Integrated Analysis of Genome-wide Copy Number Alterations and Gene Expression in MSS, CIMP-negative Colon Cancer

PubMed Central

Loo, Lenora WM; Tiirikainen, Maarit; Cheng, Iona; Lum-Jones, Annette; Seifried, Ann; Church, James M; Gryfe, Robert; Weisenberger, Daniel J; Lindor, Noralane M; Gallinger, Steven; Haile, Robert W; Duggan, David J; Thibodeau, Stephen N; Casey, Graham; Le Marchand, Loïc

2014-01-01

Microsatellite stable (MSS), CpG island methylator phenotype (CIMP)-negative colorectal tumors, the most prevalent molecular subtype of colorectal cancer, are associated with extensive copy number alteration (CNA) events and aneuploidy. We report on the identification of characteristic recurrent CNA (with frequency >25%) events and associated gene expression profiles for a total of 40 paired tumor and adjacent normal colon tissues using genome-wide microarrays. We observed recurrent CNAs, namely gains at 1q, 7p, 7q, 8p12-11, 8q, 12p13, 13q, 20p, 20q, Xp, and Xq and losses at 1p36, 1p31, 1p21, 4p15-12, 4q12-35, 5q21-22, 6q26, 8p, 14q, 15q11-12, 17p, 18p, 18q, 21q21-22, and 22q. Within these genomic regions we identified 356 genes with significant differential expression (P<0.0001 and ±1.5 fold change) in the tumor compared to adjacent normal tissue. Gene ontology and pathway analyses indicated that many of these genes were involved in functional mechanisms that regulate cell cycle, cell death, and metabolism. An amplicon present in >70% of the tumor samples at 20q11-20q13 contained several cancer-related genes (AHCY, POFUT1, RPN2, TH1L and PRPF6) that were up-regulated and demonstrated a significant linear correlation (P<0.05) for gene dosage and gene expression. Copy number loss at 8p, a CNA associated with adenocarcinoma and poor prognosis, was observed in >50% of the tumor samples and demonstrated a significant linear correlation for gene dosage and gene expression for two potential tumor suppressor genes, MTUS1 (8p22) and PPP2CB (8p12). The results from our integration analysis illustrate the complex relationship between genomic alterations and gene expression in colon cancer. PMID:23341073

A Single Banana Streak Virus Integration Event in the Banana Genome as the Origin of Infectious Endogenous Pararetrovirus▿

PubMed Central

Gayral, Philippe; Noa-Carrazana, Juan-Carlos; Lescot, Magali; Lheureux, Fabrice; Lockhart, Benham E. L.; Matsumoto, Takashi; Piffanelli, Pietro; Iskra-Caruana, Marie-Line

2008-01-01

Sequencing of plant nuclear genomes reveals the widespread presence of integrated viral sequences known as endogenous pararetroviruses (EPRVs). Banana is one of the three plant species known to harbor infectious EPRVs. Musa balbisiana carries integrated copies of Banana streak virus (BSV), which are infectious by releasing virions in interspecific hybrids. Here, we analyze the organization of the EPRV of BSV Goldfinger (BSGfV) present in the wild diploid M. balbisiana cv. Pisang Klutuk Wulung (PKW) revealed by the study of Musa bacterial artificial chromosome resources and interspecific genetic cross. cv. PKW contains two similar EPRVs of BSGfV. Genotyping of these integrants and studies of their segregation pattern show an allelic insertion. Despite the fact that integrated BSGfV has undergone extensive rearrangement, both EPRVs contain the full-length viral genome. The high degree of sequence conservation between the integrated and episomal form of the virus indicates a recent integration event; however, only one allele is infectious. Analysis of BSGfV EPRV segregation among an F1 population from an interspecific genetic cross revealed that these EPRV sequences correspond to two alleles originating from a single integration event. We describe here for the first time the full genomic and genetic organization of the two EPRVs of BSGfV present in cv. PKW in response to the challenge facing both scientists and breeders to identify and generate genetic resources free from BSV. We discuss the consequences of this unique host-pathogen interaction in terms of genetic and genomic plant defenses versus strategies of infectious BSGfV EPRVs. PMID:18417582

Single event test methodology for integrated optoelectronics

NASA Technical Reports Server (NTRS)

Label, Kenneth A.; Cooley, James A.; Stassinopoulos, E. G.; Marshall, Paul; Crabtree, Christina

1993-01-01

A single event upset (SEU), defined as a transient or glitch on the output of a device, and its applicability to integrated optoelectronics are discussed in the context of spacecraft design and the need for more than a bit error rate viewpoint for testing and analysis. A methodology for testing integrated optoelectronic receivers and transmitters for SEUs is presented, focusing on the actual test requirements and system schemes needed for integrated optoelectronic devices. Two main causes of single event effects in the space environment, including protons and galactic cosmic rays, are considered along with ground test facilities for simulating the space environment.

aCNViewer: Comprehensive genome-wide visualization of absolute copy number and copy neutral variations

PubMed Central

Wang-Renault, Shu-Fang; Letouzé, Eric; Imbeaud, Sandrine; Zucman-Rossi, Jessica; Deleuze, Jean-François; How-Kit, Alexandre

2017-01-01

Motivation Copy number variations (CNV) include net gains or losses of part or whole chromosomal regions. They differ from copy neutral loss of heterozygosity (cn-LOH) events which do not induce any net change in the copy number and are often associated with uniparental disomy. These phenomena have long been reported to be associated with diseases and particularly in cancer. Losses/gains of genomic regions are often correlated with lower/higher gene expression. On the other hand, loss of heterozygosity (LOH) and cn-LOH are common events in cancer and may be associated with the loss of a functional tumor suppressor gene. Therefore, identifying recurrent CNV and cn-LOH events can be important as they may highlight common biological components and give insights into the development or mechanisms of a disease. However, no currently available tools allow a comprehensive whole-genome visualization of recurrent CNVs and cn-LOH in groups of samples providing absolute quantification of the aberrations leading to the loss of potentially important information. Results To overcome these limitations, we developed aCNViewer (Absolute CNV Viewer), a visualization tool for absolute CNVs and cn-LOH across a group of samples. aCNViewer proposes three graphical representations: dendrograms, bi-dimensional heatmaps showing chromosomal regions sharing similar abnormality patterns, and quantitative stacked histograms facilitating the identification of recurrent absolute CNVs and cn-LOH. We illustrated aCNViewer using publically available hepatocellular carcinomas (HCCs) Affymetrix SNP Array data (Fig 1A). Regions 1q and 8q present a similar percentage of total gains but significantly different copy number gain categories (p-value of 0.0103 with a Fisher exact test), validated by another cohort of HCCs (p-value of 5.6e-7) (Fig 2B). Availability and implementation aCNViewer is implemented in python and R and is available with a GNU GPLv3 license on GitHub https

aCNViewer: Comprehensive genome-wide visualization of absolute copy number and copy neutral variations.

PubMed

Renault, Victor; Tost, Jörg; Pichon, Fabien; Wang-Renault, Shu-Fang; Letouzé, Eric; Imbeaud, Sandrine; Zucman-Rossi, Jessica; Deleuze, Jean-François; How-Kit, Alexandre

2017-01-01

Copy number variations (CNV) include net gains or losses of part or whole chromosomal regions. They differ from copy neutral loss of heterozygosity (cn-LOH) events which do not induce any net change in the copy number and are often associated with uniparental disomy. These phenomena have long been reported to be associated with diseases and particularly in cancer. Losses/gains of genomic regions are often correlated with lower/higher gene expression. On the other hand, loss of heterozygosity (LOH) and cn-LOH are common events in cancer and may be associated with the loss of a functional tumor suppressor gene. Therefore, identifying recurrent CNV and cn-LOH events can be important as they may highlight common biological components and give insights into the development or mechanisms of a disease. However, no currently available tools allow a comprehensive whole-genome visualization of recurrent CNVs and cn-LOH in groups of samples providing absolute quantification of the aberrations leading to the loss of potentially important information. To overcome these limitations, we developed aCNViewer (Absolute CNV Viewer), a visualization tool for absolute CNVs and cn-LOH across a group of samples. aCNViewer proposes three graphical representations: dendrograms, bi-dimensional heatmaps showing chromosomal regions sharing similar abnormality patterns, and quantitative stacked histograms facilitating the identification of recurrent absolute CNVs and cn-LOH. We illustrated aCNViewer using publically available hepatocellular carcinomas (HCCs) Affymetrix SNP Array data (Fig 1A). Regions 1q and 8q present a similar percentage of total gains but significantly different copy number gain categories (p-value of 0.0103 with a Fisher exact test), validated by another cohort of HCCs (p-value of 5.6e-7) (Fig 2B). aCNViewer is implemented in python and R and is available with a GNU GPLv3 license on GitHub https://github.com/FJD-CEPH/aCNViewer and Docker https

Event-driven simulations of nonlinear integrate-and-fire neurons.

PubMed

Tonnelier, Arnaud; Belmabrouk, Hana; Martinez, Dominique

2007-12-01

Event-driven strategies have been used to simulate spiking neural networks exactly. Previous work is limited to linear integrate-and-fire neurons. In this note, we extend event-driven schemes to a class of nonlinear integrate-and-fire models. Results are presented for the quadratic integrate-and-fire model with instantaneous or exponential synaptic currents. Extensions to conductance-based currents and exponential integrate-and-fire neurons are discussed.

SG-ADVISER CNV: copy-number variant annotation and interpretation.

PubMed

Erikson, Galina A; Deshpande, Neha; Kesavan, Balachandar G; Torkamani, Ali

2015-09-01

Copy-number variants have been associated with a variety of diseases, especially cancer, autism, schizophrenia, and developmental delay. The majority of clinically relevant events occur de novo, necessitating the interpretation of novel events. In this light, we present the Scripps Genome ADVISER CNV annotation pipeline and Web server, which aims to fill the gap between copy number variant detection and interpretation by performing in-depth annotations and functional predictions for copy number variants. The Scripps Genome ADVISER CNV suite includes a Web server interface to a high-performance computing environment for calculations of annotations and a table-based user interface that allows for the execution of numerous annotation-based variant filtration strategies and statistics. The annotation results include details regarding location, impact on the coding portion of genes, allele frequency information (including allele frequencies from the Scripps Wellderly cohort), and overlap information with other reference data sets (including ClinVar, DGV, DECIPHER). A summary variant classification is produced (ADVISER score) based on the American College of Medical Genetics and Genomics scoring guidelines. We demonstrate >90% sensitivity/specificity for detection of pathogenic events. Scripps Genome ADVISER CNV is designed to allow users with no prior bioinformatics expertise to manipulate large volumes of copy-number variant data. Scripps Genome ADVISER CNV is available at http://genomics.scripps.edu/ADVISER/.

Simultaneous Characterization of Somatic Events and HPV-18 Integration in a Metastatic Cervical Carcinoma Patient Using DNA and RNA Sequencing

PubMed Central

Liang, Winnie S.; Aldrich, Jessica; Nasser, Sara; Kurdoglu, Ahmet; Phillips, Lori; Reiman, Rebecca; McDonald, Jacquelyn; Izatt, Tyler; Christoforides, Alexis; Baker, Angela; Craig, Christine; Egan, Jan B.; Chase, Dana M.; Farley, John H.; Bryce, Alan H.; Stewart, A. Keith; Borad, Mitesh J.; Carpten, John D.; Craig, David W.; Monk, Bradley J.

2014-01-01

Objective Integration of carcinogenic human papillomaviruses (HPVs) into the host genome is a significant tumorigenic factor in specific cancers including cervical carcinoma. Although major strides have been made with respect to HPV diagnosis and prevention, identification and development of efficacious treatments for cervical cancer patients remains a goal and thus requires additional detailed characterization of both somatic events and HPV integration. Given this need, the goal of this study was to use the next generation sequencing to simultaneously evaluate somatic alterations and expression changes in a patient’s cervical squamous carcinoma lesion metastatic to the lung and to detect and analyze HPV infection in the same sample. Materials and Methods We performed tumor and normal exome, tumor and normal shallow whole-genome sequencing, and RNA sequencing of the patient’s lung metastasis. Results We generated over 1.2 billion mapped reads and identified 130 somatic point mutations and indels, 21 genic translocations, 16 coding regions demonstrating copy number changes, and over 36 genes demonstrating altered expression in the tumor (corrected P < 0.05). Sequencing also revealed the HPV type 18 (HPV-18) integration in the metastasis. Using both DNA and RNA reads, we pinpointed 3 major events indicating HPV-18 integration into an intronic region of chromosome 6p25.1 in the patient’s tumor and validated these events with Sanger sequencing. This integration site has not been reported for HPV-18. Conclusions We demonstrate that DNA and RNA sequencing can be used to concurrently characterize somatic alterations and expression changes in a biopsy and delineate HPV integration at base resolution in cervical cancer. Further sequencing will allow us to better understand the molecular basis of cervical cancer pathogenesis. PMID:24418928

Molecular Characterization of Transgene Integration by Next-Generation Sequencing in Transgenic Cattle

PubMed Central

Zhang, Ran; Yin, Yinliang; Zhang, Yujun; Li, Kexin; Zhu, Hongxia; Gong, Qin; Wang, Jianwu; Hu, Xiaoxiang; Li, Ning

2012-01-01

As the number of transgenic livestock increases, reliable detection and molecular characterization of transgene integration sites and copy number are crucial not only for interpreting the relationship between the integration site and the specific phenotype but also for commercial and economic demands. However, the ability of conventional PCR techniques to detect incomplete and multiple integration events is limited, making it technically challenging to characterize transgenes. Next-generation sequencing has enabled cost-effective, routine and widespread high-throughput genomic analysis. Here, we demonstrate the use of next-generation sequencing to extensively characterize cattle harboring a 150-kb human lactoferrin transgene that was initially analyzed by chromosome walking without success. Using this approach, the sites upstream and downstream of the target gene integration site in the host genome were identified at the single nucleotide level. The sequencing result was verified by event-specific PCR for the integration sites and FISH for the chromosomal location. Sequencing depth analysis revealed that multiple copies of the incomplete target gene and the vector backbone were present in the host genome. Upon integration, complex recombination was also observed between the target gene and the vector backbone. These findings indicate that next-generation sequencing is a reliable and accurate approach for the molecular characterization of the transgene sequence, integration sites and copy number in transgenic species. PMID:23185606

Single Color Multiplexed ddPCR Copy Number Measurements and Single Nucleotide Variant Genotyping.

PubMed

Wood-Bouwens, Christina M; Ji, Hanlee P

2018-01-01

Droplet digital PCR (ddPCR) allows for accurate quantification of genetic events such as copy number variation and single nucleotide variants. Probe-based assays represent the current "gold-standard" for detection and quantification of these genetic events. Here, we introduce a cost-effective single color ddPCR assay that allows for single genome resolution quantification of copy number and single nucleotide variation.

TALE nickase mediates high efficient targeted transgene integration at the human multi-copy ribosomal DNA locus.

PubMed

Wu, Yong; Gao, Tieli; Wang, Xiaolin; Hu, Youjin; Hu, Xuyun; Hu, Zhiqing; Pang, Jialun; Li, Zhuo; Xue, Jinfeng; Feng, Mai; Wu, Lingqian; Liang, Desheng

2014-03-28

Although targeted gene addition could be stimulated strikingly by a DNA double strand break (DSB) created by either zinc finger nucleases (ZFNs) or TALE nucleases (TALENs), the DSBs are really mutagenic and toxic to human cells. As a compromised solution, DNA single-strand break (SSB) or nick has been reported to mediate high efficient gene addition but with marked reduction of random mutagenesis. We previously demonstrated effective targeted gene addition at the human multicopy ribosomal DNA (rDNA) locus, a genomic safe harbor for the transgene with therapeutic potential. To improve the transgene integration efficiency by using TALENs while lowering the cytotoxicity of DSBs, we created both TALENs and TALE nickases (TALENickases) targeting this multicopy locus. A targeting vector which could integrate a GFP cassette at the rDNA locus was constructed and co-transfected with TALENs or TALENickases. Although the fraction of GFP positive cells using TALENs was greater than that using TALENickases during the first few days after transfection, it reduced to a level less than that using TALENickases after continuous culture. Our findings showed that the TALENickases were more effective than their TALEN counterparts at the multi-copy rDNA locus, though earlier studies using ZFNs and ZFNickases targeting the single-copy loci showed the reverse. Besides, TALENickases mediated the targeted integration of a 5.4 kb fragment at a frequency of up to 0.62% in HT1080 cells after drug selection, suggesting their potential application in targeted gene modification not being limited at the rDNA locus. Copyright © 2014 Elsevier Inc. All rights reserved.

Integrative analysis of copy number and gene expression data suggests novel pathogenetic mechanisms in primary myelofibrosis.

PubMed

Salati, Simona; Zini, Roberta; Nuzzo, Simona; Guglielmelli, Paola; Pennucci, Valentina; Prudente, Zelia; Ruberti, Samantha; Rontauroli, Sebastiano; Norfo, Ruggiero; Bianchi, Elisa; Bogani, Costanza; Rotunno, Giada; Fanelli, Tiziana; Mannarelli, Carmela; Rosti, Vittorio; Salmoiraghi, Silvia; Pietra, Daniela; Ferrari, Sergio; Barosi, Giovanni; Rambaldi, Alessandro; Cazzola, Mario; Bicciato, Silvio; Tagliafico, Enrico; Vannucchi, Alessandro M; Manfredini, Rossella

2016-04-01

Primary myelofibrosis (PMF) is a Myeloproliferative Neoplasm (MPN) characterized by megakaryocyte hyperplasia, progressive bone marrow fibrosis, extramedullary hematopoiesis and transformation to Acute Myeloid Leukemia (AML). A number of phenotypic driver (JAK2, CALR, MPL) and additional subclonal mutations have been described in PMF, pointing to a complex genomic landscape. To discover novel genomic lesions that can contribute to disease phenotype and/or development, gene expression and copy number signals were integrated and several genomic abnormalities leading to a concordant alteration in gene expression levels were identified. In particular, copy number gain in the polyamine oxidase (PAOX) gene locus was accompanied by a coordinated transcriptional up-regulation in PMF patients. PAOX inhibition resulted in rapid cell death of PMF progenitor cells, while sparing normal cells, suggesting that PAOX inhibition could represent a therapeutic strategy to selectively target PMF cells without affecting normal hematopoietic cells' survival. Moreover, copy number loss in the chromatin modifier HMGXB4 gene correlates with a concomitant transcriptional down-regulation in PMF patients. Interestingly, silencing of HMGXB4 induces megakaryocyte differentiation, while inhibiting erythroid development, in human hematopoietic stem/progenitor cells. These results highlight a previously un-reported, yet potentially interesting role of HMGXB4 in the hematopoietic system and suggest that genomic and transcriptional imbalances of HMGXB4 could contribute to the aberrant expansion of the megakaryocytic lineage that characterizes PMF patients. © 2015 UICC.

Integrated genomic classification of melanocytic tumors of the central nervous system using mutation analysis, copy number alterations and DNA methylation profiling.

PubMed

Griewank, Klaus; Koelsche, Christian; van de Nes, Johannes A P; Schrimpf, Daniel; Gessi, Marco; Möller, Inga; Sucker, Antje; Scolyer, Richard A; Buckland, Michael E; Murali, Rajmohan; Pietsch, Torsten; von Deimling, Andreas; Schadendorf, Dirk

2018-06-11

In the central nervous system, distinguishing primary leptomeningeal melanocytic tumors from melanoma metastases and predicting their biological behavior solely using histopathologic criteria can be challenging. We aimed to assess the diagnostic and prognostic value of integrated molecular analysis. Targeted next-generation-sequencing, array-based genome-wide methylation analysis and BAP1 immunohistochemistry was performed on the largest cohort of central nervous system melanocytic tumors analyzed to date, incl. 47 primary tumors of the central nervous system, 16 uveal melanomas. 13 cutaneous melanoma metastasis and 2 blue nevus-like melanomas. Gene mutation, DNA-methylation and copy-number profiles were correlated with clinicopathological features. Combining mutation, copy-number and DNA-methylation profiles clearly distinguished cutaneous melanoma metastases from other melanocytic tumors. Primary leptomeningeal melanocytic tumors, uveal melanomas and blue nevus-like melanoma showed common DNA-methylation, copy-number alteration and gene mutation signatures. Notably, tumors demonstrating chromosome 3 monosomy and BAP1 alterations formed a homogeneous subset within this group. Integrated molecular profiling aids in distinguishing primary from metastatic melanocytic tumors of the central nervous system. Primary leptomeningeal melanocytic tumors, uveal melanoma and blue nevus-like melanoma share molecular similarity with chromosome 3 and BAP1 alterations markers of poor prognosis. Copyright ©2018, American Association for Cancer Research.

iGC-an integrated analysis package of gene expression and copy number alteration.

PubMed

Lai, Yi-Pin; Wang, Liang-Bo; Wang, Wei-An; Lai, Liang-Chuan; Tsai, Mong-Hsun; Lu, Tzu-Pin; Chuang, Eric Y

2017-01-14

With the advancement in high-throughput technologies, researchers can simultaneously investigate gene expression and copy number alteration (CNA) data from individual patients at a lower cost. Traditional analysis methods analyze each type of data individually and integrate their results using Venn diagrams. Challenges arise, however, when the results are irreproducible and inconsistent across multiple platforms. To address these issues, one possible approach is to concurrently analyze both gene expression profiling and CNAs in the same individual. We have developed an open-source R/Bioconductor package (iGC). Multiple input formats are supported and users can define their own criteria for identifying differentially expressed genes driven by CNAs. The analysis of two real microarray datasets demonstrated that the CNA-driven genes identified by the iGC package showed significantly higher Pearson correlation coefficients with their gene expression levels and copy numbers than those genes located in a genomic region with CNA. Compared with the Venn diagram approach, the iGC package showed better performance. The iGC package is effective and useful for identifying CNA-driven genes. By simultaneously considering both comparative genomic and transcriptomic data, it can provide better understanding of biological and medical questions. The iGC package's source code and manual are freely available at https://www.bioconductor.org/packages/release/bioc/html/iGC.html .

Discretely Integrated Condition Event (DICE) Simulation for Pharmacoeconomics.

PubMed

Caro, J Jaime

2016-07-01

Several decision-analytic modeling techniques are in use for pharmacoeconomic analyses. Discretely integrated condition event (DICE) simulation is proposed as a unifying approach that has been deliberately designed to meet the modeling requirements in a straightforward transparent way, without forcing assumptions (e.g., only one transition per cycle) or unnecessary complexity. At the core of DICE are conditions that represent aspects that persist over time. They have levels that can change and many may coexist. Events reflect instantaneous occurrences that may modify some conditions or the timing of other events. The conditions are discretely integrated with events by updating their levels at those times. Profiles of determinant values allow for differences among patients in the predictors of the disease course. Any number of valuations (e.g., utility, cost, willingness-to-pay) of conditions and events can be applied concurrently in a single run. A DICE model is conveniently specified in a series of tables that follow a consistent format and the simulation can be implemented fully in MS Excel, facilitating review and validation. DICE incorporates both state-transition (Markov) models and non-resource-constrained discrete event simulation in a single formulation; it can be executed as a cohort or a microsimulation; and deterministically or stochastically.

Accurate measure of transgene copy number in crop plants using droplet digital PCR

USDA-ARS?s Scientific Manuscript database

Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy numb...

Polycomb repressive complex 1 provides a molecular explanation for repeat copy number dependency in FSHD muscular dystrophy.

PubMed

Casa, Valentina; Runfola, Valeria; Micheloni, Stefano; Aziz, Arif; Dilworth, F Jeffrey; Gabellini, Davide

2017-02-15

Repression of repetitive elements is crucial to preserve genome integrity and has been traditionally ascribed to constitutive heterochromatin pathways. FacioScapuloHumeral Muscular Dystrophy (FSHD), one of the most common myopathies, is characterized by a complex interplay of genetic and epigenetic events. The main FSHD form is linked to a reduced copy number of the D4Z4 macrosatellite repeat on 4q35, causing loss of silencing and aberrant expression of the D4Z4-embedded DUX4 gene leading to disease. By an unknown mechanism, D4Z4 copy-number correlates with FSHD phenotype. Here we show that the DUX4 proximal promoter (DUX4p) is sufficient to nucleate the enrichment of both constitutive and facultative heterochromatin components and to mediate a copy-number dependent gene silencing. We found that both the CpG/GC dense DNA content and the repetitive nature of DUX4p arrays are important for their repressive ability. We showed that DUX4p mediates a copy number-dependent Polycomb Repressive Complex 1 (PRC1) recruitment, which is responsible for the copy-number dependent gene repression. Overall, we directly link genetic and epigenetic defects in FSHD by proposing a novel molecular explanation for the copy number-dependency in FSHD pathogenesis, and offer insight into the molecular functions of repeats in chromatin regulation. © The Author 2016. Published by Oxford University Press.

Disintegration/dissolution profiles of copies of Fosamax (alendronate).

PubMed

Epstein, S; Cryer, B; Ragi, S; Zanchetta, J R; Walliser, J; Chow, J; Johnson, M A; Leyes, A E

2003-01-01

Poor quality has been reported for some generics and other copies of original products. We performed a pilot study to compare the disintegration/dissolution profiles of FOSAMAX (alendronate) 70 mg tablets with those of copies of FOSAMAX that were manufactured outside the United States. We used the standard United States Pharmacopeia (USP) disintegration method to evaluate FOSAMAX 70 mg tablets and 13 copies. At least 12 (n = 12) dosage units were tested for each product (except Fosmin, n = 10). The dissolution profiles of FOSAMAX and one representative copy were also compared. Nine copies (Osteomax, Defixal, Fosmin, Endronax, Osteomix, Genalmen, Fixopan, Osteoplus, and Fosval) disintegrated two- to ten-fold faster than FOSAMAX. Three other copies (Neobon, Regenesis, and Ostenan) disintegrated at least five-fold slower than FOSAMAX. Neobon is a softgel capsule, so special consideration was given to this different dosage form. One copy (Arendal) did not fall into either category but exhibited potentially large inter- and intra-lot variability. Dissolution of alendronate from Regenesis lagged behind that from FOSAMAX. Slower disintegration may reduce efficacy because bisphosphonates must be taken in the fasting state and contact with food or even certain beverages severely reduces bioavailability. Faster disintegration (or the use of gel-caps or other alterations to the drug formulation) could increase the risk of esophagitis, an adverse event associated with prolonged contact of the esophagus with bisphosphonates. These disintegration and dissolution results suggest that important differences may exist between FOSAMAX and its copies with regard to bioavailability, pharmacokinetics, and clinical efficacy and safety profiles. Additional testing is warranted to evaluate the pharmacokinetics and clinical safety of these copies.

Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

PubMed

Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

2005-11-30

Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.

Integration of copy number and transcriptomics provides risk stratification in prostate cancer: A discovery and validation cohort study

PubMed Central

Ross-Adams, H.; Lamb, A.D.; Dunning, M.J.; Halim, S.; Lindberg, J.; Massie, C.M.; Egevad, L.A.; Russell, R.; Ramos-Montoya, A.; Vowler, S.L.; Sharma, N.L.; Kay, J.; Whitaker, H.; Clark, J.; Hurst, R.; Gnanapragasam, V.J.; Shah, N.C.; Warren, A.Y.; Cooper, C.S.; Lynch, A.G.; Stark, R.; Mills, I.G.; Grönberg, H.; Neal, D.E.

2015-01-01

Background Understanding the heterogeneous genotypes and phenotypes of prostate cancer is fundamental to improving the way we treat this disease. As yet, there are no validated descriptions of prostate cancer subgroups derived from integrated genomics linked with clinical outcome. Methods In a study of 482 tumour, benign and germline samples from 259 men with primary prostate cancer, we used integrative analysis of copy number alterations (CNA) and array transcriptomics to identify genomic loci that affect expression levels of mRNA in an expression quantitative trait loci (eQTL) approach, to stratify patients into subgroups that we then associated with future clinical behaviour, and compared with either CNA or transcriptomics alone. Findings We identified five separate patient subgroups with distinct genomic alterations and expression profiles based on 100 discriminating genes in our separate discovery and validation sets of 125 and 103 men. These subgroups were able to consistently predict biochemical relapse (p = 0.0017 and p = 0.016 respectively) and were further validated in a third cohort with long-term follow-up (p = 0.027). We show the relative contributions of gene expression and copy number data on phenotype, and demonstrate the improved power gained from integrative analyses. We confirm alterations in six genes previously associated with prostate cancer (MAP3K7, MELK, RCBTB2, ELAC2, TPD52, ZBTB4), and also identify 94 genes not previously linked to prostate cancer progression that would not have been detected using either transcript or copy number data alone. We confirm a number of previously published molecular changes associated with high risk disease, including MYC amplification, and NKX3-1, RB1 and PTEN deletions, as well as over-expression of PCA3 and AMACR, and loss of MSMB in tumour tissue. A subset of the 100 genes outperforms established clinical predictors of poor prognosis (PSA, Gleason score), as well as previously published gene

Integrated analysis of chromosome copy number variation and gene expression in cervical carcinoma

PubMed Central

Yan, Deng; Yi, Song; Chiu, Wang Chi; Qin, Liu Gui; Kin, Wong Hoi; Kwok Hung, Chung Tony; Linxiao, Han; Wai, Choy Kwong; Yi, Sui; Tao, Yang; Tao, Tang

2017-01-01

Objective This study was conducted to explore chromosomal copy number variations (CNV) and transcript expression and to examine pathways in cervical pathogenesis using genome-wide high resolution microarrays. Methods Genome-wide chromosomal CNVs were investigated in 6 cervical cancer cell lines by Human Genome CGH Microarray Kit (4x44K). Gene expression profiles in cervical cancer cell lines, primary cervical carcinoma and normal cervical epithelium tissues were also studied using the Whole Human Genome Microarray Kit (4x44K). Results Fifty common chromosomal CNVs were identified in the cervical cancer cell lines. Correlation analysis revealed that gene up-regulation or down-regulation is significantly correlated with genomic amplification (P=0.009) or deletion (P=0.006) events. Expression profiles were identified through cluster analysis. Gene annotation analysis pinpointed cell cycle pathways was significantly (P=1.15E-08) affected in cervical cancer. Common CNVs were associated with cervical cancer. Conclusion Chromosomal CNVs may contribute to their transcript expression in cervical cancer. PMID:29312578

Integrated analysis of chromosome copy number variation and gene expression in cervical carcinoma.

PubMed

Yan, Deng; Yi, Song; Chiu, Wang Chi; Qin, Liu Gui; Kin, Wong Hoi; Kwok Hung, Chung Tony; Linxiao, Han; Wai, Choy Kwong; Yi, Sui; Tao, Yang; Tao, Tang

2017-12-12

This study was conducted to explore chromosomal copy number variations (CNV) and transcript expression and to examine pathways in cervical pathogenesis using genome-wide high resolution microarrays. Genome-wide chromosomal CNVs were investigated in 6 cervical cancer cell lines by Human Genome CGH Microarray Kit (4x44K). Gene expression profiles in cervical cancer cell lines, primary cervical carcinoma and normal cervical epithelium tissues were also studied using the Whole Human Genome Microarray Kit (4x44K). Fifty common chromosomal CNVs were identified in the cervical cancer cell lines. Correlation analysis revealed that gene up-regulation or down-regulation is significantly correlated with genomic amplification ( P =0.009) or deletion ( P =0.006) events. Expression profiles were identified through cluster analysis. Gene annotation analysis pinpointed cell cycle pathways was significantly ( P =1.15E-08) affected in cervical cancer. Common CNVs were associated with cervical cancer. Chromosomal CNVs may contribute to their transcript expression in cervical cancer.

Hard Copy Market Overview

NASA Astrophysics Data System (ADS)

Testan, Peter R.

1987-04-01

A number of Color Hard Copy (CHC) market drivers are currently indicating strong growth in the use of CHC technologies for the business graphics marketplace. These market drivers relate to product, software, color monitors and color copiers. The use of color in business graphics allows more information to be relayed than is normally the case in a monochrome format. The communicative powers of full-color computer generated output in the business graphics application area will continue to induce end users to desire and require color in their future applications. A number of color hard copy technologies will be utilized in the presentation graphics arena. Thermal transfer, ink jet, photographic and electrophotographic technologies are all expected to be utilized in the business graphics presentation application area in the future. Since the end of 1984, the availability of color application software packages has grown significantly. Sales revenue generated by business graphics software is expected to grow at a compound annual growth rate of just over 40 percent to 1990. Increased availability of packages to allow the integration of text and graphics is expected. Currently, the latest versions of page description languages such as Postscript, Interpress and DDL all support color output. The use of color monitors will also drive the demand for color hard copy in the business graphics market place. The availability of higher resolution screens is allowing color monitors to be easily used for both text and graphics applications in the office environment. During 1987, the sales of color monitors are expected to surpass the sales of monochrome monitors. Another major color hard copy market driver will be the color copier. In order to take advantage of the communications power of computer generated color output, multiple copies are required for distribution. Product introductions of a new generation of color copiers is now underway with additional introductions expected

Interpreting aCGH-defined karyotypic changes in gliomas using copy number status, loss of heterozygosity and allelic ratios

PubMed Central

Cowell, John K; Lo, Ken C; Luce, Jesse; Hawthorn, Lesleyann

2009-01-01

We have used SNP mapping arrays to simultaneously record copy number changes, loss of heterozygosity and allele ratios (ploidy) in a series of 13 gliomas. This combined analysis has defined novel amplification events in this tumor type involving chr1:241544532-243005121 and chr18:54716681-54917277 which contain the AKT3 and ZNF532 genes respectively. The high resolution of this analysis has also identified homozygous deletions involving chr17:25600031-26490848 and Chr19:53883612-55061878. Throughout the karyotypes of these tumors, the combined analysis revealed counter intuitive relationships between copy number and LOH that requires reinterpretation of the significance of copy number gains and losses. It was not uncommon to observe copy number gains that were associated with loss of heterozygosity as well as copy number losses that were not. These events appeared to be related to ploidy status in the tumors as determined using allelic ratio calculations. Overall, this analysis of gliomas provides evidence for the need to perform more comprehensive interpretation of the CGH data beyond copy number analysis alone to evaluate the significance of individual events in the karyotypes. PMID:19818351

Estimating the Probability of Traditional Copying, Conditional on Answer-Copying Statistics.

PubMed

Allen, Jeff; Ghattas, Andrew

2016-06-01

Statistics for detecting copying on multiple-choice tests produce p values measuring the probability of a value at least as large as that observed, under the null hypothesis of no copying. The posterior probability of copying is arguably more relevant than the p value, but cannot be derived from Bayes' theorem unless the population probability of copying and probability distribution of the answer-copying statistic under copying are known. In this article, the authors develop an estimator for the posterior probability of copying that is based on estimable quantities and can be used with any answer-copying statistic. The performance of the estimator is evaluated via simulation, and the authors demonstrate how to apply the formula using actual data. Potential uses, generalizability to other types of cheating, and limitations of the approach are discussed.

High copy and stable expression of the xylanase XynHB in Saccharomyces cerevisiae by rDNA-mediated integration.

PubMed

Fang, Cheng; Wang, Qinhong; Selvaraj, Jonathan Nimal; Zhou, Yuling; Ma, Lixin; Zhang, Guimin; Ma, Yanhe

2017-08-18

Xylanase is a widely-used additive in baking industry for enhancing dough and bread quality. Several xylanases used in baking industry were expressed in different systems, but their expression in antibiotic free vector system is highly essential and safe. In the present study, an alternative rDNA-mediated technology was developed to increase the copy number of target gene by integrating it into Saccharomyces cerevisiae genome. A xylanase-encoding gene xynHB from Bacillus sp. was cloned into pHBM367H and integrated into S. cerevisiae genome through rDNA-mediated recombination. Exogenous XynHB expressed by recombinant S. cerevisiae strain A13 exhibited higher degradation activity towards xylan than other transformants. The real-time PCR analysis on A13 genome revealed the presence of 13.64 copies of xynHB gene. Though no antibiotics have been used, the genetic stability and the xylanase activity of xynHB remained stable up to 1,011 generations of cultivation. S. cerevisiae strain A13 expressing xylanase reduced the required kneading time and increased the height and diameter of the dough size, which would be safe and effective in baking industry as no antibiotics-resistance risk. The new effective rDNA-mediated technology without using antibiotics here provides a way to clone other food related industrial enzymes for applications.

Propagating Molecular Recognition Events through Highly Integrated Sense-Response Chemical Systems

DTIC Science & Technology

2017-08-01

Propagating Molecular Recognition Events through Highly Integrated Sense-Response Chemical Systems The views, opinions and/or findings contained in...University of California - San Diego Title: Propagating Molecular Recognition Events through Highly Integrated Sense-Response Chemical Systems Report Term...including enzymatic reactions , occurring at the aqueous interfaces of thermotropic LCs show promise as the basis of biomolecular triggers of LC

TAGCNA: A Method to Identify Significant Consensus Events of Copy Number Alterations in Cancer

PubMed Central

Yuan, Xiguo; Zhang, Junying; Yang, Liying; Zhang, Shengli; Chen, Baodi; Geng, Yaojun; Wang, Yue

2012-01-01

Somatic copy number alteration (CNA) is a common phenomenon in cancer genome. Distinguishing significant consensus events (SCEs) from random background CNAs in a set of subjects has been proven to be a valuable tool to study cancer. In order to identify SCEs with an acceptable type I error rate, better computational approaches should be developed based on reasonable statistics and null distributions. In this article, we propose a new approach named TAGCNA for identifying SCEs in somatic CNAs that may encompass cancer driver genes. TAGCNA employs a peel-off permutation scheme to generate a reasonable null distribution based on a prior step of selecting tag CNA markers from the genome being considered. We demonstrate the statistical power of TAGCNA on simulated ground truth data, and validate its applicability using two publicly available cancer datasets: lung and prostate adenocarcinoma. TAGCNA identifies SCEs that are known to be involved with proto-oncogenes (e.g. EGFR, CDK4) and tumor suppressor genes (e.g. CDKN2A, CDKN2B), and provides many additional SCEs with potential biological relevance in these data. TAGCNA can be used to analyze the significance of CNAs in various cancers. It is implemented in R and is freely available at http://tagcna.sourceforge.net/. PMID:22815924

Identification of Tf1 integration events in S. pombe under nonselective conditions

PubMed Central

Cherry, Kristina E.; Hearn, Willis E.; Seshie, Osborne Y.; Singleton, Teresa L.; Singleton, Teresa L.

2014-01-01

Integration of retroviral elements into the host genome is a phenomena observed among many classes of retroviruses. Much information concerning integration of retroviral elements has been documented based on in vitro analysis or expression of selectable markers. To identify possible Tf1 integration events within silent regions of the S. pombe genome, we focused on performing an in vivo genome-wide analysis of Tf1 integration events from the nonselective phase of the retrotransposition assay. We analyzed 1000 individual colonies streaked from four independent Tf1 transposed patches under nonselection conditions. Our analysis detected a population of G418S/neo+ Tf1 integration events that would have been overlooked during the selective phase of the assay. Further RNA analysis from the G418S/neo+ clones revealed 50% of clones expressing the neo selectable marker. Our data reveals Tf1’s ability to insert within silent regions of S. pombe’s genome. PMID:24680781

Identification of Tf1 integration events in S. pombe under nonselective conditions.

PubMed

Cherry, Kristina E; Hearn, Willis E; Seshie, Osborne Y K; Singleton, Teresa L

2014-06-01

Integration of retroviral elements into the host genome is a phenomena observed among many classes of retroviruses. Much information concerning the integration of retroviral elements has been documented based on in vitro analysis or expression of selectable markers. To identify possible Tf1 integration events within silent regions of the Schizosaccharomyces pombe genome, we focused on performing an in vivo genome-wide analysis of Tf1 integration events from the nonselective phase of the retrotransposition assay. We analyzed 1000 individual colonies streaked from four independent Tf1 transposed patches under nonselection conditions. Our analysis detected a population of G418(S)/neo(+) Tf1 integration events that would have been overlooked during the selective phase of the assay. Further RNA analysis from the G418(S)/neo(+) clones revealed 50% of clones expressing the neo selectable marker. Our data reveals Tf1's ability to insert within silent regions of S. pombe's genome. Copyright © 2014 Elsevier B.V. All rights reserved.

ParseCNV integrative copy number variation association software with quality tracking

PubMed Central

Glessner, Joseph T.; Li, Jin; Hakonarson, Hakon

2013-01-01

A number of copy number variation (CNV) calling algorithms exist; however, comprehensive software tools for CNV association studies are lacking. We describe ParseCNV, unique software that takes CNV calls and creates probe-based statistics for CNV occurrence in both case–control design and in family based studies addressing both de novo and inheritance events, which are then summarized based on CNV regions (CNVRs). CNVRs are defined in a dynamic manner to allow for a complex CNV overlap while maintaining precise association region. Using this approach, we avoid failure to converge and non-monotonic curve fitting weaknesses of programs, such as CNVtools and CNVassoc, and although Plink is easy to use, it only provides combined CNV state probe-based statistics, not state-specific CNVRs. Existing CNV association methods do not provide any quality tracking information to filter confident associations, a key issue which is fully addressed by ParseCNV. In addition, uncertainty in CNV calls underlying CNV associations is evaluated to verify significant results, including CNV overlap profiles, genomic context, number of probes supporting the CNV and single-probe intensities. When optimal quality control parameters are followed using ParseCNV, 90% of CNVs validate by polymerase chain reaction, an often problematic stage because of inadequate significant association review. ParseCNV is freely available at http://parsecnv.sourceforge.net. PMID:23293001

ParseCNV integrative copy number variation association software with quality tracking.

PubMed

Glessner, Joseph T; Li, Jin; Hakonarson, Hakon

2013-03-01

A number of copy number variation (CNV) calling algorithms exist; however, comprehensive software tools for CNV association studies are lacking. We describe ParseCNV, unique software that takes CNV calls and creates probe-based statistics for CNV occurrence in both case-control design and in family based studies addressing both de novo and inheritance events, which are then summarized based on CNV regions (CNVRs). CNVRs are defined in a dynamic manner to allow for a complex CNV overlap while maintaining precise association region. Using this approach, we avoid failure to converge and non-monotonic curve fitting weaknesses of programs, such as CNVtools and CNVassoc, and although Plink is easy to use, it only provides combined CNV state probe-based statistics, not state-specific CNVRs. Existing CNV association methods do not provide any quality tracking information to filter confident associations, a key issue which is fully addressed by ParseCNV. In addition, uncertainty in CNV calls underlying CNV associations is evaluated to verify significant results, including CNV overlap profiles, genomic context, number of probes supporting the CNV and single-probe intensities. When optimal quality control parameters are followed using ParseCNV, 90% of CNVs validate by polymerase chain reaction, an often problematic stage because of inadequate significant association review. ParseCNV is freely available at http://parsecnv.sourceforge.net.

Safe Practices for Copy and Paste in the EHR. Systematic Review, Recommendations, and Novel Model for Health IT Collaboration.

PubMed

Tsou, Amy Y; Lehmann, Christoph U; Michel, Jeremy; Solomon, Ronni; Possanza, Lorraine; Gandhi, Tejal

2017-01-11

Copy and paste functionality can support efficiency during clinical documentation, but may promote inaccurate documentation with risks for patient safety. The Partnership for Health IT Patient Safety was formed to gather data, conduct analysis, educate, and disseminate safe practices for safer care using health information technology (IT). To characterize copy and paste events in clinical care, identify safety risks, describe existing evidence, and develop implementable practice recommendations for safe reuse of information via copy and paste. The Partnership 1) reviewed 12 reported safety events, 2) solicited expert input, and 3) performed a systematic literature review (2010 to January 2015) to identify publications addressing frequency, perceptions/attitudes, patient safety risks, existing guidance, and potential interventions and mitigation practices. The literature review identified 51 publications that were included. Overall, 66% to 90% of clinicians routinely use copy and paste. One study of diagnostic errors found that copy and paste led to 2.6% of errors in which a missed diagnosis required patients to seek additional unplanned care. Copy and paste can promote note bloat, internal inconsistencies, error propagation, and documentation in the wrong patient chart. Existing guidance identified specific responsibilities for authors, organizations, and electronic health record (EHR) developers. Analysis of 12 reported copy and paste safety events was congruent with problems identified from the literature review. Despite regular copy and paste use, evidence regarding direct risk to patient safety remains sparse, with significant study limitations. Drawing on existing evidence, the Partnership developed four safe practice recommendations: 1) Provide a mechanism to make copy and paste material easily identifiable; 2) Ensure the provenance of copy and paste material is readily available; 3) Ensure adequate staff training and education; 4) Ensure copy and paste

Low copy number of the salivary amylase gene predisposes to obesity.

PubMed

Falchi, Mario; El-Sayed Moustafa, Julia Sarah; Takousis, Petros; Pesce, Francesco; Bonnefond, Amélie; Andersson-Assarsson, Johanna C; Sudmant, Peter H; Dorajoo, Rajkumar; Al-Shafai, Mashael Nedham; Bottolo, Leonardo; Ozdemir, Erdal; So, Hon-Cheong; Davies, Robert W; Patrice, Alexandre; Dent, Robert; Mangino, Massimo; Hysi, Pirro G; Dechaume, Aurélie; Huyvaert, Marlène; Skinner, Jane; Pigeyre, Marie; Caiazzo, Robert; Raverdy, Violeta; Vaillant, Emmanuel; Field, Sarah; Balkau, Beverley; Marre, Michel; Visvikis-Siest, Sophie; Weill, Jacques; Poulain-Godefroy, Odile; Jacobson, Peter; Sjostrom, Lars; Hammond, Christopher J; Deloukas, Panos; Sham, Pak Chung; McPherson, Ruth; Lee, Jeannette; Tai, E Shyong; Sladek, Robert; Carlsson, Lena M S; Walley, Andrew; Eichler, Evan E; Pattou, Francois; Spector, Timothy D; Froguel, Philippe

2014-05-01

Common multi-allelic copy number variants (CNVs) appear enriched for phenotypic associations compared to their biallelic counterparts. Here we investigated the influence of gene dosage effects on adiposity through a CNV association study of gene expression levels in adipose tissue. We identified significant association of a multi-allelic CNV encompassing the salivary amylase gene (AMY1) with body mass index (BMI) and obesity, and we replicated this finding in 6,200 subjects. Increased AMY1 copy number was positively associated with both amylase gene expression (P = 2.31 × 10(-14)) and serum enzyme levels (P < 2.20 × 10(-16)), whereas reduced AMY1 copy number was associated with increased BMI (change in BMI per estimated copy = -0.15 (0.02) kg/m(2); P = 6.93 × 10(-10)) and obesity risk (odds ratio (OR) per estimated copy = 1.19, 95% confidence interval (CI) = 1.13-1.26; P = 1.46 × 10(-10)). The OR value of 1.19 per copy of AMY1 translates into about an eightfold difference in risk of obesity between subjects in the top (copy number > 9) and bottom (copy number < 4) 10% of the copy number distribution. Our study provides a first genetic link between carbohydrate metabolism and BMI and demonstrates the power of integrated genomic approaches beyond genome-wide association studies.

Screening for common copy-number variants in cancer genes.

PubMed

Tyson, Jess; Majerus, Tamsin M O; Walker, Susan; Armour, John A L

2010-12-01

For most cases of colorectal cancer that arise without a family history of the disease, it is proposed that an appreciable heritable component of predisposition is the result of contributions from many loci. Although progress has been made in identifying single nucleotide variants associated with colorectal cancer risk, the involvement of low-penetrance copy number variants is relatively unexplored. We have used multiplex amplifiable probe hybridization (MAPH) in a fourfold multiplex (QuadMAPH), positioned at an average resolution of one probe per 2 kb, to screen a total of 1.56 Mb of genomic DNA for copy number variants around the genes APC, AXIN1, BRCA1, BRCA2, CTNNB1, HRAS, MLH1, MSH2, and TP53. Two deletion events were detected, one upstream of MLH1 in a control individual and the other in APC in a colorectal cancer patient, but these do not seem to correspond to copy number polymorphisms with measurably high population frequencies. In summary, by means of our QuadMAPH assay, copy number measurement data were of sufficient resolution and accuracy to detect any copy number variants with high probability. However, this study has demonstrated a very low incidence of deletion and duplication variants within intronic and flanking regions of these nine genes, in both control individuals and colorectal cancer patients. Copyright © 2010 Elsevier Inc. All rights reserved.

Copy-Number Gains of HUWE1 Due to Replication- and Recombination-Based Rearrangements

PubMed Central

Froyen, Guy; Belet, Stefanie; Martinez, Francisco; Santos-Rebouças, Cíntia Barros; Declercq, Matthias; Verbeeck, Jelle; Donckers, Lene; Berland, Siren; Mayo, Sonia; Rosello, Monica; Pimentel, Márcia Mattos Gonçalves; Fintelman-Rodrigues, Natalia; Hovland, Randi; Rodrigues dos Santos, Suely; Raymond, F. Lucy; Bose, Tulika; Corbett, Mark A.; Sheffield, Leslie; van Ravenswaaij-Arts, Conny M.A.; Dijkhuizen, Trijnie; Coutton, Charles; Satre, Veronique; Siu, Victoria; Marynen, Peter

2012-01-01

We previously reported on nonrecurrent overlapping duplications at Xp11.22 in individuals with nonsyndromic intellectual disability (ID) harboring HSD17B10, HUWE1, and the microRNAs miR-98 and let-7f-2 in the smallest region of overlap. Here, we describe six additional individuals with nonsyndromic ID and overlapping microduplications that segregate in the families. High-resolution mapping of the 12 copy-number gains reduced the minimal duplicated region to the HUWE1 locus only. Consequently, increased mRNA levels were detected for HUWE1, but not HSD17B10. Marker and SNP analysis, together with identification of two de novo events, suggested a paternally derived intrachromosomal duplication event. In four independent families, we report on a polymorphic 70 kb recurrent copy-number gain, which harbors part of HUWE1 (exon 28 to 3′ untranslated region), including miR-98 and let-7f-2. Our findings thus demonstrate that HUWE1 is the only remaining dosage-sensitive gene associated with the ID phenotype. Junction and in silico analysis of breakpoint regions demonstrated simple microhomology-mediated rearrangements suggestive of replication-based duplication events. Intriguingly, in a single family, the duplication was generated through nonallelic homologous recombination (NAHR) with the use of HUWE1-flanking imperfect low-copy repeats, which drive this infrequent NAHR event. The recurrent partial HUWE1 copy-number gain was also generated through NAHR, but here, the homologous sequences used were identified as TcMAR-Tigger DNA elements, a template that has not yet been reported for NAHR. In summary, we showed that an increased dosage of HUWE1 causes nonsyndromic ID and demonstrated that the Xp11.22 region is prone to recombination- and replication-based rearrangements. PMID:22840365

Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events.

PubMed

Demeke, Tigst; Eng, Monika

2018-05-01

Droplet digital PCR (ddPCR) has been used for absolute quantification of genetically engineered (GE) events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences ( HMG-I/Y , FatA(A), CruA and Ccf) for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A), reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A) reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences) were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes.

Allelic recombination between distinct genomic locations generates copy number diversity in human β-defensins

PubMed Central

Bakar, Suhaili Abu; Hollox, Edward J.; Armour, John A. L.

2009-01-01

β-Defensins are small secreted antimicrobial and signaling peptides involved in the innate immune response of vertebrates. In humans, a cluster of at least 7 of these genes shows extensive copy number variation, with a diploid copy number commonly ranging between 2 and 7. Using a genetic mapping approach, we show that this cluster is at not 1 but 2 distinct genomic loci ≈5 Mb apart on chromosome band 8p23.1, contradicting the most recent genome assembly. We also demonstrate that the predominant mechanism of change in β-defensin copy number is simple allelic recombination occurring in the interval between the 2 distinct genomic loci for these genes. In 416 meiotic transmissions, we observe 3 events creating a haplotype copy number not found in the parent, equivalent to a germ-line rate of copy number change of ≈0.7% per gamete. This places it among the fastest-changing copy number variants currently known. PMID:19131514

Real-Time PCR for the Detection of Precise Transgene Copy Number in Wheat.

PubMed

Giancaspro, Angelica; Gadaleta, Agata; Blanco, Antonio

2017-01-01

Despite the unceasing advances in genetic transformation techniques, the success of common delivery methods still lies on the behavior of the integrated transgenes in the host genome. Stability and expression of the introduced genes are influenced by several factors such as chromosomal location, transgene copy number and interaction with the host genotype. Such factors are traditionally characterized by Southern blot analysis, which can be time-consuming, laborious, and often unable to detect the exact copy number of rearranged transgenes. Recent research in crop field suggests real-time PCR as an effective and reliable tool for the precise quantification and characterization of transgene loci. This technique overcomes most problems linked to phenotypic segregation analysis and can analyze hundreds of samples in a day, making it an efficient method for estimating a gene copy number integrated in a transgenic line. This protocol describes the use of real-time PCR for the detection of transgene copy number in durum wheat transgenic lines by means of two different chemistries (SYBR ® Green I dye and TaqMan ® probes).

Accurate measurement of transgene copy number in crop plants using droplet digital PCR.

PubMed

Collier, Ray; Dasgupta, Kasturi; Xing, Yan-Ping; Hernandez, Bryan Tarape; Shao, Min; Rohozinski, Dominica; Kovak, Emma; Lin, Jeanie; de Oliveira, Maria Luiza P; Stover, Ed; McCue, Kent F; Harmon, Frank G; Blechl, Ann; Thomson, James G; Thilmony, Roger

2017-06-01

Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy number is estimated by either Southern blot hybridization analyses or quantitative polymerase chain reaction (qPCR) experiments. Southern hybridization is a convincing and reliable method, but it also is expensive, time-consuming and often requires a large amount of genomic DNA and radioactively labeled probes. Alternatively, qPCR requires less DNA and is potentially simpler to perform, but its results can lack the accuracy and precision needed to confidently distinguish between one- and two-copy events in transgenic plants with large genomes. To address this need, we developed a droplet digital PCR-based method for transgene copy number measurement in an array of crops: rice, citrus, potato, maize, tomato and wheat. The method utilizes specific primers to amplify target transgenes, and endogenous reference genes in a single duplexed reaction containing thousands of droplets. Endpoint amplicon production in the droplets is detected and quantified using sequence-specific fluorescently labeled probes. The results demonstrate that this approach can generate confident copy number measurements in independent transgenic lines in these crop species. This method and the compendium of probes and primers will be a useful resource for the plant research community, enabling the simple and accurate determination of transgene copy number in these six important crop species. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

Unconscious symmetrical inferences: A role of consciousness in event integration.

PubMed

Alonso, Diego; Fuentes, Luis J; Hommel, Bernhard

2006-06-01

Explicit and implicit learning have been attributed to different learning processes that create different types of knowledge structures. Consistent with that claim, our study provides evidence that people integrate stimulus events differently when consciously aware versus unaware of the relationship between the events. In a first, acquisition phase participants sorted words into two categories (A and B), which were fully predicted by task-irrelevant primes-the labels of two other, semantically unrelated categories (C and D). In a second, test phase participants performed a lexical decision task, in which all word stimuli stemmed from the previous prime categories (C and D) and the (now nonpredictive) primes were the labels of the previous target categories (A and B). Reliable priming effects in the second phase demonstrated that bidirectional associations between the respective categories had been formed in the acquisition phase (A<-->C and B<-->D), but these effects were found only in participants that were unaware of the relationship between the categories! We suggest that unconscious, implicit learning of event relationships results in the rather unsophisticated integration (i.e., bidirectional association) of the underlying event representations, whereas explicit learning takes the meaning of the order of the events into account, and thus creates unidirectional associations.

Competency Based Competitive Events. Integrating DECA into the DE Instructional Program.

ERIC Educational Resources Information Center

Cosgrove, Glenna; Moore, Harold W.

Designed to be integrated into a competency-based distributive education program, these competitive DECA (Distributive Education Clubs of America) events were developed, utilized, and evaluated by distributive education and cooperative education coordinators in Arkansas. These events are organized under the following occupational categories: food…

[Development of a mouse cell line containing stably integrated copies of pMCLacI/Neo plasmid: a model for studying mutations in vitro].

PubMed

Lu, Y; Li, H; Fu, J

2000-04-01

To establish a suitable model for studying the different mechanisms of mutation between expressed and non-expressed genes in mammalian cells. The NIH3T3 cells were transfected with the linearized pMCLacI/Neo DNAs by liposome-mediated transfection, and grew in the presence of G418. One drug resistant cell clone was selected to proliferate and to be analyzed with Southern blot and RT-PCR analyses on its genomic DNAs. (1) Multiple copies of pMCLacI/Neo plasmid DNA were intactly integrated in the genomic DNAs of the cell clone. (2) One of lac I target genes in the integrated plasmid could be transcribed in the NIH3T3 cells while the other could not. (3) The pMCLacI/Neo plasmid DNA could be efficiently rescued from the genomic DNAs of the cell clone with the average rescue efficiency of 410 cfu/microg DNA. The NIH3T3 cell line containing copies of a stably integrated pMCLacI/Neo has been established. The two lacI target genes in the cell line could imitate the functional states of expressed and non-expressed genes in mammalian cells respectively. The cell line will be a useful model for studying the different mechanisms of mutation between expressed and non-expressed genes in mammalian cells.

12. Photographic copy of copy of Twin Lakes Outlet Works ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

12. Photographic copy of copy of Twin Lakes Outlet Works construction drawing dated January 15, 1951. Drawn by W.A. Doe for the Twin Lakes Reservoir and Canal Co. (copy in possession of Bureau of Reclamation, location of original unknown) 'AS CONSTRUCTED' PLANS OF 1949-50, REHABILITATION OF TWIN LAKES RESERVOIR OUTLET WORKS, DETAILS OF DISCHARGE BASIN. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

Reporting requirements for skeletal digital radiography: comparison of soft-copy and hard-copy presentation.

PubMed

O'Connor, P J; Davies, A G; Fowler, R C; Lintott, D J; Bury, R F; Parkin, G J; Martinez, D; Saifuddin, A; Cowen, A R

1998-04-01

To assess diagnostic performance and reader preference when reporting results from digital hard-copy and two soft-copy formats of skeletal digital radiography. The data comprised hand radiographs of patients undergoing renal dialysis. Normal hand radiographs obtained in trauma patients were assessed as control images. One hundred fifteen images acquired with a photostimulable-phosphor computed radiography system were analyzed. Image selection and initial assessment were by consensus of two experienced radiologists, who graded the radiographic changes of hyperparathyroidism with the Ritz scoring system. The images were then presented to four readers in three formats: hard-copy output and soft-copy presentations at 2K2 and 1K2 resolutions. These readers scored pathologic change and image preference. The results were analyzed with the receiver operating characteristic technique. There was a significant improvement in diagnostic performance for both soft-copy formats relative to the hard-copy format (P < .001). No significant difference in diagnostic performance was found between the two soft-copy formats. There was a significant preference for both soft-copy formats relative to the hard-copy format (P < .01), with the 2K2 soft-copy images preferred to the 1K2 images (P < .01). Soft-copy reporting can provide superior diagnostic performance even for images viewed at a modest (1K2) resolution. The lack of difference between the two soft-copy formats has important economic implications with respect to departmental hardware requirements.

11. Photographic copy of copy of Twin Lakes Outlet Works ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

11. Photographic copy of copy of Twin Lakes Outlet Works construction drawing dated January 15, 1951. Drawn by W.A. Doe for the Twin Lakes Reservoir and Canal Co. (copy in possession of Bureau of Reclamation, location of original unknown) 'AS CONSTRUCTED' PLANS OF 1949-1950, REHABILITATION OF TWIN LAKES RESERVOIR OUTLET WORKS, DETAILS OF UPSTREAM WING WALLS. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

Does testing with feedback improve adult spelling skills relative to copying and reading?

PubMed

Pan, Steven C; Rubin, Benjamin R; Rickard, Timothy C

2015-12-01

We examined testing's ability to enhance adult spelling acquisition, relative to copying and reading. Across 3 experiments in which testing with feedback was compared with copying, the spelling improvement after testing matched that following the same amount of time spent copying. A potent testing advantage, however, was observed for spelling words free-recalled. In the fourth experiment, a large testing advantage for both word free recall and spelling was observed, versus reading. Subjects also generally preferred testing and rated it as more effective than copying or reading. The equivalent performance of testing and copying for spelling contrasts with prior work involving children and suggests that retrieval practice may not be the only effective mechanism for spelling skill acquisition. Rather, we suggest that the critical learning event for spelling is focused study on phoneme-to-grapheme mappings for previously unlearned letter sequences. For adults with extensive spelling expertise, focused study is more automatic during both copying and testing with feedback than for individuals with beginning spelling skills. Reading, however, would not be expected to produce efficient focused study of phoneme-to-grapheme mappings, regardless of expertise level. Overall, adult spelling skill acquisition benefits both from testing and copying, and substantially less from reading. (c) 2015 APA, all rights reserved).

Aluminum tolerance in maize is associated with higher MATE1 gene copy number

PubMed Central

Maron, Lyza G.; Guimarães, Claudia T.; Kirst, Matias; Albert, Patrice S.; Birchler, James A.; Bradbury, Peter J.; Buckler, Edward S.; Coluccio, Alison E.; Danilova, Tatiana V.; Kudrna, David; Magalhaes, Jurandir V.; Piñeros, Miguel A.; Schatz, Michael C.; Wing, Rod A.; Kochian, Leon V.

2013-01-01

Genome structure variation, including copy number variation and presence/absence variation, comprises a large extent of maize genetic diversity; however, its effect on phenotypes remains largely unexplored. Here, we describe how copy number variation underlies a rare allele that contributes to maize aluminum (Al) tolerance. Al toxicity is the primary limitation for crop production on acid soils, which make up 50% of the world’s potentially arable lands. In a recombinant inbred line mapping population, copy number variation of the Al tolerance gene multidrug and toxic compound extrusion 1 (MATE1) is the basis for the quantitative trait locus of largest effect on phenotypic variation. This expansion in MATE1 copy number is associated with higher MATE1 expression, which in turn results in superior Al tolerance. The three MATE1 copies are identical and are part of a tandem triplication. Only three maize inbred lines carrying the three-copy allele were identified from maize and teosinte diversity panels, indicating that copy number variation for MATE1 is a rare, and quite likely recent, event. These maize lines with higher MATE1 copy number are also Al-tolerant, have high MATE1 expression, and originate from regions of highly acidic soils. Our findings show a role for copy number variation in the adaptation of maize to acidic soils in the tropics and suggest that genome structural changes may be a rapid evolutionary response to new environments. PMID:23479633

Gene copy number evolution during tetraploid cotton radiation.

PubMed

Rong, J; Feltus, F A; Liu, L; Lin, L; Paterson, A H

2010-11-01

After polyploid formation, retention or loss of duplicated genes is not random. Genes with some functional domains are convergently restored to 'singleton' state after many independent genome duplications, and have been referred to as 'duplication-resistant' (DR) genes. To further explore the timeframe for their restoration to the singleton state, 27 cotton homologs of genes found to be 'DR' in Arabidopsis were selected based on diagnostic Pfam domains. Their copy numbers were studied using southern hybridization and sequence analysis in five tetraploid species and their ancestral A and D genome diploids. DR genes had significantly lower copy number than gene families hybridizing to randomly selected cotton ESTs. Three DR genes showed complete loss of D genome-derived homoeologs in some or all tetraploid species. Prior analysis has shown gene loss in polyploid cotton to be rare, and herein only one randomly selected gene showed loss of a homoeolog in only one of the five tetraploid species (Gossypium mustelinum). BAC sequencing confirmed two cases of gene loss in tetraploid cotton. Divergence among 5' sequences of DR genes amplified from G. arboreum, G. raimondii, and Gossypioides kirkii was correlated with gene copy number. These results show that genes containing Pfam domains associated with duplication resistance in Arabidopsis have also been preferentially restored to low copy number after a more recent polyploidization event in cotton. In tetraploid cotton, genes from the progenitor D genome seem to experience more gene copy number divergence than genes from the A genome. Together with D subgenome-biased alterations in gene expression, perhaps gene loss may contribute to the relatively larger portion of quantitative trait variation attributable to D than A subgenome chromosomes of tetraploid cotton.

Integrated genome-wide DNA copy number and expression analysis identifies distinct mechanisms of primary chemoresistance in ovarian carcinomas.

PubMed

Etemadmoghadam, Dariush; deFazio, Anna; Beroukhim, Rameen; Mermel, Craig; George, Joshy; Getz, Gad; Tothill, Richard; Okamoto, Aikou; Raeder, Maria B; Harnett, Paul; Lade, Stephen; Akslen, Lars A; Tinker, Anna V; Locandro, Bianca; Alsop, Kathryn; Chiew, Yoke-Eng; Traficante, Nadia; Fereday, Sian; Johnson, Daryl; Fox, Stephen; Sellers, William; Urashima, Mitsuyoshi; Salvesen, Helga B; Meyerson, Matthew; Bowtell, David

2009-02-15

A significant number of women with serous ovarian cancer are intrinsically refractory to platinum-based treatment. We analyzed somatic DNA copy number variation and gene expression data to identify key mechanisms associated with primary resistance in advanced-stage serous cancers. Genome-wide copy number variation was measured in 118 ovarian tumors using high-resolution oligonucleotide microarrays. A well-defined subset of 85 advanced-stage serous tumors was then used to relate copy number variation to primary resistance to treatment. The discovery-based approach was complemented by quantitative-PCR copy number analysis of 12 candidate genes as independent validation of previously reported associations with clinical outcome. Likely copy number variation targets and tumor molecular subtypes were further characterized by gene expression profiling. Amplification of 19q12, containing cyclin E (CCNE1), and 20q11.22-q13.12, mapping immediately adjacent to the steroid receptor coactivator NCOA3, was significantly associated with poor response to primary treatment. Other genes previously associated with copy number variation and clinical outcome in ovarian cancer were not associated with primary treatment resistance. Chemoresistant tumors with high CCNE1 copy number and protein expression were associated with increased cellular proliferation but so too was a subset of treatment-responsive patients, suggesting a cell-cycle independent role for CCNE1 in modulating chemoresponse. Patients with a poor clinical outcome without CCNE1 amplification overexpressed genes involved in extracellular matrix deposition. We have identified two distinct mechanisms of primary treatment failure in serous ovarian cancer, involving CCNE1 amplification and enhanced extracellular matrix deposition. CCNE1 copy number is validated as a dominant marker of patient outcome in ovarian cancer.

Integrated Historical Tsunami Event and Deposit Database

NASA Astrophysics Data System (ADS)

Dunbar, P. K.; McCullough, H. L.

2010-12-01

The National Geophysical Data Center (NGDC) provides integrated access to historical tsunami event, deposit, and proxy data. The NGDC tsunami archive initially listed tsunami sources and locations with observed tsunami effects. Tsunami frequency and intensity are important for understanding tsunami hazards. Unfortunately, tsunami recurrence intervals often exceed the historic record. As a result, NGDC expanded the archive to include the Global Tsunami Deposits Database (GTD_DB). Tsunami deposits are the physical evidence left behind when a tsunami impacts a shoreline or affects submarine sediments. Proxies include co-seismic subsidence, turbidite deposits, changes in biota following an influx of marine water in a freshwater environment, etc. By adding past tsunami data inferred from the geologic record, the GTD_DB extends the record of tsunamis backward in time. Although the best methods for identifying tsunami deposits and proxies in the geologic record remain under discussion, developing an overall picture of where tsunamis have affected coasts, calculating recurrence intervals, and approximating runup height and inundation distance provides a better estimate of a region’s true tsunami hazard. Tsunami deposit and proxy descriptions in the GTD_DB were compiled from published data found in journal articles, conference proceedings, theses, books, conference abstracts, posters, web sites, etc. The database now includes over 1,200 descriptions compiled from over 1,100 citations. Each record in the GTD_DB is linked to its bibliographic citation where more information on the deposit can be found. The GTD_DB includes data for over 50 variables such as: event description (e.g., 2010 Chile Tsunami), geologic time period, year, deposit location name, latitude, longitude, country, associated body of water, setting during the event (e.g., beach, lake, river, deep sea), upper and lower contacts, underlying and overlying material, etc. If known, the tsunami source mechanism

The role of efference copy in striatal learning.

PubMed

Fee, Michale S

2014-04-01

Reinforcement learning requires the convergence of signals representing context, action, and reward. While models of basal ganglia function have well-founded hypotheses about the neural origin of signals representing context and reward, the function and origin of signals representing action are less clear. Recent findings suggest that exploratory or variable behaviors are initiated by a wide array of 'action-generating' circuits in the midbrain, brainstem, and cortex. Thus, in order to learn, the striatum must incorporate an efference copy of action decisions made in these action-generating circuits. Here we review several recent neural models of reinforcement learning that emphasize the role of efference copy signals. Also described are ideas about how these signals might be integrated with inputs signaling context and reward. Copyright © 2014 Elsevier Ltd. All rights reserved.

10. Photographic copy of copy of original construction drawing, dated ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

10. Photographic copy of copy of original construction drawing, dated 1899?. Original in possession of Twin Lakes Reservoir and Canal Company, Ordway, Colorado. PLAN OF DAM AND HEAD GATES FOR THE TWIN LAKES RESERVOIR. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

Accurate measurement of transgene copy number in crop plants using droplet digital PCR

USDA-ARS?s Scientific Manuscript database

Technical abstract: Genetic transformation is a powerful means for the improvement of crop plants, but requires labor and resource intensive methods. An efficient method for identifying single copy transgene insertion events from a population of independent transgenic lines is desirable. Currently ...

Integrative analysis of gene expression and copy number alterations using canonical correlation analysis.

PubMed

Soneson, Charlotte; Lilljebjörn, Henrik; Fioretos, Thoas; Fontes, Magnus

2010-04-15

With the rapid development of new genetic measurement methods, several types of genetic alterations can be quantified in a high-throughput manner. While the initial focus has been on investigating each data set separately, there is an increasing interest in studying the correlation structure between two or more data sets. Multivariate methods based on Canonical Correlation Analysis (CCA) have been proposed for integrating paired genetic data sets. The high dimensionality of microarray data imposes computational difficulties, which have been addressed for instance by studying the covariance structure of the data, or by reducing the number of variables prior to applying the CCA. In this work, we propose a new method for analyzing high-dimensional paired genetic data sets, which mainly emphasizes the correlation structure and still permits efficient application to very large data sets. The method is implemented by translating a regularized CCA to its dual form, where the computational complexity depends mainly on the number of samples instead of the number of variables. The optimal regularization parameters are chosen by cross-validation. We apply the regularized dual CCA, as well as a classical CCA preceded by a dimension-reducing Principal Components Analysis (PCA), to a paired data set of gene expression changes and copy number alterations in leukemia. Using the correlation-maximizing methods, regularized dual CCA and PCA+CCA, we show that without pre-selection of known disease-relevant genes, and without using information about clinical class membership, an exploratory analysis singles out two patient groups, corresponding to well-known leukemia subtypes. Furthermore, the variables showing the highest relevance to the extracted features agree with previous biological knowledge concerning copy number alterations and gene expression changes in these subtypes. Finally, the correlation-maximizing methods are shown to yield results which are more biologically

Generalization of the event-based Carnevale-Hines integration scheme for integrate-and-fire models.

PubMed

van Elburg, Ronald A J; van Ooyen, Arjen

2009-07-01

An event-based integration scheme for an integrate-and-fire neuron model with exponentially decaying excitatory synaptic currents and double exponential inhibitory synaptic currents has been introduced by Carnevale and Hines. However, the integration scheme imposes nonphysiological constraints on the time constants of the synaptic currents, which hamper its general applicability. This letter addresses this problem in two ways. First, we provide physical arguments demonstrating why these constraints on the time constants can be relaxed. Second, we give a formal proof showing which constraints can be abolished. As part of our formal proof, we introduce the generalized Carnevale-Hines lemma, a new tool for comparing double exponentials as they naturally occur in many cascaded decay systems, including receptor-neurotransmitter dissociation followed by channel closing. Through repeated application of the generalized lemma, we lift most of the original constraints on the time constants. Thus, we show that the Carnevale-Hines integration scheme for the integrate-and-fire model can be employed for simulating a much wider range of neuron and synapse types than was previously thought.

Using Copy Change with Trade Books to Teach Earth Science

ERIC Educational Resources Information Center

Bintz, William P.; Wright, Pam; Sheffer, Julie

2010-01-01

Developing and implementing relevant, challenging, integrative, and exploratory curriculum is critical at all levels of schooling. This article describes one attempt to develop and implement an instance of interdisciplinary curriculum by using copy change with trade books to teach earth science. Specifically, it introduces trade books as a way to…

Integrative analysis of copy number and gene expression in breast cancer using formalin-fixed paraffin-embedded core biopsy tissue: a feasibility study.

PubMed

Iddawela, Mahesh; Rueda, Oscar; Eremin, Jenny; Eremin, Oleg; Cowley, Jed; Earl, Helena M; Caldas, Carlos

2017-07-11

An absence of reliable molecular markers has hampered individualised breast cancer treatments, and a major limitation for translational research is the lack of fresh tissue. There are, however, abundant banks of formalin-fixed paraffin-embedded (FFPE) tissue. This study evaluated two platforms available for the analysis of DNA copy number and gene expression using FFPE samples. The cDNA-mediated annealing, selection, extension, and ligation assay (DASL™) has been developed for gene expression analysis and the Molecular Inversion Probes assay (Oncoscan™), were used for copy number analysis using FFPE tissues. Gene expression and copy number were evaluated in core-biopsy samples from patients with breast cancer undergoing neoadjuvant chemotherapy (NAC). Forty-three core-biopsies were evaluated and characteristic copy number changes in breast cancers, gains in 1q, 8q, 11q, 17q and 20q and losses in 6q, 8p, 13q and 16q, were confirmed. Regions that frequently exhibited gains in tumours showing a pathological complete response (pCR) to NAC were 1q (55%), 8q (40%) and 17q (40%), whereas 11q11 (37%) gain was the most frequent change in non-pCR tumours. Gains associated with poor survival were 11q13 (62%), 8q24 (54%) and 20q (47%). Gene expression assessed by DASL correlated with immunohistochemistry (IHC) analysis for oestrogen receptor (ER) [area under the curve (AUC) = 0.95], progesterone receptor (PR)(AUC = 0.90) and human epidermal growth factor type-2 receptor (HER-2) (AUC = 0.96). Differential expression analysis between ER+ and ER- cancers identified over-expression of TTF1, LAF-4 and C-MYB (p ≤ 0.05), and between pCR vs non-pCRs, over-expression of CXCL9, AREG, B-MYB and under-expression of ABCG2. This study was an integrative analysis of copy number and gene expression using FFPE core biopsies and showed that molecular marker data from FFPE tissues were consistent with those in previous studies using fresh-frozen samples. FFPE tissue can provide

GeneBreak: detection of recurrent DNA copy number aberration-associated chromosomal breakpoints within genes.

PubMed

van den Broek, Evert; van Lieshout, Stef; Rausch, Christian; Ylstra, Bauke; van de Wiel, Mark A; Meijer, Gerrit A; Fijneman, Remond J A; Abeln, Sanne

2016-01-01

Development of cancer is driven by somatic alterations, including numerical and structural chromosomal aberrations. Currently, several computational methods are available and are widely applied to detect numerical copy number aberrations (CNAs) of chromosomal segments in tumor genomes. However, there is lack of computational methods that systematically detect structural chromosomal aberrations by virtue of the genomic location of CNA-associated chromosomal breaks and identify genes that appear non-randomly affected by chromosomal breakpoints across (large) series of tumor samples. 'GeneBreak' is developed to systematically identify genes recurrently affected by the genomic location of chromosomal CNA-associated breaks by a genome-wide approach, which can be applied to DNA copy number data obtained by array-Comparative Genomic Hybridization (CGH) or by (low-pass) whole genome sequencing (WGS). First, 'GeneBreak' collects the genomic locations of chromosomal CNA-associated breaks that were previously pinpointed by the segmentation algorithm that was applied to obtain CNA profiles. Next, a tailored annotation approach for breakpoint-to-gene mapping is implemented. Finally, dedicated cohort-based statistics is incorporated with correction for covariates that influence the probability to be a breakpoint gene. In addition, multiple testing correction is integrated to reveal recurrent breakpoint events. This easy-to-use algorithm, 'GeneBreak', is implemented in R ( www.cran.r-project.org ) and is available from Bioconductor ( www.bioconductor.org/packages/release/bioc/html/GeneBreak.html ).

Punctuated Copy Number Evolution and Clonal Stasis in Triple-Negative Breast Cancer

PubMed Central

Gao, Ruli; Davis, Alexander; McDonald, Thomas O.; Sei, Emi; Shi, Xiuqing; Wang, Yong; Tsai, Pei-Ching; Casasent, Anna; Waters, Jill; Zhang, Hong; Meric-Bernstam, Funda; Michor, Franziska; Navin, Nicholas E.

2016-01-01

Aneuploidy is a hallmark of breast cancer; however, our knowledge of how these complex genomic rearrangements evolve during tumorigenesis is limited. In this study we developed a highly multiplexed single-nucleus-sequencing method to investigate copy number evolution in triple-negative breast cancer patients. We sequenced 1000 single cells from 12 patients and identified 1–3 major clonal subpopulations in each tumor that shared a common evolutionary lineage. We also identified a minor subpopulation of non-clonal cells that were classified as: 1) metastable, 2) pseudo-diploid, or 3) chromazemic. Phylogenetic analysis and mathematical modeling suggest that these data are unlikely to be explained by the gradual accumulation of copy number events over time. In contrast, our data challenge the paradigm of gradual evolution, showing that the majority of copy number aberrations are acquired at the earliest stages of tumor evolution, in short punctuated bursts, followed by stable clonal expansions that form the tumor mass. PMID:27526321

9. Photographic copy enlargement from a 4x5 copy negative. (Original ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

9. Photographic copy enlargement from a 4x5 copy negative. (Original drawing located on abandoned NASA site, currently owned by the City of Downey, Downey, California). 1976 BLDGS.25, 41 SITE PLAN. - NASA Industrial Plant, Storage Facility, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

Identification of multiple serine to asparagine sequence variation sites in an intended copy product of LUCENTIS® by mass spectrometry.

PubMed

Griaud, François; Winter, Andrej; Denefeld, Blandine; Lang, Manuel; Hensinger, Héloïse; Straube, Frank; Sackewitz, Mirko; Berg, Matthias

Patent expiration of first-generation biologics and the high cost of innovative biologics are 2 drivers for the development of biosimilar products. There are, however, technical challenges to the production of exact copies of such large molecules. In this study, we performed a head-to-head comparison between the originator anti-VEGF-A Fab product LUCENTIS® (ranibizumab) and an intended copy product using an integrated analytical approach. While no differences could be observed using size-exclusion chromatography, capillary electrophoresis-sodium dodecyl sulfate and potency assays, different acidic peaks were identified with cation ion exchange chromatography and capillary zone electrophoresis. Further investigation of the intact Fab, subunits and primary sequence with mass spectrometry demonstrated the presence of a modified light chain variant in the intended copy product batches. This variant was characterized with a mass increase of 27.01 Da compared to the originator sequence and its abundance was estimated in the range of 6-9% of the intended copy product light chain. MS/MS spectra interrogation confirmed that this modification relates to a serine to asparagine sequence variant found in the intended copy product light chain. We demonstrated that the integration of high-resolution and sensitive orthogonal technologies was beneficial to assess the similarity of an originator and an intended copy product.

Event-specific real-time detection and quantification of genetically modified Roundup Ready soybean.

PubMed

Huang, Chia-Chia; Pan, Tzu-Ming

2005-05-18

The event-specific real-time detection and quantification of Roundup Ready soybean (RRS) using an ABI PRISM 7700 sequence detection system with light upon extension (LUX) primer was developed in this study. The event-specific primers were designed, targeting the junction of the RRS 5' integration site and the endogenous gene lectin1. Then, a standard reference plasmid was constructed that carried both of the targeted sequences for quantitative analysis. The detection limit of the LUX real-time PCR system was 0.05 ng of 100% RRS genomic DNA, which was equal to 20.5 copies. The range of quantification was from 0.1 to 100%. The sensitivity and range of quantification successfully met the requirement of the labeling rules in the European Union and Taiwan.

Application of droplet digital PCR to determine copy number of endogenous genes and transgenes in sugarcane.

PubMed

Sun, Yue; Joyce, Priya Aiyar

2017-11-01

Droplet digital PCR combined with the low copy ACT allele as endogenous reference gene, makes accurate and rapid estimation of gene copy number in Q208 A and Q240 A attainable. Sugarcane is an important cultivated crop with both high polyploidy and aneuploidy in its 10 Gb genome. Without a known copy number reference gene, it is difficult to accurately estimate the copy number of any gene of interest by PCR-based methods in sugarcane. Recently, a new technology, known as droplet digital PCR (ddPCR) has been developed which can measure the absolute amount of the target DNA in a given sample. In this study, we deduced the true copy number of three endogenous genes, actin depolymerizing factor (ADF), adenine phosphoribosyltransferase (APRT) and actin (ACT) in three Australian sugarcane varieties, using ddPCR by comparing the absolute amounts of the above genes with a transgene of known copy number. A single copy of the ACT allele was detected in Q208 A , two copies in Q240 A , but was absent in Q117. Copy number variation was also observed for both APRT and ADF, and ranged from 9 to 11 in the three tested varieties. Using this newly developed ddPCR method, transgene copy number was successfully determined in 19 transgenic Q208 A and Q240 A events using ACT as the reference endogenous gene. Our study demonstrates that ddPCR can be used for high-throughput genetic analysis and is a quick, accurate and reliable alternative method for gene copy number determination in sugarcane. This discovered ACT allele would be a suitable endogenous reference gene for future gene copy number variation and dosage studies of functional genes in Q208 A and Q240 A .

Non-fluent speech following stroke is caused by impaired efference copy.

PubMed

Feenaughty, Lynda; Basilakos, Alexandra; Bonilha, Leonardo; den Ouden, Dirk-Bart; Rorden, Chris; Stark, Brielle; Fridriksson, Julius

2017-09-01

Efference copy is a cognitive mechanism argued to be critical for initiating and monitoring speech: however, the extent to which breakdown of efference copy mechanisms impact speech production is unclear. This study examined the best mechanistic predictors of non-fluent speech among 88 stroke survivors. Objective speech fluency measures were subjected to a principal component analysis (PCA). The primary PCA factor was then entered into a multiple stepwise linear regression analysis as the dependent variable, with a set of independent mechanistic variables. Participants' ability to mimic audio-visual speech ("speech entrainment response") was the best independent predictor of non-fluent speech. We suggest that this "speech entrainment" factor reflects integrity of internal monitoring (i.e., efference copy) of speech production, which affects speech initiation and maintenance. Results support models of normal speech production and suggest that therapy focused on speech initiation and maintenance may improve speech fluency for individuals with chronic non-fluent aphasia post stroke.

Geophysical events

NASA Astrophysics Data System (ADS)

This is a summary of SEAN Bulletin, 13(2), February 29, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-002 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $ 1.

10 CFR 73.71 - Reporting of safeguards events.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 10 Energy 2 2014-01-01 2014-01-01 false Reporting of safeguards events. 73.71 Section 73.71 Energy... § 73.71 Reporting of safeguards events. (a)(1) Each licensee subject to the provisions of §§ 73.25, 73... revised information. Each licensee shall maintain a copy of the written report of an event submitted under...

10 CFR 73.71 - Reporting of safeguards events.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 10 Energy 2 2012-01-01 2012-01-01 false Reporting of safeguards events. 73.71 Section 73.71 Energy... § 73.71 Reporting of safeguards events. (a)(1) Each licensee subject to the provisions of §§ 73.25, 73... revised information. Each licensee shall maintain a copy of the written report of an event submitted under...

10 CFR 73.71 - Reporting of safeguards events.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 10 Energy 2 2013-01-01 2013-01-01 false Reporting of safeguards events. 73.71 Section 73.71 Energy... § 73.71 Reporting of safeguards events. (a)(1) Each licensee subject to the provisions of §§ 73.25, 73... revised information. Each licensee shall maintain a copy of the written report of an event submitted under...

15. Photographic copy englargement from a 4x5 copy negative (Original ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

15. Photographic copy englargement from a 4x5 copy negative (Original drawing located on abandoned NASA site, currently owned by the City of Downey, Downey, California). 1980 BLDG 10, BLDG 42 FLOOR PLAN, NASA MARCH 15 1980. - NASA Industrial Plant, Maintenance Facility, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

7 CFR 97.179 - Copies and certified copies.

Code of Federal Regulations, 2010 CFR

2010-01-01

..., Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) COMMODITY LABORATORY TESTING PROGRAMS..., copies of applications, certificates, or of any records, books, papers, drawings, or photographs in the...

Chemiluminescent Detection for Estimating Relative Copy Numbers of Porcine Endogenous Retrovirus Proviruses from Chinese Minipigs Based on Magnetic Nanoparticles.

PubMed

Yang, Haowen; Liu, Ming; Zhou, Bingcong; Deng, Yan; He, Nongyue; Jiang, Hesheng; Guo, Yafen; Lan, Ganqiu; Jiang, Qinyang; Yang, Xiurong; Li, Zhiyang

2016-06-01

Chinese Bama minipigs could be potential donors for the supply of xenografts because they are genetically stable, highly inbred, and inexpensive. However, porcine endogenous retrovirus (PERV) is commonly integrated in pig genomes and could cause a cross-species infection by xenotransplantation. For screening out the pigs with low copy numbers of PERV proviruses, we have developed a novel semiquantitative analysis approach based on magnetic nanoparticles (MNPs) and chemiluminescence (CL) for estimating relative copy numbers (RCNs) of PERV proviruses in Chinese Bama minipigs. The CL intensities of PERV proviruses and the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were respectively determined with this method, and the RCNs of PERV proviruses were calculated by the equation: RCN of PERV provirus = CL intensity of PERV provirus/CL intensity of GAPDH. The results showed that PERVs were integrated in the genomes of Bama minipigs at different copy numbers, and the copy numbers of PERV-C subtype were greatly low. Two Bama minipigs with low copy numbers of PERV proviruses were detected out and could be considered as xenograft donor candidates. Although only semiquantitation can be achieved, this approach has potential for screening out safe and suitable pig donors for xenotransplantation.

23. Photographic copy enlargement from a 4x5 copy negative of ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

23. Photographic copy enlargement from a 4x5 copy negative of a drawing (Original drawing located on abandoned NASA site, currently owned by the City of Downey, Downey, Calfornia). JANUARY 1960 USAF PLANT 16 MASTER PLOT AND GRID PLAN. - NASA Industrial Plant, Missile Research Laboratory, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

14. Photographic copy englargement from a 4x5 copy negative (Original ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

14. Photographic copy englargement from a 4x5 copy negative (Original photograph by original photographer located on abandoned NASA site, currently owned by the City of Downey, Downey, California). AERIAL PHOTOGRAPH 1935-1936 CONSOLIDATED VULTEE AIRCRAFT CORPORATION FROM WEST TO EAST - NASA Industrial Plant, Maintenance Facility, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

22. Photographic copy enlargement from a 4x5 copy negative of ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

22. Photographic copy enlargement from a 4x5 copy negative of a print. (Original print located on abandoned NASA site, currently owned by the City of Downey, Downey, California). 1954 USAF PLANT 16 AERIAL BUILDING 41 NORTH TO SOUTH. - NASA Industrial Plant, Missile Research Laboratory, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

Esthetic Rehabilitation of Anterior Teeth with Copy-Milled Restorations: A Report of Two Cases.

PubMed

Rani, Sapna; Devi, Jyoti; Jain, Chandan; Mutneja, Parul; Verma, Mahesh

2017-01-01

Digitalization has become part and parcel of contemporary prosthodontics with the probability of most of the procedures being based on the digital techniques in the near future. This digital revolution started in the latter half of the 20th century by converting analog objects/signals into digital bits and bytes. Recent developments in all-ceramic materials and systems of computer-aided designing and computer-aided manufacturing (CAD/CAM), copy milling, and so forth offer excellent esthetics and superb biocompatibility. Copy milling system for ceramics enables milling of the zirconia cores of all-ceramic restorations precisely and also if this system is properly used the procedure for fabricating all-ceramic restorations can be substantially simplified. This case report presents fabrication of all-ceramic Maryland Bridge and post-core with a copy milling system for esthetics and preservation of integrity of tooth. For both of the patients, the use of biologic, all-ceramic, copy-milled restorations resulted in clinical success and recovered function and esthetics.

Esthetic Rehabilitation of Anterior Teeth with Copy-Milled Restorations: A Report of Two Cases

PubMed Central

Jain, Chandan; Mutneja, Parul; Verma, Mahesh

2017-01-01

Digitalization has become part and parcel of contemporary prosthodontics with the probability of most of the procedures being based on the digital techniques in the near future. This digital revolution started in the latter half of the 20th century by converting analog objects/signals into digital bits and bytes. Recent developments in all-ceramic materials and systems of computer-aided designing and computer-aided manufacturing (CAD/CAM), copy milling, and so forth offer excellent esthetics and superb biocompatibility. Copy milling system for ceramics enables milling of the zirconia cores of all-ceramic restorations precisely and also if this system is properly used the procedure for fabricating all-ceramic restorations can be substantially simplified. This case report presents fabrication of all-ceramic Maryland Bridge and post-core with a copy milling system for esthetics and preservation of integrity of tooth. For both of the patients, the use of biologic, all-ceramic, copy-milled restorations resulted in clinical success and recovered function and esthetics. PMID:28326203

Heavy-ion induced single-event upset in integrated circuits

NASA Technical Reports Server (NTRS)

Zoutendyk, J. A.

1991-01-01

The cosmic ray environment in space can affect the operation of Integrated Circuit (IC) devices via the phenomenon of Single Event Upset (SEU). In particular, heavy ions passing through an IC can induce sufficient integrated current (charge) to alter the state of a bistable circuit, for example a memory cell. The SEU effect is studied in great detail in both static and dynamic memory devices, as well as microprocessors fabricated from bipolar, Complementary Metal Oxide Semiconductor (CMOS) and N channel Metal Oxide Semiconductor (NMOS) technologies. Each device/process reflects its individual characteristics (minimum scale geometry/process parameters) via a unique response to the direct ionization of electron hole pairs by heavy ion tracks. A summary of these analytical and experimental SEU investigations is presented.

Patterns, correlates, and reduction of homework copying

NASA Astrophysics Data System (ADS)

Palazzo, David J.; Lee, Young-Jin; Warnakulasooriya, Rasil; Pritchard, David E.

2010-06-01

Submissions to an online homework tutor were analyzed to determine whether they were copied. The fraction of copied submissions increased rapidly over the semester, as each weekly deadline approached and for problems later in each assignment. The majority of students, who copied less than 10% of their problems, worked steadily over the three days prior to the deadline, whereas repetitive copiers (those who copied >30% of their submitted problems) exerted little effort early. Importantly, copying homework problems that require an analytic answer correlates with a 2(σ) decline over the semester in relative score for similar problems on exams but does not significantly correlate with the amount of conceptual learning as measured by pretesting and post-testing. An anonymous survey containing questions used in many previous studies of self-reported academic dishonesty showed ˜1/3 less copying than actually was detected. The observed patterns of copying, free response questions on the survey, and interview data suggest that time pressure on students who do not start their homework in a timely fashion is the proximate cause of copying. Several measures of initial ability in math or physics correlated with copying weakly or not at all. Changes in course format and instructional practices that previous self-reported academic dishonesty surveys and/or the observed copying patterns suggested would reduce copying have been accompanied by more than a factor of 4 reduction of copying from ˜11% of all electronic problems to less than 3%. As expected (since repetitive copiers have approximately three times the chance of failing), this was accompanied by a reduction in the overall course failure rate. Survey results indicate that students copy almost twice as much written homework as online homework and show that students nationally admit to more academic dishonesty than MIT students.

48 CFR 3401.104-3 - Copies.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Copies. 3401.104-3 Section 3401.104-3 Federal Acquisition Regulations System DEPARTMENT OF EDUCATION ACQUISITION REGULATION GENERAL ED ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 3401.104-3 Copies. Copies of the...

Sampled-data consensus in switching networks of integrators based on edge events

NASA Astrophysics Data System (ADS)

Xiao, Feng; Meng, Xiangyu; Chen, Tongwen

2015-02-01

This paper investigates the event-driven sampled-data consensus in switching networks of multiple integrators and studies both the bidirectional interaction and leader-following passive reaction topologies in a unified framework. In these topologies, each information link is modelled by an edge of the information graph and assigned a sequence of edge events, which activate the mutual data sampling and controller updates of the two linked agents. Two kinds of edge-event-detecting rules are proposed for the general asynchronous data-sampling case and the synchronous periodic event-detecting case. They are implemented in a distributed fashion, and their effectiveness in reducing communication costs and solving consensus problems under a jointly connected topology condition is shown by both theoretical analysis and simulation examples.

The Landscape of Somatic Chromosomal Copy Number Aberrations in GEM Models of Prostate Carcinoma

PubMed Central

Bianchi-Frias, Daniella; Hernandez, Susana A.; Coleman, Roger; Wu, Hong; Nelson, Peter S.

2015-01-01

Human prostate cancer (PCa) is known to harbor recurrent genomic aberrations consisting of chromosomal losses, gains, rearrangements and mutations that involve oncogenes and tumor suppressors. Genetically engineered mouse (GEM) models have been constructed to assess the causal role of these putative oncogenic events and provide molecular insight into disease pathogenesis. While GEM models generally initiate neoplasia by manipulating a single gene, expression profiles of GEM tumors typically comprise hundreds of transcript alterations. It is unclear whether these transcriptional changes represent the pleiotropic effects of single oncogenes, and/or cooperating genomic or epigenomic events. Therefore, it was determined if structural chromosomal alterations occur in GEM models of PCa and whether the changes are concordant with human carcinomas. Whole genome array-based comparative genomic hybridization (CGH) was used to identify somatic chromosomal copy number aberrations (SCNAs) in the widely used TRAMP, Hi-Myc, Pten-null and LADY GEM models. Interestingly, very few SCNAs were identified and the genomic architecture of Hi-Myc, Pten-null and LADY tumors were essentially identical to the germline. TRAMP neuroendocrine carcinomas contained SCNAs, which comprised three recurrent aberrations including a single copy loss of chromosome 19 (encoding Pten). In contrast, cell lines derived from the TRAMP, Hi-Myc, and Pten-null tumors were notable for numerous SCNAs that included copy gains of chromosome 15 (encoding Myc) and losses of chromosome 11 (encoding p53). PMID:25298407

Molecular Inversion Probe Analysis of Gene Copy Alterations Reveals Distinct Categories of Colorectal Carcinoma

PubMed Central

Ji, Hanlee; Kumm, Jochen; Zhang, Michael; Farnam, Kyle; Salari, Keyan; Faham, Malek; Ford, James M.; Davis, Ronald W.

2006-01-01

Genomic instability is a major feature of neoplastic development in colorectal carcinoma and other cancers. Specific genomic instability events, such as deletions in chromosomes and other alterations in gene copy number, have potential utility as biologically relevant prognostic biomarkers. For example, genomic deletions on chromosome arm 18q are an indicator of colorectal carcinoma behavior and potentially useful as a prognostic indicator. Adapting a novel genomic technology called molecular inversion probes which can determine gene copy alterations, such as genomic deletions, we designed a set of probes to interrogate several hundred individual exons of >200 cancer genes with an overall distribution covering all chromosome arms. In addition, >100 probes were designed in close proximity of microsatellite markers on chromosome arm 18q. We analyzed a set of colorectal carcinoma cell lines and primary colorectal tumor samples for gene copy alterations and deletion mutations in exons. Based on clustering analysis, we distinguished the different categories of genomic instability among the colorectal cancer cell lines. Our analysis of primary tumors uncovered several distinct categories of colorectal carcinoma, each with specific patterns of 18q deletions and deletion mutations in specific genes. This finding has potential clinical ramifications given the application of 18q loss of heterozygosity events as a potential indicator for adjuvant treatment in stage II colorectal carcinoma. PMID:16912164

48 CFR 1301.105-3 - Copies.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Copies. 1301.105-3 Section 1301.105-3 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE GENERAL DEPARTMENT OF COMMERCE ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 1301.105-3 Copies. (a) Copies of the CAR in...

22 CFR 401.13 - Copies required.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Copies required. 401.13 Section 401.13 Foreign Relations INTERNATIONAL JOINT COMMISSION, UNITED STATES AND CANADA RULES OF PROCEDURE Applications § 401.13 Copies required. (a) Subject to paragraph (c) of this section, two duplicate originals and fifty copies...

Genome-Wide Copy Number Variation Association Analyses for Age at Menarche

PubMed Central

Li, Jian; Pan, Rong; Shen, Hui; Tian, Qing; Zhou, Yu; Liu, Yong-Jun

2012-01-01

Context: Menarche is a significant physiological event for women. Age at menarche (AAM) is a heritable trait associated with many common female diseases. The genetic basis and the mechanism for AAM are largely unknown. Copy number variation (CNV) is a common type of genetic variation underlying human complex traits. The importance of CNV to AAM variation is unclear. Objective: The objective of the study was to identify CNV important to AAM variation. Design: We performed the first genome-wide CNV study of AAM in 1654 Caucasian females using Affymetrix human single-nucleotide polymorphism 6.0 array. We also replicated our findings in another Chinese cohort containing 752 women. Results: We identified a CNV, variation_38399, in the 2q14.2 region, for association with AAM (P = 1.03 × 10−3). The CNV has two variants (one copy and two copy), with a mean AAM of 14.00 yr and 12.90 yr, respectively. Interestingly, in a Chinese sample containing 752 women, this CNV has been replicated both with a marginally significant P = 0.090 and with a same direction of effect (a lower copy number for a later AAM). The CNV is located approximately 75 kb upstream of the diazepam binding inhibitor (DBI), a gene known to regulate estrogen levels, a key factor for menarche. Conclusion: Our findings for the first time identified a novel CNV and suggested the DBI-mediated endocrinological pathway as a potential mechanism for AAM regulation. PMID:22904172

Zero-Copy Objects System

NASA Technical Reports Server (NTRS)

Burleigh, Scott C.

2011-01-01

Zero-Copy Objects System software enables application data to be encapsulated in layers of communication protocol without being copied. Indirect referencing enables application source data, either in memory or in a file, to be encapsulated in place within an unlimited number of protocol headers and/or trailers. Zero-copy objects (ZCOs) are abstract data access representations designed to minimize I/O (input/output) in the encapsulation of application source data within one or more layers of communication protocol structure. They are constructed within the heap space of a Simple Data Recorder (SDR) data store to which all participating layers of the stack must have access. Each ZCO contains general information enabling access to the core source data object (an item of application data), together with (a) a linked list of zero or more specific extents that reference portions of this source data object, and (b) linked lists of protocol header and trailer capsules. The concatenation of the headers (in ascending stack sequence), the source data object extents, and the trailers (in descending stack sequence) constitute the transmitted data object constructed from the ZCO. This scheme enables a source data object to be encapsulated in a succession of protocol layers without ever having to be copied from a buffer at one layer of the protocol stack to an encapsulating buffer at a lower layer of the stack. For large source data objects, the savings in copy time and reduction in memory consumption may be considerable.

14 CFR 187.7 - Copies; seal.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 14 Aeronautics and Space 3 2011-01-01 2011-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents and for affixation of the seal for a certification or validation are the same as those provided in subpart...

14 CFR 187.7 - Copies; seal.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents and for affixation of the seal for a certification or validation are the same as those provided in subpart...

Copy number analysis reveals a novel multiexon deletion of the COLQ gene in congenital myasthenia.

PubMed

Wang, Wei; Wu, Yanhong; Wang, Chen; Jiao, Jinsong; Klein, Christopher J

2016-12-01

Congenital myasthenic syndrome (CMS) is genetically and clinically heterogeneous. 1 Despite a considerable number of causal genes discovered, many patients are left without a specific diagnosis after genetic testing. The presumption is that novel genes yet to be discovered will account for the majority of such patients. However, it is also possible that we are neglecting a type of genetic variation: copy number changes (>50 bp) as causal for some of these patients. Next-generation sequencing (NGS) can simultaneously screen all known causal genes 2 and is increasingly being validated to have a potential to identify copy number changes. 3 We present a CMS case who did not receive a genetic diagnosis from previous Sanger sequencing, but through a novel copy number analysis algorithm integrated into our targeted NGS panel, we discovered a novel copy number mutation in the COLQ gene and made a genetic diagnosis. This discovery expands the genotype-phenotype correlation of CMS, leads to improved genetic counsel, and allows for specific pharmacologic treatment. 1 .

Multiple-copy entanglement transformation and entanglement catalysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duan Runyao; Feng Yuan; Li Xin

2005-04-01

We prove that any multiple-copy entanglement transformation [S. Bandyopadhyay, V. Roychowdhury, and U. Sen, Phys. Rev. A 65, 052315 (2002)] can be implemented by a suitable entanglement-assisted local transformation [D. Jonathan and M. B. Plenio, Phys. Rev. Lett. 83, 3566 (1999)]. Furthermore, we show that the combination of multiple-copy entanglement transformation and the entanglement-assisted one is still equivalent to the pure entanglement-assisted one. The mathematical structure of multiple-copy entanglement transformations then is carefully investigated. Many interesting properties of multiple-copy entanglement transformations are presented, which exactly coincide with those satisfied by the entanglement-assisted ones. Most interestingly, we show that an arbitrarilymore » large number of copies of state should be considered in multiple-copy entanglement transformations.« less

COPI selectively drives maturation of the early Golgi

PubMed Central

Papanikou, Effrosyni; Day, Kasey J; Austin, Jotham; Glick, Benjamin S

2015-01-01

COPI coated vesicles carry material between Golgi compartments, but the role of COPI in the secretory pathway has been ambiguous. Previous studies of thermosensitive yeast COPI mutants yielded the surprising conclusion that COPI was dispensable both for the secretion of certain proteins and for Golgi cisternal maturation. To revisit these issues, we optimized the anchor-away method, which allows peripheral membrane proteins such as COPI to be sequestered rapidly by adding rapamycin. Video fluorescence microscopy revealed that COPI inactivation causes an early Golgi protein to remain in place while late Golgi proteins undergo cycles of arrival and departure. These dynamics generate partially functional hybrid Golgi structures that contain both early and late Golgi proteins, explaining how secretion can persist when COPI has been inactivated. Our findings suggest that cisternal maturation involves a COPI-dependent pathway that recycles early Golgi proteins, followed by multiple COPI-independent pathways that recycle late Golgi proteins. DOI: http://dx.doi.org/10.7554/eLife.13232.001 PMID:26709839

COPI selectively drives maturation of the early Golgi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Papanikou, Effrosyni; Day, Kasey J.; Austin, II, Jotham

COPI coated vesicles carry material between Golgi compartments, but the role of COPI in the secretory pathway has been ambiguous. Previous studies of thermosensitive yeast COPI mutants yielded the surprising conclusion that COPI was dispensable both for the secretion of certain proteins and for Golgi cisternal maturation. To revisit these issues, we optimized the anchor-away method, which allows peripheral membrane proteins such as COPI to be sequestered rapidly by adding rapamycin. Video fluorescence microscopy revealed that COPI inactivation causes an early Golgi protein to remain in place while late Golgi proteins undergo cycles of arrival and departure. These dynamics generatemore » partially functional hybrid Golgi structures that contain both early and late Golgi proteins, explaining how secretion can persist when COPI has been inactivated. Lastly, our findings suggest that cisternal maturation involves a COPI-dependent pathway that recycles early Golgi proteins, followed by multiple COPI-independent pathways that recycle late Golgi proteins.« less

COPI selectively drives maturation of the early Golgi

DOE PAGES

Papanikou, Effrosyni; Day, Kasey J.; Austin, II, Jotham; ...

2015-12-28

COPI coated vesicles carry material between Golgi compartments, but the role of COPI in the secretory pathway has been ambiguous. Previous studies of thermosensitive yeast COPI mutants yielded the surprising conclusion that COPI was dispensable both for the secretion of certain proteins and for Golgi cisternal maturation. To revisit these issues, we optimized the anchor-away method, which allows peripheral membrane proteins such as COPI to be sequestered rapidly by adding rapamycin. Video fluorescence microscopy revealed that COPI inactivation causes an early Golgi protein to remain in place while late Golgi proteins undergo cycles of arrival and departure. These dynamics generatemore » partially functional hybrid Golgi structures that contain both early and late Golgi proteins, explaining how secretion can persist when COPI has been inactivated. Lastly, our findings suggest that cisternal maturation involves a COPI-dependent pathway that recycles early Golgi proteins, followed by multiple COPI-independent pathways that recycle late Golgi proteins.« less

Chopping Copy.

ERIC Educational Resources Information Center

Bush, Don

1994-01-01

Discusses ways an editor can cut out words to help the reader understand quickly. Discusses dead wood, redundancy, redundancy in thought, smothered verbs, false precision, editing and academia, and making copy smoother. (SR)

Conceptual Integration of Arithmetic Operations with Real-World Knowledge: Evidence from Event-Related Potentials

ERIC Educational Resources Information Center

Guthormsen, Amy M.; Fisher, Kristie J.; Bassok, Miriam; Osterhout, Lee; DeWolf, Melissa; Holyoak, Keith J.

2016-01-01

Research on language processing has shown that the disruption of conceptual integration gives rise to specific patterns of event-related brain potentials (ERPs)--N400 and P600 effects. Here, we report similar ERP effects when adults performed cross-domain conceptual integration of analogous semantic and mathematical relations. In a problem-solving…

A New Integrated Threshold Selection Methodology for Spatial Forecast Verification of Extreme Events

NASA Astrophysics Data System (ADS)

Kholodovsky, V.

2017-12-01

Extreme weather and climate events such as heavy precipitation, heat waves and strong winds can cause extensive damage to the society in terms of human lives and financial losses. As climate changes, it is important to understand how extreme weather events may change as a result. Climate and statistical models are often independently used to model those phenomena. To better assess performance of the climate models, a variety of spatial forecast verification methods have been developed. However, spatial verification metrics that are widely used in comparing mean states, in most cases, do not have an adequate theoretical justification to benchmark extreme weather events. We proposed a new integrated threshold selection methodology for spatial forecast verification of extreme events that couples existing pattern recognition indices with high threshold choices. This integrated approach has three main steps: 1) dimension reduction; 2) geometric domain mapping; and 3) thresholds clustering. We apply this approach to an observed precipitation dataset over CONUS. The results are evaluated by displaying threshold distribution seasonally, monthly and annually. The method offers user the flexibility of selecting a high threshold that is linked to desired geometrical properties. The proposed high threshold methodology could either complement existing spatial verification methods, where threshold selection is arbitrary, or be directly applicable in extreme value theory.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Quantifying integrated SIV-DNA by repetitive-sampling Alu-gag PCR.

PubMed

Mavigner, Maud; Lee, S Thera; Habib, Jakob; Robinson, Cameron; Silvestri, Guido; O'Doherty, Una; Chahroudi, Ann

2016-10-05

Although antiretroviral therapy (ART) effectively suppresses HIV-1 replication, it does not eradicate the virus and ART interruption consistently results in rebound of viraemia, demonstrating the persistence of a long-lived viral reservoir. Several approaches aimed at reducing virus persistence are being developed, and accurate measurements of the latent reservoir (LR) are necessary to assess the effectiveness of anti-latency interventions. We sought to measure the LR in SIV/SHIV-infected rhesus macaques (RMs) by quantifying integrated SIV-DNA. We optimised a repetitive sampling Alu-gag PCR to quantify integrated SIV-DNA ex vivo in ART-naïve and ART-experienced SIV/SHIV-infected RMs. In ART-naïve RMs, we found the median level of integrated SIV-DNA to be 1660 copies and 866 copies per million PBMC during untreated acute and chronic SHIV infection, respectively. Integrated and total SIV-DNA levels were positively correlated with one another. In ART-treated RMs, integrated SIV-DNA was readily detected in lymph nodes and spleen and levels of total (3319 copies/million cells) and integrated (3160 copies/million cells) SIV-DNA were similar after a median of 404 days of ART. In peripheral blood CD4+ T cells from ART-treated RMs, levels of total (3319 copies/million cells) and integrated (2742 copies/million cells) SIV-DNA were not significantly different and were positively correlated. The assay described here is validated and can be used in interventional studies testing HIV/SIV cure strategies in RMs. Measurement of integrated SIV-DNA in ART-treated RMs, along with other reservoir analyses, gives an estimate of the size of the LR.

rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants

PubMed Central

Kwan, Elizabeth X.; Wang, Xiaobin S.; Amemiya, Haley M.; Brewer, Bonita J.; Raghuraman, M. K.

2016-01-01

The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. PMID:27449518

rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants.

PubMed

Kwan, Elizabeth X; Wang, Xiaobin S; Amemiya, Haley M; Brewer, Bonita J; Raghuraman, M K

2016-09-08

The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. Copyright © 2016 Kwan et al.

Practical method for appearance match between soft copy and hard copy

NASA Astrophysics Data System (ADS)

Katoh, Naoya

1994-04-01

CRT monitors are often used as a soft proofing device for the hard copy image output. However, what the user sees on the monitor does not match its output, even if the monitor and the output device are calibrated with CIE/XYZ or CIE/Lab. This is especially obvious when correlated color temperature (CCT) of CRT monitor's white point significantly differs from ambient light. In a typical office environment, one uses a computer graphic monitor having a CCT of 9300K in a room of white fluorescent light of 4150K CCT. In such a case, human visual system is partially adapted to the CRT monitor's white point and partially to the ambient light. The visual experiments were performed on the effect of the ambient lighting. Practical method for soft copy color reproduction that matches the hard copy image in appearance is presented in this paper. This method is fundamentally based on a simple von Kries' adaptation model and takes into account the human visual system's partial adaptation and contrast matching.

Integrating natural language processing expertise with patient safety event review committees to improve the analysis of medication events.

PubMed

Fong, Allan; Harriott, Nicole; Walters, Donna M; Foley, Hanan; Morrissey, Richard; Ratwani, Raj R

2017-08-01

Many healthcare providers have implemented patient safety event reporting systems to better understand and improve patient safety. Reviewing and analyzing these reports is often time consuming and resource intensive because of both the quantity of reports and length of free-text descriptions in the reports. Natural language processing (NLP) experts collaborated with clinical experts on a patient safety committee to assist in the identification and analysis of medication related patient safety events. Different NLP algorithmic approaches were developed to identify four types of medication related patient safety events and the models were compared. Well performing NLP models were generated to categorize medication related events into pharmacy delivery delays, dispensing errors, Pyxis discrepancies, and prescriber errors with receiver operating characteristic areas under the curve of 0.96, 0.87, 0.96, and 0.81 respectively. We also found that modeling the brief without the resolution text generally improved model performance. These models were integrated into a dashboard visualization to support the patient safety committee review process. We demonstrate the capabilities of various NLP models and the use of two text inclusion strategies at categorizing medication related patient safety events. The NLP models and visualization could be used to improve the efficiency of patient safety event data review and analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

19 CFR 133.42 - Infringing copies or phonorecords.

Code of Federal Regulations, 2010 CFR

2010-04-01

....42 Infringing copies or phonorecords. (a) Definition. Infringing copies or phonorecords are “piratical” articles, i.e., copies or phonorecords which are unlawfully made (without the authorization of... chapter. Lawfully made copies are not subject to seizure and forfeiture by Customs. (d) Disclosure. When...

Integrating Urban Infrastructure and Health System Impact Modeling for Disasters and Mass-Casualty Events

NASA Astrophysics Data System (ADS)

Balbus, J. M.; Kirsch, T.; Mitrani-Reiser, J.

2017-12-01

Over recent decades, natural disasters and mass-casualty events in United States have repeatedly revealed the serious consequences of health care facility vulnerability and the subsequent ability to deliver care for the affected people. Advances in predictive modeling and vulnerability assessment for health care facility failure, integrated infrastructure, and extreme weather events have now enabled a more rigorous scientific approach to evaluating health care system vulnerability and assessing impacts of natural and human disasters as well as the value of specific interventions. Concurrent advances in computing capacity also allow, for the first time, full integration of these multiple individual models, along with the modeling of population behaviors and mass casualty responses during a disaster. A team of federal and academic investigators led by the National Center for Disaster Medicine and Public Health (NCDMPH) is develoing a platform for integrating extreme event forecasts, health risk/impact assessment and population simulations, critical infrastructure (electrical, water, transportation, communication) impact and response models, health care facility-specific vulnerability and failure assessments, and health system/patient flow responses. The integration of these models is intended to develop much greater understanding of critical tipping points in the vulnerability of health systems during natural and human disasters and build an evidence base for specific interventions. Development of such a modeling platform will greatly facilitate the assessment of potential concurrent or sequential catastrophic events, such as a terrorism act following a severe heat wave or hurricane. This presentation will highlight the development of this modeling platform as well as applications not just for the US health system, but also for international science-based disaster risk reduction efforts, such as the Sendai Framework and the WHO SMART hospital project.

Geophysical events

NASA Astrophysics Data System (ADS)

This is a summary of SEAN Bulletin, 13 (1), January 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-001 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $ 1. Subscriptions to SEAN Bulletin are also available from AGU Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid.

Geophysical events

NASA Astrophysics Data System (ADS)

This is a summary of SEAN Bulletin, 13(3), March 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-002 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid.

Copy Counts

ERIC Educational Resources Information Center

Beaumont, Lee R.

1970-01-01

The level of difficulty of straight copy, which is used to measure typewriting speed, is influenced by syllable intensity (the average number of syllables per word), stroke intensity (average number of strokes per word), and high-frequency words. (CH)

GenomeCAT: a versatile tool for the analysis and integrative visualization of DNA copy number variants.

PubMed

Tebel, Katrin; Boldt, Vivien; Steininger, Anne; Port, Matthias; Ebert, Grit; Ullmann, Reinhard

2017-01-06

The analysis of DNA copy number variants (CNV) has increasing impact in the field of genetic diagnostics and research. However, the interpretation of CNV data derived from high resolution array CGH or NGS platforms is complicated by the considerable variability of the human genome. Therefore, tools for multidimensional data analysis and comparison of patient cohorts are needed to assist in the discrimination of clinically relevant CNVs from others. We developed GenomeCAT, a standalone Java application for the analysis and integrative visualization of CNVs. GenomeCAT is composed of three modules dedicated to the inspection of single cases, comparative analysis of multidimensional data and group comparisons aiming at the identification of recurrent aberrations in patients sharing the same phenotype, respectively. Its flexible import options ease the comparative analysis of own results derived from microarray or NGS platforms with data from literature or public depositories. Multidimensional data obtained from different experiment types can be merged into a common data matrix to enable common visualization and analysis. All results are stored in the integrated MySQL database, but can also be exported as tab delimited files for further statistical calculations in external programs. GenomeCAT offers a broad spectrum of visualization and analysis tools that assist in the evaluation of CNVs in the context of other experiment data and annotations. The use of GenomeCAT does not require any specialized computer skills. The various R packages implemented for data analysis are fully integrated into GenomeCATs graphical user interface and the installation process is supported by a wizard. The flexibility in terms of data import and export in combination with the ability to create a common data matrix makes the program also well suited as an interface between genomic data from heterogeneous sources and external software tools. Due to the modular architecture the functionality of

Micro-Scale Genomic DNA Copy Number Aberrations as Another Means of Mutagenesis in Breast Cancer

PubMed Central

Chao, Hann-Hsiang; He, Xiaping; Parker, Joel S.; Zhao, Wei; Perou, Charles M.

2012-01-01

Introduction In breast cancer, the basal-like subtype has high levels of genomic instability relative to other breast cancer subtypes with many basal-like-specific regions of aberration. There is evidence that this genomic instability extends to smaller scale genomic aberrations, as shown by a previously described micro-deletion event in the PTEN gene in the Basal-like SUM149 breast cancer cell line. Methods We sought to identify if small regions of genomic DNA copy number changes exist by using a high density, gene-centric Comparative Genomic Hybridizations (CGH) array on cell lines and primary tumors. A custom tiling array for CGH (244,000 probes, 200 bp tiling resolution) was created to identify small regions of genomic change, which was focused on previously identified basal-like-specific, and general cancer genes. Tumor genomic DNA from 94 patients and 2 breast cancer cell lines was labeled and hybridized to these arrays. Aberrations were called using SWITCHdna and the smallest 25% of SWITCHdna-defined genomic segments were called micro-aberrations (<64 contiguous probes, ∼ 15 kb). Results Our data showed that primary tumor breast cancer genomes frequently contained many small-scale copy number gains and losses, termed micro-aberrations, most of which are undetectable using typical-density genome-wide aCGH arrays. The basal-like subtype exhibited the highest incidence of these events. These micro-aberrations sometimes altered expression of the involved gene. We confirmed the presence of the PTEN micro-amplification in SUM149 and by mRNA-seq showed that this resulted in loss of expression of all exons downstream of this event. Micro-aberrations disproportionately affected the 5′ regions of the affected genes, including the promoter region, and high frequency of micro-aberrations was associated with poor survival. Conclusion Using a high-probe-density, gene-centric aCGH microarray, we present evidence of small-scale genomic aberrations that can contribute to

Copy Number Variation across European Populations

PubMed Central

Chen, Wanting; Hayward, Caroline; Wright, Alan F.; Hicks, Andrew A.; Vitart, Veronique; Knott, Sara; Wild, Sarah H.; Pramstaller, Peter P.; Wilson, James F.; Rudan, Igor; Porteous, David J.

2011-01-01

Genome analysis provides a powerful approach to test for evidence of genetic variation within and between geographical regions and local populations. Copy number variants which comprise insertions, deletions and duplications of genomic sequence provide one such convenient and informative source. Here, we investigate copy number variants from genome wide scans of single nucleotide polymorphisms in three European population isolates, the island of Vis in Croatia, the islands of Orkney in Scotland and the South Tyrol in Italy. We show that whereas the overall copy number variant frequencies are similar between populations, their distribution is highly specific to the population of origin, a finding which is supported by evidence for increased kinship correlation for specific copy number variants within populations. PMID:21829696

33 CFR 72.01-40 - Single copies.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Single copies. 72.01-40 Section 72.01-40 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY AIDS TO NAVIGATION MARINE INFORMATION Notices to Mariners § 72.01-40 Single copies. Single copies of the “Notice to...

33 CFR 72.01-40 - Single copies.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Single copies. 72.01-40 Section 72.01-40 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY AIDS TO NAVIGATION MARINE INFORMATION Notices to Mariners § 72.01-40 Single copies. Single copies of the “Notice to...

Effects of a petunia scaffold/matrix attachment region on copy number dependency and stability of transgene expression in Nicotiana tabacum.

PubMed

Dietz-Pfeilstetter, Antje; Arndt, Nicola; Manske, Ulrike

2016-04-01

Transgenes in genetically modified plants are often not reliably expressed during development or in subsequent generations. Transcriptional gene silencing (TGS) as well as post-transcriptional gene silencing (PTGS) have been shown to occur in transgenic plants depending on integration pattern, copy number and integration site. In an effort to reduce position effects, to prevent read-through transcription and to provide a more accessible chromatin structure, a P35S-ß-glucuronidase (P35S-gus) transgene flanked by a scaffold/matrix attachment region from petunia (Petun-SAR), was introduced in Nicotiana tabacum plants by Agrobacterium tumefaciens mediated transformation. It was found that Petun-SAR mediates enhanced expression and copy number dependency up to 2 gene copies, but did not prevent gene silencing in transformants with multiple and rearranged gene copies. However, in contrast to the non-SAR transformants where silencing was irreversible and proceeded during long-term vegetative propagation and in progeny plants, gus expression in Petun-SAR plants was re-established in the course of development. Gene silencing was not necessarily accompanied by DNA methylation, while the gus transgene could still be expressed despite considerable CG methylation within the coding region.

Sounds can boost the awareness of visual events through attention without cross-modal integration.

PubMed

Pápai, Márta Szabina; Soto-Faraco, Salvador

2017-01-31

Cross-modal interactions can lead to enhancement of visual perception, even for visual events below awareness. However, the underlying mechanism is still unclear. Can purely bottom-up cross-modal integration break through the threshold of awareness? We used a binocular rivalry paradigm to measure perceptual switches after brief flashes or sounds which, sometimes, co-occurred. When flashes at the suppressed eye coincided with sounds, perceptual switches occurred the earliest. Yet, contrary to the hypothesis of cross-modal integration, this facilitation never surpassed the assumption of probability summation of independent sensory signals. A follow-up experiment replicated the same pattern of results using silent gaps embedded in continuous noise, instead of sounds. This manipulation should weaken putative sound-flash integration, although keep them salient as bottom-up attention cues. Additional results showed that spatial congruency between flashes and sounds did not determine the effectiveness of cross-modal facilitation, which was again not better than probability summation. Thus, the present findings fail to fully support the hypothesis of bottom-up cross-modal integration, above and beyond the independent contribution of two transient signals, as an account for cross-modal enhancement of visual events below level of awareness.

How best practices are copied, transferred, or translated between health care facilities: A conceptual framework.

PubMed

Guzman, Gustavo; Fitzgerald, Janna Anneke; Fulop, Liz; Hayes, Kathryn; Poropat, Arthur; Avery, Mark; Campbell, Steve; Fisher, Ron; Gapp, Rod; Herington, Carmel; McPhail, Ruth; Vecchio, Nerina

2015-01-01

In spite of significant investment in quality programs and activities, there is a persistent struggle to achieve quality outcomes and performance improvements within the constraints and support of sociopolitical parsimonies. Equally, such constraints have intensified the need to better understand the best practice methods for achieving quality improvements in health care organizations over time.This study proposes a conceptual framework to assist with strategies for the copying, transferring, and/or translation of best practice between different health care facilities. Applying a deductive logic, the conceptual framework was developed by blending selected theoretical lenses drawn from the knowledge management and organizational learning literatures. The proposed framework highlighted that (a) major constraints need to be addressed to turn best practices into everyday practices and (b) double-loop learning is an adequate learning mode to copy and to transfer best practices and deuteron learning mode is a more suitable learning mode for translating best practice. We also found that, in complex organizations, copying, transferring, and translating new knowledge is more difficult than in smaller, less complex organizations. We also posit that knowledge translation cannot happen without transfer and copy, and transfer cannot happen without copy of best practices. Hence, an integration of all three learning processes is required for knowledge translation (copy best practice-transfer knowledge about best practice-translation of best practice into new context). In addition, the higher the level of complexity of the organization, the more best practice is tacit oriented and, in this case, the higher the level of K&L capabilities are required to successfully copy, transfer, and/or translate best practices between organizations. The approach provides a framework for assessing organizational context and capabilities to guide copy/transfer/translation of best practices. A

36 CFR 1290.6 - Originals and copies.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Originals and copies. 1290.6... ASSASSINATION RECORDS COLLECTION ACT OF 1992 (JFK ACT) § 1290.6 Originals and copies. (a) For purposes of determining whether originals or copies of assassination records will be made part of the President John F...

40 CFR 262.22 - Number of copies.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 26 2011-07-01 2011-07-01 false Number of copies. 262.22 Section 262...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner...

40 CFR 262.22 - Number of copies.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 27 2012-07-01 2012-07-01 false Number of copies. 262.22 Section 262...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner...

40 CFR 262.22 - Number of copies.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Number of copies. 262.22 Section 262...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner...

COPI Is Required for Enterovirus 71 Replication

PubMed Central

Wang, Jianmin; Wu, Zhiqiang; Jin, Qi

2012-01-01

Enterovirus 71 (EV71), a member of the Picornaviridae family, is found in Asian countries where it causes a wide range of human diseases. No effective therapy is available for the treatment of these infections. Picornaviruses undergo RNA replication in association with membranes of infected cells. COPI and COPII have been shown to be involved in the formation of picornavirus-induced vesicles. Replication of several picornaviruses, including poliovirus and Echovirus 11 (EV11), is dependent on COPI or COPII. Here, we report that COPI, but not COPII, is required for EV71 replication. Replication of EV71 was inhibited by brefeldin A and golgicide A, inhibitors of COPI activity. Furthermore, we found EV71 2C protein interacted with COPI subunits by co-immunoprecipitation and GST pull-down assay, indicating that COPI coatomer might be directed to the viral replication complex through viral 2C protein. Additionally, because the pathway is conserved among different species of enteroviruses, it may represent a novel target for antiviral therapies. PMID:22662263

Temporal integration: intentional sound discrimination does not modulate stimulus-driven processes in auditory event synthesis.

PubMed

Sussman, Elyse; Winkler, István; Kreuzer, Judith; Saher, Marieke; Näätänen, Risto; Ritter, Walter

2002-12-01

Our previous study showed that the auditory context could influence whether two successive acoustic changes occurring within the temporal integration window (approximately 200ms) were pre-attentively encoded as a single auditory event or as two discrete events (Cogn Brain Res 12 (2001) 431). The aim of the current study was to assess whether top-down processes could influence the stimulus-driven processes in determining what constitutes an auditory event. Electroencepholagram (EEG) was recorded from 11 scalp electrodes to frequently occurring standard and infrequently occurring deviant sounds. Within the stimulus blocks, deviants either occurred only in pairs (successive feature changes) or both singly and in pairs. Event-related potential indices of change and target detection, the mismatch negativity (MMN) and the N2b component, respectively, were compared with the simultaneously measured performance in discriminating the deviants. Even though subjects could voluntarily distinguish the two successive auditory feature changes from each other, which was also indicated by the elicitation of the N2b target-detection response, top-down processes did not modify the event organization reflected by the MMN response. Top-down processes can extract elemental auditory information from a single integrated acoustic event, but the extraction occurs at a later processing stage than the one whose outcome is indexed by MMN. Initial processes of auditory event-formation are fully governed by the context within which the sounds occur. Perception of the deviants as two separate sound events (the top-down effects) did not change the initial neural representation of the same deviants as one event (indexed by the MMN), without a corresponding change in the stimulus-driven sound organization.

Copy-Editing: The Cambridge Handbook.

ERIC Educational Resources Information Center

Butcher, Judith

This handbook is designed as a reference manual for copy editors who prepare typescript for printing. It deals with the following topics: the copy editor's function; the work to be done at each stage in the production process; some difficult points of spelling, capitalization, and other features collectively known as "house style"; the parts of a…

Topic Structure Affects Semantic Integration: Evidence from Event-Related Potentials

PubMed Central

Yang, Xiaohong; Chen, Xuhai; Chen, Shuang; Xu, Xiaoying; Yang, Yufang

2013-01-01

This study investigated whether semantic integration in discourse context could be influenced by topic structure using event-related brain potentials. Participants read discourses in which the last sentence contained a critical word that was either congruent or incongruent with the topic established in the first sentence. The intervening sentences between the first and the last sentence of the discourse either maintained or shifted the original topic. Results showed that incongruent words in topic-maintained discourses elicited an N400 effect that was broadly distributed over the scalp while those in topic-shifted discourses elicited an N400 effect that was lateralized to the right hemisphere and localized over central and posterior areas. Moreover, a late positivity effect was only elicited by incongruent words in topic-shifted discourses, but not in topic-maintained discourses. This suggests an important role for discourse structure in semantic integration, such that compared with topic-maintained discourses, the complexity of discourse structure in topic-shifted condition reduces the initial stage of semantic integration and enhances the later stage in which a mental representation is updated. PMID:24348994

Topic structure affects semantic integration: evidence from event-related potentials.

PubMed

Yang, Xiaohong; Chen, Xuhai; Chen, Shuang; Xu, Xiaoying; Yang, Yufang

2013-01-01

This study investigated whether semantic integration in discourse context could be influenced by topic structure using event-related brain potentials. Participants read discourses in which the last sentence contained a critical word that was either congruent or incongruent with the topic established in the first sentence. The intervening sentences between the first and the last sentence of the discourse either maintained or shifted the original topic. Results showed that incongruent words in topic-maintained discourses elicited an N400 effect that was broadly distributed over the scalp while those in topic-shifted discourses elicited an N400 effect that was lateralized to the right hemisphere and localized over central and posterior areas. Moreover, a late positivity effect was only elicited by incongruent words in topic-shifted discourses, but not in topic-maintained discourses. This suggests an important role for discourse structure in semantic integration, such that compared with topic-maintained discourses, the complexity of discourse structure in topic-shifted condition reduces the initial stage of semantic integration and enhances the later stage in which a mental representation is updated.

Impact of induced seismic events on seal integrity, Texas Gulf Coast

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nicot, Jean-Philippe; Meckel, Timothy A.; Carr, David A.

Recent publications have suggested that large-scale CO 2 injection could trigger earthquakes and that even small- to moderate-sized earthquakes may threaten the seal integrity of the injection zone, and potentially damage buildings and other surface structures. In this study, we compared seal thickness to estimated fault displacement due to a single hypothetical seismic event in a selected area of the Texas Gulf Coast comprising an offshore strip of state waters along two Texas counties. To evaluate the slip generated by a single seismic event, we compiled well log information on shale/sand sequences and seismic information on fault geometric characteristics ofmore » a section of Lower Miocene age. The section is thousands of feet thick and is overlain and underlain by marine shales (Amph. B and Anahuac, respectively) that are relatively easy to correlate between wells. The Amph. B. shale is the secondary and ultimate seal for all injection intervals in the Lower Miocene. Given its thickness, no realistic seismic event or small series of seismic events will offset it significantly. However, this may not be true of smaller local primary seals. An analysis of geophysical logs of a total of 71 wells yielded a total of 2,871 sand / shale binary intervals. An analysis of the dedicated 3D seismic survey counted 723 fault traces at five roughly horizontal horizons within the Lower Miocene Fault displacement estimated using the product of the fault length times an uncertain multiplier coefficient assumed to follow a triangular distribution with a 10 -3 to 10 -5 range and a mode of 8 × 10 -5. We then compared estimated single-event fault displacements to seal thicknesses by means of a Monte-Carlo analysis. Only 1.8% of thickness/displacement pairs display a displacement greater than 20% of the seal thickness. Only 0.26% of the pairs result in a displacement of half the seal thickness and only 0.05% of thickness/displacement pairs result in a clear seal rupture. The next

Impact of induced seismic events on seal integrity, Texas Gulf Coast

DOE PAGES

Nicot, Jean-Philippe; Meckel, Timothy A.; Carr, David A.; ...

2014-12-31

Recent publications have suggested that large-scale CO 2 injection could trigger earthquakes and that even small- to moderate-sized earthquakes may threaten the seal integrity of the injection zone, and potentially damage buildings and other surface structures. In this study, we compared seal thickness to estimated fault displacement due to a single hypothetical seismic event in a selected area of the Texas Gulf Coast comprising an offshore strip of state waters along two Texas counties. To evaluate the slip generated by a single seismic event, we compiled well log information on shale/sand sequences and seismic information on fault geometric characteristics ofmore » a section of Lower Miocene age. The section is thousands of feet thick and is overlain and underlain by marine shales (Amph. B and Anahuac, respectively) that are relatively easy to correlate between wells. The Amph. B. shale is the secondary and ultimate seal for all injection intervals in the Lower Miocene. Given its thickness, no realistic seismic event or small series of seismic events will offset it significantly. However, this may not be true of smaller local primary seals. An analysis of geophysical logs of a total of 71 wells yielded a total of 2,871 sand / shale binary intervals. An analysis of the dedicated 3D seismic survey counted 723 fault traces at five roughly horizontal horizons within the Lower Miocene Fault displacement estimated using the product of the fault length times an uncertain multiplier coefficient assumed to follow a triangular distribution with a 10 -3 to 10 -5 range and a mode of 8 × 10 -5. We then compared estimated single-event fault displacements to seal thicknesses by means of a Monte-Carlo analysis. Only 1.8% of thickness/displacement pairs display a displacement greater than 20% of the seal thickness. Only 0.26% of the pairs result in a displacement of half the seal thickness and only 0.05% of thickness/displacement pairs result in a clear seal rupture. The next

An integrative process model of leadership: examining loci, mechanisms, and event cycles.

PubMed

Eberly, Marion B; Johnson, Michael D; Hernandez, Morela; Avolio, Bruce J

2013-09-01

Utilizing the locus (source) and mechanism (transmission) of leadership framework (Hernandez, Eberly, Avolio, & Johnson, 2011), we propose and examine the application of an integrative process model of leadership to help determine the psychological interactive processes that constitute leadership. In particular, we identify the various dynamics involved in generating leadership processes by modeling how the loci and mechanisms interact through a series of leadership event cycles. We discuss the major implications of this model for advancing an integrative understanding of what constitutes leadership and its current and future impact on the field of psychological theory, research, and practice. © 2013 APA, all rights reserved.

Global copy number profiling of cancer genomes | Office of Cancer Genomics

Cancer.gov

In this article, we introduce a robust and efficient strategy for deriving global and allele-specific copy number alternations (CNA) from cancer whole exome sequencing data based on Log R ratios and B-allele frequencies. Applying the approach to the analysis of over 200 skin cancer samples, we demonstrate its utility for discovering distinct CNA events and for deriving ancillary information such as tumor purity. Availability and implementation: https://github.com/xfwang/CLOSE CONTACT: xuefeng.wang@stonybrook.edu or michael.krauthammer@yale.edu. (Publication Abstract)

A Role of DLPFC in the Learning Process of Human Mate Copying

PubMed Central

Zhuang, Jin-Ying; Xie, Jiajia; Hu, Die; Fan, Mingxia; Zheng, Li

2016-01-01

In the current study, we conducted a behavioral experiment to test the mate coping effect and a functional magnetic resonance imaging (fMRI) experiment to test the neural basis involved in the social learning process of mate copying. In the behavioral experiment, participants were asked to rate the attractiveness of isolated opposite-sex (potential mates) facial photographs, then shown the targets associating with a neutral-faced model with textual cues indicating the models’ attitude (interested vs. not-interested) toward the potential mates, and then asked to re-evaluate the potential mates’ attractiveness. Using a similar procedure as the behavioral experiment, participants were scanned while observing the compound images in the fMRI experiment. The mate copying effect was confirmed in the behavioral experiment –greater increase in attractiveness ratings was observed for opposite-sex photographs in the interested than in the not-interested condition. The fMRI results showed that the dorsolateral prefrontal gyrus (DLPFC) was significantly active in the comparison of interested > not-interested condition, suggesting that a cognitive integration and selection function may be involved when participants process information from conditions related to mate copying. PMID:27148151

Systematic Prioritization and Integrative Analysis of Copy Number Variations in Schizophrenia Reveal Key Schizophrenia Susceptibility Genes

PubMed Central

Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin

2014-01-01

Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and

Geophysical events

NASA Astrophysics Data System (ADS)

This is a summary of SEAN Bulletin, 25(10), October 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-010 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $ 1 . Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid. SEAN Bulletin is available on Kosmos. Type CHECK SEAN on Part A of Kosmos

Geophysical events

NASA Astrophysics Data System (ADS)

This is a summary of SEAN Bulletin, 13 (5), May 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-004 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $ 1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid. SEAN Bulletin is available on Kosmos. Type CHECK SEAN on Part A of Kosmos.

Geophysical events

NASA Astrophysics Data System (ADS)

This is a summary of SEAN Bulletin, 13(9), September 30, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-013 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid. SEAN Bulletin is available on Kosmos. Type CHECK SEAN on Part A of Kosmos.

Geophysical events

NASA Astrophysics Data System (ADS)

This is a summary of SEAN Bulletin, 13 (6), June 30, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-005 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $ 1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid. SEAN Bulletin is available on Kosmos. Type CHECK SEAN on Part A of Kosmos.

Geophysical events

NASA Astrophysics Data System (ADS)

This is a summary of SEAN Bulletin, 13 (7), July 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-007 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid. SEAN Bulletin is available on Kosmos. Type CHECK SEAN on Part A of Kosmos.

48 CFR 201.105-3 - Copies.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Copies. 201.105-3 Section 201.105-3 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE GENERAL FEDERAL ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 201.105-3 Copies. The...

CCL3L1 copy number and susceptibility to malaria

PubMed Central

Carpenter, Danielle; Färnert, Anna; Rooth, Ingegerd; Armour, John A.L.; Shaw, Marie-Anne

2012-01-01

Copy number variation can contribute to the variation observed in susceptibility to complex diseases. Here we present the first study to investigate copy number variation of the chemokine gene CCL3L1 with susceptibility to malaria. We present a family-based genetic analysis of a Tanzanian population (n = 922), using parasite load, mean number of clinical infections of malaria and haemoglobin levels as phenotypes. Copy number of CCL3L1 was measured using the paralogue ratio test (PRT) and the dataset exhibited copy numbers ranging between 1 and 10 copies per diploid genome (pdg). Association between copy number and phenotypes was assessed. Furthermore, we were able to identify copy number haplotypes in some families, using microsatellites within the copy variable region, for transmission disequilibrium testing. We identified a high level of copy number haplotype diversity and find some evidence for an association of low CCL3L1 copy number with protection from anaemia. PMID:22484763

CCL3L1 copy number and susceptibility to malaria.

PubMed

Carpenter, Danielle; Färnert, Anna; Rooth, Ingegerd; Armour, John A L; Shaw, Marie-Anne

2012-07-01

Copy number variation can contribute to the variation observed in susceptibility to complex diseases. Here we present the first study to investigate copy number variation of the chemokine gene CCL3L1 with susceptibility to malaria. We present a family-based genetic analysis of a Tanzanian population (n=922), using parasite load, mean number of clinical infections of malaria and haemoglobin levels as phenotypes. Copy number of CCL3L1 was measured using the paralogue ratio test (PRT) and the dataset exhibited copy numbers ranging between 1 and 10 copies per diploid genome (pdg). Association between copy number and phenotypes was assessed. Furthermore, we were able to identify copy number haplotypes in some families, using microsatellites within the copy variable region, for transmission disequilibrium testing. We identified a high level of copy number haplotype diversity and find some evidence for an association of low CCL3L1 copy number with protection from anaemia. Copyright © 2012 Elsevier B.V. All rights reserved.

Exploratory factor analysis of pathway copy number data with an application towards the integration with gene expression data.

PubMed

van Wieringen, Wessel N; van de Wiel, Mark A

2011-05-01

Realizing that genes often operate together, studies into the molecular biology of cancer shift focus from individual genes to pathways. In order to understand the regulatory mechanisms of a pathway, one must study its genes at all molecular levels. To facilitate such study at the genomic level, we developed exploratory factor analysis for the characterization of the variability of a pathway's copy number data. A latent variable model that describes the call probability data of a pathway is introduced and fitted with an EM algorithm. In two breast cancer data sets, it is shown that the first two latent variables of GO nodes, which inherit a clear interpretation from the call probabilities, are often related to the proportion of aberrations and a contrast of the probabilities of a loss and of a gain. Linking the latent variables to the node's gene expression data suggests that they capture the "global" effect of genomic aberrations on these transcript levels. In all, the proposed method provides an possibly insightful characterization of pathway copy number data, which may be fruitfully exploited to study the interaction between the pathway's DNA copy number aberrations and data from other molecular levels like gene expression.

An integrated logit model for contamination event detection in water distribution systems.

PubMed

Housh, Mashor; Ostfeld, Avi

2015-05-15

The problem of contamination event detection in water distribution systems has become one of the most challenging research topics in water distribution systems analysis. Current attempts for event detection utilize a variety of approaches including statistical, heuristics, machine learning, and optimization methods. Several existing event detection systems share a common feature in which alarms are obtained separately for each of the water quality indicators. Unifying those single alarms from different indicators is usually performed by means of simple heuristics. A salient feature of the current developed approach is using a statistically oriented model for discrete choice prediction which is estimated using the maximum likelihood method for integrating the single alarms. The discrete choice model is jointly calibrated with other components of the event detection system framework in a training data set using genetic algorithms. The fusing process of each indicator probabilities, which is left out of focus in many existing event detection system models, is confirmed to be a crucial part of the system which could be modelled by exploiting a discrete choice model for improving its performance. The developed methodology is tested on real water quality data, showing improved performances in decreasing the number of false positive alarms and in its ability to detect events with higher probabilities, compared to previous studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

Characterization of the exogenous insert and development of event-specific PCR detection methods for genetically modified Huanong No. 1 papaya.

PubMed

Guo, Jinchao; Yang, Litao; Liu, Xin; Guan, Xiaoyan; Jiang, Lingxi; Zhang, Dabing

2009-08-26

Genetically modified (GM) papaya (Carica papaya L.), Huanong No. 1, was approved for commercialization in Guangdong province, China in 2006, and the development of the Huanong No. 1 papaya detection method is necessary for implementing genetically modified organism (GMO) labeling regulations. In this study, we reported the characterization of the exogenous integration of GM Huanong No. 1 papaya by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. The results suggested that one intact copy of the initial construction was integrated in the papaya genome and which probably resulted in one deletion (38 bp in size) of the host genomic DNA. Also, one unintended insertion of a 92 bp truncated NptII fragment was observed at the 5' end of the exogenous insert. Furthermore, we revealed its 5' and 3' flanking sequences between the insert DNA and the papaya genomic DNA, and developed the event-specific qualitative and quantitative PCR assays for GM Huanong No. 1 papaya based on the 5' integration flanking sequence. The relative limit of detection (LOD) of the qualitative PCR assay was about 0.01% in 100 ng of total papaya genomic DNA, corresponding to about 25 copies of papaya haploid genome. In the quantitative PCR, the limits of detection and quantification (LOD and LOQ) were as low as 12.5 and 25 copies of papaya haploid genome, respectively. In practical sample quantification, the quantified biases between the test and true values of three samples ranged from 0.44% to 4.41%. Collectively, we proposed that all of these results are useful for the identification and quantification of Huanong No. 1 papaya and its derivates.

48 CFR 1501.105-3 - Copies.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Copies. 1501.105-3 Section 1501.105-3 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY GENERAL GENERAL... 20402. Copies of loose-leaf EPAAR are distributed within EPA and may be obtained from the EPA Facilities...

Evaluation of viral load thresholds for predicting new WHO Stage 3 and 4 events in HIV-infected children receiving highly active antiretroviral therapy

PubMed Central

Siberry, George K; Harris, D. Robert; Oliveira, Ricardo Hugo; Krauss, Margot R.; Hofer, Cristina B.; Tiraboschi, Adriana Aparecida; Marques, Heloisa; Succi, Regina C.; Abreu, Thalita; Negra, Marinella Della; Mofenson, Lynne M.; Hazra, Rohan

2012-01-01

Background This study evaluated a wide range of viral load (VL) thresholds to identify a cut-point that best predicts new clinical events in children on stable highly-active antiretroviral therapy (HAART). Methods Cox proportional hazards modeling was used to assess the adjusted risk of World Health Organization stage 3 or 4 clinical events (WHO events) as a function of time-varying CD4, VL, and hemoglobin values in a cohort study of Latin American children on HAART ≥ 6 months. Models were fit using different VL cut-points between 400 and 50,000 copies/mL, with model fit evaluated on the basis of the minimum Akaike Information Criterion (AIC) value, a standard model fit statistic. Results Models were based on 67 subjects with WHO events out of 550 subjects on study. The VL cutpoints of > 2600 copies/mL and > 32,000 copies/mL corresponded to the lowest AIC values and were associated with the highest hazard ratios [2.0 (p = 0.015) and 2.1 (p = 0.0058), respectively] for WHO events. Conclusions In HIV-infected Latin American children on stable HAART, two distinct VL thresholds (> 2,600 copies/mL and > 32,000 copies/mL) were identified for predicting children at significantly increased risk of HIV-related clinical illness, after accounting for CD4 level, hemoglobin level, and other significant factors. PMID:22343177

1 CFR 18.1 - Original and copies required.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 1 General Provisions 1 2014-01-01 2012-01-01 true Original and copies required. 18.1 Section 18.1... PROCESSING OF DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.1 Original and copies... two duplicate originals or certified copies. 1 However, if the document is printed or processed on...

1 CFR 18.1 - Original and copies required.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 1 General Provisions 1 2013-01-01 2012-01-01 true Original and copies required. 18.1 Section 18.1... PROCESSING OF DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.1 Original and copies... two duplicate originals or certified copies. 1 However, if the document is printed or processed on...

1 CFR 18.1 - Original and copies required.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 1 General Provisions 1 2012-01-01 2012-01-01 false Original and copies required. 18.1 Section 18.1... PROCESSING OF DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.1 Original and copies... two duplicate originals or certified copies. 1 However, if the document is printed or processed on...

40 CFR 264.53 - Copies of contingency plan.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Copies of contingency plan. 264.53... Contingency Plan and Emergency Procedures § 264.53 Copies of contingency plan. A copy of the contingency plan... called upon to provide emergency services. [Comment: The contingency plan must be submitted to the...

Mitochondrial fusion increases the mitochondrial DNA copy number in budding yeast.

PubMed

Hori, Akiko; Yoshida, Minoru; Ling, Feng

2011-05-01

Mitochondrial fusion plays an important role in mitochondrial DNA (mtDNA) maintenance, although the underlying mechanisms are unclear. In budding yeast, certain levels of reactive oxygen species (ROS) can promote recombination-mediated mtDNA replication, and mtDNA maintenance depends on the homologous DNA pairing protein Mhr1. Here, we show that the fusion of isolated yeast mitochondria, which can be monitored by the bimolecular fluorescence complementation-derived green fluorescent protein (GFP) fluorescence, increases the mtDNA copy number in a manner dependent on Mhr1. The fusion event, accompanied by the degradation of dissociated electron transport chain complex IV and transient reductions in the complex IV subunits by the inner membrane AAA proteases such as Yme1, increases ROS levels. Analysis of the initial stage of mitochondrial fusion in early log-phase cells produced similar results. Moreover, higher ROS levels in mitochondrial fusion-deficient mutant cells increased the amount of newly synthesized mtDNA, resulting in increases in the mtDNA copy number. In contrast, reducing ROS levels in yme1 null mutant cells significantly decreased the mtDNA copy number, leading to an increase in cells lacking mtDNA. Our results indicate that mitochondrial fusion induces mtDNA synthesis by facilitating ROS-triggered, recombination-mediated replication and thereby prevents the generation of mitochondria lacking DNA. © 2011 The Authors. Journal compilation © 2011 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

Somatic copy number alterations in gastric adenocarcinomas among Asian and Western patients

PubMed Central

Corso, Giovanni; Ryu, Min-Hee; Kang, Yoon-Koo; Roviello, Franco; Saksena, Gordon; Peng, Shouyong; Shivdasani, Ramesh A.; Bass, Adam J.; Beroukhim, Rameen

2017-01-01

Gastric cancer, a leading worldwide cause of cancer mortality, shows high geographic and ethnic variation in incidence rates, which are highest in East Asia. The anatomic locations and clinical behavior also differ by geography, leading to the controversial idea that Eastern and Western forms of the disease are distinct. In view of these differences, we investigated whether gastric cancers from Eastern and Western patients show distinct genomic profiles. We used high-density profiling of somatic copy-number aberrations to analyze the largest collection to date of gastric adenocarcinomas and utilized genotyping data to rigorously annotate ethnic status. The size of this collection allowed us to accurately identify regions of significant copy-number alteration and separately to evaluate tumors arising in Eastern and Western patients. Among molecular subtypes classified by The Cancer Genome Atlas, the frequency of gastric cancers showing chromosomal instability was modestly higher in Western patients. After accounting for this difference, however, gastric cancers arising in Easterners and Westerners have highly similar somatic copy-number patterns. Only one genomic event, focal deletion of the phosphatase gene PTPRD, was significantly enriched in Western cases, though also detected in Eastern cases. Thus, despite the different risk factors and clinical features, gastric cancer appears to be a fundamentally similar disease in both populations and the divergent clinical outcomes cannot be ascribed to different underlying structural somatic genetic aberrations. PMID:28426752

In Vitro Progression of HPV16 Episome-Associated Cervical Neoplasia Displays Fundamental Similarities to Integrant-Associated Carcinogenesis

PubMed Central

Gray, Elizabeth; Pett, Mark R.; Ward, Dawn; Winder, David M.; Stanley, Margaret A.; Roberts, Ian; Scarpini, Cinzia G.; Coleman, Nicholas

2010-01-01

An important event in the development of cervical squamous cell carcinoma (SCC) is deregulated expression of high-risk human papillomavirus (HR-HPV) oncogenes, most commonly related to viral integration into host DNA. Mechanisms of development of the ~15% of SCCs that contain extra-chromosomal (episomal) HR-HPV are poorly understood, due to limited longitudinal data. We therefore employed the W12 model to study mechanisms of cervical carcinogenesis associated with episomal HPV16. In vitro progression of W12 normally occurs through selection of cells containing integrated HPV16. However, in one long-term culture, keratinocytes developed a selective growth advantage and invasive phenotype, while retaining HPV16 episomes at increased copy number in the absence of transcriptionally active integrants. Longitudinal investigations revealed similarities between the episome- and integrant-associated routes of neoplastic progression. Most notable were dynamic changes in viral early gene expression in episome-retaining cells, consistent with continually changing selective pressures. An early increase in viral transcription preceded elevated episome copy number and was followed by a reduction to near baseline after the development of invasiveness. Episomal transcriptional deregulation did not require selection of a specific sequence variant of the HPV16 upstream regulatory region, although increased levels of acetylated histone H4 around the late promoter implicated a role for altered chromatin structure. Interestingly, invasive episome-retaining cells demonstrated high levels of HPV16-E2/E6 proteins (despite decreased transcript levels) and reduced expression of interferon-stimulated genes, adaptations that support viral persistence and cell survival. Our findings suggest a unified working model for events important in cervical neoplastic progression, regardless of HR-HPV physical state. PMID:20442284

40 CFR 265.53 - Copies of contingency plan.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 26 2011-07-01 2011-07-01 false Copies of contingency plan. 265.53... DISPOSAL FACILITIES Contingency Plan and Emergency Procedures § 265.53 Copies of contingency plan. A copy of the contingency plan and all revisions to the plan must be: (a) Maintained at the facility; and (b...

40 CFR 265.53 - Copies of contingency plan.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 27 2012-07-01 2012-07-01 false Copies of contingency plan. 265.53... DISPOSAL FACILITIES Contingency Plan and Emergency Procedures § 265.53 Copies of contingency plan. A copy of the contingency plan and all revisions to the plan must be: (a) Maintained at the facility; and (b...

40 CFR 265.53 - Copies of contingency plan.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 26 2014-07-01 2014-07-01 false Copies of contingency plan. 265.53... DISPOSAL FACILITIES Contingency Plan and Emergency Procedures § 265.53 Copies of contingency plan. A copy of the contingency plan and all revisions to the plan must be: (a) Maintained at the facility; and (b...

40 CFR 265.53 - Copies of contingency plan.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 27 2013-07-01 2013-07-01 false Copies of contingency plan. 265.53... DISPOSAL FACILITIES Contingency Plan and Emergency Procedures § 265.53 Copies of contingency plan. A copy of the contingency plan and all revisions to the plan must be: (a) Maintained at the facility; and (b...

40 CFR 265.53 - Copies of contingency plan.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Copies of contingency plan. 265.53... DISPOSAL FACILITIES Contingency Plan and Emergency Procedures § 265.53 Copies of contingency plan. A copy of the contingency plan and all revisions to the plan must be: (a) Maintained at the facility; and (b...

Effects of cellular differentiation, chromosomal integration and 5-aza-2'-deoxycytidine treatment on human papillomavirus-16 DNA methylation in cultured cell lines.

PubMed

Kalantari, Mina; Lee, Denis; Calleja-Macias, Itzel E; Lambert, Paul F; Bernard, Hans-Ulrich

2008-05-10

life cycle, (ii) integration of the viral genome into the host chromosome events leads to an alteration in methylation patterns on the viral genome that is dependent upon the type of integration event and possibly copy number, and (iii) integration universally results in the viral DNA becoming refractory to changes in methylation state upon cellular differentiation that are observed with extrachromosomal HPV-16 genomes.

Multivoxel pattern similarity suggests the integration of temporal duration in hippocampal event sequence representations.

PubMed

Thavabalasingam, Sathesan; O'Neil, Edward B; Lee, Andy C H

2018-05-22

Recent rodent work suggests the hippocampus may provide a temporal representation of event sequences, in which the order of events and the interval durations between them are encoded. There is, however, limited human evidence for the latter, in particular whether the hippocampus processes duration information pertaining to the passage of time rather than qualitative or quantitative changes in event content. We scanned participants while they made match-mismatch judgements on each trial between a study sequence of events and a subsequent test sequence. Participants explicitly remembered event order or interval duration information (Experiment 1), or monitored order only, with duration being manipulated implicitly (Experiment 2). Hippocampal study-test pattern similarity was significantly reduced by changes to order or duration in mismatch trials, even when duration was processed implicitly. Our findings suggest the human hippocampus processes short intervals within sequences and support the idea that duration information is integrated into hippocampal mnemonic representations. Copyright © 2018 Elsevier Inc. All rights reserved.

Functional effects of CCL3L1 copy number

PubMed Central

Carpenter, Danielle; McIntosh, Richard S; Pleass, Richard J; Armour, John AL

2012-01-01

Copy number variation (CNV) is becoming increasingly important as a feature of human variation in disease susceptibility studies. However, the consequences of copy number variation are not so well understood. Here we present data exploring the functional consequences of copy number variation of CCL3L1 in 55 independent UK samples with no known clinical phenotypes. Copy number of CCL3L1 was determined by the paralogue ratio test (PRT), and expression levels of MIP-1α and mRNA from stimulated monocytes were measured and analysed. The data show no statistically significant association of MIP-1α protein levels with copy number. However, there was a significant correlation between copy number and CCL3L1:CCL3 mRNA ratio. The data also provide evidence that expression of CCL3 predominates in both protein and mRNA, and therefore the observed variation of CCL3 is potentially more important biologically than that of copy number variation of CCL3L1. PMID:22476153

40 CFR 264.53 - Copies of contingency plan.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 26 2014-07-01 2014-07-01 false Copies of contingency plan. 264.53... Contingency Plan and Emergency Procedures § 264.53 Copies of contingency plan. A copy of the contingency plan and all revisions to the plan must be: (a) Maintained at the facility; and (b) Submitted to all local...

40 CFR 264.53 - Copies of contingency plan.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 27 2013-07-01 2013-07-01 false Copies of contingency plan. 264.53... Contingency Plan and Emergency Procedures § 264.53 Copies of contingency plan. A copy of the contingency plan and all revisions to the plan must be: (a) Maintained at the facility; and (b) Submitted to all local...

40 CFR 264.53 - Copies of contingency plan.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 40 Protection of Environment 27 2012-07-01 2012-07-01 false Copies of contingency plan. 264.53... Contingency Plan and Emergency Procedures § 264.53 Copies of contingency plan. A copy of the contingency plan and all revisions to the plan must be: (a) Maintained at the facility; and (b) Submitted to all local...

40 CFR 264.53 - Copies of contingency plan.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 26 2011-07-01 2011-07-01 false Copies of contingency plan. 264.53... Contingency Plan and Emergency Procedures § 264.53 Copies of contingency plan. A copy of the contingency plan and all revisions to the plan must be: (a) Maintained at the facility; and (b) Submitted to all local...

INTEGRAL Detection of the First Prompt Gamma-Ray Signal Coincident with the Gravitational-wave Event GW170817

DOE Office of Scientific and Technical Information (OSTI.GOV)

Savchenko, V.; Ferrigno, C.; Bozzo, E.

We report the INTernational Gamma-ray Astrophysics Laboratory ( INTEGRAL ) detection of the short gamma-ray burst GRB 170817A (discovered by Fermi -GBM) with a signal-to-noise ratio of 4.6, and, for the first time, its association with the gravitational waves (GWs) from binary neutron star (BNS) merging event GW170817 detected by the LIGO and Virgo observatories. The significance of association between the gamma-ray burst observed by INTEGRAL and GW170817 is 3.2σ, while the association between the Fermi -GBM and INTEGRAL detections is 4.2σ. GRB 170817A was detected by the SPI-ACS instrument about 2 s after the end of the GW event.more » We measure a fluence of (1.4 ± 0.4 ± 0.6) × 10{sup −7} erg cm{sup −2} (75–2000 keV), where, respectively, the statistical error is given at the 1σ confidence level, and the systematic error corresponds to the uncertainty in the spectral model and instrument response. We also report on the pointed follow-up observations carried out by INTEGRAL , starting 19.5 hr after the event, and lasting for 5.4 days. We provide a stringent upper limit on any electromagnetic signal in a very broad energy range, from 3 keV to 8 MeV, constraining the soft gamma-ray afterglow flux to <7.1 × 10{sup −11} erg cm{sup −2} s{sup −1} (80–300 keV). Exploiting the unique capabilities of INTEGRAL , we constrained the gamma-ray line emission from radioactive decays that are expected to be the principal source of the energy behind a kilonova event following a BNS coalescence. Finally, we put a stringent upper limit on any delayed bursting activity, for example, from a newly formed magnetar.« less

Technical note: Efficient online source identification algorithm for integration within a contamination event management system

NASA Astrophysics Data System (ADS)

Deuerlein, Jochen; Meyer-Harries, Lea; Guth, Nicolai

2017-07-01

Drinking water distribution networks are part of critical infrastructures and are exposed to a number of different risks. One of them is the risk of unintended or deliberate contamination of the drinking water within the pipe network. Over the past decade research has focused on the development of new sensors that are able to detect malicious substances in the network and early warning systems for contamination. In addition to the optimal placement of sensors, the automatic identification of the source of a contamination is an important component of an early warning and event management system for security enhancement of water supply networks. Many publications deal with the algorithmic development; however, only little information exists about the integration within a comprehensive real-time event detection and management system. In the following the analytical solution and the software implementation of a real-time source identification module and its integration within a web-based event management system are described. The development was part of the SAFEWATER project, which was funded under FP 7 of the European Commission.

Deficient multisensory integration in schizophrenia: an event-related potential study.

PubMed

Stekelenburg, Jeroen J; Maes, Jan Pieter; Van Gool, Arthur R; Sitskoorn, Margriet; Vroomen, Jean

2013-07-01

In many natural audiovisual events (e.g., the sight of a face articulating the syllable /ba/), the visual signal precedes the sound and thus allows observers to predict the onset and the content of the sound. In healthy adults, the N1 component of the event-related brain potential (ERP), reflecting neural activity associated with basic sound processing, is suppressed if a sound is accompanied by a video that reliably predicts sound onset. If the sound does not match the content of the video (e.g., hearing /ba/ while lipreading /fu/), the later occurring P2 component is affected. Here, we examined whether these visual information sources affect auditory processing in patients with schizophrenia. The electroencephalography (EEG) was recorded in 18 patients with schizophrenia and compared with that of 18 healthy volunteers. As stimuli we used video recordings of natural actions in which visual information preceded and predicted the onset of the sound that was either congruent or incongruent with the video. For the healthy control group, visual information reduced the auditory-evoked N1 if compared to a sound-only condition, and stimulus-congruency affected the P2. This reduction in N1 was absent in patients with schizophrenia, and the congruency effect on the P2 was diminished. Distributed source estimations revealed deficits in the network subserving audiovisual integration in patients with schizophrenia. The results show a deficit in multisensory processing in patients with schizophrenia and suggest that multisensory integration dysfunction may be an important and, to date, under-researched aspect of schizophrenia. Copyright © 2013. Published by Elsevier B.V.

CBM First-level Event Selector Input Interface Demonstrator

NASA Astrophysics Data System (ADS)

Hutter, Dirk; de Cuveland, Jan; Lindenstruth, Volker

2017-10-01

CBM is a heavy-ion experiment at the future FAIR facility in Darmstadt, Germany. Featuring self-triggered front-end electronics and free-streaming read-out, event selection will exclusively be done by the First Level Event Selector (FLES). Designed as an HPC cluster with several hundred nodes its task is an online analysis and selection of the physics data at a total input data rate exceeding 1 TByte/s. To allow efficient event selection, the FLES performs timeslice building, which combines the data from all given input links to self-contained, potentially overlapping processing intervals and distributes them to compute nodes. Partitioning the input data streams into specialized containers allows performing this task very efficiently. The FLES Input Interface defines the linkage between the FEE and the FLES data transport framework. A custom FPGA PCIe board, the FLES Interface Board (FLIB), is used to receive data via optical links and transfer them via DMA to the host’s memory. The current prototype of the FLIB features a Kintex-7 FPGA and provides up to eight 10 GBit/s optical links. A custom FPGA design has been developed for this board. DMA transfers and data structures are optimized for subsequent timeslice building. Index tables generated by the FPGA enable fast random access to the written data containers. In addition the DMA target buffers can directly serve as InfiniBand RDMA source buffers without copying the data. The usage of POSIX shared memory for these buffers allows data access from multiple processes. An accompanying HDL module has been developed to integrate the FLES link into the front-end FPGA designs. It implements the front-end logic interface as well as the link protocol. Prototypes of all Input Interface components have been implemented and integrated into the FLES test framework. This allows the implementation and evaluation of the foreseen CBM read-out chain.

Measurement methods and accuracy in copy number variation: failure to replicate associations of beta-defensin copy number with Crohn's disease.

PubMed

Aldhous, Marian C; Abu Bakar, Suhaili; Prescott, Natalie J; Palla, Raquel; Soo, Kimberley; Mansfield, John C; Mathew, Christopher G; Satsangi, Jack; Armour, John A L

2010-12-15

The copy number variation in beta-defensin genes on human chromosome 8 has been proposed to underlie susceptibility to inflammatory disorders, but presents considerable challenges for accurate typing on the scale required for adequately powered case-control studies. In this work, we have used accurate methods of copy number typing based on the paralogue ratio test (PRT) to assess beta-defensin copy number in more than 1500 UK DNA samples including more than 1000 cases of Crohn's disease. A subset of 625 samples was typed using both PRT-based methods and standard real-time PCR methods, from which direct comparisons highlight potentially serious shortcomings of a real-time PCR assay for typing this variant. Comparing our PRT-based results with two previous studies based only on real-time PCR, we find no evidence to support the reported association of Crohn's disease with either low or high beta-defensin copy number; furthermore, it is noteworthy that there are disagreements between different studies on the observed frequency distribution of copy number states among European controls. We suggest safeguards to be adopted in assessing and reporting the accuracy of copy number measurement, with particular emphasis on integer clustering of results, to avoid reporting of spurious associations in future case-control studies.

A comprehensive profile of DNA copy number variations in a Korean population: identification of copy number invariant regions among Koreans.

PubMed

Jeon, Jae Pil; Shim, Sung Mi; Jung, Jong Sun; Nam, Hye Young; Lee, Hye Jin; Oh, Berm Seok; Kim, Kuchan; Kim, Hyung Lae; Han, Bok Ghee

2009-09-30

To examine copy number variations among the Korean population, we compared individual genomes with the Korean reference genome assembly using the publicly available Korean HapMap SNP 50 k chip data from 90 individuals. Korean individuals exhibited 123 copy number variation regions (CNVRs) covering 27.2 mb, equivalent to 1.0% of the genome in the copy number variation (CNV) analysis using the combined criteria of P value (P<0.01) and standard deviation of copy numbers (SD>or= 0.25) among study subjects. In contrast, when compared to the Affymetrix reference genome assembly from multiple ethnic groups, considerably more CNVRs (n=643) were detected in larger proportions (5.0%) of the genome covering 135.1 mb even by more stringent criteria (P<0.001 and SD>or=0.25), reflecting ethnic diversity of structural variations between Korean and other populations. Some CNVRs were validated by the quantitative multiplex PCR of short fluorescent fragment (QMPSF) method, and then copy number invariant regions were detected among the study subjects. These copy number invariant regions would be used as good internal controls for further CNV studies. Lastly, we demonstrated that the CNV information could stratify even a single ethnic population with a proper reference genome assembly from multiple heterogeneous populations.

Measurement methods and accuracy in copy number variation: failure to replicate associations of beta-defensin copy number with Crohn's disease

PubMed Central

Aldhous, Marian C.; Abu Bakar, Suhaili; Prescott, Natalie J.; Palla, Raquel; Soo, Kimberley; Mansfield, John C.; Mathew, Christopher G.; Satsangi, Jack; Armour, John A.L.

2010-01-01

The copy number variation in beta-defensin genes on human chromosome 8 has been proposed to underlie susceptibility to inflammatory disorders, but presents considerable challenges for accurate typing on the scale required for adequately powered case–control studies. In this work, we have used accurate methods of copy number typing based on the paralogue ratio test (PRT) to assess beta-defensin copy number in more than 1500 UK DNA samples including more than 1000 cases of Crohn's disease. A subset of 625 samples was typed using both PRT-based methods and standard real-time PCR methods, from which direct comparisons highlight potentially serious shortcomings of a real-time PCR assay for typing this variant. Comparing our PRT-based results with two previous studies based only on real-time PCR, we find no evidence to support the reported association of Crohn's disease with either low or high beta-defensin copy number; furthermore, it is noteworthy that there are disagreements between different studies on the observed frequency distribution of copy number states among European controls. We suggest safeguards to be adopted in assessing and reporting the accuracy of copy number measurement, with particular emphasis on integer clustering of results, to avoid reporting of spurious associations in future case–control studies. PMID:20858604

Multiple Events of Allopolyploidy in the Evolution of the Racemose Lineages in Prunus (Rosaceae) Based on Integrated Evidence from Nuclear and Plastid Data.

PubMed

Zhao, Liang; Jiang, Xi-Wang; Zuo, Yun-Juan; Liu, Xiao-Lin; Chin, Siew-Wai; Haberle, Rosemarie; Potter, Daniel; Chang, Zhao-Yang; Wen, Jun

2016-01-01

Prunus is an economically important genus well-known for cherries, plums, almonds, and peaches. The genus can be divided into three major groups based on inflorescence structure and ploidy levels: (1) the diploid solitary-flower group (subg. Prunus, Amygdalus and Emplectocladus); (2) the diploid corymbose group (subg. Cerasus); and (3) the polyploid racemose group (subg. Padus, subg. Laurocerasus, and the Maddenia group). The plastid phylogeny suggests three major clades within Prunus: Prunus-Amygdalus-Emplectocladus, Cerasus, and Laurocerasus-Padus-Maddenia, while nuclear ITS trees resolve Laurocerasus-Padus-Maddenia as a paraphyletic group. In this study, we employed sequences of the nuclear loci At103, ITS and s6pdh to explore the origins and evolution of the racemose group. Two copies of the At103 gene were identified in Prunus. One copy is found in Prunus species with solitary and corymbose inflorescences as well as those with racemose inflorescences, while the second copy (II) is present only in taxa with racemose inflorescences. The copy I sequences suggest that all racemose species form a paraphyletic group composed of four clades, each of which is definable by morphology and geography. The tree from the combined At103 and ITS sequences and the tree based on the single gene s6pdh had similar general topologies to the tree based on the copy I sequences of At103, with the combined At103-ITS tree showing stronger support in most clades. The nuclear At103, ITS and s6pdh data in conjunction with the plastid data are consistent with the hypothesis that multiple independent allopolyploidy events contributed to the origins of the racemose group. A widespread species or lineage may have served as the maternal parent for multiple hybridizations involving several paternal lineages. This hypothesis of the complex evolutionary history of the racemose group in Prunus reflects a major step forward in our understanding of diversification of the genus and has important

Multiple Events of Allopolyploidy in the Evolution of the Racemose Lineages in Prunus (Rosaceae) Based on Integrated Evidence from Nuclear and Plastid Data

PubMed Central

Zuo, Yun-juan; Liu, Xiao-Lin; Chin, Siew-Wai; Haberle, Rosemarie; Potter, Daniel; Chang, Zhao-Yang; Wen, Jun

2016-01-01

Prunus is an economically important genus well-known for cherries, plums, almonds, and peaches. The genus can be divided into three major groups based on inflorescence structure and ploidy levels: (1) the diploid solitary-flower group (subg. Prunus, Amygdalus and Emplectocladus); (2) the diploid corymbose group (subg. Cerasus); and (3) the polyploid racemose group (subg. Padus, subg. Laurocerasus, and the Maddenia group). The plastid phylogeny suggests three major clades within Prunus: Prunus-Amygdalus-Emplectocladus, Cerasus, and Laurocerasus-Padus-Maddenia, while nuclear ITS trees resolve Laurocerasus-Padus-Maddenia as a paraphyletic group. In this study, we employed sequences of the nuclear loci At103, ITS and s6pdh to explore the origins and evolution of the racemose group. Two copies of the At103 gene were identified in Prunus. One copy is found in Prunus species with solitary and corymbose inflorescences as well as those with racemose inflorescences, while the second copy (II) is present only in taxa with racemose inflorescences. The copy I sequences suggest that all racemose species form a paraphyletic group composed of four clades, each of which is definable by morphology and geography. The tree from the combined At103 and ITS sequences and the tree based on the single gene s6pdh had similar general topologies to the tree based on the copy I sequences of At103, with the combined At103-ITS tree showing stronger support in most clades. The nuclear At103, ITS and s6pdh data in conjunction with the plastid data are consistent with the hypothesis that multiple independent allopolyploidy events contributed to the origins of the racemose group. A widespread species or lineage may have served as the maternal parent for multiple hybridizations involving several paternal lineages. This hypothesis of the complex evolutionary history of the racemose group in Prunus reflects a major step forward in our understanding of diversification of the genus and has important

The effect of myostatin genotype on body temperature during extreme temperature events.

PubMed

Howard, J T; Kachman, S D; Nielsen, M K; Mader, T L; Spangler, M L

2013-07-01

Extreme heat and cold events can create deleterious physiological changes in cattle as they attempt to cope. The genetic background of animals can influence their response to these events. The objective of the current study was to determine the impact of myostatin genotype (MG) on body temperature during periods of heat and cold stress. Two groups of crossbred steers and heifers of unknown pedigree and breed fraction with varying percentages of Angus, Simmental, and Piedmontese were placed in a feedlot over 2 summers and 2 winters. Before arrival, animals were genotyped for the Piedmontese-derived myostatin mutation (C313Y) to determine their MG as either homozygous normal (0 copy; n = 84), heterozygous (1 copy; n = 96), or homozygous for inactive myostatin (2 copy; n = 59). Hourly tympanic and vaginal temperature measurements were collected for steers and heifers, respectively, for 5 d during times of anticipated heat and cold stress. Mean (±SD) ambient temperature for summer and winter stress events were 24.4 (±4.64) and -1.80 (±11.71), respectively. A trigonometric function (sine + cosine) with periods of 12 and 24 h was used to describe the diurnal cyclical pattern. Hourly body temperature was analyzed within a season, and fixed effects included MG, group, trigonometric functions nested within group, and interaction of MG with trigonometric functions nested within group; random effects were animal and residual (Model [I]). A combined analysis of season and group was also investigated with the inclusion of season as a main effect and the nesting of effects within both group and season (Model [C]). In both models, the residual was fitted using an autoregressive covariance structure. A 3-way interaction of MG, season, and trigonometric function periodicities of 24 h (P < 0.001) and 12 h (P < 0.02) for Model [C] indicate that a genotype × environment interaction exists for MG. For MG during summer stress events the additive estimate was 0.10°C (P < 0.01) and

Neural bases of event knowledge and syntax integration in comprehension of complex sentences.

PubMed

Malaia, Evie; Newman, Sharlene

2015-01-01

Comprehension of complex sentences is necessarily supported by both syntactic and semantic knowledge, but what linguistic factors trigger a readers' reliance on a specific system? This functional neuroimaging study orthogonally manipulated argument plausibility and verb event type to investigate cortical bases of the semantic effect on argument comprehension during reading. The data suggest that telic verbs facilitate online processing by means of consolidating the event schemas in episodic memory and by easing the computation of syntactico-thematic hierarchies in the left inferior frontal gyrus. The results demonstrate that syntax-semantics integration relies on trade-offs among a distributed network of regions for maximum comprehension efficiency.

Low-cost soft-copy display accuracy in the detection of pulmonary nodules by single-exposure dual-energy subtraction: comparison with hard-copy viewing.

PubMed

Kido, S; Kuriyama, K; Hosomi, N; Inoue, E; Kuroda, C; Horai, T

2000-02-01

This study endeavored to clarify the usefulness of single-exposure dual-energy subtraction computed radiography (CR) of the chest and the ability of soft-copy images to detect low-contrast simulated pulmonary nodules. Conventional and bone-subtracted CR images of 25 chest phantom image sets with a low-contrast nylon nodule and 25 without a nodule were interpreted by 12 observers (6 radiologists, 6 chest physicians) who rated each on a continuous confidence scale and marked the position of the nodule if one was present. Hard-copy images were 7 x 7-inch laser-printed CR films, and soft-copy images were displayed on a 21-inch noninterlaced color CRT monitor with an optimized dynamic range. Soft-copy images were adjusted to the same size as hard-copy images and were viewed under darkened illumination in the reading room. No significant differences were found between hard- and soft-copy images. In conclusion, the soft-copy images were found to be useful in detecting low-contrast simulated pulmonary nodules.

5 CFR 2638.311 - Copies of published formal advisory opinions.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Copies of published formal advisory... Service § 2638.311 Copies of published formal advisory opinions. Each designated agency ethics official shall receive a copy of each published opinion. Copies will also be available to the public from the...

Fluorescent in situ hybridization (FISH) assessment of chromosome copy number in sperm

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheu, M.; Sigman, M.; Mark, H.F.L.

Approximately 15% of all recognized pregnancies end in spontaneous abortions. The overall frequency of chromosome abnormalities in spontaneous abortions is approximately 50%. Thus aneuploidy is a significant cause of fetal wastage. In addition, structural and numerical abnormalities of chromosomes can also lead to birth defects, developmental delay, mental retardation and infertility. Conventional cytogenetic analysis via GTG- and other banding techniques is a powerful tool in the elucidation of the nature of chromosomal abnormalities. Fluorescent in situ hybridization (FISH) enables detection of numerical chromosomal abnormalities, especially trisomies, in intact cells. Using FISH and commercially available biotin-labeled probes, we have initiated amore » prospective study to assess specific chromosome copy number of preparations of unstained smears from men referred for a male infertility evaluation as well as smears from normal control males chosen randomly from the sample of sperm donors. A total of approximately 19,000 sperm nuclei have been examined thus far. Of those suitable for analysis, 7382 (38.75%) were normal possessing one copy of chromosome 8, 155 (0.81%) were disomic, and 15 (0.079%) had more than two copies of chromosome 8. Comparisons with data available in the literature will be discussed. Work is ongoing to increase the efficiency of hybridization using both reported and previously untried pretreatment and fixation protocols. We have also initiated studies using multicolor FISH with various chromosome enumeration probes. The assay described here is a potentially powerful tool for detecting rare events such as spontaneous germ cell aneuploidy, aneuploidy detected in semen from men with carcinoma in situ of the testis and aneuploidy induced by potential environmental genotoxicants. It can also be utilized for segregation analysis and for correlating chromosome copy number with germ cell morphology.« less

Comparative analyses across cattle breeds reveal the pitfalls caused by artificial and lineage-differential copy number variations

USDA-ARS?s Scientific Manuscript database

Copy number variations (CNV) are well known genomic variants, which often complicate structural and functional genomics studies. Here, we integrated the CNV region (CNVR) result detected from 1,682 Nellore cattle with the equivalent result derived from the Bovine HapMap samples. Through comparing CN...

Screening somatic cell nuclear transfer parameters for generation of transgenic cloned cattle with intragenomic integration of additional gene copies that encode bovine adipocyte-type fatty acid-binding protein (A-FABP).

PubMed

Guo, Yong; Li, Hejuan; Wang, Ying; Yan, Xingrong; Sheng, Xihui; Chang, Di; Qi, Xiaolong; Wang, Xiangguo; Liu, Yunhai; Li, Junya; Ni, Hemin

2017-02-01

Somatic cell nuclear transfer (SCNT) is frequently used to produce transgenic cloned livestock, but it is still associated with low success rates. To our knowledge, we are the first to report successful production of transgenic cattle that overexpress bovine adipocyte-type fatty acid binding proteins (A-FABPs) with the aid of SCNT. Intragenomic integration of additional A-FABP gene copies has been found to be positively correlated with the intramuscular fat content in different farm livestock species. First, we optimized the cloning parameters to produce bovine embryos integrated with A-FABP by SCNT, such as applied voltage field strength and pulse duration for electrofusion, morphology and size of donor cells, and number of donor cells passages. Then, bovine fibroblast cells from Qinchuan cattle were transfected with A-FABP and used as donor cells for SCNT. Hybrids of Simmental and Luxi local cattle were selected as the recipient females for A-FABP transgenic SCNT-derived embryos. The results showed that a field strength of 2.5 kV/cm with two 10-μs duration electrical pulses was ideal for electrofusion, and 4-6th generation circular smooth type donor cells with diameters of 15-25 μm were optimal for producing transgenic bovine embryos by SCNT, and resulted in higher fusion (80%), cleavage (73%), and blastocyst (27%) rates. In addition, we obtained two transgenic cloned calves that expressed additional bovine A-FABP gene copies, as detected by PCR-amplified cDNA sequencing. We proposed a set of optimal protocols to produce transgenic SCNT-derived cattle with intragenomic integration of ectopic A-FABP-inherited exon sequences.

ACTG A5353: A Pilot Study of Dolutegravir Plus Lamivudine for Initial Treatment of Human Immunodeficiency Virus-1 (HIV-1)-infected Participants With HIV-1 RNA <500000 Copies/mL.

PubMed

Taiwo, Babafemi O; Zheng, Lu; Stefanescu, Andrei; Nyaku, Amesika; Bezins, Baiba; Wallis, Carole L; Godfrey, Catherine; Sax, Paul E; Acosta, Edward; Haas, David; Smith, Kimberly Y; Sha, Beverly; Van Dam, Cornelius; Gulick, Roy M

2018-05-17

Limited data exist on initial human immunodeficiency virus type 1 (HIV-1) treatment with dolutegravir plus lamivudine. A5353 is a phase 2, single-arm, pilot study of once-daily dolutegravir (50 mg) plus lamivudine (300 mg) in treatment-naive participants with HIV-1 RNA ≥1000 and <500000 copies/mL. Exclusion criteria included active hepatitis B or major protease, reverse transcriptase, or integrase resistance. The primary efficacy measure was the proportion with HIV-1 RNA <50 copies/mL (FDA [US Food and Drug Administration] Snapshot) at week 24. Virologic failure (VF) was confirmed HIV-1 RNA >400 copies/mL at week 16/20 or >200 copies/mL at or after week 24. Dolutegravir levels and drug resistance testing were performed at VF. One hundred and twenty participants (87% male, median age 30 years, 37 (31%) HIV-1 RNA >100000 copies/mL) initiated study treatment. Median entry HIV-1 RNA and CD4 count were 4.61 log10 copies/mL and 387 cells/mm3. Virologic efficacy at week 24 was 108/120 (90%, confidence interval [83%, 95%]), with comparable results in the >100000 copies/mL and ≤100000 copies/mL strata, that is, 89% (75%, 97%) and 90% (82%, 96%), respectively. Three participants with VF, had undetected plasma dolutegravir at ≥1 time points; the M184V and R263R/K mutations developed in 1 participant. Two participants experienced grade 3 possible/probable treatment-related adverse events; none discontinued treatment due to adverse events. Dolutegravir plus lamivudine demonstrated efficacy in individuals with pretreatment HIV-1 RNA up to 500000 copies/mL in this pilot trial, but a participant developed resistance mutations. NCT02582684.

Establishment and application of event-specific polymerase chain reaction methods for two genetically modified soybean events, A2704-12 and A5547-127.

PubMed

Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao

2011-12-28

For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products.

DNA replication stress restricts ribosomal DNA copy number

PubMed Central

Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

2017-01-01

Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

DNA replication stress restricts ribosomal DNA copy number.

PubMed

Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

2017-09-01

Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

Hacking DNA copy number for circuit engineering.

PubMed

Wu, Feilun; You, Lingchong

2017-07-27

DNA copy number represents an essential parameter in the dynamics of synthetic gene circuits but typically is not explicitly considered. A new study demonstrates how dynamic control of DNA copy number can serve as an effective strategy to program robust oscillations in gene expression circuits.

47 CFR 3.25 - Number of copies.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL AUTHORIZATION AND ADMINISTRATION OF ACCOUNTING... copies. One original and one copy of FCC Form 44, “Application For Certification As An Accounting... commencement of settlement activities to allow time for the Commission to review the application and to allow...

21 CFR 1312.14 - Distribution of copies of import permit.

Code of Federal Regulations, 2012 CFR

2012-04-01

... the proper governmental authorities of the exporting country. (c) The quadruplet copy (Copy 4) shall... original copy (Copy 1) and the bill of lading upon arrival of the merchandise. If a discrepancy is noted... 74715, Nov. 12, 1980; 51 FR 5319, Feb. 13, 1986; 53 FR 48244, Nov. 30, 1988; 62 FR 13969, Mar. 24, 1997] ...

21 CFR 1312.14 - Distribution of copies of import permit.

Code of Federal Regulations, 2011 CFR

2011-04-01

... the proper governmental authorities of the exporting country. (c) The quadruplet copy (Copy 4) shall... original copy (Copy 1) and the bill of lading upon arrival of the merchandise. If a discrepancy is noted... 74715, Nov. 12, 1980; 51 FR 5319, Feb. 13, 1986; 53 FR 48244, Nov. 30, 1988; 62 FR 13969, Mar. 24, 1997] ...

21 CFR 1312.14 - Distribution of copies of import permit.

Code of Federal Regulations, 2014 CFR

2014-04-01

... the proper governmental authorities of the exporting country. (c) The quadruplet copy (Copy 4) shall... original copy (Copy 1) and the bill of lading upon arrival of the merchandise. If a discrepancy is noted... 74715, Nov. 12, 1980; 51 FR 5319, Feb. 13, 1986; 53 FR 48244, Nov. 30, 1988; 62 FR 13969, Mar. 24, 1997] ...

21 CFR 1312.14 - Distribution of copies of import permit.

Code of Federal Regulations, 2010 CFR

2010-04-01

... the proper governmental authorities of the exporting country. (c) The quadruplet copy (Copy 4) shall... original copy (Copy 1) and the bill of lading upon arrival of the merchandise. If a discrepancy is noted... 74715, Nov. 12, 1980; 51 FR 5319, Feb. 13, 1986; 53 FR 48244, Nov. 30, 1988; 62 FR 13969, Mar. 24, 1997] ...

21 CFR 1312.14 - Distribution of copies of import permit.

Code of Federal Regulations, 2013 CFR

2013-04-01

... the proper governmental authorities of the exporting country. (c) The quadruplet copy (Copy 4) shall... original copy (Copy 1) and the bill of lading upon arrival of the merchandise. If a discrepancy is noted... 74715, Nov. 12, 1980; 51 FR 5319, Feb. 13, 1986; 53 FR 48244, Nov. 30, 1988; 62 FR 13969, Mar. 24, 1997] ...

An Integrated Approach for RNA-seq Data Normalization.

PubMed

Yang, Shengping; Mercante, Donald E; Zhang, Kun; Fang, Zhide

2016-01-01

DNA copy number alteration is common in many cancers. Studies have shown that insertion or deletion of DNA sequences can directly alter gene expression, and significant correlation exists between DNA copy number and gene expression. Data normalization is a critical step in the analysis of gene expression generated by RNA-seq technology. Successful normalization reduces/removes unwanted nonbiological variations in the data, while keeping meaningful information intact. However, as far as we know, no attempt has been made to adjust for the variation due to DNA copy number changes in RNA-seq data normalization. In this article, we propose an integrated approach for RNA-seq data normalization. Comparisons show that the proposed normalization can improve power for downstream differentially expressed gene detection and generate more biologically meaningful results in gene profiling. In addition, our findings show that due to the effects of copy number changes, some housekeeping genes are not always suitable internal controls for studying gene expression. Using information from DNA copy number, integrated approach is successful in reducing noises due to both biological and nonbiological causes in RNA-seq data, thus increasing the accuracy of gene profiling.

22 CFR 1429.25 - Number of copies.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Number of copies. 1429.25 Section 1429.25 Foreign Relations FOREIGN SERVICE LABOR RELATIONS BOARD; FEDERAL LABOR RELATIONS AUTHORITY; GENERAL... AND GENERAL REQUIREMENTS General Requirements § 1429.25 Number of copies. Unless otherwise provided by...

Penalized differential pathway analysis of integrative oncogenomics studies.

PubMed

van Wieringen, Wessel N; van de Wiel, Mark A

2014-04-01

Through integration of genomic data from multiple sources, we may obtain a more accurate and complete picture of the molecular mechanisms underlying tumorigenesis. We discuss the integration of DNA copy number and mRNA gene expression data from an observational integrative genomics study involving cancer patients. The two molecular levels involved are linked through the central dogma of molecular biology. DNA copy number aberrations abound in the cancer cell. Here we investigate how these aberrations affect gene expression levels within a pathway using observational integrative genomics data of cancer patients. In particular, we aim to identify differential edges between regulatory networks of two groups involving these molecular levels. Motivated by the rate equations, the regulatory mechanism between DNA copy number aberrations and gene expression levels within a pathway is modeled by a simultaneous-equations model, for the one- and two-group case. The latter facilitates the identification of differential interactions between the two groups. Model parameters are estimated by penalized least squares using the lasso (L1) penalty to obtain a sparse pathway topology. Simulations show that the inclusion of DNA copy number data benefits the discovery of gene-gene interactions. In addition, the simulations reveal that cis-effects tend to be over-estimated in a univariate (single gene) analysis. In the application to real data from integrative oncogenomic studies we show that inclusion of prior information on the regulatory network architecture benefits the reproducibility of all edges. Furthermore, analyses of the TP53 and TGFb signaling pathways between ER+ and ER- samples from an integrative genomics breast cancer study identify reproducible differential regulatory patterns that corroborate with existing literature.

Readability as a Factor in Magazine Ad Copy Recall.

ERIC Educational Resources Information Center

Wesson, David A.

1989-01-01

Examines the relationship between advertising copy readability and advertising effectiveness. Finds that recall is improved when the copy style is either fairly easy or fairly hard to read. Suggests the value of considering copy readability as a potential contributor, though a minor one, to the success of magazine advertising. (RS)

Single-cell sequencing deciphers a convergent evolution of copy number alterations from primary to circulating tumor cells.

PubMed

Gao, Yan; Ni, Xiaohui; Guo, Hua; Su, Zhe; Ba, Yi; Tong, Zhongsheng; Guo, Zhi; Yao, Xin; Chen, Xixi; Yin, Jian; Yan, Zhao; Guo, Lin; Liu, Ying; Bai, Fan; Xie, X Sunney; Zhang, Ning

2017-08-01

Copy number alteration (CNA) is a major contributor to genome instability, a hallmark of cancer. Here, we studied genomic alterations in single primary tumor cells and circulating tumor cells (CTCs) from the same patient. Single-nucleotide variants (SNVs) in single cells from both samples occurred sporadically, whereas CNAs among primary tumor cells emerged accumulatively rather than abruptly, converging toward the CNA in CTCs. Focal CNAs affecting the MYC gene and the PTEN gene were observed only in a minor portion of primary tumor cells but were present in all CTCs, suggesting a strong selection toward metastasis. Single-cell structural variant (SV) analyses revealed a two-step mechanism, a complex rearrangement followed by gene amplification, for the simultaneous formation of anomalous CNAs in multiple chromosome regions. Integrative CNA analyses of 97 CTCs from 23 patients confirmed the convergence of CNAs and revealed single, concurrent, and mutually exclusive CNAs that could be the driving events in cancer metastasis. © 2017 Gao et al.; Published by Cold Spring Harbor Laboratory Press.

Screw-symmetric gravitational waves: A double copy of the vortex

NASA Astrophysics Data System (ADS)

Ilderton, A.

2018-07-01

Plane gravitational waves can admit a sixth 'screw' isometry beyond the usual five. The same is true of plane electromagnetic waves. From the point of view of integrable systems, a sixth isometry would appear to over-constrain particle dynamics in such waves; we show here, though, that no effect of the sixth isometry is independent of those from the usual five. Many properties of particle dynamics in a screw-symmetric gravitational wave are also seen in a (non-plane-wave) electromagnetic vortex; we make this connection explicit, showing that the screw-symmetric gravitational wave is the classical double copy of the vortex.

Allele-specific copy-number discovery from whole-genome and whole-exome sequencing

PubMed Central

Wang, WeiBo; Wang, Wei; Sun, Wei; Crowley, James J.; Szatkiewicz, Jin P.

2015-01-01

Copy-number variants (CNVs) are a major form of genetic variation and a risk factor for various human diseases, so it is crucial to accurately detect and characterize them. It is conceivable that allele-specific reads from high-throughput sequencing data could be leveraged to both enhance CNV detection and produce allele-specific copy number (ASCN) calls. Although statistical methods have been developed to detect CNVs using whole-genome sequence (WGS) and/or whole-exome sequence (WES) data, information from allele-specific read counts has not yet been adequately exploited. In this paper, we develop an integrated method, called AS-GENSENG, which incorporates allele-specific read counts in CNV detection and estimates ASCN using either WGS or WES data. To evaluate the performance of AS-GENSENG, we conducted extensive simulations, generated empirical data using existing WGS and WES data sets and validated predicted CNVs using an independent methodology. We conclude that AS-GENSENG not only predicts accurate ASCN calls but also improves the accuracy of total copy number calls, owing to its unique ability to exploit information from both total and allele-specific read counts while accounting for various experimental biases in sequence data. Our novel, user-friendly and computationally efficient method and a complete analytic protocol is freely available at https://sourceforge.net/projects/asgenseng/. PMID:25883151

The integration processing of the visual and auditory information in videos of real-world events: an ERP study.

PubMed

Liu, Baolin; Wang, Zhongning; Jin, Zhixing

2009-09-11

In real life, the human brain usually receives information through visual and auditory channels and processes the multisensory information, but studies on the integration processing of the dynamic visual and auditory information are relatively few. In this paper, we have designed an experiment, where through the presentation of common scenario, real-world videos, with matched and mismatched actions (images) and sounds as stimuli, we aimed to study the integration processing of synchronized visual and auditory information in videos of real-world events in the human brain, through the use event-related potentials (ERPs) methods. Experimental results showed that videos of mismatched actions (images) and sounds would elicit a larger P400 as compared to videos of matched actions (images) and sounds. We believe that the P400 waveform might be related to the cognitive integration processing of mismatched multisensory information in the human brain. The results also indicated that synchronized multisensory information would interfere with each other, which would influence the results of the cognitive integration processing.

Diversity of human copy number variation and multicopy genes.

PubMed

Sudmant, Peter H; Kitzman, Jacob O; Antonacci, Francesca; Alkan, Can; Malig, Maika; Tsalenko, Anya; Sampas, Nick; Bruhn, Laurakay; Shendure, Jay; Eichler, Evan E

2010-10-29

Copy number variants affect both disease and normal phenotypic variation, but those lying within heavily duplicated, highly identical sequence have been difficult to assay. By analyzing short-read mapping depth for 159 human genomes, we demonstrated accurate estimation of absolute copy number for duplications as small as 1.9 kilobase pairs, ranging from 0 to 48 copies. We identified 4.1 million "singly unique nucleotide" positions informative in distinguishing specific copies and used them to genotype the copy and content of specific paralogs within highly duplicated gene families. These data identify human-specific expansions in genes associated with brain development, reveal extensive population genetic diversity, and detect signatures consistent with gene conversion in the human species. Our approach makes ~1000 genes accessible to genetic studies of disease association.

Impact of duplicate gene copies on phylogenetic analysis and divergence time estimates in butterflies.

PubMed

Pohl, Nélida; Sison-Mangus, Marilou P; Yee, Emily N; Liswi, Saif W; Briscoe, Adriana D

2009-05-13

The increase in availability of genomic sequences for a wide range of organisms has revealed gene duplication to be a relatively common event. Encounters with duplicate gene copies have consequently become almost inevitable in the context of collecting gene sequences for inferring species trees. Here we examine the effect of incorporating duplicate gene copies evolving at different rates on tree reconstruction and time estimation of recent and deep divergences in butterflies. Sequences from ultraviolet-sensitive (UVRh), blue-sensitive (BRh), and long-wavelength sensitive (LWRh) opsins,EF-1 and COI were obtained from 27 taxa representing the five major butterfly families (5535 bp total). Both BRh and LWRh are present in multiple copies in some butterfly lineages and the different copies evolve at different rates. Regardless of the phylogenetic reconstruction method used, we found that analyses of combined data sets using either slower or faster evolving copies of duplicate genes resulted in a single topology in agreement with our current understanding of butterfly family relationships based on morphology and molecules. Interestingly, individual analyses of BRh and LWRh sequences also recovered these family-level relationships. Two different relaxed clock methods resulted in similar divergence time estimates at the shallower nodes in the tree, regardless of whether faster or slower evolving copies were used, with larger discrepancies observed at deeper nodes in the phylogeny. The time of divergence between the monarch butterfly Danaus plexippus and the queen D. gilippus (15.3-35.6 Mya) was found to be much older than the time of divergence between monarch co-mimic Limenitis archippus and red-spotted purple L. arthemis (4.7-13.6 Mya), and overlapping with the time of divergence of the co-mimetic passionflower butterflies Heliconius erato and H. melpomene (13.5-26.1 Mya). Our family-level results are congruent with recent estimates found in the literature and indicate

Impact of duplicate gene copies on phylogenetic analysis and divergence time estimates in butterflies

PubMed Central

Pohl, Nélida; Sison-Mangus, Marilou P; Yee, Emily N; Liswi, Saif W; Briscoe, Adriana D

2009-01-01

Background The increase in availability of genomic sequences for a wide range of organisms has revealed gene duplication to be a relatively common event. Encounters with duplicate gene copies have consequently become almost inevitable in the context of collecting gene sequences for inferring species trees. Here we examine the effect of incorporating duplicate gene copies evolving at different rates on tree reconstruction and time estimation of recent and deep divergences in butterflies. Results Sequences from ultraviolet-sensitive (UVRh), blue-sensitive (BRh), and long-wavelength sensitive (LWRh) opsins,EF-1α and COI were obtained from 27 taxa representing the five major butterfly families (5535 bp total). Both BRh and LWRh are present in multiple copies in some butterfly lineages and the different copies evolve at different rates. Regardless of the phylogenetic reconstruction method used, we found that analyses of combined data sets using either slower or faster evolving copies of duplicate genes resulted in a single topology in agreement with our current understanding of butterfly family relationships based on morphology and molecules. Interestingly, individual analyses of BRh and LWRh sequences also recovered these family-level relationships. Two different relaxed clock methods resulted in similar divergence time estimates at the shallower nodes in the tree, regardless of whether faster or slower evolving copies were used, with larger discrepancies observed at deeper nodes in the phylogeny. The time of divergence between the monarch butterfly Danaus plexippus and the queen D. gilippus (15.3–35.6 Mya) was found to be much older than the time of divergence between monarch co-mimic Limenitis archippus and red-spotted purple L. arthemis (4.7–13.6 Mya), and overlapping with the time of divergence of the co-mimetic passionflower butterflies Heliconius erato and H. melpomene (13.5–26.1 Mya). Our family-level results are congruent with recent estimates found in

Copy-number and gene dependency analysis reveals partial copy loss of wild-type SF3B1 as a novel cancer vulnerability. | Office of Cancer Genomics

Cancer.gov

Genomic instability is a hallmark of human cancer, and results in widespread somatic copy number alterations. We used a genome-scale shRNA viability screen in human cancer cell lines to systematically identify genes that are essential in the context of particular copy-number alterations (copy-number associated gene dependencies). The most enriched class of copy-number associated gene dependencies was CYCLOPS (Copy-number alterations Yielding Cancer Liabilities Owing to Partial losS) genes, and spliceosome components were the most prevalent.

36 CFR § 703.20 - File copies.

Code of Federal Regulations, 2013 CFR

2013-07-01

... § 703.20 Parks, Forests, and Public Property LIBRARY OF CONGRESS DISCLOSURE OR PRODUCTION OF... Where the Library Is Not a Party § 703.20 File copies. The Office of the General Counsel will maintain the official file of copies of all demands served on the Library and deciding officials' responses. ...

18 CFR 33.8 - Number of copies.

Code of Federal Regulations, 2010 CFR

2010-04-01

... ENERGY REGULATIONS UNDER THE FEDERAL POWER ACT APPLICATIONS UNDER FEDERAL POWER ACT SECTION 203 § 33.8 Number of copies. An original and eight copies of the application under this part must be submitted. If..., the applicant must submit all such information in electronic format (e.g., on computer diskette or on...

14 CFR 221.92 - Number of copies required.

Code of Federal Regulations, 2010 CFR

2010-01-01

... PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Filing Tariff Publications With Department § 221.92 Number of copies required. Two copies of each paper tariff, tariff revision and adoption notice to be filed shall be sent to...

Fast Bayesian Inference of Copy Number Variants using Hidden Markov Models with Wavelet Compression

PubMed Central

Wiedenhoeft, John; Brugel, Eric; Schliep, Alexander

2016-01-01

By integrating Haar wavelets with Hidden Markov Models, we achieve drastically reduced running times for Bayesian inference using Forward-Backward Gibbs sampling. We show that this improves detection of genomic copy number variants (CNV) in array CGH experiments compared to the state-of-the-art, including standard Gibbs sampling. The method concentrates computational effort on chromosomal segments which are difficult to call, by dynamically and adaptively recomputing consecutive blocks of observations likely to share a copy number. This makes routine diagnostic use and re-analysis of legacy data collections feasible; to this end, we also propose an effective automatic prior. An open source software implementation of our method is available at http://schlieplab.org/Software/HaMMLET/ (DOI: 10.5281/zenodo.46262). This paper was selected for oral presentation at RECOMB 2016, and an abstract is published in the conference proceedings. PMID:27177143

Vocal copying of individually distinctive signature whistles in bottlenose dolphins

PubMed Central

King, Stephanie L.; Sayigh, Laela S.; Wells, Randall S.; Fellner, Wendi; Janik, Vincent M.

2013-01-01

Vocal learning is relatively common in birds but less so in mammals. Sexual selection and individual or group recognition have been identified as major forces in its evolution. While important in the development of vocal displays, vocal learning also allows signal copying in social interactions. Such copying can function in addressing or labelling selected conspecifics. Most examples of addressing in non-humans come from bird song, where matching occurs in an aggressive context. However, in other animals, addressing with learned signals is very much an affiliative signal. We studied the function of vocal copying in a mammal that shows vocal learning as well as complex cognitive and social behaviour, the bottlenose dolphin (Tursiops truncatus). Copying occurred almost exclusively between close associates such as mother–calf pairs and male alliances during separation and was not followed by aggression. All copies were clearly recognizable as such because copiers consistently modified some acoustic parameters of a signal when copying it. We found no evidence for the use of copying in aggression or deception. This use of vocal copying is similar to its use in human language, where the maintenance of social bonds appears to be more important than the immediate defence of resources. PMID:23427174

Molecular Characterization of Transgenic Events Using Next Generation Sequencing Approach.

PubMed

Guttikonda, Satish K; Marri, Pradeep; Mammadov, Jafar; Ye, Liang; Soe, Khaing; Richey, Kimberly; Cruse, James; Zhuang, Meibao; Gao, Zhifang; Evans, Clive; Rounsley, Steve; Kumpatla, Siva P

2016-01-01

Demand for the commercial use of genetically modified (GM) crops has been increasing in light of the projected growth of world population to nine billion by 2050. A prerequisite of paramount importance for regulatory submissions is the rigorous safety assessment of GM crops. One of the components of safety assessment is molecular characterization at DNA level which helps to determine the copy number, integrity and stability of a transgene; characterize the integration site within a host genome; and confirm the absence of vector DNA. Historically, molecular characterization has been carried out using Southern blot analysis coupled with Sanger sequencing. While this is a robust approach to characterize the transgenic crops, it is both time- and resource-consuming. The emergence of next-generation sequencing (NGS) technologies has provided highly sensitive and cost- and labor-effective alternative for molecular characterization compared to traditional Southern blot analysis. Herein, we have demonstrated the successful application of both whole genome sequencing and target capture sequencing approaches for the characterization of single and stacked transgenic events and compared the results and inferences with traditional method with respect to key criteria required for regulatory submissions.

Genomic copy number gains of ErbB family members predict poor clinical outcomes in glioma patients

PubMed Central

Liu, Rui; Qu, Yiping; Chen, Lihong; Pu, Jun; Ma, Sharui; Zhang, Xiaozhi; Yang, Qi; Shi, Bingyin; Hou, Peng; Ji, Meiju

2017-01-01

The aim of this study was to investigate copy number of ErbB family members (including EGFR, HER2, HER3 and HER4) in a cohort of gliomas and benign meningiomas (control subjects), and explore the associations of their copy number with clinicopathological characteristics and clinical outcomes of glioma patients. Using real-time quantitative PCR assay, we demonstrated that copy number of EGFR, HER2, HER3 and HER4 in glioma patients was significantly increased compared to control subjects. Moreover, our data also showed that the risk of cancer-related death was positively associated with copy number gain (CNG) of EGFR, HER3 and HER4, but not HER2. CNG of EGFR and HER2 was positively related to radiotherapy, while CNG of HER3 and HER4 was negatively related to chemotherapy. Importantly, EGFR CNG significantly shortened median survival times of glioma patients regardless of gender, tumor grade and therapeutic regimens. Stratified analysis showed that CNG of HER2-4 almost did not influence the survival of male patients, patients with high-grade tumors and patients receiving chemotherapy, but dramatically shortened median survival times of female patients, those with low-grade tumors and those receiving radiotherapy. Collectively, our data not only demonstrate that the members of ErbB family are frequently amplified in gliomas, but also suggest that these common genetic events may be prognostic factors for poor clinical outcomes in glioma patients. PMID:29190914

Integrated genomics for pinpointing survival loci within arm-level somatic copy number alterations

PubMed Central

Roy, David M.; Walsh, Logan A.; Desrichard, Alexis; Huse, Jason T.; Wu, Wei; Gao, JianJiong; Bose, Promita; Lee, William; Chan, Timothy A.

2016-01-01

SUMMARY The identification of driver loci underlying arm-level somatic copy number alterations (SCNAs) in cancer has remained challenging and incomplete. Here we assess the relative impact and present a detailed landscape of arm-level SCNAs in 10985 patient samples across 33 cancer types from The Cancer Genome Atlas (TCGA). Further, using chromosome 9p loss in lower grade glioma (LGG) as a model, we employ a unique multi-tiered genomic dissection strategy using 540 patients from 3 independent LGG datasets to identify genetic loci that govern tumor aggressiveness and poor survival. This comprehensive approach uncovered several 9p loss-specific prognostic markers, validated existing ones, and re-defined the impact of CDKN2A loss in LGG. PMID:27165745

The Differential Effects of Two Self-Managed Math Instruction Procedures: Cover, Copy, and Compare versus Copy, Cover, and Compare

ERIC Educational Resources Information Center

Grafman, Joel M.; Cates, Gary L.

2010-01-01

This study compared the fluency and error rates produced when using the Cover, Copy, and Compare (CCC) and a modified CCC procedure (MCCC) called Copy, Cover, and Compare to complete subtraction math problems. Two second-grade classrooms consisting of 47 total students participated in the study. The following items were administered to…

Physical Mapping of Amplified Copies of the 5-Enolpyruvylshikimate-3-Phosphate Synthase Gene in Glyphosate-Resistant Amaranthus tuberculatus1[OPEN

PubMed Central

Dillon, Andrew; Varanasi, Vijay K.; Koo, Dal-Hoe; Nakka, Sridevi; Peterson, Dallas E.; Friebe, Bernd

2017-01-01

Recent and rapid evolution of resistance to glyphosate, the most widely used herbicides, in several weed species, including common waterhemp (Amaranthus tuberculatus), poses a serious threat to sustained crop production. We report that glyphosate resistance in A. tuberculatus was due to amplification of the 5-enolpyruvylshikimate-3-P synthase (EPSPS) gene, which encodes the molecular target of glyphosate. There was a positive correlation between EPSPS gene copies and its transcript expression. We analyzed the distribution of EPSPS copies in the genome of A. tuberculatus using fluorescence in situ hybridization on mitotic metaphase chromosomes and interphase nuclei. Fluorescence in situ hybridization analysis mapped the EPSPS gene to pericentromeric regions of two homologous chromosomes in glyphosate sensitive A. tuberculatus. In glyphosate-resistant plants, a cluster of EPSPS genes on the pericentromeric region on one pair of homologous chromosomes was detected. Intriguingly, two highly glyphosate-resistant plants harbored an additional chromosome with several EPSPS copies besides the native chromosome pair with EPSPS copies. These results suggest that the initial event of EPSPS gene duplication may have occurred because of unequal recombination mediated by repetitive DNA. Subsequently, gene amplification may have resulted via several other mechanisms, such as chromosomal rearrangements, deletion/insertion, transposon-mediated dispersion, or possibly by interspecific hybridization. This report illustrates the physical mapping of amplified EPSPS copies in A. tuberculatus. PMID:27956489

Integrated DNA methylation and copy-number profiling identify three clinically and biologically relevant groups of anaplastic glioma.

PubMed

Wiestler, Benedikt; Capper, David; Sill, Martin; Jones, David T W; Hovestadt, Volker; Sturm, Dominik; Koelsche, Christian; Bertoni, Anna; Schweizer, Leonille; Korshunov, Andrey; Weiß, Elisa K; Schliesser, Maximilian G; Radbruch, Alexander; Herold-Mende, Christel; Roth, Patrick; Unterberg, Andreas; Hartmann, Christian; Pietsch, Torsten; Reifenberger, Guido; Lichter, Peter; Radlwimmer, Bernhard; Platten, Michael; Pfister, Stefan M; von Deimling, Andreas; Weller, Michael; Wick, Wolfgang

2014-10-01

The outcome of patients with anaplastic gliomas varies considerably. Whether a molecular classification of anaplastic gliomas based on large-scale genomic or epigenomic analyses is superior to histopathology for reflecting distinct biological groups, predicting outcomes and guiding therapy decisions has yet to be determined. Epigenome-wide DNA methylation analysis, using a platform which also allows the detection of copy-number aberrations, was performed in a cohort of 228 patients with anaplastic gliomas (astrocytomas, oligoastrocytomas, and oligodendrogliomas), including 115 patients of the NOA-04 trial. We further compared these tumors with a group of 55 glioblastomas. Unsupervised clustering of DNA methylation patterns revealed two main groups correlated with IDH status: CpG island methylator phenotype (CIMP) positive (77.5 %) or negative (22.5 %). CIMP(pos) (IDH mutant) tumors showed a further separation based on copy-number status of chromosome arms 1p and 19q. CIMP(neg) (IDH wild type) tumors showed hallmark copy-number alterations of glioblastomas, and clustered together with CIMP(neg) glioblastomas without forming separate groups based on WHO grade. Notably, there was no molecular evidence for a distinct biological entity representing anaplastic oligoastrocytoma. Tumor classification based on CIMP and 1p/19q status was significantly associated with survival, allowing a better prediction of outcome than the current histopathological classification: patients with CIMP(pos) tumors with 1p/19q codeletion (CIMP-codel) had the best prognosis, followed by patients with CIMP(pos) tumors but intact 1p/19q status (CIMP-non-codel). Patients with CIMP(neg) anaplastic gliomas (GBM-like) had the worst prognosis. Collectively, our data suggest that anaplastic gliomas can be grouped by IDH and 1p/19q status into three molecular groups that show clear links to underlying biology and a significant association with clinical outcome in a prospective trial cohort.

Protocols for Copying and Proofreading in Template-Assisted Polymerization

NASA Astrophysics Data System (ADS)

Pigolotti, Simone; Sartori, Pablo

2016-03-01

We discuss how information encoded in a template polymer can be stochastically copied into a copy polymer. We consider four different stochastic copy protocols of increasing complexity, inspired by building blocks of the mRNA translation pathway. In the first protocol, monomer incorporation occurs in a single stochastic transition. We then move to a more elaborate protocol in which an intermediate step can be used for error correction. Finally, we discuss the operating regimes of two kinetic proofreading protocols: one in which proofreading acts from the final copying step, and one in which it acts from an intermediate step. We review known results for these models and, in some cases, extend them to analyze all possible combinations of energetic and kinetic discrimination. We show that, in each of these protocols, only a limited number of these combinations leads to an improvement of the overall copying accuracy.

New digital anti-copy/scan and verification technologies

NASA Astrophysics Data System (ADS)

Phillips, George K.

2004-06-01

This white paper reviews the method for making bearer printed information indistinguishable on a non-copyable substrate when a copied attempt is made on either an analog or digital electrostatic photocopier device. In 1995 we received patent number 5,704,651 for a non-copyable technology trademarked MetallicSafe. In this patent the abstract describes the usage of a reflective layer, formed on a complex pattern region and having graphic or font size shapes and type coordinating to particular patterns in the complex pattern region. The technology used in this patent has now been improved and evolved to new methods of creating a non-copyable substrate trademarked CopySafe+. CopySafe+ is formed of a metallic specular light reflector, a white camouflaged diffused light reflector, and the content information 'light absorption' layer. The synthesizing of these layers on a substrate creates dynamic camouflaged interference patterns and the phenomena of image chaos on a copy. In short, the orientation of a plurality of spectral and diffused light reflection camouflaged layers, mixed and coordinated with light absorption printed information, inhibits the copying device from reproducing the printed content.

"Dear Teacher, Johnny Copied."

ERIC Educational Resources Information Center

Jackson, Louise A.; And Others

1987-01-01

Presents the problem of intentional or unintentional plagiarism on the part of young students, several possible causes for it, and offers ways teachers can help students avoid copying and understand the value of owning one's writing. (JC)

Gene copy number variation and its significance in cyanobacterial phylogeny

PubMed Central

2012-01-01

Background In eukaryotes, variation in gene copy numbers is often associated with deleterious effects, but may also have positive effects. For prokaryotes, studies on gene copy number variation are rare. Previous studies have suggested that high numbers of rRNA gene copies can be advantageous in environments with changing resource availability, but further association of gene copies and phenotypic traits are not documented. We used one of the morphologically most diverse prokaryotic phyla to test whether numbers of gene copies are associated with levels of cell differentiation. Results We implemented a search algorithm that identified 44 genes with highly conserved copies across 22 fully sequenced cyanobacterial taxa. For two very basal cyanobacterial species, Gloeobacter violaceus and a thermophilic Synechococcus species, distinct phylogenetic positions previously found were supported by identical protein coding gene copy numbers. Furthermore, we found that increased ribosomal gene copy numbers showed a strong correlation to cyanobacteria capable of terminal cell differentiation. Additionally, we detected extremely low variation of 16S rRNA sequence copies within the cyanobacteria. We compared our results for 16S rRNA to three other eubacterial phyla (Chroroflexi, Spirochaetes and Bacteroidetes). Based on Bayesian phylogenetic inference and the comparisons of genetic distances, we could confirm that cyanobacterial 16S rRNA paralogs and orthologs show significantly stronger conservation than found in other eubacterial phyla. Conclusions A higher number of ribosomal operons could potentially provide an advantage to terminally differentiated cyanobacteria. Furthermore, we suggest that 16S rRNA gene copies in cyanobacteria are homogenized by both concerted evolution and purifying selection. In addition, the small ribosomal subunit in cyanobacteria appears to evolve at extraordinary slow evolutionary rates, an observation that has been made previously for morphological

Detection of clinically relevant copy number alterations in oral cancer progression using multiplexed droplet digital PCR.

PubMed

Hughesman, Curtis B; Lu, X J David; Liu, Kelly Y P; Zhu, Yuqi; Towle, Rebecca M; Haynes, Charles; Poh, Catherine F

2017-09-19

Copy number alterations (CNAs), a common genomic event during carcinogenesis, are known to affect a large fraction of the genome. Common recurrent gains or losses of specific chromosomal regions occur at frequencies that they may be considered distinctive features of tumoral cells. Here we introduce a novel multiplexed droplet digital PCR (ddPCR) assay capable of detecting recurrent CNAs that drive tumorigenesis of oral squamous cell carcinoma. Applied to DNA extracted from oral cell lines and clinical samples of various disease stages, we found good agreement between CNAs detected by our ddPCR assay with those previously reported using comparative genomic hybridization or single nucleotide polymorphism arrays. Furthermore, we demonstrate that the ability to target specific locations of the genome permits detection of clinically relevant oncogenic events such as small, submicroscopic homozygous deletions. Additional capabilities of the multiplexed ddPCR assay include the ability to infer ploidy level, quantify the change in copy number of target loci with high-level gains, and simultaneously assess the status and viral load for high-risk human papillomavirus types 16 and 18. This novel multiplexed ddPCR assay therefore may have clinical value in differentiating between benign oral lesions from those that are at risk of progressing to oral cancer.

New ΦBT1 site-specific integrative vectors with neutral phenotype in Streptomyces.

PubMed

Gonzalez-Quiñonez, Nathaly; López-García, María Teresa; Yagüe, Paula; Rioseras, Beatriz; Pisciotta, Annalisa; Alduina, Rosa; Manteca, Ángel

2016-03-01

Integrative plasmids are one of the best options to introduce genes in low copy and in a stable form into bacteria. The ΦC31-derived plasmids constitute the most common integrative vectors used in Streptomyces. They integrate at different positions (attB and pseudo-attB sites) generating different mutations. The less common ΦBT1-derived vectors integrate at the unique attB site localized in the SCO4848 gene (S. coelicolor genome) or their orthologues in other streptomycetes. This work demonstrates that disruption of SCO4848 generates a delay in spore germination. SCO4848 is co-transcribed with SCO4849, and the spore germination phenotype is complemented by SCO4849. Plasmids pNG1-4 were created by modifying the ΦBT1 integrative vector pMS82 by introducing a copy of SCO4849 under the control of the promoter region of SCO4848. pNG2 and pNG4 also included a copy of the P ermE * in order to facilitate gene overexpression. pNG3 and pNG4 harboured a copy of the bla gene (ampicillin resistance) to facilitate selection in E. coli. pNG1-4 are the only integrative vectors designed to produce a neutral phenotype when they are integrated into the Streptomyces genome. The experimental approach developed in this work can be applied to create phenotypically neutral integrative plasmids in other bacteria.

38 CFR 1.526 - Copies of records and papers.

Code of Federal Regulations, 2010 CFR

2010-07-01

... papers. 1.526 Section 1.526 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS... Copies of records and papers. (a) Any person desiring a copy of any record or document in the custody of... plain one-sided paper copies of a standard size (81/2″ × 11″; 81/2″ × 14″; 11″ × 14″) $0.15 per page...

38 CFR 1.526 - Copies of records and papers.

Code of Federal Regulations, 2011 CFR

2011-07-01

... papers. 1.526 Section 1.526 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS... Copies of records and papers. (a) Any person desiring a copy of any record or document in the custody of... plain one-sided paper copies of a standard size (81/2″ × 11″; 81/2″ × 14″; 11″ × 14″) $0.15 per page...

Different Facets of Copy Number Changes: Permanent, Transient, and Adaptive

PubMed Central

Mishra, Sweta

2016-01-01

Chromosomal copy number changes are frequently associated with harmful consequences and are thought of as an underlying mechanism for the development of diseases. However, changes in copy number are observed during development and occur during normal biological processes. In this review, we highlight the causes and consequences of copy number changes in normal physiologic processes as well as cover their associations with cancer and acquired drug resistance. We discuss the permanent and transient nature of copy number gains and relate these observations to a new mechanism driving transient site-specific copy gains (TSSGs). Finally, we discuss implications of TSSGs in generating intratumoral heterogeneity and tumor evolution and how TSSGs can influence the therapeutic response in cancer. PMID:26755558

Management of gastric mucosa-associated lymphoid tissue lymphoma in patients with extra copies of the MALT1 gene.

PubMed

Iwamuro, Masaya; Takenaka, Ryuta; Nakagawa, Masahiro; Moritou, Yuki; Saito, Shunsuke; Hori, Shinichiro; Inaba, Tomoki; Kawai, Yoshinari; Toyokawa, Tatsuya; Tanaka, Takehiro; Yoshino, Tadashi; Okada, Hiroyuki

2017-09-07

To identify the clinical features of gastric mucosa-associated lymphoid tissue (MALT) lymphoma with extra copies of MALT1. This is a multi-centered, retrospective study. We reviewed 146 patients with MALT lymphoma in the stomach who underwent fluorescence in situ hybridization analysis for t(11;18) translocation. Patients were subdivided into patients without t(11;18) translocation or extra copies of MALT1 (Group A, n = 88), patients with t(11;18) translocation (Group B, n = 27), and patients with extra copies of MALT1 (Group C, n = 31). The clinical background, treatment, and outcomes of each group were investigated. Groups A and C showed slight female predominance, whereas Group B showed slight male predominance. Mean ages and clinical stages at lymphoma diagnosis were not different between groups. Complete response was obtained in 61 patients in Group A (69.3%), 22 in Group B (81.5%), and 21 in Group C (67.7%). Helicobacter pylori (H. pylori) eradication alone resulted in complete remission in 44 patients in Group A and 13 in Group C. In Group B, 14 patients underwent radiotherapy alone, which resulted in lymphoma disappearance. Although the difference was not statistically significant, event-free survival in Group C tended to be inferior to that in Group A (P = 0.10). Patients with t(11;18) translocation should be treated differently from others. Patients with extra copies of MALT1 could be initially treated with H. pylori eradication, similar to patients without t(11;18) translocation or extra copies of MALT1.

Management of gastric mucosa-associated lymphoid tissue lymphoma in patients with extra copies of the MALT1 gene

PubMed Central

Iwamuro, Masaya; Takenaka, Ryuta; Nakagawa, Masahiro; Moritou, Yuki; Saito, Shunsuke; Hori, Shinichiro; Inaba, Tomoki; Kawai, Yoshinari; Toyokawa, Tatsuya; Tanaka, Takehiro; Yoshino, Tadashi; Okada, Hiroyuki

2017-01-01

AIM To identify the clinical features of gastric mucosa-associated lymphoid tissue (MALT) lymphoma with extra copies of MALT1. METHODS This is a multi-centered, retrospective study. We reviewed 146 patients with MALT lymphoma in the stomach who underwent fluorescence in situ hybridization analysis for t(11;18) translocation. Patients were subdivided into patients without t(11;18) translocation or extra copies of MALT1 (Group A, n = 88), patients with t(11;18) translocation (Group B, n = 27), and patients with extra copies of MALT1 (Group C, n = 31). The clinical background, treatment, and outcomes of each group were investigated. RESULTS Groups A and C showed slight female predominance, whereas Group B showed slight male predominance. Mean ages and clinical stages at lymphoma diagnosis were not different between groups. Complete response was obtained in 61 patients in Group A (69.3%), 22 in Group B (81.5%), and 21 in Group C (67.7%). Helicobacter pylori (H. pylori) eradication alone resulted in complete remission in 44 patients in Group A and 13 in Group C. In Group B, 14 patients underwent radiotherapy alone, which resulted in lymphoma disappearance. Although the difference was not statistically significant, event-free survival in Group C tended to be inferior to that in Group A (P = 0.10). CONCLUSION Patients with t(11;18) translocation should be treated differently from others. Patients with extra copies of MALT1 could be initially treated with H. pylori eradication, similar to patients without t(11;18) translocation or extra copies of MALT1. PMID:28970731

Beyond Copying: A Comparison of Multi-Component Interventions on Chinese Early Literacy Skills

ERIC Educational Resources Information Center

Wang, Ying; McBride, Catherine

2017-01-01

This study assessed the effects of three intervention programs for Chinese literacy development in kindergartners: the copying (Copy) program; a combined program of copying and Pinyin knowledge (Copy + Pinyin); and a combined program of copying and morphological awareness (Copy + MA). Ninety-seven kindergarteners aged 5-7 years in mainland China…

29 CFR 1956.64 - Location of plan for inspection and copying.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Location of plan for inspection and copying. 1956.64... PLANS New Jersey § 1956.64 Location of plan for inspection and copying. A copy of the plan may be inspected and copied during normal business hours at the following locations: Office of State Programs, U.S...

18. Wayne Chandler, Photographer, August 1993 Photographic copy of Xerox ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

18. Wayne Chandler, Photographer, August 1993 Photographic copy of Xerox copy of original plans, dated 1932, by Wisconsin Highway Commission. Xerox copy in possession of Westbrook Associated Engineers, Spring Green, Wisconsin. SUPERSTRUCTURE DETAILS. - Chippewa River Bridge, Spanning Chippewa River at State Highway 35, Nelson, Buffalo County, WI

16. Wayne Chandler, Photographer, August 1993 Photographic copy of Xerox ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

16. Wayne Chandler, Photographer, August 1993 Photographic copy of Xerox copy of original plans, dated 1932, by Wisconsin Highway Commission. Xerox copy in possession of Westbrook Associated Engineers, Spring Green, Wisconsin. SUPERSTRUCTURE DETAILS. - Chippewa River Bridge, Spanning Chippewa River at State Highway 35, Nelson, Buffalo County, WI

17. Wayne Chandler, Photographer, August 1993 Photographic copy of Xerox ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

17. Wayne Chandler, Photographer, August 1993 Photographic copy of Xerox copy of original plans, dated 1932, by Wisconsin Highway Commission. Xerox copy in possession of Westbrook Associated Engineers, Spring Green, Wisconsin. SUPERSTRUCTURE DETAILS. - Chippewa River Bridge, Spanning Chippewa River at State Highway 35, Nelson, Buffalo County, WI

The relationship between mitochondrial DNA copy number and stallion sperm function.

PubMed

Darr, Christa R; Moraes, Luis E; Connon, Richard E; Love, Charles C; Teague, Sheila; Varner, Dickson D; Meyers, Stuart A

2017-05-01

Mitochondrial DNA (mtDNA) copy number has been utilized as a measure of sperm quality in several species including mice, dogs, and humans, and has been suggested as a potential biomarker of fertility in stallion sperm. The results of the present study extend this recent discovery using sperm samples from American Quarter Horse stallions of varying age. By determining copy number of three mitochondrial genes, cytochrome b (CYTB), NADH dehydrogenase 1 (ND1) and NADH dehydrogenase 4 (ND4), instead of a single gene, we demonstrate an improved understanding of mtDNA fate in stallion sperm mitochondria following spermatogenesis. Sperm samples from 37 stallions ranging from 3 to 24 years old were collected at four breeding ranches in north and central Texas during the 2015 breeding season. Samples were analyzed for sperm motion characteristics, nuclear DNA denaturability and mtDNA copy number. Mitochondrial DNA content in individual sperm was determined by real-time qPCR and normalized with a single copy nuclear gene, Beta actin. Exploratory correlation analysis revealed that total motility was negatively correlated with CYTB copy number and sperm chromatin structure. Stallion age did not have a significant effect on copy number for any of the genes. Copy number differences existed between the three genes with CYTB having the greatest number of copies (20.6 ± 1.2 copies, range: 6.0 to 41.1) followed by ND4 (15.5 ± 0.8 copies, range: 6.7 to 27.8) and finally ND1 (12.0 ± 1.0 copies, range: 0.4 to 26.6) (P < 0.05). Varying copy number across mitochondrial genes is likely to be a result of mtDNA fragmentation and degradation since downregulation of sperm mtDNA occurs during spermatogenesis and may be important for normal sperm function. Beta regression analysis suggested that for every unit increase in mtDNA copy number of CYTB, there was a 4% decrease in the odds of sperm movement (P = 0.001). Influential analysis suggested that results are robust and not highly

A Likelihood-Based Framework for Association Analysis of Allele-Specific Copy Numbers.

PubMed

Hu, Y J; Lin, D Y; Sun, W; Zeng, D

2014-10-01

Copy number variants (CNVs) and single nucleotide polymorphisms (SNPs) co-exist throughout the human genome and jointly contribute to phenotypic variations. Thus, it is desirable to consider both types of variants, as characterized by allele-specific copy numbers (ASCNs), in association studies of complex human diseases. Current SNP genotyping technologies capture the CNV and SNP information simultaneously via fluorescent intensity measurements. The common practice of calling ASCNs from the intensity measurements and then using the ASCN calls in downstream association analysis has important limitations. First, the association tests are prone to false-positive findings when differential measurement errors between cases and controls arise from differences in DNA quality or handling. Second, the uncertainties in the ASCN calls are ignored. We present a general framework for the integrated analysis of CNVs and SNPs, including the analysis of total copy numbers as a special case. Our approach combines the ASCN calling and the association analysis into a single step while allowing for differential measurement errors. We construct likelihood functions that properly account for case-control sampling and measurement errors. We establish the asymptotic properties of the maximum likelihood estimators and develop EM algorithms to implement the corresponding inference procedures. The advantages of the proposed methods over the existing ones are demonstrated through realistic simulation studies and an application to a genome-wide association study of schizophrenia. Extensions to next-generation sequencing data are discussed.

Allele-specific copy-number discovery from whole-genome and whole-exome sequencing.

PubMed

Wang, WeiBo; Wang, Wei; Sun, Wei; Crowley, James J; Szatkiewicz, Jin P

2015-08-18

Copy-number variants (CNVs) are a major form of genetic variation and a risk factor for various human diseases, so it is crucial to accurately detect and characterize them. It is conceivable that allele-specific reads from high-throughput sequencing data could be leveraged to both enhance CNV detection and produce allele-specific copy number (ASCN) calls. Although statistical methods have been developed to detect CNVs using whole-genome sequence (WGS) and/or whole-exome sequence (WES) data, information from allele-specific read counts has not yet been adequately exploited. In this paper, we develop an integrated method, called AS-GENSENG, which incorporates allele-specific read counts in CNV detection and estimates ASCN using either WGS or WES data. To evaluate the performance of AS-GENSENG, we conducted extensive simulations, generated empirical data using existing WGS and WES data sets and validated predicted CNVs using an independent methodology. We conclude that AS-GENSENG not only predicts accurate ASCN calls but also improves the accuracy of total copy number calls, owing to its unique ability to exploit information from both total and allele-specific read counts while accounting for various experimental biases in sequence data. Our novel, user-friendly and computationally efficient method and a complete analytic protocol is freely available at https://sourceforge.net/projects/asgenseng/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

15. Wayne Chandler, Photographer, August 1993 Photographic copy of Xerox ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

15. Wayne Chandler, Photographer, August 1993 Photographic copy of Xerox copy of original plans, dated 1932, by Wisconsin Highway Commission. Xerox copy in possession of Westbrook Associated Engineers, Spring Green, Wisconsin. GENERAL PLAN AND ELEVATION OF BRIDGE. - Chippewa River Bridge, Spanning Chippewa River at State Highway 35, Nelson, Buffalo County, WI

Radiative double copy for Einstein-Yang-Mills theory

NASA Astrophysics Data System (ADS)

Chester, David

2018-04-01

Recently, a double-copy formalism was used to calculate gravitational radiation from classical Yang-Mills radiation solutions. This work shows that the Yang-Mills theory coupled to a biadjoint scalar field admits a radiative double copy that agrees with solutions in the Einstein-Yang-Mills theory at the lowest finite order. Within this context, the trace-reversed metric h¯μ ν is a natural double copy of the gauge boson Aμ a . This work provides additional evidence that solutions in gauge and gravity theories are related, even though their respective Lagrangians and nonlinear equations of motion appear to be different.

Hard copies for digital medical images: an overview

NASA Astrophysics Data System (ADS)

Blume, Hartwig R.; Muka, Edward

1995-04-01

This paper is a condensed version of an invited overview on the technology of film hard-copies used in radiology. Because the overview was given to an essentially nonmedical audience, the reliance on film hard-copies in radiology is outlined in greater detail. The overview is concerned with laser image recorders generating monochrome prints on silver-halide films. The basic components of laser image recorders are sketched. The paper concentrates on the physical parameters - characteristic function, dynamic range, digitization resolution, modulation transfer function, and noise power spectrum - which define image quality and information transfer capability of the printed image. A preliminary approach is presented to compare the printed image quality with noise in the acquired image as well as with the noise of state-of- the-art cathode-ray-tube display systems. High-performance laser-image- recorder/silver-halide-film/light-box systems are well capable of reproducing acquired radiologic information. Most recently development was begun toward a display function standard for soft-copy display systems to facilitate similarity of image presentation between different soft-copy displays as well as between soft- and hard-copy displays. The standard display function is based on perceptional linearization. The standard is briefly reviewed to encourage the printer industry to adopt it, too.

CNV Workshop: an integrated platform for high-throughput copy number variation discovery and clinical diagnostics.

PubMed

Gai, Xiaowu; Perin, Juan C; Murphy, Kevin; O'Hara, Ryan; D'arcy, Monica; Wenocur, Adam; Xie, Hongbo M; Rappaport, Eric F; Shaikh, Tamim H; White, Peter S

2010-02-04

Recent studies have shown that copy number variations (CNVs) are frequent in higher eukaryotes and associated with a substantial portion of inherited and acquired risk for various human diseases. The increasing availability of high-resolution genome surveillance platforms provides opportunity for rapidly assessing research and clinical samples for CNV content, as well as for determining the potential pathogenicity of identified variants. However, few informatics tools for accurate and efficient CNV detection and assessment currently exist. We developed a suite of software tools and resources (CNV Workshop) for automated, genome-wide CNV detection from a variety of SNP array platforms. CNV Workshop includes three major components: detection, annotation, and presentation of structural variants from genome array data. CNV detection utilizes a robust and genotype-specific extension of the Circular Binary Segmentation algorithm, and the use of additional detection algorithms is supported. Predicted CNVs are captured in a MySQL database that supports cohort-based projects and incorporates a secure user authentication layer and user/admin roles. To assist with determination of pathogenicity, detected CNVs are also annotated automatically for gene content, known disease loci, and gene-based literature references. Results are easily queried, sorted, filtered, and visualized via a web-based presentation layer that includes a GBrowse-based graphical representation of CNV content and relevant public data, integration with the UCSC Genome Browser, and tabular displays of genomic attributes for each CNV. To our knowledge, CNV Workshop represents the first cohesive and convenient platform for detection, annotation, and assessment of the biological and clinical significance of structural variants. CNV Workshop has been successfully utilized for assessment of genomic variation in healthy individuals and disease cohorts and is an ideal platform for coordinating multiple associated

19. Wayne Chandler, Photographer, August 1993 Photographic copy of Xerox ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

19. Wayne Chandler, Photographer, August 1993 Photographic copy of Xerox copy of original plans, dated 1932, by Wisconsin Highway Commission. Xerox copy in possession of Westbrook Associated Engineers, Spring Green, Wisconsin. DETAILS FOR PIERS NO. 1, 2, 5 & 6. - Chippewa River Bridge, Spanning Chippewa River at State Highway 35, Nelson, Buffalo County, WI

14 CFR 221.92 - Number of copies required.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 14 Aeronautics and Space 4 2014-01-01 2014-01-01 false Number of copies required. 221.92 Section 221.92 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS) ECONOMIC REGULATIONS TARIFFS Filing Tariff Publications With Department § 221.92 Number of copies...

Neurophysiological evidence of efference copies to inner speech

PubMed Central

Jack, Bradley N; Pearson, Daniel; Griffiths, Oren; Luque, David; Harris, Anthony WF; Spencer, Kevin M; Le Pelley, Mike E

2017-01-01

Efference copies refer to internal duplicates of movement-producing neural signals. Their primary function is to predict, and often suppress, the sensory consequences of willed movements. Efference copies have been almost exclusively investigated in the context of overt movements. The current electrophysiological study employed a novel design to show that inner speech – the silent production of words in one’s mind – is also associated with an efference copy. Participants produced an inner phoneme at a precisely specified time, at which an audible phoneme was concurrently presented. The production of the inner phoneme resulted in electrophysiological suppression, but only if the content of the inner phoneme matched the content of the audible phoneme. These results demonstrate that inner speech – a purely mental action – is associated with an efference copy with detailed auditory properties. These findings suggest that inner speech may ultimately reflect a special type of overt speech. PMID:29199947

Detection of Copy-Rotate-Move Forgery Using Zernike Moments

NASA Astrophysics Data System (ADS)

Ryu, Seung-Jin; Lee, Min-Jeong; Lee, Heung-Kyu

As forgeries have become popular, the importance of forgery detection is much increased. Copy-move forgery, one of the most commonly used methods, copies a part of the image and pastes it into another part of the the image. In this paper, we propose a detection method of copy-move forgery that localizes duplicated regions using Zernike moments. Since the magnitude of Zernike moments is algebraically invariant against rotation, the proposed method can detect a forged region even though it is rotated. Our scheme is also resilient to the intentional distortions such as additive white Gaussian noise, JPEG compression, and blurring. Experimental results demonstrate that the proposed scheme is appropriate to identify the forged region by copy-rotate-move forgery.

39 CFR 955.23 - Copies of papers, withdrawal of exhibits.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 39 Postal Service 1 2010-07-01 2010-07-01 false Copies of papers, withdrawal of exhibits. 955.23... SERVICE BOARD OF CONTRACT APPEALS § 955.23 Copies of papers, withdrawal of exhibits. (a) When books, records, papers, or documents have been received in evidence, a true copy thereof or of such part thereof...

19 CFR 210.55 - Content of service copies.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 19 Customs Duties 3 2010-04-01 2010-04-01 false Content of service copies. 210.55 Section 210.55 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Temporary Relief § 210.55 Content of service copies. (a) Any...

The integrative epigenomic-transcriptomic landscape of ER positive breast cancer.

PubMed

Gao, Yang; Jones, Allison; Fasching, Peter A; Ruebner, Matthias; Beckmann, Matthias W; Widschwendter, Martin; Teschendorff, Andrew E

2015-01-01

While recent integrative analyses of copy number and gene expression data in breast cancer have revealed a complex molecular landscape with multiple subtypes and many oncogenic/tumour suppressor driver events, much less is known about the role of DNA methylation in shaping breast cancer taxonomy and defining driver events. Here, we applied a powerful integrative network algorithm to matched DNA methylation and RNA-Seq data for 724 estrogen receptor (ER)-positive (ER+) breast cancers and 111 normal adjacent tissue specimens from The Cancer Genome Atlas (TCGA) project, in order to identify putative epigenetic driver events and to explore the resulting molecular taxonomy. This revealed the existence of nine functionally deregulated epigenetic hotspots encompassing a total of 146 genes, which we were able to validate in independent data sets encompassing over 1000 ER+ breast cancers. Integrative clustering of the matched messenger RNA (mRNA) and DNA methylation data over these genes resulted in only two clusters, which correlated very strongly with the luminal-A and luminal B subtypes. Overall, luminal-A and luminal-B breast cancers shared the same epigenetically deregulated hotspots but with luminal-B cancers exhibiting increased aberrant DNA methylation patterns relative to normal tissue. We show that increased levels of DNA methylation and mRNA expression deviation from the normal state define a marker of poor prognosis. Our data further implicates epigenetic silencing of WNT signalling antagonists and bone morphogenetic proteins (BMP) as key events underlying both luminal subtypes but specially of luminal-B breast cancer. Finally, we show that DNA methylation changes within the identified epigenetic interactome hotspots do not exhibit mutually exclusive patterns within the same cancer sample, instead exhibiting coordinated changes within the sample. Our results indicate that the integrative DNA methylation and transcriptomic landscape of ER+ breast cancer is

45 CFR 1703.404 - Copying and transcription charges.

Code of Federal Regulations, 2011 CFR

2011-10-01

... 45 Public Welfare 4 2011-10-01 2011-10-01 false Copying and transcription charges. 1703.404... Copying and transcription charges. (a) The Commission will charge fees for furnishing records at the rate of ten cents per page for photocopies and at the actual cost of transcription. When the anticipated...

Property and Propriety in the Digital Environment: Towards an Examination Copy License.

ERIC Educational Resources Information Center

Kahin, Brian

1988-01-01

Discussion of copyright issues involving computer software focuses on faculty examination of software for evaluation purposes. Two model examination copy licenses are proposed: one a circulating evaluation copy, for libraries and other centers where individual evaluators are not involved in copying; and one a distributable evaluation copy. (five…

Effects of Sound Frequency on Audiovisual Integration: An Event-Related Potential Study.

PubMed

Yang, Weiping; Yang, Jingjing; Gao, Yulin; Tang, Xiaoyu; Ren, Yanna; Takahashi, Satoshi; Wu, Jinglong

2015-01-01

A combination of signals across modalities can facilitate sensory perception. The audiovisual facilitative effect strongly depends on the features of the stimulus. Here, we investigated how sound frequency, which is one of basic features of an auditory signal, modulates audiovisual integration. In this study, the task of the participant was to respond to a visual target stimulus by pressing a key while ignoring auditory stimuli, comprising of tones of different frequencies (0.5, 1, 2.5 and 5 kHz). A significant facilitation of reaction times was obtained following audiovisual stimulation, irrespective of whether the task-irrelevant sounds were low or high frequency. Using event-related potential (ERP), audiovisual integration was found over the occipital area for 0.5 kHz auditory stimuli from 190-210 ms, for 1 kHz stimuli from 170-200 ms, for 2.5 kHz stimuli from 140-200 ms, 5 kHz stimuli from 100-200 ms. These findings suggest that a higher frequency sound signal paired with visual stimuli might be early processed or integrated despite the auditory stimuli being task-irrelevant information. Furthermore, audiovisual integration in late latency (300-340 ms) ERPs with fronto-central topography was found for auditory stimuli of lower frequencies (0.5, 1 and 2.5 kHz). Our results confirmed that audiovisual integration is affected by the frequency of an auditory stimulus. Taken together, the neurophysiological results provide unique insight into how the brain processes a multisensory visual signal and auditory stimuli of different frequencies.

Effects of Sound Frequency on Audiovisual Integration: An Event-Related Potential Study

PubMed Central

Yang, Weiping; Yang, Jingjing; Gao, Yulin; Tang, Xiaoyu; Ren, Yanna; Takahashi, Satoshi; Wu, Jinglong

2015-01-01

A combination of signals across modalities can facilitate sensory perception. The audiovisual facilitative effect strongly depends on the features of the stimulus. Here, we investigated how sound frequency, which is one of basic features of an auditory signal, modulates audiovisual integration. In this study, the task of the participant was to respond to a visual target stimulus by pressing a key while ignoring auditory stimuli, comprising of tones of different frequencies (0.5, 1, 2.5 and 5 kHz). A significant facilitation of reaction times was obtained following audiovisual stimulation, irrespective of whether the task-irrelevant sounds were low or high frequency. Using event-related potential (ERP), audiovisual integration was found over the occipital area for 0.5 kHz auditory stimuli from 190–210 ms, for 1 kHz stimuli from 170–200 ms, for 2.5 kHz stimuli from 140–200 ms, 5 kHz stimuli from 100–200 ms. These findings suggest that a higher frequency sound signal paired with visual stimuli might be early processed or integrated despite the auditory stimuli being task-irrelevant information. Furthermore, audiovisual integration in late latency (300–340 ms) ERPs with fronto-central topography was found for auditory stimuli of lower frequencies (0.5, 1 and 2.5 kHz). Our results confirmed that audiovisual integration is affected by the frequency of an auditory stimulus. Taken together, the neurophysiological results provide unique insight into how the brain processes a multisensory visual signal and auditory stimuli of different frequencies. PMID:26384256

Unexpected Inheritance: Multiple Integrations of Ancient Bornavirus and Ebolavirus/Marburgvirus Sequences in Vertebrate Genomes

PubMed Central

Belyi, Vladimir A.; Levine, Arnold J.; Skalka, Anna Marie

2010-01-01

Vertebrate genomes contain numerous copies of retroviral sequences, acquired over the course of evolution. Until recently they were thought to be the only type of RNA viruses to be so represented, because integration of a DNA copy of their genome is required for their replication. In this study, an extensive sequence comparison was conducted in which 5,666 viral genes from all known non-retroviral families with single-stranded RNA genomes were matched against the germline genomes of 48 vertebrate species, to determine if such viruses could also contribute to the vertebrate genetic heritage. In 19 of the tested vertebrate species, we discovered as many as 80 high-confidence examples of genomic DNA sequences that appear to be derived, as long ago as 40 million years, from ancestral members of 4 currently circulating virus families with single strand RNA genomes. Surprisingly, almost all of the sequences are related to only two families in the Order Mononegavirales: the Bornaviruses and the Filoviruses, which cause lethal neurological disease and hemorrhagic fevers, respectively. Based on signature landmarks some, and perhaps all, of the endogenous virus-like DNA sequences appear to be LINE element-facilitated integrations derived from viral mRNAs. The integrations represent genes that encode viral nucleocapsid, RNA-dependent-RNA-polymerase, matrix and, possibly, glycoproteins. Integrations are generally limited to one or very few copies of a related viral gene per species, suggesting that once the initial germline integration was obtained (or selected), later integrations failed or provided little advantage to the host. The conservation of relatively long open reading frames for several of the endogenous sequences, the virus-like protein regions represented, and a potential correlation between their presence and a species' resistance to the diseases caused by these pathogens, are consistent with the notion that their products provide some important biological

Unexpected inheritance: multiple integrations of ancient bornavirus and ebolavirus/marburgvirus sequences in vertebrate genomes.

PubMed

Belyi, Vladimir A; Levine, Arnold J; Skalka, Anna Marie

2010-07-29

Vertebrate genomes contain numerous copies of retroviral sequences, acquired over the course of evolution. Until recently they were thought to be the only type of RNA viruses to be so represented, because integration of a DNA copy of their genome is required for their replication. In this study, an extensive sequence comparison was conducted in which 5,666 viral genes from all known non-retroviral families with single-stranded RNA genomes were matched against the germline genomes of 48 vertebrate species, to determine if such viruses could also contribute to the vertebrate genetic heritage. In 19 of the tested vertebrate species, we discovered as many as 80 high-confidence examples of genomic DNA sequences that appear to be derived, as long ago as 40 million years, from ancestral members of 4 currently circulating virus families with single strand RNA genomes. Surprisingly, almost all of the sequences are related to only two families in the Order Mononegavirales: the Bornaviruses and the Filoviruses, which cause lethal neurological disease and hemorrhagic fevers, respectively. Based on signature landmarks some, and perhaps all, of the endogenous virus-like DNA sequences appear to be LINE element-facilitated integrations derived from viral mRNAs. The integrations represent genes that encode viral nucleocapsid, RNA-dependent-RNA-polymerase, matrix and, possibly, glycoproteins. Integrations are generally limited to one or very few copies of a related viral gene per species, suggesting that once the initial germline integration was obtained (or selected), later integrations failed or provided little advantage to the host. The conservation of relatively long open reading frames for several of the endogenous sequences, the virus-like protein regions represented, and a potential correlation between their presence and a species' resistance to the diseases caused by these pathogens, are consistent with the notion that their products provide some important biological

Penicillin production in industrial strain Penicillium chrysogenum P2niaD18 is not dependent on the copy number of biosynthesis genes.

PubMed

Ziemons, Sandra; Koutsantas, Katerina; Becker, Kordula; Dahlmann, Tim; Kück, Ulrich

2017-02-16

Multi-copy gene integration into microbial genomes is a conventional tool for obtaining improved gene expression. For Penicillium chrysogenum, the fungal producer of the beta-lactam antibiotic penicillin, many production strains carry multiple copies of the penicillin biosynthesis gene cluster. This discovery led to the generally accepted view that high penicillin titers are the result of multiple copies of penicillin genes. Here we investigated strain P2niaD18, a production line that carries only two copies of the penicillin gene cluster. We performed pulsed-field gel electrophoresis (PFGE), quantitative qRT-PCR, and penicillin bioassays to investigate production, deletion and overexpression strains generated in the P. chrysogenum P2niaD18 background, in order to determine the copy number of the penicillin biosynthesis gene cluster, and study the expression of one penicillin biosynthesis gene, and the penicillin titer. Analysis of production and recombinant strain showed that the enhanced penicillin titer did not depend on the copy number of the penicillin gene cluster. Our assumption was strengthened by results with a penicillin null strain lacking pcbC encoding isopenicillin N synthase. Reintroduction of one or two copies of the cluster into the pcbC deletion strain restored transcriptional high expression of the pcbC gene, but recombinant strains showed no significantly different penicillin titer compared to parental strains. Here we present a molecular genetic analysis of production and recombinant strains in the P2niaD18 background carrying different copy numbers of the penicillin biosynthesis gene cluster. Our analysis shows that the enhanced penicillin titer does not strictly depend on the copy number of the cluster. Based on these overall findings, we hypothesize that instead, complex regulatory mechanisms are prominently implicated in increased penicillin biosynthesis in production strains.

Copying of holograms by spot scanning approach.

PubMed

Okui, Makoto; Wakunami, Koki; Oi, Ryutaro; Ichihashi, Yasuyuki; Jackin, Boaz Jessie; Yamamoto, Kenji

2018-05-20

To replicate holograms, contact copying has conventionally been used. In this approach, a photosensitive material is fixed together with a master hologram and illuminated with a coherent beam. This method is simple and enables high-quality copies; however, it requires a large optical setup for large-area holograms. In this paper, we present a new method of replicating holograms that uses a relatively compact optical system even for the replication of large holograms. A small laser spot that irradiates only part of the hologram is used to reproduce the hologram by scanning the spot over the whole area of the hologram. We report on the results of experiments carried out to confirm the copy quality, along with a guide to design scanning conditions. The results show the potential effectiveness of the large-area hologram replication technology using a relatively compact apparatus.

An Evidence-Informed Picture of Course-Related Copying

ERIC Educational Resources Information Center

Graham, Rumi

2016-01-01

Recent changes in Canadian copyright law have prompted Canada's educational institutions to reexamine their need for a blanket copying license. Users' rights under the amended Copyright Act now include fair dealing for purposes of education, and the Supreme Court has established that copying short excerpts for classroom use can qualify as fair…

Differentially expressed microRNAs in lung adenocarcinoma invert effects of copy number aberrations of prognostic genes

PubMed Central

Tokar, Tomas; Pastrello, Chiara; Ramnarine, Varune R.; Zhu, Chang-Qi; Craddock, Kenneth J.; Pikor, Larrisa A.; Vucic, Emily A.; Vary, Simon; Shepherd, Frances A.; Tsao, Ming-Sound; Lam, Wan L.; Jurisica, Igor

2018-01-01

In many cancers, significantly down- or upregulated genes are found within chromosomal regions with DNA copy number alteration opposite to the expression changes. Generally, this paradox has been overlooked as noise, but can potentially be a consequence of interference of epigenetic regulatory mechanisms, including microRNA-mediated control of mRNA levels. To explore potential associations between microRNAs and paradoxes in non-small-cell lung cancer (NSCLC) we curated and analyzed lung adenocarcinoma (LUAD) data, comprising gene expressions, copy number aberrations (CNAs) and microRNA expressions. We integrated data from 1,062 tumor samples and 241 normal lung samples, including newly-generated array comparative genomic hybridization (aCGH) data from 63 LUAD samples. We identified 85 “paradoxical” genes whose differential expression consistently contrasted with aberrations of their copy numbers. Paradoxical status of 70 out of 85 genes was validated on sample-wise basis using The Cancer Genome Atlas (TCGA) LUAD data. Of these, 41 genes are prognostic and form a clinically relevant signature, which we validated on three independent datasets. By meta-analysis of results from 9 LUAD microRNA expression studies we identified 24 consistently-deregulated microRNAs. Using TCGA-LUAD data we showed that deregulation of 19 of these microRNAs explains differential expression of the paradoxical genes. Our results show that deregulation of paradoxical genes is crucial in LUAD and their expression pattern is maintained epigenetically, defying gene copy number status. PMID:29507679

19 CFR 151.64 - Extra copy of entry summary.

Code of Federal Regulations, 2013 CFR

2013-04-01

... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate per...

19 CFR 151.64 - Extra copy of entry summary.

Code of Federal Regulations, 2012 CFR

2012-04-01

... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate per...

19 CFR 151.64 - Extra copy of entry summary.

Code of Federal Regulations, 2011 CFR

2011-04-01

... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate per...

19 CFR 151.64 - Extra copy of entry summary.

Code of Federal Regulations, 2014 CFR

2014-04-01

... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate per...

19 CFR 151.64 - Extra copy of entry summary.

Code of Federal Regulations, 2010 CFR

2010-04-01

... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate per...

Motivation and intention to integrate physical activity into daily school life: the JAM World Record event.

PubMed

Vazou, Spyridoula; Vlachopoulos, Symeon P

2014-11-01

Research on the motivation of stakeholders to integrate physical activity into daily school life is limited. The purpose was to examine the motivation of stakeholders to participate in a world record physical activity event and whether motivation was associated with future intention to use activity breaks during the daily school life and future participation in a similar event. After the 2012 JAM (Just-a-Minute) World Record event, 686 adults (591 women; 76.1% participated for children <10 years) completed measures of motivational regulations and future intention to (a) use the activity breaks and (b) participate in the event. High intrinsic motivation and low extrinsic motivation and amotivation for participation in the next event were reported. Hierarchical regression analysis, controlling for age, gender, and occupation, showed that intrinsic forms of motivation positively predicted, whereas amotivation negatively predicted, future intention to participate in the event and use the activity breaks. Multivariate analyses of variance revealed that school-related participants were more intrinsically motivated and intended to use the activity breaks and repeat the event more than those who were not affiliated with a school. Nonschool participants reported higher extrinsic motivation and amotivation than school-related participants. © 2014 Society for Public Health Education.

31 CFR 1.4 - Public inspection and copying.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Public inspection and copying. 1.4 Section 1.4 Money and Finance: Treasury Office of the Secretary of the Treasury DISCLOSURE OF RECORDS Freedom of Information Act § 1.4 Public inspection and copying. (a) In general. Subject to the application...

rrndb: the Ribosomal RNA Operon Copy Number Database

PubMed Central

Klappenbach, Joel A.; Saxman, Paul R.; Cole, James R.; Schmidt, Thomas M.

2001-01-01

The Ribosomal RNA Operon Copy Number Database (rrndb) is an Internet-accessible database containing annotated information on rRNA operon copy number among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, yet the rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of 16S rRNA gene sequences for identification of prokaryotes, information on the number and sequence of individual rRNA genes in a genome is not readily accessible. In an attempt to understand the evolutionary implications of rRNA operon redundancy, we have created a phylogenetically arranged report on rRNA gene copy number for a diverse collection of prokaryotic microorganisms. Each entry (organism) in the rrndb contains detailed information linked directly to external websites including the Ribosomal Database Project, GenBank, PubMed and several culture collections. Data contained in the rrndb will be valuable to researchers investigating microbial ecology and evolution using 16S rRNA gene sequences. The rrndb web site is directly accessible on the WWW at http://rrndb.cme.msu.edu. PMID:11125085

Spontaneously broken Yang-Mills-Einstein supergravities as double copies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chiodaroli, Marco; Günaydin, Murat; Johansson, Henrik

Color/kinematics duality and the double-copy construction have proved to be systematic tools for gaining new insight into gravitational theories. Extending our earlier work, in this article we introduce new double-copy constructions for large classes of spontaneously-broken Yang-Mills-Einstein theories with adjoint Higgs elds. One gaugetheory copy entering the construction is a spontaneously-broken (super-)Yang-Mills theory, while the other copy is a bosonic Yang-Mills-scalar theory with trilinear scalar interactions that display an explicitly-broken global symmetry. We show that the kinematic numerators of these gauge theories can be made to obey color/kinematics duality by exhibiting particular additional Lie-algebraic relations. We discuss in detail explicitmore » examples with N = 2 supersymmetry, focusing on Yang-Mills-Einstein supergravity theories belonging to the generic Jordan family in four and five dimensions, and identify the map between the supergravity and double-copy elds and parameters. We also briefly discuss the application of our results to N = 4 supergravity theories. The constructions are illustrated by explicit examples of tree-level and one-loop scattering amplitudes.« less

Spontaneously broken Yang-Mills-Einstein supergravities as double copies

DOE PAGES

Chiodaroli, Marco; Günaydin, Murat; Johansson, Henrik; ...

2017-06-13

Color/kinematics duality and the double-copy construction have proved to be systematic tools for gaining new insight into gravitational theories. Extending our earlier work, in this article we introduce new double-copy constructions for large classes of spontaneously-broken Yang-Mills-Einstein theories with adjoint Higgs elds. One gaugetheory copy entering the construction is a spontaneously-broken (super-)Yang-Mills theory, while the other copy is a bosonic Yang-Mills-scalar theory with trilinear scalar interactions that display an explicitly-broken global symmetry. We show that the kinematic numerators of these gauge theories can be made to obey color/kinematics duality by exhibiting particular additional Lie-algebraic relations. We discuss in detail explicitmore » examples with N = 2 supersymmetry, focusing on Yang-Mills-Einstein supergravity theories belonging to the generic Jordan family in four and five dimensions, and identify the map between the supergravity and double-copy elds and parameters. We also briefly discuss the application of our results to N = 4 supergravity theories. The constructions are illustrated by explicit examples of tree-level and one-loop scattering amplitudes.« less

Mitochondrial DNA Copy Number in Sleep Duration Discordant Monozygotic Twins

PubMed Central

Wrede, Joanna E.; Mengel-From, Jonas; Buchwald, Dedra; Vitiello, Michael V.; Bamshad, Michael; Noonan, Carolyn; Christiansen, Lene; Christensen, Kaare; Watson, Nathaniel F.

2015-01-01

Study Objectives: Mitochondrial DNA (mtDNA) copy number is an important component of mitochondrial function and varies with age, disease, and environmental factors. We aimed to determine whether mtDNA copy number varies with habitual differences in sleep duration within pairs of monozygotic twins. Setting: Academic clinical research center. Participants: 15 sleep duration discordant monozygotic twin pairs (30 twins, 80% female; mean age 42.1 years [SD 15.0]). Design: Sleep duration was phenotyped with wrist actigraphy. Each twin pair included a “normal” (7–9 h/24) and “short” (< 7 h/24) sleeping twin. Fasting peripheral blood leukocyte DNA was assessed for mtDNA copy number via the n-fold difference between qPCR measured mtDNA and nuclear DNA creating an mtDNA measure without absolute units. We used generalized estimating equation linear regression models accounting for the correlated data structure to assess within-pair effects of sleep duration on mtDNA copy number. Measurements and Results: Mean within-pair sleep duration difference per 24 hours was 94.3 minutes (SD 62.6 min). We found reduced sleep duration (β = 0.06; 95% CI 0.004, 0.12; P < 0.05) and sleep efficiency (β = 0.51; 95% CI 0.06, 0.95; P < 0.05) were significantly associated with reduced mtDNA copy number within twin pairs. Thus every 1-minute decrease in actigraphy-defined sleep duration was associated with a decrease in mtDNA copy number of 0.06. Likewise, a 1% decrease in actigraphy-defined sleep efficiency was associated with a decrease in mtDNA copy number of 0.51. Conclusions: Reduced sleep duration and sleep efficiency were associated with reduced mitochondrial DNA copy number in sleep duration discordant monozygotic twins offering a potential mechanism whereby short sleep impairs health and longevity through mitochondrial stress. Citation: Wrede JE, Mengel-From J, Buchwald D, Vitiello MV, Bamshad M, Noonan C, Christiansen L, Christensen K, Watson NF. Mitochondrial DNA copy number

Plasmodium copy number variation scan: gene copy numbers evaluation in haploid genomes.

PubMed

Beghain, Johann; Langlois, Anne-Claire; Legrand, Eric; Grange, Laura; Khim, Nimol; Witkowski, Benoit; Duru, Valentine; Ma, Laurence; Bouchier, Christiane; Ménard, Didier; Paul, Richard E; Ariey, Frédéric

2016-04-12

In eukaryotic genomes, deletion or amplification rates have been estimated to be a thousand more frequent than single nucleotide variation. In Plasmodium falciparum, relatively few transcription factors have been identified, and the regulation of transcription is seemingly largely influenced by gene amplification events. Thus copy number variation (CNV) is a major mechanism enabling parasite genomes to adapt to new environmental changes. Currently, the detection of CNVs is based on quantitative PCR (qPCR), which is significantly limited by the relatively small number of genes that can be analysed at any one time. Technological advances that facilitate whole-genome sequencing, such as next generation sequencing (NGS) enable deeper analyses of the genomic variation to be performed. Because the characteristics of Plasmodium CNVs need special consideration in algorithms and strategies for which classical CNV detection programs are not suited a dedicated algorithm to detect CNVs across the entire exome of P. falciparum was developed. This algorithm is based on a custom read depth strategy through NGS data and called PlasmoCNVScan. The analysis of CNV identification on three genes known to have different levels of amplification and which are located either in the nuclear, apicoplast or mitochondrial genomes is presented. The results are correlated with the qPCR experiments, usually used for identification of locus specific amplification/deletion. This tool will facilitate the study of P. falciparum genomic adaptation in response to ecological changes: drug pressure, decreased transmission, reduction of the parasite population size (transition to pre-elimination endemic area).

A spatial haplotype copying model with applications to genotype imputation.

PubMed

Yang, Wen-Yun; Hormozdiari, Farhad; Eskin, Eleazar; Pasaniuc, Bogdan

2015-05-01

Ever since its introduction, the haplotype copy model has proven to be one of the most successful approaches for modeling genetic variation in human populations, with applications ranging from ancestry inference to genotype phasing and imputation. Motivated by coalescent theory, this approach assumes that any chromosome (haplotype) can be modeled as a mosaic of segments copied from a set of chromosomes sampled from the same population. At the core of the model is the assumption that any chromosome from the sample is equally likely to contribute a priori to the copying process. Motivated by recent works that model genetic variation in a geographic continuum, we propose a new spatial-aware haplotype copy model that jointly models geography and the haplotype copying process. We extend hidden Markov models of haplotype diversity such that at any given location, haplotypes that are closest in the genetic-geographic continuum map are a priori more likely to contribute to the copying process than distant ones. Through simulations starting from the 1000 Genomes data, we show that our model achieves superior accuracy in genotype imputation over the standard spatial-unaware haplotype copy model. In addition, we show the utility of our model in selecting a small personalized reference panel for imputation that leads to both improved accuracy as well as to a lower computational runtime than the standard approach. Finally, we show our proposed model can be used to localize individuals on the genetic-geographical map on the basis of their genotype data.

NASA printing, duplicating, and copying management handbook

NASA Technical Reports Server (NTRS)

1993-01-01

This handbook provides information and procedures for the implementation of NASA policy and applicable laws and regulations relating to printing, duplicating, and copying. The topics addressed include a description of relevant laws and regulations, authorizations required, and responsible entities for NASA printing, duplicating, and copying. The policy of NASA is to ensure understanding and application of authority and responsibility on printing matters. Where necessary, the handbook clarifies the intent of basic laws and regulations applicable to NASA.

Oculomotor learning revisited: a model of reinforcement learning in the basal ganglia incorporating an efference copy of motor actions

PubMed Central

Fee, Michale S.

2012-01-01

In its simplest formulation, reinforcement learning is based on the idea that if an action taken in a particular context is followed by a favorable outcome, then, in the same context, the tendency to produce that action should be strengthened, or reinforced. While reinforcement learning forms the basis of many current theories of basal ganglia (BG) function, these models do not incorporate distinct computational roles for signals that convey context, and those that convey what action an animal takes. Recent experiments in the songbird suggest that vocal-related BG circuitry receives two functionally distinct excitatory inputs. One input is from a cortical region that carries context information about the current “time” in the motor sequence. The other is an efference copy of motor commands from a separate cortical brain region that generates vocal variability during learning. Based on these findings, I propose here a general model of vertebrate BG function that combines context information with a distinct motor efference copy signal. The signals are integrated by a learning rule in which efference copy inputs gate the potentiation of context inputs (but not efference copy inputs) onto medium spiny neurons in response to a rewarded action. The hypothesis is described in terms of a circuit that implements the learning of visually guided saccades. The model makes testable predictions about the anatomical and functional properties of hypothesized context and efference copy inputs to the striatum from both thalamic and cortical sources. PMID:22754501

Oculomotor learning revisited: a model of reinforcement learning in the basal ganglia incorporating an efference copy of motor actions.

PubMed

Fee, Michale S

2012-01-01

In its simplest formulation, reinforcement learning is based on the idea that if an action taken in a particular context is followed by a favorable outcome, then, in the same context, the tendency to produce that action should be strengthened, or reinforced. While reinforcement learning forms the basis of many current theories of basal ganglia (BG) function, these models do not incorporate distinct computational roles for signals that convey context, and those that convey what action an animal takes. Recent experiments in the songbird suggest that vocal-related BG circuitry receives two functionally distinct excitatory inputs. One input is from a cortical region that carries context information about the current "time" in the motor sequence. The other is an efference copy of motor commands from a separate cortical brain region that generates vocal variability during learning. Based on these findings, I propose here a general model of vertebrate BG function that combines context information with a distinct motor efference copy signal. The signals are integrated by a learning rule in which efference copy inputs gate the potentiation of context inputs (but not efference copy inputs) onto medium spiny neurons in response to a rewarded action. The hypothesis is described in terms of a circuit that implements the learning of visually guided saccades. The model makes testable predictions about the anatomical and functional properties of hypothesized context and efference copy inputs to the striatum from both thalamic and cortical sources.

Simultaneous and Sequential Integration by Cre/loxP Site-Specific Recombination in Saccharomyces cerevisiae.

PubMed

Choi, Ho-Jung; Kim, Yeon-Hee

2018-05-28

A Cre/ loxP -δ-integration system was developed to allow sequential and simultaneous integration of a multiple gene expression cassette in Saccharomyces cerevisiae . To allow repeated integrations, the reusable Candida glabrata MARKER ( CgMARKER ) carrying loxP sequences was used, and the integrated CgMARKER was efficiently removed by inducing Cre recombinase. The XYLP and XYLB genes encoding endoxylanase and β-xylosidase, respectively, were used as model genes for xylan metabolism in this system, and the copy number of these genes was increased to 15.8 and 16.9 copies/cell, respectively, by repeated integration. This integration system is a promising approach for the easy construction of yeast strains with enhanced metabolic pathways through multicopy gene expression.

44 CFR 5.85 - Authentication and attestation of copies.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Authentication and attestation of copies. 5.85 Section 5.85 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT... Authentication and attestation of copies. The Administrator, Deputy Administrators, Regional Administrators...

36 CFR 703.19 - Requests for authenticated copies of Library documents.

Code of Federal Regulations, 2010 CFR

2010-07-01

... copies of Library documents. 703.19 Section 703.19 Parks, Forests, and Public Property LIBRARY OF... Documents in Certain Legal Proceedings Where the Library Is Not a Party § 703.19 Requests for authenticated copies of Library documents. Requests for authenticated copies of Library documents for purposes of...

36 CFR 703.19 - Requests for authenticated copies of Library documents.

Code of Federal Regulations, 2011 CFR

2011-07-01

... copies of Library documents. 703.19 Section 703.19 Parks, Forests, and Public Property LIBRARY OF... Documents in Certain Legal Proceedings Where the Library Is Not a Party § 703.19 Requests for authenticated copies of Library documents. Requests for authenticated copies of Library documents for purposes of...

36 CFR 703.19 - Requests for authenticated copies of Library documents.

Code of Federal Regulations, 2012 CFR

2012-07-01

... copies of Library documents. 703.19 Section 703.19 Parks, Forests, and Public Property LIBRARY OF... Documents in Certain Legal Proceedings Where the Library Is Not a Party § 703.19 Requests for authenticated copies of Library documents. Requests for authenticated copies of Library documents for purposes of...

36 CFR 703.19 - Requests for authenticated copies of Library documents.

Code of Federal Regulations, 2014 CFR

2014-07-01

... copies of Library documents. 703.19 Section 703.19 Parks, Forests, and Public Property LIBRARY OF... Documents in Certain Legal Proceedings Where the Library Is Not a Party § 703.19 Requests for authenticated copies of Library documents. Requests for authenticated copies of Library documents for purposes of...

Mitochondrial DNA Copy Number in Sleep Duration Discordant Monozygotic Twins.

PubMed

Wrede, Joanna E; Mengel-From, Jonas; Buchwald, Dedra; Vitiello, Michael V; Bamshad, Michael; Noonan, Carolyn; Christiansen, Lene; Christensen, Kaare; Watson, Nathaniel F

2015-10-01

Mitochondrial DNA (mtDNA) copy number is an important component of mitochondrial function and varies with age, disease, and environmental factors. We aimed to determine whether mtDNA copy number varies with habitual differences in sleep duration within pairs of monozygotic twins. Academic clinical research center. 15 sleep duration discordant monozygotic twin pairs (30 twins, 80% female; mean age 42.1 years [SD 15.0]). Sleep duration was phenotyped with wrist actigraphy. Each twin pair included a "normal" (7-9 h/24) and "short" (< 7 h/24) sleeping twin. Fasting peripheral blood leukocyte DNA was assessed for mtDNA copy number via the n-fold difference between qPCR measured mtDNA and nuclear DNA creating an mtDNA measure without absolute units. We used generalized estimating equation linear regression models accounting for the correlated data structure to assess within-pair effects of sleep duration on mtDNA copy number. Mean within-pair sleep duration difference per 24 hours was 94.3 minutes (SD 62.6 min). We found reduced sleep duration (β = 0.06; 95% CI 0.004, 0.12; P < 0.05) and sleep efficiency (β = 0.51; 95% CI 0.06, 0.95; P < 0.05) were significantly associated with reduced mtDNA copy number within twin pairs. Thus every 1-minute decrease in actigraphy-defined sleep duration was associated with a decrease in mtDNA copy number of 0.06. Likewise, a 1% decrease in actigraphy-defined sleep efficiency was associated with a decrease in mtDNA copy number of 0.51. Reduced sleep duration and sleep efficiency were associated with reduced mitochondrial DNA copy number in sleep duration discordant monozygotic twins offering a potential mechanism whereby short sleep impairs health and longevity through mitochondrial stress. © 2015 Associated Professional Sleep Societies, LLC.

Unambiguous discrimination between linearly dependent equidistant states with multiple copies

NASA Astrophysics Data System (ADS)

Zhang, Wen-Hai; Ren, Gang

2018-07-01

Linearly independent quantum states can be unambiguously discriminated, but linearly dependent ones cannot. For linearly dependent quantum states, however, if C copies of the single states are available, then they may form linearly independent states, and can be unambiguously discriminated. We consider unambiguous discrimination among N = D + 1 linearly dependent states given that C copies are available and that the single copies span a D-dimensional space with equal inner products. The maximum unambiguous discrimination probability is derived for all C with equal a priori probabilities. For this classification of the linearly dependent equidistant states, our result shows that if C is even then adding a further copy fails to increase the maximum discrimination probability.

17 CFR 270.8b-11 - Number of copies; signatures; binding.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Number of copies; signatures... (CONTINUED) RULES AND REGULATIONS, INVESTMENT COMPANY ACT OF 1940 § 270.8b-11 Number of copies; signatures... manner prescribed by the appropriate form. Unsigned copies shall be conformed. If the signature of any...

Microseismic event location using global optimization algorithms: An integrated and automated workflow

NASA Astrophysics Data System (ADS)

Lagos, Soledad R.; Velis, Danilo R.

2018-02-01

We perform the location of microseismic events generated in hydraulic fracturing monitoring scenarios using two global optimization techniques: Very Fast Simulated Annealing (VFSA) and Particle Swarm Optimization (PSO), and compare them against the classical grid search (GS). To this end, we present an integrated and optimized workflow that concatenates into an automated bash script the different steps that lead to the microseismic events location from raw 3C data. First, we carry out the automatic detection, denoising and identification of the P- and S-waves. Secondly, we estimate their corresponding backazimuths using polarization information, and propose a simple energy-based criterion to automatically decide which is the most reliable estimate. Finally, after taking proper care of the size of the search space using the backazimuth information, we perform the location using the aforementioned algorithms for 2D and 3D usual scenarios of hydraulic fracturing processes. We assess the impact of restricting the search space and show the advantages of using either VFSA or PSO over GS to attain significant speed-ups.

MixHMM: Inferring Copy Number Variation and Allelic Imbalance Using SNP Arrays and Tumor Samples Mixed with Stromal Cells

PubMed Central

Schulz, Vincent; Chen, Min; Tuck, David

2010-01-01

Background Genotyping platforms such as single nucleotide polymorphism (SNP) arrays are powerful tools to study genomic aberrations in cancer samples. Allele specific information from SNP arrays provides valuable information for interpreting copy number variation (CNV) and allelic imbalance including loss-of-heterozygosity (LOH) beyond that obtained from the total DNA signal available from array comparative genomic hybridization (aCGH) platforms. Several algorithms based on hidden Markov models (HMMs) have been designed to detect copy number changes and copy-neutral LOH making use of the allele information on SNP arrays. However heterogeneity in clinical samples, due to stromal contamination and somatic alterations, complicates analysis and interpretation of these data. Methods We have developed MixHMM, a novel hidden Markov model using hidden states based on chromosomal structural aberrations. MixHMM allows CNV detection for copy numbers up to 7 and allows more complete and accurate description of other forms of allelic imbalance, such as increased copy number LOH or imbalanced amplifications. MixHMM also incorporates a novel sample mixing model that allows detection of tumor CNV events in heterogeneous tumor samples, where cancer cells are mixed with a proportion of stromal cells. Conclusions We validate MixHMM and demonstrate its advantages with simulated samples, clinical tumor samples and a dilution series of mixed samples. We have shown that the CNVs of cancer cells in a tumor sample contaminated with up to 80% of stromal cells can be detected accurately using Illumina BeadChip and MixHMM. Availability The MixHMM is available as a Python package provided with some other useful tools at http://genecube.med.yale.edu:8080/MixHMM. PMID:20532221

The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?

PubMed Central

2008-01-01

Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD) occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4), a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish), Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes), the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD) and the DNA binding domain (DBD). Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be connected to the well

Use of autocorrelation scanning in DNA copy number analysis.

PubMed

Zhang, Liangcai; Zhang, Li

2013-11-01

Data quality is a critical issue in the analyses of DNA copy number alterations obtained from microarrays. It is commonly assumed that copy number alteration data can be modeled as piecewise constant and the measurement errors of different probes are independent. However, these assumptions do not always hold in practice. In some published datasets, we find that measurement errors are highly correlated between probes that interrogate nearby genomic loci, and the piecewise-constant model does not fit the data well. The correlated errors cause problems in downstream analysis, leading to a large number of DNA segments falsely identified as having copy number gains and losses. We developed a simple tool, called autocorrelation scanning profile, to assess the dependence of measurement error between neighboring probes. Autocorrelation scanning profile can be used to check data quality and refine the analysis of DNA copy number data, which we demonstrate in some typical datasets. lzhangli@mdanderson.org. Supplementary data are available at Bioinformatics online.

Functional effects of CCL3L1 copy number.

PubMed

Carpenter, D; McIntosh, R S; Pleass, R J; Armour, J A L

2012-07-01

Copy number variation (CNV) is becoming increasingly important as a feature of human variation in disease susceptibility studies. However, the consequences of CNV are not so well understood. Here, we present data exploring the functional consequences of CNV of CCL3L1 in 55 independent UK samples with no known clinical phenotypes. The copy number of CCL3L1 was determined by the paralogue ratio test, and expression levels of macrophage inflammatory protein-1α (MIP-1α) and mRNA from stimulated monocytes were measured and analysed. The data show no statistically significant association of MIP-1α protein levels with copy number. However, there was a significant correlation between copy number and CCL3L1:CCL3 mRNA ratio. The data also provide evidence that expression of CCL3 predominates in both protein and mRNA, and therefore the observed variation of CCL3 is potentially more important biologically than that of CNV of CCL3L1.

Simultaneous Use of Multiple Answer Copying Indexes to Improve Detection Rates

ERIC Educational Resources Information Center

Wollack, James A.

2006-01-01

Many of the currently available statistical indexes to detect answer copying lack sufficient power at small [alpha] levels or when the amount of copying is relatively small. Furthermore, there is no one index that is uniformly best. Depending on the type or amount of copying, certain indexes are better than others. The purpose of this article was…

Second and Fourth Graders' Copying Ability: From Graphical to Linguistic Processing

ERIC Educational Resources Information Center

Grabowski, Joachim; Weinzierl, Christian; Schmitt, Markus

2010-01-01

Particularly in primary school, good performance on copy tasks is an important working technique. With respect to writing skills, copying is a very basic process on which more complex writing abilities are based. We studied the copying ability of second and fourth graders across four types of symbols which vary with respect to their semantic and…

DNA copy number, including telomeres and mitochondria, assayed using next-generation sequencing.

PubMed

Castle, John C; Biery, Matthew; Bouzek, Heather; Xie, Tao; Chen, Ronghua; Misura, Kira; Jackson, Stuart; Armour, Christopher D; Johnson, Jason M; Rohl, Carol A; Raymond, Christopher K

2010-04-16

DNA copy number variations occur within populations and aberrations can cause disease. We sought to develop an improved lab-automatable, cost-efficient, accurate platform to profile DNA copy number. We developed a sequencing-based assay of nuclear, mitochondrial, and telomeric DNA copy number that draws on the unbiased nature of next-generation sequencing and incorporates techniques developed for RNA expression profiling. To demonstrate this platform, we assayed UMC-11 cells using 5 million 33 nt reads and found tremendous copy number variation, including regions of single and homogeneous deletions and amplifications to 29 copies; 5 times more mitochondria and 4 times less telomeric sequence than a pool of non-diseased, blood-derived DNA; and that UMC-11 was derived from a male individual. The described assay outputs absolute copy number, outputs an error estimate (p-value), and is more accurate than array-based platforms at high copy number. The platform enables profiling of mitochondrial levels and telomeric length. The assay is lab-automatable and has a genomic resolution and cost that are tunable based on the number of sequence reads.

Mines Systems Safety Improvement Using an Integrated Event Tree and Fault Tree Analysis

NASA Astrophysics Data System (ADS)

Kumar, Ranjan; Ghosh, Achyuta Krishna

2017-04-01

Mines systems such as ventilation system, strata support system, flame proof safety equipment, are exposed to dynamic operational conditions such as stress, humidity, dust, temperature, etc., and safety improvement of such systems can be done preferably during planning and design stage. However, the existing safety analysis methods do not handle the accident initiation and progression of mine systems explicitly. To bridge this gap, this paper presents an integrated Event Tree (ET) and Fault Tree (FT) approach for safety analysis and improvement of mine systems design. This approach includes ET and FT modeling coupled with redundancy allocation technique. In this method, a concept of top hazard probability is introduced for identifying system failure probability and redundancy is allocated to the system either at component or system level. A case study on mine methane explosion safety with two initiating events is performed. The results demonstrate that the presented method can reveal the accident scenarios and improve the safety of complex mine systems simultaneously.

22 CFR 92.79 - Procuring copies of foreign public documents.

Code of Federal Regulations, 2012 CFR

2012-04-01

... foreign officials copies of birth, death, and marriage certificates, or copies of other public records... assistance. Persons requesting documents for use in the preparation of family trees or in the compilation of...

22 CFR 92.79 - Procuring copies of foreign public documents.

Code of Federal Regulations, 2013 CFR

2013-04-01

... foreign officials copies of birth, death, and marriage certificates, or copies of other public records... assistance. Persons requesting documents for use in the preparation of family trees or in the compilation of...

22 CFR 92.79 - Procuring copies of foreign public documents.

Code of Federal Regulations, 2011 CFR

2011-04-01

... foreign officials copies of birth, death, and marriage certificates, or copies of other public records... assistance. Persons requesting documents for use in the preparation of family trees or in the compilation of...

22 CFR 92.79 - Procuring copies of foreign public documents.

Code of Federal Regulations, 2014 CFR

2014-04-01

... foreign officials copies of birth, death, and marriage certificates, or copies of other public records... assistance. Persons requesting documents for use in the preparation of family trees or in the compilation of...

Comparison of medical students' learning approaches between electronic and hard copy team-based learning.

PubMed

Sharaf, Fawzy; Alnohair, Sultan

2017-01-01

To compare the students' perception of team-based learning (TBL): The paper (hard copy) compared with the e-copy (electronic copy) in the family medicine course of the fifth year medical students, Qassim University College of Medicine. A cross-sectional study was conducted during the family medicine course in 2015-2016 to compare the hard copy and the e-copy TBL sessions. We used Google drive to distribute, collect and analyze the questionnaire. The results of the e-copy TBL are shown and displayed directly with each session to the students, which was not the same as practiced with hard copy. We used also SPSS (version 17 for Windows) for more statistical analysis. The total number of respondents of students in each was 96; a phase of TBL phase 1 (hard copy) and phase 2 (e-copy). Male were 64 (66.7%) and females 32 (33.3%). The first three knowledge questions showed no difference between the mean score between paper and e-copy TBL, but of the perception questions showed a significant difference between the paper and e-copy TBL. The results of the survey showed that the students prefer e-copy TBL as a course format, as it was an attraction for most of the students and making them even more successful in the key exam and e-copy TBL develop the skills needed to work productively in task-groups.

Multisensory integration and attention in autism spectrum disorder: evidence from event-related potentials.

PubMed

Magnée, Maurice J C M; de Gelder, Beatrice; van Engeland, Herman; Kemner, Chantal

2011-01-01

Successful integration of various simultaneously perceived perceptual signals is crucial for social behavior. Recent findings indicate that this multisensory integration (MSI) can be modulated by attention. Theories of Autism Spectrum Disorders (ASDs) suggest that MSI is affected in this population while it remains unclear to what extent this is related to impairments in attentional capacity. In the present study Event-related potentials (ERPs) following emotionally congruent and incongruent face-voice pairs were measured in 23 high-functioning, adult ASD individuals and 24 age- and IQ-matched controls. MSI was studied while the attention of the participants was manipulated. ERPs were measured at typical auditory and visual processing peaks, namely, P2 and N170. While controls showed MSI during divided attention and easy selective attention tasks, individuals with ASD showed MSI during easy selective attention tasks only. It was concluded that individuals with ASD are able to process multisensory emotional stimuli, but this is differently modulated by attention mechanisms in these participants, especially those associated with divided attention. This atypical interaction between attention and MSI is also relevant to treatment strategies, with training of multisensory attentional control possibly being more beneficial than conventional sensory integration therapy.

7 CFR 3801.2 - Public inspection, copying, and indexing.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 15 2013-01-01 2013-01-01 false Public inspection, copying, and indexing. 3801.2 Section 3801.2 Agriculture Regulations of the Department of Agriculture (Continued) WORLD AGRICULTURAL... inspection, copying, and indexing. 5 U.S.C. 552(a)(2) requires that certain materials be made available for...

7 CFR 3801.2 - Public inspection, copying, and indexing.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 15 2012-01-01 2012-01-01 false Public inspection, copying, and indexing. 3801.2 Section 3801.2 Agriculture Regulations of the Department of Agriculture (Continued) WORLD AGRICULTURAL... inspection, copying, and indexing. 5 U.S.C. 552(a)(2) requires that certain materials be made available for...

7 CFR 3404.2 - Public inspection, copying, and indexing.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 15 2010-01-01 2010-01-01 false Public inspection, copying, and indexing. 3404.2 Section 3404.2 Agriculture Regulations of the Department of Agriculture (Continued) COOPERATIVE STATE... inspection, copying, and indexing. 5 U.S.C. 552(a)(2) requires that certain materials be made available for...

7 CFR 3801.2 - Public inspection, copying, and indexing.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 15 2010-01-01 2010-01-01 false Public inspection, copying, and indexing. 3801.2 Section 3801.2 Agriculture Regulations of the Department of Agriculture (Continued) WORLD AGRICULTURAL... inspection, copying, and indexing. 5 U.S.C. 552(a)(2) requires that certain materials be made available for...

7 CFR 3801.2 - Public inspection, copying, and indexing.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 15 2014-01-01 2014-01-01 false Public inspection, copying, and indexing. 3801.2 Section 3801.2 Agriculture Regulations of the Department of Agriculture (Continued) WORLD AGRICULTURAL... inspection, copying, and indexing. 5 U.S.C. 552(a)(2) requires that certain materials be made available for...

7 CFR 3801.2 - Public inspection, copying, and indexing.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 15 2011-01-01 2011-01-01 false Public inspection, copying, and indexing. 3801.2 Section 3801.2 Agriculture Regulations of the Department of Agriculture (Continued) WORLD AGRICULTURAL... inspection, copying, and indexing. 5 U.S.C. 552(a)(2) requires that certain materials be made available for...

48 CFR 6302.25 - Copies of papers (Rule 25).

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Copies of papers (Rule 25). 6302.25 Section 6302.25 Federal Acquisition Regulations System DEPARTMENT OF TRANSPORTATION BOARD OF CONTRACT APPEALS RULES OF PROCEDURE 6302.25 Copies of papers (Rule 25). When books, records, papers, or...

48 CFR 6302.25 - Copies of papers (Rule 25).

Code of Federal Regulations, 2011 CFR

2011-10-01

... 48 Federal Acquisition Regulations System 7 2011-10-01 2011-10-01 false Copies of papers (Rule 25). 6302.25 Section 6302.25 Federal Acquisition Regulations System DEPARTMENT OF TRANSPORTATION BOARD OF CONTRACT APPEALS RULES OF PROCEDURE 6302.25 Copies of papers (Rule 25). When books, records, papers, or...

The role of copy and paste function in orthopedic trauma progress notes.

PubMed

Winn, Wesley; Shakir, Irshad A; Israel, Heidi; Cannada, Lisa K

2017-01-01

The electronic medical record (EMR) is standard in institutions. While there is not concern for legibility of notes and access to charts, there is an ease of copy and paste for daily notes. This may not lead to accurate portrayal of patient's status. Our purpose was to evaluate the use of copy and paste functions in daily notes of patients with injuries at high risk for complications. IRB approval was obtained for a retrospective review. Inclusion criteria included patients aged 18 and older treated at our Level 1 Trauma Center after implementation of Epic Systems Corporation, Verona, WI, USA. Those who were surgically treated for bicondylar tibial plateau fracture, or open tibial shaft fracture type I or II were included. Manual comparison of daily progress to the previous day's note was carried out. Comparisons were made by evaluating the subjective, objective, and plan portions of the notes, coded nominally using 1 for a change 0 for remaining the same. 38 patients' charts were reviewed during a 10-month (July 2012-April 2013) period, and the average length of stay was 12 days (range: 2-35). A total of 418 notes were compared. The overall average of copied data was 85% daily. In the subjective portion, 85-97% of the data was copied on a daily basis and 71-92% of the data was copied within the objective portion of the notes. There were 15 medical complications necessitating intervention. Of these medical complications, the note the day after the complication reflected the event in 10 out of 15, or 70%, of the complications. Thus 5, or 30%, of the patients did not have notes reflecting the complication ( p  < 0.05). There were 7 complications related to the injuries: 4 cases of compartment syndrome, 1 case of foot drop, representing a change in neurologic status, an amputation, and a wound infection treated with antibiotics. Four of the 7 complications (57%) were not reflected in the notes the following day after the complication ( p  < 0.05). There were 54

A novel quadruplex real-time PCR method for simultaneous detection of Cry2Ae and two genetically modified cotton events (GHB119 and T304-40).

PubMed

Li, Xiang; Wang, Xiuxiu; Yang, Jielin; Liu, Yueming; He, Yuping; Pan, Liangwen

2014-05-16

To date, over 150 genetically modified (GM) crops are widely cultivated. To comply with regulations developed for genetically modified organisms (GMOs), including labeling policies, many detection methods for GMO identification and quantification have been developed. To detect the entrance and exit of unauthorized GM crop events in China, we developed a novel quadruplex real-time PCR method for simultaneous detection and quantification of GM cotton events GHB119 and T304-40 in cotton-derived products (based on the 5'-flanking sequence) and the insect-resistance gene Cry2Ae. The limit of detection was 10 copies for GHB119 and Cry2Ae and 25 copies for T304-40. The limit of quantification was 25 copies for GHB119 and Cry2Ae and 50 copies for T304-40. Moreover, low bias and acceptable standard deviation and relative standard deviation values were obtained in quantification analysis of six blind samples containing different GHB119 and T304-40 ingredients. The developed quadruplex quantitative method could be used for quantitative detection of two GM cotton events (GHB119 and T304-40) and Cry2Ae gene ingredient in cotton derived products.

Integration of multi-omics data for integrative gene regulatory network inference.

PubMed

Zarayeneh, Neda; Ko, Euiseong; Oh, Jung Hun; Suh, Sang; Liu, Chunyu; Gao, Jean; Kim, Donghyun; Kang, Mingon

2017-01-01

Gene regulatory networks provide comprehensive insights and indepth understanding of complex biological processes. The molecular interactions of gene regulatory networks are inferred from a single type of genomic data, e.g., gene expression data in most research. However, gene expression is a product of sequential interactions of multiple biological processes, such as DNA sequence variations, copy number variations, histone modifications, transcription factors, and DNA methylations. The recent rapid advances of high-throughput omics technologies enable one to measure multiple types of omics data, called 'multi-omics data', that represent the various biological processes. In this paper, we propose an Integrative Gene Regulatory Network inference method (iGRN) that incorporates multi-omics data and their interactions in gene regulatory networks. In addition to gene expressions, copy number variations and DNA methylations were considered for multi-omics data in this paper. The intensive experiments were carried out with simulation data, where iGRN's capability that infers the integrative gene regulatory network is assessed. Through the experiments, iGRN shows its better performance on model representation and interpretation than other integrative methods in gene regulatory network inference. iGRN was also applied to a human brain dataset of psychiatric disorders, and the biological network of psychiatric disorders was analysed.

Integration of multi-omics data for integrative gene regulatory network inference

PubMed Central

Zarayeneh, Neda; Ko, Euiseong; Oh, Jung Hun; Suh, Sang; Liu, Chunyu; Gao, Jean; Kim, Donghyun

2017-01-01

Gene regulatory networks provide comprehensive insights and indepth understanding of complex biological processes. The molecular interactions of gene regulatory networks are inferred from a single type of genomic data, e.g., gene expression data in most research. However, gene expression is a product of sequential interactions of multiple biological processes, such as DNA sequence variations, copy number variations, histone modifications, transcription factors, and DNA methylations. The recent rapid advances of high-throughput omics technologies enable one to measure multiple types of omics data, called ‘multi-omics data’, that represent the various biological processes. In this paper, we propose an Integrative Gene Regulatory Network inference method (iGRN) that incorporates multi-omics data and their interactions in gene regulatory networks. In addition to gene expressions, copy number variations and DNA methylations were considered for multi-omics data in this paper. The intensive experiments were carried out with simulation data, where iGRN’s capability that infers the integrative gene regulatory network is assessed. Through the experiments, iGRN shows its better performance on model representation and interpretation than other integrative methods in gene regulatory network inference. iGRN was also applied to a human brain dataset of psychiatric disorders, and the biological network of psychiatric disorders was analysed. PMID:29354189

Tightly regulated, high-level expression from controlled copy number vectors based on the replicon of temperate phage N15.

PubMed

Mardanov, Andrey V; Strakhova, Taisia S; Smagin, Vladimir A; Ravin, Nikolai V

2007-06-15

A new Escherichia coli host/vector system has been developed to allow a dual regulation of both the plasmid copy number and gene expression. The new pN15E vectors are low copy number plasmids based on the replicon of temperate phage N15, comprising the repA replicase gene and cB repressor gene, controlling the plasmid copy number. Regulation of pN15E copy number is achieved through arabinose-inducible expression of phage N15 antirepressor protein, AntA, whose gene was integrated into the chromosome of the host strain under control of the PBAD promoter. The host strain also carried phage N15 partition operon, sop, allowing stable inheritance of pN15E vectors in the absence of selection pressure. In the first vector, pN15E4, the same PBAD promoter controls expression of a cloned gene. The second vector, pN15E6, carries the phage T5 promoter with a double lac operator repression module thus allowing independent regulation of promoter activity and copy number. Using the lacZ gene to monitor expression in these vectors, we show that the ratio of induction/repression can be about 7600-fold for pN15E4 and more than 15,000-fold for pN15E6. The low copy number of these vectors ensures very low basal level of expression allowing cloning genes encoding toxic products that was demonstrated by the stable maintenance of a gene encoding a restriction endonuclease in pN15E4. The tight control of transcription and the potential to regulate gene activities quantitatively over wide ranges will open up new approaches in the study of gene function in vivo and controlled expression of heterologous genes.

Stable transformation of a mosquito cell line results in extraordinarily high copy numbers of the plasmid.

PubMed Central

Monroe, T J; Muhlmann-Diaz, M C; Kovach, M J; Carlson, J O; Bedford, J S; Beaty, B J

1992-01-01

Stable incorporation of high copy numbers (greater than 10,000 per cell) of a plasmid vector containing a gene conferring resistance to the antibiotic hygromycin was achieved in a cell line derived from the Aedes albopictus mosquito. Plasmid sequences were readily observed by ethidium bromide staining of cellular DNA after restriction endonuclease digestion and agarose gel electrophoresis. The plasmid was demonstrated by in situ hybridization to be present in large arrays integrated in metaphase chromosomes and in minute and double-minute replicating elements. In one subclone, approximately 60,000 copies of the plasmid were organized in a large array that resembles a chromosome, morphologically and in the segregation of its chromatids during anaphase. The original as well as modified versions of the plasmid were rescued by transformation of Escherichia coli using total cellular DNA. Southern blot analyses of recovered plasmids indicate the presence of mosquito-derived sequences. Images PMID:1631052

1. Historic American Buildings Survey Charles E. Peterson, Photographer Copied ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

1. Historic American Buildings Survey Charles E. Peterson, Photographer Copied July 29, 1940 Copied from old photograph - Joseph R. Brown House, Sam Brown Memorial Park (moved from Dakota Territory), Browns Valley, Traverse County, MN

Probalistic Models for Solar Particle Events

NASA Technical Reports Server (NTRS)

Adams, James H., Jr.; Xapsos, Michael

2009-01-01

Probabilistic Models of Solar Particle Events (SPEs) are used in space mission design studies to describe the radiation environment that can be expected at a specified confidence level. The task of the designer is then to choose a design that will operate in the model radiation environment. Probabilistic models have already been developed for solar proton events that describe the peak flux, event-integrated fluence and missionintegrated fluence. In addition a probabilistic model has been developed that describes the mission-integrated fluence for the Z>2 elemental spectra. This talk will focus on completing this suite of models by developing models for peak flux and event-integrated fluence elemental spectra for the Z>2 element

49 CFR 512.5 - How many copies should I submit?

Code of Federal Regulations, 2010 CFR

2010-10-01

... must send the following in hard copy or electronic format to the Chief Counsel when making a claim for... format, a copy of any special software required to review materials for which confidential treatment is...

37. Photographic copy of architects plan, no date, (original in ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

37. Photographic copy of architects plan, no date, (original in possession of Montana State University, Bozeman, Montana.) PHOTOGRAPHIC COPY OF ORIGINAL DRAWING - Hardin City Water Works, 101 East Fourth Street, Hardin, Big Horn County, MT

Digital authentication with copy-detection patterns

NASA Astrophysics Data System (ADS)

Picard, Justin

2004-06-01

Technologies for making high-quality copies of documents are getting more available, cheaper, and more efficient. As a result, the counterfeiting business engenders huge losses, ranging to 5% to 8% of worldwide sales of brand products, and endangers the reputation and value of the brands themselves. Moreover, the growth of the Internet drives the business of counterfeited documents (fake IDs, university diplomas, checks, and so on), which can be bought easily and anonymously from hundreds of companies on the Web. The incredible progress of digital imaging equipment has put in question the very possibility of verifying the authenticity of documents: how can we discern genuine documents from seemingly "perfect" copies? This paper proposes a solution based on creating digital images with specific properties, called a Copy-detection patterns (CDP), that is printed on arbitrary documents, packages, etc. CDPs make an optimal use of an "information loss principle": every time an imae is printed or scanned, some information is lost about the original digital image. That principle applies even for the highest quality scanning, digital imaging, printing or photocopying equipment today, and will likely remain true for tomorrow. By measuring the amount of information contained in a scanned CDP, the CDP detector can take a decision on the authenticity of the document.

Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR.

PubMed

Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz

2017-01-01

Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a

Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR

PubMed Central

Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz

2017-01-01

Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a

Copying Machine Improvement

NASA Technical Reports Server (NTRS)

1981-01-01

Manufacturer of the Model 2210 copying machine was looking for a plastic valve bushing material that could be produced by a low-cost injection molding process to replace the unsuitable valve bushing they were using. NERAC conducted a computer search of the NASA database and was able to supply Nashua Corporation with several technical reports in their area of interest. Information aided the company's development of a urethane valve bushing which solved the problem and created a dramatic reduction in unit cost.

40 CFR 716.30 - Submission of copies of studies.

Code of Federal Regulations, 2012 CFR

2012-07-01

... SUBSTANCES CONTROL ACT HEALTH AND SAFETY DATA REPORTING General Provisions § 716.30 Submission of copies of... health and safety studies in their possession for the substances or mixtures listed in § 716.120. Persons... is to satisfy reporting requirements under this part. (c) You must submit copies of health and safety...

40 CFR 716.30 - Submission of copies of studies.

Code of Federal Regulations, 2010 CFR

2010-07-01

... SUBSTANCES CONTROL ACT HEALTH AND SAFETY DATA REPORTING General Provisions § 716.30 Submission of copies of... health and safety studies in their possession for the substances or mixtures listed in § 716.120. Persons... is to satisfy reporting requirements under this part. (c) You must submit copies of health and safety...

40 CFR 716.30 - Submission of copies of studies.

Code of Federal Regulations, 2013 CFR

2013-07-01

... SUBSTANCES CONTROL ACT HEALTH AND SAFETY DATA REPORTING General Provisions § 716.30 Submission of copies of... health and safety studies in their possession for the substances or mixtures listed in § 716.120. Persons... is to satisfy reporting requirements under this part. (c) You must submit copies of health and safety...

40 CFR 716.30 - Submission of copies of studies.

Code of Federal Regulations, 2014 CFR

2014-07-01

... SUBSTANCES CONTROL ACT HEALTH AND SAFETY DATA REPORTING General Provisions § 716.30 Submission of copies of... health and safety studies in their possession for the substances or mixtures listed in § 716.120. Persons... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Submission of copies of studies. 716...

A Lesson for Instructors: Top 10 Copy-Editing Skills.

ERIC Educational Resources Information Center

Auman, Ann

1995-01-01

Presents results of a survey of 164 newspaper editors regarding which skills they believe are crucial for entry-level copy editors to know, and in which areas they see the most deficiencies. Notes that the skills identified reflect the changing duties of the copy editor and the increasing complexities of the job. (SR)

DNA copy number, including telomeres and mitochondria, assayed using next-generation sequencing

PubMed Central

2010-01-01

Background DNA copy number variations occur within populations and aberrations can cause disease. We sought to develop an improved lab-automatable, cost-efficient, accurate platform to profile DNA copy number. Results We developed a sequencing-based assay of nuclear, mitochondrial, and telomeric DNA copy number that draws on the unbiased nature of next-generation sequencing and incorporates techniques developed for RNA expression profiling. To demonstrate this platform, we assayed UMC-11 cells using 5 million 33 nt reads and found tremendous copy number variation, including regions of single and homogeneous deletions and amplifications to 29 copies; 5 times more mitochondria and 4 times less telomeric sequence than a pool of non-diseased, blood-derived DNA; and that UMC-11 was derived from a male individual. Conclusion The described assay outputs absolute copy number, outputs an error estimate (p-value), and is more accurate than array-based platforms at high copy number. The platform enables profiling of mitochondrial levels and telomeric length. The assay is lab-automatable and has a genomic resolution and cost that are tunable based on the number of sequence reads. PMID:20398377

Phylogenetic Copy-Number Factorization of Multiple Tumor Samples.

PubMed

Zaccaria, Simone; El-Kebir, Mohammed; Klau, Gunnar W; Raphael, Benjamin J

2018-04-16

Cancer is an evolutionary process driven by somatic mutations. This process can be represented as a phylogenetic tree. Constructing such a phylogenetic tree from genome sequencing data is a challenging task due to the many types of mutations in cancer and the fact that nearly all cancer sequencing is of a bulk tumor, measuring a superposition of somatic mutations present in different cells. We study the problem of reconstructing tumor phylogenies from copy-number aberrations (CNAs) measured in bulk-sequencing data. We introduce the Copy-Number Tree Mixture Deconvolution (CNTMD) problem, which aims to find the phylogenetic tree with the fewest number of CNAs that explain the copy-number data from multiple samples of a tumor. We design an algorithm for solving the CNTMD problem and apply the algorithm to both simulated and real data. On simulated data, we find that our algorithm outperforms existing approaches that either perform deconvolution/factorization of mixed tumor samples or build phylogenetic trees assuming homogeneous tumor samples. On real data, we analyze multiple samples from a prostate cancer patient, identifying clones within these samples and a phylogenetic tree that relates these clones and their differing proportions across samples. This phylogenetic tree provides a higher resolution view of copy-number evolution of this cancer than published analyses.

Optimized breeding strategies for multiple trait integration: II. Process efficiency in event pyramiding and trait fixation.

PubMed

Peng, Ting; Sun, Xiaochun; Mumm, Rita H

2014-01-01

Multiple trait integration (MTI) is a multi-step process of converting an elite variety/hybrid for value-added traits (e.g. transgenic events) through backcross breeding. From a breeding standpoint, MTI involves four steps: single event introgression, event pyramiding, trait fixation, and version testing. This study explores the feasibility of marker-aided backcross conversion of a target maize hybrid for 15 transgenic events in the light of the overall goal of MTI of recovering equivalent performance in the finished hybrid conversion along with reliable expression of the value-added traits. Using the results to optimize single event introgression (Peng et al. Optimized breeding strategies for multiple trait integration: I. Minimizing linkage drag in single event introgression. Mol Breed, 2013) which produced single event conversions of recurrent parents (RPs) with ≤8 cM of residual non-recurrent parent (NRP) germplasm with ~1 cM of NRP germplasm in the 20 cM regions flanking the event, this study focused on optimizing process efficiency in the second and third steps in MTI: event pyramiding and trait fixation. Using computer simulation and probability theory, we aimed to (1) fit an optimal breeding strategy for pyramiding of eight events into the female RP and seven in the male RP, and (2) identify optimal breeding strategies for trait fixation to create a 'finished' conversion of each RP homozygous for all events. In addition, next-generation seed needs were taken into account for a practical approach to process efficiency. Building on work by Ishii and Yonezawa (Optimization of the marker-based procedures for pyramiding genes from multiple donor lines: I. Schedule of crossing between the donor lines. Crop Sci 47:537-546, 2007a), a symmetric crossing schedule for event pyramiding was devised for stacking eight (seven) events in a given RP. Options for trait fixation breeding strategies considered selfing and doubled haploid approaches to achieve homozygosity

The effect of input DNA copy number on genotype call and characterising SNP markers in the humpback whale genome using a nanofluidic array.

PubMed

Bhat, Somanath; Polanowski, Andrea M; Double, Mike C; Jarman, Simon N; Emslie, Kerry R

2012-01-01

Recent advances in nanofluidic technologies have enabled the use of Integrated Fluidic Circuits (IFCs) for high-throughput Single Nucleotide Polymorphism (SNP) genotyping (GT). In this study, we implemented and validated a relatively low cost nanofluidic system for SNP-GT with and without Specific Target Amplification (STA). As proof of principle, we first validated the effect of input DNA copy number on genotype call rate using well characterised, digital PCR (dPCR) quantified human genomic DNA samples and then implemented the validated method to genotype 45 SNPs in the humpback whale, Megaptera novaeangliae, nuclear genome. When STA was not incorporated, for a homozygous human DNA sample, reaction chambers containing, on average 9 to 97 copies, showed 100% call rate and accuracy. Below 9 copies, the call rate decreased, and at one copy it was 40%. For a heterozygous human DNA sample, the call rate decreased from 100% to 21% when predicted copies per reaction chamber decreased from 38 copies to one copy. The tightness of genotype clusters on a scatter plot also decreased. In contrast, when the same samples were subjected to STA prior to genotyping a call rate and a call accuracy of 100% were achieved. Our results demonstrate that low input DNA copy number affects the quality of data generated, in particular for a heterozygous sample. Similar to human genomic DNA, a call rate and a call accuracy of 100% was achieved with whale genomic DNA samples following multiplex STA using either 15 or 45 SNP-GT assays. These calls were 100% concordant with their true genotypes determined by an independent method, suggesting that the nanofluidic system is a reliable platform for executing call rates with high accuracy and concordance in genomic sequences derived from biological tissue.

Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

NASA Astrophysics Data System (ADS)

Pérez Urquiza, M.; Acatzi Silva, A. I.

2014-02-01

Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

Copying referral letters to patients: prepare for change.

PubMed

White, Philip

2004-08-01

The National Health Service (NHS) Plan for England has directed that from April 2004 clinicians will offer patients the opportunity to receive copies of letters that are written about them. Patients like to have more information and patients who have received copies of letters have found them useful. It is hoped that copying letters will improve relationships between doctors and patients, encourage patients to be better informed, and improve the quality of information provided to patients. Relatively little empirical research has been performed in this area but what exists is generally supportive. Attention will need to be paid to issues of confidentiality, the language and content of letters, and individuals who may have difficulty obtaining information from letters. This initiative is one of many that the NHS has introduced to enhance openness, honesty and the quality of information provided to patients.

77 FR 27125 - Periodicals-Recognition of Distribution of Periodicals via Electronic Copies

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-09

... Electronic Copies AGENCY: Postal Service\\TM\\. ACTION: Final rule. SUMMARY: The Postal Service will revise the... limited reporting of electronic copies of Periodicals publications to satisfy the circulation standards...--Recognition of Distribution of Periodicals via Electronic Copies (77 FR 5470-5471) revising DMM 707.6 by...

A Simulation Model for Purchasing Duplicate Copies in a Library

ERIC Educational Resources Information Center

Arms, W. Y.; Walter, T. P.

1974-01-01

A method of estimating the number of duplicate copies of books needed based on a computer simulation which takes into account number of copies available, number of loans, total underlying demand, satisfaction level, percentage time on shelf. (LS)

ATLAS EventIndex general dataflow and monitoring infrastructure

NASA Astrophysics Data System (ADS)

Fernández Casaní, Á.; Barberis, D.; Favareto, A.; García Montoro, C.; González de la Hoz, S.; Hřivnáč, J.; Prokoshin, F.; Salt, J.; Sánchez, J.; Többicke, R.; Yuan, R.; ATLAS Collaboration

2017-10-01

The ATLAS EventIndex has been running in production since mid-2015, reliably collecting information worldwide about all produced events and storing them in a central Hadoop infrastructure at CERN. A subset of this information is copied to an Oracle relational database for fast dataset discovery, event-picking, crosschecks with other ATLAS systems and checks for event duplication. The system design and its optimization is serving event picking from requests of a few events up to scales of tens of thousand of events, and in addition, data consistency checks are performed for large production campaigns. Detecting duplicate events with a scope of physics collections has recently arisen as an important use case. This paper describes the general architecture of the project and the data flow and operation issues, which are addressed by recent developments to improve the throughput of the overall system. In this direction, the data collection system is reducing the usage of the messaging infrastructure to overcome the performance shortcomings detected during production peaks; an object storage approach is instead used to convey the event index information, and messages to signal their location and status. Recent changes in the Producer/Consumer architecture are also presented in detail, as well as the monitoring infrastructure.

Life Events, Genetic Susceptibility, and Smoking among Adolescents

PubMed Central

Pampel, Fred C.; Boardman, Jason D.; Daw, Jonathan; Stallings, Michael C.; Smolen, Andrew; Haberstick, Brett; Widaman, Keith F.; Neppl, Tricia K.; Conger, Rand D.

2015-01-01

Although stressful life events during adolescence are associated with the adoption of unhealthy behaviors such as smoking, both social circumstances and physical traits can moderate the relationship. This study builds on the stress paradigm and gene-environment approach to social behavior by examining how a polymorphism in the serotonin transporter gene 5-HTTLPR moderates the effect of life events on adolescent smoking. Tests of interaction hypotheses use data from the Family Transitions Project, a longitudinal study of 7th graders followed for 5 years. A sibling-pair design with separate models for the gender composition of pairs (brothers, sisters, or brother/sister) controls for unmeasured family background. The results show that negative life events are significantly and positively associated with smoking. Among brother pairs but not other pairs, the results provide evidence of gene-environment interaction by showing that life events more strongly influence smoking behavior for those with more copies of the 5-HTTLPR S allele. PMID:26463545

Functional impact of global rare copy number variation in autism spectrum disorders.

PubMed

Pinto, Dalila; Pagnamenta, Alistair T; Klei, Lambertus; Anney, Richard; Merico, Daniele; Regan, Regina; Conroy, Judith; Magalhaes, Tiago R; Correia, Catarina; Abrahams, Brett S; Almeida, Joana; Bacchelli, Elena; Bader, Gary D; Bailey, Anthony J; Baird, Gillian; Battaglia, Agatino; Berney, Tom; Bolshakova, Nadia; Bölte, Sven; Bolton, Patrick F; Bourgeron, Thomas; Brennan, Sean; Brian, Jessica; Bryson, Susan E; Carson, Andrew R; Casallo, Guillermo; Casey, Jillian; Chung, Brian H Y; Cochrane, Lynne; Corsello, Christina; Crawford, Emily L; Crossett, Andrew; Cytrynbaum, Cheryl; Dawson, Geraldine; de Jonge, Maretha; Delorme, Richard; Drmic, Irene; Duketis, Eftichia; Duque, Frederico; Estes, Annette; Farrar, Penny; Fernandez, Bridget A; Folstein, Susan E; Fombonne, Eric; Freitag, Christine M; Gilbert, John; Gillberg, Christopher; Glessner, Joseph T; Goldberg, Jeremy; Green, Andrew; Green, Jonathan; Guter, Stephen J; Hakonarson, Hakon; Heron, Elizabeth A; Hill, Matthew; Holt, Richard; Howe, Jennifer L; Hughes, Gillian; Hus, Vanessa; Igliozzi, Roberta; Kim, Cecilia; Klauck, Sabine M; Kolevzon, Alexander; Korvatska, Olena; Kustanovich, Vlad; Lajonchere, Clara M; Lamb, Janine A; Laskawiec, Magdalena; Leboyer, Marion; Le Couteur, Ann; Leventhal, Bennett L; Lionel, Anath C; Liu, Xiao-Qing; Lord, Catherine; Lotspeich, Linda; Lund, Sabata C; Maestrini, Elena; Mahoney, William; Mantoulan, Carine; Marshall, Christian R; McConachie, Helen; McDougle, Christopher J; McGrath, Jane; McMahon, William M; Merikangas, Alison; Migita, Ohsuke; Minshew, Nancy J; Mirza, Ghazala K; Munson, Jeff; Nelson, Stanley F; Noakes, Carolyn; Noor, Abdul; Nygren, Gudrun; Oliveira, Guiomar; Papanikolaou, Katerina; Parr, Jeremy R; Parrini, Barbara; Paton, Tara; Pickles, Andrew; Pilorge, Marion; Piven, Joseph; Ponting, Chris P; Posey, David J; Poustka, Annemarie; Poustka, Fritz; Prasad, Aparna; Ragoussis, Jiannis; Renshaw, Katy; Rickaby, Jessica; Roberts, Wendy; Roeder, Kathryn; Roge, Bernadette; Rutter, Michael L; Bierut, Laura J; Rice, John P; Salt, Jeff; Sansom, Katherine; Sato, Daisuke; Segurado, Ricardo; Sequeira, Ana F; Senman, Lili; Shah, Naisha; Sheffield, Val C; Soorya, Latha; Sousa, Inês; Stein, Olaf; Sykes, Nuala; Stoppioni, Vera; Strawbridge, Christina; Tancredi, Raffaella; Tansey, Katherine; Thiruvahindrapduram, Bhooma; Thompson, Ann P; Thomson, Susanne; Tryfon, Ana; Tsiantis, John; Van Engeland, Herman; Vincent, John B; Volkmar, Fred; Wallace, Simon; Wang, Kai; Wang, Zhouzhi; Wassink, Thomas H; Webber, Caleb; Weksberg, Rosanna; Wing, Kirsty; Wittemeyer, Kerstin; Wood, Shawn; Wu, Jing; Yaspan, Brian L; Zurawiecki, Danielle; Zwaigenbaum, Lonnie; Buxbaum, Joseph D; Cantor, Rita M; Cook, Edwin H; Coon, Hilary; Cuccaro, Michael L; Devlin, Bernie; Ennis, Sean; Gallagher, Louise; Geschwind, Daniel H; Gill, Michael; Haines, Jonathan L; Hallmayer, Joachim; Miller, Judith; Monaco, Anthony P; Nurnberger, John I; Paterson, Andrew D; Pericak-Vance, Margaret A; Schellenberg, Gerard D; Szatmari, Peter; Vicente, Astrid M; Vieland, Veronica J; Wijsman, Ellen M; Scherer, Stephen W; Sutcliffe, James S; Betancur, Catalina

2010-07-15

The autism spectrum disorders (ASDs) are a group of conditions characterized by impairments in reciprocal social interaction and communication, and the presence of restricted and repetitive behaviours. Individuals with an ASD vary greatly in cognitive development, which can range from above average to intellectual disability. Although ASDs are known to be highly heritable ( approximately 90%), the underlying genetic determinants are still largely unknown. Here we analysed the genome-wide characteristics of rare (<1% frequency) copy number variation in ASD using dense genotyping arrays. When comparing 996 ASD individuals of European ancestry to 1,287 matched controls, cases were found to carry a higher global burden of rare, genic copy number variants (CNVs) (1.19 fold, P = 0.012), especially so for loci previously implicated in either ASD and/or intellectual disability (1.69 fold, P = 3.4 x 10(-4)). Among the CNVs there were numerous de novo and inherited events, sometimes in combination in a given family, implicating many novel ASD genes such as SHANK2, SYNGAP1, DLGAP2 and the X-linked DDX53-PTCHD1 locus. We also discovered an enrichment of CNVs disrupting functional gene sets involved in cellular proliferation, projection and motility, and GTPase/Ras signalling. Our results reveal many new genetic and functional targets in ASD that may lead to final connected pathways.

Retroviral DNA Integration

PubMed Central

2016-01-01

The integration of a DNA copy of the viral RNA genome into host chromatin is the defining step of retroviral replication. This enzymatic process is catalyzed by the virus-encoded integrase protein, which is conserved among retroviruses and LTR-retrotransposons. Retroviral integration proceeds via two integrase activities: 3′-processing of the viral DNA ends, followed by the strand transfer of the processed ends into host cell chromosomal DNA. Herein we review the molecular mechanism of retroviral DNA integration, with an emphasis on reaction chemistries and architectures of the nucleoprotein complexes involved. We additionally discuss the latest advances on anti-integrase drug development for the treatment of AIDS and the utility of integrating retroviral vectors in gene therapy applications. PMID:27198982

[Study on analysis of copy paper by Fourier transform infrared spectroscopy].

PubMed

Li, Ji-Min; Wang, Yan-Ji; Wang, Jing-Han; Yao, Li-Juan; Zhang, Biao

2009-06-01

A new method of fast identification of copy papers by Fourier transform infrared spectroscopy (FTIR) was developed. The kinds of filler and the cellulosic degree of crystallinity were analyzed by FTIR, and the ageing curves of cellulosic paper were studied with heating and ultraviolet light. The cellulosic degree of crystallinity was showed by the ratio of absorbance at 1 429 cm(-1) to that at 893 cm(-1), the standard deviation of different brands of copy papers was 0.010 7-0.016 0, and the standard deviation of the same brands of copy papers was 0.014 8. The kinds of filler and the cellulosic degree of crystallinity were different in copy papers from different brands of different manufacturing plants, different brands of same manufacturing plants and different manufacturing times of the same brands from the same manufacturing plants, and the curves of ageing were different with heating and ultraviolet light. The results of fast identification of copy papers by FTIR are satisfactory.

Integrated survival analysis using an event-time approach in a Bayesian framework

USGS Publications Warehouse

Walsh, Daniel P.; Dreitz, VJ; Heisey, Dennis M.

2015-01-01

Event-time or continuous-time statistical approaches have been applied throughout the biostatistical literature and have led to numerous scientific advances. However, these techniques have traditionally relied on knowing failure times. This has limited application of these analyses, particularly, within the ecological field where fates of marked animals may be unknown. To address these limitations, we developed an integrated approach within a Bayesian framework to estimate hazard rates in the face of unknown fates. We combine failure/survival times from individuals whose fates are known and times of which are interval-censored with information from those whose fates are unknown, and model the process of detecting animals with unknown fates. This provides the foundation for our integrated model and permits necessary parameter estimation. We provide the Bayesian model, its derivation, and use simulation techniques to investigate the properties and performance of our approach under several scenarios. Lastly, we apply our estimation technique using a piece-wise constant hazard function to investigate the effects of year, age, chick size and sex, sex of the tending adult, and nesting habitat on mortality hazard rates of the endangered mountain plover (Charadrius montanus) chicks. Traditional models were inappropriate for this analysis because fates of some individual chicks were unknown due to failed radio transmitters. Simulations revealed biases of posterior mean estimates were minimal (≤ 4.95%), and posterior distributions behaved as expected with RMSE of the estimates decreasing as sample sizes, detection probability, and survival increased. We determined mortality hazard rates for plover chicks were highest at <5 days old and were lower for chicks with larger birth weights and/or whose nest was within agricultural habitats. Based on its performance, our approach greatly expands the range of problems for which event-time analyses can be used by eliminating the

Integrated survival analysis using an event-time approach in a Bayesian framework.

PubMed

Walsh, Daniel P; Dreitz, Victoria J; Heisey, Dennis M

2015-02-01

Event-time or continuous-time statistical approaches have been applied throughout the biostatistical literature and have led to numerous scientific advances. However, these techniques have traditionally relied on knowing failure times. This has limited application of these analyses, particularly, within the ecological field where fates of marked animals may be unknown. To address these limitations, we developed an integrated approach within a Bayesian framework to estimate hazard rates in the face of unknown fates. We combine failure/survival times from individuals whose fates are known and times of which are interval-censored with information from those whose fates are unknown, and model the process of detecting animals with unknown fates. This provides the foundation for our integrated model and permits necessary parameter estimation. We provide the Bayesian model, its derivation, and use simulation techniques to investigate the properties and performance of our approach under several scenarios. Lastly, we apply our estimation technique using a piece-wise constant hazard function to investigate the effects of year, age, chick size and sex, sex of the tending adult, and nesting habitat on mortality hazard rates of the endangered mountain plover (Charadrius montanus) chicks. Traditional models were inappropriate for this analysis because fates of some individual chicks were unknown due to failed radio transmitters. Simulations revealed biases of posterior mean estimates were minimal (≤ 4.95%), and posterior distributions behaved as expected with RMSE of the estimates decreasing as sample sizes, detection probability, and survival increased. We determined mortality hazard rates for plover chicks were highest at <5 days old and were lower for chicks with larger birth weights and/or whose nest was within agricultural habitats. Based on its performance, our approach greatly expands the range of problems for which event-time analyses can be used by eliminating the

The double copy: gravity from gluons

NASA Astrophysics Data System (ADS)

White, C. D.

2018-04-01

Three of the four fundamental forces in nature are described by so-called gauge theories, which include the effects of both relativity and quantum mechanics. Gravity, on the other hand, is described by General Relativity, and the lack of a well-behaved quantum theory - believed to be relevant at the centre of black holes, and at the Big Bang itself - remains a notorious unsolved problem. Recently a new correspondence, the double copy, has been discovered between scattering amplitudes (quantities related to the probability for particles to interact) in gravity, and their gauge theory counterparts. This has subsequently been extended to other quantities, providing gauge theory analogues of e.g. black holes. We here review current research on the double copy, and describe some possible applications.

Audiovisual integration of emotional signals in voice and face: an event-related fMRI study.

PubMed

Kreifelts, Benjamin; Ethofer, Thomas; Grodd, Wolfgang; Erb, Michael; Wildgruber, Dirk

2007-10-01

In a natural environment, non-verbal emotional communication is multimodal (i.e. speech melody, facial expression) and multifaceted concerning the variety of expressed emotions. Understanding these communicative signals and integrating them into a common percept is paramount to successful social behaviour. While many previous studies have focused on the neurobiology of emotional communication in the auditory or visual modality alone, far less is known about multimodal integration of auditory and visual non-verbal emotional information. The present study investigated this process using event-related fMRI. Behavioural data revealed that audiovisual presentation of non-verbal emotional information resulted in a significant increase in correctly classified stimuli when compared with visual and auditory stimulation. This behavioural gain was paralleled by enhanced activation in bilateral posterior superior temporal gyrus (pSTG) and right thalamus, when contrasting audiovisual to auditory and visual conditions. Further, a characteristic of these brain regions, substantiating their role in the emotional integration process, is a linear relationship between the gain in classification accuracy and the strength of the BOLD response during the bimodal condition. Additionally, enhanced effective connectivity between audiovisual integration areas and associative auditory and visual cortices was observed during audiovisual stimulation, offering further insight into the neural process accomplishing multimodal integration. Finally, we were able to document an enhanced sensitivity of the putative integration sites to stimuli with emotional non-verbal content as compared to neutral stimuli.

Cover-Copy-Compare and Spelling: One versus Three Repetitions

ERIC Educational Resources Information Center

Erion, Joel; Davenport, Cindy; Rodax, Nicole; Scholl, Bethany; Hardy, Jennifer

2009-01-01

Cover, copy, compare (CCC) has been used with success to improve spelling skills. This study adds to existing research by completing an analysis of the rewriting component of the intervention. The impact of varying the number of times a subject copied a word following an error was examined with four elementary age students. An adaptive alternating…

40. Photographic copy of original construction drawing, dated June 1911 ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

40. Photographic copy of original construction drawing, dated June 1911 (from paper-copy of aperture-card negative at Bureau of Reclamation, Pacific Northwest Regional Office, Boise, ID). ROOF PLAN. - Boise Project, Boise Project Office, 214 Broadway, Boise, Ada County, ID

38. Photographic copy of original construction drawing, dated June 1911 ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

38. Photographic copy of original construction drawing, dated June 1911 (from paper-copy of aperture-card negative at Bureau of Reclamation, Pacific Northwest Regional Office, Boise, ID). FIRST FLOOR PLAN. - Boise Project, Boise Project Office, 214 Broadway, Boise, Ada County, ID

37. Photographic copy of original construction drawing, dated June 1911 ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

37. Photographic copy of original construction drawing, dated June 1911 (from paper-copy of aperture-card negative at Bureau of Reclamation, Pacific Northwest Regional Office, Boise, ID). BASEMENT PLAN. - Boise Project, Boise Project Office, 214 Broadway, Boise, Ada County, ID

39. Photographic copy of original construction drawing, dated June 1911 ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

39. Photographic copy of original construction drawing, dated June 1911 (from paper-copy of aperture-card negative at Bureau of Reclamation, Pacific Northwest Regional Office, Boise, ID). SECOND FLOOR PLAN. - Boise Project, Boise Project Office, 214 Broadway, Boise, Ada County, ID

45. Photographic copy of original construction drawing, dated 16 February ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

45. Photographic copy of original construction drawing, dated 16 February 1916 (from paper-copy of aperture-card negative at Bureau of Reclamation, Pacific Northwest Regional Office, Boise, ID). LOT SURVEY. - Boise Project, Boise Project Office, 214 Broadway, Boise, Ada County, ID

41. Photographic copy of original construction drawing, dated June 1911 ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

41. Photographic copy of original construction drawing, dated June 1911 (from paper-copy of aperture-card negative at Bureau of Reclamation, Pacific Northwest Regional Office, Boise, ID). CROSS SECTIONS. - Boise Project, Boise Project Office, 214 Broadway, Boise, Ada County, ID

41 CFR 105-50.202-1 - Copies of statistical or other studies.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 41 Public Contracts and Property Management 3 2011-01-01 2011-01-01 false Copies of statistical or... Services Administration § 105-50.202-1 Copies of statistical or other studies. This material includes a copy of any existing statistical or other studies and compilations, results of technical tests and...

41 CFR 105-50.202-1 - Copies of statistical or other studies.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Copies of statistical or... Services Administration § 105-50.202-1 Copies of statistical or other studies. This material includes a copy of any existing statistical or other studies and compilations, results of technical tests and...

Cognitive integration of asynchronous natural or non-natural auditory and visual information in videos of real-world events: an event-related potential study.

PubMed

Liu, B; Wang, Z; Wu, G; Meng, X

2011-04-28

In this paper, we aim to study the cognitive integration of asynchronous natural or non-natural auditory and visual information in videos of real-world events. Videos with asynchronous semantically consistent or inconsistent natural sound or speech were used as stimuli in order to compare the difference and similarity between multisensory integrations of videos with asynchronous natural sound and speech. The event-related potential (ERP) results showed that N1 and P250 components were elicited irrespective of whether natural sounds were consistent or inconsistent with critical actions in videos. Videos with inconsistent natural sound could elicit N400-P600 effects compared to videos with consistent natural sound, which was similar to the results from unisensory visual studies. Videos with semantically consistent or inconsistent speech could both elicit N1 components. Meanwhile, videos with inconsistent speech would elicit N400-LPN effects in comparison with videos with consistent speech, which showed that this semantic processing was probably related to recognition memory. Moreover, the N400 effect elicited by videos with semantically inconsistent speech was larger and later than that elicited by videos with semantically inconsistent natural sound. Overall, multisensory integration of videos with natural sound or speech could be roughly divided into two stages. For the videos with natural sound, the first stage might reflect the connection between the received information and the stored information in memory; and the second one might stand for the evaluation process of inconsistent semantic information. For the videos with speech, the first stage was similar to the first stage of videos with natural sound; while the second one might be related to recognition memory process. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

The 19th Project Integration Meeting

NASA Technical Reports Server (NTRS)

Mcdonald, R. R.

1981-01-01

The Flat-Plate Solar Array Project is described. Project analysis and integration is discussed. Technology research in silicon material, large-area silicon sheet and environmental isolation; cell and module formation; engineering sciences, and module performance and failure analysis. It includes a report on, and copies of visual presentations made at, the 19th Project Integration Meeting held at Pasadena, California, on November 11, 1981.

Video copy protection and detection framework (VPD) for e-learning systems

NASA Astrophysics Data System (ADS)

ZandI, Babak; Doustarmoghaddam, Danial; Pour, Mahsa R.

2013-03-01

This Article reviews and compares the copyright issues related to the digital video files, which can be categorized as contended based and Digital watermarking copy Detection. Then we describe how to protect a digital video by using a special Video data hiding method and algorithm. We also discuss how to detect the copy right of the file, Based on expounding Direction of the technology of the video copy detection, and Combining with the own research results, brings forward a new video protection and copy detection approach in terms of plagiarism and e-learning systems using the video data hiding technology. Finally we introduce a framework for Video protection and detection in e-learning systems (VPD Framework).

One Novel Multiple-Target Plasmid Reference Molecule Targeting Eight Genetically Modified Canola Events for Genetically Modified Canola Detection.

PubMed

Li, Zhuqing; Li, Xiang; Wang, Canhua; Song, Guiwen; Pi, Liqun; Zheng, Lan; Zhang, Dabing; Yang, Litao

2017-09-27

Multiple-target plasmid DNA reference materials have been generated and utilized as good substitutes of matrix-based reference materials in the analysis of genetically modified organisms (GMOs). Herein, we report the construction of one multiple-target plasmid reference molecule, pCAN, which harbors eight GM canola event-specific sequences (RF1, RF2, MS1, MS8, Topas 19/2, Oxy235, RT73, and T45) and a partial sequence of the canola endogenous reference gene PEP. The applicability of this plasmid reference material in qualitative and quantitative PCR assays of the eight GM canola events was evaluated, including the analysis of specificity, limit of detection (LOD), limit of quantification (LOQ), and performance of pCAN in the analysis of various canola samples, etc. The LODs are 15 copies for RF2, MS1, and RT73 assays using pCAN as the calibrator and 10 genome copies for the other events. The LOQ in each event-specific real-time PCR assay is 20 copies. In quantitative real-time PCR analysis, the PCR efficiencies of all event-specific and PEP assays are between 91% and 97%, and the squared regression coefficients (R 2 ) are all higher than 0.99. The quantification bias values varied from 0.47% to 20.68% with relative standard deviation (RSD) from 1.06% to 24.61% in the quantification of simulated samples. Furthermore, 10 practical canola samples sampled from imported shipments in the port of Shanghai, China, were analyzed employing pCAN as the calibrator, and the results were comparable with those assays using commercial certified materials as the calibrator. Concluding from these results, we believe that this newly developed pCAN plasmid is one good candidate for being a plasmid DNA reference material in the detection and quantification of the eight GM canola events in routine analysis.

Adverse events in an integrated trauma-focused intervention for women in community substance abuse treatment.

PubMed

Killeen, Therese; Hien, Denise; Campbell, Aimee; Brown, Chanda; Hansen, Cheri; Jiang, Huiping; Kristman-Valente, Allison; Neuenfeldt, Christine; Rocz-de la Luz, Nicci; Sampson, Royce; Suarez-Morales, Lourdes; Wells, Elizabeth; Brigham, Greg; Nunes, Edward

2008-10-01

A substantial number of women who enter substance abuse treatment have a history of trauma and meet criteria for posttraumatic stress disorder (PTSD). Fear regarding the extent to which PTSD treatment can evoke negative consequences remains a research question. This study explored adverse events related to the implementation of an integrated treatment for women with trauma and substance use disorder (Seeking Safety) compared with a nontrauma-focused intervention (Women's Health Education). Three hundred fifty-three women enrolled in community substance abuse treatment were randomized to 1 of the 2 study groups and monitored weekly for adverse events. There were no differences between the two intervention groups in the number of women reporting study-related adverse events (28 [9.6%] for the Seeking Safety group and 21[7.2%] for the Women's Health Education group). Implementing PTSD treatment in substance abuse treatment programs appears to be safe, with minimal impact on intervention-related adverse psychiatric and substance abuse symptoms. More research is needed on the efficacy of such interventions to improve outcomes of PTSD and substance use.

17 CFR 260.7a-3 - Number of copies; filing; signatures; binding.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Number of copies; filing; signatures; binding. 260.7a-3 Section 260.7a-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... § 260.7a-3 Number of copies; filing; signatures; binding. (a) Three copies of the complete application...

17 CFR 260.5a-3 - Number of copies; filing; signatures; binding.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Number of copies; filing; signatures; binding. 260.5a-3 Section 260.5a-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... § 260.5a-3 Number of copies; filing; signatures; binding. (a) Three copies of each statement of...

36 CFR § 703.19 - Requests for authenticated copies of Library documents.

Code of Federal Regulations, 2013 CFR

2013-07-01

... copies of Library documents. § 703.19 Section § 703.19 Parks, Forests, and Public Property LIBRARY OF... Documents in Certain Legal Proceedings Where the Library Is Not a Party § 703.19 Requests for authenticated copies of Library documents. Requests for authenticated copies of Library documents for purposes of...

A remark on copy number variation detection methods.

PubMed

Li, Shuo; Dou, Xialiang; Gao, Ruiqi; Ge, Xinzhou; Qian, Minping; Wan, Lin

2018-01-01

Copy number variations (CNVs) are gain and loss of DNA sequence of a genome. High throughput platforms such as microarrays and next generation sequencing technologies (NGS) have been applied for genome wide copy number losses. Although progress has been made in both approaches, the accuracy and consistency of CNV calling from the two platforms remain in dispute. In this study, we perform a deep analysis on copy number losses on 254 human DNA samples, which have both SNP microarray data and NGS data publicly available from Hapmap Project and 1000 Genomes Project respectively. We show that the copy number losses reported from Hapmap Project and 1000 Genome Project only have < 30% overlap, while these reports are required to have cross-platform (e.g. PCR, microarray and high-throughput sequencing) experimental supporting by their corresponding projects, even though state-of-art calling methods were employed. On the other hand, copy number losses are found directly from HapMap microarray data by an accurate algorithm, i.e. CNVhac, almost all of which have lower read mapping depth in NGS data; furthermore, 88% of which can be supported by the sequences with breakpoint in NGS data. Our results suggest the ability of microarray calling CNVs and the possible introduction of false negatives from the unessential requirement of the additional cross-platform supporting. The inconsistency of CNV reports from Hapmap Project and 1000 Genomes Project might result from the inadequate information containing in microarray data, the inconsistent detection criteria, or the filtration effect of cross-platform supporting. The statistical test on CNVs called from CNVhac show that the microarray data can offer reliable CNV reports, and majority of CNV candidates can be confirmed by raw sequences. Therefore, the CNV candidates given by a good caller could be highly reliable without cross-platform supporting, so additional experimental information should be applied in need instead of

44. Photographic copy of original construction drawing, dated August 1911 ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

44. Photographic copy of original construction drawing, dated August 1911 (from paper-copy of aperture-card negative at Bureau of Reclamation, Pacific Northwest Regional Office, Boise, ID). PLANS AND SECTIONS OF VAULTS. - Boise Project, Boise Project Office, 214 Broadway, Boise, Ada County, ID

Notable Carrier Risks for Individuals Having Two Copies of SMN1 in Spinal Muscular Atrophy Families with 2-copy Alleles: Estimation Based on Chinese Meta-analysis Data.

PubMed

Wei, Xianda; Tan, Hu; Yang, Pu; Zhang, Rui; Tan, Bo; Zhang, Yue; Mei, Libin; Liang, Desheng; Wu, Lingqian

2017-02-01

Spinal muscular atrophy is an autosomal recessive neuromuscular disease mainly caused by homozygous deletion of SMN1. The 2-copy SMN1 allele may present in the families of SMA patients with homozygous deletion of SMN1, one of whose parents has two SMN1 copies. In such families, individuals having two SMN1 copies still have a chance to be "2 + 0" carriers. In this study, the risks for the parents, fetuses and other siblings having two SMN1 copies to be "2 + 0" carriers were estimated based on Chinese meta-analysis data and turned out to be rather striking. Our findings would help to optimize genetic counseling regarding spinal muscular atrophy.

Intergenerational Continuity in Parents’ and Adolescents’ Externalizing Problems: The Role of Life Events and their Interaction with GABRA2

PubMed Central

Salvatore, Jessica E.; Meyers, Jacquelyn L.; Yan, Jia; Aliev, Fazil; Lansford, Jennifer E.; Pettit, Gregory S.; Bates, John E.; Dodge, Kenneth A.; Rose, Richard J.; Pulkkinen, Lea; Kaprio, Jaakko; Dick, Danielle M.

2015-01-01

We examine whether parental externalizing behavior has an indirect effect on adolescent externalizing behavior via elevations in life events, and whether this indirect effect is further qualified by an interaction between life events and adolescents’ GABRA2 genotype (rs279871). We use data from two samples: the Child Development Project [CDP] (n = 324) and FinnTwin12 (n = 802). In CDP, repeated measures of life events, mother-reported adolescent externalizing, and teacher-reported adolescent externalizing were used. In FinnTwin12, life events and externalizing were assessed at age 14. Parental externalizing was indexed by measures of antisocial behavior and alcohol problems or alcohol dependence symptoms in both samples. In CDP, parental externalizing was associated with more life events, and the association between life events and subsequent adolescent externalizing varied as a function of GABRA2 genotype (p ≤ 0.05). The association between life events and subsequent adolescent externalizing was stronger for adolescents with 0 copies of the G minor allele (MA) compared to those with 1 or 2 copies of the MA. Parallel moderation trends were observed in FinnTwin12 (p ≤ 0.11). The discussion focuses on how the strength of intergenerational pathways for externalizing psychopathology may differ as a function of adolescent-level individual differences. PMID:26075969

The partitioning and copy number control systems of the selfish yeast plasmid: an optimized molecular design for stable persistence in host cells

PubMed Central

Yen-Ting-Liu; Sau, Saumitra; Ma, Chien-Hui; Kachroo, Aashiq H; Rowley, Paul A; Chang, Keng-Ming; Fan, Hsiu-Fang; Jayaram, Makkuni

2014-01-01

Summary The multi-copy 2 micron plasmid of Saccharomyces cerevisiae, a resident of the nucleus, is remarkable for its high chromosome-like stability. The plasmid does not appear to contribute to the fitness of the host, nor does it impose a significant metabolic burden on the host at its steady state copy number. The plasmid may be viewed as a highly optimized selfish DNA element whose genome design is devoted entirely towards efficient replication, equal segregation and copy number maintenance. A partitioning system comprised of two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB is responsible for equal or nearly equal segregation of plasmid molecules to mother and daughter cells. Current evidence supports a model in which the Rep-STB system promotes the physical association of the plasmid with chromosomes and thus plasmid segregation by a hitchhiking mechanism. The Flp site-specific recombination system housed by the plasmid plays a critical role in maintaining steady state plasmid copy number. A decrease in plasmid population due to rare missegregation events is rectified by plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through host mediated post-translational modification(s) of Flp. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination, to bring about directed genetic alterations for addressing fundamental problems in biology, and as a tool in biotechnological applications. PMID:25541598

The partitioning and copy number control systems of the selfish yeast plasmid: an optimized molecular design for stable persistence in host cells.

PubMed

Yen-Ting-Liu; Sau, Saumitra; Ma, Chien-Hui; Kachroo, Aashiq H; Rowley, Paul A; Chang, Keng-Ming; Fan, Hsiu-Fang; Jayaram, Makkuni

2014-10-01

The multi-copy 2 micron plasmid of Saccharomyces cerevisiae, a resident of the nucleus, is remarkable for its high chromosome-like stability. The plasmid does not appear to contribute to the fitness of the host, nor does it impose a significant metabolic burden on the host at its steady state copy number. The plasmid may be viewed as a highly optimized selfish DNA element whose genome design is devoted entirely towards efficient replication, equal segregation and copy number maintenance. A partitioning system comprised of two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB is responsible for equal or nearly equal segregation of plasmid molecules to mother and daughter cells. Current evidence supports a model in which the Rep-STB system promotes the physical association of the plasmid with chromosomes and thus plasmid segregation by a hitchhiking mechanism. The Flp site-specific recombination system housed by the plasmid plays a critical role in maintaining steady state plasmid copy number. A decrease in plasmid population due to rare missegregation events is rectified by plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through host mediated post-translational modification(s) of Flp. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination, to bring about directed genetic alterations for addressing fundamental problems in biology, and as a tool in biotechnological applications.

17 CFR 260.4c-3 - Number of copies; filing; signatures; binding.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Number of copies; filing; signatures; binding. 260.4c-3 Section 260.4c-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... § 260.4c-3 Number of copies; filing; signatures; binding. (a) Three copies of every application and of...

Does Visual Attention Span Relate to Eye Movements during Reading and Copying?

ERIC Educational Resources Information Center

Bosse, Marie-Line; Kandel, Sonia; Prado, Chloé; Valdois, Sylviane

2014-01-01

This research investigated whether text reading and copying involve visual attention-processing skills. Children in grades 3 and 5 read and copied the same text. We measured eye movements while reading and the number of gaze lifts (GL) during copying. The children were also administered letter report tasks that constitute an estimation of the…

28 CFR 5.1101 - Copies of the Report of the Attorney General.

Code of Federal Regulations, 2011 CFR

2011-07-01

... ENFORCEMENT OF FOREIGN AGENTS REGISTRATION ACT OF 1938, AS AMENDED § 5.1101 Copies of the Report of the Attorney General. Copies of the Report of the Attorney General to the Congress on the Administration of the... 28 Judicial Administration 1 2011-07-01 2011-07-01 false Copies of the Report of the Attorney...

28 CFR 5.1101 - Copies of the Report of the Attorney General.

Code of Federal Regulations, 2012 CFR

2012-07-01

... ENFORCEMENT OF FOREIGN AGENTS REGISTRATION ACT OF 1938, AS AMENDED § 5.1101 Copies of the Report of the Attorney General. Copies of the Report of the Attorney General to the Congress on the Administration of the... 28 Judicial Administration 1 2012-07-01 2012-07-01 false Copies of the Report of the Attorney...

28 CFR 5.1101 - Copies of the Report of the Attorney General.

Code of Federal Regulations, 2010 CFR

2010-07-01

... ENFORCEMENT OF FOREIGN AGENTS REGISTRATION ACT OF 1938, AS AMENDED § 5.1101 Copies of the Report of the Attorney General. Copies of the Report of the Attorney General to the Congress on the Administration of the... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Copies of the Report of the Attorney...

28 CFR 5.1101 - Copies of the Report of the Attorney General.

Code of Federal Regulations, 2014 CFR

2014-07-01

... ENFORCEMENT OF FOREIGN AGENTS REGISTRATION ACT OF 1938, AS AMENDED § 5.1101 Copies of the Report of the Attorney General. Copies of the Report of the Attorney General to the Congress on the Administration of the... 28 Judicial Administration 1 2014-07-01 2014-07-01 false Copies of the Report of the Attorney...

A multi-landing pad DNA integration platform for mammalian cell engineering

PubMed Central

Gaidukov, Leonid; Wroblewska, Liliana; Teague, Brian; Nelson, Tom; Zhang, Xin; Liu, Yan; Jagtap, Kalpana; Mamo, Selamawit; Tseng, Wen Allen; Lowe, Alexis; Das, Jishnu; Bandara, Kalpanie; Baijuraj, Swetha; Summers, Nevin M; Zhang, Lin; Weiss, Ron

2018-01-01

Abstract Engineering mammalian cell lines that stably express many transgenes requires the precise insertion of large amounts of heterologous DNA into well-characterized genomic loci, but current methods are limited. To facilitate reliable large-scale engineering of CHO cells, we identified 21 novel genomic sites that supported stable long-term expression of transgenes, and then constructed cell lines containing one, two or three ‘landing pad’ recombination sites at selected loci. By using a highly efficient BxB1 recombinase along with different selection markers at each site, we directed recombinase-mediated insertion of heterologous DNA to selected sites, including targeting all three with a single transfection. We used this method to controllably integrate up to nine copies of a monoclonal antibody, representing about 100 kb of heterologous DNA in 21 transcriptional units. Because the integration was targeted to pre-validated loci, recombinant protein expression remained stable for weeks and additional copies of the antibody cassette in the integrated payload resulted in a linear increase in antibody expression. Overall, this multi-copy site-specific integration platform allows for controllable and reproducible insertion of large amounts of DNA into stable genomic sites, which has broad applications for mammalian synthetic biology, recombinant protein production and biomanufacturing. PMID:29617873

40 CFR 716.30 - Submission of copies of studies.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Submission of copies of studies. 716... studies. (a)(1) Except as provided in §§ 716.5, 716.20, and 716.50, persons must send to EPA copies of any health and safety studies in their possession for the substances or mixtures listed in § 716.120. Persons...

37. Photographic copy of the original construction drawing, 1934, by ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

37. Photographic copy of the original construction drawing, 1934, by Sverdrup and Parcel, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Stress sheet, continuous span - Mark Twain Memorial Bridge, Spanning Mississippi River at US Route 36, Hannibal, Marion County, MO

10 CFR 34.81 - Copies of operating and emergency procedures.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 10 Energy 1 2014-01-01 2014-01-01 false Copies of operating and emergency procedures. 34.81 Section 34.81 Energy NUCLEAR REGULATORY COMMISSION LICENSES FOR INDUSTRIAL RADIOGRAPHY AND RADIATION SAFETY REQUIREMENTS FOR INDUSTRIAL RADIOGRAPHIC OPERATIONS Recordkeeping Requirements § 34.81 Copies of...

10 CFR 34.81 - Copies of operating and emergency procedures.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 1 2010-01-01 2010-01-01 false Copies of operating and emergency procedures. 34.81 Section 34.81 Energy NUCLEAR REGULATORY COMMISSION LICENSES FOR INDUSTRIAL RADIOGRAPHY AND RADIATION SAFETY REQUIREMENTS FOR INDUSTRIAL RADIOGRAPHIC OPERATIONS Recordkeeping Requirements § 34.81 Copies of...

10 CFR 34.81 - Copies of operating and emergency procedures.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 10 Energy 1 2011-01-01 2011-01-01 false Copies of operating and emergency procedures. 34.81 Section 34.81 Energy NUCLEAR REGULATORY COMMISSION LICENSES FOR INDUSTRIAL RADIOGRAPHY AND RADIATION SAFETY REQUIREMENTS FOR INDUSTRIAL RADIOGRAPHIC OPERATIONS Recordkeeping Requirements § 34.81 Copies of...

10 CFR 34.81 - Copies of operating and emergency procedures.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 10 Energy 1 2013-01-01 2013-01-01 false Copies of operating and emergency procedures. 34.81 Section 34.81 Energy NUCLEAR REGULATORY COMMISSION LICENSES FOR INDUSTRIAL RADIOGRAPHY AND RADIATION SAFETY REQUIREMENTS FOR INDUSTRIAL RADIOGRAPHIC OPERATIONS Recordkeeping Requirements § 34.81 Copies of...

10 CFR 34.81 - Copies of operating and emergency procedures.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 10 Energy 1 2012-01-01 2012-01-01 false Copies of operating and emergency procedures. 34.81 Section 34.81 Energy NUCLEAR REGULATORY COMMISSION LICENSES FOR INDUSTRIAL RADIOGRAPHY AND RADIATION SAFETY REQUIREMENTS FOR INDUSTRIAL RADIOGRAPHIC OPERATIONS Recordkeeping Requirements § 34.81 Copies of...

Integrated Copy Number and Expression Analysis Identifies Profiles of Whole-Arm Chromosomal Alterations and Subgroups with Favorable Outcome in Ovarian Clear Cell Carcinomas

PubMed Central

Uehara, Yuriko; Oda, Katsutoshi; Ikeda, Yuji; Koso, Takahiro; Tsuji, Shingo; Yamamoto, Shogo; Asada, Kayo; Sone, Kenbun; Kurikawa, Reiko; Makii, Chinami; Hagiwara, Otoe; Tanikawa, Michihiro; Maeda, Daichi; Hasegawa, Kosei; Nakagawa, Shunsuke; Wada-Hiraike, Osamu; Kawana, Kei; Fukayama, Masashi; Fujiwara, Keiichi; Yano, Tetsu; Osuga, Yutaka; Fujii, Tomoyuki; Aburatani, Hiroyuki

2015-01-01

Ovarian clear cell carcinoma (CCC) is generally associated with chemoresistance and poor clinical outcome, even with early diagnosis; whereas high-grade serous carcinomas (SCs) and endometrioid carcinomas (ECs) are commonly chemosensitive at advanced stages. Although an integrated genomic analysis of SC has been performed, conclusive views on copy number and expression profiles for CCC are still limited. In this study, we performed single nucleotide polymorphism analysis with 57 epithelial ovarian cancers (31 CCCs, 14 SCs, and 12 ECs) and microarray expression analysis with 55 cancers (25 CCCs, 16 SCs, and 14 ECs). We then evaluated PIK3CA mutations and ARID1A expression in CCCs. SNP array analysis classified 13% of CCCs into a cluster with high frequency and focal range of copy number alterations (CNAs), significantly lower than for SCs (93%, P < 0.01) and ECs (50%, P = 0.017). The ratio of whole-arm to all CNAs was higher in CCCs (46.9%) than SCs (21.7%; P < 0.0001). SCs with loss of heterozygosity (LOH) of BRCA1 (85%) also had LOH of NF1 and TP53, and LOH of BRCA2 (62%) coexisted with LOH of RB1 and TP53. Microarray analysis classified CCCs into three clusters. One cluster (CCC-2, n = 10) showed more favorable prognosis than the CCC-1 and CCC-3 clusters (P = 0.041). Coexistent alterations of PIK3CA and ARID1A were more common in CCC-1 and CCC-3 (7/11, 64%) than in CCC-2 (0/10, 0%; P < 0.01). Being in cluster CCC-2 was an independent favorable prognostic factor in CCC. In conclusion, CCC was characterized by a high ratio of whole-arm CNAs; whereas CNAs in SC were mainly focal, but preferentially caused LOH of well-known tumor suppressor genes. As such, expression profiles might be useful for sub-classification of CCC, and might provide useful information on prognosis. PMID:26043110

A novel quadruplex real-time PCR method for simultaneous detection of Cry2Ae and two genetically modified cotton events (GHB119 and T304-40)

PubMed Central

2014-01-01

Background To date, over 150 genetically modified (GM) crops are widely cultivated. To comply with regulations developed for genetically modified organisms (GMOs), including labeling policies, many detection methods for GMO identification and quantification have been developed. Results To detect the entrance and exit of unauthorized GM crop events in China, we developed a novel quadruplex real-time PCR method for simultaneous detection and quantification of GM cotton events GHB119 and T304-40 in cotton-derived products (based on the 5′-flanking sequence) and the insect-resistance gene Cry2Ae. The limit of detection was 10 copies for GHB119 and Cry2Ae and 25 copies for T304-40. The limit of quantification was 25 copies for GHB119 and Cry2Ae and 50 copies for T304-40. Moreover, low bias and acceptable standard deviation and relative standard deviation values were obtained in quantification analysis of six blind samples containing different GHB119 and T304-40 ingredients. Conclusions The developed quadruplex quantitative method could be used for quantitative detection of two GM cotton events (GHB119 and T304-40) and Cry2Ae gene ingredient in cotton derived products. PMID:24884946

aCGH Local Copy Number Aberrations Associated with Overall Copy Number Genomic Instability in Colorectal Cancer: Coordinate Involvement of the Regions Including BCR and ABL

PubMed Central

Bartos, Jeremy D.; Gaile, Daniel P.; McQuaid, Devin E.; Conroy, Jeffrey M.; Darbary, Huferesh; Nowak, Norma J.; Block, Annemarie; Petrelli, Nicholas J.; Mittelman, Arnold; Stoler, Daniel L.; Anderson, Garth R.

2007-01-01

In order to identify small regions of the genome whose specific copy number alteration is associated with high genomic instability in the form of overall genome-wide copy number aberrations, we have analyzed array-based comparative genomic hybridization (aCGH) data from 33 sporadic colorectal carcinomas. Copy number changes of a small number of specific regions were significantly correlated with elevated overall amplifications and deletions scattered throughout the entire genome. One significant region at 9q34 includes the c-ABL gene Another region spanning 22q11–13 includes the breakpoint cluster region (BCR) of the Philadelphia chromosome Coordinate 22q11–13 alterations were observed in nine of eleven tumors with the 9q34 alteration Additional regions on 1q and 14q were associated with overall genome-wide copy number changes, while copy number aberrations on chromosome 7p, 7q, and 13q21.1–31.3 were found associated with this instability only in tumors from patients with a smoking history Our analysis demonstrates there are a small number of regions of the genome where gain or loss is commonly associated with a tumor’s overall level of copy number aberrations Our finding BCR and ABL located within two of the instability-associated regions, and the involvement of these two regions occurring coordinately, suggests a system akin to the BCR-ABL translocation of CML may be involved in genomic instability in about one-third of human colorectal carcinomas. PMID:17196995

The spatial reliability of task-irrelevant sounds modulates bimodal audiovisual integration: An event-related potential study.

PubMed

Li, Qi; Yu, Hongtao; Wu, Yan; Gao, Ning

2016-08-26

The integration of multiple sensory inputs is essential for perception of the external world. The spatial factor is a fundamental property of multisensory audiovisual integration. Previous studies of the spatial constraints on bimodal audiovisual integration have mainly focused on the spatial congruity of audiovisual information. However, the effect of spatial reliability within audiovisual information on bimodal audiovisual integration remains unclear. In this study, we used event-related potentials (ERPs) to examine the effect of spatial reliability of task-irrelevant sounds on audiovisual integration. Three relevant ERP components emerged: the first at 140-200ms over a wide central area, the second at 280-320ms over the fronto-central area, and a third at 380-440ms over the parieto-occipital area. Our results demonstrate that ERP amplitudes elicited by audiovisual stimuli with reliable spatial relationships are larger than those elicited by stimuli with inconsistent spatial relationships. In addition, we hypothesized that spatial reliability within an audiovisual stimulus enhances feedback projections to the primary visual cortex from multisensory integration regions. Overall, our findings suggest that the spatial linking of visual and auditory information depends on spatial reliability within an audiovisual stimulus and occurs at a relatively late stage of processing. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

21 CFR 1316.68 - Copies of petitions for judicial review.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Copies of petitions for judicial review. 1316.68 Section 1316.68 Food and Drugs DRUG ENFORCEMENT ADMINISTRATION, DEPARTMENT OF JUSTICE ADMINISTRATIVE FUNCTIONS, PRACTICES, AND PROCEDURES Administrative Hearings § 1316.68 Copies of petitions for judicial...

59. Photographic copy of the original construction drawing, 1934, by ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

59. Photographic copy of the original construction drawing, 1934, by Sverdrup and Parcel, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Construction changes in pier 7 - Mark Twain Memorial Bridge, Spanning Mississippi River at US Route 36, Hannibal, Marion County, MO

43. Photographic copy of original construction drawing, dated June 1911 ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

43. Photographic copy of original construction drawing, dated June 1911 (from paper-copy of aperture-card negative at Bureau of Reclamation, Pacific Northwest Regional Office, Boise, ID). NORTH ELEVATION (NORTH SIDE) AND WEST ELEVATION (WEST SIDE). - Boise Project, Boise Project Office, 214 Broadway, Boise, Ada County, ID

42. Photographic copy of original construction drawing, dated June 1911 ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

42. Photographic copy of original construction drawing, dated June 1911 (from paper-copy of aperture-card negative at Bureau of Reclamation, Pacific Northwest Regional Office, Boise, ID). EAST ELEVATION (EAST SIDE) AND SOUTH ELEVATION (SOUTH SIDE). - Boise Project, Boise Project Office, 214 Broadway, Boise, Ada County, ID

45. Photographic copy of the original construction drawing, 1934, by ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

45. Photographic copy of the original construction drawing, 1934, by Sverdrup and Parcel, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Cross section--300-ft. span - Mark Twain Memorial Bridge, Spanning Mississippi River at US Route 36, Hannibal, Marion County, MO

44. Photographic copy of the original construction drawing, 1934, by ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

44. Photographic copy of the original construction drawing, 1934, by Sverdrup and Parcel, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Details of 300-ft. span - Mark Twain Memorial Bridge, Spanning Mississippi River at US Route 36, Hannibal, Marion County, MO

18. Photocopy of copy of drawing of boiler plant and ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

18. Photocopy of copy of drawing of boiler plant and shops building, dated June 15, 1944. Copy of drawing stored at 436 Civil Engineer Squadron, Design Management Element Cece, 600 8th Street, Dover AFB, DE - Dover Air Force Base, Hangar No. 1301, Dover, Kent County, DE

17. Photocopy of copy of drawing of Hangar 1301, dated ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

17. Photocopy of copy of drawing of Hangar 1301, dated June 15, 1944. Copy of drawing stored at 436 Civil Engineer Squadron, Design Management Element Cece, 600 8th Street, Dover Air Force Base, DE - Dover Air Force Base, Hangar No. 1301, Dover, Kent County, DE

Conservatism and "copy-if-better" in chimpanzees (Pan troglodytes).

PubMed

van Leeuwen, Edwin J C; Call, Josep

2017-05-01

Social learning is predicted to evolve in socially living animals provided the learning process is not random but biased by certain socio-ecological factors. One bias of particular interest for the emergence of (cumulative) culture is the tendency to forgo personal behaviour in favour of relatively better variants observed in others, also known as the "copy-if-better" strategy. We investigated whether chimpanzees employ copy-if-better in a simple token-exchange paradigm controlling for individual and random social learning. After being trained on one token-type, subjects were confronted with a conspecific demonstrator who either received the same food reward as the subject (control condition) or a higher value food reward than the subject (test condition) for exchanging another token-type. In general, the chimpanzees persisted in exchanging the token-type they were trained on individually, indicating a form of conservatism consistent with previous studies. However, the chimpanzees were more inclined to copy the demonstrator in the test compared to the control condition, indicating a tendency to employ a copy-if-better strategy. We discuss the validity of our results by considering alternative explanations and relate our findings to the emergence of cumulative culture.

Scattering on plane waves and the double copy

NASA Astrophysics Data System (ADS)

Adamo, Tim; Casali, Eduardo; Mason, Lionel; Nekovar, Stefan

2018-01-01

Perturbatively around flat space, the scattering amplitudes of gravity are related to those of Yang–Mills by colour-kinematic duality, under which gravitational amplitudes are obtained as the ‘double copy’ of the corresponding gauge theory amplitudes. We consider the question of how to extend this relationship to curved scattering backgrounds, focusing on certain ‘sandwich’ plane waves. We calculate the 3-point amplitudes on these backgrounds and find that a notion of double copy remains in the presence of background curvature: graviton amplitudes on a gravitational plane wave are the double copy of gluon amplitudes on a gauge field plane wave. This is non-trivial in that it requires a non-local replacement rule for the background fields and the momenta and polarization vectors of the fields scattering on the backgrounds. It must also account for new ‘tail’ terms arising from scattering off the background. These encode a memory effect in the scattering amplitudes, which naturally double copies as well.

Semantic integration of differently asynchronous audio-visual information in videos of real-world events in cognitive processing: an ERP study.

PubMed

Liu, Baolin; Wu, Guangning; Wang, Zhongning; Ji, Xiang

2011-07-01

In the real world, some of the auditory and visual information received by the human brain are temporally asynchronous. How is such information integrated in cognitive processing in the brain? In this paper, we aimed to study the semantic integration of differently asynchronous audio-visual information in cognitive processing using ERP (event-related potential) method. Subjects were presented with videos of real world events, in which the auditory and visual information are temporally asynchronous. When the critical action was prior to the sound, sounds incongruous with the preceding critical actions elicited a N400 effect when compared to congruous condition. This result demonstrates that semantic contextual integration indexed by N400 also applies to cognitive processing of multisensory information. In addition, the N400 effect is early in latency when contrasted with other visually induced N400 studies. It is shown that cross modal information is facilitated in time when contrasted with visual information in isolation. When the sound was prior to the critical action, a larger late positive wave was observed under the incongruous condition compared to congruous condition. P600 might represent a reanalysis process, in which the mismatch between the critical action and the preceding sound was evaluated. It is shown that environmental sound may affect the cognitive processing of a visual event. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

UGT2B17 and SULT1A1 gene copy number variation (CNV) detection by LabChip microfluidic technology.

PubMed

Gaedigk, Andrea; Gaedigk, Roger; Leeder, J Steven

2010-05-01

Gene copy number variations (CNVs) are increasingly recognized to play important roles in the expression of genes and hence on their respective enzymatic activities. This has been demonstrated for a number of drug metabolizing genes, such as UDP-glucuronosyltransferases 2B17 (UGT2B17) and sulfotransferase 1A1 (SULT1A1), which are subject to genetic heterogeneity, including CNV. Quantitative assays to assess gene copy number are therefore becoming an integral part of accurate genotype assessment and phenotype prediction. In this study, we evaluated a microfluidics-based system, the Bio-Rad Experion system, to determine the power and utility of this platform to detect UGT2B17 and SULT1A1 CNV in DNA samples derived from blood and tissue. UGT2B17 is known to present with 0, 1 or 2 and SULT1A1 with up to 5 gene copies. Distinct clustering (p<0.001) into copy number groups was achieved for both genes. DNA samples derived from blood exhibited less inter-run variability compared to DNA samples obtained from liver tissue. This variability may be caused by tissue-specific PCR inhibitors as it could be overcome by using DNA from another tissue, or after the DNA had undergone whole genome amplification. This method produced results comparable to those reported for other quantitative test platforms.

Genetic plasticity of the Shigella virulence plasmid is mediated by intra- and inter-molecular events between insertion sequences.

PubMed

Pilla, Giulia; McVicker, Gareth; Tang, Christoph M

2017-09-01

Acquisition of a single copy, large virulence plasmid, pINV, led to the emergence of Shigella spp. from Escherichia coli. The plasmid encodes a Type III secretion system (T3SS) on a 30 kb pathogenicity island (PAI), and is maintained in a bacterial population through a series of toxin:antitoxin (TA) systems which mediate post-segregational killing (PSK). The T3SS imposes a significant cost on the bacterium, and strains which have lost the plasmid and/or genes encoding the T3SS grow faster than wild-type strains in the laboratory, and fail to bind the indicator dye Congo Red (CR). Our aim was to define the molecular events in Shigella flexneri that cause loss of Type III secretion (T3S), and to examine whether TA systems exert positional effects on pINV. During growth at 37°C, we found that deletions of regions of the plasmid including the PAI lead to the emergence of CR-negative colonies; deletions occur through intra-molecular recombination events between insertion sequences (ISs) flanking the PAI. Furthermore, by repositioning MvpAT (which belongs to the VapBC family of TA systems) near the PAI, we demonstrate that the location of this TA system alters the rearrangements that lead to loss of T3S, indicating that MvpAT acts both globally (by reducing loss of pINV through PSK) as well as locally (by preventing loss of adjacent sequences). During growth at environmental temperatures, we show for the first time that pINV spontaneously integrates into different sites in the chromosome, and this is mediated by inter-molecular events involving IS1294. Integration leads to reduced PAI gene expression and impaired secretion through the T3SS, while excision of pINV from the chromosome restores T3SS function. Therefore, pINV integration provides a reversible mechanism for Shigella to circumvent the metabolic burden imposed by pINV. Intra- and inter-molecular events between ISs, which are abundant in Shigella spp., mediate plasticity of S. flexneri pINV.

Assessment of large copy number variants in patients with apparently isolated congenital left-sided cardiac lesions reveals clinically relevant genomic events.

PubMed

Hanchard, Neil A; Umana, Luis A; D'Alessandro, Lisa; Azamian, Mahshid; Poopola, Mojisola; Morris, Shaine A; Fernbach, Susan; Lalani, Seema R; Towbin, Jeffrey A; Zender, Gloria A; Fitzgerald-Butt, Sara; Garg, Vidu; Bowman, Jessica; Zapata, Gladys; Hernandez, Patricia; Arrington, Cammon B; Furthner, Dieter; Prakash, Siddharth K; Bowles, Neil E; McBride, Kim L; Belmont, John W

2017-08-01

Congenital left-sided cardiac lesions (LSLs) are a significant contributor to the mortality and morbidity of congenital heart disease (CHD). Structural copy number variants (CNVs) have been implicated in LSL without extra-cardiac features; however, non-penetrance and variable expressivity have created uncertainty over the use of CNV analyses in such patients. High-density SNP microarray genotyping data were used to infer large, likely-pathogenic, autosomal CNVs in a cohort of 1,139 probands with LSL and their families. CNVs were molecularly confirmed and the medical records of individual carriers reviewed. The gene content of novel CNVs was then compared with public CNV data from CHD patients. Large CNVs (>1 MB) were observed in 33 probands (∼3%). Six of these were de novo and 14 were not observed in the only available parent sample. Associated cardiac phenotypes spanned a broad spectrum without clear predilection. Candidate CNVs were largely non-recurrent, associated with heterozygous loss of copy number, and overlapped known CHD genomic regions. Novel CNV regions were enriched for cardiac development genes, including seven that have not been previously associated with human CHD. CNV analysis can be a clinically useful and molecularly informative tool in LSLs without obvious extra-cardiac defects, and may identify a clinically relevant genomic disorder in a small but important proportion of these individuals. © 2017 Wiley Periodicals, Inc.

Using Event-related Potentials to Inform the Neurocognitive Processes Underlying Knowledge Extension through Memory Integration.

PubMed

Varga, Nicole L; Bauer, Patricia J

2017-11-01

To build a general knowledge base, it is imperative that individuals acquire, integrate, and further extend knowledge across experiences. For instance, in one episode an individual may learn that George Washington was the first president. In a separate episode they may then learn that Washington was the commander of the Continental Army. Integration of the information in memory may then support self-derivation of the new knowledge that the leader of the Continental Army was also the first president. Despite a considerable amount of fMRI research aimed at further elucidating the neuroanatomical regions supporting this ability, a consensus has yet to be reached with regards to the precise neurocognitive processes involved. In the present research, we capitalized on the high temporal resolution of event-related potentials (ERPs) to inform the time course of processes elicited during successful integration and further extension of new factual knowledge. Adults read novel, related stem facts and were tested for self-derivation of novel integration facts while ERPs were recorded. Consistent with current theoretical models, memory integration was first triggered by novelty detection within 400 msec of experience of a second, related stem fact. Two additional temporally staged encoding processes were then observed interpreted to reflect (1) explicit meaning comprehension and (2) representation of the integrated relation in memory. During the test for self-derivation, a single ERP was elicited, which presumably reflected retrieval and/or recombination of previously integrated knowledge. Together, the present research provides important insight into the time course of neurocognitive processing associated with the formation of a knowledge base.

27. Photographic copy of original construction drawing, dated May 22, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

27. Photographic copy of original construction drawing, dated May 22, 1951 (from paper copy at Engineering Flight, Ellsworth Air Force Base, SD). Readiness hangar architectural: plan at clerestory & elevation. - Ellsworth Air Force Base, Readiness Hangar, Kenny Road, southeast corner of interstction with G Avenue, Blackhawk, Meade County, SD

41. Photographic copy of the original construction drawing, 192627, by ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

41. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. STRESS SHEET - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

40 CFR 761.209 - Number of copies of a manifest.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., AND USE PROHIBITIONS PCB Waste Disposal Records and Reports § 761.209 Number of copies of a manifest... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Number of copies of a manifest. 761.209 Section 761.209 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC...

40 CFR 761.209 - Number of copies of a manifest.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., AND USE PROHIBITIONS PCB Waste Disposal Records and Reports § 761.209 Number of copies of a manifest... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Number of copies of a manifest. 761.209 Section 761.209 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC...

Age-related decline in mitochondrial DNA copy number in isolated human pancreatic islets.

PubMed

Cree, L M; Patel, S K; Pyle, A; Lynn, S; Turnbull, D M; Chinnery, P F; Walker, M

2008-08-01

Pancreatic beta cell function has been shown to decline with age in man. Depletion of mitochondrial DNA (mtDNA) copy number is associated with impaired insulin secretion in pancreatic beta cell lines, and decreased mtDNA copy number has been observed with age in skeletal muscle in man. We investigated whether mtDNA copy number decreases with age in human pancreatic beta cells, which might in turn contribute to the age-related decline in insulin secretory capacity. We quantified mtDNA copy number in isolated human islet preparations from 15 pancreas donors aged between 17 and 75 years. Islets (n = 20) were individually hand-picked and pooled from each donor isolate for the quantification of mtDNA copy number and deleted mtDNA (%), which were determined using real-time PCR methods. There was a significant negative correlation between mtDNA copy number and islet donor age (r = -0.53, p = 0.044). mtDNA copy number was significantly decreased in islet preparations from donors aged > or =50 years (n = 8) compared with those aged <50 years (n = 7) (median [interquartile range]: 418 [236-503] vs 596 [554-729] mtDNA copy number/diploid genome; p = 0.032). None of the islet preparations harboured high levels of deleted mtDNA affecting the major arc. Given the correlation between mtDNA content and respiratory chain activity, the age-related decrease in mtDNA copy number that we observed in human pancreatic islet preparations may contribute to the age-dependent decline in pancreatic beta cell insulin secretory capacity.

Event Display for the Visualization of CMS Events

NASA Astrophysics Data System (ADS)

Bauerdick, L. A. T.; Eulisse, G.; Jones, C. D.; Kovalskyi, D.; McCauley, T.; Mrak Tadel, A.; Muelmenstaedt, J.; Osborne, I.; Tadel, M.; Tu, Y.; Yagil, A.

2011-12-01

During the last year the CMS experiment engaged in consolidation of its existing event display programs. The core of the new system is based on the Fireworks event display program which was by-design directly integrated with the CMS Event Data Model (EDM) and the light version of the software framework (FWLite). The Event Visualization Environment (EVE) of the ROOT framework is used to manage a consistent set of 3D and 2D views, selection, user-feedback and user-interaction with the graphics windows; several EVE components were developed by CMS in collaboration with the ROOT project. In event display operation simple plugins are registered into the system to perform conversion from EDM collections into their visual representations which are then managed by the application. Full event navigation and filtering as well as collection-level filtering is supported. The same data-extraction principle can also be applied when Fireworks will eventually operate as a service within the full software framework.

Event triggered state estimation techniques for power systems with integrated variable energy resources.

PubMed

Francy, Reshma C; Farid, Amro M; Youcef-Toumi, Kamal

2015-05-01

For many decades, state estimation (SE) has been a critical technology for energy management systems utilized by power system operators. Over time, it has become a mature technology that provides an accurate representation of system state under fairly stable and well understood system operation. The integration of variable energy resources (VERs) such as wind and solar generation, however, introduces new fast frequency dynamics and uncertainties into the system. Furthermore, such renewable energy is often integrated into the distribution system thus requiring real-time monitoring all the way to the periphery of the power grid topology and not just the (central) transmission system. The conventional solution is two fold: solve the SE problem (1) at a faster rate in accordance with the newly added VER dynamics and (2) for the entire power grid topology including the transmission and distribution systems. Such an approach results in exponentially growing problem sets which need to be solver at faster rates. This work seeks to address these two simultaneous requirements and builds upon two recent SE methods which incorporate event-triggering such that the state estimator is only called in the case of considerable novelty in the evolution of the system state. The first method incorporates only event-triggering while the second adds the concept of tracking. Both SE methods are demonstrated on the standard IEEE 14-bus system and the results are observed for a specific bus for two difference scenarios: (1) a spike in the wind power injection and (2) ramp events with higher variability. Relative to traditional state estimation, the numerical case studies showed that the proposed methods can result in computational time reductions of 90%. These results were supported by a theoretical discussion of the computational complexity of three SE techniques. The work concludes that the proposed SE techniques demonstrate practical improvements to the computational complexity of

Single Event Effects Test Results for Advanced Field Programmable Gate Arrays

NASA Technical Reports Server (NTRS)

Allen, Gregory R.; Swift, Gary M.

2006-01-01

Reconfigurable Field Programmable Gate Arrays (FPGAs) from Altera and Actel and an FPGA-based quick-turnApplication Specific Integrated Circuit (ASIC) from Altera were subjected to single-event testing using heavy ions. Both Altera devices (Stratix II and HardCopy II) exhibited a low latchup threshold (below an LET of 3 MeV-cm2/mg) and thus are not recommended for applications in the space radiation environment. The flash-based Actel ProASIC Plus device did not exhibit latchup to an effective LET of 75 MeV-cm2/mg at room temperature. In addition, these tests did not show flash cell charge loss (upset) or retention damage. Upset characterization of the design-level flip-flops yielded an LET threshold below 10 MeV-cm2/mg and a high LET cross section of about lxlO-6 cm2/bit for storing ones and about lxl0-7 cm2/bit for storing zeros . Thus, the ProASIC device may be suitable for critical flight applications with appropriate triple modular redundancy mitigation techniques.

How bio-questionable are the different recombinant human erythropoietin copy products in Thailand?

PubMed

Halim, Liem Andhyk; Brinks, Vera; Jiskoot, Wim; Romeijn, Stefan; Praditpornsilpa, Kearkiat; Assawamakin, Anunchai; Schellekens, Huub

2014-05-01

The high prevalence of pure red cell aplasia in Thailand has been associated with the sharp increase in number of recombinant human erythropoietin (rhEPO) copy products, based on a classical generic regulatory pathway, which have entered the market. This study aims to assess the quality of rhEPO copy products being used in Thailand. Twelve rhEPO copy products were purchased from pharmacies in Thailand, shipped under controlled cold chain conditions to the Netherlands and characterized using (1) high performance size-exclusion chromatography, (2) asymmetrical flow field-flow fractionation, (3) sodium dodecyl sulfate polyacrylamide gel electrophoresis in combination with (4) Western blotting and additionally tested for (5) host cell protein impurities as well as (6) endotoxin contamination. Some of the tested rhEPO copy products showed high aggregate levels and contained a substantial amount of protein fragments. Also, one of rhEPO copy products had a high endotoxin level, exceeding the FDA limit. Our observations show that some of the tested copy products on the Thai market differ significantly from the originator rhEPO product, Epogen®. This comparison study supports a link between the quality attributes of copy rhEPO products and their immunogenicity.

Imitation, Inspiration, and Creation: Cognitive Process of Creative Drawing by Copying Others' Artworks.

PubMed

Okada, Takeshi; Ishibashi, Kentaro

2017-09-01

To investigate the cognitive processes underlying creative inspiration, we tested the extent to which viewing or copying prior examples impacted creative output in art. In Experiment 1, undergraduates made drawings under three conditions: (a) copying an artist's drawing, then producing an original drawing; (b) producing an original drawing without having seen another's work; and (c) copying another artist's work, then reproducing that artist's style independently. We discovered that through copying unfamiliar abstract drawings, participants were able to produce creative drawings qualitatively different from the model drawings. Process analyses suggested that participants' cognitive constraints became relaxed, and new perspectives were formed from copying another's artwork. Experiment 2 showed that exposure to styles of artwork considered unfamiliar facilitated creativity in drawing, while styles considered familiar did not do so. Experiment 3 showed that both copying and thoroughly viewing artwork executed using an unfamiliar style facilitated creativity in drawing, whereas merely thinking about alternative styles of artistic representation did not do so. These experiments revealed that deep encounters with unfamiliar artworks-whether through copying or prolonged observation-change people's cognitive representations of the act of drawing to produce novel artwork. Copyright © 2016 Cognitive Science Society, Inc.

SIRENA software for Athena X-IFU event reconstruction

NASA Astrophysics Data System (ADS)

Ceballos, M. T.; Cobo, B.; Peille, P.; Wilms, J.; Brand, T.; Dauser, T.; Bandler, S.; Smith, S.

2017-03-01

The X-ray Observatory Athena was proposed in April 2014 as the mission to implement the science theme "The Hot and Energetic Universe" selected by ESA for L2 (the second Large-class mission in ESA’s Cosmic Vision science programme). One of the two X-ray detectors designed to be onboard Athena is X-IFU, a cryogenic microcalorimeter based on Transition Edge Sensor (TES) technology that will provide spatially resolved high-resolution spectroscopy. X-IFU will be developed by an international consortium led by IRAP (PI), SRON (co-PI) and IAPS/INAF (co-PI) and involving ESA Member States, Japan and the United States. In Spain, IFCA (CSIC-UC) has an anticipated contribution to X-IFU through the Digital Readout Electronics (DRE) unit, in particular in the Event Processor Subsystem. For this purpose and in collaboration with the Athena end-to-end simulations team, we are currently developing the SIRENA package as part of the publicly available SIXTE end-to-end simulator. SIRENA comprises a set of processing algorithms aimed at recognizing, from a noisy signal, the intensity pulses generated by the absorption of the X-ray photons, to lately reconstruct their energy, position and arrival time. This poster describes the structure of the package and the different algorithms currently implemented as well as their comparative performance in the energy resolution achieved in the reconstruction of the instrument events.

20 CFR 404.707 - Original records or copies as evidence.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Original records or copies as evidence. 404... DISABILITY INSURANCE (1950- ) Evidence General § 404.707 Original records or copies as evidence. (a) General... original document or record. These original records or documents will be returned to you after we have...

52. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

52. Photocopy of copy of original Officers' Duplex Quarters drawing by Copeland, 7 April 1932 (Original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Heating - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

18 CFR 156.3 - Applications; number of copies; general requirements.

Code of Federal Regulations, 2010 CFR

2010-04-01

... copies; general requirements. 156.3 Section 156.3 Conservation of Power and Water Resources FEDERAL... requirements. (a) Applicable rules. An original and 7 conformed copies of an application under this part shall... other respects applications shall conform to the requirements of §§ 156.1 through 156.5. Amendments to...

8. PHOTOGRAPHIC COPY OF AERIAL PHOTOGRAPH, DATED CA. 19201925, FORT ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

8. PHOTOGRAPHIC COPY OF AERIAL PHOTOGRAPH, DATED CA. 1920-1925, FORT BLISS, ARROW POINTS TO 7TH CAVALRY CANTONMENT, COPY ON FILE IN THE ENVIRONMENTAL MANAGEMENT OFFICE, FORT BLISS - Fort Bliss, 7th Cavalry Buildings, U.S. Army Air Defence Artillery Center & Fort Bliss, El Paso, El Paso County, TX

10 CFR 205.324 - Form and style; number of copies.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 3 2010-01-01 2010-01-01 false Form and style; number of copies. 205.324 Section 205.324 Energy DEPARTMENT OF ENERGY OIL ADMINISTRATIVE PROCEDURES AND SANCTIONS Electric Power System Permits and... Electric Energy at International Boundaries § 205.324 Form and style; number of copies. All applicants...

17 CFR 230.472 - Filing of amendments; number of copies.

Code of Federal Regulations, 2010 CFR

2010-04-01

... exhibits and all other papers and documents filed as part of the amendment, and eight additional copies of... include the consent of the certifying accountant to the use of his certificate in connection with the... Commission three complete, unmarked copies of every amendment, including exhibits and all other papers and...

17 CFR 230.472 - Filing of amendments; number of copies.

Code of Federal Regulations, 2014 CFR

2014-04-01

... exhibits and all other papers and documents filed as part of the amendment, and eight additional copies of... include the consent of the certifying accountant to the use of his certificate in connection with the... Commission three complete, unmarked copies of every amendment, including exhibits and all other papers and...

17 CFR 230.472 - Filing of amendments; number of copies.

Code of Federal Regulations, 2011 CFR

2011-04-01

... exhibits and all other papers and documents filed as part of the amendment, and eight additional copies of... include the consent of the certifying accountant to the use of his certificate in connection with the... Commission three complete, unmarked copies of every amendment, including exhibits and all other papers and...

17 CFR 230.472 - Filing of amendments; number of copies.

Code of Federal Regulations, 2013 CFR

2013-04-01

... exhibits and all other papers and documents filed as part of the amendment, and eight additional copies of... include the consent of the certifying accountant to the use of his certificate in connection with the... Commission three complete, unmarked copies of every amendment, including exhibits and all other papers and...

17 CFR 230.472 - Filing of amendments; number of copies.

Code of Federal Regulations, 2012 CFR

2012-04-01

... exhibits and all other papers and documents filed as part of the amendment, and eight additional copies of... include the consent of the certifying accountant to the use of his certificate in connection with the... Commission three complete, unmarked copies of every amendment, including exhibits and all other papers and...

29 CFR 1921.17 - Service; copies of documents and pleadings.

Code of Federal Regulations, 2014 CFR

2014-07-01

... service. A certificate of the person serving the pleading or other document by personal delivery or by... 29 Labor 7 2014-07-01 2014-07-01 false Service; copies of documents and pleadings. 1921.17 Section... LONGSHOREMEN'S AND HARBOR WORKERS' COMPENSATION ACT Miscellaneous § 1921.17 Service; copies of documents and...

29 CFR 1921.17 - Service; copies of documents and pleadings.

Code of Federal Regulations, 2012 CFR

2012-07-01

... service. A certificate of the person serving the pleading or other document by personal delivery or by... 29 Labor 7 2012-07-01 2012-07-01 false Service; copies of documents and pleadings. 1921.17 Section... LONGSHOREMEN'S AND HARBOR WORKERS' COMPENSATION ACT Miscellaneous § 1921.17 Service; copies of documents and...

29 CFR 1921.17 - Service; copies of documents and pleadings.

Code of Federal Regulations, 2010 CFR

2010-07-01

... service. A certificate of the person serving the pleading or other document by personal delivery or by... 29 Labor 7 2010-07-01 2010-07-01 false Service; copies of documents and pleadings. 1921.17 Section... LONGSHOREMEN'S AND HARBOR WORKERS' COMPENSATION ACT Miscellaneous § 1921.17 Service; copies of documents and...

29 CFR 1921.17 - Service; copies of documents and pleadings.

Code of Federal Regulations, 2011 CFR

2011-07-01

... service. A certificate of the person serving the pleading or other document by personal delivery or by... 29 Labor 7 2011-07-01 2011-07-01 false Service; copies of documents and pleadings. 1921.17 Section... LONGSHOREMEN'S AND HARBOR WORKERS' COMPENSATION ACT Miscellaneous § 1921.17 Service; copies of documents and...

29 CFR 1921.17 - Service; copies of documents and pleadings.

Code of Federal Regulations, 2013 CFR

2013-07-01

... service. A certificate of the person serving the pleading or other document by personal delivery or by... 29 Labor 7 2013-07-01 2013-07-01 false Service; copies of documents and pleadings. 1921.17 Section... LONGSHOREMEN'S AND HARBOR WORKERS' COMPENSATION ACT Miscellaneous § 1921.17 Service; copies of documents and...

1. Historic American Buildings Survey Copy photo: Albern Color Research, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

1. Historic American Buildings Survey Copy photo: Albern Color Research, Inc., Philadelphia, July 1960 COPY OF A PHOTOGRAPH TAKEN ca. 1904 SHOWING PART OF THE ENFIELD, NEW HAMPSHIRE SHAKER COMMUNITY WITH THE GREAT STONE HOUSE IN THE CENTER - Shaker Church Family General Views, State Route 4A, Enfield, Grafton County, NH

10 CFR 205.324 - Form and style; number of copies.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 10 Energy 3 2011-01-01 2011-01-01 false Form and style; number of copies. 205.324 Section 205.324 Energy DEPARTMENT OF ENERGY OIL ADMINISTRATIVE PROCEDURES AND SANCTIONS Electric Power System Permits and... Electric Energy at International Boundaries § 205.324 Form and style; number of copies. All applicants...

20 CFR 416.804 - Certified copy in lieu of original.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 20 Employees' Benefits 2 2011-04-01 2011-04-01 false Certified copy in lieu of original. 416.804 Section 416.804 Employees' Benefits SOCIAL SECURITY ADMINISTRATION SUPPLEMENTAL SECURITY INCOME FOR THE AGED, BLIND, AND DISABLED Determination of Age § 416.804 Certified copy in lieu of original. In lieu of...

Copy number losses define subgroups of dedifferentiated liposarcoma with poor prognosis and genomic instability.

PubMed

Crago, Aimee M; Socci, Nicholas D; DeCarolis, Penelope; O'Connor, Rachael; Taylor, Barry S; Qin, Li-Xuan; Antonescu, Cristina R; Singer, Samuel

2012-03-01

Molecular events underlying progression of well-differentiated liposarcoma (WDLS) to dedifferentiated liposarcoma (DDLS) are poorly defined. This study sought to identify copy number alterations (CNA) associated with dedifferentiation of WDLS, with DDLS morphology, and with patient outcomes. Fifty-five WDLS and 52 DDLS were analyzed using Agilent 244K comparative genomic hybridization and Affymetrix U133A expression arrays. CNAs were identified by RAE analysis. Thirty-nine of the DDLS specimens were categorized morphologically by a single pathologist. Nine regions of CNA were identified as recurrent in DDLS but not WDLS; 79% of DDLS had at least one of these CNAs. Loss of the chromosome segment 11q23-24, the most common event, was observed only in DDLS that morphologically resembled the genomically complex sarcomas, undifferentiated pleomorphic sarcoma and myxofibrosarcoma. 11q23-24 loss was itself associated with increased genomic complexity in DDLS. Loss of 19q13, but not 11q23-24, was associated with poor prognosis. Median disease-specific survival was shorter for patients with19q13 loss (27 months) than for patients with diploid 19q13 (>90 months; P < 0.0025), and 19q13 loss was associated with local recurrence (HR, 2.86; P = 0.013). Common copy number losses were associated with transcriptional downregulation of potential tumor suppressors and adipogenesis-related genes (e.g., EI24 and CEBPA). Dedifferentiation of WDLS is associated with recurrent CNAs in 79% of tumors. In DDLS, loss of 11q23-24 is associated with genomic complexity and distinct morphology whereas loss of 19q13 predicts poor prognosis. CNAs in liposarcoma improve risk stratification for patients and will help identify potential tumor suppressors driving liposarcoma progression.

Copy number losses define subgroups of dedifferentiated liposarcoma with poor prognosis and genomic instability

PubMed Central

Crago, Aimee M.; Socci, Nicholas D.; DeCarolis, Penelope; O'Connor, Rachael; Taylor, Barry S.; Qin, Li-Xuan; Antonescu, Cristina R.; Singer, Samuel

2012-01-01

Purpose Molecular events underlying progression of well-differentiated liposarcoma (WDLS) to dedifferentiated liposarcoma (DDLS) are poorly defined. This study sought to identify copy number alterations (CNAs) associated with dedifferentiation of WDLS, with DDLS morphology, and with patient outcomes. Experimental Design 55 WDLS and 52 DDLS were analyzed using Agilent 244K comparative genomic hybridization and Affymetrix U133A expression arrays. CNAs were identified by RAE analysis. Thirty-nine of the DDLS specimens were categorized morphologically by a single pathologist. Results Nine regions of CNA were identified as recurrent in DDLS but not WDLS; 79% of DDLS had at least one of these CNAs. Loss of the chromosome segment 11q23–24, the most common event, was observed only in DDLS that morphologically resembled the genomically complex sarcomas undifferentiated pleomorphic sarcoma and myxofibrosarcoma. 11q23–24 loss was itself associated with increased genomic complexity in DDLS. Loss of 19q13, but not 11q23–24, was associated with poor prognosis. Median disease-specific survival was shorter for patients with19q13 loss (27 months) than for patients with diploid 19q13 (>90 months; p<0.0025), and 19q13 loss was associated with local recurrence (HR 2.86, p=0.013). Common copy number losses were associated with transcriptional downregulation of potential tumor suppressors and adipogenesis-related genes (e.g., EI24 and CEBPA). Conclusions Dedifferentiation of WDLS is associated with recurrent CNAs in 79% of tumors. In DDLS, loss of 11q23–24 is associated with genomic complexity and distinct morphology while loss of 19q13 predicts poor prognosis. CNAs in liposarcoma improve risk stratification for patients and will help identify potential tumor suppressors driving liposarcoma progression. PMID:22241790

Saving HEBBLE Data from Oblivion: From Faded Paper Copy to Digital Files

NASA Astrophysics Data System (ADS)

Mishonov, A. V.; Richardson, M. J.; Gardner, W. D.

2017-12-01

The high-energy benthic boundary-layer experiment (HEBBLE) was designed to test the hypothesis that bed modifications can result from contemporary local erosion and deposition. We observed several 'benthic storms' that resuspended record-high concentrations of particulate matter - filtered samples up to 12,700 µg/l. High kinetic energy and near-bed flow were associated with these record-high concentrations of particulate matter at 4,9600 m off the Nova Scotian Rise in the north-west Atlantic, showing that large episodic events resuspend bottom sediments in deep ocean areas. As part of HEBBLE, CTD/Transmissometer data were collected in the late 1970's and early 1980's, including more than 40 stations on cruise KN74. Although many papers were published based on HEBBLE data, no electronic copies of the KN74 CTD/Transmissometer data were preserved. Because of the uniqueness of the record-high particulate matter concentrations, with ambient current velocities of >70 cm/sec near the seafloor, it was important to rescue these data. We had a paper printout of all of the digital CTD data. Attempts to scan and apply OCR to the data proved futile with standard copying/scanning machines. Texas A&M University Library Digital Service Center scanned our copies with a SupraScanQuartzA00-CamQuartzHD scanner and used ABBYY Fine Reader for OCR and PDF, more frequently used in the humanities for digital preservation and conservation. Their scans were markedly better, but still contained many errors because of poor quality originals. Two students were hired to QA/QC the hundreds of pages of data. While tedious, they successfully corrected the data, thus making it possible to make maps and sections shown here and submit data to publicly accessible archives for future generations to use. These data reside in the OAKTrust Digital Repository at Texas A&M University. After final QA/QC these data will be submitted to NCEI and will be merged with World Ocean Database (WOD).

Integrated fingerprinting in secure digital cinema projection

NASA Astrophysics Data System (ADS)

Delannay, Damien; Delaigle, Jean-Francois; Macq, Benoit M. M.; Quisquater, Jean-Jacques; Mas Ribes, Joan M.; Boucqueau, Jean M.; Nivart, Jean-Francois

2001-12-01

This paper describes the functional model of a combined conditional access and fingerprinting copyright (-or projectionright) protection system in a digital cinema framework. In the cinema industry, a large part of early movie piracy comes from copies made in the theater itself with a camera. The evolution towards digital cinema broadcast enables watermark based fingerprinting protection systems. Besides an appropriate fingerprinting technology, a number of well defined security/cryptographic tools are integrated in order to guaranty the integrity of the whole system. The requirements are two-fold: On one side, we must ensure that the media content is only accessible at exhibition time (under specific authorization obtained after an ad-hoc film rental agreement) and contains the related exhibition fingerprint. At the other end, we must prove our ability to retrieve the fingerprint information from an illegal copy of the media.

1 CFR 15.4 - Reproduction and certification of copies of acts and documents.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 1 General Provisions 1 2011-01-01 2011-01-01 false Reproduction and certification of copies of... Reproduction and certification of copies of acts and documents. The Director of the Federal Register shall furnish to requesting agencies, at cost, reproductions or certified copies of original acts and documents...

29 CFR 1626.14 - Right to inspect or copy data.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 29 Labor 4 2014-07-01 2014-07-01 false Right to inspect or copy data. 1626.14 Section 1626.14 Labor Regulations Relating to Labor (Continued) EQUAL EMPLOYMENT OPPORTUNITY COMMISSION PROCEDURES-AGE DISCRIMINATION IN EMPLOYMENT ACT § 1626.14 Right to inspect or copy data. A person who submits data or evidence...

29 CFR 1626.14 - Right to inspect or copy data.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 29 Labor 4 2011-07-01 2011-07-01 false Right to inspect or copy data. 1626.14 Section 1626.14 Labor Regulations Relating to Labor (Continued) EQUAL EMPLOYMENT OPPORTUNITY COMMISSION PROCEDURES-AGE DISCRIMINATION IN EMPLOYMENT ACT § 1626.14 Right to inspect or copy data. A person who submits data or evidence...

29 CFR 1626.14 - Right to inspect or copy data.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 29 Labor 4 2010-07-01 2010-07-01 false Right to inspect or copy data. 1626.14 Section 1626.14 Labor Regulations Relating to Labor (Continued) EQUAL EMPLOYMENT OPPORTUNITY COMMISSION PROCEDURES-AGE DISCRIMINATION IN EMPLOYMENT ACT § 1626.14 Right to inspect or copy data. A person who submits data or evidence...

29 CFR 1626.14 - Right to inspect or copy data.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 29 Labor 4 2012-07-01 2012-07-01 false Right to inspect or copy data. 1626.14 Section 1626.14 Labor Regulations Relating to Labor (Continued) EQUAL EMPLOYMENT OPPORTUNITY COMMISSION PROCEDURES-AGE DISCRIMINATION IN EMPLOYMENT ACT § 1626.14 Right to inspect or copy data. A person who submits data or evidence...

29 CFR 2201.7 - Fees for copying, searching, and review.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 29 Labor 9 2014-07-01 2014-07-01 false Fees for copying, searching, and review. 2201.7 Section... REGULATIONS IMPLEMENTING THE FREEDOM OF INFORMATION ACT § 2201.7 Fees for copying, searching, and review. (a..., searching and reviewing will be based on the direct costs of these services, including the average hourly...

29 CFR 2201.7 - Fees for copying, searching, and review.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 29 Labor 9 2011-07-01 2011-07-01 false Fees for copying, searching, and review. 2201.7 Section... REGULATIONS IMPLEMENTING THE FREEDOM OF INFORMATION ACT § 2201.7 Fees for copying, searching, and review. (a..., searching and reviewing will be based on the direct costs of these services, including the average hourly...

29 CFR 2201.7 - Fees for copying, searching, and review.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 29 Labor 9 2013-07-01 2013-07-01 false Fees for copying, searching, and review. 2201.7 Section... REGULATIONS IMPLEMENTING THE FREEDOM OF INFORMATION ACT § 2201.7 Fees for copying, searching, and review. (a..., searching and reviewing will be based on the direct costs of these services, including the average hourly...

29 CFR 2201.7 - Fees for copying, searching, and review.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 29 Labor 9 2012-07-01 2012-07-01 false Fees for copying, searching, and review. 2201.7 Section... REGULATIONS IMPLEMENTING THE FREEDOM OF INFORMATION ACT § 2201.7 Fees for copying, searching, and review. (a..., searching and reviewing will be based on the direct costs of these services, including the average hourly...

53. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

53. Photocopy of copy of original Officers' Duplex Quarters drawing by A.G.D., 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Electrical - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

51. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

51. Photocopy of copy of original Officers' Duplex Quarters drawing by B.S. Elliott, 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Plumbing - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

20. Photographic copy of the original construction drawing, 193031, by ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

20. Photographic copy of the original construction drawing, 1930-31, by Sverdrup and Parcel, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. Truss stress diagram, and plans of laterals and sway braces - Gasconade Bridge, Spanning Gasconade River at State Route 100, Gasconade, Gasconade County, MO

4. PHOTOGRAPHIC COPY OF ORIGINAL CONSTRUCTION DRAWING, DATED MAY 13, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

4. PHOTOGRAPHIC COPY OF ORIGINAL CONSTRUCTION DRAWING, DATED MAY 13, 1919, DETACHMENT BARRACK WITHOUT MESS, WAR DEPARTMENT, CONSTRUCTION DIVISION, PLAN # 353, COPY ON FILE IN THE ENVIRONMENTAL MANAGEMENT OFFICE, FORT BLISS - Fort Bliss, 7th Cavalry Buildings, U.S. Army Air Defence Artillery Center & Fort Bliss, El Paso, El Paso County, TX

Imitation in Young Children: When Who Gets Copied Is More Important than What Gets Copied

ERIC Educational Resources Information Center

Nielsen, Mark; Blank, Cornelia

2011-01-01

Unlike other animals, human children will copy all of an adult's goal-directed actions, including ones that are clearly unnecessary for achieving the demonstrated goal. Here we highlight how social affiliation is key to this species-specific behavior. Preschoolers watched 2 adults retrieve a toy from a novel apparatus. One adult included…

Detecting independent and recurrent copy number aberrations using interval graphs.

PubMed

Wu, Hsin-Ta; Hajirasouliha, Iman; Raphael, Benjamin J

2014-06-15

Somatic copy number aberrations SCNAS: are frequent in cancer genomes, but many of these are random, passenger events. A common strategy to distinguish functional aberrations from passengers is to identify those aberrations that are recurrent across multiple samples. However, the extensive variability in the length and position of SCNA: s makes the problem of identifying recurrent aberrations notoriously difficult. We introduce a combinatorial approach to the problem of identifying independent and recurrent SCNA: s, focusing on the key challenging of separating the overlaps in aberrations across individuals into independent events. We derive independent and recurrent SCNA: s as maximal cliques in an interval graph constructed from overlaps between aberrations. We efficiently enumerate all such cliques, and derive a dynamic programming algorithm to find an optimal selection of non-overlapping cliques, resulting in a very fast algorithm, which we call RAIG (Recurrent Aberrations from Interval Graphs). We show that RAIG outperforms other methods on simulated data and also performs well on data from three cancer types from The Cancer Genome Atlas (TCGA). In contrast to existing approaches that employ various heuristics to select independent aberrations, RAIG optimizes a well-defined objective function. We show that this allows RAIG to identify rare aberrations that are likely functional, but are obscured by overlaps with larger passenger aberrations. http://compbio.cs.brown.edu/software. © The Author 2014. Published by Oxford University Press.

Comparative studies of copy number variation detection methods for next-generation sequencing technologies.

PubMed

Duan, Junbo; Zhang, Ji-Gang; Deng, Hong-Wen; Wang, Yu-Ping

2013-01-01

Copy number variation (CNV) has played an important role in studies of susceptibility or resistance to complex diseases. Traditional methods such as fluorescence in situ hybridization (FISH) and array comparative genomic hybridization (aCGH) suffer from low resolution of genomic regions. Following the emergence of next generation sequencing (NGS) technologies, CNV detection methods based on the short read data have recently been developed. However, due to the relatively young age of the procedures, their performance is not fully understood. To help investigators choose suitable methods to detect CNVs, comparative studies are needed. We compared six publicly available CNV detection methods: CNV-seq, FREEC, readDepth, CNVnator, SegSeq and event-wise testing (EWT). They are evaluated both on simulated and real data with different experiment settings. The receiver operating characteristic (ROC) curve is employed to demonstrate the detection performance in terms of sensitivity and specificity, box plot is employed to compare their performances in terms of breakpoint and copy number estimation, Venn diagram is employed to show the consistency among these methods, and F-score is employed to show the overlapping quality of detected CNVs. The computational demands are also studied. The results of our work provide a comprehensive evaluation on the performances of the selected CNV detection methods, which will help biological investigators choose the best possible method.

Mate-choice copying, social information processing, and the roles of oxytocin.

PubMed

Kavaliers, Martin; Matta, Richard; Choleris, Elena

2017-01-01

Social and sexual behaviors, including that of mate choice, are dependent on social information. Mate choice can be modified by prior and ongoing social factors and experience. The mate choice decisions of one individual can be influenced by either the actual or potential mate choice of another female or male. Such non-independent mate choice, where individuals gain social information and socially learn about and recognizes potential mates by observing the choices of another female or male, has been termed "mate-choice copying". Here we first briefly review how, why, and under what circumstances individuals engage in mate-choice copying. Secondly, we review the neurobiological mechanisms underlying mate-choice copying. In particular, we consider the roles of the nonapeptide, oxytocin, in the processing of social information and the expression of mate-choice copying. Copyright © 2016 Elsevier Ltd. All rights reserved.

DNA copy number changes define spatial patterns of heterogeneity in colorectal cancer

PubMed Central

Mamlouk, Soulafa; Childs, Liam Harold; Aust, Daniela; Heim, Daniel; Melching, Friederike; Oliveira, Cristiano; Wolf, Thomas; Durek, Pawel; Schumacher, Dirk; Bläker, Hendrik; von Winterfeld, Moritz; Gastl, Bastian; Möhr, Kerstin; Menne, Andrea; Zeugner, Silke; Redmer, Torben; Lenze, Dido; Tierling, Sascha; Möbs, Markus; Weichert, Wilko; Folprecht, Gunnar; Blanc, Eric; Beule, Dieter; Schäfer, Reinhold; Morkel, Markus; Klauschen, Frederick; Leser, Ulf; Sers, Christine

2017-01-01

Genetic heterogeneity between and within tumours is a major factor determining cancer progression and therapy response. Here we examined DNA sequence and DNA copy-number heterogeneity in colorectal cancer (CRC) by targeted high-depth sequencing of 100 most frequently altered genes. In 97 samples, with primary tumours and matched metastases from 27 patients, we observe inter-tumour concordance for coding mutations; in contrast, gene copy numbers are highly discordant between primary tumours and metastases as validated by fluorescent in situ hybridization. To further investigate intra-tumour heterogeneity, we dissected a single tumour into 68 spatially defined samples and sequenced them separately. We identify evenly distributed coding mutations in APC and TP53 in all tumour areas, yet highly variable gene copy numbers in numerous genes. 3D morpho-molecular reconstruction reveals two clusters with divergent copy number aberrations along the proximal–distal axis indicating that DNA copy number variations are a major source of tumour heterogeneity in CRC. PMID:28120820

18 CFR 45.7 - Form of application; number of copies.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Form of application; number of copies. 45.7 Section 45.7 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... in accordance with § 131.60 of this chapter. Each copy shall bear the date and signature that appear...

10 CFR 205.307 - Form and style; number of copies

Code of Federal Regulations, 2010 CFR

2010-01-01

... 10 Energy 3 2010-01-01 2010-01-01 false Form and style; number of copies 205.307 Section 205.307 Energy DEPARTMENT OF ENERGY OIL ADMINISTRATIVE PROCEDURES AND SANCTIONS Electric Power System Permits and... Electric Energy to A Foreign Country § 205.307 Form and style; number of copies An original and two...

6. PHOTOGRAPHIC COPY OF ORIGINAL CONSTRUCTION DRAWING, DATED MAY 15, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

6. PHOTOGRAPHIC COPY OF ORIGINAL CONSTRUCTION DRAWING, DATED MAY 15, 1919, 7TH CAVALRY CANTONMENT POST EXCHANGE, WAR DEPARTMENT, CONSTRUCTION DIVISION, PLAN No. 357, COPY ON FILE IN THE ENVIRONMENTAL MANAGEMENT OFFICE, FORT BLISS - Fort Bliss, 7th Cavalry Buildings, U.S. Army Air Defence Artillery Center & Fort Bliss, El Paso, El Paso County, TX

10 CFR 205.307 - Form and style; number of copies

Code of Federal Regulations, 2011 CFR

2011-01-01

... 10 Energy 3 2011-01-01 2011-01-01 false Form and style; number of copies 205.307 Section 205.307 Energy DEPARTMENT OF ENERGY OIL ADMINISTRATIVE PROCEDURES AND SANCTIONS Electric Power System Permits and... Electric Energy to A Foreign Country § 205.307 Form and style; number of copies An original and two...

Peripheral artery disease, calf skeletal muscle mitochondrial DNA copy number, and functional performance.

PubMed

McDermott, Mary M; Peterson, Charlotte A; Sufit, Robert; Ferrucci, Luigi; Guralnik, Jack M; Kibbe, Melina R; Polonsky, Tamar S; Tian, Lu; Criqui, Michael H; Zhao, Lihui; Stein, James H; Li, Lingyu; Leeuwenburgh, Christiaan

2018-05-01

In people without lower extremity peripheral artery disease (PAD), mitochondrial DNA copy number declines with aging, and this decline is associated with declines in mitochondrial activity and functional performance. However, whether lower extremity ischemia is associated with lower mitochondrial DNA copy number and whether mitochondrial DNA copy number is associated with the degree of functional impairment in people with PAD is unknown. In people with and without PAD, age 65 years and older, we studied associations of the ankle-brachial index (ABI) with mitochondrial DNA copy number and associations of mitochondrial DNA copy number with functional impairment. Calf muscle biopsies were obtained from 34 participants with PAD (mean age: 73.5 years (SD 6.4), mean ABI: 0.67 (SD 0.15), mean 6-minute walk distance: 1191 feet (SD 223)) and 10 controls without PAD (mean age: 73.1 years (SD 4.7), mean ABI: 1.14 (SD 0.07), mean 6-minute walk distance: 1387 feet (SD 488)). Adjusting for age and sex, lower ABI values were associated with higher mitochondrial DNA copy number, measured in relative copy number (ABI<0.60: 914, ABI 0.60-0.90: 731, ABI 0.90-1.50: 593; p trend=0.016). The association of mitochondrial DNA copy number with the 6-minute walk distance and 4-meter walking velocity differed significantly between participants with versus without PAD ( p-value for interaction=0.001 and p=0.015, respectively). The correlation coefficient between mitochondrial DNA copy number and the 6-minute walk distance was 0.653 ( p=0.056) among people without PAD and -0.254 ( p=0.154) among people with PAD and ABI < 0.90. In conclusion, lower ABI values are associated with increased mitochondrial DNA copy number. Associations of mitochondrial DNA copy number with the 6-minute walk distance and 4-meter walking velocity significantly differed between people with versus without PAD, with stronger positive associations observed in people without PAD than in people with PAD. The cross

The 17th Project Integration Meeting

NASA Technical Reports Server (NTRS)

Mcdonald, R. R.

1981-01-01

Progress made by the Low-Cost Solar Array Project during the period September 1980 to February 1981 is described. Included are reports on project analysis and integration; technology development in silicon material, large-area silicon sheet and encapsulation; production process and equipment development; engineering, and operations. A report on and copies of visual presentations made at the Project Integration Meeting held at Pasadena, California on February 4 and 5, 1981 are also included.

NAHR-mediated copy-number variants in a clinical population: mechanistic insights into both genomic disorders and Mendelizing traits.

PubMed

Dittwald, Piotr; Gambin, Tomasz; Szafranski, Przemyslaw; Li, Jian; Amato, Stephen; Divon, Michael Y; Rodríguez Rojas, Lisa Ximena; Elton, Lindsay E; Scott, Daryl A; Schaaf, Christian P; Torres-Martinez, Wilfredo; Stevens, Abby K; Rosenfeld, Jill A; Agadi, Satish; Francis, David; Kang, Sung-Hae L; Breman, Amy; Lalani, Seema R; Bacino, Carlos A; Bi, Weimin; Milosavljevic, Aleksandar; Beaudet, Arthur L; Patel, Ankita; Shaw, Chad A; Lupski, James R; Gambin, Anna; Cheung, Sau Wai; Stankiewicz, Pawel

2013-09-01

We delineated and analyzed directly oriented paralogous low-copy repeats (DP-LCRs) in the most recent version of the human haploid reference genome. The computationally defined DP-LCRs were cross-referenced with our chromosomal microarray analysis (CMA) database of 25,144 patients subjected to genome-wide assays. This computationally guided approach to the empirically derived large data set allowed us to investigate genomic rearrangement relative frequencies and identify new loci for recurrent nonallelic homologous recombination (NAHR)-mediated copy-number variants (CNVs). The most commonly observed recurrent CNVs were NPHP1 duplications (233), CHRNA7 duplications (175), and 22q11.21 deletions (DiGeorge/velocardiofacial syndrome, 166). In the ∼25% of CMA cases for which parental studies were available, we identified 190 de novo recurrent CNVs. In this group, the most frequently observed events were deletions of 22q11.21 (48), 16p11.2 (autism, 34), and 7q11.23 (Williams-Beuren syndrome, 11). Several features of DP-LCRs, including length, distance between NAHR substrate elements, DNA sequence identity (fraction matching), GC content, and concentration of the homologous recombination (HR) hot spot motif 5'-CCNCCNTNNCCNC-3', correlate with the frequencies of the recurrent CNVs events. Four novel adjacent DP-LCR-flanked and NAHR-prone regions, involving 2q12.2q13, were elucidated in association with novel genomic disorders. Our study quantitates genome architectural features responsible for NAHR-mediated genomic instability and further elucidates the role of NAHR in human disease.

Using DMA for copying performance counter data to memory

DOEpatents

Gara, Alan; Salapura, Valentina; Wisniewski, Robert W.

2012-09-25

A device for copying performance counter data includes hardware path that connects a direct memory access (DMA) unit to a plurality of hardware performance counters and a memory device. Software prepares an injection packet for the DMA unit to perform copying, while the software can perform other tasks. In one aspect, the software that prepares the injection packet runs on a processing core other than the core that gathers the hardware performance counter data.

Using DMA for copying performance counter data to memory

DOEpatents

Gara, Alan; Salapura, Valentina; Wisniewski, Robert W

2013-12-31

A device for copying performance counter data includes hardware path that connects a direct memory access (DMA) unit to a plurality of hardware performance counters and a memory device. Software prepares an injection packet for the DMA unit to perform copying, while the software can perform other tasks. In one aspect, the software that prepares the injection packet runs on a processing core other than the core that gathers the hardware performance data.

Retroviral DNA Integration Directed by HIV Integration Protein in Vitro

NASA Astrophysics Data System (ADS)

Bushman, Frederic D.; Fujiwara, Tamio; Craigie, Robert

1990-09-01

Efficient retroviral growth requires integration of a DNA copy of the viral RNA genome into a chromosome of the host. As a first step in analyzing the mechanism of integration of human immunodeficiency virus (HIV) DNA, a cell-free system was established that models the integration reaction. The in vitro system depends on the HIV integration (IN) protein, which was partially purified from insect cells engineered to express IN protein in large quantities. Integration was detected in a biological assay that scores the insertion of a linear DNA containing HIV terminal sequences into a λ DNA target. Some integration products generated in this assay contained five-base pair duplications of the target DNA at the recombination junctions, a characteristic of HIV integration in vivo; the remaining products contained aberrant junctional sequences that may have been produced in a variation of the normal reaction. These results indicate that HIV IN protein is the only viral protein required to insert model HIV DNA sequences into a target DNA in vitro.

20 CFR 416.804 - Certified copy in lieu of original.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Certified copy in lieu of original. 416.804... AGED, BLIND, AND DISABLED Determination of Age § 416.804 Certified copy in lieu of original. In lieu of the original of any record, except a Bible or other family record, there may be submitted as evidence...

50. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

50. Photocopy of copy of original Officers' Duplex Quarters drawing by Turner, 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University. Detail of front entrance and of gable dormer - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

49. Photocopy of copy of original Officers' Duplex Quarters drawing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

49. Photocopy of copy of original Officers' Duplex Quarters drawing by Turner, 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Front, rear, and side elevations, and cross-section - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

Cover-Copy-Compare: A Method for Enhancing Evidence-Based Instruction