Sample records for copy integration events

  1. Genome-wide screening of copy number alterations and LOH events in renal cell carcinomas and integration with gene expression profile

    PubMed Central

    Cifola, Ingrid; Spinelli, Roberta; Beltrame, Luca; Peano, Clelia; Fasoli, Ester; Ferrero, Stefano; Bosari, Silvano; Signorini, Stefano; Rocco, Francesco; Perego, Roberto; Proserpio, Vanessa; Raimondo, Francesca; Mocarelli, Paolo; Battaglia, Cristina


    Background Clear cell renal carcinoma (RCC) is the most common and invasive adult renal cancer. For the purpose of identifying RCC biomarkers, we investigated chromosomal regions and individual genes modulated in RCC pathology. We applied the dual strategy of assessing and integrating genomic and transcriptomic data, today considered the most effective approach for understanding genetic mechanisms of cancer and the most sensitive for identifying cancer-related genes. Results We performed the first integrated analysis of DNA and RNA profiles of RCC samples using Affymetrix technology. Using 100K SNP mapping arrays, we assembled a genome-wide map of DNA copy number alterations and LOH areas. We thus confirmed the typical genetic signature of RCC but also identified other amplified regions (e.g. on chr. 4, 11, 12), deleted regions (chr. 1, 9, 22) and LOH areas (chr. 1, 2, 9, 13). Simultaneously, using HG-U133 Plus 2.0 arrays, we identified differentially expressed genes (DEGs) in tumor vs. normal samples. Combining genomic and transcriptomic data, we identified 71 DEGs in aberrant chromosomal regions and observed, in amplified regions, a predominance of up-regulated genes (27 of 37 DEGs) and a trend to clustering. Functional annotation of these genes revealed some already implicated in RCC pathology and other cancers, as well as others that may be novel tumor biomarkers. Conclusion By combining genomic and transcriptomic profiles from a collection of RCC samples, we identified specific genomic regions with concordant alterations in DNA and RNA profiles and focused on regions with increased DNA copy number. Since the transcriptional modulation of up-regulated genes in amplified regions may be attributed to the genomic alterations characteristic of RCC, these genes may encode novel RCC biomarkers actively involved in tumor initiation and progression and useful in clinical applications. PMID:18194544

  2. Integrating unseen events over time.


    Reber, Thomas P; Henke, Katharina


    Events often share elements that guide us to integrate knowledge from these events. Integration allows us to make inferences that affect reactions to new events. Integrating events and making inferences are thought to depend on consciousness. We show that even unconsciously experienced events, that share elements, are integrated and influence reactions to new events. An unconscious event consisted of the subliminal presentation of two unrelated words. Half of subliminal word pairs shared one word ('winter red', 'red computer'). Overlapping word pairs were presented between 6s and 78 s apart. The test for integration required participants to judge the semantic distance between suprathreshold words ('winter computer'). Evidence of integration was provided by faster reactions to suprathreshold words that were indirectly related versus unrelated. This effect was independent of the time interval between overlapping word pairs. We conclude that consciousness is no requirement for the integration of discontiguous events.

  3. Directed gene copy number amplification in Pichia pastoris by vector integration into the ribosomal DNA locus.


    Marx, Hans; Mecklenbräuker, Astrid; Gasser, Brigitte; Sauer, Michael; Mattanovich, Diethard


    The yeast Pichia pastoris is a widely used host organism for heterologous protein production. One of the basic steps for strain improvement is to ensure a sufficient level of transcription of the heterologous gene, based on promoter strength and gene copy number. To date, high-copy-number integrants of P. pastoris are achievable only by screening of random events or by cloning of gene concatemers. Methods for rapid and reliable multicopy integration of the expression cassette are therefore desirable. Here we present such a method based on vector integration into the rDNA locus and post-transformational vector amplification by repeated selection on increased antibiotic concentrations. Data are presented for two exemplary products: human serum albumin, which is secreted into the supernatant, and human superoxide dismutase, which is accumulated in the cytoplasm of the cells. The striking picture evolving is that intracellular protein production is tightly correlated with gene copy number, while use of the secretory pathway introduces a high clonal variability and the correlation with gene copy number is valid only for low gene copy numbers. PMID:19799640

  4. Integrated Reproduction of Human Motion Components by Motion Copying System

    NASA Astrophysics Data System (ADS)

    Tsunashima, Noboru; Katsura, Seiichiro

    Currently, the development of leading-edge technology for recording and loading human motion on the basis of haptic information is required in the field of manufacturing and human support. Human movement is an assembly of motion components. Since human movements should be supported by a robot in real time, it is necessary to integrate the morion components, which were saved earlier. Once such motion integration is realized, future technology for use in daily human life is developed. This paper proposes the integrated reproduction of the decomposed components of human motion by using a motion copying system. This system is the key technology for the realization of the acquisition, saving and reproduction of the real-world haptic information. By the proposed method, it is possible not only to achieve expert skill acquisition, skill transfer to robots, and power assist for each motion component but also to open up new areas of applications.

  5. Strategies to improve low copy transgenic events in Agrobacterium-mediated transformation of maize.


    Sivamani, Elumalai; Li, Xianggan; Nalapalli, Samson; Barron, Yoshimi; Prairie, Anna; Bradley, David; Doyle, Michele; Que, Qiudeng


    Transgenic plants containing low copy transgene insertion free of vector backbone are highly desired for many biotechnological applications. We have investigated two different strategies for increasing the percentage of low copy events in Agrobacterium-mediated transformation experiments in maize. One of the strategies is to use a binary vector with two separate T-DNAs, one T-DNA containing an intact E.coli manA gene encoding phosphomannose isomerase (PMI) as selectable marker gene cassette and another T-DNA containing an RNAi cassette of PMI sequences. By using this strategy, low copy transgenic events containing the transgenes were increased from 43 to 60 % in maize. An alternate strategy is using selectable marker gene cassettes containing regulatory or coding sequences derived from essential plant genes such as 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) or MADS box transcription factor. In this paper we demonstrate that higher percentage of low copy transgenic events can be obtained in Agrobacterium-mediated maize transformation experiments using both strategies. We propose that the above two strategies can be used independently or in combination to increase transgenic events that contain low copy transgene insertion in Agrobacterium-mediated transformation experiments.

  6. Three Course Connections: Integrated Event Design

    ERIC Educational Resources Information Center

    Johnson, Corey W.; Pate, Joseph A.


    Integrated Event Design (IED) capitalizes on three distinct courses to achieve a blended course delivery: Event Management, Research and Evaluation (for undergraduate students), and Experiential Education (for graduate students). Through the use of an event management company metaphor that fully integrates the diverse curricular concepts, course…

  7. Gene copy number variations in the leukocyte genome of hepatocellular carcinoma patients with integrated hepatitis B virus DNA

    PubMed Central

    Xu, Guixia; Cheng, Kai; Cao, Guangwen; Wu, Mengchao; Cheng, Shuqun; Liu, Shanrong


    Integration of hepatitis B virus (HBV) DNA into the human liver cell genome is believed to promote HBV-related carcinogenesis. This study aimed to quantify the integration of HBV DNA into the leukocyte genome in hepatocellular carcinoma (HCC) patients in order to identify potential biomarkers for HBV-related diseases. Whole-genome comparative genomic hybridization (CGH) chip array analyses were performed to screen gene copy number variations (CNV) in the leukocyte genome, and the results were confirmed by quantitative polymerase chain reaction (qPCR). The commonly detected regions included chromosome arms 19p, 5q, 1q and 15p, where 200 copy number gain events and 270 copy number loss events were noted. In particular, gains were observed in 5q35.3 (OR4F3) and 19p13.3 (OR4F17) in 90% of the samples. Successful homologous recombination of OR4F3 and the HBV P gene was demonstrated, and the amplification at 5q35.3 is potentially associated with the integration of HBV P gene into natural killer cells isolated from peripheral blood mononuclear cells (PBMCs). Receiver operating characteristic (ROC) curve analysis indicated that the combination of OR4F3 and OR4F17 a novel potential biomarker of HBV-related diseases. PMID:26769853

  8. Integrated genotype calling and association analysis of SNPs, common copy number polymorphisms and rare CNVs

    PubMed Central

    Korn, Joshua M; Kuruvilla, Finny G; McCarroll, Steven A; Wysoker, Alec; Nemesh, James; Cawley, Simon; Hubbell, Earl; Veitch, Jim; Collins, Patrick J; Darvishi, Katayoon; Lee, Charles; Nizzari, Marcia M; Gabriel, Stacey B; Purcell, Shaun; Daly, Mark J; Altshuler, David


    Accurate and complete measurement of single nucleotide (SNP) and copy number (CNV) variants, both common and rare, will be required to understand the role of genetic variation in disease. We present Birdsuite, a four-stage analytical framework instantiated in software for deriving integrated and mutually consistent copy number and SNP genotypes. The method sequentially assigns copy number across regions of common copy number polymorphisms (CNPs), calls genotypes of SNPs, identifies rare CNVs via a hidden Markov model (HMM), and generates an integrated sequence and copy number genotype at every locus (for example, including genotypes such as A-null, AAB and BBB in addition to AA, AB and BB calls). Such genotypes more accurately depict the underlying sequence of each individual, reducing the rate of apparent mendelian inconsistencies. The Birdsuite software is applied here to data from the Affymetrix SNP 6.0 array. Additionally, we describe a method, implemented in PLINK, to utilize these combined SNP and CNV genotypes for association testing with a phenotype. PMID:18776909

  9. Integration of transcript expression, copy number and LOH analysis of infiltrating ductal carcinoma of the breast

    PubMed Central


    Background A major challenge in the interpretation of genomic profiling data generated from breast cancer samples is the identification of driver genes as distinct from bystander genes which do not impact tumorigenesis. One way to assess the relative importance of alterations in the transcriptome profile is to combine parallel analyses that assess changes in the copy number alterations (CNAs). This integrated analysis permits the identification of genes with altered expression that map within specific chromosomal regions which demonstrate copy number alterations, providing a mechanistic approach to identify the 'driver genes'. Methods We have performed whole genome analysis of CNAs using the Affymetrix 250K Mapping array on 22 infiltrating ductal carcinoma samples (IDCs). Analysis of transcript expression alterations was performed using the Affymetrix U133 Plus2.0 array on 16 IDC samples. Fourteen IDC samples were analyzed using both platforms and the data integrated. We also incorporated data from loss of heterozygosity (LOH) analysis to identify genes showing altered expression in LOH regions. Results Common chromosome gains and amplifications were identified at 1q21.3, 6p21.3, 7p11.2-p12.1, 8q21.11 and 8q24.3. A novel amplicon was identified at 5p15.33. Frequent losses were found at 1p36.22, 8q23.3, 11p13, 11q23, and 22q13. Over 130 genes were identified with concurrent increases or decreases in expression that mapped to these regions of copy number alterations. LOH analysis revealed three tumors with whole chromosome or p arm allelic loss of chromosome 17. Genes were identified that mapped to copy neutral LOH regions. LOH with accompanying copy loss was detected on Xp24 and Xp25 and genes mapping to these regions with decreased expression were identified. Gene expression data highlighted the PPARα/RXRα Activation Pathway as down-regulated in the tumor samples. Conclusion We have demonstrated the utility of the application of integrated analysis using high

  10. Integrative Analysis of Transcriptional Regulatory Network and Copy Number Variation in Intrahepatic Cholangiocarcinoma

    PubMed Central

    Li, Ling; Lian, Baofeng; Li, Chao; Li, Wei; Li, Jing; Zhang, Yuannv; He, Xianghuo; Li, Yixue; Xie, Lu


    Background Transcriptional regulatory network (TRN) is used to study conditional regulatory relationships between transcriptional factors and genes. However few studies have tried to integrate genomic variation information such as copy number variation (CNV) with TRN to find causal disturbances in a network. Intrahepatic cholangiocarcinoma (ICC) is the second most common hepatic carcinoma with high malignancy and poor prognosis. Research about ICC is relatively limited comparing to hepatocellular carcinoma, and there are no approved gene therapeutic targets yet. Method We first constructed TRN of ICC (ICC-TRN) using forward-and-reverse combined engineering method, and then integrated copy number variation information with ICC-TRN to select CNV-related modules and constructed CNV-ICC-TRN. We also integrated CNV-ICC-TRN with KEGG signaling pathways to investigate how CNV genes disturb signaling pathways. At last, unsupervised clustering method was applied to classify samples into distinct classes. Result We obtained CNV-ICC-TRN containing 33 modules which were enriched in ICC-related signaling pathways. Integrated analysis of the regulatory network and signaling pathways illustrated that CNV might interrupt signaling through locating on either genomic sites of nodes or regulators of nodes in a signaling pathway. In the end, expression profiles of nodes in CNV-ICC-TRN were used to cluster the ICC patients into two robust groups with distinct biological function features. Conclusion Our work represents a primary effort to construct TRN in ICC, also a primary effort to try to identify key transcriptional modules based on their involvement of genetic variations shown by gene copy number variations (CNV). This kind of approach may bring the traditional studies of TRN based only on expression data one step further to genetic disturbance. Such kind of approach can easily be extended to other disease samples with appropriate data. PMID:24897108

  11. Integrated Historical Tsunami Event and Deposit Database

    NASA Astrophysics Data System (ADS)

    Dunbar, P. K.; McCullough, H. L.


    The National Geophysical Data Center (NGDC) provides integrated access to historical tsunami event, deposit, and proxy data. The NGDC tsunami archive initially listed tsunami sources and locations with observed tsunami effects. Tsunami frequency and intensity are important for understanding tsunami hazards. Unfortunately, tsunami recurrence intervals often exceed the historic record. As a result, NGDC expanded the archive to include the Global Tsunami Deposits Database (GTD_DB). Tsunami deposits are the physical evidence left behind when a tsunami impacts a shoreline or affects submarine sediments. Proxies include co-seismic subsidence, turbidite deposits, changes in biota following an influx of marine water in a freshwater environment, etc. By adding past tsunami data inferred from the geologic record, the GTD_DB extends the record of tsunamis backward in time. Although the best methods for identifying tsunami deposits and proxies in the geologic record remain under discussion, developing an overall picture of where tsunamis have affected coasts, calculating recurrence intervals, and approximating runup height and inundation distance provides a better estimate of a region’s true tsunami hazard. Tsunami deposit and proxy descriptions in the GTD_DB were compiled from published data found in journal articles, conference proceedings, theses, books, conference abstracts, posters, web sites, etc. The database now includes over 1,200 descriptions compiled from over 1,100 citations. Each record in the GTD_DB is linked to its bibliographic citation where more information on the deposit can be found. The GTD_DB includes data for over 50 variables such as: event description (e.g., 2010 Chile Tsunami), geologic time period, year, deposit location name, latitude, longitude, country, associated body of water, setting during the event (e.g., beach, lake, river, deep sea), upper and lower contacts, underlying and overlying material, etc. If known, the tsunami source mechanism

  12. Inverse PCR and Quantitative PCR as Alternative Methods to Southern Blotting Analysis to Assess Transgene Copy Number and Characterize the Integration Site in Transgenic Woody Plants.


    Stefano, Biricolti; Patrizia, Bogani; Matteo, Cerboneschi; Massimo, Gori


    One of the major unanswered questions with respect to the commercial use of genetic transformation in woody plants is the stability of the transgene expression over several decades within the same individual. Gene expression is strongly affected by the copy number which has been integrated into the plant genome and by the local DNA features close to the integration sites. Because woody plants cannot be subjected to selfing or backcrossing to modify the transgenic allelic structure without affecting the valuable traits of the cultivar, molecular characterization of the transformation event is therefore crucial. After assessing the transgene copy number of a set of apple transgenic clones with Southern blotting, we describe two alternative methods: the first is based on inverse PCR (i-PCR) and the second on the quantitative PCR (q-PCR). The methods produced comparable results with the exception of the data regarding a high copy number clone, but while the q-PCR-based system is rapid and easily adaptable to high throughput systems, the i-PCR-based method can provide information regarding the transformation event and the characteristics of the sequences flanking the transgenic construct.

  13. High-level expression and characterization of a novel serine protease in Pichia pastoris by multi-copy integration.


    Shu, Min; Shen, Wei; Yang, Shihui; Wang, Xiaojuan; Wang, Fei; Wang, Yaping; Ma, Lixin


    A novel serine protease from Trichoderma koningii (SPTK) was synthesized and expressed in Pichia pastoris. The recombinant SPTK was completely inhibited by phenyl methyl sulfonyl fluoride (PMSF), suggesting that SPTK belonged to the subgroup of serine proteases. The optimum pH and temperature for the recombinant SPTK reaction were 6.0 and 55°C, respectively. SPTK performed a tolerance to most organic solvents and metal ions, and the addition of Triton X-100 exhibited an activation of SPTK up to 243% of its initial activity but SDS strongly inhibited. Moreover, our study showed that a portion of SPTK was N-glycosylated during fermentation. The activity and thermal stability of the recombinant SPTK were improved after the removal of glycosylation, and the N-glycosylation of SPTK could be efficiently removed through co-culture with P. pastoris strains expressing Endo-β-N-acetylglucosaminidase H. We constructed expression vectors harboring from one to four repeats of Sptk-expressing cassettes via an in vitro BioBrick assembly approach. And the result of quantitative polymerase chain reaction (qPCR) indicated that the tandem expression cassettes were integrated into the genome of P. pastoris through a single recombination event. These strains were used to study the correlation between the gene copy number and the expression level of SPTK. The results of qPCR and enzyme activity assays indicated that the copy number variation of Sptk gene generally had a positive effect on the expression level of SPTK, while an increase in integration of target gene did not guarantee its high expression. The maximum yield and specific activity of SPTK in P. pastoris were obtained from the recombinant yeast strain harboring two-copy tandem Sptk-expressing cassettes, the yield reached 0.48g/l after a 6-d induction using menthol in shake flasks and 3.2g/l in high-density fermentation with specific activity of 5200U/mg. In addition, the recombinant SPTK could efficiently degrade chicken

  14. High-level expression and characterization of a novel serine protease in Pichia pastoris by multi-copy integration.


    Shu, Min; Shen, Wei; Yang, Shihui; Wang, Xiaojuan; Wang, Fei; Wang, Yaping; Ma, Lixin


    A novel serine protease from Trichoderma koningii (SPTK) was synthesized and expressed in Pichia pastoris. The recombinant SPTK was completely inhibited by phenyl methyl sulfonyl fluoride (PMSF), suggesting that SPTK belonged to the subgroup of serine proteases. The optimum pH and temperature for the recombinant SPTK reaction were 6.0 and 55°C, respectively. SPTK performed a tolerance to most organic solvents and metal ions, and the addition of Triton X-100 exhibited an activation of SPTK up to 243% of its initial activity but SDS strongly inhibited. Moreover, our study showed that a portion of SPTK was N-glycosylated during fermentation. The activity and thermal stability of the recombinant SPTK were improved after the removal of glycosylation, and the N-glycosylation of SPTK could be efficiently removed through co-culture with P. pastoris strains expressing Endo-β-N-acetylglucosaminidase H. We constructed expression vectors harboring from one to four repeats of Sptk-expressing cassettes via an in vitro BioBrick assembly approach. And the result of quantitative polymerase chain reaction (qPCR) indicated that the tandem expression cassettes were integrated into the genome of P. pastoris through a single recombination event. These strains were used to study the correlation between the gene copy number and the expression level of SPTK. The results of qPCR and enzyme activity assays indicated that the copy number variation of Sptk gene generally had a positive effect on the expression level of SPTK, while an increase in integration of target gene did not guarantee its high expression. The maximum yield and specific activity of SPTK in P. pastoris were obtained from the recombinant yeast strain harboring two-copy tandem Sptk-expressing cassettes, the yield reached 0.48g/l after a 6-d induction using menthol in shake flasks and 3.2g/l in high-density fermentation with specific activity of 5200U/mg. In addition, the recombinant SPTK could efficiently degrade chicken

  15. An integrated analysis of miRNA and gene copy numbers in xenografts of Ewing's sarcoma

    PubMed Central


    Background Xenografts have been shown to provide a suitable source of tumor tissue for molecular analysis in the absence of primary tumor material. We utilized ES xenograft series for integrated microarray analyses to identify novel biomarkers. Method Microarray technology (array comparative genomic hybridization (aCGH) and micro RNA arrays) was used to screen and identify copy number changes and differentially expressed miRNAs of 34 and 14 passages, respectively. Incubated cells used for xenografting (Passage 0) were considered to represent the primary tumor. Four important differentially expressed miRNAs (miR-31, miR-31*, miR-145, miR-106) were selected for further validation by real time polymerase chain reaction (RT-PCR). Integrated analysis of aCGH and miRNA data was performed on 14 xenograft passages by bioinformatic methods. Results The most frequent losses and gains of DNA copy number were detected at 9p21.3, 16q and at 8, 15, 17q21.32-qter, 1q21.1-qter, respectively. The presence of these alterations was consistent in all tumor passages. aCGH profiles of xenograft passages of each series resembled their corresponding primary tumors (passage 0). MiR-21, miR-31, miR-31*, miR-106b, miR-145, miR-150*, miR-371-5p, miR-557 and miR-598 showed recurrently altered expression. These miRNAS were predicted to regulate many ES-associated genes, such as genes of the IGF1 pathway, EWSR1, FLI1 and their fusion gene (EWS-FLI1). Twenty differentially expressed miRNAs were pinpointed in regions carrying altered copy numbers. Conclusion In the present study, ES xenografts were successfully applied for integrated microarray analyses. Our findings showed expression changes of miRNAs that were predicted to regulate many ES associated genes, such as IGF1 pathway genes, FLI1, EWSR1, and the EWS-FLI1 fusion genes. PMID:22429812

  16. Integrated small copy number variations and epigenome maps of disorders of sex development

    PubMed Central

    Amarillo, Ina E; Nievera, Isabelle; Hagan, Andrew; Huchthagowder, Vishwa; Heeley, Jennifer; Hollander, Abby; Koenig, Joel; Austin, Paul; Wang, Ting


    Small copy number variations (CNVs) have typically not been analyzed or reported in clinical settings and hence have remained underrepresented in databases and the literature. Here, we focused our investigations on these small CNVs using chromosome microarray analysis (CMA) data previously obtained from patients with atypical characteristics or disorders of sex development (DSD). Using our customized CMA track targeting 334 genes involved in the development of urogenital and reproductive structures and a less stringent analysis filter, we uncovered small genes with recurrent and overlapping CNVs as small as 1 kb, and small regions of homozygosity (ROHs), imprinting and position effects. Detailed analysis of these high-resolution data revealed CNVs and ROHs involving structural and functional domains, repeat elements, active transcription sites and regulatory regions. Integration of these genomic data with DNA methylation, histone modification and predicted RNA expression profiles in normal testes and ovaries suggested spatiotemporal and tissue-specific gene regulation. This study emphasized a DSD-specific and gene-targeted CMA approach that uncovered previously unanalyzed or unreported small genes and CNVs, contributing to the growing resources on small CNVs and facilitating the narrowing of the genomic gap for identifying candidate genes or regions. This high-resolution analysis tool could improve the diagnostic utility of CMA, not only in patients with DSD but also in other clinical populations. These integrated data provided a better genomic-epigenomic landscape of DSD and greater opportunities for downstream research. PMID:27340555

  17. Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

    PubMed Central

    Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.


    Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

  18. Organellar genome copy number variation and integrity during moderate maturation of roots and leaves of maize seedlings.


    Ma, Jin; Li, Xiu-Qing


    Little information is available about organellar genome copy numbers and integrity in plant roots, although it was reported recently that the plastid and mitochondrial genomes were damaged under light, resulting in non-functional fragments in green seedling leaves in a maize line. In the present study, we investigated organellar genome copy numbers and integrity, after assessing the cellular ploidy, in seedling leaves and roots of two elite maize (Zea mays) cultivars using both long-fragment polymerase chain reaction (long-PCR) and real-time quantitative polymerase chain reaction (qPCR, a type of short-PCR). Since maize leaf and root cells are mainly diploid according to chromosome number counting and the literature, the DNA amount ratio between the organellar genomes and the nuclear genome could be used to estimate average organellar genome copy numbers per cell. In the present study, both long-PCR and qPCR analyses found that green leaves had dramatically more plastid DNA and less mitochondrial DNA than roots had in both cultivars. The similarity in results from long-PCR and qPCR suggests that green leaves and roots during moderate maturation have largely intact plastid and mitochondrial genomes. The high resolution of qPCR led to the detection of an increase in copies in the plastid genome and a decrease in copies in the analyzed mitochondrial sub-genomes during the moderate maturation of seedling leaves and roots. These results suggest that green seedling leaves and roots of these two maize cultivars during moderate maturation had essentially intact organellar genomes, an increased copy number of the plastid genome, and decreased copy numbers of certain mitochondrial sub-genomes.

  19. Systematic prioritization and integrative analysis of copy number variations in schizophrenia reveal key schizophrenia susceptibility genes.


    Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin


    Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and

  20. SRBreak: A Read-Depth and Split-Read Framework to Identify Breakpoints of Different Events Inside Simple Copy-Number Variable Regions

    PubMed Central

    Nguyen, Hoang T.; Boocock, James; Merriman, Tony R.; Black, Michael A.


    Copy-number variation (CNV) has been associated with increased risk of complex diseases. High-throughput sequencing (HTS) technologies facilitate the detection of copy-number variable regions (CNVRs) and their breakpoints. This helps in understanding genome structure as well as their evolution process. Various approaches have been proposed for detecting CNV breakpoints, but currently it is still challenging for tools based on a single analysis method to identify breakpoints of CNVs. It has been shown, however, that pipelines which integrate multiple approaches are able to report more reliable breakpoints. Here, based on HTS data, we have developed a pipeline to identify approximate breakpoints (±10 bp) relating to different ancestral events within a specific CNVR. The pipeline combines read-depth and split-read information to infer breakpoints, using information from multiple samples to allow an imputation approach to be taken. The main steps involve using a normal mixture model to cluster samples into different groups, followed by simple kernel-based approaches to maximize information obtained from read-depth and split-read approaches, after which common breakpoints of groups are inferred. The pipeline uses split-read information directly from CIGAR strings of BAM files, without using a re-alignment step. On simulated data sets, it was able to report breakpoints for very low-coverage samples including those for which only single-end reads were available. When applied to three loci from existing human resequencing data sets (NEGR1, LCE3, IRGM) the pipeline obtained good concordance with results from the 1000 Genomes Project (92, 100, and 82%, respectively). The package is available at, and also as a docker-based application at PMID:27695476

  1. SRBreak: A Read-Depth and Split-Read Framework to Identify Breakpoints of Different Events Inside Simple Copy-Number Variable Regions

    PubMed Central

    Nguyen, Hoang T.; Boocock, James; Merriman, Tony R.; Black, Michael A.


    Copy-number variation (CNV) has been associated with increased risk of complex diseases. High-throughput sequencing (HTS) technologies facilitate the detection of copy-number variable regions (CNVRs) and their breakpoints. This helps in understanding genome structure as well as their evolution process. Various approaches have been proposed for detecting CNV breakpoints, but currently it is still challenging for tools based on a single analysis method to identify breakpoints of CNVs. It has been shown, however, that pipelines which integrate multiple approaches are able to report more reliable breakpoints. Here, based on HTS data, we have developed a pipeline to identify approximate breakpoints (±10 bp) relating to different ancestral events within a specific CNVR. The pipeline combines read-depth and split-read information to infer breakpoints, using information from multiple samples to allow an imputation approach to be taken. The main steps involve using a normal mixture model to cluster samples into different groups, followed by simple kernel-based approaches to maximize information obtained from read-depth and split-read approaches, after which common breakpoints of groups are inferred. The pipeline uses split-read information directly from CIGAR strings of BAM files, without using a re-alignment step. On simulated data sets, it was able to report breakpoints for very low-coverage samples including those for which only single-end reads were available. When applied to three loci from existing human resequencing data sets (NEGR1, LCE3, IRGM) the pipeline obtained good concordance with results from the 1000 Genomes Project (92, 100, and 82%, respectively). The package is available at, and also as a docker-based application at

  2. Identifying In-Trans Process Associated Genes in Breast Cancer by Integrated Analysis of Copy Number and Expression Data

    PubMed Central

    Liestøl, Knut; Lipson, Doron; Nyberg, Sandra; Naume, Bjørn; Sahlberg, Kristine Kleivi; Kristensen, Vessela N.; Børresen-Dale, Anne-Lise; Lingjærde, Ole Christian; Yakhini, Zohar


    Genomic copy number alterations are common in cancer. Finding the genes causally implicated in oncogenesis is challenging because the gain or loss of a chromosomal region may affect a few key driver genes and many passengers. Integrative analyses have opened new vistas for addressing this issue. One approach is to identify genes with frequent copy number alterations and corresponding changes in expression. Several methods also analyse effects of transcriptional changes on known pathways. Here, we propose a method that analyses in-cis correlated genes for evidence of in-trans association to biological processes, with no bias towards processes of a particular type or function. The method aims to identify cis-regulated genes for which the expression correlation to other genes provides further evidence of a network-perturbing role in cancer. The proposed unsupervised approach involves a sequence of statistical tests to systematically narrow down the list of relevant genes, based on integrative analysis of copy number and gene expression data. A novel adjustment method handles confounding effects of co-occurring copy number aberrations, potentially a large source of false positives in such studies. Applying the method to whole-genome copy number and expression data from 100 primary breast carcinomas, 6373 genes were identified as commonly aberrant, 578 were highly in-cis correlated, and 56 were in addition associated in-trans to biological processes. Among these in-trans process associated and cis-correlated (iPAC) genes, 28% have previously been reported as breast cancer associated, and 64% as cancer associated. By combining statistical evidence from three separate subanalyses that focus respectively on copy number, gene expression and the combination of the two, the proposed method identifies several known and novel cancer driver candidates. Validation in an independent data set supports the conclusion that the method identifies genes implicated in cancer. PMID

  3. Integrated DNA Copy Number and Gene Expression Regulatory Network Analysis of Non-small Cell Lung Cancer Metastasis

    PubMed Central

    Iranmanesh, Seyed M; Guo, Nancy L


    Integrative analysis of multi-level molecular profiles can distinguish interactions that cannot be revealed based on one kind of data in the analysis of cancer susceptibility and metastasis. DNA copy number variations (CNVs) are common in cancer cells, and their role in cell behaviors and relationship to gene expression (GE) is poorly understood. An integrative analysis of CNV and genome-wide mRNA expression can discover copy number alterations and their possible regulatory effects on GE. This study presents a novel framework to identify important genes and construct potential regulatory networks based on these genes. Using this approach, DNA copy number aberrations and their effects on GE in lung cancer progression were revealed. Specifically, this approach contains the following steps: (1) select a pool of candidate driver genes, which have significant CNV in lung cancer patient tumors or have a significant association with the clinical outcome at the transcriptional level; (2) rank important driver genes in lung cancer patients with good prognosis and poor prognosis, respectively, and use top-ranked driver genes to construct regulatory networks with the COpy Number and EXpression In Cancer (CONEXIC) method; (3) identify experimentally confirmed molecular interactions in the constructed regulatory networks using Ingenuity Pathway Analysis (IPA); and (4) visualize the refined regulatory networks with the software package Genatomy. The constructed CNV/mRNA regulatory networks provide important insights into potential CNV-regulated transcriptional mechanisms in lung cancer metastasis. PMID:25392690

  4. CNV Workshop: an integrated platform for high-throughput copy number variation discovery and clinical diagnostics

    PubMed Central


    Background Recent studies have shown that copy number variations (CNVs) are frequent in higher eukaryotes and associated with a substantial portion of inherited and acquired risk for various human diseases. The increasing availability of high-resolution genome surveillance platforms provides opportunity for rapidly assessing research and clinical samples for CNV content, as well as for determining the potential pathogenicity of identified variants. However, few informatics tools for accurate and efficient CNV detection and assessment currently exist. Results We developed a suite of software tools and resources (CNV Workshop) for automated, genome-wide CNV detection from a variety of SNP array platforms. CNV Workshop includes three major components: detection, annotation, and presentation of structural variants from genome array data. CNV detection utilizes a robust and genotype-specific extension of the Circular Binary Segmentation algorithm, and the use of additional detection algorithms is supported. Predicted CNVs are captured in a MySQL database that supports cohort-based projects and incorporates a secure user authentication layer and user/admin roles. To assist with determination of pathogenicity, detected CNVs are also annotated automatically for gene content, known disease loci, and gene-based literature references. Results are easily queried, sorted, filtered, and visualized via a web-based presentation layer that includes a GBrowse-based graphical representation of CNV content and relevant public data, integration with the UCSC Genome Browser, and tabular displays of genomic attributes for each CNV. Conclusions To our knowledge, CNV Workshop represents the first cohesive and convenient platform for detection, annotation, and assessment of the biological and clinical significance of structural variants. CNV Workshop has been successfully utilized for assessment of genomic variation in healthy individuals and disease cohorts and is an ideal platform for

  5. Single Event Transients in Linear Integrated Circuits

    NASA Technical Reports Server (NTRS)

    Buchner, Stephen; McMorrow, Dale


    On November 5, 2001, a processor reset occurred on board the Microwave Anisotropy Probe (MAP), a NASA mission to measure the anisotropy of the microwave radiation left over from the Big Bang. The reset caused the spacecraft to enter a safehold mode from which it took several days to recover. Were that to happen regularly, the entire mission would be compromised, so it was important to find the cause of the reset and, if possible, to mitigate it. NASA assembled a team of engineers that included experts in radiation effects to tackle the problem. The first clue was the observation that the processor reset occurred during a solar event characterized by large increases in the proton and heavy ion fluxes emitted by the sun. To the radiation effects engineers on the team, this strongly suggested that particle radiation might be the culprit, particularly when it was discovered that the reset circuit contained three voltage comparators (LM139). Previous testing revealed that large voltage transients, or glitches appeared at the output of the LM139 when it was exposed to a beam of heavy ions [NI96]. The function of the reset circuit was to monitor the supply voltage and to issue a reset command to the processor should the voltage fall below a reference of 2.5 V [PO02]. Eventually, the team of engineers concluded that ionizing particle radiation from the solar event produced a negative voltage transient on the output of one of the LM139s sufficiently large to reset the processor on MAP. Fortunately, as of the end of 2004, only two such resets have occurred. The reset on MAP was not the first malfunction on a spacecraft attributed to a transient. That occurred shortly after the launch of NASA s TOPEX/Poseidon satellite in 1992. It was suspected, and later confirmed, that an anomaly in the Earth Sensor was caused by a transient in an operational amplifier (OP-15) [KO93]. Over the next few years, problems on TDRS, CASSINI, [PR02] SOHO [HA99,HA01] and TERRA were also attributed

  6. Copy-neutral loss of heterozygosity is prevalent and a late event in the pathogenesis of FLT3/ITD AML.


    Stirewalt, D L; Pogosova-Agadjanyan, E L; Tsuchiya, K; Joaquin, J; Meshinchi, S


    Patients with high FLT3 internal tandem duplication allelic ratios (FLT3/ITD-ARs) have a poor prognosis. Single-nucleotide polymorphism/comparative genomic hybridization, single-cell PCR and colony-forming assays were used to evaluate genotypic evolution of high FLT3/ITD-ARs in 85 acute myeloid leukemia (AML) patients. Microarrays were used to examine molecular pathways disrupted in leukemic blasts with high FLT3/ITD-ARs. Copy-neutral loss of heterozygosity (CN-LOH) was identified at the FLT3 locus in diagnostic samples with high FLT3/ITD-ARs (N=11), but not in samples with low FLT3/ITD-ARs (N=24), FLT3-activating loop mutations (N=11) or wild-type FLT3 (N=39). Single-cell assays showed that homozygous FLT3/ITD genotype was present in subsets of leukemic blasts at diagnosis but became the dominant clone at relapse. Less differentiated CD34(+)/CD33(-) progenitor colonies were heterozygous for FLT3/ITD, whereas more differentiated CD34(+)/CD33(+) progenitor colonies were homozygous for FLT3/ITD. Expression profiling revealed that samples harboring high FLT3/ITD-ARs aberrantly expressed genes within the recombination/DNA repair pathway. Thus, the development of CN-LOH at the FLT3 locus, which results in high FLT3/ITD-ARs, likely represents a late genomic event that occurs after the acquisition of the FLT3/ITD. Although the etiology underlying the development of CN-LOH remains to be clarified, the disruption in recombination/DNA repair pathway, which is present before the development of LOH, may have a role. PMID:24786392

  7. Integrative analysis of 1q23.3 copy number gain in metastatic urothelial carcinoma

    PubMed Central

    Riester, Markus; Werner, Lillian; Bellmunt, Joaquim; Selvarajah, Shamini; Guancial, Elizabeth A.; Weir, Barbara A.; Stack, Edward C.; Park, Rachel S.; O’Brien, Robert; Schutz, Fabio A. B.; Choueiri, Toni K.; Signoretti, Sabina; Lloreta, Josep; Marchionni, Luigi; Gallardo, Enrique; Rojo, Federico; Garcia, Denise I.; Chekaluk, Yvonne; Kwiatkowski, David; Bochner, Bernard; Hahn, William C.; Ligon, Azra H.; Barletta, Justine A.; Loda, Massimo; Berman, David M.; Kantoff, Philip; Michor, Franziska; Rosenberg, Jonathan E.


    Purpose Metastatic urothelial carcinoma (UC) of the bladder is associated with multiple somatic copy number alterations (SCNAs). We evaluated SCNAs to identify predictors of poor survival in patients with metastatic UC treated with platinum-based chemotherapy. Experimental Design We obtained overall survival (OS) and array DNA copy number data from metastatic UC patients in two cohorts. Associations between recurrent SCNAs and OS were determined by a Cox proportional hazard model adjusting for performance status and visceral disease. mRNA expression was evaluated for potential candidate genes by Nanostring nCounter to identify transcripts from the region that are associated with copy number gain. In addition, expression data from an independent cohort was used to identify candidate genes. Results Multiple areas of recurrent significant gains and losses were identified. Gain of 1q23.3 was independently associated with a shortened OS in the both cohorts (adjusted HR 2.96; 95% CI, 1.35 to 6.48; P = 0.01 and adjusted HR 5.03; 95% CI 1.43-17.73; P < 0.001). The F11R, PFDN2, PPOX, USP21 and DEDD genes, all located on 1q23.3, were closely associated with poor outcome. Conclusions 1q23.3 copy number gain displayed association with poor survival in two cohorts of metastatic UC. The identification of the target of this copy number gain is ongoing, and exploration of this finding in other disease states may be useful for the early identification of poor risk UC patients. Prospective validation of the survival association is necessary to demonstrate clinical relevance. PMID:24486590


    SciTech Connect

    Humberto E. Garcia; Wen-Chiao Lin; Tae-Sic Yoo


    There is a recognized safeguards benefit from using process monitoring (PM) on nuclear facilities to complement nuclear materials accountancy. We introduce a model-based approach for PM in which the assessment regarding the state of the monitored system is conducted at a system-centric level. The proposed architecture integrates both time-driven and event-driven data integration and analysis for decision-making. While the time-driven layers of the proposed architecture encompass more traditional PM methods based on time series data and analysis, the event-driven layers encompass operation monitoring methods based on discrete event data integration and analysis. By integrating process- and operation-related information and methodologies within an unified modeling and monitoring framework that includes not only current but also past plant behaviors, the task of anomaly detection is greatly improved because this decision-making approach can benefit from not only known time-series relationships among measured signals but also from known event sequence relationships among generated events. Building from the proposed system-centric PM architecture, we briefly introduce methods that can be used to implement its different components. The application of the proposed approach is then demonstrated via simulation experiments.

  9. Eclipse period during replication of plasmid R1: contributions from structural events and from the copy-number control system.


    Olsson, Jan A; Berg, Otto G; Dasgupta, Santanu; Nordström, Kurt


    The eclipse period (the time period during which a newly replicated plasmid copy is not available for a new replication) of plasmid R1 in Escherichia coli was determined with the classic Meselson-Stahl density-shift experiment. A mini-plasmid with the wild-type R1 replicon and a mutant with a thermo-inducible runaway-replication phenotype were used in this work. The eclipses of the chromosome and of the wild-type plasmid were 0.6 and 0.2 generation times, respectively, at temperatures ranging from 30 degrees C to 42 degrees C. The mutant plasmid had a similar eclipse at temperatures up to 38 degrees C. At 42 degrees C, the plasmid copy number increased rapidly because of the absence of replication control and replication reached a rate of 350-400 plasmid replications per cell and cell generation. During uncontrolled replication, the eclipse was about 3 min compared with 10 min at controlled replication (the wild-type plasmid at 42 degrees C). Hence, the copy-number control system contributed significantly to the eclipse. The eclipse in the absence of copy-number control (3 min) presumably is caused by structural requirements: the covalently closed circular plasmid DNA has to regain the right degree of superhelicity needed for initiation of replication and it takes time to assemble the initiation factors. PMID:14507381

  10. Eclipse period during replication of plasmid R1: contributions from structural events and from the copy-number control system.


    Olsson, Jan A; Berg, Otto G; Dasgupta, Santanu; Nordström, Kurt


    The eclipse period (the time period during which a newly replicated plasmid copy is not available for a new replication) of plasmid R1 in Escherichia coli was determined with the classic Meselson-Stahl density-shift experiment. A mini-plasmid with the wild-type R1 replicon and a mutant with a thermo-inducible runaway-replication phenotype were used in this work. The eclipses of the chromosome and of the wild-type plasmid were 0.6 and 0.2 generation times, respectively, at temperatures ranging from 30 degrees C to 42 degrees C. The mutant plasmid had a similar eclipse at temperatures up to 38 degrees C. At 42 degrees C, the plasmid copy number increased rapidly because of the absence of replication control and replication reached a rate of 350-400 plasmid replications per cell and cell generation. During uncontrolled replication, the eclipse was about 3 min compared with 10 min at controlled replication (the wild-type plasmid at 42 degrees C). Hence, the copy-number control system contributed significantly to the eclipse. The eclipse in the absence of copy-number control (3 min) presumably is caused by structural requirements: the covalently closed circular plasmid DNA has to regain the right degree of superhelicity needed for initiation of replication and it takes time to assemble the initiation factors.

  11. Changes in DNA damage, molecular integrity, and copy number for plastid DNA and mitochondrial DNA during maize development

    PubMed Central

    Kumar, Rachana A.; Oldenburg, Delene J.; Bendich, Arnold J.


    The amount and structural integrity of organellar DNAs change during plant development, although the mechanisms of change are poorly understood. Using PCR-based methods, we quantified DNA damage, molecular integrity, and genome copy number for plastid and mitochondrial DNAs of maize seedlings. A DNA repair assay was also used to assess DNA impediments. During development, DNA damage increased and molecules with impediments that prevented amplification by Taq DNA polymerase increased, with light causing the greatest change. DNA copy number values depended on the assay method, with standard real-time quantitative PCR (qPCR) values exceeding those determined by long-PCR by 100- to 1000-fold. As the organelles develop, their DNAs may be damaged in oxidative environments created by photo-oxidative reactions and photosynthetic/respiratory electron transfer. Some molecules may be repaired, while molecules with unrepaired damage may be degraded to non-functional fragments measured by standard qPCR but not by long-PCR. PMID:25261192

  12. Single event soft error in advanced integrated circuit

    NASA Astrophysics Data System (ADS)

    Yuanfu, Zhao; Suge, Yue; Xinyuan, Zhao; Shijin, Lu; Qiang, Bian; Liang, Wang; Yongshu, Sun


    As technology feature size decreases, single event upset (SEU), and single event transient (SET) dominate the radiation response of microcircuits. Multiple bit upset (MBU) (or multi cell upset) effects, digital single event transient (DSET) and analogue single event transient (ASET) cause serious problems for advanced integrated circuits (ICs) applied in a radiation environment and have become a pressing issue. To face this challenge, a lot of work has been put into the single event soft error mechanism and mitigation schemes. This paper presents a review of SEU and SET, including: a brief historical overview, which summarizes the historical development of the SEU and SET since their first observation in the 1970's; effects prominent in advanced technology, which reviews the effects such as MBU, MSET as well as SET broadening and quenching with the influence of temperature, device structure etc.; the present understanding of single event soft error mechanisms, which review the basic mechanism of single event generation including various component of charge collection; and a discussion of various SEU and SET mitigation schemes divided as circuit hardening and layout hardening that could help the designer meet his goals.

  13. TALE nickase mediates high efficient targeted transgene integration at the human multi-copy ribosomal DNA locus.


    Wu, Yong; Gao, Tieli; Wang, Xiaolin; Hu, Youjin; Hu, Xuyun; Hu, Zhiqing; Pang, Jialun; Li, Zhuo; Xue, Jinfeng; Feng, Mai; Wu, Lingqian; Liang, Desheng


    Although targeted gene addition could be stimulated strikingly by a DNA double strand break (DSB) created by either zinc finger nucleases (ZFNs) or TALE nucleases (TALENs), the DSBs are really mutagenic and toxic to human cells. As a compromised solution, DNA single-strand break (SSB) or nick has been reported to mediate high efficient gene addition but with marked reduction of random mutagenesis. We previously demonstrated effective targeted gene addition at the human multicopy ribosomal DNA (rDNA) locus, a genomic safe harbor for the transgene with therapeutic potential. To improve the transgene integration efficiency by using TALENs while lowering the cytotoxicity of DSBs, we created both TALENs and TALE nickases (TALENickases) targeting this multicopy locus. A targeting vector which could integrate a GFP cassette at the rDNA locus was constructed and co-transfected with TALENs or TALENickases. Although the fraction of GFP positive cells using TALENs was greater than that using TALENickases during the first few days after transfection, it reduced to a level less than that using TALENickases after continuous culture. Our findings showed that the TALENickases were more effective than their TALEN counterparts at the multi-copy rDNA locus, though earlier studies using ZFNs and ZFNickases targeting the single-copy loci showed the reverse. Besides, TALENickases mediated the targeted integration of a 5.4 kb fragment at a frequency of up to 0.62% in HT1080 cells after drug selection, suggesting their potential application in targeted gene modification not being limited at the rDNA locus.

  14. An integrated approach to reveal miRNAs' impacts on the functional consequence of copy number alterations in cancer.


    Li, Kening; Liu, Yongjing; Zhou, Yuanshuai; Zhang, Rui; Zhao, Ning; Yan, Zichuang; Zhang, Qiang; Zhang, Shujuan; Qiu, Fujun; Xu, Yan


    Copy number alteration (CNA) is known to induce gene expression changes mainly through dosage effect, and therefore affect the initiation and progression of tumor. However, tumor samples exhibit heterogeneity in gene dosage sensitivity due to the complicated mechanisms of transcriptional regulation. Currently, no high-throughput method has been available for identifying the regulatory factors affecting the functional consequences of CNA, and determining their effects on cancer. In view of the important regulatory role of miRNA, we investigated the influence of miRNAs on the dosage sensitivities of genes within the CNA regions. By integrating copy number, mRNA expression, miRNA expression profiles of three kinds of cancer, we observed a tendency for high dosage-sensitivity genes to be more targeted by miRNAs in cancer, and identified the miRNAs regulating the dosage sensitivity of amplified/deleted target genes. The results show that miRNAs can modulate oncogenic biological functions by regulating the genes within the CNA regions, and thus play a role as a trigger or balancer in cancer, affecting cancer processes, even survival. This work provided a framework for analyzing the regulation of dosage effect, which will shed a light on understanding the oncogenic and tumor suppressive mechanisms of CNA. Besides, new cancer-related miRNAs were identified. PMID:26099552

  15. An integrated approach to reveal miRNAs’ impacts on the functional consequence of copy number alterations in cancer

    PubMed Central

    Li, Kening; Liu, Yongjing; Zhou, Yuanshuai; Zhang, Rui; Zhao, Ning; Yan, Zichuang; Zhang, Qiang; Zhang, Shujuan; Qiu, Fujun; Xu, Yan


    Copy number alteration (CNA) is known to induce gene expression changes mainly through dosage effect, and therefore affect the initiation and progression of tumor. However, tumor samples exhibit heterogeneity in gene dosage sensitivity due to the complicated mechanisms of transcriptional regulation. Currently, no high-throughput method has been available for identifying the regulatory factors affecting the functional consequences of CNA, and determining their effects on cancer. In view of the important regulatory role of miRNA, we investigated the influence of miRNAs on the dosage sensitivities of genes within the CNA regions. By integrating copy number, mRNA expression, miRNA expression profiles of three kinds of cancer, we observed a tendency for high dosage-sensitivity genes to be more targeted by miRNAs in cancer, and identified the miRNAs regulating the dosage sensitivity of amplified/deleted target genes. The results show that miRNAs can modulate oncogenic biological functions by regulating the genes within the CNA regions, and thus play a role as a trigger or balancer in cancer, affecting cancer processes, even survival. This work provided a framework for analyzing the regulation of dosage effect, which will shed a light on understanding the oncogenic and tumor suppressive mechanisms of CNA. Besides, new cancer-related miRNAs were identified. PMID:26099552

  16. A highly efficient single-step, markerless strategy for multi-copy chromosomal integration of large biochemical pathways in Saccharomyces cerevisiae.


    Shi, Shuobo; Liang, Youyun; Zhang, Mingzi M; Ang, Ee Lui; Zhao, Huimin


    Despite recent advances in genome editing capabilities for the model organism Saccharomyces cerevisiae, the chromosomal integration of large biochemical pathways for stable industrial production remains challenging. In this work, we developed a simple platform for high-efficiency, single-step, markerless, multi-copy chromosomal integration of full biochemical pathways in Saccharomyces cerevisiae. In this Di-CRISPR (delta integration CRISPR-Cas) platform based on the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated systems (Cas), we specifically designed guide RNA sequences to target multiple delta sites in the yeast genome. The generation of double stranded breaks at the delta sites allowed simultaneous integration of multiple copies of linearized donor DNA containing large biochemical pathways. With our newly developed Di-CRISPR platform, we were able to attain highly efficient and markerless integration of large biochemical pathways and achieve an unprecedented 18-copy genomic integration of a 24 kb combined xylose utilization and (R,R)-2,3-butanediol (BDO) production pathway in a single step, thus generating a strain that was able to produce BDO directly from xylose. The simplicity and high efficiency of the Di-CRISPR platform could provide a superior alternative to high copy plasmids and would render this platform an invaluable tool for genome editing and metabolic engineering in S. cerevisiae.

  17. Effects of Integrating and Non-Integrating Reprogramming Methods on Copy Number Variation and Genomic Stability of Human Induced Pluripotent Stem Cells.


    Kang, Xiangjin; Yu, Qian; Huang, Yuling; Song, Bing; Chen, Yaoyong; Gao, Xingcheng; He, Wenyin; Sun, Xiaofang; Fan, Yong


    Human-induced pluripotent stem cells (iPSCs) are derived from differentiated somatic cells using defined factors and provide a renewable source of autologous cells for cell therapy. Many reprogramming methods have been employed to generate human iPSCs, including the use of integrating vectors and non-integrating vectors. Maintenance of the genomic integrity of iPSCs is highly desirable if the cells are to be used in clinical applications. Here, using the Affymetrix Cytoscan HD array, we investigated the genomic aberration profiles of 19 human cell lines: 5 embryonic stem cell (ESC) lines, 6 iPSC lines derived using integrating vectors ("integrating iPSC lines"), 6 iPSC lines derived using non-integrating vectors ("non-integrating iPSC lines"), and the 2 parental cell lines from which the iPSCs were derived. The genome-wide copy number variation (CNV), loss of heterozygosity (LOH) and mosaicism patterns of integrating and non-integrating iPSC lines were investigated. The maximum sizes of CNVs in the genomes of the integrating iPSC lines were 20 times higher than those of the non-integrating iPSC lines. Moreover, the total number of CNVs was much higher in integrating iPSC lines than in other cell lines. The average numbers of novel CNVs with a low degree of overlap with the DGV and of likely pathogenic CNVs with a high degree of overlap with the ISCA (International Symposium on Computer Architecture) database were highest in integrating iPSC lines. Different single nucleotide polymorphisms (SNP) calls revealed that, using the parental cell genotype as a reference, integrating iPSC lines displayed more single nucleotide variations and mosaicism than did non-integrating iPSC lines. This study describes the genome stability of human iPSCs generated using either a DNA-integrating or non-integrating reprogramming method, of the corresponding somatic cells, and of hESCs. Our results highlight the importance of using a high-resolution method to monitor genomic aberrations

  18. Effects of Integrating and Non-Integrating Reprogramming Methods on Copy Number Variation and Genomic Stability of Human Induced Pluripotent Stem Cells.


    Kang, Xiangjin; Yu, Qian; Huang, Yuling; Song, Bing; Chen, Yaoyong; Gao, Xingcheng; He, Wenyin; Sun, Xiaofang; Fan, Yong


    Human-induced pluripotent stem cells (iPSCs) are derived from differentiated somatic cells using defined factors and provide a renewable source of autologous cells for cell therapy. Many reprogramming methods have been employed to generate human iPSCs, including the use of integrating vectors and non-integrating vectors. Maintenance of the genomic integrity of iPSCs is highly desirable if the cells are to be used in clinical applications. Here, using the Affymetrix Cytoscan HD array, we investigated the genomic aberration profiles of 19 human cell lines: 5 embryonic stem cell (ESC) lines, 6 iPSC lines derived using integrating vectors ("integrating iPSC lines"), 6 iPSC lines derived using non-integrating vectors ("non-integrating iPSC lines"), and the 2 parental cell lines from which the iPSCs were derived. The genome-wide copy number variation (CNV), loss of heterozygosity (LOH) and mosaicism patterns of integrating and non-integrating iPSC lines were investigated. The maximum sizes of CNVs in the genomes of the integrating iPSC lines were 20 times higher than those of the non-integrating iPSC lines. Moreover, the total number of CNVs was much higher in integrating iPSC lines than in other cell lines. The average numbers of novel CNVs with a low degree of overlap with the DGV and of likely pathogenic CNVs with a high degree of overlap with the ISCA (International Symposium on Computer Architecture) database were highest in integrating iPSC lines. Different single nucleotide polymorphisms (SNP) calls revealed that, using the parental cell genotype as a reference, integrating iPSC lines displayed more single nucleotide variations and mosaicism than did non-integrating iPSC lines. This study describes the genome stability of human iPSCs generated using either a DNA-integrating or non-integrating reprogramming method, of the corresponding somatic cells, and of hESCs. Our results highlight the importance of using a high-resolution method to monitor genomic

  19. Multiple proviral integration events after virological synapse-mediated HIV-1 spread

    SciTech Connect

    Russell, Rebecca A.; Martin, Nicola; Mitar, Ivonne; Jones, Emma; Sattentau, Quentin J.


    HIV-1 can move directly between T cells via virological synapses (VS). Although aspects of the molecular and cellular mechanisms underlying this mode of spread have been elucidated, the outcomes for infection of the target cell remain incompletely understood. We set out to determine whether HIV-1 transfer via VS results in productive, high-multiplicity HIV-1 infection. We found that HIV-1 cell-to-cell spread resulted in nuclear import of multiple proviruses into target cells as seen by fluorescence in-situ hybridization. Proviral integration into the target cell genome was significantly higher than that seen in a cell-free infection system, and consequent de novo viral DNA and RNA production in the target cell detected by quantitative PCR increased over time. Our data show efficient proviral integration across VS, implying the probability of multiple integration events in target cells that drive productive T cell infection. - Highlights: • Cell-to-cell HIV-1 infection delivers multiple vRNA copies to the target cell. • Cell-to-cell infection results in productive infection of the target cell. • Cell-to-cell transmission is more efficient than cell-free HIV-1 infection. • Suggests a mechanism for recombination in cells infected with multiple viral genomes.

  20. Modeling of single-event upset in bipolar integrated circuits

    NASA Technical Reports Server (NTRS)

    Zoutendyk, J. A.


    The results of work done on the quantitative characterization of single-event upset (SEU) in bipolar random-access memories (RAMs) have been obtained through computer simulation of SEU in RAM cells that contain circuit models for bipolar transistors. The models include current generators that emulate the charge collected from ion tracks. The computer simulation results are compared with test data obtained from a RAM in a bipolar microprocessor chip. This methodology is applicable to other bipolar integrated circuit constructions in addition to RAM cells.

  1. CLIPS, AppleEvents, and AppleScript: Integrating CLIPS with commercial software

    NASA Technical Reports Server (NTRS)

    Compton, Michael M.; Wolfe, Shawn R.


    Many of today's intelligent systems are comprised of several modules, perhaps written in different tools and languages, that together help solve the user's problem. These systems often employ a knowledge-based component that is not accessed directly by the user, but instead operates 'in the background' offering assistance to the user as necessary. In these types of modular systems, an efficient, flexible, and eady-to-use mechanism for sharing data between programs is crucial. To help permit transparent integration of CLIPS with other Macintosh applications, the AI Research Branch at NASA Ames Research Center has extended CLIPS to allow it to communicate transparently with other applications through two popular data-sharing mechanisms provided by the Macintosh operating system: Apple Events (a 'high-level' event mechanism for program-to-program communication), and AppleScript, a recently-released scripting language for the Macintosh. This capability permits other applications (running on either the same or a remote machine) to send a command to CLIPS, which then responds as if the command were typed into the CLIPS dialog window. Any result returned by the command is then automatically returned to the program that sent it. Likewise, CLIPS can send several types of Apple Events directly to other local or remote applications. This CLIPS system has been successfully integrated with a variety of commercial applications, including data collection programs, electronics forms packages, DBMS's, and email programs. These mechanisms can permit transparent user access to the knowledge base from within a commercial application, and allow a single copy of the knowledge base to service multiple users in a networked environment.

  2. Early integration of high copy HPV16 detectable in women with normal and low grade cervical cytology and histology

    PubMed Central

    Kulmala, S‐M A; Syrjänen, S M; Gyllensten, U B; Shabalova, I P; Petrovichev, N; Tosi, P; Syrjänen, K J; Johansson, B C


    Background Integration of human papillomavirus (HPV) DNA has been considered a late event in cervical carcinogenesis. However, integrated forms of HPV were recently detected in cancer precursor lesions using a new real time polymerase chain reaction (PCR) to detect the deletions at the 3362–3443 region of HPV16 E2 Objective To study the frequency of HPV16 DNA integration in cervical lesions and compare the sensitivity of an additional upstream region of the E2 ORF (2962–3138) in detecting HPV integration. Methods Using the TaqMan based PCR, HPV16 positive DNA samples were analysed in 164 cervical scrapings from women participating in a multicentre screening trial. Biopsy confirmation was available in 62 cases. Results Primers targeting the 3362–3443 region detected the majority of E2 deletions. In only 23% of the samples was the E2 upstream region equal or better target than the 3362–3443 region. Mixed (episomal/integrated) pattern was the most prevalent physical state of HPV16, also present in PAP smears with normal morphology. Pure integrated form was most prevalent in HSIL and cancer lesions, but also detectable in low grade abnormalities (NSIL, ASC‐US, LSIL). Women with only integrated HPV16 were almost 10 years older than those with episomal HPV16. Viral load of integrated HPV16 was related to cytological abnormality (p = 0.003) but not to histology. Conclusions Integrated HPV16 is present in low grade cervical lesions, mostly mixed with the episomal form. Women with the pure integrated form of HPV16 are older than those with the other forms. PMID:16484445

  3. Data integration and analysis using the Heliophysics Event Knowledgebase

    NASA Astrophysics Data System (ADS)

    Hurlburt, Neal; Reardon, Kevin

    The Heliophysics Event Knowledgebase (HEK) system provides an integrated framework for automated data mining using a variety of feature-detection methods; high-performance data systems to cope with over 1TB/day of multi-mission data; and web services and clients for searching the resulting metadata, reviewing results, and efficiently accessing the data products. We have recently enhanced the capabilities of the HEK to support the complex datasets being produced by the Interface Region Imaging Spectrograph (IRIS). We are also developing the mechanisms to incorporate descriptions of coordinated observations from ground-based facilities, including the NSO's Dunn Solar Telescope (DST). We will discuss the system and its recent evolution and demonstrate its ability to support coordinated science investigations.

  4. An integrated system for hydrological analysis of flood events

    NASA Astrophysics Data System (ADS)

    Katsafados, Petros; Chalkias, Christos; Karymbalis, Efthymios; Gaki-Papanastassiou, Kalliopi; Mavromatidis, Elias; Papadopoulos, Anastasios


    The significant increase of extreme flood events during recent decades has led to an urgent social and economic demand for improve prediction and sustainable prevention. Remedial actions require accurate estimation of the spatiotemporal variability of runoff volume and local peaks, which can be analyzed through integrated simulation tools. Despite the fact that such advanced modeling systems allow the investigation of the dynamics controlling the behavior of those complex processes they can also be used as early warning systems. Moreover, simulation is assuming as the appropriate method to derive quantitative estimates of various atmospheric and hydrologic parameters especially in cases of absence reliable and accurate measurements of precipitation and flow rates. Such sophisticated techniques enable the flood risk assessment and improve the decision-making support on protection actions. This study presents an integrated system for the simulation of the essential atmospheric and soil parameters in the context of hydrological flood modeling. The system is consisted of two main cores: a numerical weather prediction model coupled with a geographical information system for the accurate simulation of groundwater advection and rainfall runoff estimation. Synoptic and mesoscale atmospheric motions are simulated with a non-hydrostatic limited area model on a very high resolution domain of integration. The model includes advanced schemes for the microphysics and the surface layer physics description as well as the longwave and sortwave radiation budget estimation. It is also fully coupled with a land-surface model in order to resolve the surface heat fluxes and the simulation of the air-land energy exchange processes. Detailed atmospheric and soil parameters derived from the atmospheric model are used as input data for the GIS-based runoff modeling. Geographical information system (GIS) technology is used for further hydrological analysis and estimation of direct

  5. A Single Banana Streak Virus Integration Event in the Banana Genome as the Origin of Infectious Endogenous Pararetrovirus▿

    PubMed Central

    Gayral, Philippe; Noa-Carrazana, Juan-Carlos; Lescot, Magali; Lheureux, Fabrice; Lockhart, Benham E. L.; Matsumoto, Takashi; Piffanelli, Pietro; Iskra-Caruana, Marie-Line


    Sequencing of plant nuclear genomes reveals the widespread presence of integrated viral sequences known as endogenous pararetroviruses (EPRVs). Banana is one of the three plant species known to harbor infectious EPRVs. Musa balbisiana carries integrated copies of Banana streak virus (BSV), which are infectious by releasing virions in interspecific hybrids. Here, we analyze the organization of the EPRV of BSV Goldfinger (BSGfV) present in the wild diploid M. balbisiana cv. Pisang Klutuk Wulung (PKW) revealed by the study of Musa bacterial artificial chromosome resources and interspecific genetic cross. cv. PKW contains two similar EPRVs of BSGfV. Genotyping of these integrants and studies of their segregation pattern show an allelic insertion. Despite the fact that integrated BSGfV has undergone extensive rearrangement, both EPRVs contain the full-length viral genome. The high degree of sequence conservation between the integrated and episomal form of the virus indicates a recent integration event; however, only one allele is infectious. Analysis of BSGfV EPRV segregation among an F1 population from an interspecific genetic cross revealed that these EPRV sequences correspond to two alleles originating from a single integration event. We describe here for the first time the full genomic and genetic organization of the two EPRVs of BSGfV present in cv. PKW in response to the challenge facing both scientists and breeders to identify and generate genetic resources free from BSV. We discuss the consequences of this unique host-pathogen interaction in terms of genetic and genomic plant defenses versus strategies of infectious BSGfV EPRVs. PMID:18417582

  6. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.


    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H


    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite. PMID:22614281

  7. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.


    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H


    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  8. Discovery of common Asian copy number variants using integrated high-resolution array CGH and massively parallel DNA sequencing.


    Park, Hansoo; Kim, Jong-Il; Ju, Young Seok; Gokcumen, Omer; Mills, Ryan E; Kim, Sheehyun; Lee, Seungbok; Suh, Dongwhan; Hong, Dongwan; Kang, Hyunseok Peter; Yoo, Yun Joo; Shin, Jong-Yeon; Kim, Hyun-Jin; Yavartanoo, Maryam; Chang, Young Wha; Ha, Jung-Sook; Chong, Wilson; Hwang, Ga-Ram; Darvishi, Katayoon; Kim, Hyeran; Yang, Song Ju; Yang, Kap-Seok; Kim, Hyungtae; Hurles, Matthew E; Scherer, Stephen W; Carter, Nigel P; Tyler-Smith, Chris; Lee, Charles; Seo, Jeong-Sun


    Copy number variants (CNVs) account for the majority of human genomic diversity in terms of base coverage. Here, we have developed and applied a new method to combine high-resolution array comparative genomic hybridization (CGH) data with whole-genome DNA sequencing data to obtain a comprehensive catalog of common CNVs in Asian individuals. The genomes of 30 individuals from three Asian populations (Korean, Chinese and Japanese) were interrogated with an ultra-high-resolution array CGH platform containing 24 million probes. Whole-genome sequencing data from a reference genome (NA10851, with 28.3x coverage) and two Asian genomes (AK1, with 27.8x coverage and AK2, with 32.0x coverage) were used to transform the relative copy number information obtained from array CGH experiments into absolute copy number values. We discovered 5,177 CNVs, of which 3,547 were putative Asian-specific CNVs. These common CNVs in Asian populations will be a useful resource for subsequent genetic studies in these populations, and the new method of calling absolute CNVs will be essential for applying CNV data to personalized medicine.

  9. Qualitative and quantitative event-specific PCR detection methods for oxy-235 canola based on the 3' integration flanking sequence.


    Yang, Litao; Guo, Jinchao; Zhang, Haibo; Liu, Jia; Zhang, Dabing


    As more genetically modified plant events are approved for commercialization worldwide, the event-specific PCR method has become the key method for genetically modified organism (GMO) identification and quantification. This study reveals the 3' flanking sequence of the exogenous integration of Oxy-235 canola employing thermal asymmetric interlaced PCR (TAIL-PCR). On the basis of the revealed 3' flanking sequence, PCR primers and TaqMan probe were designed and qualitative and quantitative PCR assays were established for Oxy-235 canola. The specificity and limits of detection (LOD) and quantification (LOQ) of these two PCR assays were validated to as low as 0.1% for the relative LOD of qualitative PCR assay; the absolute LOD and LOQ were low to 10 and 20 copies of canola genomic DNA in quantitative PCR assay, respectively. Furthermore, ideal quantified results were obtained in the practical canola sample detection. All of the results indicate that the developed qualitative and quantitative PCR methods based on the revealed 3' integration flanking sequence are suitable for GM canola Oxy-235 identification and quantification.

  10. Enhancing Business Process Automation by Integrating RFID Data and Events

    NASA Astrophysics Data System (ADS)

    Zhao, Xiaohui; Liu, Chengfei; Lin, Tao

    Business process automation is one of the major benefits for utilising Radio Frequency Identification (RFID) technology. Through readers to RFID middleware systems, the information and the movements of tagged objects can be used to trigger business transactions. These features change the way of business applications for dealing with the physical world from mostly quantity-based to object-based. Aiming to facilitate business process automation, this paper introduces a new method to model and incorporate business logics into RFID edge systems from an object-oriented perspective with emphasises on RFID's event-driven characteristics. A framework covering business rule modelling, event handling and system operation invocations is presented on the basis of the event calculus. In regard to the identified delayed effects in RFID-enabled applications, a two-block buffering mechanism is proposed to improve RFID query efficiency within the framework. The performance improvements are analysed with related experiments.

  11. Indico central - events organisation, ergonomics and collaboration tools integration

    NASA Astrophysics Data System (ADS)

    Benito Gonzélez López, José; Ferreira, José Pedro; Baron, Thomas


    While the remote collaboration services at CERN slowly aggregate around the Indico event management software, its new version which is the result of a careful maturation process includes improvements which will set a new reference in its domain. The presentation will focus on the description of the new features of the tool, the user feedback process which resulted in a new record of usability. We will also describe the interactions with the worldwide community of users and server administrators and the impact this has had on our development process, as well as the tools set in place to streamline the work between the different collaborating sites. A last part will be dedicated to the use of Indico as a central hub for operating other local services around the event organisation (registration epayment, audiovisual recording, webcast, room booking, and videoconference support)

  12. Integrated Seismic Event Detection and Location by Advanced Array Processing

    SciTech Connect

    Kvaerna, T; Gibbons, S J; Ringdal, F; Harris, D B


    The principal objective of this two-year study is to develop and test a new advanced, automatic approach to seismic detection/location using array processing. We address a strategy to obtain significantly improved precision in the location of low-magnitude events compared with current fully-automatic approaches, combined with a low false alarm rate. We have developed and evaluated a prototype automatic system which uses as a basis regional array processing with fixed, carefully calibrated, site-specific parameters in conjuction with improved automatic phase onset time estimation. We have in parallel developed tools for Matched Field Processing for optimized detection and source-region identification of seismic signals. This narrow-band procedure aims to mitigate some of the causes of difficulty encountered using the standard array processing system, specifically complicated source-time histories of seismic events and shortcomings in the plane-wave approximation for seismic phase arrivals at regional arrays.

  13. Stable high-copy-number integration of Aspergillus oryzae alpha-AMYLASE cDNA in an industrial baker's yeast strain.


    Nieto, A; Prieto, J A; Sanz, P


    The Aspergillus oryzae alpha-amylase cDNA was placed under the control of the Saccharomyces cerevisiae actin promoter (pACT1) and introduced into the ribosomal DNA locus of an industrial baker's yeast strain. To obtain a strain eligible for commercial use, we constructed an integrative cassette lacking bacterial DNA sequences but containing the alpha-amylase cDNA and ribosomal DNA sequences to target the integration to this locus. High-copy-number integrants were obtained including a defective TRP1d promoter in the integrative cassette. We selected one transformant, Rib-AMY (CECT10872), in which the multi-integrated sequences were stable even after 200 generations of growth in nonselective medium. This transformant also expressed and secreted high levels of alpha-amylase. Bread made with this strain had a higher volume, lower density, and softer crumbs than bread made with a control strain. The Rib-AMY transformant also was useful in retarding bread firming. This new strain fulfills all the requirements for commercial utilization and should reduce or eliminate the requirement for addition of exogenous alpha-amylase to the flour, reducing allergenic work-related symptoms due to this enzyme.

  14. Integration of mRNA expression profile, copy number alterations, and microRNA expression levels in breast cancer to improve grade definition.


    Cava, Claudia; Bertoli, Gloria; Ripamonti, Marilena; Mauri, Giancarlo; Zoppis, Italo; Della Rosa, Pasquale Anthony; Gilardi, Maria Carla; Castiglioni, Isabella


    Defining the aggressiveness and growth rate of a malignant cell population is a key step in the clinical approach to treating tumor disease. The correct grading of breast cancer (BC) is a fundamental part in determining the appropriate treatment. Biological variables can make it difficult to elucidate the mechanisms underlying BC development. To identify potential markers that can be used for BC classification, we analyzed mRNAs expression profiles, gene copy numbers, microRNAs expression and their association with tumor grade in BC microarray-derived datasets. From mRNA expression results, we found that grade 2 BC is most likely a mixture of grade 1 and grade 3 that have been misclassified, being described by the gene signature of either grade 1 or grade 3. We assessed the potential of the new approach of integrating mRNA expression profile, copy number alterations, and microRNA expression levels to select a limited number of genomic BC biomarkers. The combination of mRNA profile analysis and copy number data with microRNA expression levels led to the identification of two gene signatures of 42 and 4 altered genes (FOXM1, KPNA4, H2AFV and DDX19A) respectively, the latter obtained through a meta-analytical procedure. The 42-based gene signature identifies 4 classes of up- or down-regulated microRNAs (17 microRNAs) and of their 17 target mRNA, and the 4-based genes signature identified 4 microRNAs (Hsa-miR-320d, Hsa-miR-139-5p, Hsa-miR-567 and Hsa-let-7c). These results are discussed from a biological point of view with respect to pathological features of BC. Our identified mRNAs and microRNAs were validated as prognostic factors of BC disease progression, and could potentially facilitate the implementation of assays for laboratory validation, due to their reduced number. PMID:24866763

  15. Competency Based Competitive Events. Integrating DECA into the DE Instructional Program.

    ERIC Educational Resources Information Center

    Cosgrove, Glenna; Moore, Harold W.

    Designed to be integrated into a competency-based distributive education program, these competitive DECA (Distributive Education Clubs of America) events were developed, utilized, and evaluated by distributive education and cooperative education coordinators in Arkansas. These events are organized under the following occupational categories: food…

  16. Identification of Tf1 integration events in S. pombe under nonselective conditions.


    Cherry, Kristina E; Hearn, Willis E; Seshie, Osborne Y K; Singleton, Teresa L


    Integration of retroviral elements into the host genome is a phenomena observed among many classes of retroviruses. Much information concerning the integration of retroviral elements has been documented based on in vitro analysis or expression of selectable markers. To identify possible Tf1 integration events within silent regions of the Schizosaccharomyces pombe genome, we focused on performing an in vivo genome-wide analysis of Tf1 integration events from the nonselective phase of the retrotransposition assay. We analyzed 1000 individual colonies streaked from four independent Tf1 transposed patches under nonselection conditions. Our analysis detected a population of G418(S)/neo(+) Tf1 integration events that would have been overlooked during the selective phase of the assay. Further RNA analysis from the G418(S)/neo(+) clones revealed 50% of clones expressing the neo selectable marker. Our data reveals Tf1's ability to insert within silent regions of S. pombe's genome.

  17. Deciphering the Correlation between Breast Tumor Samples and Cell Lines by Integrating Copy Number Changes and Gene Expression Profiles.


    Sun, Yi; Liu, Qi


    Breast cancer is one of the most common cancers with high incident rate and high mortality rate worldwide. Although different breast cancer cell lines were widely used in laboratory investigations, accumulated evidences have indicated that genomic differences exist between cancer cell lines and tissue samples in the past decades. The abundant molecular profiles of cancer cell lines and tumor samples deposited in the Cancer Cell Line Encyclopedia and The Cancer Genome Atlas now allow a systematical comparison of the breast cancer cell lines with breast tumors. We depicted the genomic characteristics of breast primary tumors based on the copy number variation and gene expression profiles and the breast cancer cell lines were compared to different subgroups of breast tumors. We identified that some of the breast cancer cell lines show high correlation with the tumor group that agrees with previous knowledge, while a big part of them do not, including the most used MCF7, MDA-MB-231, and T-47D. We presented a computational framework to identify cell lines that mostly resemble a certain tumor group for the breast tumor study. Our investigation presents a useful guide to bridge the gap between cell lines and tumors and helps to select the most suitable cell line models for personalized cancer studies. PMID:26273658

  18. Single-Event Upset and Snapback in Silicon-on-Insulator Devices and Integrated Circuits

    SciTech Connect



    The characteristics Of ion-induced charge collection and single-event upset are studied in SOI transistors and circuits with various body tie structures. Impact ionization effects including single-event snapback are shown to be very important. Focused ion microbeam experiments are used to find single-event snapback drain voltage thresholds in n-channel SOI transistors as a function of device width. Three-Dimensional device simulations are used to determine single-event upset and snapback thresholds in SOI SRAMS, and to study design tradeoffs for various body-tie structures. A window of vulnerability to single-event snapback is shown to exist below the single-event upset threshold. The presence of single-event snapback in commercial SOI SRAMS is confirmed through broadbeam ion testing, and implications for hardness assurance testing of SOI integrated circuits are discussed.

  19. Conceptual Integration of Arithmetic Operations with Real-World Knowledge: Evidence from Event-Related Potentials

    ERIC Educational Resources Information Center

    Guthormsen, Amy M.; Fisher, Kristie J.; Bassok, Miriam; Osterhout, Lee; DeWolf, Melissa; Holyoak, Keith J.


    Research on language processing has shown that the disruption of conceptual integration gives rise to specific patterns of event-related brain potentials (ERPs)--N400 and P600 effects. Here, we report similar ERP effects when adults performed cross-domain conceptual integration of analogous semantic and mathematical relations. In a problem-solving…

  20. Integrating optical finger motion tracking with surface touch events

    PubMed Central

    MacRitchie, Jennifer; McPherson, Andrew P.


    This paper presents a method of integrating two contrasting sensor systems for studying human interaction with a mechanical system, using piano performance as the case study. Piano technique requires both precise small-scale motion of fingers on the key surfaces and planned large-scale movement of the hands and arms. Where studies of performance often focus on one of these scales in isolation, this paper investigates the relationship between them. Two sensor systems were installed on an acoustic grand piano: a monocular high-speed camera tracking the position of painted markers on the hands, and capacitive touch sensors attach to the key surfaces which measure the location of finger-key contacts. This paper highlights a method of fusing the data from these systems, including temporal and spatial alignment, segmentation into notes and automatic fingering annotation. Three case studies demonstrate the utility of the multi-sensor data: analysis of finger flexion or extension based on touch and camera marker location, timing analysis of finger-key contact preceding and following key presses, and characterization of individual finger movements in the transitions between successive key presses. Piano performance is the focus of this paper, but the sensor method could equally apply to other fine motor control scenarios, with applications to human-computer interaction. PMID:26082732

  1. Integrating optical finger motion tracking with surface touch events.


    MacRitchie, Jennifer; McPherson, Andrew P


    This paper presents a method of integrating two contrasting sensor systems for studying human interaction with a mechanical system, using piano performance as the case study. Piano technique requires both precise small-scale motion of fingers on the key surfaces and planned large-scale movement of the hands and arms. Where studies of performance often focus on one of these scales in isolation, this paper investigates the relationship between them. Two sensor systems were installed on an acoustic grand piano: a monocular high-speed camera tracking the position of painted markers on the hands, and capacitive touch sensors attach to the key surfaces which measure the location of finger-key contacts. This paper highlights a method of fusing the data from these systems, including temporal and spatial alignment, segmentation into notes and automatic fingering annotation. Three case studies demonstrate the utility of the multi-sensor data: analysis of finger flexion or extension based on touch and camera marker location, timing analysis of finger-key contact preceding and following key presses, and characterization of individual finger movements in the transitions between successive key presses. Piano performance is the focus of this paper, but the sensor method could equally apply to other fine motor control scenarios, with applications to human-computer interaction.

  2. Integrating optical finger motion tracking with surface touch events.


    MacRitchie, Jennifer; McPherson, Andrew P


    This paper presents a method of integrating two contrasting sensor systems for studying human interaction with a mechanical system, using piano performance as the case study. Piano technique requires both precise small-scale motion of fingers on the key surfaces and planned large-scale movement of the hands and arms. Where studies of performance often focus on one of these scales in isolation, this paper investigates the relationship between them. Two sensor systems were installed on an acoustic grand piano: a monocular high-speed camera tracking the position of painted markers on the hands, and capacitive touch sensors attach to the key surfaces which measure the location of finger-key contacts. This paper highlights a method of fusing the data from these systems, including temporal and spatial alignment, segmentation into notes and automatic fingering annotation. Three case studies demonstrate the utility of the multi-sensor data: analysis of finger flexion or extension based on touch and camera marker location, timing analysis of finger-key contact preceding and following key presses, and characterization of individual finger movements in the transitions between successive key presses. Piano performance is the focus of this paper, but the sensor method could equally apply to other fine motor control scenarios, with applications to human-computer interaction. PMID:26082732

  3. The single-event effect evaluation technology for nano integrated circuits

    NASA Astrophysics Data System (ADS)

    Hongchao, Zheng; Yuanfu, Zhao; Suge, Yue; Long, Fan; Shougang, Du; Maoxin, Chen; Chunqing, Yu


    Single-event effects of nano scale integrated circuits are investigated. Evaluation methods for single-event transients, single-event upsets, and single-event functional interrupts in nano circuits are summarized and classified in detail. The difficulties in SEE testing are discussed as well as the development direction of test technology, with emphasis placed on the experimental evaluation of a nano circuit under heavy ion, proton, and laser irradiation. The conclusions in this paper are based on many years of testing at accelerator facilities and our present understanding of the mechanisms for SEEs, which have been well verified experimentally.

  4. Evaluation of reactor vessel beltline integrity following unanticipated operating events: Final report

    SciTech Connect

    Gamble, R.M.


    The ASME Section XI Special Working Group on Operating Plant Criteria began in March 1983 to develop a simplified method for evaluating the severity of an unanticipated event that violated the pressure temperature limits in the Plant Technical Specifications. This report presents the technical bases for the ASME Code guidelines to determine if a reactor can be returned to normal operation following an unanticipated operating event. These guidelines include: (1) a screening criterion that can be used to quickly assess, without significant analysis, vessel integrity subsequent to an unanticipated transient, and (2) a general fracture mechanics evaluation procedure and acceptance criterion for detailed assessment of vessel integrity following a reactor transient. The results from this work have been placed into the ASME Code, Section XI as Paragraph IWB-3700, ''Analytical Evaluation of Plant Operating Events,'' which references nonmandatory Appendix E, ''Evaluation of Unanticipated Operating Events.''

  5. Integrated upstream parasitic event building architecture for BTeV level 1 pixel trigger system

    SciTech Connect

    Wu, Jin-Yuan; Wang, M.; Gottschalk, E.; Christian, D.; Li, X.; Shi, Z.; Pavlicek, V.; Cancelo, G.; /Fermilab


    Contemporary event building approaches use data switches, either homemade or commercial off-the-shelf ones, to merge data from different channels and distribute them among processor nodes. However, in many trigger and DAQ systems, the merging and distributing functions can often be performed in pre-processing stages. By carefully integrating these functions into the upstream pre-processing stages, the events can be built without dedicated switches. In addition to the cost reducing, extra benefits are gain when the event is built early upstream. In this document, an example of the integrated upstream parasitic event building architecture that has been studied for the BTeV level 1 pixel trigger system is described. Several design considerations that experimentalists of other projects might be interested in are also discussed.

  6. Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.


    Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing


    Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

  7. Event based self-supervised temporal integration for multimodal sensor data.


    Barakova, Emilia I; Lourens, Tino


    A method for synergistic integration of multimodal sensor data is proposed in this paper. This method is based on two aspects of the integration process: (1) achieving synergistic integration of two or more sensory modalities, and (2) fusing the various information streams at particular moments during processing. Inspired by psychophysical experiments, we propose a self-supervised learning method for achieving synergy with combined representations. Evidence from temporal registration and binding experiments indicates that different cues are processed individually at specific time intervals. Therefore, an event-based temporal co-occurrence principle is proposed for the integration process. This integration method was applied to a mobile robot exploring unfamiliar environments. Simulations showed that integration enhanced route recognition with many perceptual similarities; moreover, they indicate that a perceptual hierarchy of knowledge about instant movement contributes significantly to short-term navigation, but that visual perceptions have bigger impact over longer intervals.

  8. Event based self-supervised temporal integration for multimodal sensor data.


    Barakova, Emilia I; Lourens, Tino


    A method for synergistic integration of multimodal sensor data is proposed in this paper. This method is based on two aspects of the integration process: (1) achieving synergistic integration of two or more sensory modalities, and (2) fusing the various information streams at particular moments during processing. Inspired by psychophysical experiments, we propose a self-supervised learning method for achieving synergy with combined representations. Evidence from temporal registration and binding experiments indicates that different cues are processed individually at specific time intervals. Therefore, an event-based temporal co-occurrence principle is proposed for the integration process. This integration method was applied to a mobile robot exploring unfamiliar environments. Simulations showed that integration enhanced route recognition with many perceptual similarities; moreover, they indicate that a perceptual hierarchy of knowledge about instant movement contributes significantly to short-term navigation, but that visual perceptions have bigger impact over longer intervals. PMID:15988800

  9. Loss estimation of debris flow events in mountain areas - An integrated tool for local authorities

    NASA Astrophysics Data System (ADS)

    Papathoma-Koehle, M.; Zischg, A.; Fuchs, S.; Keiler, M.; Glade, T.


    Torrents prone to debris flows regularly cause extensive destruction of the built environment, loss of life stock, agricultural land and loss of life in mountain areas. Climate change may increase the frequency and intensity of such events. On the other hand, extensive development of mountain areas is expected to change the spatial pattern of elements at risk exposed and their vulnerability. Consequently, the costs of debris flow events are likely to increase in the coming years. Local authorities responsible for disaster risk reduction are in need of tools that may enable them to assess the future consequences of debris flow events, in particular with respect to the vulnerability of elements at risk. An integrated tool for loss estimation is presented here which is based on a newly developed vulnerability curve and which is applied in test sites in the Province of South Tyrol, Italy. The tool has a dual function: 1) continuous updating of the database regarding damages and process intensities that will eventually improve the existing vulnerability curve and 2) loss estimation of future events and hypothetical events or built environment scenarios by using the existing curve. The tool integrates the vulnerability curve together with new user friendly forms of damage documentation. The integrated tool presented here can be used by local authorities not only for the recording of damage caused by debris flows and the allocation of compensation to the owners of damaged buildings but also for land use planning, cost benefit analysis of structural protection measures and emergency planning.

  10. Event-Related Potential Indicators of Text Integration across Sentence Boundaries

    ERIC Educational Resources Information Center

    Yang, Chin Lung; Perfetti, Charles A.; Schmalhofer, Franz


    An event-related potentials (ERPs) study examined word-to-text integration processes across sentence boundaries. In a two-sentence passage, the accessibility of a referent for the first content word of the second sentence (the target word) was varied by the wording of the first sentence in one of the following ways: lexically (explicitly using…

  11. Acquired copy-neutral loss of heterozygosity of chromosome 1p as a molecular event associated with marrow fibrosis in MPL-mutated myeloproliferative neoplasms

    PubMed Central

    Pietra, Daniela; Guglielmelli, Paola; Bordoni, Roberta; Casetti, Ilaria; Milanesi, Chiara; Sant’Antonio, Emanuela; Ferretti, Virginia; Pancrazzi, Alessandro; Rotunno, Giada; Severgnini, Marco; Pietrelli, Alessandro; Astori, Cesare; Fugazza, Elena; Pascutto, Cristiana; Boveri, Emanuela; Passamonti, Francesco; De Bellis, Gianluca; Vannucchi, Alessandro; Cazzola, Mario


    We studied mutations of MPL exon 10 in patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF), first investigating a cohort of 892 consecutive patients. MPL mutation scanning was performed on granulocyte genomic DNA by using a high-resolution melt assay, and the mutant allele burden was evaluated by using deep sequencing. Somatic mutations of MPL, all but one involving codon W515, were detected in 26/661 (4%) patients with ET, 10/187 (5%) with PMF, and 7/44 (16%) patients with post-ET myelofibrosis. Comparison of JAK2 (V617F)–mutated and MPL-mutated patients showed only minor phenotypic differences. In an extended group of 62 MPL-mutated patients, the granulocyte mutant allele burden ranged from 1% to 95% and was significantly higher in patients with PMF or post-ET myelofibrosis compared with those with ET. Patients with higher mutation burdens had evidence of acquired copy-neutral loss of heterozygosity (CN-LOH) of chromosome 1p in granulocytes, consistent with a transition from heterozygosity to homozygosity for the MPL mutation in clonal cells. A significant association was found between MPL-mutant allele burden greater than 50% and marrow fibrosis. These observations suggest that acquired CN-LOH of chromosome 1p involving the MPL location may represent a molecular mechanism of fibrotic transformation in MPL-mutated myeloproliferative neoplasms. PMID:23575445

  12. Novel Candidate Key Drivers in the Integrative Network of Genes, MicroRNAs, Methylations, and Copy Number Variations in Squamous Cell Lung Carcinoma

    PubMed Central

    Cai, Yu-dong


    The mechanisms of lung cancer are highly complex. Not only mRNA gene expression but also microRNAs, DNA methylation, and copy number variation (CNV) play roles in tumorigenesis. It is difficult to incorporate so much information into a single model that can comprehensively reflect all these lung cancer mechanisms. In this study, we analyzed the 129 TCGA (The Cancer Genome Atlas) squamous cell lung carcinoma samples with gene expression, microRNA expression, DNA methylation, and CNV data. First, we used variance inflation factor (VIF) regression to build the whole genome integrative network. Then, we isolated the lung cancer subnetwork by identifying the known lung cancer genes and their direct regulators. This subnetwork was refined by the Bayesian method, and the directed regulations among mRNA genes, microRNAs, methylations, and CNVs were obtained. The novel candidate key drivers in this refined subnetwork, such as the methylation of ARHGDIB and HOXD3, microRNA let-7a and miR-31, and the CNV of AGAP2, were identified and analyzed. On three large public available lung cancer datasets, the key drivers ARHGDIB and HOXD3 demonstrated significant associations with the overall survival of lung cancer patients. Our results provide new insights into lung cancer mechanisms. PMID:25802847

  13. Rare Copy Number Variants

    PubMed Central

    Grozeva, Detelina; Kirov, George; Ivanov, Dobril; Jones, Ian R.; Jones, Lisa; Green, Elaine K.; St Clair, David M.; Young, Allan H.; Ferrier, Nicol; Farmer, Anne E.; McGuffin, Peter; Holmans, Peter A.; Owen, Michael J.; O’Donovan, Michael C.; Craddock, Nick


    Context Recent studies suggest that copy number variation in the human genome is extensive and may play an important role in susceptibility to disease, including neuropsychiatric disorders such as schizophrenia and autism. The possible involvement of copy number variants (CNVs) in bipolar disorder has received little attention to date. Objectives To determine whether large (>100 000 base pairs) and rare (found in <1% of the population) CNVs are associated with susceptibility to bipolar disorder and to compare with findings in schizophrenia. Design A genome-wide survey of large, rare CNVs in a case-control sample using a high-density microarray. Setting The Wellcome Trust Case Control Consortium. Participants There were 1697 cases of bipolar disorder and 2806 nonpsychiatric controls. All participants were white UK residents. Main Outcome Measures Overall load of CNVs and presence of rare CNVs. Results The burden of CNVs in bipolar disorder was not increased compared with controls and was significantly less than in schizophrenia cases. The CNVs previously implicated in the etiology of schizophrenia were not more common in cases with bipolar disorder. Conclusions Schizophrenia and bipolar disorder differ with respect to CNV burden in general and association with specific CNVs in particular. Our data are consistent with the possibility that possession of large, rare deletions may modify the phenotype in those at risk of psychosis: those possessing such events are more likely to be diagnosed as having schizophrenia, and those without them are more likely to be diagnosed as having bipolar disorder. PMID:20368508

  14. Motivation and intention to integrate physical activity into daily school life: the JAM World Record event.


    Vazou, Spyridoula; Vlachopoulos, Symeon P


    Research on the motivation of stakeholders to integrate physical activity into daily school life is limited. The purpose was to examine the motivation of stakeholders to participate in a world record physical activity event and whether motivation was associated with future intention to use activity breaks during the daily school life and future participation in a similar event. After the 2012 JAM (Just-a-Minute) World Record event, 686 adults (591 women; 76.1% participated for children <10 years) completed measures of motivational regulations and future intention to (a) use the activity breaks and (b) participate in the event. High intrinsic motivation and low extrinsic motivation and amotivation for participation in the next event were reported. Hierarchical regression analysis, controlling for age, gender, and occupation, showed that intrinsic forms of motivation positively predicted, whereas amotivation negatively predicted, future intention to participate in the event and use the activity breaks. Multivariate analyses of variance revealed that school-related participants were more intrinsically motivated and intended to use the activity breaks and repeat the event more than those who were not affiliated with a school. Nonschool participants reported higher extrinsic motivation and amotivation than school-related participants. PMID:25001232

  15. Motivation and intention to integrate physical activity into daily school life: the JAM World Record event.


    Vazou, Spyridoula; Vlachopoulos, Symeon P


    Research on the motivation of stakeholders to integrate physical activity into daily school life is limited. The purpose was to examine the motivation of stakeholders to participate in a world record physical activity event and whether motivation was associated with future intention to use activity breaks during the daily school life and future participation in a similar event. After the 2012 JAM (Just-a-Minute) World Record event, 686 adults (591 women; 76.1% participated for children <10 years) completed measures of motivational regulations and future intention to (a) use the activity breaks and (b) participate in the event. High intrinsic motivation and low extrinsic motivation and amotivation for participation in the next event were reported. Hierarchical regression analysis, controlling for age, gender, and occupation, showed that intrinsic forms of motivation positively predicted, whereas amotivation negatively predicted, future intention to participate in the event and use the activity breaks. Multivariate analyses of variance revealed that school-related participants were more intrinsically motivated and intended to use the activity breaks and repeat the event more than those who were not affiliated with a school. Nonschool participants reported higher extrinsic motivation and amotivation than school-related participants.

  16. Asymptotic Effectiveness of the Event-Based Sampling according to the Integral Criterion

    PubMed Central

    Miskowicz, Marek


    A rapid progress in intelligent sensing technology creates new interest in a development of analysis and design of non-conventional sampling schemes. The investigation of the event-based sampling according to the integral criterion is presented in this paper. The investigated sampling scheme is an extension of the pure linear send-on-delta/level-crossing algorithm utilized for reporting the state of objects monitored by intelligent sensors. The motivation of using the event-based integral sampling is outlined. The related works in adaptive sampling are summarized. The analytical closed-form formulas for the evaluation of the mean rate of event-based traffic, and the asymptotic integral sampling effectiveness, are derived. The simulation results verifying the analytical formulas are reported. The effectiveness of the integral sampling is compared with the related linear send-on-delta/level-crossing scheme. The calculation of the asymptotic effectiveness for common signals, which model the state evolution of dynamic systems in time, is exemplified.

  17. Neural bases of event knowledge and syntax integration in comprehension of complex sentences.


    Malaia, Evie; Newman, Sharlene


    Comprehension of complex sentences is necessarily supported by both syntactic and semantic knowledge, but what linguistic factors trigger a readers' reliance on a specific system? This functional neuroimaging study orthogonally manipulated argument plausibility and verb event type to investigate cortical bases of the semantic effect on argument comprehension during reading. The data suggest that telic verbs facilitate online processing by means of consolidating the event schemas in episodic memory and by easing the computation of syntactico-thematic hierarchies in the left inferior frontal gyrus. The results demonstrate that syntax-semantics integration relies on trade-offs among a distributed network of regions for maximum comprehension efficiency.

  18. Integral-based event triggering controller design for stochastic LTI systems via convex optimisation

    NASA Astrophysics Data System (ADS)

    Mousavi, S. H.; Marquez, H. J.


    The presence of measurement noise in the event-based systems can lower system efficiency both in terms of data exchange rate and performance. In this paper, an integral-based event triggering control system is proposed for LTI systems with stochastic measurement noise. We show that the new mechanism is robust against noise and effectively reduces the flow of communication between plant and controller, and also improves output performance. Using a Lyapunov approach, stability in the mean square sense is proved. A simulated example illustrates the properties of our approach.

  19. An integrated logit model for contamination event detection in water distribution systems.


    Housh, Mashor; Ostfeld, Avi


    The problem of contamination event detection in water distribution systems has become one of the most challenging research topics in water distribution systems analysis. Current attempts for event detection utilize a variety of approaches including statistical, heuristics, machine learning, and optimization methods. Several existing event detection systems share a common feature in which alarms are obtained separately for each of the water quality indicators. Unifying those single alarms from different indicators is usually performed by means of simple heuristics. A salient feature of the current developed approach is using a statistically oriented model for discrete choice prediction which is estimated using the maximum likelihood method for integrating the single alarms. The discrete choice model is jointly calibrated with other components of the event detection system framework in a training data set using genetic algorithms. The fusing process of each indicator probabilities, which is left out of focus in many existing event detection system models, is confirmed to be a crucial part of the system which could be modelled by exploiting a discrete choice model for improving its performance. The developed methodology is tested on real water quality data, showing improved performances in decreasing the number of false positive alarms and in its ability to detect events with higher probabilities, compared to previous studies.

  20. Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.


    Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing


    Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.

  1. An integrative process model of leadership: examining loci, mechanisms, and event cycles.


    Eberly, Marion B; Johnson, Michael D; Hernandez, Morela; Avolio, Bruce J


    Utilizing the locus (source) and mechanism (transmission) of leadership framework (Hernandez, Eberly, Avolio, & Johnson, 2011), we propose and examine the application of an integrative process model of leadership to help determine the psychological interactive processes that constitute leadership. In particular, we identify the various dynamics involved in generating leadership processes by modeling how the loci and mechanisms interact through a series of leadership event cycles. We discuss the major implications of this model for advancing an integrative understanding of what constitutes leadership and its current and future impact on the field of psychological theory, research, and practice.

  2. Increased Frequency of De Novo Copy Number Variations in Congenital Heart Disease by Integrative Analysis of SNP Array and Exome Sequence Data

    PubMed Central

    Rodriguez-Murillo, Laura; Fromer, Menachem; Mazaika, Erica; Vardarajan, Badri; Italia, Michael; Leipzig, Jeremy; DePalma, Steven R.; Golhar, Ryan; Sanders, Stephan J.; Yamrom, Boris; Ronemus, Michael; Iossifov, Ivan; Willsey, A. Jeremy; State, Matthew W.; Kaltman, Jonathan R.; White, Peter S.; Shen, Yufeng; Warburton, Dorothy; Brueckner, Martina; Seidman, Christine; Goldmuntz, Elizabeth; Gelb, Bruce D.; Lifton, Richard; Seidman, Jonathan; Hakonarson, Hakon; Chung, Wendy K.


    Rationale Congenital heart disease (CHD) is among the most common birth defects. Most cases are of unknown etiology. Objective To determine the contribution of de novo copy number variants (CNVs) in the etiology of sporadic CHD. Methods and Results We studied 538 CHD trios using genome-wide dense single nucleotide polymorphism (SNP) arrays and/or whole exome sequencing (WES). Results were experimentally validated using digital droplet PCR. We compared validated CNVs in CHD cases to CNVs in 1,301 healthy control trios. The two complementary high-resolution technologies identified 63 validated de novo CNVs in 51 CHD cases. A significant increase in CNV burden was observed when comparing CHD trios with healthy trios, using either SNP array (p=7x10−5, Odds Ratio (OR)=4.6) or WES data (p=6x10−4, OR=3.5) and remained after removing 16% of de novo CNV loci previously reported as pathogenic (p=0.02, OR=2.7). We observed recurrent de novo CNVs on 15q11.2 encompassing CYFIP1, NIPA1, and NIPA2 and single de novo CNVs encompassing DUSP1, JUN, JUP, MED15, MED9, PTPRE SREBF1, TOP2A, and ZEB2, genes that interact with established CHD proteins NKX2-5 and GATA4. Integrating de novo variants in WES and CNV data suggests that ETS1 is the pathogenic gene altered by 11q24.2-q25 deletions in Jacobsen syndrome and that CTBP2 is the pathogenic gene in 10q sub-telomeric deletions. Conclusions We demonstrate a significantly increased frequency of rare de novo CNVs in CHD patients compared with healthy controls and suggest several novel genetic loci for CHD. PMID:25205790

  3. Optimized breeding strategies for multiple trait integration: II. Process efficiency in event pyramiding and trait fixation.


    Peng, Ting; Sun, Xiaochun; Mumm, Rita H


    Multiple trait integration (MTI) is a multi-step process of converting an elite variety/hybrid for value-added traits (e.g. transgenic events) through backcross breeding. From a breeding standpoint, MTI involves four steps: single event introgression, event pyramiding, trait fixation, and version testing. This study explores the feasibility of marker-aided backcross conversion of a target maize hybrid for 15 transgenic events in the light of the overall goal of MTI of recovering equivalent performance in the finished hybrid conversion along with reliable expression of the value-added traits. Using the results to optimize single event introgression (Peng et al. Optimized breeding strategies for multiple trait integration: I. Minimizing linkage drag in single event introgression. Mol Breed, 2013) which produced single event conversions of recurrent parents (RPs) with ≤8 cM of residual non-recurrent parent (NRP) germplasm with ~1 cM of NRP germplasm in the 20 cM regions flanking the event, this study focused on optimizing process efficiency in the second and third steps in MTI: event pyramiding and trait fixation. Using computer simulation and probability theory, we aimed to (1) fit an optimal breeding strategy for pyramiding of eight events into the female RP and seven in the male RP, and (2) identify optimal breeding strategies for trait fixation to create a 'finished' conversion of each RP homozygous for all events. In addition, next-generation seed needs were taken into account for a practical approach to process efficiency. Building on work by Ishii and Yonezawa (Optimization of the marker-based procedures for pyramiding genes from multiple donor lines: I. Schedule of crossing between the donor lines. Crop Sci 47:537-546, 2007a), a symmetric crossing schedule for event pyramiding was devised for stacking eight (seven) events in a given RP. Options for trait fixation breeding strategies considered selfing and doubled haploid approaches to achieve homozygosity

  4. 37 CFR 1.13 - Copies and certified copies.

    Code of Federal Regulations, 2010 CFR


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Copies and certified copies... Patent and Trademark Office § 1.13 Copies and certified copies. (a) Non-certified copies of patents, and... States Patent and Trademark Office to any person, and copies of other records or papers will be...

  5. 37 CFR 2.201 - Copies and certified copies.

    Code of Federal Regulations, 2010 CFR


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Copies and certified copies... Trademark Office § 2.201 Copies and certified copies. (a) Non-certified copies of trademark registrations... appropriate fee required by § 2.6. (b) Certified copies of trademark registrations and of any...

  6. How Distance Affects Semantic Integration in Discourse: Evidence from Event-Related Potentials

    PubMed Central

    Yang, Xiaohong; Chen, Shuang; Chen, Xuhai; Yang, Yufang


    Event-related potentials were used to investigate whether semantic integration in discourse is influenced by the number of intervening sentences between the endpoints of integration. Readers read discourses in which the last sentence contained a critical word that was either congruent or incongruent with the information introduced in the first sentence. Furthermore, for the short discourses, the first and last sentence were intervened by only one sentence while for the long discourses, they were intervened by three sentences. We found that the incongruent words elicited an N400 effect for both the short and long discourses. However, a P600 effect was only observed for the long discourses, but not for the short ones. These results suggest that although readers can successfully integrate upcoming words into the existing discourse representation, the effort required for this integration process is modulated by the number of intervening sentences. Thus, discourse distance as measured by the number of intervening sentences should be taken as an important factor for semantic integration in discourse. PMID:26569606

  7. How Distance Affects Semantic Integration in Discourse: Evidence from Event-Related Potentials.


    Yang, Xiaohong; Chen, Shuang; Chen, Xuhai; Yang, Yufang


    Event-related potentials were used to investigate whether semantic integration in discourse is influenced by the number of intervening sentences between the endpoints of integration. Readers read discourses in which the last sentence contained a critical word that was either congruent or incongruent with the information introduced in the first sentence. Furthermore, for the short discourses, the first and last sentence were intervened by only one sentence while for the long discourses, they were intervened by three sentences. We found that the incongruent words elicited an N400 effect for both the short and long discourses. However, a P600 effect was only observed for the long discourses, but not for the short ones. These results suggest that although readers can successfully integrate upcoming words into the existing discourse representation, the effort required for this integration process is modulated by the number of intervening sentences. Thus, discourse distance as measured by the number of intervening sentences should be taken as an important factor for semantic integration in discourse.

  8. Mines Systems Safety Improvement Using an Integrated Event Tree and Fault Tree Analysis

    NASA Astrophysics Data System (ADS)

    Kumar, Ranjan; Ghosh, Achyuta Krishna


    Mines systems such as ventilation system, strata support system, flame proof safety equipment, are exposed to dynamic operational conditions such as stress, humidity, dust, temperature, etc., and safety improvement of such systems can be done preferably during planning and design stage. However, the existing safety analysis methods do not handle the accident initiation and progression of mine systems explicitly. To bridge this gap, this paper presents an integrated Event Tree (ET) and Fault Tree (FT) approach for safety analysis and improvement of mine systems design. This approach includes ET and FT modeling coupled with redundancy allocation technique. In this method, a concept of top hazard probability is introduced for identifying system failure probability and redundancy is allocated to the system either at component or system level. A case study on mine methane explosion safety with two initiating events is performed. The results demonstrate that the presented method can reveal the accident scenarios and improve the safety of complex mine systems simultaneously.

  9. Reprogrammable field programmable gate array with integrated system for mitigating effects of single event upsets

    NASA Technical Reports Server (NTRS)

    Ng, Tak-kwong (Inventor); Herath, Jeffrey A. (Inventor)


    An integrated system mitigates the effects of a single event upset (SEU) on a reprogrammable field programmable gate array (RFPGA). The system includes (i) a RFPGA having an internal configuration memory, and (ii) a memory for storing a configuration associated with the RFPGA. Logic circuitry programmed into the RFPGA and coupled to the memory reloads a portion of the configuration from the memory into the RFPGA's internal configuration memory at predetermined times. Additional SEU mitigation can be provided by logic circuitry on the RFPGA that monitors and maintains synchronized operation of the RFPGA's digital clock managers.

  10. Impact of induced seismic events on seal integrity, Texas Gulf Coast

    SciTech Connect

    Nicot, Jean-Philippe; Meckel, Timothy A.; Carr, David A.; Oldenburg, Curtis M.


    Recent publications have suggested that large-scale CO2 injection could trigger earthquakes and that even small- to moderate-sized earthquakes may threaten the seal integrity of the injection zone, and potentially damage buildings and other surface structures. In this study, we compared seal thickness to estimated fault displacement due to a single hypothetical seismic event in a selected area of the Texas Gulf Coast comprising an offshore strip of state waters along two Texas counties. To evaluate the slip generated by a single seismic event, we compiled well log information on shale/sand sequences and seismic information on fault geometric characteristics of a section of Lower Miocene age. The section is thousands of feet thick and is overlain and underlain by marine shales (Amph. B and Anahuac, respectively) that are relatively easy to correlate between wells. The Amph. B. shale is the secondary and ultimate seal for all injection intervals in the Lower Miocene. Given its thickness, no realistic seismic event or small series of seismic events will offset it significantly. However, this may not be true of smaller local primary seals. An analysis of geophysical logs of a total of 71 wells yielded a total of 2,871 sand / shale binary intervals. An analysis of the dedicated 3D seismic survey counted 723 fault traces at five roughly horizontal horizons within the Lower Miocene Fault displacement estimated using the product of the fault length times an uncertain multiplier coefficient assumed to follow a triangular distribution with a 10-3 to 10-5 range and a mode of 8 × 10-5. We then compared estimated single-event fault displacements to seal thicknesses by means of a Monte-Carlo analysis. Only 1.8% of thickness/displacement pairs display a displacement greater than 20% of the seal thickness. Only 0.26% of the pairs result in a displacement of half the seal thickness and only 0.05% of thickness/displacement pairs result in

  11. Impact of induced seismic events on seal integrity, Texas Gulf Coast


    Nicot, Jean-Philippe; Meckel, Timothy A.; Carr, David A.; Oldenburg, Curtis M.


    Recent publications have suggested that large-scale CO2 injection could trigger earthquakes and that even small- to moderate-sized earthquakes may threaten the seal integrity of the injection zone, and potentially damage buildings and other surface structures. In this study, we compared seal thickness to estimated fault displacement due to a single hypothetical seismic event in a selected area of the Texas Gulf Coast comprising an offshore strip of state waters along two Texas counties. To evaluate the slip generated by a single seismic event, we compiled well log information on shale/sand sequences and seismic information on fault geometric characteristics of amore » section of Lower Miocene age. The section is thousands of feet thick and is overlain and underlain by marine shales (Amph. B and Anahuac, respectively) that are relatively easy to correlate between wells. The Amph. B. shale is the secondary and ultimate seal for all injection intervals in the Lower Miocene. Given its thickness, no realistic seismic event or small series of seismic events will offset it significantly. However, this may not be true of smaller local primary seals. An analysis of geophysical logs of a total of 71 wells yielded a total of 2,871 sand / shale binary intervals. An analysis of the dedicated 3D seismic survey counted 723 fault traces at five roughly horizontal horizons within the Lower Miocene Fault displacement estimated using the product of the fault length times an uncertain multiplier coefficient assumed to follow a triangular distribution with a 10-3 to 10-5 range and a mode of 8 × 10-5. We then compared estimated single-event fault displacements to seal thicknesses by means of a Monte-Carlo analysis. Only 1.8% of thickness/displacement pairs display a displacement greater than 20% of the seal thickness. Only 0.26% of the pairs result in a displacement of half the seal thickness and only 0.05% of thickness/displacement pairs result in a clear seal rupture. The next step

  12. Integrating the Meaning of Person Names into Discourse Context: An Event-Related Potential Study

    PubMed Central

    Wang, Lin; Yang, Yufang


    The meaning of person names is determined by their associated information. This study used event related potentials to investigate the time course of integrating the newly constructed meaning of person names into discourse context. The meaning of person names was built by two-sentence descriptions of the names. Then we manipulated the congruence of person names relative to discourse context in a way that the meaning of person names either matched or did not match the previous context. ERPs elicited by the names were compared between the congruent and the incongruent conditions. We found that the incongruent names elicited a larger N400 as well as a larger P600 compared to the congruent names. The results suggest that the meaning of unknown names can be effectively constructed from short linguistic descriptions and that the established meaning can be rapidly retrieved and integrated into contexts. PMID:24349462

  13. Heavy-ion induced single-event upset in integrated circuits

    NASA Technical Reports Server (NTRS)

    Zoutendyk, J. A.


    The cosmic ray environment in space can affect the operation of Integrated Circuit (IC) devices via the phenomenon of Single Event Upset (SEU). In particular, heavy ions passing through an IC can induce sufficient integrated current (charge) to alter the state of a bistable circuit, for example a memory cell. The SEU effect is studied in great detail in both static and dynamic memory devices, as well as microprocessors fabricated from bipolar, Complementary Metal Oxide Semiconductor (CMOS) and N channel Metal Oxide Semiconductor (NMOS) technologies. Each device/process reflects its individual characteristics (minimum scale geometry/process parameters) via a unique response to the direct ionization of electron hole pairs by heavy ion tracks. A summary of these analytical and experimental SEU investigations is presented.

  14. Copy-left and Copy-right

    NASA Astrophysics Data System (ADS)

    VanderPlas, Jacob


    Any discussion of open licensing almost invariably devolves into a debate between copy-left licenses and permissive licenses, both sides defending their views with a nearly religious fervor. Copy-left licenses, typified by the GPL family of licenses, require all derived products to maintain the open, GPL license. Permissive licenses, typified by the BSD family of licenses, do not impose such requirements. I'll briefly explore the common arguments put forth in favor of either approach, and discuss some concrete examples of where these approaches have helped or hindered the software packages that used them.

  15. INTEGRAL upper limits on gamma-ray emission associated with the gravitational wave event GW150914

    NASA Astrophysics Data System (ADS)

    Savchenko, Volodymyr; Ferrigno, Carlo; Mereghetti, Sandro; Natalucci, Lorenzo; Bazzano, Angela; Bozzo, Enrico; Courvoisier, Thierry J.-L.; Brandt, Soren; Hanlon, Lorraine; Kuulkers, Erik; Laurent, Philippe; Lebrun, François; Roques, Jean-Pierre; Ubertini, Pietro; Weidenspointner, Georg


    Using observations of the INTErnational Gamma-Ray Astrophysics Laboratory (INTEGRAL), we put tight upper limits on the gamma-ray and hard X-ray prompt emission associated with the gravitational wave event GW150914, discovered by the LIGO/Virgo collaboration. The omni-directional view of the INTEGRAL/SPI-ACS has allowed us to constrain the fraction of energy emitted in the hard X-ray electromagnetic component for the full high-probability sky region of LIGO/Virgo trigger. Our upper limits on the hard X-ray fluence at the time of the event range from Fγ=2x10-8 erg cm-2 to Fγ=10-6 erg cm-2 in the 75 keV - 2 MeV energy range for typical spectral models. Our results constrain the ratio of the energy promptly released in gamma-rays in the direction of the observer to the gravitational wave energy Eγ/EGW<10-6. We discuss the implication of gamma-ray limits on the characteristics of the gravitational wave source, based on the available predictions for prompt electromagnetic emission.

  16. INTEGRAL upper limits on gamma-ray emission associated with the gravitational wave event GW150914

    NASA Astrophysics Data System (ADS)

    Savchenko, V.; Ferrigno, C.; Mereghetti, S.; Natalucci, L.; Kuulkers, E.


    Using observations of the INTErnational Gamma-Ray Astrophysics Laboratory (INTEGRAL), we put tight upper limits on the gamma-ray and hard X-ray prompt emission associated with the gravitational wave event GW150914, discovered by the LIGO/Virgo collaboration. The omni-directional view of the INTEGRAL/SPI-ACS has allowed us to constrain the fraction of energy emitted in the hard X-ray electromagnetic component for the full high-probability sky region of LIGO/Virgo trigger. Our upper limits on the hard X-ray fluence at the time of the event range from F_{γ}=2 × 10^{-8} erg cm^{-2} to F_{γ}=10^{-6} erg cm^{-2} in the 75 keV - 2 MeV energy range for typical spectral models. Our results constrain the ratio of the energy promptly released in gamma-rays in the direction of the observer to the gravitational wave energy E_γ/E_{GW}<10^{-6}. We discuss the implication of gamma-ray limits on the characteristics of the gravitational wave source, based on the available predictions for prompt electromagnetic emission. This work has been possible thanks to a Memorandum of Understanding with the LIGO-Virgo scientific collaboration and is presented on behalf of a larger collaboration.

  17. Analysis of Severe Weather Events by Integration of Civil Protection Operation Data

    NASA Astrophysics Data System (ADS)

    Heisterkamp, Tobias; Kox, Thomas


    In Germany, winter storms belong to those natural hazards responsible for the largest damages (GDV 2014). This is a huge challenge for the civil protection, especially in metropolitan areas like Berlin. Nowadays, large-scale storm events are generally well predictable, but detailed forecasts on urban district or even street level are still out of range. Fire brigades, as major stakeholder covering severe weather consequences, operate on this small scale and in the whole area due to their juris-diction. For forensic investigation of disasters this presentation offers an additional approach by using the documentation of fire brigade operations as a new data source. Hazard dimensions and conse-quences of severe weather events are reconstructed via GIS-based analyses of these operations. Local case studies of recent storms are used as a comparison and as an additional information to three WMO weather stations in Berlin. Thus, hot spots of these selected events can be identified by operation site accumulations. Further indicators for Berlin are added to detect aspects that de-termine vulnerabilities. The conclusion discusses the potential of this approach as well as possible benefits of integration into warning systems.

  18. Replication protein A safeguards genome integrity by controlling NER incision events

    PubMed Central

    Overmeer, René M.; Moser, Jill; Volker, Marcel; Kool, Hanneke; Tomkinson, Alan E.; van Zeeland, Albert A.


    Single-stranded DNA gaps that might arise by futile repair processes can lead to mutagenic events and challenge genome integrity. Nucleotide excision repair (NER) is an evolutionarily conserved repair mechanism, essential for removal of helix-distorting DNA lesions. In the currently prevailing model, NER operates through coordinated assembly of repair factors into pre- and post-incision complexes; however, its regulation in vivo is poorly understood. Notably, the transition from dual incision to repair synthesis should be rigidly synchronized as it might lead to accumulation of unprocessed repair intermediates. We monitored NER regulatory events in vivo using sequential UV irradiations. Under conditions that allow incision yet prevent completion of repair synthesis or ligation, preincision factors can reassociate with new damage sites. In contrast, replication protein A remains at the incomplete NER sites and regulates a feedback loop from completion of DNA repair synthesis to subsequent damage recognition, independently of ATR signaling. Our data reveal an important function for replication protein A in averting further generation of DNA strand breaks that could lead to mutagenic and recombinogenic events. PMID:21282463

  19. Effects of Sound Frequency on Audiovisual Integration: An Event-Related Potential Study.


    Yang, Weiping; Yang, Jingjing; Gao, Yulin; Tang, Xiaoyu; Ren, Yanna; Takahashi, Satoshi; Wu, Jinglong


    A combination of signals across modalities can facilitate sensory perception. The audiovisual facilitative effect strongly depends on the features of the stimulus. Here, we investigated how sound frequency, which is one of basic features of an auditory signal, modulates audiovisual integration. In this study, the task of the participant was to respond to a visual target stimulus by pressing a key while ignoring auditory stimuli, comprising of tones of different frequencies (0.5, 1, 2.5 and 5 kHz). A significant facilitation of reaction times was obtained following audiovisual stimulation, irrespective of whether the task-irrelevant sounds were low or high frequency. Using event-related potential (ERP), audiovisual integration was found over the occipital area for 0.5 kHz auditory stimuli from 190-210 ms, for 1 kHz stimuli from 170-200 ms, for 2.5 kHz stimuli from 140-200 ms, 5 kHz stimuli from 100-200 ms. These findings suggest that a higher frequency sound signal paired with visual stimuli might be early processed or integrated despite the auditory stimuli being task-irrelevant information. Furthermore, audiovisual integration in late latency (300-340 ms) ERPs with fronto-central topography was found for auditory stimuli of lower frequencies (0.5, 1 and 2.5 kHz). Our results confirmed that audiovisual integration is affected by the frequency of an auditory stimulus. Taken together, the neurophysiological results provide unique insight into how the brain processes a multisensory visual signal and auditory stimuli of different frequencies.

  20. Effects of Sound Frequency on Audiovisual Integration: An Event-Related Potential Study.


    Yang, Weiping; Yang, Jingjing; Gao, Yulin; Tang, Xiaoyu; Ren, Yanna; Takahashi, Satoshi; Wu, Jinglong


    A combination of signals across modalities can facilitate sensory perception. The audiovisual facilitative effect strongly depends on the features of the stimulus. Here, we investigated how sound frequency, which is one of basic features of an auditory signal, modulates audiovisual integration. In this study, the task of the participant was to respond to a visual target stimulus by pressing a key while ignoring auditory stimuli, comprising of tones of different frequencies (0.5, 1, 2.5 and 5 kHz). A significant facilitation of reaction times was obtained following audiovisual stimulation, irrespective of whether the task-irrelevant sounds were low or high frequency. Using event-related potential (ERP), audiovisual integration was found over the occipital area for 0.5 kHz auditory stimuli from 190-210 ms, for 1 kHz stimuli from 170-200 ms, for 2.5 kHz stimuli from 140-200 ms, 5 kHz stimuli from 100-200 ms. These findings suggest that a higher frequency sound signal paired with visual stimuli might be early processed or integrated despite the auditory stimuli being task-irrelevant information. Furthermore, audiovisual integration in late latency (300-340 ms) ERPs with fronto-central topography was found for auditory stimuli of lower frequencies (0.5, 1 and 2.5 kHz). Our results confirmed that audiovisual integration is affected by the frequency of an auditory stimulus. Taken together, the neurophysiological results provide unique insight into how the brain processes a multisensory visual signal and auditory stimuli of different frequencies. PMID:26384256

  1. 7 CFR 97.179 - Copies and certified copies.

    Code of Federal Regulations, 2010 CFR


    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Copies and certified copies. 97.179 Section 97.179... PLANT VARIETY AND PROTECTION Fees and Charges § 97.179 Copies and certified copies. (a) Upon request, copies of applications, certificates, or of any records, books, papers, drawings, or photographs in...

  2. An event-related potential examination of contour integration deficits in schizophrenia.


    Butler, Pamela D; Abeles, Ilana Y; Silverstein, Steven M; Dias, Elisa C; Weiskopf, Nicole G; Calderone, Daniel J; Sehatpour, Pejman


    Perceptual organization, which refers to the ability to integrate fragments of stimuli to form a representation of a whole edge, part, or object, is impaired in schizophrenia. A contour integration paradigm, involving detection of a set of Gabor patches forming an oval contour pointing to the right or left embedded in a field of randomly oriented Gabors, has been developed for use in clinical trials of schizophrenia. The purpose of the present study was to assess contributions of early and later stages of processing to deficits in contour integration, as well as to develop an event-related potential (ERP) analog of this task. Twenty-one patients with schizophrenia and 28 controls participated. The Gabor elements forming the contours were given a low or high degree of orientational jitter, making it either easy or difficult to identify the direction in which the contour was pointing. ERP results showed greater negative peaks at ~165 (N1 component) and ~270 ms for the low-jitter versus the high-jitter contours, with a much greater difference between jitter conditions at 270 ms. This later ERP component was previously termed Ncl for closure negativity. Source localization identified the Ncl in the lateral occipital object recognition area. Patients showed a significant decrease in the Ncl, but not N1, compared to controls, and this was associated with impaired behavioral ability to identify contours. In addition, an earlier negative peak was found at ~120 ms (termed N120) that differentiated jitter conditions, had a dorsal stream source, and differed between patients and controls. Patients also showed a deficit in the dorsal stream sensory P1 component. These results are in accord with impairments in distributed circuitry contributing to perceptual organization deficits and provide an ERP analog to the behavioral contour integration task.

  3. A prediction technique for single-event effects on complex integrated circuits

    NASA Astrophysics Data System (ADS)

    Yuanfu, Zhao; Chunqing, Yu; Long, Fan; Suge, Yue; Maoxin, Chen; Shougang, Du; Hongchao, Zheng


    The sensitivity of complex integrated circuits to single-event effects is investigated. Sensitivity depends not only on the cross section of physical modules but also on the behavior of data patterns running on the system. A method dividing the main functional modules is proposed. The intrinsic cross section and the duty cycles of different sensitive modules are obtained during the execution of data patterns. A method for extracting the duty cycle is presented and a set of test patterns with different duty cycles are implemented experimentally. By combining the intrinsic cross section and the duty cycle of different sensitive modules, a universal method to predict SEE sensitivities of different test patterns is proposed, which is verified by experiments based on the target circuit of a microprocessor. Experimental results show that the deviation between prediction and experiment is less than 20%.

  4. Integrated survival analysis using an event-time approach in a Bayesian framework

    USGS Publications Warehouse

    Walsh, Daniel P.; Dreitz, VJ; Heisey, Dennis M.


    Event-time or continuous-time statistical approaches have been applied throughout the biostatistical literature and have led to numerous scientific advances. However, these techniques have traditionally relied on knowing failure times. This has limited application of these analyses, particularly, within the ecological field where fates of marked animals may be unknown. To address these limitations, we developed an integrated approach within a Bayesian framework to estimate hazard rates in the face of unknown fates. We combine failure/survival times from individuals whose fates are known and times of which are interval-censored with information from those whose fates are unknown, and model the process of detecting animals with unknown fates. This provides the foundation for our integrated model and permits necessary parameter estimation. We provide the Bayesian model, its derivation, and use simulation techniques to investigate the properties and performance of our approach under several scenarios. Lastly, we apply our estimation technique using a piece-wise constant hazard function to investigate the effects of year, age, chick size and sex, sex of the tending adult, and nesting habitat on mortality hazard rates of the endangered mountain plover (Charadrius montanus) chicks. Traditional models were inappropriate for this analysis because fates of some individual chicks were unknown due to failed radio transmitters. Simulations revealed biases of posterior mean estimates were minimal (≤ 4.95%), and posterior distributions behaved as expected with RMSE of the estimates decreasing as sample sizes, detection probability, and survival increased. We determined mortality hazard rates for plover chicks were highest at <5 days old and were lower for chicks with larger birth weights and/or whose nest was within agricultural habitats. Based on its performance, our approach greatly expands the range of problems for which event-time analyses can be used by eliminating the

  5. Integrated survival analysis using an event-time approach in a Bayesian framework

    PubMed Central

    Walsh, Daniel P; Dreitz, Victoria J; Heisey, Dennis M


    Event-time or continuous-time statistical approaches have been applied throughout the biostatistical literature and have led to numerous scientific advances. However, these techniques have traditionally relied on knowing failure times. This has limited application of these analyses, particularly, within the ecological field where fates of marked animals may be unknown. To address these limitations, we developed an integrated approach within a Bayesian framework to estimate hazard rates in the face of unknown fates. We combine failure/survival times from individuals whose fates are known and times of which are interval-censored with information from those whose fates are unknown, and model the process of detecting animals with unknown fates. This provides the foundation for our integrated model and permits necessary parameter estimation. We provide the Bayesian model, its derivation, and use simulation techniques to investigate the properties and performance of our approach under several scenarios. Lastly, we apply our estimation technique using a piece-wise constant hazard function to investigate the effects of year, age, chick size and sex, sex of the tending adult, and nesting habitat on mortality hazard rates of the endangered mountain plover (Charadrius montanus) chicks. Traditional models were inappropriate for this analysis because fates of some individual chicks were unknown due to failed radio transmitters. Simulations revealed biases of posterior mean estimates were minimal (≤ 4.95%), and posterior distributions behaved as expected with RMSE of the estimates decreasing as sample sizes, detection probability, and survival increased. We determined mortality hazard rates for plover chicks were highest at <5 days old and were lower for chicks with larger birth weights and/or whose nest was within agricultural habitats. Based on its performance, our approach greatly expands the range of problems for which event-time analyses can be used by eliminating the

  6. Integrated survival analysis using an event-time approach in a Bayesian framework.


    Walsh, Daniel P; Dreitz, Victoria J; Heisey, Dennis M


    Event-time or continuous-time statistical approaches have been applied throughout the biostatistical literature and have led to numerous scientific advances. However, these techniques have traditionally relied on knowing failure times. This has limited application of these analyses, particularly, within the ecological field where fates of marked animals may be unknown. To address these limitations, we developed an integrated approach within a Bayesian framework to estimate hazard rates in the face of unknown fates. We combine failure/survival times from individuals whose fates are known and times of which are interval-censored with information from those whose fates are unknown, and model the process of detecting animals with unknown fates. This provides the foundation for our integrated model and permits necessary parameter estimation. We provide the Bayesian model, its derivation, and use simulation techniques to investigate the properties and performance of our approach under several scenarios. Lastly, we apply our estimation technique using a piece-wise constant hazard function to investigate the effects of year, age, chick size and sex, sex of the tending adult, and nesting habitat on mortality hazard rates of the endangered mountain plover (Charadrius montanus) chicks. Traditional models were inappropriate for this analysis because fates of some individual chicks were unknown due to failed radio transmitters. Simulations revealed biases of posterior mean estimates were minimal (≤ 4.95%), and posterior distributions behaved as expected with RMSE of the estimates decreasing as sample sizes, detection probability, and survival increased. We determined mortality hazard rates for plover chicks were highest at <5 days old and were lower for chicks with larger birth weights and/or whose nest was within agricultural habitats. Based on its performance, our approach greatly expands the range of problems for which event-time analyses can be used by eliminating the

  7. Developing clinical competency in crisis event management: an integrated simulation problem-based learning activity.


    Liaw, S Y; Chen, F G; Klainin, P; Brammer, J; O'Brien, A; Samarasekera, D D


    This study aimed to evaluate the integration of a simulation based learning activity on nursing students' clinical crisis management performance in a problem-based learning (PBL) curriculum. It was hypothesized that the clinical performance of first year nursing students who participated in a simulated learning activity during the PBL session would be superior to those who completed the conventional problem-based session. The students were allocated into either simulation with problem-based discussion (SPBD) or problem-based discussion (PBD) for scenarios on respiratory and cardiac distress. Following completion of each scenario, students from both groups were invited to sit an optional individual test involving a systematic assessment and immediate management of a simulated patient facing a crisis event. A total of thirty students participated in the first post test related to a respiratory scenario and thirty-three participated in the second post test related to a cardiac scenario. Their clinical performances were scored using a checklist. Mean test scores for students completing the SPBD were significantly higher than those who completing the PBD for both the first post test (SPBD 20.08, PBD 18.19) and second post test (SPBD 27.56, PBD 23.07). Incorporation of simulation learning activities into problem-based discussion appeared to be an effective educational strategy for teaching nursing students to assess and manage crisis events.

  8. Double Power Laws in the Event-integrated Solar Energetic Particle Spectrum

    NASA Astrophysics Data System (ADS)

    Zhao, Lulu; Zhang, Ming; Rassoul, Hamid K.


    A double power law or a power law with exponential rollover at a few to tens of MeV nucleon-1 of the event-integrated differential spectra has been reported in many solar energetic particle (SEP) events. The rollover energies per nucleon of different elements correlate with a particle's charge-to-mass ratio (Q/A). The probable causes are suggested as residing in shock finite lifetimes, shock finite sizes, shock geometry, and an adiabatic cooling effect. In this work, we conduct a numerical simulation to investigate a particle's transport process in the inner heliosphere. We solve the focused transport equation using a time-backward Markov stochastic approach. The convection, magnetic focusing, adiabatic cooling effect, and pitch-angle scattering are included. The effects that the interplanetary turbulence imposes on the shape of the resulting SEP spectra are examined. By assuming a pure power-law differential spectrum at the Sun, a perfect double-power-law feature with a break energy ranging from 10 to 120 MeV nucleon-1 is obtained at 1 au. We found that the double power law of the differential energy spectrum is a robust result of SEP interplanetary propagation. It works for many assumptions of interplanetary turbulence spectra that give various forms of momentum dependence of a particle's mean free path. The different spectral shapes in low-energy and high-energy ends are not just a transition from the convection-dominated propagation to diffusion-dominated propagation.

  9. iGEMS: an integrated model for identification of alternative exon usage events

    PubMed Central

    Sood, Sanjana; Szkop, Krzysztof J.; Nakhuda, Asif; Gallagher, Iain J.; Murie, Carl; Brogan, Robert J.; Kaprio, Jaakko; Kainulainen, Heikki; Atherton, Philip J.; Kujala, Urho M.; Gustafsson, Thomas; Larsson, Ola; Timmons, James A.


    DNA microarrays and RNAseq are complementary methods for studying RNA molecules. Current computational methods to determine alternative exon usage (AEU) using such data require impractical visual inspection and still yield high false-positive rates. Integrated Gene and Exon Model of Splicing (iGEMS) adapts a gene-level residuals model with a gene size adjusted false discovery rate and exon-level analysis to circumvent these limitations. iGEMS was applied to two new DNA microarray datasets, including the high coverage Human Transcriptome Arrays 2.0 and performance was validated using RT-qPCR. First, AEU was studied in adipocytes treated with (n = 9) or without (n = 8) the anti-diabetes drug, rosiglitazone. iGEMS identified 555 genes with AEU, and robust verification by RT-qPCR (∼90%). Second, in a three-way human tissue comparison (muscle, adipose and blood, n = 41) iGEMS identified 4421 genes with at least one AEU event, with excellent RT-qPCR verification (95%, n = 22). Importantly, iGEMS identified a variety of AEU events, including 3′UTR extension, as well as exon inclusion/exclusion impacting on protein kinase and extracellular matrix domains. In conclusion, iGEMS is a robust method for identification of AEU while the variety of exon usage between human tissues is 5–10 times more prevalent than reported by the Genotype-Tissue Expression consortium using RNA sequencing. PMID:27095197

  10. Non-parametric frequency analysis of extreme values for integrated disaster management considering probable maximum events

    NASA Astrophysics Data System (ADS)

    Takara, K. T.


    This paper describes a non-parametric frequency analysis method for hydrological extreme-value samples with a size larger than 100, verifying the estimation accuracy with a computer intensive statistics (CIS) resampling such as the bootstrap. Probable maximum values are also incorporated into the analysis for extreme events larger than a design level of flood control. Traditional parametric frequency analysis methods of extreme values include the following steps: Step 1: Collecting and checking extreme-value data; Step 2: Enumerating probability distributions that would be fitted well to the data; Step 3: Parameter estimation; Step 4: Testing goodness of fit; Step 5: Checking the variability of quantile (T-year event) estimates by the jackknife resampling method; and Step_6: Selection of the best distribution (final model). The non-parametric method (NPM) proposed here can skip Steps 2, 3, 4 and 6. Comparing traditional parameter methods (PM) with the NPM, this paper shows that PM often underestimates 100-year quantiles for annual maximum rainfall samples with records of more than 100 years. Overestimation examples are also demonstrated. The bootstrap resampling can do bias correction for the NPM and can also give the estimation accuracy as the bootstrap standard error. This NPM has advantages to avoid various difficulties in above-mentioned steps in the traditional PM. Probable maximum events are also incorporated into the NPM as an upper bound of the hydrological variable. Probable maximum precipitation (PMP) and probable maximum flood (PMF) can be a new parameter value combined with the NPM. An idea how to incorporate these values into frequency analysis is proposed for better management of disasters that exceed the design level. The idea stimulates more integrated approach by geoscientists and statisticians as well as encourages practitioners to consider the worst cases of disasters in their disaster management planning and practices.

  11. Event triggered state estimation techniques for power systems with integrated variable energy resources.


    Francy, Reshma C; Farid, Amro M; Youcef-Toumi, Kamal


    For many decades, state estimation (SE) has been a critical technology for energy management systems utilized by power system operators. Over time, it has become a mature technology that provides an accurate representation of system state under fairly stable and well understood system operation. The integration of variable energy resources (VERs) such as wind and solar generation, however, introduces new fast frequency dynamics and uncertainties into the system. Furthermore, such renewable energy is often integrated into the distribution system thus requiring real-time monitoring all the way to the periphery of the power grid topology and not just the (central) transmission system. The conventional solution is two fold: solve the SE problem (1) at a faster rate in accordance with the newly added VER dynamics and (2) for the entire power grid topology including the transmission and distribution systems. Such an approach results in exponentially growing problem sets which need to be solver at faster rates. This work seeks to address these two simultaneous requirements and builds upon two recent SE methods which incorporate event-triggering such that the state estimator is only called in the case of considerable novelty in the evolution of the system state. The first method incorporates only event-triggering while the second adds the concept of tracking. Both SE methods are demonstrated on the standard IEEE 14-bus system and the results are observed for a specific bus for two difference scenarios: (1) a spike in the wind power injection and (2) ramp events with higher variability. Relative to traditional state estimation, the numerical case studies showed that the proposed methods can result in computational time reductions of 90%. These results were supported by a theoretical discussion of the computational complexity of three SE techniques. The work concludes that the proposed SE techniques demonstrate practical improvements to the computational complexity of

  12. Event triggered state estimation techniques for power systems with integrated variable energy resources.


    Francy, Reshma C; Farid, Amro M; Youcef-Toumi, Kamal


    For many decades, state estimation (SE) has been a critical technology for energy management systems utilized by power system operators. Over time, it has become a mature technology that provides an accurate representation of system state under fairly stable and well understood system operation. The integration of variable energy resources (VERs) such as wind and solar generation, however, introduces new fast frequency dynamics and uncertainties into the system. Furthermore, such renewable energy is often integrated into the distribution system thus requiring real-time monitoring all the way to the periphery of the power grid topology and not just the (central) transmission system. The conventional solution is two fold: solve the SE problem (1) at a faster rate in accordance with the newly added VER dynamics and (2) for the entire power grid topology including the transmission and distribution systems. Such an approach results in exponentially growing problem sets which need to be solver at faster rates. This work seeks to address these two simultaneous requirements and builds upon two recent SE methods which incorporate event-triggering such that the state estimator is only called in the case of considerable novelty in the evolution of the system state. The first method incorporates only event-triggering while the second adds the concept of tracking. Both SE methods are demonstrated on the standard IEEE 14-bus system and the results are observed for a specific bus for two difference scenarios: (1) a spike in the wind power injection and (2) ramp events with higher variability. Relative to traditional state estimation, the numerical case studies showed that the proposed methods can result in computational time reductions of 90%. These results were supported by a theoretical discussion of the computational complexity of three SE techniques. The work concludes that the proposed SE techniques demonstrate practical improvements to the computational complexity of

  13. Solar Energetic Particle Events detected by the Standard Radiation Environment Monitor (SREM) onboard INTEGRAL

    NASA Astrophysics Data System (ADS)

    Georgoulis, M.; Daglis, I. A.; Anastasiadis, A.; Sandberg, I.; Balasis, G.; Nieminen, P.


    The SREM is a cost-effective instrument mounted onboard multiple ESA missions. The SREM objective is the in-situ measurement of high-energy solar particles at the spacecraft location. Within the previous solar cycle 23, SREM units onboard ESA's INTEGRAL and Rosetta missions detected several tens of SEPEs and accurately pinpointed their onset, rise, and decay times. We have undertaken a detailed study to determine the solar sources and subsequent interplanetary coronal mass ejections (ICMEs) that gave rise to these events, as well as the timing of SEPEs with the onset of possible geomagnetic activity triggered by these ICMEs. We find that virtually all SREM SEPEs may be associated with CME-driven shocks. For a number of well-studied INTEGRAL/SREM SEPEs, moreover, we see an association between the SEPE peak and the shock passage at L1. Shortly (typically within a few hours) after the SEPE peak, the ICME-driven modulation of the magnetosphere kicks in, with either an increase or a dip of the Dst index, indicating stormy conditions in geospace. We conclude that, pending additional investigation, SREM units may prove useful for a short-term prediction of inclement space-weather conditions in Geospace, especially if mounted onboard dayside missions ahead of the magnetospheric bow shock.

  14. The Knowledge-Integrated Network Biomarkers Discovery for Major Adverse Cardiac Events

    PubMed Central

    Jin, Guangxu; Zhou, Xiaobo; Wang, Honghui; Zhao, Hong; Cui, Kemi; Zhang, Xiang-Sun; Chen, Luonan; Hazen, Stanley L.; Li, King; Wong, Stephen T. C.


    The mass spectrometry (MS) technology in clinical proteomics is very promising for discovery of new biomarkers for diseases management. To overcome the obstacles of data noises in MS analysis, we proposed a new approach of knowledge-integrated biomarker discovery using data from Major Adverse Cardiac Events (MACE) patients. We first built up a cardiovascular-related network based on protein information coming from protein annotations in Uniprot, protein–protein interaction (PPI), and signal transduction database. Distinct from the previous machine learning methods in MS data processing, we then used statistical methods to discover biomarkers in cardiovascular-related network. Through the tradeoff between known protein information and data noises in mass spectrometry data, we finally could firmly identify those high-confident biomarkers. Most importantly, aided by protein–protein interaction network, that is, cardiovascular-related network, we proposed a new type of biomarkers, that is, network biomarkers, composed of a set of proteins and the interactions among them. The candidate network biomarkers can classify the two groups of patients more accurately than current single ones without consideration of biological molecular interaction. PMID:18665624

  15. Methods for external event screening quantification: Risk Methods Integration and Evaluation Program (RMIEP) methods development

    SciTech Connect

    Ravindra, M.K.; Banon, H. )


    In this report, the scoping quantification procedures for external events in probabilistic risk assessments of nuclear power plants are described. External event analysis in a PRA has three important goals; (1) the analysis should be complete in that all events are considered; (2) by following some selected screening criteria, the more significant events are identified for detailed analysis; (3) the selected events are analyzed in depth by taking into account the unique features of the events: hazard, fragility of structures and equipment, external-event initiated accident sequences, etc. Based on the above goals, external event analysis may be considered as a three-stage process: Stage I: Identification and Initial Screening of External Events; Stage II: Bounding Analysis; Stage III: Detailed Risk Analysis. In the present report, first, a review of published PRAs is given to focus on the significance and treatment of external events in full-scope PRAs. Except for seismic, flooding, fire, and extreme wind events, the contributions of other external events to plant risk have been found to be negligible. Second, scoping methods for external events not covered in detail in the NRC's PRA Procedures Guide are provided. For this purpose, bounding analyses for transportation accidents, extreme winds and tornadoes, aircraft impacts, turbine missiles, and chemical release are described.

  16. Methods for external event screening quantification: Risk Methods Integration and Evaluation Program (RMIEP) methods development

    SciTech Connect

    Ravindra, M.K.; Banon, H.


    In this report, the scoping quantification procedures for external events in probabilistic risk assessments of nuclear power plants are described. External event analysis in a PRA has three important goals; (1) the analysis should be complete in that all events are considered; (2) by following some selected screening criteria, the more significant events are identified for detailed analysis; (3) the selected events are analyzed in depth by taking into account the unique features of the events: hazard, fragility of structures and equipment, external-event initiated accident sequences, etc. Based on the above goals, external event analysis may be considered as a three-stage process: Stage I: Identification and Initial Screening of External Events; Stage II: Bounding Analysis; Stage III: Detailed Risk Analysis. In the present report, first, a review of published PRAs is given to focus on the significance and treatment of external events in full-scope PRAs. Except for seismic, flooding, fire, and extreme wind events, the contributions of other external events to plant risk have been found to be negligible. Second, scoping methods for external events not covered in detail in the NRC`s PRA Procedures Guide are provided. For this purpose, bounding analyses for transportation accidents, extreme winds and tornadoes, aircraft impacts, turbine missiles, and chemical release are described.

  17. An integrative approach to investigate the respective roles of single-nucleotide variants and copy-number variants in Attention-Deficit/Hyperactivity Disorder

    PubMed Central

    de Araújo Lima, Leandro; Feio-dos-Santos, Ana Cecília; Belangero, Sintia Iole; Gadelha, Ary; Bressan, Rodrigo Affonseca; Salum, Giovanni Abrahão; Pan, Pedro Mario; Moriyama, Tais Silveira; Graeff-Martins, Ana Soledade; Tamanaha, Ana Carina; Alvarenga, Pedro; Krieger, Fernanda Valle; Fleitlich-Bilyk, Bacy; Jackowski, Andrea Parolin; Brietzke, Elisa; Sato, João Ricardo; Polanczyk, Guilherme Vanoni; Mari, Jair de Jesus; Manfro, Gisele Gus; do Rosário, Maria Conceição; Miguel, Eurípedes Constantino; Puga, Renato David; Tahira, Ana Carolina; Souza, Viviane Neri; Chile, Thais; Gouveia, Gisele Rodrigues; Simões, Sérgio Nery; Chang, Xiao; Pellegrino, Renata; Tian, Lifeng; Glessner, Joseph T.; Hashimoto, Ronaldo Fumio; Rohde, Luis Augusto; Sleiman, Patrick M.A.; Hakonarson, Hakon; Brentani, Helena


    Many studies have attempted to investigate the genetic susceptibility of Attention-Deficit/Hyperactivity Disorder (ADHD), but without much success. The present study aimed to analyze both single-nucleotide and copy-number variants contributing to the genetic architecture of ADHD. We generated exome data from 30 Brazilian trios with sporadic ADHD. We also analyzed a Brazilian sample of 503 children/adolescent controls from a High Risk Cohort Study for the Development of Childhood Psychiatric Disorders, and also previously published results of five CNV studies and one GWAS meta-analysis of ADHD involving children/adolescents. The results from the Brazilian trios showed that cases with de novo SNVs tend not to have de novo CNVs and vice-versa. Although the sample size is small, we could also see that various comorbidities are more frequent in cases with only inherited variants. Moreover, using only genes expressed in brain, we constructed two “in silico” protein-protein interaction networks, one with genes from any analysis, and other with genes with hits in two analyses. Topological and functional analyses of genes in this network uncovered genes related to synapse, cell adhesion, glutamatergic and serotoninergic pathways, both confirming findings of previous studies and capturing new genes and genetic variants in these pathways. PMID:26947246

  18. Integrated stratigraphy of the Cenomanian-Turonian boundary interval: improving understanding of Oceanic Anoxic Events

    NASA Astrophysics Data System (ADS)

    Jarvis, Ian


    The Cenomanian-Turonian boundary (CTB) interval ~ 94 Ma represented a period of major global palaeoenvironmental change. Increasingly detailed multidisciplinary studies integrating sedimentological, palaeontological and geochemical data from multiple basins, are enabling the development of refined but complex models that aid understanding of the mechanisms driving changes in ocean productivity and climate. This paper reviews some of the exciting new developments in this field. Facies change characterizes the CTB interval in most areas. In the Chalk seas of northern Europe, a widespead hiatus was followed by the deposition of clay-rich organic-lean beds of the Plenus Marl and its equivalents, and then nodular chalks. In the North Sea basin and its onshore extension in eastern England and northern Germany, black shales of the Black Band (Blodøks Formation, Hasseltal Formation) occur. Similarly, in northern Tethys, a brief interval of black shale accumulation within a predominantly carbonate succession, is exemplified by the Niveau Thomel in the Vocontian Basin (SE France), and the Livello Bonarelli in Italy. Widespread deposition of organic-rich marine sediments during CTB times led to 12C depletion in surface carbon reservoirs (oceans, atmosphere, biosphere), and a large positive global δ13C excursion preserved in marine carbonates and both marine and terrestrial organic matter (Oceanic Anoxic Event 2). Significant biotic turnover characterises the boundary interval, and inter-regional correlation may be achieved at high resolution using integrated biostratigraphy employing macrofossils (ammonites, inoceramid bivalves), microfossils (planktonic foraminifera, dinoflagellate cysts) and calcareous nannofossils. Correlations can be tested against those based on comparison of δ13C profiles - carbon isotope chemostratigraphy, supplemented by oxygen isotope and elemental data. Interpretation of paired carbonate - organic matter δ13C data from multiple CTB sections

  19. Creating Single-Copy Genetic Circuits.


    Lee, Jeong Wook; Gyorgy, Andras; Cameron, D Ewen; Pyenson, Nora; Choi, Kyeong Rok; Way, Jeffrey C; Silver, Pamela A; Del Vecchio, Domitilla; Collins, James J


    Synthetic biology is increasingly used to develop sophisticated living devices for basic and applied research. Many of these genetic devices are engineered using multi-copy plasmids, but as the field progresses from proof-of-principle demonstrations to practical applications, it is important to develop single-copy synthetic modules that minimize consumption of cellular resources and can be stably maintained as genomic integrants. Here we use empirical design, mathematical modeling, and iterative construction and testing to build single-copy, bistable toggle switches with improved performance and reduced metabolic load that can be stably integrated into the host genome. Deterministic and stochastic models led us to focus on basal transcription to optimize circuit performance and helped to explain the resulting circuit robustness across a large range of component expression levels. The design parameters developed here provide important guidance for future efforts to convert functional multi-copy gene circuits into optimized single-copy circuits for practical, real-world use. PMID:27425413

  20. Copying Machine Improvement

    NASA Technical Reports Server (NTRS)


    Manufacturer of the Model 2210 copying machine was looking for a plastic valve bushing material that could be produced by a low-cost injection molding process to replace the unsuitable valve bushing they were using. NERAC conducted a computer search of the NASA database and was able to supply Nashua Corporation with several technical reports in their area of interest. Information aided the company's development of a urethane valve bushing which solved the problem and created a dramatic reduction in unit cost.

  1. Effects of ipsilateral and bilateral auditory stimuli on audiovisual integration: a behavioral and event-related potential study.


    Gao, Yulin; Li, Qi; Yang, Weiping; Yang, Jingjing; Tang, Xiaoyu; Wu, Jinglong


    We used event-related potential measures to compare the effects of ipsilateral and bilateral auditory stimuli on audiovisual (AV) integration. Behavioral results showed that the responses to visual stimuli with either type of auditory stimulus were faster than responses to visual stimuli only and that perceptual sensitivity (d') for visual detection was enhanced for visual stimuli with ipsilateral auditory stimuli. Furthermore, event-related potential components related to AV integrations were identified over the occipital areas at ∼180-200 ms during early-stage sensory processing by the effect of ipsilateral auditory stimuli and over the frontocentral areas at ∼300-320 ms during late-stage cognitive processing by the effect of ipsilateral and bilateral auditory stimuli. Our results confirmed that AV integration was also elicited, despite the effect of bilateral auditory stimuli, and only occurred at later stages of cognitive processing in response to a visual detection task. Furthermore, integration from early-stage sensory processing was observed by the effect of ipsilateral auditory stimuli, suggesting that the integration of AV information in the human brain might be particularly sensitive to ipsilaterally presented AV stimuli.

  2. The Solid Gold Copy Editor.

    ERIC Educational Resources Information Center

    Riblet, Carl, Jr.

    This book discusses the role of the newspaper copy editor on a daily newspaper and contains lessons instructing editors on how to prepare copy for print. The book is specifically designed to polish the skills of the already experienced newspaper copy editor, although a beginner will find the lessons useful and instructive. Contained in the lessons…

  3. Method for critical software event execution reliability in high integrity software

    SciTech Connect

    Kidd, M.E.


    This report contains viewgraphs on a method called SEER, which provides a high level of confidence that critical software driven event execution sequences faithfully exceute in the face of transient computer architecture failures in both normal and abnormal operating environments.

  4. Vy-PER: eliminating false positive detection of virus integration events in next generation sequencing data.


    Forster, Michael; Szymczak, Silke; Ellinghaus, David; Hemmrich, Georg; Rühlemann, Malte; Kraemer, Lars; Mucha, Sören; Wienbrandt, Lars; Stanulla, Martin; Franke, Andre


    Several pathogenic viruses such as hepatitis B and human immunodeficiency viruses may integrate into the host genome. These virus/host integrations are detectable using paired-end next generation sequencing. However, the low number of expected true virus integrations may be difficult to distinguish from the noise of many false positive candidates. Here, we propose a novel filtering approach that increases specificity without compromising sensitivity for virus/host chimera detection. Our detection pipeline termed Vy-PER (Virus integration detection bY Paired End Reads) outperforms existing similar tools in speed and accuracy. We analysed whole genome data from childhood acute lymphoblastic leukemia (ALL), which is characterised by genomic rearrangements and usually associated with radiation exposure. This analysis was motivated by the recently reported virus integrations at genomic rearrangement sites and association with chromosomal instability in liver cancer. However, as expected, our analysis of 20 tumour and matched germline genomes from ALL patients finds no significant evidence for integrations by known viruses. Nevertheless, our method eliminates 12,800 false positives per genome (80× coverage) and only our method detects singleton human-phiX174-chimeras caused by optical errors of the Illumina HiSeq platform. This high accuracy is useful for detecting low virus integration levels as well as non-integrated viruses. PMID:26166306

  5. Vy-PER: eliminating false positive detection of virus integration events in next generation sequencing data.


    Forster, Michael; Szymczak, Silke; Ellinghaus, David; Hemmrich, Georg; Rühlemann, Malte; Kraemer, Lars; Mucha, Sören; Wienbrandt, Lars; Stanulla, Martin; Franke, Andre


    Several pathogenic viruses such as hepatitis B and human immunodeficiency viruses may integrate into the host genome. These virus/host integrations are detectable using paired-end next generation sequencing. However, the low number of expected true virus integrations may be difficult to distinguish from the noise of many false positive candidates. Here, we propose a novel filtering approach that increases specificity without compromising sensitivity for virus/host chimera detection. Our detection pipeline termed Vy-PER (Virus integration detection bY Paired End Reads) outperforms existing similar tools in speed and accuracy. We analysed whole genome data from childhood acute lymphoblastic leukemia (ALL), which is characterised by genomic rearrangements and usually associated with radiation exposure. This analysis was motivated by the recently reported virus integrations at genomic rearrangement sites and association with chromosomal instability in liver cancer. However, as expected, our analysis of 20 tumour and matched germline genomes from ALL patients finds no significant evidence for integrations by known viruses. Nevertheless, our method eliminates 12,800 false positives per genome (80× coverage) and only our method detects singleton human-phiX174-chimeras caused by optical errors of the Illumina HiSeq platform. This high accuracy is useful for detecting low virus integration levels as well as non-integrated viruses.

  6. Vy-PER: eliminating false positive detection of virus integration events in next generation sequencing data

    PubMed Central

    Forster, Michael; Szymczak, Silke; Ellinghaus, David; Hemmrich, Georg; Rühlemann, Malte; Kraemer, Lars; Mucha, Sören; Wienbrandt, Lars; Stanulla, Martin; Franke, Andre


    Several pathogenic viruses such as hepatitis B and human immunodeficiency viruses may integrate into the host genome. These virus/host integrations are detectable using paired-end next generation sequencing. However, the low number of expected true virus integrations may be difficult to distinguish from the noise of many false positive candidates. Here, we propose a novel filtering approach that increases specificity without compromising sensitivity for virus/host chimera detection. Our detection pipeline termed Vy-PER (Virus integration detection bY Paired End Reads) outperforms existing similar tools in speed and accuracy. We analysed whole genome data from childhood acute lymphoblastic leukemia (ALL), which is characterised by genomic rearrangements and usually associated with radiation exposure. This analysis was motivated by the recently reported virus integrations at genomic rearrangement sites and association with chromosomal instability in liver cancer. However, as expected, our analysis of 20 tumour and matched germline genomes from ALL patients finds no significant evidence for integrations by known viruses. Nevertheless, our method eliminates 12,800 false positives per genome (80× coverage) and only our method detects singleton human-phiX174-chimeras caused by optical errors of the Illumina HiSeq platform. This high accuracy is useful for detecting low virus integration levels as well as non-integrated viruses. PMID:26166306

  7. Analysis of adverse events of potential autoimmune aetiology in a large integrated safety database of AS04 adjuvanted vaccines.


    Verstraeten, Thomas; Descamps, Dominique; David, Marie-Pierre; Zahaf, Toufik; Hardt, Karin; Izurieta, Patricia; Dubin, Gary; Breuer, Thomas


    Newly licensed vaccines against human papillomavirus (HPV) and hepatitis B (HBV), and several vaccines in development, including a vaccine against genital herpes simplex virus (HSV), contain a novel Adjuvant System, AS04, composed of 3-O-desacyl-4' monophosphoryl lipid A and aluminium salts. Given the background incidence of autoimmune disorders in some of the groups targeted for immunisation with these vaccines, it is likely that autoimmune events will be reported in temporal association with vaccination, even in the absence of a causal relationship. The objective of this integrated analysis was to assess safety of AS04 adjuvanted vaccines with regard to adverse events (AEs) of potential autoimmune aetiology, particularly in adolescents and young adults. All randomised, controlled trials of HPV-16/18, HSV and HBV vaccines were analysed in an integrated analysis of individual data (N = 68,512). A separate analysis of the HPV-16/18 vaccine trials alone was also undertaken (N = 39,160). All data were collected prospectively during the vaccine development programmes (mean follow-up of 21.4 months), and included in the analysis up to a pre-defined data lock point. Reporting rates of overall autoimmune events were around 0.5% and did not differ between the AS04 and control groups. The relative risk (AS04/control) of experiencing any autoimmune event was 0.98 (95% confidence intervals 0.80, 1.21) in the integrated analysis and 0.92 (0.70, 1.22) in the HPV-16/18 vaccine analysis. Relative risks calculated overall, for disease category or for individual events were close to 1, and all confidence intervals around the relative risk included 1, indicating no statistically significant difference in event rates between the AS04 and control groups. This integrated analysis of over 68,000 participants who received AS04 adjuvanted vaccines or controls demonstrated a low rate of autoimmune disorders, without evidence of an increase in relative risk associated with AS04 adjuvanted

  8. Estimation of integrated public risks for nonseismic external events affecting the Savannah River Site

    SciTech Connect

    Durant, W.S.; robinette, R.J.; Kirchner, J.R.


    In essence, this study was envisioned as the ``combination`` of existing accident dose and risk calculations from safety analyses of individual facilities. However, because of the extended time period over which the safety analyses were prepared, calculational assumptions and methodologies differed between the analyses. The scope of this study therefore included the standardization of assumptions and calculations as necessary to insure that the analytical logic was consistent for all the facilities. Each of the nonseismic external events considered in the analyses are addressed in individual sections in this report. In Section 2, extreme straight-line winds are examined. Section 3 addresses tornadoes, and Section 4 addresses other external events [floods, other extreme weather events (lightning, hail, and extremes in temperature or precipitation), vehicle impact, accidents involving adjacent facilities, aircraft impact, and meteorite impact]. Section 5 provides a summary of the general conclusions of the report.

  9. The spatial reliability of task-irrelevant sounds modulates bimodal audiovisual integration: An event-related potential study.


    Li, Qi; Yu, Hongtao; Wu, Yan; Gao, Ning


    The integration of multiple sensory inputs is essential for perception of the external world. The spatial factor is a fundamental property of multisensory audiovisual integration. Previous studies of the spatial constraints on bimodal audiovisual integration have mainly focused on the spatial congruity of audiovisual information. However, the effect of spatial reliability within audiovisual information on bimodal audiovisual integration remains unclear. In this study, we used event-related potentials (ERPs) to examine the effect of spatial reliability of task-irrelevant sounds on audiovisual integration. Three relevant ERP components emerged: the first at 140-200ms over a wide central area, the second at 280-320ms over the fronto-central area, and a third at 380-440ms over the parieto-occipital area. Our results demonstrate that ERP amplitudes elicited by audiovisual stimuli with reliable spatial relationships are larger than those elicited by stimuli with inconsistent spatial relationships. In addition, we hypothesized that spatial reliability within an audiovisual stimulus enhances feedback projections to the primary visual cortex from multisensory integration regions. Overall, our findings suggest that the spatial linking of visual and auditory information depends on spatial reliability within an audiovisual stimulus and occurs at a relatively late stage of processing.

  10. The spatial reliability of task-irrelevant sounds modulates bimodal audiovisual integration: An event-related potential study.


    Li, Qi; Yu, Hongtao; Wu, Yan; Gao, Ning


    The integration of multiple sensory inputs is essential for perception of the external world. The spatial factor is a fundamental property of multisensory audiovisual integration. Previous studies of the spatial constraints on bimodal audiovisual integration have mainly focused on the spatial congruity of audiovisual information. However, the effect of spatial reliability within audiovisual information on bimodal audiovisual integration remains unclear. In this study, we used event-related potentials (ERPs) to examine the effect of spatial reliability of task-irrelevant sounds on audiovisual integration. Three relevant ERP components emerged: the first at 140-200ms over a wide central area, the second at 280-320ms over the fronto-central area, and a third at 380-440ms over the parieto-occipital area. Our results demonstrate that ERP amplitudes elicited by audiovisual stimuli with reliable spatial relationships are larger than those elicited by stimuli with inconsistent spatial relationships. In addition, we hypothesized that spatial reliability within an audiovisual stimulus enhances feedback projections to the primary visual cortex from multisensory integration regions. Overall, our findings suggest that the spatial linking of visual and auditory information depends on spatial reliability within an audiovisual stimulus and occurs at a relatively late stage of processing. PMID:27392755

  11. Usefulness of a KT Event to Address Practice and Policy Gaps Related to Integrated Care.


    Jackson, Karen; Boakye, Omenaa; Wallace, Nicole


    There are limited evaluations of the impact of knowledge translation (KT) activities aimed at addressing practice and policy gaps. We report on the impact of an interactive, end-of-grant KT event. Although action items were developed and key stakeholder support attained, minimal follow-through had occurred three months after the KT event. Several organizational obstacles to transitioning knowledge into action were identified: leadership, program policies, infrastructure, changing priorities, workload and physician engagement. Key messages include: (1) ensure ongoing and facilitated networking opportunities, (2) invest in building implementation capacity, (3) target multi-level implementation activities and (4) focus further research on KT evaluation.

  12. Integrated Analysis of Genetic and Proteomic Data Identifies Biomarkers Associated with Adverse Events Following Smallpox Vaccination

    EPA Science Inventory

    Complex clinical outcomes, such as adverse reaction to vaccination, arise from the concerted interactions among the myriad components of a biological system. Therefore, comprehensive etiological models can be developed only through the integrated study of multiple types of experi...

  13. Magellan: a web based system for the integrated analysis of heterogeneous biological data and annotations; application to DNA copy number and expression data in ovarian cancer.


    Kingsley, Chris B; Kuo, Wen-Lin; Polikoff, Daniel; Berchuck, Andy; Gray, Joe W; Jain, Ajay N


    Recent advances in high throughput biological methods allow researchers to generate enormous amounts of data from a single experiment. In order to extract meaningful conclusions from this tidal wave of data, it will be necessary to develop analytical methods of sufficient power and utility. It is particularly important that biologists themselves be able to perform many of these analyses, such that their background knowledge of the experimental system under study can be used to interpret results and direct further inquiries. We have developed a web-based system, Magellan, which allows the upload, storage, and analysis of multivariate data and textual or numerical annotations. Data and annotations are treated as abstract entities, to maximize the different types of information the system can store and analyze. Annotations can be used in analyses/visualizations, as a means of subsetting data to reduce dimensionality, or as a means of projecting variables from one data type or data set to another. Analytical methods are deployed within Magellan such that new functionalities can be added in a straightforward fashion. Using Magellan, we performed an integrated analysis of genome-wide comparative genomic hybridization (CGH), mRNA expression, and clinical data from ovarian tumors. Analyses included the use of permutation-based methods to identify genes whose mRNA expression levels correlated with patient survival, a nearest neighbor classifier to predict patient survival from CGH data, and curated annotations such as genomic position and derived annotations such as statistical computations to explore the quantitative relationship between CGH and mRNA expression data.

  14. Integrating Sentence-Structural and Event Information in Early Verb Learning

    ERIC Educational Resources Information Center

    Yuan, Sylvia Hsin Wei


    Children use syntax as well as observations of events to learn verb meanings. This is known as syntactic bootstrapping. This dissertation investigated the origins and mechanisms of syntactic bootstrapping. Prior evidence suggested that two-year-olds, but not younger children, could use aspects of sentence structure to assign different…

  15. Final Scientific Report, Integrated Seismic Event Detection and Location by Advanced Array Processing

    SciTech Connect

    Kvaerna, T.; Gibbons. S.J.; Ringdal, F; Harris, D.B.


    In the field of nuclear explosion monitoring, it has become a priority to detect, locate, and identify seismic events down to increasingly small magnitudes. The consideration of smaller seismic events has implications for a reliable monitoring regime. Firstly, the number of events to be considered increases greatly; an exponential increase in naturally occurring seismicity is compounded by large numbers of seismic signals generated by human activity. Secondly, the signals from smaller events become more difficult to detect above the background noise and estimates of parameters required for locating the events may be subject to greater errors. Thirdly, events are likely to be observed by a far smaller number of seismic stations, and the reliability of event detection and location using a very limited set of observations needs to be quantified. For many key seismic stations, detection lists may be dominated by signals from routine industrial explosions which should be ascribed, automatically and with a high level of confidence, to known sources. This means that expensive analyst time is not spent locating routine events from repeating seismic sources and that events from unknown sources, which could be of concern in an explosion monitoring context, are more easily identified and can be examined with due care. We have obtained extensive lists of confirmed seismic events from mining and other artificial sources which have provided an excellent opportunity to assess the quality of existing fully-automatic event bulletins and to guide the development of new techniques for online seismic processing. Comparing the times and locations of confirmed events from sources in Fennoscandia and NW Russia with the corresponding time and location estimates reported in existing automatic bulletins has revealed substantial mislocation errors which preclude a confident association of detected signals with known industrial sources. The causes of the errors are well understood and are

  16. 12. Photographic copy of copy of Twin Lakes Outlet Works ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. Photographic copy of copy of Twin Lakes Outlet Works construction drawing dated January 15, 1951. Drawn by W.A. Doe for the Twin Lakes Reservoir and Canal Co. (copy in possession of Bureau of Reclamation, location of original unknown) 'AS CONSTRUCTED' PLANS OF 1949-50, REHABILITATION OF TWIN LAKES RESERVOIR OUTLET WORKS, DETAILS OF DISCHARGE BASIN. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

  17. 11. Photographic copy of copy of Twin Lakes Outlet Works ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. Photographic copy of copy of Twin Lakes Outlet Works construction drawing dated January 15, 1951. Drawn by W.A. Doe for the Twin Lakes Reservoir and Canal Co. (copy in possession of Bureau of Reclamation, location of original unknown) 'AS CONSTRUCTED' PLANS OF 1949-1950, REHABILITATION OF TWIN LAKES RESERVOIR OUTLET WORKS, DETAILS OF UPSTREAM WING WALLS. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

  18. Expression of endogenous para-retroviral genes and molecular analysis of the integration events in its plant host Dahlia variabilis.


    Eid, S; Pappu, H R


    The dahlia (Dahlia variabilis) genome contains an endogenous pararetrovirus sequence (EPRS) tentatively designated as DvEPRS. The DvEPRS shares genome structure and organization that is typical of members of the Caulimovirus genus. Studies were carried out to better understand the nature of this integration and to determine the gene expression of this DvEPRS. Genomic Southern hybridization showed multiple and random integration events of the DvEPRS in the dahlia genome. To investigate the presence of DvEPRS transcripts, RT-PCR was done on DNase-treated total RNA from DvEPRS-infected dahlia plants. Results showed the expression of open reading frames I, V, and VI. Direct PCR from sap extracts produced more intense DNA amplicons of Dahlia mosaic virus and Dahlia common mosaic virus which are believed to exist as typical episomal caulimoviruses, whereas significantly less intense amplicon was seen in case of DvEPRS in comparison with internal transcribed spacer region of dahlias amplicon. The DvEPRS in wild and cultivated species of Dahlia offer a model system to study the molecular events underlying the ecology, evolution and spread of DvEPRS within natural and managed ecosystems and the factors affecting integration of these EPRS in the plant genome. PMID:24258394

  19. Bayesian Analysis for Risk Assessment of Selected Medical Events in Support of the Integrated Medical Model Effort

    NASA Technical Reports Server (NTRS)

    Gilkey, Kelly M.; Myers, Jerry G.; McRae, Michael P.; Griffin, Elise A.; Kallrui, Aditya S.


    The Exploration Medical Capability project is creating a catalog of risk assessments using the Integrated Medical Model (IMM). The IMM is a software-based system intended to assist mission planners in preparing for spaceflight missions by helping them to make informed decisions about medical preparations and supplies needed for combating and treating various medical events using Probabilistic Risk Assessment. The objective is to use statistical analyses to inform the IMM decision tool with estimated probabilities of medical events occurring during an exploration mission. Because data regarding astronaut health are limited, Bayesian statistical analysis is used. Bayesian inference combines prior knowledge, such as data from the general U.S. population, the U.S. Submarine Force, or the analog astronaut population located at the NASA Johnson Space Center, with observed data for the medical condition of interest. The posterior results reflect the best evidence for specific medical events occurring in flight. Bayes theorem provides a formal mechanism for combining available observed data with data from similar studies to support the quantification process. The IMM team performed Bayesian updates on the following medical events: angina, appendicitis, atrial fibrillation, atrial flutter, dental abscess, dental caries, dental periodontal disease, gallstone disease, herpes zoster, renal stones, seizure, and stroke.

  20. Developing Clinical Competency in Crisis Event Management: An Integrated Simulation Problem-Based Learning Activity

    ERIC Educational Resources Information Center

    Liaw, S. Y.; Chen, F. G.; Klainin, P.; Brammer, J.; O'Brien, A.; Samarasekera, D. D.


    This study aimed to evaluate the integration of a simulation based learning activity on nursing students' clinical crisis management performance in a problem-based learning (PBL) curriculum. It was hypothesized that the clinical performance of first year nursing students who participated in a simulated learning activity during the PBL session…

  1. Method and apparatus for increasing resistance of bipolar buried layer integrated circuit devices to single-event upsets

    NASA Technical Reports Server (NTRS)

    Zoutendyk, John A. (Inventor)


    Bipolar transistors fabricated in separate buried layers of an integrated circuit chip are electrically isolated with a built-in potential barrier established by doping the buried layer with a polarity opposite doping in the chip substrate. To increase the resistance of the bipolar transistors to single-event upsets due to ionized particle radiation, the substrate is biased relative to the buried layer with an external bias voltage selected to offset the built-in potential just enough (typically between about +0.1 to +0.2 volt) to prevent an accumulation of charge in the buried-layer-substrate junction.

  2. Quantitative hazard assessment at Vulcano (Aeolian islands): integration of geology, event statistics and physical modelling

    NASA Astrophysics Data System (ADS)

    Dellino, Pierfrancesco; de Astis, Gianfilippo; La Volpe, Luigi; Mele, Daniela; Sulpizio, Roberto


    The analysis of stratigraphy and of pyroclastic deposits particle features allowed the reconstruction of the volcanic history of La Fossa di Vulcano. An eruptive scenario driven by superficial phreatomagmatic explosions emerged. A statistical analysis of the pyroclastic Successions led to define a repetitive sequence of dilute pyroclastic density currents as the most probable events at short term, followed by fallout of dense ballistic blocks. The scale of such events is related to the amount of magma involved in each explosion. Events involving a million of cubic meters of magma are probable in view of what happened in the most recent eruptions. They led to the formation of hundreds of meters thick dilute pyroclastic density currents, moving down the volcano slope at velocities exceeding 50 m/sec. The dispersion of desnity currents affected the whole Vulcano Porto area, the Vulcanello area and also overrode the Fossa Caldera's rim, spreading over the Piano area. Similarly, older pyroclastic deposits erupted at different times (Piano Grotte dei Rossi formation, ~20-7.7 ka) from vents within La Fossa Caldera and before La Fossa Cone formation. They also were phreatomagmatic in origin and fed dilute pyroclastic density currents (PDC). They represent the eruptions with the highest magnitude on the Island. Therefore, for the aim of hazard assessment, these deposits from La Fossa Cone and La Fossa Caldera were used to depict eruptive scenarios at short term and at long term. On the base of physical models that make use of pyroclastic deposits particle features, the impact parameters for each scenario have been calculated. They are dynamic pressure and particle volumetric concentration of density currents, and impact energy of ballistic blocks. On this base, a quantitative hazard map is presented, which could be of direct use for territory planning and for the calculation of the expected damage.

  3. Using Discrete Event Simulation to Model Integrated Commodities Consumption for a Launch Campaign of the Space Launch System

    NASA Technical Reports Server (NTRS)

    Leonard, Daniel; Parsons, Jeremy W.; Cates, Grant


    In May 2013, NASA's GSDO Program requested a study to develop a discrete event simulation (DES) model that analyzes the launch campaign process of the Space Launch System (SLS) from an integrated commodities perspective. The scope of the study includes launch countdown and scrub turnaround and focuses on four core launch commodities: hydrogen, oxygen, nitrogen, and helium. Previously, the commodities were only analyzed individually and deterministically for their launch support capability, but this study was the first to integrate them to examine the impact of their interactions on a launch campaign as well as the effects of process variability on commodity availability. The study produced a validated DES model with Rockwell Arena that showed that Kennedy Space Center's ground systems were capable of supporting a 48-hour scrub turnaround for the SLS. The model will be maintained and updated to provide commodity consumption analysis of future ground system and SLS configurations.

  4. Ensuring critical event sequences in high integrity software by applying path expressions

    SciTech Connect

    Kidd, M.E.C.


    The goal of this work is to extend the use of existing path expression theory and methodologies to ensure that critical software event sequences are maintained even in the face of malevolent attacks and harsh or unstable operating environments. This will be accomplished by providing dynamic fault management measures directly to the software developer and to their varied development environments. This paper discusses the perceived problems, a brief overview of path expressions, and the author`s proposed extension areas. The authors discuss how the traditional path expression usage and implementation differs from the intended usage and implementation.

  5. 10. Photographic copy of copy of original construction drawing, dated ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. Photographic copy of copy of original construction drawing, dated 1899?. Original in possession of Twin Lakes Reservoir and Canal Company, Ordway, Colorado. PLAN OF DAM AND HEAD GATES FOR THE TWIN LAKES RESERVOIR. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

  6. Integration of scheduling and discrete event simulation systems to improve production flow planning

    NASA Astrophysics Data System (ADS)

    Krenczyk, D.; Paprocka, I.; Kempa, W. M.; Grabowik, C.; Kalinowski, K.


    The increased availability of data and computer-aided technologies such as MRPI/II, ERP and MES system, allowing producers to be more adaptive to market dynamics and to improve production scheduling. Integration of production scheduling and computer modelling, simulation and visualization systems can be useful in the analysis of production system constraints related to the efficiency of manufacturing systems. A integration methodology based on semi-automatic model generation method for eliminating problems associated with complexity of the model and labour-intensive and time-consuming process of simulation model creation is proposed. Data mapping and data transformation techniques for the proposed method have been applied. This approach has been illustrated through examples of practical implementation of the proposed method using KbRS scheduling system and Enterprise Dynamics simulation system.

  7. Propensity and risk assessment for solar particle events: Consideration of integral fluence at high proton energies

    NASA Astrophysics Data System (ADS)

    Kim, Myung-Hee; Hayat, Matthew; Feiveson, Alan; Cucinotta, Francis A.

    For future space missions with longer duration, exposure to large solar particle events (SPEs) with high energy levels is the major concern during extra-vehicular activities (EVAs) on the lunar and Mars surface. The propensity for SPE occurrence with large proton fluence was estimated as a function of time within a solar cycle from a non-homogeneous Poisson model using the historical database for measurements of protons with energy >30 MeV, Φ30 . The database includes a continuous data set for the past 5 solar cycles. The resultant SPE risk analysis for a specific mission period was made for blood forming organ (BFO) dose ranging from its 5th to 95th percentile. In addition to the total particle intensity of SPEs, the detailed energy spectra of protons, especially at high energy levels, were recognized as extremely important for assessing the cancer risk associated with energetic particles for large events. Using all the recorded proton fluence of SPEs for energies >60 and >100 MeV, Φ60 and Φ100 , respectively, the expected numbers of SPEs abundant with high energy protons were estimated from the same non-homogeneous Poisson model and the representative cancer risk was analyzed. The dependencies of risk with different energy spectra, for e.g. between soft and hard SPEs, were evaluated. Finally, we describe approaches to improve radiation protection of astronauts and optimize mission planning for future space missions.

  8. Propensity and Risk Assessment for Solar Particle Events: Consideration of Integral Fluence at High Proton Energies

    NASA Technical Reports Server (NTRS)

    Kim, Myung-Hee; Hayat, Matthew J.; Feiveson, alan H.; Cucinotta, Francis A.


    For future space missions with longer duration, exposure to large solar particle events (SPEs) with high energy levels is the major concern during extra-vehicular activities (EVAs) on the lunar and Mars surface. The expected SPE propensity for large proton fluence was estimated from a non-homogeneous Poisson model using the historical database for measurements of protons with energy > 30 MeV, Phi(sub 30). The database includes a continuous data set for the past 5 solar cycles. The resultant SPE risk analysis for a specific mission period was made including the 95% confidence level. In addition to total particle intensity of SPE, the detailed energy spectra of protons especially at high energy levels were recognized as extremely important parameter for the risk assessment, since there remains a significant cancer risks from those energetic particles for large events. Using all the recorded proton fluence of SPEs for energies >60 and >100 MeV, Phi(sub 60) and Phi(sub 100), respectively, the expected propensities of SPEs abundant with high energy protons were estimated from the same non-homogeneous Poisson model and the representative cancer risk was analyzed. The dependencies of risk with different energy spectra, for e.g. between soft and hard SPEs, were evaluated. Finally, we describe approaches to improve radiation protection of astronauts and optimize mission planning for future space missions.

  9. An integrated and coordinated approach to preventing recurrent coronary heart disease events in Australia.


    Briffa, Tom G; Kinsman, Leigh; Maiorana, Andrew J; Zecchin, Robert; Redfern, Julie; Davidson, Patricia M; Paull, Glenn; Nagle, Amanda; Denniss, A Robert


    Implementing existing knowledge about cardiac rehabilitation (CR) and heart failure management could markedly reduce mortality after acute coronary syndromes and revascularisation therapy. Contemporary CR and secondary prevention programs are cost-effective, safe and beneficial for patients of all ages, leading to improved survival, fewer revascularisation procedures and reduced rehospitalisation. Despite the proven benefits attributed to these secondary prevention interventions, they are not well attended by patients. Modern programs must be flexible, culturally safe, multifaceted and integrated with the patient's primary health care provider to achieve optimal and sustainable benefits for most patients.

  10. Counting copy number and calories.


    White, Stefan


    Copy number variation (CNV) at several genomic loci has been associated with different human traits and diseases, but in many cases the findings could not be replicated. A new study provides insights into the degree of variation present at the amylase locus and calls into question a previous association between amylase copy number and body mass index. PMID:26220133

  11. Escherichia coli O157:H7 strains isolated from “High Event Period” beef contamination have strong biofilm forming ability and low sanitizer susceptibility which are associated with high pO157 plasmid copy number

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the meat industry, a “High Event Period” (HEP) is defined as a time period when beef processing establishments experience an increased occurrence of product contamination by E. coli O157:H7. Our previous studies suggested that bacterial biofilm formation and sanitizer resistance might contribute...

  12. Event-triggered logical flow control for comprehensive process integration of multi-step assays on centrifugal microfluidic platforms.


    Kinahan, David J; Kearney, Sinéad M; Dimov, Nikolay; Glynn, Macdara T; Ducrée, Jens


    The centrifugal "lab-on-a-disc" concept has proven to have great potential for process integration of bioanalytical assays, in particular where ease-of-use, ruggedness, portability, fast turn-around time and cost efficiency are of paramount importance. Yet, as all liquids residing on the disc are exposed to the same centrifugal field, an inherent challenge of these systems remains the automation of multi-step, multi-liquid sample processing and subsequent detection. In order to orchestrate the underlying bioanalytical protocols, an ample palette of rotationally and externally actuated valving schemes has been developed. While excelling with the level of flow control, externally actuated valves require interaction with peripheral instrumentation, thus compromising the conceptual simplicity of the centrifugal platform. In turn, for rotationally controlled schemes, such as common capillary burst valves, typical manufacturing tolerances tend to limit the number of consecutive laboratory unit operations (LUOs) that can be automated on a single disc. In this paper, a major advancement on recently established dissolvable film (DF) valving is presented; for the very first time, a liquid handling sequence can be controlled in response to completion of preceding liquid transfer event, i.e. completely independent of external stimulus or changes in speed of disc rotation. The basic, event-triggered valve configuration is further adapted to leverage conditional, large-scale process integration. First, we demonstrate a fluidic network on a disc encompassing 10 discrete valving steps including logical relationships such as an AND-conditional as well as serial and parallel flow control. Then we present a disc which is capable of implementing common laboratory unit operations such as metering and selective routing of flows. Finally, as a pilot study, these functions are integrated on a single disc to automate a common, multi-step lab protocol for the extraction of total RNA from

  13. Seamless prevention of adverse events from tattooing: integrated strategy emphasising the customer-tattooist interaction.


    Serup, Jørgen


    The boom in tattooing has been paralleled by more frequent adverse events, which may be localised in the skin or systemic and manifested clinically or latent. Infections, allergic reactions from red-coloured tattoos and papulo-nodular reactions from black tattoos dominate. Mild complaints are very common, with 1/5 of all tattooed individuals having acquired sensitivity to sunlight in the tattooed skin. The potential risk of cancer due to potential carcinogens in some tattoo inks has hitherto not manifested in clinical reports, despite the millions of people who have been tattooed over many decades. A risk of death from tattooing remains associated with severe infection, i.e. sepsis. Preventive strategies may rely on focused preventions, and sterility and preservation of ink is essential, rational and knowledge-based. The chemical and particle contents of ink nanoparticles cannot be unrestricted; however, focused control of ink is facing many uncertainties, including analytical problems, lack of identification of allergens in ink and discrepancies between the content of potential carcinogens and manifestation of cancer in the clinic. The concept of seamless prevention is introduced as a pragmatic strategy that emphasises the customer-tattooist interaction, which is the 'engine' of tattoo safety. This strategy amalgamates the range of narrow-scope preventive instruments and shall ensure that any relevant instrument is used actively and without deficiency or drop out, thus resulting in a complete orchestration of a multi-targeted strategy. High-priority elements of this strategy shall facilitate a qualified 'go' or 'no go' decision by the customer before the tattoo is made and should involve informed consent, qualification of the tattooist and the parlour, including supplies of inks etc., and attention to hygienic security. Records and documentation of tattoo cases with complications and the culprit inks as well as the establishment of national or European

  14. Enabling heterogeneous data integration and biomedical event prediction through ICT: the test case of cancer reoccurrence.


    Picone, Marco; Steger, Sebastian; Exarchos, Konstantinos; De Fazio, Marco; Goletsis, Yorgos; Fotiadis, Dimitrios I; Martinelli, Elena; Ardigò, Diego


    Early prediction of cancer reoccurrence constitutes a challenge for oncologists and surgeons. This chapter describes one ongoing experience, the EU-Project NeoMark, where scientists from different medical and biology research fields joined efforts with Information Technology experts to identify methods and algorithms that are able to early predict the reoccurrence risk for one of the most devastating tumors, the oral cavity squamous cell carcinoma (OSCC). The challenge of NeoMark is to develop algorithms able to identify a "signature" or bio-profile of the disease, by integrating multiscale and multivariate data from medical images, genomic profile from tissue and circulating cells RNA, and other medical parameters collected from patients before and after treatment. A limited number of relevant biomarkers will be identified and used in a real-time PCR device for early detection of disease reoccurrence.

  15. Integrating Recent Data in Managing Adverse Events in the Treatment of Hepatocellular Carcinoma

    PubMed Central

    Gish, Robert G.; Abou-Alfa, Ghassan K.; Tong, Myron J.


    Hepatocellular carcinoma (HCC) is a major cause of cancer-related morbidity and mortality worldwide. In the United States, HCC is the main cause of death in patients with cirrhosis, and the incidence of this malignancy is on the rise. Because HCC is associated with a particularly poor prognosis, emphasis is placed on surveillance of high-risk patients. Early detection allows a greater chance of diagnosing HCC before it has spread, thus increasing the chances that the patient can be potentially cured with surgical techniques such as resection and transplantation. However, most cases of HCC are not diagnosed until at least some of the cancer has spread or multiple nodules exist. For these patients, treatment options include percutaneous and transarterial ablation, as well as systemic chemotherapy. Systemic therapy is now considered the standard of care for patients with advanced tumors. Traditional treatment was based on cytotoxic chemotherapeutic agents, such as doxorubicin. This approach was associated with minimal benefit and a high rate of toxicity. Recently, targeted agents have proven more effective and safer in this setting. The oral multikinase inhibitor sorafenib is now approved for the treatment of unresectable HCC and is currently the only approved agent for advanced HCC. In order to maximize the benefit of sorafenib and other investigational agents for patients with advanced disease, effective interventions have been designed to mitigate their associated adverse events, such as hand-foot skin reactions and hypertension. PMID:22423222

  16. Dispositional mindfulness and semantic integration of emotional words: Evidence from event-related brain potentials.


    Dorjee, Dusana; Lally, Níall; Darrall-Rew, Jonathan; Thierry, Guillaume


    Initial research shows that mindfulness training can enhance attention and modulate the affective response. However, links between mindfulness and language processing remain virtually unexplored despite the prominent role of overt and silent negative ruminative speech in depressive and anxiety-related symptomatology. Here, we measured dispositional mindfulness and recorded participants' event-related brain potential responses to positive and negative target words preceded by words congruent or incongruent with the targets in terms of semantic relatedness and emotional valence. While the low mindfulness group showed similar N400 effect pattern for positive and negative targets, high dispositional mindfulness was associated with larger N400 effect to negative targets. This result suggests that negative meanings are less readily accessible in people with high dispositional mindfulness. Furthermore, high dispositional mindfulness was associated with reduced P600 amplitudes to emotional words, suggesting less post-analysis and attentional effort which possibly relates to a lower inclination to ruminate. Overall, these findings provide initial evidence on associations between modifications in language systems and mindfulness.

  17. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.


    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing


    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  18. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7

    PubMed Central

    Wang, Xujing; Wang, Zhixing


    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  19. Causal Factors and Adverse Events of Aviation Accidents and Incidents Related to Integrated Vehicle Health Management

    NASA Technical Reports Server (NTRS)

    Reveley, Mary S.; Briggs, Jeffrey L.; Evans, Joni K.; Jones, Sharon M.; Kurtoglu, Tolga; Leone, Karen M.; Sandifer, Carl E.


    Causal factors in aviation accidents and incidents related to system/component failure/malfunction (SCFM) were examined for Federal Aviation Regulation Parts 121 and 135 operations to establish future requirements for the NASA Aviation Safety Program s Integrated Vehicle Health Management (IVHM) Project. Data analyzed includes National Transportation Safety Board (NSTB) accident data (1988 to 2003), Federal Aviation Administration (FAA) incident data (1988 to 2003), and Aviation Safety Reporting System (ASRS) incident data (1993 to 2008). Failure modes and effects analyses were examined to identify possible modes of SCFM. A table of potential adverse conditions was developed to help evaluate IVHM research technologies. Tables present details of specific SCFM for the incidents and accidents. Of the 370 NTSB accidents affected by SCFM, 48 percent involved the engine or fuel system, and 31 percent involved landing gear or hydraulic failure and malfunctions. A total of 35 percent of all SCFM accidents were caused by improper maintenance. Of the 7732 FAA database incidents affected by SCFM, 33 percent involved landing gear or hydraulics, and 33 percent involved the engine and fuel system. The most frequent SCFM found in ASRS were turbine engine, pressurization system, hydraulic main system, flight management system/flight management computer, and engine. Because the IVHM Project does not address maintenance issues, and landing gear and hydraulic systems accidents are usually not fatal, the focus of research should be those SCFMs that occur in the engine/fuel and flight control/structures systems as well as power systems.

  20. Whole transcriptome characterization of aberrant splicing events induced by lentiviral vector integrations

    PubMed Central

    Cesana, Daniela; Sgualdino, Jacopo; Rudilosso, Laura; Merella, Stefania; Naldini, Luigi; Montini, Eugenio


    Gamma-retroviral/lentiviral vectors (γRV/LV) with self-inactivating (SIN) long terminal repeats (LTRs) and internal moderate cellular promoters pose a reduced risk of insertional mutagenesis when compared with vectors with active LTRs. Yet, in a recent LV-based clinical trial for β-thalassemia, vector integration within the HMGA2 gene induced the formation of an aberrantly spliced mRNA form that appeared to cause clonal dominance. Using a method that we developed, cDNA linear amplification-mediated PCR, in combination with high-throughput sequencing, we conducted a whole transcriptome analysis of chimeric LV-cellular fusion transcripts in transduced human lymphoblastoid cells and primary hematopoietic stem/progenitor cells. We observed a surprising abundance of read-through transcription originating outside and inside the provirus and identified the vector sequences contributing to the aberrant splicing process. We found that SIN LV has a sharply reduced propensity to engage in aberrant splicing compared with that of vectors carrying active LTRs. Moreover, by recoding the identified vector splice sites, we reduced residual read-through transcription and demonstrated an effective strategy for improving vectors. Characterization of the mechanisms and genetic features underlying vector-induced aberrant splicing will enable the generation of safer vectors, with low impact on the cellular transcriptome. PMID:22523064

  1. Copy-choice illegitimate DNA recombination revisited.

    PubMed Central

    d'Alençon, E; Petranovic, M; Michel, B; Noirot, P; Aucouturier, A; Uzest, M; Ehrlich, S D


    Nearly precise excision of a transposon related to Tn10 from an Escherichia coli plasmid was used as a model to study illegitimate DNA recombination between short direct repeats. The excision was stimulated 100-1000 times by induction of plasmid single-stranded DNA synthesis and did not involve transfer of DNA from the parental to the progeny molecule. We conclude that it occurred by copy-choice DNA recombination, and propose that other events of recombination between short direct repeats might be a result of the same process. Images PMID:8013470

  2. Gene copy number and cell cycle arrest

    NASA Astrophysics Data System (ADS)

    Ghosh, Bhaswar; Bose, Indrani


    The cell cycle is an orderly sequence of events which ultimately lead to the division of a single cell into two daughter cells. In the case of DNA damage by radiation or chemicals, the damage checkpoints in the G1 and G2 phases of the cell cycle are activated. This results in an arrest of the cell cycle so that the DNA damage can be repaired. Once this is done, the cell continues with its usual cycle of activity. We study a mathematical model of the DNA damage checkpoint in the G2 phase which arrests the transition from the G2 to the M (mitotic) phase of the cell cycle. The tumor suppressor protein p53 plays a key role in activating the pathways leading to cell cycle arrest in mammalian systems. If the DNA damage is severe, the p53 proteins activate other pathways which bring about apoptosis, i.e., programmed cell death. Loss of the p53 gene results in the proliferation of cells containing damaged DNA, i.e., in the growth of tumors which may ultimately become cancerous. There is some recent experimental evidence which suggests that the mutation of a single copy of the p53 gene (in the normal cell each gene has two identical copies) is sufficient to trigger the formation of tumors. We study the effect of reducing the gene copy number of the p53 and two other genes on cell cycle arrest and obtain results consistent with experimental observations.

  3. Functionally integrated neural processing of linguistic and talker information: An event-related fMRI and ERP study.


    Zhang, Caicai; Pugh, Kenneth R; Mencl, W Einar; Molfese, Peter J; Frost, Stephen J; Magnuson, James S; Peng, Gang; Wang, William S-Y


    Speech signals contain information of both linguistic content and a talker's voice. Conventionally, linguistic and talker processing are thought to be mediated by distinct neural systems in the left and right hemispheres respectively, but there is growing evidence that linguistic and talker processing interact in many ways. Previous studies suggest that talker-related vocal tract changes are processed integrally with phonetic changes in the bilateral posterior superior temporal gyrus/superior temporal sulcus (STG/STS), because the vocal tract parameter influences the perception of phonetic information. It is yet unclear whether the bilateral STG is also activated by the integral processing of another parameter - pitch, which influences the perception of lexical tone information and is related to talker differences in tone languages. In this study, we conducted separate functional magnetic resonance imaging (fMRI) and event-related potential (ERP) experiments to examine the spatial and temporal loci of interactions of lexical tone and talker-related pitch processing in Cantonese. We found that the STG was activated bilaterally during the processing of talker changes when listeners attended to lexical tone changes in the stimuli and during the processing of lexical tone changes when listeners attended to talker changes, suggesting that lexical tone and talker processing are functionally integrated in the bilateral STG. It extends the previous study, providing evidence for a general neural mechanism of integral phonetic and talker processing in the bilateral STG. The ERP results show interactions of lexical tone and talker processing 500-800ms after auditory word onset (a simultaneous posterior P3b and a frontal negativity). Moreover, there is some asymmetry in the interaction, such that unattended talker changes affect linguistic processing more than vice versa, which may be related to the ambiguity that talker changes cause in speech perception and/or attention bias

  4. Functionally integrated neural processing of linguistic and talker information: An event-related fMRI and ERP study.


    Zhang, Caicai; Pugh, Kenneth R; Mencl, W Einar; Molfese, Peter J; Frost, Stephen J; Magnuson, James S; Peng, Gang; Wang, William S-Y


    Speech signals contain information of both linguistic content and a talker's voice. Conventionally, linguistic and talker processing are thought to be mediated by distinct neural systems in the left and right hemispheres respectively, but there is growing evidence that linguistic and talker processing interact in many ways. Previous studies suggest that talker-related vocal tract changes are processed integrally with phonetic changes in the bilateral posterior superior temporal gyrus/superior temporal sulcus (STG/STS), because the vocal tract parameter influences the perception of phonetic information. It is yet unclear whether the bilateral STG is also activated by the integral processing of another parameter - pitch, which influences the perception of lexical tone information and is related to talker differences in tone languages. In this study, we conducted separate functional magnetic resonance imaging (fMRI) and event-related potential (ERP) experiments to examine the spatial and temporal loci of interactions of lexical tone and talker-related pitch processing in Cantonese. We found that the STG was activated bilaterally during the processing of talker changes when listeners attended to lexical tone changes in the stimuli and during the processing of lexical tone changes when listeners attended to talker changes, suggesting that lexical tone and talker processing are functionally integrated in the bilateral STG. It extends the previous study, providing evidence for a general neural mechanism of integral phonetic and talker processing in the bilateral STG. The ERP results show interactions of lexical tone and talker processing 500-800ms after auditory word onset (a simultaneous posterior P3b and a frontal negativity). Moreover, there is some asymmetry in the interaction, such that unattended talker changes affect linguistic processing more than vice versa, which may be related to the ambiguity that talker changes cause in speech perception and/or attention bias

  5. Effects of auditory stimuli in the horizontal plane on audiovisual integration: an event-related potential study.


    Yang, Weiping; Li, Qi; Ochi, Tatsuya; Yang, Jingjing; Gao, Yulin; Tang, Xiaoyu; Takahashi, Satoshi; Wu, Jinglong


    This article aims to investigate whether auditory stimuli in the horizontal plane, particularly originating from behind the participant, affect audiovisual integration by using behavioral and event-related potential (ERP) measurements. In this study, visual stimuli were presented directly in front of the participants, auditory stimuli were presented at one location in an equidistant horizontal plane at the front (0°, the fixation point), right (90°), back (180°), or left (270°) of the participants, and audiovisual stimuli that include both visual stimuli and auditory stimuli originating from one of the four locations were simultaneously presented. These stimuli were presented randomly with equal probability; during this time, participants were asked to attend to the visual stimulus and respond promptly only to visual target stimuli (a unimodal visual target stimulus and the visual target of the audiovisual stimulus). A significant facilitation of reaction times and hit rates was obtained following audiovisual stimulation, irrespective of whether the auditory stimuli were presented in the front or back of the participant. However, no significant interactions were found between visual stimuli and auditory stimuli from the right or left. Two main ERP components related to audiovisual integration were found: first, auditory stimuli from the front location produced an ERP reaction over the right temporal area and right occipital area at approximately 160-200 milliseconds; second, auditory stimuli from the back produced a reaction over the parietal and occipital areas at approximately 360-400 milliseconds. Our results confirmed that audiovisual integration was also elicited, even though auditory stimuli were presented behind the participant, but no integration occurred when auditory stimuli were presented in the right or left spaces, suggesting that the human brain might be particularly sensitive to information received from behind than both sides.

  6. Event-related potential indices of congruency sequence effects without feature integration or contingency learning confounds.


    Larson, Michael J; Clayson, Peter E; Kirwan, C Brock; Weissman, Daniel H


    The congruency effect in Stroop-like tasks (i.e., increased response time and reduced accuracy in incongruent relative to congruent trials) is often smaller when the previous trial was incongruent as compared to congruent. This congruency sequence effect (CSE) is thought to reflect cognitive control processes that shift attention to the target and/or modulate the response engendered by the distracter differently after incongruent relative to congruent trials. The neural signatures of CSEs are therefore usually attributed to cognitive control processes that minimize distraction from irrelevant stimuli. However, CSEs in previous functional neuroimaging studies were ubiquitously confounded with feature integration and/or contingency learning processes. We therefore investigated whether a neural CSE can be observed without such confounds in a group of healthy young adults (n = 56). To this end, we combined a prime-probe task that lacks such confounds with high-density ERPs to identify, for the first time, the neural time course of confound-minimized CSEs. Replicating recent behavioral findings, we observed strong CSEs in this task for mean response time and mean accuracy. Critically, conceptually replicating prior ERP results from confounded tasks, we also observed a CSE in both the parietal conflict slow potential (conflict SP) and the frontomedial N450. These findings indicate for the first time that neural CSEs as indexed by ERPs can be observed without the typical confounds. More broadly, the present study provides a confound-minimized protocol that will help future researchers to better isolate the neural bases of control processes that minimize distraction from irrelevant stimuli. PMID:26854028

  7. An integrated model for three-dimensional cohesive sediment transport in storm event and its application on Lianyungang Harbor, China

    NASA Astrophysics Data System (ADS)

    Yang, Xiaochen; Zhang, Qinghe; Zhang, Jinfeng; Tan, Feng; Wu, Yuru; Zhang, Na; Yang, Hua; Pang, Qixiu


    Prediction of cohesive sediment transport in storm process is important for both navigation safety and environment of the coastal zone. The difficulties to simulate cohesive sediment transport for a small-scale area such as around a harbor during storm events mainly include the low spatial resolution of the present reanalysis atmosphere forcing, the complex hydrodynamic and sediment transport processes, and their interactions. In this paper, an integrated atmosphere-wave-3D hydrodynamic and cohesive sediment transport model with unstructured grid, which is comprised of the Weather Research and Forecasting (WRF) model, Simulating WAves Nearshore (SWAN) model, and Finite-Volume Coastal Ocean Model (FVCOM), was developed to solve the abovementioned problems. For cohesive sediment, the flocculation and hindered settling were included, and a self-weight consolidation processes was introduced to the existing FVCOM. Interactions between components were considered by providing data fields to each other in an offline manner. The integrated model was applied to simulate cohesive sediment transport around Lianyungang Harbor, China, during Typhoon Wipha in 2007. Results identify that the atmosphere model WRF performed better in the simulation of wind field during typhoon process compared with QuikSCAT/National Centers for Environmental Prediction (QSCAT/NCEP) data. Simulation of wave model was directly affected by wind results as wave vector field driven by WRF wind field showed anticlockwise vortex while waves driven by QSCAT/NCEP wind field did not. The influence of water elevation and flow field on waves was great at the nearshore area. However, the effect of wave on current was not apparent, while the wind field played a more important role, especially on the current velocity. The cohesive sediment transport was greatly affected by wave due to the combined wave-current-induced shear stress. In general, simulation results of wind, wave, current, and sediment showed

  8. Multiple Events of Allopolyploidy in the Evolution of the Racemose Lineages in Prunus (Rosaceae) Based on Integrated Evidence from Nuclear and Plastid Data.


    Zhao, Liang; Jiang, Xi-Wang; Zuo, Yun-Juan; Liu, Xiao-Lin; Chin, Siew-Wai; Haberle, Rosemarie; Potter, Daniel; Chang, Zhao-Yang; Wen, Jun


    Prunus is an economically important genus well-known for cherries, plums, almonds, and peaches. The genus can be divided into three major groups based on inflorescence structure and ploidy levels: (1) the diploid solitary-flower group (subg. Prunus, Amygdalus and Emplectocladus); (2) the diploid corymbose group (subg. Cerasus); and (3) the polyploid racemose group (subg. Padus, subg. Laurocerasus, and the Maddenia group). The plastid phylogeny suggests three major clades within Prunus: Prunus-Amygdalus-Emplectocladus, Cerasus, and Laurocerasus-Padus-Maddenia, while nuclear ITS trees resolve Laurocerasus-Padus-Maddenia as a paraphyletic group. In this study, we employed sequences of the nuclear loci At103, ITS and s6pdh to explore the origins and evolution of the racemose group. Two copies of the At103 gene were identified in Prunus. One copy is found in Prunus species with solitary and corymbose inflorescences as well as those with racemose inflorescences, while the second copy (II) is present only in taxa with racemose inflorescences. The copy I sequences suggest that all racemose species form a paraphyletic group composed of four clades, each of which is definable by morphology and geography. The tree from the combined At103 and ITS sequences and the tree based on the single gene s6pdh had similar general topologies to the tree based on the copy I sequences of At103, with the combined At103-ITS tree showing stronger support in most clades. The nuclear At103, ITS and s6pdh data in conjunction with the plastid data are consistent with the hypothesis that multiple independent allopolyploidy events contributed to the origins of the racemose group. A widespread species or lineage may have served as the maternal parent for multiple hybridizations involving several paternal lineages. This hypothesis of the complex evolutionary history of the racemose group in Prunus reflects a major step forward in our understanding of diversification of the genus and has important

  9. Multiple Events of Allopolyploidy in the Evolution of the Racemose Lineages in Prunus (Rosaceae) Based on Integrated Evidence from Nuclear and Plastid Data

    PubMed Central

    Zuo, Yun-juan; Liu, Xiao-Lin; Chin, Siew-Wai; Haberle, Rosemarie; Potter, Daniel; Chang, Zhao-Yang; Wen, Jun


    Prunus is an economically important genus well-known for cherries, plums, almonds, and peaches. The genus can be divided into three major groups based on inflorescence structure and ploidy levels: (1) the diploid solitary-flower group (subg. Prunus, Amygdalus and Emplectocladus); (2) the diploid corymbose group (subg. Cerasus); and (3) the polyploid racemose group (subg. Padus, subg. Laurocerasus, and the Maddenia group). The plastid phylogeny suggests three major clades within Prunus: Prunus-Amygdalus-Emplectocladus, Cerasus, and Laurocerasus-Padus-Maddenia, while nuclear ITS trees resolve Laurocerasus-Padus-Maddenia as a paraphyletic group. In this study, we employed sequences of the nuclear loci At103, ITS and s6pdh to explore the origins and evolution of the racemose group. Two copies of the At103 gene were identified in Prunus. One copy is found in Prunus species with solitary and corymbose inflorescences as well as those with racemose inflorescences, while the second copy (II) is present only in taxa with racemose inflorescences. The copy I sequences suggest that all racemose species form a paraphyletic group composed of four clades, each of which is definable by morphology and geography. The tree from the combined At103 and ITS sequences and the tree based on the single gene s6pdh had similar general topologies to the tree based on the copy I sequences of At103, with the combined At103-ITS tree showing stronger support in most clades. The nuclear At103, ITS and s6pdh data in conjunction with the plastid data are consistent with the hypothesis that multiple independent allopolyploidy events contributed to the origins of the racemose group. A widespread species or lineage may have served as the maternal parent for multiple hybridizations involving several paternal lineages. This hypothesis of the complex evolutionary history of the racemose group in Prunus reflects a major step forward in our understanding of diversification of the genus and has important

  10. Integrating Remote Sensing Data, Hybrid-Cloud Computing, and Event Notifications for Advanced Rapid Imaging & Analysis (Invited)

    NASA Astrophysics Data System (ADS)

    Hua, H.; Owen, S. E.; Yun, S.; Lundgren, P.; Fielding, E. J.; Agram, P.; Manipon, G.; Stough, T. M.; Simons, M.; Rosen, P. A.; Wilson, B. D.; Poland, M. P.; Cervelli, P. F.; Cruz, J.


    Space-based geodetic measurement techniques such as Interferometric Synthetic Aperture Radar (InSAR) and Continuous Global Positioning System (CGPS) are now important elements in our toolset for monitoring earthquake-generating faults, volcanic eruptions, hurricane damage, landslides, reservoir subsidence, and other natural and man-made hazards. Geodetic imaging's unique ability to capture surface deformation with high spatial and temporal resolution has revolutionized both earthquake science and volcanology. Continuous monitoring of surface deformation and surface change before, during, and after natural hazards improves decision-making from better forecasts, increased situational awareness, and more informed recovery. However, analyses of InSAR and GPS data sets are currently handcrafted following events and are not generated rapidly and reliably enough for use in operational response to natural disasters. Additionally, the sheer data volumes needed to handle a continuous stream of InSAR data sets also presents a bottleneck. It has been estimated that continuous processing of InSAR coverage of California alone over 3-years would reach PB-scale data volumes. Our Advanced Rapid Imaging and Analysis for Monitoring Hazards (ARIA-MH) science data system enables both science and decision-making communities to monitor areas of interest with derived geodetic data products via seamless data preparation, processing, discovery, and access. We will present our findings on the use of hybrid-cloud computing to improve the timely processing and delivery of geodetic data products, integrating event notifications from USGS to improve the timely processing for response, as well as providing browse results for quick looks with other tools for integrative analysis.

  11. Event-specific qualitative and quantitative polymerase chain reaction methods for detection of genetically modified rapeseed Ms8xRf3 based on the right border junctions.


    Wu, Gang; Wu, Yuhua; Xiao, Ling; Lu, Changming


    Ms8xRf3 is a genetically modified rapeseed hybrid which is widely cultivated in Canada and exported to some other countries for production of foodstuffs or fodder. In this study, the genomic sequences flanking the right borders of the integrated transgenic sequences in the Ms8xRf3 genome were characterized and showed high similarities with the bacterial artificial chromosome clone of Chinese cabbage. Event-specific qualitative polymerase chain reaction (PCR) methods were established with the primers and probes targeting the junction regions to produce a 123 base pair (bp) product for the Ms8 event and 92 bp for the Rf3 event. The absolute detection limit of qualitative PCR was 2.5 initial template copies for the Ms8 event and 50 copies for the Rf3 event. Quantitiative detection methods were established, with the absolute quantification limit being approximately 25 initial template copies.

  12. Elevated Gene Copy Number Does Not Always Explain Elevated Amylase Activities in Fishes.


    German, Donovan P; Foti, Dolly M; Heras, Joseph; Amerkhanian, Hooree; Lockwood, Brent L


    Amylase activity variation in the guts of several model organisms appears to be explained by amylase gene copy number variation. We tested the hypothesis that amylase gene copy number is always elevated in animals with high amylolytic activity. We therefore sequenced the amylase genes and examined amylase gene copy number in prickleback fishes (family Stichaeidae) with different diets including two species of convergently evolved herbivores with the elevated amylase activity phenotype. We found elevated amylase gene copy number (six haploid copies) with sequence variation among copies in one herbivore (Cebidichthys violaceus) and modest gene copy number (two to three haploid copies) with little sequence variation in the remaining taxa, which included herbivores, omnivores, and a carnivore. Few functional differences in amylase biochemistry were observed, and previous investigations showed similar digestibility among the convergently evolved herbivores with differing amylase genetics. Hence, the phenotype of elevated amylase activity can be achieved by different mechanisms (i.e., elevated expression of fewer genes, increased gene copy number, or expression of more efficient amylase proteins) with similar results. Phylogenetic and comparative genomic analyses of available fish amylase genes show mostly lineage-specific duplication events leading to gene copy number variation, although a whole-genome duplication event or chromosomal translocation may have produced multiple amylase copies in the Ostariophysi, again showing multiple routes to the same result. PMID:27327179

  13. Elevated Gene Copy Number Does Not Always Explain Elevated Amylase Activities in Fishes.


    German, Donovan P; Foti, Dolly M; Heras, Joseph; Amerkhanian, Hooree; Lockwood, Brent L


    Amylase activity variation in the guts of several model organisms appears to be explained by amylase gene copy number variation. We tested the hypothesis that amylase gene copy number is always elevated in animals with high amylolytic activity. We therefore sequenced the amylase genes and examined amylase gene copy number in prickleback fishes (family Stichaeidae) with different diets including two species of convergently evolved herbivores with the elevated amylase activity phenotype. We found elevated amylase gene copy number (six haploid copies) with sequence variation among copies in one herbivore (Cebidichthys violaceus) and modest gene copy number (two to three haploid copies) with little sequence variation in the remaining taxa, which included herbivores, omnivores, and a carnivore. Few functional differences in amylase biochemistry were observed, and previous investigations showed similar digestibility among the convergently evolved herbivores with differing amylase genetics. Hence, the phenotype of elevated amylase activity can be achieved by different mechanisms (i.e., elevated expression of fewer genes, increased gene copy number, or expression of more efficient amylase proteins) with similar results. Phylogenetic and comparative genomic analyses of available fish amylase genes show mostly lineage-specific duplication events leading to gene copy number variation, although a whole-genome duplication event or chromosomal translocation may have produced multiple amylase copies in the Ostariophysi, again showing multiple routes to the same result.

  14. Integrative transcriptome sequencing identifies trans-splicing events with important roles in human embryonic stem cell pluripotency.


    Wu, Chan-Shuo; Yu, Chun-Ying; Chuang, Ching-Yu; Hsiao, Michael; Kao, Cheng-Fu; Kuo, Hung-Chih; Chuang, Trees-Juen


    Trans-splicing is a post-transcriptional event that joins exons from separate pre-mRNAs. Detection of trans-splicing is usually severely hampered by experimental artifacts and genetic rearrangements. Here, we develop a new computational pipeline, TSscan, which integrates different types of high-throughput long-/short-read transcriptome sequencing of different human embryonic stem cell (hESC) lines to effectively minimize false positives while detecting trans-splicing. Combining TSscan screening with multiple experimental validation steps revealed that most chimeric RNA products were platform-dependent experimental artifacts of RNA sequencing. We successfully identified and confirmed four trans-spliced RNAs, including the first reported trans-spliced large intergenic noncoding RNA ("tsRMST"). We showed that these trans-spliced RNAs were all highly expressed in human pluripotent stem cells and differentially expressed during hESC differentiation. Our results further indicated that tsRMST can contribute to pluripotency maintenance of hESCs by suppressing lineage-specific gene expression through the recruitment of NANOG and the PRC2 complex factor, SUZ12. Taken together, our findings provide important insights into the role of trans-splicing in pluripotency maintenance of hESCs and help to facilitate future studies into trans-splicing, opening up this important but understudied class of post-transcriptional events for comprehensive characterization.

  15. Integrative transcriptome sequencing identifies trans-splicing events with important roles in human embryonic stem cell pluripotency

    PubMed Central

    Wu, Chan-Shuo; Yu, Chun-Ying; Chuang, Ching-Yu; Hsiao, Michael; Kao, Cheng-Fu; Kuo, Hung-Chih; Chuang, Trees-Juen


    Trans-splicing is a post-transcriptional event that joins exons from separate pre-mRNAs. Detection of trans-splicing is usually severely hampered by experimental artifacts and genetic rearrangements. Here, we develop a new computational pipeline, TSscan, which integrates different types of high-throughput long-/short-read transcriptome sequencing of different human embryonic stem cell (hESC) lines to effectively minimize false positives while detecting trans-splicing. Combining TSscan screening with multiple experimental validation steps revealed that most chimeric RNA products were platform-dependent experimental artifacts of RNA sequencing. We successfully identified and confirmed four trans-spliced RNAs, including the first reported trans-spliced large intergenic noncoding RNA (“tsRMST”). We showed that these trans-spliced RNAs were all highly expressed in human pluripotent stem cells and differentially expressed during hESC differentiation. Our results further indicated that tsRMST can contribute to pluripotency maintenance of hESCs by suppressing lineage-specific gene expression through the recruitment of NANOG and the PRC2 complex factor, SUZ12. Taken together, our findings provide important insights into the role of trans-splicing in pluripotency maintenance of hESCs and help to facilitate future studies into trans-splicing, opening up this important but understudied class of post-transcriptional events for comprehensive characterization. PMID:24131564

  16. Basic psychological needs and neurophysiological responsiveness to decisional conflict: an event-related potential study of integrative self processes.


    Di Domenico, Stefano I; Le, Ada; Liu, Yichuan; Ayaz, Hasan; Fournier, Marc A


    Fulfillment of the basic psychological needs for competence, relatedness, and autonomy is believed to facilitate people's integrative tendencies to process psychological conflicts and develop a coherent sense of self. The present study therefore used event-related potentials (ERPs) to examine the relation between need fulfillment and the amplitude of conflict negativity (CN), a neurophysiological measure of conflict during personal decision making. Participants completed a decision-making task in which they made a series of forced choices according to their personal preferences. Three types of decision-making situations were created on the basis of participants' unique preference ratings, which were obtained prior to ERP recording: low-conflict situations (choosing between an attractive and an unattractive option), high-conflict approach-approach situations (choosing between two similarly attractive options), and high-conflict avoidance-avoidance situations (choosing between two similarly unattractive options). As expected, CN amplitudes were larger in high- relative to low-conflict situations, and source localization analyses suggested that the anterior cingulate cortex was the generating structure of the CN. Most importantly, people reporting higher need fulfillment exhibited larger CN amplitudes in avoidance-avoidance situations relative to low-conflict situations; to a lesser extent, they also exhibited larger CN amplitudes in approach-approach situations relative to low-conflict situations. By contrast, people reporting lower need fulfillment exhibited CN amplitudes that poorly discriminated the three decision situations. These results suggest that need fulfillment may promote self-coherent functioning by increasing people's receptivity to and processing of events that challenge their abilities to make efficient, self-congruent choices.

  17. Zero-Copy Objects System

    NASA Technical Reports Server (NTRS)

    Burleigh, Scott C.


    Zero-Copy Objects System software enables application data to be encapsulated in layers of communication protocol without being copied. Indirect referencing enables application source data, either in memory or in a file, to be encapsulated in place within an unlimited number of protocol headers and/or trailers. Zero-copy objects (ZCOs) are abstract data access representations designed to minimize I/O (input/output) in the encapsulation of application source data within one or more layers of communication protocol structure. They are constructed within the heap space of a Simple Data Recorder (SDR) data store to which all participating layers of the stack must have access. Each ZCO contains general information enabling access to the core source data object (an item of application data), together with (a) a linked list of zero or more specific extents that reference portions of this source data object, and (b) linked lists of protocol header and trailer capsules. The concatenation of the headers (in ascending stack sequence), the source data object extents, and the trailers (in descending stack sequence) constitute the transmitted data object constructed from the ZCO. This scheme enables a source data object to be encapsulated in a succession of protocol layers without ever having to be copied from a buffer at one layer of the protocol stack to an encapsulating buffer at a lower layer of the stack. For large source data objects, the savings in copy time and reduction in memory consumption may be considerable.

  18. 1 CFR 18.5 - Certified copies.

    Code of Federal Regulations, 2010 CFR


    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Certified copies. 18.5 Section 18.5 General... DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.5 Certified copies. The certified copies or duplicate originals of each document must be submitted with the original. Each copy or...

  19. Gene Copy-Number Polymorphism Caused by Retrotransposition in Humans

    PubMed Central

    Galante, Pedro A. F.; Parmigiani, Raphael B.; Camargo, Anamaria A.; Hahn, Matthew W.; de Souza, Sandro J.


    The era of whole-genome sequencing has revealed that gene copy-number changes caused by duplication and deletion events have important evolutionary, functional, and phenotypic consequences. Recent studies have therefore focused on revealing the extent of variation in copy-number within natural populations of humans and other species. These studies have found a large number of copy-number variants (CNVs) in humans, many of which have been shown to have clinical or evolutionary importance. For the most part, these studies have failed to detect an important class of gene copy-number polymorphism: gene duplications caused by retrotransposition, which result in a new intron-less copy of the parental gene being inserted into a random location in the genome. Here we describe a computational approach leveraging next-generation sequence data to detect gene copy-number variants caused by retrotransposition (retroCNVs), and we report the first genome-wide analysis of these variants in humans. We find that retroCNVs account for a substantial fraction of gene copy-number differences between any two individuals. Moreover, we show that these variants may often result in expressed chimeric transcripts, underscoring their potential for the evolution of novel gene functions. By locating the insertion sites of these duplicates, we are able to show that retroCNVs have had an important role in recent human adaptation, and we also uncover evidence that positive selection may currently be driving multiple retroCNVs toward fixation. Together these findings imply that retroCNVs are an especially important class of polymorphism, and that future studies of copy-number variation should search for these variants in order to illuminate their potential evolutionary and functional relevance. PMID:23359205

  20. Chromatic adaptation in hard copy/soft copy comparisons

    NASA Astrophysics Data System (ADS)

    Fairchild, Mark D.


    The human visual system has evolved with a sophisticated set of mechanisms to produce stable perceptions of object colors across changes in illumination. This phenomenon is typically referred to as chromatic adaptation or color constancy. When viewing scenes or hard-copy reproductions, it is generally assumed that one adapts almost completely to the color and luminance of the prevailing light source. This is likely not the case when soft-copy image displays are viewed. Differences in the degree of chromatic adaptation to hard-copy and soft- copy displays point to two types of chromatic-adaptation mechanisms: sensory and cognitive. Sensory mechanisms are those that act automatically in response to the stimulus, such as retinal gain control. Cognitive mechanisms are those that rely on observers' knowledge of scene content. A series of experiments that measured the spatial, temporal, and chromatic properties of chromatic-adaptation mechanisms are reviewed and a mathematical model for predicting these chromatic adaptation effects is briefly described along with some practical recommendations, based on psychophysical experiments, on how to approach these problems in typical cross-media color reproduction situations.

  1. Event Analysis of Systemic Teamwork (EAST): a novel integration of ergonomics methods to analyse C4i activity.


    Walker, Guy H; Gibson, Huw; Stanton, Neville A; Baber, Chris; Salmon, Paul; Green, Damian

    C4i is defined as the management infrastructure needed for the execution of a common goal supported by multiple agents in multiple locations and technology. In order to extract data from complex and diverse C4i scenarios a descriptive methodology called Event Analysis for Systemic Teamwork (EAST) has been developed. With over 90 existing ergonomics methodologies already available, the approach taken was to integrate a hierarchical task analysis, a coordination demand analysis, a communications usage diagram, a social network analysis, and the critical decision method. The outputs of these methods provide two summary representations in the form of an enhanced operation sequence diagram and a propositional network. These offer multiple overlapping perspectives on key descriptive constructs including who the agents are in a scenario, when tasks occur, where agents are located, how agents collaborate and communicate, what information is used, and what knowledge is shared. The application of these methods to live data drawn from the UK rail industry demonstrates how alternative scenarios can be compared on key metrics, how multiple perspectives on the same data can be taken, and what further detailed insights can be extracted. The ultimate aim of EAST is, by applying it across a number of scenarios in different civil and military domains, to provide data to develop generic models of C4i activity and to improve the design of systems aimed at enhancing this management infrastructure. PMID:17008260

  2. Integral probability of auroral electron flux events from SSJ/4 DMSP F9 electron measurements. Interim report

    SciTech Connect

    Hardy, D.A.; Bounar, K.H.


    A study has been completed to determine the probability of observing different levels of auroral electron precipitation both within fixed spatial elements in magnetic local time and corrected geomagnetic latitude, and within spatial elements when the magnetic local time is fixed but the latitude range can be varied. The auroral electron precipitation probability is defined for a series of thresholds in electron average energy and electron energy flux as a function of geomagnetic activity. The study provides the capability to determine the probability of observation of an auroral electron precipitation event for any specified threshold in average energy, energy flux, and level of geomagnetic activity for any location in the auroral region or for any line of sight through the auroral region. The input for the study is one year of data from the SSJ/4 electron and proton spectrometer flown on the F9 satellite of the Defense Meteorological Satellite Program (DMSP) comprising approximately 10, 141 hemispheric passes through the auroral region. The binning technique used to determine these probabilities is presented and some results are discussed. The operation of the software package to display the probability results is described. Defense Meteorological Satellite Program (DMSP), Aurora, Precipitating electrons, Geomagnetic Kp index, Integral probability.

  3. Using the Integration of Discrete Event and Agent-Based Simulation to Enhance Outpatient Service Quality in an Orthopedic Department.


    Kittipittayakorn, Cholada; Ying, Kuo-Ching


    Many hospitals are currently paying more attention to patient satisfaction since it is an important service quality index. Many Asian countries' healthcare systems have a mixed-type registration, accepting both walk-in patients and scheduled patients. This complex registration system causes a long patient waiting time in outpatient clinics. Different approaches have been proposed to reduce the waiting time. This study uses the integration of discrete event simulation (DES) and agent-based simulation (ABS) to improve patient waiting time and is the first attempt to apply this approach to solve this key problem faced by orthopedic departments. From the data collected, patient behaviors are modeled and incorporated into a massive agent-based simulation. The proposed approach is an aid for analyzing and modifying orthopedic department processes, allows us to consider far more details, and provides more reliable results. After applying the proposed approach, the total waiting time of the orthopedic department fell from 1246.39 minutes to 847.21 minutes. Thus, using the correct simulation model significantly reduces patient waiting time in an orthopedic department. PMID:27195606

  4. Event Analysis of Systemic Teamwork (EAST): a novel integration of ergonomics methods to analyse C4i activity.


    Walker, Guy H; Gibson, Huw; Stanton, Neville A; Baber, Chris; Salmon, Paul; Green, Damian

    C4i is defined as the management infrastructure needed for the execution of a common goal supported by multiple agents in multiple locations and technology. In order to extract data from complex and diverse C4i scenarios a descriptive methodology called Event Analysis for Systemic Teamwork (EAST) has been developed. With over 90 existing ergonomics methodologies already available, the approach taken was to integrate a hierarchical task analysis, a coordination demand analysis, a communications usage diagram, a social network analysis, and the critical decision method. The outputs of these methods provide two summary representations in the form of an enhanced operation sequence diagram and a propositional network. These offer multiple overlapping perspectives on key descriptive constructs including who the agents are in a scenario, when tasks occur, where agents are located, how agents collaborate and communicate, what information is used, and what knowledge is shared. The application of these methods to live data drawn from the UK rail industry demonstrates how alternative scenarios can be compared on key metrics, how multiple perspectives on the same data can be taken, and what further detailed insights can be extracted. The ultimate aim of EAST is, by applying it across a number of scenarios in different civil and military domains, to provide data to develop generic models of C4i activity and to improve the design of systems aimed at enhancing this management infrastructure.

  5. Efficient Integration of Old and New Research Tools for Automating the Identification and Analysis of Seismic Reference Events

    SciTech Connect

    Wagner, Robert; Rivers, Wilmer


    any single computer program for seismic data analysis will not have all the capabilities needed to study reference events, since hese detailed studies will be highly specialized. It may be necessary to develop and test new algorithms, and then these special ;odes must be integrated with existing software to use their conventional data-processing routines. We have investigated two neans of establishing communications between the legacy and new codes: CORBA and XML/SOAP Web services. We have nvestigated making new Java code communicate with a legacy C-language program, geotool, running under Linux. Both methods vere successful, but both were difficult to implement. C programs on UNIX/Linux are poorly supported for Web services, compared vith the Java and .NET languages and platforms. Easier-to-use middleware will be required for scientists to construct distributed applications as easily as stand-alone ones. Considerable difficulty was encountered in modifying geotool, and this problem shows he need to use component-based user interfaces instead of large C-language codes where changes to one part of the program nay introduce side effects into other parts. We have nevertheless made bug fixes and enhancements to that legacy program, but t remains difficult to expand it through communications with external software.

  6. Making Sense of the Meaning Literature: An Integrative Review of Meaning Making and Its Effects on Adjustment to Stressful Life Events

    ERIC Educational Resources Information Center

    Park, Crystal L.


    Interest in meaning and meaning making in the context of stressful life events continues to grow, but research is hampered by conceptual and methodological limitations. Drawing on current theories, the author first presents an integrated model of meaning making. This model distinguishes between the constructs of global and situational meaning and…

  7. Copy number variation and mutation

    NASA Astrophysics Data System (ADS)

    Clark, Brian; Weidner, Jacob; Wabick, Kevin


    Until very recently, the standard model of DNA included two genes for each trait. This dated model has given way to a model that includes copies of some genes well in excess of the canonical two. Copy number variations in the human genome play critical roles in causing or aggravating a number of syndromes and diseases while providing increased resistance to others. We explore the role of mutation, crossover, inversion, and reproduction in determining copy number variations in a numerical simulation of a population. The numerical model consists of a population of individuals, where each individual is represented by a single strand of DNA with the same number of genes. Each gene is initially assigned to one of two traits. Fitness of the individual is determined by the two most fit genes for trait one, and trait two genetic material is treated as a reservoir of junk DNA. After a sufficient number of generations, during which the genetic distribution is allowed to reach a steady-state, the mean numberof genes per trait and the copy number variation are recorded. Here, we focus on the role of mutation and compare simulation results to theory.

  8. Using Copy Change with Trade Books to Teach Earth Science

    ERIC Educational Resources Information Center

    Bintz, William P.; Wright, Pam; Sheffer, Julie


    Developing and implementing relevant, challenging, integrative, and exploratory curriculum is critical at all levels of schooling. This article describes one attempt to develop and implement an instance of interdisciplinary curriculum by using copy change with trade books to teach earth science. Specifically, it introduces trade books as a way to…

  9. FSHD: copy number variations on the theme of muscular dystrophy

    PubMed Central

    Cabianca, Daphne Selvaggia


    In humans, copy number variations (CNVs) are a common source of phenotypic diversity and disease susceptibility. Facioscapulohumeral muscular dystrophy (FSHD) is an important genetic disease caused by CNVs. It is an autosomal-dominant myopathy caused by a reduction in the copy number of the D4Z4 macrosatellite repeat located at chromosome 4q35. Interestingly, the reduction of D4Z4 copy number is not sufficient by itself to cause FSHD. A number of epigenetic events appear to affect the severity of the disease, its rate of progression, and the distribution of muscle weakness. Indeed, recent findings suggest that virtually all levels of epigenetic regulation, from DNA methylation to higher order chromosomal architecture, are altered at the disease locus, causing the de-regulation of 4q35 gene expression and ultimately FSHD. PMID:21149563

  10. Comparative analysis of a translocated copy of the trnK intron in carnivorous family Nepenthaceae.


    Meimberg, Harald; Thalhammer, Stefan; Brachmann, Andreas; Heubl, Günther


    During phylogenetic analysis of the Nepenthaceae cpDNA trnK intron, it became apparent that a second non-functional copy of the locus was present in most of the investigated taxa. The translocation event was older than the radiation of all recent Nepenthaceae, and the translocated pseudogenized copy was conserved in nearly all members of the plant family. Using single chloroplast PCR and inverse PCR, we could exclude a plastom location for the second copy. Although translocation into the nucleus is possible, mitochondrial localization seems more likely based on these data. In total, the translocated sequence contained at least 3525 base pairs (bp) that were homologous to the Spinacia oleracea chloroplast genome. Comparative phylogenetic analysis of the non-functional copy revealed a high amount of homoplasies compared to topologies from the cpDNA trnK intron phylogenetic reconstruction. Therefore, this copy proved to be insufficient for phylogenetic reconstruction of the family. Since two different paralogs of the non-functional copy were found in one species, it is feasible that different paralogs were conserved in different groups and that paralogous sequences were included in the data matrix. These data demonstrate that phylogenetic analyses of pseudogenized copies of phylogenetically relevant loci should be performed with great caution. In addition, pseudogenized copies can exist in nearly every member of a plant family, and can be PCR-amplified at levels comparable to the specific copy. In this case, the inclusion of such copies can easily remain unnoticed, thus leading to faulty hypotheses.

  11. Gain of a New Exon by a Lineage-Specific Alu Element-Integration Event in the BCS1L Gene during Primate Evolution

    PubMed Central

    Park, Sang-Je; Kim, Young-Hyun; Lee, Sang-Rae; Choe, Se-Hee; Kim, Myung-Jin; Kim, Sun-Uk; Kim, Ji-Su; Sim, Bo-Woong; Song, Bong-Seok; Jeong, Kang-Jin; Jin, Yeung-Bae; Lee, Youngjeon; Park, Young-Ho; Park, Young Il; Huh, Jae-Won; Chang, Kyu-Tae


    BCS1L gene encodes mitochondrial protein and is a member of conserved AAA protein family. This gene is involved in the incorporation of Rieske FeS and Qcr10p into complex III of respiratory chain. In our previous study, AluYRa2-derived alternative transcript in rhesus monkey genome was identified. However, this transcript has not been reported in human genome. In present study, we conducted evolutionary analysis of AluYRa2-exonized transcript with various primate genomic DNAs and cDNAs from humans, rhesus monkeys, and crab-eating monkeys. Remarkably, our results show that AluYRa2 element has only been integrated into genomes of Macaca species. This Macaca lineage-specific integration of AluYRa2 element led to exonization event in the first intron region of BCS1L gene by producing a conserved 3′ splice site. Intriguingly, in rhesus and crab-eating monkeys, more diverse transcript variants by alternative splicing (AS) events, including exon skipping and different 5′ splice sites from humans, were identified. Alignment of amino acid sequences revealed that AluYRa2-exonized transcript has short N-terminal peptides. Therefore, AS events play a major role in the generation of various transcripts and proteins during primate evolution. In particular, lineage-specific integration of Alu elements and species-specific Alu-derived exonization events could be important sources of gene diversification in primates. PMID:26537194

  12. Copy number variation and schizophrenia.


    St Clair, David


    Over the last 12 months, a series of major articles have reported associations with schizophrenia of copy number variants at 1q21, 15q11.2, 15q13.3, 16p11.2, 22q12, and Neurexin 1 loci. These are rare high-penetrant mutations that increase risk not only of schizophrenia but also of a range of other psychiatric disorders including autism and mental retardation. In some cases, the same phenotype can occur irrespective of whether the copy number variant causes a deletion or duplication. Some of these mutations occur at very high rates in human populations, but because of reduced fecundity associated with major psychiatric disorders the overall frequency in the population remains low. These new findings raise fundamental clinical and scientific questions concerning classification of major neuropsychiatric disorders, modes of inheritance, diagnostics, and genetic counseling. Although the loci identified so far account for only a small proportion of cases, many more are likely to be discovered over the next few years. A major focus of research will be to identify the key, the genetic and environmental determinants of schizophrenia risk in carriers of these copy number variants, and to discover whether their rates of mutation are unstable or fixed. PMID:18990708

  13. 48 CFR 1501.105-3 - Copies.

    Code of Federal Regulations, 2014 CFR


    ... Purpose, Authority, Issuance 1501.105-3 Copies. Copies of the EPAAR in Federal Register and CFR form may be purchased from the Superintendent of Documents, Government Printing Office (GPO), Washington,...

  14. 48 CFR 1501.105-3 - Copies.

    Code of Federal Regulations, 2012 CFR


    ... Purpose, Authority, Issuance 1501.105-3 Copies. Copies of the EPAAR in Federal Register and CFR form may be purchased from the Superintendent of Documents, Government Printing Office (GPO), Washington,...

  15. What Triggered the Recent Melt Event at Summit, Greenland? Insights from an Integrated Suite of Ground-Based Observations

    NASA Astrophysics Data System (ADS)

    Miller, N.; Pettersen, C.; Walden, V. P.; Turner, D. D.; Shupe, M.; Bennartz, R.; Neff, W. D.; Cox, C.; Kulie, M.; Castellani, B.


    The melt extent of the Greenland Ice Sheet (GIS) has been increasing in recent decades. According to a NASA press release, satellite observations show that the GIS melt extent was an anomalously high 97% in mid-July 2012, including rare melting at high altitude locations such as Summit, Greenland. This event was also captured by ground-based observations at Summit, collected by the ICECAPS (Integrated Characterization of Energy, Clouds, Atmospheric State, and Precipitation at Summit) project. The observational data also recorded increased variability in the atmospheric state for July 2012 compared to the July 2010 and 2011. One of the outliers on 11 July 2012 produced ice melt temperatures at Summit, Greenland for the first time since observational records began. The origin of the warm airmass that affected Summit on 11 July 2012 was traced to the central United States on 1 July 2012. Instead of flowing around the southern tip of Greenland, the airmass was forced over central Greenland and thus lifted to over 3200m by the thickness of the GIS. Temperature retrievals from a microwave radiometer (MWR) observed a warm front arriving on 10 July 2012, which included RH values close to saturation as recorded by a NOAA met tower. Elevated precipitable water vapor levels suggest ripe conditions for liquid water clouds. A low level liquid cloud was observed by a micropulse lidar (MPL) and a millimeter cloud radar (MMCR) from 10-11 July 2012 with elevated liquid water content retrieved from the MWRs. Observations from an infrared spectrometer (PAERI) instrument indicate increased downwelling longwave fluxes during this time. The liquid water cloud effectively traps the heat thus limiting the surface's ability to cool radiatively. Surface-based inversions are common during clear sky scenes but liquid bearing clouds often weaken these inversions. In combination with solar heating, this can create surface temperatures warmer than the air aloft. A conceptual surface energy

  16. 48 CFR 1501.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Copies. 1501.105-3 Section 1501.105-3 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY GENERAL GENERAL Purpose, Authority, Issuance 1501.105-3 Copies. Copies of the EPAAR in Federal Register and CFR form...

  17. 48 CFR 1401.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Copies. 1401.105-3 Section 1401.105-3 Federal Acquisition Regulations System DEPARTMENT OF THE INTERIOR GENERAL DEPARTMENT OF THE INTERIOR ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 1401.105-3 Copies. Copies of...

  18. 14 CFR 1206.207 - Copies.

    Code of Federal Regulations, 2011 CFR


    ... 14 Aeronautics and Space 5 2011-01-01 2010-01-01 true Copies. 1206.207 Section 1206.207 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION AVAILABILITY OF AGENCY RECORDS TO MEMBERS OF THE PUBLIC Records Available § 1206.207 Copies. The furnishing of a single copy of the...

  19. 14 CFR 1206.207 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Copies. 1206.207 Section 1206.207 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION AVAILABILITY OF AGENCY RECORDS TO MEMBERS OF THE PUBLIC Records Available § 1206.207 Copies. The furnishing of a single copy of the...

  20. Patterns, Correlates, and Reduction of Homework Copying

    ERIC Educational Resources Information Center

    Palazzo, David J.; Lee, Young-Jin; Warnakulasooriya, Rasil; Pritchard, David E.


    Submissions to an online homework tutor were analyzed to determine whether they were copied. The fraction of copied submissions increased rapidly over the semester, as each weekly deadline approached and for problems later in each assignment. The majority of students, who copied less than 10% of their problems, worked steadily over the three days…

  1. 36 CFR 703.20 - File copies.

    Code of Federal Regulations, 2010 CFR


    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false File copies. 703.20 Section... Is Not a Party § 703.20 File copies. The Office of the General Counsel will maintain the official file of copies of all demands served on the Library and deciding officials' responses....

  2. 14 CFR § 1206.207 - Copies.

    Code of Federal Regulations, 2014 CFR


    ... 14 Aeronautics and Space 5 2014-01-01 2014-01-01 false Copies. § 1206.207 Section § 1206.207 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION AVAILABILITY OF AGENCY RECORDS TO MEMBERS OF THE PUBLIC Records Available § 1206.207 Copies. The furnishing of a single copy of the...

  3. 14 CFR 1206.207 - Copies.

    Code of Federal Regulations, 2012 CFR


    ... 14 Aeronautics and Space 5 2012-01-01 2012-01-01 false Copies. 1206.207 Section 1206.207 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION AVAILABILITY OF AGENCY RECORDS TO MEMBERS OF THE PUBLIC Records Available § 1206.207 Copies. The furnishing of a single copy of the...

  4. 14 CFR 1206.207 - Copies.

    Code of Federal Regulations, 2013 CFR


    ... 14 Aeronautics and Space 5 2013-01-01 2013-01-01 false Copies. 1206.207 Section 1206.207 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION AVAILABILITY OF AGENCY RECORDS TO MEMBERS OF THE PUBLIC Records Available § 1206.207 Copies. The furnishing of a single copy of the...

  5. 49 CFR 7.8 - Copies

    Code of Federal Regulations, 2010 CFR


    ... 49 Transportation 1 2010-10-01 2010-10-01 false Copies 7.8 Section 7.8 Transportation Office of the Secretary of Transportation PUBLIC AVAILABILITY OF INFORMATION Information Required To Be Made Public by DOT § 7.8 Copies Copies of any material covered by this subpart that is not published...

  6. 48 CFR 1.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 1.105-3 Copies. Copies of the FAR in Federal Register, loose-leaf, CD-ROM and CFR form may be purchased from the Superintendent of Documents, Government... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Copies. 1.105-3 Section...

  7. 48 CFR 3401.104-3 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... GENERAL ED ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 3401.104-3 Copies. Copies of the EDAR in the Federal Register and Code of Federal Regulations (CFR) form may be purchased from the... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Copies. 3401.104-3...

  8. 48 CFR 1001.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... TREASURY ACQUISITION REGULATORY (DTAR) SYSTEM Purpose, Authority, Issuance 1001.105-3 Copies. Copies of the DTAR in Federal Register or CFR form may be purchased from the Superintendent of Documents, Government... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Copies. 1001.105-3...

  9. 48 CFR 2001.104-3 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... REGULATORY COMMISSION ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 2001.104-3 Copies. Copies of the NRCAR in Federal Register and CFR form may be purchased from the Superintendent of Documents... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Copies. 2001.104-3...

  10. 48 CFR 901.104-3 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Copies. 901.104-3 Section 901.104-3 Federal Acquisition Regulations System DEPARTMENT OF ENERGY GENERAL FEDERAL ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 901.104-3 Copies. Copies of the DEAR published in the...

  11. 44 CFR 6.81 - Additional copies.

    Code of Federal Regulations, 2010 CFR


    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Additional copies. 6.81... HOMELAND SECURITY GENERAL IMPLEMENTATION OF THE PRIVACY ACT OF 1974 Fees § 6.81 Additional copies. A reasonable number of additional copies shall be provided for the applicable fee to a requestor who...

  12. 22 CFR 92.76 - Copying documents.

    Code of Federal Regulations, 2013 CFR


    ... 22 Foreign Relations 1 2013-04-01 2013-04-01 false Copying documents. 92.76 Section 92.76 Foreign Relations DEPARTMENT OF STATE LEGAL AND RELATED SERVICES NOTARIAL AND RELATED SERVICES Copying, Recording, Translating and Procuring Documents § 92.76 Copying documents. (a) Consular authority. The consular officer...

  13. 22 CFR 92.76 - Copying documents.

    Code of Federal Regulations, 2014 CFR


    ... 22 Foreign Relations 1 2014-04-01 2014-04-01 false Copying documents. 92.76 Section 92.76 Foreign Relations DEPARTMENT OF STATE LEGAL AND RELATED SERVICES NOTARIAL AND RELATED SERVICES Copying, Recording, Translating and Procuring Documents § 92.76 Copying documents. (a) Consular authority. The consular officer...

  14. 22 CFR 92.76 - Copying documents.

    Code of Federal Regulations, 2010 CFR


    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Copying documents. 92.76 Section 92.76 Foreign Relations DEPARTMENT OF STATE LEGAL AND RELATED SERVICES NOTARIAL AND RELATED SERVICES Copying, Recording, Translating and Procuring Documents § 92.76 Copying documents. (a) Consular authority. The consular officer...

  15. 22 CFR 92.76 - Copying documents.

    Code of Federal Regulations, 2012 CFR


    ... 22 Foreign Relations 1 2012-04-01 2012-04-01 false Copying documents. 92.76 Section 92.76 Foreign Relations DEPARTMENT OF STATE LEGAL AND RELATED SERVICES NOTARIAL AND RELATED SERVICES Copying, Recording, Translating and Procuring Documents § 92.76 Copying documents. (a) Consular authority. The consular officer...

  16. 22 CFR 92.76 - Copying documents.

    Code of Federal Regulations, 2011 CFR


    ... 22 Foreign Relations 1 2011-04-01 2011-04-01 false Copying documents. 92.76 Section 92.76 Foreign Relations DEPARTMENT OF STATE LEGAL AND RELATED SERVICES NOTARIAL AND RELATED SERVICES Copying, Recording, Translating and Procuring Documents § 92.76 Copying documents. (a) Consular authority. The consular officer...

  17. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2013 CFR


    ... H of 49 CFR part 7. ... 14 Aeronautics and Space 3 2013-01-01 2013-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents...

  18. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2011 CFR


    ... H of 49 CFR part 7. ... 14 Aeronautics and Space 3 2011-01-01 2011-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents...

  19. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2012 CFR


    ... H of 49 CFR part 7. ... 14 Aeronautics and Space 3 2012-01-01 2012-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents...

  20. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2010 CFR


    ... H of 49 CFR part 7. ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents...

  1. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2014 CFR


    ... H of 49 CFR part 7. ... 14 Aeronautics and Space 3 2014-01-01 2014-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents...

  2. Microarray analysis of copy number variation in single cells.


    Konings, Peter; Vanneste, Evelyne; Jackmaert, Sigrun; Ampe, Michèle; Verbeke, Geert; Moreau, Yves; Vermeesch, Joris Robert; Voet, Thierry


    We present a protocol for reliably detecting DNA copy number aberrations in a single human cell. Multiple displacement-amplified DNAs of a cell are hybridized to a 3,000-bacterial artificial chromosome (BAC) array and to an Affymetrix 250,000 (250K)-SNP array. Subsequent copy number calling is based on the integration of BAC probe-specific copy number probabilities that are estimated by comparing probe intensities with a single-cell whole-genome amplification (WGA) reference model for diploid chromosomes, as well as SNP copy number and loss-of-heterozygosity states estimated by hidden Markov models (HMM). All methods for detecting DNA copy number aberrations in single human cells have difficulty in confidently discriminating WGA artifacts from true genetic variants. Furthermore, some methods lack thorough validation for segmental DNA imbalance detection. Our protocol minimizes false-positive variant calling and enables uniparental isodisomy detection in single cells. Additionally, it provides quality assessment, allowing the exclusion of uninterpretable single-cell WGA samples. The protocol takes 5-7 d. PMID:22262009

  3. Accuracy estimation of foamy virus genome copying

    PubMed Central

    Gärtner, Kathleen; Wiktorowicz, Tatiana; Park, Jeonghae; Mergia, Ayalew; Rethwilm, Axel; Scheller, Carsten


    Background Foamy viruses (FVs) are the most genetically stable viruses of the retrovirus family. This is in contrast to the in vitro error rate found for recombinant FV reverse transcriptase (RT). To investigate the accuracy of FV genome copying in vivo we analyzed the occurrence of mutations in HEK 293T cell culture after a single round of reverse transcription using a replication-deficient vector system. Furthermore, the frequency of FV recombination by template switching (TS) and the cross-packaging ability of different FV strains were analyzed. Results We initially sequenced 90,000 nucleotides and detected 39 mutations, corresponding to an in vivo error rate of approximately 4 × 10-4 per site per replication cycle. Surprisingly, all mutations were transitions from G to A, suggesting that APOBEC3 activity is the driving force for the majority of mutations detected in our experimental system. In line with this, we detected a late but significant APOBEC3G and 3F mRNA by quantitative PCR in the cells. We then analyzed 170,000 additional nucleotides from experiments in which we co-transfected the APOBEC3-interfering foamy viral bet gene and observed a significant 50% drop in G to A mutations, indicating that APOBEC activity indeed contributes substantially to the foamy viral replication error rate in vivo. However, even in the presence of Bet, 35 out of 37 substitutions were G to A, suggesting that residual APOBEC activity accounted for most of the observed mutations. If we subtract these APOBEC-like mutations from the total number of mutations, we calculate a maximal intrinsic in vivo error rate of 1.1 × 10-5 per site per replication. In addition to the point mutations, we detected one 49 bp deletion within the analyzed 260000 nucleotides. Analysis of the recombination frequency of FV vector genomes revealed a 27% probability for a template switching (TS) event within a 1 kilobase (kb) region. This corresponds to a 98% probability that FVs undergo at least one

  4. Detection of the Remaining Files Copied from Removable Storage Medium

    NASA Astrophysics Data System (ADS)

    Ishizawa, Chikako; Andoh, Yuu; Nishida, Makoto

    This paper proposes a method for detecting remaining files copied from removable storage medium. The proposed method logs events that the database of a file system, “Folder”, is changed. The remaining file can be detected by tracing the sequence of logs using path/file-name matching. Our experimental result suggests that the proposed method can accurately detect remaining files left on the computer.

  5. Copying and Evolution of Neuronal Topology

    PubMed Central

    Fernando, Chrisantha; Karishma, K. K.; Szathmáry, Eörs


    We propose a mechanism for copying of neuronal networks that is of considerable interest for neuroscience for it suggests a neuronal basis for causal inference, function copying, and natural selection within the human brain. To date, no model of neuronal topology copying exists. We present three increasingly sophisticated mechanisms to demonstrate how topographic map formation coupled with Spike-Time Dependent Plasticity (STDP) can copy neuronal topology motifs. Fidelity is improved by error correction and activity-reverberation limitation. The high-fidelity topology-copying operator is used to evolve neuronal topologies. Possible roles for neuronal natural selection are discussed. PMID:19020662

  6. [Dual copy-supplement collimator].


    Wang, Z K; Lian, X; Wang, Y


    Dual Copy-Supplement Collimator consists of two lead conic sections centered on one common radioactive source and having a lot of small square holes on them. When scanning electron beams strike X-Ray target and create some X-Ray fields while passing through the primary section, they penetrate the secondary section and generate even smaller field units(FU). Using these FUs would compose various treatment fields with different energy (dosage). It is able not only to replace many existing collimators such as MLC, but also to make the conformal radiotherapy easier.

  7. Economic burden related to chemotherapy-related adverse events in patients with metastatic breast cancer in an integrated health care system

    PubMed Central

    Rashid, Nazia; Koh, Han A; Baca, Hilda C; Lin, Kathy J; Malecha, Susan E; Masaquel, Anthony


    Background Breast cancer is treated with many different modalities, including chemotherapy that can be given as a single agent or in combination. Patients often experience adverse events from chemotherapy during the cycles of treatment which can lead to economic burden. Objective The objective of this study was to evaluate costs related to chemotherapy-related adverse events in patients with metastatic breast cancer (mBC) in an integrated health care delivery system. Methods Patients with mBC newly initiated on chemotherapy were identified and the first infusion was defined as the index date. Patients were ≥18 years old at time of index date, had at least 6 months of health plan membership and drug eligibility prior to their index date. The chemotherapy adverse events were identified after the index date and during first line of chemotherapy. Episodes of care (EOC) were created using healthcare visits. Chart review was conducted to establish whether the adverse events were related to chemotherapy. Costs were calculated for each visit, including medications related to the adverse events, and aggregated to calculate the total EOC cost. Results A total of 1,682 patients with mBC were identified after applying study criteria; 54% of these patients had one or more adverse events related to chemotherapy. After applying the EOC method, there were a total of 5,475 episodes (4,185 single episodes [76.4%] and 1,290 multiple episodes [23.6%]) related to chemotherapy-related adverse events. Within single episodes, hematological (1,387 EOC, 33.1%), musculoskeletal/pain related (1,070 EOC, 25.6%), and gastrointestinal (775 EOC, 18.5%) were the most frequent adverse events. Patients with adverse events related to single EOC with anemia and neutropenia had the highest total outpatient costs with 901 EOC ($81,991) and 187 EOC ($17,017); these patients also had highest total inpatient costs with 46 EOC ($542,798) and 16 EOC ($136,768). However, within multiple episodes

  8. Low copy number of the salivary amylase gene predisposes to obesity.


    Falchi, Mario; El-Sayed Moustafa, Julia Sarah; Takousis, Petros; Pesce, Francesco; Bonnefond, Amélie; Andersson-Assarsson, Johanna C; Sudmant, Peter H; Dorajoo, Rajkumar; Al-Shafai, Mashael Nedham; Bottolo, Leonardo; Ozdemir, Erdal; So, Hon-Cheong; Davies, Robert W; Patrice, Alexandre; Dent, Robert; Mangino, Massimo; Hysi, Pirro G; Dechaume, Aurélie; Huyvaert, Marlène; Skinner, Jane; Pigeyre, Marie; Caiazzo, Robert; Raverdy, Violeta; Vaillant, Emmanuel; Field, Sarah; Balkau, Beverley; Marre, Michel; Visvikis-Siest, Sophie; Weill, Jacques; Poulain-Godefroy, Odile; Jacobson, Peter; Sjostrom, Lars; Hammond, Christopher J; Deloukas, Panos; Sham, Pak Chung; McPherson, Ruth; Lee, Jeannette; Tai, E Shyong; Sladek, Robert; Carlsson, Lena M S; Walley, Andrew; Eichler, Evan E; Pattou, Francois; Spector, Timothy D; Froguel, Philippe


    Common multi-allelic copy number variants (CNVs) appear enriched for phenotypic associations compared to their biallelic counterparts. Here we investigated the influence of gene dosage effects on adiposity through a CNV association study of gene expression levels in adipose tissue. We identified significant association of a multi-allelic CNV encompassing the salivary amylase gene (AMY1) with body mass index (BMI) and obesity, and we replicated this finding in 6,200 subjects. Increased AMY1 copy number was positively associated with both amylase gene expression (P = 2.31 × 10(-14)) and serum enzyme levels (P < 2.20 × 10(-16)), whereas reduced AMY1 copy number was associated with increased BMI (change in BMI per estimated copy = -0.15 (0.02) kg/m(2); P = 6.93 × 10(-10)) and obesity risk (odds ratio (OR) per estimated copy = 1.19, 95% confidence interval (CI) = 1.13-1.26; P = 1.46 × 10(-10)). The OR value of 1.19 per copy of AMY1 translates into about an eightfold difference in risk of obesity between subjects in the top (copy number > 9) and bottom (copy number < 4) 10% of the copy number distribution. Our study provides a first genetic link between carbohydrate metabolism and BMI and demonstrates the power of integrated genomic approaches beyond genome-wide association studies. PMID:24686848

  9. Copy Number Alterations in Prostate Tumors and Disease Aggressiveness

    PubMed Central

    Cheng, Iona; Levin, Albert M.; Tai, Yu Chuan; Plummer, Sarah; Chen, Gary K.; Neslund-Dudas, Christine; Casey, Graham; Rybicki, Benjamin A.; Witte, John S.


    Detecting genomic alterations that result in more aggressive prostate cancer may improve clinical treatment and our understanding of the biology underlying this common but complex disease. To this end, we undertook a genome-wide copy number alterations (CNAs) study of clinicopathological characteristics of 62 prostate tumors using the Illumina 1M SNP array. The highest overall frequencies of CNAs were on chromosomes 8q (gains), 8p (loss and copy-neutral) and 6q (copy-loss). Combined loss and copy-neutral events were associated with increasing disease grade (p=0.03), stage (p=0.01), and diagnostic PSA (p=0.01). Further evaluation of CNAs using gene ontology identified pathways involved with disease aggressiveness. The ‘regulation of apoptosis’ pathway was associated with stage of disease (p=0.004), while the ‘reproductive cellular process’ pathway was associated with diagnostic PSA (p=0.00038). Specific genes within these pathways exhibited strong associations with clinical characteristics; for example, in the apoptosis pathway BNIP3L was associated with increasing prostate tumor stage (p=0.007). These findings confirm known regions of CNAs in prostate cancer, and localize additional regions and possible genes (e.g., BNIP3L, WWOX, and GATM) that may help clarify the genetic basis of prostate cancer aggressiveness. PMID:21965145

  10. Escherichia coli minichromosomes: random segregation and absence of copy number control.


    Jensen, M R; Løbner-Olesen, A; Rasmussen, K V


    Minichromosomes, i.e. plasmids that can replicate from an integrated oriC, have been puzzling because of their high copy numbers compared to that of the chromosomal oriC, their lack of incompatibility with the chromosome and their high loss frequencies. Using single cell resistance to tetracycline or ampicillin as an indicator of copy number we followed the development of minichromosome distributions in Escherichia coli cells transformed with minichromosomes and then allowed to grow towards the steady state. The final copy number distribution was not reached within 15 to 20 generations. If the minichromosome carried the sop (partitioning) genes from plasmid F, the development of the copy number distribution was further drastically delayed. We conclude that E. coli cells have no function that directly controls minichromosomal copy numbers, hence the absence of incompatibility in the sense of shared copy number control. We suggest that minichromosomes are subject to the same replication control as the chromosome but segregate randomly in the absence of integrated partitioning genes. This, combined with evidence that the lowest copy number classes are normally present despite high average copy numbers, can account for the high loss frequencies.

  11. Aggregate Remote Memory Copy Interface


    The purpose of the Aggregate Remote Memory Copy (ARMCI) library is to provide a general- purpose, efficient, and Widely portable remote memory access (RMA) operations (one-sided communication) optimized for Contiguous and noncontiguous (strided, scatter/gather, I/O vector) data transfers. In addition, ARMCI includes a set of atomic and mutual exclusion operations. The development ARMCI is driven by the need to support the global-addres space communication model in context of distributed regular or irregular distributed data structures,more » communication libraries, and compilers. ARMCI is a standalone system that could be used to support user-level libraries and applications that use MPI or PVM.« less

  12. Tephrochronology and the extended intimate (integration of ice-core, marine and terrestrial records) event stratigraphy 8-128 ka b2k

    NASA Astrophysics Data System (ADS)

    Blockley, Simon P. E.; Bourne, Anna J.; Brauer, Achim; Davies, Siwan M.; Hardiman, Mark; Harding, Poppy R.; Lane, Christine S.; MacLeod, Alison; Matthews, Ian P.; Pyne-O'Donnell, Sean D. F.; Rasmussen, Sune O.; Wulf, Sabine; Zanchetta, Giovanni


    The comparison of palaeoclimate records on their own independent timescales is central to the work of the INTIMATE (INTegrating Ice core, MArine and TErrestrial records) network. For the North Atlantic region, an event stratigraphy has been established from the high-precision Greenland ice-core records and the integrated GICC05 chronology. This stratotype provides a palaeoclimate signal to which the timing and nature of palaeoenvironmental change recorded in marine and terrestrial archives can be compared. To facilitate this wider comparison, without assuming synchroneity of climatic change/proxy response, INTIMATE has also focussed on the development of tools to achieve this. In particular the use of time-parallel marker horizons e.g. tephra layers (volcanic ash). Coupled with the recent temporal extension of the Greenland stratotype, as part of this special issue, we present an updated INTIMATE event stratigraphy highlighting key tephra horizons used for correlation across Europe and the North Atlantic. We discuss the advantages of such an approach, and the key challenges for the further integration of terrestrial palaeoenvironmental records with those from ice cores and the marine realm.

  13. A spatio-temporal reconstruction of sea surface temperature during Dansgaard-Oeschger events from model-data integration

    NASA Astrophysics Data System (ADS)

    Jensen, Mari F.; Nummelin, Aleksi; Borg Nielsen, Søren; Sadatzki, Henrik; Sessford, Evangeline; Kleppin, Hannah; Risebrobakken, Bjørg; Born, Andreas


    Proxy data suggests a large variability in the North Atlantic sea surface temperature (SST) and sea ice cover during the Dansgaard Oeschger (DO) events of the last glacial. However, the mechanisms behind these changes are still debated. It is not clear whether the ocean temperatures are controlled by forced changes in the northward ocean heat transport or by local surface fluxes, or if, instead, the SST changes can be explained by internal variability. We address these questions by analyzing a full DO event using proxy-surrogate reconstructions. This method provides a means to extrapolate the temporally accurate information from scarce proxy reconstructions with the spatial and physical consistency of climate models. Model simulations are treated as a pool of possible ocean states from which the closest match to the reconstructions, e.g., one model year, is selected based on an objective cost function. The original chronology of the model is replaced by that of the proxy data. Repeating this algorithm for each proxy time step yields a comprehensive four-dimensional dataset that is consistent with reconstructed data. In addition, the solution also includes variables and locations for which no reconstructions exist. We show that by only using climate model data from the preindustrial control simulations, we are able to reconstruct the SST variability in the subpolar gyre region over the DO event. In the eastern Nordic Seas, on the other hand, we lack the amplitude of the variations while capturing the temporal pattern. Based on our analysis, we suggest that the variability of the subpolar gyre during the analyzed DO event can be explained by internal variability of the climate system alone. Further research is needed to explain whether the lacking amplitude in the Nordic Seas is due to the model deficiencies or if external forcing or some feedback mechanisms could give rise to larger SST variability.

  14. Effects of Toys on the Social Behavior of Preschool Children in Integrated and Nonintegrated Groups: Investigation of a Setting Event.

    ERIC Educational Resources Information Center

    Martin, Sylvia S.; And Others


    Eighteen handicapped and six nonhandicapped preschool children were observed during free play time. Children engaged in social behavior more often when playing with toys classified as social toys compared to isolate toys, and the incidence of social play was higher in integrated groups than in nonintegrated groups. (Author/JDD)

  15. Simple approach to soft-copy quality monitoring

    NASA Astrophysics Data System (ADS)

    Reiker, Gregory G.; Gohel, Nilesh R.; Muka, Edward; Blaine, G. James


    As presentation of medical radiographic images on soft-copy displays (cathode ray tubes) becomes increasingly prevalent in electronic radiography, methods of quality assurance must be developed to ensure that radiologists can effectively transfer film-based reading skills. Luminance measurements provide the basis for evaluating the state of soft-copy displays. An integrated approach has been implemented at Mallinckrodt Institute of Radiology (MIR) which facilitates measurement of geographically distributed soft-copy displays with centralized data logging, performance tracking and calibration. MIR''s central radiology image manager (RIM) exercises the display station which drives the monitor, harvests the measurement data, stores the results and submits the resulting data for additional processing. The luminance measurements are collected by a small, portable photometric instrument designed at MIR that includes a serial port which is accessed via local area terminal service (LAT) supported by the RIM. The design details of the photometric instrument and example luminance characteristics of several soft-copy displays used at the Mallinckrodt Institute are presented in this paper.

  16. Copy Number Variation in the Horse Genome

    PubMed Central

    Ghosh, Sharmila; Qu, Zhipeng; Das, Pranab J.; Fang, Erica; Juras, Rytis; Cothran, E. Gus; McDonell, Sue; Kenney, Daniel G.; Lear, Teri L.; Adelson, David L.; Chowdhary, Bhanu P.; Raudsepp, Terje


    We constructed a 400K WG tiling oligoarray for the horse and applied it for the discovery of copy number variations (CNVs) in 38 normal horses of 16 diverse breeds, and the Przewalski horse. Probes on the array represented 18,763 autosomal and X-linked genes, and intergenic, sub-telomeric and chrY sequences. We identified 258 CNV regions (CNVRs) across all autosomes, chrX and chrUn, but not in chrY. CNVs comprised 1.3% of the horse genome with chr12 being most enriched. American Miniature horses had the highest and American Quarter Horses the lowest number of CNVs in relation to Thoroughbred reference. The Przewalski horse was similar to native ponies and draft breeds. The majority of CNVRs involved genes, while 20% were located in intergenic regions. Similar to previous studies in horses and other mammals, molecular functions of CNV-associated genes were predominantly in sensory perception, immunity and reproduction. The findings were integrated with previous studies to generate a composite genome-wide dataset of 1476 CNVRs. Of these, 301 CNVRs were shared between studies, while 1174 were novel and require further validation. Integrated data revealed that to date, 41 out of over 400 breeds of the domestic horse have been analyzed for CNVs, of which 11 new breeds were added in this study. Finally, the composite CNV dataset was applied in a pilot study for the discovery of CNVs in 6 horses with XY disorders of sexual development. A homozygous deletion involving AKR1C gene cluster in chr29 in two affected horses was considered possibly causative because of the known role of AKR1C genes in testicular androgen synthesis and sexual development. While the findings improve and integrate the knowledge of CNVs in horses, they also show that for effective discovery of variants of biomedical importance, more breeds and individuals need to be analyzed using comparable methodological approaches. PMID:25340504

  17. Copy number variation in the horse genome.


    Ghosh, Sharmila; Qu, Zhipeng; Das, Pranab J; Fang, Erica; Juras, Rytis; Cothran, E Gus; McDonell, Sue; Kenney, Daniel G; Lear, Teri L; Adelson, David L; Chowdhary, Bhanu P; Raudsepp, Terje


    We constructed a 400K WG tiling oligoarray for the horse and applied it for the discovery of copy number variations (CNVs) in 38 normal horses of 16 diverse breeds, and the Przewalski horse. Probes on the array represented 18,763 autosomal and X-linked genes, and intergenic, sub-telomeric and chrY sequences. We identified 258 CNV regions (CNVRs) across all autosomes, chrX and chrUn, but not in chrY. CNVs comprised 1.3% of the horse genome with chr12 being most enriched. American Miniature horses had the highest and American Quarter Horses the lowest number of CNVs in relation to Thoroughbred reference. The Przewalski horse was similar to native ponies and draft breeds. The majority of CNVRs involved genes, while 20% were located in intergenic regions. Similar to previous studies in horses and other mammals, molecular functions of CNV-associated genes were predominantly in sensory perception, immunity and reproduction. The findings were integrated with previous studies to generate a composite genome-wide dataset of 1476 CNVRs. Of these, 301 CNVRs were shared between studies, while 1174 were novel and require further validation. Integrated data revealed that to date, 41 out of over 400 breeds of the domestic horse have been analyzed for CNVs, of which 11 new breeds were added in this study. Finally, the composite CNV dataset was applied in a pilot study for the discovery of CNVs in 6 horses with XY disorders of sexual development. A homozygous deletion involving AKR1C gene cluster in chr29 in two affected horses was considered possibly causative because of the known role of AKR1C genes in testicular androgen synthesis and sexual development. While the findings improve and integrate the knowledge of CNVs in horses, they also show that for effective discovery of variants of biomedical importance, more breeds and individuals need to be analyzed using comparable methodological approaches.

  18. A Framework of Knowledge Integration and Discovery for Supporting Pharmacogenomics Target Predication of Adverse Drug Events: A Case Study of Drug-Induced Long QT Syndrome.


    Jiang, Guoqian; Wang, Chen; Zhu, Qian; Chute, Christopher G


    Knowledge-driven text mining is becoming an important research area for identifying pharmacogenomics target genes. However, few of such studies have been focused on the pharmacogenomics targets of adverse drug events (ADEs). The objective of the present study is to build a framework of knowledge integration and discovery that aims to support pharmacogenomics target predication of ADEs. We integrate a semantically annotated literature corpus Semantic MEDLINE with a semantically coded ADE knowledgebase known as ADEpedia using a semantic web based framework. We developed a knowledge discovery approach combining a network analysis of a protein-protein interaction (PPI) network and a gene functional classification approach. We performed a case study of drug-induced long QT syndrome for demonstrating the usefulness of the framework in predicting potential pharmacogenomics targets of ADEs.

  19. A Framework of Knowledge Integration and Discovery for Supporting Pharmacogenomics Target Predication of Adverse Drug Events: A Case Study of Drug-Induced Long QT Syndrome

    PubMed Central

    Jiang, Guoqian; Wang, Chen; Zhu, Qian; Chute, Christopher G.


    Knowledge-driven text mining is becoming an important research area for identifying pharmacogenomics target genes. However, few of such studies have been focused on the pharmacogenomics targets of adverse drug events (ADEs). The objective of the present study is to build a framework of knowledge integration and discovery that aims to support pharmacogenomics target predication of ADEs. We integrate a semantically annotated literature corpus Semantic MEDLINE with a semantically coded ADE knowledgebase known as ADEpedia using a semantic web based framework. We developed a knowledge discovery approach combining a network analysis of a protein-protein interaction (PPI) network and a gene functional classification approach. We performed a case study of drug-induced long QT syndrome for demonstrating the usefulness of the framework in predicting potential pharmacogenomics targets of ADEs. PMID:24303306

  20. Time-stratigraphic reconstruction and integration of paleopedologic, sedimentologic, and biotic events (Willwood Formation, Lower Eocene, northwest Wyoming, USA)

    USGS Publications Warehouse

    Bown, T.M.; Kraus, M.J.


    An empirically-based model is advanced using paleosol maturities to estimate the relative geologic time separating any stratigraphic levels within the lower Eocene Willwood Formation. The reviewed Willwood time stratigraphy from this analysis helps evaluate the nature, tempo, and possible causes of three major episodes of mammalian appearance and disappearance. These faunal events are directly correlated with certain apects of paleosol evolution in the Willwood Formation. That evolution is tied directly to climatic changes and to varying sediment accumulation rates in response to tectonism. -from Authors

  1. 48 CFR 401.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 401.105-3 Copies. Copies of the AGAR published in CFR form may be purchased from the Superintendent of Documents, Government Printing Office, Washington, D.C. 20402. Requests should reference Chapter 4 of Title 48 CFR....

  2. 48 CFR 401.105-3 - Copies.

    Code of Federal Regulations, 2011 CFR


    ... ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 401.105-3 Copies. Copies of the AGAR published in CFR form may be purchased from the Superintendent of Documents, Government Printing Office, Washington, D.C. 20402. Requests should reference Chapter 4 of Title 48 CFR....

  3. Copy-Editing: The Cambridge Handbook.

    ERIC Educational Resources Information Center

    Butcher, Judith

    This handbook is designed as a reference manual for copy editors who prepare typescript for printing. It deals with the following topics: the copy editor's function; the work to be done at each stage in the production process; some difficult points of spelling, capitalization, and other features collectively known as "house style"; the parts of a…

  4. 14 CFR 249.4 - Photographic copies.

    Code of Federal Regulations, 2010 CFR


    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Photographic copies. 249.4 Section 249.4 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS PRESERVATION OF AIR CARRIER RECORDS General Instructions § 249.4 Photographic copies. (a)...

  5. 22 CFR 401.13 - Copies required.

    Code of Federal Regulations, 2010 CFR


    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Copies required. 401.13 Section 401.13 Foreign Relations INTERNATIONAL JOINT COMMISSION, UNITED STATES AND CANADA RULES OF PROCEDURE Applications § 401.13 Copies required. (a) Subject to paragraph (c) of this section, two duplicate originals and fifty...

  6. 48 CFR 601.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Copies. 601.105-3 Section 601.105-3 Federal Acquisition Regulations System DEPARTMENT OF STATE GENERAL DEPARTMENT OF STATE ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 601.105-3 Copies. The DOSAR is available...

  7. 48 CFR 201.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Copies. 201.105-3 Section 201.105-3 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE GENERAL FEDERAL ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 201.105-3 Copies....

  8. 48 CFR 3001.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Copies. 3001.105-3 Section 3001.105-3 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND SECURITY....105-3 Copies. The HSAR is available in the Federal Register and electronically at...

  9. 48 CFR 501.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR


    ... SERVICES ADMINISTRATION ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 501.105-3 Copies. The GSAR in CFR form may be purchased from: Superintendent of Documents, Government Printing Office... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Copies. 501.105-3...

  10. Reconstruction of multiple tectonic events in continental margins by integrated tectonostratigraphic and geochronological analysis: the Mesozoic to Paleogene Caribbean-South American interaction in northeastern Colombia

    NASA Astrophysics Data System (ADS)

    Cardona, Agustin; Montes, Camilo; Bayona, German; Valencia, Victor; Ramirez, Diego; Zapata, Sebastian; Lara, Mario; Lopez-Martinez, Margarita; Thomson, Stuart; Weber, Marion


    Although the older record and successive tectonic scenarios experienced by a continental margin is commonly fragmentary, integrated field, petrological and geochronological analysis can reconstruct the long term tectonic evolution of continental margins and characterized major controls on the orogenic style. We present new geochronological constraints from igneous and low to very low grade metasedimentary rocks from the Caribbean continental margin of northeastern Colombia (Guajira region) in order to reconstruct the different tectonic events recorded by the margin before, during and following the arc-continent collision with the front of the Caribbean plate. Zircon U-Pb LA-ICP-MS geochronology results from leucogranites associated with garnet amphibolites, tonalites and volcanic rocks that made the continental basement of northeastern Colombia reveals and Early to Middle Mesozoic tectonic activity with peaks at ca. 220-230 Ma and 170-180 Ma. This magmatic record is related to a collisional belt link to the final agglutination of Pangea and was followed by an overimposed far field back-arc setting associated to the subduction of the Pacific (Farrallon) plate under the Pangea supercontinent. Muscovite and biotite Ar-Ar geochronology from basement rocks and low grade Mesozoic metasediments also reveals the existence of Middle Jurassic to Early Cretaceous thermal events link to the final opening of the proto-Caribbean ocean. The South American continental margin was subsequently affected by an arc-continent collisional event with the front of the Caribbean plate. This event is recorded by the growth of a Banda-type collisional melange that mixed South American continental margin sediments with mafic and ultramafic blocks of intra-oceanic arc origin, the formation of a coherent metasedimentary belt also made of South American margin sediments, and the mylonitization of the continental basement. Ar-Ar temporal constraints on the low grade metasedimentary rocks and

  11. Structure and mechanism of COPI vesicle biogenesis.


    Jackson, Lauren P


    Distinct trafficking pathways within the secretory and endocytic systems ensure prompt and precise delivery of specific cargo molecules to different cellular compartments via small vesicular (50-150nm) and tubular carriers. The COPI vesicular coat is required for retrograde trafficking from the cis-Golgi back to the ER and within the Golgi stack. Recent structural data have been obtained from X-ray crystallographic studies on COPI coat components alone and on COPI subunits in complex with either cargo motifs or Arf1, and from reconstructions of COPI coated vesicles by electron tomography. These studies provide important molecular information and indicate key differences in COPI coat assembly as compared with clathrin-based and COPII-based coats. PMID:24840894

  12. Time-stratigraphic reconstruction and integration of paleopedologic, sedimentologic, and biotic events (Willwood Formation, lower Eocene, northwest Wyoming, USA)

    SciTech Connect

    Brown, T.M. ); Kraus, M.J. )


    Relative paleosol maturities are inversely proportional to the accumulation rates of the sediment upon which they formed, and are therefore excellent relative indicators of how much geologic time elapsed between any two horizons. An empirically-based model is advanced using paleosol maturities to estimate the relative geologic time separating any stratigraphic levels within the lower Eocene Willwood Formation. The revised Willwood time stratigraphy from this analysis helps evaluate the nature, tempo, and possible causes of three major episodes of mammalian appearance and disappearance. These faunal events are directly correlated with certain aspects of paleosol evolution in the Willwood Formation. That evolution is tied directly to climatic changes and to varying sediment accumulation rates in response to tectonism. The first faunal turnover occurs at the base of the Willwood Formation. It coincides with a major increase in pedogenic maturity, reflecting a major decrease in sediment accumulation rate, and accompanying general climatic warming at about the time of the Paleocene-Eocene boundary. Throughout the remainder of Willwood time, there was a gradual, yet continual, decrease in paleosol maturity and degree of hydromorphy, probably related to the progressive structural elevation of the Owl Creek antiform bounding the south and southeast margins of the Bighorn Basin. This gradual decrease was punctuated by two intervals of more significant decline in paleosol maturity and in the incidence of hydromorphic soils. Both intervals are also marked by faunal turnovers. These sedimentologic and biologic events may reflect tectonic, periods when the rate of basin subsidence increased more rapidly. 58 refs., 7 figs., 2 tabs.

  13. Integration of Harvest and Time-to-Event Data Used to Estimate Demographic Parameters for White-tailed Deer

    NASA Astrophysics Data System (ADS)

    Norton, Andrew S.

    An integral component of managing game species is an understanding of population dynamics and relative abundance. Harvest data are frequently used to estimate abundance of white-tailed deer. Unless harvest age-structure is representative of the population age-structure and harvest vulnerability remains constant from year to year, these data alone are of limited value. Additional model structure and auxiliary information has accommodated this shortcoming. Specifically, integrated age-at-harvest (AAH) state-space population models can formally combine multiple sources of data, and regularization via hierarchical model structure can increase flexibility of model parameters. I collected known fates data, which I evaluated and used to inform trends in survival parameters for an integrated AAH model. I used temperature and snow depth covariates to predict survival outside of the hunting season, and opening weekend temperature and percent of corn harvest covariates to predict hunting season survival. When auxiliary empirical data were unavailable for the AAH model, moderately informative priors provided sufficient information for convergence and parameter estimates. The AAH model was most sensitive to errors in initial abundance, but this error was calibrated after 3 years. Among vital rates, the AAH model was most sensitive to reporting rates (percentage of mortality during the hunting season related to harvest). The AAH model, using only harvest data, was able to track changing abundance trends due to changes in survival rates even when prior models did not inform these changes (i.e. prior models were constant when truth varied). I also compared AAH model results with estimates from the Wisconsin Department of Natural Resources (WIDNR). Trends in abundance estimates from both models were similar, although AAH model predictions were systematically higher than WIDNR estimates in the East study area. When I incorporated auxiliary information (i.e. integrated AAH model

  14. Integrating Cutting-edge Approaches to Describe and Interpret the Timing of Physical and Biological events: A Leap Forward for Monitoring Global Change Across Scales

    NASA Astrophysics Data System (ADS)

    Sadinski, W.; Gallant, A.; Thompson, D.; Houlahan, J.; Roth, M.; Brisco, B.; Kaya, S.; Gage, S.; Brininger, W.; Mushet, D.; Petersen, D.; Tessler, D.; Snively, M.; Jones, P. M.; Tate, D. P.; Morton, J. M.; Brodman, R.; Muths, E.; Brown, J. F.; Pauli, B.; Rosenberry, D. O.


    Our ability to integrate measures of phenological events across methods and scales has taken a significant step forward with recent advances in recording and analyzing sounds. For example, we now can measure bird and amphibian responses to climate/global change extensively and intensively from the ground and relate them to other landscape responses measured via satellite, airborne, and ground-based sensors. Thus, we can document changes in the timing of related biotic and abiotic events and understand the ramifications for biodiversity-related ecosystem services more fully. We designed and continue to expand the Terrestrial Wetland Global Change Research Network based upon this new potential to describe and interpret the impacts of global change and to provide stakeholders vital information on the specific nature and relevance of those impacts. We began implementing field research in 2008 and continue to add new research nodes across portions of Alaska, Canada, and the conterminous U.S. by leveraging resources across multiple organizations. Our standardized approach enables us to compare phenological responses in wetland-upland landscape matrices across local, regional, and continental scales and along several physical and ecological gradients. The power of this approach is evident in comparisons of calling events for individual species or entire soundscapes with other biotic and abiotic conditions and demonstrates a significant step forward in our ability to describe and interpret the impacts of global change on interconnected wetlands and uplands.

  15. Integrated Analysis of Asian Dust Events from CALIPSO Space Lidar Data in Conjunction with Passive Remote Sensing and Ground-Based Observations

    NASA Astrophysics Data System (ADS)

    Choi, H.; Sokolik, I. N.; Winker, D. M.; Kurosaki, Y.


    The vast arid regions of East Asia are active dust sources. Each spring, large amounts of mineral dust are emitted into the atmosphere, affecting the regional air quality, environment and climate. This study presents analyses of Asian dust events by integrating CALIPSO lidar data with A-Train satellite multi-sensor observations (Ozone Monitoring Instrument, OMI, and Moderate-Resolution Imaging Spectroradiometer, MODIS) as well as ground-based observations. We use data from WMO meteorological stations located in China, Mongolia, Korea and Japan that report different present weather types related to dust events. Also, lidar data from Asian network sites were included in the analysis. The focus is on dust events that occurred during the spring seasons of 2006- 2008. The capability of CALIPSO to detect dust was investigated by analyzing the CALIPSO features against independent observations for selected CALPSO overpasses on a case-by-case basis. The changes in the linear depolarization ratio were analyzed in conjunction with T-matrix optical modeling to constrain the particle nonsphericity and size distribution. The dust properties and vertical distribution in different dust sources (the Taklamakan vs. Gobi) were analyzed. The evolution of dust properties during the mid-range transport was also investigated from combined CALIPSO and lidar data.

  16. Comparative analysis of a translocated copy of the trnK intron in carnivorous family Nepenthaceae.


    Meimberg, Harald; Thalhammer, Stefan; Brachmann, Andreas; Heubl, Günther


    During phylogenetic analysis of the Nepenthaceae cpDNA trnK intron, it became apparent that a second non-functional copy of the locus was present in most of the investigated taxa. The translocation event was older than the radiation of all recent Nepenthaceae, and the translocated pseudogenized copy was conserved in nearly all members of the plant family. Using single chloroplast PCR and inverse PCR, we could exclude a plastom location for the second copy. Although translocation into the nucleus is possible, mitochondrial localization seems more likely based on these data. In total, the translocated sequence contained at least 3525 base pairs (bp) that were homologous to the Spinacia oleracea chloroplast genome. Comparative phylogenetic analysis of the non-functional copy revealed a high amount of homoplasies compared to topologies from the cpDNA trnK intron phylogenetic reconstruction. Therefore, this copy proved to be insufficient for phylogenetic reconstruction of the family. Since two different paralogs of the non-functional copy were found in one species, it is feasible that different paralogs were conserved in different groups and that paralogous sequences were included in the data matrix. These data demonstrate that phylogenetic analyses of pseudogenized copies of phylogenetically relevant loci should be performed with great caution. In addition, pseudogenized copies can exist in nearly every member of a plant family, and can be PCR-amplified at levels comparable to the specific copy. In this case, the inclusion of such copies can easily remain unnoticed, thus leading to faulty hypotheses. PMID:16414286

  17. GeoMedStat: an integrated spatial surveillance system to track air pollution and associated healthcare events.


    Faruque, Fazlay S; Li, Hui; Williams, Worth B; Waller, Lance A; Brackin, Bruce T; Zhang, Lei; Grimes, Kim A; Finley, Richard W


    Air pollutants, such as particulate matter with a diameter ≤2.5 microns (PM2.5) and ozone (O3), are known to exacerbate asthma and other respiratory diseases. An integrated surveillance system that tracks such air pollutants and associated disease incidence can assist in risk assessment, healthcare preparedness and public awareness. However, the implementation of such an integrated environmental health surveillance system is a challenge due to the disparate sources of many types of data and the implementation becomes even more complicated for a spatial and real-time system due to lack of standardised technological components and data incompatibility. In addition, accessing and utilising health data that are considered as Protected Health Information (PHI) require maintaining stringent protocols, which have to be supported by the system. This paper aims to illustrate the development of a spatial surveillance system (GeoMedStat) that is capable of tracking daily environmental pollutants along with both daily and historical patient encounter data. It utilises satellite data and the groundmonitor data from the US National Aeronautics and Space Administration (NASA) and the US Environemental Protection Agenecy (EPA), rspectively as inputs estimating air pollutants and is linked to hospital information systems for accessing chief complaints and disease classification codes. The components, developmental methods, functionality of GeoMedStat and its use as a real-time environmental health surveillance system for asthma and other respiratory syndromes in connection with with PM2.5 and ozone are described. It is expected that the framework presented will serve as an example to others developing real-time spatial surveillance systems for pollutants and hospital visits. PMID:25599635

  18. Emotional Processing and Attention Control Impairments in Children with Anxiety: An Integrative Review of Event-Related Potentials Findings.


    Wauthia, Erika; Rossignol, Mandy


    Anxiety disorders in adults have been associated with biased processing of emotional information which may be due to a deficit in attentional control. This deficit leads to an hypervigilance and a selective attention toward threatening information. Event-related potentials (ERPs) have been used to study this topic in anxious adults. Similar biases have been reported in children with anxiety but researches investigating the ERPs components underpinning these biases are more scarce. However, the understanding of the neural correlates of attentional biases in anxious children seem quite important since they could play a role in the etiology and the maintenance of this disorder. This review summarizes the results of researches having used ERPs to index emotional processing and attention control in children suffering from anxiety. We will focus on the P1, indexing basic visual perceptual processing, the N2, thought to reflect cognitive control process, the P3 typically associated with response inhibition, and the late positive potential (LPP) that indicates sustained attention toward motivationally salient stimuli. We will also examine the error-related negativity (ERN) that indexes monitoring system for detecting errors. Electro-physiological studies generally reported increased amplitudes of these components in anxious children, even when they did not differ from typically developing children at a behavioral level. These results suggest diminished cognitive control that influences children's selective attention mechanisms toward threatening information. Theoretical perspectives and implications for future researches will be discussed in the framework of current models of childhood anxiety. PMID:27199802

  19. Emotional Processing and Attention Control Impairments in Children with Anxiety: An Integrative Review of Event-Related Potentials Findings

    PubMed Central

    Wauthia, Erika; Rossignol, Mandy


    Anxiety disorders in adults have been associated with biased processing of emotional information which may be due to a deficit in attentional control. This deficit leads to an hypervigilance and a selective attention toward threatening information. Event-related potentials (ERPs) have been used to study this topic in anxious adults. Similar biases have been reported in children with anxiety but researches investigating the ERPs components underpinning these biases are more scarce. However, the understanding of the neural correlates of attentional biases in anxious children seem quite important since they could play a role in the etiology and the maintenance of this disorder. This review summarizes the results of researches having used ERPs to index emotional processing and attention control in children suffering from anxiety. We will focus on the P1, indexing basic visual perceptual processing, the N2, thought to reflect cognitive control process, the P3 typically associated with response inhibition, and the late positive potential (LPP) that indicates sustained attention toward motivationally salient stimuli. We will also examine the error-related negativity (ERN) that indexes monitoring system for detecting errors. Electro-physiological studies generally reported increased amplitudes of these components in anxious children, even when they did not differ from typically developing children at a behavioral level. These results suggest diminished cognitive control that influences children's selective attention mechanisms toward threatening information. Theoretical perspectives and implications for future researches will be discussed in the framework of current models of childhood anxiety. PMID:27199802

  20. Integrating data and mashup concepts in Hydro-Meteorological Research: the torrential rainfall event in Genoa (4th November 2011) case study.

    NASA Astrophysics Data System (ADS)

    Bedrina, T.; Parodi, A.; Quarati, A.; Clematis, A.; Rebora, N.; Laiosa, D.


    One of the critical issues in Hydro-Meteorological Research (HMR) is a better exploitation of data archives according to a multidisciplinary perspective. Different Earth science databases offer a huge amount of observational data, which often need to be assembled, processed, combined accordingly HM scientists needs. The cooperation between scientists active in HMR and Information and Communication Technologies (ICT) is essential in the development of innovative tools and applications for manipulating, aggregating and re-arranging heterogeneous information in flexible way. In this paper it is described an application devoted to the collection and integration of HM datasets, originated by public or private sources, freely exposed via Web services API. This application uses the mashup, recently become very popular in many fields, (Chow S.-W., 2007) technology concepts. Such methodology means combination of data and/or programs published by external online sources into an integrated experience. Mashup seems to be a promising methodology to respond to the multiple data-related activities into which HM researchers are daily involved (e.g. finding and retrieving high volume data; learning formats and developing readers; extracting parameters; performing filtering and mask; developing analysis and visualization tools). The specific case study of the recent extreme rainfall event, occurred over Genoa in Italy on the 4th November 2011 is shown through the integration of semi-professional weather observational networks as free available data source in addition to official weather networks.

  1. 25 CFR 571.13 - Copies of audit reports.

    Code of Federal Regulations, 2010 CFR


    ... submit to the Commission two paper copies or one electronic copy of the financial statements and audits... Commission two paper copies or one electronic copy of the financial statements, reports, and audits required... 25 Indians 2 2010-04-01 2010-04-01 false Copies of audit reports. 571.13 Section 571.13...

  2. Event-specific qualitative and quantitative PCR methods for the detection of genetically modified rapeseed Oxy-235.


    Wu, Gang; Wu, Yuhua; Xiao, Ling; Lu, Changming


    Oxy-235 is an oxynil-tolerant genetically modified rapeseed approved for commercialized planting in Canada. The aim of this study was to establish event-specific qualitative and quantitative detection methods for Oxy-235. Both the 5'- and 3'-junction sequences spanning the plant DNA and the integrated gene construct of the Oxy-235 event were isolated, sequenced and analyzed. A 1298-bp deletion of the rapeseed genomic DNA that showed a high similarity to the mRNA sequence of Arabidopsis thaliana was found in the integration site of the insert DNA. Event-specific qualitative PCR methods were established, with one method producing a 105-bp product specific for the 5'-integration junction and the other method producing a 124-bp product specific for the 3'-junction. The absolute detection limits for the qualitative PCR were determined to be 100 initial template copies for the 5'-junction and ten for the 3'-junction. Quantitative methods were also developed that targeted both of the junction fragments. The limit of detection of the quantitative PCR analysis was ten initial template copies for either the 5'- or 3'-junction, while the limit of quantification was determined to be approximately 50 initial template copies. The real-time PCR systems so established were examined with two mixed rapeseed samples with known Oxy-235 contents and found to obtain the expected results.

  3. Does testing with feedback improve adult spelling skills relative to copying and reading?


    Pan, Steven C; Rubin, Benjamin R; Rickard, Timothy C


    We examined testing's ability to enhance adult spelling acquisition, relative to copying and reading. Across 3 experiments in which testing with feedback was compared with copying, the spelling improvement after testing matched that following the same amount of time spent copying. A potent testing advantage, however, was observed for spelling words free-recalled. In the fourth experiment, a large testing advantage for both word free recall and spelling was observed, versus reading. Subjects also generally preferred testing and rated it as more effective than copying or reading. The equivalent performance of testing and copying for spelling contrasts with prior work involving children and suggests that retrieval practice may not be the only effective mechanism for spelling skill acquisition. Rather, we suggest that the critical learning event for spelling is focused study on phoneme-to-grapheme mappings for previously unlearned letter sequences. For adults with extensive spelling expertise, focused study is more automatic during both copying and testing with feedback than for individuals with beginning spelling skills. Reading, however, would not be expected to produce efficient focused study of phoneme-to-grapheme mappings, regardless of expertise level. Overall, adult spelling skill acquisition benefits both from testing and copying, and substantially less from reading.

  4. Does testing with feedback improve adult spelling skills relative to copying and reading?


    Pan, Steven C; Rubin, Benjamin R; Rickard, Timothy C


    We examined testing's ability to enhance adult spelling acquisition, relative to copying and reading. Across 3 experiments in which testing with feedback was compared with copying, the spelling improvement after testing matched that following the same amount of time spent copying. A potent testing advantage, however, was observed for spelling words free-recalled. In the fourth experiment, a large testing advantage for both word free recall and spelling was observed, versus reading. Subjects also generally preferred testing and rated it as more effective than copying or reading. The equivalent performance of testing and copying for spelling contrasts with prior work involving children and suggests that retrieval practice may not be the only effective mechanism for spelling skill acquisition. Rather, we suggest that the critical learning event for spelling is focused study on phoneme-to-grapheme mappings for previously unlearned letter sequences. For adults with extensive spelling expertise, focused study is more automatic during both copying and testing with feedback than for individuals with beginning spelling skills. Reading, however, would not be expected to produce efficient focused study of phoneme-to-grapheme mappings, regardless of expertise level. Overall, adult spelling skill acquisition benefits both from testing and copying, and substantially less from reading. PMID:26460674

  5. Droplet digital PCR-aided screening and characterization of Pichia pastoris multiple gene copy strains.


    Cámara, Elena; Albiol, Joan; Ferrer, Pau


    Pichia (syn. Komagataella) pastoris is a widely used yeast platform for heterologous protein production. Expression cassettes are usually stably integrated into the genome of this host via homologous recombination. Although increasing gene dosage is a powerful strategy to improve recombinant protein production, an excess in the number of gene copies often leads to decreased product yields and increased metabolic burden, particularly for secreted proteins. We have constructed a series of strains harboring different copy numbers of a Rhizopus oryzae lipase gene (ROL), aiming to find the optimum gene dosage for secreted Rol production. In order to accurately determine ROL gene dosage, we implemented a novel protocol based on droplet digital PCR (ddPCR), and cross validated it with conventional real-time PCR. Gene copy number determination based on ddPCR allowed for an accurate ranking of transformants according to their ROL gene dosage. Results indicated that ddPCR was particularly superior at lower gene dosages (one to five copies) over quantitative real-time PCR (qPCR). This facilitated the determination of the optimal ROL gene dosage as low as two copies. The ranking of ROL gene dosage versus Rol yield was consistent at both small scale and bioreactor chemostat cultures, thereby easing clone characterization in terms of gene dosage dependent physiological effects, which could be discriminated even among strains differing by only one ROL copy. A selected two-copy strain showed twofold increase in Rol specific production in a chemostat culture over the single copy strain. Conversely, strains harboring more than two copies of the ROL gene showed decreased product and biomass yields, as well as altered substrate consumption specific rates, compared to the reference (one-copy) strain. Biotechnol. Bioeng. 2016;113: 1542-1551. © 2015 Wiley Periodicals, Inc. PMID:26704939

  6. Final Scientific/Technical Report, DE-FG02-06ER64171, Integrated Nucleic Acid System for In-Field Monitoring of Microbial Community Dynamics and Metabolic Activity – Subproject to Co-PI Eric E. Roden

    SciTech Connect

    Eric E. Roden


    This report summarizes research conducted in conjunction with a project entitled “Integrated Nucleic Acid System for In-Field Monitoring of Microbial Community Dynamics and Metabolic Activity”, which was funded through the Integrative Studies Element of the former NABIR Program (now the Environmental Remediation Sciences Program) within the Office of Biological and Environmental Research. Dr. Darrell Chandler (originally at Argonne National Laboratory, now with Akonni Biosystems) was the overall PI/PD for the project. The overall project goals were to (1) apply a model iron-reducer and sulfate-reducer microarray and instrumentation systems to sediment and groundwater samples from the Scheibe et al. FRC Area 2 field site, UMTRA sediments, and other DOE contaminated sites; (2) continue development and expansion of a 16S rRNA/rDNA¬-targeted probe suite for microbial community dynamics as new sequences are obtained from DOE-relevant sites; and (3) address the fundamental molecular biology and analytical chemistry associated with the extraction, purification and analysis of functional genes and mRNA in environmental samples. Work on the UW subproject focused on conducting detailed batch and semicontinuous culture reactor experiments with uranium-contaminated FRC Area 2 sediment. The reactor experiments were designed to provide coherent geochemical and microbiological data in support of microarray analyses of microbial communities in Area 2 sediments undergoing biostimulation with ethanol. A total of four major experiments were conducted (one batch and three semicontinuous culture), three of which (the batch and two semicontinuous culture) provided samples for DNA microarray analysis. A variety of other molecular analyses (clone libraries, 16S PhyloChip, RT-PCR, and T-RFLP) were conducted on parallel samples from the various experiments in order to provide independent information on microbial community response to biostimulation.

  7. A low cost, fully integrated, event-driven, real-time control and data acquisition system for fusion experiments

    NASA Astrophysics Data System (ADS)

    Batista, A. J. N.; Combo, A.; Sousa, J.; Varandas, C. A. F.


    A new, real-time, distributed, control and data acquisition system architecture for long duration fusion experiments was developed based on the new optical communications technologies and the "System on a Chip" methodology. The architecture integrates data routing, data storage, real-time data processing and control and data acquisition nodes, interconnected by a switched-packed, gigabit, point-to-point, communications network. The routing nodes provide connections to the autonomous storage and processing nodes through standard network links. The control and data acquisition nodes are connected to the routing nodes by specifically designed optical links which provide both data transport and timing/synchronism support. The acquired data are time stamped and can be dynamically processed for local control or sent to the external storage, the real-time processing or the control nodes. The standard processor and the reconfigurable field programmable gate array included in each node allow the programming of the data reduction, adaptive signal processing, and control algorithms from a high level system description language. All nodes will be controlled through an instrumentation-specific implementation of the Extensible Markup Language. A control and data acquisition node with 32 independent and galvanically isolated analog channels of 16 bits resolution is under development. All input signals are continuously and simultaneously sampled at a rate of 2 MSPS, time stamped, optionally digitally filtered, and stored in a large circular memory buffer. Three other node configuration sets will also be implemented: 16 channels, 20 MSPS, 16 bit; 8 channels, 100 MSPS, 12 bit; 2 channels, 1 GSPS, 8 bit.

  8. An exact, closed-form expression of the integral chord-length distribution for the calculation of single-event upsets induced by cosmic rays

    NASA Technical Reports Server (NTRS)

    Luke, Keung L.; Buehler, Martin G.


    This paper presents a derivation of an exact closed-form expression of the integral chord-length distribution for the calculation of single-event upsets (SEUs) in an electronic memory cell, caused by cosmic rays. Results computed for two rectangular parallelepipeds using this exact expression are compared with those computed with Bradford's (1979) semiexact expression of C(x). It is found that the values of C(x) are identical for x equal or smaller than b but are vastly different for x greater than b. Moreover, while C(x) of Bradford gives reasonably accurate values of SEU rate for certain sets of computational parameters, it gives values more than 10 times larger than the correct values for other sets of parameters.

  9. Kinetic versus Energetic Discrimination in Biological Copying

    NASA Astrophysics Data System (ADS)

    Sartori, Pablo; Pigolotti, Simone


    We study stochastic copying schemes in which discrimination between a right and a wrong match is achieved via different kinetic barriers or different binding energies of the two matches. We demonstrate that, in single-step reactions, the two discrimination mechanisms are strictly alternative and cannot be mixed to further reduce the error fraction. Close to the lowest error limit, kinetic discrimination results in a diverging copying velocity and dissipation per copied bit. On the other hand, energetic discrimination reaches its lowest error limit in an adiabatic regime where dissipation and velocity vanish. By analyzing experimentally measured kinetic rates of two DNA polymerases, T7 and Polγ, we argue that one of them operates in the kinetic and the other in the energetic regime. Finally, we show how the two mechanisms can be combined in copying schemes implementing error correction through a proofreading pathway.

  10. NASA printing, duplicating, and copying management handbook

    NASA Technical Reports Server (NTRS)


    This handbook provides information and procedures for the implementation of NASA policy and applicable laws and regulations relating to printing, duplicating, and copying. The topics addressed include a description of relevant laws and regulations, authorizations required, and responsible entities for NASA printing, duplicating, and copying. The policy of NASA is to ensure understanding and application of authority and responsibility on printing matters. Where necessary, the handbook clarifies the intent of basic laws and regulations applicable to NASA.

  11. The physics of a single-event upset in integrated circuits: A review and critique of analytical models for charge collection

    NASA Technical Reports Server (NTRS)

    Vonroos, O.; Zoutendyk, J.


    When an energetic particle (kinetic energy 0.5 MeV) originating from a radioactive decay or a cosmic ray transverse the active regions of semiconductor devices used in integrated circuit (IC) chips, it leaves along its track a high density electron hole plasma. The subsequent decay of this plasma by drift and diffusion leads to charge collection at the electrodes large enough in most cases to engender a false reading, hence the name single-event upset (SEU). The problem of SEU's is particularly severe within the harsh environment of Jupiter's radiation belts and constitutes therefore a matter of concern for the Galileo mission. The physics of an SEU event is analyzed in some detail. Owing to the predominance of nonlinear space charge effects and the fact that positive (holes) and negative (electrons) charges must be treated on an equal footing, analytical models for the ionized-charge collection and their corresponding currents as a function of time prove to be inadequate even in the simplest case of uniformly doped, abrupt p-n junctions in a one-dimensional geometry. The necessity for full-fledged computer simulation of the pertinent equations governing the electron-hole plasma therefore becomes imperative.

  12. A Spiking Neural Simulator Integrating Event-Driven and Time-Driven Computation Schemes Using Parallel CPU-GPU Co-Processing: A Case Study.


    Naveros, Francisco; Luque, Niceto R; Garrido, Jesús A; Carrillo, Richard R; Anguita, Mancia; Ros, Eduardo


    Time-driven simulation methods in traditional CPU architectures perform well and precisely when simulating small-scale spiking neural networks. Nevertheless, they still have drawbacks when simulating large-scale systems. Conversely, event-driven simulation methods in CPUs and time-driven simulation methods in graphic processing units (GPUs) can outperform CPU time-driven methods under certain conditions. With this performance improvement in mind, we have developed an event-and-time-driven spiking neural network simulator suitable for a hybrid CPU-GPU platform. Our neural simulator is able to efficiently simulate bio-inspired spiking neural networks consisting of different neural models, which can be distributed heterogeneously in both small layers and large layers or subsystems. For the sake of efficiency, the low-activity parts of the neural network can be simulated in CPU using event-driven methods while the high-activity subsystems can be simulated in either CPU (a few neurons) or GPU (thousands or millions of neurons) using time-driven methods. In this brief, we have undertaken a comparative study of these different simulation methods. For benchmarking the different simulation methods and platforms, we have used a cerebellar-inspired neural-network model consisting of a very dense granular layer and a Purkinje layer with a smaller number of cells (according to biological ratios). Thus, this cerebellar-like network includes a dense diverging neural layer (increasing the dimensionality of its internal representation and sparse coding) and a converging neural layer (integration) similar to many other biologically inspired and also artificial neural networks.

  13. COPI Is Required for Enterovirus 71 Replication

    PubMed Central

    Wang, Jianmin; Wu, Zhiqiang; Jin, Qi


    Enterovirus 71 (EV71), a member of the Picornaviridae family, is found in Asian countries where it causes a wide range of human diseases. No effective therapy is available for the treatment of these infections. Picornaviruses undergo RNA replication in association with membranes of infected cells. COPI and COPII have been shown to be involved in the formation of picornavirus-induced vesicles. Replication of several picornaviruses, including poliovirus and Echovirus 11 (EV11), is dependent on COPI or COPII. Here, we report that COPI, but not COPII, is required for EV71 replication. Replication of EV71 was inhibited by brefeldin A and golgicide A, inhibitors of COPI activity. Furthermore, we found EV71 2C protein interacted with COPI subunits by co-immunoprecipitation and GST pull-down assay, indicating that COPI coatomer might be directed to the viral replication complex through viral 2C protein. Additionally, because the pathway is conserved among different species of enteroviruses, it may represent a novel target for antiviral therapies. PMID:22662263

  14. Copy Number Profiling of Brazilian Astrocytomas

    PubMed Central

    Bidinotto, Lucas Tadeu; Torrieri, Raul; Mackay, Alan; Almeida, Gisele Caravina; Viana-Pereira, Marta; Cruvinel-Carloni, Adriana; Spina, Maria Luisa; Campanella, Nathalia Cristina; Pereira de Menezes, Weder; Clara, Carlos Afonso; Becker, Aline Paixão; Jones, Chris; Reis, Rui Manuel


    Copy number alterations (CNA) are one of the driving mechanisms of glioma tumorigenesis, and are currently used as important biomarkers in the routine setting. Therefore, we performed CNA profiling of 65 astrocytomas of distinct malignant grades (WHO grade I–IV) of Brazilian origin, using array-CGH and microsatellite instability analysis (MSI), and investigated their correlation with TERT and IDH1 mutational status and clinico-pathological features. Furthermore, in silico analysis using the Oncomine database was performed to validate our findings and extend the findings to gene expression level. We found that the number of genomic alterations increases in accordance with glioma grade. In glioblastomas (GBM), the most common alterations were gene amplifications (PDGFRA, KIT, KDR, EGFR, and MET) and deletions (CDKN2A and PTEN). Log-rank analysis correlated EGFR amplification and/or chr7 gain with better survival of the patients. MSI was observed in 11% of GBMs. A total of 69% of GBMs presented TERT mutation, whereas IDH1 mutation was most frequent in diffuse (85.7%) and anaplastic (100%) astrocytomas. The combination of 1p19q deletion and TERT and IDH1 mutational status separated tumor groups that showed distinct age of diagnosis and outcome. In silico validation pointed to less explored genes that may be worthy of future investigation, such as CDK2, DMRTA1, and MTAP. Herein, using an extensive integrated analysis, we indicated potentially important genes, not extensively studied in gliomas, that could be further explored to assess their biological and clinical impact in astrocytomas. PMID:27172220

  15. A method for calling copy number polymorphism using haplotypes

    PubMed Central

    Ho Jang, Gun; Christie, Jason D.; Feng, Rui


    Single nucleotide polymorphism (SNP) and copy number variation (CNV) are both widespread characteristic of the human genome, but are often called separately on common genotyping platforms. To capture integrated SNP and CNV information, methods have been developed for calling allelic specific copy numbers or so called copy number polymorphism (CNP), using limited inter-marker correlation. In this paper, we proposed a haplotype-based maximum likelihood method to call CNP, which takes advantage of the valuable multi-locus linkage disequilibrium (LD) information in the population. We also developed a computationally efficient algorithm to estimate haplotype frequencies and optimize individual CNP calls iteratively, even at presence of missing data. Through simulations, we demonstrated our model is more sensitive and accurate in detecting various CNV regions, compared with commonly-used CNV calling methods including PennCNV, another hidden Markov model (HMM) using CNP, a scan statistic, segCNV, and cnvHap. Our method often performs better in the regions with higher LD, in longer CNV regions, and in common CNV than the opposite. We implemented our method on the genotypes of 90 HapMap CEU samples and 23 patients with acute lung injury (ALI). For each ALI patient the genotyping was performed twice. The CNPs from our method show good consistency and accuracy comparable to others. PMID:24069028

  16. Minimal Information for Neural Electromagnetic Ontologies (MINEMO): A standards-compliant method for analysis and integration of event-related potentials (ERP) data.


    Frishkoff, Gwen; Sydes, Jason; Mueller, Kurt; Frank, Robert; Curran, Tim; Connolly, John; Kilborn, Kerry; Molfese, Dennis; Perfetti, Charles; Malony, Allen


    We present MINEMO (Minimal Information for Neural ElectroMagnetic Ontologies), a checklist for the description of event-related potentials (ERP) studies. MINEMO extends MINI (Minimal Information for Neuroscience Investigations)to the ERP domain. Checklist terms are explicated in NEMO, a formal ontology that is designed to support ERP data sharing and integration. MINEMO is also linked to an ERP database and web application (the NEMO portal). Users upload their data and enter MINEMO information through the portal. The database then stores these entries in RDF (Resource Description Framework), along with summary metrics, i.e., spatial and temporal metadata. Together these spatial, temporal, and functional metadata provide a complete description of ERP data and the context in which these data were acquired. The RDF files then serve as inputs to ontology-based labeling and meta-analysis. Our ultimate goal is to represent ERPs using a rich semantic structure, so results can be queried at multiple levels, to stimulate novel hypotheses and to promote a high-level, integrative account of ERP results across diverse study methods and paradigms.

  17. Grid collector: An event catalog with automated file management

    SciTech Connect

    Wu, Kesheng; Zhang, Wei-Ming; Sim, Alexander; Gu, Junmin; Shoshani, Arie


    High Energy Nuclear Physics (HENP) experiments such as STAR at BNL and ATLAS at CERN produce large amounts of data that are stored as files on mass storage systems in computer centers. In these files, the basic unit of data is an event. Analysis is typically performed on a selected set of events. The files containing these events have to be located, copied from mass storage systems to disks before analysis, and removed when no longer needed. These file management tasks are tedious and time consuming. Typically, all events contained in the files are read into memory before a selection is made. Since the time to read the events dominate the overall execution time, reading the unwanted event needlessly increases the analysis time. The Grid Collector is a set of software modules that works together to address these two issues. It automates the file management tasks and provides ''direct'' access to the selected events for analyses. It is currently integrated with the STAR analysis framework. The users can select events based on tags, such as, ''production date between March 10 and 20, and the number of charged tracks > 100.'' The Grid Collector locates the files containing relevant events, transfers the files across the Grid if necessary, and delivers the events to the analysis code through the familiar iterators. There has been some research efforts to address the file management issues, the Grid Collector is unique in that it addresses the event access issue together with the file management issues. This makes it more useful to a large variety of users.

  18. Estimating Copy Number and Allelic Variation at the Immunoglobulin Heavy Chain Locus Using Short Reads.


    Luo, Shishi; Yu, Jane A; Song, Yun S


    The study of genomic regions that contain gene copies and structural variation is a major challenge in modern genomics. Unlike variation involving single nucleotide changes, data on the variation of copy number is difficult to collect and few tools exist for analyzing the variation between individuals. The immunoglobulin heavy variable (IGHV) locus, which plays an integral role in the adaptive immune response, is an example of a complex genomic region that varies in gene copy number. Lack of standard methods to genotype this region prevents it from being included in association studies and is holding back the growing field of antibody repertoire analysis. Here we develop a method that takes short reads from high-throughput sequencing and outputs a genetic profile of the IGHV locus with the read coverage depth and a putative nucleotide sequence for each operationally defined gene cluster. Our operationally defined gene clusters aim to address a major challenge in studying the IGHV locus: the high sequence similarity between gene segments in different genomic locations. Tests on simulated data demonstrate that our approach can accurately determine the presence or absence of a gene cluster from reads as short as 70 bp. More detailed resolution on the copy number of gene clusters can be obtained from read coverage depth using longer reads (e.g., ≥ 100 bp). Detail at the nucleotide resolution of single copy genes (genes present in one copy per haplotype) can be determined with 250 bp reads. For IGHV genes with more than one copy, accurate nucleotide-resolution reconstruction is currently beyond the means of our approach. When applied to a family of European ancestry, our pipeline outputs genotypes that are consistent with the family pedigree, confirms existing multigene variants and suggests new copy number variants. This study paves the way for analyzing population-level patterns of variation in IGHV gene clusters in larger diverse datasets and for quantitatively

  19. Estimating Copy Number and Allelic Variation at the Immunoglobulin Heavy Chain Locus Using Short Reads

    PubMed Central

    Luo, Shishi; Song, Yun S.


    The study of genomic regions that contain gene copies and structural variation is a major challenge in modern genomics. Unlike variation involving single nucleotide changes, data on the variation of copy number is difficult to collect and few tools exist for analyzing the variation between individuals. The immunoglobulin heavy variable (IGHV) locus, which plays an integral role in the adaptive immune response, is an example of a complex genomic region that varies in gene copy number. Lack of standard methods to genotype this region prevents it from being included in association studies and is holding back the growing field of antibody repertoire analysis. Here we develop a method that takes short reads from high-throughput sequencing and outputs a genetic profile of the IGHV locus with the read coverage depth and a putative nucleotide sequence for each operationally defined gene cluster. Our operationally defined gene clusters aim to address a major challenge in studying the IGHV locus: the high sequence similarity between gene segments in different genomic locations. Tests on simulated data demonstrate that our approach can accurately determine the presence or absence of a gene cluster from reads as short as 70 bp. More detailed resolution on the copy number of gene clusters can be obtained from read coverage depth using longer reads (e.g., ≥ 100 bp). Detail at the nucleotide resolution of single copy genes (genes present in one copy per haplotype) can be determined with 250 bp reads. For IGHV genes with more than one copy, accurate nucleotide-resolution reconstruction is currently beyond the means of our approach. When applied to a family of European ancestry, our pipeline outputs genotypes that are consistent with the family pedigree, confirms existing multigene variants and suggests new copy number variants. This study paves the way for analyzing population-level patterns of variation in IGHV gene clusters in larger diverse datasets and for quantitatively

  20. Characterization and event specific-detection by quantitative real-time PCR of T25 maize insert.


    Collonnier, Cécile; Schattner, Alexandra; Berthier, Georges; Boyer, Francine; Coué-Philippe, Géraldine; Diolez, Annick; Duplan, Marie-Noëlle; Fernandez, Sophie; Kebdani, Naïma; Kobilinsky, André; Romaniuk, Marcel; de Beuckeleer, Marc; de Loose, Marc; Windels, Pieter; Bertheau, Yves


    T25 is one of the 4 maize transformation events from which commercial lines have so far been authorized in Europe. It was created by polyethylene glycol-mediated transformation using a construct bearing one copy of the synthetic pat gene associated with both promoter and terminator of the 35S ribosomal gene from cauliflower mosaic virus. In this article, we report the sequencing of the whole T25 insert and the characterization of its integration site by using a genome walking strategy. Our results confirmed that one intact copy of the initial construct had been integrated in the plant genome. They also revealed, at the 5' junction of the insert, the presence of a second truncated 35S promoter, probably resulting from rearrangements which may have occurred before or during integration of the plasmid DNA. The analysis of the junction fragments showed that the integration site of the insert presented high homologies with the Huck retrotransposon family. By using one primer annealing in the maize genome and the other in the 5' end of the integrated DNA, we developed a reliable event-specific detection system for T25 maize. To provide means to comply with the European regulation, a real-time PCR test was designed for specific quantitation of T25 event by using Taqman chemistry.

  1. Characterization and event specific-detection by quantitative real-time PCR of T25 maize insert.


    Collonnier, Cécile; Schattner, Alexandra; Berthier, Georges; Boyer, Francine; Coué-Philippe, Géraldine; Diolez, Annick; Duplan, Marie-Noëlle; Fernandez, Sophie; Kebdani, Naïma; Kobilinsky, André; Romaniuk, Marcel; de Beuckeleer, Marc; de Loose, Marc; Windels, Pieter; Bertheau, Yves


    T25 is one of the 4 maize transformation events from which commercial lines have so far been authorized in Europe. It was created by polyethylene glycol-mediated transformation using a construct bearing one copy of the synthetic pat gene associated with both promoter and terminator of the 35S ribosomal gene from cauliflower mosaic virus. In this article, we report the sequencing of the whole T25 insert and the characterization of its integration site by using a genome walking strategy. Our results confirmed that one intact copy of the initial construct had been integrated in the plant genome. They also revealed, at the 5' junction of the insert, the presence of a second truncated 35S promoter, probably resulting from rearrangements which may have occurred before or during integration of the plasmid DNA. The analysis of the junction fragments showed that the integration site of the insert presented high homologies with the Huck retrotransposon family. By using one primer annealing in the maize genome and the other in the 5' end of the integrated DNA, we developed a reliable event-specific detection system for T25 maize. To provide means to comply with the European regulation, a real-time PCR test was designed for specific quantitation of T25 event by using Taqman chemistry. PMID:15859082

  2. Peer-to-Peer Computing for Secure High Performance Data Copying

    SciTech Connect

    Hanushevsky, Andrew B


    The BaBar Copy Program (bbcp) is an excellent representative of peer-to-peer (P2P) computing. It is also a pioneering application of its type in the P2P arena. Built upon the foundation of its predecessor, Secure Fast Copy (sfcp), bbcp incorporates significant improvements performance and usability. As with sfcp, bbcp uses ssh for authentication; providing an elegant and simple working model--if you can ssh to a location, you can copy files to or from that location. To fully support this notion, bbcp transparently supports 3rd party copy operations. The program also incorporates several mechanism to deal with firewall security; the bane of P2P computing. To achieve high performance in a wide area network, bbcp allows a user to independently specify, the number of parallel network streams, tcp window size, and the file I/O blocking factor. Using these parameters, data is pipelined from source to target to provide a uniform traffic pattern that maximizes router efficiency. For improved recoverability, bbcp also keeps track of copy operations so that an operation can be restarted from the point of failure at a later time; minimizing the amount of network traffic in the event of a copy failure. Here, we preset the bbcp architecture, it's various features, and the reasons for their inclusion.

  3. 15. Photographic copy englargement from a 4x5 copy negative (Original ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    15. Photographic copy englargement from a 4x5 copy negative (Original drawing located on abandoned NASA site, currently owned by the City of Downey, Downey, California). 1980 BLDG 10, BLDG 42 FLOOR PLAN, NASA MARCH 15 1980. - NASA Industrial Plant, Maintenance Facility, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

  4. 14. Photographic copy englargement from a 4x5 copy negative (Original ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. Photographic copy englargement from a 4x5 copy negative (Original photograph by original photographer located on abandoned NASA site, currently owned by the City of Downey, Downey, California). AERIAL PHOTOGRAPH 1935-1936 CONSOLIDATED VULTEE AIRCRAFT CORPORATION FROM WEST TO EAST - NASA Industrial Plant, Maintenance Facility, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

  5. 22. Photographic copy enlargement from a 4x5 copy negative of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. Photographic copy enlargement from a 4x5 copy negative of a print. (Original print located on abandoned NASA site, currently owned by the City of Downey, Downey, California). 1954 USAF PLANT 16 AERIAL BUILDING 41 NORTH TO SOUTH. - NASA Industrial Plant, Missile Research Laboratory, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

  6. 9. Photographic copy enlargement from a 4x5 copy negative. (Original ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. Photographic copy enlargement from a 4x5 copy negative. (Original drawing located on abandoned NASA site, currently owned by the City of Downey, Downey, California). 1976 BLDGS.25, 41 SITE PLAN. - NASA Industrial Plant, Storage Facility, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

  7. 23. Photographic copy enlargement from a 4x5 copy negative of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    23. Photographic copy enlargement from a 4x5 copy negative of a drawing (Original drawing located on abandoned NASA site, currently owned by the City of Downey, Downey, Calfornia). JANUARY 1960 USAF PLANT 16 MASTER PLOT AND GRID PLAN. - NASA Industrial Plant, Missile Research Laboratory, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

  8. 43 CFR 4.437 - Copies of transcript.

    Code of Federal Regulations, 2010 CFR


    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Copies of transcript. 4.437 Section 4.437... Fact § 4.437 Copies of transcript. Each party shall pay for any copies of the transcript obtained by him. Unless a summary of the evidence is stipulated to, the Government will file the original copy...

  9. 22 CFR 1471.4 - Copies and service.

    Code of Federal Regulations, 2010 CFR


    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Copies and service. 1471.4 Section 1471.4... SERVICE IMPASSE DISPUTES PANEL PROCEDURES OF THE PANEL § 1471.4 Copies and service. Any party submitting a... file an original and one copy with the Panel, shall serve a copy promptly on the other party to...

  10. 22 CFR 1423.6 - Filing and service of copies.

    Code of Federal Regulations, 2010 CFR


    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Filing and service of copies. 1423.6 Section... LABOR PRACTICE PROCEEDINGS § 1423.6 Filing and service of copies. (a) An original and four (4) copies of the charge together with one copy for each additional charged party named shall be filed with...

  11. 7 CFR 46.42 - Copies of records; how obtained.

    Code of Federal Regulations, 2010 CFR


    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Copies of records; how obtained. 46.42 Section 46.42... REGULATIONS (OTHER THAN RULES OF PRACTICE) UNDER THE PERISHABLE AGRICULTURAL COMMODITIES ACT, 1930 Copies of Records § 46.42 Copies of records; how obtained. Copies of records pertaining to licensees under the...

  12. 49 CFR 1310.6 - Furnishing copies of tariff publications.

    Code of Federal Regulations, 2010 CFR


    ... 49 Transportation 9 2010-10-01 2010-10-01 false Furnishing copies of tariff publications. 1310.6... REQUIREMENTS FOR HOUSEHOLD GOODS CARRIERS § 1310.6 Furnishing copies of tariff publications. (a) Copies of... copies of tariff publications to interested persons. If a charge is made, the charge must be...

  13. 40 CFR 121.11 - Copies of documents.

    Code of Federal Regulations, 2010 CFR


    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Copies of documents. 121.11 Section....11 Copies of documents. (a) Upon receipt from an applicant of an application for a license or permit... copy of the application to the appropriate certifying agency and two copies to the...

  14. 33 CFR 401.94 - Keeping copies of regulations.

    Code of Federal Regulations, 2010 CFR


    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Keeping copies of regulations..., DEPARTMENT OF TRANSPORTATION SEAWAY REGULATIONS AND RULES Regulations General § 401.94 Keeping copies of regulations. (a) A copy of these Regulations (subpart A of part 401), a copy of the vessel's valid...

  15. 22 CFR 1429.25 - Number of copies.

    Code of Federal Regulations, 2010 CFR


    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Number of copies. 1429.25 Section 1429.25... AND GENERAL REQUIREMENTS General Requirements § 1429.25 Number of copies. Unless otherwise provided by... therewith, shall be submitted in an original and four (4) copies. A clean copy capable of being used as...

  16. Using copy milling technology in restorative dentistry.


    McLaren, E A


    A technique for the fabrication of copy milled ceramic restorations has been presented. Both direct and indirect fabrication techniques of inlays, onlays, veneers, and crowns are possible. A copy milling machine can mill accurately fitting restorations with a marginal gap of 50 microns. The machine uses premanufactured porcelain blanks, which have improved physical properties over conventional porcelains used in standard techniques. Recently, the ability to mill In-Ceram crowns from presintered alumina blocks and Spinell crowns from alumina/magnesia blocks has been added to the system. The copings are veneered with aluminous porcelain as in the conventional In-Ceram technique.

  17. The Effects of Answer Copying on the Ability Level Estimates of Cheater Examinees in Answer Copying Pairs

    ERIC Educational Resources Information Center

    Zopluoglu, Cengiz; Davenport, Ernest C., Jr.


    The purpose of this study was to examine the effects of answer copying on the ability level estimates of cheater examinees in answer copying pairs. The study generated answer copying pairs for each of 1440 conditions, source ability (12) x cheater ability (12) x amount of copying (10). The average difference between the ability level estimates…

  18. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants

    PubMed Central

    Kwan, Elizabeth X.; Wang, Xiaobin S.; Amemiya, Haley M.; Brewer, Bonita J.; Raghuraman, M. K.


    The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. PMID:27449518

  19. Integrated system checkout report

    SciTech Connect

    Not Available


    The planning and preparation phase of the Integrated Systems Checkout Program (ISCP) was conducted from October 1989 to July 1991. A copy of the ISCP, DOE-WIPP 90--002, is included in this report as an appendix. The final phase of the Checkout was conducted from July 10, 1991, to July 23, 1991. This phase exercised all the procedures and equipment required to receive, emplace, and retrieve contact handled transuranium (CH TRU) waste filled dry bins. In addition, abnormal events were introduced to simulate various equipment failures, loose surface radioactive contamination events, and personnel injury. This report provides a detailed summary of each days activities during this period. Qualification of personnel to safely conduct the tasks identified in the procedures and the abnormal events were verified by observers familiar with the Bin-Scale CH TRU Waste Test requirements. These observers were members of the staffs of Westinghouse WID Engineering, QA, Training, Health Physics, Safety, and SNL. Observers representing a number of DOE departments, the state of new Mexico, and the Defense Nuclear Facilities Safety Board observed those Checkout activities conducted during the period from July 17, 1991, to July 23, 1991. Observer comments described in this report are those obtained from the staff member observers. 1 figs., 1 tab.

  20. Copyright & Home Copying. Technology Challenges the Law.

    ERIC Educational Resources Information Center

    Congress of the U.S., Washington, DC. Office of Technology Assessment.

    Home recording technologies allow today's consumer to make near-perfect copies of recorded music, television shows, movies, and other copyrighted works for private use at home. With the advance of digital recording equipment, consumers will be able to reproduce these copyrighted works with even greater accuracy. This is an issue of great concern…

  1. Teaching Ad Copy--I and II.

    ERIC Educational Resources Information Center

    Welty, Ward; Vanden Bergh, Bruce G.


    Ward Welty notes that the standard advertising course could be improved by including a unit of study in rhetoric, especially Aristotelian rhetoric. Bruce Vanden Bergh reports on research on the differences in creating advertising copy for radio versus the visual media of magazines, newspapers, and television. (RL)

  2. 36 CFR 703.20 - File copies.

    Code of Federal Regulations, 2013 CFR


    ... 703.20 Parks, Forests, and Public Property LIBRARY OF CONGRESS DISCLOSURE OR PRODUCTION OF RECORDS OR INFORMATION Testimony by Employees and Production of Documents in Certain Legal Proceedings Where the Library... file of copies of all demands served on the Library and deciding officials' responses....

  3. 36 CFR 703.20 - File copies.

    Code of Federal Regulations, 2014 CFR


    ... 703.20 Parks, Forests, and Public Property LIBRARY OF CONGRESS DISCLOSURE OR PRODUCTION OF RECORDS OR INFORMATION Testimony by Employees and Production of Documents in Certain Legal Proceedings Where the Library... file of copies of all demands served on the Library and deciding officials' responses....

  4. 36 CFR 703.20 - File copies.

    Code of Federal Regulations, 2012 CFR


    ... 703.20 Parks, Forests, and Public Property LIBRARY OF CONGRESS DISCLOSURE OR PRODUCTION OF RECORDS OR INFORMATION Testimony by Employees and Production of Documents in Certain Legal Proceedings Where the Library... file of copies of all demands served on the Library and deciding officials' responses....

  5. Do Scribes Learn? Copying and Information Use.

    ERIC Educational Resources Information Center

    McGregor, Joy H.; Streitenberger, Denise C.


    Discusses two field studies that observed the behavior of 11th-grade students as they used reference sources to write research papers. Topics include plagiarism, citing sources correctly, paraphrasing, and the intervention role of the teacher of information skills and composition. Examples of copying are appended. (Author/LRW)

  6. Copy to contiguous example using C descriptor

    SciTech Connect

    Rasmussen, Craig E


    In N1838-2 there is an example of how to use the CFI-cdesc-t type in a C implementation of a BIND (C) interface. This paper provides another example of using the CFI-cdesc-t type in C. This new example provides code to copy an array (possibly noncontiguous) into a contiguous buffer.

  7. CNVkit: Genome-Wide Copy Number Detection and Visualization from Targeted DNA Sequencing

    PubMed Central

    Shain, A. Hunter; Botton, Thomas; Bastian, Boris C.


    Germline copy number variants (CNVs) and somatic copy number alterations (SCNAs) are of significant importance in syndromic conditions and cancer. Massively parallel sequencing is increasingly used to infer copy number information from variations in the read depth in sequencing data. However, this approach has limitations in the case of targeted re-sequencing, which leaves gaps in coverage between the regions chosen for enrichment and introduces biases related to the efficiency of target capture and library preparation. We present a method for copy number detection, implemented in the software package CNVkit, that uses both the targeted reads and the nonspecifically captured off-target reads to infer copy number evenly across the genome. This combination achieves both exon-level resolution in targeted regions and sufficient resolution in the larger intronic and intergenic regions to identify copy number changes. In particular, we successfully inferred copy number at equivalent to 100-kilobase resolution genome-wide from a platform targeting as few as 293 genes. After normalizing read counts to a pooled reference, we evaluated and corrected for three sources of bias that explain most of the extraneous variability in the sequencing read depth: GC content, target footprint size and spacing, and repetitive sequences. We compared the performance of CNVkit to copy number changes identified by array comparative genomic hybridization. We packaged the components of CNVkit so that it is straightforward to use and provides visualizations, detailed reporting of significant features, and export options for integration into existing analysis pipelines. CNVkit is freely available from PMID:27100738

  8. 37 CFR 202.21 - Deposit of identifying material instead of copies.

    Code of Federal Regulations, 2013 CFR


    ... embodied in a soundtrack that is an integral part of a motion picture, identifying material deposited in lieu of an actual copy of the motion picture shall consist of: (1) A transcription of the entire work... from the motion picture showing the title of the motion picture, the soundtrack credits, and...

  9. 37 CFR 202.21 - Deposit of identifying material instead of copies.

    Code of Federal Regulations, 2014 CFR


    ... embodied in a soundtrack that is an integral part of a motion picture, identifying material deposited in lieu of an actual copy of the motion picture shall consist of: (1) A transcription of the entire work... from the motion picture showing the title of the motion picture, the soundtrack credits, and...

  10. COPI selectively drives maturation of the early Golgi


    Papanikou, Effrosyni; Day, Kasey J.; Austin, Jotham; Glick, Benjamin S.


    COPI coated vesicles carry material between Golgi compartments, but the role of COPI in the secretory pathway has been ambiguous. Previous studies of thermosensitive yeast COPI mutants yielded the surprising conclusion that COPI was dispensable both for the secretion of certain proteins and for Golgi cisternal maturation. To revisit these issues, we optimized the anchor-away method, which allows peripheral membrane proteins such as COPI to be sequestered rapidly by adding rapamycin. Video fluorescence microscopy revealed that COPI inactivation causes an early Golgi protein to remain in place while late Golgi proteins undergo cycles of arrival and departure. These dynamics generatemore » partially functional hybrid Golgi structures that contain both early and late Golgi proteins, explaining how secretion can persist when COPI has been inactivated. Our findings suggest that cisternal maturation involves a COPI-dependent pathway that recycles early Golgi proteins, followed by multiple COPI-independent pathways that recycle late Golgi proteins.« less

  11. Systems analysis programs for hands-on integrated reliability evaluations (SAPHIRE) Version 5.0. Fault tree, event tree, and piping & instrumentation diagram (FEP) editors reference manual: Volume 7

    SciTech Connect

    McKay, M.K.; Skinner, N.L.; Wood, S.T.


    The Systems Analysis Programs for Hands-on Integrated Reliability Evaluations (SAPHIRE) refers to a set of several microcomputer programs that were developed to create and analyze probabilistic risk assessments (PRAs), primarily for nuclear power plants. The Fault Tree, Event Tree, and Piping and Instrumentation Diagram (FEP) editors allow the user to graphically build and edit fault trees, and event trees, and piping and instrumentation diagrams (P and IDs). The software is designed to enable the independent use of the graphical-based editors found in the Integrated Reliability and Risk Assessment System (IRRAS). FEP is comprised of three separate editors (Fault Tree, Event Tree, and Piping and Instrumentation Diagram) and a utility module. This reference manual provides a screen-by-screen guide of the entire FEP System.

  12. Integrating multidisciplinary science, modelling and impact data into evolving, syn-event volcanic hazard mapping and communication: A case study from the 2012 Tongariro eruption crisis, New Zealand

    NASA Astrophysics Data System (ADS)

    Leonard, Graham S.; Stewart, Carol; Wilson, Thomas M.; Procter, Jonathan N.; Scott, Bradley J.; Keys, Harry J.; Jolly, Gill E.; Wardman, Johnny B.; Cronin, Shane J.; McBride, Sara K.


    New Zealand's Tongariro National Park volcanoes produce hazardous eruptions every few years to decades. On 6 August 2012 the Te Maari vent of Tongariro Volcano erupted, producing a series of explosions and a fine ash of minor volume which was dispersed rapidly to the east. This manuscript presents a summary of the eruption impacts and the way these supported science communication during the crisis, particularly in terms of hazard map development. The most significant proximal impact was damage from pyroclastic surges and ballistics to the popular and economically-important Tongariro Alpine Crossing track. The only hazard to affect the medial impact zone was a few mms of ashfall with minor impacts. Field testing indicated that the Te Maari ash had extremely low resistivity when wetted, implying a very high potential to cause disruption to nationally-important power transmission networks via the mechanism of insulator flashover. This was not observed, presumably due to insufficient ash accumulation on insulators. Virtually no impacts from distal ashfall were reported. Post-event analysis of PM10 data demonstrates the additional value of regional air quality monitoring networks in quantifying population exposure to airborne respirable ash. While the eruption was minor, it generated a high level of public interest and a demand for information on volcanic hazards and impacts from emergency managers, the public, critical infrastructure managers, health officials, and the agriculture sector. Meeting this demand fully taxed available resources. We present here aspects of the New Zealand experience which may have wider applicability in moving towards improved integration of hazard impact information, mapping, and communication. These include wide use of a wiki technical clearinghouse and email listservs, a focus on multi-agency consistent messages, and a recently developed environment of collaboration and alignment of both research funding and technical science advice

  13. 10 CFR 73.71 - Reporting of safeguards events.

    Code of Federal Regulations, 2010 CFR


    ... 10 Energy 2 2010-01-01 2010-01-01 false Reporting of safeguards events. 73.71 Section 73.71 Energy... § 73.71 Reporting of safeguards events. (a)(1) Each licensee subject to the provisions of §§ 73.25, 73... revised information. Each licensee shall maintain a copy of the written report of an event submitted...

  14. Genome-wide copy number variations in Oryza sativa L.

    PubMed Central


    Background Copy number variation (CNV) can lead to intra-specific genome variations. It is not only part of normal genetic variation, but also is the source of phenotypic differences. Rice (Oryza sativa L.) is a model organism with a well-annotated genome, but investigation of CNVs in rice lags behind its mammalian counterparts. Results We comprehensively assayed CNVs using high-density array comparative genomic hybridization in a panel of 20 Asian cultivated rice comprising six indica, three aus, two rayada, two aromatic, three tropical japonica, and four temperate japonica varieties. We used a stringent criterion to identify a total of 2886 high-confidence copy number variable regions (CNVRs), which span 10.28 Mb (or 2.69%) of the rice genome, overlapping 1321 genes. These genes were significantly enriched for specific biological functions involved in cell death, protein phosphorylation, and defense response. Transposable elements (TEs) and other repetitive sequences were identified in the majority of CNVRs. Chromosome 11 showed the greatest enrichment for CNVs. Of subspecies-specific CNVRs, 55.75% and 61.96% were observed in only one cultivar of ssp. indica and ssp. japonica, respectively. Some CNVs with high frequency differences among groups resided in genes underlying rice adaptation. Conclusions Higher recombination rates and the presence of homologous gene clusters are probably predispositions for generation of the higher number of CNVs on chromosome 11 by non-allelic homologous recombination events. The subspecies-specific variants are enriched for rare alleles, which suggests that CNVs are relatively recent events that have arisen within breeding populations. A number of the CNVs identified in this study are candidates for generation of group-specific phenotypes. PMID:24059626

  15. Low Mitochondrial DNA Copy Number is Associated With Adverse Clinical Outcomes in Peritoneal Dialysis Patients

    PubMed Central

    Yoon, Chang-Yun; Park, Jung Tak; Kee, Youn Kyung; Han, Seung Gyu; Han, In Mee; Kwon, Young Eun; Park, Kyoung Sook; Lee, Mi Jung; Han, Seung Hyeok; Kang, Shin-Wook; Yoo, Tae-Hyun


    Abstract Mitochondrial dysfunction may play an important role in abnormal glucose metabolism and systemic inflammation. We aimed to investigate the relationship between mitochondrial DNA (mtDNA) copy number and clinical outcomes in peritoneal dialysis (PD) patients. We recruited 120 prevalent PD patients and determined mtDNA copy number by PCR. Primary outcome was all-cause mortality, whereas secondary outcomes included cardiovascular events, technical PD failure, and incident malignancy. Cox proportional hazards analysis determined the independent association of mtDNA copy number with outcomes. The mean patient age was 52.3 years; 42.5% were men. The mean log mtDNA copy number was 3.30 ± 0.50. During a follow-up period of 35.4 ± 19.3 months, all-cause mortality and secondary outcomes were observed in 20.0% and 59.2% of patients, respectively. Secondary outcomes were significantly lower in the highest mtDNA copy number group than in the lower groups. In multiple Cox analysis, the mtDNA copy number was not associated with all-cause mortality (lower two vs highest tertile: hazard ratio [HR] = 1.208, 95% confidence interval [CI] = 0.477–3.061). However, the highest tertile group was significantly associated with lower incidences of secondary outcomes (lower two vs highest tertile: HR [95% CI] = 0.494 [0.277–0.882]) after adjusting for confounding factors. The decreased mtDNA copy number was significantly associated with adverse clinical outcomes in PD patients. PMID:26886611

  16. Digital authentication with copy-detection patterns

    NASA Astrophysics Data System (ADS)

    Picard, Justin


    Technologies for making high-quality copies of documents are getting more available, cheaper, and more efficient. As a result, the counterfeiting business engenders huge losses, ranging to 5% to 8% of worldwide sales of brand products, and endangers the reputation and value of the brands themselves. Moreover, the growth of the Internet drives the business of counterfeited documents (fake IDs, university diplomas, checks, and so on), which can be bought easily and anonymously from hundreds of companies on the Web. The incredible progress of digital imaging equipment has put in question the very possibility of verifying the authenticity of documents: how can we discern genuine documents from seemingly "perfect" copies? This paper proposes a solution based on creating digital images with specific properties, called a Copy-detection patterns (CDP), that is printed on arbitrary documents, packages, etc. CDPs make an optimal use of an "information loss principle": every time an imae is printed or scanned, some information is lost about the original digital image. That principle applies even for the highest quality scanning, digital imaging, printing or photocopying equipment today, and will likely remain true for tomorrow. By measuring the amount of information contained in a scanned CDP, the CDP detector can take a decision on the authenticity of the document.

  17. Event-specific qualitative and quantitative polymerase chain reaction analysis for genetically modified canola T45.


    Yang, Litao; Pan, Aihu; Zhang, Haibo; Guo, Jinchao; Yin, Changsong; Zhang, Dabing


    Polymerase chain reaction (PCR) methods have been the main technical support for the detection of genetically modified organisms (GMOs). To date, GMO-specific PCR detection strategies have been developed basically at four different levels, such as screening-, gene-, construct-, and event-specific detection methods. Event-specific PCR detection method is the primary trend in GMO detection because of its high specificity based on the flanking sequence of exogenous integrant. GM canola, event T45, with tolerance to glufosinate ammonium is one of the commercial genetically modified (GM) canola events approved in China. In this study, the 5'-integration junction sequence between host plant DNA and the integrated gene construct of T45 canola was cloned and revealed by means of TAIL-PCR. Specific PCR primers and TaqMan probes were designed based upon the revealed sequence, and qualitative and quantitative TaqMan real-time PCR detection assays employing these primers and probe were developed. In qualitative PCR, the limit of detection (LOD) was 0.1% for T45 canola in 100 ng of genomic DNA. The quantitative PCR assay showed limits of detection and quantification (LOD and LOQ) of 5 and 50 haploid genome copies, respectively. In addition, three mixed canola samples with known GM contents were detected employing the developed real-time PCR assay, and expected results were obtained. These results indicated that the developed event-specific PCR methods can be used for identification and quantification of T45 canola and its derivates.

  18. 19 CFR 151.64 - Extra copy of entry summary.

    Code of Federal Regulations, 2013 CFR


    ... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate...

  19. 19 CFR 151.64 - Extra copy of entry summary.

    Code of Federal Regulations, 2011 CFR


    ... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate...

  20. 19 CFR 151.64 - Extra copy of entry summary.

    Code of Federal Regulations, 2014 CFR


    ... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate...

  1. 19 CFR 151.64 - Extra copy of entry summary.

    Code of Federal Regulations, 2012 CFR


    ... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate...

  2. A Simulation Model for Purchasing Duplicate Copies in a Library

    ERIC Educational Resources Information Center

    Arms, W. Y.; Walter, T. P.


    A method of estimating the number of duplicate copies of books needed based on a computer simulation which takes into account number of copies available, number of loans, total underlying demand, satisfaction level, percentage time on shelf. (LS)


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. PHOTOGRAPHIC COPY OF HISTORIC POSTCARD, THE HOSE FIGHT, HOMECOMING, 1911 (Original copy in possession of Mrs. Elizabeth C. Arnesi) - Bridge Street Bridge, Spanning Grand River at Bridge Street, Portland, Ionia County, MI

  4. 19 CFR 151.64 - Extra copy of entry summary.

    Code of Federal Regulations, 2010 CFR


    ... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate...

  5. 40 CFR 262.22 - Number of copies.

    Code of Federal Regulations, 2014 CFR


    ...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner... returned to the generator....

  6. 40 CFR 262.22 - Number of copies.

    Code of Federal Regulations, 2013 CFR


    ...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner... returned to the generator....

  7. 40 CFR 262.22 - Number of copies.

    Code of Federal Regulations, 2010 CFR


    ...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner... returned to the generator....

  8. 40 CFR 262.22 - Number of copies.

    Code of Federal Regulations, 2012 CFR


    ...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner... returned to the generator....

  9. 40 CFR 262.22 - Number of copies.

    Code of Federal Regulations, 2011 CFR


    ...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner... returned to the generator....

  10. To copy or not to copy: A compile-time technique for assessing when data copying should be used to eliminate cache conflicts

    SciTech Connect

    Temam, O.; Granston, E.D.; Jalby, W.


    In recent years, loop tiling has become an increasingly popular technique for increasing cache effectiveness. This is accomplished by transforming a loop nest so that the temporal and spatial locality can be better exploited for a given cache size. However, this optimization only targets the reduction of capacity misses. As recently demonstrated by several groups of researchers, conflict misses can still preclude effective cache utilization. Moreover, the severity of cache conflicts can vary greatly with slight variations in problem size and starting addresses, making performance difficult to even predict, let alone optimize. To reduce conflict misses, data copying has been proposed. With this technique, data layout in cache is adjusted by copying array tiles into temporary arrays that exhibit better cache behavior. Although copying has been proposed as the panacea to the problem of cache conflicts, this solution experiences a cost proportional to the amount of data being copied. To date, there has been no discussion regarding either this tradeoff or the problem of determining what and when to copy. In this paper, the authors present a compile-time technique for making this determination, and present a selective copying strategy based on this methodology. Preliminary experimental results demonstrate that, because of the sensitivity of cache conflicts to small changes in problem size and base addresses, selective copying can lead to better overall performance than either no copying, complete copying, or copying based on manually applied heuristics.

  11. Chloroplast DNA Copy Number Changes during Plant Development in Organelle DNA Polymerase Mutants

    PubMed Central

    Morley, Stewart A.; Nielsen, Brent L.


    Chloroplast genome copy number is very high in leaf tissue, with upwards of 10,000 or more copies of the chloroplast DNA (ctDNA) per leaf cell. This is often promoted as a major advantage for engineering the plastid genome, as it provides high gene copy number and thus is expected to result in high expression of foreign proteins from integrated genes. However, it is also known that ctDNA copy number and ctDNA integrity decrease as cells age. Quantitative PCR (qPCR) allows measurement of organelle DNA levels relative to a nuclear gene target. We have used this approach to determine changes in copy number of ctDNA relative to the nuclear genome at different ages of Arabidopsis plant growth and in organellar DNA polymerase mutants. The mutant plant lines have T-DNA insertions in genes encoding the two organelle localized DNA polymerases (PolIA and PolIB). Each of these mutant lines exhibits some delay in plant growth and development as compared to wild-type plants, with the PolIB plants having a more pronounced delay. Both mutant lines develop to maturity and produce viable seeds. Mutants for both proteins were observed to have a reduction in ctDNA and mtDNA copy number relative to wild type plants at all time points as measured by qPCR. Both DNA polymerase mutants had a fairly similar decrease in ctDNA copy number, while the PolIB mutant had a greater effect of reduction in mtDNA levels. However, despite similar decreases in genome copy number, RT-PCR analysis of PolIA mutants show that PolIB expression remains unchanged, suggesting that PolIA may not be essential to plant survival. Furthermore, genotypic analysis of plants from heterozygous parents display a strong pressure to maintain two functioning copies of PolIB. These results indicate that the two DNA polymerases are both important in ctDNA replication, and they are not fully redundant to each other, suggesting each has a specific function in plant organelles. PMID:26870072

  12. 42 CFR 456.612 - Copies of reports.

    Code of Federal Regulations, 2010 CFR


    ... 42 Public Health 4 2010-10-01 2010-10-01 false Copies of reports. 456.612 Section 456.612 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Institutions for Mental Diseases § 456.612 Copies of reports. The agency must send a copy of each...

  13. 27 CFR 18.64 - Photographic copies of records.

    Code of Federal Regulations, 2010 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Photographic copies of records. 18.64 Section 18.64 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE... Reports § 18.64 Photographic copies of records. Proprietors may record, copy, or reproduce...

  14. 27 CFR 31.192 - Photographic copies of records.

    Code of Federal Regulations, 2010 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Photographic copies of records. 31.192 Section 31.192 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE... Records and Files § 31.192 Photographic copies of records. (a) General. Dealers may record, copy,...

  15. 27 CFR 22.165 - Photographic copies of records.

    Code of Federal Regulations, 2010 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Photographic copies of records. 22.165 Section 22.165 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE... Transactions § 22.165 Photographic copies of records. (a) General. Permittees may record, copy, or...

  16. 49 CFR 390.31 - Copies of records or documents.

    Code of Federal Regulations, 2010 CFR


    ... retention period. (b) To be acceptable in lieu of original records, photographic copies of records must meet the following minimum requirements: (1) Photographic copies shall be no less readily accessible than... facilities shall be available to locate, identify, read, and reproduce such photographic copies. (2)...

  17. 27 CFR 19.725 - Photographic copies of records.

    Code of Federal Regulations, 2010 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Photographic copies of records. 19.725 Section 19.725 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE... Photographic copies of records. (a) Application. Proprietors who desire to record, copy or reproduce...

  18. 27 CFR 20.268 - Photographic copies of records.

    Code of Federal Regulations, 2010 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Photographic copies of records. 20.268 Section 20.268 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE... Reports § 20.268 Photographic copies of records. (a) General. Permittees may record, copy, or...

  19. Syllables as Functional Units in a Copying Task

    ERIC Educational Resources Information Center

    Kandel, Sonia; Valdois, Sylviane


    This research used a copying task to study spelling acquisition from a perception and action perspective. First to fifth graders copied words and pseudo-words on a digitiser. Simultaneously, a camera registered the children's gaze lifts. First and second graders copied the first syllable and then produced a gaze lift to obtain information on the…

  20. Readability as a Factor in Magazine Ad Copy Recall.

    ERIC Educational Resources Information Center

    Wesson, David A.


    Examines the relationship between advertising copy readability and advertising effectiveness. Finds that recall is improved when the copy style is either fairly easy or fairly hard to read. Suggests the value of considering copy readability as a potential contributor, though a minor one, to the success of magazine advertising. (RS)

  1. 1 CFR 18.1 - Original and copies required.

    Code of Federal Regulations, 2014 CFR


    ... 1 General Provisions 1 2014-01-01 2012-01-01 true Original and copies required. 18.1 Section 18.1... PROCESSING OF DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.1 Original and copies... two duplicate originals or certified copies. 1 However, if the document is printed or processed...

  2. 1 CFR 18.1 - Original and copies required.

    Code of Federal Regulations, 2013 CFR


    ... 1 General Provisions 1 2013-01-01 2012-01-01 true Original and copies required. 18.1 Section 18.1... PROCESSING OF DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.1 Original and copies... two duplicate originals or certified copies. 1 However, if the document is printed or processed...

  3. 1 CFR 18.1 - Original and copies required.

    Code of Federal Regulations, 2012 CFR


    ... 1 General Provisions 1 2012-01-01 2012-01-01 false Original and copies required. 18.1 Section 18.1... PROCESSING OF DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.1 Original and copies... two duplicate originals or certified copies. 1 However, if the document is printed or processed...

  4. 75 FR 4031 - Streamlining Hard-Copy Postage Statement Processing

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... 111 Streamlining Hard-Copy Postage Statement Processing AGENCY: Postal Service\\TM\\. ACTION: Proposed... Postal Service, Domestic Mail Manual (DMM ), to reflect changes in the processing of hard-copy postage... complete the ``USPS Use Only'' section of, or round date, hard-copy postage statements...

  5. 47 CFR 3.25 - Number of copies.

    Code of Federal Regulations, 2010 CFR


    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Number of copies. 3.25 Section 3.25 Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL AUTHORIZATION AND ADMINISTRATION OF ACCOUNTING... copies. One original and one copy of FCC Form 44, “Application For Certification As An...

  6. 7 CFR 1200.12 - Copies of the transcript.

    Code of Federal Regulations, 2010 CFR


    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Copies of the transcript. 1200.12 Section 1200.12... Governing Proceedings To Formulate and Amend an Order § 1200.12 Copies of the transcript. (a) During the period in which the proceeding has an active status in the Department, a copy of the transcript...

  7. 26 CFR 601.525 - Certification of copies of documents.

    Code of Federal Regulations, 2010 CFR


    ... 26 Internal Revenue 20 2010-04-01 2010-04-01 false Certification of copies of documents. 601.525... Alcohol, Tobacco, and Firearms Activities § 601.525 Certification of copies of documents. The provisions of paragraph (e) of § 601.504 with respect to certification of copies are applicable to a power...

  8. 46 CFR 67.539 - Copies of instruments and documents.

    Code of Federal Regulations, 2010 CFR


    ... VESSELS DOCUMENTATION OF VESSELS Fees § 67.539 Copies of instruments and documents. The fee charged for furnishing a copy of any instrument or document is calculated in the same manner as described in 49 CFR 7.95. ... 46 Shipping 2 2010-10-01 2010-10-01 false Copies of instruments and documents. 67.539 Section...

  9. 40 CFR 374.5 - Copy of complaint.

    Code of Federal Regulations, 2010 CFR


    ... 40 Protection of Environment 27 2010-07-01 2010-07-01 false Copy of complaint. 374.5 Section 374.5... COMMUNITY RIGHT-TO-KNOW PROGRAMS PRIOR NOTICE OF CITIZEN SUITS § 374.5 Copy of complaint. At the time of filing an action under this Act, the plaintiff must provide a copy of the complaint to the...

  10. 47 CFR 78.67 - Copies of rules.

    Code of Federal Regulations, 2010 CFR


    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Copies of rules. 78.67 Section 78.67... SERVICE General Operating Requirements § 78.67 Copies of rules. The licensee of a CARS station shall have a current copy of this part 78, and, in cases where aeronautical obstruction marking of antennas...

  11. 7 CFR 46.8 - Copies of licenses.

    Code of Federal Regulations, 2010 CFR


    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Copies of licenses. 46.8 Section 46.8 Agriculture... THAN RULES OF PRACTICE) UNDER THE PERISHABLE AGRICULTURAL COMMODITIES ACT, 1930 Licenses § 46.8 Copies of licenses. Copies of licenses may be issued upon request and upon the payment of a fee of...

  12. 18 CFR 385.1904 - Copies of transcripts (Rule 1904).

    Code of Federal Regulations, 2010 CFR


    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Copies of transcripts... § 385.1904 Copies of transcripts (Rule 1904). The Commission will cause to be made a stenographic record of public hearings and such copies of the transcript thereof as it requires for its own...

  13. 12 CFR 269b.730 - Number of copies; form.

    Code of Federal Regulations, 2010 CFR


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Number of copies; form. 269b.730 Section 269b... SYSTEM CHARGES OF UNFAIR LABOR PRACTICES General Rules § 269b.730 Number of copies; form. Except as... copies in addition to the original. All matters filed shall be printed, typed, or otherwise...

  14. 7 CFR 900.11 - Copies of the transcript.

    Code of Federal Regulations, 2010 CFR


    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Copies of the transcript. 900.11 Section 900.11....11 Copies of the transcript. (a) During the period in which the proceeding has an active status in the Department, a copy of the transcript and exhibits shall be kept on file in the office of...

  15. 45 CFR 1309.40 - Copies of documents.

    Code of Federal Regulations, 2010 CFR


    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false Copies of documents. 1309.40 Section 1309.40 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES... § 1309.40 Copies of documents. Certified copies of the deed, lease, loan instrument, mortgage, and...

  16. 44 CFR 5.85 - Authentication and attestation of copies.

    Code of Federal Regulations, 2010 CFR


    ... attestation of copies. 5.85 Section 5.85 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT... Authentication and attestation of copies. The Administrator, Deputy Administrators, Regional Administrators... name of the Administrator to authenticate and attest for copies or reproductions of...

  17. 5 CFR 2423.6 - Filing and service of copies.

    Code of Federal Regulations, 2010 CFR


    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Filing and service of copies. 2423.6..., Investigating, Resolving, and Acting on Charges § 2423.6 Filing and service of copies. (a) Where to file. A... Charging Party is not required to file an original copy of the charge with the Region. A Charging...

  18. 40 CFR 264.53 - Copies of contingency plan.

    Code of Federal Regulations, 2010 CFR


    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Copies of contingency plan. 264.53 Section 264.53 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES... Contingency Plan and Emergency Procedures § 264.53 Copies of contingency plan. A copy of the contingency...

  19. 37 CFR 360.5 - Copies of claims.

    Code of Federal Regulations, 2010 CFR


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Copies of claims. 360.5... § 360.5 Copies of claims. A claimant shall, for each claim submitted to the Copyright Royalty Board by hand delivery or by mail, file an original and one copy of the claim to cable royalty fees....

  20. 45 CFR 2106.4 - Requests for copies of records.

    Code of Federal Regulations, 2010 CFR


    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false Requests for copies of records. 2106.4 Section... FOR COMPLIANCE WITH 5 U.S.C. 552a, THE PRIVACY ACT OF 1974 § 2106.4 Requests for copies of records. Rules governing requests for copies of records are the same as those for the granting of access to...

  1. 40 CFR 51.281 - Copies of rules and regulations.

    Code of Federal Regulations, 2010 CFR


    ... 40 Protection of Environment 2 2010-07-01 2010-07-01 false Copies of rules and regulations. 51.281... Requirements § 51.281 Copies of rules and regulations. Emission limitations and other measures necessary for... requirements of subpart L must be adopted as rules and regulations enforceable by the State agency. Copies...

  2. 34 CFR 5.52 - Copies of records.

    Code of Federal Regulations, 2010 CFR


    ... 34 Education 1 2010-07-01 2010-07-01 false Copies of records. 5.52 Section 5.52 Education Office.... L. 90-23 (Eff. until 7-14-10) Procedures for Requesting Access to Records § 5.52 Copies of records. Copies of available records shall be produced as promptly as possible upon receipt of the fee...

  3. 33 CFR 88.05 - Copy of rules.

    Code of Federal Regulations, 2010 CFR


    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Copy of rules. 88.05 Section 88... RULES ANNEX V: PILOT RULES § 88.05 Copy of rules. The operator of each self-propelled vessel 12 meters or more in length shall carry on board and maintain for ready reference a copy of the...

  4. 19 CFR 210.55 - Content of service copies.

    Code of Federal Regulations, 2010 CFR


    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Content of service copies. 210.55 Section 210.55... TRADE ADJUDICATION AND ENFORCEMENT Temporary Relief § 210.55 Content of service copies. (a) Any purported confidential business information that is deleted from the nonconfidential service copies of...

  5. 27 CFR 478.95 - Certified copy of license.

    Code of Federal Regulations, 2010 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 3 2010-04-01 2010-04-01 false Certified copy of license... Conduct of Business § 478.95 Certified copy of license. The license furnished to each person licensed... the licensee desires an additional copy of the license for certification (instead of making...

  6. 47 CFR 95.673 - Copy of rules.

    Code of Federal Regulations, 2010 CFR


    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Copy of rules. 95.673 Section 95.673... SERVICES Technical Regulations Additional Certification Requirements for Cb Transmitters § 95.673 Copy of rules. A copy of part 95, subpart D, of the FCC Rules, current at the time of packing of the...

  7. 40 CFR 35.935-10 - Copies of contract documents.

    Code of Federal Regulations, 2010 CFR


    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Copies of contract documents. 35.935-10... Copies of contract documents. In addition to the notification of project changes under § 30.900 of this chapter, a grantee must promptly submit to the Regional Administrator a copy of any prime contract...

  8. 49 CFR 1312.13 - Furnishing copies of tariff publications.

    Code of Federal Regulations, 2010 CFR


    ... with 49 CFR 1312.13 has been made. (d) Charges. (1) If any charge is made, the charge for copies of... 49 Transportation 9 2010-10-01 2010-10-01 false Furnishing copies of tariff publications. 1312.13... CARRIER IN NONCONTIGUOUS DOMESTIC TRADE § 1312.13 Furnishing copies of tariff publications....

  9. 47 CFR 1.356 - Copies of exhibits.

    Code of Federal Regulations, 2010 CFR


    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Copies of exhibits. 1.356 Section 1.356....356 Copies of exhibits. No document or exhibit, or part thereof, shall be received as, or admitted in... offered in evidence, copies shall be furnished to other counsel unless the presiding officer...

  10. 37 CFR 360.14 - Copies of claims.

    Code of Federal Regulations, 2010 CFR


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Copies of claims. 360.14... Claims § 360.14 Copies of claims. A claimant shall, for each claim submitted to the Copyright Royalty Board by hand delivery or by mail, file an original and one copy of the claim to satellite...

  11. 29 CFR 1905.7 - Form of documents; subscription; copies.

    Code of Federal Regulations, 2010 CFR


    ... 29 Labor 5 2010-07-01 2010-07-01 false Form of documents; subscription; copies. 1905.7 Section...; subscription; copies. (a) No particular form is prescribed for applications and other papers which may be filed.... An original and six copies of any application or other papers shall be filed. The original shall...

  12. 46 CFR 502.168 - Copies of data or evidence.

    Code of Federal Regulations, 2010 CFR


    ... 46 Shipping 9 2010-10-01 2010-10-01 false Copies of data or evidence. 502.168 Section 502.168... Hearings; Presiding Officers; Evidence § 502.168 Copies of data or evidence. Every person compelled to submit data or evidence shall be entitled to retain or, on payment of proper costs, procure a copy...

  13. 33 CFR 72.01-40 - Single copies.

    Code of Federal Regulations, 2010 CFR


    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Single copies. 72.01-40 Section 72.01-40 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY AIDS TO NAVIGATION MARINE INFORMATION Notices to Mariners § 72.01-40 Single copies. Single copies of the “Notice...

  14. 49 CFR 1001.2 - Certified copies of records.

    Code of Federal Regulations, 2010 CFR


    ... 49 Transportation 8 2010-10-01 2010-10-01 false Certified copies of records. 1001.2 Section 1001.2... OF TRANSPORTATION GENERAL RULES AND REGULATIONS INSPECTION OF RECORDS § 1001.2 Certified copies of records. Copies of and extracts from public records will be certified by the Records Officer....

  15. 30 CFR 47.72 - Cost for copies.

    Code of Federal Regulations, 2010 CFR


    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Cost for copies. 47.72 Section 47.72 Mineral... COMMUNICATION (HazCom) Making HazCom Information Available § 47.72 Cost for copies. (a) The operator must provide the first copy and each revision of the HazCom material without cost. (b) Fees for a...

  16. 47 CFR 78.67 - Copies of rules.

    Code of Federal Regulations, 2011 CFR


    ... 47 Telecommunication 4 2011-10-01 2011-10-01 false Copies of rules. 78.67 Section 78.67 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES CABLE TELEVISION RELAY SERVICE General Operating Requirements § 78.67 Copies of rules. The licensee of a CARS station shall have a current copy of this part 78, and,...

  17. 47 CFR 78.67 - Copies of rules.

    Code of Federal Regulations, 2012 CFR


    ... 47 Telecommunication 4 2012-10-01 2012-10-01 false Copies of rules. 78.67 Section 78.67 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES CABLE TELEVISION RELAY SERVICE General Operating Requirements § 78.67 Copies of rules. The licensee of a CARS station shall have a current copy of this part 78, and,...

  18. 47 CFR 78.67 - Copies of rules.

    Code of Federal Regulations, 2014 CFR


    ... 47 Telecommunication 4 2014-10-01 2014-10-01 false Copies of rules. 78.67 Section 78.67 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES CABLE TELEVISION RELAY SERVICE General Operating Requirements § 78.67 Copies of rules. The licensee of a CARS station shall have a current copy of this part 78, and,...

  19. 47 CFR 78.67 - Copies of rules.

    Code of Federal Regulations, 2013 CFR


    ... 47 Telecommunication 4 2013-10-01 2013-10-01 false Copies of rules. 78.67 Section 78.67 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES CABLE TELEVISION RELAY SERVICE General Operating Requirements § 78.67 Copies of rules. The licensee of a CARS station shall have a current copy of this part 78, and,...

  20. 18 CFR 33.8 - Number of copies.

    Code of Federal Regulations, 2010 CFR


    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Number of copies. 33.8 Section 33.8 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF... Number of copies. An original and eight copies of the application under this part must be submitted....

  1. 1 CFR 18.1 - Original and copies required.

    Code of Federal Regulations, 2011 CFR


    ... 1 General Provisions 1 2011-01-01 2011-01-01 false Original and copies required. 18.1 Section 18.1... PROCESSING OF DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.1 Original and copies... two duplicate originals or certified copies. 1 However, if the document is printed or processed...

  2. 1 CFR 18.1 - Original and copies required.

    Code of Federal Regulations, 2010 CFR


    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Original and copies required. 18.1 Section 18.1... PROCESSING OF DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.1 Original and copies... two duplicate originals or certified copies. 1 However, if the document is printed or processed...

  3. Vitrification of Carotid Artery Segments: An Integrated Study of Thermophysical Events and Functional Recovery Toward Scale-Up for Clinical Applications

    PubMed Central



    In recent years, ice-free cryopreservation by vitrification has been demonstrated to provide superior preservation of tissues compared with conventional freezing methods. To date, this has been accomplished almost exclusively for small model systems, whereas cryopreservation of large tissue samples—of a clinically useful size—continues to be hampered by thermomechanical effects that compromise the structure and function of the tissue. Reduction of mechanical stress is an integral condition of successful cryopreservation of large specimens. The current study focuses on the impact of sample size on both the physical events, observed by cryomacroscopy, and on the outcome on tissue function. To this end, the current study sought to address the question of functional recovery of vitrified carotid artery segments, processed as either artery rings (3–4 mm long) or segments (25 mm long) as selected models; the latter model represents a significant increase in sample size for evaluating the effects of vitrification. Tissue vitrification using an 8.4 M cryoprotectant cocktail solution (VS55) was achieved in 1-ml samples by imposing either a high (50–70 °C/min) or a low (2–3 °C/min) cooling rate, between −40°C and −100°C, and a high rewarming rate between −100°C and −40°C. Following cryoprotectant removal, the artery segments were cut into 3 to 4-mm rings for function testing on a contractility apparatus by measuring isometric responses to four agonist and antagonists (norepinephrine, phenylepinephrine, calcium ionophore, and sodium nitroprusside). In addition, nonspecific metabolic function of the vessel rings was determined using the REDOX indicator alamarBlue. Contractile function in response to the agonists norepinephrine and phenylepinephrine was maintained at the same level (350%) for the segments as for the rings, when compared with noncryopreserved control samples. Relaxation in response to the antagonists calcium ionophore and sodium

  4. Slow slip events in the Kii Peninsula and Shikoku, Japan detected by strain changes at the integrated observatories of Geological Survey of Japan, AIST

    NASA Astrophysics Data System (ADS)

    Itaba, S.; Ohtani, R.; Kitagawa, Y.; Matsumoto, N.; Koizumi, N.


    In 2006, Geological Survey of Japan (GSJ), National Institute of Advanced Industrial Science and Technology (AIST) started constructing integrated observatories in and around Shikoku and Kii Peninsula, Japan for research on the Tonankai and Nankai earthquakes. Two observatories were constructed at Kii Peninsula in June 2007, and ten were completed in January 2009. Each observatory has three wells where water temperature, water level (pressure) and ground motion are observed. At one of the three wells, crustal strain is also observed by a multi-component borehole strain meter. According to Automatic Tremor Monitoring System (ATMOS) of Hiroshima University, 11 tremor activities have occurred in the Kii Peninsula since June 2007. We detected strain changes related to these tremor activities. The changes can be explained by short-term slow slip events (SSEs) occurring at several segments of the plate boundary, whose locations are consistent with the tremor activities (e.g. Itaba et al., 2009a). We analyzed these SSEs with the forward method in consideration of locations of the tremors. On the other hand, the observation suggested the existence of SSEs before or without the tremors (e.g. Fukuda and Sagiya, 2008; Itaba et al., 2009b). Therefore, it is important to detect SSEs just by strain changes. We tried to decide the fault planes for SSEs only using the strain data of the observatories of AIST. Since it is difficult to detect strain changes related to SSEs at two or more observatories of AIST, we decided the fault plain by a grid-search method. As a result, the fault plains for SSEs were consistent with the locations of the tremors. References Fukuda, M. and T. Sagiya, Slow strain changes recorded at Shingu borehole station in the southeastern Kii peninsula, The 7th General Assembly of Asian Seismological Commission and The 2008 Fall meeting of Seismological Society of Japan, Tsukuba, 2008. Itaba, S., N. Koizumi, N. Matsumoto and R. Ohtani, Continuous Observation of

  5. Copy-Number Gains of HUWE1 Due to Replication- and Recombination-Based Rearrangements

    PubMed Central

    Froyen, Guy; Belet, Stefanie; Martinez, Francisco; Santos-Rebouças, Cíntia Barros; Declercq, Matthias; Verbeeck, Jelle; Donckers, Lene; Berland, Siren; Mayo, Sonia; Rosello, Monica; Pimentel, Márcia Mattos Gonçalves; Fintelman-Rodrigues, Natalia; Hovland, Randi; Rodrigues dos Santos, Suely; Raymond, F. Lucy; Bose, Tulika; Corbett, Mark A.; Sheffield, Leslie; van Ravenswaaij-Arts, Conny M.A.; Dijkhuizen, Trijnie; Coutton, Charles; Satre, Veronique; Siu, Victoria; Marynen, Peter


    We previously reported on nonrecurrent overlapping duplications at Xp11.22 in individuals with nonsyndromic intellectual disability (ID) harboring HSD17B10, HUWE1, and the microRNAs miR-98 and let-7f-2 in the smallest region of overlap. Here, we describe six additional individuals with nonsyndromic ID and overlapping microduplications that segregate in the families. High-resolution mapping of the 12 copy-number gains reduced the minimal duplicated region to the HUWE1 locus only. Consequently, increased mRNA levels were detected for HUWE1, but not HSD17B10. Marker and SNP analysis, together with identification of two de novo events, suggested a paternally derived intrachromosomal duplication event. In four independent families, we report on a polymorphic 70 kb recurrent copy-number gain, which harbors part of HUWE1 (exon 28 to 3′ untranslated region), including miR-98 and let-7f-2. Our findings thus demonstrate that HUWE1 is the only remaining dosage-sensitive gene associated with the ID phenotype. Junction and in silico analysis of breakpoint regions demonstrated simple microhomology-mediated rearrangements suggestive of replication-based duplication events. Intriguingly, in a single family, the duplication was generated through nonallelic homologous recombination (NAHR) with the use of HUWE1-flanking imperfect low-copy repeats, which drive this infrequent NAHR event. The recurrent partial HUWE1 copy-number gain was also generated through NAHR, but here, the homologous sequences used were identified as TcMAR-Tigger DNA elements, a template that has not yet been reported for NAHR. In summary, we showed that an increased dosage of HUWE1 causes nonsyndromic ID and demonstrated that the Xp11.22 region is prone to recombination- and replication-based rearrangements. PMID:22840365

  6. Copy-number gains of HUWE1 due to replication- and recombination-based rearrangements.


    Froyen, Guy; Belet, Stefanie; Martinez, Francisco; Santos-Rebouças, Cíntia Barros; Declercq, Matthias; Verbeeck, Jelle; Donckers, Lene; Berland, Siren; Mayo, Sonia; Rosello, Monica; Pimentel, Márcia Mattos Gonçalves; Fintelman-Rodrigues, Natalia; Hovland, Randi; Rodrigues dos Santos, Suely; Raymond, F Lucy; Bose, Tulika; Corbett, Mark A; Sheffield, Leslie; van Ravenswaaij-Arts, Conny M A; Dijkhuizen, Trijnie; Coutton, Charles; Satre, Veronique; Siu, Victoria; Marynen, Peter


    We previously reported on nonrecurrent overlapping duplications at Xp11.22 in individuals with nonsyndromic intellectual disability (ID) harboring HSD17B10, HUWE1, and the microRNAs miR-98 and let-7f-2 in the smallest region of overlap. Here, we describe six additional individuals with nonsyndromic ID and overlapping microduplications that segregate in the families. High-resolution mapping of the 12 copy-number gains reduced the minimal duplicated region to the HUWE1 locus only. Consequently, increased mRNA levels were detected for HUWE1, but not HSD17B10. Marker and SNP analysis, together with identification of two de novo events, suggested a paternally derived intrachromosomal duplication event. In four independent families, we report on a polymorphic 70 kb recurrent copy-number gain, which harbors part of HUWE1 (exon 28 to 3' untranslated region), including miR-98 and let-7f-2. Our findings thus demonstrate that HUWE1 is the only remaining dosage-sensitive gene associated with the ID phenotype. Junction and in silico analysis of breakpoint regions demonstrated simple microhomology-mediated rearrangements suggestive of replication-based duplication events. Intriguingly, in a single family, the duplication was generated through nonallelic homologous recombination (NAHR) with the use of HUWE1-flanking imperfect low-copy repeats, which drive this infrequent NAHR event. The recurrent partial HUWE1 copy-number gain was also generated through NAHR, but here, the homologous sequences used were identified as TcMAR-Tigger DNA elements, a template that has not yet been reported for NAHR. In summary, we showed that an increased dosage of HUWE1 causes nonsyndromic ID and demonstrated that the Xp11.22 region is prone to recombination- and replication-based rearrangements.

  7. Digital image forensics for photographic copying

    NASA Astrophysics Data System (ADS)

    Yin, Jing; Fang, Yanmei


    Image display technology has greatly developed over the past few decades, which make it possible to recapture high-quality images from the display medium, such as a liquid crystal display(LCD) screen or a printed paper. The recaptured images are not regarded as a separate image class in the current research of digital image forensics, while the content of the recaptured images may have been tempered. In this paper, two sets of features based on the noise and the traces of double JPEG compression are proposed to identify these recaptured images. Experimental results showed that our proposed features perform well for detecting photographic copying.

  8. Getting DNA copy numbers without control samples

    PubMed Central


    Background The selection of the reference to scale the data in a copy number analysis has paramount importance to achieve accurate estimates. Usually this reference is generated using control samples included in the study. However, these control samples are not always available and in these cases, an artificial reference must be created. A proper generation of this signal is crucial in terms of both noise and bias. We propose NSA (Normality Search Algorithm), a scaling method that works with and without control samples. It is based on the assumption that genomic regions enriched in SNPs with identical copy numbers in both alleles are likely to be normal. These normal regions are predicted for each sample individually and used to calculate the final reference signal. NSA can be applied to any CN data regardless the microarray technology and preprocessing method. It also finds an optimal weighting of the samples minimizing possible batch effects. Results Five human datasets (a subset of HapMap samples, Glioblastoma Multiforme (GBM), Ovarian, Prostate and Lung Cancer experiments) have been analyzed. It is shown that using only tumoral samples, NSA is able to remove the bias in the copy number estimation, to reduce the noise and therefore, to increase the ability to detect copy number aberrations (CNAs). These improvements allow NSA to also detect recurrent aberrations more accurately than other state of the art methods. Conclusions NSA provides a robust and accurate reference for scaling probe signals data to CN values without the need of control samples. It minimizes the problems of bias, noise and batch effects in the estimation of CNs. Therefore, NSA scaling approach helps to better detect recurrent CNAs than current methods. The automatic selection of references makes it useful to perform bulk analysis of many GEO or ArrayExpress experiments without the need of developing a parser to find the normal samples or possible batches within the data. The method is

  9. Combined analysis of gene expression, DNA copy number, and mutation profiling data to display biological process anomalies in individual breast cancers.


    Shi, Weiwei; Balazs, Balint; Györffy, Balazs; Jiang, Tingting; Symmans, W Fraser; Hatzis, Christos; Pusztai, Lajos


    The goal of this analysis was to develop a computational tool that integrates the totality of gene expression, DNA copy number, and sequence abnormalities in individual cancers in the framework of biological processes. We used the hierarchical structure of the gene ontology (GO) database to create a reference network and projected mRNA expression, DNA copy number and mutation anomalies detected in single samples into this space. We applied our method to 59 breast cancers where all three types of molecular data were available. Each cancer had a large number of disturbed biological processes. Locomotion, multicellular organismal process, and signal transduction pathways were the most commonly affected GO terms, but the individual molecular events were different from case-to-case. Estrogen receptor-positive and -negative cancers had different repertoire of anomalies. We tested the functional impact of 27 mRNAs that had overexpression in cancer with variable frequency (<2-42 %) using an siRNA screen. Each of these genes inhibited cell growth in at least some of 18 breast cancer cell lines. We developed a free, on-line software tool ( ) to display the complex genomic abnormalities in individual cancers in the biological framework of the GO biological processes. Each cancer harbored a variable number of pathway anomalies and the individual molecular events that caused an anomaly varied from case-to-case. Our in vitro experiments indicate that rare case-specific molecular abnormalities can play a functional role and driver events may vary from case-to-case depending on the constellation of other molecular anomalies.

  10. FACETS: allele-specific copy number and clonal heterogeneity analysis tool for high-throughput DNA sequencing.


    Shen, Ronglai; Seshan, Venkatraman E


    Allele-specific copy number analysis (ASCN) from next generation sequencing (NGS) data can greatly extend the utility of NGS beyond the identification of mutations to precisely annotate the genome for the detection of homozygous/heterozygous deletions, copy-neutral loss-of-heterozygosity (LOH), allele-specific gains/amplifications. In addition, as targeted gene panels are increasingly used in clinical sequencing studies for the detection of 'actionable' mutations and copy number alterations to guide treatment decisions, accurate, tumor purity-, ploidy- and clonal heterogeneity-adjusted integer copy number calls are greatly needed to more reliably interpret NGS-based cancer gene copy number data in the context of clinical sequencing. We developed FACETS, an ASCN tool and open-source software with a broad application to whole genome, whole-exome, as well as targeted panel sequencing platforms. It is a fully integrated stand-alone pipeline that includes sequencing BAM file post-processing, joint segmentation of total- and allele-specific read counts, and integer copy number calls corrected for tumor purity, ploidy and clonal heterogeneity, with comprehensive output and integrated visualization. We demonstrate the application of FACETS using The Cancer Genome Atlas (TCGA) whole-exome sequencing of lung adenocarcinoma samples. We also demonstrate its application to a clinical sequencing platform based on a targeted gene panel.

  11. FACETS: allele-specific copy number and clonal heterogeneity analysis tool for high-throughput DNA sequencing

    PubMed Central

    Shen, Ronglai; Seshan, Venkatraman E.


    Allele-specific copy number analysis (ASCN) from next generation sequencing (NGS) data can greatly extend the utility of NGS beyond the identification of mutations to precisely annotate the genome for the detection of homozygous/heterozygous deletions, copy-neutral loss-of-heterozygosity (LOH), allele-specific gains/amplifications. In addition, as targeted gene panels are increasingly used in clinical sequencing studies for the detection of ‘actionable’ mutations and copy number alterations to guide treatment decisions, accurate, tumor purity-, ploidy- and clonal heterogeneity-adjusted integer copy number calls are greatly needed to more reliably interpret NGS-based cancer gene copy number data in the context of clinical sequencing. We developed FACETS, an ASCN tool and open-source software with a broad application to whole genome, whole-exome, as well as targeted panel sequencing platforms. It is a fully integrated stand-alone pipeline that includes sequencing BAM file post-processing, joint segmentation of total- and allele-specific read counts, and integer copy number calls corrected for tumor purity, ploidy and clonal heterogeneity, with comprehensive output and integrated visualization. We demonstrate the application of FACETS using The Cancer Genome Atlas (TCGA) whole-exome sequencing of lung adenocarcinoma samples. We also demonstrate its application to a clinical sequencing platform based on a targeted gene panel. PMID:27270079

  12. FACETS: allele-specific copy number and clonal heterogeneity analysis tool for high-throughput DNA sequencing.


    Shen, Ronglai; Seshan, Venkatraman E


    Allele-specific copy number analysis (ASCN) from next generation sequencing (NGS) data can greatly extend the utility of NGS beyond the identification of mutations to precisely annotate the genome for the detection of homozygous/heterozygous deletions, copy-neutral loss-of-heterozygosity (LOH), allele-specific gains/amplifications. In addition, as targeted gene panels are increasingly used in clinical sequencing studies for the detection of 'actionable' mutations and copy number alterations to guide treatment decisions, accurate, tumor purity-, ploidy- and clonal heterogeneity-adjusted integer copy number calls are greatly needed to more reliably interpret NGS-based cancer gene copy number data in the context of clinical sequencing. We developed FACETS, an ASCN tool and open-source software with a broad application to whole genome, whole-exome, as well as targeted panel sequencing platforms. It is a fully integrated stand-alone pipeline that includes sequencing BAM file post-processing, joint segmentation of total- and allele-specific read counts, and integer copy number calls corrected for tumor purity, ploidy and clonal heterogeneity, with comprehensive output and integrated visualization. We demonstrate the application of FACETS using The Cancer Genome Atlas (TCGA) whole-exome sequencing of lung adenocarcinoma samples. We also demonstrate its application to a clinical sequencing platform based on a targeted gene panel. PMID:27270079

  13. Rapid selection using G418 of high copy number transformants of Pichia pastoris for high-level foreign gene expression.


    Scorer, C A; Clare, J J; McCombie, W R; Romanos, M A; Sreekrishna, K


    Pichia pastoris is a methylotrophic yeast increasingly important in the production of therapeutic proteins. Expression vectors are based on the methanol-inducible AOX1 promoter and are integrated into the host chromosome. In most cases high copy number integration has been shown to be important for high-level expression. Since this occurs at low frequency during transformation, we previously used DNA dot blot screens to identify suitable clones. In this paper we report the use of vectors containing the Tn903 kanr gene conferring G418-resistance. Initial experiments demonstrated that copy number showed a tight correlation with drug-resistance. Using a G418 growth inhibition screen, we readily isolated a series of transformants, containing progressively increasing numbers (1 to 12) of a vector expressing HIV-1 ENV, which we used to examine the relationship between copy number and foreign mRNA levels. Northern blot analysis indicated that ENV mRNA levels from a single-copy clone were nearly as high as AOX1 mRNA, and increased progressively with increasing copy number so as to greatly exceed AOX1 mRNA. We have also developed protocols for the selection, using G418, of high copy number transformants following spheroplast transformation or electroporation. We anticipate that these protocols will simplify the use of Pichia as a biotechnological tool.

  14. Integration of the Pleasant Events (PE) and Activity Restriction (AR) Models: Development and Validation of a “PEAR” Model of Negative Outcomes in Alzheimer’s Caregivers

    PubMed Central

    Mausbach, Brent T; Roepke, Susan K; Depp, Colin A.; Moore, Raeanne; Patterson, Thomas L; Grant, Igor


    This study examined an activity restriction/pleasurable activities mismatch model for psychosocial and health-related outcomes. A total of 108 spousal caregivers of patients with Alzheimer’s Disease (AD) were assessed for their experience of social and recreational activities over the past month as well as their perception of how restricted they were for engaging in social and recreational activities. Participants were divided into three groups based on their reported activities and activity restriction: HPLR = High Pleasant Events + Low Activity Restriction (i.e., reference group; N = 28); HPHR/LPLR = Either High Pleasant Events + High Activity Restriction or Low Pleasant Events + Low Activity Restriction (N = 43); LPHR = Low Pleasant Events + High Activity Restriction (N = 37). We hypothesized that participants reporting low pleasant events combined with high activity restriction (LPHR) would demonstrate greater disturbance relative to other two groups in multiple outcome domains including: a) greater mood disturbance, b) greater use of negative coping factors, c) reduced use of positive coping strategies, d) reduced report of psychological resource factors (e.g., personal mastery, self-efficacy), and increased report of subjective health difficulties (e.g., sleep disturbance). Results generally supported our hypotheses, suggesting that assessment of both constructs is important for best predicting quality of well-being in AD caregivers, and potentially for establishing maximal effect in behavior therapy for caregivers. PMID:21292054

  15. Identification of Copy Number Variations in Xiang and Kele Pigs

    PubMed Central

    Xie, Jian; Li, Rongrong; Li, Sheng; Ran, Xueqin; Wang, Jiafu; Jiang, Jicai; Zhao, Pengju


    Xiang and Kele pigs are two well-known local Chinese pig breeds that possess rich genetic resources and have enormous economic and scientific value. We performed a comprehensive genomic analysis of the copy number variations (CNVs) in these breeds. CNVs are one of the most important forms of genomic variation and have profound effects on phenotypic variation. In this study, PorcineSNP60 genotyping data from 98 Xiang pigs and 22 Kele pigs were used to identify CNVs. In total, 172 candidate CNV regions (CNVRs) were identified, ranging from 3.19 kb to 8175.26 kb and covering 80.41 Mb of the pig genome. Approximately 56.40% (97/172) of the CNVRs overlapped with those identified in seven previous studies, and 43.60% (75/172) of the identified CNVRs were novel. Of the identified CNVRs, 82 (47 gain, 33 loss, and two gain-loss events that covered 4.58 Mb of the pig genome) were found only in a Xiang population with a large litter size. In contrast, 13 CNVRs (8 gain and 5 loss events) were unique to a Xiang population with small litter sizes, and 30 CNVRs (14 loss and 16 gain events) were unique to Kele pigs. The CNVRs span approximately 660 annotated Sus scrofa genes that are significantly enriched for specific biological functions, such as sensory perception, cognition, reproduction, ATP biosynthetic processes, and neurological processes. Many CNVR-associated genes, particularly the genes involved in reproductive traits, differed between the Xiang populations with large and small litter sizes, and these genes warrant further investigation due to their importance in determining the reproductive performance of Xiang pigs. Our results provide meaningful information about genomic variation, which may be useful in future assessments of the associations between CNVs and important phenotypes in Xiang and Kele pigs to ultimately help protect these rare breeds. PMID:26840413

  16. Copying Actions and Copying Outcomes: Social Learning through the Second Year

    ERIC Educational Resources Information Center

    Nielsen, Mark


    The present work documents how the logic of a model's demonstration and the communicative cues that the model provides interact with age to influence how children engage in social learning. Children at ages 12, 18, and 24 months (n = 204) watched a model open a series of boxes. Twelve-month-old subjects only copied the specific actions of the…

  17. Imitation in Young Children: When Who Gets Copied Is More Important than What Gets Copied

    ERIC Educational Resources Information Center

    Nielsen, Mark; Blank, Cornelia


    Unlike other animals, human children will copy all of an adult's goal-directed actions, including ones that are clearly unnecessary for achieving the demonstrated goal. Here we highlight how social affiliation is key to this species-specific behavior. Preschoolers watched 2 adults retrieve a toy from a novel apparatus. One adult included…

  18. Conditionally Amplifiable BACs: Switching From Single-Copy to High-Copy Vectors and Genomic Clones

    PubMed Central

    Wild, Jadwiga; Hradecna, Zdenka; Szybalski, Waclaw


    The widely used, very-low-copy BAC (bacterial artificial chromosome) vectors are the mainstay of present genomic research. The principal advantage of BACs is the high stability of inserted clones, but an important disadvantage is the low yield of DNA, both for vectors alone and when carrying genomic inserts. We describe here a novel class of single-copy/high-copy (SC/HC) pBAC/oriV vectors that retain all the advantages of low-copy BAC vectors, but are endowed with a conditional and tightly controlled oriV/TrfA amplification system that allows: (1) a yield of ∼100 copies of the vector per host cell when conditionally induced with l-arabinose, and (2) analogous DNA amplification (only upon induction and with copy number depending on the insert size) of pBAC/oriV clones carrying >100-kb inserts. Amplifiable clones and libraries facilitate high-throughput DNA sequencing and other applications requiring HC plasmid DNA. To turn on DNA amplification, which is driven by the oriV origin of replication, we used copy-up mutations in the gene trfA whose expression was very tightly controlled by the araC–ParaBAD promoter/regulator system. This system is inducible by l-arabinose, and could be further regulated by glucose and fucose. Amplification of DNA upon induction with l-arabinose and its modulation by glucose are robust and reliable. Furthermore, we discovered that addition of 0.2% d-glucose to the growth medium helped toward the objective of obtaining a real SC state for all BAC systems, thus enhancing the stability of their maintenance, which became equivalent to cloning into the host chromosome. [The following individuals kindly provided reagents, samples or unpublished information as indicated in the paper: F.R. Blattner D. Helinski, S. Valla, F. Schomburg, C. Small, R. Bogden, C. Gaskins, M.P. Mayer, D.C. Schwartz, and O. Azzam.] PMID:12213781

  19. An integrated approach for identifying homogeneous regions of extreme rainfall events and estimating IDF curves in Southern Ontario, Canada: Incorporating radar observations

    NASA Astrophysics Data System (ADS)

    Paixao, Edson; Mirza, M. Monirul Qader; Shephard, Mark W.; Auld, Heather; Klaassen, Joan; Smith, Graham


    Reliable extreme rainfall information is required for many applications including infrastructure design, management of water resources, and planning for weather-related emergencies in urban and rural areas. In this study, in situ TBRG sub-daily rainfall rate observations have been supplemented with weather radar information to better capture the spatial and temporal variability of heavy rainfall events regionally. Comparison of extreme rainfall events show that the absolute differences between the rain gauge and radar generally increase with increasing rainfall. Better agreement between the two observations is found when comparing the collocated radar and TBRG annual maximum values. The median difference is <18% for the annual maximum rainfall values ⩽50 mm. The median of difference of IDF estimates obtained through the Gumbel distribution for 10-year return period values computed from TBRG and radar are also found to be 4%. The overall results of this analysis demonstrates the potential value of incorporating remotely sensed radar with traditional point source TBRG network observations to provide additional insight on extreme rainfall events regionally, especially in terms of identifying homogeneous regions of extreme rainfall. The radar observations are particularly useful in areas where there is insufficient TBRG station density to statistically capture the extreme rainfall events.

  20. Copy Number Variants in pharmacogenetic genes

    PubMed Central

    He, Yijing; Hoskins, Janelle M.; McLeod, Howard L.


    Variation in drug efficacy and toxicity remains an important clinical concern. Presently, single nucleotide polymorphisms (SNP) only explain a portion of this problem, even in situations where the pharmacological trait is clearly heritable. The Human CNV Project identified copy number variations (CNVs) across approximately 12% of the human genome, and these CNVs were considered causes of diseases. Although the contribution of CNVs to the pathogenesis of many common diseases is questionable, CNVs play a clear role in drug related genes by altering drug metabolizing and drug response. Here we provide a comprehensive review of the clinical relevance of CNVs to drug efficacy, toxicity, disease prevalence in world populations and discuss the implication of using CNVs as diagnosis in clinical intervention. PMID:21388883

  1. Imperfect mirror copies of the standard model

    NASA Astrophysics Data System (ADS)

    Berryman, Jeffrey M.; de Gouvêa, André; Hernández, Daniel; Kelly, Kevin J.


    Inspired by the standard model of particle physics, we discuss a mechanism for constructing chiral, anomaly-free gauge theories. The gauge symmetries and particle content of such theories are identified using subgroups and complex representations of simple anomaly-free Lie groups, such as S O (10 ) or E6. We explore, using mostly S O (10 ) and the 16 representation, several of these "imperfect copies" of the standard model, including U (1 )N theories, S U (5 )⊗U (1 ) theories, S U (4 )⊗U (1 )2 theories with 4-plets and 6-plets, and chiral S U (3 )⊗S U (2 )⊗U (1 ) . A few general properties of such theories are discussed, as is how they might shed light on nonzero neutrino masses, the dark matter puzzle, and other phenomenologically relevant questions.

  2. Double-copy constructions and unitarity cuts

    NASA Astrophysics Data System (ADS)

    Bern, Zvi; Davies, Scott; Nohle, Josh


    The duality between color and kinematics enables the construction of multiloop gravity integrands directly from corresponding gauge-theory integrands. This has led to new nontrivial insights into the structure of gravity theories, including the discovery of enhanced ultraviolet cancellations. To continue to gain deeper understandings and probe these new properties, it is crucial to further improve techniques for constructing multiloop gravity integrands. In this paper, we show by example how one can alleviate difficulties encountered at the multiloop level by relaxing the color-kinematics duality conditions to hold manifestly only on unitarity cuts instead of globally on loop integrands. As an example, we use a minimal Ansatz to construct an integrand for the two-loop four-point nonsupersymmetric pure Yang-Mills amplitude in D dimensions that is compatible with these relaxed color-kinematics duality constraints. We then immediately obtain a corresponding gravity integrand through the double-copy procedure. Comments on ultraviolet divergences are also included.

  3. Copy-move forgery detection in digital image

    NASA Astrophysics Data System (ADS)

    Alamro, Loai; Yusoff, Nooraini


    Copy-move is considered as one of the most popular kind of digital image tempering, in which one or more parts of a digital image are copied and pasted into different locations. Geometric transformation is among the major challenges in detecting copy-move forgery of a digital image. In such forgery, the copied and moved parts of a forged image are either rotated or/and re-scaled. Hence, in this study we propose a combination of Discrete Wavelet Transform (DWT) and Speeded Up Robust Features (SURF) to detect a copy-move activity. The experiments results prove that the proposed method is superior with overall accuracy 95%. The copy-move attacks in digital image has been successfully detected and the method is also can detect the fraud parts exposed to rotation and scaling issue.

  4. Event selection services in ATLAS

    NASA Astrophysics Data System (ADS)

    Cranshaw, J.; Cuhadar-Donszelmann, T.; Gallas, E.; Hrivnac, J.; Kenyon, M.; McGlone, H.; Malon, D.; Mambelli, M.; Nowak, M.; Viegas, F.; Vinek, E.; Zhang, Q.


    ATLAS has developed and deployed event-level selection services based upon event metadata records ("TAGS") and supporting file and database technology. These services allow physicists to extract events that satisfy their selection predicates from any stage of data processing and use them as input to later analyses. One component of these services is a web-based Event-Level Selection Service Interface (ELSSI). ELSSI supports event selection by integrating run-level metadata, luminosity-block-level metadata (e.g., detector status and quality information), and event-by-event information (e.g., triggers passed and physics content). The list of events that survive after some selection criterion is returned in a form that can be used directly as input to local or distributed analysis; indeed, it is possible to submit a skimming job directly from the ELSSI interface using grid proxy credential delegation. ELSSI allows physicists to explore ATLAS event metadata as a means to understand, qualitatively and quantitatively, the distributional characteristics of ATLAS data. In fact, the ELSSI service provides an easy interface to see the highest missing ET events or the events with the most leptons, to count how many events passed a given set of triggers, or to find events that failed a given trigger but nonetheless look relevant to an analysis based upon the results of offline reconstruction, and more. This work provides an overview of ATLAS event-level selection services, with an emphasis upon the interactive Event-Level Selection Service Interface.

  5. 38 CFR 1.526 - Copies of records and papers.

    Code of Federal Regulations, 2012 CFR


    ... papers. 1.526 Section 1.526 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS... Copies of records and papers. (a) Any person desiring a copy of any record or document in the custody of... plain one-sided paper copies of a standard size (81/2″ × 11″; 81/2″ × 14″; 11″ × 14″) $0.15 per...

  6. 6. Photographic copy of historic photograph (from Wind Cave National ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. Photographic copy of historic photograph (from Wind Cave National Park), photographer unknown, date unknown. Route 87, Pigtail Bridge, elevation. - Pigtail Bridge, Hot Springs, Fall River County, SD

  7. COPI selectively drives maturation of the early Golgi

    PubMed Central

    Papanikou, Effrosyni; Day, Kasey J; Austin, Jotham; Glick, Benjamin S


    COPI coated vesicles carry material between Golgi compartments, but the role of COPI in the secretory pathway has been ambiguous. Previous studies of thermosensitive yeast COPI mutants yielded the surprising conclusion that COPI was dispensable both for the secretion of certain proteins and for Golgi cisternal maturation. To revisit these issues, we optimized the anchor-away method, which allows peripheral membrane proteins such as COPI to be sequestered rapidly by adding rapamycin. Video fluorescence microscopy revealed that COPI inactivation causes an early Golgi protein to remain in place while late Golgi proteins undergo cycles of arrival and departure. These dynamics generate partially functional hybrid Golgi structures that contain both early and late Golgi proteins, explaining how secretion can persist when COPI has been inactivated. Our findings suggest that cisternal maturation involves a COPI-dependent pathway that recycles early Golgi proteins, followed by multiple COPI-independent pathways that recycle late Golgi proteins. DOI: PMID:26709839

  8. The Landscape of Somatic Chromosomal Copy Number Aberrations in GEM Models of Prostate Carcinoma

    PubMed Central

    Bianchi-Frias, Daniella; Hernandez, Susana A.; Coleman, Roger; Wu, Hong; Nelson, Peter S.


    Human prostate cancer (PCa) is known to harbor recurrent genomic aberrations consisting of chromosomal losses, gains, rearrangements and mutations that involve oncogenes and tumor suppressors. Genetically engineered mouse (GEM) models have been constructed to assess the causal role of these putative oncogenic events and provide molecular insight into disease pathogenesis. While GEM models generally initiate neoplasia by manipulating a single gene, expression profiles of GEM tumors typically comprise hundreds of transcript alterations. It is unclear whether these transcriptional changes represent the pleiotropic effects of single oncogenes, and/or cooperating genomic or epigenomic events. Therefore, it was determined if structural chromosomal alterations occur in GEM models of PCa and whether the changes are concordant with human carcinomas. Whole genome array-based comparative genomic hybridization (CGH) was used to identify somatic chromosomal copy number aberrations (SCNAs) in the widely used TRAMP, Hi-Myc, Pten-null and LADY GEM models. Interestingly, very few SCNAs were identified and the genomic architecture of Hi-Myc, Pten-null and LADY tumors were essentially identical to the germline. TRAMP neuroendocrine carcinomas contained SCNAs, which comprised three recurrent aberrations including a single copy loss of chromosome 19 (encoding Pten). In contrast, cell lines derived from the TRAMP, Hi-Myc, and Pten-null tumors were notable for numerous SCNAs that included copy gains of chromosome 15 (encoding Myc) and losses of chromosome 11 (encoding p53). PMID:25298407


    SciTech Connect

    Lori Braase; Jodi Grgich


    Event planning is expensive and resource intensive. Function analysis provides a solid foundation for comprehensive event planning (e.g., workshops, conferences, symposiums, or meetings). It has been used at Idaho National Laboratory (INL) to successfully plan events and capture lessons learned, and played a significant role in the development and implementation of the “INL Guide for Hosting an Event.” Using a guide and a functional approach to planning utilizes resources more efficiently and reduces errors that could be distracting or detrimental to an event. This integrated approach to logistics and program planning – with the primary focus on the participant – gives us the edge.

  10. Integrated orbital time scale of the Valanginian-Hauterivian (Early Cretaceous): Chronological relationships between Paraná-Etendeka LIP, Weissert and Faraoni events

    NASA Astrophysics Data System (ADS)

    Martinez, Mathieu; Deconinck, Jean-François; Pellenard, Pierre; Riquier, Laurent; Company, Miguel; Moiroud, Mathieu; Reboulet, Stéphane


    During the Valanginian and the Hauterivian stages, the Weissert and Faraoni Events recorded global perturbations of the carbon cycle, marine organic matter deposits and rapid ecosystem changes. Both events were successively attributed to the activity of the Paraná-Etendeka Large Igneous Province (LIP). However, due to the scarcity of the radiometric ages available for this time interval, the chronological relationships between these events and the activity of the Paraná-Etendeka LIP remain unclear. Recently, the duration of the Valanginian Stage was calculated using a cyclostratigraphic approach on GSSP candidates and stratotypes (Martinez et al., 2013), but could not be anchored on a radiometric age. Here, we propose a duration assessment of the Hauterivian Stage using a similar cyclostratigraphic approach on the hemipelagic marl-limestone alternations from the La Charce section (Hauterivian GSSP candidate; SE France) and the Río Argos section (Barremian GSSP candidate; SE Spain). This duration could be anchored on an U/Pb age from a tuff level precisely dated using calcareous nannofossils and chemostratigraphy, to provide a refined geological time scale for the Valanginian and the Hauterivian stages. A total of 2000 spectral gamma-ray measurements were performed with a constant 0.20-m sample step. Spectral analyses were performed on the gamma-ray series to detect any sedimentary cycle. The precession, obliquity, 100-kyr and 405-kyr eccentricity cycles were identified by comparing sedimentary to orbital period ratios. The duration of the Hauterivian Stage could be assessed at 5.9 myr, using the 405-kyr eccentricity cycle as a reference. By anchoring the U/Pb age of Aguirre-Urreta et al. (2008) on the orbital time scale provided for the Valanginian-Hauterivian stages, the base of the Valanginian Stage could be dated at -140.2 ± 1.5 Ma, the base of the Hauterivian at -135.1 ± 1.5 Ma and the base of the Barremian at -129.2 ± 1.5 Ma. In addition, the Weissert

  11. Parameters of Semantic Multisensory Integration Depend on Timing and Modality Order among People on the Autism Spectrum: Evidence from Event-Related Potentials

    ERIC Educational Resources Information Center

    Russo, N.; Mottron, L.; Burack, J. A.; Jemel, B.


    Individuals with autism spectrum disorders (ASD) report difficulty integrating simultaneously presented visual and auditory stimuli (Iarocci & McDonald, 2006), albeit showing enhanced perceptual processing of unisensory stimuli, as well as an enhanced role of perception in higher-order cognitive tasks (Enhanced Perceptual Functioning (EPF) model;…

  12. Integration of New Domain-Related States and Events from Texts and Illustrations by Subjects with High and Low Prior Knowledge

    ERIC Educational Resources Information Center

    Molinari, Gaelle; Tapiero, Isabelle


    The aim of this article is to investigate with high and low knowledge subjects in the scientific domain of the neuron, the way information should be presented and illustrated to promote the integration of new information. This fundamental process for learning was examined in two experiments using a primed recognition task. In the first study, the…

  13. Pontine regulation of REM sleep components in cats: integrity of the pedunculopontine tegmentum (PPT) is important for phasic events but unnecessary for atonia during REM sleep.


    Shouse, M N; Siegel, J M


    Transection, lesion and unit recording studies have localized rapid eye movement (REM) sleep mechanisms to the pons. Recent work has emphasized the role of pontine cholinergic cells, especially those of the pedunculopontine tegmentum (PPT). The present study differentiated REM sleep deficits associated with lesions of the PPT from other pontine regions implicated in REM sleep generation, including those with predominantly cholinergic vs non-cholinergic cells. Twelve hour polygraphic recordings were obtained in 18 cats before and 1-2 weeks after bilateral electrolytic or radio frequency lesions of either: (1) PPT, which contains the dorsolateral pontine cholinergic cell column; (2) laterodorsal tegmental nucleus (LDT), which contains the dorsomedial pontine cholinergic cell column; (3) locus ceruleus (LC), which contains mostly noradrenergic cells; or (4) subceruleus (LC alpha, peri-LC alpha and the lateral tegmental field), which also contains predominantly noncholinergic cells. There were three main findings: (i) Only lesions of PPT and subceruleus significantly affected REM sleep time. These lesions produced comparable reductions in REM sleep time but influenced REM sleep components quite differently: (ii) PPT lesions, estimated to damage 90 +/- 4% of cholinergic cells, reduced the number of REM sleep entrances and phasic events, including ponto-geniculooccipital (PGO) spikes and rapid eye movements (REMs), but did not prevent complete atonia during REM sleep: (iii) Subceruleus lesions eliminated atonia during REM sleep. Mobility appeared to arouse the cat prematurely from REM sleep and may explain the brief duration of REM sleep epochs seen exclusively in this group. Despite the reduced amount of REM sleep, the total number of PGO spikes and REM sleep entrances increased over baseline values. Collectively, the results distinguish pontine loci regulating phasic events vs atonia. PPT lesions reduced phasic events, whereas subceruleus lesions created REM sleep

  14. Chemiluminescent Detection for Estimating Relative Copy Numbers of Porcine Endogenous Retrovirus Proviruses from Chinese Minipigs Based on Magnetic Nanoparticles.


    Yang, Haowen; Liu, Ming; Zhou, Bingcong; Deng, Yan; He, Nongyue; Jiang, Hesheng; Guo, Yafen; Lan, Ganqiu; Jiang, Qinyang; Yang, Xiurong; Li, Zhiyang


    Chinese Bama minipigs could be potential donors for the supply of xenografts because they are genetically stable, highly inbred, and inexpensive. However, porcine endogenous retrovirus (PERV) is commonly integrated in pig genomes and could cause a cross-species infection by xenotransplantation. For screening out the pigs with low copy numbers of PERV proviruses, we have developed a novel semiquantitative analysis approach based on magnetic nanoparticles (MNPs) and chemiluminescence (CL) for estimating relative copy numbers (RCNs) of PERV proviruses in Chinese Bama minipigs. The CL intensities of PERV proviruses and the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were respectively determined with this method, and the RCNs of PERV proviruses were calculated by the equation: RCN of PERV provirus = CL intensity of PERV provirus/CL intensity of GAPDH. The results showed that PERVs were integrated in the genomes of Bama minipigs at different copy numbers, and the copy numbers of PERV-C subtype were greatly low. Two Bama minipigs with low copy numbers of PERV proviruses were detected out and could be considered as xenograft donor candidates. Although only semiquantitation can be achieved, this approach has potential for screening out safe and suitable pig donors for xenotransplantation. PMID:27427744

  15. Comparative analyses across cattle breeds reveal the pitfalls caused by artificial and lineage-differential copy number variations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Copy number variations (CNV) are well known genomic variants, which often complicate structural and functional genomics studies. Here, we integrated the CNV region (CNVR) result detected from 1,682 Nellore cattle with the equivalent result derived from the Bovine HapMap samples. Through comparing CN...

  16. Vocal copying of individually distinctive signature whistles in bottlenose dolphins

    PubMed Central

    King, Stephanie L.; Sayigh, Laela S.; Wells, Randall S.; Fellner, Wendi; Janik, Vincent M.


    Vocal learning is relatively common in birds but less so in mammals. Sexual selection and individual or group recognition have been identified as major forces in its evolution. While important in the development of vocal displays, vocal learning also allows signal copying in social interactions. Such copying can function in addressing or labelling selected conspecifics. Most examples of addressing in non-humans come from bird song, where matching occurs in an aggressive context. However, in other animals, addressing with learned signals is very much an affiliative signal. We studied the function of vocal copying in a mammal that shows vocal learning as well as complex cognitive and social behaviour, the bottlenose dolphin (Tursiops truncatus). Copying occurred almost exclusively between close associates such as mother–calf pairs and male alliances during separation and was not followed by aggression. All copies were clearly recognizable as such because copiers consistently modified some acoustic parameters of a signal when copying it. We found no evidence for the use of copying in aggression or deception. This use of vocal copying is similar to its use in human language, where the maintenance of social bonds appears to be more important than the immediate defence of resources. PMID:23427174

  17. 14 CFR 1206.206 - Availability for copying.

    Code of Federal Regulations, 2011 CFR


    ... 14 Aeronautics and Space 5 2011-01-01 2010-01-01 true Availability for copying. 1206.206 Section 1206.206 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION AVAILABILITY OF AGENCY RECORDS TO MEMBERS OF THE PUBLIC Records Available § 1206.206 Availability for copying. Except as...

  18. 14 CFR 1206.206 - Availability for copying.

    Code of Federal Regulations, 2010 CFR


    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Availability for copying. 1206.206 Section 1206.206 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION AVAILABILITY OF AGENCY RECORDS TO MEMBERS OF THE PUBLIC Records Available § 1206.206 Availability for copying. Except as...

  19. 7 CFR 295.6 - Public inspection and copying.

    Code of Federal Regulations, 2010 CFR


    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Public inspection and copying. 295.6 Section 295.6 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE GENERAL REGULATIONS AVAILABILITY OF INFORMATION AND RECORDS TO THE PUBLIC § 295.6 Public inspection and copying. 5 U.S.C....

  20. 56. Photographic copy of the original construction drawing, 1934, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    56. Photographic copy of the original construction drawing, 1934, by Sverdrup and Parcel, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Bar bill and bending details - Mark Twain Memorial Bridge, Spanning Mississippi River at US Route 36, Hannibal, Marion County, MO

  1. 52. Photocopy of copy of original Officers' Duplex Quarters drawing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    52. Photocopy of copy of original Officers' Duplex Quarters drawing by Copeland, 7 April 1932 (Original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Heating - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

  2. COPI is essential for Golgi cisternal maturation and dynamics

    PubMed Central

    Ishii, Midori; Suda, Yasuyuki


    ABSTRACT Proteins synthesized in the endoplasmic reticulum (ER) are transported to the Golgi and then sorted to their destinations. For their passage through the Golgi, one widely accepted mechanism is cisternal maturation. Cisternal maturation is fulfilled by the retrograde transport of Golgi-resident proteins from later to earlier cisternae, and candidate carriers for this retrograde transport are coat protein complex I (COPI)-coated vesicles. We examined the COPI function in cisternal maturation directly by 4D observation of the transmembrane Golgi-resident proteins in living yeast cells. COPI temperature-sensitive mutants and induced degradation of COPI proteins were used to knockdown COPI function. For both methods, inactivation of COPI subunits Ret1 and Sec21 markedly impaired the transition from cis to medial and to trans cisternae. Furthermore, the movement of cisternae within the cytoplasm was severely restricted when COPI subunits were depleted. Our results demonstrate the essential roles of COPI proteins in retrograde trafficking of the Golgi-resident proteins and dynamics of the Golgi cisternae. PMID:27445311

  3. 48. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    48. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS L9 TO L12 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  4. 55. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    55. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS U17 TO U20 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  5. 54. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    54. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS U13 TO U16 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  6. 47. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    47. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS L5 TO L8 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  7. 46. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    46. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS L1 TO L4 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  8. 52. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    52. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS U5 TO U8 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  9. 49. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    49. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS L13 TO L16 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  10. 53. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    53. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS U9 TO U12 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  11. 50. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    50. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS L17 TO L20 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  12. 29 CFR 2570.51 - Public inspection and copies.

    Code of Federal Regulations, 2012 CFR


    ... 29 Labor 9 2012-07-01 2012-07-01 false Public inspection and copies. 2570.51 Section 2570.51 Labor Regulations Relating to Labor (Continued) EMPLOYEE BENEFITS SECURITY ADMINISTRATION, DEPARTMENT OF LABOR... Prohibited Transaction Exemption Applications § 2570.51 Public inspection and copies. (a) The...

  13. 51. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    51. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS L0, U2 TO U4, PORTAL AT U2 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  14. 29 CFR 2570.51 - Public inspection and copies.

    Code of Federal Regulations, 2013 CFR


    ... 29 Labor 9 2013-07-01 2013-07-01 false Public inspection and copies. 2570.51 Section 2570.51 Labor Regulations Relating to Labor (Continued) EMPLOYEE BENEFITS SECURITY ADMINISTRATION, DEPARTMENT OF LABOR... Prohibited Transaction Exemption Applications § 2570.51 Public inspection and copies. (a) The...

  15. 51. Photocopy of copy of original Officers' Duplex Quarters drawing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    51. Photocopy of copy of original Officers' Duplex Quarters drawing by B.S. Elliott, 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Plumbing - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

  16. 40 CFR 716.30 - Submission of copies of studies.

    Code of Federal Regulations, 2014 CFR


    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Submission of copies of studies. 716.30 Section 716.30 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC... studies. (a)(1) Except as provided in §§ 716.5, 716.20, and 716.50, persons must send to EPA copies of...

  17. 40 CFR 716.30 - Submission of copies of studies.

    Code of Federal Regulations, 2012 CFR


    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Submission of copies of studies. 716.30 Section 716.30 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC... studies. (a)(1) Except as provided in §§ 716.5, 716.20, and 716.50, persons must send to EPA copies of...

  18. 36 CFR 1254.64 - Will NARA certify copies?

    Code of Federal Regulations, 2010 CFR


    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Will NARA certify copies? 1254.64 Section 1254.64 Parks, Forests, and Public Property NATIONAL ARCHIVES AND RECORDS ADMINISTRATION PUBLIC AVAILABILITY AND USE USING RECORDS AND DONATED HISTORICAL MATERIALS Copying...

  19. 36 CFR 1254.60 - What are NARA's copying services?

    Code of Federal Regulations, 2010 CFR


    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false What are NARA's copying services? 1254.60 Section 1254.60 Parks, Forests, and Public Property NATIONAL ARCHIVES AND RECORDS ADMINISTRATION PUBLIC AVAILABILITY AND USE USING RECORDS AND DONATED HISTORICAL MATERIALS Copying...

  20. 37. Photographic copy of the original construction drawing, 1924, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    37. Photographic copy of the original construction drawing, 1924, by Kansas City Structural Steel Company, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Details of 200' span - Van Buren Bridge, Spanning Current River at US Route 60, Van Buren, Carter County, MO

  1. 29. Photographic copy of the original construction drawing, 1924, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    29. Photographic copy of the original construction drawing, 1924, by Missouri State Highway Department, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. General elevation and plan - Van Buren Bridge, Spanning Current River at US Route 60, Van Buren, Carter County, MO

  2. 38. Photographic copy of the original construction drawing, 1924, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    38. Photographic copy of the original construction drawing, 1924, by Kansas City Structural Steel Company, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Details of 200' span - Van Buren Bridge, Spanning Current River at US Route 60, Van Buren, Carter County, MO

  3. 32. Photographic copy of the original construction drawing, 1924, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    32. Photographic copy of the original construction drawing, 1924, by Missouri State Highway Department, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Details of intermediate bends and bent 14 - Van Buren Bridge, Spanning Current River at US Route 60, Van Buren, Carter County, MO

  4. 30. Photographic copy of the original construction drawing, 1924, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    30. Photographic copy of the original construction drawing, 1924, by Missouri State Highway Department, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Details of pier 2 and 3 - Van Buren Bridge, Spanning Current River at US Route 60, Van Buren, Carter County, MO

  5. 35. Photographic copy of the original construction drawing, 1924, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    35. Photographic copy of the original construction drawing, 1924, by Kansas City Structural Steel Company, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Details of 120' span - Van Buren Bridge, Spanning Current River at US Route 60, Van Buren, Carter County, MO

  6. 39. Photographic copy of the original construction drawing, 1924, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    39. Photographic copy of the original construction drawing, 1924, by Kansas City Structural Steel Company, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Details of 80' span - Van Buren Bridge, Spanning Current River at US Route 60, Van Buren, Carter County, MO

  7. 36. Photographic copy of the original construction drawing, 1924, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    36. Photographic copy of the original construction drawing, 1924, by Kansas City Structural Steel Company, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Beams and laterals - Van Buren Bridge, Spanning Current River at US Route 60, Van Buren, Carter County, MO

  8. 33. Photographic copy of the original construction drawing, 1925, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    33. Photographic copy of the original construction drawing, 1925, by Missouri State Highway Department, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Details of abutment no. 1 (revised) - Van Buren Bridge, Spanning Current River at US Route 60, Van Buren, Carter County, MO

  9. 31. Photographic copy of the original construction drawing, 1924, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. Photographic copy of the original construction drawing, 1924, by Missouri State Highway Department, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Details of pier 9 and abutment 1 - Van Buren Bridge, Spanning Current River at US Route 60, Van Buren, Carter County, MO

  10. 34. Photographic copy of the original construction drawing, 1924, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    34. Photographic copy of the original construction drawing, 1924, by Kansas City Structural Steel Company, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Plans and elevations - Van Buren Bridge, Spanning Current River at US Route 60, Van Buren, Carter County, MO

  11. 36 CFR 404.5 - Inspection and copying.

    Code of Federal Regulations, 2014 CFR


    ... 36 Parks, Forests, and Public Property 3 2014-07-01 2014-07-01 false Inspection and copying. 404.5 Section 404.5 Parks, Forests, and Public Property AMERICAN BATTLE MONUMENTS COMMISSION PROCEDURES AND GUIDELINES FOR COMPLIANCE WITH THE FREEDOM OF INFORMATION ACT § 404.5 Inspection and copying. When a...

  12. 36 CFR 404.5 - Inspection and copying.

    Code of Federal Regulations, 2012 CFR


    ... 36 Parks, Forests, and Public Property 3 2012-07-01 2012-07-01 false Inspection and copying. 404.5 Section 404.5 Parks, Forests, and Public Property AMERICAN BATTLE MONUMENTS COMMISSION PROCEDURES AND GUIDELINES FOR COMPLIANCE WITH THE FREEDOM OF INFORMATION ACT § 404.5 Inspection and copying. When a...

  13. 36 CFR 404.5 - Inspection and copying.

    Code of Federal Regulations, 2010 CFR


    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Inspection and copying. 404.5 Section 404.5 Parks, Forests, and Public Property AMERICAN BATTLE MONUMENTS COMMISSION PROCEDURES AND GUIDELINES FOR COMPLIANCE WITH THE FREEDOM OF INFORMATION ACT § 404.5 Inspection and copying. When a...

  14. 36 CFR 404.5 - Inspection and copying.

    Code of Federal Regulations, 2013 CFR


    ... 36 Parks, Forests, and Public Property 3 2013-07-01 2012-07-01 true Inspection and copying. 404.5 Section 404.5 Parks, Forests, and Public Property AMERICAN BATTLE MONUMENTS COMMISSION PROCEDURES AND GUIDELINES FOR COMPLIANCE WITH THE FREEDOM OF INFORMATION ACT § 404.5 Inspection and copying. When a...

  15. 36 CFR 404.5 - Inspection and copying.

    Code of Federal Regulations, 2011 CFR


    ... 36 Parks, Forests, and Public Property 3 2011-07-01 2011-07-01 false Inspection and copying. 404.5 Section 404.5 Parks, Forests, and Public Property AMERICAN BATTLE MONUMENTS COMMISSION PROCEDURES AND GUIDELINES FOR COMPLIANCE WITH THE FREEDOM OF INFORMATION ACT § 404.5 Inspection and copying. When a...

  16. 13. Photographic copy of the original construction drawing, dated August ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. Photographic copy of the original construction drawing, dated August 1914, from blueprint copy in possession of Utah County Engineering office, Provo, Utah. JORDAN RIVER BRIDGE ON NORTH BOUNDARY, SECTION 12T5S, R1W (SIDE AND END VIEWS) - Jordan Narrows Bridge, Crossing Jordan River at 9600 North, Lehi, Utah County, UT


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  18. 18. Photocopy of copy of drawing of boiler plant and ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. Photocopy of copy of drawing of boiler plant and shops building, dated June 15, 1944. Copy of drawing stored at 436 Civil Engineer Squadron, Design Management Element Cece, 600 8th Street, Dover AFB, DE - Dover Air Force Base, Hangar No. 1301, Dover, Kent County, DE


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey



    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  2. 17. Photocopy of copy of drawing of Hangar 1301, dated ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. Photocopy of copy of drawing of Hangar 1301, dated June 15, 1944. Copy of drawing stored at 436 Civil Engineer Squadron, Design Management Element Cece, 600 8th Street, Dover Air Force Base, DE - Dover Air Force Base, Hangar No. 1301, Dover, Kent County, DE

  3. Photo copy of historic photograph, 1944. BUILDING 652, LOOKING SOUTH. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photo copy of historic photograph, 1944. BUILDING 652, LOOKING SOUTH. OCT. 14, 1944. File no. 141. Copy print on file at Library, Corps of Engineers, New England Division, Waltham, Massachusetts - Watertown Arsenal, Building No. 652, Arsenal Street, Watertown, Middlesex County, MA

  4. 48 CFR 6302.25 - Copies of papers (Rule 25).

    Code of Federal Regulations, 2011 CFR


    ... 48 Federal Acquisition Regulations System 7 2011-10-01 2011-10-01 false Copies of papers (Rule 25). 6302.25 Section 6302.25 Federal Acquisition Regulations System DEPARTMENT OF TRANSPORTATION BOARD OF CONTRACT APPEALS RULES OF PROCEDURE 6302.25 Copies of papers (Rule 25). When books, records, papers,...

  5. 6. Photo copy of photograph, (original owned by Mary Gaudineer, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. Photo copy of photograph, (original owned by Mary Gaudineer, Beckley, WV, copy at National Forest Office, Elkins, WV), Don Gaudineer, 1934. CONSTRUCTION OF FERNOW EXPERIMENTAL FOREST BUNKHOUSE AND GARAGE. (see also historic photograph WV-237-13) - Parsons Nursery, Fernow Experimental Forest Residence, South side of U.S. Route 219, Parsons, Tucker County, WV

  6. Vocal copying of individually distinctive signature whistles in bottlenose dolphins.


    King, Stephanie L; Sayigh, Laela S; Wells, Randall S; Fellner, Wendi; Janik, Vincent M


    Vocal learning is relatively common in birds but less so in mammals. Sexual selection and individual or group recognition have been identified as major forces in its evolution. While important in the development of vocal displays, vocal learning also allows signal copying in social interactions. Such copying can function in addressing or labelling selected conspecifics. Most examples of addressing in non-humans come from bird song, where matching occurs in an aggressive context. However, in other animals, addressing with learned signals is very much an affiliative signal. We studied the function of vocal copying in a mammal that shows vocal learning as well as complex cognitive and social behaviour, the bottlenose dolphin (Tursiops truncatus). Copying occurred almost exclusively between close associates such as mother-calf pairs and male alliances during separation and was not followed by aggression. All copies were clearly recognizable as such because copiers consistently modified some acoustic parameters of a signal when copying it. We found no evidence for the use of copying in aggression or deception. This use of vocal copying is similar to its use in human language, where the maintenance of social bonds appears to be more important than the immediate defence of resources.

  7. An Evidence-Informed Picture of Course-Related Copying

    ERIC Educational Resources Information Center

    Graham, Rumi


    Recent changes in Canadian copyright law have prompted Canada's educational institutions to reexamine their need for a blanket copying license. Users' rights under the amended Copyright Act now include fair dealing for purposes of education, and the Supreme Court has established that copying short excerpts for classroom use can qualify as fair…

  8. 48. Photocopy of copy of original Officers' Duplex Quarters drawing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    48. Photocopy of copy of original Officers' Duplex Quarters drawing by Turner, 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Attic and roof, basement, first floor, and second floor plans - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

  9. 50. Photocopy of copy of original Officers' Duplex Quarters drawing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    50. Photocopy of copy of original Officers' Duplex Quarters drawing by Turner, 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University. Detail of front entrance and of gable dormer - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

  10. 49. Photocopy of copy of original Officers' Duplex Quarters drawing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    49. Photocopy of copy of original Officers' Duplex Quarters drawing by Turner, 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Front, rear, and side elevations, and cross-section - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

  11. 31 CFR 1.4 - Public inspection and copying.

    Code of Federal Regulations, 2010 CFR


    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Public inspection and copying. 1.4 Section 1.4 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Freedom of Information Act § 1.4 Public inspection and copying. (a) In general. Subject to the application of the exemptions and exclusions...

  12. 37 CFR 1.95 - Copies of exhibits.

    Code of Federal Regulations, 2010 CFR


    ... COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions Models, Exhibits, Specimens § 1.95 Copies of exhibits. Copies of models or other physical exhibits will not ordinarily be furnished by the Office, and any model or exhibit in an application or patent shall not be taken from...

  13. 56. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    56. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, SPECIAL FEATURES FOR SPAN 1 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  14. 61. Photographic copy of the original construction drawing, 19356, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    61. Photographic copy of the original construction drawing, 1935-6, by Sverdrup and Parcel, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Revisions in back wall of abutment B17 - Mark Twain Memorial Bridge, Spanning Mississippi River at US Route 36, Hannibal, Marion County, MO

  15. 5 CFR 9301.16 - Requests for copies of records.

    Code of Federal Regulations, 2014 CFR


    ... 5 Administrative Personnel 3 2014-01-01 2014-01-01 false Requests for copies of records. 9301.16 Section 9301.16 Administrative Personnel SPECIAL INSPECTOR GENERAL FOR AFGHANISTAN RECONSTRUCTION DISCLOSURE OF RECORDS AND INFORMATION Privacy Act § 9301.16 Requests for copies of records. Rules...

  16. 5 CFR 9301.16 - Requests for copies of records.

    Code of Federal Regulations, 2013 CFR


    ... 5 Administrative Personnel 3 2013-01-01 2013-01-01 false Requests for copies of records. 9301.16 Section 9301.16 Administrative Personnel SPECIAL INSPECTOR GENERAL FOR AFGHANISTAN RECONSTRUCTION DISCLOSURE OF RECORDS AND INFORMATION Privacy Act § 9301.16 Requests for copies of records. Rules...

  17. 48 CFR 6302.25 - Copies of papers (Rule 25).

    Code of Federal Regulations, 2010 CFR


    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Copies of papers (Rule 25). 6302.25 Section 6302.25 Federal Acquisition Regulations System DEPARTMENT OF TRANSPORTATION BOARD OF CONTRACT APPEALS RULES OF PROCEDURE 6302.25 Copies of papers (Rule 25). When books, records, papers,...

  18. 9. Photographic copy of USRS design drawing, April 1906 (from ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. Photographic copy of USRS design drawing, April 1906 (from duplicate copy on file at United States Bureau of Reclamation, Denver Service Center, Denver, Colorado). Main canal diversion weir from Salmon River - Salmon Creek Diversion Dam, Salmon Creek, Okanogan, Okanogan County, WA

  19. The Effect of Copying on the Producers of Originals.

    ERIC Educational Resources Information Center

    Johnson, William R.

    Arguing that the seller of creative works--including audio and video productions and computer software--will be affected by the ability of consumers to make high quality copies of these works, this paper examines the theoretical effects of copying on the sellers of originals and speculates about ways to estimate these effects empirically. The…

  20. The Development of Context Sensitivity in Children's Graphic Copying Strategies

    ERIC Educational Resources Information Center

    Vinter, Annie; Marot, Valerie


    The authors report on a series of 5 experiments in which 462 5- to 10-year-old children and 109 adults were required to copy geometric figures either with no constraints or following prior exposure to primes consisting of different parsings of the figures. The analysis focused on the graphic strategies adopted by the participants to copy the…

  1. 9. Photo copy of historic photograph, Nov. 4, 1944. Building ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. Photo copy of historic photograph, Nov. 4, 1944. Building 60, INTERIOR, EAST END, LOOKING NORTH AT AIR COMPRESSORS. File No. 75. Copy print on file, Library, U.S. Army Corps of Engineers, New England Division, Waltham, Massachusetts. - Watertown Arsenal, Building No. 60, Arsenal Street, Watertown, Middlesex County, MA

  2. 11. Photo copy of historic photograph, May 1953. Building 60, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. Photo copy of historic photograph, May 1953. Building 60, INTERIOR, WEST END, LOOKING SOUTHWEST AT NEWLY INSTALLED ERIE CITY IRON WORKS BOILERS AND CONTROL PANEL. File no. 200. Copy print on file, Library, Corps of Engineers, New England Division, Waltham, Massachusetts. - Watertown Arsenal, Building No. 60, Arsenal Street, Watertown, Middlesex County, MA

  3. 10. Photo copy of historic photograph, Nov. 4, 1944. Building ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. Photo copy of historic photograph, Nov. 4, 1944. Building 60, INTERIOR, WEST END, LOOKING SOUTH BETWEEN BANKS OF HEINE BOILERS. File No. 74, Copy print on file, Library, U.S. Army Corps of Engineers, New England Division, Waltham, Massachusetts. - Watertown Arsenal, Building No. 60, Arsenal Street, Watertown, Middlesex County, MA

  4. 35. Photographic copy of original construction drawing, dated May 22, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    35. Photographic copy of original construction drawing, dated May 22, 1951 (from paper copy at Engineering Flight, Ellsworth Air Force Base, SD). Readiness hangar structural: front elevation bracing details. - Ellsworth Air Force Base, Readiness Hangar, Kenny Road, southeast corner of interstction with G Avenue, Blackhawk, Meade County, SD

  5. 36. Photographic copy of original construction drawing, dated May 22, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    36. Photographic copy of original construction drawing, dated May 22, 1951 (from paper copy at Engineering Flight, Ellsworth Air Force Base, SD). Readiness hangar structural: rear elevation framing details. - Ellsworth Air Force Base, Readiness Hangar, Kenny Road, southeast corner of interstction with G Avenue, Blackhawk, Meade County, SD

  6. 34. Photographic copy of original construction drawing, dated May 22, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    34. Photographic copy of original construction drawing, dated May 22, 1951 (from paper copy at Engineering Flight, Ellsworth Air Force Base, SD). Readiness hangar structural: truss braces TB1 to TB4. - Ellsworth Air Force Base, Readiness Hangar, Kenny Road, southeast corner of interstction with G Avenue, Blackhawk, Meade County, SD

  7. 30. Photographic copy of original construction drawing, dated May 22, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    30. Photographic copy of original construction drawing, dated May 22, 1951 (from paper copy at Engineering Flight, Ellsworth Air Force Base, SD). Readiness hangar structural: buttresses & misc. Details. - Ellsworth Air Force Base, Readiness Hangar, Kenny Road, southeast corner of interstction with G Avenue, Blackhawk, Meade County, SD

  8. 33. Photographic copy of original construction drawing, dated May 22, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    33. Photographic copy of original construction drawing, dated May 22, 1951 (from paper copy at Engineering Flight, Ellsworth Air Force Base, SD). Readiness hangar structural: details of trusses T2 to T6. - Ellsworth Air Force Base, Readiness Hangar, Kenny Road, southeast corner of interstction with G Avenue, Blackhawk, Meade County, SD

  9. 32. Photographic copy of original construction drawing, dated May 22, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    32. Photographic copy of original construction drawing, dated May 22, 1951 (from paper copy at Engineering Flight, Ellsworth Air Force Base, SD). Readiness hangar structural: details of trusses T1 & T7. - Ellsworth Air Force Base, Readiness Hangar, Kenny Road, southeast corner of interstction with G Avenue, Blackhawk, Meade County, SD

  10. 31. Photographic copy of original construction drawing, dated May 22, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. Photographic copy of original construction drawing, dated May 22, 1951 (from paper copy at Engineering Flight, Ellsworth Air Force Base, SD). Readiness hangar structural: top chord framing & details. - Ellsworth Air Force Base, Readiness Hangar, Kenny Road, southeast corner of interstction with G Avenue, Blackhawk, Meade County, SD

  11. 10 CFR 205.372 - Filing procedures; number of copies.

    Code of Federal Regulations, 2013 CFR


    ... 10 Energy 3 2013-01-01 2013-01-01 false Filing procedures; number of copies. 205.372 Section 205.372 Energy DEPARTMENT OF ENERGY OIL ADMINISTRATIVE PROCEDURES AND SANCTIONS Electric Power System... and Reliability, Department of Energy. Copies of all documents also shall be served on: (a)...

  12. 10 CFR 205.372 - Filing procedures; number of copies.

    Code of Federal Regulations, 2011 CFR


    ... 10 Energy 3 2011-01-01 2011-01-01 false Filing procedures; number of copies. 205.372 Section 205.372 Energy DEPARTMENT OF ENERGY OIL ADMINISTRATIVE PROCEDURES AND SANCTIONS Electric Power System... and Reliability, Department of Energy. Copies of all documents also shall be served on: (a)...

  13. 1. Historic American Buildings Survey Copy photo: Albern Color Research, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. Historic American Buildings Survey Copy photo: Albern Color Research, Inc., Philadelphia, July 1960 COPY OF A PHOTOGRAPH TAKEN ca. 1904 SHOWING PART OF THE ENFIELD, NEW HAMPSHIRE SHAKER COMMUNITY WITH THE GREAT STONE HOUSE IN THE CENTER - Shaker Church Family General Views, State Route 4A, Enfield, Grafton County, NH

  14. 41. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    41. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. STRESS SHEET - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  15. 20. Photographic copy of the original construction drawing, 193031, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. Photographic copy of the original construction drawing, 1930-31, by Sverdrup and Parcel, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. Truss stress diagram, and plans of laterals and sway braces - Gasconade Bridge, Spanning Gasconade River at State Route 100, Gasconade, Gasconade County, MO

  16. 37. Photographic copy of the original construction drawing, 1934, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    37. Photographic copy of the original construction drawing, 1934, by Sverdrup and Parcel, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Stress sheet, continuous span - Mark Twain Memorial Bridge, Spanning Mississippi River at US Route 36, Hannibal, Marion County, MO

  17. 29 CFR 2570.51 - Public inspection and copies.

    Code of Federal Regulations, 2010 CFR


    ... 29 Labor 9 2010-07-01 2010-07-01 false Public inspection and copies. 2570.51 Section 2570.51 Labor Regulations Relating to Labor (Continued) EMPLOYEE BENEFITS SECURITY ADMINISTRATION, DEPARTMENT OF LABOR... Transaction Exemption Applications § 2570.51 Public inspection and copies. (a) The administrative record...

  18. 40 CFR 265.53 - Copies of contingency plan.

    Code of Federal Regulations, 2010 CFR


    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Copies of contingency plan. 265.53 Section 265.53 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES... DISPOSAL FACILITIES Contingency Plan and Emergency Procedures § 265.53 Copies of contingency plan. A...

  19. 53. Photographic copy of historic photograph, view of north front ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    53. Photographic copy of historic photograph, view of north front corner showing cast-iron fence, 1902 (Portsmouth Naval Shipyard Museum, Portsmouth, VA; copy photo for Marshall W. Butt's Portsmouth Under Four Flags 1752-1970, p. 135) - Portsmouth Naval Hospital, Hospital Building, Rixey Place, bounded by Williamson Drive, Holcomb Road, & The Circle, Portsmouth, Portsmouth, VA

  20. 22 CFR 1429.25 - Number of copies.

    Code of Federal Regulations, 2011 CFR


    ... 22 Foreign Relations 2 2011-04-01 2009-04-01 true Number of copies. 1429.25 Section 1429.25 Foreign Relations FOREIGN SERVICE LABOR RELATIONS BOARD; FEDERAL LABOR RELATIONS AUTHORITY; GENERAL... AND GENERAL REQUIREMENTS General Requirements § 1429.25 Number of copies. Unless otherwise provided...