkhakov, Azat G; Morgunova, Ekaterina Y; Voelter, Wolfgang; Kachalova, Galina S; Stepanova, Elena V; Koroleva, Ol'ga V; Lamzin, Victor S; Tishkov, Vladimir I; Betzel, Christian; Lindley, Peter F; Mikhailov, Al'bert M

2006-11-01

Laccases are members of the blue multi-copper oxidase family. These enzymes oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and following the transfer of four electrons is reduced to two molecules of water. The X-ray structure of a laccase from Cerrena maxima has been elucidated at 1.9 A resolution using synchrotron data and the molecular replacement technique. The final refinement coefficients are Rcryst = 16.8% and Rfree = 23.0%, with root mean square deviations on bond lengths and bond angles of 0.015 A and 1.51 degrees , respectively. The type 1 copper centre has an isoleucine residue at the axial position and the "resting" state of the trinuclear centre comprises a single oxygen (OH) moiety asymmetrically disposed between the two type 3 copper ions and a water molecule attached to the type 2 ion. Several carbohydrate binding sites have been identified and the glycan chains appear to promote the formation of well-ordered crystals. Two tyrosine residues near the protein surface have been found in a nitrated state.

Full-length cellular β-secretase has a trimeric subunit stoichiometry, and its sulfur-rich transmembrane interaction site modulates cytosolic copper compartmentalization.

PubMed

Liebsch, Filip; Aurousseau, Mark R P; Bethge, Tobias; McGuire, Hugo; Scolari, Silvia; Herrmann, Andreas; Blunck, Rikard; Bowie, Derek; Multhaup, Gerd

2017-08-11

The β-secretase (BACE1) initiates processing of the amyloid precursor protein (APP) into Aβ peptides, which have been implicated as central players in the pathology of Alzheimer disease. BACE1 has been described as a copper-binding protein and its oligomeric state as being monomeric, dimeric, and/or multimeric, but the native cellular stoichiometry has remained elusive. Here, by using single-molecule fluorescence and in vitro cross-linking experiments with photo-activatable unnatural amino acids, we show that full-length BACE1, independently of its subcellular localization, exists as trimers in human cells. We found that trimerization requires the BACE1 transmembrane sequences (TMSs) and cytoplasmic domains, with residues Ala 463 and Cys 466 buried within the trimer interface of the sulfur-rich core of the TMSs. Our 3D model predicts that the sulfur-rich core of the trimeric BACE1 TMS is accessible to metal ions, but copper ions did not trigger trimerization. The results of functional assays of endogenous BACE1 suggest that it has a role in intracellular copper compartmentalization by transferring cytosolic copper to intracellular compartments, while leaving the overall cellular copper concentration unaltered. Adding to existing physiological models, our results provide novel insight into the atypical interactions between copper and BACE1 and into its non-enzymatic activities. In conclusion, therapeutic Alzheimer disease prevention strategies aimed at decreasing BACE1 protein levels should be regarded with caution, because adverse effects in copper homeostasis may occur. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Copper induction and differential expression of laccase in Aspergillus flavus

PubMed Central

Gomaa, Ola M.; Momtaz, Osama A.

2015-01-01

Aspergillus flavus was isolated from soil and exhibited laccase activity under both constitutive and copper induced conditions. Spiking the medium with 1 mM copper sulfate resulted in an increase in the activity which reached 51.84 U/mL, a distinctive protein band was detected at 60 kDa. The extracellular enzyme was purified 81 fold using gel filtration chromatography and resulted in two different laccase fractions L1 and L2, the latter had a higher enzymatic activity which reached 79.57 U/mL and specific activity of 64.17 U/μg protein. The analysis of the spectrum of the L2 fraction showed a shoulder at 330 nm which is characteristic for T2/T3 copper centers; both copper and zinc were detected suggesting that this is an unconventional white laccase. Primers of laccase gene were designed and synthesized to recover specific gene from A. flavus . Sequence analysis indicated putative laccase (Genbank ID: JF683612) at the amino acid level suggesting a close identity to laccases from other genera containing the copper binding site. Decolorization of textile waste water under different conditions showed possible application in bioremediation within a short period of time. The effect of copper on A. flavus was concentration dependent. PMID:26221119

Roles of Copper and a Conserved Aspartic Acid in the Autocatalytic Hydroxylation of a Specific Tryptophan Residue during Cysteine Tryptophylquinone Biogenesis.

PubMed

Williamson, Heather R; Sehanobish, Esha; Shiller, Alan M; Sanchez-Amat, Antonio; Davidson, Victor L

2017-02-21

The first posttranslational modification step in the biosynthesis of the tryptophan-derived quinone cofactors is the autocatalytic hydroxylation of a specific Trp residue at position C-7 on the indole side chain. Subsequent modifications are catalyzed by modifying enzymes, but the mechanism by which this first step occurs is unknown. LodA possesses a cysteine tryptophylquinone (CTQ) cofactor. Metal analysis as well as spectroscopic and kinetic studies of the mature and precursor forms of a D512A LodA variant provides evidence that copper is required for the initial hydroxylation of the precursor protein and that if alternative metals are bound, the modification does not occur and the precursor is unstable. It is shown that the mature native LodA also contains loosely bound copper, which affects the visible absorbance spectrum and quenches the fluorescence spectrum that is attributed to the mature CTQ cofactor. When copper is removed, the fluorescence appears, and when it is added back to the protein, the fluorescence is quenched, indicating that copper reversibly binds in the proximity of CTQ. Removal of copper does not diminish the enzymatic activity of LodA. This distinguishes LodA from enzymes with protein-derived tyrosylquinone cofactors in which copper is present near the cofactor and is absolutely required for activity. Mechanisms are proposed for the role of copper in the hydroxylation of the unactivated Trp side chain. These results demonstrate that the reason that the highly conserved Asp512 is critical for LodA, and possibly all tryptophylquinone enzymes, is not because it is required for catalysis but because it is necessary for CTQ biosynthesis, more specifically to facilitate the initial copper-dependent hydroxylation of a specific Trp residue.

Impairment of Interrelated Iron- and Copper Homeostatic Mechanisms in Brain Contributes to the Pathogenesis of Neurodegenerative Disorders

PubMed Central

Skjørringe, Tina; Møller, Lisbeth Birk; Moos, Torben

2012-01-01

Iron and copper are important co-factors for a number of enzymes in the brain, including enzymes involved in neurotransmitter synthesis and myelin formation. Both shortage and an excess of iron or copper will affect the brain. The transport of iron and copper into the brain from the circulation is strictly regulated, and concordantly protective barriers, i.e., the blood-brain barrier (BBB) and the blood-cerebrospinal fluid (CSF) barrier (BCB) have evolved to separate the brain environment from the circulation. The uptake mechanisms of the two metals interact. Both iron deficiency and overload lead to altered copper homeostasis in the brain. Similarly, changes in dietary copper affect the brain iron homeostasis. Moreover, the uptake routes of iron and copper overlap each other which affect the interplay between the concentrations of the two metals in the brain. The divalent metal transporter-1 (DMT1) is involved in the uptake of both iron and copper. Furthermore, copper is an essential co-factor in numerous proteins that are vital for iron homeostasis and affects the binding of iron-response proteins to iron-response elements in the mRNA of the transferrin receptor, DMT1, and ferroportin, all highly involved in iron transport. Iron and copper are mainly taken up at the BBB, but the BCB also plays a vital role in the homeostasis of the two metals, in terms of sequestering, uptake, and efflux of iron and copper from the brain. Inside the brain, iron and copper are taken up by neurons and glia cells that express various transporters. PMID:23055972

Testing the Underlying Chemical Principles of the Biotic Ligand Model (BLM) to Marine Copper Systems: Measuring Copper Speciation Using Fluorescence Quenching.

PubMed

Tait, Tara N; McGeer, James C; Smith, D Scott

2018-01-01

Speciation of copper in marine systems strongly influences the ability of copper to cause toxicity. Natural organic matter (NOM) contains many binding sites which provides a protective effect on copper toxicity. The purpose of this study was to characterize copper binding with NOM using fluorescence quenching techniques. Fluorescence quenching of NOM with copper was performed on nine sea water samples. The resulting stability constants and binding capacities were consistent with literature values of marine NOM, showing strong binding with [Formula: see text] values from 7.64 to 10.2 and binding capacities ranging from 15 to 3110 nmol mg [Formula: see text] Free copper concentrations estimated at total dissolved copper concentrations corresponding to previously published rotifer effect concentrations, in the same nine samples, were statistically the same as the range of free copper calculated for the effect concentration in NOM-free artificial seawater. These data confirms the applicability of fluorescence spectroscopy techniques for NOM and copper speciation characterization in sea water and demonstrates that such measured speciation is consistent with the chemical principles underlying the biotic ligand model approach for bioavailability-based metals risk assessment.

Advanced hair damage model from ultra-violet radiation in the presence of copper.

PubMed

Marsh, J M; Davis, M G; Flagler, M J; Sun, Y; Chaudhary, T; Mamak, M; McComb, D W; Williams, R E A; Greis, K D; Rubio, L; Coderch, L

2015-10-01

Damage to hair from UV exposure has been well reported in the literature and is known to be a highly complex process involving initiation via absorption of UV light followed by formation and propagation of reactive oxygen species (ROS). The objective of this work was to understand these mechanisms, explain the role of copper in accelerating the formation of ROS and identify strategies to reduce the hair damage caused by these reactive species. The location of copper in hair was measured by Transmission electron microscopy-(TEM) X-ray energy dispersive spectroscopy (XEDS) and levels measured by ICP-OES. Protein changes were measured as total protein loss via the Lowry assay, and MALDI ToF was used to identify the biomarker protein fragments. TBARS assay was used to measure lipid peroxide formation. Sensory methods and dry combing friction were used to measure hair damage due to copper and UV exposure and to demonstrate the efficacy of N,N' ethylenediamine disuccinic acid (EDDS) and histidine chelants to reduce this damage. In this work, a biomarker protein fragment formed during UV exposure is identified using mass spectrometry. This fragment originates from the calcium-binding protein S100A3. Also shown is the accelerated formation of this peptide fragment in hair containing low levels of copper absorbed from hair during washing with tap water containing copper ions. Transmission electron microscopy (TEM) X-ray energy dispersive spectroscopy (XEDS) studies indicate copper is located in the sulphur-poor endo-cuticle region, a region where the S100A3 protein is concentrated. A mechanism for formation of this peptide fragment is proposed in addition to the possible role of lipids in UV oxidation. A shampoo and conditioner containing chelants (EDDS in shampoo and histidine in conditioner) is shown to reduce copper uptake from tap water and reduce protein loss and formation of S100A3 protein fragment. In addition, the long-term consequences of UV oxidation and additional damage induced by copper are illustrated in a four-month wear study where hair was treated with a consumer relevant protocol of hair colouring treatments, UV exposure and regular shampoo and conditioning. The role of copper in accelerating UV damage to hair has been demonstrated as well as the ability of chelants such as EDDS and histidine in shampoo and conditioner products to reduce this damage. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Copper/MYC/CTR1 interplay: a dangerous relationship in hepatocellular carcinoma

PubMed Central

Barbaro, Barbara; Illi, Barbara; Nasi, Sergio; Martini, Maurizio; Licata, Anna; Miele, Luca; Grieco, Antonio; Balsano, Clara

2018-01-01

Free serum copper correlates with tumor incidence and progression of human cancers, including hepatocellular carcinoma (HCC). Copper extracellular uptake is provided by the transporter CTR1, whose expression is regulated to avoid excessive intracellular copper entry. Inadequate copper serum concentration is involved in the pathogenesis of Non Alcoholic Fatty Liver Disease (NAFLD), which is becoming a major cause of liver damage progression and HCC incidence. Finally, MYC is over-expressed in most of HCCs and is a critical regulator of cellular growth, tumor invasion and metastasis. The purpose of our study was to understand if higher serum copper concentrations might be involved in the progression of NAFLD-cirrhosis toward-HCC. We investigated whether high exogenous copper levels sensitize liver cells to transformation and if it exists an interplay between copper-related proteins and MYC oncogene. NAFLD-cirrhotic patients were characterized by a statistical significant enhancement of serum copper levels, even more evident in HCC patients. We demonstrated that high extracellular copper concentrations increase cell growth, migration, and invasion of liver cancer cells by modulating MYC/CTR1 axis. We highlighted that MYC binds a specific region of the CTR1 promoter, regulating its transcription. Accordingly, CTR1 and MYC proteins expression were progressively up-regulated in liver tissues from NAFLD-cirrhotic to HCC patients. This work provides novel insights on the molecular mechanisms by which copper may favor the progression from cirrhosis to cancer. The Cu/MYC/CTR1 interplay opens a window to refine HCC diagnosis and design new combined therapies. PMID:29507693

Binding of copper to lysozyme: Spectroscopic, isothermal titration calorimetry and molecular docking studies

NASA Astrophysics Data System (ADS)

Jing, Mingyang; Song, Wei; Liu, Rutao

2016-07-01

Although copper is essential to all living organisms, its potential toxicity to human health have aroused wide concerns. Previous studies have reported copper could alter physical properties of lysozyme. The direct binding of copper with lysozyme might induce the conformational and functional changes of lysozyme and then influence the body's resistance to bacterial attack. To better understand the potential toxicity and toxic mechanisms of copper, the interaction of copper with lysozyme was investigated by biophysical methods including multi-spectroscopic measurements, isothermal titration calorimetry (ITC), molecular docking study and enzyme activity assay. Multi-spectroscopic measurements proved that copper quenched the intrinsic fluorescence of lysozyme in a static process accompanied by complex formation and conformational changes. The ITC results indicated that the binding interaction was a spontaneous process with approximately three thermodynamical binding sites at 298 K and the hydrophobic force is the predominant driven force. The enzyme activity was obviously inhibited by the addition of copper with catalytic residues Glu 35 and Asp 52 locating at the binding sites. This study helps to elucidate the molecular mechanism of the interaction between copper and lysozyme and provides reference for toxicological studies of copper.

Differential affinity of BsSCO for Cu(II) and Cu(I) suggests a redox role in copper transfer to the Cu(A) center of cytochrome c oxidase.

PubMed

Hill, Bruce C; Andrews, Diann

2012-06-01

SCO (synthesis of cytochrome c oxidase) proteins are involved in the assembly of the respiratory chain enzyme cytochrome c oxidase acting to assist in the assembly of the Cu(A) center contained within subunit II of the oxidase complex. The Cu(A) center receives electrons from the reductive substrate ferrocytochrome c, and passes them on to the cytochrome a center. Cytochrome a feeds electrons to the oxygen reaction site composed of cytochrome a(3) and Cu(B). Cu(A) consists of two copper ions positioned within bonding distance and ligated by two histidine side chains, one methionine, a backbone carbonyl and two bridging cysteine residues. The complex structure and redox capacity of Cu(A) present a potential assembly challenge. SCO proteins are members of the thioredoxin family which led to the early suggestion of a disulfide exchange function for SCO in Cu(A) assembly, whereas the copper binding capacity of the Bacillus subtilis version of SCO (i.e., BsSCO) suggests a direct role for SCO proteins in copper transfer. We have characterized redox and copper exchange properties of apo- and metalated-BsSCO. The release of copper (II) from its complex with BsSCO is best achieved by reducing it to Cu(I). We propose a mechanism involving both disulfide and copper exchange between BsSCO and the apo-Cu(A) site. This article is part of a Special Issue entitled: Biogenesis/Assembly of Respiratory Enzyme Complexes. Copyright © 2011 Elsevier B.V. All rights reserved.

c-Type Cytochrome Assembly Is a Key Target of Copper Toxicity within the Bacterial Periplasm

PubMed Central

Durand, Anne; Azzouzi, Asma; Bourbon, Marie-Line; Steunou, Anne-Soisig; Liotenberg, Sylviane; Maeshima, Akinori; Astier, Chantal; Argentini, Manuela; Saito, Shingo

2015-01-01

ABSTRACT In the absence of a tight control of copper entrance into cells, bacteria have evolved different systems to control copper concentration within the cytoplasm and the periplasm. Central to these systems, the Cu+ ATPase CopA plays a major role in copper tolerance and translocates copper from the cytoplasm to the periplasm. The fate of copper in the periplasm varies among species. Copper can be sequestered, oxidized, or released outside the cells. Here we describe the identification of CopI, a periplasmic protein present in many proteobacteria, and show its requirement for copper tolerance in Rubrivivax gelatinosus. The ΔcopI mutant is more susceptible to copper than the Cu+ ATPase copA mutant. CopI is induced by copper, localized in the periplasm and could bind copper. Interestingly, copper affects cytochrome c membrane complexes (cbb3 oxidase and photosystem) in both ΔcopI and copA-null mutants, but the causes are different. In the copA mutant, heme and chlorophyll synthesis are affected, whereas in ΔcopI mutant, the decrease is a consequence of impaired cytochrome c assembly. This impact on c-type cytochromes would contribute also to the copper toxicity in the periplasm of the wild-type cells when they are exposed to high copper concentrations. PMID:26396241

Biogenic manganese oxide nanoparticle formation by a multimeric multicopper oxidase Mnx.

PubMed

Romano, Christine A; Zhou, Mowei; Song, Yang; Wysocki, Vicki H; Dohnalkova, Alice C; Kovarik, Libor; Paša-Tolić, Ljiljana; Tebo, Bradley M

2017-09-29

Bacteria that produce Mn oxides are extraordinarily skilled engineers of nanomaterials that contribute significantly to global biogeochemical cycles. Their enzyme-based reaction mechanisms may be genetically tailored for environmental remediation applications or bioenergy production. However, significant challenges exist for structural characterization of the enzymes responsible for biomineralization. The active Mn oxidase in Bacillus sp. PL-12, Mnx, is a complex composed of a multicopper oxidase (MCO), MnxG, and two accessory proteins, MnxE and MnxF. MnxG shares sequence similarity with other, structurally characterized MCOs. MnxE and MnxF have no similarity to any characterized proteins. The ~200 kDa complex has been recalcitrant to crystallization, so its structure is unknown. Here, we show that native mass spectrometry defines the subunit topology and copper binding of Mnx, while high-resolution electron microscopy visualizes the protein and nascent Mn oxide minerals. These data provide critical structural information for understanding Mn biomineralization by such unexplored enzymes.Significant challenges exist for structural characterization of enzymes responsible for biomineralization. Here the authors show that native mass spectrometry and high resolution electron microscopy can define the subunit topology and copper binding of a manganese oxidizing complex, and describe early stage formation of its mineral products.

Copper(II) binding by dissolved organic matter: Importance of the copper-to-dissolved organic matter ratio and implications for the Biotic Ligand Model

USGS Publications Warehouse

Craven, Alison M.; Aiken, George R.; Ryan, Joseph N.

2012-01-01

The ratio of copper to dissolved organic matter (DOM) is known to affect the strength of copper binding by DOM, but previous methods to determine the Cu2+–DOM binding strength have generally not measured binding constants over the same Cu:DOM ratios. In this study, we used a competitive ligand exchange–solid-phase extraction (CLE-SPE) method to determine conditional stability constants for Cu2+–DOM binding at pH 6.6 and 0.01 M ionic strength over a range of Cu:DOM ratios that bridge the detection windows of copper-ion-selective electrode and voltammetry measurements. As the Cu:DOM ratio increased from 0.0005 to 0.1 mg of Cu/mg of DOM, the measured conditional binding constant (cKCuDOM) decreased from 1011.5 to 105.6 M–1. A comparison of the binding constants measured by CLE-SPE with those measured by copper-ion-selective electrode and voltammetry demonstrates that the Cu:DOM ratio is an important factor controlling Cu2+–DOM binding strength even for DOM isolates of different types and different sources and for whole water samples. The results were modeled with Visual MINTEQ and compared to results from the biotic ligand model (BLM). The BLM was found to over-estimate Cu2+ at low total copper concentrations and under-estimate Cu2+ at high total copper concentrations.

Laboratory evolution of copper tolerant yeast strains

PubMed Central

2012-01-01

Background Yeast strains endowed with robustness towards copper and/or enriched in intracellular Cu might find application in biotechnology processes, among others in the production of functional foods. Moreover, they can contribute to the study of human diseases related to impairments of copper metabolism. In this study, we investigated the molecular and physiological factors that confer copper tolerance to strains of baker's yeasts. Results We characterized the effects elicited in natural strains of Candida humilis and Saccharomyces cerevisiae by the exposure to copper in the culture broth. We observed that, whereas the growth of Saccharomyces cells was inhibited already at low Cu concentration, C. humilis was naturally robust and tolerated up to 1 g · L-1 CuSO4 in the medium. This resistant strain accumulated over 7 mg of Cu per gram of biomass and escaped severe oxidative stress thanks to high constitutive levels of superoxide dismutase and catalase. Both yeasts were then "evolved" to obtain hyper-resistant cells able to proliferate in high copper medium. While in S. cerevisiae the evolution of robustness towards Cu was paralleled by the increase of antioxidative enzymes, these same activities decreased in evolved hyper-resistant Candida cells. We also characterized in some detail changes in the profile of copper binding proteins, that appeared to be modified by evolution but, again, in a different way in the two yeasts. Conclusions Following evolution, both Candida and Saccharomyces cells were able to proliferate up to 2.5 g · L-1 CuSO4 and to accumulate high amounts of intracellular copper. The comparison of yeasts differing in their robustness, allowed highlighting physiological and molecular determinants of natural and acquired copper tolerance. We observed that different mechanisms contribute to confer metal tolerance: the control of copper uptake, changes in the levels of enzymes involved in oxidative stress response and changes in the copper-binding proteome. However, copper elicits different physiological and molecular reactions in yeasts with different backgrounds. PMID:22214286

Mitochondrial Copper Metabolism and Delivery to Cytochrome c Oxidase

PubMed Central

Horn, Darryl; Barrientos, Antoni

2010-01-01

Summary Metals are essential elements of all living organisms. Among them, copper is required for a multiplicity of functions including mitochondrial oxidative phosphorylation and protection against oxidative stress. Here we will focus on describing the pathways involved in the delivery of copper to cytochrome c oxidase (COX), a mitochondrial metalloenzyme acting as the terminal enzyme of the mitochondrial respiratory chain. The catalytic core of COX is formed by three mitochondrially-encoded subunits and contains three copper atoms. Two copper atoms bound to subunit 2 constitute the CuA site, the primary acceptor of electrons from ferrocytochrome c. The third copper, CuB, is associated with the high-spin heme a3 group of subunit 1. Recent studies, mostly performed in the yeast Saccharomyces cerevisiae, have provided new clues about 1- the source of the copper used for COX metallation; 2- the roles of Sco1p and Cox11p, the proteins involved in the direct delivery of copper to the CuA and CuB sites, respectively; 3- the action mechanism of Cox17p, a copper chaperone that provides copper to Sco1p and Cox11p; 4- the existence of at least four Cox17p homologues carrying a similar twin CX9C domain suggestive of metal binding, Cox19p, Cox23p, Pet191p and Cmc1p, that could be part of the same pathway; and 5- the presence of a disulfide relay system in the intermembrane space of mitochondria that mediates import of proteins with conserved cysteines motifs such as the CX9C characteristic of Cox17p and its homologues. The different pathways are reviewed and discussed in the context of both mitochondrial COX assembly and copper homeostasis. PMID:18459161

Bioinorganic Chemistry of Parkinson's Disease: Affinity and Structural Features of Cu(I) Binding to the Full-Length β-Synuclein Protein.

PubMed

Miotto, Marco C; Pavese, Mayra D; Quintanar, Liliana; Zweckstetter, Markus; Griesinger, Christian; Fernández, Claudio O

2017-09-05

Alterations in the levels of copper in brain tissue and formation of α-synuclein (αS)-copper complexes might play a key role in the amyloid aggregation of αS and the onset of Parkinson's disease (PD). Recently, we demonstrated that formation of the high-affinity Cu(I) complex with the N-terminally acetylated form of the protein αS substantially increases and stabilizes local conformations with α-helical secondary structure and restricted motility. In this work, we performed a detailed NMR-based structural characterization of the Cu(I) complexes with the full-length acetylated form of its homologue β-synuclein (βS), which is colocalized with αS in vivo and can bind copper ions. Our results show that, similarly to αS, the N-terminal region of βS constitutes the preferential binding interface for Cu(I) ions, encompassing two independent and noninteractive Cu(I) binding sites. According to these results, βS binds the metal ion with higher affinity than αS, in a coordination environment that involves the participation of Met-1, Met-5, and Met-10 residues (site 1). Compared to αS, the shift of His from position 50 to 65 in the N-terminal region of βS does not change the Cu(I) affinity features at that site (site 2). Interestingly, the formation of the high-affinity βS-Cu(I) complex at site 1 in the N-terminus promotes a short α-helix conformation that is restricted to the 1-5 segment of the AcβS sequence, which differs with the substantial increase in α-helix conformations seen for N-terminally acetylated αS upon Cu(I) complexation. Our NMR data demonstrate conclusively that the differences observed in the conformational transitions triggered by Cu(I) binding to AcαS and AcβS find a correlation at the level of their backbone dynamic properties; added to the potential biological implications of these findings, this fact opens new avenues of investigations into the bioinorganic chemistry of PD.

Analysis of metal-binding proteins separated by non-denaturating gel electrophoresis using matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) and laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS).

PubMed

Becker, J Susanne; Mounicou, Sandra; Zoriy, Miroslav V; Becker, J Sabine; Lobinski, Ryszard

2008-09-15

Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) and laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) have become established as very efficient and sensitive biopolymer and elemental mass spectrometric techniques for studying metal-binding proteins (metalloproteins) in life sciences. Protein complexes present in rat tissues (liver and kidney) were separated in their native state in the first dimension by blue native gel electrophoresis (BN-PAGE). Essential and toxic metals, such as zinc, copper, iron, nickel, chromium, cadmium and lead, were detected by scanning the gel bands using quadrupole LA-ICP-MS with and without collision cell as a microanalytical technique. Several proteins were identified by using MALDI-TOF-MS together with a database search. For example, on one protein band cut from the BN-PAGE gel and digested with the enzyme trypsin, two different proteins - protein FAM44B and cathepsin B precursor - were identified. By combining biomolecular and elemental mass spectrometry, it was possible to characterize and identify selected metal-binding rat liver and kidney tissue proteins.

Methanobactin and the Link between Copper and Bacterial Methane Oxidation

PubMed Central

Semrau, Jeremy D.; Murrell, J. Colin; Gallagher, Warren H.; Dennison, Christopher; Vuilleumier, Stéphane

2016-01-01

SUMMARY Methanobactins (mbs) are low-molecular-mass (<1,200 Da) copper-binding peptides, or chalkophores, produced by many methane-oxidizing bacteria (methanotrophs). These molecules exhibit similarities to certain iron-binding siderophores but are expressed and secreted in response to copper limitation. Structurally, mbs are characterized by a pair of heterocyclic rings with associated thioamide groups that form the copper coordination site. One of the rings is always an oxazolone and the second ring an oxazolone, an imidazolone, or a pyrazinedione moiety. The mb molecule originates from a peptide precursor that undergoes a series of posttranslational modifications, including (i) ring formation, (ii) cleavage of a leader peptide sequence, and (iii) in some cases, addition of a sulfate group. Functionally, mbs represent the extracellular component of a copper acquisition system. Consistent with this role in copper acquisition, mbs have a high affinity for copper ions. Following binding, mbs rapidly reduce Cu2+ to Cu1+. In addition to binding copper, mbs will bind most transition metals and near-transition metals and protect the host methanotroph as well as other bacteria from toxic metals. Several other physiological functions have been assigned to mbs, based primarily on their redox and metal-binding properties. In this review, we examine the current state of knowledge of this novel type of metal-binding peptide. We also explore its potential applications, how mbs may alter the bioavailability of multiple metals, and the many roles mbs may play in the physiology of methanotrophs. PMID:26984926

The structure and inhibition of human diamine oxidase†,‡

PubMed Central

McGrath, Aaron P; Hilmer, Kimberly M; Collyer, Charles A; Shepard, Eric M; Elmore, Bradley O.; Brown, Doreen E; Dooley, David M; Guss, J Mitchell

2009-01-01

Humans have three functioning genes that code for copper-containing amine oxidases. The product of the AOC1 gene is a so-called diamine oxidase (hDAO), named for its substrate preference for diamines, particularly histamine. hDAO has been cloned and expressed in insect cells and the structure of the native enzyme determined by X-ray crystallography to a resolution of 1.8 Å. The homodimeric structure has the archetypal amine oxidase fold. Two active sites, one in each subunit, are characterized by the presence of a copper ion and a topaquinone residue formed by the post-translational modification of a tyrosine. Although hDAO shares 37.9 % sequence identity with another human copper amine oxidase, semicarbazide sensitive amine oxidase or vascular adhesion protein-1, its substrate binding pocket and entry channel are distinctly different in accord with the different substrate specificities. The structures of two inhibitor complexes of hDAO, berenil and pentamidine, have been refined to resolutions of 2.1 Å and 2.2 Å, respectively. They bind non-covalently in the active site channel. The inhibitor binding suggests that an aspartic acid residue, conserved in all diamine oxidases but absent from other amine oxidases, is responsible for the diamine specificity by interacting with the second amino group of preferred diamine substrates. PMID:19764817

In silico characterization and transcriptomic analysis of nif family genes from Anabaena sp. PCC7120.

PubMed

Singh, Shilpi; Shrivastava, Alok Kumar

2017-10-01

In silico approaches in conjunction with morphology, nitrogenase activity, and qRT-PCR explore the impact of selected abiotic stressor such as arsenic, salt, cadmium, copper, and butachlor on nitrogen fixing (nif family) genes of diazotrophic cyanobacterium Anabaena sp. PCC7120. A total of 19 nif genes are present within the Anabaena genome that is involved in the process of nitrogen fixation. Docking studies revealed the interaction between these nif gene-encoded proteins and the selected abiotic stressors which were further validated through decreased heterocyst frequency, fragmentation of filaments, and downregulation of nitrogenase activity under these stresses indicating towards their toxic impact on nitrogen fixation potential of filamentous cyanobacterium Anabaena sp. PCC7120. Another appealing finding of this study is even though having similar binding energy and similar interacting residues between arsenic/salt and copper/cadmium to nif-encoded proteins, arsenic and cadmium are more toxic than salt and copper for nitrogenase activity of Anabaena which is crucial for growth and yield of rice paddy and soil reclamation.

FINDSITE-metal: Integrating evolutionary information and machine learning for structure-based metal binding site prediction at the proteome level

PubMed Central

Brylinski, Michal; Skolnick, Jeffrey

2010-01-01

The rapid accumulation of gene sequences, many of which are hypothetical proteins with unknown function, has stimulated the development of accurate computational tools for protein function prediction with evolution/structure-based approaches showing considerable promise. In this paper, we present FINDSITE-metal, a new threading-based method designed specifically to detect metal binding sites in modeled protein structures. Comprehensive benchmarks using different quality protein structures show that weakly homologous protein models provide sufficient structural information for quite accurate annotation by FINDSITE-metal. Combining structure/evolutionary information with machine learning results in highly accurate metal binding annotations; for protein models constructed by TASSER, whose average Cα RMSD from the native structure is 8.9 Å, 59.5% (71.9%) of the best of top five predicted metal locations are within 4 Å (8 Å) from a bound metal in the crystal structure. For most of the targets, multiple metal binding sites are detected with the best predicted binding site at rank 1 and within the top 2 ranks in 65.6% and 83.1% of the cases, respectively. Furthermore, for iron, copper, zinc, calcium and magnesium ions, the binding metal can be predicted with high, typically 70-90%, accuracy. FINDSITE-metal also provides a set of confidence indexes that help assess the reliability of predictions. Finally, we describe the proteome-wide application of FINDSITE-metal that quantifies the metal binding complement of the human proteome. FINDSITE-metal is freely available to the academic community at http://cssb.biology.gatech.edu/findsite-metal/. PMID:21287609

Competition between Metals for Binding to Methanobactin Enables Expression of Soluble Methane Monooxygenase in the Presence of Copper

PubMed Central

Kalidass, Bhagyalakshmi; Ul-Haque, Muhammad Farhan; Baral, Bipin S.; DiSpirito, Alan A.

2014-01-01

It is well known that copper is a key factor regulating expression of the two forms of methane monooxygenase found in proteobacterial methanotrophs. Of these forms, the cytoplasmic, or soluble, methane monooxygenase (sMMO) is expressed only at low copper concentrations. The membrane-bound, or particulate, methane monooxygenase (pMMO) is constitutively expressed with respect to copper, and such expression increases with increasing copper. Recent findings have shown that copper uptake is mediated by a modified polypeptide, or chalkophore, termed methanobactin. Although methanobactin has high specificity for copper, it can bind other metals, e.g., gold. Here we show that in Methylosinus trichosporium OB3b, sMMO is expressed and active in the presence of copper if gold is also simultaneously present. Such expression appears to be due to gold binding to methanobactin produced by M. trichosporium OB3b, thereby limiting copper uptake. Such expression and activity, however, was significantly reduced if methanobactin preloaded with copper was also added. Further, quantitative reverse transcriptase PCR (RT-qPCR) of transcripts of genes encoding polypeptides of both forms of MMO and SDS-PAGE results indicate that both sMMO and pMMO can be expressed when copper and gold are present, as gold effectively competes with copper for binding to methanobactin. Such findings suggest that under certain geochemical conditions, both forms of MMO may be expressed and active in situ. Finally, these findings also suggest strategies whereby field sites can be manipulated to enhance sMMO expression, i.e., through the addition of a metal that can compete with copper for binding to methanobactin. PMID:25416758

Competition between metals for binding to methanobactin enables expression of soluble methane monooxygenase in the presence of copper.

PubMed

Kalidass, Bhagyalakshmi; Ul-Haque, Muhammad Farhan; Baral, Bipin S; DiSpirito, Alan A; Semrau, Jeremy D

2015-02-01

It is well known that copper is a key factor regulating expression of the two forms of methane monooxygenase found in proteobacterial methanotrophs. Of these forms, the cytoplasmic, or soluble, methane monooxygenase (sMMO) is expressed only at low copper concentrations. The membrane-bound, or particulate, methane monooxygenase (pMMO) is constitutively expressed with respect to copper, and such expression increases with increasing copper. Recent findings have shown that copper uptake is mediated by a modified polypeptide, or chalkophore, termed methanobactin. Although methanobactin has high specificity for copper, it can bind other metals, e.g., gold. Here we show that in Methylosinus trichosporium OB3b, sMMO is expressed and active in the presence of copper if gold is also simultaneously present. Such expression appears to be due to gold binding to methanobactin produced by M. trichosporium OB3b, thereby limiting copper uptake. Such expression and activity, however, was significantly reduced if methanobactin preloaded with copper was also added. Further, quantitative reverse transcriptase PCR (RT-qPCR) of transcripts of genes encoding polypeptides of both forms of MMO and SDS-PAGE results indicate that both sMMO and pMMO can be expressed when copper and gold are present, as gold effectively competes with copper for binding to methanobactin. Such findings suggest that under certain geochemical conditions, both forms of MMO may be expressed and active in situ. Finally, these findings also suggest strategies whereby field sites can be manipulated to enhance sMMO expression, i.e., through the addition of a metal that can compete with copper for binding to methanobactin. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Models for the mechanism for activating copper-zinc superoxide dismutase in the absence of the CCS Cu chaperone in Arabidopsis.

PubMed

Huang, Chien-Hsun; Kuo, Wen-Yu; Jinn, Tsung-Luo

2012-03-01

Copper-zinc superoxide dismutase (CuZnSOD; CSD) is an important antioxidant enzyme for oxidative stress protection. To date, two activation pathways have been identified in many species. One requiring the CCS, Cu chaperone for SOD, to insert Cu and activate CSD (referred to as CCS-dependent pathway), and the other works independently of CCS (referred to as CCS-independent pathway). In our previous study, we suggest an unidentified factor will work with glutathione (GSH) for CSD activation in the absence of the CCS. Here, two models of the CCS-independent mechanism are proposed. The role of the unidentified factor may work as a scaffold protein, which provides a platform for the CSD protein and Cu-GSH to interact, or as a Cu carrier, which itself can bind Cu and interact with CSD proteins. We also suggest that the CSD protein conformation at C-terminal is important in providing a docking site for unidentified factor to access.

Iron and copper as virulence modulators in human fungal pathogens.

PubMed

Ding, Chen; Festa, Richard A; Sun, Tian-Shu; Wang, Zhan-You

2014-07-01

Fungal pathogens have evolved sophisticated machinery to precisely balance the fine line between acquiring essential metals and defending against metal toxicity. Iron and copper are essential metals for many processes in both fungal pathogens and their mammalian hosts, but reduce viability when present in excess. However, during infection, the host uses these two metals differently. Fe has a long-standing history of influencing virulence in pathogenic fungi, mostly in regards to Fe acquisition. Numerous studies demonstrate the requirement of the Fe acquisition pathway of Candida, Cryptococcus and Aspergillus for successful systemic infection. Fe is not free in the host, but is associated with Fe-binding proteins, leading fungi to develop mechanisms to interact with and to acquire Fe from these Fe-bound proteins. Cu is also essential for cell growth and development. Essential Cu-binding proteins include Fe transporters, superoxide dismutase (SOD) and cytochrome c oxidase. Although Cu acquisition plays critical roles in fungal survival in the host, recent work has revealed that Cu detoxification is extremely important. Here, we review fungal responses to altered metal conditions presented by the host, contrast the roles of Fe and Cu during infection, and outline the critical roles of fungal metal homeostasis machinery at the host-pathogen axis. © 2014 John Wiley & Sons Ltd.

A novel-type phosphatidylinositol phosphate-interactive, Ca-binding protein PCaP1 in Arabidopsis thaliana: stable association with plasma membrane and partial involvement in stomata closure.

PubMed

Nagata, Chisako; Miwa, Chika; Tanaka, Natsuki; Kato, Mariko; Suito, Momoe; Tsuchihira, Ayako; Sato, Yori; Segami, Shoji; Maeshima, Masayoshi

2016-05-01

The Ca(2+)-binding protein-1 (PCaP1) of Arabidopsis thaliana is a new type protein that binds to phosphatidylinositol phosphates and Ca(2+)-calmodulin complex as well as free Ca(2+). Although biochemical properties, such as binding to ligands and N-myristoylation, have been revealed, the intracellular localization, tissue and cell specificity, integrity of membrane association and physiological roles of PCaP1 are unknown. We investigated the tissue and intracellular distribution of PCaP1 by using transgenic lines expressing PCaP1 linked with a green fluorescence protein (GFP) at the carboxyl terminus of PCaP1. GFP fluorescence was obviously detected in most tissues including root, stem, leaf and flower. In these tissues, PCaP1-GFP signal was observed predominantly in the plasma membrane even under physiological stress conditions but not in other organelles. The fluorescence was detected in the cytosol when the 25-residue N-terminal sequence was deleted from PCaP1 indicating essential contribution of N-myristoylation to the plasma membrane anchoring. Fluorescence intensity of PCaP1-GFP in roots was slightly decreased in seedlings grown in medium supplemented with high concentrations of iron for 1 week and increased in those grown with copper. In stomatal guard cells, PCaP1-GFP was strictly, specifically localized to the plasma membrane at the epidermal-cell side but not at the pore side. A T-DNA insertion mutant line of PCaP1 did not show marked phenotype in a life cycle except for well growth under high CO2 conditions. However, stomata of the mutant line did not close entirely even in high osmolarity, which usually induces stomata closure. These results suggest that PCaP1 is involved in the stomatal movement, especially closure process, in leaves and response to excessive copper in root and leaf as a mineral nutrient as a physiological role.

Determination of an organic-acid analog of DOC for use in copper toxicity studies on salmonids

DOE Office of Scientific and Technical Information (OSTI.GOV)

MacRae, R.K.; Meyer, J.S.; Hansen, J.A.

1995-12-31

Concentrations of dissolved copper in streams draining mine sites often exceed concentrations shown to cause acute and chronic mortality in salmonids. However, toxicity and impaired behaviors may be modified by dissolved organic carbon (DOC) and other inorganic components present in the site water. The effects of DOC on copper speciation, and thus bioavailability and toxicity, were determined by titrating stream waters with copper, using a cupric ion-specific electrode to detect free copper concentrations. Effects of various competing cations (e.g., Ca{sup +2}, Co{sup +2}) on copper-DOC binding were also evaluated. Titration results were evaluated using Scatchard and non-linear regression analyses tomore » quantify the strength and capacity of copper-DOC binding. Inorganic speciation was determined using the geochemical model MINEQL{sup +}. Results of these titrations indicated the presence of two or three distinct copper binding components in site water DOC. Three commercially available organic acids where then chosen to mimic the binding characteristics of natural DOC. This DOC-analog was used successfully in fish toxicity studies to evaluate the influence of DOC on copper bioavailability. Geochemical models were developed to predict copper speciation in both laboratory test waters and site waters, for any typical combination of water chemistry parameters (pH, alkalinity, [DOC], etc.). A combined interpretation of fish toxicity and modeling results indicate that some DOC-bound copper was bioavailable.« less

Role of copper transport protein Antioxidant-1 in Angiotensin II-induced hypertension: A key regulator of Extracellular SOD

PubMed Central

Ozumi, Kiyoshi; Sudhahar, Varadarajan; Kim, Ha Won; Chen, Gin-Fu; Kohno, Takashi; Finney, Lydia; Vogt, Stefan; McKinney, Ronald D.; Ushio-Fukai, Masuko; Fukai, Tohru

2012-01-01

Extracellular superoxide dismutase (SOD3) is a secretory copper enzyme involved in protecting angiotensin II (Ang II)-induced hypertension. We previously found that Ang II upregulates SOD3 expression and activity as a counter-regulatory mechanism; however, underlying mechanisms are unclear. Antioxidant-1 (Atox1) is shown to act as a copper-dependent transcription factor as well as copper chaperone for SOD3 in vitro, but its role in Ang II-induced hypertension in vivo is unknown. Here we show that Ang II infusion increases Atox1 expression as well as SOD3 expression and activity in aortas of wild-type mice, which are inhibited in mice lacking Atox1. Accordingly, Ang II increases vascular O2•− production, reduces endothelium-dependent vasodilation and increases vasoconstriction in mesenteric arterioles to a greater extent in Atox1−/− than in wild-type mice. This contributes to augmented hypertensive response to Ang II in Atox1−/− mice. In cultured vascular smooth muscle cells, Ang II promotes translocation of Atox1 to the nucleus, thereby increasing SOD3 transcription by binding to Atox1 responsive element in the SOD3 promoter. Furthermore, Ang II increases Atox1 binding to the copper exporter ATP7A which obtains copper from Atox1 as well as translocation of ATP7A to plasma membranes where it colocalizes with SOD3. As its consequence, Ang II decreases vascular copper levels, which is inhibited in Atox1−/− mice. In summary, Atox1 functions to prevent Ang II-induced endothelial dysfunction and hyper-contraction in resistant vessels as well as hypertension in vivo by reducing extracellular O2•− levels via increasing vascular SOD3 expression and activity. PMID:22753205

Fluorescence properties and conformational stability of the beta-hemocyanin of Helix pomatia.

PubMed

Idakieva, Krassimira; Siddiqui, Nurul I; Parvanova, Katja; Nikolov, Peter; Gielens, Constant

2006-04-01

The beta-hemocyanin (beta-HpH) is one of the three dioxygen-binding proteins found freely dissolved in the hemolymph of the gastropodan mollusc Helix pomatia. The didecameric molecule (molecular mass 9 MDa) is built up of only one type of subunits. The fluorescence properties of the oxygenated and apo-form (copper-deprived) of the didecamer and its subunits were characterized. Upon excitation of the hemocyanins at 295 or 280 nm, tryptophyl residues buried in the hydrophobic interior of the protein determine the fluorescence emission. This is confirmed by quenching experiments with acrylamide, cesium chloride and potassium iodide. The copper-dioxygen system at the binuclear active site quenches the tryptophan emission of the oxy-beta-HpH. The removal of this system increases the fluorescence quantum yield and causes structural rearrangement of the microenvironment of the emitting tryptophyl residues in the apo-form. Time-resolved fluorescence measurements show that the oxygenated and copper-deprived forms of the beta-HpH and its subunits exist in different conformations. The thermal stability of the oxy- and apo-beta-HpH is characterized by a transition temperature (Tm) of 84 degrees C and 63 degrees C, respectively, obtained by differential scanning calorimetry. Increase of the temperature influences the active site at lower temperatures than the environments of tryptophans and tyrosines causing a loss of oxygen bound to the copper atoms. This process is, at least partially, reversible as after cooling of the protein samples, around 60% reinstatement of the copper-peroxide band has been observed. The results confirm the role of the copper-dioxygen complex for the stabilization of the hemocyanin structure in solution. The other important stabilizing factor is oligomerization of the hemocyanin molecule.

Competitive Binding to Cuprous Ions of Protein and BCA in the Bicinchoninic Acid Protein Assay

PubMed Central

Huang, Tao; Long, Mian; Huo, Bo

2010-01-01

Although Bicinchoninic acid (BCA) has been widely used to determine protein concentration, the mechanism of interaction between protein, copper ion and BCA in this assay is still not well known. Using the Micro BCA protein assay kit (Pierce Company), we measured the absorbance at 562 nm of BSA solutions with different concentrations of protein, and also varied the BCA concentration. When the concentration of protein was increased, the absorbance exhibited the known linear and nonlinear increase, and then reached an unexpected plateau followed by a gradual decrease. We introduced a model in which peptide chains competed with BCA for binding to cuprous ions. Formation of the well-known chromogenic complex of BCA-Cu1+-BCA was competed with the binding of two peptide bonds (NTPB) to cuprous ion, and there is the possibility of the existence of two new complexes. A simple equilibrium equation was established to describe the correlations between the substances in solution at equilibrium, and an empirical exponential function was introduced to describe the reduction reaction. Theoretical predictions of absorbance from the model were in good agreement with the measurements, which not only validated the competitive binding model, but also predicted a new complex of BCA-Cu1+-NTPB that might exist in the final solution. This work provides a new insight into understanding the chemical bases of the BCA protein assay and might extend the assay to higher protein concentration. PMID:21625379

Functional characterization of the copper transcription factor AfMac1 from Aspergillus fumigatus.

PubMed

Park, Yong-Sung; Kim, Tae-Hyoung; Yun, Cheol-Won

2017-07-03

Although copper functions as a cofactor in many physiological processes, copper overload leads to harmful effects in living cells. Thus, copper homeostasis is tightly regulated. However, detailed copper metabolic pathways have not yet been identified in filamentous fungi. In this report, we investigated the copper transcription factor AfMac1 ( A spergillus f umigatus Mac1 homolog) and identified its regulatory mechanism in A. fumigatus AfMac1 has domains homologous to the DNA-binding and copper-binding domains of Mac1 from Saccharomyces cerevisiae , and AfMac1 efficiently complemented Mac1 in S. cerevisiae Expression of Afmac1 resulted in CTR1 up-regulation, and mutation of the DNA-binding domain of Afmac1 failed to activate CTR1 expression in S. cerevisiae The Afmac1 deletion strain of A. fumigatus failed to grow in copper-limited media, and its growth was restored by introducing ctrC We found that AfMac1 specifically bound to the promoter region of ctrC based on EMSA. The AfMac1-binding motif 5'-TGTGCTCA-3' was identified from the promoter region of ctrC , and the addition of mutant ctrC lacking the AfMac1-binding motif failed to up-regulate ctrC in A. fumigatus Furthermore, deletion of Afmac1 significantly reduced strain virulence and activated conidial killing activity by neutrophils and macrophages. Taken together, these results suggest that AfMac1 is a copper transcription factor that regulates cellular copper homeostasis in A. fumigatus . © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

Effect of Dioxygen on Copper(II) Binding to α-Synuclein

PubMed Central

Lucas, Heather R.; Lee, Jennifer C.

2010-01-01

Using the fluorescent amino acid tryptophan (Trp), we have characterized the copper(II) binding of F4W α-synuclein in the presence and absence of dioxygen at neutral pH. Variations in Trp fluorescence indicate that copper(II) binding is enhanced by the presence of dioxygen, with the apparent dissociation constant (Kd(app)) changing from 100 nM (anaerobic) to 10 nM (aerobic). To investigate the possible role of methionine oxidation, complementary work focused on synthetic peptide models of the N-terminal Cu(II)-α-syn site, MDV(F/W) and M*DV(F/W), where M*= methionine sulfoxide. Furthermore, we employed circular dichroism (CD) spectroscopy to demonstrate that the phenyl-to-indole (F→W) substitution does not alter copper(II) binding properties and to confirm the 1:1 metal-peptide binding stoichiometry. CD comparisons also revealed that Met1 oxidation does not affect the copper-peptide conformation and further suggested the possible existence of a CuII-Trp/Phe (cation-π) interaction. PMID:20064662

DNA/RNA binding and anticancer/antimicrobial activities of polymer-copper(II) complexes

NASA Astrophysics Data System (ADS)

Lakshmipraba, Jagadeesan; Arunachalam, Sankaralingam; Riyasdeen, Anvarbatcha; Dhivya, Rajakumar; Vignesh, Sivanandham; Akbarsha, Mohammad Abdulkader; James, Rathinam Arthur

2013-05-01

Water soluble polymer-copper(II) complexes with various degrees of coordination in the polymer chain were synthesized and characterized by elemental analysis, IR, UV-visible and EPR spectra. The DNA/RNA binding behavior of these polymer-copper(II) complexes was examined by UV-visible absorption, emission and circular dichroism spectroscopic methods, and cyclic voltammetry techniques. The binding of the polymer-copper(II) complexes with DNA/RNA was mainly through intercalation but some amount of electrostatic interaction was also observed. This binding capacity increased with the degree of coordination of the complexes. The polymer-copper(II) complex having the highest degree of coordination was subjected to analysis of cytotoxic and antimicrobial properties. The cytotoxicity study indicated that the polymer-copper(II) complexes affected the viability of MCF-7 mammary carcinoma cells, and the cells responded to the treatment with mostly through apoptosis although a few cells succumbed to necrosis. The antimicrobial screening showed activity against some human pathogens.

Tracking metal ions through a Cu/Ag efflux pump assigns the functional roles of the periplasmic proteins

DOE PAGES

Chacon, Kelly N.; Mealman, Tiffany D.; McEvoy, Megan M.; ...

2014-10-13

Copper is an essential nutrient for all aerobic organisms but is toxic in excess. At the host–pathogen interface, macrophages respond to bacterial infection by copper-dependent killing mechanisms, whereas the invading bacteria are thought to counter with an up-regulation of copper transporters and efflux pumps. The tripartite efflux pump CusCBA and its metallochaperone CusF are vital to the detoxification of copper and silver ions in the periplasm of Escherichia coli. However, the mechanism of efflux by this complex, which requires the activation of the inner membrane pump CusA, is poorly understood. In this paper, we use selenomethionine (SeM) active site labelsmore » in a series of biological X-ray absorption studies at the selenium, copper, and silver edges to establish a “switch” role for the membrane fusion protein CusB. We determine that metal-bound CusB is required for activation of cuprous ion transfer from CusF directly to a site in the CusA antiporter, showing for the first time (to our knowledge) the in vitro activation of the Cus efflux pump. This metal-binding site of CusA is unlike that observed in the crystal structures of the CusA protein and is composed of one oxygen and two sulfur ligands. Finally, our results suggest that metal transfer occurs between CusF and apo-CusB, and that, when metal-loaded, CusB plays a role in the regulation of metal ion transfer from CusF to CusA in the periplasm.« less

Tracking metal ions through a Cu/Ag efflux pump assigns the functional roles of the periplasmic proteins.

PubMed

Chacón, Kelly N; Mealman, Tiffany D; McEvoy, Megan M; Blackburn, Ninian J

2014-10-28

Copper is an essential nutrient for all aerobic organisms but is toxic in excess. At the host-pathogen interface, macrophages respond to bacterial infection by copper-dependent killing mechanisms, whereas the invading bacteria are thought to counter with an up-regulation of copper transporters and efflux pumps. The tripartite efflux pump CusCBA and its metallochaperone CusF are vital to the detoxification of copper and silver ions in the periplasm of Escherichia coli. However, the mechanism of efflux by this complex, which requires the activation of the inner membrane pump CusA, is poorly understood. Here, we use selenomethionine (SeM) active site labels in a series of biological X-ray absorption studies at the selenium, copper, and silver edges to establish a "switch" role for the membrane fusion protein CusB. We determine that metal-bound CusB is required for activation of cuprous ion transfer from CusF directly to a site in the CusA antiporter, showing for the first time (to our knowledge) the in vitro activation of the Cus efflux pump. This metal-binding site of CusA is unlike that observed in the crystal structures of the CusA protein and is composed of one oxygen and two sulfur ligands. Our results suggest that metal transfer occurs between CusF and apo-CusB, and that, when metal-loaded, CusB plays a role in the regulation of metal ion transfer from CusF to CusA in the periplasm.

Molecular Basis of the Bohr Effect in Arthropod Hemocyanin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hirota, S.; Kawahara, T; Beltramini, M

2008-01-01

Flash photolysis and K-edge x-ray absorption spectroscopy (XAS) were used to investigate the functional and structural effects of pH on the oxygen affinity of three homologous arthropod hemocyanins (Hcs). Flash photolysis measurements showed that the well-characterized pH dependence of oxygen affinity (Bohr effect) is attributable to changes in the oxygen binding rate constant, kon, rather than changes in koff. In parallel, coordination geometry of copper in Hc was evaluated as a function of pH by XAS. It was found that the geometry of copper in the oxygenated protein is unchanged at all pH values investigated, while significant changes were observedmore » for the deoxygenated protein as a function of pH. The interpretation of these changes was based on previously described correlations between spectral lineshape and coordination geometry obtained for model compounds of known structure A pH-dependent change in the geometry of cuprous copper in the active site of deoxyHc, from pseudotetrahedral toward trigonal was assigned from the observed intensity dependence of the 1s ? 4pz transition in x-ray absorption near edge structure (XANES) spectra. The structural alteration correlated well with increase in oxygen affinity at alkaline pH determined in flash photolysis experiments. These results suggest that the oxygen binding rate in deoxyHc depends on the coordination geometry of Cu(I) and suggest a structural origin for the Bohr effect in arthropod Hcs.« less

Multi-Copper Oxidases and Human Iron Metabolism

PubMed Central

Vashchenko, Ganna; MacGillivray, Ross T. A.

2013-01-01

Multi-copper oxidases (MCOs) are a small group of enzymes that oxidize their substrate with the concomitant reduction of dioxygen to two water molecules. Generally, multi-copper oxidases are promiscuous with regards to their reducing substrates and are capable of performing various functions in different species. To date, three multi-copper oxidases have been detected in humans—ceruloplasmin, hephaestin and zyklopen. Each of these enzymes has a high specificity towards iron with the resulting ferroxidase activity being associated with ferroportin, the only known iron exporter protein in humans. Ferroportin exports iron as Fe2+, but transferrin, the major iron transporter protein of blood, can bind only Fe3+ effectively. Iron oxidation in enterocytes is mediated mainly by hephaestin thus allowing dietary iron to enter the bloodstream. Zyklopen is involved in iron efflux from placental trophoblasts during iron transfer from mother to fetus. Release of iron from the liver relies on ferroportin and the ferroxidase activity of ceruloplasmin which is found in blood in a soluble form. Ceruloplasmin, hephaestin and zyklopen show distinctive expression patterns and have unique mechanisms for regulating their expression. These features of human multi-copper ferroxidases can serve as a basis for the precise control of iron efflux in different tissues. In this manuscript, we review the biochemical and biological properties of the three human MCOs and discuss their potential roles in human iron homeostasis. PMID:23807651

Triplin, a small molecule, reveals copper ion transport in ethylene signaling from ATX1 to RAN1.

PubMed

Li, Wenbo; Lacey, Randy F; Ye, Yajin; Lu, Juan; Yeh, Kuo-Chen; Xiao, Youli; Li, Laigeng; Wen, Chi-Kuang; Binder, Brad M; Zhao, Yang

2017-04-01

Copper ions play an important role in ethylene receptor biogenesis and proper function. The copper transporter RESPONSIVE-TO-ANTAGONIST1 (RAN1) is essential for copper ion transport in Arabidopsis thaliana. However it is still unclear how copper ions are delivered to RAN1 and how copper ions affect ethylene receptors. There is not a specific copper chelator which could be used to explore these questions. Here, by chemical genetics, we identified a novel small molecule, triplin, which could cause a triple response phenotype on dark-grown Arabidopsis seedlings through ethylene signaling pathway. ran1-1 and ran1-2 are hypersensitive to triplin. Adding copper ions in growth medium could partially restore the phenotype on plant caused by triplin. Mass spectrometry analysis showed that triplin could bind copper ion. Compared to the known chelators, triplin acts more specifically to copper ion and it suppresses the toxic effects of excess copper ions on plant root growth. We further showed that mutants of ANTIOXIDANT PROTEIN1 (ATX1) are hypersensitive to tiplin, but with less sensitivity comparing with the ones of ran1-1 and ran1-2. Our study provided genetic evidence for the first time that, copper ions necessary for ethylene receptor biogenesis and signaling are transported from ATX1 to RAN1. Considering that triplin could chelate copper ions in Arabidopsis, and copper ions are essential for plant and animal, we believe that, triplin not only could be useful for studying copper ion transport of plants, but also could be useful for copper metabolism study in animal and human.

Binding of Copper and Silver to Single-Site Variants of Peptidylglycine Monooxygenase Reveals the Structure and Chemistry of the Individual Metal Centers

PubMed Central

2015-01-01

Peptidylglycine monooxygenase (PHM) catalyzes the final step in the biosynthesis of amidated peptides that serve as important signaling molecules in numerous endocrine pathways. The catalytic mechanism has attracted much attention because of a number of unique attributes, including the presence of a pair of uncoupled copper centers separated by 11 Å (termed CuH and CuM), an unusual Cu(I)SMet interaction at the oxygen binding M-site, and the postulated Cu(II)–superoxo intermediate. Understanding the mechanism requires determining the catalytic roles of the individual copper centers and how they change during catalysis, a task made more difficult by the overlapping spectral signals from each copper center in the wild-type (WT) protein. To aid in this effort, we constructed and characterized two PHM variants that bound metal at only one site. The H242A variant bound copper at the H-center, while the H107AH108A double mutant bound copper at the M-center; both mutants were devoid of catalytic activity. Oxidized Cu(II) forms showed electron paramagnetic resonance and extended X-ray absorption fine structure (EXAFS) spectra consistent with their previously determined Cu(II)His3O and Cu(II)His2O2 ligand sets for the H- and M-centers, respectively. Cu(I) forms, on the other hand, showed unique chemistry. The M-center bound two histidines and a methionine at all pHs, while the H-center was two-coordinate at neutral pH but coordinated a new methionine S ligand at low pH. Fourier transform infrared studies confirmed and extended previous assignments of CO binding and showed unambiguously that the 2092 cm–1 absorbing species observed in the WT and many variant forms is an M-site Cu(I)–CO adduct. Silver binding was also investigated. When H107AH108A and M109I (a WT analogue with both sites intact) were incubated with excess AgNO3, each variant bound a single Ag(I) ion, from which it was inferred that Ag(I) binds selectively at the M-center with little or no affinity for the H-center. EXAFS at the Ag K-edge established a strong degree of similarity between the ligand sets of Cu and Ag bound at the M-center. These studies validate previous spectral assignments and provide new insights into the detailed chemistry of each metal site. PMID:24471980

Destruction of the Capsid and Genome of GII.4 Human Norovirus Occurs during Exposure to Metal Alloys Containing Copper

PubMed Central

Manuel, C. S.; Moore, M. D.

2015-01-01

Human norovirus (HuNoV) represents a significant public health burden worldwide and can be environmentally transmitted. Copper surfaces have been shown to inactivate the cultivable surrogate murine norovirus, but no such data exist for HuNoV. The purpose of this study was to characterize the destruction of GII.4 HuNoV and virus-like particles (VLPs) during exposure to copper alloy surfaces. Fecal suspensions positive for a GII.4 HuNoV outbreak strain or GII.4 VLPs were exposed to copper alloys or stainless steel for 0 to 240 min and recovered by elution. HuNoV genome integrity was assessed by reverse transcription-quantitative PCR (RT-qPCR) (without RNase treatment), and capsid integrity was assessed by RT-qPCR (with RNase treatment), transmission electron microscopy (TEM), SDS-PAGE/Western blot analysis, and a histo-blood group antigen (HBGA) binding assay. Exposure of fecal suspensions to pure copper for 60 min reduced the GII.4 HuNoV RNA copy number by ∼3 log10 units when analyzed by RT-qPCR without RNase treatment and by 4 log10 units when a prior RNase treatment was used. The rate of reduction of the HuNoV RNA copy number was approximately proportional to the percentage of copper in each alloy. Exposure of GII.4 HuNoV VLPs to pure-copper surfaces resulted in noticeable aggregation and destruction within 240 min, an 80% reduction in the VP1 major capsid protein band intensity in 15 min, and a near-complete loss of HBGA receptor binding within 8 min. In all experiments, HuNoV remained stable on stainless steel. These results suggest that copper surfaces destroy HuNoV and may be useful in preventing environmental transmission of the virus in at-risk settings. PMID:25979897

Interaction between the AAA ATPase p97/VCP and a concealed UBX domain in the copper transporter ATP7A is associated with motor neuron degeneration.

PubMed

Yi, Ling; Kaler, Stephen G

2018-05-18

The copper-transporting ATPase ATP7A contains eight transmembrane domains and is required for normal human copper homeostasis. Mutations in the ATP7A gene may lead to infantile-onset cerebral degeneration (Menkes disease); occipital horn syndrome (OHS), a related but much milder illness; or an adult-onset isolated distal motor neuropathy. The ATP7A missense mutation T994I is located in the sixth transmembrane domain of ATP7A, represents one of the variants associated with the latter phenotype, and is associated with an abnormal interaction with p97/valosin-containing protein (VCP), a hexameric AAA ATPase (ATPase associated with diverse cellular activities) with multiple biological functions. In this study, we further characterized this interaction and discovered a concealed UBX domain in the third lumenal loop of ATP7A, between its fifth and sixth transmembrane domains. We show that the T994I substitution results in conformational exposure of the UBX domain, which then binds the N-terminal domain of p97/VCP. We also show that this abnormal interaction occurs at or near the cell plasma membrane. The UBX domain has a conserved hydrophobic FP (Phe-Pro) motif, and substitution with di-alanine abrogated the interaction and restored the proper intracellular localization of ATP7A in the trans -Golgi network. Using protein MS, we identified potential coordinating components of the ATP7A T994I -p97 complex, including NSFL1 cofactor (NSF1C or p47) that may be relevant to the pathophysiology and clinical effects associated with ATP7A T994I Our study represents the first report of p97/VCP binding to a UBX domain that is not normally exposed, resulting in an aberrant protein-protein interaction leading to motor neuron degeneration.

DNA binding and biological studies of some novel water-soluble polymer-copper(II)-phenanthroline complexes.

PubMed

Kumar, Rajendran Senthil; Arunachalam, Sankaralingam; Periasamy, Vaiyapuri Subbarayan; Preethy, Christo Paul; Riyasdeen, Anvarbatcha; Akbarsha, Mohammad Abdulkader

2008-10-01

Some novel water-soluble polymer-copper(II)-phenanthroline complex samples, [Cu(phen)2(BPEI)]Cl(2).4H2O (phen=1,10-phenanthroline, BPEI=branched polyethyleneimine), with different degrees of copper complex content in the polymer chain have been prepared by ligand substitution method in water-ethanol medium and characterized by infrared, UV-visible, EPR spectral and elemental analysis methods. The binding of these complex samples with DNA has been investigated by electronic absorption spectroscopy, emission spectroscopy and gel retardation assay. Electrostatic interactions between DNA molecule and polymer-copper(II) complex molecule containing many high positive charges have been observed. Besides these ionic interactions, van der Waals interactions, hydrogen bonding and other partial intercalation binding modes may also exist in this system. The polymer-copper(II) complex with higher degree of copper complex content was screened for its antimicrobial activity and antitumor activity.

Identification of the prooxidant site of human ceruloplasmin: a model for oxidative damage by copper bound to protein surfaces

NASA Technical Reports Server (NTRS)

Mukhopadhyay, C. K.; Mazumder, B.; Lindley, P. F.; Fox, P. L.

1997-01-01

Free transition metal ions oxidize lipids and lipoproteins in vitro; however, recent evidence suggests that free metal ion-independent mechanisms are more likely in vivo. We have shown previously that human ceruloplasmin (Cp), a serum protein containing seven Cu atoms, induces low density lipoprotein oxidation in vitro and that the activity depends on the presence of a single, chelatable Cu atom. We here use biochemical and molecular approaches to determine the site responsible for Cp prooxidant activity. Experiments with the His-specific reagent diethylpyrocarbonate (DEPC) showed that one or more His residues was specifically required. Quantitative [14C]DEPC binding studies indicated the importance of a single His residue because only one was exposed upon removal of the prooxidant Cu. Plasmin digestion of [14C]DEPC-treated Cp (and N-terminal sequence analysis of the fragments) showed that the critical His was in a 17-kDa region containing four His residues in the second major sequence homology domain of Cp. A full length human Cp cDNA was modified by site-directed mutagenesis to give His-to-Ala substitutions at each of the four positions and was transfected into COS-7 cells, and low density lipoprotein oxidation was measured. The prooxidant site was localized to a region containing His426 because CpH426A almost completely lacked prooxidant activity whereas the other mutants expressed normal activity. These observations support the hypothesis that Cu bound at specific sites on protein surfaces can cause oxidative damage to macromolecules in their environment. Cp may serve as a model protein for understanding mechanisms of oxidant damage by copper-containing (or -binding) proteins such as Cu, Zn superoxide dismutase, and amyloid precursor protein.

An Early Nodulin-Like Protein Accumulates in the Sieve Element Plasma Membrane of Arabidopsis1[OA

PubMed Central

Khan, Junaid A.; Wang, Qi; Sjölund, Richard D.; Schulz, Alexander; Thompson, Gary A.

2007-01-01

Membrane proteins within the sieve element-companion cell complex have essential roles in the physiological functioning of the phloem. The monoclonal antibody line RS6, selected from hybridomas raised against sieve elements isolated from California shield leaf (Streptanthus tortuosus; Brassicaceae) tissue cultures, recognizes an antigen in the Arabidopsis (Arabidopsis thaliana) ecotype Columbia that is associated specifically with the plasma membrane of sieve elements, but not companion cells, and accumulates at the earliest stages of sieve element differentiation. The identity of the RS6 antigen was revealed by reverse transcription-PCR of Arabidopsis leaf RNA using degenerate primers to be an early nodulin (ENOD)-like protein that is encoded by the expressed gene At3g20570. Arabidopsis ENOD-like proteins are encoded by a multigene family composed of several types of structurally related phytocyanins that have a similar overall domain structure of an amino-terminal signal peptide, plastocyanin-like copper-binding domain, proline/serine-rich domain, and carboxy-terminal hydrophobic domain. The amino- and carboxy-terminal domains of the 21.5-kD sieve element-specific ENOD are posttranslationally cleaved from the precursor protein, resulting in a mature peptide of approximately 15 kD that is attached to the sieve element plasma membrane via a carboxy-terminal glycosylphosphatidylinositol membrane anchor. Many of the Arabidopsis ENOD-like proteins accumulate in gametophytic tissues, whereas in both floral and vegetative tissues, the sieve element-specific ENOD is expressed only within the phloem. Members of the ENOD subfamily of the cupredoxin superfamily do not appear to bind copper and have unknown functions. Phenotypic analysis of homozygous T-DNA insertion mutants for the gene At3g20570 shows minimal alteration in vegetative growth but a significant reduction in the overall reproductive potential. PMID:17293437

An early nodulin-like protein accumulates in the sieve element plasma membrane of Arabidopsis.

PubMed

Khan, Junaid A; Wang, Qi; Sjölund, Richard D; Schulz, Alexander; Thompson, Gary A

2007-04-01

Membrane proteins within the sieve element-companion cell complex have essential roles in the physiological functioning of the phloem. The monoclonal antibody line RS6, selected from hybridomas raised against sieve elements isolated from California shield leaf (Streptanthus tortuosus; Brassicaceae) tissue cultures, recognizes an antigen in the Arabidopsis (Arabidopsis thaliana) ecotype Columbia that is associated specifically with the plasma membrane of sieve elements, but not companion cells, and accumulates at the earliest stages of sieve element differentiation. The identity of the RS6 antigen was revealed by reverse transcription-PCR of Arabidopsis leaf RNA using degenerate primers to be an early nodulin (ENOD)-like protein that is encoded by the expressed gene At3g20570. Arabidopsis ENOD-like proteins are encoded by a multigene family composed of several types of structurally related phytocyanins that have a similar overall domain structure of an amino-terminal signal peptide, plastocyanin-like copper-binding domain, proline/serine-rich domain, and carboxy-terminal hydrophobic domain. The amino- and carboxy-terminal domains of the 21.5-kD sieve element-specific ENOD are posttranslationally cleaved from the precursor protein, resulting in a mature peptide of approximately 15 kD that is attached to the sieve element plasma membrane via a carboxy-terminal glycosylphosphatidylinositol membrane anchor. Many of the Arabidopsis ENOD-like proteins accumulate in gametophytic tissues, whereas in both floral and vegetative tissues, the sieve element-specific ENOD is expressed only within the phloem. Members of the ENOD subfamily of the cupredoxin superfamily do not appear to bind copper and have unknown functions. Phenotypic analysis of homozygous T-DNA insertion mutants for the gene At3g20570 shows minimal alteration in vegetative growth but a significant reduction in the overall reproductive potential.

The Arabidopsis SKU5 gene encodes an extracellular glycosyl phosphatidylinositol-anchored glycoprotein involved in directional root growth

NASA Technical Reports Server (NTRS)

Sedbrook, John C.; Carroll, Kathleen L.; Hung, Kai F.; Masson, Patrick H.; Somerville, Chris R.

2002-01-01

To investigate how roots respond to directional cues, we characterized a T-DNA-tagged Arabidopsis mutant named sku5 in which the roots skewed and looped away from the normal downward direction of growth on inclined agar surfaces. sku5 roots and etiolated hypocotyls were slightly shorter than normal and exhibited a counterclockwise (left-handed) axial rotation bias. The surface-dependent skewing phenotype disappeared when the roots penetrated the agar surface, but the axial rotation defect persisted, revealing that these two directional growth processes are separable. The SKU5 gene belongs to a 19-member gene family designated SKS (SKU5 Similar) that is related structurally to the multiple-copper oxidases ascorbate oxidase and laccase. However, the SKS proteins lack several of the conserved copper binding motifs characteristic of copper oxidases, and no enzymatic function could be assigned to the SKU5 protein. Analysis of plants expressing SKU5 reporter constructs and protein gel blot analysis showed that SKU5 was expressed most strongly in expanding tissues. SKU5 was glycosylated and modified by glycosyl phosphatidylinositol and localized to both the plasma membrane and the cell wall. Our observations suggest that SKU5 affects two directional growth processes, possibly by participating in cell wall expansion.

Crystal structure of human lysyl oxidase-like 2 (hLOXL2) in a precursor state.

PubMed

Zhang, Xi; Wang, Qifan; Wu, Jianping; Wang, Jiawei; Shi, Yigong; Liu, Minhao

2018-04-10

Lysyl oxidases (LOXs), a type of copper- and lysyl tyrosylquinone (LTQ) -dependent amine oxidase, catalyze the oxidative deamination of lysine residues of extracellular matrix (ECM) proteins such as elastins and collagens and generate aldehyde groups. The oxidative deamination of lysine represents the foundational step for the cross-linking of elastin and collagen and thus is crucial for ECM modeling. Despite their physiological significance, the structure of this important family of enzymes remains elusive. Here we report the crystal structure of human lysyl oxidase-like 2 (hLOXL2) at 2.4-Å resolution. Unexpectedly, the copper-binding site of hLOXL2 is occupied by zinc, which blocks LTQ generation and the enzymatic activity of hLOXL2 in our in vitro assay. Biochemical analysis confirms that copper loading robustly activates hLOXL2 and supports LTQ formation. Furthermore, the LTQ precursor residues in the structure are distanced by 16.6 Å, corroborating the notion that the present structure may represent a precursor state and that pronounced conformational rearrangements would be required for protein activation. The structure presented here establishes an important foundation for understanding the structure-function relationship of LOX proteins and will facilitate LOX-targeting drug discovery. Copyright © 2018 the Author(s). Published by PNAS.

Triplin, a small molecule, reveals copper ion transport in ethylene signaling from ATX1 to RAN1

PubMed Central

Li, Wenbo; Ye, Yajin; Lu, Juan; Yeh, Kuo-Chen; Xiao, Youli; Li, Laigeng; Binder, Brad M.

2017-01-01

Copper ions play an important role in ethylene receptor biogenesis and proper function. The copper transporter RESPONSIVE-TO-ANTAGONIST1 (RAN1) is essential for copper ion transport in Arabidopsis thaliana. However it is still unclear how copper ions are delivered to RAN1 and how copper ions affect ethylene receptors. There is not a specific copper chelator which could be used to explore these questions. Here, by chemical genetics, we identified a novel small molecule, triplin, which could cause a triple response phenotype on dark-grown Arabidopsis seedlings through ethylene signaling pathway. ran1-1 and ran1-2 are hypersensitive to triplin. Adding copper ions in growth medium could partially restore the phenotype on plant caused by triplin. Mass spectrometry analysis showed that triplin could bind copper ion. Compared to the known chelators, triplin acts more specifically to copper ion and it suppresses the toxic effects of excess copper ions on plant root growth. We further showed that mutants of ANTIOXIDANT PROTEIN1 (ATX1) are hypersensitive to tiplin, but with less sensitivity comparing with the ones of ran1-1 and ran1-2. Our study provided genetic evidence for the first time that, copper ions necessary for ethylene receptor biogenesis and signaling are transported from ATX1 to RAN1. Considering that triplin could chelate copper ions in Arabidopsis, and copper ions are essential for plant and animal, we believe that, triplin not only could be useful for studying copper ion transport of plants, but also could be useful for copper metabolism study in animal and human. PMID:28388654

Methanobactin: a copper binding compound having antibiotic and antioxidant activity isolated from methanotrophic bacteria

DOEpatents

DiSpirito, Alan A [Ames, IA; Zahn, James A [Harbor Beach, MI; Graham, David W [Lawrence, KS; Kim, Hyung J [St. Paul, MN; Alterman, Michail [Lawrence, KS; Larive, Cynthia [Lawrence, KS

2007-04-03

A means and method for treating bacterial infection, providing antioxidant activity, and chelating copper using a copper binding compound produced by methanotrophic bacteria is described. The compound, known as methanobactin, is the first of a new class of antibiotics having gram-positive activity. Methanobactin has been sequenced, and its structural formula determined.

Copper-redox cycling by coumarin-di(2-picolyl)amine hybrid molecule leads to ROS-mediated DNA damage and apoptosis: A mechanism for cancer chemoprevention.

PubMed

Khan, Saman; Zafar, Atif; Naseem, Imrana

2018-06-25

Coumarin is an important bioactive pharmacophore. It is found in plants as a secondary metabolite and exhibits diverse pharmacological properties including anticancer effects against different malignancies. Therapeutic efficacy of coumarin derivatives depends on the pattern of substitution and conjugation with different moieties. Cancer cells contain elevated copper as compared to normal cells that plays a role in angiogenesis. Thus, targeting copper in malignant cells via copper chelators can serve as an attractive targeted anticancer strategy. Our previous efforts led to the synthesis of di(2-picolyl)amine-3(bromoacetyl)coumarin hybrid molecule (ligand-L) endowed with DNA/Cu(II) binding properties, and ROS generation ability in the presence of copper ions. In the present study, we aimed to validate copper-dependent cytotoxic action of ligand-L against malignant cells. For this, we used a cellular model system of copper (Cu) overloaded lymphocytes (CuOLs) to simulate malignancy-like condition. In CuOLs, lipid peroxidation/protein carbonylation, ROS generation, DNA fragmentation and apoptosis were investigated in the presence of ligand-L. Results showed that ligand-L-Cu(II) interaction leads to ROS generation, lipid peroxidation/protein carbonylation (oxidative stress parameters), DNA damage, up-regulation of p53 and mitochondrial-mediated apoptosis in treated lymphocytes. Further, pre-incubation with neocuproine (membrane permeable copper chelator) and ROS scavengers attenuated the DNA damage and apoptosis. These results suggest that cellular copper acts as molecular target for ligand-L to propagate redox cycling and generation of ROS via Fenton-like reaction leading to DNA damage and apoptosis. Further, we showed that ligand-L targets elevated copper in breast cancer MCF-7 and colon cancer HCT116 cells leading to a pro-oxidant inhibition of proliferation of cancer cells. In conclusion, we propose copper-dependent ROS-mediated mechanism for the cytotoxic action of ligand-L in malignant cells. Thus, targeting elevated copper represents an effective therapeutic strategy for selective cytotoxicity against malignant cells. Copyright © 2018 Elsevier B.V. All rights reserved.

Substitutions of PrP N-terminal histidine residues modulate scrapie disease pathogenesis and incubation time in transgenic mice

PubMed Central

Eigenbrod, Sabina; Frick, Petra; Bertsch, Uwe; Mitteregger-Kretzschmar, Gerda; Mielke, Janina; Maringer, Marko; Piening, Niklas; Hepp, Alexander; Daude, Nathalie; Windl, Otto; Levin, Johannes; Giese, Armin; Sakthivelu, Vignesh; Tatzelt, Jörg

2017-01-01

Prion diseases have been linked to impaired copper homeostasis and copper induced-oxidative damage to the brain. Divalent metal ions, such as Cu2+ and Zn2+, bind to cellular prion protein (PrPC) at octapeptide repeat (OR) and non-OR sites within the N-terminal half of the protein but information on the impact of such binding on conversion to the misfolded isoform often derives from studies using either OR and non-OR peptides or bacterially-expressed recombinant PrP. Here we created new transgenic mouse lines expressing PrP with disrupted copper binding sites within all four histidine-containing OR's (sites 1–4, H60G, H68G, H76G, H84G, "TetraH>G" allele) or at site 5 (composed of residues His-95 and His-110; "H95G" allele) and monitored the formation of misfolded PrP in vivo. Novel transgenic mice expressing PrP(TetraH>G) at levels comparable to wild-type (wt) controls were susceptible to mouse-adapted scrapie strain RML but showed significantly prolonged incubation times. In contrast, amino acid replacement at residue 95 accelerated disease progression in corresponding PrP(H95G) mice. Neuropathological lesions in terminally ill transgenic mice were similar to scrapie-infected wt controls, but less severe. The pattern of PrPSc deposition, however, was not synaptic as seen in wt animals, but instead dense globular plaque-like accumulations of PrPSc in TgPrP(TetraH>G) mice and diffuse PrPSc deposition in (TgPrP(H95G) mice), were observed throughout all brain sections. We conclude that OR and site 5 histidine substitutions have divergent phenotypic impacts and that cis interactions between the OR region and the site 5 region modulate pathogenic outcomes by affecting the PrP globular domain. PMID:29220360

Cytoplasmic Copper Detoxification in Salmonella Can Contribute to SodC Metalation but Is Dispensable during Systemic Infection

PubMed Central

Fenlon, Luke A.

2017-01-01

ABSTRACT Salmonella enterica serovar Typhimurium is a leading cause of foodborne disease worldwide. Severe infections result from the ability of S. Typhimurium to survive within host immune cells, despite being exposed to various host antimicrobial factors. SodCI, a copper-zinc-cofactored superoxide dismutase, is required to defend against phagocytic superoxide. SodCII, an additional periplasmic superoxide dismutase, although produced during infection, does not function in the host. Previous studies suggested that CueP, a periplasmic copper binding protein, facilitates acquisition of copper by SodCII. CopA and GolT, both inner membrane ATPases that pump copper from the cytoplasm to the periplasm, are a source of copper for CueP. Using in vitro SOD assays, we found that SodCI can also utilize CueP to acquire copper. However, both SodCI and SodCII have a significant fraction of activity independent of CueP and cytoplasmic copper export. We utilized a series of mouse competition assays to address the in vivo role of CueP-mediated SodC activation. A copA golT cueP triple mutant was equally as competitive as the wild type, suggesting that sufficient SodCI is active to defend against phagocytic superoxide independent of CueP and cytoplasmic copper export. We also confirmed that a strain containing a modified SodCII, which is capable of complementing a sodCI deletion, was fully virulent in a copA golT cueP background competed against the wild type. These competitions also address the potential impact of cytoplasmic copper toxicity within the phagosome. Our data suggest that Salmonella does not encounter inhibitory concentrations of copper during systemic infection. IMPORTANCE Salmonella is a leading cause of gastrointestinal disease worldwide. In severe cases, Salmonella can cause life-threatening systemic infections, particularly in very young children, the elderly, or people who are immunocompromised. To cause disease, Salmonella must survive the hostile environment inside host immune cells, a location in which most bacteria are killed. Our work examines how one particular metal, copper, is acquired by Salmonella to activate a protein important for survival within immune cells. At high levels, copper itself can inhibit Salmonella. Using a strain of Salmonella that cannot detoxify intracellular copper, we also addressed the in vivo role of copper as an antimicrobial agent. PMID:28924031

Cytoplasmic Copper Detoxification in Salmonella Can Contribute to SodC Metalation but Is Dispensable during Systemic Infection.

PubMed

Fenlon, Luke A; Slauch, James M

2017-12-15

Salmonella enterica serovar Typhimurium is a leading cause of foodborne disease worldwide. Severe infections result from the ability of S Typhimurium to survive within host immune cells, despite being exposed to various host antimicrobial factors. SodCI, a copper-zinc-cofactored superoxide dismutase, is required to defend against phagocytic superoxide. SodCII, an additional periplasmic superoxide dismutase, although produced during infection, does not function in the host. Previous studies suggested that CueP, a periplasmic copper binding protein, facilitates acquisition of copper by SodCII. CopA and GolT, both inner membrane ATPases that pump copper from the cytoplasm to the periplasm, are a source of copper for CueP. Using in vitro SOD assays, we found that SodCI can also utilize CueP to acquire copper. However, both SodCI and SodCII have a significant fraction of activity independent of CueP and cytoplasmic copper export. We utilized a series of mouse competition assays to address the in vivo role of CueP-mediated SodC activation. A copA golT cueP triple mutant was equally as competitive as the wild type, suggesting that sufficient SodCI is active to defend against phagocytic superoxide independent of CueP and cytoplasmic copper export. We also confirmed that a strain containing a modified SodCII, which is capable of complementing a sodCI deletion, was fully virulent in a copA golT cueP background competed against the wild type. These competitions also address the potential impact of cytoplasmic copper toxicity within the phagosome. Our data suggest that Salmonella does not encounter inhibitory concentrations of copper during systemic infection. IMPORTANCE Salmonella is a leading cause of gastrointestinal disease worldwide. In severe cases, Salmonella can cause life-threatening systemic infections, particularly in very young children, the elderly, or people who are immunocompromised. To cause disease, Salmonella must survive the hostile environment inside host immune cells, a location in which most bacteria are killed. Our work examines how one particular metal, copper, is acquired by Salmonella to activate a protein important for survival within immune cells. At high levels, copper itself can inhibit Salmonella Using a strain of Salmonella that cannot detoxify intracellular copper, we also addressed the in vivo role of copper as an antimicrobial agent. Copyright © 2017 American Society for Microbiology.

Copper and Zinc Metallation Status of Copper Zinc Superoxide Dismutase form Amyotrophic Lateral Sclerosis Transgenic Mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lelie, H.L.; Miller, L.; Liba, A.

2010-09-24

Mutations in the metalloenzyme copper-zinc superoxide dismutase (SOD1) cause one form of familial amyotrophic lateral sclerosis (ALS), and metals are suspected to play a pivotal role in ALS pathology. To learn more about metals in ALS, we determined the metallation states of human wild-type or mutant (G37R, G93A, and H46R/H48Q) SOD1 proteins from SOD1-ALS transgenic mice spinal cords. SOD1 was gently extracted from spinal cord and separated into insoluble (aggregated) and soluble (supernatant) fractions, and then metallation states were determined by HPLC inductively coupled plasma MS. Insoluble SOD1-rich fractions were not enriched in copper and zinc. However, the soluble mutantmore » and WT SOD1s were highly metallated except for the metal-binding-region mutant H46R/H48Q, which did not bind any copper. Due to the stability conferred by high metallation of G37R and G93A, it is unlikely that these soluble SOD1s are prone to aggregation in vivo, supporting the hypothesis that immature nascent SOD1 is the substrate for aggregation. We also investigated the effect of SOD1 overexpression and disease on metal homeostasis in spinal cord cross-sections of SOD1-ALS mice using synchrotron-based x-ray fluorescence microscopy. In each mouse genotype, except for the H46R/H48Q mouse, we found a redistribution of copper between gray and white matters correlated to areas of high SOD1. Interestingly, a disease-specific increase of zinc was observed in the white matter for all mutant SOD1 mice. Together these data provide a picture of copper and zinc in the cell as well as highlight the importance of these metals in understanding SOD1-ALS pathology.« less

Proton and metal ion binding to natural organic polyelectrolytes-II. Preliminary investigation with a peat and a humic acid

USGS Publications Warehouse

Marinsky, J.A.; Reddy, M.M.

1984-01-01

We summarize here experimental studies of proton and metal ion binding to a peat and a humic acid. Data analysis is based on a unified physico-chemical model for reaction of simple ions with polyelectrolytes employing a modified Henderson-Hasselbalch equation. Peat exhibited an apparent intrinsic acid dissociation constant of 10-4.05, and an apparent intrinsic metal ion binding constant of: 400 for cadmium ion; 600 for zinc ion; 4000 for copper ion; 20000 for lead ion. A humic acid was found to have an apparent intrinsic proton binding constant of 10-2.6. Copper ion binding to this humic acid sample occurred at two types of sites. The first site exhibited reaction characteristics which were independent of solution pH and required the interaction of two ligands on the humic acid matrix to simultaneously complex with each copper ion. The second complex species is assumed to be a simple monodentate copper ion-carboxylate species with a stability constant of 18. ?? 1984.

Isolation of metallothionein from cells derived from aggressive form of high-grade prostate carcinoma using paramagnetic antibody-modified microbeads off-line coupled with electrochemical and electrophoretic analysis.

PubMed

Masarik, Michal; Gumulec, Jaromir; Sztalmachova, Marketa; Hlavna, Marian; Babula, Petr; Krizkova, Sona; Ryvolova, Marketa; Jurajda, Michal; Sochor, Jiri; Adam, Vojtech; Kizek, Rene

2011-12-01

Prostate cancer with altered zinc(II) cell metabolism is the second most frequently diagnosed cancer in developed countries. The alterations of zinc(II) metabolism can influence metabolism of other metal ions and can also be associated with the expression and translation of metal-binding proteins including metallothioneins. The aim of this article was to optimize immunoseparation protocol based on paramagnetic beads conjugated with protein G for the isolation of metallothionein. Isolated metallothionein was determined by differential pulse voltammetry Brdicka reaction and SDS-PAGE. Optimal conditions: antigen-binding time - 60 min, temperature - 70°C, and buffer composition and pH - acetate buffer, pH 4.3, were determined. Under the optimized conditions, lysates from 22Rv1 prostate cancer cells treated with various concentrations of cadmium(II) and copper(II) ions were analyzed. We observed strong correlation in all experimental groups and all lysate types (r>0.83 at p<0.041) between metallothionein concentration related to viability and concentration of copper(II) ions and cadmium(II) ions in medium. Moreover, the results were compared with standard sample preparation as heat treatment and SDS-PAGE analysis. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Organic Complexation of Dissolved Copper and Iron from Shipboard Incubations in the Central California Current System: Investigating the Impacts of Light Conditions and Phytoplankton Growth on Iron- and Copper-Binding Ligand Characteristics

NASA Astrophysics Data System (ADS)

Mellett, T.; Parker, C.; Brown, M.; Coale, T.; Duckham, C.; Chappell, D.; Maldonado, M. T.; Bruland, K. W.; Buck, K. N.

2016-02-01

Two shipboard incubation experiments were carried out in July of 2014 to investigate potential sources and sinks of iron- and copper-binding organic ligands in the surface ocean. Seawater for the experiments was collected from the central California Current System (cCCS) and incubated under varying light conditions and in the presence and absence of natural phytoplankton communities. Incubation treatments were sampled over a period of up to 3 days for measurements of total dissolved copper and iron, and for the concentration and conditional stability constants of copper- and iron-binding organic ligands. Dissolved copper and iron were determined by inductively coupled plasma-mass spectrometry (ICP-MS) following preconcentration on a Nobias PA1 resin. Organic ligand characteristics for iron and copper were determined using a method of competitive ligand exchange-absorptive cathodic stripping voltammetry (CLE-ACSV) with the added competing ligand salicylaldoxime. Trends in ligand concentrations and conditional stability constants across the different treatments and over the course of the incubation experiments will be presented.

Global Transcriptional Profiles of the Copper Responses in the Cyanobacterium Synechocystis sp. PCC 6803

PubMed Central

Giner-Lamia, Joaquin; López-Maury, Luis; Florencio, Francisco J.

2014-01-01

Copper is an essential element involved in fundamental processes like respiration and photosynthesis. However, it becomes toxic at high concentration, which has forced organisms to control its cellular concentration. We have recently described a copper resistance system in the cyanobacterium Synechocystis sp. PCC 6803, which is mediated by the two-component system, CopRS, a RND metal transport system, CopBAC and a protein of unknown function, CopM. Here, we report the transcriptional responses to copper additions at non-toxic (0.3 µM) and toxic concentrations (3 µM) in the wild type and in the copper sensitive copR mutant strain. While 0.3 µM copper slightly stimulated metabolism and promoted the exchange between cytochrome c6 and plastocyanin as soluble electron carriers, the addition of 3 µM copper catalyzed the formation of ROS, led to a general stress response and induced expression of Fe-S cluster biogenesis genes. According to this, a double mutant strain copRsufR, which expresses constitutively the sufBCDS operon, tolerated higher copper concentration than the copR mutant strain, suggesting that Fe-S clusters are direct targets of copper toxicity in Synechocystis. In addition we have also demonstrated that InrS, a nickel binding transcriptional repressor that belong to the CsoR family of transcriptional factor, was involved in heavy metal homeostasis, including copper, in Synechocystis. Finally, global gene expression analysis of the copR mutant strain suggested that CopRS only controls the expression of copMRS and copBAC operons in response to copper. PMID:25268225

Theoretical, biological and in silico studies of pendant-armed heteroleptic copper(II) phenolate complexes

NASA Astrophysics Data System (ADS)

Arthi, P.; Mahendiran, D.; Shobana, S.; Srinivasan, P.; Rahiman, A. Kalilur

2018-06-01

A new series of pendant-armed heteroleptic copper(II) phenolate complexes of the type [CuL1-3(diimine)] (1-6) have been synthesized by the reaction of pendant-armed ligands 2,2'-(benzoyliminodiethylene)bissalicylidene (H2L1), 2,2'-(4-nitrobenzoyliminodiethylene)bissalicylidene (H2L2) or 2,2'-(3,5-dinitrobenzoyliminodiethylene)bissalicylidene (H2L3) with coligands (diimine; 2,2‧-bipyridyl (bpy) or 1,10-phenanthroline (phen)) in the presence of copper(II) chloride, and characterized by spectroscopic techniques. The seven coordinated pentagonal-bipyramidal geometry around the copper(II) center was inferred from the electronic spectra of the complexes. The bond length, bond angle and HOMO-LUMO energy gap calculations were carried out by DFT studies, using Gaussian 03 program. Electrochemical studies of the mononuclear complexes evidenced one-electron irreversible reduction wave in the cathodic region (Epc = -0.61 to -0.65 V). Experimental and in silico molecular docking studies support groove mode of binding with DNA. Further, the molecular docking studies of complexes with B-DNA indicate the binding of the guanine-cytosine residues in the minor groove of the DNA. Molecular docking studies also revealed the interaction of complexes with protein ERK2 kinase and significant topoisomerase (Topo-I) inhibitory activity. All the complexes display pronounced cleavage activity against supercoiled pBR322 DNA in the presence of H2O2. In vitro cytotoxicity of the complexes was tested against liver cancer cell line (HepG2) by MTT reduction assay.

The effect of zinc supplementation on linear growth, body composition, and growth factors in preterm infants.

PubMed

Díaz-Gómez, N Marta; Doménech, Eduardo; Barroso, Flora; Castells, Silvia; Cortabarria, Carmen; Jiménez, Alejandro

2003-05-01

The aim of our study was to evaluate the effect of zinc supplementation on linear growth, body composition, and growth factors in premature infants. Thirty-six preterm infants (gestational age: 32.0 +/- 2.1 weeks, birth weight: 1704 +/- 364 g) participated in a longitudinal double-blind, randomized clinical trial. They were randomly allocated either to the supplemental (S) group fed with a standard term formula supplemented with zinc (final content 10 mg/L) and a small quantity of copper (final content 0.6 mg/L), or to the placebo group fed with the same formula without supplementation (final content of zinc: 5 mg/L and copper: 0.4 mg/L), from 36 weeks postconceptional age until 6 months corrected postnatal age. At each evaluation, anthropometric variables and bioelectrical impedance were measured, a 3-day dietary record was collected, and a blood sample was taken. We analyzed serum levels of total alkaline phosphatase, skeletal alkaline phosphatase (sALP), insulin growth factor (IGF)-I, IGF binding protein-3, IGF binding protein-1, zinc and copper, and the concentrations of zinc in erythrocytes. The S group had significantly higher zinc levels in serum and erythrocytes and lower serum copper levels with respect to the placebo group. We found that the S group had a greater linear growth (from baseline to 3 months corrected age: Delta score deviation standard length: 1.32 +/-.8 vs.38 +/-.8). The increase in total body water and in serum levels of sALP was also significantly higher in the S group (total body water: 3 months; corrected age: 3.8 +/-.5 vs 3.5 +/-.4 kg, 6 months; corrected age: 4.5 +/-.5 vs 4.2 +/-.4 kg; sALP: 3 months; corrected age: 140.2 +/- 28.7 vs 118.7 +/- 18.8 micro g/L). Zinc supplementation has a positive effect on linear growth in premature infants.

Active-site protein dynamics and solvent accessibility in native Achromobacter cycloclastes copper nitrite reductase.

PubMed

Sen, Kakali; Horrell, Sam; Kekilli, Demet; Yong, Chin W; Keal, Thomas W; Atakisi, Hakan; Moreau, David W; Thorne, Robert E; Hough, Michael A; Strange, Richard W

2017-07-01

Microbial nitrite reductases are denitrifying enzymes that are a major component of the global nitrogen cycle. Multiple structures measured from one crystal (MSOX data) of copper nitrite reductase at 240 K, together with molecular-dynamics simulations, have revealed protein dynamics at the type 2 copper site that are significant for its catalytic properties and for the entry and exit of solvent or ligands to and from the active site. Molecular-dynamics simulations were performed using different protonation states of the key catalytic residues (Asp CAT and His CAT ) involved in the nitrite-reduction mechanism of this enzyme. Taken together, the crystal structures and simulations show that the Asp CAT protonation state strongly influences the active-site solvent accessibility, while the dynamics of the active-site 'capping residue' (Ile CAT ), a determinant of ligand binding, are influenced both by temperature and by the protonation state of Asp CAT . A previously unobserved conformation of Ile CAT is seen in the elevated temperature series compared with 100 K structures. DFT calculations also show that the loss of a bound water ligand at the active site during the MSOX series is consistent with reduction of the type 2 Cu atom.

Protein sequences insight into heavy metal tolerance in Cronobacter sakazakii BAA-894 encoded by plasmid pESA3.

PubMed

Chaturvedi, Navaneet; Kajsik, Michal; Forsythe, Stephen; Pandey, Paras Nath

2015-12-01

The recently annotated genome of the bacterium Cronobacter sakazakii BAA-894 suggests that the organism has the ability to bind heavy metals. This study demonstrates heavy metal tolerance in C. sakazakii, in which proteins with the heavy metal interaction were recognized by computational and experimental study. As the result, approximately one-fourth of proteins encoded on the plasmid pESA3 are proposed to have potential interaction with heavy metals. Interaction between heavy metals and predicted proteins was further corroborated using protein crystal structures from protein data bank database and comparison of metal-binding ligands. In addition, a phylogenetic study was undertaken for the toxic heavy metals, arsenic, cadmium, lead and mercury, which generated relatedness clustering for lead, cadmium and arsenic. Laboratory studies confirmed the organism's tolerance to tellurite, copper and silver. These experimental and computational study data extend our understanding of the genes encoding for proteins of this important neonatal pathogen and provide further insights into the genotypes associated with features that can contribute to its persistence in the environment. The information will be of value for future environmental protection from heavy toxic metals.

A Strong Loss-of-Function Mutation in RAN1 Results in Constitutive Activation of the Ethylene Response Pathway as Well as a Rosette-Lethal Phenotype

PubMed Central

Woeste, Keith E.; Kieber, Joseph J.

2000-01-01

A recessive mutation was identified that constitutively activated the ethylene response pathway in Arabidopsis and resulted in a rosette-lethal phenotype. Positional cloning of the gene corresponding to this mutation revealed that it was allelic to responsive to antagonist1 (ran1), a mutation that causes seedlings to respond in a positive manner to what is normally a competitive inhibitor of ethylene binding. In contrast to the previously identified ran1-1 and ran1-2 alleles that are morphologically indistinguishable from wild-type plants, this ran1-3 allele results in a rosette-lethal phenotype. The predicted protein encoded by the RAN1 gene is similar to the Wilson and Menkes disease proteins and yeast Ccc2 protein, which are integral membrane cation-transporting P-type ATPases involved in copper trafficking. Genetic epistasis analysis indicated that RAN1 acts upstream of mutations in the ethylene receptor gene family. However, the rosette-lethal phenotype of ran1-3 was not suppressed by ethylene-insensitive mutants, suggesting that this mutation also affects a non-ethylene-dependent pathway regulating cell expansion. The phenotype of ran1-3 mutants is similar to loss-of-function ethylene receptor mutants, suggesting that RAN1 may be required to form functional ethylene receptors. Furthermore, these results suggest that copper is required not only for ethylene binding but also for the signaling function of the ethylene receptors. PMID:10715329

A strong loss-of-function mutation in RAN1 results in constitutive activation of the ethylene response pathway as well as a rosette-lethal phenotype

NASA Technical Reports Server (NTRS)

Woeste, K. E.; Kieber, J. J.; Evans, M. L. (Principal Investigator)

2000-01-01

A recessive mutation was identified that constitutively activated the ethylene response pathway in Arabidopsis and resulted in a rosette-lethal phenotype. Positional cloning of the gene corresponding to this mutation revealed that it was allelic to responsive to antagonist1 (ran1), a mutation that causes seedlings to respond in a positive manner to what is normally a competitive inhibitor of ethylene binding. In contrast to the previously identified ran1-1 and ran1-2 alleles that are morphologically indistinguishable from wild-type plants, this ran1-3 allele results in a rosette-lethal phenotype. The predicted protein encoded by the RAN1 gene is similar to the Wilson and Menkes disease proteins and yeast Ccc2 protein, which are integral membrane cation-transporting P-type ATPases involved in copper trafficking. Genetic epistasis analysis indicated that RAN1 acts upstream of mutations in the ethylene receptor gene family. However, the rosette-lethal phenotype of ran1-3 was not suppressed by ethylene-insensitive mutants, suggesting that this mutation also affects a non-ethylene-dependent pathway regulating cell expansion. The phenotype of ran1-3 mutants is similar to loss-of-function ethylene receptor mutants, suggesting that RAN1 may be required to form functional ethylene receptors. Furthermore, these results suggest that copper is required not only for ethylene binding but also for the signaling function of the ethylene receptors.

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

Dynamics of the metal binding domains and regulation of the human copper transporters ATP7B and ATP7A.

PubMed

Yu, Corey H; Dolgova, Natalia V; Dmitriev, Oleg Y

2017-04-01

Copper transporters ATP7A and ATP7B regulate copper levels in the human cells and deliver copper to the biosynthetic pathways. ATP7A and ATP7B belong to the P-type ATPases and share much of the domain architecture and the mechanism of ATP hydrolysis with the other, well-studied, enzymes of this type. A unique structural feature of the copper ATPases is the chain of six cytosolic metal-binding domains (MBDs), which are believed to be involved in copper-dependent regulation of the activity and intracellular localization of these enzymes. Although the structures of all the MBDs have been solved, the mechanism of copper-dependent regulation of ATP7B and ATP7A, the roles of individual MBDs, and the relationship between the regulatory and catalytic copper binding are still unknown. We describe the structure and dynamics of the MBDs, review the current knowledge about their functional roles and propose a mechanism of regulation of ATP7B by copper-dependent changes in the dynamics and conformation of the MBD chain. Transient interactions between the MBDs, rather than transitions between distinct static conformations are likely to form the structural basis of regulation of the ATP-dependent copper transporters in human cells. © 2016 IUBMB Life, 69(4):226-235, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

Identification and Characterization of a New Pecan [Carya illinoinensis (Wangenh.) K. Koch] Allergen, Car i 2.

PubMed

Zhang, Yuzhu; Lee, BoRam; Du, Wen-Xian; Lyu, Shu-Chen; Nadeau, Kari C; Grauke, Larry J; Zhang, Yan; Wang, Shuo; Fan, Yuting; Yi, Jiang; McHugh, Tara H

2016-05-25

The 7S vicilin and 11S legumin seed storage globulins belong to the cupin protein superfamily and are major food allergens in many foods from the "big eight" food allergen groups. Here, for the first time, pecan vicilin was found to be a food allergen. Western blot experiments revealed that 30% of 27 sera used in this study and 24% of the sera from 25 patients with double-blind, placebo controlled clinical pecan allergy contained IgE antibodies specific to pecan vicilin. This allergen consists of a low-complexity region at its N-terminal and a structured domain at the C-terminal that contains two cupin motifs and forms homotrimers. The crystal structure of recombinant pecan vicilin was determined. The refined structure gave R/Rfree values of 0.218/0.262 for all data to 2.65 Å. There were two trimeric biological units in the crystallographic asymmetric unit. Pecan vicilin is also a copper protein. These data may facilitate the understanding of the nutritional value and the allergenicity relevance of the copper binding property of seed storage proteins in tree nuts.

Advanced purification strategy for CueR, a cysteine containing copper(I) and DNA binding protein.

PubMed

Balogh, Ria K; Gyurcsik, Béla; Hunyadi-Gulyás, Éva; Christensen, Hans E M; Jancsó, Attila

2016-07-01

Metal ion regulation is essential for living organisms. In prokaryotes metal ion dependent transcriptional factors, the so-called metalloregulatory proteins play a fundamental role in controlling the concentration of metal ions. These proteins recognize metal ions with an outstanding selectivity. A detailed understanding of their function may be exploited in potential health, environmental and analytical applications. Members of the MerR protein family sense a broad range of mostly late transition and heavy metal ions through their cysteine thiolates. The air sensitivity of latter groups makes the expression and purification of such proteins challenging. Here we describe a method for the purification of the copper-regulatory CueR protein under optimized conditions. In order to avoid protein precipitation and/or eventual aggregation and to get rid of the co-purifying Escherichia coli elongation factor, our procedure consisted of four steps supplemented by DNA digestion. Subsequent anion exchange on Sepharose FF Q 16/10, affinity chromatography on Heparin FF 16/10, second anion exchange on Source 30 Q 16/13 and gel filtration on Superdex 75 26/60 resulted in large amounts of pure CueR protein without any affinity tag. Structure and functionality tests performed with mass spectrometry, circular dichroism spectroscopy and electrophoretic gel mobility shift assays approved the success of the purification procedure. Copyright © 2016 Elsevier Inc. All rights reserved.

The flavinyl transferase ApbE of Pseudomonas stutzeri matures the NosR protein required for nitrous oxide reduction.

PubMed

Zhang, Lin; Trncik, Christian; Andrade, Susana L A; Einsle, Oliver

2017-02-01

The copper-containing enzyme nitrous oxide reductase (N 2 OR) catalyzes the transformation of nitrous oxide (N 2 O) to dinitrogen (N 2 ) in microbial denitrification. Several accessory factors are essential for assembling the two copper sites Cu A and Cu Z , and for maintaining the activity. In particular, the deletion of either the transmembrane iron-sulfur flavoprotein NosR or the periplasmic protein NosX, a member of the ApbE family, abolishes N 2 O respiration. Here we demonstrate through biochemical and structural studies that the ApbE protein from Pseudomonas stutzeri, where the nosX gene is absent, is a monomeric FAD-binding protein that can serve as the flavin donor for NosR maturation via covalent flavinylation of a threonine residue. The flavin transfer reaction proceeds both in vivo and in vitro to generate post-translationally modified NosR with covalently bound FMN. Only FAD can act as substrate and the reaction requires a divalent cation, preferably Mg 2+ that was also present in the crystal structure. In addition, the reaction is species-specific to a certain extent. Copyright © 2016 Elsevier B.V. All rights reserved.

Membrane-Associated Transporter Protein (MATP) Regulates Melanosomal pH and Influences Tyrosinase Activity

PubMed Central

Bin, Bum-Ho; Bhin, Jinhyuk; Yang, Seung Ha; Shin, Misun; Nam, Yeon-Ju; Choi, Dong-Hwa; Shin, Dong Wook; Lee, Ai-Young; Hwang, Daehee; Cho, Eun-Gyung; Lee, Tae Ryong

2015-01-01

The SLC45A2 gene encodes a Membrane-Associated Transporter Protein (MATP). Mutations of this gene cause oculocutaneous albinism type 4 (OCA4). However, the molecular mechanism of its action in melanogenesis has not been elucidated. Here, we discuss the role of MATP in melanin production. The SLC45A2 gene is highly enriched in human melanocytes and melanoma cell lines, and its protein, MATP, is located in melanosomes. The knockdown of MATP using siRNAs reduced melanin content and tyrosinase activity without any morphological change in melanosomes or the expression of melanogenesis-related proteins. Interestingly, the knockdown of MATP significantly lowered the melanosomal pH, as verified through DAMP analysis, suggesting that MATP regulates melanosomal pH and therefore affects tyrosinase activity. Finally, we found that the reduction of tyrosinase activity associated with the knockdown of MATP was readily recovered by copper treatment in the in vitro L-DOPA oxidase activity assay of tyrosinase. Considering that copper is an important element for tyrosinase activity and that its binding to tyrosinase depends on melanosomal pH, MATP may play an important role in regulating tyrosinase activity via controlling melanosomal pH. PMID:26057890

Intestinal microbiota and lipid metabolism responses in the common carp (Cyprinus carpio L.) following copper exposure.

PubMed

Meng, Xiao-Lin; Li, Shuai; Qin, Chao-Bin; Zhu, Zhen-Xiang; Hu, Wen-Pan; Yang, Li-Ping; Lu, Rong-Hua; Li, Wen-Jun; Nie, Guo-Xing

2018-09-30

The present study was conducted to determine the effects of waterborne copper exposure on the lipid metabolism and intestinal microbiota of juvenile common carp (Cyprinus carpio L.). Common carp were exposed to four waterborne copper (Cu) concentrations (0 (control), 0.07 (low), 0.14 (medium), and 0.28 (high) mg Cu/L) for 8 weeks. Exposure to a high concentration of Cu had a negative effect on growth indices (weight gain rate (WGR) and specific growth rate (SGR)). The biochemical indices measured in serum (low-density lipoprotein (LDL) and triglycerides (TGs)) were significantly affected by exposure to medium concentration levels of Cu. The mRNA levels of lipogenic enzymes (acetyl-CoA carboxylase 1 (ACC-1) and fatty acid synthase (FAS)) and sterol-regulator element-binding protein-1 (SREBP-1) in liver tissue and tight binding protein genes (ZO-1 and occludin) in intestinal epithelial tissue were significantly downregulated in the 0.14 and 0.28 mg/L Cu treatment groups, accompanied by upregulated mRNA levels of lipolysis enzymes (lipoprotein lipase (LPL) and carnitine palmitoyl transferase 1 (CPT-1)) in the liver. The data also showed that the composition of intestinal microbiota was changed following Cu exposure and could alter the α-diversity and β-diversity. The abundances of few putative short-chain fatty acid (SCFA)-producing bacteria, including Allobaculum, Blautia, Coprococcus, Faecalibacterium, Roseburia, and Ruminococcus, decreased significantly. More specifically, Roseburia sequences were positively associated with lipogenic enzymes, total protein (TP), and TGs and negatively associated with lipolysis enzymes. Other sequences related to probiotics (Lactobacillus, Bacillus and Akkermansia) were also found to decrease, accompanied by an increase in sequences related to pathogens (Pseudomonas and Acinetobacter). To the best of our knowledge, the present study provides the first evidence that waterborne, chronic Cu exposure can disturb the composition of intestinal microbiota related to lipid metabolism and immunity in freshwater fish, thereby increasing the risk of pathogen invasion. Copyright © 2018 Elsevier Inc. All rights reserved.

Cu2+ triggers reversible aggregation of a disordered His-rich dehydrin MpDhn12 from Musa paradisiaca.

PubMed

Mu, Peiqiang; Feng, Dongru; Su, Jianbin; Zhang, Yang; Dai, Jinran; Jin, Honglei; Liu, Bing; He, Yanming; Qi, Kangbiao; Wang, Hongbin; Wang, Jinfa

2011-11-01

Copper is an essential nutrient, but it is toxic in excess. Here, we cloned and characterized a His-rich low molecular weight dehydrin from Musa paradisiaca, MpDhn12. Analysis by circular dichroism (CD) spectra and a thermal stability assay showed that MpDhn12 is an intrinsically disordered protein, and immobilized-metal affinity chromatography (IMAC) analysis revealed that MpDhn12 can bind Cu(2+) both in vitro and in vivo. Interestingly, MpDhn12 aggregated under excess Cu(2+) conditions, and the aggregation was reversible and impaired by histidine modification with diethylpyrocarbonate (DEPC), while the disordered structure of another dehydrin ERD14 (as a control) was not changed. Furthermore, MpDhn12 could complement the copper-sensitive phenotype of yeast mutant Δsod1. These results together suggested that MpDhn12 may take part in buffering copper levels through chelation and formation of aggregates in excess Cu(2+) conditions. To the best of our knowledge, it is the first report that a dehydrin interchanged between disordered and aggregated state triggered by copper.

Detention of copper by sulfur nanoparticles inhibits the proliferation of A375 malignant melanoma and MCF-7 breast cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Hao; Zhang, Yikai; Zheng, Shanyuan

Selective induction of cell death or growth inhibition of cancer cells is the future of chemotherapy. Clinical trials have found that cancer tissues are enriched with copper. Based on this finding, many copper-containing compounds and complexes have been designed to “copper” cancer cells using copper as bait. However, recent studies have demonstrated that copper boosts tumor development, and copper deprivation from serum was shown to effectively inhibit the promotion of cancer. Mechanistically, copper is an essential cofactor for mitogen-activated protein kinase (MAPK)/extracellular activating kinase (ERK) kinase (MEK), a central molecule in the BRAF/MEK/ERK pathway. Therefore, depleting copper from cancer cellsmore » by directly sequestering copper has a wider field for research and potential for combination therapy. Based on the affinity between sulfur and copper, we therefore designed sulfur nanoparticles (Nano-S) that detain copper, achieving tumor growth restriction. We found that spherical Nano-S could effectively bind copper and form a tighter surficial structure. Moreover, this Nano-S detention of copper effectively inhibited the proliferation of A375 melanoma and MCF-7 breast cancer cells with minimum toxicity to normal cells. Mechanistic studies revealed that Nano-S triggered inactivation of the MEK-ERK pathway followed by inhibition of the proliferation of the A375 and MCF-7 cells. In addition, lower Nano-S concentrations and shorter exposure stimulated the expression of a copper transporter as compensation, which further increased the cellular uptake and anticancer activities of cisplatin. Collectively, our results highlight the potential of Nano-S as an anticancer agent or adjuvant through its detention of copper. - Highlights: • Nano-S selectively inhibited the mitosis of A375 and MCF-7 cells by depleting copper. • Nano-S inactivated MEK/ERK pathway through the detention of copper. • Nano-S improved the cellular uptake and anticancer activities of cisplatin.« less

The metal chaperone Atox1 regulates the activity of the human copper transporter ATP7B by modulating domain dynamics.

PubMed

Yu, Corey H; Yang, Nan; Bothe, Jameson; Tonelli, Marco; Nokhrin, Sergiy; Dolgova, Natalia V; Braiterman, Lelita; Lutsenko, Svetlana; Dmitriev, Oleg Y

2017-11-03

The human transporter ATP7B delivers copper to the biosynthetic pathways and maintains copper homeostasis in the liver. Mutations in ATP7B cause the potentially fatal hepatoneurological disorder Wilson disease. The activity and intracellular localization of ATP7B are regulated by copper, but the molecular mechanism of this regulation is largely unknown. We show that the copper chaperone Atox1, which delivers copper to ATP7B, and the group of the first three metal-binding domains (MBD1-3) are central to the activity regulation of ATP7B. Atox1-Cu binding to ATP7B changes domain dynamics and interactions within the MBD1-3 group and activates ATP hydrolysis. To understand the mechanism linking Atox1-MBD interactions and enzyme activity, we have determined the MBD1-3 conformational space using small angle X-ray scattering and identified changes in MBD dynamics caused by apo -Atox1 and Atox1-Cu by solution NMR. The results show that copper transfer from Atox1 decreases domain interactions within the MBD1-3 group and increases the mobility of the individual domains. The N-terminal segment of MBD1-3 was found to interact with the nucleotide-binding domain of ATP7B, thus physically coupling the domains involved in copper binding and those involved in ATP hydrolysis. Taken together, the data suggest a regulatory mechanism in which Atox1-mediated copper transfer activates ATP7B by releasing inhibitory constraints through increased freedom of MBD1-3 motions. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Reactivity Study of Unsymmetrical β-Diketiminato Copper(I) Complexes: Effect of the Chelating Ring.

PubMed

Chuang, Wan-Jung; Hsu, Sung-Po; Chand, Kuldeep; Yu, Fu-Lun; Tsai, Cheng-Long; Tseng, Yu-Hsuan; Lu, Yuh-Hsiu; Kuo, Jen-Yu; Carey, James R; Chen, Hsuan-Ying; Chen, Hsing-Yin; Chiang, Michael Y; Hsu, Sodio C N

2017-03-06

β-Diketiminato copper(I) complexes play important roles in bioinspired catalytic chemistry and in applications to the materials industry. However, it has been observed that these complexes are very susceptible to disproportionation. Coordinating solvents or Lewis bases are typically used to prevent disproportionation and to block the coordination sites of the copper(I) center from further decomposition. Here, we incorporate this coordination protection directly into the molecule in order to increase the stability and reactivity of these complexes and to discover new copper(I) binding motifs. Here we describe the synthesis, structural characterization, and reactivity of a series of unsymmetrical N-aryl-N'-alkylpyridyl β-diketiminato copper(I) complexes and discuss the structures and reactivity of these complexes with respect to the length of the pyridyl arm. All of the aforementioned unsymmetrical ß-diketiminato copper(I) complexes bind CO reversibly and are stable to disproportionation. The binding ability of CO and the rate of pyridyl ligand decoordination of these copper(I) complexes are directly related to the competition between the degree of puckering of the chelate system and the steric demands of the N-aryl substituent.

MicroRNA408 Is Critical for the HY5-SPL7 Gene Network That Mediates the Coordinated Response to Light and Copper[C][W

PubMed Central

Zhang, Huiyong; Zhao, Xin; Li, Jigang; Cai, Huaqing; Deng, Xing Wang; Li, Lei

2014-01-01

Light and copper are important environmental determinants of plant growth and development. Despite the wealth of knowledge on both light and copper signaling, the molecular mechanisms that integrate the two pathways remain poorly understood. Here, we use Arabidopsis thaliana to demonstrate an interaction between SQUAMOSA PROMOTER BINDING PROTEIN-LIKE7 (SPL7) and ELONGATED HYPOCOTYL5 (HY5), which mediate copper and light signaling, respectively. Through whole-genome chromatin immunoprecipitation and RNA sequencing analyses, we elucidated the SPL7 regulon and compared it with that of HY5. We found that the two transcription factors coregulate many genes, including those involved in anthocyanin accumulation and photosynthesis. Moreover, SPL7 and HY5 act coordinately to transcriptionally regulate MIR408, which results in differential expression of microRNA408 (miR408) and its target genes in response to changing light and copper conditions. We demonstrate that this regulation is tied to copper allocation to the chloroplast and plastocyanin levels. Finally, we found that constitutively activated miR408 rescues the distinct developmental defects of the hy5, spl7, and hy5 spl7 mutants. These findings revealed the existence of crosstalk between light and copper, mediated by a HY5-SPL7 network. Furthermore, integration of transcriptional and posttranscriptional regulation is critical for governing proper metabolism and development in response to combined copper and light signaling. PMID:25516599

Bioinorganic Chemical Modeling of Dioxygen-Activating Copper Proteins.

ERIC Educational Resources Information Center

Karlin, Kenneth D.; Gultneh, Yilma

1985-01-01

Discusses studies done in modeling the copper centers in the proteins hemocyanin (a dioxygen carrier), tyrosinase, and dopamine beta-hydroxylase. Copper proteins, model approach in copper bioinorganic chemistry, characterization of reversible oxygen carriers and dioxygen-metal complexes, a copper mono-oxygenase model reaction, and other topics are…

Alteration of the Copper-Binding Capacity of Iron-Rich Humic Colloids during Transport from Peatland to Marine Waters.

PubMed

Muller, François L L; Cuscov, Marco

2017-03-21

Blanket bogs contain vast amounts of Sphagnum-derived organic substances which can act as powerful chelators for dissolved iron and thus enhance its export to the coastal ocean. To investigate the variations in quantity and quality of these exports, adsorptive cathodic stripping voltammetry (CSV) was used to characterize the metal binding properties of molecular weight-fractionated dissolved organic matter (MW-fractionated DOM) in the catchment and coastal plume of a small peat-draining river over a seasonal cycle. Within the plume, both iron- and copper-binding organic ligands showed a linear, conservative distribution with increasing salinity, illustrating the high stability of peatland-derived humic substances (HS). Within the catchment, humic colloids lost up to 50% of their copper-binding capacity, expressed as a molar ratio to organic carbon, after residing for 1 week or more in the main reservoir of the catchment. Immediately downstream of the reservoir, the molar ratio [L 2 ]/[C org ], where L 2 was the second strongest copper-binding ligand, was 0.75 × 10 -4 when the reservoir residence time was 5 h but 0.34 × 10 -4 when it was 25 days. Residence time did not affect the carbon specific iron-binding capacity of the humic substances which was [L]/[C org ] = (0.80 ± 0.20) × 10 -2 . Our results suggest that the loss of copper-binding capacity with increasing residence time is caused by intracolloidal interactions between iron and HS during transit from peat soil to river mouth.

Characterization of Cu(II)-reconstituted ACC Oxidase using experimental and theoretical approaches.

PubMed

El Bakkali-Tahéri, Nadia; Tachon, Sybille; Orio, Maylis; Bertaina, Sylvain; Martinho, Marlène; Robert, Viviane; Réglier, Marius; Tron, Thierry; Dorlet, Pierre; Simaan, A Jalila

2017-06-01

1-Aminocyclopropane-1-carboxylic acid oxidase (ACCO) is a non heme iron(II) containing enzyme that catalyzes the final step of the ethylene biosynthesis in plants. The iron(II) ion is bound in a facial triad composed of two histidines and one aspartate (H177, D179 and H234). Several active site variants were generated to provide alternate binding motifs and the enzymes were reconstituted with copper(II). Continuous wave (cw) and pulsed Electron Paramagnetic Resonance (EPR) spectroscopies as well as Density Functional Theory (DFT) calculations were performed and models for the copper(II) binding sites were deduced. In all investigated enzymes, the copper ion is equatorially coordinated by the two histidine residues (H177 and H234) and probably two water molecules. The copper-containing enzymes are inactive, even when hydrogen peroxide is used in peroxide shunt approach. EPR experiments and DFT calculations were undertaken to investigate substrate's (ACC) binding on the copper ion and the results were used to rationalize the lack of copper-mediated activity. Copyright © 2017 Elsevier Inc. All rights reserved.

Construction of a high efficiency copper adsorption bacterial system via peptide display and its application on copper dye polluted wastewater.

PubMed

Maruthamuthu, Murali Kannan; Nadarajan, Saravanan Prabhu; Ganesh, Irisappan; Ravikumar, Sambandam; Yun, Hyungdon; Yoo, Ik-Keun; Hong, Soon Ho

2015-11-01

For the construction of an efficient copper waste treatment system, a cell surface display strategy was employed. The copper adsorption ability of recombinant bacterial strains displaying three different copper binding peptides were evaluated in LB Luria-Bertani medium (LB), artificial wastewater, and copper phthalocyanine containing textile dye industry wastewater samples. Structural characteristics of the three peptides were also analyzed by similarity-based structure modeling. The best binding peptide was chosen for the construction of a dimeric peptide display and the adsorption ability of the monomeric and dimeric peptide displayed strains were compared. The dimeric peptide displayed strain showed superior copper adsorption in all three tested conditions (LB, artificial wastewater, and textile dye industry wastewater). When the strains were exposed to copper phthalocyanine dye polluted wastewater, the dimeric peptide display [543.27 µmol/g DCW dry cell weight (DCW)] showed higher adsorption of copper when compared with the monomeric strains (243.53 µmol/g DCW).

Therapeutic potential of copper chelation with triethylenetetramine in managing diabetes mellitus and Alzheimer's disease.

PubMed

Cooper, Garth J S

2011-07-09

This article reviews recent evidence, much of which has been generated by my group's research programme, which has identified for the first time a previously unknown copper-overload state that is central to the pathogenesis of diabetic organ damage. This state causes tissue damage in the blood vessels, heart, kidneys, retina and nerves through copper-mediated oxidative stress. This author now considers this copper-overload state to provide an important new target for therapeutic intervention, the objective of which is to prevent or reverse the diabetic complications. Triethylenetetramine (TETA) has recently been identified as the first in a new class of anti-diabetic molecules through the original work reviewed here, thus providing a new use for this molecule, which was previously approved by the US FDA in 1985 as a second-line treatment for Wilson's disease. TETA acts as a highly selective divalent copper (Cu(II)) chelator that prevents or reverses diabetic copper overload, thereby suppressing oxidative stress. TETA treatment of diabetic animals and patients has identified and quantified the interlinked defects in copper metabolism that characterize this systemic copper overload state. Copper overload in diabetes mellitus differs from that in Wilson's disease through differences in their respective causative molecular mechanisms, and resulting differences in tissue localization and behaviour of the excess copper. Elevated pathogenetic tissue binding of copper occurs in diabetes. It may well be mediated by advanced-glycation endproduct (AGE) modification of susceptible amino-acid residues in long-lived fibrous proteins, for example, connective tissue collagens in locations such as blood vessel walls. These AGE modifications can act as localized, fixed endogenous chelators that increase the chelatable-copper content of organs such as the heart and kidneys by binding excessive amounts of catalytically active Cu(II) in specific vascular beds, thereby focusing the related copper-mediated oxidative stress in susceptible tissues. In this review, summarized evidence from our clinical studies in healthy volunteers and diabetic patients with left-ventricular hypertrophy, and from nonclinical models of diabetic cardiac, arterial, renal and neural disease is used to construct descriptions of the mechanisms by which TETA treatment prevents injury and regenerates damaged organs. Our recent phase II proof-of-principle studies in patients with type 2 diabetes and in nonclinical models of diabetes have helped to define the pathogenetic defects in copper regulation, and have shown that they are reversible by TETA. The drug tightly binds and extracts excess systemic Cu(II) into the urine whilst neutralizing its catalytic activity, but does not cause systemic copper deficiency, even after prolonged use. Its physicochemical properties, which are pivotal for its safety and efficacy, clearly differentiate it from all other clinically available transition metal chelators, including D-penicillamine, ammonium tetrathiomolybdate and clioquinol. The studies reviewed here show that TETA treatment is generally effective in preventing or reversing diabetic organ damage, and support its ongoing development as a new medicine for diabetes. Trientine (TETA dihydrochloride) has been used since the mid-1980s as a second-line treatment for Wilson's disease, and our recent clinical studies have reinforced the impression that it is likely to be safe for long-term use in patients with diabetes and related metabolic disorders. There is substantive evidence to support the view that diabetes shares many pathogenetic mechanisms with Alzheimer's disease and vascular dementia. Indeed, the close epidemiological and molecular linkages between them point to Alzheimer's disease/vascular dementia as a further therapeutic target where experimental pharmacotherapy with TETA could well find further clinical application.

Potassium and the K+/H+ Exchanger Kha1p Promote Binding of Copper to ApoFet3p Multi-copper Ferroxidase*

PubMed Central

Wu, Xiaobin; Kim, Heejeong; Seravalli, Javier; Barycki, Joseph J.; Hart, P. John; Gohara, David W.; Di Cera, Enrico; Jung, Won Hee; Kosman, Daniel J.; Lee, Jaekwon

2016-01-01

Acquisition and distribution of metal ions support a number of biological processes. Here we show that respiratory growth of and iron acquisition by the yeast Saccharomyces cerevisiae relies on potassium (K+) compartmentalization to the trans-Golgi network via Kha1p, a K+/H+ exchanger. K+ in the trans-Golgi network facilitates binding of copper to the Fet3p multi-copper ferroxidase. The effect of K+ is not dependent on stable binding with Fet3p or alteration of the characteristics of the secretory pathway. The data suggest that K+ acts as a chemical factor in Fet3p maturation, a role similar to that of cations in folding of nucleic acids. Up-regulation of KHA1 gene in response to iron limitation via iron-specific transcription factors indicates that K+ compartmentalization is linked to cellular iron homeostasis. Our study reveals a novel functional role of K+ in the binding of copper to apoFet3p and identifies a K+/H+ exchanger at the secretory pathway as a new molecular factor associated with iron uptake in yeast. PMID:26966178

Tetrathiomolybdate inhibits the reaction of cisplatin with human copper chaperone Atox1.

PubMed

Tian, Yao; Fang, Tiantian; Yuan, Siming; Zheng, Yuchuan; Arnesano, Fabio; Natile, Giovanni; Liu, Yangzhong

2018-05-23

Cisplatin is a widely used anticancer drug in clinic, and ammonium tetrathiomolybdate ([(NH4)2MoS4], TM) is a copper chelator used in clinic for the treatment of Wilson's disease. Recently, TM has been found to enhance the therapeutic effect of cisplatin; however, the origin of this effect is not clear. Here we found that TM can inhibit the reaction of cisplatin with Cu-Atox1 and prevent the protein unfolding and aggregation induced by cisplatin. Although Ag(i) binds to Atox1 in a way similar to Cu(i)-Atox1, TM does not prevent the reaction of Ag-Atox1 with cisplatin. This result indicates that the formation of a Mo-centered trimeric protein cluster in the TM-Cu-Atox1 system plays a role in the inhibitory effect. This work provides new insights into the mechanism by which TM enhances the cytotoxic efficacy of cisplatin and helps to circumvent cisplatin resistance of tumor cells.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tian, Shiliang; Liu, Jing; Cowley, Ryan E.

Here, S-Nitrosothiols are known as reagents for NO storage and transportation and as regulators in many physiological processes. Although the S-nitrosylation catalysed by haem proteins is well known, no direct evidence of S-nitrosylation in copper proteins has been reported. Here, we report reversible insertion of NO into a copper–thiolate bond in an engineered copper centre in Pseudomonas aeruginosa azurin by rational design of the primary coordination sphere and tuning its reduction potential by deleting a hydrogen bond in the secondary coordination sphere. The results not only provide the first direct evidence of S-nitrosylation of Cu(II)-bound cysteine in metalloproteins, but alsomore » shed light on the reaction mechanism and structural features responsible for stabilizing the elusive Cu(I)–S(Cys)NO species. The fast, efficient and reversible S-nitrosylation reaction is used to demonstrate its ability to prevent NO inhibition of cytochrome bo 3 oxidase activity by competing for NO binding with the native enzyme under physiologically relevant conditions.« less

Reversible S-nitrosylation in an engineered azurin

DOE PAGES

Tian, Shiliang; Liu, Jing; Cowley, Ryan E.; ...

2016-04-25

Here, S-Nitrosothiols are known as reagents for NO storage and transportation and as regulators in many physiological processes. Although the S-nitrosylation catalysed by haem proteins is well known, no direct evidence of S-nitrosylation in copper proteins has been reported. Here, we report reversible insertion of NO into a copper–thiolate bond in an engineered copper centre in Pseudomonas aeruginosa azurin by rational design of the primary coordination sphere and tuning its reduction potential by deleting a hydrogen bond in the secondary coordination sphere. The results not only provide the first direct evidence of S-nitrosylation of Cu(II)-bound cysteine in metalloproteins, but alsomore » shed light on the reaction mechanism and structural features responsible for stabilizing the elusive Cu(I)–S(Cys)NO species. The fast, efficient and reversible S-nitrosylation reaction is used to demonstrate its ability to prevent NO inhibition of cytochrome bo 3 oxidase activity by competing for NO binding with the native enzyme under physiologically relevant conditions.« less

Ethylene Receptor 1 (ETR1) Is Sufficient and Has the Predominant Role in Mediating Inhibition of Ethylene Responses by Silver in Arabidopsis thaliana*

PubMed Central

McDaniel, Brittany K.; Binder, Brad M.

2012-01-01

Ethylene influences many processes in Arabidopsis thaliana through the action of five receptor isoforms. All five isoforms use copper as a cofactor for binding ethylene. Previous research showed that silver can substitute for copper as a cofactor for ethylene binding activity in the ETR1 ethylene receptor yet also inhibit ethylene responses in plants. End-point and rapid kinetic analyses of dark-grown seedling growth revealed that the effects of silver are mostly dependent upon ETR1, and ETR1 alone is sufficient for the effects of silver. Ethylene responses in etr1-6 etr2-3 ein4-4 triple mutants were not blocked by silver. Transformation of these triple mutants with cDNA for each receptor isoform under the promoter control of ETR1 revealed that the cETR1 transgene completely rescued responses to silver while the cETR2 transgene failed to rescue these responses. The other three isoforms partially rescued responses to silver. Ethylene binding assays on the binding domains of the five receptor isoforms expressed in yeast showed that silver supports ethylene binding to ETR1 and ERS1 but not the other isoforms. Thus, silver may have an effect on ethylene signaling outside of the ethylene binding pocket of the receptors. Ethylene binding to ETR1 with silver was ∼30% of binding with copper. However, alterations in the Kd for ethylene binding to ETR1 and the half-time of ethylene dissociation from ETR1 do not underlie this lower binding. Thus, it is likely that the lower ethylene binding activity of ETR1 with silver is due to fewer ethylene binding sites generated with silver versus copper. PMID:22692214

The cardiac copper chaperone proteins Sco1 and CCS are up-regulated, but Cox 1 and Cox4 are down-regulated, by copper deficiency.

PubMed

Getz, Jean; Lin, Dingbo; Medeiros, Denis M

2011-10-01

Copper is ferried in a cell complexed to chaperone proteins, and in the heart much copper is required for cytochrome c oxidase (Cox). It is not completely understood how copper status affects the levels of these proteins. Here we determined if dietary copper deficiency could up- or down-regulate select copper chaperone proteins and Cox subunits 1 and 4 in cardiac tissue of rats. Sixteen weanling male Long-Evans rats were randomized into treatment groups, one group receiving a copper-deficient diet (<1 mg Cu/kg diet) and one group receiving a diet containing adequate copper (6 mg Cu/kg diet) for 5 weeks. Hearts were removed, weighed, and non-myofibrillar proteins separated to analyze for levels of CCS, Sco1, Ctr1, Cox17, Cox1, and Cox4 by SDS-PAGE and Western blotting. No changes were observed in the concentrations of CTR1 and Cox17 between copper-adequate and copper-deficient rats. CCS and Sco1 were up-regulated and Cox1 and Cox4 were both down-regulated as a result of copper deficiency. These data suggest that select chaperone proteins and may be up-regulated, and Cox1 and 4 down-regulated, by a dietary copper deficiency, whereas others appear not to be affected by copper status.

Protein nanopore-based, single-molecule exploration of copper binding to an antimicrobial-derived, histidine-containing chimera peptide.

PubMed

Mereuta, Loredana; Schiopu, Irina; Asandei, Alina; Park, Yoonkyung; Hahm, Kyung-Soo; Luchian, Tudor

2012-12-11

Metal ions binding exert a crucial influence upon the aggregation properties and stability of peptides, and the propensity of folding in various substates. Herein, we demonstrate the use of the α-HL protein as a powerful nanoscopic tool to probe Cu(2+)-triggered physicochemical changes of a 20 aminoacids long, antimicrobial-derived chimera peptide with a His residue as metal-binding site, and simultaneously dissect the kinetics of the free- and Cu(2+)-bound peptide interaction to the α-HL pore. Combining single-molecule electrophysiology on reconstituted lipid membranes and fluorescence spectroscopy, we show that the association rate constant between the α-HL pore and a Cu(2+)-free peptide is higher than that of a Cu(2+)-complexed peptide. We posit that mainly due to conformational changes induced by the bound Cu(2+) on the peptide, the resulting complex encounters a higher energy barrier toward its association with the protein pore, stemming most likely from an extra entropy cost needed to fit the Cu(2+)-complexed peptide within the α-HL lumen region. The lower dissociation rate constant of the Cu(2+)-complexed peptide from α-HL pore, as compared to that of Cu(2+)-free peptide, supports the existence of a deeper free energy well for the protein interaction with a Cu(2+)-complexed peptide, which may be indicative of specific Cu(2+)-mediated contributions to the binding of the Cu(2+)-complexed peptide within the pore lumen.

Active-site copper reduction promotes substrate binding of fungal lytic polysaccharide monooxygenase and reduces stability.

PubMed

Kracher, Daniel; Andlar, Martina; Furtmüller, Paul G; Ludwig, Roland

2018-02-02

Lytic polysaccharide monooxygenases (LPMOs) are a class of copper-containing enzymes that oxidatively degrade insoluble plant polysaccharides and soluble oligosaccharides. Upon reductive activation, they cleave the substrate and promote biomass degradation by hydrolytic enzymes. In this study, we employed LPMO9C from Neurospora crassa , which is active toward cellulose and soluble β-glucans, to study the enzyme-substrate interaction and thermal stability. Binding studies showed that the reduction of the mononuclear active-site copper by ascorbic acid increased the affinity and the maximum binding capacity of LPMO for cellulose. The reduced redox state of the active-site copper and not the subsequent formation of the activated oxygen species increased the affinity toward cellulose. The lower affinity of oxidized LPMO could support its desorption after catalysis and allow hydrolases to access the cleavage site. It also suggests that the copper reduction is not necessarily performed in the substrate-bound state of LPMO. Differential scanning fluorimetry showed a stabilizing effect of the substrates cellulose and xyloglucan on the apparent transition midpoint temperature of the reduced, catalytically active enzyme. Oxidative auto-inactivation and destabilization were observed in the absence of a suitable substrate. Our data reveal the determinants of LPMO stability under turnover and non-turnover conditions and indicate that the reduction of the active-site copper initiates substrate binding. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

A molecular chaperone activity of CCS restores the maturation of SOD1 fALS mutants.

PubMed

Luchinat, Enrico; Barbieri, Letizia; Banci, Lucia

2017-12-12

Superoxide dismutase 1 (SOD1) is an important metalloprotein for cellular oxidative stress defence, that is mutated in familiar variants of Amyotrophic Lateral Sclerosis (fALS). Some mutations destabilize the apo protein, leading to the formation of misfolded, toxic species. The Copper Chaperone for SOD1 (CCS) transiently interacts with SOD1 and promotes its correct maturation by transferring copper and catalyzing disulfide bond formation. By in vitro and in-cell NMR, we investigated the role of the SOD-like domain of CCS (CCS-D2). We showed that CCS-D2 forms a stable complex with zinc-bound SOD1 in human cells, that has a twofold stabilizing effect: it both prevents the accumulation of unstructured mutant SOD1 and promotes zinc binding. We further showed that CCS-D2 interacts with apo-SOD1 in vitro, suggesting that in cells CCS stabilizes mutant apo-SOD1 prior to zinc binding. Such molecular chaperone function of CCS-D2 is novel and its implications in SOD-linked fALS deserve further investigation.

A genetic screen reveals a periplasmic copper chaperone required for nitrite reductase activity in pathogenic Neisseria.

PubMed

Jen, Freda E-C; Djoko, Karrera Y; Bent, Stephen J; Day, Christopher J; McEwan, Alastair G; Jennings, Michael P

2015-09-01

Under conditions of low oxygen availability, Neisseria meningitidis and Neisseria gonorrhoeae are able to respire via a partial denitrification pathway in which nitrite is converted to nitrous oxide. In this process, nitrite reductase (AniA), a copper (Cu)-containing protein converts nitrite to NO, and this product is converted to nitrous oxide by nitric oxide reductase (NorB). NorB also confers protection against toxic NO, and so we devised a conditional lethal screen, using a norB mutant, to identify mutants that were resistant to nitrite-dependent killing. After random-deletion mutagenesis of N. meningitidis, this genetic screen identified a gene encoding a Cu chaperone that is essential for AniA function, AccA. Purified AccA binds one Cu (I) ion and also possesses a second binding site for Cu (II). This novel periplasmic Cu chaperone (AccA) appears to be essential for provision of Cu ions to AniA of pathogenic Neisseria to generate an active nitrite reductase. Apart from the Neisseria genus, AccA is distributed across a wide range of environmental Proteobacteria species. © FASEB.

Copper speciation and binding by organic matter in copper-contaminated streamwater

USGS Publications Warehouse

Breault, R.F.; Colman, J.A.; Aiken, G.R.; McKnight, D.

1996-01-01

Fulvic acid binding sites (1.3-70 ??M) and EDTA (0.0017-0.18 ??M) accounted for organically bound Cu in seven stream samples measured by potentiometric titration. Cu was 84-99% organically bound in filtrates with 200 nM total Cu. Binding of Cu by EDTA was limited by competition from other trace metals. Water hardness was inversely related to properties of dissolved organic carbon (DOC) that enhance fulvic acid binding: DOC concentration, percentage of DOC that is fulvic acid, and binding sites per fulvic acid carbon. Dissolved trace metals, stabilized by organic binding, occurred at increased concentration in soft water as compared to hard water.

Using two-dimensional correlation size exclusion chromatography (2D-CoSEC) to explore the size-dependent heterogeneity of humic substances for copper binding.

PubMed

Lee, Yun-Kyung; Hur, Jin

2017-08-01

Knowledge of the heterogeneous distribution of humic substances (HS) reactivities along a continuum of molecular weight (MW) is crucial for the systems where the HS MW is subject to change. In this study, two dimensional correlation spectroscopy combined with size exclusion chromatography (2D-CoSEC) was first utilized to obtain a continuous and heterogeneous presence of copper binding characteristics within bulk HS with respect to MW. HS solutions with varying copper concentrations were directly injected into a size exclusion chromatography (SEC) system with Tris-HCl buffer as a mobile phase. Several validation tests confirmed neither structural disruption of HS nor competition effect of the mobile phase used. Similar to batch systems, fluorescence quenching was observed in the chromatograms over a wide range of HS MW. 2D-CoSEC maps of a soil-derived HS (Elliot soil humic acid) showed the greater fluorescence quenching degrees with respect to the apparent MW on the order of 12500 Da > 10600 Da > 7000 Da > 15800 Da. The binding constants calculated based on modified Stern-Volmer equation were consistent with the 2D-CoSEC results. More heterogeneity of copper binding affinities within bulk HS was found for the soil-derived HS versus an aquatic HS. The traditional fluorescence quenching titration method using ultrafiltered HS size fractions failed to delineate detailed distribution of the copper binding characteristics, exhibiting a much shorter range of the binding constants than those obtained from the 2D-CoSEC. Our proposed technique demonstrated a great potential to describe metal binding characteristics of HS at high MW resolution, providing a clear picture of the size-dependent metal-HS interactions. Copyright © 2017 Elsevier Ltd. All rights reserved.

COPT6 Is a Plasma Membrane Transporter That Functions in Copper Homeostasis in Arabidopsis and Is a Novel Target of SQUAMOSA Promoter-binding Protein-like 7*

PubMed Central

Jung, Ha-il; Gayomba, Sheena R.; Rutzke, Michael A.; Craft, Eric; Kochian, Leon V.; Vatamaniuk, Olena K.

2012-01-01

Among the mechanisms controlling copper homeostasis in plants is the regulation of its uptake and tissue partitioning. Here we characterized a newly identified member of the conserved CTR/COPT family of copper transporters in Arabidopsis thaliana, COPT6. We showed that COPT6 resides at the plasma membrane and mediates copper accumulation when expressed in the Saccharomyces cerevisiae copper uptake mutant. Although the primary sequence of COPT6 contains the family conserved domains, including methionine-rich motifs in the extracellular N-terminal domain and a second transmembrane helix (TM2), it is different from the founding family member, S. cerevisiae Ctr1p. This conclusion was based on the finding that although the positionally conserved Met106 residue in the TM2 of COPT6 is functionally essential, the conserved Met27 in the N-terminal domain is not. Structure-function studies revealed that the N-terminal domain is dispensable for COPT6 function in copper-replete conditions but is important under copper-limiting conditions. In addition, COPT6 interacts with itself and with its homolog, COPT1, unlike Ctr1p, which interacts only with itself. Analyses of the expression pattern showed that although COPT6 is expressed in different cell types of different plant organs, the bulk of its expression is located in the vasculature. We also show that COPT6 expression is regulated by copper availability that, in part, is controlled by a master regulator of copper homeostasis, SPL7. Finally, studies using the A. thaliana copt6-1 mutant and plants overexpressing COPT6 revealed its essential role during copper limitation and excess. PMID:22865877

Zinc or copper deficiency-induced impaired inflammatory response to brain trauma may be caused by the concomitant metallothionein changes.

PubMed

Penkowa, M; Giralt, M; Thomsen, P S; Carrasco, J; Hidalgo, J

2001-04-01

The role of zinc- and copper-deficient diets on the inflammatory response to traumatic brain injury (TBI) has been evaluated in adult rats. As expected, zinc deficiency decreased food intake and body weight gain, and the latter effect was higher than that observed in pair-fed rats. In noninjured brains, zinc deficiency only affected significantly lectin (increasing) and glial fibrillary acidic protein (GFAP) and Cu,Zn-superoxide dismutase (Cu,Zn-SOD) (decreasing) immunoreactivities (irs). In injured brains, a profound gliosis was observed in the area surrounding the lesion, along with severe damage to neurons as indicated by neuron specific enolase (NSE) ir, and the number of cells undergoing apoptosis (measured by TUNEL) was dramatically increased. Zinc deficiency significantly altered brain response to TBI, potentiating the microgliosis and reducing the astrogliosis, while increasing the number of apoptotic cells. Metallothioneins (MTs) are important zinc- and copper-binding proteins in the CNS, which could influence significantly the brain response to TBI because of their putative roles in metal homeostasis and antioxidant defenses. MT-I+II expression was dramatically increased by TBI, and this response was significantly blunted by zinc deficiency. The MT-III isoform was moderately increased by both TBI and zinc deficiency. TBI strongly increased oxidative stress levels, as demonstrated by malondialdehyde (MDA), protein tyrosine nitration (NITT), and nuclear factor kappaB (NF-kappaB) levels irs, all of which were potentiated by zinc deficiency. Further analysis revealed unbalanced expression of prooxidant and antioxidant proteins besides MT, since the levels of inducible nitric oxide synthase (iNOS) and Cu,Zn-SOD were increased and decreased, respectively, by zinc deficiency. All these effects were attributable to zinc deficiency, since pair-fed rats did not differ from normally fed rats. In general, copper deficiency caused a similar pattern of responses, albeit more moderate. Results obtained in mice with a null mutation for the MT-I+II isoforms strongly suggest that most of the effects observed in the rat brain after zinc and copper deficiencies are attributable to the concomitant changes in the MT expression.

Facile Method for the Site-Specific, Covalent Attachment of full-length IgG onto Nanoparticles

PubMed Central

Hui, James Zhe; Al Zaki, Ajlan; Cheng, Zhiliang; Popik, Vladimir; Zhang, Hongtao; Luning Prak, Eline T.

2014-01-01

Antibodies, most commonly IgGs, have been widely used as targeting ligands in research and therapeutic applications due to their wide array of targets, high specificity and proven efficacy. Many of these applications require antibodies to be conjugated onto surfaces (e.g. nanoparticles and microplates); however, most conventional bioconjugation techniques exhibit low crosslinking efficiencies, reduced functionality due to non-site-specific labeling and random surface orientation, and/or require protein engineering (e.g. cysteine handles), which can be technically challenging. To overcome these limitations, we have recombinantly expressed Protein Z, which binds the Fc region of IgG, with an UV active non-natural amino acid benzoylphenyalanine (BPA) within its binding domain. Upon exposure to long wavelength UV light, the BPA is activated and forms a covalent link between the Protein Z and the bound Fc region of IgG. This technology was combined with expressed protein ligation (EPL), which allowed for the introduction of a fluorophore and click chemistry-compatible azide group onto the C-terminus of Protein Z during the recombinant protein purification step. This enabled crosslinked-Protein Z-IgG complexes to be efficiently and site-specifically attached to aza-dibenzycyclooctyne-modified nanoparticles, via copper-free click chemistry. PMID:24729432

Facile method for the site-specific, covalent attachment of full-length IgG onto nanoparticles.

PubMed

Hui, James Zhe; Al Zaki, Ajlan; Cheng, Zhiliang; Popik, Vladimir; Zhang, Hongtao; Luning Prak, Eline T; Tsourkas, Andrew

2014-08-27

Antibodies, most commonly IgGs, have been widely used as targeting ligands in research and therapeutic applications due to their wide array of targets, high specificity and proven efficacy. Many of these applications require antibodies to be conjugated onto surfaces (e.g. nanoparticles and microplates); however, most conventional bioconjugation techniques exhibit low crosslinking efficiencies, reduced functionality due to non-site-specific labeling and random surface orientation, and/or require protein engineering (e.g. cysteine handles), which can be technically challenging. To overcome these limitations, we have recombinantly expressed Protein Z, which binds the Fc region of IgG, with an UV active non-natural amino acid benzoylphenyalanine (BPA) within its binding domain. Upon exposure to long wavelength UV light, the BPA is activated and forms a covalent link between the Protein Z and the bound Fc region of IgG. This technology was combined with expressed protein ligation (EPL), which allowed for the introduction of a fluorophore and click chemistry-compatible azide group onto the C-terminus of Protein Z during the recombinant protein purification step. This enabled the crosslinked-Protein Z-IgG complexes to be efficiently and site-specifically attached to aza-dibenzocyclooctyne-modified nanoparticles, via copper-free click chemistry. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

An approach to crystallizing proteins by metal-mediated synthetic symmetrization

PubMed Central

Laganowsky, Arthur; Zhao, Minglei; Soriaga, Angela B; Sawaya, Michael R; Cascio, Duilio; Yeates, Todd O

2011-01-01

Combining the concepts of synthetic symmetrization with the approach of engineering metal-binding sites, we have developed a new crystallization methodology termed metal-mediated synthetic symmetrization. In this method, pairs of histidine or cysteine mutations are introduced on the surface of target proteins, generating crystal lattice contacts or oligomeric assemblies upon coordination with metal. Metal-mediated synthetic symmetrization greatly expands the packing and oligomeric assembly possibilities of target proteins, thereby increasing the chances of growing diffraction-quality crystals. To demonstrate this method, we designed various T4 lysozyme (T4L) and maltose-binding protein (MBP) mutants and cocrystallized them with one of three metal ions: copper (Cu2+), nickel (Ni2+), or zinc (Zn2+). The approach resulted in 16 new crystal structures—eight for T4L and eight for MBP—displaying a variety of oligomeric assemblies and packing modes, representing in total 13 new and distinct crystal forms for these proteins. We discuss the potential utility of the method for crystallizing target proteins of unknown structure by engineering in pairs of histidine or cysteine residues. As an alternate strategy, we propose that the varied crystallization-prone forms of T4L or MBP engineered in this work could be used as crystallization chaperones, by fusing them genetically to target proteins of interest. PMID:21898649

Genistein Binding to Copper(II)-Solvent Dependence and Effects on Radical Scavenging.

PubMed

Yang, Jing; Xu, Yi; Liu, Hao-Yu; Han, Rui-Min; Zhang, Jian-Ping; Skibsted, Leif H

2017-10-18

Genistein, but not daidzein, binds to copper(II) with a 1:2 stoichiometry in ethanol and with a 1:1 stoichiometry in methanol, indicating chelation by the 5-phenol and the 4-keto group of the isoflavonoid as demonstrated by the Jobs method and UV-visible absorption spectroscopy. In ethanol, the stability constants had the value 1.12 × 10 11 L²∙mol -2 for the 1:2 complex and in methanol 6.0 × 10⁵ L∙mol -1 for the 1:1 complex at 25 °C. Binding was not detected in water, as confirmed by an upper limit for the 1:1 stability constant of K = 5 mol -1 L as calculated from the difference in solvation free energy of copper(II) between methanol and the more polar water. Solvent molecules compete with genistein as demonstrated in methanol where binding stoichiometry changes from 1:2 to 1:1 compared to ethanol and methanol/chloroform (7/3, v / v ). Genistein binding to copper(II) increases the scavenging rate of the stable, neutral 2,2-diphenyl-1-picrylhydrazyl radical by more than a factor of four, while only small effects were seen for the short-lived but more oxidizing β -carotene radical cation using laser flash photolysis. The increased efficiency of coordinated genistein is concluded to depend on kinetic rather than on thermodynamic factors, as confirmed by the small change in reduction potential of -0.016 V detected by cyclic voltammetry upon binding of genistein to copper(II) in methanol/chloroform solutions.

Expression and purification of recombinant proteins in Escherichia coli tagged with the metal-binding protein CusF.

PubMed

Cantu-Bustos, J Enrique; Vargas-Cortez, Teresa; Morones-Ramirez, Jose Ruben; Balderas-Renteria, Isaias; Galbraith, David W; McEvoy, Megan M; Zarate, Xristo

2016-05-01

Production of recombinant proteins in Escherichia coli has been improved considerably through the use of fusion proteins, because they increase protein solubility and facilitate purification via affinity chromatography. In this article, we propose the use of CusF as a new fusion partner for expression and purification of recombinant proteins in E. coli. Using a cell-free protein expression system, based on the E. coli S30 extract, Green Fluorescent Protein (GFP) was expressed with a series of different N-terminal tags, immobilized on self-assembled protein microarrays, and its fluorescence quantified. GFP tagged with CusF showed the highest fluorescence intensity, and this was greater than the intensities from corresponding GFP constructs that contained MBP or GST tags. Analysis of protein production in vivo showed that CusF produces large amounts of soluble protein with low levels of inclusion bodies. Furthermore, fusion proteins can be exported to the cellular periplasm, if CusF contains the signal sequence. Taking advantage of its ability to bind copper ions, recombinant proteins can be purified with readily available IMAC resins charged with this metal ion, producing pure proteins after purification and tag removal. We therefore recommend the use of CusF as a viable alternative to MBP or GST as a fusion protein/affinity tag for the production of soluble recombinant proteins in E. coli. Copyright © 2016 Elsevier Inc. All rights reserved.

N‐Heterocyclic Carbene Self‐assembled Monolayers on Copper and Gold: Dramatic Effect of Wingtip Groups on Binding, Orientation and Assembly

PubMed Central

Larrea, Christian R.; Narouz, Mina R.; Mosey, Nicholas J.; Horton, J. Hugh; Crudden, Cathleen M.

2017-01-01

Abstract Self‐assembled monolayers of N‐heterocyclic carbenes (NHCs) on copper are reported. The monolayer structure is highly dependent on the N,N‐substituents on the NHC. On both Cu(111) and Au(111), bulky isopropyl substituents force the NHC to bind perpendicular to the metal surface while methyl‐ or ethyl‐substituted NHCs lie flat. Temperature‐programmed desorption studies show that the NHC binds to Cu(111) with a desorption energy of E des=152±10 kJ mol−1. NHCs that bind upright desorb cleanly, while flat‐lying NHCs decompose leaving adsorbed organic residues. Scanning tunneling microscopy of methylated NHCs reveals arrays of covalently linked dimers which transform into adsorbed (NHC)2Cu species by extraction of a copper atom from the surface after annealing. PMID:28960768

Influence of Dietary Copper on Serum Growth-Related Hormone Levels and Growth Performance of Weanling Pigs.

PubMed

Wang, Jianguo; Zhu, Xiaoyan; Guo, Yazhou; Wang, Zhe; Zhao, Baoyu; Yin, Yunhou; Liu, Guowen

2016-07-01

To investigate the effect of dietary copper on serum growth-related hormones levels and growth performance, a total of 60 weanling pigs were randomly assigned to six groups each containing 10 pigs, fed on basal diets supplemented with 0 (control), 100, 150, 200, 250, and 300 mg/kg copper sulfate for 80 days, respectively. The average daily gain (ADG), feed to gain ratio (F/G), feed intake and serum growth hormone (GH), insulin (INS), insulin-like growth factor 1 (IGF-1), and insulin-like growth factor-binding protein 3 (IGFBP-3) levels were detected at interval of 20 days. The results revealed that ADG, and serum GH, INS, IGF-1, and IGFBP-3 concentrations were increased significantly in the pigs fed on diets added with 100, 150, 200, 250, and 300 mg/kg copper sulfate. Meanwhile, in the pigs supplemented with 250 mg/kg copper sulfate, ADG was increased significantly from the 40th to the 60th day of the experiment (P < 0.01), and the levels of GH, INS, IGF-1, and IGFBP-3 in serum were elevated significantly from the 20th to the 40th day of the experiment (P < 0.01). It is concluded that effects of copper supplemented in the diet on the growth of pigs were related to the increasing levels of GH, INS, IGF-1, and IGFBP-3 in serum which were induced by copper. High dietary copper increase the concentrations of growth-related hormones in serum, resulting in improving the growth performance of weanling pigs.

Natural variations of copper and sulfur stable isotopes in blood of hepatocellular carcinoma patients

NASA Astrophysics Data System (ADS)

Balter, Vincent; Nogueira da Costa, Andre; Paky Bondanese, Victor; Jaouen, Klervia; Lamboux, Aline; Sangrajrang, Suleeporn; Vincent, Nicolas; Fourel, François; Télouk, Philippe; Gigou, Michelle; Lécuyer, Christophe; Srivatanakul, Petcharin; Bréchot, Christian; Albarède, Francis; Hainaut, Pierre

2015-01-01

The widespread hypoxic conditions of the tumor microenvironment can impair the metabolism of bioessential elements such as copper and sulfur, notably by changing their redox state and, as a consequence, their ability to bind specific molecules. Because competing redox state is known to drive isotopic fractionation, we have used here the stable isotope compositions of copper (65Cu/63Cu) and sulfur (34S/32S) in the blood of patients with hepatocellular carcinoma (HCC) as a tool to explore the cancer-driven copper and sulfur imbalances. We report that copper is 63Cu-enriched by ∼0.4‰ and sulfur is 32S-enriched by ∼1.5‰ in the blood of patients compared with that of control subjects. As expected, HCC patients have more copper in red blood cells and serum compared with control subjects. However, the isotopic signature of this blood extra copper burden is not in favor of a dietary origin but rather suggests a reallocation in the body of copper bound to cysteine-rich proteins such as metallothioneins. The magnitude of the sulfur isotope effect is similar in red blood cells and serum of HCC patients, implying that sulfur fractionation is systemic. The 32S-enrichment of sulfur in the blood of HCC patients is compatible with the notion that sulfur partly originates from tumor-derived sulfides. The measurement of natural variations of stable isotope compositions, using techniques developed in the field of Earth sciences, can provide new means to detect and quantify cancer metabolic changes and provide insights into underlying mechanisms.

Comparison of ultrafiltration and solid phase extraction for the separation of free and protein-bound serum copper for the Wilson's disease diagnosis.

PubMed

Bohrer, Denise; Do Nascimento, Paulo Cícero; Ramirez, Adrian G; Mendonça, Jean Karlo A; De Carvalho, Leandro M; Pomblum, Solange Cristina G

2004-07-01

The determination of the ratio free/protein-bound serum copper along with urinary copper can be used as a preliminary test for the Wilson's Disease diagnosis. In this work, the determination of these copper fractions in serum samples was carried out in two different ways; after separation of the copper bound to proteins from the free fraction by a column for protein adsorption and by ultrafiltration. As proteins can be adsorbed onto plastic polymeric surfaces, polyethylene (PE) with different molecular weights in powder form was investigated for protein adsorption. A small column was adapted in a flow system to carry out a solid-phase extraction (SPE) on-line. Preliminary experiments defined conditions for protein retention and elution and column saturation. Good performance was achieved using Mg(NO3)2 solution as carrier and methanol as eluent. The presence of proteins in both fraction (column effluent and eluate) was checked by the Coomassie Brilliant Blue test. Copper was measured by graphite furnace atomic absorption spectrometry. The measurement in the column effluent furnished the free-fraction of copper while the copper measured in the eluate the bound-fraction. The method was compared with ultrafiltration (20 kDa), measuring the free-copper in the ultrafiltrate. For the determination of protein-bound copper, the copper found in the ultrafitrate was discounted from the total copper measured in the sample. Serum samples of 10 individuals were analyzed by both methods with good agreement of the results. The regression plots, obtained by analysing the samples by both methods, presented r2 and slope of 0.97 and 0.96 for free copper and 1.00 and 1.00 for bound copper, respectively. Protein-bound copper (PB) concentrations ranged from 74 to 2074 microg/l and free-copper (F) from 22 to 54 microg/l. The ratio F/PB, calculated from SPE data, was 29.7% for one individual, with Wilson Disease well-characterized, and ranged from 1.2% to 5.2% for the others. The SPE method performed well in terms of accuracy and precision, and showed good agreement with the UF. Advantages of SPE are small sample volume (50 microl), separation carried out in 10 min, and the use of the same column for several analyses. Copyright 2004 Elsevier B.V.

Synthesis of heteroglycoclusters by using orthogonal chemoselective ligations

PubMed Central

Thomas, Baptiste; Fiore, Michele; Bossu, Isabelle; Dumy, Pascal

2012-01-01

Summary Synthetic heteroglycoclusters are being subjected to increasing interest due to their potential to serve as selective ligands for carbohydrate-binding proteins. In this paper, we describe an expedient strategy to prepare cyclopeptides displaying well-defined distributions and combinations of carbohydrates. By using both oxime ligation and copper(I)-catalyzed alkyne–azide cycloaddition, two series of compounds bearing binary combinations of αMan, αFuc or βLac in an overall tetravalent presentation, and either 2:2 or 3:1 relative proportions, have been prepared. PMID:22509212

Biosorption of metal ions from aqueous solutions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Jiaping; Yiacoumi, Sotira

1997-01-01

Copper biosorption from aqueous solutions by calcium alginate is reported in this paper. The experimental section includes potentiometric titrations of biosorbents, batch equilibrium and kinetic studies of copper biosorption, as well as fixed-bed biosorption experiments. The potentiometric titration results show that the surface charge increases with decreasing pH. The biosorption of copper strongly depends on solution pH; the metal ion binding increases from 0 to 90 percent in pH ranging from 1.5 to 5.0. In addition, a decrease in ionic strength results in an increase of copper ion removal. Kinetic studies indicate that mass transfer plays an important role inmore » the biosorption rate. Furthermore, a fixed-bed biosorption experiment shows that calcium alginate has a significant capacity for copper ion removal. The two-pK Basic Stem model successfully represents the surface charge and equilibrium biosorption experimental data. The calculation results demonstrate that the copper removal may result from the binding of free copper and its hydroxide with surface functional groups of the biosorbents.« less

Impaired copper and iron metabolism in blood cells and muscles of patients affected by copper deficiency myeloneuropathy.

PubMed

Spinazzi, Marco; Sghirlanzoni, Angelo; Salviati, Leonardo; Angelini, Corrado

2014-12-01

Severe copper deficiency leads in humans to a treatable multisystem disease characterized by anaemia and degeneration of spinal cord and nerves, but its mechanisms have not been investigated. We tested whether copper deficit leads to alterations in fundamental copper-dependent proteins and in iron metabolism in blood and muscles of patients affected by copper deficiency myeloneuropathy, and if these metabolic abnormalities are associated with compensatory mechanisms for copper maintenance. We evaluated the expression of critical copper enzymes, of iron-related proteins, and copper chaperones and transporters in blood and muscles from five copper-deficient patients presenting with subacute sensory ataxia, muscle paralysis, liver steatosis and variable anaemia. Severe copper deficiency was caused by chronic zinc intoxication in all of the patients, with an additional history of gastrectomy in two cases. The antioxidant enzyme SOD1 and subunit 2 of cytochrome c oxidase were significantly decreased in blood cells and in muscles of copper-deficient patients compared with controls. In muscle, the iron storage protein ferritin was dramatically reduced despite normal serum ferritin, and the expression of the haem-proteins cytochrome c and myoglobin was impaired. Muscle expression of the copper transporter CTR1 and of the copper chaperone CCS, was strikingly increased, while antioxidant protein 1 was diminished. copper-dependent enzymes with critical functions in antioxidant defences, in mitochondrial energy production, and in iron metabolism are affected in blood and muscles of patients with profound copper deficiency leading to myeloneuropathy. Homeostatic mechanisms are strongly activated to increase intracellular copper retention. © 2013 British Neuropathological Society.

The copper metallome in eukaryotic cells.

PubMed

Vest, Katherine E; Hashemi, Hayaa F; Cobine, Paul A

2013-01-01

Copper is an element that is both essential and toxic. It is a required micronutrient for energy production in aerobic eukaryotes, from unicellular yeast to plants and mammals. Copper is also required for the acquisition and systemic distribution of the essential metal iron, and so copper deficiency results in iron deficiency. Copper enzymes have been identified that explain the wide variety of symptoms suffered by copper deficient subjects. The cloning of the genes encoding transport proteins responsible for copper-related Menkes and Wilson diseases inspired and coincided with the discovery of copper chaperones that stimulated the copper homeostasis field. Copper continues to be implicated in new array of proteins, notably those involved in a variety of neurodegenerative diseases. Here we will describe the cadre of important historical copper proteins and survey the major metallochaperones and transporters responsible for mobilization and sequestration of copper in yeast, mammals and plants.

Interaction of a common painkiller piroxicam and copper-piroxicam with chromatin causes structural alterations accompanied by modulation at the epigenomic/genomic level.

PubMed

Goswami, Sathi; Sanyal, Sulagna; Chakraborty, Payal; Das, Chandrima; Sarkar, Munna

2017-08-01

NSAIDs are the most common class of painkillers and anti-inflammatory agents. They also show other functions like chemoprevention and chemosuppression for which they act at the protein but not at the genome level since they are mostly anions at physiological pH, which prohibit their approach to the poly-anionic DNA. Complexing the drugs with bioactive metal obliterate their negative charge and allow them to bind to the DNA, thereby, opening the possibility of genome level interaction. To test this hypothesis, we present the interaction of a traditional NSAID, Piroxicam and its copper complex with core histone and chromatin. Spectroscopy, DLS, and SEM studies were applied to see the effect of the interaction on the structure of histone/chromatin. This was coupled with MTT assay, immunoblot analysis, confocal microscopy, micro array analysis and qRT-PCR. The interaction of Piroxicam and its copper complex with histone/chromatin results in structural alterations. Such structural alterations can have different biological manifestations, but to test our hypothesis, we have focused only on the accompanied modulations at the epigenomic/genomic level. The complex, showed alteration of key epigenetic signatures implicated in transcription in the global context, although Piroxicam caused no significant changes. We have correlated such alterations caused by the complex with the changes in global gene expression and validated the candidate gene expression alterations. Our results provide the proof of concept that DNA binding ability of the copper complexes of a traditional NSAID, opens up the possibility of modulations at the epigenomic/genomic level. Copyright © 2017 Elsevier B.V. All rights reserved.

Macrocyclic metal complexes for metalloenzyme mimicry and sensor development.

PubMed

Joshi, Tanmaya; Graham, Bim; Spiccia, Leone

2015-08-18

Examples of proteins that incorporate one or more metal ions within their structure are found within a broad range of classes, including oxidases, oxidoreductases, reductases, proteases, proton transport proteins, electron transfer/transport proteins, storage proteins, lyases, rusticyanins, metallochaperones, sporulation proteins, hydrolases, endopeptidases, luminescent proteins, iron transport proteins, oxygen storage/transport proteins, calcium binding proteins, and monooxygenases. The metal coordination environment therein is often generated from residues inherent to the protein, small exogenous molecules (e.g., aqua ligands) and/or macrocyclic porphyrin units found, for example, in hemoglobin, myoglobin, cytochrome C, cytochrome C oxidase, and vitamin B12. Thus, there continues to be considerable interest in employing macrocyclic metal complexes to construct low-molecular weight models for metallobiosites that mirror essential features of the coordination environment of a bound metal ion without inclusion of the surrounding protein framework. Herein, we review and appraise our research exploring the application of the metal complexes formed by two macrocyclic ligands, 1,4,7-triazacyclononane (tacn) and 1,4,7,10-tetraazacyclododecane (cyclen), and their derivatives in biological inorganic chemistry. Taking advantage of the kinetic inertness and thermodynamic stability of their metal complexes, these macrocyclic scaffolds have been employed in the development of models that aid the understanding of metal ion-binding natural systems, and complexes with potential applications in biomolecule sensing, diagnosis, and therapy. In particular, the focus has been on "coordinatively unsaturated" metal complexes that incorporate a kinetically inert and stable metal-ligand moiety, but which also contain one or more weakly bound ligands, allowing for the reversible binding of guest molecules via the formation and dissociation of coordinate bonds. With regards to mimicking metallobiosites, examples are presented from our work on tacn-based complexes developed as simplified structural models for multimetallic enzyme sites. In particular, structural comparisons are made between multinuclear copper(II) complexes formed by such ligands and multicopper enzymes featuring type-2 and type-3 copper centers, such as ascorbate oxidase (AO) and laccase (Lc). Likewise, with the aid of relevant examples, we highlight the importance of cooperativity between either multiple metal centers or a metal center and a proximal auxiliary unit appended to the macrocyclic ligand in achieving efficient phosphate ester cleavage. Finally, the critical importance of the Zn(II)-imido and Zn(II)-phosphate interactions in Zn-cyclen-based systems for delivering highly sensitive electrochemical and fluorescent chemosensors is also showcased. The Account additionally highlights some of the factors that limit the performance of these synthetic nucleases and the practical application of the biosensors, and then identifies some avenues for the development of more effective macrocyclic constructs in the future.

Excitation-Energy Transfer Paths from Tryptophans to Coordinated Copper Ions in Engineered Azurins: a Source of Observables for Monitoring Protein Structural Changes

NASA Astrophysics Data System (ADS)

Di Rocco, Giulia; Bernini, Fabrizio; Borsari, Marco; Martinelli, Ilaria; Bortolotti, Carlo Augusto; Battistuzzi, Gianantonio; Ranieri, Antonio; Caselli, Monica; Sola, Marco; Ponterini, Glauco

2016-09-01

The intrinsic fluorescence of recombinant proteins offers a powerful tool to detect and characterize structural changes induced by chemical or biological stimuli. We show that metal-ion binding to a hexahistidine tail can significantly broaden the range of such structurally sensitive fluorescence observables. Bipositive metal-ions as Cu2+, Ni2+ and Zn2+ bind 6xHis-tag azurin and its 6xHis-tagged R129W and W48A-R129W mutants with good efficiency and, thereby, quench their intrinsic fluorescence. Due to a much more favourable spectral overlap, the 6xHis-tag/Cu2+ complex(es) are the most efficient quenchers of both W48 and W129 emissions. Based on simple Förster-type dependence of energy-transfer efficiency on donor/acceptor distance, we can trace several excitation-energy transfer paths across the protein structure. Unexpected lifetime components in the azurin 6xHis-tag/Cu2+ complex emission decays reveal underneath complexity in the conformational landscape of these systems. The new tryptophan emission quenching paths provide additional signals for detecting and identifying protein structural changes.

X-ray structure of a two-domain type laccase: a missing link in the evolution of multi-copper proteins.

PubMed

Komori, Hirofumi; Miyazaki, Kentaro; Higuchi, Yoshiki

2009-04-02

A multi-copper protein with two cupredoxin-like domains was identified from our in-house metagenomic database. The recombinant protein, mgLAC, contained four copper ions/subunits, oxidized various phenolic and non-phenolic substrates, and had spectroscopic properties similar to common laccases. X-ray structure analysis revealed a homotrimeric architecture for this enzyme, which resembles nitrite reductase (NIR). However, a difference in copper coordination was found at the domain interface. mgLAC contains a T2/T3 tri-nuclear copper cluster at this site, whereas a mononuclear T2 copper occupies this position in NIR. The trimer is thus an essential part of the architecture of two-domain multi-copper proteins, and mgLAC may be an evolutionary precursor of NIR.

Terminal oxidase diversity and function in "Metallosphaera yellowstonensis": gene expression and protein modeling suggest mechanisms of Fe(II) oxidation in the sulfolobales.

PubMed

Kozubal, M A; Dlakic, M; Macur, R E; Inskeep, W P

2011-03-01

"Metallosphaera yellowstonensis" is a thermoacidophilic archaeon isolated from Yellowstone National Park that is capable of autotrophic growth using Fe(II), elemental S, or pyrite as electron donors. Analysis of the draft genome sequence from M. yellowstonensis strain MK1 revealed seven different copies of heme copper oxidases (subunit I) in a total of five different terminal oxidase complexes, including doxBCEF, foxABCDEFGHIJ, soxABC, and the soxM supercomplex, as well as a novel hypothetical two-protein doxB-like polyferredoxin complex. Other genes found in M. yellowstonensis with possible roles in S and or Fe cycling include a thiosulfate oxidase (tqoAB), a sulfite oxidase (som), a cbsA cytochrome b(558/566), several small blue copper proteins, and a novel gene sequence coding for a putative multicopper oxidase (Mco). Results from gene expression studies, including reverse transcriptase (RT) quantitative PCR (qPCR) of cultures grown autotrophically on either Fe(II), pyrite, or elemental S showed that the fox gene cluster and mco are highly expressed under conditions where Fe(II) is an electron donor. Metagenome sequence and gene expression studies of Fe-oxide mats confirmed the importance of fox genes (e.g., foxA and foxC) and mco under Fe(II)-oxidizing conditions. Protein modeling of FoxC suggests a novel lysine-lysine or lysine-arginine heme B binding domain, indicating that it is likely the cytochrome component of a heterodimer complex with foxG as a ferredoxin subunit. Analysis of mco shows that it encodes a novel multicopper blue protein with two plastocyanin type I copper domains that may play a role in the transfer of electrons within the Fox protein complex. An understanding of metabolic pathways involved in aerobic iron and sulfur oxidation in Sulfolobales has broad implications for understanding the evolution and niche diversification of these thermophiles as well as practical applications in fields such as bioleaching of trace metals from pyritic ores.

Synthesis and crystal structure determination of copper(II)-complex: In vitro DNA and HSA binding, pBR322 plasmid cleavage, cell imaging and cytotoxic studies.

PubMed

Tabassum, Sartaj; Zaki, Mehvash; Ahmad, Musheer; Afzal, Mohd; Srivastav, Saurabh; Srikrishna, Saripella; Arjmand, Farukh

2014-08-18

New Cu(II) complex 1 of indole-3-propionic acid and 1,10-phenanthroline was synthesized and characterized by analytical, spectroscopic and single crystal X-ray diffraction. In vitro DNA binding studies of 1 was performed by employing UV-vis and fluorescence spectroscopic techniques. The binding affinity towards human serum albumin (HSA) was also investigated to understand the carrier role in body system, as the time dependent HPLC experiment of 1 revealed that bonded drug with protein releases slowly in presence of DNA. Complex 1 exhibited good anti-tumor activity (GI50 values <10 μg/ml), and to elucidate the mechanism of tumor inhibition, topoisomerase I enzymatic activity was carried out and further validated by cell imaging studies which clearly showed its nuclear localization. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Binding Selectivity of Methanobactin from Methylosinus trichosporium OB3b for Copper(I), Silver(I), Zinc(II), Nickel(II), Cobalt(II), Manganese(II), Lead(II), and Iron(II)

NASA Astrophysics Data System (ADS)

McCabe, Jacob W.; Vangala, Rajpal; Angel, Laurence A.

2017-12-01

Methanobactin (Mb) from Methylosinus trichosporium OB3b is a member of a class of metal binding peptides identified in methanotrophic bacteria. Mb will selectively bind and reduce Cu(II) to Cu(I), and is thought to mediate the acquisition of the copper cofactor for the enzyme methane monooxygenase. These copper chelating properties of Mb make it potentially useful as a chelating agent for treatment of diseases where copper plays a role including Wilson's disease, cancers, and neurodegenerative diseases. Utilizing traveling wave ion mobility-mass spectrometry (TWIMS), the competition for the Mb copper binding site from Ag(I), Pb(II), Co(II), Fe(II), Mn(II), Ni(II), and Zn(II) has been determined by a series of metal ion titrations, pH titrations, and metal ion displacement titrations. The TWIMS analyses allowed for the explicit identification and quantification of all the individual Mb species present during the titrations and measured their collision cross-sections and collision-induced dissociation patterns. The results showed Ag(I) and Ni(II) could irreversibly bind to Mb and not be effectively displaced by Cu(I), whereas Ag(I) could also partially displace Cu(I) from the Mb complex. At pH ≈ 6.5, the Mb binding selectivity follows the order Ag(I)≈Cu(I)>Ni(II)≈Zn(II)>Co(II)>>Mn(II)≈Pb(II)>Fe(II), and at pH 7.5 to 10.4 the order is Ag(I)>Cu(I)>Ni(II)>Co(II)>Zn(II)>Mn(II)≈Pb(II)>Fe(II). Breakdown curves of the disulfide reduced Cu(I) and Ag(I) complexes showed a correlation existed between their relative stability and their compact folded structure indicated by their CCS. Fluorescence spectroscopy, which allowed the determination of the binding constant, compared well with the TWIMS analyses, with the exception of the Ni(II) complex. [Figure not available: see fulltext.

Binding Selectivity of Methanobactin from Methylosinus trichosporium OB3b for Copper(I), Silver(I), Zinc(II), Nickel(II), Cobalt(II), Manganese(II), Lead(II), and Iron(II).

PubMed

McCabe, Jacob W; Vangala, Rajpal; Angel, Laurence A

2017-12-01

Methanobactin (Mb) from Methylosinus trichosporium OB3b is a member of a class of metal binding peptides identified in methanotrophic bacteria. Mb will selectively bind and reduce Cu(II) to Cu(I), and is thought to mediate the acquisition of the copper cofactor for the enzyme methane monooxygenase. These copper chelating properties of Mb make it potentially useful as a chelating agent for treatment of diseases where copper plays a role including Wilson's disease, cancers, and neurodegenerative diseases. Utilizing traveling wave ion mobility-mass spectrometry (TWIMS), the competition for the Mb copper binding site from Ag(I), Pb(II), Co(II), Fe(II), Mn(II), Ni(II), and Zn(II) has been determined by a series of metal ion titrations, pH titrations, and metal ion displacement titrations. The TWIMS analyses allowed for the explicit identification and quantification of all the individual Mb species present during the titrations and measured their collision cross-sections and collision-induced dissociation patterns. The results showed Ag(I) and Ni(II) could irreversibly bind to Mb and not be effectively displaced by Cu(I), whereas Ag(I) could also partially displace Cu(I) from the Mb complex. At pH ≈ 6.5, the Mb binding selectivity follows the order Ag(I)≈Cu(I)>Ni(II)≈Zn(II)>Co(II)>Mn(II)≈Pb(II)>Fe(II), and at pH 7.5 to 10.4 the order is Ag(I)>Cu(I)>Ni(II)>Co(II)>Zn(II)>Mn(II)≈Pb(II)>Fe(II). Breakdown curves of the disulfide reduced Cu(I) and Ag(I) complexes showed a correlation existed between their relative stability and their compact folded structure indicated by their CCS. Fluorescence spectroscopy, which allowed the determination of the binding constant, compared well with the TWIMS analyses, with the exception of the Ni(II) complex. Graphical abstract ᅟ.

Metallochaperone for Cu,Zn-superoxide dismutase (CCS) protein but not mRNA is higher in organs from copper-deficient mice and rats.

PubMed

Prohaska, Joseph R; Broderius, Margaret; Brokate, Bruce

2003-09-15

Cu,Zn-superoxide dismutase (SOD1) is an abundant metalloenzyme important in scavenging superoxide ions. Cu-deficient rats and mice have lower SOD1 activity and protein, possibly because apo-SOD1 is degraded faster than holo-SOD1. SOD1 interacts with and requires its metallochaperone CCS for donating copper. We produced dietary Cu deficiency in rodents to determine if the reduction in SOD1 was related to the level of its specific metallochaperone CCS. CCS levels determined by immunoblot were 2- to 3-fold higher in liver, heart, kidney, and brain from male Cu-deficient rats and mice under a variety of conditions. CCS was also higher in livers of Cu-deficient dams. Interestingly, CCS levels in brain of Cu-deficient mice were also higher even though SOD1 activity and protein were not altered, suggesting that the rise in CCS is correlated with altered Cu status rather than a direct result of lower SOD1. A DNA probe specific for rat CCS detected a single transcript by Northern blot hybridization with liver RNA. CCS mRNA levels in mouse and rat liver were not altered by dietary treatment. These results suggest a posttranscriptional mechanism for higher CCS protein when Cu is limiting in the cell, perhaps due to slower protein turnover. Elevation in CCS level is one of the most dramatic alterations in Cu binding proteins accompanying Cu deficiency and may be useful to assess Cu status.

Substrate specificity and copper loading of the manganese-oxidizing multicopper oxidase Mnx from Bacillus sp. PL-12.

PubMed

Butterfield, Cristina N; Tebo, Bradley M

2017-02-22

Manganese(ii) oxidation in the environment is thought to be driven by bacteria because enzymatic catalysis is many orders of magnitude faster than the abiotic processes. The heterologously purified Mn oxidase (Mnx) from marine Bacillus sp. PL-12 is made up of the multicopper oxidase (MCO) MnxG and two small Cu and heme-binding proteins of unknown function, MnxE and MnxF. Mnx binds Cu and oxidizes both Mn(ii) and Mn(iii), generating Mn(iv) oxide minerals that resemble those found on the Bacillus spore surface. Spectroscopic techniques have illuminated details about the metallo-cofactors of Mnx, but very little is known about their requirement for catalytic activity, and even less is known about the substrate specificity of Mnx. Here we quantify the canonical MCO Cu and persistent peripheral Cu bound to Mnx, and test Mnx oxidizing ability toward different substrates at varying pH. Mn(ii) appears to be the best substrate in terms of k cat , but its oxidation does not follow Michaelis-Menten kinetics, instead showing a sigmoidal cooperative behavior. Mnx also oxidizes Fe(ii) substrate, but in a Michaelis-Menten manner and with a decreased activity, as well as organic substrates. The reduced metals are more rapidly consumed than the larger organic substrates, suggesting the hypothesis that the Mnx substrate site is small and tuned for metal oxidation. Of biological relevance is the result that Mnx has the highest catalytic efficiency for Mn(ii) at the pH of sea water, especially when the protein is loaded with greater than the requisite four MCO copper atoms, suggesting that the protein has evolved specifically for Mn oxidation.

Interaction of polyethyleneimine-anchored copper(II) complexes with tRNA studied by spectroscopy methods and biological activities.

PubMed

Lakshmipraba, Jagadeesan; Arunachalam, Sankaralingam; Gandi, Devadas A; Thirunalasundari, Thyagarajan; Vignesh, Sivanandham; James, Rathinam A

2017-05-01

Ultraviolet-visible, emission and circular dichroism spectroscopic methods were used in transfer RNA (tRNA) interaction studies performed for polyethyleneimine-copper(II) complexes [Cu(phen)(l-Tyr)BPEI]ClO 4 (where phen =1,10-phenanthroline, l-Tyr = l-tyrosine and BPEI = branched polyethyleneimine) with various degrees of coordination (x = 0.059, 0.149, 0.182) in the polymer chain. The results indicated that polyethyleneimine-copper(II) complexes bind with tRNA mostly through surface binding, although other binding modes, such as hydrogen bonding and van der Waals interactions, might also be present. Dye-exclusion, sulforhodamine B and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assays of a polyethyleneimine-copper(II) complex with a higher degree of coordination against different cancer cell lines proved that the complex exhibited cytotoxic specificity and a significant cancer cell inhibition rate. Antimicrobial screening showed activity against some human pathogens. Copyright © 2016 John Wiley & Sons, Ltd.

Copper binding affinity of the C2B domain of synaptotagmin-1 and its potential role in the nonclassical secretion of Acidic Fibroblast Growth Factor

PubMed Central

Jayanthi, Srinivas; Kathir, Karuppanan Muthusamy; Rajalingam, Dakshinamurthy; Furr, Mercede; Daily, Anna; Thurman, Ryan; Rutherford, Lindsay; Chandrashekar, Reena; Adams, Paul; Prudovsky, Igor; Suresh Kumar, Thallapuranam Krishnaswamy

2014-01-01

Fibroblast growth factor 1 (FGF1) is a heparin-binding proangiogenic protein. FGF1 lacks the conventional N-terminal signal peptide required for secretion through the endoplasmic reticulum (ER) -Golgi secretory pathway. FGF1 is released through a Cu2+ - mediated nonclassical secretion pathway. The secretion of FGF1 involves the formation of a Cu2+- mediated multiprotein release complex (MRC) including FGF1, S100A13 (a calcium-binding protein) and p40 synaptotagmin (Syt1). It is believed that binding of Cu2+ to the C2B domain is important for the release of FGF1 in to the extracellular medium. In this study, using a variety of biophysical studies, Cu2+ and lipid interactions of the C2B domain of Syt1were characterized. Isothermal titration calorimetry (ITC) experiments reveal that C2B domain binds to Cu2+ in a biphasic manner involving an initial endothermic and a subsequent exothermic phase. Fluorescence energy transfer experiments using Tb3+ show that there are two Cu2+- binding pockets on the C2B domain, and one of these is also a Ca2+- binding site. Lipid-binding studies using ITC demonstrate that the C2B domain preferentially binds to small unilamellar vesicles of phosphatidyl serine (PS). Results of the differential scanning calorimetry and limited trypsin digestion experiments suggest that C2B domain is marginally destabilized upon binding to PS vesicles. These results, for the first time, suggest that the main role of the C2B domain of Syt1 is to serve as an anchor for the FGF1 MRC on the membrane bilayer. In addition, binding of the C2B domain to the lipid bilayer is shown to significantly decrease the binding affinity of the protein to Cu2+. The study provides valuable insights on the sequence of structural events that occur in the nonclassical secretion of FGF1. PMID:25224745

The Phylogeny and Active Site Design of Eukaryotic Copper-only Superoxide Dismutases*

PubMed Central

Peterson, Ryan L.; Galaleldeen, Ahmad; Villarreal, Johanna; Taylor, Alexander B.; Cabelli, Diane E.; Hart, P. John; Culotta, Valeria C.

2016-01-01

In eukaryotes the bimetallic Cu/Zn superoxide dismutase (SOD) enzymes play important roles in the biology of reactive oxygen species by disproportionating superoxide anion. Recently, we reported that the fungal pathogen Candida albicans expresses a novel copper-only SOD, known as SOD5, that lacks the zinc cofactor and electrostatic loop (ESL) domain of Cu/Zn-SODs for substrate guidance. Despite these abnormalities, C. albicans SOD5 can disproportionate superoxide at rates limited only by diffusion. Here we demonstrate that this curious copper-only SOD occurs throughout the fungal kingdom as well as in phylogenetically distant oomycetes or “pseudofungi” species. It is the only form of extracellular SOD in fungi and oomycetes, in stark contrast to the extracellular Cu/Zn-SODs of plants and animals. Through structural biology and biochemical approaches we demonstrate that these copper-only SODs have evolved with a specialized active site consisting of two highly conserved residues equivalent to SOD5 Glu-110 and Asp-113. The equivalent positions are zinc binding ligands in Cu/Zn-SODs and have evolved in copper-only SODs to control catalysis and copper binding in lieu of zinc and the ESL. Similar to the zinc ion in Cu/Zn-SODs, SOD5 Glu-110 helps orient a key copper-coordinating histidine and extends the pH range of enzyme catalysis. SOD5 Asp-113 connects to the active site in a manner similar to that of the ESL in Cu/Zn-SODs and assists in copper cofactor binding. Copper-only SODs are virulence factors for certain fungal pathogens; thus this unique active site may be a target for future anti-fungal strategies. PMID:27535222

The Phylogeny and Active Site Design of Eukaryotic Copper-only Superoxide Dismutases

DOE PAGES

Peterson, Ryan L.; Galaleldeen, Ahmad; Villarreal, Johanna; ...

2016-08-17

In eukaryotes the bimetallic Cu/Zn superoxide dismutase (SOD) enzymes play important roles in the biology of reactive oxygen species by disproportionating superoxide anion. We reported that the fungal pathogen Candida albicans expresses a novel copper-only SOD, known as SOD5, that lacks the zinc cofactor and electrostatic loop (ESL) domain of Cu/Zn-SODs for substrate guidance. In spite of these abnormalities, C. albicans SOD5 can disproportionate superoxide at rates limited only by diffusion. Here we demonstrate that this curious copper-only SOD occurs throughout the fungal kingdom as well as in phylogenetically distant oomycetes or “pseudofungi” species. It is the only form ofmore » extracellular SOD in fungi and oomycetes, in stark contrast to the extracellular Cu/Zn-SODs of plants and animals. Through structural biology and biochemical approaches we demonstrate that these copper-only SODs have evolved with a specialized active site consisting of two highly conserved residues equivalent to SOD5 Glu-110 and Asp-113. The equivalent positions are zinc binding ligands in Cu/Zn-SODs and have evolved in copper-only SODs to control catalysis and copper binding in lieu of zinc and the ESL. Similar to the zinc ion in Cu/Zn-SODs, SOD5 Glu-110 helps orient a key copper-coordinating histidine and extends the pH range of enzyme catalysis. Furthermore, SOD5 Asp-113 connects to the active site in a manner similar to that of the ESL in Cu/Zn-SODs and assists in copper cofactor binding. Copper-only SODs are virulence factors for certain fungal pathogens; thus this unique active site may be a target for future anti-fungal strategies.« less

Control of copper resistance and inorganic sulfur metabolism by paralogous regulators in Staphylococcus aureus.

PubMed

Grossoehme, Nicholas; Kehl-Fie, Thomas E; Ma, Zhen; Adams, Keith W; Cowart, Darin M; Scott, Robert A; Skaar, Eric P; Giedroc, David P

2011-04-15

All strains of Staphylococcus aureus encode a putative copper-sensitive operon repressor (CsoR) and one other CsoR-like protein of unknown function. We show here that NWMN_1991 encodes a bona fide Cu(I)-inducible CsoR of a genetically unlinked copA-copZ copper resistance operon in S. aureus strain Newman. In contrast, an unannotated open reading frame found between NWMN_0027 and NWMN_0026 (denoted NWMN_0026.5) encodes a CsoR-like regulator that represses expression of adjacent genes by binding specifically to a pair of canonical operator sites positioned in the NWMN_0027-0026.5 intergenic region. Inspection of these regulated genes suggests a role in assimilation of inorganic sulfur from thiosulfate and vectorial sulfur transfer, and we designate NWMN_0026.5 as CstR (CsoR-like sulfur transferase repressor). Expression analysis demonstrates that CsoR and CstR control their respective regulons in response to distinct stimuli with no overlap in vivo. Unlike CsoR, CstR does not form a stable complex with Cu(I); operator binding is instead inhibited by oxidation of the intersubunit cysteine pair to a mixture of disulfide and trisulfide linkages by a likely metabolite of thiosulfate assimilation, sulfite. CsoR is unreactive toward sulfite under the same conditions. We conclude that CsoR and CstR are paralogs in S. aureus that function in the same cytoplasm to control distinct physiological processes.

Control of Copper Resistance and Inorganic Sulfur Metabolism by Paralogous Regulators in Staphylococcus aureus*

PubMed Central

Grossoehme, Nicholas; Kehl-Fie, Thomas E.; Ma, Zhen; Adams, Keith W.; Cowart, Darin M.; Scott, Robert A.; Skaar, Eric P.; Giedroc, David P.

2011-01-01

All strains of Staphylococcus aureus encode a putative copper-sensitive operon repressor (CsoR) and one other CsoR-like protein of unknown function. We show here that NWMN_1991 encodes a bona fide Cu(I)-inducible CsoR of a genetically unlinked copA-copZ copper resistance operon in S. aureus strain Newman. In contrast, an unannotated open reading frame found between NWMN_0027 and NWMN_0026 (denoted NWMN_0026.5) encodes a CsoR-like regulator that represses expression of adjacent genes by binding specifically to a pair of canonical operator sites positioned in the NWMN_0027–0026.5 intergenic region. Inspection of these regulated genes suggests a role in assimilation of inorganic sulfur from thiosulfate and vectorial sulfur transfer, and we designate NWMN_0026.5 as CstR (CsoR-like sulfur transferase repressor). Expression analysis demonstrates that CsoR and CstR control their respective regulons in response to distinct stimuli with no overlap in vivo. Unlike CsoR, CstR does not form a stable complex with Cu(I); operator binding is instead inhibited by oxidation of the intersubunit cysteine pair to a mixture of disulfide and trisulfide linkages by a likely metabolite of thiosulfate assimilation, sulfite. CsoR is unreactive toward sulfite under the same conditions. We conclude that CsoR and CstR are paralogs in S. aureus that function in the same cytoplasm to control distinct physiological processes. PMID:21339296

Digestive kinetics determines bioavailability of pollutants. Final report, 1 June 1993--30 September 1998

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jumars, P.A.; Mayer, L.M.

1999-04-19

The authors assayed digestive capabilities of marine deposit feeders (animals that eat sediments) by using fluorescently tagged substrates and contact-angle measurements of surfactancy. Polychaetes on average showed higher enzyme activities and surfactancy than echinoderms. They found that surfactants produced by deposit feeders substantially enhance their abilities to solubilize hydrophobic pollutants such as polycyclic aromatic hydrocarbons (PAHs). Amounts solubilized were consistent with incorporation into micelles of the surfactant. Kinetics of PAH uptake could be explained by passive diffusion. The authors also found that the digestive strategies of deposit feeders often produce concentrations of proteins (digestive enzymes plus products of protein digestion)more » that are sufficient to solubilize metals. Histidine residues in these proteins were found to be critical for copper binding.« less

A cadmium-transporting P1B-type ATPase in yeast Saccharomyces cerevisiae.

PubMed

Adle, David J; Sinani, Devis; Kim, Heejeong; Lee, Jaekwon

2007-01-12

Detoxification and homeostatic acquisition of metal ions are vital for all living organisms. We have identified PCA1 in yeast Saccharomyces cerevisiae as an overexpression suppressor of copper toxicity. PCA1 possesses signatures of a P1B-type heavy metal-transporting ATPase that is widely distributed from bacteria to humans. Copper resistance conferred by PCA1 is not dependent on catalytic activity, but it appears that a cysteine-rich region located in the N terminus sequesters copper. Unexpectedly, when compared with two independent natural isolates and an industrial S. cerevisiae strain, the PCA1 allele of the common laboratory strains we have examined possesses a missense mutation in a predicted ATP-binding residue conserved in P1B-type ATPases. Consistent with a previous report that identifies an equivalent mutation in a copper-transporting P1B-type ATPase of a Wilson disease patient, the PCA1 allele found in laboratory yeast strains is nonfunctional. Overexpression or deletion of the functional allele in yeast demonstrates that PCA1 is a cadmium efflux pump. Cadmium as well as copper and silver, but not other metals examined, dramatically increase PCA1 protein expression through post-transcriptional regulation and promote subcellular localization to the plasma membrane. Our study has revealed a novel metal detoxification mechanism in yeast mediated by a P1B-type ATPase that is unique in structure, substrate specificity, and mode of regulation.

Acute phase response and plasma carotenoid concentrations in older women: findings from the nun study.

PubMed

Boosalis, M G; Snowdon, D A; Tully, C L; Gross, M D

1996-01-01

This cross-sectional study investigated whether the acute phase response was associated with suppressed circulating levels of antioxidants in a population of 85 Catholic sisters (nuns) ages 77-99 y. Fasting blood was drawn to determine the presence of an acute phase response, as defined by an elevation in the serum concentration of C-reactive protein. Serum concentrations of albumin, thyroxine-binding prealbumin, zinc, copper, and fibrinogen were determined as were plasma concentrations of carotenoids and alpha tocopherol. Results showed that the presence of an acute phase response was associated with (1) an expected significant decrease in the serum concentrations of albumin (p < 0.001) and thyroxine-binding prealbumin (p < 0.001); (2) an expected significant increase in copper (p < 0.001) and fibrinogen (p = 0.003); and (3) a significant decrease in the plasma concentrations of lycopene (p = 0.03), alpha carotene (p = 0.02), beta carotene (p = 0.02), and total carotenoids (p = 0.01). The acute phase response was associated with decreased plasma levels of the antioxidants lycopene, alpha carotene, and beta carotene. This decrease in circulating antioxidants may further compromise antioxidant status and increase oxidative stress and damage in elders.

Mechanism of Copper Uptake from Blood Plasma Ceruloplasmin by Mammalian Cells

PubMed Central

Ramos, Danny; Vargas, Rebecca; Gaite, Michaella; Montgomery, Aaron; Linder, Maria C.

2016-01-01

Ceruloplasmin, the main copper binding protein in blood plasma, has been of particular interest for its role in efflux of iron from cells, but has additional functions. Here we tested the hypothesis that it releases its copper for cell uptake by interacting with a cell surface reductase and transporters, producing apoceruloplasmin. Uptake and transepithelial transport of copper from ceruloplasmin was demonstrated with mammary epithelial cell monolayers (PMC42) with tight junctions grown in bicameral chambers, and purified human 64Cu-labeled ceruloplasmin secreted by HepG2 cells. Monolayers took up virtually all the 64Cu over 16h and secreted half into the apical (milk) fluid. This was partly inhibited by Ag(I). The 64Cu in ceruloplasmin purified from plasma of 64Cu-injected mice accumulated linearly in mouse embryonic fibroblasts (MEFs) over 3-6h. Rates were somewhat higher in Ctr1+/+ versus Ctr1-/- cells, and 3-fold lower at 2°C. The ceruloplasmin-derived 64Cu could not be removed by extensive washing or trypsin treatment, and most was recovered in the cytosol. Actual cell copper (determined by furnace atomic absorption) increased markedly upon 24h exposure to holoceruloplasmin. This was accompanied by a conversion of holo to apoceruloplasmin in the culture medium and did not occur during incubation in the absence of cells. Four different endocytosis inhibitors failed to prevent 64Cu uptake from ceruloplasmin. High concentrations of non-radioactive Cu(II)- or Fe(III)-NTA (substrates for cell surface reductases), or Cu(I)-NTA (to compete for transporter uptake) almost eliminated uptake of 64Cu from ceruloplasmin. MEFs had cell surface reductase activity and expressed Steap 2 (but not Steaps 3 and 4 or dCytB). However, six-day siRNA treatment was insufficient to reduce activity or uptake. We conclude that ceruloplasmin is a circulating copper transport protein that may interact with Steap2 on the cell surface, forming apoceruloplasmin, and Cu(I) that enters cells through CTR1 and an unknown copper uptake transporter. PMID:26934375

Evaluation of Cu(i) binding to the E2 domain of the amyloid precursor protein - a lesson in quantification of metal binding to proteins via ligand competition.

PubMed

Young, Tessa R; Wedd, Anthony G; Xiao, Zhiguang

2018-01-24

The extracellular domain E2 of the amyloid precursor protein (APP) features a His-rich metal-binding site (denoted as the M1 site). In conjunction with surrounding basic residues, the site participates in interactions with components of the extracellular matrix including heparins, a class of negatively charged polysaccharide molecules of varying length. This work studied the chemistry of Cu(i) binding to APP E2 with the probe ligands Bcs, Bca, Fz and Fs. APP E2 forms a stable Cu(i)-mediated ternary complex with each of these anionic ligands. The complex with Bca was selected for isolation and characterization and was demonstrated, by native ESI-MS analysis, to have the stoichiometry E2 : Cu(i) : Bca = 1 : 1 : 1. Formation of these ternary complexes is specific for the APP E2 domain and requires Cu(i) coordination to the M1 site. Mutation of the M1 site was consistent with the His ligands being part of the E2 ligand set. It is likely that interactions between the negatively charged probe ligands and a positively charged patch on the surface of APP E2 are one aspect of the generation of the stable ternary complexes. Their formation prevented meaningful quantification of the affinity of Cu(i) binding to the M1 site with these probe ligands. However, the ternary complexes are disrupted by heparin, allowing reliable determination of a picomolar Cu(i) affinity for the E2/heparin complex with the Fz or Bca probe ligands. This is the first documented example of the formation of stable ternary complexes between a Cu(i) binding protein and a probe ligand. The ready disruption of the complexes by heparin identified clear 'tell-tale' signs for diagnosis of ternary complex formation and allowed a systematic review of conditions and criteria for reliable determination of affinities for metal binding via ligand competition. This study also provides new insights into a potential correlation of APP functions regulated by copper binding and heparin interaction.

Characterization and structure prediction of partial length protein sequences of pcoA, pcoR and chrB genes from heavy metal resistant bacteria from the Klip River, South Africa.

PubMed

Chihomvu, Patience; Stegmann, Peter; Pillay, Michael

2015-04-01

The Klip River has suffered from severe anthropogenic effects from industrial activities such as mining. Long-term exposure to heavy metal pollution has led to the development of heavy metal resistant strains of Pseudomonas sp. KR23, Lysinibacillus sp. KR25, and E. coli KR29. The objectives of this study were to characterize the genetics of copper and chromate resistance of the isolates. Copper and chromate resistance determinants were cloned and sequenced. Open reading frames (ORFs) related to the genes CopA and CopR were identified in E. coli KR29, PcoA in Lysinibacillus sp. KR25 and none related to chromate resistance were detected. The 3D-models predicted by I-TASSER disclose that the PcoA proteins consist of β-sheets, which form a part of the cupredoxin domain of the CopA copper resistance family of genes. The model for PcoR_29 revealed the presence of a helix turn helix; this forms part of a DNA binding protein, which is part of a heavy metal transcriptional regulator. The bacterial strains were cured using ethidium bromide. The genes encoding for heavy metal resistance and antibiotic resistance were found to be located on the chromosome for both Pseudomonas sp. (KR23) and E. coli (KR29). For Lysinibacillus (KR25) the heavy metal resistance determinants are suspected to be located on a mobile genetic element, which was not detected using gel electrophoresis.

Characterization and Structure Prediction of Partial Length Protein Sequences of pcoA, pcoR and chrB Genes from Heavy Metal Resistant Bacteria from the Klip River, South Africa

PubMed Central

Chihomvu, Patience; Stegmann, Peter; Pillay, Michael

2015-01-01

The Klip River has suffered from severe anthropogenic effects from industrial activities such as mining. Long-term exposure to heavy metal pollution has led to the development of heavy metal resistant strains of Pseudomonas sp. KR23, Lysinibacillus sp. KR25, and E. coli KR29. The objectives of this study were to characterize the genetics of copper and chromate resistance of the isolates. Copper and chromate resistance determinants were cloned and sequenced. Open reading frames (ORFs) related to the genes CopA and CopR were identified in E. coli KR29, PcoA in Lysinibacillus sp. KR25 and none related to chromate resistance were detected. The 3D-models predicted by I-TASSER disclose that the PcoA proteins consist of β-sheets, which form a part of the cupredoxin domain of the CopA copper resistance family of genes. The model for PcoR_29 revealed the presence of a helix turn helix; this forms part of a DNA binding protein, which is part of a heavy metal transcriptional regulator. The bacterial strains were cured using ethidium bromide. The genes encoding for heavy metal resistance and antibiotic resistance were found to be located on the chromosome for both Pseudomonas sp. (KR23) and E. coli (KR29). For Lysinibacillus (KR25) the heavy metal resistance determinants are suspected to be located on a mobile genetic element, which was not detected using gel electrophoresis. PMID:25837632

ESI-MS measurements for the equilibrium constants of copper(II)-insulin complexes.

PubMed

Gülfen, Mustafa; Özdemir, Abdil; Lin, Jung-Lee; Chen, Chung-Hsuan

2018-06-01

Trace elements regulate many biological reactions in the body. Copper(II) is known as one of trace elements and capable of binding to proteins. Insulin is a blood glucose-lowering peptide hormone and it is secreted by the pancreatic β-cells. In this study, Cu(II)-insulin complexes were investigated by using ESI-MS method. Insulin molecule gives ESI-MS peaks at +4, +5, +6 and +7 charged states. Cu(II)-insulin complexes can be monitored and quantified on the ESI-MS spectra as the shifted peaks according to insulin peaks. The solutions of Cu(II)-insulin complexes at different pHs and mole ratios of Cu(II) ions to insulin molecule were measured on the ESI-MS. The highest complex formation ratio for Cu(II)-insulin were found at pH 7. The multiple bindings of Cu(II) ions to insulin molecule was observed. The formation equilibrium constants of Cu(II)-insulin complexes were calculated as Kf 1 : 3.34 × 10 4 , Kf 2 : 2.99 × 10 4 , Kf 3 : 7.00 × 10 3 and Kf 4 :2.86 × 10 3 . The specific binding property of Cu(II) ions was controlled by using different spray ion sources including electrospray and nano-electrospray. The binding property of Cu(II) also investigated by MS/MS fragmentation. It was concluded from the ESI-MS measurements that Cu(II) ion has a high affinity to insulin molecules to form stable complexes. Copyright © 2018 Elsevier B.V. All rights reserved.

Recognition- and Reactivity-Based Fluorescent Probes for Studying Transition Metal Signaling in Living Systems

PubMed Central

2015-01-01

Conspectus Metals are essential for life, playing critical roles in all aspects of the central dogma of biology (e.g., the transcription and translation of nucleic acids and synthesis of proteins). Redox-inactive alkali, alkaline earth, and transition metals such as sodium, potassium, calcium, and zinc are widely recognized as dynamic signals, whereas redox-active transition metals such as copper and iron are traditionally thought of as sequestered by protein ligands, including as static enzyme cofactors, in part because of their potential to trigger oxidative stress and damage via Fenton chemistry. Metals in biology can be broadly categorized into two pools: static and labile. In the former, proteins and other macromolecules tightly bind metals; in the latter, metals are bound relatively weakly to cellular ligands, including proteins and low molecular weight ligands. Fluorescent probes can be useful tools for studying the roles of transition metals in their labile forms. Probes for imaging transition metal dynamics in living systems must meet several stringent criteria. In addition to exhibiting desirable photophysical properties and biocompatibility, they must be selective and show a fluorescence turn-on response to the metal of interest. To meet this challenge, we have pursued two general strategies for metal detection, termed “recognition” and “reactivity”. Our design of transition metal probes makes use of a recognition-based approach for copper and nickel and a reactivity-based approach for cobalt and iron. This Account summarizes progress in our laboratory on both the development and application of fluorescent probes to identify and study the signaling roles of transition metals in biology. In conjunction with complementary methods for direct metal detection and genetic and/or pharmacological manipulations, fluorescent probes for transition metals have helped reveal a number of principles underlying transition metal dynamics. In this Account, we give three recent examples from our laboratory and collaborations in which applications of chemical probes reveal that labile copper contributes to various physiologies. The first example shows that copper is an endogenous regulator of neuronal activity, the second illustrates cellular prioritization of mitochondrial copper homeostasis, and the third identifies the “cuprosome” as a new copper storage compartment in Chlamydomonas reinhardtii green algae. Indeed, recognition- and reactivity-based fluorescent probes have helped to uncover new biological roles for labile transition metals, and the further development of fluorescent probes, including ones with varied Kd values and new reaction triggers and recognition receptors, will continue to reveal exciting and new biological roles for labile transition metals. PMID:26215055

Recognition- and reactivity-based fluorescent probes for studying transition metal signaling in living systems.

PubMed

Aron, Allegra T; Ramos-Torres, Karla M; Cotruvo, Joseph A; Chang, Christopher J

2015-08-18

Metals are essential for life, playing critical roles in all aspects of the central dogma of biology (e.g., the transcription and translation of nucleic acids and synthesis of proteins). Redox-inactive alkali, alkaline earth, and transition metals such as sodium, potassium, calcium, and zinc are widely recognized as dynamic signals, whereas redox-active transition metals such as copper and iron are traditionally thought of as sequestered by protein ligands, including as static enzyme cofactors, in part because of their potential to trigger oxidative stress and damage via Fenton chemistry. Metals in biology can be broadly categorized into two pools: static and labile. In the former, proteins and other macromolecules tightly bind metals; in the latter, metals are bound relatively weakly to cellular ligands, including proteins and low molecular weight ligands. Fluorescent probes can be useful tools for studying the roles of transition metals in their labile forms. Probes for imaging transition metal dynamics in living systems must meet several stringent criteria. In addition to exhibiting desirable photophysical properties and biocompatibility, they must be selective and show a fluorescence turn-on response to the metal of interest. To meet this challenge, we have pursued two general strategies for metal detection, termed "recognition" and "reactivity". Our design of transition metal probes makes use of a recognition-based approach for copper and nickel and a reactivity-based approach for cobalt and iron. This Account summarizes progress in our laboratory on both the development and application of fluorescent probes to identify and study the signaling roles of transition metals in biology. In conjunction with complementary methods for direct metal detection and genetic and/or pharmacological manipulations, fluorescent probes for transition metals have helped reveal a number of principles underlying transition metal dynamics. In this Account, we give three recent examples from our laboratory and collaborations in which applications of chemical probes reveal that labile copper contributes to various physiologies. The first example shows that copper is an endogenous regulator of neuronal activity, the second illustrates cellular prioritization of mitochondrial copper homeostasis, and the third identifies the "cuprosome" as a new copper storage compartment in Chlamydomonas reinhardtii green algae. Indeed, recognition- and reactivity-based fluorescent probes have helped to uncover new biological roles for labile transition metals, and the further development of fluorescent probes, including ones with varied Kd values and new reaction triggers and recognition receptors, will continue to reveal exciting and new biological roles for labile transition metals.

Response to copper of Acidithiobacillus ferrooxidans ATCC 23270 grown in elemental sulfur.

PubMed

Almárcegui, Rodrigo J; Navarro, Claudio A; Paradela, Alberto; Albar, Juan Pablo; von Bernath, Diego; Jerez, Carlos A

2014-11-01

The response of Acidithiobacillus ferrooxidans ATCC 23270 to copper was analyzed in sulfur-grown cells by using quantitative proteomics. Forty-seven proteins showed altered levels in cells grown in the presence of 50 mM copper sulfate. Of these proteins, 24 were up-regulated and 23 down-regulated. As seen before in ferrous iron-grown cells, there was a notorious up-regulation of RND-type Cus systems and different RND-type efflux pumps, indicating that these proteins are very important in copper resistance. Copper also triggered the down-regulation of the major outer membrane porin of A. ferrooxidans in sulfur-grown bacteria, suggesting they respond to the metal by decreasing the influx of cations into the cell. On the contrary, copper in sulfur-grown cells caused an overexpression of putative TadA and TadB proteins known to be essential for biofilm formation in bacteria. Surprisingly, sulfur-grown microorganisms showed increased levels of proteins related with energy generation (rus and petII operons) in the presence of copper. Although rus operon is overexpressed mainly in cells grown in ferrous iron, the up-regulation of rusticyanin in sulfur indicates a possible role for this protein in copper resistance as well. Finally, copper response in A. ferrooxidans appears to be influenced by the substrate being oxidized by the microorganism. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Characterization of binding site heterogeneity for copper within dissolved organic matter fractions using two-dimensional correlation fluorescence spectroscopy.

PubMed

Hur, Jin; Lee, Bo-Mi

2011-06-01

The heterogeneity of copper binding characteristics for dissolved organic matter (DOM) fractions was investigated based on the fluorescence quenching of the synchronous fluorescence spectra upon the addition of copper and two-dimensional correlation spectroscopy (2D-COS). Hydrophobic acid (HoA) and hydrophilic (Hi) fractions of two different DOM (algal and leaf litter DOM) were used for this study. For both DOM, fluorescence quenching occurred at a wider range of wavelengths for the HoA fractions compared to the Hi fractions. The combined information of the synchronous and asynchronous maps derived from 2D-COS provided a clear picture of the heterogeneous distribution of the copper binding sites within each DOM fraction, which was not readily recognized by a simple comparison of the changes in the synchronous fluorescence spectra upon the addition of copper. For the algal DOM, higher stability constants were exhibited for the HoA versus the Hi fractions. The logarithms of the stability constants ranged from 4.8 to 6.1 and from 4.5 to 5.0 for the HoA and the Hi fractions of the algal DOM, respectively, depending on the associated wavelength and the fitted models. In contrast, no distinctive difference in the binding characteristics was found between the two fractions of the leaf litter DOM. This suggests that influences of the structural and chemical properties of DOM on copper binding may differ for DOM from different sources. The relative difference of the calculated stability constants within the DOM fractions were consistent with the sequential orders interpreted from the asynchronous 2D-COS. It is expected that 2D-COS will be widely applied to other DOM studies requiring detailed information on the heterogeneous nature and subsequent effects under a range of environmental conditions. Copyright © 2011 Elsevier Ltd. All rights reserved.

Engineering nanomaterials with a combined electrochemical and molecular biomimetic approach

NASA Astrophysics Data System (ADS)

Dai, Haixia

Biocomposite materials, such as bones, teeth, and shells, are created using mild aqueous solution-based processes near room temperature. Proteins add flexibility to these processes by facilitating the nucleation, growth, and ordering of specific inorganic materials into hierarchical structures. We aim to develop a biomimetic strategy for engineering technologically relevant inorganic materials with controlled compositions and structures, as Nature does, using proteins to orchestrate material formation and assembly. This approach involves three basic steps: (i) preparation of inorganic substrates compatible with combinatorial polypeptide screening; (ii) identification of inorganic-binding polypeptides and their engineering into inorganic-binding proteins; and (iii) protein-mediated inorganic nucleation and organization. Cuprous oxide (Cu2O), a p-type semiconductor, has been used to demonstrate all three steps. Zinc oxide (ZnO), an n-type semiconductor, has been used to show the generality of selected steps. Step (i), preparation of high quality inorganic substrates to select inorganic-binding polypeptides, was accomplished using electrochemical microfabrication to grow and pattern Cu2O and ZnO. Raman spectroscopy and x-ray photoelectron spectroscopy were used to verify phase purity and compositional stability of these surfaces during polypeptide screening. Step (ii), accomplished in collaboration with personnel in Prof Baneyx' lab at the University of Washington, involved incubating the inorganic substrates with the FliTrx(TM) random peptide library to identify cysteine-constrained dodecapeptides that bind the targeted inorganic. Insertion of a Cu2O-binding dodecapeptide into the DNA-binding protein TraI endowed the engineered TraI with strong affinity for Cu2O (Kd ≈ 10 -8 M). Finally, step (iii) involved nonequilibrium synthesis and organization of Cu2O nanoparticles, taking advantage of the inorganic and DNA recognition properties of the engineered TraI. The high affinity of the engineered TraI for Cu2O over other related copper compounds led to the formation of Cu2O nanoparticles from a cuprous chloride complex (Cu2Cln1-n, n = 2 or 3) electrolyte under conditions where the mineral atacamite (CuCl(OH) 3) is thermodynamically preferred. The nonequilibrium Cu 2O nanoparticles consisted of 2--3 nm Cu2O cores and functional protein shells that enabled predictable meso-scale assembly on DNA templates. In short, we have rationally designed a protein-based scheme for forming and organizing inorganic materials that Nature has not previous worked with.

A [Cu]rious Ribosomal Profiling Pattern Leads to the Discovery of Ribosomal Frameshifting in the Synthesis of a Copper Chaperone.

PubMed

Atkins, John F; Loughran, Gary; Baranov, Pavel V

2017-01-19

In many bacteria, separate genes encode a copper binding chaperone and a copper efflux pump, but in some the chaperone encoding gene has been elusive. In this issue of Molecular Cell, Meydan et al. (2017) report that ribosomes translating the ORF that encodes the copper pump frequently frameshift and terminate to produce the copper chaperone. Copyright © 2017 Elsevier Inc. All rights reserved.

Serum ceruloplasmin protein expression and activity increases in iron-deficient rats and is further enhanced by higher dietary copper intake

PubMed Central

Ranganathan, Perungavur N.; Lu, Yan; Jiang, Lingli; Kim, Changae

2011-01-01

Increases in serum and liver copper content are noted during iron deficiency in mammals, suggesting that copper-dependent processes participate during iron deprivation. One point of intersection between the 2 metals is the liver-derived, multicopper ferroxidase ceruloplasmin (Cp) that is important for iron release from certain tissues. The current study sought to explore Cp expression and activity during physiologic states in which hepatic copper loading occurs (eg, iron deficiency). Weanling rats were fed control or low iron diets containing low, normal, or high copper for ∼ 5 weeks, and parameters of iron homeostasis were measured. Liver copper increased in control and iron-deficient rats fed extra copper. Hepatic Cp mRNA levels did not change; however, serum Cp protein was higher during iron deprivation and with higher copper consumption. In-gel and spectrophotometric ferroxidase and amine oxidase assays demonstrated that Cp activity was enhanced when hepatic copper loading occurred. Interestingly, liver copper levels strongly correlated with Cp protein expression and activity. These observations support the possibility that liver copper loading increases metallation of the Cp protein, leading to increased production of the holo enzyme. Moreover, this phenomenon may play an important role in the compensatory response to maintain iron homeostasis during iron deficiency. PMID:21768302

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peterson, Ryan L.; Galaleldeen, Ahmad; Villarreal, Johanna

In eukaryotes the bimetallic Cu/Zn superoxide dismutase (SOD) enzymes play important roles in the biology of reactive oxygen species by disproportionating superoxide anion. We reported that the fungal pathogen Candida albicans expresses a novel copper-only SOD, known as SOD5, that lacks the zinc cofactor and electrostatic loop (ESL) domain of Cu/Zn-SODs for substrate guidance. In spite of these abnormalities, C. albicans SOD5 can disproportionate superoxide at rates limited only by diffusion. Here we demonstrate that this curious copper-only SOD occurs throughout the fungal kingdom as well as in phylogenetically distant oomycetes or “pseudofungi” species. It is the only form ofmore » extracellular SOD in fungi and oomycetes, in stark contrast to the extracellular Cu/Zn-SODs of plants and animals. Through structural biology and biochemical approaches we demonstrate that these copper-only SODs have evolved with a specialized active site consisting of two highly conserved residues equivalent to SOD5 Glu-110 and Asp-113. The equivalent positions are zinc binding ligands in Cu/Zn-SODs and have evolved in copper-only SODs to control catalysis and copper binding in lieu of zinc and the ESL. Similar to the zinc ion in Cu/Zn-SODs, SOD5 Glu-110 helps orient a key copper-coordinating histidine and extends the pH range of enzyme catalysis. Furthermore, SOD5 Asp-113 connects to the active site in a manner similar to that of the ESL in Cu/Zn-SODs and assists in copper cofactor binding. Copper-only SODs are virulence factors for certain fungal pathogens; thus this unique active site may be a target for future anti-fungal strategies.« less

Pulse-radiolysis studies on the interaction of one-electron reduced species with blue oxidases. Reduction of type-2-copper-depleted ascorbate oxidase.

PubMed

O'Neill, P; Fielden, E M; Avigliano, L; Marcozzi, G; Ballini, A; Agrò, F

1984-08-15

The interaction of one-electron reduced metronidazole (ArNO2.-) with native and Type-2-copper-depleted ascorbate oxidase were studied in buffered aqueous solution at pH 6.0 and 7.4 by using the technique of pulse radiolysis. With ArNO2.-, reduction of Type 1 copper of the native enzyme and of the Type-2-copper-depleted ascorbate oxidase occurs via a bimolecular step and at the same rate. Whereas the native protein accepts, in the absence of O2, 6-7 reducing equivalents, Type-2-copper-depleted ascorbate oxidase accepts only 3 reducing equivalents with stoichiometric reduction of Type 1 copper. On reaction of O2.- with ascorbate oxidase under conditions of [O2.-] much greater than [ascorbate oxidase], removal of Type 2 copper results in reduction of all the Type 1 copper atoms, in contrast with reduction of the equivalent of only one Type 1 copper atom in the holoprotein. From observations at 610 nm, the rate of reduction of ascorbate oxidase by O2.- is not dependent on the presence of Type 2 copper. For the holoprotein, no significant optical-absorption changes were observed at 330 nm. It is proposed that electrons enter the protein via Type 1 copper in a rate-determining step followed by a fast intramolecular transfer of electrons within the protein. For the Type-2-copper-depleted protein, intramolecular transfer within the protein, however, is slow or does not occur. In the presence of O2, it is also suggested that re-oxidation of the partially reduced holoprotein occurs at steady state, as inferred from the observations at 330 nm and 610 nm. The role of Type 2 copper in ascorbate oxidase is discussed in terms of its involvement in redistribution of electrons within the protein or structural considerations.

Meta-omic signatures of microbial metal and nitrogen cycling in marine oxygen minimum zones

PubMed Central

Glass, Jennifer B.; Kretz, Cecilia B.; Ganesh, Sangita; Ranjan, Piyush; Seston, Sherry L.; Buck, Kristen N.; Landing, William M.; Morton, Peter L.; Moffett, James W.; Giovannoni, Stephen J.; Vergin, Kevin L.; Stewart, Frank J.

2015-01-01

Iron (Fe) and copper (Cu) are essential cofactors for microbial metalloenzymes, but little is known about the metalloenyzme inventory of anaerobic marine microbial communities despite their importance to the nitrogen cycle. We compared dissolved O2, NO3−, NO2−, Fe and Cu concentrations with nucleic acid sequences encoding Fe and Cu-binding proteins in 21 metagenomes and 9 metatranscriptomes from Eastern Tropical North and South Pacific oxygen minimum zones and 7 metagenomes from the Bermuda Atlantic Time-series Station. Dissolved Fe concentrations increased sharply at upper oxic-anoxic transition zones, with the highest Fe:Cu molar ratio (1.8) occurring at the anoxic core of the Eastern Tropical North Pacific oxygen minimum zone and matching the predicted maximum ratio based on data from diverse ocean sites. The relative abundance of genes encoding Fe-binding proteins was negatively correlated with O2, driven by significant increases in genes encoding Fe-proteins involved in dissimilatory nitrogen metabolisms under anoxia. Transcripts encoding cytochrome c oxidase, the Fe- and Cu-containing terminal reductase in aerobic respiration, were positively correlated with O2 content. A comparison of the taxonomy of genes encoding Fe- and Cu-binding vs. bulk proteins in OMZs revealed that Planctomycetes represented a higher percentage of Fe genes while Thaumarchaeota represented a higher percentage of Cu genes, particularly at oxyclines. These results are broadly consistent with higher relative abundance of genes encoding Fe-proteins in the genome of a marine planctomycete vs. higher relative abundance of genes encoding Cu-proteins in the genome of a marine thaumarchaeote. These findings highlight the importance of metalloenzymes for microbial processes in oxygen minimum zones and suggest preferential Cu use in oxic habitats with Cu > Fe vs. preferential Fe use in anoxic niches with Fe > Cu. PMID:26441925

Meta-omic signatures of microbial metal and nitrogen cycling in marine oxygen minimum zones.

PubMed

Glass, Jennifer B; Kretz, Cecilia B; Ganesh, Sangita; Ranjan, Piyush; Seston, Sherry L; Buck, Kristen N; Landing, William M; Morton, Peter L; Moffett, James W; Giovannoni, Stephen J; Vergin, Kevin L; Stewart, Frank J

2015-01-01

Iron (Fe) and copper (Cu) are essential cofactors for microbial metalloenzymes, but little is known about the metalloenyzme inventory of anaerobic marine microbial communities despite their importance to the nitrogen cycle. We compared dissolved O2, NO[Formula: see text], NO[Formula: see text], Fe and Cu concentrations with nucleic acid sequences encoding Fe and Cu-binding proteins in 21 metagenomes and 9 metatranscriptomes from Eastern Tropical North and South Pacific oxygen minimum zones and 7 metagenomes from the Bermuda Atlantic Time-series Station. Dissolved Fe concentrations increased sharply at upper oxic-anoxic transition zones, with the highest Fe:Cu molar ratio (1.8) occurring at the anoxic core of the Eastern Tropical North Pacific oxygen minimum zone and matching the predicted maximum ratio based on data from diverse ocean sites. The relative abundance of genes encoding Fe-binding proteins was negatively correlated with O2, driven by significant increases in genes encoding Fe-proteins involved in dissimilatory nitrogen metabolisms under anoxia. Transcripts encoding cytochrome c oxidase, the Fe- and Cu-containing terminal reductase in aerobic respiration, were positively correlated with O2 content. A comparison of the taxonomy of genes encoding Fe- and Cu-binding vs. bulk proteins in OMZs revealed that Planctomycetes represented a higher percentage of Fe genes while Thaumarchaeota represented a higher percentage of Cu genes, particularly at oxyclines. These results are broadly consistent with higher relative abundance of genes encoding Fe-proteins in the genome of a marine planctomycete vs. higher relative abundance of genes encoding Cu-proteins in the genome of a marine thaumarchaeote. These findings highlight the importance of metalloenzymes for microbial processes in oxygen minimum zones and suggest preferential Cu use in oxic habitats with Cu > Fe vs. preferential Fe use in anoxic niches with Fe > Cu.

Identification of the key molecules involved in chronic copper exposure-aggravated memory impairment in transgenic mice of Alzheimer's disease using proteomic analysis.

PubMed

Yu, Jun; Luo, Xiaobin; Xu, Hua; Ma, Quan; Yuan, Jianhui; Li, Xuling; Chang, Raymond Chuen-Chung; Qu, Zhongsen; Huang, Xinfeng; Zhuang, Zhixiong; Liu, Jianjun; Yang, Xifei

2015-01-01

Alzheimer's disease (AD) is the most common neurodegenerative disease characterized by a progressive impairment of cognitive functions including spatial learning and memory. Excess copper exposure accelerates the development of AD; however, the potential mechanisms by which copper exacerbates the symptoms of AD remain unknown. In this study, we explored the effects of chronic copper exposure on cognitive function by treating 6 month-old triple AD transgenic (3xTg-AD) mice with 250 ppm copper sulfate in drinking water for 6 months, and identified several potential key molecules involved in the effects of chronic copper exposure on memory by proteomic analysis. The behavioral test showed that chronic copper exposure aggravated memory impairment of 3xTg-AD mice. Two-dimensional fluorescence difference gel electrophoresis (2D-DIGE) coupled with mass spectrometry revealed a total of 44 differentially expressed proteins (18 upregulated and 26 down-regulated) in hippocampus between the wild-type (WT) mice and non-exposed 3xTg-AD mice. A total of 40 differentially expressed proteins were revealed (20 upregulated and 20 down-regulated) in hippocampus between copper exposed and non-exposed 3xTg-AD mice. Among these differentially expressed proteins, complexin-1 and complexin-2, two memory associated proteins, were significantly decreased in hippocampus of 3xTg-AD mice compared with the WT mice. Furthermore, the expression of these two proteins was further down-regulated in 3xTg-AD mice when exposed to copper. The abnormal expression of complexin-1 and complexin-2 identified by proteomic analysis was verified by western blot analysis. Taken together, our data showed that chronic copper exposure accelerated memory impairment and altered the expression of proteins in hippocampus in 3xTg-AD mice. The functional analysis on the differentially expressed proteins suggested that complexin-1 and complexin-2 may be the key molecules involved in chronic copper exposure-aggravated memory impairment in AD.

A Family Knockout of All Four Drosophila Metallothioneins Reveals a Central Role in Copper Homeostasis and Detoxification†

PubMed Central

Egli, Dieter; Yepiskoposyan, Hasmik; Selvaraj, Anand; Balamurugan, Kuppusamy; Rajaram, Rama; Simons, Andreas; Multhaup, Gerd; Mettler, Simone; Vardanyan, Alla; Georgiev, Oleg; Schaffner, Walter

2006-01-01

Metallothioneins are ubiquitous, small, cysteine-rich proteins with the ability to bind heavy metals. In spite of their biochemical characterization, their in vivo function remains elusive. Here, we report the generation of a metallothionein gene family knockout in Drosophila melanogaster by targeted disruption of all four genes (MtnA to -D). These flies are viable if raised in standard laboratory food. During development, however, they are highly sensitive to copper, cadmium, and (to a lesser extent) zinc load. Metallothionein expression is particularly important for male viability; while copper load during development affects males and females equally, adult males lacking metallothioneins display a severely reduced life span, possibly due to copper-mediated oxidative stress. Using various reporter gene constructs, we find that different metallothioneins are expressed with virtually the same tissue specificity in larvae, notably in the intestinal tract at sites of metal accumulation, including the midgut's “copper cells.” The same expression pattern is observed with a synthetic minipromoter consisting only of four tandem metal response elements. From these and other experiments, we conclude that tissue specificity of metallothionein expression is a consequence, rather than a cause, of metal distribution in the organism. The bright orange luminescence of copper accumulated in copper cells of the midgut is severely reduced in the metallothionein gene family knockout, as well as in mutants of metal-responsive transcription factor 1 (MTF-1), the main regulator of metallothionein expression. This indicates that an in vivo metallothionein-copper complex forms the basis of this luminescence. Strikingly, metallothionein mutants show an increased, MTF-1-dependent induction of metallothionein promoters in response to copper, cadmium, silver, zinc, and mercury. We conclude that free metal, but not metallothionein-bound metal, triggers the activation of MTF-1 and that metallothioneins regulate their own expression by a negative feedback loop. PMID:16508004

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Hang; Ha, Emmeline; Donaldson, Robert P.

Native electrospray ionization (ESI) mass spectrometry (MS) is often used to monitor noncovalent complex formation between peptides and ligands. The relatively low throughput of this technique, however, is not compatible with extensive screening. Laser ablation electrospray ionization (LAESI) MS combined with ion mobility separation (IMS) can analyze complex formation and provide conformation information within a matter of seconds. Islet amyloid polypeptide (IAPP) or amylin, a 37-amino acid residue peptide, is produced in pancreatic beta-cells through proteolytic cleavage of its prohormone. Both amylin and its precursor can aggregate and produce toxic oligomers and fibrils leading to cell death in the pancreasmore » that can eventually contribute to the development of type 2 diabetes mellitus. The inhibitory effect of the copper(II) ion on amylin aggregation has been recently discovered, but details of the interaction remain unknown. Finding other more physiologically tolerated approaches requires large scale screening of potential inhibitors. In this paper, we demonstrate that LAESI-IMS-MS can reveal the binding stoichiometry, copper oxidation state, and the dissociation constant of human amylin–copper(II) complex. The conformations of hIAPP in the presence of copper(II) ions were also analyzed by IMS, and preferential association between the β-hairpin amylin monomer and the metal ion was found. The copper(II) ion exhibited strong association with the —HSSNN– residues of the amylin. In the absence of copper(II), amylin dimers were detected with collision cross sections consistent with monomers of β-hairpin conformation. When copper(II) was present in the solution, no dimers were detected. Thus, the copper(II) ions disrupt the association pathway to the formation of β-sheet rich amylin fibrils. Using LAESI-IMS-MS for the assessment of amylin–copper(II) interactions demonstrates the utility of this technique for the high-throughput screening of potential inhibitors of amylin oligomerization and fibril formation. Finally and more generally, this rapid technique opens the door for high-throughput screening of potential inhibitors of amyloid protein aggregation.« less

Zinc and Copper Differentially Modulate Amyloid Precursor Protein Processing by γ-Secretase and Amyloid-β Peptide Production.

PubMed

Gerber, Hermeto; Wu, Fang; Dimitrov, Mitko; Garcia Osuna, Guillermo M; Fraering, Patrick C

2017-03-03

Recent evidence suggests involvement of biometal homeostasis in the pathological mechanisms in Alzheimer's disease (AD). For example, increased intracellular copper or zinc has been linked to a reduction in secreted levels of the AD-causing amyloid-β peptide (Aβ). However, little is known about whether these biometals modulate the generation of Aβ. In the present study we demonstrate in both cell-free and cell-based assays that zinc and copper regulate Aβ production by distinct molecular mechanisms affecting the processing by γ-secretase of its Aβ precursor protein substrate APP-C99. We found that Zn 2+ induces APP-C99 dimerization, which prevents its cleavage by γ-secretase and Aβ production, with an IC 50 value of 15 μm Importantly, at this concentration, Zn 2+ also drastically raised the production of the aggregation-prone Aβ43 found in the senile plaques of AD brains and elevated the Aβ43:Aβ40 ratio, a promising biomarker for neurotoxicity and AD. We further demonstrate that the APP-C99 histidine residues His-6, His-13, and His-14 control the Zn 2+ -dependent APP-C99 dimerization and inhibition of Aβ production, whereas the increased Aβ43:Aβ40 ratio is substrate dimerization-independent and involves the known Zn 2+ binding lysine Lys-28 residue that orientates the APP-C99 transmembrane domain within the lipid bilayer. Unlike zinc, copper inhibited Aβ production by directly targeting the subunits presenilin and nicastrin in the γ-secretase complex. Altogether, our data demonstrate that zinc and copper differentially modulate Aβ production. They further suggest that dimerization of APP-C99 or the specific targeting of individual residues regulating the production of the long, toxic Aβ species, may offer two therapeutic strategies for preventing AD. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

The Arabidopsis RCC1 Family Protein TCF1 Regulates Freezing Tolerance and Cold Acclimation through Modulating Lignin Biosynthesis

PubMed Central

Jenkins, Gareth I.; Wang, Shuangfeng; Shang, Zhonglin; Shi, Yiting; Yang, Shuhua; Li, Xia

2015-01-01

Abstract Cell water permeability and cell wall properties are critical to survival of plant cells during freezing, however the underlying molecular mechanisms remain elusive. Here, we report that a specifically cold-induced nuclear protein, Tolerant to Chilling and Freezing 1 (TCF1), interacts with histones H3 and H4 and associates with chromatin containing a target gene, BLUE-COPPER-BINDING PROTEIN (BCB), encoding a glycosylphosphatidylinositol-anchored protein that regulates lignin biosynthesis. Loss of TCF1 function leads to reduced BCB transcription through affecting H3K4me2 and H3K27me3 levels within the BCB gene, resulting in reduced lignin content and enhanced freezing tolerance. Furthermore, plants with knocked-down BCB expression (amiRNA-BCB) under cold acclimation had reduced lignin accumulation and increased freezing tolerance. The pal1pal2 double mutant (lignin content reduced by 30% compared with WT) also showed the freezing tolerant phenotype, and TCF1 and BCB act upstream of PALs to regulate lignin content. In addition, TCF1 acts independently of the CBF (C-repeat binding factor) pathway. Our findings delineate a novel molecular pathway linking the TCF1-mediated cold-specific transcriptional program to lignin biosynthesis, thus achieving cell wall remodeling with increased freezing tolerance. PMID:26393916

Engineering Copper Carboxylate Functionalities on Water Stable Metal–Organic Frameworks for Enhancement of Ammonia Removal Capacities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Joshi, Jayraj N.; Garcia-Gutierrez, Erika Y.; Moran, Colton M.

Functionalization of copper carboxylate groups on a series of UiO-66 metal organic framework (MOF) analogues and their corresponding impact on humid and dry ammonia adsorption behavior were studied. Relative locations of possible carboxylic acid binding sites for copper on the MOF analogues were varied on ligand and missing linker defect sites. Materials after copper incorporation exhibited increased water vapor and ammonia affinity during isothermal adsorption and breakthrough experiments, respectively. The introduction of copper markedly increased ammonia adsorption capacities for all adsorbents possessing carboxyl binding sites. In particular, the new MOF UiO-66-(COOCu)2 displayed the highest ammonia breakthrough capacities of 6.38 andmore » 6.84 mmol g–1 under dry and humid conditions, respectively, while retaining crystallinity and porosity. Relative carboxylic acid site locations were also found to impact sorbent stability, as missing linker defect functionalized materials degraded under humid conditions after copper incorporation. Postsynthetic metal insertion provides a method for adding sites that are analogous to open metal sites while maintaining good structural stability.« less

[Effect of Cu2+ and Zn2+ ions in Ca-ATPase activity isolated from Pachymerus nucleorum (Fabricius) (Coleoptera: Chrysomelidae, Bruchinae) larvae].

PubMed

Dias, Decivaldo S; Coelho, Milton V

2007-01-01

ATPases, an important target of insecticides, are enzymes that hydrolyze ATP and use the energy released in that process to accomplish some type of cellular work. Pachymerus nucleorum (Fabricius) larvae possess an ATPase, that presents high Ca-ATPase activity, but no Mg-ATPase activity. In the present study, the effect of zinc and copper ions in the activity Ca-ATPase of that enzyme was tested. More than 90% of the Ca-ATPase activity was inhibited in 0.5 mM of copper ions or 0.25 mM of zinc ions. In the presence of EDTA, but not in the absence, the inhibition by zinc was reverted with the increase of calcium concentration. The inhibition by copper ions was not reverted in the presence or absence of EDTA. The Ca-ATPase was not inhibited by treatment of the ATPase fraction with copper, suggesting that the copper ion does not bind directly to the enzyme. The results suggest that zinc and copper ions form a complex with ATP and bind to the enzyme inhibiting its Ca-ATPase activity.

Cu-rGO subsurface layer creation on copper substrate and its resistance to oxidation

NASA Astrophysics Data System (ADS)

Pietrzak, Katarzyna; Strojny-Nędza, Agata; Olesińska, Wiesława; Bańkowska, Anna; Gładki, Andrzej

2017-11-01

On the basis of a specially designed experiment, this paper presents a model, which is an attempt to explain the mechanism of formatting and creating oxidation resistance of Cu-rGO subsurface layers. Practically zero chemical affinity of copper to carbon is a fundamental difficulty in creating composite structures of Cu-C, properties which are theoretically possible to estimate. In order to bind the thermally reduced graphene oxide with copper surface, the effect of structural rebuilding of the copper oxide, in the process of annealing in a nitrogen atmosphere, have been used. On intentionally oxidized and anoxic copper substrates the dispersed graphene oxide (GO) and thermally reduced graphene oxide (rGO) were loaded. Annealing processes after the binding effects of both graphene oxide forms to Cu substrates were tested. The methods for high-resolution electron microscopy were found subsurface rGO-Cu layer having a substantially greater resistance to oxidation than pure copper. The mechanism for the effective resistance to oxidation of the Cu-rGO has been presented in a hypothetical form.

The impact of aging wine in high and low oxygen conditions on the fractionation of Cu and Fe in Chardonnay wine.

PubMed

Kontoudakis, Nikolaos; Guo, Anque; Scollary, Geoffrey R; Clark, Andrew C

2017-08-15

Solid-phase extraction has previously been used to fractionate copper and iron into hydrophobic, cationic and residual forms. This study showed the change in fractionated copper and iron in Chardonnay wines with 1-year of bottle aging under variable oxygen and protein concentrations. Wines containing protein in low oxygen conditions induced a decrease (20-50%) in total copper and increased the proportion of the hydrophobic copper fraction, associated with copper(I) sulfide. In contrast, protein stabilised wines showed a lower proportion of the hydrophobic copper fraction after 1-year of aging. In oxidative storage conditions, the total iron decreased by 60% when at high concentration, and the concentration of the residual fraction of both copper and iron increased. The results show that oxidative storage increases the most oxidative catalytic form of the metal, whilst changes during reductive storage depend on the extent of protein stabilisation of the wine. Copyright © 2017 Elsevier Ltd. All rights reserved.

Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

PubMed Central

Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

2008-01-01

The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

Computational screening of functional groups for capture of toxic industrial chemicals in porous materials.

PubMed

Kim, Ki Chul; Fairen-Jimenez, David; Snurr, Randall Q

2017-12-06

A thermodynamic analysis using quantum chemical methods was carried out to identify optimal functional group candidates that can be included in metal-organic frameworks and activated carbons for the selective capture of toxic industrial chemicals (TICs) in humid air. We calculated the binding energies of 14 critical TICs plus water with a series of 10 functional groups attached to a naphthalene ring model. Using vibrational calculations, the free energies of adsorption were calculated in addition to the binding energies. Our results show that, in these systems, the binding energies and free energies follow similar trends. We identified copper(i) carboxylate as the optimal functional group (among those studied) for the selective binding of the majority of the TICs in humid air, and this functional group exhibits especially strong binding for sulfuric acid. Further thermodynamic analysis shows that the presence of water weakens the binding strength of sulfuric acid with the copper carboxylate group. Our calculations predict that functionalization of aromatic rings would be detrimental to selective capture of COCl 2 , CO 2 , and Cl 2 under humid conditions. Finally, we found that forming an ionic complex, H 3 O + HSO 4 - , between H 2 SO 4 and H 2 O via proton transfer is not favorable on copper carboxylate.

The modulation of extracellular superoxide dismutase in the specifically enhanced cellular immune response against secondary challenge of Vibrio splendidus in Pacific oyster (Crassostrea gigas).

PubMed

Liu, Conghui; Zhang, Tao; Wang, Lingling; Wang, Mengqiang; Wang, Weilin; Jia, Zhihao; Jiang, Shuai; Song, Linsheng

2016-10-01

Extracellular superoxide dismutase (EcSOD) is a copper-containing glycoprotein playing an important role in antioxidant defense of living cells exposed to oxidative stress, and also participating in microorganism internalization and cell adhesion in invertebrates. EcSOD from oyster (designated CgEcSOD) had been previously reported to bind lipopolysaccharides (LPS) and act as a bridge molecule in Vibrio splendidus internalization. Its mRNA expression pattern, PAMP binding spectrum and microorganism binding capability were examined in the present study. The mRNA expression of CgEcSOD in hemocytes was significantly up-regulated at the initial phase and decreased sharply at 48 h post V. splendidus stimulation. The recombinant CgEcSOD protein (rCgEcSOD) could bind LPS, PGN and poly (I:C), as well as various microorganisms including Micrococcus luteus, Staphylococcus aureus, Escherichia coli, Vibrio anguillarum, V. splendidus, Pastoris pastoris and Yarrowia lipolytica at the presence of divalent metal ions Cu(2+). After the secondary V. splendidus stimulation, the mRNA and protein of CgEcSOD were both down-regulated significantly. The results collectively indicated that CgEcSOD could not only function in the immune recognition, but also might contribute to the immune priming of oyster by inhibiting the foreign microbe invasion through a specific down-regulation. Copyright © 2016 Elsevier Ltd. All rights reserved.

Fusaric acid induces a notochord malformation in zebrafish via copper chelation.

PubMed

Yin, Emily S; Rakhmankulova, Malika; Kucera, Kaury; de Sena Filho, Jose Guedes; Portero, Carolina E; Narváez-Trujillo, Alexandra; Holley, Scott A; Strobel, Scott A

2015-08-01

Over a thousand extracts were tested for phenotypic effects in developing zebrafish embryos to identify bioactive molecules produced by endophytic fungi. One extract isolated from Fusarium sp., a widely distributed fungal genus found in soil and often associated with plants, induced an undulated notochord in developing zebrafish embryos. The active compound was isolated and identified as fusaric acid. Previous literature has shown this phenotype to be associated with copper chelation from the active site of lysyl oxidase, but the ability of fusaric acid to bind copper ions has not been well described. Isothermal titration calorimetry revealed that fusaric acid is a modest copper chelator with a binding constant of 4.4 × 10(5) M(-1). These results shed light on the toxicity of fusaric acid and the potential teratogenic effects of consuming plants infected with Fusarium sp.

Eukaryotic copper-only superoxide dismutases (SODs): A new class of SOD enzymes and SOD-like protein domains.

PubMed

Robinett, Natalie G; Peterson, Ryan L; Culotta, Valeria C

2018-03-30

The copper-containing superoxide dismutases (SODs) represent a large family of enzymes that participate in the metabolism of reactive oxygen species by disproportionating superoxide anion radical to oxygen and hydrogen peroxide. Catalysis is driven by the redox-active copper ion, and in most cases, SODs also harbor a zinc at the active site that enhances copper catalysis and stabilizes the protein. Such bimetallic Cu,Zn-SODs are widespread, from the periplasm of bacteria to virtually every organelle in the human cell. However, a new class of copper-containing SODs has recently emerged that function without zinc. These copper-only enzymes serve as extracellular SODs in specific bacteria ( i.e. Mycobacteria), throughout the fungal kingdom, and in the fungus-like oomycetes. The eukaryotic copper-only SODs are particularly unique in that they lack an electrostatic loop for substrate guidance and have an unusual open-access copper site, yet they can still react with superoxide at rates limited only by diffusion. Copper-only SOD sequences similar to those seen in fungi and oomycetes are also found in the animal kingdom, but rather than single-domain enzymes, they appear as tandem repeats in large polypeptides we refer to as CSRPs (copper-only SOD-repeat proteins). Here, we compare and contrast the Cu,Zn versus copper-only SODs and discuss the evolution of copper-only SOD protein domains in animals and fungi. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Synthesis and structure elucidation of a copper(II) Schiff-base complex: in vitro DNA binding, pBR322 plasmid cleavage and HSA binding studies.

PubMed

Tabassum, Sartaj; Ahmad, Musheer; Afzal, Mohd; Zaki, Mehvash; Bharadwaj, Parimal K

2014-11-01

New copper(II) complex with Schiff base ligand 4-[(2-Hydroxy-3-methoxy-benzylidene)-amino]-benzoic acid (H₂L) was synthesized and characterized by spectroscopic and analytical and single crystal X-ray diffraction studies which revealed that the complex 1 exist in a distorted octahedral environment. In vitro CT-DNA binding studies were performed by employing different biophysical technique which indicated that the 1 strongly binds to DNA in comparison to ligand via electrostatic binding mode. Complex 1 cleaves pBR322 DNA via hydrolytic pathway and recognizes minor groove of DNA double helix. The HSA binding results showed that ligand and complex 1 has ability to quench the fluorescence emission intensity of Trp 214 residue available in the subdomain IIA of HSA. Copyright © 2014 Elsevier B.V. All rights reserved.

Multispectroscopic and molecular modeling studies on the interaction of copper-ibuprofenate complex with bovine serum albumin (BSA).

PubMed

Shiri, Farshad; Rahimi-Nasrabadi, Mehdi; Ahmadi, Farhad; Ehrlich, Hermann

2018-05-31

Bovine serum albumin (BSA) represents the well recognized model protein for investigations of diverse intermolecular reactions in studies on pharmacological activities of modern drugs. In the present work, the interaction between copper ibuprofenate ([Cu2(IBU)4]) and BSA under simulative physiological conditions was investigated by the using of diverse spectral methods including fluorescence, UV-vis absorption, CD spectroscopy and also molecular docking. The obtained results showed that there was a strong fluorescence quenching of BSA by [Cu2(IBU)4] (2.964E+4 M -1 at room temperature). Using the continuous variation method, a single class of binding sites, (1:1), for [Cu2(IBU)4] on BSA was put in evidence. The Stern-Volmer analysis of fluorescence quenching data shows the presence of the static quenching mechanism. The binding constants K b were calculated and the thermodynamic parameters ∆G°, ∆H° and ∆S° were given. The obtained thermodynamic values and the change observed in the alpha-helical content signature suggests that hydrogen bonding and hydrophobic forces play a major role in the [Cu2(IBU)4]-BSA binding interaction. Site marker competitive experiments indicated that the binding of [Cu2(IBU)4] to BSA primarily took place in sub-domain IIA that this observation were substantiated by molecular docking studies. The results of CD and UV-vis spectroscopy showed for the first time that the presence of [Cu2(IBU)4] increased the ɑ-helical content of BSA (from 48.56% to 55.71%) and conformational changes of BSA molecules. Copyright © 2017 Elsevier B.V. All rights reserved.

Quantitation and localization of intracellular redox active metals by X-ray fluorescence microscopy in cortical neurons derived from APP and APLP2 knockout tissue

DOE PAGES

Ciccotosto, Giuseppe D.; James, Simon A.; Altissimo, Matteo; ...

2014-10-01

The amyloid precursor protein (APP) gene family includes APP and the amyloid precursor-like proteins, APLP1 and APLP2. These proteins contain metal binding sites for copper, zinc and iron and are known to have physiological roles in modulating the metal homeostasis in brain cells. Here we report the application of X-ray fluorescence microscopy (XFM) to investigate the subcellular distribution patterns of the metal ions Cu, Zn, Fe, and Ca in individual neurons derived from APP and APLP2 knockout mice brains to further define their role in metal homeostasis. These studies add to the growing body of data that the APP familymore » of proteins are metalloproteins that have shared as well as distinct effects on metals. As we continue to delineate the cellular effects of the APP family of proteins it is important to consider how metals are involved in their actions.« less

Elemental analysis of sunflower cataract in Wilson's disease: a study using scanning transmission electron microscopy and energy dispersive spectroscopy.

PubMed

Jang, Hyo Ju; Kim, Joon Mo; Choi, Chul Young

2014-04-01

Signature ophthalmic characteristics of Wilson's disease (WD) are regarded as diagnostically important manifestations of the disease. Previous studies have proved the common occurrence of copper accumulation in the liver of patients with WD. However, in the case of sunflower cataracts, one of the rare diagnostic signs of WD, no study has demonstrated copper accumulation in the lens capsules of sunflower cataracts in WD patients. To investigate the nanostructure and elemental composition of sunflower cataracts in WD, transmission electron microscopy (TEM) was done on the capsulorhexised anterior lens capsule of sunflower cataracts in WD in order to evaluate anatomical variation and elemental changes. We utilized energy dispersive X-ray spectroscopy (EDS) to investigate the elemental composition of the lens capsule using both point and mapping spectroscopy. Quantitative analysis was performed for relative comparison of the elements. TEM showed the presence of granular deposits of varying size (20-350 nm), appearing mainly in the posterior one third of the anterior capsule. The deposits appeared in linear patterns with scattered dots. There were no electron-dense particles in the epithelial cell layer of the lens. Copper and sulfur peaks were consistently revealed in electron-dense granular deposits. In contrast, copper and sulfur peaks were absent in other tissues, including granule-free lens capsules and epithelial tissue. Most copper was exclusively located in clusters of electron-dense particles, and the copper distribution overlapped with sulfur on mapping spectroscopy. Quantitative analysis presented inconsistent ratios of copper to sulfur in each electron-dense granule. The mean ratio of copper to sulfur was about 3.25 (with a range of 2.39-3.78). This is the first elemental analysis of single electron particles in sunflower cataracts using EDS in the ophthalmic area. Sunflower cataracts with WD are assumed to be the result of accumulation of heterogeneous compounds composed of several materials, including copper, sulfur, and/or copper-binding proteins. Linear patterns of copper and sulfur deposition were detected in various sizes and composition ratios with these elements in cases of WD. Copyright © 2014 Elsevier Ltd. All rights reserved.

Bacterial copper storage proteins.

PubMed

Dennison, Christopher; David, Sholto; Lee, Jaeick

2018-03-30

Copper is essential for most organisms as a cofactor for key enzymes involved in fundamental processes such as respiration and photosynthesis. However, copper also has toxic effects in cells, which is why eukaryotes and prokaryotes have evolved mechanisms for safe copper handling. A new family of bacterial proteins uses a Cys-rich four-helix bundle to safely store large quantities of Cu(I). The work leading to the discovery of these proteins, their properties and physiological functions, and how their presence potentially impacts the current views of bacterial copper handling and use are discussed in this review. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Computational study of the binding of CuII to Alzheimer's amyloid-beta peptide: do Abeta42 and Abeta40 bind copper in identical fashion?

PubMed

Mantri, Yogita; Fioroni, Marco; Baik, Mu-Hyun

2008-11-01

One of the many hypotheses on the pathogenesis of Alzheimer's disease is that the amyloid-beta peptide (Abeta) binds CuII and can catalytically generate H2O2, leading to oxidative damage in brain tissues. For a molecular level understanding of such catalysis it is critical to know the structure of the Abeta-CuII complex precisely. Unfortunately, no high-resolution structure is available to date and there is considerable debate over the copper coordination environment with no clear consensus on which residues are directly bound to CuII. Considering all plausible isomers of the copper-bound Abeta42 and Abeta40 using a combination of density functional theory and classical molecular dynamics methods, we report an atomic resolution structure for each possible complex. We evaluated the relative energies of these isomeric structures and surprisingly found that Abeta42 and Abeta40 display very different binding modes, suggesting that shorter peptides that are truncated at the C-terminus may not be realistic models for understanding the chemistry of the most neurotoxic peptide, Abeta42.

Enantiospecific adsorption of propranolol enantiomers on naturally chiral copper surface: A molecular dynamics simulation investigation

NASA Astrophysics Data System (ADS)

Sedghamiz, Tahereh; Bahrami, Maryam; Ghatee, Mohammad Hadi

2017-04-01

Adsorption of propranolol enantiomers on naturally chiral copper (Cu(3,1,17)S) and achiral copper (Cu(100)) surfaces were studied by molecular dynamics simulation to unravel the features of adsorbate-adsorbent enantioselectivity. Adsorption of S- and R-propranolol on Cu(3,1,17)S terraces (with 100 plane) leads mainly to endo- and exo-conformers, respectively. Simulated pair correlation function (g(r)) and mean square displacement (MSD) were analyzed to identify adsorption sites of enantiomers on Cu(3,1,17)S substrate surface, and their simulated binding energies were used to access the adsorption strength. According to (g(r)), R-propranolol adsorbs via naphtyl group while S-propranolol mainly adsorbs through chain group. R-enantiomer binds more tightly to the chiral substrate surface than S-enantiomer as indicated by a higher simulated binding energy by 2.74 kJ mol-1 per molecule. The difference in binding energies of propranolol enantiomers on naturally chiral Cu(3,1,17)S is almost six times larger than on the achiral Cu(100) surface, which substantiates the appreciably strong specific enantioselective adsorption on the former surface.

Evolution of Electron Transport Chains During the Anaerobic to Aerobic Transition on Early Earth

NASA Astrophysics Data System (ADS)

Sepúlveda, R.; Ortiz, R.; Holmes, D. S.

2015-12-01

Sepulveda, R., Ortiz R. and Holmes DS. Center for Bioinformatics and Genome Biology, Fundacion Ciencia y Vida, and Facultad de Ciencias Biologicas, Universidad Andres Bello, Santiago, Chile.According to several models, life emerged on earth in an anoxic environment where oxygen was not available as a terminal electron acceptor for energy generating reactions. After the Great Oxidation Event (GOE) about 2.4 billion years ago, or perhaps even before the GOE, oxygen became the most widespread and efficient terminal electron acceptor and was accompanied by the evolution of a number of redox proteins that could deliver electrons to reduce oxygen to water. Where did these proteins come from? One hypothesis is that they evolved by the neofunctionalization of previously existing redox proteins that had been used in anaerobic conditions as terminal electron donors to reduce compounds such as perchlorate, nitric oxide or iron. We have used a number of bioinformatic tools to explore a large number of genomes looking for discernable signals of such redeployment of function. A Perl pipeline was designed to detect sequence similarity, conserved gene context, remote homology detection, identification of domains and functional evolution of electron carrier proteins from extreme acidophiles, including the small blue copper protein rusticyanin (involved in FeII oxidation), cytochrome oxidase subunit II and quinol-dependent nitric oxide reductase (qNOR). The protein folds and copper binding sites of rusticyanin are conserved in cytochrome oxidase aa3 subunit II, a protein complex that is responsible for the final passage of electrons to reduce oxygen. Therefore, we hypothesize that rusticyanin, cytochrome oxidase II and qNOR are evolutionarily related. Acknowledgments: Fondecyt 1130683.

Bifunctional Diaminoterephthalate Fluorescent Dye as Probe for Cross-Linking Proteins.

PubMed

Wallisch, Melanie; Sulmann, Stefan; Koch, Karl-Wilhelm; Christoffers, Jens

2017-05-11

Diaminoterephthalates are fluorescent dyes and define scaffolds, which can be orthogonally functionalized at their two carboxylate residues with functional residues bearing task specific reactive groups. The synthesis of monofunctionalized dyes with thiol groups for surface binding, an azide for click chemistry, and a biotinoylated congener for streptavidin binding is reported. Two bifunctionalized dyes were prepared: One with an azide for click chemistry and a biotin for streptavidin binding, the other with a maleimide for reaction with thiol and a cyclooctyne moiety for ligation with copper-free click chemistry. In general, the compounds are red to orange, fluorescent materials with an absorption at about 450 nm and an emission at 560 nm with quantum yields between 2-41 %. Of particular interest is the maleimide-functionalized compound, which shows low fluorescence quantum yield (2 %) by itself. After addition of a thiol, the fluorescence is "turned on"; quantum yield 41 %. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Copper(II) ions and the Alzheimer's amyloid-β peptide: Affinity and stoichiometry of binding

NASA Astrophysics Data System (ADS)

Tõugu, Vello; Friedemann, Merlin; Tiiman, Ann; Palumaa, Peep

2014-10-01

Deposition of amyloid beta (Aβ) peptides into amyloid plaques is the hallmark of Alzheimer's disease. According to the amyloid cascade hypothesis this deposition is an early event and primary cause of the disease, however, the mechanisms that cause this deposition remain elusive. An increasing amount of evidence shows that the interactions of biometals can contribute to the fibrillization and amyloid formation by amyloidogenic peptides. From different anions the copper ions deserve the most attention since it can contribute not only toamyloid formation but also to its toxicity due to the generation of ROS. In this thesis we focus on the affinity and stoichiometry of copper(II) binding to the Aβ molecule.

Surface Induced Dissociation Coupled with High Resolution Mass Spectrometry Unveils Heterogeneity of a 211 kDa Multicopper Oxidase Protein Complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Mowei; Yan, Jing; Romano, Christine A.

Manganese oxidation is an important biogeochemical process that is largely regulated by bacteria through enzymatic reactions. However, the detailed mechanism is poorly understood due to challenges in isolating and characterizing these unknown enzymes. A manganese oxidase Mnx from Bacillus sp. PL-12 has been successfully overexpressed in active form, unexpectedly, as a protein complex with a molecular weight of 211 kDa with no homology to known proteins in the database. We have recently used surface induced dissociation (SID) and ion mobility – mass spectrometry (IM-MS) to release and detect folded subcomplexes for determining subunit connectivity and quaternary structure. The data frommore » the native mass spectrometry experiment led to a plausible model of this unknown multicopper oxidase which has been difficult to study by conventional structural biology methods. However, because each subunit of Mnx binds copper ions as cofactor at varying ratios, there were remaining ambiguities in assigning some of the observed peaks to metal-binding species because of the sample heterogeneity and limited mass resolution. In this study, we performed SID in a modified Fourier transform – ion cyclotron resonance (FT-ICR) mass spectrometer for obtaining the ultimate resolution on the released subcomplexes of Mnx. The high mass accuracy and resolution unveiled unexpected artificial modifications in the protein that have been previously thought to be iron bound species based on lower resolution data. Additionally, most released subcomplexes were isotopically resolved for defining metal binding stoichiometry at each structural level. This method holds great potential for in-depth characterization of metalloproteins and protein-ligand complexes.« less

Copper uptake and retention in liver parenchymal cells isolated from nutritionally copper-deficient rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van den Berg, G.J.; de Goeij, J.J.; Bock, I.

1991-08-01

Copper uptake and retention were studied in primary cultures of liver parenchymal cells isolated from copper-deficient rats. Male Sprague-Dawley rats were fed a copper-deficient diet (less than 1 mg Cu/kg) for 10 wk. Copper-deficient rats were characterized by low copper concentrations in plasma and liver, anemia, low plasma ceruloplasmin oxidase activity and increased 64Cu whole-body retention. Freshly isolated liver parenchymal cells from copper-deficient rats showed a higher 64Cu influx, which was associated with a higher apparent Vmax of 45 {plus minus} 4 pmol Cu.mg protein-1.min-1 as compared with 30 {plus minus} 3 pmol Cu.mg protein-1.min-1 for cells isolated from copper-sufficientmore » rats. No significant difference in the apparent Km (approximately 30 mumol/L) was observed. Relative 64Cu efflux from cells from copper-deficient rats was significantly smaller than the efflux from cells from copper-sufficient rats after prelabeling as determined by 2-h efflux experiments. Analysis of the medium after efflux from cells from copper-deficient rats showed elevated protein-associated 64Cu, suggesting a higher incorporation of radioactive copper during metalloprotein synthesis. Effects of copper deficiency persist in primary cultures of parenchymal cells derived from copper-deficient rats, and short-term cultures of these cells offer a prospect for the study of cell biological aspects of the metabolic adaptation of the liver to copper deficiency.« less

Selenocysteine Positional Variants Reveal Contributions to Copper Binding From Cysteine Residues in Domains 2 And 3 of Human Copper Chaperone for Superoxide Dismutase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barry, A.N.; Clark, K.M.; Otoikhian, A.

2009-05-11

The human copper chaperone for superoxide dismutase binds copper both in an Atx1-like MTCQSC motif in domain 1 and via a multinuclear cluster formed by two CXC motifs at the D3 dimer interface. The composition of the Cu(I) cluster has been investigated previously by mutagenesis of the CXC motif, and by construction of a CXU selenocysteine derivative, which has permitted XAS studies at both Cu and Se absorption edges. Here, we report the semisynthesis and spectroscopic characterization of a series of derivatives with the sequences 243-CACA, 243-CAUA, 243-UACA, and 243-UAUA in the D1 double mutant (C22AC25A) background, prepared by expressedmore » protein ligation of Sec-containing tetrapeptides to an hCCS-243 truncation. By varying the position of the Se atom in the CXC motif, we have been able to show that Se is always bridging (2 Se-Cu) rather than terminal (1 Se-Cu). Substitution of both D3 Cys residues by Sec in the UAUA variant does not eliminate the Cu-S contribution, confirming our previous description of the cluster as most likely a Cu{sub 4}S{sub 6} species, and suggesting that D2 Cys residues contribute to the cluster. As predicted by this model, when Cys residues C141, C144, and C227 are mutated to alanine either individually or together as a triple mutant, the cluster nuclearity is dramatically attenuated. These data suggest that Cys residues in D2 of hCCS are involved in the formation, stability, and redox potential of the D3 cluster. The significance of these finding to the SOD1 thiol/disulfide oxidase activity are discussed in terms of a model in which a similar multinuclear cluster may form in the CCS-SOD heterodimer.« less

Probing Interfacial Processes on Graphene Surface by Mass Detection

NASA Astrophysics Data System (ADS)

Kakenov, Nurbek; Kocabas, Coskun

2013-03-01

In this work we studied the mass density of graphene, probed interfacial processes on graphene surface and examined the formation of graphene oxide by mass detection. The graphene layers were synthesized by chemical vapor deposition method on copper foils and transfer-printed on a quartz crystal microbalance (QCM). The mass density of single layer graphene was measured by investigating the mechanical resonance of the QCM. Moreover, we extended the developed technique to probe the binding dynamics of proteins on the surface of graphene, were able to obtain nonspecific binding constant of BSA protein of graphene surface in aqueous solution. The time trace of resonance signal showed that the BSA molecules rapidly saturated by filling the available binding sites on graphene surface. Furthermore, we monitored oxidation of graphene surface under oxygen plasma by tracing the changes of interfacial mass of the graphene controlled by the shifts in Raman spectra. Three regimes were observed the formation of graphene oxide which increases the interfacial mass, the release of carbon dioxide and the removal of small graphene/graphene oxide flakes. Scientific and Technological Research Council of Turkey (TUBITAK) grant no. 110T304, 109T209, Marie Curie International Reintegration Grant (IRG) grant no 256458, Turkish Academy of Science (TUBA-Gebip).

Copper induces hepatocyte injury due to the endoplasmic reticulum stress in cultured cells and patients with Wilson disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oe, Shinji, E-mail: ooes@med.uoeh-u.ac.jp; Miyagawa, Koichiro, E-mail: koichiro@med.uoeh-u.ac.jp; Honma, Yuichi, E-mail: y-homma@med.uoeh-u.ac.jp

Copper is an essential trace element, however, excess copper is harmful to human health. Excess copper-derived oxidants contribute to the progression of Wilson disease, and oxidative stress induces accumulation of abnormal proteins. It is known that the endoplasmic reticulum (ER) plays an important role in proper protein folding, and that accumulation of misfolded proteins disturbs ER homeostasis resulting in ER stress. However, copper-induced ER homeostasis disturbance has not been fully clarified. We treated human hepatoma cell line (Huh7) and immortalized-human hepatocyte cell line (OUMS29) with copper and chemical chaperones, including 4-phenylbutyrate and ursodeoxycholic acid. We examined copper-induced oxidative stress, ERmore » stress and apoptosis by immunofluorescence microscopy and immunoblot analyses. Furthermore, we examined the effects of copper on carcinogenesis. Excess copper induced not only oxidative stress but also ER stress. Furthermore, excess copper induced DNA damage and reduced cell proliferation. Chemical chaperones reduced this copper-induced hepatotoxicity. Excess copper induced hepatotoxicity via ER stress. We also confirmed the abnormality of ultra-structure of the ER of hepatocytes in patients with Wilson disease. These findings show that ER stress plays a pivotal role in Wilson disease, and suggests that chemical chaperones may have beneficial effects in the treatment of Wilson disease.« less

Bio-mimicking galactose oxidase and hemocyanin, two dioxygen-processing copper proteins.

PubMed

Gamez, Patrick; Koval, Iryna A; Reedijk, Jan

2004-12-21

The modelling of the active sites of metalloproteins is one of the most challenging tasks in bio-inorganic chemistry. Copper proteins form part of this stimulating field of research as copper enzymes are mainly involved in oxidation bio-reactions. Thus, the understanding of the structure-function relationship of their active sites will allow the design of effective and environmental friendly oxidation catalysts. This perspective illustrates some outstanding structural and functional synthetic models of the active site of copper proteins, with special attention given to models of galactose oxidase and hemocyanin.

Electrostatic occlusion and quaternary structural ion pairing are key determinants of Cu(I)-mediated allostery in the copper-sensing operon repressor (CsoR).

PubMed

Chang, Feng-Ming James; Martin, Julia E; Giedroc, David P

2015-04-21

The copper-sensing operon repressor (CsoR) is an all-α-helical disc-shaped D2-symmetric homotetramer that forms a 2:1 tetramer/DNA operator complex and represses the expression of copper-resistance genes in a number of bacteria. A previous bioinformatics analysis of CsoR-family repressors distributes Cu(I)-sensing CsoRs in four of seven distinct clades on the basis of global sequence similarity. In this work, we define energetically important determinants of DNA binding in the apo-state (ΔΔGbind), and for allosteric negative coupling of Cu(I) binding to DNA binding (ΔΔGc) in a model clade IV CsoR from Geobacillus thermodenitrificans (Gt) of known structure, by selectively targeting for mutagenesis those charged residues uniquely conserved in clade IV CsoRs. These include a folded N-terminal "tail" and a number of Cu(I)-sensor and clade-specific residues that when mapped onto a model of Cu(I)-bound Gt CsoR define a path across one face of the tetramer. We find that Cu(I)-binding prevents formation of the 2:1 "sandwich" complex rather than DNA binding altogether. Folding of the N-terminal tail (residues R18, E22, R74) upon Cu-binding to the periphery of the tetramer inhibits assembly of the 2:1 apoprotein-DNA complex. In contrast, Ala substitution of residues that surround the central "hole" (R65, K101) in the tetramer, as well R48, impact DNA binding. We also identify a quaternary structural ion-pair, E73-K101″, that crosses the tetramer interface, charge-reversal of which restores DNA binding activity, allosteric regulation by Cu(I), and transcriptional derepression by Cu(I) in cells. These findings suggest an "electrostatic occlusion" model, in which basic residues important for DNA binding and/or allostery become sequestered via ion-pairing specifically in the Cu(I)-bound state, and this aids in copper-dependent disassembly of a repression complex.

Cooperation between two periplasmic copper chaperones is required for full activity of the cbb 3-type cytochrome c oxidase and copper homeostasis in Rhodobacter capsulatus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trasnea, Petru -Iulian; Utz, Marcel; Khalfaoui-Hassani, Bahia

Copper (Cu) is an essential micronutrient that functions as a cofactor in several important enzymes, like respiratory heme-copper oxygen reductases. Yet, Cu is also toxic and therefore cells engage a highly coordinated Cu uptake and delivery system to prevent the accumulation of toxic Cu concentrations. In the current work we analyzed Cu delivery to the cbb 3-type cytochrome c oxidase ( cbb 3-Cox) of Rhodobacter capsulatus. We identified the PCu AC-like periplasmic chaperone PccA and analyzed its contribution to cbb 3-Cox assembly. Our data demonstrate that PccA is a Cu-binding protein with a preference for Cu(I), which is required formore » efficient cbb 3-Cox assembly, in particular at low Cu concentrations. By using in vivo and in vitro crosslinking we show that PccA forms a complex with the Sco1-homologue SenC. This complex is stabilized in the absence of the cbb 3-Cox specific assembly factors CcoGHIS. In cells lacking SenC, the cytoplasmic Cu content is significantly increased, but the simultaneous absence of PccA prevents this Cu accumulation. Lastly, these data demonstrate that the interplay between PccA and SenC is not only required for Cu delivery during cbb 3-Cox assembly, but that it also regulates Cu homeostasis in R. capsulatus.« less

Cooperation between two periplasmic copper chaperones is required for full activity of the cbb 3-type cytochrome c oxidase and copper homeostasis in Rhodobacter capsulatus

DOE PAGES

Trasnea, Petru -Iulian; Utz, Marcel; Khalfaoui-Hassani, Bahia; ...

2016-02-28

Copper (Cu) is an essential micronutrient that functions as a cofactor in several important enzymes, like respiratory heme-copper oxygen reductases. Yet, Cu is also toxic and therefore cells engage a highly coordinated Cu uptake and delivery system to prevent the accumulation of toxic Cu concentrations. In the current work we analyzed Cu delivery to the cbb 3-type cytochrome c oxidase ( cbb 3-Cox) of Rhodobacter capsulatus. We identified the PCu AC-like periplasmic chaperone PccA and analyzed its contribution to cbb 3-Cox assembly. Our data demonstrate that PccA is a Cu-binding protein with a preference for Cu(I), which is required formore » efficient cbb 3-Cox assembly, in particular at low Cu concentrations. By using in vivo and in vitro crosslinking we show that PccA forms a complex with the Sco1-homologue SenC. This complex is stabilized in the absence of the cbb 3-Cox specific assembly factors CcoGHIS. In cells lacking SenC, the cytoplasmic Cu content is significantly increased, but the simultaneous absence of PccA prevents this Cu accumulation. Lastly, these data demonstrate that the interplay between PccA and SenC is not only required for Cu delivery during cbb 3-Cox assembly, but that it also regulates Cu homeostasis in R. capsulatus.« less

Copper and the oxidation of hemoglobin: a comparison of horse and human hemoglobins.

PubMed

Rifkind, J M; Lauer, L D; Chiang, S C; Li, N C

1976-11-30

Oxidation studies of hemoglobin by Cu(II) indicate that for horse hemoglobin, up to a Cu(II)/heme molar ratio of 0.5, all of the Cu(II) added is used to rapidly oxidize the heme. On the other hand, most of the Cu(II) added to human hemoglobin at low Cu(II)/heme molar ratios is unable to oxidize the heme. Only at Cu(II)/heme molar ratios greater than 0.5 does the amount of oxidation per added Cu(II) approach that of horse hemoglobin. At the same time, binding studies indicate that human hemoglobin has an additional binding site involving one copper for every two hemes, which has a higher copper affinity than the single horse hemoglobin binding site. The Cu(II) oxidation of human hemoglobin is explained utilizing this additional binding site by a mechanism where a transfer of electrons cannot occur between the heme and the Cu(II) bound to the high affinity human binding site. The electron transfer must involve the Cu(II) bound to the lower affinity human hemoglobin binding site, which is similar to the only horse hemoglobin site. The involvement of beta-2 histidine in the binding of this additional copper is indicated by a comparison of the amino acid sequences of various hemoglobins which possess the additional site, with the amino acid sequences of hemoglobins which do not possess the additional site. Zn(II), Hg(II), and N-ethylmaleimide (NEM) are found to decrease the Cu(II) oxidation of hemoglobin. The sulfhydryl reagents, Hg(II) and NEM, produce a very dramatic decrease in the rate of oxidation, which can only be explained by an effect on the rate for the actual transfer of electrons between the Cu(II) and the Fe(II). The effect of Zn(II) is much smaller and can, for the most part, be explained by the increased oxygen affinity, which affects the ligand dissociation process that must precede the electron transfer process.

Rapid assessment of human amylin aggregation and its inhibition by copper(II) ions by laser ablation electrospray ionization mass spectrometry with ion mobility separation

DOE PAGES

Li, Hang; Ha, Emmeline; Donaldson, Robert P.; ...

2015-09-09

Native electrospray ionization (ESI) mass spectrometry (MS) is often used to monitor noncovalent complex formation between peptides and ligands. The relatively low throughput of this technique, however, is not compatible with extensive screening. Laser ablation electrospray ionization (LAESI) MS combined with ion mobility separation (IMS) can analyze complex formation and provide conformation information within a matter of seconds. Islet amyloid polypeptide (IAPP) or amylin, a 37-amino acid residue peptide, is produced in pancreatic beta-cells through proteolytic cleavage of its prohormone. Both amylin and its precursor can aggregate and produce toxic oligomers and fibrils leading to cell death in the pancreasmore » that can eventually contribute to the development of type 2 diabetes mellitus. The inhibitory effect of the copper(II) ion on amylin aggregation has been recently discovered, but details of the interaction remain unknown. Finding other more physiologically tolerated approaches requires large scale screening of potential inhibitors. In this paper, we demonstrate that LAESI-IMS-MS can reveal the binding stoichiometry, copper oxidation state, and the dissociation constant of human amylin–copper(II) complex. The conformations of hIAPP in the presence of copper(II) ions were also analyzed by IMS, and preferential association between the β-hairpin amylin monomer and the metal ion was found. The copper(II) ion exhibited strong association with the —HSSNN– residues of the amylin. In the absence of copper(II), amylin dimers were detected with collision cross sections consistent with monomers of β-hairpin conformation. When copper(II) was present in the solution, no dimers were detected. Thus, the copper(II) ions disrupt the association pathway to the formation of β-sheet rich amylin fibrils. Using LAESI-IMS-MS for the assessment of amylin–copper(II) interactions demonstrates the utility of this technique for the high-throughput screening of potential inhibitors of amylin oligomerization and fibril formation. Finally and more generally, this rapid technique opens the door for high-throughput screening of potential inhibitors of amyloid protein aggregation.« less

Amyloid Plaques in PSAPP Mice Bind Less Metal than Plaques in Human Alzheimer's Disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leskovjan, A.; Lanzirotti, A; Miller, L

2009-01-01

Amyloid beta (A{Beta}) is the primary component of Alzheimer's disease (AD) plaques, a key pathological feature of the disease. Metal ions of zinc (Zn), copper (Cu), iron (Fe), and calcium (Ca) are elevated in human amyloid plaques and are thought to be involved in neurodegeneration. Transgenic mouse models of AD also exhibit amyloid plaques, but fail to exhibit the high degree of neurodegeneration observed in humans. In this study, we imaged the Zn, Cu, Fe, and Ca ion distribution in the PSAPP transgenic mouse model representing end-stage AD (N = 6) using synchrotron X-ray fluorescence (XRF) microprobe. In order tomore » account for differences in density in the plaques, the relative protein content was imaged with synchrotron Fourier transform infrared microspectroscopy (FTIRM) on the same samples. FTIRM results revealed a 61% increase in protein content in the plaques compared to the surrounding tissue. After normalizing to protein density, we found that the PSAPP plaques contained only a 29% increase in Zn and there was actually less Cu, Fe, and Ca in the plaque compared to the surrounding tissue. Since metal binding to A{beta} is thought to induce redox chemistry that is toxic to neurons, the reduced metal binding in PSAPP mice is consistent with the lack of neurodegeneration in these animals. These findings were in stark contrast to the high metal ion content observed in human AD plaques, further implicating the role of metal ions in human AD pathology.« less

Pulse-radiolysis studies on the interaction of one-electron reduced species with blue oxidases. Reduction of native and type-2-copper-depleted Vietnamese-lacquer-tree and Japanese-lacquer-tree laccases.

PubMed

O'Neill, P; Fielden, E M; Morpurgo, L; Agostinelli, E

1984-08-15

The interactions of one-electron reduced metronidazole (ArNO2.-) and O2.- with native and Type-2-copper-depleted Vietnamese- and Japanese-lacquer-tree laccases were studied in aqueous solution at pH 6.0 and 7.4 by using the technique of pulse radiolysis. On reaction with ArNO2.-, in the absence of O2, the holo- and the Type-2-copper-depleted proteins accept, with reduction of Type 1 copper, 2 and 1 reducing equivalents respectively. On reaction with O2.- of both holo- and Type-2-copper-depleted Vietnamese-lacquer-tree laccase, almost complete reduction of Type 1 copper was observed and, after completion of the reaction, some (less than 20%) reoxidation of Type 1 copper occurs. Reduction of Type 1 copper of the laccases by these one-electron donors occurs via a bimolecular step; however, the rate of reduction of Vietnamese-lacquer-tree laccase is over 10 times that of Japanese-lacquer-tree laccase. It is inferred that electrons enter the protein via Type 1 copper with, in the case of the holoprotein, subsequent rapid intramolecular transfer of 1 reducing equivalent within the protein. Furthermore it is suggested that intra-molecular electron transfer to Type 3 copper atoms is slow and, in the case of Type-2-copper-depleted protein, may not occur. This slow process may partially account for the variation of the catalytic activities of 'blue' oxidases.

Localization and Specification of Copper Ions in Biofilms on Corroding Copper Surfaces.

DTIC Science & Technology

1994-01-01

WW~nhi~. OC ;mmS 1 . Agency use unay (L-mUv umia. IA. "O" ,.ie. $3. Report Type and Dates Covered. I 1994 Final - Proceedings 4. Title and Subtitle. S...structure (XANES) techniques can be used to differentiate Cu’ 1 and Cu+2 species within biofilms attached to surfaces. Copper ions , uld not be... 1 The organism with associated polymer has been shown to bind copper ions from solution. Geesey et al.2 demonstrated that exopolymers produced by

Evolution and diversity of periplasmic proteins involved in copper homeostasis in gamma proteobacteria

PubMed Central

2012-01-01

Background Different systems contributing to copper homeostasis in bacteria have been described in recent years involving periplasmic and transport proteins that provide resistance via metal efflux to the extracellular media (CopA/Cue, Cus, Cut, and Pco). The participation of these proteins in the assembly of membrane, periplasmic and secreted cuproproteins has also been postulated. The integration and interrelation of these systems and their apparent redundancies are less clear since they have been studied in alternative systems. Based on the idea that cellular copper is not free but rather it is transferred via protein-protein interactions, we hypothesized that systems would coevolve and be constituted by set numbers of essential components. Results By the use of a phylogenomic approach we identified the distribution of 14 proteins previously characterized as members of homeostasis systems in the genomes of 268 gamma proteobacteria. Only 3% of the genomes presented the complete systems and 5% of them, all intracellular parasites, lacked the 14 genes. Surprisingly, copper homeostatic pathways did not behave as evolutionary units with particular species assembling different combinations of basic functions. The most frequent functions, and probably because of its distribution the most vital, were copper extrusion from the cytoplasm to the periplasm performed by CopA and copper export from the cytoplasm to the extracellular space performed by CusC, which along with the remaining 12 proteins, assemble in nine different functional repertoires. Conclusions These observations suggest complex evolutionary dynamics and still unexplored interactions to achieve copper homeostasis, challenging some of the molecular transport mechanism proposed for these systems. PMID:23122209

The trade-off of availability and growth inhibition through copper for the production of copper-dependent enzymes by Pichia pastoris.

PubMed

Balakumaran, Palanisamy Athiyaman; Förster, Jan; Zimmermann, Martin; Charumathi, Jayachandran; Schmitz, Andreas; Czarnotta, Eik; Lehnen, Mathias; Sudarsan, Suresh; Ebert, Birgitta E; Blank, Lars Mathias; Meenakshisundaram, Sankaranarayanan

2016-02-20

Copper is an essential chemical element for life as it is a part of prosthetic groups of enzymes including super oxide dismutase and cytochrome c oxidase; however, it is also toxic at high concentrations. Here, we present the trade-off of copper availability and growth inhibition of a common host used for copper-dependent protein production, Pichia pastoris. At copper concentrations ranging from 0.1 mM (6.35 mg/L) to 2 mM (127 mg/L), growth rates of 0.25 h(-1) to 0.16 h(-1) were observed with copper uptake of as high as 20 mgcopper/gCDW. The intracellular copper content was estimated by subtracting the copper adsorbed on the cell wall from the total copper concentration in the biomass. Higher copper concentrations led to stronger cell growth retardation and, at 10 mM (635 mg/L) and above, to growth inhibition. To test the determined copper concentration range for optimal recombinant protein production, a laccase gene from Aspergillus clavatus [EMBL: EAW07265.1] was cloned under the control of the constitutive glyceraldehyde-3-phosphate (GAP) dehydrogenase promoter for expression in P. pastoris. Notably, in the presence of copper, laccase expression improved the specific growth rate of P. pastoris. Although copper concentrations of 0.1 mM and 0.2 mM augmented laccase expression 4 times up to 3 U/mL compared to the control (0.75 U/mL), while higher copper concentrations resulted in reduced laccase production. An intracellular copper content between 1 and 2 mgcopper/gCDW was sufficient for increased laccase activity. The physiology of the yeast could be excluded as a reason for the stop of laccase production at moderate copper concentrations as no flux redistribution could be observed by (13)C-metabolic flux analysis. Copper and its pivotal role to sustain cellular functions is noteworthy. However, knowledge on its cellular accumulation, availability and distribution for recombinant protein production is limited. This study attempts to address one such challenge, which revealed the fact that intracellular copper accumulation influenced laccase production and should be considered for high protein expression of copper-dependent enzymes when using P. pastoris. The results are discussed in the context of P. pastoris as a general host for copper -dependent enzyme production.

Copper Import into the Mitochondrial Matrix in Saccharomyces cerevisiae Is Mediated by Pic2, a Mitochondrial Carrier Family Protein*

PubMed Central

Vest, Katherine E.; Leary, Scot C.; Winge, Dennis R.; Cobine, Paul A.

2013-01-01

Saccharomyces cerevisiae must import copper into the mitochondrial matrix for eventual assembly of cytochrome c oxidase. This copper is bound to an anionic fluorescent molecule known as the copper ligand (CuL). Here, we identify for the first time a mitochondrial carrier family protein capable of importing copper into the matrix. In vitro transport of the CuL into the mitochondrial matrix was saturable and temperature-dependent. Strains with a deletion of PIC2 grew poorly on copper-deficient non-fermentable medium supplemented with silver and under respiratory conditions when challenged with a matrix-targeted copper competitor. Mitochondria from pic2Δ cells had lower total mitochondrial copper and exhibited a decreased capacity for copper uptake. Heterologous expression of Pic2 in Lactococcus lactis significantly enhanced CuL transport into these cells. Therefore, we propose a novel role for Pic2 in copper import into mitochondria. PMID:23846699

Copper import into the mitochondrial matrix in Saccharomyces cerevisiae is mediated by Pic2, a mitochondrial carrier family protein.

PubMed

Vest, Katherine E; Leary, Scot C; Winge, Dennis R; Cobine, Paul A

2013-08-16

Saccharomyces cerevisiae must import copper into the mitochondrial matrix for eventual assembly of cytochrome c oxidase. This copper is bound to an anionic fluorescent molecule known as the copper ligand (CuL). Here, we identify for the first time a mitochondrial carrier family protein capable of importing copper into the matrix. In vitro transport of the CuL into the mitochondrial matrix was saturable and temperature-dependent. Strains with a deletion of PIC2 grew poorly on copper-deficient non-fermentable medium supplemented with silver and under respiratory conditions when challenged with a matrix-targeted copper competitor. Mitochondria from pic2Δ cells had lower total mitochondrial copper and exhibited a decreased capacity for copper uptake. Heterologous expression of Pic2 in Lactococcus lactis significantly enhanced CuL transport into these cells. Therefore, we propose a novel role for Pic2 in copper import into mitochondria.

Colorimetric detection of copper in water using a Schiff base derivative

NASA Astrophysics Data System (ADS)

Peralta Domínguez, D.; Ramos-Ortiz, G.; Maldonado, J. L.; Rodriguez, M.; Meneses-Nava, M. A.; Barbosa-Garcia, O.; Santillan, R.; Farfán, N.

2013-09-01

Organic molecular sensors have the advantage of being used through an easy, fast, economical and reliable optical method for detecting toxic metal ions in our environment. In this work, we present a simple but highly specific organic ligand compound 5-Chloro-2-((E)-((E)-3-(4-(dimethylamino)phenyl)allylidene)amino)phenol (L1) that acts as a colorimetric sensor for ions in a mixture of acetonitrile/water (ratio 10:1, v:v). Binding interaction between L1 and various metal-ions has been established by ultraviolet-visible spectroscopic measurements that indicate favorable coordination of the ligand with selective metal ions, particularly, with copper. These results showed that the electronic transition band shape of L1 change after binding with copper in aqueous solution. L1 exhibited binding-induced color changes from yellow to pink one detected by the naked eye. This new sensor presented 2.5 × 10-6 M as limit detection, even under the presence of other metal ions.

Spectral investigations on binding of DNA-CTMA complex with tetrameric copper phthalocyanines

NASA Astrophysics Data System (ADS)

Venkat, Narayanan; Haley, Joy E.; Swiger, Rachel; Zhu, Lei; Wei, Xiaoliang; Ouchen, Fahima; Grote, James G.

2013-10-01

The binding of DNA-CTMA (Deoxyribonucleic acid-cetyltrimethylammonium) complex with two tetrameric Copper Phthalocyanine (CuPc) systems, substituted with carboxylic acid (CuPc-COOH) and derivatized further as an imidazolium salt (CuPc-COOR), was investigated in dimethylsulfoxide (DMSO) solutions using UV/Visible Spectroscopy. Absorbance changes at 685 nm (Q band of the CuPc) were monitored as a function of DNA-CTMA added to the dye solution and stock concentrations of DNA-CTMA in DMSO were varied to facilitate observation of the full binding process. Our findings indicated that while binding with DNA-CTMA was more well-defined in the case of CuPc-COOH, the binding profile of the CuPc-COOR showed initial growth followed by decay in its Q-band absorbance which was indicative of a more complex binding mechanism involving the dye and DNA-CTMA. Preliminary findings from photophysical studies involving the CuPc tetramers and DNA-CTMA are also discussed in this paper.

ATP7B mediates vesicular sequestration of copper: insight into biliary copper excretion.

PubMed

Cater, Michael A; La Fontaine, Sharon; Shield, Kristy; Deal, Yolanda; Mercer, Julian F B

2006-02-01

The Wilson protein (ATP7B) regulates levels of systemic copper by excreting excess copper into bile. It is not clear whether ATP7B translocates excess intrahepatic copper directly across the canalicular membrane or sequesters this copper into exocytic vesicles, which subsequently fuse with canalicular membrane to expel their contents into bile. The aim of this study was to clarify the mechanism underlying ATP7B-mediated copper detoxification by investigating endogenous ATP7B localization in the HepG2 hepatoma cell line and its ability to mediate vesicular sequestration of excess intracellular copper. Immunofluorescence microscopy was used to investigate the effect of copper concentration on the localization of endogenous ATP7B in HepG2 cells. Copper accumulation studies to determine whether ATP7B can mediate vesicular sequestration of excess intracellular copper were performed using Chinese hamster ovary cells that exogenously expressed wild-type and mutant ATP7B proteins. In HepG2 cells, elevated copper levels stimulated trafficking of ATP7B to pericanalicular vesicles and not to the canalicular membrane as previously reported. Mutation of an endocytic retrieval signal in ATP7B caused the protein to constitutively localize to vesicles and not to the plasma membrane, suggesting that a vesicular compartment(s) is the final trafficking destination for ATP7B. Expression of wild-type and mutant ATP7B caused Chinese hamster ovary cells to accumulate copper in vesicles, which subsequently undergo exocytosis, releasing copper across the plasma membrane. This report provides compelling evidence that the primary mechanism of biliary copper excretion involves ATP7B-mediated vesicular sequestration of copper rather than direct copper translocation across the canalicular membrane.

Single and Combined Exposure to Zinc- and Copper-Containing Welding Fumes Lead to Asymptomatic Systemic Inflammation.

PubMed

Markert, Agnieszka; Baumann, Ralf; Gerhards, Benjamin; Gube, Monika; Kossack, Veronika; Kraus, Thomas; Brand, Peter

2016-02-01

Recently, it has been shown that exposure to welding fumes containing both zinc and copper leads to asymptomatic systemic inflammation in humans as shown by an increase of blood C-reactive protein. In the present study, it was investigated which metal is responsible for this effect. Fifteen healthy male subjects were exposed under controlled conditions to welding fumes containing either zinc, or copper, or copper and zinc. For each exposure blood C-reactive protein increased. Copper- and zinc-containing welding fumes are able to induce systemic inflammation.

Mechanistic studies of copper(II)-aminoglycoside mediated DNA damage and magnesium catalyzed nuclease activity of hammerhead ribozyme

NASA Astrophysics Data System (ADS)

Patwardhan, Anjali A.

The antibacterial activity of aminoglycosides stems from their high affinity binding to the 16S rRNA in bacteria resulting in inhibition of protein synthesis. Used to treat acute bacterial infections these antibiotics have limited applications due to their high dosage requirements and the emergence of resistant strains. We have synthesized and characterized Cu(II) derivatives of the aminoglycosides, kanamycin A, tobramycin, neamine, kanamycin B, neomycin B, and paromomycin. The first three exhibit preferential and tight binding to Cu(II) as against neomycin B and kanamycin B and paromomycin. EPR of frozen solutions and UV-visible spectroscopy suggest a change in geometry around the Cu(II) but the stabilities of the complexes in water differ. These copper derivatives efficiently cleave plasmid DNA at micromolar concentrations (hydrolytic) and at nanomolar concentrations in the presence co-reactants like hydrogen peroxide or ascorbic acid. Hydrolysis is multi turnover and exhibits Michelis-Menten kinetics with enzyme-like behavior whereas oxidative cleavage is highly specific with C-4' H abstraction resulting in characteristic base propenal and nucleotide base products. Hydroxyl radicals generated are copper based and are generated in close proximity of the substrate. Hammerhead ribozymes are selectively hydrolyzed in the presence of divalent ions with Mg2+ being the metal ion of choice in vivo . Our studies with complex ions like cobalt hexaammine and fac-triamminetriaquochromium(III) establish outer sphere interactions of Mg2+ with the hammerhead in the catalytic site. There are two sets of sites, one structural and one catalytic. Complex ions in the catalytic site and divalent ions in the structural site result in a slow but active hammerhead ribozyme suggesting that the complex ions are not inhibitory, contrary to what was suggested previously.

Structural and electronic snapshots during the transition from a Cu(II) to Cu(I) metal center of a lytic polysaccharide monooxygenase by X-ray photoreduction.

PubMed

Gudmundsson, Mikael; Kim, Seonah; Wu, Miao; Ishida, Takuya; Momeni, Majid Hadadd; Vaaje-Kolstad, Gustav; Lundberg, Daniel; Royant, Antoine; Ståhlberg, Jerry; Eijsink, Vincent G H; Beckham, Gregg T; Sandgren, Mats

2014-07-04

Lytic polysaccharide monooxygenases (LPMOs) are a recently discovered class of enzymes that employ a copper-mediated, oxidative mechanism to cleave glycosidic bonds. The LPMO catalytic mechanism likely requires that molecular oxygen first binds to Cu(I), but the oxidation state in many reported LPMO structures is ambiguous, and the changes in the LPMO active site required to accommodate both oxidation states of copper have not been fully elucidated. Here, a diffraction data collection strategy minimizing the deposited x-ray dose was used to solve the crystal structure of a chitin-specific LPMO from Enterococcus faecalis (EfaCBM33A) in the Cu(II)-bound form. Subsequently, the crystalline protein was photoreduced in the x-ray beam, which revealed structural changes associated with the conversion from the initial Cu(II)-oxidized form with two coordinated water molecules, which adopts a trigonal bipyramidal geometry, to a reduced Cu(I) form in a T-shaped geometry with no coordinated water molecules. A comprehensive survey of Cu(II) and Cu(I) structures in the Cambridge Structural Database unambiguously shows that the geometries observed in the least and most reduced structures reflect binding of Cu(II) and Cu(I), respectively. Quantum mechanical calculations of the oxidized and reduced active sites reveal little change in the electronic structure of the active site measured by the active site partial charges. Together with a previous theoretical investigation of a fungal LPMO, this suggests significant functional plasticity in LPMO active sites. Overall, this study provides molecular snapshots along the reduction process to activate the LPMO catalytic machinery and provides a general method for solving LPMO structures in both copper oxidation states. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

In-cell NMR reveals potential precursor of toxic species from SOD1 fALS mutants

NASA Astrophysics Data System (ADS)

Luchinat, Enrico; Barbieri, Letizia; Rubino, Jeffrey T.; Kozyreva, Tatiana; Cantini, Francesca; Banci, Lucia

2014-11-01

Mutations in the superoxide dismutase 1 (SOD1) gene are related to familial cases of amyotrophic lateral sclerosis (fALS). Here we exploit in-cell NMR to characterize the protein folding and maturation of a series of fALS-linked SOD1 mutants in human cells and to obtain insight into their behaviour in the cellular context, at the molecular level. The effect of various mutations on SOD1 maturation are investigated by changing the availability of metal ions in the cells, and by coexpressing the copper chaperone for SOD1, hCCS. We observe for most of the mutants the occurrence of an unstructured SOD1 species, unable to bind zinc. This species may be a common precursor of potentially toxic oligomeric species, that are associated with fALS. Coexpression of hCCS in the presence of copper restores the correct maturation of the SOD1 mutants and prevents the formation of the unstructured species, confirming that hCCS also acts as a molecular chaperone.

Signal transduction in neurons: effects of cellular prion protein on fyn kinase and ERK1/2 kinase.

PubMed

Tomasi, Vittorio

2010-12-16

It has been reported that cellular prion protein (PrPc) co-localizes with caveolin-1 and participates to signal transduction events by recruiting Fyn kinase. As PrPc is a secreted protein anchored to the outer surface membrane through a glycosylphosphatidylinositol (GPI) anchor (secPrP) and caveolin-1 is located in the inner leaflet of plasma membrane, there is a problem of how the two proteins can physically interact each other and transduce signals. By using the GST-fusion proteins system we observed that PrPc strongly interacts with caveolin-1 scaffolding domain and with a caveolin-1 hydrophilic C-terminal region, but not with the caveolin-1 N-terminal region. In vitro binding experiments were also performed to define the site(s) of PrPc interacting with cav-1. The results are consistent with a participation of PrPc octapeptide repeats motif in the binding to caveolin-1 scaffolding domain. The caveolar localization of PrPc was ascertained by co-immunoprecipitation, by co-localization after flotation in density gradients and by confocal microscopy analysis of PrPc and caveolin-1 distributions in a neuronal cell line (GN11) expressing caveolin-1 at high levels. We observed that, after antibody-mediated cross-linking or copper treatment, PrPc was internalized probably into caveolae. We propose that following translocation from rafts to caveolae or caveolae-like domains, secPrP could interact with caveolin-1 and induce signal transduction events.

Physiological serum copper concentrations found in malignancies cause unfolding induced aggregation of human serum albumin in vitro.

PubMed

Rizvi, Asim; Furkan, Mohd; Naseem, Imrana

2017-12-15

Malignancies are characterized by several drastic metabolic changes, one of which is a progressive rise in the levels of serum copper. This rise in serum copper is documented across all malignancies and across malignancies in several species. This study aims to explore in vitro the effect of increased copper levels on the structure of the blood protein human serum albumin. Exposure of human serum albumin to physiologically relevant copper concentrations for 21 days resulted in structural modifications in the protein which were evident by changes in the intrinsic florescence. A loss of the predominantly alpha helical structure of human serum albumin was recorded along with a tendency to form protein aggregates. This aggregation was characterized by Thioflavin T and Congo Red assays. Rayleigh light scattering and turbidity assays confirmed aggregation. The aggregates were visually confirmed using transmission electron microscopy. This is the first report implicating increased copper levels as a cause of aggregation of blood proteins in malignancies. The physiological and biochemical implications of this phenomenon are discussed. Copyright © 2017. Published by Elsevier Inc.

Molecular cloning, expression, and functional analysis of the copper amine oxidase gene in the endophytic fungus Shiraia sp. Slf14 from Huperzia serrata.

PubMed

Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du

2016-12-01

Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.

Turning tumor-promoting copper into an anti-cancer weapon via high-throughput chemistry.

PubMed

Wang, F; Jiao, P; Qi, M; Frezza, M; Dou, Q P; Yan, B

2010-01-01

Copper is an essential element for multiple biological processes. Its concentration is elevated to a very high level in cancer tissues for promoting cancer development through processes such as angiogenesis. Organic chelators of copper can passively reduce cellular copper and serve the role as inhibitors of angiogenesis. However, they can also actively attack cellular targets such as proteasome, which plays a critical role in cancer development and survival. The discovery of such molecules initially relied on a step by step synthesis followed by biological assays. Today high-throughput chemistry and high-throughput screening have significantly expedited the copper-binding molecules discovery to turn "cancer-promoting" copper into anti-cancer agents.

Molecular Diagnostics of Copper-Transporting Protein Mutations Allows Early Onset Individual Therapy of Menkes Disease.

PubMed

Králík, L; Flachsová, E; Hansíková, H; Saudek, V; Zeman, J; Martásek, P

2017-01-01

Menkes disease is a severe X-linked recessive disorder caused by a defect in the ATP7A gene, which encodes a membrane copper-transporting ATPase. Deficient activity of the ATP7A protein results in decreased intestinal absorption of copper, low copper level in serum and defective distribution of copper in tissues. The clinical symptoms are caused by decreased activities of copper-dependent enzymes and include neurodegeneration, connective tissue disorders, arterial changes and hair abnormalities. Without therapy, the disease is fatal in early infancy. Rapid diagnosis of Menkes disease and early start of copper therapy is critical for the effectiveness of treatment. We report a molecular biology-based strategy that allows early diagnosis of copper transport defects and implementation of individual therapies before the full development of pathological symptoms. Low serum copper and decreased activity of copperdependent mitochondrial cytochrome c oxidase in isolated platelets found in three patients indicated a possibility of functional defects in copper-transporting proteins, especially in the ATPA7 protein, a copper- transporting P-type ATPase. Rapid mutational screening of the ATP7A gene using high-resolution melting analysis of DNA indicated presence of mutations in the patients. Molecular investigation for mutations in the ATP7A gene revealed three nonsense mutations: c.2170C>T (p.Gln724Ter); c.3745G>T (p.Glu1249Ter); and c.3862C>T (p.Gln1288Ter). The mutation c.3745G>T (p.Glu1249Ter) has not been identified previously. Molecular analysis of the ATOX1 gene as a possible modulating factor of Menkes disease did not reveal presence of pathogenic mutations. Molecular diagnostics allowed early onset of individual therapies, adequate genetic counselling and prenatal diagnosis in the affected families.

Metal dealing at the origin of the Chordata phylum: the metallothionein system and metal overload response in amphioxus.

PubMed

Guirola, Maria; Pérez-Rafael, Sílvia; Capdevila, Mercè; Palacios, Oscar; Atrian, Sílvia

2012-01-01

Non-vertebrate chordates, specifically amphioxus, are considered of the utmost interest for gaining insight into the evolutionary trends, i.e. differentiation and specialization, of gene/protein systems. In this work, MTs (metallothioneins), the most important metal binding proteins, are characterized for the first time in the cephalochordate subphylum at both gene and protein level, together with the main features defining the amphioxus response to cadmium and copper overload. Two MT genes (BfMT1 and BfMT2) have been identified in a contiguous region of the genome, as well as several ARE (antioxidant response element) and MRE (metal response element) located upstream the transcribed region. Their corresponding cDNAs exhibit identical sequence in the two lancelet species (B. floridae and B. lanceolatum), BfMT2 cDNA resulting from an alternative splicing event. BfMT1 is a polyvalent metal binding peptide that coordinates any of the studied metal ions (Zn, Cd or Cu) rendering complexes stable enough to last in physiological environments, which is fully concordant with the constitutive expression of its gene, and therefore, with a metal homeostasis housekeeping role. On the contrary, BfMT2 exhibits a clear ability to coordinate Cd(II) ions, while it is absolutely unable to fold into stable Cu (I) complexes, even as mixed species. This identifies it as an essential detoxification agent, which is consequently only induced in emergency situations. The cephalochordate MTs are not directly related to vertebrate MTs, neither by gene structure, protein similarity nor metal-binding behavior of the encoded peptides. The closest relative is the echinoderm MT, which confirm proposed phylogenetic relationships between these two groups. The current findings support the existence in most organisms of two types of MTs as for their metal binding preferences, devoted to different biological functions: multivalent MTs for housekeeping roles, and specialized MTs that evolve either as Cd-thioneins or Cu-thioneins, according to the ecophysiological needs of each kind of organisms.

Metal Dealing at the Origin of the Chordata Phylum: The Metallothionein System and Metal Overload Response in Amphioxus

PubMed Central

Capdevila, Mercè; Palacios, Òscar; Atrian, Sílvia

2012-01-01

Non-vertebrate chordates, specifically amphioxus, are considered of the utmost interest for gaining insight into the evolutionary trends, i.e. differentiation and specialization, of gene/protein systems. In this work, MTs (metallothioneins), the most important metal binding proteins, are characterized for the first time in the cephalochordate subphylum at both gene and protein level, together with the main features defining the amphioxus response to cadmium and copper overload. Two MT genes (BfMT1 and BfMT2) have been identified in a contiguous region of the genome, as well as several ARE (antioxidant response element) and MRE (metal response element) located upstream the transcribed region. Their corresponding cDNAs exhibit identical sequence in the two lancelet species (B. floridae and B. lanceolatum), BfMT2 cDNA resulting from an alternative splicing event. BfMT1 is a polyvalent metal binding peptide that coordinates any of the studied metal ions (Zn, Cd or Cu) rendering complexes stable enough to last in physiological environments, which is fully concordant with the constitutive expression of its gene, and therefore, with a metal homeostasis housekeeping role. On the contrary, BfMT2 exhibits a clear ability to coordinate Cd(II) ions, while it is absolutely unable to fold into stable Cu (I) complexes, even as mixed species. This identifies it as an essential detoxification agent, which is consequently only induced in emergency situations. The cephalochordate MTs are not directly related to vertebrate MTs, neither by gene structure, protein similarity nor metal-binding behavior of the encoded peptides. The closest relative is the echinoderm MT, which confirm proposed phylogenetic relationships between these two groups. The current findings support the existence in most organisms of two types of MTs as for their metal binding preferences, devoted to different biological functions: multivalent MTs for housekeeping roles, and specialized MTs that evolve either as Cd-thioneins or Cu-thioneins, according to the ecophysiological needs of each kind of organisms. PMID:22905252

Barley Metallothioneins: MT3 and MT4 Are Localized in the Grain Aleurone Layer and Show Differential Zinc Binding1[W][OA

PubMed Central

Hegelund, Josefine Nymark; Schiller, Michaela; Kichey, Thomas; Hansen, Thomas Hesselhøj; Pedas, Pai; Husted, Søren; Schjoerring, Jan Kofod

2012-01-01

Metallothioneins (MTs) are low-molecular-weight, cysteine-rich proteins believed to play a role in cytosolic zinc (Zn) and copper (Cu) homeostasis. However, evidence for the functional properties of MTs has been hampered by methodological problems in the isolation and characterization of the proteins. Here, we document that barley (Hordeum vulgare) MT3 and MT4 proteins exist in planta and that they differ in tissue localization as well as in metal coordination chemistry. Combined transcriptional and histological analyses showed temporal and spatial correlations between transcript levels and protein abundance during grain development. MT3 was present in tissues of both maternal and filial origin throughout grain filling. In contrast, MT4 was confined to the embryo and aleurone layer, where it appeared during tissue specialization and remained until maturity. Using state-of-the-art speciation analysis by size-exclusion chromatography inductively coupled plasma mass spectrometry and electrospray ionization time-of-flight mass spectrometry on recombinant MT3 and MT4, their specificity and capacity for metal ion binding were quantified, showing a strong preferential Zn binding relative to Cu and cadmium (Cd) in MT4, which was not the case for MT3. When complementary DNAs from barley MTs were expressed in Cu- or Cd-sensitive yeast mutants, MT3 provided a much stronger complementation than did MT4. We conclude that MT3 may play a housekeeping role in metal homeostasis, while MT4 may function in Zn storage in developing and mature grains. The localization of MT4 and its discrimination against Cd make it an ideal candidate for future biofortification strategies directed toward increasing food and feed Zn concentrations. PMID:22582132

Barley metallothioneins: MT3 and MT4 are localized in the grain aleurone layer and show differential zinc binding.

PubMed

Hegelund, Josefine Nymark; Schiller, Michaela; Kichey, Thomas; Hansen, Thomas Hesselhøj; Pedas, Pai; Husted, Søren; Schjoerring, Jan Kofod

2012-07-01

Metallothioneins (MTs) are low-molecular-weight, cysteine-rich proteins believed to play a role in cytosolic zinc (Zn) and copper (Cu) homeostasis. However, evidence for the functional properties of MTs has been hampered by methodological problems in the isolation and characterization of the proteins. Here, we document that barley (Hordeum vulgare) MT3 and MT4 proteins exist in planta and that they differ in tissue localization as well as in metal coordination chemistry. Combined transcriptional and histological analyses showed temporal and spatial correlations between transcript levels and protein abundance during grain development. MT3 was present in tissues of both maternal and filial origin throughout grain filling. In contrast, MT4 was confined to the embryo and aleurone layer, where it appeared during tissue specialization and remained until maturity. Using state-of-the-art speciation analysis by size-exclusion chromatography inductively coupled plasma mass spectrometry and electrospray ionization time-of-flight mass spectrometry on recombinant MT3 and MT4, their specificity and capacity for metal ion binding were quantified, showing a strong preferential Zn binding relative to Cu and cadmium (Cd) in MT4, which was not the case for MT3. When complementary DNAs from barley MTs were expressed in Cu- or Cd-sensitive yeast mutants, MT3 provided a much stronger complementation than did MT4. We conclude that MT3 may play a housekeeping role in metal homeostasis, while MT4 may function in Zn storage in developing and mature grains. The localization of MT4 and its discrimination against Cd make it an ideal candidate for future biofortification strategies directed toward increasing food and feed Zn concentrations.

A copper(I) dye-sensitised TiO2-based system for efficient light harvesting and photoconversion of CO2 into hydrocarbon fuel.

PubMed

Yuan, Yong-Jun; Yu, Zhen-Tao; Zhang, Ji-Yuan; Zou, Zhi-Gang

2012-08-28

A new copper(I) complex with the ability to bind to TiO(2) was synthesised and successfully employed as a solar cell sensitizer. Furthermore, we demonstrated that the copper(I) dye-sensitised TiO(2)-based photocatalyst exhibits impressive effectiveness for the selective photoreduction of CO(2) to CH(4) under visible light.

Copper Metallochaperones

PubMed Central

Robinson, Nigel J.; Winge, Dennis R.

2014-01-01

The current state of knowledge on how copper metallochaperones support the maturation of cuproproteins is reviewed. Copper is needed within mitochondria to supply the CuA and intramembrane CuB sites of cytochrome oxidase, within the trans-Golgi network to supply secreted cuproproteins and within the cytosol to supply superoxide dismutase 1 (Sod1). Subpopulations of copper-zinc superoxide dismutase also localize to mitochondria, the secretory system, the nucleus and, in plants, the chloroplast, which also requires copper for plastocyanin. Prokaryotic cuproproteins are found in the cell membrane and in the periplasm of gram-negative bacteria. Cu(I) and Cu(II) form tight complexes with organic molecules and drive redox chemistry, which unrestrained would be destructive. Copper metallochaperones assist copper in reaching vital destinations without inflicting damage or becoming trapped in adventitious binding sites. Copper ions are specifically released from copper metallochaperones upon contact with their cognate cuproproteins and metal transfer is thought to proceed by ligand substitution. PMID:20205585

Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici

PubMed Central

Feng, Bao Zhen; Li, Peiqian

2014-01-01

Laccases are blue copper oxidases (E.C. 1.10.3.2) that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. A novel laccase gene pclac2 and its corresponding full-length cDNA were cloned and characterized from Phytophthora capsici for the first time. The 1683 bp full-length cDNA of pclac2 encoded a mature laccase protein containing 560 amino acids preceded by a signal peptide of 23 amino acids. The deduced protein sequence of PCLAC2 showed high similarity with other known fungal laccases and contained four copper-binding conserved domains of typical laccase protein. In order to achieve a high level secretion and full activity expression of PCLAC2, expression vector pPIC9K with the Pichia pastoris expression system was used. The recombinant PCLAC2 protein was purified and showed on SDS-PAGE as a single band with an apparent molecular weight ca. 68 kDa. The high activity of purified PCLAC2, 84 U/mL, at the seventh day induced with methanol, was observed with 2,2′-azino-di-(3-ethylbenzothialozin-6-sulfonic acid) (ABTS) as substrate. The optimum pH and temperature for ABTS were 4.0 and 30 °C, respectively. The reported data add a new piece to the knowledge about P. Capsici laccase multigene family and shed light on potential function about biotechnological and industrial applications of the individual laccase isoforms in oomycetes. PMID:24948955

Proteomic analysis of acute responses to copper sulfate stress in larvae of the brine shrimp, Artemia sinica

NASA Astrophysics Data System (ADS)

Zhou, Qian; Wu, Changgong; Dong, Bo; Li, Fuhua; Liu, Fengqi; Xiang, Jianhai

2010-03-01

Proteomics was used to reveal the differential protein expression profiles of acute responses to copper sulfate exposure in larvae of Artemia sinica. Fourteen differentially displayed protein spots were detected and seven of them were identified. Three spots were up-expressed and identified: actin, heat shock protein 70, and chaperone subunit 1; three down-regulated proteins were identified: arginine kinase, elongation factor-2, and glycine-rich protein; and a newly expressed protein was identified as peroxiredoxin. The study indicates the involvement of all the differentially expressed proteins in the early responses of protein expression, and in the survival of A. sinica in the presence of copper and other heavy metals; the findings improve understanding of the organism’s adaptive responses and resistance.

Resistance mechanisms of Mycobacterium tuberculosis against phagosomal copper overload

PubMed Central

Rowland, Jennifer L.; Niederweis, Michael

2012-01-01

SUMMARY Mycobacterium tuberculosis is an important bacterial pathogen with an extremely slow growth rate, an unusual outer membrane of very low permeability and a cunning ability to survive inside the human host despite a potent immune response. A key trait of M. tuberculosis is to acquire essential nutrients while still preserving its natural resistance to toxic compounds. In this regard, copper homeostasis mechanisms are particularly interesting, because copper is an important element for bacterial growth, but copper overload is toxic. In M. tuberculosis at least two enzymes require copper as a cofactor: the Cu/Zn-superoxide dismutase SodC and the cytochrome c oxidase which is essential for growth in vitro. Mutants of M. tuberculosis lacking the copper metallothionein MymT, the efflux pump CtpV and the membrane protein MctB are more susceptible to copper indicating that these proteins are part of a multipronged system to balance intracellular copper levels. Recent evidence showed that part of copper toxicity is a reversible damage of accessible Fe-S clusters of dehydratases and the displacement of other divalent cations such as zinc and manganese as cofactors in proteins. There is accumulating evidence that macrophages use copper to poison bacteria trapped inside phagosomes. Here, we review the rapidly increasing knowledge about copper homeostasis mechanisms in M. tuberculosis and contrast those with similar mechanisms in E. coli. These findings reveal an intricate interplay between the host which aims to overload the phagosome with copper and M. tuberculosis which utilizes several mechanisms to reduce the toxic effects of excess copper. PMID:22361385

Neuronal differentiation is associated with a redox-regulated increase of copper flow to the secretory pathway

PubMed Central

Hatori, Yuta; Yan, Ye; Schmidt, Katharina; Furukawa, Eri; Hasan, Nesrin M.; Yang, Nan; Liu, Chin-Nung; Sockanathan, Shanthini; Lutsenko, Svetlana

2016-01-01

Brain development requires a fine-tuned copper homoeostasis. Copper deficiency or excess results in severe neuro-pathologies. We demonstrate that upon neuronal differentiation, cellular demand for copper increases, especially within the secretory pathway. Copper flow to this compartment is facilitated through transcriptional and metabolic regulation. Quantitative real-time imaging revealed a gradual change in the oxidation state of cytosolic glutathione upon neuronal differentiation. Transition from a broad range of redox states to a uniformly reducing cytosol facilitates reduction of the copper chaperone Atox1, liberating its metal-binding site. Concomitantly, expression of Atox1 and its partner, a copper transporter ATP7A, is upregulated. These events produce a higher flux of copper through the secretory pathway that balances copper in the cytosol and increases supply of the cofactor to copper-dependent enzymes, expression of which is elevated in differentiated neurons. Direct link between glutathione oxidation and copper compartmentalization allows for rapid metabolic adjustments essential for normal neuronal function. PMID:26879543

Neuronal differentiation is associated with a redox-regulated increase of copper flow to the secretory pathway.

PubMed

Hatori, Yuta; Yan, Ye; Schmidt, Katharina; Furukawa, Eri; Hasan, Nesrin M; Yang, Nan; Liu, Chin-Nung; Sockanathan, Shanthini; Lutsenko, Svetlana

2016-02-16

Brain development requires a fine-tuned copper homoeostasis. Copper deficiency or excess results in severe neuro-pathologies. We demonstrate that upon neuronal differentiation, cellular demand for copper increases, especially within the secretory pathway. Copper flow to this compartment is facilitated through transcriptional and metabolic regulation. Quantitative real-time imaging revealed a gradual change in the oxidation state of cytosolic glutathione upon neuronal differentiation. Transition from a broad range of redox states to a uniformly reducing cytosol facilitates reduction of the copper chaperone Atox1, liberating its metal-binding site. Concomitantly, expression of Atox1 and its partner, a copper transporter ATP7A, is upregulated. These events produce a higher flux of copper through the secretory pathway that balances copper in the cytosol and increases supply of the cofactor to copper-dependent enzymes, expression of which is elevated in differentiated neurons. Direct link between glutathione oxidation and copper compartmentalization allows for rapid metabolic adjustments essential for normal neuronal function.

Covalent attachment of Arc repressor subunits by a peptide linker enhances affinity for operator DNA.

PubMed

Robinson, C R; Sauer, R T

1996-01-09

By designing a recombinant gene containing tandem copies of the arc coding sequence with intervening DNA encoding the linker sequence GGGSGGGTGGGSGGG, the two subunits of the P22 Are repressor dimer have been covalently linked to form a single-chain protein called Arc-L1-Arc. The 15-residue linker joins the C-terminus of one monomer to the N-terminus of the second, a distance of approximately 45 A in the Arc-operator cocrystal structure. Arc-L1-Arc is expressed at high levels in Escherichia coli, with no evidence of degradation or proteolytic clipping of the linker, and is more active than wild-type Arc in repression assays. The purified Arc-L1-Arc protein has the molecular weight expected for the designed protein and unfolds cooperatively, reversibly, and with no concentration dependence in thermal-denaturation studies. Arc-L1-Arc protects operator DNA in a manner indistinguishable from that of wild-type Arc in DNase I and copper-phenanthroline footprinting studies, but the covalent attachment of the two monomers results in enhanced affinity for operator DNA. Arc-L1-Arc binds operator DNA half-maximally at a concentration of 1.7 pM, compared with the wild-type value of 185 pM, and also binds DNA fragments containing the left or right operator half-sites more tightly than wild type. Because wild-type Arc is monomeric at sub-nanomolar concentrations and must dimerize before binding to the operator, it was anticipated that Arc-L1-Arc would exhibit a lower half-maximal binding concentration. However, even when the change from a monomeric to a dimeric species is taken into account, the affinity of Arc-L1-Arc for operator and half-operator DNA is greater than the wild-type affinity. This tighter binding appears to result from slower dissociation, as Arc-L1-Arc DNA complexes with full or half-site operators dissociate at rates 5-10 times slower than the corresponding Arc--DNA complexes. Hence, the activity of the designed Arc-L1-Arc protein is substantially increased relative to wild-type Arc in a variety of assays.

A P2X receptor from the tardigrade species Hypsibius dujardini with fast kinetics and sensitivity to zinc and copper.

PubMed

Bavan, Selvan; Straub, Volko A; Blaxter, Mark L; Ennion, Steven J

2009-01-20

Orthologs of the vertebrate ATP gated P2X channels have been identified in Dictyostelium and green algae, demonstrating that the emergence of ionotropic purinergic signalling was an early event in eukaryotic evolution. However, the genomes of a number of animals including Drosophila melanogaster and Caenorhabditis elegans, both members of the Ecdysozoa superphylum, lack P2X-like proteins, whilst other species such as the flatworm Schistosoma mansoni have P2X proteins making it unclear as to what stages in evolution P2X receptors were lost. Here we describe the functional characterisation of a P2X receptor (HdP2X) from the tardigrade Hypsibius dujardini demonstrating that purinergic signalling is preserved in some ecdysozoa. ATP (EC50 approximately 44.5 microM) evoked transient inward currents in HdP2X with millisecond rates of activation and desensitisation. HdP2X is antagonised by pyridoxal-phosphate-6-azophenyl-2',4' disulfonic acid (IC50 15.0 microM) and suramin (IC50 22.6 microM) and zinc and copper inhibit ATP-evoked currents with IC50 values of 62.8 microM and 19.9 microM respectively. Site-directed mutagenesis showed that unlike vertebrate P2X receptors, extracellular histidines do not play a major role in coordinating metal binding in HdP2X. However, H306 was identified as playing a minor role in the actions of copper but not zinc. Ivermectin potentiated responses to ATP with no effect on the rates of current activation or decay. The presence of a P2X receptor in a tardigrade species suggests that both nematodes and arthropods lost their P2X genes independently, as both traditional and molecular phylogenies place the divergence between Nematoda and Arthropoda before their divergence from Tardigrada. The phylogenetic analysis performed in our study also clearly demonstrates that the emergence of the family of seven P2X channels in human and other mammalian species was a relatively recent evolutionary event that occurred subsequent to the split between vertebrates and invertebrates. Furthermore, several characteristics of HdP2X including fast kinetics with low ATP sensitivity, potentiation by ivermectin in a channel with fast kinetics and distinct copper and zinc binding sites not dependent on histidines make HdP2X a useful model for comparative structure-function studies allowing a better understanding of P2X receptors in higher organisms.

A P2X receptor from the tardigrade species Hypsibius dujardini with fast kinetics and sensitivity to zinc and copper

PubMed Central

Bavan, Selvan; Straub, Volko A; Blaxter, Mark L; Ennion, Steven J

2009-01-01

Background Orthologs of the vertebrate ATP gated P2X channels have been identified in Dictyostelium and green algae, demonstrating that the emergence of ionotropic purinergic signalling was an early event in eukaryotic evolution. However, the genomes of a number of animals including Drosophila melanogaster and Caenorhabditis elegans, both members of the Ecdysozoa superphylum, lack P2X-like proteins, whilst other species such as the flatworm Schistosoma mansoni have P2X proteins making it unclear as to what stages in evolution P2X receptors were lost. Here we describe the functional characterisation of a P2X receptor (HdP2X) from the tardigrade Hypsibius dujardini demonstrating that purinergic signalling is preserved in some ecdysozoa. Results ATP (EC50 ~44.5 μM) evoked transient inward currents in HdP2X with millisecond rates of activation and desensitisation. HdP2X is antagonised by pyridoxal-phosphate-6-azophenyl-2',4' disulfonic acid (IC50 15.0 μM) and suramin (IC50 22.6 μM) and zinc and copper inhibit ATP-evoked currents with IC50 values of 62.8 μM and 19.9 μM respectively. Site-directed mutagenesis showed that unlike vertebrate P2X receptors, extracellular histidines do not play a major role in coordinating metal binding in HdP2X. However, H306 was identified as playing a minor role in the actions of copper but not zinc. Ivermectin potentiated responses to ATP with no effect on the rates of current activation or decay. Conclusion The presence of a P2X receptor in a tardigrade species suggests that both nematodes and arthropods lost their P2X genes independently, as both traditional and molecular phylogenies place the divergence between Nematoda and Arthropoda before their divergence from Tardigrada. The phylogenetic analysis performed in our study also clearly demonstrates that the emergence of the family of seven P2X channels in human and other mammalian species was a relatively recent evolutionary event that occurred subsequent to the split between vertebrates and invertebrates. Furthermore, several characteristics of HdP2X including fast kinetics with low ATP sensitivity, potentiation by ivermectin in a channel with fast kinetics and distinct copper and zinc binding sites not dependent on histidines make HdP2X a useful model for comparative structure-function studies allowing a better understanding of P2X receptors in higher organisms. PMID:19154569

Arabidopsis copper transport protein COPT2 participates in the cross talk between iron deficiency responses and low-phosphate signaling.

PubMed

Perea-García, Ana; Garcia-Molina, Antoni; Andrés-Colás, Nuria; Vera-Sirera, Francisco; Pérez-Amador, Miguel A; Puig, Sergi; Peñarrubia, Lola

2013-05-01

Copper and iron are essential micronutrients for most living organisms because they participate as cofactors in biological processes, including respiration, photosynthesis, and oxidative stress protection. In many eukaryotic organisms, including yeast (Saccharomyces cerevisiae) and mammals, copper and iron homeostases are highly interconnected; yet, such interdependence is not well established in higher plants. Here, we propose that COPT2, a high-affinity copper transport protein, functions under copper and iron deficiencies in Arabidopsis (Arabidopsis thaliana). COPT2 is a plasma membrane protein that functions in copper acquisition and distribution. Characterization of the COPT2 expression pattern indicates a synergic response to copper and iron limitation in roots. We characterized a knockout of COPT2, copt2-1, that leads to increased resistance to simultaneous copper and iron deficiencies, measured as reduced leaf chlorosis and improved maintenance of the photosynthetic apparatus. We propose that COPT2 could play a dual role under iron deficiency. First, COPT2 participates in the attenuation of copper deficiency responses driven by iron limitation, possibly to minimize further iron consumption. Second, global expression analyses of copt2-1 versus wild-type Arabidopsis plants indicate that low-phosphate responses increase in the mutant. These results open up new biotechnological approaches to fight iron deficiency in crops.

Developing Anticancer Copper(II) Pro-drugs Based on the Nature of Cancer Cells and the Human Serum Albumin Carrier IIA Subdomain.

PubMed

Gou, Yi; Qi, Jinxu; Ajayi, Joshua-Paul; Zhang, Yao; Zhou, Zuping; Wu, Xiaoyang; Yang, Feng; Liang, Hong

2015-10-05

To synergistically enhance the selectivity and efficiency of anticancer copper drugs, we proposed and built a model to develop anticancer copper pro-drugs based on the nature of human serum albumin (HSA) IIA subdomain and cancer cells. Three copper(II) compounds of a 2-hydroxy-1-naphthaldehyde benzoyl hydrazone Schiff-base ligand in the presence pyridine, imidazole, or indazole ligands were synthesized (C1-C3). The structures of three HSA complexes revealed that the Cu compounds bind to the hydrophobic cavity in the HSA IIA subdomain. Among them, the pyridine and imidazole ligands of C1 and C2 are replaced by Lys199, and His242 directly coordinates with Cu(II). The indazole and Br ligands of C3 are replaced by Lys199 and His242, respectively. Compared with the Cu(II) compounds alone, the HSA complexes enhance cytotoxicity in MCF-7 cells approximately 3-5-fold, but do not raise cytotoxicity levels in normal cells in vitro through selectively accumulating in cancer cells to some extent. We find that the HSA complex has a stronger capacity for cell cycle arrest in the G2/M phase of MCF-7 by targeting cyclin-dependent kinase 1 (CDK1) and down-regulating the expression of CDK1 and cyclin B1. Moreover, the HSA complex promotes MCF-7 cell apoptosis possibly through the intrinsic reactive oxygen species (ROS) mediated mitochondrial pathway, accompanied by the regulation of Bcl-2 family proteins.

Refolding of laccase in dilution additive mode with copper-based ionic liquid.

PubMed

Bae, Sang-Woo; Ahn, Kihun; Koo, Yoon-Mo; Ha, Sung Ho

2013-11-01

Ionic liquids (ILs) are molten salts which do not crystallize at room temperature. Tunable physicochemical properties of ILs including hydrophobicity and polarity facilitate their applications in many biological processes. In this study, a copper-based IL was employed in order to enhance the refolding efficiency of laccase from Trametes versicolor which requires copper as a cofactor. When 1-ethyl-3-methylimidazolium trichlorocuprate ([EMIM][CuCl₃]) was added to refolding buffer instead of urea, the laccase refolding yield was improved more than 2.7 times compared to the conventional refolding buffer which contains urea. When the refolding of laccase was carried out at different temperatures (4, 25, and 37 °C), the highest refolding yield was obtained at 25 °C. At low temperature, two conflicting effects, i.e., suppression of the aggregate formation and decrease of folding rate, influence the protein refolding. In contrast, a copper-based IL did not enhance the refolding of lysozyme, a non-copper-containing protein. From these results, we can conclude that this copper-based IL, [EMIM][CuCl₃], was exclusively effective on the refolding process of a copper-containing protein.

Role of the constant region domain in the structural diversity of human antibody light chains.

PubMed

Hifumi, Emi; Taguchi, Hiroaki; Kato, Ryuichi; Uda, Taizo

2017-04-01

Issues regarding the structural diversity (heterogeneity) of an antibody molecule have been the subject of discussion along with the development of antibody drugs. Research on heterogeneity has been extensive in recent years, but no clear solution has been reached. Heterogeneity is also observed in catalytic antibody κ light chains (CLs). In this study, we investigated how the constant region domain of CLs concerns structural diversity because it is a simple and good example for elucidating heterogeneity. By means of cation-exchange chromatography, SDS-PAGE, and 2-dimensional electrophoresis for the CL, multimolecular forms consisting of different electrical charges and molecular sizes coexisted in the solution, resulting in the similar heterogeneity of the full length of CLs. The addition of copper ion could cause the multimolecular forms to change to monomolecular forms. Copper ion contributed greatly to the enrichment of the dimer form of CL and the homogenization of the differently charged CLs. Two molecules of the CL protein bound one copper ion. The binding affinity of the ion was 48.0 μM -1 Several divalent metal ions were examined, but only zinc showed a similar effect.-Hifumi, E., Taguchi, H., Kato, R., Uda, T. Role of the constant region domain in the structural diversity of human antibody light chains. © FASEB.

Effects of preoperative oral carbohydrates and trace elements on perioperative nutritional status in elective surgery patients.

PubMed

Oyama, Yoshimasa; Iwasaka, Hideo; Shiihara, Keisuke; Hagiwara, Satoshi; Kubo, Nobuhiro; Fujitomi, Yutaka; Noguchi, Takayuki

2011-10-01

In order to enhance postoperative recovery, preoperative consumption of carbohydrate (CHO) drinks has been used to suppress metabolic fluctuations. Trace elements such as zinc and copper are known to play an important role in postoperative recovery. Here, we examined the effects of preoperatively consuming a CHO drink containing zinc and copper. Subjects were 122 elective surgery patients divided into two groups (overnight fasting and CHO groups); each group was further divided into morning or afternoon surgery groups. Subjects in the CHO group consumed 300 mL of a CHO drink the night before surgery, followed by 200 ml before morning surgery or 700 ml before afternoon surgery (> or =2 hours before anesthesia induction). Blood levels of glucose, nonesterified fatty acids (NEFA), retinol-binding protein, zinc, and copper were determined. One subject in the CHO group was excluded after refusing the drink. There were no adverse effects from the CHO drink. NEFA levels increased in the fasting groups. Although zinc levels increased in the CHO group immediately after anesthesia induction, no group differences were observed the day after surgery. Preoperative consumption of a CHO drink containing trace elements suppressed preoperative metabolic fluctuations without complications and prevented trace element deficiency. Further beneficial effects during the perioperative period can be expected by adding trace elements to CHO supplements.

The Structure of the Metal Transporter Tp34 and its Affinity for Divalent Metal Ions

NASA Astrophysics Data System (ADS)

Knutsen, Gregory; Deka, Ranjit; Brautigam, Chad; Tomchick, Diana; Machius, Mischa; Norgard, Michael

2007-10-01

Tp34 is periplasmic membrane protein of the nonculitvatable spirochete Treponema pallidum, the pathogen of syphillis. It was proposed that Tp34 is a divalent metal transporter, but the identity of the preferred metal ion(s) was unclear. In this study we investigated the ability of divalent metal ions to induce rTp34 dimerization using hydrodynamic techniques and determine the crystal structure of metal bound forms. Using analytical ultracentrifugation sedimentation velocity experiments, we determined that cobalt is superior to nickel at inducing the dimerization of rTp34. rTp34 was crystallized and selected crystals were incubated at a pH 7.5 with CuSO4 and NiSO4. Diffraction experiments were conducted and the processed electron density maps showed that copper was bound to the major metal binding site as well as to three additional minor binding sites. By contrast nickel was only bound to the major metal binding site in one monomer and to three additional minor sites. These results along with previous findings support evidence of Tp34 being involved with metal transport and/or iron utilization.

α-Conotoxin dendrimers have enhanced potency and selectivity for homomeric nicotinic acetylcholine receptors.

PubMed

Wan, Jingjing; Huang, Johnny X; Vetter, Irina; Mobli, Mehdi; Lawson, Joshua; Tae, Han-Shen; Abraham, Nikita; Paul, Blessy; Cooper, Matthew A; Adams, David J; Lewis, Richard J; Alewood, Paul F

2015-03-11

Covalently attached peptide dendrimers can enhance binding affinity and functional activity. Homogenous di- and tetravalent dendrimers incorporating the α7-nicotinic receptor blocker α-conotoxin ImI (α-ImI) with polyethylene glycol spacers were designed and synthesized via a copper-catalyzed azide-alkyne cycloaddition of azide-modified α-ImI to an alkyne-modified polylysine dendron. NMR and CD structural analysis confirmed that each α-ImI moiety in the dendrimers had the same 3D structure as native α-ImI. The binding of the α-ImI dendrimers to binding protein Ac-AChBP was measured by surface plasmon resonance and revealed enhanced affinity. Quantitative electrophysiology showed that α-ImI dendrimers had ∼100-fold enhanced potency at hα7 nAChRs (IC50 = 4 nM) compared to native α-ImI (IC50 = 440 nM). In contrast, no significant potency enhancement was observed at heteromeric hα3β2 and hα9α10 nAChRs. These findings indicate that multimeric ligands can significantly enhance conotoxin potency and selectivity at homomeric nicotinic ion channels.

Crystal structures of E. coli laccase CueO at different copper concentrations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li Xu; Wei Zhiyi; National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101

2007-03-02

CueO protein is a hypothetical bacterial laccase and a good laccase candidate for large scale industrial application. Four CueO crystal structures were determined at different copper concentrations. Low copper occupancy in apo-CueO and slow copper reconstitution process in CueO with exogenous copper were demonstrated. These observations well explain the copper dependence of CueO oxidase activity. Structural comparison between CueO and other three fungal laccase proteins indicates that Glu106 in CueO constitutes the primary counter-work for reconstitution of the trinuclear copper site. Mutation of Glu106 to a Phe enhanced CueO oxidation activity and supported this hypothesis. In addition, an extra {alpha}-helixmore » from Leu351 to Gly378 covers substrate biding pocket of CueO and might compromises the electron transfer from substrate to type I copper.« less

EDTA chelation effects on urinary losses of cadmium, calcium, chromium, cobalt, copper, lead, magnesium, and zinc.

PubMed

Waters, R S; Bryden, N A; Patterson, K Y; Veillon, C; Anderson, R A

2001-12-01

The efficacy of a chelating agent in binding a given metal in a biological system depends on the binding constants of the chelator for the particular metals in the system, the concentration of the metals, and the presence and concentrations of other ligands competing for the metals in question. In this study, we make a comparison of the in vitro binding constants for the chelator, ethylenediaminetetraacetic acid, with the quantitative urinary excretion of the metals measured before and after EDTA infusion in 16 patients. There were significant increases in lead, zinc, cadmium, and calcium, and these increases roughly corresponded to the expected relative increases predicted by the EDTA-metal-binding constants as measured in vitro. There were no significant increases in urinary cobalt, chromium, or copper as a result of EDTA infusion. The actual increase in cobalt could be entirely attributed to the cobalt content of the cyanocobalamin that was added to the infusion. Although copper did increase in the post-EDTA specimens, the increase was not statistically significant. In the case of magnesium, there was a net retention of approximately 85% following chelation. These data demonstrate that EDTA chelation therapy results in significantly increased urinary losses of lead, zinc, cadmium, and calcium following EDTA chelation therapy. There were no significant changes in cobalt, chromium, or copper and a retention of magnesium. These effects are likely to have significant effects on nutrient concentrations and interactions and partially explain the clinical improvements seen in patients undergoing EDTA chelation therapy.

Copper toxicity in the crab, Scylla serrata, copper levels in tissues and regulation after exposure to a copper-rich medium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arumugam, M.; Ravindranath, M.H.

1987-10-01

In the decapod crustaceans copper is distributed in various tissues. In these animals the tissue copper generally exists in four forms; ionic, bound to proteins, lipids and membrane. In the estuarine crab Scylla serrata, the haemolymph copper exists only in association with proteins, whereas in the hepatopancreas it exists in all the four forms and in gills it exists in all the forms except in combination with lipids. Although food is the major source of copper in decapod crustaceans evidence indicate that copper may be directly obtained from the environment. It was postulated earlier that in Scylla serrata the haemolymphmore » and hepatopancreas may be involved in copper regulation. In the present work the authors have studied the nature and levels of copper in different tissues after exposing the crabs to copper-rich medium. The results indicate the relative importance of various tissues in accumulation an the possible mechanisms of regulation of the environmental copper. Besides, as a pre-requisite for studies of this kind, the toxic levels for different forms of copper were estimated since the form of toxicant is known to influence the toxicity to the decapod crustaceans.« less

Proteomic study of the yeast Rhodotorula mucilaginosa RCL-11 under copper stress.

PubMed

Irazusta, Verónica; Estévez, Cristina; Amoroso, María Julia; de Figueroa, Lucía I C

2012-06-01

In order to understand the mechanism involved in Rhodotorula mucilaginosa RCL-11 resistance to copper a proteomic study was conducted. Atomic absorption spectroscopy showed that the copper concentration in the medium decreased from 0.5 to 0.19 mM 48 h after inoculation of the yeast. Analysis of one-dimensional gel electrophoresis of crude cell extracts revealed expression of differential bands between cells with and without copper. In order to study this difference, two-dimensional electrophoresis of R. mucilaginosa RCL-11 exposed to Cu for 16, 24, and 48 h was carried out. Identification of differentially expressed proteins was performed by MALDI-TOF/TOF. Ten of the 16 spots identified belonged to heat shock proteins. Superoxide dismutase, methionine synthase and beta-glucosidase were also found over-expressed at high copper concentrations. The results obtained in the present work show that when R. mucilaginosa RCL-11 is exposed to 0.5 mM copper, differential proteins, involved in cell resistance mechanisms, are expressed.

Positron trapping at defects in copper oxide superconductors

NASA Astrophysics Data System (ADS)

McMullen, T.; Jena, P.; Khanna, S. N.; Li, Yi; Jensen, Kjeld O.

1991-05-01

Positron states and lifetimes at defects in the copper oxide superconductors La2-xSrxCuO4, YBa2Cu3O7-x, and Bi2Sr2CaCu2O8+x are calculated with use of the superposed-atom model. In the Bi2Sr2CaCu2O8+x compound, we find that the smaller metal-ion vacancies appear to only bind positrons weakly, while missing oxygens do not trap positrons. In contrast, metal-ion vacancies in La2-xSrxCuO4 and YBa2Cu3O7-x bind positrons by ~1 eV, and oxygen-related defects appear to be the weak-binding sites in these materials. The sites that bind positrons only weakly, by energies ~kBT, are of particular interest in view of the complex temperature dependences of the annihilation characteristics that are observed in these materials.

Engineering Klebsiella sp. 601 multicopper oxidase enhances the catalytic efficiency towards phenolic substrates.

PubMed

Li, Yadong; Gong, Zijun; Li, Xin; Li, Yang; Wang, Xing-Guo

2011-05-31

Structural comparison between bacterial CueO and fungal laccases has suggested that a charged residue Glu (E106) in CueO replaces the corresponding residue Phe in fungal laccases at the gate of the tunnel connecting type II copper to the protein surface and an extra α-helix (L351-G378) near the type I copper site covers the substrate binding pocket and might compromise the electron transfer from substrate to type I copper. To test this hypothesis, several mutants were made in Klebsiella sp. 601 multicopper oxidase, which is highly homologous to E. coli CueO with a similarity of 90% and an identity of 78%. The E106F mutant gave smaller K(m) (2.4-7 fold) and k(cat) (1-4.4 fold) values for all three substrates DMP, ABTS and SGZ as compared with those for the wild-type enzyme. Its slightly larger k(cat)/K(m) values for three substrates mainly come from the decreased K(m). Deleting α-helix (L351-G378) resulted in the formation of inactive inclusion body when the mutant (Δ)α351-378 was expressed in E. coli. Another mutant α351-380M was then made via substitution of seven amino acid residues in the α-helix (L351-G378) region. The α351-380M mutant was active, and displayed a far-UV CD spectrum markedly different from that for wild-type enzyme. Kinetic studies showed the α351-380M mutant gave very low K(m) values for DMP, ABTS and SGZ, 4.5-, 1.9- and 7-fold less than those for the wild type. In addition, k(cat)/K(m) values were increased, 9.4-fold for DMP, similar for ABTS and 3-fold for SGZ. The Glu residue at position 106 appears not to be the only factor affecting the copper binding, and it may also play a role in maintaining enzyme conformation. The α-helix (L351-G378) may not only block access to the type I copper site but also play a role in substrate specificities of bacterial MCOs. The α351-380M mutant catalyzing oxidation of the phenolic substrate DMP effectively would be very useful in green chemistry.

Fast O2 Binding at Dicopper Complexes Containing Schiff-Base Dinucleating Ligands

PubMed Central

Company, Anna; Gómez, Laura; Mas-Ballesté, Rubén; Korendovych, Ivan V.; Ribas, Xavi; Poater, Albert; Parella, Teodor; Fontrodona, Xavier; Benet-Buchholz, Jordi; Solà, Miquel; Que, Lawrence; Rybak-Akimova, Elena; Costas, Miquel

2008-01-01

A new family of dicopper(I) complexes [CuI2RL](X)2, (R = H, 1X, R = tBu, 2X and R = NO2, 3X, X = CF3SO3, ClO4, SbF6 or BArF, BArF = [B{3,5-(CF3)2-C6H3}4]−), where RL is a Schiff-base ligand containing two tridentate binding sites linked by a xylyl spacer have been prepared, characterized, and their reaction with O2 studied. The complexes were designed with the aim of reproducing structural aspects of the active site of type 3 dicopper proteins; they contain two three-coordinate copper sites and a rather flexible podand ligand backbone. The solid state structures of 1ClO4, 2CF3SO3, 2ClO4 and 3BArF·CH3CN have been established by single crystal X-ray diffraction analysis. 1ClO4 adopts a polymeric structure in solution while 2CF3SO3, 2ClO4 and 3BArF·CH3CN are monomeric. The complexes have been studied in solution by means of 1H and 19F NMR spectroscopy, which put forward the presence of dynamic processes in solution. 1-3BArF and 1-3CF3SO3 in acetone react rapidly with O2 to generate metaestable [CuIII2(μ-O)2(RL)]2+ 1-3(O2) and [CuIII2(μ-O)2(CF3SO3)(RL)]+ 1-3(O2)(CF3SO3) species, respectively that have been characterized by UV-vis spectroscopy and resonance Raman analysis. Instead, reaction of 1-3BArF with O2 in CH2Cl2 results in intermolecular O2 binding. DFT methods have been used to study the chemical identities and structural parameters of the O2 adducts, and the relative stability of the CuIII2(μ-O)2 form with respect to the CuII2(μ-η2: η2-peroxo) isomer. The reaction of 1X, X = CF3SO3 and BArF with O2 in acetone has been studied by stopped-flow exhibiting an unexpected very fast reaction rate (k = 3.82(4) × 103 M−1s−1, ΔH‡ = 4.9 ± 0.5 kJ·mol−1, ΔS‡ = −148 ± 5 J·K−1·mol−1), nearly three orders of magnitude faster than in the parent [CuI2(m-XYLMeAN)]2+. Thermal decomposition of 1-3(O2) does not result in aromatic hydroxylation. The mechanism and kinetics of O2 binding to 1X (X = CF3SO3 and BArF) is discussed and compared with those associated to selected examples of reported models of O2-processing copper proteins. A synergistic role of the copper ions in O2 binding and activation is clearly established from this analysis. PMID:17500512

Understanding the antimicrobial activity behind thin- and thick-rolled copper plates.

PubMed

Yousuf, Basit; Ahire, Jayesh J; Dicks, Leon M T

2016-06-01

The aim of this study was to compare the antibacterial properties of the surfaces of copper plates that were rolled to a thickness of 25 and 100 μm. Differences in topology of 25- and 100-μm-thick copper plates were studied using scanning electron microscopy (SEM), atomic force microscopy (AFM), and X-ray diffraction (XRD). Antibacterial activity of the copper surfaces was tested against strains of Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Listeria monocytogenes, Salmonella typhimurium, Streptococcus sp. BY1, Enterococcus sp. BY2, and Bacillus cereus BY3. Changes in viable cell numbers were determined by plating onto optimal growth media and staining with LIVE/DEAD BacLight™. Changes in metabolic activity were recorded by expression of the luciferase (lux) gene. Cell morphology was studied using SEM. Accumulation and diffusion of copper from cells were recorded using inductively coupled plasma mass spectroscopy (ICP-MS). Lipid and protein oxidation were recorded spectrophotometrically. Surfaces of 25-μm-thick copper plates were rough compared to that of 100-μm-thick copper plates. For most species, a five-log reduction in cell numbers, cell membrane instability, and a decline in metabolic activity were recorded after 15 min of exposure to 25-μm-thick copper plates. Copper accumulated in the cells, and lipids and proteins were oxidized. The rough surface of thinner copper plates (25 μm thick) released more copper and was more antimicrobial compared to thicker (100 μm) copper plates. Cell death was attributed to destabilization of the cell membrane, lipid peroxidation, and protein oxidation.

Newer systems for bacterial resistances to toxic heavy metals.

PubMed Central

Silver, S; Ji, G

1994-01-01

Bacterial plasmids contain specific genes for resistances to toxic heavy metal ions including Ag+, AsO2-, AsO4(3-), Cd2+, Co2+, CrO4(2-), Cu2+, Hg2+, Ni2+, Pb2+, Sb3+, and Zn2+. Recent progress with plasmid copper-resistance systems in Escherichia coli and Pseudomonas syringae show a system of four gene products, an inner membrane protein (PcoD), an outer membrane protein (PcoB), and two periplasmic Cu(2+)-binding proteins (PcoA and PcoC). Synthesis of this system is governed by two regulatory proteins (the membrane sensor PcoS and the soluble responder PcoR, probably a DNA-binding protein), homologous to other bacterial two-component regulatory systems. Chromosomally encoded Cu2+ P-type ATPases have recently been recognized in Enterococcus hirae and these are closely homologous to the bacterial cadmium efflux ATPase and the human copper-deficiency disease Menkes gene product. The Cd(2+)-efflux ATPase of gram-positive bacteria is a large P-type ATPase, homologous to the muscle Ca2+ ATPase and the Na+/K+ ATPases of animals. The arsenic-resistance system of gram-negative bacteria functions as an oxyanion efflux ATPase for arsenite and presumably antimonite. However, the structure of the arsenic ATPase is fundamentally different from that of P-type ATPases. The absence of the arsA gene (for the ATPase subunit) in gram-positive bacteria raises questions of energy-coupling for arsenite efflux. The ArsC protein product of the arsenic-resistance operons of both gram-positive and gram-negative bacteria is an intracellular enzyme that reduces arsenate [As(V)] to arsenite [As(III)], the substrate for the transport pump. Newly studied cation efflux systems for Cd2+, Zn2+, and Co2+ (Czc) or Co2+ and Ni2+ resistance (Cnr) lack ATPase motifs in their predicted polypeptide sequences. Therefore, not all plasmid-resistance systems that function through toxic ion efflux are ATPases. The first well-defined bacterial metallothionein was found in the cyanobacterium Synechococcus. Bacterial metallothionein is encoded by the smtA gene and contains 56 amino acids, including nine cysteine residues (fewer than animal metallothioneins). The synthesis of Synechococcus metallothionein is regulated by a repressor protein, the product of the adjacent but separately transcribed smtB gene. Regulation of metallothionein synthesis occurs at different levels; quickly by derepression of repressor activity, or over a longer time by deletion of the repressor gene at fixed positions and by amplification of the metallothionein DNA region leading to multiple copies of the gene. PMID:7843081

Effects of cell condition, pH, and temperature on lead, zinc, and copper sorption to Acidithiobacillus caldus strain BC13

DOE Office of Scientific and Technical Information (OSTI.GOV)

John E. Aston; William A. Apel; Brady D. Lee

2010-12-01

This study describes the effects of cell condition, pH, and temperature on lead, zinc, and copper sorption to Acidithiobacillus caldus strain BC13 with a Langmuir model. Copper exhibited the highest loading capacity, 4.76 ± 0.28 mmol g-1, to viable cells at pH 5.5. The highest kL (binding-site affinity) observed was 61.2 ± 3.0 L mmol-1 to dehydrated cells at pH 4.0. The pHs that maximized loading capacities and binding-site affinities were generally between 4.0 and 5.5, where the sum of free-proton and complexed-metal concentrations was near a minimum. Of additional importance, lead, zinc, and copper sorbed to viable cells atmore » pH values as low as 1.5. Previous studies with other acidithiobacilli did not measure viable-cell sorption below pH 4.0. In separate experiments, desorption studies showed that far less copper was recovered from viable cells than any other metal or cell condition, suggesting that uptake may play an important role in copper sorption by At. caldus strain BC13. To reflect an applied system, the sorption of metal mixtures was also studied. In these experiments, lead, zinc, and copper sorption from a tertiary mixture were 40.2 ± 4.3%, 28.7 ± 3.8%, and 91.3 ± 3.0%, respectively, of that sorbed in single-metal systems.« less

Site-Specific 64Cu Labeling of the Serine Protease, Active Site Inhibited Factor Seven Azide (FVIIai-N3), Using Copper Free Click Chemistry.

PubMed

Jeppesen, Troels E; Kristensen, Lotte K; Nielsen, Carsten H; Petersen, Lars C; Kristensen, Jesper B; Behrens, Carsten; Madsen, Jacob; Kjaer, Andreas

2018-01-17

A method for site-specific radiolabeling of the serine protease active site inhibited factor seven (FVIIai) with 64 Cu has been applied using a biorthogonal click reaction. FVIIai binds to tissue factor (TF), a trans-membrane protein involved in hemostasis, angiogenesis, proliferation, cell migration, and survival of cancer cells. First a single azide moiety was introduced in the active site of this 50 kDa protease. Then a NOTA moiety was introduced via a strain promoted azide-alkyne reaction and the corresponding conjugate was labeled with 64 Cu. Binding to TF and the stability was evaluated in vitro. TF targeting capability of the radiolabeled conjugate was tested in vivo by positron emission tomography (PET) imaging in pancreatic human xenograft cancer mouse models with various TF expressions. The conjugate showed good stability (>91% at 16 h), an immunoreactivity of 93.5%, and a mean tumor uptake of 2.1 ± 0.2%ID/g at 15 h post injection. In conclusion, FVIIai was radiolabeled with 64 Cu in single well-defined position of the protein. This method can be utilized to prepare conjugates from serine proteases with the label at a specific position.

Copper and zinc contamination in oysters: subcellular distribution and detoxification.

PubMed

Wang, Wen-Xiong; Yang, Yubo; Guo, Xiaoyu; He, Mei; Guo, Feng; Ke, Caihuan

2011-08-01

Metal pollution levels in estuarine and coastal environments have been widely reported, but few documented reports exist of severe contamination in specific environments. Here, we report on a metal-contaminated estuary in Fujian Province, China, in which blue oysters (Crassostrea hongkongensis) and green oysters (Crassostrea angulata) were discovered to be contaminated with Cu and other metals. Extraordinarily high metal concentrations were found in the oysters collected from the estuary. Comparison with historical data suggests that the estuary has recently been contaminated with Cr, Cu, Ni, and Zn. Metal concentrations in blue oysters were as high as 1.4 and 2.4% of whole-body tissue dry wt for Cu and Zn, respectively. Cellular debris was the main subcellular fraction binding the metals, but metal-rich granules were important for Cr, Ni, and Pb. With increasing Cu accumulation, its partitioning into the cytosolic proteins decreased. In contrast, metallothionein-like proteins increased their importance in binding with Zn as tissue concentrations of Zn increased. In the most severely contaminated oysters, only a negligible fraction of their Cu and Zn was bound with the metal-sensitive fraction, which may explain the survival of oysters in such contaminated environments. Copyright © 2011 SETAC.

A three-dimensional model of mammalian tyrosinase active site accounting for loss of function mutations.

PubMed

Schweikardt, Thorsten; Olivares, Concepción; Solano, Francisco; Jaenicke, Elmar; García-Borrón, José Carlos; Decker, Heinz

2007-10-01

Tyrosinases are the first and rate-limiting enzymes in the synthesis of melanin pigments responsible for colouring hair, skin and eyes. Mutation of tyrosinases often decreases melanin production resulting in albinism, but the effects are not always understood at the molecular level. Homology modelling of mouse tyrosinase based on recently published crystal structures of non-mammalian tyrosinases provides an active site model accounting for loss-of-function mutations. According to the model, the copper-binding histidines are located in a helix bundle comprising four densely packed helices. A loop containing residues M374, S375 and V377 connects the CuA and CuB centres, with the peptide oxygens of M374 and V377 serving as hydrogen acceptors for the NH-groups of the imidazole rings of the copper-binding His367 and His180. Therefore, this loop is essential for the stability of the active site architecture. A double substitution (374)MS(375) --> (374)GG(375) or a single M374G mutation lead to a local perturbation of the protein matrix at the active site affecting the orientation of the H367 side chain, that may be unable to bind CuB reliably, resulting in loss of activity. The model also accounts for loss of function in two naturally occurring albino mutations, S380P and V393F. The hydroxyl group in S380 contributes to the correct orientation of M374, and the substitution of V393 for a bulkier phenylalanine sterically impedes correct side chain packing at the active site. Therefore, our model explains the mechanistic necessity for conservation of not only active site histidines but also adjacent amino acids in tyrosinase.

Copper Resistance of the Emerging Pathogen Acinetobacter baumannii

PubMed Central

Williams, Caitlin L.; Neu, Heather M.; Gilbreath, Jeremy J.; Michel, Sarah L. J.; Zurawski, Daniel V.

2016-01-01

ABSTRACT Acinetobacter baumannii is an important emerging pathogen that is capable of causing many types of severe infection, especially in immunocompromised hosts. Since A. baumannii can rapidly acquire antibiotic resistance genes, many infections are on the verge of being untreatable, and novel therapies are desperately needed. To investigate the potential utility of copper-based antibacterial strategies against Acinetobacter infections, we characterized copper resistance in a panel of recent clinical A. baumannii isolates. Exposure to increasing concentrations of copper in liquid culture and on solid surfaces resulted in dose-dependent and strain-dependent effects; levels of copper resistance varied broadly across isolates, possibly resulting from identified genotypic variation among strains. Examination of the growth-phase-dependent effect of copper on A. baumannii revealed that resistance to copper increased dramatically in stationary phase. Moreover, A. baumannii biofilms were more resistant to copper than planktonic cells but were still susceptible to copper toxicity. Exposure of bacteria to subinhibitory concentrations of copper allowed them to better adapt to and grow in high concentrations of copper; this copper tolerance response is likely achieved via increased expression of copper resistance mechanisms. Indeed, genomic analysis revealed numerous putative copper resistance proteins that share amino acid homology to known proteins in Escherichia coli and Pseudomonas aeruginosa. Transcriptional analysis revealed significant upregulation of these putative copper resistance genes following brief copper exposure. Future characterization of copper resistance mechanisms may aid in the search for novel antibiotics against Acinetobacter and other highly antibiotic-resistant pathogens. IMPORTANCE Acinetobacter baumannii causes many types of severe nosocomial infections; unfortunately, some isolates have acquired resistance to almost every available antibiotic, and treatment options are incredibly limited. Copper is an essential nutrient but becomes toxic at high concentrations. The inherent antimicrobial properties of copper give it potential for use in novel therapeutics against drug-resistant pathogens. We show that A. baumannii clinical isolates are sensitive to copper in vitro, both in liquid and on solid metal surfaces. Since bacterial resistance to copper is mediated though mechanisms of efflux and detoxification, we identified genes encoding putative copper-related proteins in A. baumannii and showed that expression of some of these genes is regulated by the copper concentration. We propose that the antimicrobial effects of copper may be beneficial in the development of future therapeutics that target multidrug-resistant bacteria. PMID:27520808

Systems biology approach in Chlamydomonas reveals connections between copper nutrition and multiple metabolic steps.

PubMed

Castruita, Madeli; Casero, David; Karpowicz, Steven J; Kropat, Janette; Vieler, Astrid; Hsieh, Scott I; Yan, Weihong; Cokus, Shawn; Loo, Joseph A; Benning, Christoph; Pellegrini, Matteo; Merchant, Sabeeha S

2011-04-01

In this work, we query the Chlamydomonas reinhardtii copper regulon at a whole-genome level. Our RNA-Seq data simulation and analysis pipeline validated a 2-fold cutoff and 10 RPKM (reads per kilobase of mappable length per million mapped reads) (~1 mRNA per cell) to reveal 63 CRR1 targets plus another 86 copper-responsive genes. Proteomic and immunoblot analyses captured 25% of the corresponding proteins, whose abundance was also dependent on copper nutrition, validating transcriptional regulation as a major control mechanism for copper signaling in Chlamydomonas. The impact of copper deficiency on the expression of several O₂-dependent enzymes included steps in lipid modification pathways. Quantitative lipid profiles indicated increased polyunsaturation of fatty acids on thylakoid membrane digalactosyldiglycerides, indicating a global impact of copper deficiency on the photosynthetic apparatus. Discovery of a putative plastid copper chaperone and a membrane protease in the thylakoid suggest a mechanism for blocking copper utilization in the chloroplast. We also found an example of copper sparing in the N assimilation pathway: the replacement of copper amine oxidase by a flavin-dependent backup enzyme. Forty percent of the targets are previously uncharacterized proteins, indicating considerable potential for new discovery in the biology of copper.

The ropAe gene encodes a porin-like protein involved in copper transit in Rhizobium etli CFN42.

PubMed

González-Sánchez, Antonio; Cubillas, Ciro A; Miranda, Fabiola; Dávalos, Araceli; García-de Los Santos, Alejandro

2017-12-27

Copper (Cu) is an essential micronutrient for all aerobic forms of life. Its oxidation states (Cu + /Cu 2+ ) make this metal an important cofactor of enzymes catalyzing redox reactions in essential biological processes. In gram-negative bacteria, Cu uptake is an unexplored component of a finely regulated trafficking network, mediated by protein-protein interactions that deliver Cu to target proteins and efflux surplus metal to avoid toxicity. Rhizobium etliCFN42 is a facultative symbiotic diazotroph that must ensure its appropriate Cu supply for living either free in the soil or as an intracellular symbiont of leguminous plants. In crop fields, rhizobia have to contend with copper-based fungicides. A detailed deletion analysis of the pRet42e (505 kb) plasmid from an R. etli mutant with enhanced CuCl 2 tolerance led us to the identification of the ropAe gene, predicted to encode an outer membrane protein (OMP) with a β-barrel channel structure that may be involved in Cu transport. In support of this hypothesis, the functional characterization of ropAe revealed that: (I) gene disruption increased copper tolerance of the mutant, and its complementation with the wild-type gene restored its wild-type copper sensitivity; (II) the ropAe gene maintains a low basal transcription level in copper overload, but is upregulated when copper is scarce; (III) disruption of ropAe in an actP (copA) mutant background, defective in copper efflux, partially reduced its copper sensitivity phenotype. Finally, BLASTP comparisons and a maximum likelihood phylogenetic analysis highlight the diversification of four RopA paralogs in members of the Rhizobiaceae family. Orthologs of RopAe are highly conserved in the Rhizobiales order, poorly conserved in other alpha proteobacteria and phylogenetically unrelated to characterized porins involved in Cu or Mn uptake. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Copper economy in Chlamydomonas: Prioritized allocation and reallocation of copper to respiration vs. photosynthesis

PubMed Central

Kropat, Janette; Gallaher, Sean D.; Urzica, Eugen I.; Nakamoto, Stacie S.; Strenkert, Daniela; Tottey, Stephen; Mason, Andrew Z.; Merchant, Sabeeha S.

2015-01-01

Inorganic elements, although required only in trace amounts, permit life and primary productivity because of their functions in catalysis. Every organism has a minimal requirement of each metal based on the intracellular abundance of proteins that use inorganic cofactors, but elemental sparing mechanisms can reduce this quota. A well-studied copper-sparing mechanism that operates in microalgae faced with copper deficiency is the replacement of the abundant copper protein plastocyanin with a heme-containing substitute, cytochrome (Cyt) c6. This switch, which is dependent on a copper-sensing transcription factor, copper response regulator 1 (CRR1), dramatically reduces the copper quota. We show here that in a situation of marginal copper availability, copper is preferentially allocated from plastocyanin, whose function is dispensable, to other more critical copper-dependent enzymes like Cyt oxidase and a ferroxidase. In the absence of an extracellular source, copper allocation to Cyt oxidase includes CRR1-dependent proteolysis of plastocyanin and quantitative recycling of the copper cofactor from plastocyanin to Cyt oxidase. Transcriptome profiling identifies a gene encoding a Zn-metalloprotease, as a candidate effecting copper recycling. One reason for the retention of genes encoding both plastocyanin and Cyt c6 in algal and cyanobacterial genomes might be because plastocyanin provides a competitive advantage in copper-depleted environments as a ready source of copper. PMID:25646490

Copper interacts with nonylphenol to cancel the effect of nonylphenol on fish chemosensory behaviour.

PubMed

Ward, Ashley J W; Thistle, Maria; Ghandi, Khashayar; Currie, Suzanne

2013-10-15

The majority of ecotoxicological studies have been concerned with responses of organisms to a single contaminant. While this approach remains valid, the challenge now is to understand the way in which multiple contaminants and stressors interact to produce effects in study organisms. Here we take an integrated biological and physico-chemical approach to understand the effects of 4-nonylphenol and copper on fish (white perch, Morone americana) chemosensory behaviour. We show that a one hour exposure to 2 μg L(-1) nonylphenol removes chemosensory attraction to conspecific chemical cues, while exposure to 5 μg L(-1) copper for one hour had no significant effect on the fish's attraction to these cues. Further, we show that simultaneous exposure to both contaminants at the stated dosage and for the same duration has no significant effect on the chemosensory attraction of white perch to conspecific chemical cues suggesting that copper mediates the effect of nonylphenol on fish in this respect. Physico-chemical data show that copper ions bind to nonylphenol in water, providing a mechanistic explanation for this change in the effect of nonylphenol. Furthermore, the finding that the copper ions bind to the lone pair of O on the nonylphenol molecule offers the tantalising possibility that it is this region of the nonylphenol molecule that plays the key role in disrupting fish chemical communication. Copyright © 2013 Elsevier B.V. All rights reserved.

Arabidopsis Copper Transport Protein COPT2 Participates in the Cross Talk between Iron Deficiency Responses and Low-Phosphate Signaling1[C][W

PubMed Central

Perea-García, Ana; Garcia-Molina, Antoni; Andrés-Colás, Nuria; Vera-Sirera, Francisco; Pérez-Amador, Miguel A.; Puig, Sergi; Peñarrubia, Lola

2013-01-01

Copper and iron are essential micronutrients for most living organisms because they participate as cofactors in biological processes, including respiration, photosynthesis, and oxidative stress protection. In many eukaryotic organisms, including yeast (Saccharomyces cerevisiae) and mammals, copper and iron homeostases are highly interconnected; yet, such interdependence is not well established in higher plants. Here, we propose that COPT2, a high-affinity copper transport protein, functions under copper and iron deficiencies in Arabidopsis (Arabidopsis thaliana). COPT2 is a plasma membrane protein that functions in copper acquisition and distribution. Characterization of the COPT2 expression pattern indicates a synergic response to copper and iron limitation in roots. We characterized a knockout of COPT2, copt2-1, that leads to increased resistance to simultaneous copper and iron deficiencies, measured as reduced leaf chlorosis and improved maintenance of the photosynthetic apparatus. We propose that COPT2 could play a dual role under iron deficiency. First, COPT2 participates in the attenuation of copper deficiency responses driven by iron limitation, possibly to minimize further iron consumption. Second, global expression analyses of copt2-1 versus wild-type Arabidopsis plants indicate that low-phosphate responses increase in the mutant. These results open up new biotechnological approaches to fight iron deficiency in crops. PMID:23487432

Biogenic manganese oxide nanoparticle formation by a multimeric multicopper oxidase Mnx

DOE Office of Scientific and Technical Information (OSTI.GOV)

Romano, Christine A.; Zhou, Mowei; Song, Yang

Bacteria that produce Mn oxides are extraordinarily skilled engineers of nanomaterials that contribute significantly to global biogeochemical cycles. Their enzyme-based reaction mechanisms may be genetically tailored for environmental remediation applications or bioenergy production. However, significant challenges exist for structural characterization of the enzymes responsible for biomineralization. The active Mn oxidase, Mnx, in Bacillus sp. PL-12 is a complex composed of a multicopper oxidase (MCO), MnxG, and two accessory proteins MnxE and MnxF. MnxG shares sequence similarity with other, structurally characterized MCOs. However, MnxE and MnxF have no similarity to any characterized proteins. The ~200 kDa complex has been recalcitrant tomore » crystallization, so its structure is unknown. In this study, native mass spectrometry defines the subunit topology and copper binding of the Mnx complex, while high resolution electron microscopy visualizes the protein and nascent Mn oxide minerals. These data provide critical structural information for conceptualizing how Mnx produces nanoparticulate Mn oxides.« less

Cadmium accumulation and protein binding patterns in tissues of the rainbow trout, Salmo gairdneri.

PubMed Central

Kay, J; Thomas, D G; Brown, M W; Cryer, A; Shurben, D; Solbe, J F; Garvey, J S

1986-01-01

Rainbow trout were exposed to defined levels of cadmium in their aquarium water for differing periods at a variety of near-lethal concentrations that ensured the survival of the majority of the fish. The gills, liver and kidney together accounted for 99% of the accumulated load of body cadmium in the fish under these conditions. Although the proportion of total cadmium present in the liver remained relatively constant throughout, the distribution of the remainder between gill and kidney altered with the time of exposure. The cadmium in all three organs was bound by two low molecular weight proteins distinct in character from metallothionein. The isoforms of metallothionein were also present but were found to bind only zinc and copper. By contrast, when trout were injected with cadmium intraperitoneally, most of the metal accumulated in the liver where it was sequestered by the two isoforms of metallothionein. Pre-exposure of the trout to either a low concentration of cadmium (for several months) or to an elevated concentration of zinc (for 5 days) allowed the animals to survive a subsequent exposure to a high, otherwise lethal concentration of cadmium. The proteins responsible for sequestration of the two metals were identified, but two different mechanisms seemed to be involved in the protection of the animals. The significance of these observations in terms of the induction of proteins and the prevention of the toxic effects of cadmium is considered. PMID:3709433

Chemical proteomics approaches for identifying the cellular targets of natural products

PubMed Central

Sieber, S. A.

2016-01-01

Covering: 2010 up to 2016 Deconvoluting the mode of action of natural products and drugs remains one of the biggest challenges in chemistry and biology today. Chemical proteomics is a growing area of chemical biology that seeks to design small molecule probes to understand protein function. In the context of natural products, chemical proteomics can be used to identify the protein binding partners or targets of small molecules in live cells. Here, we highlight recent examples of chemical probes based on natural products and their application for target identification. The review focuses on probes that can be covalently linked to their target proteins (either via intrinsic chemical reactivity or via the introduction of photocrosslinkers), and can be applied “in situ” – in living systems rather than cell lysates. We also focus here on strategies that employ a click reaction, the copper-catalysed azide–alkyne cycloaddition reaction (CuAAC), to allow minimal functionalisation of natural product scaffolds with an alkyne or azide tag. We also discuss ‘competitive mode’ approaches that screen for natural products that compete with a well-characterised chemical probe for binding to a particular set of protein targets. Fuelled by advances in mass spectrometry instrumentation and bioinformatics, many modern strategies are now embracing quantitative proteomics to help define the true interacting partners of probes, and we highlight the opportunities this rapidly evolving technology provides in chemical proteomics. Finally, some of the limitations and challenges of chemical proteomics approaches are discussed. PMID:27098809

Roles of glutamates and metal ions in a rationally designed nitric oxide reductase based on myoglobin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Y.W.; Robinson, H.; Yeung, N.

2010-05-11

A structural and functional model of bacterial nitric oxide reductase (NOR) has been designed by introducing two glutamates (Glu) and three histidines (His) in sperm whale myoglobin. X-ray structural data indicate that the three His and one Glu (V68E) residues bind iron, mimicking the putative FeB site in NOR, while the second Glu (I107E) interacts with a water molecule and forms a hydrogen bonding network in the designed protein. Unlike the first Glu (V68E), which lowered the heme reduction potential by {approx}110 mV, the second Glu has little effect on the heme potential, suggesting that the negatively charged Glu hasmore » a different role in redox tuning. More importantly, introducing the second Glu resulted in a {approx}100% increase in NOR activity, suggesting the importance of a hydrogen bonding network in facilitating proton delivery during NOR reactivity. In addition, EPR and X-ray structural studies indicate that the designed protein binds iron, copper, or zinc in the FeB site, each with different effects on the structures and NOR activities, suggesting that both redox activity and an intermediate five-coordinate heme-NO species are important for high NOR activity. The designed protein offers an excellent model for NOR and demonstrates the power of using designed proteins as a simpler and more well-defined system to address important chemical and biological issues.« less

Roles of Glutamates and Metal ions in a Rationally Designed Nitric Oxide Reductase Based on Myoglobin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Y Lin; N Yeung; Y Gao

2011-12-31

A structural and functional model of bacterial nitric oxide reductase (NOR) has been designed by introducing two glutamates (Glu) and three histidines (His) in sperm whale myoglobin. X-ray structural data indicate that the three His and one Glu (V68E) residues bind iron, mimicking the putative FeB site in NOR, while the second Glu (I107E) interacts with a water molecule and forms a hydrogen bonding network in the designed protein. Unlike the first Glu (V68E), which lowered the heme reduction potential by {approx}110 mV, the second Glu has little effect on the heme potential, suggesting that the negatively charged Glu hasmore » a different role in redox tuning. More importantly, introducing the second Glu resulted in a {approx}100% increase in NOR activity, suggesting the importance of a hydrogen bonding network in facilitating proton delivery during NOR reactivity. In addition, EPR and X-ray structural studies indicate that the designed protein binds iron, copper, or zinc in the FeB site, each with different effects on the structures and NOR activities, suggesting that both redox activity and an intermediate five-coordinate heme-NO species are important for high NOR activity. The designed protein offers an excellent model for NOR and demonstrates the power of using designed proteins as a simpler and more well-defined system to address important chemical and biological issues.« less

Platinum transfer from hCTR1 to Atox1 is dependent on the type of platinum complex.

PubMed

Wu, Xuelei; Yuan, Siming; Wang, Erqiong; Tong, Yang; Ma, Guolin; Wei, Kaiju; Liu, Yangzhong

2017-05-24

In spite of their wide application, the cellular uptake of platinum based anticancer drugs is still unclear. The copper transport protein, hCTR1, is proposed to facilitate the cellular uptake of cisplatin, whereas organic cation transport (OCT) is more important for oxaliplatin. It has been reported that both N-terminal and C-terminal metal binding motifs of hCTR1 are highly reactive to cisplatin, which is the initial step of protein assisted cellular uptake of cisplatin. It is still unknown how the platinum drugs in hCTR1 transfer to cytoplasmic media, and whether various platinum complexes possess different activities in this process. Herein, we investigated the reaction of the platinated C-terminal metal binding motif of hCTR1 (C8) with the down-stream protein Atox1. Results show that Atox1 is highly reactive to the platinated C8 adducts of cisplatin and transplatin, whereas the oxaliplatin/C8 adduct is much less reactive. The platinum transfer from C8 to Atox1 occurs in the reaction, which results in the protein unfolding of Atox1. These results demonstrated that the platinated intracellular-domain of hCTR1 is reactive to Atox1, and the reactivity is dependent on the ligand and the coordination structure of platinum complexes. The different reactivity is consistent with the hypothesis that hCTR1 is more significant in the transport of cisplatin than that of oxaliplatin.

Chemical proteomics approaches for identifying the cellular targets of natural products.

PubMed

Wright, M H; Sieber, S A

2016-05-04

Covering: 2010 up to 2016Deconvoluting the mode of action of natural products and drugs remains one of the biggest challenges in chemistry and biology today. Chemical proteomics is a growing area of chemical biology that seeks to design small molecule probes to understand protein function. In the context of natural products, chemical proteomics can be used to identify the protein binding partners or targets of small molecules in live cells. Here, we highlight recent examples of chemical probes based on natural products and their application for target identification. The review focuses on probes that can be covalently linked to their target proteins (either via intrinsic chemical reactivity or via the introduction of photocrosslinkers), and can be applied "in situ" - in living systems rather than cell lysates. We also focus here on strategies that employ a click reaction, the copper-catalysed azide-alkyne cycloaddition reaction (CuAAC), to allow minimal functionalisation of natural product scaffolds with an alkyne or azide tag. We also discuss 'competitive mode' approaches that screen for natural products that compete with a well-characterised chemical probe for binding to a particular set of protein targets. Fuelled by advances in mass spectrometry instrumentation and bioinformatics, many modern strategies are now embracing quantitative proteomics to help define the true interacting partners of probes, and we highlight the opportunities this rapidly evolving technology provides in chemical proteomics. Finally, some of the limitations and challenges of chemical proteomics approaches are discussed.

Interaction of a copper (II) complex containing an artificial sweetener (aspartame) with calf thymus DNA.

PubMed

Shahabadi, Nahid; Khodaei, Mohammad Mehdi; Kashanian, Soheila; Kheirdoosh, Fahimeh

2014-01-01

A copper (II) complex containing aspartame (APM) as ligand, Cu(APM)2Cl2⋅2H2O, was synthesized and characterized. In vitro binding interaction of this complex with native calf thymus DNA (CT-DNA) was studied at physiological pH. The interaction was studied using different methods: spectrophotometric, spectrofluorometric, competition experiment, circular dichroism (CD) and viscosimetric techniques. Hyperchromicity was observed in UV absorption band of Cu(APM)2Cl2⋅2H2O. A strong fluorescence quenching reaction of DNA to Cu(APM)2Cl2⋅2H2O was observed and the binding constants (Kf) and corresponding numbers of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy change (ΔH) and entropy change (ΔS) were calculated to be+89.3 kJ mol(-1) and+379.3 J mol(-1) K(-1) according to Van't Hoff equation which indicated that reaction is predominantly entropically driven. Experimental results from spectroscopic methods were comparable and further supported by viscosity measurements. We suggest that Cu(APM)2Cl2⋅2H2O interacts with calf thymus DNA via a groove interaction mode with an intrinsic binding constant of 8×10+4 M(-1). Binding of this copper complex to DNA was found to be stronger compared to aspartame which was studied recently. Copyright © 2013 Elsevier B.V. All rights reserved.

Preliminary results of human PrPC protein studied by spectroscopic techniques

NASA Astrophysics Data System (ADS)

Nowakowski, Michał; Czapla-Masztafiak, Joanna; Kozak, Maciej; Zhukov, Igor; Zhukova, Lilia; Szlachetko, Jakub; Kwiatek, Wojciech M.

2017-11-01

Neurodegenerative diseases are one of the malfunctions of human nervous system, being a class of complex and prominent pathologies. The human prion Protease Resistant Protein (PrP) is protein regulating copper metabolism in mammalian cells through binding of Cu(II) ions to specific fragments. Nowadays misfolding of this protein is associated with development of prion diseases. Therefore, it is crucial to obtain structural information about coordination of Cu(II) by PrP protein. Herein, we report X-ray absorption spectroscopy (XAS) measurements, carried out on SuperXAS beamline (SLS, PSI Villigen) on PrPC-Cu(II) complexes. Obtained results were compared with theoretical predictions done by FEFF 9.6 software. Complementary to XAS data, Atomic Force Microscopy (AFM) measurements were conducted to obtain low resolution structural information about prepared sample that allow to develop protocol of fixing PrPC molecules on solid substrate used for further experiments. It has been established that folded C-terminal domain of PrPC protein has around 5 nm in diameter. Presented results showed that both XAS and AFM methods are useful tools in detailed examination of complexes of human PrPC either with Cu(II) or with other divalent metal ions.

Surface Induced Dissociation Coupled with High Resolution Mass Spectrometry Unveils Heterogeneity of a 211 kDa Multicopper Oxidase Protein Complex

NASA Astrophysics Data System (ADS)

Zhou, Mowei; Yan, Jing; Romano, Christine A.; Tebo, Bradley M.; Wysocki, Vicki H.; Paša-Tolić, Ljiljana

2018-01-01

Manganese oxidation is an important biogeochemical process that is largely regulated by bacteria through enzymatic reactions. However, the detailed mechanism is poorly understood due to challenges in isolating and characterizing these unknown enzymes. A manganese oxidase, Mnx, from Bacillus sp. PL-12 has been successfully overexpressed in active form as a protein complex with a molecular mass of 211 kDa. We have recently used surface induced dissociation (SID) and ion mobility-mass spectrometry (IM-MS) to release and detect folded subcomplexes for determining subunit connectivity and quaternary structure. The data from the native mass spectrometry experiments led to a plausible structural model of this multicopper oxidase, which has been difficult to study by conventional structural biology methods. It was also revealed that each Mnx subunit binds a variable number of copper ions. Becasue of the heterogeneity of the protein and limited mass resolution, ambiguities in assigning some of the observed peaks remained as a barrier to fully understanding the role of metals and potential unknown ligands in Mnx. In this study, we performed SID in a modified Fourier transform-ion cyclotron resonance (FTICR) mass spectrometer. The high mass accuracy and resolution offered by FTICR unveiled unexpected artificial modifications on the protein that had been previously thought to be iron bound species based on lower resolution spectra. Additionally, isotopically resolved spectra of the released subcomplexes revealed the metal binding stoichiometry at different structural levels. This method holds great potential for in-depth characterization of metalloproteins and protein-ligand complexes. [Figure not available: see fulltext.

Inhibition of human copper trafficking by a small molecule significantly attenuates cancer cell proliferation.

PubMed

Wang, Jing; Luo, Cheng; Shan, Changliang; You, Qiancheng; Lu, Junyan; Elf, Shannon; Zhou, Yu; Wen, Yi; Vinkenborg, Jan L; Fan, Jun; Kang, Heebum; Lin, Ruiting; Han, Dali; Xie, Yuxin; Karpus, Jason; Chen, Shijie; Ouyang, Shisheng; Luan, Chihao; Zhang, Naixia; Ding, Hong; Merkx, Maarten; Liu, Hong; Chen, Jing; Jiang, Hualiang; He, Chuan

2015-12-01

Copper is a transition metal that plays critical roles in many life processes. Controlling the cellular concentration and trafficking of copper offers a route to disrupt these processes. Here we report small molecules that inhibit the human copper-trafficking proteins Atox1 and CCS, and so provide a selective approach to disrupt cellular copper transport. The knockdown of Atox1 and CCS or their inhibition leads to a significantly reduced proliferation of cancer cells, but not of normal cells, as well as to attenuated tumour growth in mouse models. We show that blocking copper trafficking induces cellular oxidative stress and reduces levels of cellular ATP. The reduced level of ATP results in activation of the AMP-activated protein kinase that leads to reduced lipogenesis. Both effects contribute to the inhibition of cancer cell proliferation. Our results establish copper chaperones as new targets for future developments in anticancer therapies.

Inhibition of human copper trafficking by a small molecule significantly attenuates cancer cell proliferation

PubMed Central

Wang, Jing; Luo, Cheng; Shan, Changliang; You, Qiancheng; Lu, Junyan; Elf, Shannon; Zhou, Yu; Wen, Yi; Vinkenborg, Jan L.; Fan, Jun; Kang, Heebum; Lin, Ruiting; Han, Dali; Xie, Yuxin; Karpus, Jason; Chen, Shijie; Ouyang, Shisheng; Luan, Chihao; Zhang, Naixia; Ding, Hong; Merkx, Maarten; Liu, Hong; Chen, Jing; Jiang, Hualiang; He, Chuan

2016-01-01

Copper is a transition metal that plays critical roles in many life processes. Controlling the cellular concentration and trafficking of copper offers a route to disrupt these processes. Here we report small molecules that inhibit the human copper-trafficking proteins Atox1 and CCS, and so provide a selective approach to disrupt cellular copper transport. The knockdown of Atox1 and CCS or their inhibition leads to a significantly reduced proliferation of cancer cells, but not of normal cells, as well as to attenuated tumour growth in mouse models. We show that blocking copper trafficking induces cellular oxidative stress and reduces levels of cellular ATP. The reduced level of ATP results in activation of the AMP-activated protein kinase that leads to reduced lipogenesis. Both effects contribute to the inhibition of cancer cell proliferation. Our results establish copper chaperones as new targets for future developments in anticancer therapies. PMID:26587712

Inhibition of human copper trafficking by a small molecule significantly attenuates cancer cell proliferation

NASA Astrophysics Data System (ADS)

Wang, Jing; Luo, Cheng; Shan, Changliang; You, Qiancheng; Lu, Junyan; Elf, Shannon; Zhou, Yu; Wen, Yi; Vinkenborg, Jan L.; Fan, Jun; Kang, Heebum; Lin, Ruiting; Han, Dali; Xie, Yuxin; Karpus, Jason; Chen, Shijie; Ouyang, Shisheng; Luan, Chihao; Zhang, Naixia; Ding, Hong; Merkx, Maarten; Liu, Hong; Chen, Jing; Jiang, Hualiang; He, Chuan

2015-12-01

Copper is a transition metal that plays critical roles in many life processes. Controlling the cellular concentration and trafficking of copper offers a route to disrupt these processes. Here we report small molecules that inhibit the human copper-trafficking proteins Atox1 and CCS, and so provide a selective approach to disrupt cellular copper transport. The knockdown of Atox1 and CCS or their inhibition leads to a significantly reduced proliferation of cancer cells, but not of normal cells, as well as to attenuated tumour growth in mouse models. We show that blocking copper trafficking induces cellular oxidative stress and reduces levels of cellular ATP. The reduced level of ATP results in activation of the AMP-activated protein kinase that leads to reduced lipogenesis. Both effects contribute to the inhibition of cancer cell proliferation. Our results establish copper chaperones as new targets for future developments in anticancer therapies.

Biochemical Evolution of Iron and Copper Proteins, Substances Vital to Life

ERIC Educational Resources Information Center

Frieden, Earl

1974-01-01

Summarizes studies in the area of biochemical evolution of iron, copper, and heme proteins to provide an historical outline. Included are lists of major kinds of proteins and enzymes and charts illustrating electron flow in a cytochrome electron transport system and interconversion of jerrous to ferric ion in iron metabolism. (CC)

Investigation of the effects of dietary protein source on copper and zinc bioavailability in rainbow trout

USDA-ARS?s Scientific Manuscript database

Limited research has examined the effects that dietary protein sources have on copper (Cu) and Zinc (Zn) absorption, interactions and utilization in rainbow trout. Therefore, the objective of the first trial was to determine what effect protein source (plant vs. animal based), Cu source (complex vs....

Excretion of laccase by sycamore (Acer pseudoplatanus L.) cells. Purification and properties of the enzyme.

PubMed Central

Bligny, R; Douce, R

1983-01-01

A laccase-type polyphenol oxidase is excreted by sycamore cells (Acer pseudoplatanus L.) cells. The enzyme has been purified by classical purification techniques. It is a blue copper protein of Mr 97 000, containing 45% carbohydrate and 0.24% copper. This protein consists of one single unit and the copper content corresponds to four copper atoms per protein molecule. The specific activity of the purified extracellular sycamore-cell laccase measured at pH 6.6 (optimum pH) and in the presence of 20mM-4-methhylcatechol (optimum substrate conditions) corresponded to an oxygen uptake of 32 000 nmol of O2/min per mg of protein. Under these conditions, the catalytic-centre activity of the enzyme reached 100 s-1. The excretion of laccase by sycamore cells is significant, being about 2% of the total protein synthesized by the cells during the exponential phase of growth, and is independent of cell growth. The physiological significance and the problems raised by the passage of this protein across the cytoplasmic membrane are discussed. PMID:6847630

Molasses melanoidin promotes copper uptake for radish sprouts: the potential for an accelerator of phytoextraction.

PubMed

Hatano, Ken-Ichi; Kanazawa, Kazuki; Tomura, Hiroki; Yamatsu, Takeshi; Tsunoda, Kin-Ichi; Kubota, Kenji

2016-09-01

Phytoextraction has been proposed as an alternative remediation technology for heavy metal contamination, and it is well known that chelators may alter the toxicity of heavy metals and the bioavailability in plants. Our previous work demonstrated that an adsorbent-column chromatography can effectively separate melanoidin-like product (MLP) from sugarcane molasses. The aim of this study was to examine the chelating property of MLP and to evaluate the facilitatory influence on the phytoextraction efficiency of Japanese radish. The result showed that MLP binds to all the metal ions examined and the binding capacity of MLP toward Cu(2+) seems to be the highest among them. The metal detoxification by MLP followed the order of Pb(2+) > Zn(2+) > Ni(2+) > Cu(2+) > Fe(2+) > Cd(2+) > Co(2+). Furthermore, in the phytoextraction experiment using copper sulfate, the application of MLP accelerated the detoxification of copper and the bioavailability in radish sprouts. Thus, these results suggest that MLP possesses the potential for an accelerator of phytoextraction in the copper-contaminated media.

Bioavailable copper modulates oxidative phosphorylation and growth of tumors

PubMed Central

Ishida, Seiko; Andreux, Pénélope; Poitry-Yamate, Carole; Auwerx, Johan; Hanahan, Douglas

2013-01-01

Copper is an essential trace element, the imbalances of which are associated with various pathological conditions, including cancer, albeit via largely undefined molecular and cellular mechanisms. Here we provide evidence that levels of bioavailable copper modulate tumor growth. Chronic exposure to elevated levels of copper in drinking water, corresponding to the maximum allowed in public water supplies, stimulated proliferation of cancer cells and de novo pancreatic tumor growth in mice. Conversely, reducing systemic copper levels with a chelating drug, clinically used to treat copper disorders, impaired both. Under such copper limitation, tumors displayed decreased activity of the copper-binding mitochondrial enzyme cytochrome c oxidase and reduced ATP levels, despite enhanced glycolysis, which was not accompanied by increased invasiveness of tumors. The antiproliferative effect of copper chelation was enhanced when combined with inhibitors of glycolysis. Interestingly, larger tumors contained less copper than smaller tumors and exhibited comparatively lower activity of cytochrome c oxidase and increased glucose uptake. These results establish copper as a tumor promoter and reveal that varying levels of copper serves to regulate oxidative phosphorylation in rapidly proliferating cancer cells inside solid tumors. Thus, activation of glycolysis in tumors may in part reflect insufficient copper bioavailability in the tumor microenvironment. PMID:24218578

Nanoengineered analytical immobilized metal affinity chromatography stationary phase by atom transfer radical polymerization: Separation of synthetic prion peptides

PubMed Central

McCarthy, P.; Chattopadhyay, M.; Millhauser, G.L.; Tsarevsky, N.V.; Bombalski, L.; Matyjaszewski, K.; Shimmin, D.; Avdalovic, N.; Pohl, C.

2010-01-01

Atom transfer radical polymerization (ATRP) was employed to create isolated, metal-containing nanoparticles on the surface of non-porous polymeric beads with the goal of developing a new immobilized metal affnity chromatography (IMAC) stationary phase for separating prion peptides and proteins. Transmission electron microscopy was used to visualize nanoparticles on the substrate surface. Individual ferritin molecules were also visualized as ferritin–nanoparticle complexes. The column's resolving power was tested by synthesizing peptide analogs to the copper binding region of prion protein and injecting mixtures of these analogs onto the column. As expected, the column was capable of separating prion-related peptides differing in number of octapeptide repeat units (PHGGGWGQ), (PHGGGWGQ)2, and (PHGGGWGQ)4. Unexpectedly, the column could also resolve peptides containing the same number of repeats but differing only in the presence of a hydrophilic tail, Q → A substitution, or amide nitrogen methylation. PMID:17481564

Synthesis, characterization, antibacterial activity, SOD mimic and interaction with DNA of drug based copper(II) complexes

NASA Astrophysics Data System (ADS)

Patel, Mohan N.; Dosi, Promise A.; Bhatt, Bhupesh S.; Thakkar, Vasudev R.

2011-02-01

Novel metal complexes of the second-generation quinolone antibacterial agent enrofloxacin with copper(II) and neutral bidentate ligands have been prepared and characterized with elemental analysis reflectance, IR and mass spectroscopy. Complexes have been screened for their in-vitro antibacterial activity against two Gram (+ve)Staphylococcus aureus, Bacillus subtilis, and three Gram (-ve)Serratia marcescens, Escherichia coli and Pseudomonas aeruginosa organisms using the double dilution technique. The binding of this complex with CT-DNA has been investigated by absorption titration, salt effect and viscosity measurements. Binding constant is ranging from 1.3 × 10 4-3.7 × 10 4. The cleavage ability of complexes has been assessed by gel electrophoresis using pUC19 DNA. The catalytic activity of the copper(II) complexes towards the superoxide anion (O 2rad -) dismutation was assayed by their ability to inhibit the reduction of nitroblue tetrazolium (NBT).

Systems Biology Approach in Chlamydomonas Reveals Connections between Copper Nutrition and Multiple Metabolic Steps[C][W][OA

PubMed Central

Castruita, Madeli; Casero, David; Karpowicz, Steven J.; Kropat, Janette; Vieler, Astrid; Hsieh, Scott I.; Yan, Weihong; Cokus, Shawn; Loo, Joseph A.; Benning, Christoph; Pellegrini, Matteo; Merchant, Sabeeha S.

2011-01-01

In this work, we query the Chlamydomonas reinhardtii copper regulon at a whole-genome level. Our RNA-Seq data simulation and analysis pipeline validated a 2-fold cutoff and 10 RPKM (reads per kilobase of mappable length per million mapped reads) (~1 mRNA per cell) to reveal 63 CRR1 targets plus another 86 copper-responsive genes. Proteomic and immunoblot analyses captured 25% of the corresponding proteins, whose abundance was also dependent on copper nutrition, validating transcriptional regulation as a major control mechanism for copper signaling in Chlamydomonas. The impact of copper deficiency on the expression of several O2-dependent enzymes included steps in lipid modification pathways. Quantitative lipid profiles indicated increased polyunsaturation of fatty acids on thylakoid membrane digalactosyldiglycerides, indicating a global impact of copper deficiency on the photosynthetic apparatus. Discovery of a putative plastid copper chaperone and a membrane protease in the thylakoid suggest a mechanism for blocking copper utilization in the chloroplast. We also found an example of copper sparing in the N assimilation pathway: the replacement of copper amine oxidase by a flavin-dependent backup enzyme. Forty percent of the targets are previously uncharacterized proteins, indicating considerable potential for new discovery in the biology of copper. PMID:21498682

Interactions between copper(II) and DOM in the urban stormwater runoff: modeling and characterizations.

PubMed

Zhao, Chen; Wang, Chong-Chen; Li, Jun-Qi; Wang, Peng; Ou, Jia-Qi; Cui, Jing-Rui

2018-01-01

Dissolved organic matter (DOM) can strongly interact with both organic and inorganic contaminants to influence their transportation, transformation, bioavailability, toxicity and even their ultimate fate. Within this work, DOM was extracted from urban stormwater runoff samples collected from a regular sampling site of a typical residential area in Beijing, China. Copper(II) ions were selected as model to investigate the interactions between DOM and typical heavy metals. Both ultraviolet (UV) absorbance and fluorescence titration methods were introduced to determine the complex capacities (C L ) and conditional stability constants (log K M ) of bonding between DOM and copper (II) ions, which revealed that the values of C L were 85.62 and 87.23 μmol mg -1 and the log K M values were 5.37 and 5.48, respectively. The results suggested the successful complexation between DOM and copper(II) ions. Furthermore, morphology of the DOM binding to copper(II) ions was confirmed by both energy-dispersive X-ray spectroscopy (EDX) and X-ray photoelectron spectroscopy (XPS), which can facilitate to clarify the corresponding mechanism. The Cu 2p 3/2 peak at 933.7 eV and the characteristic shake-up peaks of Cu-O were found in the XPS spectra, implying that copper(II) ions might coordinate with hydroxyl (aliphatic or phenolic) or carboxyl groups. With these profitable results, it can be concluded that DOM in urban stormwater runoff has a strong binding affinity with copper(II) ions, which may further lead to potentially significant influence on their migration and transformation.

The mechanochemistry of copper reports on the directionality of unfolding in model cupredoxin proteins

NASA Astrophysics Data System (ADS)

Beedle, Amy E. M.; Lezamiz, Ainhoa; Stirnemann, Guillaume; Garcia-Manyes, Sergi

2015-08-01

Understanding the directionality and sequence of protein unfolding is crucial to elucidate the underlying folding free energy landscape. An extra layer of complexity is added in metalloproteins, where a metal cofactor participates in the correct, functional fold of the protein. However, the precise mechanisms by which organometallic interactions are dynamically broken and reformed on (un)folding are largely unknown. Here we use single molecule force spectroscopy AFM combined with protein engineering and MD simulations to study the individual unfolding pathways of the blue-copper proteins azurin and plastocyanin. Using the nanomechanical properties of the native copper centre as a structurally embedded molecular reporter, we demonstrate that both proteins unfold via two independent, competing pathways. Our results provide experimental evidence of a novel kinetic partitioning scenario whereby the protein can stochastically unfold through two distinct main transition states placed at the N and C termini that dictate the direction in which unfolding occurs.

Intracellular Copper Does Not Catalyze the Formation of Oxidative DNA Damage in Escherichia coli▿

PubMed Central

Macomber, Lee; Rensing, Christopher; Imlay, James A.

2007-01-01

Because copper catalyzes the conversion of H2O2 to hydroxyl radicals in vitro, it has been proposed that oxidative DNA damage may be an important component of copper toxicity. Elimination of the copper export genes, copA, cueO, and cusCFBA, rendered Escherichia coli sensitive to growth inhibition by copper and provided forcing circumstances in which this hypothesis could be tested. When the cells were grown in medium supplemented with copper, the intracellular copper content increased 20-fold. However, the copper-loaded mutants were actually less sensitive to killing by H2O2 than cells grown without copper supplementation. The kinetics of cell death showed that excessive intracellular copper eliminated iron-mediated oxidative killing without contributing a copper-mediated component. Measurements of mutagenesis and quantitative PCR analysis confirmed that copper decreased the rate at which H2O2 damaged DNA. Electron paramagnetic resonance (EPR) spin trapping showed that the copper-dependent H2O2 resistance was not caused by inhibition of the Fenton reaction, for copper-supplemented cells exhibited substantial hydroxyl radical formation. However, copper EPR spectroscopy suggested that the majority of H2O2-oxidizable copper is located in the periplasm; therefore, most of the copper-mediated hydroxyl radical formation occurs in this compartment and away from the DNA. Indeed, while E. coli responds to H2O2 stress by inducing iron sequestration proteins, H2O2-stressed cells do not induce proteins that control copper levels. These observations do not explain how copper suppresses iron-mediated damage. However, it is clear that copper does not catalyze significant oxidative DNA damage in vivo; therefore, copper toxicity must occur by a different mechanism. PMID:17189367

Isolation, characterization, and amino acid sequences of auracyanins, blue copper proteins from the green photosynthetic bacterium Chloroflexus aurantiacus

NASA Technical Reports Server (NTRS)

McManus, J. D.; Brune, D. C.; Han, J.; Sanders-Loehr, J.; Meyer, T. E.; Cusanovich, M. A.; Tollin, G.; Blankenship, R. E.

1992-01-01

Three small blue copper proteins designated auracyanin A, auracyanin B-1, and auracyanin B-2 have been isolated from the thermophilic green gliding photosynthetic bacterium Chloroflexus aurantiacus. All three auracyanins are peripheral membrane proteins. Auracyanin A was described previously (Trost, J. T., McManus, J. D., Freeman, J. C., Ramakrishna, B. L., and Blankenship, R. E. (1988) Biochemistry 27, 7858-7863) and is not glycosylated. The two B forms are glycoproteins and have almost identical properties to each other, but are distinct from the A form. The sodium dodecyl sulfate-polyacrylamide gel electrophoresis apparent monomer molecular masses are 14 (A), 18 (B-2), and 22 (B-1) kDa. The amino acid sequences of the B forms are presented. All three proteins have similar absorbance, circular dichroism, and resonance Raman spectra, but the electron spin resonance signals are quite different. Laser flash photolysis kinetic analysis of the reactions of the three forms of auracyanin with lumiflavin and flavin mononucleotide semiquinones indicates that the site of electron transfer is negatively charged and has an accessibility similar to that found in other blue copper proteins. Copper analysis indicates that all three proteins contain 1 mol of copper per mol of protein. All three auracyanins exhibit a midpoint redox potential of +240 mV. Light-induced absorbance changes and electron spin resonance signals suggest that auracyanin A may play a role in photosynthetic electron transfer. Kinetic data indicate that all three proteins can donate electrons to cytochrome c-554, the electron donor to the photosynthetic reaction center.

Unraveling the Amycolatopsis tucumanensis copper-resistome.

PubMed

Dávila Costa, José Sebastián; Kothe, Erika; Abate, Carlos Mauricio; Amoroso, María Julia

2012-10-01

Heavy metal pollution is widespread causing serious ecological problems in many parts of the world; especially in developing countries where a budget for remediation technology is not affordable. Therefore, screening for microbes with high accumulation capacities and studying their stable resistance characteristics is advisable to define cost-effective any remediation strategies. Herein, the copper-resistome of the novel copper-resistant strain Amycolatopsis tucumanensis was studied using several approaches. Two dimensional gel electrophoresis revealed that proteins of the central metabolism, energy production, transcriptional regulators, two-component system, antioxidants and protective metabolites increased their abundance upon copper-stress conditions. Transcriptome analysis revealed that in presence of copper, superoxide dismutase, alkyl hydroperoxide reductase and mycothiol reductase genes were markedly induced in expression. The oxidative damage of protein and lipid from A. tucumanensis was negligible compared with that observed in the copper-sensitive strain Amycolatopsis eurytherma. Thus, we provide evidence that A. tucumamensis shows a high adaptation towards copper, the sum of which is proposed as the copper-resistome. This adaptation allows the strain to accumulate copper and survive this stress; besides, it constitutes the first report in which the copper-resistome of a strain of the genus Amycolatopsis with bioremediation potential has been evaluated.

Aspergillus fumigatus Copper Export Machinery and Reactive Oxygen Intermediate Defense Counter Host Copper-Mediated Oxidative Antimicrobial Offense.

PubMed

Wiemann, Philipp; Perevitsky, Adi; Lim, Fang Yun; Shadkchan, Yana; Knox, Benjamin P; Landero Figueora, Julio A; Choera, Tsokyi; Niu, Mengyao; Steinberger, Andrew J; Wüthrich, Marcel; Idol, Rachel A; Klein, Bruce S; Dinauer, Mary C; Huttenlocher, Anna; Osherov, Nir; Keller, Nancy P

2017-05-02

The Fenton-chemistry-generating properties of copper ions are considered a potent phagolysosome defense against pathogenic microbes, yet our understanding of underlying host/microbe dynamics remains unclear. We address this issue in invasive aspergillosis and demonstrate that host and fungal responses inextricably connect copper and reactive oxygen intermediate (ROI) mechanisms. Loss of the copper-binding transcription factor AceA yields an Aspergillus fumigatus strain displaying increased sensitivity to copper and ROI in vitro, increased intracellular copper concentrations, decreased survival in challenge with murine alveolar macrophages (AMΦs), and reduced virulence in a non-neutropenic murine model. ΔaceA survival is remediated by dampening of host ROI (chemically or genetically) or enhancement of copper-exporting activity (CrpA) in A. fumigatus. Our study exposes a complex host/microbe multifactorial interplay that highlights the importance of host immune status and reveals key targetable A. fumigatus counter-defenses. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Computational analysis of histidine mutations on the structural stability of human tyrosinases leading to albinism insurgence.

PubMed

Hassan, Mubashir; Abbas, Qamar; Raza, Hussain; Moustafa, Ahmed A; Seo, Sung-Yum

2017-07-25

Misfolding and structural alteration in proteins lead to serious malfunctions and cause various diseases in humans. Mutations at the active binding site in tyrosinase impair structural stability and cause lethal albinism by abolishing copper binding. To evaluate the histidine mutational effect, all mutated structures were built using homology modelling. The protein sequence was retrieved from the UniProt database, and 3D models of original and mutated human tyrosinase sequences were predicted by changing the residual positions within the target sequence separately. Structural and mutational analyses were performed to interpret the significance of mutated residues (N 180 , R 202 , Q 202 , R 211 , Y 363 , R 367 , Y 367 and D 390 ) at the active binding site of tyrosinases. CSpritz analysis depicted that 23.25% residues actively participate in the instability of tyrosinase. The accuracy of predicted models was confirmed through online servers ProSA-web, ERRAT score and VERIFY 3D values. The theoretical pI and GRAVY generated results also showed the accuracy of the predicted models. The CCA negative correlation results depicted that the replacement of mutated residues at His within the active binding site disturbs the structural stability of tyrosinases. The predicted CCA scores of Tyr 367 (-0.079) and Q/R 202 (0.032) revealed that both mutations have more potential to disturb the structural stability. MD simulation analyses of all predicted models justified that Gln 202 , Arg 202 , Tyr 367 and D 390 replacement made the protein structures more susceptible to destabilization. Mutational results showed that the replacement of His with Q/R 202 and Y/R 363 has a lethal effect and may cause melanin associated diseases such as OCA1. Taken together, our computational analysis depicts that the mutated residues such as Q/R 202 and Y/R 363 actively participate in instability and misfolding of tyrosinases, which may govern OCA1 through disturbing the melanin biosynthetic pathway.

Interaction between phillygenin and human serum albumin based on spectroscopic and molecular docking

NASA Astrophysics Data System (ADS)

Song, W.; Ao, M. Z.; Shi, Y.; Yuan, L. F.; Yuan, X. X.; Yu, L. J.

2012-01-01

In this paper, the interaction of human serum albumin (HSA) with phillygenin was investigated by fluorescence, circular dichroism (CD), UV-vis spectroscopic and molecular docking methods under physiological conditions. The Stern-Volmer analysis indicated that the fluorescence quenching of HSA by phillygenin resulted from static mechanism, and the binding constants were 1.71 × 10 5, 1.61 × 10 5 and 1.47 × 10 4 at 300, 305 and 310 K, respectively. The results of UV-vis spectra show that the secondary structure of the protein has been changed in the presence of phillygenin. The CD spectra showed that HSA conformation was altered by phillygenin with a major reduction of α-helix and an increase in β-sheet and random coil structures, indicating a partial protein unfolding. The distance between donor (HSA) and acceptor (phillygenin) was calculated to be 3.52 nm and the results of synchronous fluorescence spectra showed that binding of phillygenin to HSA can induce conformational changes in HSA. Molecular docking experiments found that phillygenin binds with HSA at IIIA domain of hydrophobic pocket with hydrogen bond interactions. The ionic bonds were formed with the O (4), O (5) and O (6) of phillygenin with nitrogen of ASN109, ARG186 and LEU115, respectively. The hydrogen bonds are formed between O (2) of phillygenin and SER419. In the presence of copper (II), iron (III) and alcohol, the apparent association constant KA and the number of binding sites of phillygenin on HSA were both decreased in the range of 88.84-91.97% and 16.09-18.85%, respectively. In view of the evidence presented, it is expected to enrich our knowledge of the interaction dynamics of phillygenin to the important plasma protein HSA, and it is also expected to provide important information of designs of new inspired drugs.

Parkinson Disease Protein DJ-1 Binds Metals and Protects against Metal-induced Cytotoxicity*

PubMed Central

Björkblom, Benny; Adilbayeva, Altynai; Maple-Grødem, Jodi; Piston, Dominik; Ökvist, Mats; Xu, Xiang Ming; Brede, Cato; Larsen, Jan Petter; Møller, Simon Geir

2013-01-01

The progressive loss of motor control due to reduction of dopamine-producing neurons in the substantia nigra pars compacta and decreased striatal dopamine levels are the classically described features of Parkinson disease (PD). Neuronal damage also progresses to other regions of the brain, and additional non-motor dysfunctions are common. Accumulation of environmental toxins, such as pesticides and metals, are suggested risk factors for the development of typical late onset PD, although genetic factors seem to be substantial in early onset cases. Mutations of DJ-1 are known to cause a form of recessive early onset Parkinson disease, highlighting an important functional role for DJ-1 in early disease prevention. This study identifies human DJ-1 as a metal-binding protein able to evidently bind copper as well as toxic mercury ions in vitro. The study further characterizes the cytoprotective function of DJ-1 and PD-mutated variants of DJ-1 with respect to induced metal cytotoxicity. The results show that expression of DJ-1 enhances the cells' protective mechanisms against induced metal toxicity and that this protection is lost for DJ-1 PD mutations A104T and D149A. The study also shows that oxidation site-mutated DJ-1 C106A retains its ability to protect cells. We also show that concomitant addition of dopamine exposure sensitizes cells to metal-induced cytotoxicity. We also confirm that redox-active dopamine adducts enhance metal-catalyzed oxidation of intracellular proteins in vivo by use of live cell imaging of redox-sensitive S3roGFP. The study indicates that even a small genetic alteration can sensitize cells to metal-induced cell death, a finding that may revive the interest in exogenous factors in the etiology of PD. PMID:23792957

Quantum mechanical calculations suggest that lytic polysaccharide monooxygenases use a copper-oxyl, oxygen-rebound mechanism

PubMed Central

Kim, Seonah; Ståhlberg, Jerry; Sandgren, Mats; Paton, Robert S.; Beckham, Gregg T.

2014-01-01

Lytic polysaccharide monooxygenases (LPMOs) exhibit a mononuclear copper-containing active site and use dioxygen and a reducing agent to oxidatively cleave glycosidic linkages in polysaccharides. LPMOs represent a unique paradigm in carbohydrate turnover and exhibit synergy with hydrolytic enzymes in biomass depolymerization. To date, several features of copper binding to LPMOs have been elucidated, but the identity of the reactive oxygen species and the key steps in the oxidative mechanism have not been elucidated. Here, density functional theory calculations are used with an enzyme active site model to identify the reactive oxygen species and compare two hypothesized reaction pathways in LPMOs for hydrogen abstraction and polysaccharide hydroxylation; namely, a mechanism that employs a η1-superoxo intermediate, which abstracts a substrate hydrogen and a hydroperoxo species is responsible for substrate hydroxylation, and a mechanism wherein a copper-oxyl radical abstracts a hydrogen and subsequently hydroxylates the substrate via an oxygen-rebound mechanism. The results predict that oxygen binds end-on (η1) to copper, and that a copper-oxyl–mediated, oxygen-rebound mechanism is energetically preferred. The N-terminal histidine methylation is also examined, which is thought to modify the structure and reactivity of the enzyme. Density functional theory calculations suggest that this posttranslational modification has only a minor effect on the LPMO active site structure or reactivity for the examined steps. Overall, this study suggests the steps in the LPMO mechanism for oxidative cleavage of glycosidic bonds. PMID:24344312

Elucidating the mechanism for the reduction of nitrite by copper nitrite reductase--a contribution from quantum chemical studies.

PubMed

De Marothy, S A; Blomberg, M R A; Siegbahn, P E M

2007-01-30

Density functional methods have been applied to investigate the properties of the active site of copper-containing nitrite reductases and possible reaction mechanisms for the enzyme catalysis. The results for a model of the active site indicate that a hydroxyl intermediate is not formed during the catalytic cycle, but rather a state with a protonated nitrite bound to the reduced copper. Electron affinity calculations indicate that reduction of the T2 copper site does not occur immediately after nitrite binding. Proton affinity calculations are indicative of substantial pK(a) differences between different states of the T2 site. The calculations further suggest that the reaction does not proceed until uptake of a second proton from the bulk solution. They also indicate that Asp-92 may play both a key role as a proton donor to the substrate, and a structural role in promoting catalysis. In the D92N mutant another base, presumably a nearby histidine (His-249) may take the role as the proton donor. On the basis of these model calculations and available experimental evidence, an ordered reaction mechanism for the reduction of nitrite is suggested. An investigation of the binding modes of the nitric oxide product and the nitrite substrate to the model site has also been made, indicating that nitric oxide prefers to bind in an end-on fashion to the reduced T2 site.

Micro determination of plasma and erythrocyte copper by atomic absorption spectrophotometry

PubMed Central

Blomfield, Jeanette; Macmahon, R. A.

1969-01-01

The free and total plasma copper and total erythrocyte copper levels have been determined by simple, yet sensitive and highly specific methods, using atomic absorption spectrophotometry. For total copper determination, the copper was split from its protein combination in plasma or red cells by the action of hydrochloric acid at room temperature. The liberated copper was chelated by ammonium pyrrolidine dithiocarbamate and extracted into n-butyl acetate by shaking and the organic extract was aspirated into the atomic absorption spectrophotometer flame. The entire procedure was carried out in polypropylene centrifuge tubes, capped during shaking. For the free plasma copper measurement the hydrochloric acid step was omitted. Removal of the plasma or erythrocyte proteins was found to be unnecessary, and, in addition, the presence of trichloracetic acid caused an appreciable lowering of absorption. Using a double-beam atomic absorption spectrophotometer and scale expansion × 10, micro methods have been derived for determining the total copper of plasma or erythrocytes with 0·1 ml of sample, and the free copper of plasma with 0·5 ml. The macro plasma copper method requires 2 ml of plasma and is suitable for use with single-beam atomic absorption spectrophotometers. With blood from 50 blood donors, normal ranges of plasma and erythrocyte copper have been determined. PMID:5776543

The mammalian phosphate carrier SLC25A3 is a mitochondrial copper transporter required for cytochrome c oxidase biogenesis

PubMed Central

Boulet, Aren; Vest, Katherine E.; Maynard, Margaret K.; Gammon, Micah G.; Russell, Antoinette C.; Mathews, Alexander T.; Cole, Shelbie E.; Zhu, Xinyu; Phillips, Casey B.; Kwong, Jennifer Q.; Dodani, Sheel C.; Leary, Scot C.; Cobine, Paul A.

2018-01-01

Copper is required for the activity of cytochrome c oxidase (COX), the terminal electron-accepting complex of the mitochondrial respiratory chain. The likely source of copper used for COX biogenesis is a labile pool found in the mitochondrial matrix. In mammals, the proteins that transport copper across the inner mitochondrial membrane remain unknown. We previously reported that the mitochondrial carrier family protein Pic2 in budding yeast is a copper importer. The closest Pic2 ortholog in mammalian cells is the mitochondrial phosphate carrier SLC25A3. Here, to investigate whether SLC25A3 also transports copper, we manipulated its expression in several murine and human cell lines. SLC25A3 knockdown or deletion consistently resulted in an isolated COX deficiency in these cells, and copper addition to the culture medium suppressed these biochemical defects. Consistent with a conserved role for SLC25A3 in copper transport, its heterologous expression in yeast complemented copper-specific defects observed upon deletion of PIC2. Additionally, assays in Lactococcus lactis and in reconstituted liposomes directly demonstrated that SLC25A3 functions as a copper transporter. Taken together, these data indicate that SLC25A3 can transport copper both in vitro and in vivo. PMID:29237729

Effects of copper supplement on growth and viability of strains used as starters and adjunct cultures for Emmental cheese manufacture.

PubMed

Rodríguez, L Mato; Alatossava, T

2008-10-01

To determine the effects of supplemented copper (Cu2+) on growth and viability of strains used as starters and adjunct cultures for Emmental cheese manufacture. Thirteen strains belonging to Lactobacillus delbrueckii, Lactobacillus helveticus, Lactobacillus rhamnosus, Streptococcus thermophilus or Propionibacterium freudenreichii species were exposed to various copper concentrations in the proper growth medium at relevant growth temperatures, and the effects of supplemented copper on bacterial growth and cell viability were determined by optical density and pH measurements, also by platings. Among the species considered, L. delbrueckii was the most copper resistant and S. thermophilus the most sensitive to copper. Anaerobic conditions increased this sensitivity significantly. There was also a considerable amount of variation in copper resistance at strain level. Copper resistance is both a species- and strain-dependent property and may reflect variability in copper-binding capacities by cell wall components among species and strains. In addition, the chemical state of copper may be involved. This study revealed that copper resistance is a highly variable property among starter and adjunct strains, and this variability should be considered when strains are selected for Emmental cheese manufacture.

Purification, crystallization and preliminary X-ray study of the fungal laccase from Cerrena maxima

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lyashenko, Andrey V.; Zhukhlistova, Nadegda E.; Gabdoulkhakov, Azat G.

2006-10-01

The crystallization and preliminary X-ray structure at 1.9 Å resolution of the fungal laccase from C. maxima are presented. Laccases are members of the blue multi-copper oxidase family that oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and, following the transfer of four electrons, is reduced to two molecules of water. Crystals of the laccase from Cerrena maxima have been obtained and X-ray data were collected to 1.9 Å resolution using synchrotron radiation. A preliminary analysis shows that the enzyme has the typical laccasemore » structure and several carbohydrate sites have been identified. The carbohydrate chains appear to be involved in stabilization of the intermolecular contacts in the crystal structure, thus promoting the formation of well ordered crystals of the enzyme. Here, the results of an X-ray crystallographic study on the laccase from the fungus Cerrena maxima are reported. Crystals that diffract well to a resolution of at least 1.9 Å (R factor = 18.953%; R{sub free} = 23.835; r.m.s.d. bond lengths, 0.06 Å; r.m.s.d. bond angles, 1.07°) have been obtained despite the presence of glycan moieties. The overall spatial organization of C. maxima laccase and the structure of its copper-containing active centre have been determined by the molecular-replacement method using the laccase from Trametes versicolor (Piontek et al., 2002 ▶) as a structural template. In addition, four glycan-binding sites were identified and the 1.9 Å X-ray data were used to determine the previously unknown primary structure of this protein. The identity (calculated from sequence alignment) between the C. maxima laccase and the T. versicolor laccase is about 87%. Tyr196 and Tyr372 show significant extra density at the ortho positions and this has been interpreted in terms of NO{sub 2} substituents.« less

Perspectives on the Role and Relevance of Copper in Cardiac Disease.

PubMed

Medeiros, Denis M

2017-03-01

Cardiac hypertrophy as a result of dietary copper deficiency has been studied for 40 plus years and is the subject of this review. While connective tissue anomalies occur, a hallmark pathology is cardiac hypertrophy, increased mitochondrial biogenesis, with disruptive cristae, vacuolization of mitochondria, and deposition of lipid droplets. Electrocardiogram abnormalities have been demonstrated along with biochemical changes especially as it relates to the copper-containing enzyme cytochrome c oxidase. The master controller of mitochondrial biogenesis, PGC1-α expression and protein, along with other proteins and transcriptional factors that play a role are upregulated. Nitric oxide, vascular endothelial growth factor, and cytochrome c oxidase all may enhance the upregulation of mitochondrial biogenesis. Marginal copper intakes reveal similar pathologies in the absence of cardiac hypertrophy. Reversibility of the copper-deficient rat heart with a copper-replete diet has resulted in mixed results, depending on both the animal model used and temporal relationships. New information has revealed that copper supplementation may rescue cardiac hypertrophy induced by pressure overload.

Protective Effects of Lactobacillus plantarum CCFM8246 against Copper Toxicity in Mice

PubMed Central

Li, Xiaoxiao; Zhai, Qixiao; Wang, Gang; Zhang, Qiuxiang; Zhang, Hao; Chen, Wei

2015-01-01

Lactobacillus plantarum CCFM8246, which has a relatively strong copper binding capacity and tolerance to copper ions, was obtained by screening from 16 lactic acid bacteria in vitro. The selected strain was then applied to a mouse model to evaluate its protective function against copper intoxication in vivo. The experimental mice were divided into an intervention group and a therapy group; mice in the intervention group received co-administration of CCFM8246 and a copper ion solution by gavage, while mice in the therapy group were treated with CCFM8246 after 4 weeks of copper exposure. In both two groups, mice treated with copper alone and that treated with neither CCFM8246 nor copper served as positive and negative controls, respectively. At the end of the experimental period, the copper content in feces and tissues, the activity of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in serum, and oxidation stress indices in liver and kidney tissue were determined. Learning and memory ability was evaluated by Morris water maze experiments. The results indicated that treatment with CCFM8246 significantly increased the copper content in feces to promote copper excretion, reduce the accumulation of copper in tissues, reverse oxidative stress induced by copper exposure, recover the ALT and AST in serum and improve the spatial memory of mice. PMID:26605944

Activation of dioxygen by copper metalloproteins and insights from model complexes

PubMed Central

Quist, David A.; Diaz, Daniel E.; Liu, Jeffrey J.; Karlin, Kenneth D.

2017-01-01

Nature uses dioxygen as a key oxidant in the transformation of biomolecules. Among the enzymes that are utilized for these reactions are copper-containing met-alloenzymes, which are responsible for important biological functions such as the regulation of neurotransmitters, dioxygen transport, and cellular respiration. Enzymatic and model system studies work in tandem in order to gain an understanding of the fundamental reductive activation of dioxygen by copper complexes. This review covers the most recent advancements in the structures, spectroscopy, and reaction mechanisms for dioxygen-activating copper proteins and relevant synthetic models thereof. An emphasis has also been placed on cofactor biogenesis, a fundamentally important process whereby biomolecules are post-translationally modified by the pro-enzyme active site to generate cofactors which are essential for the catalytic enzymatic reaction. Significant questions remaining in copper-ion-mediated O2-activation in copper proteins are addressed. PMID:27921179

Activation of dioxygen by copper metalloproteins and insights from model complexes.

PubMed

Quist, David A; Diaz, Daniel E; Liu, Jeffrey J; Karlin, Kenneth D

2017-04-01

Nature uses dioxygen as a key oxidant in the transformation of biomolecules. Among the enzymes that are utilized for these reactions are copper-containing metalloenzymes, which are responsible for important biological functions such as the regulation of neurotransmitters, dioxygen transport, and cellular respiration. Enzymatic and model system studies work in tandem in order to gain an understanding of the fundamental reductive activation of dioxygen by copper complexes. This review covers the most recent advancements in the structures, spectroscopy, and reaction mechanisms for dioxygen-activating copper proteins and relevant synthetic models thereof. An emphasis has also been placed on cofactor biogenesis, a fundamentally important process whereby biomolecules are post-translationally modified by the pro-enzyme active site to generate cofactors which are essential for the catalytic enzymatic reaction. Significant questions remaining in copper-ion-mediated O 2 -activation in copper proteins are addressed.

A 37-year-old Menkes disease patient-Residual ATP7A activity and early copper administration as key factors in beneficial treatment.

PubMed

Tümer, Z; Petris, M; Zhu, S; Mercer, J; Bukrinski, J; Bilz, S; Baerlocher, K; Horn, N; Møller, L B

2017-11-01

Menkes disease (MD) is a lethal disorder characterized by severe neurological symptoms and connective tissue abnormalities; and results from malfunctioning of cuproenzymes, which cannot receive copper due to a defective intracellular copper transporting protein, ATP7A. Early parenteral copper-histidine supplementation may modify disease progression substantially but beneficial effects of long-term treatment have been recorded in only a few patients. Here we report on the eldest surviving MD patient (37 years) receiving early-onset and long-term copper treatment. He has few neurological symptoms without connective tissue disturbances; and a missense ATP7A variant, p.(Pro852Leu), which results in impaired protein trafficking while the copper transport function is spared. These findings suggest that some cuproenzymes maintain their function when sufficient copper is provided to the cells; and underline the importance of early initiated copper treatment, efficiency of which is likely to be dependent on the mutant ATP7A function. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Concise and diversity-oriented synthesis of ligand arm-functionalized azoamides.

PubMed

Urankar, Damijana; Kosmrlj, Janez

2008-01-01

Azoamides, previously established as bioactive intracellular GSH-depleting agents, were decorated with a terminal alkyne moiety to 4 and then were transformed, by copper(I)-catalyzed azide-alkyne cycloaddition (CuAAC), into different ligand-arm functionalized azoamides 6. Azides 5 having ligand-arms amenable for binding to platinum(II) were selected for this study. Because, for the fragile azoamides 4, the typically employed reaction conditions for CuAAC failed, several alternative solvents and copper catalysts were tested. Excellent results were obtained with copper(II) sulfate pentahydrate/metallic copper and especially with heterogeneous catalysts, such as copper-in-charcoal, cupric oxide, and cuprous oxide. The heterogeneous catalysts were employed to obtain the desired products in almost quantitative yields by a simple three-step "stir-filter-evaporate" protocol with no or negligible contamination with copper impurities. This is of particular importance because compounds 6 have been designed for coordination.

Characterization of Lactobacillus brevis L62 strain, highly tolerant to copper ions.

PubMed

Mrvčić, Jasna; Butorac, Ana; Solić, Ema; Stanzer, Damir; Bačun-Družina, Višnja; Cindrić, Mario; Stehlik-Tomas, Vesna

2013-01-01

Lactic acid bacteria (LAB) as starter culture in food industry must be suitable for large-scale industrial production and possess the ability to survive in unfavorable processes and storage conditions. Approaches taken to address these problems include the selection of stress-resistant strains. In food industry, LAB are often exposed to metal ions induced stress. The interactions between LAB and metal ions are very poorly investigated. Because of that, the influence of non-toxic, toxic and antioxidant metal ions (Zn, Cu, and Mn) on growth, acid production, metal ions binding capacity of wild and adapted species of Leuconostoc mesenteroides L3, Lactobacillus brevis L62 and Lactobacillus plantarum L73 were investigated. The proteomic approach was applied to clarify how the LAB cells, especially the adapted ones, protect themselves and tolerate high concentrations of toxic metal ions. Results have shown that Zn and Mn addition into MRS medium in the investigated concentrations did not have effect on the bacterial growth and acid production, while copper ions were highly toxic, especially in static conditions. Leuc. mesenteroides L3 was the most efficient in Zn binding processes among the chosen LAB species, while L. plantarum L73 accumulated the highest concentration of Mn. L. brevis L62 was the most copper resistant species. Adaptation had a positive effect on growth and acid production of all species in the presence of copper. However, the adapted species incorporated less metal ions than the wild species. The exception was adapted L. brevis L62 that accumulated high concentration of copper ions in static conditions. The obtained results showed that L. brevis L62 is highly tolerant to copper ions, which allows its use as starter culture in fermentative processes in media with high concentration of copper ions.

Phthalocyanine tetrasulfonates affect the amyloid formation and cytotoxicity of alpha-synuclein.

PubMed

Lee, Eui-Nam; Cho, Hyun-Ju; Lee, Choong-Hwan; Lee, Daekyun; Chung, Kwang Chul; Paik, Seung R

2004-03-30

Alpha-synuclein is a pathological component of Parkinson's disease by constituting the filamentous component of Lewy bodies. Phthalocyanine (Pc) effects on the amyloidosis of alpha-synuclein have been examined. The copper complex of phthalocyanine tetrasulfonate (PcTS-Cu(2+)) caused the self-oligomerization of alpha-synuclein while Pc-Cu(2+) did not affect the protein, indicating that introduction of the sulfonate groups was critical for the selective protein interaction. The PcTS-Cu(2+) interaction with alpha-synuclein has occurred predominantly at the N-terminal region of the protein with a K(d) of 0.83 microM apart from the hydrophobic NAC (non-Abeta component of Alzheimer's disease amyloid) segment. Phthalocyanine tetrasulfonate (PcTS) lacking the intercalated copper ion also showed a considerable affinity toward alpha-synuclein with a K(d) of 3.12 microM, and its binding site, on the other hand, was located at the acidic C-terminus. These mutually exclusive interactions between PcTS and PcTS-Cu(2+) toward alpha-synuclein resulted in distinctive features on the kinetics of protein aggregation, morphologies of the final aggregates, and their in vitro cytotoxicities. The PcTS actually suppressed the fibrous amyloid formation of alpha-synuclein, but it produced the chopped-wood-looking protein aggregates. The aggregates showed rather low toxicity (9.5%) on human neuroblastoma cells (SH-SY5Y). In fact, the PcTS was shown to effectively rescue the cell death of alpha-synuclein overexpressing cells caused by the lactacystin treatment as a proteasome inhibitor. The anti-aggregative and anti-amyloidogenic properties of PcTS were also demonstrated with alcohol dehydrogenase, glutathione S-transferase, and amyloid beta/A4 protein under their aggregative conditions. The PcTS-Cu(2+), on the other hand, promoted the protein aggregation of alpha-synuclein, which gave rise to the fibrillar protein aggregates whose cytotoxicity became significant to 35.8%. Taken together, the data provided in this study indicate that PcTS/PcTS-Cu(2+) could be considered as possible candidates for the development of therapeutic or prophylactic strategies against the alpha-synuclein-related neurodegenerative disorders.

A smart magnetic resonance contrast agent for selective copper sensing.

PubMed

Que, Emily L; Chang, Christopher J

2006-12-20

We describe the synthesis and properties of Copper-Gad-1 (CG1), a new type of smart magnetic resonance (MR) sensor for selective detection of copper. CG1 is composed of a gadolinium contrast agent core tethered to copper-selective recognition motif. Cu2+-induced modulation of inner-sphere water access to the Gd3+ center provides a sensing mechanism for reporting Cu2+ levels by reading out changes in longitudinal proton relaxivity values. CG1 features good selectivity for Cu2+ over abundant biological cations and a 41% increase in relaxivity upon Cu2+ binding and is capable of detecting micromolar changes in Cu2+ concentrations in aqueous media.

Antimalarial, antimicrobial, cytotoxic, DNA interaction and SOD like activities of tetrahedral copper(II) complexes

NASA Astrophysics Data System (ADS)

Mehta, Jugal V.; Gajera, Sanjay B.; Patel, Mohan N.

2015-02-01

The mononuclear copper(II) complexes with P, O-donor ligand and different fluoroquinolones have been synthesized and characterized by elemental analysis, electronic spectra, TGA, EPR, FT-IR and LC-MS spectroscopy. An antimicrobial efficiency of the complexes has been tested against five different microorganisms in terms of minimum inhibitory concentration (MIC) and displays very good antimicrobial activity. The binding strength and binding mode of the complexes with Herring Sperm DNA (HS DNA) have been investigated by absorption titration and viscosity measurement studies. The studies suggest the classical intercalative mode of DNA binding. Gel electrophoresis assay determines the ability of the complexes to cleave the supercoiled form of pUC19 DNA. Synthesized complexes have been tested for their SOD mimic activity using nonenzymatic NBT/NADH/PMS system and found to have good antioxidant activity. All the complexes show good cytotoxic and in vitro antimalarial activities.

The mammalian phosphate carrier SLC25A3 is a mitochondrial copper transporter required for cytochrome c oxidase biogenesis.

PubMed

Boulet, Aren; Vest, Katherine E; Maynard, Margaret K; Gammon, Micah G; Russell, Antoinette C; Mathews, Alexander T; Cole, Shelbie E; Zhu, Xinyu; Phillips, Casey B; Kwong, Jennifer Q; Dodani, Sheel C; Leary, Scot C; Cobine, Paul A

2018-02-09

Copper is required for the activity of cytochrome c oxidase (COX), the terminal electron-accepting complex of the mitochondrial respiratory chain. The likely source of copper used for COX biogenesis is a labile pool found in the mitochondrial matrix. In mammals, the proteins that transport copper across the inner mitochondrial membrane remain unknown. We previously reported that the mitochondrial carrier family protein Pic2 in budding yeast is a copper importer. The closest Pic2 ortholog in mammalian cells is the mitochondrial phosphate carrier SLC25A3. Here, to investigate whether SLC25A3 also transports copper, we manipulated its expression in several murine and human cell lines. SLC25A3 knockdown or deletion consistently resulted in an isolated COX deficiency in these cells, and copper addition to the culture medium suppressed these biochemical defects. Consistent with a conserved role for SLC25A3 in copper transport, its heterologous expression in yeast complemented copper-specific defects observed upon deletion of PIC2 Additionally, assays in Lactococcus lactis and in reconstituted liposomes directly demonstrated that SLC25A3 functions as a copper transporter. Taken together, these data indicate that SLC25A3 can transport copper both in vitro and in vivo . © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Low copper and high manganese levels in prion protein plaques

USGS Publications Warehouse

Johnson, Christopher J.; Gilbert, P.U.P.A.; Abrecth, Mike; Baldwin, Katherine L.; Russell, Robin E.; Pedersen, Joel A.; McKenzie, Debbie

2013-01-01

Accumulation of aggregates rich in an abnormally folded form of the prion protein characterize the neurodegeneration caused by transmissible spongiform encephalopathies (TSEs). The molecular triggers of plaque formation and neurodegeneration remain unknown, but analyses of TSE-infected brain homogenates and preparations enriched for abnormal prion protein suggest that reduced levels of copper and increased levels of manganese are associated with disease. The objectives of this study were to: (1) assess copper and manganese levels in healthy and TSE-infected Syrian hamster brain homogenates; (2) determine if the distribution of these metals can be mapped in TSE-infected brain tissue using X-ray photoelectron emission microscopy (X-PEEM) with synchrotron radiation; and (3) use X-PEEM to assess the relative amounts of copper and manganese in prion plaques in situ. In agreement with studies of other TSEs and species, we found reduced brain levels of copper and increased levels of manganese associated with disease in our hamster model. We also found that the in situ levels of these metals in brainstem were sufficient to image by X-PEEM. Using immunolabeled prion plaques in directly adjacent tissue sections to identify regions to image by X-PEEM, we found a statistically significant relationship of copper-manganese dysregulation in prion plaques: copper was depleted whereas manganese was enriched. These data provide evidence for prion plaques altering local transition metal distribution in the TSE-infected central nervous system.

Copper complexes containing thiosemicarbazones derived from 6-nitropiperonal: Antimicrobial and biophysical properties

NASA Astrophysics Data System (ADS)

Beckford, Floyd A.; Webb, Kelsey R.

2017-08-01

A series of four thiosemicarbazones from 6-nitropiperonal along with the corresponding copper complexes were synthesized. The biophysical characteristics of the complexes were investigated by the binding to DNA and human serum albumin. The binding to DNA is moderate; the binding constants run from (0.49-7.50) × 104 M- 1. In relation to HSA, the complexes interact strongly with binding constants on the order of 105 M- 1. The complexes also display antioxidant behavior as determined by the ability to scavenge diphenylpicrylhydrazyl (dpph) and nitric oxide radicals. The antimicrobial profiles of the compounds, tested against a panel of microbes including five of the ESKAPE pathogens (Staphylococcus aureus, MRSA, Escherichia coli, Klebsiella pneumoniae, MDR, Acinetobacter baumannii, Pseudomonas aeruginosa) and two yeasts (Candida albicans and Cryptococcus neoformans var. grubii), are also described. The compounds contain a core moiety that is similar to oxolinic acid, a quinolone antibiotic that targets DNA gyrase and topoisomerase (IV). The binding interaction between the complexes and these important antibacterial targets were studied by computational methods, chiefly docking studies. The calculated dissociation constants for the interaction with DNA gyrase B (from Staphylococcus aureus) range from 4.32 to 24.65 μM; the binding was much stronger to topoisomerase IV, with dissociation constants ranging from 0.37 to 1.27 μM.

Factors affecting catalysis of copper corrosion products in NDMA formation from DMA in simulated premise plumbing.

PubMed

Zhang, Hong; Andrews, Susan A

2013-11-01

This study investigated the effects of corrosion products of copper, a metal commonly employed in household plumbing systems, on N-nitrosodimethylamine (NDMA) formation from a known NDMA precursor, dimethylamine (DMA). Copper-catalyzed NDMA formation increased with increasing copper concentrations, DMA concentrations, alkalinity and hardness, but decreased with increasing natural organic matter (NOM) concentration. pH influenced the speciation of chloramine and the interactions of copper with DMA. The transformation of monochloramine (NH2Cl) to dichloramine and complexation of copper with DMA were involved in elevating the formation of NDMA by copper at pH 7.0. The inhibiting effect of NOM on copper catalysis was attributed to the rapid consumption of NH2Cl by NOM and/or the competitive complexation of NOM with copper to limit the formation of DMA-copper complexes. Hardness ions, as represented by Ca(2+), also competed with copper for binding sites on NOM, thereby weakening the inhibitory effect of NOM on NDMA formation. Common copper corrosion products also participated in these reactions but in different ways. Aqueous copper released from malachite [Cu2CO3(OH)2] was shown to promote NDMA formation while NDMA formation decreased in the presence of CuO, most likely due to the adsorption of DMA. Copyright © 2013 Elsevier Ltd. All rights reserved.

Thiol-based copper handling by the copper chaperone Atox1.

PubMed

Hatori, Yuta; Inouye, Sachiye; Akagi, Reiko

2017-04-01

Human antioxidant protein 1 (Atox1) plays a crucial role in cellular copper homeostasis. Atox1 captures cytosolic copper for subsequent transfer to copper pumps in trans Golgi network, thereby facilitating copper supply to various copper-dependent oxidereductases matured within the secretory vesicles. Atox1 and other copper chaperones handle cytosolic copper using Cys thiols which are ideal ligands for coordinating Cu(I). Recent studies demonstrated reversible oxidation of these Cys residues in copper chaperones, linking cellular redox state to copper homeostasis. Highlighted in this review are unique redox properties of Atox1 and other copper chaperones. Also, summarized are the redox nodes in the cytosol which potentially play dominant roles in the redox regulation of copper chaperones. © 2016 IUBMB Life, 69(4):246-254, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

The evaluation and validation of copper (II) force field parameters of the Auxiliary Activity family 9 enzymes

NASA Astrophysics Data System (ADS)

Moses, Vuyani; Tastan Bishop, Özlem; Lobb, Kevin A.

2017-06-01

The Auxiliary Activity family 9 (AA9) proteins are Cu2+ coordinating enzymes which are crucial for the early stages of cellulose degradation. In this study, the force field parameters for copper-containing bonds in the Type 1 AA9 protein active site were established and used in a molecular dynamics simulation on a solvated, neutralized system containing an AA9 protein, Cu2+ and a β-cellulose surface. The copper to cellulose interaction was evident during the dynamics, which could also be accelerated by the use of high Cusbnd O van der Waals parameters. The interaction of AA9, Cu2+ and cellulose is described in detail.

Methane and Trichloroethylene Degradation by Methylosinus trichosporium OB3b Expressing Particulate Methane Monooxygenase

PubMed Central

Lontoh, Sonny; Semrau, Jeremy D.

1998-01-01

Whole-cell assays of methane and trichloroethylene (TCE) consumption have been performed on Methylosinus trichosporium OB3b expressing particulate methane monooxygenase (pMMO). From these assays it is apparent that varying the growth concentration of copper causes a change in the kinetics of methane and TCE degradation. For M. trichosporium OB3b, increasing the copper growth concentration from 2.5 to 20 μM caused the maximal degradation rate of methane (Vmax) to decrease from 300 to 82 nmol of methane/min/mg of protein. The methane concentration at half the maximal degradation rate (Ks) also decreased from 62 to 8.3 μM. The pseudo-first-order rate constant for methane, Vmax/Ks, doubled from 4.9 × 10−3 to 9.9 × 10−3 liters/min/mg of protein, however, as the growth concentration of copper increased from 2.5 to 20 μM. TCE degradation by M. trichosporium OB3b was also examined with varying copper and formate concentrations. M. trichosporium OB3b grown with 2.5 μM copper was unable to degrade TCE in both the absence and presence of an exogenous source of reducing equivalents in the form of formate. Cells grown with 20 μM copper, however, were able to degrade TCE regardless of whether formate was provided. Without formate the Vmax for TCE was 2.5 nmol/min/mg of protein, while providing formate increased the Vmax to 4.1 nmol/min/mg of protein. The affinity for TCE also increased with increasing copper, as seen by a change in Ks from 36 to 7.9 μM. Vmax/Ks for TCE degradation by pMMO also increased from 6.9 × 10−5 to 5.2 × 10−4 liters/min/mg of protein with the addition of formate. From these whole-cell studies it is apparent that the amount of copper available is critical in determining the oxidation of substrates in methanotrophs that are expressing only pMMO. PMID:16349516

Clinical relevance of trace element measurement in patients on initiation of parenteral nutrition.

PubMed

Salota, Rashim; Omar, Sohail; Sherwood, Roy A; Raja, Kishor; Vincent, Royce P

2016-11-01

Background and Aims Serum zinc, copper and selenium are measured in patients prior to commencing on parenteral nutrition; however, their interpretation can be difficult due to acute phase reactions. We assessed (i) the relationship of raised C-reactive protein with trace elements and albumin (ii) benefits of measuring trace elements when C-reactive protein is raised in patients requiring short-term parenteral nutrition. Methods Samples were collected for zinc, copper, selenium and albumin at baseline and then every two weeks and correlated with C-reactive protein results in patients on parenteral nutrition. Results were categorized into four groups based on the C-reactive protein concentrations: (i) <20 mg/L, (ii) 20-39 mg/L, (iii) 40-79 mg/L and (iv) ≥80 mg/L. Results In 166 patients, zinc, selenium and albumin correlated (Spearman's) negatively with C-reactive protein; r = -0.26, P < 0.001 (95% CI -0.40 to -0.11), r = -0.44, P < 0.001 (-0.56 to -0.29) and r = -0.22 P = 0.005 (-0.36 to -0.07), respectively. Copper did not correlate with C-reactive protein (r = 0.09, P = 0.25 [-0.07 to 0.25]). Comparison of trace elements between the four groups showed no difference in zinc and copper (both P > 0.05), whereas selenium and albumin were lower in the group with C-reactive protein > 40 mg/L ( P < 0.05). Conclusion In patients on short-term parenteral nutrition, measurement of C-reactive protein is essential when interpreting zinc and selenium but not copper results. Routine measurement of trace elements prior to commencing parenteral nutrition has to be considered on an individual basis in patients with inflammation.

The second Cu(II)-binding site in a proton-rich environment interferes with the aggregation of amyloid-beta(1-40) into amyloid fibrils.

PubMed

Jun, Sangmi; Gillespie, Joel R; Shin, Byong-kyu; Saxena, Sunil

2009-11-17

The overall morphology and Cu(II) ion coordination for the aggregated amyloid-beta(1-40) [Abeta(1-40)] in N-ethylmorpholine (NEM) buffer are affected by Cu(II) ion concentration. This effect is investigated by transmission electron microscopy (TEM), atomic force microscopy (AFM), and electron spin echo envelope modulation (ESEEM) spectroscopy. At lower than equimolar concentrations of Cu(II) ions, fibrillar aggregates of Abeta(1-40) are observed. At these concentrations of Cu(II), the monomeric and fibrillar Abeta(1-40) ESEEM data indicate that the Cu(II) ion is coordinated by histidine residues. For aggregated Abeta(1-40) at a Cu(II):Abeta molar ratio of 2:1, TEM and AFM images show both linear fibrils and granular amorphous aggregates. The ESEEM spectra show that the multi-histidine coordination for Cu(II) ion partially breaks up and becomes exposed to water or exchangeable protons of the peptide at a higher Cu(II) concentration. Since the continuous-wave electron spin resonance results also suggest two copper-binding sites in Abeta(1-40), the proton ESEEM peak may arise from the second copper-binding site, which may be significantly involved in the formation of granular amorphous aggregates. Thioflavin T fluorescence and circular dichroism experiments also show that Cu(II) inhibits the formation of fibrils and induces a nonfibrillar beta-sheet conformation. Therefore, we propose that Abeta(1-40) has a second copper-binding site in a proton-rich environment and the second binding Cu(II) ion interferes with a conformational transition into amyloid fibrils, inducing the formation of granular amorphous aggregates.

An investigation into the unusual linkage isomerization and nitrite reduction activity of a novel tris(2-pyridyl) copper complex

NASA Astrophysics Data System (ADS)

Roger, Isolda; Wilson, Claire; Senn, Hans M.; Sproules, Stephen; Symes, Mark D.

2017-08-01

The copper-containing nitrite reductases (CuNIRs) are a class of enzymes that mediate the reduction of nitrite to nitric oxide in biological systems. Metal-ligand complexes that reproduce the salient features of the active site of CuNIRs are therefore of fundamental interest, both for elucidating the possible mode of action of the enzymes and for developing biomimetic catalysts for nitrite reduction. Herein, we describe the synthesis and characterization of a new tris(2-pyridyl) copper complex ([Cu1(NO2)2]) that binds two molecules of nitrite, and displays all three of the common binding modes for NO2-, with one nitrite bound in an asymmetric quasi-bidentate κ2-ONO manner and the other bound in a monodentate fashion with a linkage isomerism between the κ1-ONO and κ1-NO2 binding modes. We use density functional theory to help rationalize the presence of all three of these linkage isomers in one compound, before assessing the redox activity of [Cu1(NO2)2]. These latter studies show that the complex is not a competent nitrite reduction electrocatalyst in non-aqueous solvent, even in the presence of additional proton donors, a finding which may have implications for the design of biomimetic catalysts for nitrite reduction.

Functional and Biochemical Characterization of Cucumber Genes Encoding Two Copper ATPases CsHMA5.1 and CsHMA5.2*

PubMed Central

Migocka, Magdalena; Posyniak, Ewelina; Maciaszczyk-Dziubinska, Ewa; Papierniak, Anna; Kosieradzaka, Anna

2015-01-01

Plant copper P1B-type ATPases appear to be crucial for maintaining copper homeostasis within plant cells, but until now they have been studied mostly in model plant systems. Here, we present the molecular and biochemical characterization of two cucumber copper ATPases, CsHMA5.1 and CsHMA5.2, indicating a different function for HMA5-like proteins in different plants. When expressed in yeast, CsHMA5.1 and CsHMA5.2 localize to the vacuolar membrane and are activated by monovalent copper or silver ions and cysteine, showing different affinities to Cu+ (Km ∼1 or 0.5 μm, respectively) and similar affinity to Ag+ (Km ∼2.5 μm). Both proteins restore the growth of yeast mutants sensitive to copper excess and silver through intracellular copper sequestration, indicating that they contribute to copper and silver detoxification. Immunoblotting with specific antibodies revealed the presence of CsHMA5.1 and CsHMA5.2 in the tonoplast of cucumber cells. Interestingly, the root-specific CsHMA5.1 was not affected by copper stress, whereas the widely expressed CsHMA5.2 was up-regulated or down-regulated in roots upon copper excess or deficiency, respectively. The copper-induced increase in tonoplast CsHMA5.2 is consistent with the increased activity of ATP-dependent copper transport into tonoplast vesicles isolated from roots of plants grown under copper excess. These data identify CsHMA5.1 and CsHMA5.2 as high affinity Cu+ transporters and suggest that CsHMA5.2 is responsible for the increased sequestration of copper in vacuoles of cucumber root cells under copper excess. PMID:25963145

Subsurface Oxygen in Oxide-Derived Copper Electrocatalysts for Carbon Dioxide Reduction

DOE PAGES

Eilert, Andre; Cavalca, Filippo; Roberts, F. Sloan; ...

2016-12-16

Copper electrocatalysts derived from an oxide have shown extraordinary electrochemical properties for the carbon dioxide reduction reaction (CO 2RR). Using in situ ambient pressure X-ray photoelectron spectroscopy and quasi in situ electron energy-loss spectroscopy in a transmission electron microscope, we show that there is a substantial amount of residual oxygen in nanostructured, oxide-derived copper electrocatalysts but no residual copper oxide. On the basis of these findings in combination with density functional theory simulations, we propose that residual subsurface oxygen changes the electronic structure of the catalyst and creates sites with higher carbon monoxide binding energy. If such sites are stablemore » under the strongly reducing conditions found in CO 2RR, these findings would explain the high efficiencies of oxide-derived copper in reducing carbon dioxide to multicarbon compounds such as ethylene.« less

CCS mRNA transcripts and serum CCS protein as copper marker in adults suffering inflammatory processes.

PubMed

Araya, Magdalena; Gutiérrez, Ricardo; Arredondo, Miguel

2014-08-01

The chaperone to Zn-Cu superoxide dismutase (CCS) has been postulated as a candidate copper indicator, changing in a consistent manner in induced and recovered copper deficiency, in experimental cell and animal models. In real life people have various conditions that may modify molecules acting as acute phase proteins, such as serum ceruloplasmin and copper concentration and could alter CCS responses. With the hypothesis that CCS mRNA transcripts and protein would be different in individuals suffering inflammatory processes in comparison to healthy individuals, we assessed adult individuals who, although not ill had conditions known to induce variable degrees of inflammation. Screening of 600 adults resulted in two study groups, formed on the basis of their clinical history and levels of serum C reactive protein (CRP): Group 1 (n = 61, mean (range) CRP = 0.9 (0.3-2.0 mg/dL) and Group 2 (n = 150, mean (range) CRP = 6.1 (4.3-8.7 mg/dL). Results showed that mRNA transcripts relative abundance was not different for CCS, MTIIA, TNF-alpha and Cu-Zn-SOD by group (p > 0.05, one way Anova), nor between sexes (p > 0.05, one way Anova). Distribution of CCS mRNA transcripts and CCS protein in serum did not show any differences or trends. Results disproved our hypothesis that CCS abundance of transcripts and CCS protein would be different in individuals suffering inflammatory processes, adding further support to the idea that CCS may be a copper marker.

Outer-Sphere Contributions to the Electronic Structure of Type Zero Copper Proteins

PubMed Central

Lancaster, Kyle M.; Zaballa, María-Eugenia; Sproules, Stephen; Sundararajan, Mahesh; DeBeer, Serena; Richards, John H.; Vila, Alejandro J.; Neese, Frank; Gray, Harry B.

2016-01-01

Bioinorganic canon states that active-site thiolate coordination promotes rapid electron transfer (ET) to and from type 1 copper proteins. In recent work, we have found that copper ET sites in proteins also can be constructed without thiolate ligation (called “type zero” sites). Here we report multifrequency electron paramagnetic resonance (EPR), magnetic circular dichroism (MCD), and nuclear magnetic resonance (NMR) spectroscopic data together with density functional theory (DFT) and spectroscopy-oriented configuration interaction (SORCI) calculations for type zero Pseudomonas aeruginosa azurin variants. Wild-type (type 1) and type zero copper centers experience virtually identical ligand fields. Moreover, O-donor covalency is enhanced in type zero centers relative that in the C112D (type 2) protein. At the same time, N-donor covalency is reduced in a similar fashion to type 1 centers. QM/MM and SORCI calculations show that the electronic structures of type zero and type 2 are intimately linked to the orientation and coordination mode of the carboxylate ligand, which in turn is influenced by outer-sphere hydrogen bonding. PMID:22563915

Measurement of labile copper in wine by medium exchange stripping potentiometry utilising screen printed carbon electrodes.

PubMed

Clark, Andrew C; Kontoudakis, Nikolaos; Barril, Celia; Schmidtke, Leigh M; Scollary, Geoffrey R

2016-07-01

The presence of copper in wine is known to impact the reductive, oxidative and colloidal stability of wine, and techniques enabling measurement of different forms of copper in wine are of particular interest in understanding these spoilage processes. Electrochemical stripping techniques developed to date require significant pretreatment of wine, potentially disturbing the copper binding equilibria. A thin mercury film on a screen printed carbon electrode was utilised in a flow system for the direct analysis of labile copper in red and white wine by constant current stripping potentiometry with medium exchange. Under the optimised conditions, including an enrichment time of 500s and constant current of 1.0μA, the response range was linear from 0.015 to 0.200mg/L. The analysis of 52 red and white wines showed that this technique generally provided lower labile copper concentrations than reported for batch measurement by related techniques. Studies in a model system and in finished wines showed that the copper sulfide was not measured as labile copper, and that loss of hydrogen sulfide via volatilisation induced an increase in labile copper within the model wine system. Copyright © 2016 Elsevier B.V. All rights reserved.

Reactivity of food phenols with iron and copper ions: binding, dioxygen activation and oxidation mechanisms.

PubMed

Nkhili, Ezzohra; Loonis, Michèle; Mihai, Simona; El Hajji, Hakima; Dangles, Olivier

2014-06-01

In this work, the affinity of common dietary phenols (gallic acid, caffeic acid, catechin, and rutin) for iron and copper ions was quantitatively investigated in neutral phosphate buffer as well as the reactivity of the complexes toward dioxygen. Contrasting behaviors were observed: because of the competing phosphate ions, Fe(III) binding is much slower than Fe(II) binding, which is rapidly followed by autoxidation of Fe(II) into Fe(III). With both ions, O2 consumption and H2O2 production are modest and the phenolic ligands are only slowly oxidized. By contrast, metal-phenol binding is fast with both Cu(I) and Cu(II). With Cu(I), O2 consumption and H2O2 production are very significant and the phenolic ligands are rapidly oxidized into a complex mixture of oligomers. The corresponding mechanism with Cu(II) is hampered by the preliminary rate-determining step of Cu(II) reduction by the phenols. The consequences of these findings for the stability and antioxidant activity of plant phenols are discussed.

Synthesis of novel coumarin nucleus-based DPA drug-like molecular entity: In vitro DNA/Cu(II) binding, DNA cleavage and pro-oxidant mechanism for anticancer action

PubMed Central

Khan, Saman; Malla, Ali Mohammed; Zafar, Atif

2017-01-01

Despite substantial research on cancer therapeutics, systemic toxicity and drug-resistance limits the clinical application of many drugs like cisplatin. Therefore, new chemotherapeutic strategies against different malignancies are needed. Targeted cancer therapy is a new paradigm for cancer therapeutics which targets pathways or chemical entities specific to cancer cells than normal ones. Unlike normal cells, cancer cells contain elevated copper which plays an integral role in angiogenesis. Copper is an important metal ion associated with chromatin DNA, particularly with guanine. Thus, targeting copper via copper-specific chelators in cancer cells can serve as an effective anticancer strategy. New pharmacophore di(2-picolyl)amine (DPA)-3(bromoacetyl) coumarin (ligand-L) was synthesized and characterized by IR, ESI-MS, 1H- and 13C-NMR. Binding ability of ligand-L to DNA/Cu(II) was evaluated using a plethora of biophysical techniques which revealed ligand-L-DNA and ligand-L-Cu(II) interaction. Competitive displacement assay and docking confirmed non-intercalative binding mode of ligand-L with ctDNA. Cyclic voltammetry confirmed ligand-L causes quasi reversible Cu(II)/Cu(I) conversion. Further, acute toxicity studies revealed no toxic effects of ligand-L on mice. To evaluate the chemotherapeutic potential and anticancer mechanism of ligand-L, DNA damage via pBR322 cleavage assay and reactive oxygen species (ROS) generation were studied. Results demonstrate that ligand-L causes DNA cleavage involving ROS generation in the presence of Cu(II). In conclusion, ligand-L causes redox cycling of Cu(II) to generate ROS which leads to oxidative DNA damage and pro-oxidant cancer cell death. These findings will establish ligand-L as a lead molecule to synthesize new molecules with better copper chelating and pro-oxidant properties against different malignancies. PMID:28763458

Xenobiotic, Bile Acid, and Cholesterol Transporters: Function and Regulation

PubMed Central

Aleksunes, Lauren M.

2010-01-01

Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting β polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) α and β] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory factors that influence transporter expression and function, including transcriptional activation and post-translational modifications as well as subcellular trafficking. Sex differences, ontogeny, and pharmacological and toxicological regulation of transporters are also addressed. Transporters are important transmembrane proteins that mediate the cellular entry and exit of a wide range of substrates throughout the body and thereby play important roles in human physiology, pharmacology, pathology, and toxicology. PMID:20103563

Novel Breast Cancer Therapeutics Based on Bacterial Cupredoxin

DTIC Science & Technology

2007-09-01

characterization of in vitro unfolding and thermodynamic stability of two copper chaperone proteins: Bacillus subtilis CopZ and Homo sapiens Atox1. We find that...thermodynamic stability of homologous copper chaperones from two different organisms: B. subtilis CopZ and H. sapiens Atox1. Although these proteins share...gene and a pET28a vector with the H. sapiens Atox1 gene were expressed in E. coli. For both proteins, published purification protocols were

DNA-hosted copper nanoclusters/graphene oxide based fluorescent biosensor for protein kinase activity detection.

PubMed

Wang, Mengke; Lin, Zihan; Liu, Qing; Jiang, Shan; Liu, Hua; Su, Xingguang

2018-07-05

A novel fluorescent biosensor for protein kinase activity (PKA) detection was designed by applying double-strands DNA-hosted copper nanoclusters (dsDNA-CuNCs) and graphene oxide (GO). One DNA strand of the dsDNA consisted of two domains, one domain can hybridize with another complementary DNA strand to stabilize the fluorescent CuNCs and another domain was adenosine 5'-triphosphate (ATP) aptamer. ATP aptamer of the dsDNA-CuNCs would be spontaneously absorbed onto the GO surface through π-π stacking interactions. Thus GO can efficiently quench the fluorescence (FL) of dsDNA-CuNCs through fluorescence resonance energy transfer (FRET). In the present of ATP, ATP specifically combined with ATP aptamer to form ATP-ATP aptamer binding complexes, which had much less affinity to GO, resulting in the fluorescence recovery of the system. Nevertheless, in the presence of PKA, ATP could be translated into ADP and ADP could not combine with ATP aptamer resulting in the fluorescence quenching of dsDNA-CuNCs again. According to the change of the fluorescence signal, PKA activity could be successfully monitored in the range of 0.1-5.0 U mL -1 with a detection limit (LOD) of 0.039 U mL -1 . Besides, the inhibitory effect of H-89 on PKA activity was studied. The sensor was performed for PKA activity detection in cell lysates with satisfactory results. Copyright © 2018 Elsevier B.V. All rights reserved.

The Biological Function of the Prion Protein: A Cell Surface Scaffold of Signaling Modules.

PubMed

Linden, Rafael

2017-01-01

The prion glycoprotein (PrP C ) is mostly located at the cell surface, tethered to the plasma membrane through a glycosyl-phosphatydil inositol (GPI) anchor. Misfolding of PrP C is associated with the transmissible spongiform encephalopathies (TSEs), whereas its normal conformer serves as a receptor for oligomers of the β-amyloid peptide, which play a major role in the pathogenesis of Alzheimer's Disease (AD). PrP C is highly expressed in both the nervous and immune systems, as well as in other organs, but its functions are controversial. Extensive experimental work disclosed multiple physiological roles of PrP C at the molecular, cellular and systemic levels, affecting the homeostasis of copper, neuroprotection, stem cell renewal and memory mechanisms, among others. Often each such process has been heralded as the bona fide function of PrP C , despite restricted attention paid to a selected phenotypic trait, associated with either modulation of gene expression or to the engagement of PrP C with a single ligand. In contrast, the GPI-anchored prion protein was shown to bind several extracellular and transmembrane ligands, which are required to endow that protein with the ability to play various roles in transmembrane signal transduction. In addition, differing sets of those ligands are available in cell type- and context-dependent scenarios. To account for such properties, we proposed that PrP C serves as a dynamic platform for the assembly of signaling modules at the cell surface, with widespread consequences for both physiology and behavior. The current review advances the hypothesis that the biological function of the prion protein is that of a cell surface scaffold protein, based on the striking similarities of its functional properties with those of scaffold proteins involved in the organization of intracellular signal transduction pathways. Those properties are: the ability to recruit spatially restricted sets of binding molecules involved in specific signaling; mediation of the crosstalk of signaling pathways; reciprocal allosteric regulation with binding partners; compartmentalized responses; dependence of signaling properties upon posttranslational modification; and stoichiometric requirements and/or oligomerization-dependent impact on signaling. The scaffold concept may contribute to novel approaches to the development of effective treatments to hitherto incurable neurodegenerative diseases, through informed modulation of prion protein-ligand interactions.

Conserved active site residues limit inhibition of a copper-containing nitrite reductase by small molecules.

PubMed

Tocheva, Elitza I; Eltis, Lindsay D; Murphy, Michael E P

2008-04-15

The interaction of copper-containing dissimilatory nitrite reductase from Alcaligenes faecalis S-6 ( AfNiR) with each of five small molecules was studied using crystallography and steady-state kinetics. Structural studies revealed that each small molecule interacted with the oxidized catalytic type 2 copper of AfNiR. Three small molecules (formate, acetate and nitrate) mimic the substrate by having at least two oxygen atoms for bidentate coordination to the type 2 copper atom. These three anions bound to the copper ion in the same asymmetric, bidentate manner as nitrite. Consistent with their weak inhibition of the enzyme ( K i >50 mM), the Cu-O distances in these AfNiR-inhibitor complexes were approximately 0.15 A longer than that observed in the AfNiR-nitrite complex. The binding mode of each inhibitor is determined in part by steric interactions with the side chain of active site residue Ile257. Moreover, the side chain of Asp98, a conserved residue that hydrogen bonds to type 2 copper-bound nitrite and nitric oxide, was either disordered or pointed away from the inhibitors. Acetate and formate inhibited AfNiR in a mixed fashion, consistent with the occurrence of second acetate binding site in the AfNiR-acetate complex that occludes access to the type 2 copper. A fourth small molecule, nitrous oxide, bound to the oxidized metal in a side-on fashion reminiscent of nitric oxide to the reduced copper. Nevertheless, nitrous oxide bound at a farther distance from the metal. The fifth small molecule, azide, inhibited the reduction of nitrite by AfNiR most strongly ( K ic = 2.0 +/- 0.1 mM). This ligand bound to the type 2 copper center end-on with a Cu-N c distance of approximately 2 A, and was the only inhibitor to form a hydrogen bond with Asp98. Overall, the data substantiate the roles of Asp98 and Ile257 in discriminating substrate from other small anions.

SOX9/miR-130a/CTR1 axis modulates DDP-resistance of cervical cancer cell.

PubMed

Feng, Chenzhe; Ma, Fang; Hu, Chunhong; Ma, Jin-An; Wang, Jingjing; Zhang, Yang; Wu, Fang; Hou, Tao; Jiang, Shun; Wang, Yapeng; Feng, Yeqian

2018-01-01

Cisplatin (DDP) -based chemotherapy is a standard strategy for cervical cancer, while chemoresistance remains a huge challenge. Copper transporter protein 1 (CTR1), a copper influx transporter required for high affinity copper (probably reduced Cu I) transport into the cell, reportedly promotes a significant fraction of DDP internalization in tumor cells. In the present study, we evaluated the function of CTR1 in the cell proliferation of cervical cancer upon DDP treatment. MicroRNAs (miRNAs) have been regarded as essential regulators of cell proliferation, apoptosis, migration, as well as chemoresistance. By using online tools, we screened for candidate miRNAs potentially regulate CTR1, among which miR-130a has been proved to promote cervical cancer cell proliferation through targeting PTEN in our previous study. In the present study, we investigated the role of miR-130a in cervical cancer chemoresistance to DDP, and confirmed the binding of miR-130a to CTR1. SOX9 also reportedly act on cancer chemoresistance. In the present study, we revealed that SOX9 inversely regulated miR-130a through direct targeting the promoter of miR-130a. Consistent with previous studies, SOX9 could affect cervical cancer chemoresistance to DDP. Taken together, we demonstrated a SOX9/miR-130a/CTR1 axis which modulated the chemoresistance of cervical cancer cell to DDP, and provided promising targets for dealing with the chemoresistance of cervical cancer.

Transcriptome Sequencing Identifies SPL7-Regulated Copper Acquisition Genes FRO4/FRO5 and the Copper Dependence of Iron Homeostasis in Arabidopsis[C][W

PubMed Central

Bernal, María; Casero, David; Singh, Vasantika; Wilson, Grandon T.; Grande, Arne; Yang, Huijun; Dodani, Sheel C.; Pellegrini, Matteo; Huijser, Peter; Connolly, Erin L.; Merchant, Sabeeha S.; Krämer, Ute

2012-01-01

The transition metal copper (Cu) is essential for all living organisms but is toxic when present in excess. To identify Cu deficiency responses comprehensively, we conducted genome-wide sequencing-based transcript profiling of Arabidopsis thaliana wild-type plants and of a mutant defective in the gene encoding SQUAMOSA PROMOTER BINDING PROTEIN-LIKE7 (SPL7), which acts as a transcriptional regulator of Cu deficiency responses. In response to Cu deficiency, FERRIC REDUCTASE OXIDASE5 (FRO5) and FRO4 transcript levels increased strongly, in an SPL7-dependent manner. Biochemical assays and confocal imaging of a Cu-specific fluorophore showed that high-affinity root Cu uptake requires prior FRO5/FRO4-dependent Cu(II)-specific reduction to Cu(I) and SPL7 function. Plant iron (Fe) deficiency markers were activated in Cu-deficient media, in which reduced growth of the spl7 mutant was partially rescued by Fe supplementation. Cultivation in Cu-deficient media caused a defect in root-to-shoot Fe translocation, which was exacerbated in spl7 and associated with a lack of ferroxidase activity. This is consistent with a possible role for a multicopper oxidase in Arabidopsis Fe homeostasis, as previously described in yeast, humans, and green algae. These insights into root Cu uptake and the interaction between Cu and Fe homeostasis will advance plant nutrition, crop breeding, and biogeochemical research. PMID:22374396

Covalent protein-oligonucleotide conjugates by copper-free click reaction

PubMed Central

Khatwani, Santoshkumar L.; Mullen, Daniel G.; Hast, Michael A.; Beese, Lorena S.; Distefano, Mark D.; Taton, T. Andrew

2013-01-01

Covalent protein-oligodeoxynucleotide (protein-ODN) conjugates are useful in a number of biological applications, but synthesizing discrete conjugates—where the connection between the two components is at a defined location in both the protein and the ODN—under mild conditions with significant yield can be a challenge. In this article, we demonstrate a strategy for synthesizing discrete protein-ODN conjugates using strain-promoted azide-alkyne [3+2] cycloaddition (SPAAC, a copper-free “click” reaction). Azide-functionalized proteins, prepared by enzymatic prenylation of C-terminal CVIA tags with synthetic azidoprenyl diphosphates, were “clicked” to ODNs that had been modified with a strained dibenzocyclooctyne (DIBO-ODN). The resulting protein-ODN conjugates were purified and characterized by size-exclusion chromatography and gel electrophoresis. We find that the yields and reaction times of the SPAAC bioconjugation reactions are comparable to those previously reported for copper-catalyzed azide-alkyne [3+2] cycloaddition (CuAAC) bioconjugation, but require no catalyst. The same SPAAC chemistry was used to immobilize azide-modified proteins onto surfaces, using surface-bound DIBO-ODN as a heterobifunctional linker. Cu-free click bioconjugation of proteins to ODNs is a simple and versatile alternative to Cu-catalyzed click methods. PMID:22682299

Grain-Boundary Resistance in Copper Interconnects: From an Atomistic Model to a Neural Network

NASA Astrophysics Data System (ADS)

Valencia, Daniel; Wilson, Evan; Jiang, Zhengping; Valencia-Zapata, Gustavo A.; Wang, Kuang-Chung; Klimeck, Gerhard; Povolotskyi, Michael

2018-04-01

Orientation effects on the specific resistance of copper grain boundaries are studied systematically with two different atomistic tight-binding methods. A methodology is developed to model the specific resistance of grain boundaries in the ballistic limit using the embedded atom model, tight- binding methods, and nonequilibrium Green's functions. The methodology is validated against first-principles calculations for thin films with a single coincident grain boundary, with 6.4% deviation in the specific resistance. A statistical ensemble of 600 large, random structures with grains is studied. For structures with three grains, it is found that the distribution of specific resistances is close to normal. Finally, a compact model for grain-boundary-specific resistance is constructed based on a neural network.

Enhanced accumulation of Kir4.1 protein, but not mRNA, in a murine model of cuprizone-induced demyelination.

PubMed

Nakajima, Mitsunari; Kawamura, Takuya; Tokui, Ryuji; Furuta, Kohei; Sugino, Mami; Nakanishi, Masayuki; Okuyama, Satoshi; Furukawa, Yoshiko

2013-11-06

Two channel proteins, inwardly rectifying potassium channel 4.1 (Kir4.1) and water channel aquaporin-4 (AQP4), were recently identified as targets of an autoantibody response in patients with multiple sclerosis and neuromyelitis optica, respectively. In the present study, we examined the expression patterns of Kir4.1 and AQP4 in a mouse model of demyelination induced by cuprizone, a copper chelator. Demyelination was confirmed by immunohistochemistry using an anti-proteolipid protein antibody in various brain regions, including the corpus callosum, of cuprizone-fed mice. Activation of microglial and astroglial cells was also confirmed by immunohistochemistry, using an anti-ionized calcium binding adapter molecule and a glial fibrillary acidic protein antibody. Western blot analysis revealed the induction of Kir4.1 protein, but not AQP4, in the cortex of cuprizone-fed mice. Immunohistochemical analysis confirmed the Kir4.1 protein induction in microvessels of the cerebral cortex. Real-time polymerase chain reaction analysis revealed that mRNA levels of Kir4.1 and AQP4 in the cortex did not change during cuprizone administration. These findings suggest that enhanced accumulation of Kir4.1 protein in the brain with an inflammatory condition facilitates the autoantibody formation against Kir4.1 in patients with multiple sclerosis. © 2013 Published by Elsevier B.V.

Assessment of nutritional status in noninstitutionalized elderly.

PubMed

Powers, J S; Folk, M C; Burger, C; Wilson, P; Stocking, B J; Collins, J

1989-08-01

Aging may modify both the availability of and needs for certain nutrients. Our study was done to assess the contribution of age alone to micronutrient levels in older volunteers (aged 60 or more). One hundred two healthy elderly white subjects, 63 women and 39 men, carefully screened by history or chart review, were studied in the fasting state. All were noninstitutionalized without serious chronic or acute illness; their diets were nutritionally adequate, containing more than two thirds of the recommended dietary allowance (RDA) for all nutrients, and no subject was taking more than twice the RDA of fat-soluble vitamins. These subjects had higher levels of plasma and red blood cell carnitine, and vitamins A, E, and C. They had lower levels of albumin, transferrin, and zinc than younger laboratory reference subjects. Retinol-binding protein, serum and red blood cell folate, and copper levels were not different. With increasing age, levels of transferrin and vitamins C and E fell; all other measured micronutrient levels were similar. Albumin, vitamin C, and copper values were higher among elderly women, and plasma and red blood cell carnitine values and zinc levels were higher in elderly men. There was great variability in the micronutrient levels despite similar nutrient intakes.

αRep A3: A Versatile Artificial Scaffold for Metalloenzyme Design.

PubMed

Di Meo, Thibault; Ghattas, Wadih; Herrero, Christian; Velours, Christophe; Minard, Philippe; Mahy, Jean-Pierre; Ricoux, Rémy; Urvoas, Agathe

2017-07-26

αRep refers to a new family of artificial proteins based on a thermostable α-helical repeated motif. One of its members, αRep A3, forms a stable homo-dimer with a wide cleft that is able to accommodate metal complexes and thus appears to be suitable for generating new artificial biocatalysts. Based on the crystal structure of αRep A3, two positions (F119 and Y26) were chosen, and independently changed into cysteine residues. A phenanthroline ligand was covalently attached to the unique cysteine residue of each protein variant, and the corresponding biohybrids were purified and characterized. Once mutated and coupled to phenanthroline, the protein remained folded and dimeric. Copper(II) was specifically bound by the two biohybrids with two different binding modes. Furthermore, the holo-biohybrid A3F119NPH was found to be capable of enantioselectively catalyzing Diels-Alder (D-A) cycloadditions with up to 62 % ee. This study validates the choice of the αRep A3 dimer as a protein scaffold and provides a promising new route for the design and production of new enantioselective biohybrids based on entirely artificial proteins obtained from a highly diverse library. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular cloning and characterization of a tumor-associated, growth-related, and time-keeping hydroquinone (NADH) oxidase (tNOX) of the HeLa cell surface

NASA Technical Reports Server (NTRS)

Chueh, Pin-Ju; Kim, Chinpal; Cho, NaMi; Morre, Dorothy M.; Morre, D. James

2002-01-01

NOX proteins are growth-related cell surface proteins that catalyze both hydroquinone or NADH oxidation and protein disulfide interchange and exhibit prion-like properties. The two enzymatic activities alternate to generate a regular period length of about 24 min. Here we report the expression, cloning, and characterization of a tumor-associated NADH oxidase (tNOX). The cDNA sequence of 1830 bp is located on gene Xq25-26 with an open reading frame encoding 610 amino acids. The activities of the bacterially expressed tNOX oscillate with a period length of 22 min as is characteristic of tNOX activities in situ. The activities are inhibited completely by capsaicin, which represents a defining characteristic of tNOX activity. Functional motifs identified by site-directed mutagenesis within the C-terminal portion of the tNOX protein corresponding to the processed plasma membrane-associated form include quinone (capsaicin), copper and adenine nucleotide binding domains, and two cysteines essential for catalytic activity. Four of the six cysteine to alanine replacements retained enzymatic activity, but the period lengths of the oscillations were increased. A single protein with two alternating enzymatic activities indicative of a time-keeping function is unprecedented in the biochemical literature.

Proteome characterization of copper stress responses in the roots of sorghum

USDA-ARS?s Scientific Manuscript database

Copper (Cu) is an essential micronutrient for all living organisms, but at elevated concentrations, it is extremely toxic to plants and can inactivate and disturb protein structures. To explore the molecular changes involved in the copper stress response, a study was conducted using the roots of sor...

Why copper is preferred over iron for oxygen activation and reduction in haem-copper oxidases.

PubMed

Bhagi-Damodaran, Ambika; Michael, Matthew A; Zhu, Qianhong; Reed, Julian; Sandoval, Braddock A; Mirts, Evan N; Chakraborty, Saumen; Moënne-Loccoz, Pierre; Zhang, Yong; Lu, Yi

2017-03-01

Haem-copper oxidase (HCO) catalyses the natural reduction of oxygen to water using a haem-copper centre. Despite decades of research on HCOs, the role of non-haem metal and the reason for nature's choice of copper over other metals such as iron remains unclear. Here, we use a biosynthetic model of HCO in myoglobin that selectively binds different non-haem metals to demonstrate 30-fold and 11-fold enhancements in the oxidase activity of Cu- and Fe-bound HCO mimics, respectively, as compared with Zn-bound mimics. Detailed electrochemical, kinetic and vibrational spectroscopic studies, in tandem with theoretical density functional theory calculations, demonstrate that the non-haem metal not only donates electrons to oxygen but also activates it for efficient O-O bond cleavage. Furthermore, the higher redox potential of copper and the enhanced weakening of the O-O bond from the higher electron density in the d orbital of copper are central to its higher oxidase activity over iron. This work resolves a long-standing question in bioenergetics, and renders a chemical-biological basis for the design of future oxygen-reduction catalysts.

Novel metal based anti-tuberculosis agent: synthesis, characterization, catalytic and pharmacological activities of copper complexes.

PubMed

Joseph, J; Nagashri, K; Janaki, G Boomadevi

2012-03-01

Copper complexes of molecular formulae, [CuL(1)(OAc)], [CuL(2)(H(2)O)], [CuL(3)(H(2)O)], [CuL(4)(H(2)O)], [CuL(5)(H(2)O)] where L(1)-L(5) represents Schiff base ligands [by the condensation of 3-hydroxyflavone with 4-aminoantipyrine (L(1))/o-aminophenol (L(2))/o-aminobenzoic acid (L(3))/o-aminothiazole (L(4))/thiosemicarbazide (L(5))], have been prepared. They were characterized using analytical and spectral techniques. The DNA binding properties of copper complexes were studied using electronic absorption spectra and viscosity measurements. Superoxide dismutase and antioxidant activities of the copper complexes have also been studied. Furthermore, the copper complexes have been found to promote pUC18 DNA cleavage in the presence of oxidant. Anti-tuberculosis activity was also performed. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Copper Complexation Screen Reveals Compounds with Potent Antibiotic Properties against Methicillin-Resistant Staphylococcus aureus

PubMed Central

Haeili, Mehri; Moore, Casey; Davis, Christopher J. C.; Cochran, James B.; Shah, Santosh; Shrestha, Tej B.; Zhang, Yaofang; Bossmann, Stefan H.; Benjamin, William H.

2014-01-01

Macrophages take advantage of the antibacterial properties of copper ions in the killing of bacterial intruders. However, despite the importance of copper for innate immune functions, coordinated efforts to exploit copper ions for therapeutic interventions against bacterial infections are not yet in place. Here we report a novel high-throughput screening platform specifically developed for the discovery and characterization of compounds with copper-dependent antibacterial properties toward methicillin-resistant Staphylococcus aureus (MRSA). We detail how one of the identified compounds, glyoxal-bis(N4-methylthiosemicarbazone) (GTSM), exerts its potent strictly copper-dependent antibacterial properties on MRSA. Our data indicate that the activity of the GTSM-copper complex goes beyond the general antibacterial effects of accumulated copper ions and suggest that, in contrast to prevailing opinion, copper complexes can indeed exhibit species- and target-specific activities. Based on experimental evidence, we propose that copper ions impose structural changes upon binding to the otherwise inactive GTSM ligand and transfer antibacterial properties to the chelate. In turn, GTSM determines target specificity and utilizes a redox-sensitive release mechanism through which copper ions are deployed at or in close proximity to a putative target. According to our proof-of-concept screen, copper activation is not a rare event and even extends to already established drugs. Thus, copper-activated compounds could define a novel class of anti-MRSA agents that amplify copper-dependent innate immune functions of the host. To this end, we provide a blueprint for a high-throughput drug screening campaign which considers the antibacterial properties of copper ions at the host-pathogen interface. PMID:24752262

Streptococcus mutans copper chaperone, CopZ, is critical for biofilm formation and competitiveness.

PubMed

Garcia, S S; Du, Q; Wu, H

2016-12-01

The oral cavity is a dynamic environment characterized by hundreds of bacterial species, saliva, and an influx of nutrients and metal ions such as copper. Although there is a physiologic level of copper in the saliva, the oral cavity is often challenged with an influx of copper ions. At high concentrations copper is toxic and must therefore be strictly regulated by pathogens for them to persist and cause disease. The cariogenic pathogen Streptococcus mutans manages excess copper using the copYAZ operon that encodes a negative DNA-binding repressor (CopY), the P1-ATPase copper exporter (CopA), and the copper chaperone (CopZ). These hypothetical roles of the copYAZ operon in regulation and copper transport to receptors led us to investigate their contribution to S. mutans virulence. Mutants defective in the copper chaperone CopZ, but not CopY or CopA, were impaired in biofilm formation and competitiveness against commensal streptococci. Characterization of the CopZ mutant biofilm revealed a decreased secretion of glucosyltransferases and reduced expression of mutacin genes. These data suggest that the function of copZ on biofilm and competitiveness is independent of copper resistance and CopZ is a global regulator for biofilm and other virulence factors. Further characterization of CopZ may lead to the identification of new biofilm pathways. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

The Novel Helicobacter pylori CznABC Metal Efflux Pump Is Required for Cadmium, Zinc, and Nickel Resistance, Urease Modulation, and Gastric Colonization

PubMed Central

Stähler, Frank Nils; Odenbreit, Stefan; Haas, Rainer; Wilrich, Julia; Vliet, Arnoud H. M. Van; Kusters, Johannes G.; Kist, Manfred; Bereswill, Stefan

2006-01-01

Maintaining metal homeostasis is crucial for the adaptation of Helicobacter pylori to the gastric environment. Iron, copper, and nickel homeostasis has recently been demonstrated to be required for the establishment of H. pylori infection in animal models. Here we demonstrate that the HP0969-0971 gene cluster encoding the Czc-type metal export pump homologs HP0969, HP0970, and the H. pylori-specific protein HP0971 forms part of a novel H. pylori metal resistance determinant, which is required for gastric colonization and for the modulation of urease activity. Insertional mutagenesis of the HP0971, HP0970, or HP0969 genes in H. pylori reference strain 26695 resulted in increased sensitivity to cadmium, zinc, and nickel (czn), suggesting that the encoded proteins constitute a metal-specific export pump. Accordingly, the genes were designated cznC (HP0971), cznB (HP0970), and cznA (HP0969). The CznC and CznA proteins play a predominant role in nickel homeostasis, since only the cznC and cznA mutants but not the cznB mutant displayed an 8- to 10-fold increase in urease activity. Nickel-specific affinity chromatography demonstrated that recombinant versions of CznC and CznB can bind to nickel and that the purified CznB protein interacted with cadmium and zinc, since both metals competitively inhibited nickel binding. Finally, single cznA, cznB, and cznC mutants did not colonize the stomach in a Mongolian gerbil-based animal model. This demonstrates that the metal export functions of H. pylori cznABC are essential for gastric colonization and underlines the extraordinary importance of metal ion homeostasis for the survival of H. pylori in the gastric environment. PMID:16790756

BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

PubMed

Wei, Qing; La, David; Kihara, Daisuke

2017-01-01

Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

A Robust Analytical Approach for the Identification of Specific Protein Carbonylation Sites: Metal-Catalyzed Oxidations of Human Serum Albumin

PubMed Central

Ugur, Zafer; Gronert, Scott

2017-01-01

The formation of protein carbonyls in the metal-catalyzed oxidation of human serum albumin (HSA) is characterized using a new analytical approach that involves tagging the modification site with multiple hydrazide reagents. Protein carbonyl formation at lysine and arginine residues was catalyzed with copper and iron ions, and the resulting oxidation patterns in HSA are contrasted. A total of 18 modification sites were identified with iron ion catalysis and 14 with copper ion catalysis. However, with the more stringent requirement of identification with at least two tagging reagents, the number of validated modification sites drops to 10 for iron and 9 for copper. Of the 14 total validated sites, there were only five in common for the two metal ions. The results illustrate the value of using multiple tagging agents and highlight the selective and specific nature of metal-catalyzed protein oxidations. PMID:28303033

The influence of duckweed species diversity on ecophysiological tolerance to copper exposure.

PubMed

Zhao, Zhao; Shi, Huijuan; Duan, Dongzhu; Li, Hongmei; Lei, Tingwen; Wang, Maolin; Zhao, Hai; Zhao, Yun

2015-07-01

In excess, copper is toxic to plants. In the plants, Landoltia punctata and Lemna minor grown in mixed and monoculture, the effects of exposure to varying concentrations of copper (0.01, 0.1, 0.5 and 1mgL(-1) Cu) for seven days were assessed by measuring changes in the chlorophyll, protein and malondialdehyde (MDA) content, catalase (CAT), superoxide dismutase (SOD) and ascorbate peroxidase (APX) activity. According to results, Cu levels in plants increased with increasing Cu concentration. The level of photosynthetic pigments and crude proteins decreased only upon exposure to high Cu concentrations. However, the starch and malondialdehyde (MDA) content increased. These results suggested a stress alleviation that was possibly the result of antioxidants such as CAT and SOD, the activities of which increased with increasing Cu levels. APX activity increased in L. punctata, but decreased in L. minor, under monoculture or mixed culture conditions. In addition, the duckweed in mixed culture exhibited increased antioxidant enzyme activities which provide increased resistance to copper in moderate copper concentrations. As the copper concentration increased, the duckweed in the mixed culture limited the uptake of copper to avoid toxicity. Copyright © 2015 Elsevier B.V. All rights reserved.

Comparative study on effects of four energy plants growth on chemical fractions of heavy metals and activity of soil enzymes in copper mine tailings.

PubMed

Zhang, Jie; Yang, Shiyong; Yang, Hongfei; Huang, Yongjie; Zheng, Liming; Yuan, Jing; Zhou, Shoubiao

2018-05-12

Four gramineous energy plants, Miscanthus sacchariflorus, M. floridulus, Phragmites australis, and Arundo donax were grown on copper tailings in the field for four years. Their phytoremediation potential was examined in terms of their effects on the fractions of heavy metals and soil enzyme activities. Results showed that plantation of these four gramineous plants has improved the proportion of organic material (OM)-binding fraction of heavy metals in copper tailings as a whole, and reduced the proportion of exchangeable and residual fractions. In particular, M. sacchariflorus growth improved significantly the proportion of the OM-binding fractions of Cu (1.73 times), Cd (1.71 times), Zn (1.18 times), and Pb (3.14 times) (P < 0.05) and reduced markedly the residual fractions of Cu (64.45%), Cd (82.38%), Zn (61.43%), and Pb (73.41%) (P < 0.05). Except for A. donax, the growth of other three energy plants improved the activity of phosphatase, urease and dehydrogenase in copper tailings to some extent. In particular, the activity of soil phosphatase and urease in planted tailings differed significantly from that of control (P < 0.05). The effect of M. sacchariflorus growth on soil enzyme was the highest, followed by P. australis, M. floridulus, and A. donax. The content of each heavy metal fraction in soil was correlated with soil enzyme activities, especially the content of OM-binding fraction, which correlated significantly with the activities of phosphatase, urease and dehydrogenase in soil. According to the effects of four gramineous plants growth on activity of soil enzymes and fractions of heavy metals, M. sacchariflorus had the optimal effects for phytoremediation. Therefore, M. sacchariflorus was a candidate plant with great potential for the revegetation of heavy metal tailings.

Angiogenesis in calcium phosphate scaffolds by inorganic copper ion release.

PubMed

Barralet, Jake; Gbureck, Uwe; Habibovic, Pamela; Vorndran, Elke; Gerard, Catherine; Doillon, Charles J

2009-07-01

Angiogenesis in a tissue-engineered device may be induced by incorporating growth factors (e.g., vascular endothelial growth factor [VEGF]), genetically modified cells, and=or vascular cells. It represents an important process during the formation and repair of tissue and is essential for nourishment and supply of reparative and immunological cells. Inorganic angiogenic factors, such as copper ions, are therefore of interest in the fields of regenerative medicine and tissue engineering due to their low cost, higher stability, and potentially greater safety compared with recombinant proteins or genetic engineering approaches. The purpose of this study was to compare tissue responses to 3D printed macroporous bioceramic scaffolds implanted in mice that had been loaded with either VEGF or copper sulfate. These factors were spatially localized at the end of a single macropore some 7 mm from the surface of the scaffold. Controls without angiogenic factors exhibited only poor tissue growth within the blocks; in contrast, low doses of copper sulfate led to the formation of microvessels oriented along the macropore axis. Further, wound tissue ingrowth was particularly sensitive to the quantity of copper sulfate and was enhanced at specific concentrations or in combination with VEGF. The potential to accelerate and guide angiogenesis and wound healing by copper ion release without the expense of inductive protein(s) is highly attractive in the area of tissue-engineered bone and offers significant future potential in the field of regenerative biomaterials.

Imparting albumin-binding affinity to a human protein by mimicking the contact surface of a bacterial binding protein.

PubMed

Oshiro, Satoshi; Honda, Shinya

2014-04-18

Attachment of a bacterial albumin-binding protein module is an attractive strategy for extending the plasma residence time of protein therapeutics. However, a protein fused with such a bacterial module could induce unfavorable immune reactions. To address this, we designed an alternative binding protein by imparting albumin-binding affinity to a human protein using molecular surface grafting. The result was a series of human-derived 6 helix-bundle proteins, one of which specifically binds to human serum albumin (HSA) with adequate affinity (KD = 100 nM). The proteins were designed by transferring key binding residues of a bacterial albumin-binding module, Finegoldia magna protein G-related albumin-binding domain (GA) module, onto the human protein scaffold. Despite 13-15 mutations, the designed proteins maintain the original secondary structure by virtue of careful grafting based on structural informatics. Competitive binding assays and thermodynamic analyses of the best binders show that the binding mode resembles that of the GA module, suggesting that the contacting surface of the GA module is mimicked well on the designed protein. These results indicate that the designed protein may act as an alternative low-risk binding module to HSA. Furthermore, molecular surface grafting in combination with structural informatics is an effective approach for avoiding deleterious mutations on a target protein and for imparting the binding function of one protein onto another.

Influence of natural organic matter source on copper speciation as demonstrated by Cu binding to fish gills, by ion selective electrode, and by DGT gel sampler

USGS Publications Warehouse

Luider, C.D.; Crusius, John; Playle, R.C.; Curtis, P.J.

2004-01-01

Rainbow trout (Oncorhynchus mykiss, 2 g) were exposed to 0−5 μM total copper in ion-poor water for 3 h in the presence or absence of 10 mg C/L of qualitatively different natural organic matter (NOM) derived from water spanning a large gradient in hydrologic residence time. Accumulation of Cu by trout gills was compared to Cu speciation determined by ion selective electrode (ISE) and by diffusive gradients in thin films (DGT) gel sampler technology. The presence of NOM decreased Cu uptake by trout gills as well as Cu concentrations determined by ISE and DGT. Furthermore, the source of NOM influenced Cu binding by trout gills with high-color, allochthonous NOM decreasing Cu accumulation by the gills more than low-color autochthonous NOM. The pattern of Cu binding to the NOM measured by Cu ISE and by Cu accumulation by DGT samplers was similar to the fish gill results. A simple Cu−gill binding model required an NOM Cu-binding factor (F) that depended on NOM quality to account for observed Cu accumulation by trout gills; values of F varied by a factor of 2. Thus, NOM metal-binding quality, as well as NOM quantity, are both important when assessing the bioavailability of metals such as Cu to aquatic organisms.

Analyte chemisorption and sensing on n- and p-channel copper phthalocyanine thin-film transistors.

PubMed

Yang, Richard D; Park, Jeongwon; Colesniuc, Corneliu N; Schuller, Ivan K; Royer, James E; Trogler, William C; Kummel, Andrew C

2009-04-28

Chemical sensing properties of phthalocyanine thin-film transistors have been investigated using nearly identical n- and p-channel devices. P-type copper phthalocyanine (CuPc) has been modified with fluorine groups to convert the charge carriers from holes to electrons. The sensor responses to the tight binding analyte dimethyl methylphosphonate (DMMP) and weak binding analyte methanol (MeOH) were compared in air and N(2). The results suggest that the sensor response involves counterdoping of pre-adsorbed oxygen (O(2)). A linear dependence of chemical response to DMMP concentration was observed in both n- and p- type devices. For DMMP, there is a factor of 2.5 difference in the chemical sensitivity between n- and p-channel CuPc thin-film transistors, even though it has similar binding strength to n- and p-type CuPc molecules as indicated by the desorption times. The effect is attributed to the difference in the analyte perturbation of electron and hole trap energies in n- and p-type materials.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eilert, Andre; Cavalca, Filippo; Roberts, F. Sloan

Copper electrocatalysts derived from an oxide have shown extraordinary electrochemical properties for the carbon dioxide reduction reaction (CO 2RR). Using in situ ambient pressure X-ray photoelectron spectroscopy and quasi in situ electron energy-loss spectroscopy in a transmission electron microscope, we show that there is a substantial amount of residual oxygen in nanostructured, oxide-derived copper electrocatalysts but no residual copper oxide. On the basis of these findings in combination with density functional theory simulations, we propose that residual subsurface oxygen changes the electronic structure of the catalyst and creates sites with higher carbon monoxide binding energy. If such sites are stablemore » under the strongly reducing conditions found in CO 2RR, these findings would explain the high efficiencies of oxide-derived copper in reducing carbon dioxide to multicarbon compounds such as ethylene.« less

Online immunocapture ICP-MS for the determination of the metalloprotein ceruloplasmin in human serum.

PubMed

Bernevic, Bogdan; El-Khatib, Ahmed H; Jakubowski, Norbert; Weller, Michael G

2018-04-02

The human copper-protein ceruloplasmin (Cp) is the major copper-containing protein in the human body. The accurate determination of Cp is mandatory for the reliable diagnosis of several diseases. However, the analysis of Cp has proven to be difficult. The aim of our work was a proof of concept for the determination of a metalloprotein-based on online immunocapture ICP-MS. The immuno-affinity step is responsible for the enrichment and isolation of the analyte from serum, whereas the compound-independent quantitation with ICP-MS delivers the sensitivity, precision, and large dynamic range. Off-line ELISA (enzyme-linked immunosorbent assay) was used in parallel to confirm the elution profile of the analyte with a structure-selective method. The total protein elution was observed with the 32 S mass trace. The ICP-MS signals were normalized on a 59 Co signal. The human copper-protein Cp could be selectively determined. This was shown with pure Cp and with a sample of human serum. The good correlation with off-line ELISA shows that Cp could be captured and eluted selectively from the anti-Cp affinity column and subsequently determined by the copper signal of ICP-MS.

Copper and ectopic expression of the Arabidopsis transport protein COPT1 alter iron homeostasis in rice (Oryza sativa L.).

PubMed

Andrés-Bordería, Amparo; Andrés, Fernando; Garcia-Molina, Antoni; Perea-García, Ana; Domingo, Concha; Puig, Sergi; Peñarrubia, Lola

2017-09-01

Copper deficiency and excess differentially affect iron homeostasis in rice and overexpression of the Arabidopsis high-affinity copper transporter COPT1 slightly increases endogenous iron concentration in rice grains. Higher plants have developed sophisticated mechanisms to efficiently acquire and use micronutrients such as copper and iron. However, the molecular mechanisms underlying the interaction between both metals remain poorly understood. In the present work, we study the effects produced on iron homeostasis by a wide range of copper concentrations in the growth media and by altered copper transport in Oryza sativa plants. Gene expression profiles in rice seedlings grown under copper excess show an altered expression of genes involved in iron homeostasis compared to standard control conditions. Thus, ferritin OsFER2 and ferredoxin OsFd1 mRNAs are down-regulated whereas the transcriptional iron regulator OsIRO2 and the nicotianamine synthase OsNAS2 mRNAs rise under copper excess. As expected, the expression of OsCOPT1, which encodes a high-affinity copper transport protein, as well as other copper-deficiency markers are down-regulated by copper. Furthermore, we show that Arabidopsis COPT1 overexpression (C1 OE ) in rice causes root shortening in high copper conditions and under iron deficiency. C1 OE rice plants modify the expression of the putative iron-sensing factors OsHRZ1 and OsHRZ2 and enhance the expression of OsIRO2 under copper excess, which suggests a role of copper transport in iron signaling. Importantly, the C1 OE rice plants grown on soil contain higher endogenous iron concentration than wild-type plants in both brown and white grains. Collectively, these results highlight the effects of rice copper status on iron homeostasis, which should be considered to obtain crops with optimized nutrient concentrations in edible parts.

Identification of human ferritin, heavy polypeptide 1 (FTH1) and yeast RGI1 (YER067W) as pro-survival sequences that counteract the effects of Bax and copper in Saccharomyces cerevisiae.

PubMed

Eid, Rawan; Boucher, Eric; Gharib, Nada; Khoury, Chamel; Arab, Nagla T T; Murray, Alistair; Young, Paul G; Mandato, Craig A; Greenwood, Michael T

2016-03-01

Ferritin is a sub-family of iron binding proteins that form multi-subunit nanotype iron storage structures and prevent oxidative stress induced apoptosis. Here we describe the identification and characterization of human ferritin, heavy polypeptide 1 (FTH1) as a suppressor of the pro-apoptotic murine Bax sequence in yeast. In addition we demonstrate that FTH1 is a general pro-survival sequence since it also prevents the cell death inducing effects of copper when heterologously expressed in yeast. Although ferritins are phylogenetically widely distributed and are present in most species of Bacteria, Archaea and Eukarya, ferritin is conspicuously absent in most fungal species including Saccharomyces cerevisiae. An in silico analysis of the yeast proteome lead to the identification of the 161 residue RGI1 (YER067W) encoded protein as a candidate for being a yeast ferritin. In addition to sharing 20% sequence identity with the 183 residue FTH1, RGI1 also has similar pro-survival properties as ferritin when overexpressed in yeast. Analysis of recombinant protein by SDS-PAGE and by electron microscopy revealed the expected formation of higher-order structures for FTH1 that was not observed with Rgi1p. Further analysis revealed that cells overexpressing RGI1 do not show increased resistance to iron toxicity and do not have enhanced capacity to store iron. In contrast, cells lacking RGI1 were found to be hypersensitive to the toxic effects of iron. Overall, our results suggest that Rgi1p is a novel pro-survival protein whose function is not related to ferritin but nevertheless it may have a role in regulating yeast sensitivity to iron stress. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Disulfiram Suppresses Growth of the Malignant Pleural Mesothelioma Cells in Part by Inducing Apoptosis

PubMed Central

Muthu, Magesh; Jamal, Shazia; Chen, Di; Yang, Huanjie; Polin, Lisa A.; Tarca, Adi L.; Pass, Harvey I.; Dou, Q. Ping; Sharma, Sunita; Wali, Anil; Rishi, Arun K.

2014-01-01

Dithiocarbamate compound Disulfiram (DSF) that binds with copper and functions as an inhibitor of aldehyde dehydrogenase is a Food and Drug Administration approved agent for treatment of alcoholism. Copper complexed DSF (DSF-Cu) also possesses anti-tumor and chemosensitizing properties; however, its molecular mechanisms of action remain unclear. Here we investigated malignant pleural mesothelioma (MPM) suppressive effects of DSF-Cu and the molecular mechanisms involved. DSF-Cu inhibited growth of the murine as well as human MPM cells in part by increasing levels of ubiquitinated proteins. DSF-Cu exposure stimulated apoptosis in MPM cells that involved activation of stress-activated protein kinases (SAPKs) p38 and JNK1/2, caspase-3, and cleavage of poly-(ADP-ribose)-polymerase, as well as increased expression of sulfatase 1 and apoptosis transducing CARP-1/CCAR1 protein. Gene-array based analyses revealed that DSF-Cu suppressed cell growth and metastasis-promoting genes including matrix metallopeptidase 3 and 10. DSF inhibited MPM cell growth and survival by upregulating cell cycle inhibitor p27Kip1, IGFBP7, and inhibitors of NF-κB such as ABIN 1 and 2 and Inhibitory κB (IκB)α and β proteins. DSF-Cu promoted cleavage of vimentin, as well as serine-phosphorylation and lysine-63 linked ubiquitination of podoplanin. Administration of 50 mg/kg DSF-Cu by daily i.p injections inhibited growth of murine MPM cell-derived tumors in vivo. Although podoplanin expression often correlates with metastatic disease and poor prognosis, phosphorylation of serines in cytoplasmic domain of podoplanin has recently been shown to interfere with cellular motility and migration signaling. Post-translational modification of podoplanin and cleavage of vimentin by DSF-Cu underscore a metastasis inhibitory property of this agent and together with our in vivo studies underscore its potential as an anti-MPM agent. PMID:24690739

21 CFR 866.5765 - Retinol-binding protein immunological test system.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement of...

21 CFR 866.5765 - Retinol-binding protein immunological test system.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement of...

21 CFR 866.5765 - Retinol-binding protein immunological test system.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement of...

21 CFR 866.5765 - Retinol-binding protein immunological test system.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement of...

Integrated system for temperature-controlled fast protein liquid chromatography comprising improved copolymer modified beaded agarose adsorbents and a travelling cooling zone reactor arrangement.

PubMed

Müller, Tobias K H; Cao, Ping; Ewert, Stephanie; Wohlgemuth, Jonas; Liu, Haiyang; Willett, Thomas C; Theodosiou, Eirini; Thomas, Owen R T; Franzreb, Matthias

2013-04-12

An integrated approach to temperature-controlled chromatography, involving copolymer modified agarose adsorbents and a novel travelling cooling zone reactor (TCZR) arrangement, is described. Sepharose CL6B was transformed into a thermoresponsive cation exchange adsorbent (thermoCEX) in four synthetic steps: (i) epichlorohydrin activation; (ii) amine capping; (iii) 4,4'-azobis(4-cyanovaleric acid) immobilization; and 'graft from' polymerization of poly(N-isopropylacrylamide-co-N-tert-butylacrylamide-co-acrylic acid-co-N,N'-methylenebisacrylamide). FT-IR, (1)H NMR, gravimetry and chemical assays allowed precise determination of the adsorbent's copolymer composition and loading, and identified the initial epoxy activation step as a critical determinant of 'on-support' copolymer loading, and in turn, protein binding performance. In batch binding studies with lactoferrin, thermoCEX's binding affinity and maximum adsorption capacity rose smoothly with temperature increase from 20 to 50 °C. In temperature shifting chromatography experiments employing thermoCEX in thermally jacketed columns, 44-51% of the lactoferrin adsorbed at 42 °C could be desorbed under binding conditions by cooling the column to 22 °C, but the elution peaks exhibited strong tailing. To more fully exploit the potential of thermoresponsive chromatography adsorbents, a new column arrangement, the TCZR, was developed. In TCZR chromatography, a narrow discrete cooling zone (special assembly of copper blocks and Peltier elements) is moved along a bespoke fixed-bed separation columnfilled with stationary phase. In tests with thermoCEX, it was possible to recover 65% of the lactoferrin bound at 35 °C using 8 successive movements of the cooling zone at a velocity of 0.1mm/s; over half of the recovered protein was eluted in the first peak in more concentrated form than in the feed. Intra-particle diffusion of desorbed protein out of the support pores, and the ratio between the velocities of the cooling zone and mobile phase were identified as the main parameters affecting TCZR performance. In contrast to conventional systems, which rely on cooling the whole column to effect elution and permit only batch-wise operation, TCZR chromatography generates sharp concentrated elution peaks without tailing effects and appears ideally suited for continuous operation. Copyright © 2013 Elsevier B.V. All rights reserved.

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less

Urinary Copper Elevation in a Mouse Model of Wilson's Disease Is a Regulated Process to Specifically Decrease the Hepatic Copper Load

PubMed Central

Gray, Lawrence W.; Peng, Fangyu; Molloy, Shannon A.; Pendyala, Venkata S.; Muchenditsi, Abigael; Muzik, Otto; Lee, Jaekwon; Kaplan, Jack H.; Lutsenko, Svetlana

2012-01-01

Body copper homeostasis is regulated by the liver, which removes excess copper via bile. In Wilson's disease (WD), this function is disrupted due to inactivation of the copper transporter ATP7B resulting in hepatic copper overload. High urinary copper is a diagnostic feature of WD linked to liver malfunction; the mechanism behind urinary copper elevation is not fully understood. Using Positron Emission Tomography-Computed Tomography (PET-CT) imaging of live Atp7b−/− mice at different stages of disease, a longitudinal metal analysis, and characterization of copper-binding molecules, we show that urinary copper elevation is a specific regulatory process mediated by distinct molecules. PET-CT and atomic absorption spectroscopy directly demonstrate an age-dependent decrease in the capacity of Atp7b−/− livers to accumulate copper, concomitant with an increase in urinary copper. This reciprocal relationship is specific for copper, indicating that cell necrosis is not the primary cause for the initial phase of metal elevation in the urine. Instead, the urinary copper increase is associated with the down-regulation of the copper-transporter Ctr1 in the liver and appearance of a 2 kDa Small Copper Carrier, SCC, in the urine. SCC is also elevated in the urine of the liver-specific Ctr1 −/− knockouts, which have normal ATP7B function, suggesting that SCC is a normal metabolite carrying copper in the serum. In agreement with this hypothesis, partially purified SCC-Cu competes with free copper for uptake by Ctr1. Thus, hepatic down-regulation of Ctr1 allows switching to an SCC-mediated removal of copper via kidney when liver function is impaired. These results demonstrate that the body regulates copper export through more than one mechanism; better understanding of urinary copper excretion may contribute to an improved diagnosis and monitoring of WD. PMID:22802922

The Menkes and Wilson disease genes counteract in copper toxicosis in Labrador retrievers: a new canine model for copper-metabolism disorders

PubMed Central

Fieten, Hille; Gill, Yadvinder; Martin, Alan J.; Concilli, Mafalda; Dirksen, Karen; van Steenbeek, Frank G.; Spee, Bart; van den Ingh, Ted S. G. A. M.; Martens, Ellen C. C. P.; Festa, Paola; Chesi, Giancarlo; van de Sluis, Bart; Houwen, Roderick H. J. H.; Watson, Adrian L.; Aulchenko, Yurii S.; Hodgkinson, Victoria L.; Zhu, Sha; Petris, Michael J.; Polishchuk, Roman S.; Leegwater, Peter A. J.; Rothuizen, Jan

2016-01-01

ABSTRACT The deleterious effects of a disrupted copper metabolism are illustrated by hereditary diseases caused by mutations in the genes coding for the copper transporters ATP7A and ATP7B. Menkes disease, involving ATP7A, is a fatal neurodegenerative disorder of copper deficiency. Mutations in ATP7B lead to Wilson disease, which is characterized by a predominantly hepatic copper accumulation. The low incidence and the phenotypic variability of human copper toxicosis hamper identification of causal genes or modifier genes involved in the disease pathogenesis. The Labrador retriever was recently characterized as a new canine model for copper toxicosis. Purebred dogs have reduced genetic variability, which facilitates identification of genes involved in complex heritable traits that might influence phenotype in both humans and dogs. We performed a genome-wide association study in 235 Labrador retrievers and identified two chromosome regions containing ATP7A and ATP7B that were associated with variation in hepatic copper levels. DNA sequence analysis identified missense mutations in each gene. The amino acid substitution ATP7B:p.Arg1453Gln was associated with copper accumulation, whereas the amino acid substitution ATP7A:p.Thr327Ile partly protected against copper accumulation. Confocal microscopy indicated that aberrant copper metabolism upon expression of the ATP7B variant occurred because of mis-localization of the protein in the endoplasmic reticulum. Dermal fibroblasts derived from ATP7A:p.Thr327Ile dogs showed copper accumulation and delayed excretion. We identified the Labrador retriever as the first natural, non-rodent model for ATP7B-associated copper toxicosis. Attenuation of copper accumulation by the ATP7A mutation sheds an interesting light on the interplay of copper transporters in body copper homeostasis and warrants a thorough investigation of ATP7A as a modifier gene in copper-metabolism disorders. The identification of two new functional variants in ATP7A and ATP7B contributes to the biological understanding of protein function, with relevance for future development of therapy. PMID:26747866

Structure-based function prediction of the expanding mollusk tyrosinase family

NASA Astrophysics Data System (ADS)

Huang, Ronglian; Li, Li; Zhang, Guofan

2017-11-01

Tyrosinase (Ty) is a common enzyme found in many different animal groups. In our previous study, genome sequencing revealed that the Ty family is expanded in the Pacific oyster ( Crassostrea gigas). Here, we examine the larger number of Ty family members in the Pacific oyster by high-level structure prediction to obtain more information about their function and evolution, especially the unknown role in biomineralization. We verified 12 Ty gene sequences from Crassostrea gigas genome and Pinctada fucata martensii transcriptome. By using phylogenetic analysis of these Tys with functionally known Tys from other molluscan species, eight subgroups were identified (CgTy_s1, CgTy_s2, MolTy_s1, MolTy-s2, MolTy-s3, PinTy-s1, PinTy-s2 and PviTy). Structural data and surface pockets of the dinuclear copper center in the eight subgroups of molluscan Ty were obtained using the latest versions of prediction online servers. Structural comparison with other Ty proteins from the protein databank revealed functionally important residues (HA1, HA2, HA3, HB1, HB2, HB3, Z1-Z9) and their location within these protein structures. The structural and chemical features of these pockets which may related to the substrate binding showed considerable variability among mollusks, which undoubtedly defines Ty substrate binding. Finally, we discuss the potential driving forces of Ty family evolution in mollusks. Based on these observations, we conclude that the Ty family has rapidly evolved as a consequence of substrate adaptation in mollusks.

Thioredoxin binding protein (TBP)-2/Txnip and α-arrestin proteins in cancer and diabetes mellitus.

PubMed

Masutani, Hiroshi; Yoshihara, Eiji; Masaki, So; Chen, Zhe; Yodoi, Junji

2012-01-01

Thioredoxin binding protein -2/ thioredoxin interacting protein is an α-arrestin protein that has attracted much attention as a multifunctional regulator. Thioredoxin binding protein -2 expression is downregulated in tumor cells and the level of thioredoxin binding protein is correlated with clinical stage of cancer. Mice with mutations or knockout of the thioredoxin binding protein -2 gene are much more susceptible to carcinogenesis than wild-type mice, indicating a role for thioredoxin binding protein -2 in cancer suppression. Studies have also revealed roles for thioredoxin binding protein -2 in metabolic control. Enhancement of thioredoxin binding protein -2 expression causes impairment of insulin sensitivity and glucose-induced insulin secretion, and β-cell apoptosis. These changes are important characteristics of type 2 diabetes mellitus. Thioredoxin binding protein -2 regulates transcription of metabolic regulating genes. Thioredoxin binding protein -2-like inducible membrane protein/ arrestin domain containing 3 regulates endocytosis of receptors such as the β(2)-adrenergic receptor. The α-arrestin family possesses PPXY motifs and may function as an adaptor/scaffold for NEDD family ubiquitin ligases. Elucidation of the molecular mechanisms of α-arrestin proteins would provide a new pharmacological basis for developing approaches against cancer and type 2 diabetes mellitus.

A Single Rainbow Trout Cobalamin-binding Protein Stands in for Three Human Binders

PubMed Central

Greibe, Eva; Fedosov, Sergey; Sorensen, Boe S.; Højrup, Peter; Poulsen, Steen S.; Nexo, Ebba

2012-01-01

Cobalamin uptake and transport in mammals are mediated by three cobalamin-binding proteins: haptocorrin, intrinsic factor, and transcobalamin. The nature of cobalamin-binding proteins in lower vertebrates remains to be elucidated. The aim of this study was to characterize the cobalamin-binding proteins of the rainbow trout (Oncorhynchus mykiss) and to compare their properties with those of the three human cobalamin-binding proteins. High cobalamin-binding capacity was found in trout stomach (210 pmol/g), roe (400 pmol/g), roe fluid (390 nmol/liter), and plasma (2500 nmol/liter). In all cases, it appeared to be the same protein based on analysis of partial sequences and immunological responses. The trout cobalamin-binding protein was purified from roe fluid, sequenced, and further characterized. Like haptocorrin, the trout cobalamin-binding protein was stable at low pH and had a high binding affinity for the cobalamin analog cobinamide. Like haptocorrin and transcobalamin, the trout cobalamin-binding protein was present in plasma and recognized ligands with altered nucleotide moiety. Like intrinsic factors, the trout cobalamin-binding protein was present in the stomach and resisted degradation by trypsin and chymotrypsin. It also resembled intrinsic factor in the composition of conserved residues in the primary cobalamin-binding site in the C terminus. The trout cobalamin-binding protein was glycosylated and displayed spectral properties comparable with those of haptocorrin and intrinsic factor. In conclusion, only one soluble cobalamin-binding protein was identified in the rainbow trout, a protein that structurally behaves like an intermediate between the three human cobalamin-binding proteins. PMID:22872637

PTPRT regulates the interaction of Syntaxin-binding protein 1 with Syntaxin 1 through dephosphorylation of specific tyrosine residue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lim, So-Hee; Moon, Jeonghee; Lee, Myungkyu

2013-09-13

Highlights: •PTPRT is a brain-specific, expressed, protein tyrosine phosphatase. •PTPRT regulated the interaction of Syntaxin-binding protein 1 with Syntaxin 1. •PTPRT dephosphorylated the specific tyrosine residue of Syntaxin-binding protein 1. •Dephosphorylation of Syntaxin-binding protein 1 enhanced the interaction with Syntaxin 1. •PTPRT appears to regulate the fusion of synaptic vesicle through dephosphorylation. -- Abstract: PTPRT (protein tyrosine phosphatase receptor T), a brain-specific tyrosine phosphatase, has been found to regulate synaptic formation and development of hippocampal neurons, but its regulation mechanism is not yet fully understood. Here, Syntaxin-binding protein 1, a key component of synaptic vesicle fusion machinery, was identified asmore » a possible interaction partner and an endogenous substrate of PTPRT. PTPRT interacted with Syntaxin-binding protein 1 in rat synaptosome, and co-localized with Syntaxin-binding protein 1 in cultured hippocampal neurons. PTPRT dephosphorylated tyrosine 145 located around the linker between domain 1 and 2 of Syntaxin-binding protein 1. Syntaxin-binding protein 1 directly binds to Syntaxin 1, a t-SNARE (soluble N-ethylmaleimide-sensitive factor attachment protein receptor) protein, and plays a role as catalysts of SNARE complex formation. Syntaxin-binding protein 1 mutant mimicking non-phosphorylation (Y145F) enhanced the interaction with Syntaxin 1 compared to wild type, and therefore, dephosphorylation of Syntaxin-binding protein 1 appeared to be important for SNARE-complex formation. In conclusion, PTPRT could regulate the interaction of Syntaxin-binding protein 1 with Syntaxin 1, and as a result, the synaptic vesicle fusion appeared to be controlled through dephosphorylation of Syntaxin-binding protein 1.« less

Structural Basis of the Lactate-dependent Allosteric Regulation of Oxygen Binding in Arthropod Hemocyanin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hirota, S.; Tanaka, N; Micetic, I

2010-01-01

Hemocyanin (Hc) is an oxygen carrier protein in which oxygen binding is regulated by allosteric effectors such as H{sup +} and L-lactate. Isothermal titration calorimetric measurements showed that L-lactate binds to dodecameric and heterohexameric Hc and to the CaeSS3 homohexamer but not to the CaeSS2 monomer. The binding of lactate caused no change in the optical absorption and x-ray absorption spectra of either oxy- or deoxy-Hc, suggesting that no structural rearrangement of the active site occurred. At pH 6.5, the oxygen binding rate constant k{sub obs} obtained by flash photolysis showed a significant increase upon addition of L-lactate, whereas L-lactatemore » addition had little effect at pH 8.3. Lactate binding caused a concentration-dependent shift in the interhexameric distances at pH 6.5 based on small angle x-ray scattering measurements. These results show that L-lactate affects oxygen affinity at pH 6.5 by modulating the global structure of Hc without affecting its binuclear copper center (the active site). In contrast to this, the active site structure of deoxy-Hc is affected by changes in pH (Hirota, S., Kawahara, T., Beltramini, M., Di Muro, P., Magliozzo, R. S., Peisach, J., Powers, L. S., Tanaka, N., Nagao, S., and Bubacco, L. (2008) J. Biol. Chem. 283, 31941-31948). Upon addiction of lactate, the kinetic behavior of oxygen rebinding for Hc was heterogeneous under low oxygen concentrations at pH 6.5 due to changes in the T and R state populations, and the equilibrium was found to shift from the T toward the R state with addition of lactate.« less

The CopRS Two-Component System Is Responsible for Resistance to Copper in the Cyanobacterium Synechocystis sp. PCC 68031[C][W][OA

PubMed Central

Giner-Lamia, Joaquín; López-Maury, Luis; Reyes, José C.; Florencio, Francisco J.

2012-01-01

Photosynthetic organisms need copper for cytochrome oxidase and for plastocyanin in the fundamental processes of respiration and photosynthesis. However, excess of free copper is detrimental inside the cells and therefore organisms have developed homeostatic mechanisms to tightly regulate its acquisition, sequestration, and efflux. Herein we show that the CopRS two-component system (also known as Hik31-Rre34) is essential for copper resistance in Synechocystis sp. PCC 6803. It regulates expression of a putative heavy-metal efflux-resistance nodulation and division type copper efflux system (encoded by copBAC) as well as its own expression (in the copMRS operon) in response to the presence of copper in the media. Mutants in this two-component system or the efflux system render cells more sensitive to the presence of copper in the media and accumulate more intracellular copper than the wild type. Furthermore, CopS periplasmic domain is able to bind copper, suggesting that CopS could be able to detect copper directly. Both operons (copMRS and copBAC) are also induced by the photosynthetic inhibitor 2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone but this induction requires the presence of copper in the media. The reduced response of two mutant strains to copper, one lacking plastocyanin and a second one impaired in copper transport to the thylakoid, due to the absence of the PI-type ATPases PacS and CtaA, suggests that CopS can detect intracellular copper. In addition, a tagged version of CopS with a triple HA epitope localizes to both the plasma and the thylakoid membranes, suggesting that CopS could be involved in copper detection in both the periplasm and the thylakoid lumen. PMID:22715108

Copper complexation screen reveals compounds with potent antibiotic properties against methicillin-resistant Staphylococcus aureus.

PubMed

Haeili, Mehri; Moore, Casey; Davis, Christopher J C; Cochran, James B; Shah, Santosh; Shrestha, Tej B; Zhang, Yaofang; Bossmann, Stefan H; Benjamin, William H; Kutsch, Olaf; Wolschendorf, Frank

2014-07-01

Macrophages take advantage of the antibacterial properties of copper ions in the killing of bacterial intruders. However, despite the importance of copper for innate immune functions, coordinated efforts to exploit copper ions for therapeutic interventions against bacterial infections are not yet in place. Here we report a novel high-throughput screening platform specifically developed for the discovery and characterization of compounds with copper-dependent antibacterial properties toward methicillin-resistant Staphylococcus aureus (MRSA). We detail how one of the identified compounds, glyoxal-bis(N4-methylthiosemicarbazone) (GTSM), exerts its potent strictly copper-dependent antibacterial properties on MRSA. Our data indicate that the activity of the GTSM-copper complex goes beyond the general antibacterial effects of accumulated copper ions and suggest that, in contrast to prevailing opinion, copper complexes can indeed exhibit species- and target-specific activities. Based on experimental evidence, we propose that copper ions impose structural changes upon binding to the otherwise inactive GTSM ligand and transfer antibacterial properties to the chelate. In turn, GTSM determines target specificity and utilizes a redox-sensitive release mechanism through which copper ions are deployed at or in close proximity to a putative target. According to our proof-of-concept screen, copper activation is not a rare event and even extends to already established drugs. Thus, copper-activated compounds could define a novel class of anti-MRSA agents that amplify copper-dependent innate immune functions of the host. To this end, we provide a blueprint for a high-throughput drug screening campaign which considers the antibacterial properties of copper ions at the host-pathogen interface. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

The CopRS two-component system is responsible for resistance to copper in the cyanobacterium Synechocystis sp. PCC 6803.

PubMed

Giner-Lamia, Joaquín; López-Maury, Luis; Reyes, José C; Florencio, Francisco J

2012-08-01

Photosynthetic organisms need copper for cytochrome oxidase and for plastocyanin in the fundamental processes of respiration and photosynthesis. However, excess of free copper is detrimental inside the cells and therefore organisms have developed homeostatic mechanisms to tightly regulate its acquisition, sequestration, and efflux. Herein we show that the CopRS two-component system (also known as Hik31-Rre34) is essential for copper resistance in Synechocystis sp. PCC 6803. It regulates expression of a putative heavy-metal efflux-resistance nodulation and division type copper efflux system (encoded by copBAC) as well as its own expression (in the copMRS operon) in response to the presence of copper in the media. Mutants in this two-component system or the efflux system render cells more sensitive to the presence of copper in the media and accumulate more intracellular copper than the wild type. Furthermore, CopS periplasmic domain is able to bind copper, suggesting that CopS could be able to detect copper directly. Both operons (copMRS and copBAC) are also induced by the photosynthetic inhibitor 2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone but this induction requires the presence of copper in the media. The reduced response of two mutant strains to copper, one lacking plastocyanin and a second one impaired in copper transport to the thylakoid, due to the absence of the P(I)-type ATPases PacS and CtaA, suggests that CopS can detect intracellular copper. In addition, a tagged version of CopS with a triple HA epitope localizes to both the plasma and the thylakoid membranes, suggesting that CopS could be involved in copper detection in both the periplasm and the thylakoid lumen.

Monoclonal antibodies to human vitamin D-binding protein.

PubMed Central

Pierce, E A; Dame, M C; Bouillon, R; Van Baelen, H; DeLuca, H F

1985-01-01

Monoclonal antibodies to vitamin D-binding protein isolated from human serum have been produced. The antibodies obtained have been shown to be specific for human vitamin D-binding protein by three independent assays. The antibodies recognize human vitamin D-binding protein specifically in an enzyme-linked immunosorbent assay. Human vitamin D-binding protein is detected specifically in both pure and crude samples by a radiometric immunosorbent assay (RISA) and by an immunoprecipitation assay. The anti-human vitamin D-binding protein antibodies cross-react with monkey and pig vitamin D-binding protein, but not with vitamin D-binding protein from rat, mouse, or chicken, as determined by the RISA and immunoprecipitation assays. Images PMID:3936035

New anionic carbosilane dendrons functionalized with a DO3A ligand at the focal point for the prevention of HIV-1 infection.

PubMed

Moreno, Silvia; Sepúlveda-Crespo, Daniel; de la Mata, F Javier; Gómez, Rafael; Muñoz-Fernández, Ma Ángeles

2017-10-01

Novel third-generation polyanionic carbosilane dendrons with sulfonate or carboxylate end-groups and functionalized with a DO3A ligand at the focal point, and their corresponding copper complexes, have been prepared as antiviral compounds to prevent HIV-1 infection. The topology enables the compound to have an excellent chelating agent, DO3A, while keeping anionic peripheral groups for a therapeutic action. In this study, the cytotoxicity and anti-HIV-1 abilities of carboxylate- (5) or sulfonate-terminated (6) dendrons containing DO3A and their copper complexes (7 or 8) were evaluated. All compounds showed low cytotoxicity and demonstrated potent and broad-spectrum anti-HIV-1 activity in vitro. We also assessed the mode of antiviral action on the inhibition of HIV-1 through a panel of different in vitro antiviral assays. Our results show that copper-free dendron 6 protects the epithelial monolayer from short-term cell disruption. Copper-free dendrons 5 and 6 exert anti-HIV-1 activity at an early stage of the HIV-1 lifecycle by binding to the envelope glycoproteins of HIV-1 and by interacting with the CD4 cell receptor and blocking the binding of gp120 to CD4, and consequently HIV-1 entry. These findings show that copper-free dendrons 5 and 6 have a high potency against HIV-1 infection, confirming their non-specific ability and suggesting that these compounds deserve further study as potential candidate microbicides to prevent HIV-1 transmission. Copyright © 2017 Elsevier B.V. All rights reserved.

Phosphatidic acid binding proteins display differential binding as a function of membrane curvature stress and chemical properties.

PubMed

Putta, Priya; Rankenberg, Johanna; Korver, Ruud A; van Wijk, Ringo; Munnik, Teun; Testerink, Christa; Kooijman, Edgar E

2016-11-01

Phosphatidic acid (PA) is a crucial membrane phospholipid involved in de novo lipid synthesis and numerous intracellular signaling cascades. The signaling function of PA is mediated by peripheral membrane proteins that specifically recognize PA. While numerous PA-binding proteins are known, much less is known about what drives specificity of PA-protein binding. Previously, we have described the ionization properties of PA, summarized in the electrostatic-hydrogen bond switch, as one aspect that drives the specific binding of PA by PA-binding proteins. Here we focus on membrane curvature stress induced by phosphatidylethanolamine and show that many PA-binding proteins display enhanced binding as a function of negative curvature stress. This result is corroborated by the observation that positive curvature stress, induced by lyso phosphatidylcholine, abolishes PA binding of target proteins. We show, for the first time, that a novel plant PA-binding protein, Arabidopsis Epsin-like Clathrin Adaptor 1 (ECA1) displays curvature-dependence in its binding to PA. Other established PA targets examined in this study include, the plant proteins TGD2, and PDK1, the yeast proteins Opi1 and Spo20, and, the mammalian protein Raf-1 kinase and the C2 domain of the mammalian phosphatidylserine binding protein Lact as control. Based on our observations, we propose that liposome binding assays are the preferred method to investigate lipid binding compared to the popular lipid overlay assays where membrane environment is lost. The use of complex lipid mixtures is important to elucidate further aspects of PA binding proteins. Copyright © 2016. Published by Elsevier B.V.

Systemic serum amyloid A as a biomarker for exposure to zinc and/or copper-containing metal fumes.

PubMed

Baumann, R; Gube, M; Markert, A; Davatgarbenam, S; Kossack, V; Gerhards, B; Kraus, T; Brand, P

2018-01-01

Zinc- and copper-containing welding fumes increase systemic C-reactive protein (CRP). The aim of this study was to investigate the performance of the biomarkers serum amyloid A (SAA) and soluble vascular cell adhesion molecule-1 (VCAM-1) in this regard. Fifteen male subjects were exposed under controlled conditions to welding fumes containing either zinc, or copper, or copper and zinc for 6 h. Plasma samples were collected before, 6 and 24 h after start of exposure and biomarkers therein were measured by electrochemiluminescent assay. For each exposure, systemic concentrations of systemic SAA, but not VCAM-1, increased significantly at 24 h after exposure start compared with baseline ("copper only": P=0.0005, "zinc only": P=0.027, "copper and zinc": P=0.001). SAA showed a wider range of concentrations than did CRP and its levels increased up to 19-fold after welding fume exposure. The recognition of copper as a potential harmful component in welding fumes, also independent from zinc, deserves further consideration. SAA might represent a new sensitive biomarker for potential subclinical sterile inflammation after inhalation of copper- and/or zinc-containing welding fumes. As elevations of CRP and SAA protein have both been linked to a higher risk for cardiovascular disease, these findings might particularly be important for long-term welders.

Sub-cellular damage by copper in the cnidarian Zoanthus robustus.

PubMed

Grant, A; Trompf, K; Seung, D; Nivison-Smith, L; Bowcock, H; Kresse, H; Holmes, S; Radford, J; Morrow, P

2010-09-01

Sessile organisms may experience chronic exposure to copper that is released into the marine environment from antifoulants and stormwater runoff. We have identified the site of damage caused by copper to the symbiotic cnidarian, Zoanthus robustus (Anthozoa, Hexacorallia). External changes to the zoanthids were apparent when compared with controls. The normally flexible bodies contracted and became rigid. Histological examination of the zoanthid tissue revealed that copper had caused sub-cellular changes to proteins within the extracellular matrix (ECM) of the tubular body. Collagen in the ECM and the internal septa increased in thickness to five and seven times that of controls respectively. The epithelium, which stained for elastin, was also twice as thick and tough to cut, but exposure to copper did not change the total amount of desmosine which is found only in elastin. We conclude that copper stimulated collagen synthesis in the ECM and also caused cross-linking of existing proteins. However, there was no expulsion of the symbiotic algae (Symbiodinium sp.) and no effect on algal pigments or respiration (44, 66 and 110 microg Cu L(-1)). A decrease in net photosynthesis was observed only at the highest copper concentration (156 microg Cu L(-1)). These results show that cnidarians may be more susceptible to damage by copper than their symbiotic algae. Copyright (c) 2010 Elsevier Inc. All rights reserved.

Non-hepatic tumors change the activity of genes encoding copper trafficking proteins in the liver

PubMed Central

Babich, Polina S.; Skvortsov, Alexey N; Rusconi, Paolo; Tsymbalenko, Nadezhda V.; Mutanen, Marja; Puchkova, Ludmila V.; Broggini, Massimo

2013-01-01

To assess the statistical relationship between tumor growth and copper metabolism, we performed a metaanalysis of studies in which patients with neoplasms were characterized according to any of the copper status indexes (atomic copper serum concentration, serum oxidase activity, ceruloplasmin protein content). Our metaanalysis shows that in the majority of cases (more than 3100 patients), tumor growth positively correlates with the copper status indexes. Nude athymic CD-1 nu/nu mice with subcutaneous tumors of human origin, C57Bl/6J mice with murine melanoma and ApcMin mice with spontaneously developing adenomas throughout the intestinal tract were studied to experimentally determine the relationship between tumor progression, liver copper metabolism, and copper status indexes. We showed that the copper status indexes increased significantly during tumor growth. In the liver tissue of tumor-bearing mice, ceruloplasmin gene expression, as well as the expression of genes related to ceruloplasmin metallation (CTR1 and ATP7B), increased significantly. Moreover, the presence of an mRNA splice variant encoding a form of ceruloplasmin anchored to the plasma membrane by glycosylphosphatidyl inositol, which is atypical for hepatocytes, was also detected. The ATP7A copper transporter gene, which is normally expressed in the liver only during embryonic copper metabolism, was also activated. Depletion of holo-ceruloplasmin resulted in retardation of human HCT116 colon carcinoma cell growth in nude mice and induced DNA fragmentation in tumor cells. In addition, the concentration of cytochrome c increased significantly in the cytosol, while decreasing in the mitochondria. We discuss a possible trans-effect of developing tumors on copper metabolism in the liver. PMID:23792645

A Cooperative Copper Metal-Organic Framework-Hydrogel System Improves Wound Healing in Diabetes.

PubMed

Xiao, Jisheng; Chen, Siyu; Yi, Ji; Zhang, Hao; Ameer, Guillermo A

2017-01-05

Chronic non-healing wounds remain a major clinical challenge that would benefit from the development of advanced, regenerative dressings that promote wound closure within a clinically relevant time frame. The use of copper ions has shown promise in wound healing applications possibly by promoting angiogenesis. However, reported treatments that use copper ions require multiple applications of copper salts or oxides to the wound bed, exposing the patient to potentially toxic levels of copper ions and resulting in variable outcomes. Herein we set out to assess whether copper metal organic framework nanoparticles (HKUST-1 NPs) embedded within an antioxidant thermoresponsive citrate-based hydrogel would decrease copper ion toxicity and accelerate wound healing in diabetic mice. HKUST-1 and poly-(polyethyleneglycol citrate-co- N -isopropylacrylamide) (PPCN) were synthesized and characterized. HKUST-1 NP stability in a protein solution with and without embedding them in PPCN hydrogel was determined. Copper ion release, cytotoxicity, apoptosis, and in vitro migration processes were measured. Wound closure rates and wound blood perfusion were assessed in vivo using the splinted excisional dermal wound diabetic mouse model. HKUST-1 NP disintegrated in protein solution while HKUST-1 NPs embedded in PPCN (H-HKUST-1) were protected from degradation and copper ions were slowly released. Cytotoxicity and apoptosis due to copper ion release were significantly reduced while dermal cell migration in vitro and wound closure rates in vivo were significantly enhanced. In vivo , H-HKUST-1 induced angiogenesis, collagen deposition, and re-epithelialization during wound healing in diabetic mice. These results suggest that a cooperatively stabilized, copper ion-releasing H-HKUST-1 hydrogel is a promising innovative dressing for the treatment of chronic wounds.

Examining mechanism of toxicity of copper oxide nanoparticles to Saccharomyces cerevisiae and Caenorhabditis elegans

NASA Astrophysics Data System (ADS)

Mashock, Michael J.

Copper oxide nanoparticles (CuO NPs) are an up and coming technology increasingly being used in industrial and consumer applications and thus may pose risk to humans and the environment. In the present study, the toxic effects of CuO NPs were studied with two model organisms Saccharomyces cerevisiae and Caenorhabditis elegans. The role of released Cu ions during dissolution of CuO NPs in growth media were studied with freshly suspended, aged NPs, and the released Cu 2+ fraction. Exposures to the different Cu treatments showed significant inhibition of S. cerevisiae cellular metabolic activity. Inhibition from the NPs was inversely proportional to size and was not fully explained by the released Cu ions. S. cerevisiae cultures grown under respiring conditions demonstrated greater metabolic sensitivity when exposed to CuO NPs compared to cultures undergoing fermentation. The cellular response to both CuO NPs and released Cu ions on gene expression was analyzed via microarray analysis after an acute exposure. It was observed that both copper exposures resulted in an increase in carbohydrate storage, a decrease in protein production, protein misfolding, increased membrane permeability, and cell cycle arrest. Cells exposed to NPs up-regulated genes related to oxidative phosphorylation but also may be inducing cell cycle arrest by a different mechanism than that observed with released Cu ions. The effect of CuO NPs on C. elegans was examined by using several toxicological endpoints. The CuO NPs displayed a more inhibitory effect, compared to copper sulfate, on nematode reproduction, feeding, and development. We investigated the effects of copper oxide nanoparticles and copper sulfate on neuronal health, a known tissue vulnerable to heavy metal toxicity. In transgenic C. eleganswith neurons expressing a green fluorescent protein reporter, neuronal degeneration was observed in up to 10% of the population after copper oxide nanoparticle exposure. Additionally, nematode mutant strains containing gene knockouts in the divalent-metal transporters smf-1 and smf-2 showed increased tolerance to copper exposure. These results lend credence to the hypothesis that some toxicological effects to eukaryotic organisms from copper oxide nanoparticle exposure may be due to properties specific to the nanoparticles and not solely from the released copper ions.

Uncovering the transmembrane metal binding site of the novel bacterial major facilitator superfamily-type copper importer CcoA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khalfaoui-Hassani, Bahia; Verissimo, Andreia F.; Koch, Hans -Georg

In this study, uptake and trafficking of metals and their delivery to their respective metalloproteins are important processes. Cells need precise control of each step to avoid exposure to excessive metal concentrations and their harmful consequences. Copper (Cu) is a required micronutrient used as a cofactor in proteins. However, in large amounts, it can induce oxidative damage; hence, Cu homeostasis is indispensable for cell survival. Biogenesis of respiratory heme-Cu oxygen (HCO) reductases includes insertion of Cu into their catalytic subunits to form heme-Cu binuclear centers. Previously, we had shown that CcoA is a major facilitator superfamily (MFS)-type bacterial Cu importermore » required for biogenesis of cbb 3-type cytochrome coxidase ( cbb 3-Cox). Here, using Rhodobacter capsulatus, we focused on the import and delivery of Cu to cbb 3-Cox. By comparing the CcoA amino acid sequence with its homologues from other bacterial species, we located several well-conserved Met, His, and Tyr residues that might be important for Cu transport. We determined the topology of the transmembrane helices that carry these residues to establish that they are membrane embedded, and substituted for them amino acids that do not ligand metal atoms. Characterization of these mutants for their uptake of radioactive 64Cu and cbb 3-Cox activities demonstrated that Met233 and His261 of CcoA are essential and Met237 and Met265 are important, whereas Tyr230 has no role for Cu uptake or cbb3-Cox biogenesis. These findings show for the first time that CcoA-mediated Cu import relies on conserved Met and His residues that could act as metal ligands at the membrane-embedded Cu binding domain of this transporter.« less

Metal-Mediated Modulation of Streptococcal Cysteine Protease Activity and Its Biological Implications

PubMed Central

Chella Krishnan, Karthickeyan; Mukundan, Santhosh; Landero Figueroa, Julio A.; Caruso, Joseph A.

2014-01-01

Streptococcal cysteine protease (SpeB), the major secreted protease produced by group A streptococcus (GAS), cleaves both host and bacterial proteins and contributes importantly to the pathogenesis of invasive GAS infections. Modulation of SpeB expression and/or its activity during invasive GAS infections has been shown to affect bacterial virulence and infection severity. Expression of SpeB is regulated by the GAS CovR-CovS two-component regulatory system, and we demonstrated that bacteria with mutations in the CovR-CovS two-component regulatory system are selected for during localized GAS infections and that these bacteria lack SpeB expression and exhibit a hypervirulent phenotype. Additionally, in a separate study, we showed that expression of SpeB can also be modulated by human transferrin- and/or lactoferrin-mediated iron chelation. Accordingly, the goal of this study was to investigate the possible roles of iron and other metals in modulating SpeB expression and/or activity in a manner that would potentiate bacterial virulence. Here, we report that the divalent metals zinc and copper inhibit SpeB activity at the posttranslational level. Utilizing online metal-binding site prediction servers, we identified two putative metal-binding sites in SpeB, one of which involves the catalytic-dyad residues 47Cys and 195His. Based on our findings, we propose that zinc and/or copper availability in the bacterial microenvironment can modulate the proteolytic activity of SpeB in a manner that preserves the integrity of several other virulence factors essential for bacterial survival and dissemination within the host and thereby may exacerbate the severity of invasive GAS infections. PMID:24799625

Uncovering the transmembrane metal binding site of the novel bacterial major facilitator superfamily-type copper importer CcoA

DOE PAGES

Khalfaoui-Hassani, Bahia; Verissimo, Andreia F.; Koch, Hans -Georg; ...

2016-01-19

In this study, uptake and trafficking of metals and their delivery to their respective metalloproteins are important processes. Cells need precise control of each step to avoid exposure to excessive metal concentrations and their harmful consequences. Copper (Cu) is a required micronutrient used as a cofactor in proteins. However, in large amounts, it can induce oxidative damage; hence, Cu homeostasis is indispensable for cell survival. Biogenesis of respiratory heme-Cu oxygen (HCO) reductases includes insertion of Cu into their catalytic subunits to form heme-Cu binuclear centers. Previously, we had shown that CcoA is a major facilitator superfamily (MFS)-type bacterial Cu importermore » required for biogenesis of cbb 3-type cytochrome coxidase ( cbb 3-Cox). Here, using Rhodobacter capsulatus, we focused on the import and delivery of Cu to cbb 3-Cox. By comparing the CcoA amino acid sequence with its homologues from other bacterial species, we located several well-conserved Met, His, and Tyr residues that might be important for Cu transport. We determined the topology of the transmembrane helices that carry these residues to establish that they are membrane embedded, and substituted for them amino acids that do not ligand metal atoms. Characterization of these mutants for their uptake of radioactive 64Cu and cbb 3-Cox activities demonstrated that Met233 and His261 of CcoA are essential and Met237 and Met265 are important, whereas Tyr230 has no role for Cu uptake or cbb3-Cox biogenesis. These findings show for the first time that CcoA-mediated Cu import relies on conserved Met and His residues that could act as metal ligands at the membrane-embedded Cu binding domain of this transporter.« less

Structural influence in the interaction of cysteine with five coordinated copper complexes: Theoretical and experimental studies

NASA Astrophysics Data System (ADS)

Huerta-Aguilar, Carlos Alberto; Thangarasu, Pandiyan; Mora, Jesús Gracia

2018-04-01

Copper complexes of N,N,N‧,N‧-tetrakis(pyridyl-2-ylmethyl)-1,2-diaminoethane (L1) and N,N,N‧,N‧-tetrakis(pyridyl-2-ylmethyl)-1,3-diaminopropane (L2) prepared were characterized completely by different analytical methods. The X-structure of the complexes shows that Cu(II) presents in trigonal bi-pyramidal (TBP) geometry, consisting with the electronic spectra where two visible bands corresponding to five coordinated structure were observed. Thus TD-DFT was used to analyze the orbital contribution to the electronic transitions for the visible bands. Furthermore, the interaction of cysteine with the complexes was spectrally studied, and the results were explained through DFT analysis, observing that the geometrical parameters and oxidation state of metal ions play a vital role in the binding of cysteine with copper ion. It appears that the TBP structure is being changed into octahedral geometry during the addition of cysteine to the complexes as two bands (from complex) is turned to a broad band in visible region, signifying the occupation of cysteine molecule at sixth position of octahedral geometry. In the molecular orbital analysis, the existence of a strong overlapping of HOMOs (from cysteine) with LUMOs of Cu ion was observed. The total energy of the systems calculated by DFT shows that cysteine binds favorably with copper (I) than that with Cu(II).

Copper absorption from human milk, cow's milk, and infant formulas using a suckling rat model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loennerdal, B.B.; Bell, J.G.; Keen, C.L.

1985-11-01

Since copper deficiency is known to occur during infancy, it becomes important to assess copper uptake from various infant diets. The authors have investigated the uptake of copper from human milk, cow's milk, cow's milk formulas, cereal/milk formula and soy formula, compensating for the decay of /sup 64/Cu and using the suckling rat as a model. Radiocopper was added to the diet in trace amounts. Ultracentrifugation, ultrafiltration, and gel filtration were used to show that the added /sup 64/Cu bound to milk fractions and individual binding compounds in a manner analogous to the distribution of native copper, thus validating themore » use of extrinsically labeled diets. Labeled diets were intubated into 14-day-old suckling rats. Animals were killed after 6 h and tissues removed and counted. Liver copper uptake was 25% from human milk, 23% from cow's milk formula, 18% from cow's milk, 17% from premature (cow's milk based) infant formula, 17% from cereal/milk formula and 10% from soy formula. These results show that the rat pup model may provide a rapid, inexpensive, and sensitive method to assay bioavailability of copper from infant foods.« less

The interaction of copper ions with Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli: an X-ray absorption near-edge structure (XANES) spectroscopy study.

PubMed

Zanzen, Ulrike; Bovenkamp-Langlois, Lisa; Klysubun, Wantana; Hormes, Josef; Prange, Alexander

2018-04-01

The antimicrobial properties of copper ions have been known for a long time. However, the exact mechanism of action of the transition metal on microorganisms has long been unclear. X-ray absorption near-edge structure (XANES) spectroscopy at the Cu K edge allows the determination of copper speciation in Staphylococcus aureus, Escherichia coli, and Pseudomonas aeruginosa that have been treated with Cu(II) and Cu(I) solutions. The death/inactivation of the bacteria was observed using plate counting and light microscopy. The Cu K-XANES spectra of the two Gram-negative bacteria are different than those of the Gram-positive strain. The results clearly show that the Cu + -S bond contributes to the antibacterial activity of copper, as in the case of silver. The detailed evaluation of the differentiated absorption spectra shows that Cu + (not Cu 2+ ) is the dominant ion that binds to the bacteria. Because Cu + is not the most common copper ion, copper is not as effective an antibacterial agent as silver, whose common valency is actually + 1. Any reaction of copper with phosphorus from the bacteria can be excluded after the evaluation of the absorption spectra.