Science.gov

Sample records for copy integration events

  1. Strategies to improve low copy transgenic events in Agrobacterium-mediated transformation of maize.

    PubMed

    Sivamani, Elumalai; Li, Xianggan; Nalapalli, Samson; Barron, Yoshimi; Prairie, Anna; Bradley, David; Doyle, Michele; Que, Qiudeng

    2015-12-01

    Transgenic plants containing low copy transgene insertion free of vector backbone are highly desired for many biotechnological applications. We have investigated two different strategies for increasing the percentage of low copy events in Agrobacterium-mediated transformation experiments in maize. One of the strategies is to use a binary vector with two separate T-DNAs, one T-DNA containing an intact E.coli manA gene encoding phosphomannose isomerase (PMI) as selectable marker gene cassette and another T-DNA containing an RNAi cassette of PMI sequences. By using this strategy, low copy transgenic events containing the transgenes were increased from 43 to 60 % in maize. An alternate strategy is using selectable marker gene cassettes containing regulatory or coding sequences derived from essential plant genes such as 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) or MADS box transcription factor. In this paper we demonstrate that higher percentage of low copy transgenic events can be obtained in Agrobacterium-mediated maize transformation experiments using both strategies. We propose that the above two strategies can be used independently or in combination to increase transgenic events that contain low copy transgene insertion in Agrobacterium-mediated transformation experiments.

  2. Three Course Connections: Integrated Event Design

    ERIC Educational Resources Information Center

    Johnson, Corey W.; Pate, Joseph A.

    2013-01-01

    Integrated Event Design (IED) capitalizes on three distinct courses to achieve a blended course delivery: Event Management, Research and Evaluation (for undergraduate students), and Experiential Education (for graduate students). Through the use of an event management company metaphor that fully integrates the diverse curricular concepts, course…

  3. Integrating Events Across Levels of Consciousness

    PubMed Central

    Henke, Katharina; Reber, Thomas P.; Duss, Simone B.

    2013-01-01

    Our knowledge grows as we integrate events experienced at different points in time. We may or may not become aware of events, their integration, and their impact on our knowledge and decisions. But can we mentally integrate two events, if they are experienced at different time points and at different levels of consciousness? In this study, an event consisted of the presentation of two unrelated words. In the stream of events, half of events shared one component (“tree desk” … “desk fish”) to facilitate event integration. We manipulated the amount of time and trials that separated two corresponding events. The contents of one event were presented subliminally (invisible) and the contents of the corresponding overlapping event supraliminally (visible). Hence, event integration required the binding of contents between consciousness levels and between time points. At the final test of integration, participants judged whether two supraliminal test words (“tree fish”) fit together semantically or not. Unbeknown to participants, half of test words were episodically related through an overlap (“desk”; experimental condition) and half were not (control condition). Participants judged episodically related test words to be closer semantically than unrelated test words. This subjective decrease in the semantic distance between test words was both independent of whether the invisible event was encoded first or second in order and independent of the number of trials and the time that separated two corresponding events. Hence, conscious and unconscious memories were mentally integrated into a linked mnemonic representation. PMID:23785318

  4. Adaptive Control of Event Integration

    ERIC Educational Resources Information Center

    Akyurek, Elkan G.; Toffanin, Paolo; Hommel, Bernhard

    2008-01-01

    Identifying 2 target stimuli in a rapid stream of visual symbols is much easier if the 2nd target appears immediately after the 1st target (i.e., at Lag 1) than if distractor stimuli intervene. As this phenomenon comes with a strong tendency to confuse the order of the targets, it seems to be due to the integration of both targets into the same…

  5. Identification of candidate growth promoting genes in ovarian cancer through integrated copy number and expression analysis.

    PubMed

    Ramakrishna, Manasa; Williams, Louise H; Boyle, Samantha E; Bearfoot, Jennifer L; Sridhar, Anita; Speed, Terence P; Gorringe, Kylie L; Campbell, Ian G

    2010-04-08

    Ovarian cancer is a disease characterised by complex genomic rearrangements but the majority of the genes that are the target of these alterations remain unidentified. Cataloguing these target genes will provide useful insights into the disease etiology and may provide an opportunity to develop novel diagnostic and therapeutic interventions. High resolution genome wide copy number and matching expression data from 68 primary epithelial ovarian carcinomas of various histotypes was integrated to identify genes in regions of most frequent amplification with the strongest correlation with expression and copy number. Regions on chromosomes 3, 7, 8, and 20 were most frequently increased in copy number (> 40% of samples). Within these regions, 703/1370 (51%) unique gene expression probesets were differentially expressed when samples with gain were compared to samples without gain. 30% of these differentially expressed probesets also showed a strong positive correlation (r > or =0.6) between expression and copy number. We also identified 21 regions of high amplitude copy number gain, in which 32 known protein coding genes showed a strong positive correlation between expression and copy number. Overall, our data validates previously known ovarian cancer genes, such as ERBB2, and also identified novel potential drivers such as MYNN, PUF60 and TPX2.

  6. Identification of Candidate Growth Promoting Genes in Ovarian Cancer through Integrated Copy Number and Expression Analysis

    PubMed Central

    Ramakrishna, Manasa; Williams, Louise H.; Boyle, Samantha E.; Bearfoot, Jennifer L.; Sridhar, Anita; Speed, Terence P.; Gorringe, Kylie L.; Campbell, Ian G.

    2010-01-01

    Ovarian cancer is a disease characterised by complex genomic rearrangements but the majority of the genes that are the target of these alterations remain unidentified. Cataloguing these target genes will provide useful insights into the disease etiology and may provide an opportunity to develop novel diagnostic and therapeutic interventions. High resolution genome wide copy number and matching expression data from 68 primary epithelial ovarian carcinomas of various histotypes was integrated to identify genes in regions of most frequent amplification with the strongest correlation with expression and copy number. Regions on chromosomes 3, 7, 8, and 20 were most frequently increased in copy number (>40% of samples). Within these regions, 703/1370 (51%) unique gene expression probesets were differentially expressed when samples with gain were compared to samples without gain. 30% of these differentially expressed probesets also showed a strong positive correlation (r≥0.6) between expression and copy number. We also identified 21 regions of high amplitude copy number gain, in which 32 known protein coding genes showed a strong positive correlation between expression and copy number. Overall, our data validates previously known ovarian cancer genes, such as ERBB2, and also identified novel potential drivers such as MYNN, PUF60 and TPX2. PMID:20386695

  7. A rapid and reliable strategy for chromosomal integration of gene(s) with multiple copies

    PubMed Central

    Gu, Pengfei; Yang, Fan; Su, Tianyuan; Wang, Qian; Liang, Quanfeng; Qi, Qingsheng

    2015-01-01

    Direct optimization of the metabolic pathways on the chromosome requires tools that can fine tune the overexpression of a desired gene or optimize the combination of multiple genes. Although plasmid-dependent overexpression has been used for this task, fundamental issues concerning its genetic stability and operational repeatability have not been addressed. Here, we describe a rapid and reliable strategy for chromosomal integration of gene(s) with multiple copies (CIGMC), which uses the flippase from the yeast 2-μm plasmid. Using green fluorescence protein as a model, we verified that the fluorescent intensity was in accordance with the integration copy number of the target gene. When a narrow-host-range replicon, R6K, was used in the integrative plasmid, the maximum integrated copy number of Escherichia coli reached 15. Applying the CIGMC method to optimize the overexpression of single or multiple genes in amino acid biosynthesis, we successfully improved the product yield and stability of the production. As a flexible strategy, CIGMC can be used in various microorganisms other than E. coli. PMID:25851494

  8. Integrative Analysis of Transcriptional Regulatory Network and Copy Number Variation in Intrahepatic Cholangiocarcinoma

    PubMed Central

    Li, Ling; Lian, Baofeng; Li, Chao; Li, Wei; Li, Jing; Zhang, Yuannv; He, Xianghuo; Li, Yixue; Xie, Lu

    2014-01-01

    Background Transcriptional regulatory network (TRN) is used to study conditional regulatory relationships between transcriptional factors and genes. However few studies have tried to integrate genomic variation information such as copy number variation (CNV) with TRN to find causal disturbances in a network. Intrahepatic cholangiocarcinoma (ICC) is the second most common hepatic carcinoma with high malignancy and poor prognosis. Research about ICC is relatively limited comparing to hepatocellular carcinoma, and there are no approved gene therapeutic targets yet. Method We first constructed TRN of ICC (ICC-TRN) using forward-and-reverse combined engineering method, and then integrated copy number variation information with ICC-TRN to select CNV-related modules and constructed CNV-ICC-TRN. We also integrated CNV-ICC-TRN with KEGG signaling pathways to investigate how CNV genes disturb signaling pathways. At last, unsupervised clustering method was applied to classify samples into distinct classes. Result We obtained CNV-ICC-TRN containing 33 modules which were enriched in ICC-related signaling pathways. Integrated analysis of the regulatory network and signaling pathways illustrated that CNV might interrupt signaling through locating on either genomic sites of nodes or regulators of nodes in a signaling pathway. In the end, expression profiles of nodes in CNV-ICC-TRN were used to cluster the ICC patients into two robust groups with distinct biological function features. Conclusion Our work represents a primary effort to construct TRN in ICC, also a primary effort to try to identify key transcriptional modules based on their involvement of genetic variations shown by gene copy number variations (CNV). This kind of approach may bring the traditional studies of TRN based only on expression data one step further to genetic disturbance. Such kind of approach can easily be extended to other disease samples with appropriate data. PMID:24897108

  9. Integrated Historical Tsunami Event and Deposit Database

    NASA Astrophysics Data System (ADS)

    Dunbar, P. K.; McCullough, H. L.

    2010-12-01

    The National Geophysical Data Center (NGDC) provides integrated access to historical tsunami event, deposit, and proxy data. The NGDC tsunami archive initially listed tsunami sources and locations with observed tsunami effects. Tsunami frequency and intensity are important for understanding tsunami hazards. Unfortunately, tsunami recurrence intervals often exceed the historic record. As a result, NGDC expanded the archive to include the Global Tsunami Deposits Database (GTD_DB). Tsunami deposits are the physical evidence left behind when a tsunami impacts a shoreline or affects submarine sediments. Proxies include co-seismic subsidence, turbidite deposits, changes in biota following an influx of marine water in a freshwater environment, etc. By adding past tsunami data inferred from the geologic record, the GTD_DB extends the record of tsunamis backward in time. Although the best methods for identifying tsunami deposits and proxies in the geologic record remain under discussion, developing an overall picture of where tsunamis have affected coasts, calculating recurrence intervals, and approximating runup height and inundation distance provides a better estimate of a region’s true tsunami hazard. Tsunami deposit and proxy descriptions in the GTD_DB were compiled from published data found in journal articles, conference proceedings, theses, books, conference abstracts, posters, web sites, etc. The database now includes over 1,200 descriptions compiled from over 1,100 citations. Each record in the GTD_DB is linked to its bibliographic citation where more information on the deposit can be found. The GTD_DB includes data for over 50 variables such as: event description (e.g., 2010 Chile Tsunami), geologic time period, year, deposit location name, latitude, longitude, country, associated body of water, setting during the event (e.g., beach, lake, river, deep sea), upper and lower contacts, underlying and overlying material, etc. If known, the tsunami source mechanism

  10. Inverse PCR and Quantitative PCR as Alternative Methods to Southern Blotting Analysis to Assess Transgene Copy Number and Characterize the Integration Site in Transgenic Woody Plants.

    PubMed

    Stefano, Biricolti; Patrizia, Bogani; Matteo, Cerboneschi; Massimo, Gori

    2016-06-01

    One of the major unanswered questions with respect to the commercial use of genetic transformation in woody plants is the stability of the transgene expression over several decades within the same individual. Gene expression is strongly affected by the copy number which has been integrated into the plant genome and by the local DNA features close to the integration sites. Because woody plants cannot be subjected to selfing or backcrossing to modify the transgenic allelic structure without affecting the valuable traits of the cultivar, molecular characterization of the transformation event is therefore crucial. After assessing the transgene copy number of a set of apple transgenic clones with Southern blotting, we describe two alternative methods: the first is based on inverse PCR (i-PCR) and the second on the quantitative PCR (q-PCR). The methods produced comparable results with the exception of the data regarding a high copy number clone, but while the q-PCR-based system is rapid and easily adaptable to high throughput systems, the i-PCR-based method can provide information regarding the transformation event and the characteristics of the sequences flanking the transgenic construct.

  11. Agrobacterium tumefaciens-mediated creeping bentgrass (Agrostis stolonifera L.) transformation using phosphinothricin selection results in a high frequency of single-copy transgene integration.

    PubMed

    Luo, H; Hu, Q; Nelson, K; Longo, C; Kausch, A P; Chandlee, J M; Wipff, J K; Fricker, C R

    2004-04-01

    Genetic transformation of creeping bentgrass mediated by Agrobacterium tumefaciens has been achieved. Embryogenic callus initiated from seeds (cv. Penn-A-4) was infected with an A. tumefaciens strain (LBA4404) harboring a super-binary vector that contained an herbicide-resistant bar gene driven either by the CaMV 35S promoter or a rice ubiquitin promoter. Plants were regenerated from 219 independent transformation events. The overall stable transformation efficiency ranged from 18% to 45%. Southern blot and genetic analysis confirmed transgene integration in the creeping bentgrass genome and normal transmission and stable expression of the transgene in the T1 generation. All independent transformation events carried one to three copies of the transgene, and a majority (60-65%) contained only a single copy of the foreign gene with no apparent rearrangements. We report here the successful use of Agrobacterium for the large-scale production of transgenic creeping bentgrass plants with a high frequency of a single-copy transgene insertion that exhibit stable inheritance patterns.

  12. Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

    PubMed Central

    Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.

    1990-01-01

    Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

  13. Integrated small copy number variations and epigenome maps of disorders of sex development

    PubMed Central

    Amarillo, Ina E; Nievera, Isabelle; Hagan, Andrew; Huchthagowder, Vishwa; Heeley, Jennifer; Hollander, Abby; Koenig, Joel; Austin, Paul; Wang, Ting

    2016-01-01

    Small copy number variations (CNVs) have typically not been analyzed or reported in clinical settings and hence have remained underrepresented in databases and the literature. Here, we focused our investigations on these small CNVs using chromosome microarray analysis (CMA) data previously obtained from patients with atypical characteristics or disorders of sex development (DSD). Using our customized CMA track targeting 334 genes involved in the development of urogenital and reproductive structures and a less stringent analysis filter, we uncovered small genes with recurrent and overlapping CNVs as small as 1 kb, and small regions of homozygosity (ROHs), imprinting and position effects. Detailed analysis of these high-resolution data revealed CNVs and ROHs involving structural and functional domains, repeat elements, active transcription sites and regulatory regions. Integration of these genomic data with DNA methylation, histone modification and predicted RNA expression profiles in normal testes and ovaries suggested spatiotemporal and tissue-specific gene regulation. This study emphasized a DSD-specific and gene-targeted CMA approach that uncovered previously unanalyzed or unreported small genes and CNVs, contributing to the growing resources on small CNVs and facilitating the narrowing of the genomic gap for identifying candidate genes or regions. This high-resolution analysis tool could improve the diagnostic utility of CMA, not only in patients with DSD but also in other clinical populations. These integrated data provided a better genomic-epigenomic landscape of DSD and greater opportunities for downstream research. PMID:27340555

  14. ParseCNV integrative copy number variation association software with quality tracking.

    PubMed

    Glessner, Joseph T; Li, Jin; Hakonarson, Hakon

    2013-03-01

    A number of copy number variation (CNV) calling algorithms exist; however, comprehensive software tools for CNV association studies are lacking. We describe ParseCNV, unique software that takes CNV calls and creates probe-based statistics for CNV occurrence in both case-control design and in family based studies addressing both de novo and inheritance events, which are then summarized based on CNV regions (CNVRs). CNVRs are defined in a dynamic manner to allow for a complex CNV overlap while maintaining precise association region. Using this approach, we avoid failure to converge and non-monotonic curve fitting weaknesses of programs, such as CNVtools and CNVassoc, and although Plink is easy to use, it only provides combined CNV state probe-based statistics, not state-specific CNVRs. Existing CNV association methods do not provide any quality tracking information to filter confident associations, a key issue which is fully addressed by ParseCNV. In addition, uncertainty in CNV calls underlying CNV associations is evaluated to verify significant results, including CNV overlap profiles, genomic context, number of probes supporting the CNV and single-probe intensities. When optimal quality control parameters are followed using ParseCNV, 90% of CNVs validate by polymerase chain reaction, an often problematic stage because of inadequate significant association review. ParseCNV is freely available at http://parsecnv.sourceforge.net.

  15. Integrated analysis of copy number variation and genome-wide expression profiling in colorectal cancer tissues.

    PubMed

    Ali Hassan, Nur Zarina; Mokhtar, Norfilza Mohd; Kok Sin, Teow; Mohamed Rose, Isa; Sagap, Ismail; Harun, Roslan; Jamal, Rahman

    2014-01-01

    Integrative analyses of multiple genomic datasets for selected samples can provide better insight into the overall data and can enhance our knowledge of cancer. The objective of this study was to elucidate the association between copy number variation (CNV) and gene expression in colorectal cancer (CRC) samples and their corresponding non-cancerous tissues. Sixty-four paired CRC samples from the same patients were subjected to CNV profiling using the Illumina HumanOmni1-Quad assay, and validation was performed using multiplex ligation probe amplification method. Genome-wide expression profiling was performed on 15 paired samples from the same group of patients using the Affymetrix Human Gene 1.0 ST array. Significant genes obtained from both array results were then overlapped. To identify molecular pathways, the data were mapped to the KEGG database. Whole genome CNV analysis that compared primary tumor and non-cancerous epithelium revealed gains in 1638 genes and losses in 36 genes. Significant gains were mostly found in chromosome 20 at position 20q12 with a frequency of 45.31% in tumor samples. Examples of genes that were associated at this cytoband were PTPRT, EMILIN3 and CHD6. The highest number of losses was detected at chromosome 8, position 8p23.2 with 17.19% occurrence in all tumor samples. Among the genes found at this cytoband were CSMD1 and DLC1. Genome-wide expression profiling showed 709 genes to be up-regulated and 699 genes to be down-regulated in CRC compared to non-cancerous samples. Integration of these two datasets identified 56 overlapping genes, which were located in chromosomes 8, 20 and 22. MLPA confirmed that the CRC samples had the highest gains in chromosome 20 compared to the reference samples. Interpretation of the CNV data in the context of the transcriptome via integrative analyses may provide more in-depth knowledge of the genomic landscape of CRC.

  16. SRBreak: A Read-Depth and Split-Read Framework to Identify Breakpoints of Different Events Inside Simple Copy-Number Variable Regions.

    PubMed

    Nguyen, Hoang T; Boocock, James; Merriman, Tony R; Black, Michael A

    2016-01-01

    Copy-number variation (CNV) has been associated with increased risk of complex diseases. High-throughput sequencing (HTS) technologies facilitate the detection of copy-number variable regions (CNVRs) and their breakpoints. This helps in understanding genome structure as well as their evolution process. Various approaches have been proposed for detecting CNV breakpoints, but currently it is still challenging for tools based on a single analysis method to identify breakpoints of CNVs. It has been shown, however, that pipelines which integrate multiple approaches are able to report more reliable breakpoints. Here, based on HTS data, we have developed a pipeline to identify approximate breakpoints (±10 bp) relating to different ancestral events within a specific CNVR. The pipeline combines read-depth and split-read information to infer breakpoints, using information from multiple samples to allow an imputation approach to be taken. The main steps involve using a normal mixture model to cluster samples into different groups, followed by simple kernel-based approaches to maximize information obtained from read-depth and split-read approaches, after which common breakpoints of groups are inferred. The pipeline uses split-read information directly from CIGAR strings of BAM files, without using a re-alignment step. On simulated data sets, it was able to report breakpoints for very low-coverage samples including those for which only single-end reads were available. When applied to three loci from existing human resequencing data sets (NEGR1, LCE3, IRGM) the pipeline obtained good concordance with results from the 1000 Genomes Project (92, 100, and 82%, respectively). The package is available at https://github.com/hoangtn/SRBreak, and also as a docker-based application at https://registry.hub.docker.com/u/hoangtn/srbreak/.

  17. SRBreak: A Read-Depth and Split-Read Framework to Identify Breakpoints of Different Events Inside Simple Copy-Number Variable Regions

    PubMed Central

    Nguyen, Hoang T.; Boocock, James; Merriman, Tony R.; Black, Michael A.

    2016-01-01

    Copy-number variation (CNV) has been associated with increased risk of complex diseases. High-throughput sequencing (HTS) technologies facilitate the detection of copy-number variable regions (CNVRs) and their breakpoints. This helps in understanding genome structure as well as their evolution process. Various approaches have been proposed for detecting CNV breakpoints, but currently it is still challenging for tools based on a single analysis method to identify breakpoints of CNVs. It has been shown, however, that pipelines which integrate multiple approaches are able to report more reliable breakpoints. Here, based on HTS data, we have developed a pipeline to identify approximate breakpoints (±10 bp) relating to different ancestral events within a specific CNVR. The pipeline combines read-depth and split-read information to infer breakpoints, using information from multiple samples to allow an imputation approach to be taken. The main steps involve using a normal mixture model to cluster samples into different groups, followed by simple kernel-based approaches to maximize information obtained from read-depth and split-read approaches, after which common breakpoints of groups are inferred. The pipeline uses split-read information directly from CIGAR strings of BAM files, without using a re-alignment step. On simulated data sets, it was able to report breakpoints for very low-coverage samples including those for which only single-end reads were available. When applied to three loci from existing human resequencing data sets (NEGR1, LCE3, IRGM) the pipeline obtained good concordance with results from the 1000 Genomes Project (92, 100, and 82%, respectively). The package is available at https://github.com/hoangtn/SRBreak, and also as a docker-based application at https://registry.hub.docker.com/u/hoangtn/srbreak/. PMID:27695476

  18. Systematic prioritization and integrative analysis of copy number variations in schizophrenia reveal key schizophrenia susceptibility genes.

    PubMed

    Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin

    2014-11-01

    Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and

  19. Integrative analysis of copy number and transcriptional expression profiles in esophageal cancer to identify a novel driver gene for therapy

    PubMed Central

    Dong, Gaochao; Mao, Qixing; Yu, Decai; Zhang, Yi; Qiu, Mantang; Dong, Gaoyue; Chen, Qiang; Xia, Wenjie; Wang, Jie; Xu, Lin; Jiang, Feng

    2017-01-01

    An increasing amount of evidence has highlighted the critical roles that copy number variants play in cancer progression. Here, we systematically analyzed the copy number alterations and differentially transcribed genes. Integrative analysis of the association between copy number variants and differential gene expression suggested that copy number variants will lead to aberrant expression of the corresponding genes. We performed a KEGG pathway and GO analysis, which revealed that cell cycle may have an effective role in the progression of esophageal cancer. FAM60A was then screened out as a potential prognostic factor through survival analysis and correlation analysis with clinical-pathological parameters. We subsequently showed that silencing of FAM60A could inhibit esophageal carcinoma tumor cell growth, migration and invasion in vitro. Through the bioinformatic analysis, we predict that FAM60A may act as a transcriptional factor to regulate genes that are correlated with each cell cycle. In summary, we comprehensively analyzed copy number segments and transcriptional expression profiles, which provided a novel approach to identify clinical biomarkers and therapeutic targets of esophageal carcinoma. PMID:28169357

  20. Single Event Transients in Linear Integrated Circuits

    NASA Technical Reports Server (NTRS)

    Buchner, Stephen; McMorrow, Dale

    2005-01-01

    On November 5, 2001, a processor reset occurred on board the Microwave Anisotropy Probe (MAP), a NASA mission to measure the anisotropy of the microwave radiation left over from the Big Bang. The reset caused the spacecraft to enter a safehold mode from which it took several days to recover. Were that to happen regularly, the entire mission would be compromised, so it was important to find the cause of the reset and, if possible, to mitigate it. NASA assembled a team of engineers that included experts in radiation effects to tackle the problem. The first clue was the observation that the processor reset occurred during a solar event characterized by large increases in the proton and heavy ion fluxes emitted by the sun. To the radiation effects engineers on the team, this strongly suggested that particle radiation might be the culprit, particularly when it was discovered that the reset circuit contained three voltage comparators (LM139). Previous testing revealed that large voltage transients, or glitches appeared at the output of the LM139 when it was exposed to a beam of heavy ions [NI96]. The function of the reset circuit was to monitor the supply voltage and to issue a reset command to the processor should the voltage fall below a reference of 2.5 V [PO02]. Eventually, the team of engineers concluded that ionizing particle radiation from the solar event produced a negative voltage transient on the output of one of the LM139s sufficiently large to reset the processor on MAP. Fortunately, as of the end of 2004, only two such resets have occurred. The reset on MAP was not the first malfunction on a spacecraft attributed to a transient. That occurred shortly after the launch of NASA s TOPEX/Poseidon satellite in 1992. It was suspected, and later confirmed, that an anomaly in the Earth Sensor was caused by a transient in an operational amplifier (OP-15) [KO93]. Over the next few years, problems on TDRS, CASSINI, [PR02] SOHO [HA99,HA01] and TERRA were also attributed

  1. Integration of DNA Copy Number Alterations and Transcriptional Expression Analysis in Human Gastric Cancer

    PubMed Central

    Coral, Ho; Yuen, Siu Tsan; Chu, Kent Man; Law, Simon; Zhang, Lianhai; Ji, Jiafu; Leung, Suet Yi; Chen, Xin

    2012-01-01

    Background Genomic instability with frequent DNA copy number alterations is one of the key hallmarks of carcinogenesis. The chromosomal regions with frequent DNA copy number gain and loss in human gastric cancer are still poorly defined. It remains unknown how the DNA copy number variations contributes to the changes of gene expression profiles, especially on the global level. Principal Findings We analyzed DNA copy number alterations in 64 human gastric cancer samples and 8 gastric cancer cell lines using bacterial artificial chromosome (BAC) arrays based comparative genomic hybridization (aCGH). Statistical analysis was applied to correlate previously published gene expression data obtained from cDNA microarrays with corresponding DNA copy number variation data to identify candidate oncogenes and tumor suppressor genes. We found that gastric cancer samples showed recurrent DNA copy number variations, including gains at 5p, 8q, 20p, 20q, and losses at 4q, 9p, 18q, 21q. The most frequent regions of amplification were 20q12 (7/72), 20q12–20q13.1 (12/72), 20q13.1–20q13.2 (11/72) and 20q13.2–20q13.3 (6/72). The most frequent deleted region was 9p21 (8/72). Correlating gene expression array data with aCGH identified 321 candidate oncogenes, which were overexpressed and showed frequent DNA copy number gains; and 12 candidate tumor suppressor genes which were down-regulated and showed frequent DNA copy number losses in human gastric cancers. Three networks of significantly expressed genes in gastric cancer samples were identified by ingenuity pathway analysis. Conclusions This study provides insight into DNA copy number variations and their contribution to altered gene expression profiles during human gastric cancer development. It provides novel candidate driver oncogenes or tumor suppressor genes for human gastric cancer, useful pathway maps for the future understanding of the molecular pathogenesis of this malignancy, and the construction of new therapeutic

  2. Integrated Analysis of Genome-Wide Copy Number Alterations and Gene Expression Profiling of Lung Cancer in Xuanwei, China

    PubMed Central

    Zhang, Yanliang; Xue, Qiuyue; Pan, Guoqing; Meng, Qing H.; Tuo, Xiaoyu; Cai, Xuemei; Chen, Zhenghui; Li, Ya; Huang, Tao; Duan, Xincen; Duan, Yong

    2017-01-01

    Objectives Lung cancer in Xuanwei (LCXW), China, is known throughout the world for its distinctive characteristics, but little is known about its pathogenesis. The purpose of this study was to screen potential novel “driver genes” in LCXW. Methods Genome-wide DNA copy number alterations (CNAs) were detected by array-based comparative genomic hybridization and differentially expressed genes (DEGs) by gene expression microarrays in 8 paired LCXW and non-cancerous lung tissues. Candidate driver genes were screened by integrated analysis of CNAs and DEGs. The candidate genes were further validated by real-time quantitative polymerase chain reaction. Results Large numbers of CNAs and DEGs were detected, respectively. Some of the most frequently occurring CNAs included gains at 5p15.33-p15.32, 5p15.1-p14.3, and 5p14.3-p14.2 and losses at 11q24.3, 21q21.1, 21q22.12-q22.13, and 21q22.2. Integrated analysis of CNAs and DEGs identified 24 candidate genes with frequent copy number gains and concordant upregulation, which were considered potential oncogenes, including CREB3L4, TRIP13, and CCNE2. In addition, the analysis identified 19 candidate genes with a negative association between copy number change and expression change, considered potential tumor suppressor genes, including AHRR, NKD2, and KLF10. One of the most studied oncogenes, MYC, may not play a carcinogenic role in LCXW. Conclusions This integrated analysis of CNAs and DEGs identified several potential novel LCXW-related genes, laying an important foundation for further research on the pathogenesis of LCXW and identification of novel biomarkers or therapeutic targets. PMID:28056099

  3. [R1 and R2 retrotransposons of German cockroach Blattella germanica: comparative analysis of 5' truncated copies integrated into genome].

    PubMed

    Kagramanova, A S; Kapelinskaia, T V; Korolev, A L; Mukha, D V

    2007-01-01

    This is the first report providing results on identification, cloning, and sequencing of extended fragments (5'-truncated copies) of R1 and R2 retrotransposons integrated into Blattella germanica genome. Comparative structural analysis of the received clones revealed two distinct subfamilies of R1 elements. However, all B. germanica R1 clones have two common features: poly(T) tails and similar target site duplications. Nucleotide structure and organization of five sequenced R2 fragments was similar. Analysis of R2 nucleotide sequences revealed typical deletions at the 3'end of target sites and lack of homopolynucleotides tails.

  4. The Influence of Sourcing and Relatedness on Event Integration

    ERIC Educational Resources Information Center

    Kim, Hyun-Jeong Joyce; Millis, Keith

    2006-01-01

    This study investigated the influence of sourcing and relatedness on the integration of events embedded in simple stories. Participants read pairs of "breaking news stories" from either 1 or 2 news agencies that were believed to be from the Internet. The stories within each pair were either related by virtue of shared situational dimensions (e.g.,…

  5. Integration of copy number and transcriptomics provides risk stratification in prostate cancer: A discovery and validation cohort study

    PubMed Central

    Ross-Adams, H.; Lamb, A.D.; Dunning, M.J.; Halim, S.; Lindberg, J.; Massie, C.M.; Egevad, L.A.; Russell, R.; Ramos-Montoya, A.; Vowler, S.L.; Sharma, N.L.; Kay, J.; Whitaker, H.; Clark, J.; Hurst, R.; Gnanapragasam, V.J.; Shah, N.C.; Warren, A.Y.; Cooper, C.S.; Lynch, A.G.; Stark, R.; Mills, I.G.; Grönberg, H.; Neal, D.E.

    2015-01-01

    Background Understanding the heterogeneous genotypes and phenotypes of prostate cancer is fundamental to improving the way we treat this disease. As yet, there are no validated descriptions of prostate cancer subgroups derived from integrated genomics linked with clinical outcome. Methods In a study of 482 tumour, benign and germline samples from 259 men with primary prostate cancer, we used integrative analysis of copy number alterations (CNA) and array transcriptomics to identify genomic loci that affect expression levels of mRNA in an expression quantitative trait loci (eQTL) approach, to stratify patients into subgroups that we then associated with future clinical behaviour, and compared with either CNA or transcriptomics alone. Findings We identified five separate patient subgroups with distinct genomic alterations and expression profiles based on 100 discriminating genes in our separate discovery and validation sets of 125 and 103 men. These subgroups were able to consistently predict biochemical relapse (p = 0.0017 and p = 0.016 respectively) and were further validated in a third cohort with long-term follow-up (p = 0.027). We show the relative contributions of gene expression and copy number data on phenotype, and demonstrate the improved power gained from integrative analyses. We confirm alterations in six genes previously associated with prostate cancer (MAP3K7, MELK, RCBTB2, ELAC2, TPD52, ZBTB4), and also identify 94 genes not previously linked to prostate cancer progression that would not have been detected using either transcript or copy number data alone. We confirm a number of previously published molecular changes associated with high risk disease, including MYC amplification, and NKX3-1, RB1 and PTEN deletions, as well as over-expression of PCA3 and AMACR, and loss of MSMB in tumour tissue. A subset of the 100 genes outperforms established clinical predictors of poor prognosis (PSA, Gleason score), as well as previously published gene

  6. Integrated genomic analyses identify frequent gene fusion events and VHL inactivation in gastrointestinal stromal tumors

    PubMed Central

    Sun, Choong-Hyun; Park, Inho; Lee, Seungmook; Kwon, Jekeun; Do, Ingu; Hong, Min Eui; Van Vrancken, Michael; Lee, Jeeyun; Park, Joon Oh; Cho, Jeonghee; Kim, Kyoung-Mee; Sohn, Tae Sung

    2016-01-01

    Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal tumors of the gastrointestinal tract. We sequenced nine exomes and transcriptomes, and two genomes of GISTs for integrated analyses. We detected 306 somatic variants in nine GISTs and recurrent protein-altering mutations in 29 genes. Transcriptome sequencing revealed 328 gene fusions, and the most frequently involved fusion events were associated with IGF2 fused to several partner genes including CCND1, FUS, and LASP1. We additionally identified three recurrent read-through fusion transcripts: POLA2-CDC42EP2, C8orf42-FBXO25, and STX16-NPEPL1. Notably, we found intragenic deletions in one of three exons of the VHL gene and increased mRNAs of VEGF, PDGF-β, and IGF-1/2 in 56% of GISTs, suggesting a mechanistic link between VHL inactivation and overexpression of hypoxia-inducible factor target genes in the absence of hypoxia. We also identified copy number gain and increased mRNA expression of AMACR, CRIM1, SKP2, and CACNA1E. Mapping of copy number and gene expression results to the KEGG pathways revealed activation of the JAK-STAT pathway in small intestinal GISTs and the MAPK pathway in wild-type GISTs. These observations will allow us to determine the genetic basis of GISTs and will facilitate further investigation to develop new therapeutic options. PMID:25987131

  7. Integrated genomic analyses identify frequent gene fusion events and VHL inactivation in gastrointestinal stromal tumors.

    PubMed

    Kang, Guhyun; Yun, Hongseok; Sun, Choong-Hyun; Park, Inho; Lee, Seungmook; Kwon, Jekeun; Do, Ingu; Hong, Min Eui; Van Vrancken, Michael; Lee, Jeeyun; Park, Joon Oh; Cho, Jeonghee; Kim, Kyoung-Mee; Sohn, Tae Sung

    2016-02-09

    Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal tumors of the gastrointestinal tract. We sequenced nine exomes and transcriptomes, and two genomes of GISTs for integrated analyses. We detected 306 somatic variants in nine GISTs and recurrent protein-altering mutations in 29 genes. Transcriptome sequencing revealed 328 gene fusions, and the most frequently involved fusion events were associated with IGF2 fused to several partner genes including CCND1, FUS, and LASP1. We additionally identified three recurrent read-through fusion transcripts: POLA2-CDC42EP2, C8orf42-FBXO25, and STX16-NPEPL1. Notably, we found intragenic deletions in one of three exons of the VHL gene and increased mRNAs of VEGF, PDGF-β, and IGF-1/2 in 56% of GISTs, suggesting a mechanistic link between VHL inactivation and overexpression of hypoxia-inducible factor target genes in the absence of hypoxia. We also identified copy number gain and increased mRNA expression of AMACR, CRIM1, SKP2, and CACNA1E. Mapping of copy number and gene expression results to the KEGG pathways revealed activation of the JAK-STAT pathway in small intestinal GISTs and the MAPK pathway in wild-type GISTs. These observations will allow us to determine the genetic basis of GISTs and will facilitate further investigation to develop new therapeutic options.

  8. Seventeen copies of the human 37 kDa laminin receptor precursor/p40 ribosome-associated protein gene are processed pseudogenes arisen from retropositional events.

    PubMed

    Jackers, P; Clausse, N; Fernandez, M; Berti, A; Princen, F; Wewer, U; Sobel, M E; Castronovo, V

    1996-02-07

    A cDNA coding for a 37 kDa polypeptide has been identified in several species as both the potential precursor of the 67 kDa laminin receptor (37LRP) and a putative ribosome-associated protein (p40). Interestingly, increased expression of this polypeptide (37LRP/p40) is consistently observed in invasive and metastatic cancer cells and is associated with poor prognosis. Southern-blot analysis of human genomic DNA predicted multiple copies of the 37LRP/p40 gene. In this study, we report that the number of copies of this sequence in the human genome is 26 +/- 2. We have sequenced and analyzed 19 genomic clones corresponding to the 37LRP/p40 gene and found that they were all processed pseudogenes. They all lack intronic sequences and show multiple genetic alterations leading in some cases to the appearance of stop codons. Moreover, they all bear characteristic features of retroposons as the presence of a poly(A)-tail at their 3' end and short direct repeated flanking DNA sequences. None of the pseudogenes analyzed present cis-elements in their 5' flanking region such as TATA or GC boxes. Our date reveal that over 50% of the 37LRP/p40 gene copies are pseudogenes most probably generated by retropositional events. The finding of multiple pseudogenes for the 37LRP/p40 suggests that the accumulation of several copies of this gene might have given a survival advantage to the cell in the course of evolution.

  9. Impact of copy number variations burden on coding genome in humans using integrated high resolution arrays.

    PubMed

    Veerappa, Avinash M; Lingaiah, Kusuma; Vishweswaraiah, Sangeetha; Murthy, Megha N; Suresh, Raviraj V; Manjegowda, Dinesh S; Ramachandra, Nallur B

    2014-12-16

    Copy number variations (CNVs) alter the transcriptional and translational levels of genes by disrupting the coding structure and this burden of CNVs seems to be a significant contributor to phenotypic variations. Therefore it was necessary to assess the complexities of CNV burden on the coding genome. A total of 1715 individuals from 12 populations were used for CNV analysis in the present investigation. Analysis was performed using Affymetrix Genome-Wide Human SNP Array 6·0 chip and CytoScan High-Density arrays. CNVs were more frequently observed in the coding region than in the non-coding region. CNVs were observed vastly more frequently in the coding region than the non-coding region. CNVs were found to be enriched in the regions containing functional genes (83-96%) compared with the regions containing pseudogenes (4-17%). CNVs across the genome of an individual showed multiple hits across many genes, whose proteins interact physically and function under the same pathway. We identified varying numbers of proteins and degrees of interactions within protein complexes of single individual genomes. This study represents the first draft of a population-specific CNV genes map as well as a cross-populational map. The complex relationship of CNVs on genes and their physically interacting partners unravels many complexities involved in phenotype expression. This study identifies four mechanisms contributing to the complexities caused by the presence of multiple CNVs across many genes in the coding part of the genome.

  10. [Length polymorphism of integrated copies of R1 and R2 retrotransposons in the German cockroach (Blattella germanica) as a potential marker for population and phylogenetic studies].

    PubMed

    Kagramanova, A S; Korolev, A L; Schal, C; Mukha, D V

    2006-04-01

    Using polymerase chain reaction technique with primers flanking target sites of retrotransposons R1 and R2, integrated copies of these transposable elements were amplified in various cockroach species (Blattodea). It was shown that each species has a unique pattern of "5'-undertranscripts" with the definite set of amplified fragments of different lengths. Intraspecies polymorphism was revealed in analysis of German cockroach specimens obtained upon individual mating. This is the first report providing results of identifying, cloning, and sequencing extended fragments (5'-truncated copies) of Blatella germanica R1 and R2 retrotransposons. It may be assumed that patterns of 5'-truncated copies of R1 and R2 elements can be used as markers in population and phylogenetic studies. Moreover, cloned and sequenced fragments will be employed in our further studies for screening of the German cockroach genomic library in order to detect full-length copies in this class transposable elements.

  11. Multiple proviral integration events after virological synapse-mediated HIV-1 spread

    SciTech Connect

    Russell, Rebecca A.; Martin, Nicola; Mitar, Ivonne; Jones, Emma; Sattentau, Quentin J.

    2013-08-15

    HIV-1 can move directly between T cells via virological synapses (VS). Although aspects of the molecular and cellular mechanisms underlying this mode of spread have been elucidated, the outcomes for infection of the target cell remain incompletely understood. We set out to determine whether HIV-1 transfer via VS results in productive, high-multiplicity HIV-1 infection. We found that HIV-1 cell-to-cell spread resulted in nuclear import of multiple proviruses into target cells as seen by fluorescence in-situ hybridization. Proviral integration into the target cell genome was significantly higher than that seen in a cell-free infection system, and consequent de novo viral DNA and RNA production in the target cell detected by quantitative PCR increased over time. Our data show efficient proviral integration across VS, implying the probability of multiple integration events in target cells that drive productive T cell infection. - Highlights: • Cell-to-cell HIV-1 infection delivers multiple vRNA copies to the target cell. • Cell-to-cell infection results in productive infection of the target cell. • Cell-to-cell transmission is more efficient than cell-free HIV-1 infection. • Suggests a mechanism for recombination in cells infected with multiple viral genomes.

  12. A highly efficient single-step, markerless strategy for multi-copy chromosomal integration of large biochemical pathways in Saccharomyces cerevisiae.

    PubMed

    Shi, Shuobo; Liang, Youyun; Zhang, Mingzi M; Ang, Ee Lui; Zhao, Huimin

    2016-01-01

    Despite recent advances in genome editing capabilities for the model organism Saccharomyces cerevisiae, the chromosomal integration of large biochemical pathways for stable industrial production remains challenging. In this work, we developed a simple platform for high-efficiency, single-step, markerless, multi-copy chromosomal integration of full biochemical pathways in Saccharomyces cerevisiae. In this Di-CRISPR (delta integration CRISPR-Cas) platform based on the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated systems (Cas), we specifically designed guide RNA sequences to target multiple delta sites in the yeast genome. The generation of double stranded breaks at the delta sites allowed simultaneous integration of multiple copies of linearized donor DNA containing large biochemical pathways. With our newly developed Di-CRISPR platform, we were able to attain highly efficient and markerless integration of large biochemical pathways and achieve an unprecedented 18-copy genomic integration of a 24 kb combined xylose utilization and (R,R)-2,3-butanediol (BDO) production pathway in a single step, thus generating a strain that was able to produce BDO directly from xylose. The simplicity and high efficiency of the Di-CRISPR platform could provide a superior alternative to high copy plasmids and would render this platform an invaluable tool for genome editing and metabolic engineering in S. cerevisiae.

  13. Modeling of single-event upset in bipolar integrated circuits

    NASA Technical Reports Server (NTRS)

    Zoutendyk, J. A.

    1983-01-01

    The results of work done on the quantitative characterization of single-event upset (SEU) in bipolar random-access memories (RAMs) have been obtained through computer simulation of SEU in RAM cells that contain circuit models for bipolar transistors. The models include current generators that emulate the charge collected from ion tracks. The computer simulation results are compared with test data obtained from a RAM in a bipolar microprocessor chip. This methodology is applicable to other bipolar integrated circuit constructions in addition to RAM cells.

  14. Integrative analysis of DNA copy number, DNA methylation and gene expression in multiple myeloma reveals alterations related to relapse

    PubMed Central

    Krzeminski, Patryk; Corchete, Luis A.; García, Juan L.; López-Corral, Lucía; Fermiñán, Encarna; García, Eva M.; Martín, Ana A.; Hernández-Rivas, Jesús M.; García-Sanz, Ramón; Miguel, Jesús F. San; Gutiérrez, Norma C.

    2016-01-01

    Multiple myeloma (MM) remains incurable despite the introduction of novel agents, and a relapsing course is observed in most patients. Although the development of genomic technologies has greatly improved our understanding of MM pathogenesis, the mechanisms underlying relapse have been less thoroughly investigated. In this study, an integrative analysis of DNA copy number, DNA methylation and gene expression was conducted in matched diagnosis and relapse samples from MM patients. Overall, the acquisition of abnormalities at relapse was much more frequent than the loss of lesions present at diagnosis, and DNA losses were significantly more frequent in relapse than in diagnosis samples. Interestingly, copy number abnormalities involving more than 100 Mb of DNA at relapse significantly affect the gene expression of these samples, provoking a particular deregulation of the IL-8 pathway. On the other hand, no significant modifications of gene expression were observed in those samples with less than 100 Mb affected by chromosomal changes. Although several statistical approaches were used to identify genes whose abnormal expression at relapse was regulated by methylation, only two genes that were significantly deregulated in relapse samples (SORL1 and GLT1D1) showed a negative correlation between methylation and expression. Further analysis revealed that DNA methylation was involved in regulating SORL1 expression in MM. Finally, relevant changes in gene expression observed in relapse samples, such us downregulation of CD27 and P2RY8, were most likely not preceded by alterations in the corresponding DNA. Taken together, these results suggest that the genomic heterogeneity described at diagnosis remains at relapse. PMID:27811368

  15. Integrative analysis of DNA copy number, DNA methylation and gene expression in multiple myeloma reveals alterations related to relapse.

    PubMed

    Krzeminski, Patryk; Corchete, Luis A; García, Juan L; López-Corral, Lucía; Fermiñán, Encarna; García, Eva M; Martín, Ana A; Hernández-Rivas, Jesús M; García-Sanz, Ramón; San Miguel, Jesús F; Gutiérrez, Norma C

    2016-12-06

    Multiple myeloma (MM) remains incurable despite the introduction of novel agents, and a relapsing course is observed in most patients. Although the development of genomic technologies has greatly improved our understanding of MM pathogenesis, the mechanisms underlying relapse have been less thoroughly investigated. In this study, an integrative analysis of DNA copy number, DNA methylation and gene expression was conducted in matched diagnosis and relapse samples from MM patients. Overall, the acquisition of abnormalities at relapse was much more frequent than the loss of lesions present at diagnosis, and DNA losses were significantly more frequent in relapse than in diagnosis samples. Interestingly, copy number abnormalities involving more than 100 Mb of DNA at relapse significantly affect the gene expression of these samples, provoking a particular deregulation of the IL-8 pathway. On the other hand, no significant modifications of gene expression were observed in those samples with less than 100 Mb affected by chromosomal changes. Although several statistical approaches were used to identify genes whose abnormal expression at relapse was regulated by methylation, only two genes that were significantly deregulated in relapse samples (SORL1 and GLT1D1) showed a negative correlation between methylation and expression. Further analysis revealed that DNA methylation was involved in regulating SORL1 expression in MM. Finally, relevant changes in gene expression observed in relapse samples, such us downregulation of CD27 and P2RY8, were most likely not preceded by alterations in the corresponding DNA. Taken together, these results suggest that the genomic heterogeneity described at diagnosis remains at relapse.

  16. CLIPS, AppleEvents, and AppleScript: Integrating CLIPS with commercial software

    NASA Technical Reports Server (NTRS)

    Compton, Michael M.; Wolfe, Shawn R.

    1994-01-01

    Many of today's intelligent systems are comprised of several modules, perhaps written in different tools and languages, that together help solve the user's problem. These systems often employ a knowledge-based component that is not accessed directly by the user, but instead operates 'in the background' offering assistance to the user as necessary. In these types of modular systems, an efficient, flexible, and eady-to-use mechanism for sharing data between programs is crucial. To help permit transparent integration of CLIPS with other Macintosh applications, the AI Research Branch at NASA Ames Research Center has extended CLIPS to allow it to communicate transparently with other applications through two popular data-sharing mechanisms provided by the Macintosh operating system: Apple Events (a 'high-level' event mechanism for program-to-program communication), and AppleScript, a recently-released scripting language for the Macintosh. This capability permits other applications (running on either the same or a remote machine) to send a command to CLIPS, which then responds as if the command were typed into the CLIPS dialog window. Any result returned by the command is then automatically returned to the program that sent it. Likewise, CLIPS can send several types of Apple Events directly to other local or remote applications. This CLIPS system has been successfully integrated with a variety of commercial applications, including data collection programs, electronics forms packages, DBMS's, and email programs. These mechanisms can permit transparent user access to the knowledge base from within a commercial application, and allow a single copy of the knowledge base to service multiple users in a networked environment.

  17. The COG and COPI complexes interact to control the abundance of GEARs, a subset of Golgi integral membrane proteins.

    PubMed

    Oka, Toshihiko; Ungar, Daniel; Hughson, Frederick M; Krieger, Monty

    2004-05-01

    The conserved oligomeric Golgi (COG) complex is a soluble hetero-octamer associated with the cytoplasmic surface of the Golgi. Mammalian somatic cell mutants lacking the Cog1 (ldlB) or Cog2 (ldlC) subunits exhibit pleiotropic defects in Golgi-associated glycoprotein and glycolipid processing that suggest COG is involved in the localization, transport, and/or function of multiple Golgi processing proteins. We have identified a set of COG-sensitive, integral membrane Golgi proteins called GEARs (mannosidase II, GOS-28, GS15, GPP130, CASP, giantin, and golgin-84) whose abundances were reduced in the mutant cells and, in some cases, increased in COG-overexpressing cells. In the mutants, some GEARs were abnormally localized in the endoplasmic reticulum and were degraded by proteasomes. The distributions of the GEARs were altered by small interfering RNA depletion of epsilon-COP in wild-type cells under conditions in which COG-insensitive proteins were unaffected. Furthermore, synthetic phenotypes arose in mutants deficient in both epsilon-COP and either Cog1 or Cog2. COG and COPI may work in concert to ensure the proper retention or retrieval of a subset of proteins in the Golgi, and COG helps prevent the endoplasmic reticulum accumulation and degradation of some GEARs.

  18. Chopping Copy.

    ERIC Educational Resources Information Center

    Bush, Don

    1994-01-01

    Discusses ways an editor can cut out words to help the reader understand quickly. Discusses dead wood, redundancy, redundancy in thought, smothered verbs, false precision, editing and academia, and making copy smoother. (SR)

  19. Additional copies of the proteolipid protein gene causing Pelizaeus-Merzbacher disease arise by separate integration into the X chromosome.

    PubMed

    Hodes, M E; Woodward, K; Spinner, N B; Emanuel, B S; Enrico-Simon, A; Kamholz, J; Stambolian, D; Zackai, E H; Pratt, V M; Thomas, I T; Crandall, K; Dlouhy, S R; Malcolm, S

    2000-07-01

    The proteolipid protein gene (PLP) is normally present at chromosome Xq22. Mutations and duplications of this gene are associated with Pelizaeus-Merzbacher disease (PMD). Here we describe two new families in which males affected with PMD were found to have a copy of PLP on the short arm of the X chromosome, in addition to a normal copy on Xq22. In the first family, the extra copy was first detected by the presence of heterozygosity of the AhaII dimorphism within the PLP gene. The results of FISH analysis showed an additional copy of PLP in Xp22.1, although no chromosomal rearrangements could be detected by standard karyotype analysis. Another three affected males from the family had similar findings. In a second unrelated family with signs of PMD, cytogenetic analysis showed a pericentric inversion of the X chromosome. In the inv(X) carried by several affected family members, FISH showed PLP signals at Xp11.4 and Xq22. A third family has previously been reported, in which affected members had an extra copy of the PLP gene detected at Xq26 in a chromosome with an otherwise normal banding pattern. The identification of three separate families in which PLP is duplicated at a noncontiguous site suggests that such duplications could be a relatively common but previously undetected cause of genetic disorders.

  20. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    PubMed

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  1. Integrated DNA methylation and copy-number profiling identify three clinically and biologically relevant groups of anaplastic glioma.

    PubMed

    Wiestler, Benedikt; Capper, David; Sill, Martin; Jones, David T W; Hovestadt, Volker; Sturm, Dominik; Koelsche, Christian; Bertoni, Anna; Schweizer, Leonille; Korshunov, Andrey; Weiß, Elisa K; Schliesser, Maximilian G; Radbruch, Alexander; Herold-Mende, Christel; Roth, Patrick; Unterberg, Andreas; Hartmann, Christian; Pietsch, Torsten; Reifenberger, Guido; Lichter, Peter; Radlwimmer, Bernhard; Platten, Michael; Pfister, Stefan M; von Deimling, Andreas; Weller, Michael; Wick, Wolfgang

    2014-10-01

    The outcome of patients with anaplastic gliomas varies considerably. Whether a molecular classification of anaplastic gliomas based on large-scale genomic or epigenomic analyses is superior to histopathology for reflecting distinct biological groups, predicting outcomes and guiding therapy decisions has yet to be determined. Epigenome-wide DNA methylation analysis, using a platform which also allows the detection of copy-number aberrations, was performed in a cohort of 228 patients with anaplastic gliomas (astrocytomas, oligoastrocytomas, and oligodendrogliomas), including 115 patients of the NOA-04 trial. We further compared these tumors with a group of 55 glioblastomas. Unsupervised clustering of DNA methylation patterns revealed two main groups correlated with IDH status: CpG island methylator phenotype (CIMP) positive (77.5 %) or negative (22.5 %). CIMP(pos) (IDH mutant) tumors showed a further separation based on copy-number status of chromosome arms 1p and 19q. CIMP(neg) (IDH wild type) tumors showed hallmark copy-number alterations of glioblastomas, and clustered together with CIMP(neg) glioblastomas without forming separate groups based on WHO grade. Notably, there was no molecular evidence for a distinct biological entity representing anaplastic oligoastrocytoma. Tumor classification based on CIMP and 1p/19q status was significantly associated with survival, allowing a better prediction of outcome than the current histopathological classification: patients with CIMP(pos) tumors with 1p/19q codeletion (CIMP-codel) had the best prognosis, followed by patients with CIMP(pos) tumors but intact 1p/19q status (CIMP-non-codel). Patients with CIMP(neg) anaplastic gliomas (GBM-like) had the worst prognosis. Collectively, our data suggest that anaplastic gliomas can be grouped by IDH and 1p/19q status into three molecular groups that show clear links to underlying biology and a significant association with clinical outcome in a prospective trial cohort.

  2. Integrated Seismic Event Detection and Location by Advanced Array Processing

    SciTech Connect

    Kvaerna, T; Gibbons, S J; Ringdal, F; Harris, D B

    2007-02-09

    The principal objective of this two-year study is to develop and test a new advanced, automatic approach to seismic detection/location using array processing. We address a strategy to obtain significantly improved precision in the location of low-magnitude events compared with current fully-automatic approaches, combined with a low false alarm rate. We have developed and evaluated a prototype automatic system which uses as a basis regional array processing with fixed, carefully calibrated, site-specific parameters in conjuction with improved automatic phase onset time estimation. We have in parallel developed tools for Matched Field Processing for optimized detection and source-region identification of seismic signals. This narrow-band procedure aims to mitigate some of the causes of difficulty encountered using the standard array processing system, specifically complicated source-time histories of seismic events and shortcomings in the plane-wave approximation for seismic phase arrivals at regional arrays.

  3. Indico central - events organisation, ergonomics and collaboration tools integration

    NASA Astrophysics Data System (ADS)

    Benito Gonzélez López, José; Ferreira, José Pedro; Baron, Thomas

    2010-04-01

    While the remote collaboration services at CERN slowly aggregate around the Indico event management software, its new version which is the result of a careful maturation process includes improvements which will set a new reference in its domain. The presentation will focus on the description of the new features of the tool, the user feedback process which resulted in a new record of usability. We will also describe the interactions with the worldwide community of users and server administrators and the impact this has had on our development process, as well as the tools set in place to streamline the work between the different collaborating sites. A last part will be dedicated to the use of Indico as a central hub for operating other local services around the event organisation (registration epayment, audiovisual recording, webcast, room booking, and videoconference support)

  4. Correlations of scores on the developmental test of visual-motor integration and copying test in a South African multi-ethnic preschool sample.

    PubMed

    Dunn, Munita; Loxton, Helene; Naidoo, Anthony

    2006-12-01

    This study assessed the intercorrelations of scores on the Developmental Test of Visual-Motor Integration, the locally standardized Copying Test, and teachers' ratings of scholastic skills in a South African multi-ethnic preschool sample. The study also investigated whether cultural and socioeconomic factors might influence test data. Participants were 71 Black, 101 Coloured, and 66 White children attending preschools in a semirural district. Participants' ages ranged from 4 yr., 9 mo. to 7yr., 0 mo. (M=5.8 yr., SD= 0.3 yr.). Analysis yielded a correlation of .75 between the test scores and supports the suitability of the widely used Developmental Test of Visual-Motor Integration in a multi-ethnic sample. Scores on the Copying Test correlated higher with teachers' ratings. However, significant differences in test performance among groups by race and socioeconomic status suggest the rate of perceptual-motor development may be related to cultural factors. Normative data are reported for groups by race and socioeconomic status.

  5. Understanding Oceanic Anoxic Events: An Integrated Geochemical Approach

    NASA Astrophysics Data System (ADS)

    Cohen, A. S.; Coe, A. L.; Kemp, D. B.; Pearce, C. R.

    2007-12-01

    Discrete intervals of widespread organic carbon accumulation, termed Oceanic Anoxic Events (OAEs), occurred at a few relatively brief intervals during the Mesozoic. Recent studies have shown that these events took place at the same time as other substantial environmental changes that included global warming, ocean acidification, and unusually high levels of species extinctions. However, many factors relating to the behaviour of the Earth System during OAEs remain unclear. These include: The primary driving mechanism(s) - was there one common mechanism or were OAEs the result of different processes; the spatial and temporal extent of seawater anoxia during OAEs; the precise effects on marine and terrestrial biota; variations in atmospheric CO2 and global temperature; and the mechanism and timescale of Earth's recovery process. The records of environmental change during OAEs are best preserved in marine deposits, with continental shelf sections being particularly well studied. The combined use of geochemical, sedimentological and palaeontological observations indicates a complex interplay of factors. Significant advances in our understanding of OAEs have taken place in the last decade or so using new geochemical and isotopic proxies and a high- resolution, multidisciplinary approach. For example, Sr- and Os-isotope data indicate that rates of chemical weathering increased markedly during the Toarcian (Early Jurassic) OAE, whilst Mo-isotope data suggest that the areal extent of seawater anoxia fluctuated during the OAE despite the persistence of euxinic conditions in some regions. The pattern of Mo-isotope data for the Toarcian contrasts strongly with new Mo-isotope results from the Kimmeridge Clay Formation (Late Jurassic), when anoxic conditions were confined to European epicontinental seas and were likely to have resulted from very different primary causes. Cyclostratigraphic analysis has been used to provide a temporal framework for the timescale of OAEs at sub

  6. Integrating event detection system operation characteristics into sensor placement optimization.

    SciTech Connect

    Hart, William Eugene; McKenna, Sean Andrew; Phillips, Cynthia Ann; Murray, Regan Elizabeth; Hart, David Blaine

    2010-05-01

    We consider the problem of placing sensors in a municipal water network when we can choose both the location of sensors and the sensitivity and specificity of the contamination warning system. Sensor stations in a municipal water distribution network continuously send sensor output information to a centralized computing facility, and event detection systems at the control center determine when to signal an anomaly worthy of response. Although most sensor placement research has assumed perfect anomaly detection, signal analysis software has parameters that control the tradeoff between false alarms and false negatives. We describe a nonlinear sensor placement formulation, which we heuristically optimize with a linear approximation that can be solved as a mixed-integer linear program. We report the results of initial experiments on a real network and discuss tradeoffs between early detection of contamination incidents, and control of false alarms.

  7. Competency Based Competitive Events. Integrating DECA into the DE Instructional Program.

    ERIC Educational Resources Information Center

    Cosgrove, Glenna; Moore, Harold W.

    Designed to be integrated into a competency-based distributive education program, these competitive DECA (Distributive Education Clubs of America) events were developed, utilized, and evaluated by distributive education and cooperative education coordinators in Arkansas. These events are organized under the following occupational categories: food…

  8. Integration of mRNA expression profile, copy number alterations, and microRNA expression levels in breast cancer to improve grade definition.

    PubMed

    Cava, Claudia; Bertoli, Gloria; Ripamonti, Marilena; Mauri, Giancarlo; Zoppis, Italo; Della Rosa, Pasquale Anthony; Gilardi, Maria Carla; Castiglioni, Isabella

    2014-01-01

    Defining the aggressiveness and growth rate of a malignant cell population is a key step in the clinical approach to treating tumor disease. The correct grading of breast cancer (BC) is a fundamental part in determining the appropriate treatment. Biological variables can make it difficult to elucidate the mechanisms underlying BC development. To identify potential markers that can be used for BC classification, we analyzed mRNAs expression profiles, gene copy numbers, microRNAs expression and their association with tumor grade in BC microarray-derived datasets. From mRNA expression results, we found that grade 2 BC is most likely a mixture of grade 1 and grade 3 that have been misclassified, being described by the gene signature of either grade 1 or grade 3. We assessed the potential of the new approach of integrating mRNA expression profile, copy number alterations, and microRNA expression levels to select a limited number of genomic BC biomarkers. The combination of mRNA profile analysis and copy number data with microRNA expression levels led to the identification of two gene signatures of 42 and 4 altered genes (FOXM1, KPNA4, H2AFV and DDX19A) respectively, the latter obtained through a meta-analytical procedure. The 42-based gene signature identifies 4 classes of up- or down-regulated microRNAs (17 microRNAs) and of their 17 target mRNA, and the 4-based genes signature identified 4 microRNAs (Hsa-miR-320d, Hsa-miR-139-5p, Hsa-miR-567 and Hsa-let-7c). These results are discussed from a biological point of view with respect to pathological features of BC. Our identified mRNAs and microRNAs were validated as prognostic factors of BC disease progression, and could potentially facilitate the implementation of assays for laboratory validation, due to their reduced number.

  9. Single-Event Upset and Snapback in Silicon-on-Insulator Devices and Integrated Circuits

    SciTech Connect

    DODD,PAUL E.; SHANEYFELT,MARTY R.; WALSH,DAVID S.; SCHWANK,JAMES R.; HASH,GERALD L.; LOEMKER,RHONDA ANN; DRAPER,BRUCE L.; WINOKUR,PETER S.

    2000-08-15

    The characteristics Of ion-induced charge collection and single-event upset are studied in SOI transistors and circuits with various body tie structures. Impact ionization effects including single-event snapback are shown to be very important. Focused ion microbeam experiments are used to find single-event snapback drain voltage thresholds in n-channel SOI transistors as a function of device width. Three-Dimensional device simulations are used to determine single-event upset and snapback thresholds in SOI SRAMS, and to study design tradeoffs for various body-tie structures. A window of vulnerability to single-event snapback is shown to exist below the single-event upset threshold. The presence of single-event snapback in commercial SOI SRAMS is confirmed through broadbeam ion testing, and implications for hardness assurance testing of SOI integrated circuits are discussed.

  10. Conceptual Integration of Arithmetic Operations with Real-World Knowledge: Evidence from Event-Related Potentials

    ERIC Educational Resources Information Center

    Guthormsen, Amy M.; Fisher, Kristie J.; Bassok, Miriam; Osterhout, Lee; DeWolf, Melissa; Holyoak, Keith J.

    2016-01-01

    Research on language processing has shown that the disruption of conceptual integration gives rise to specific patterns of event-related brain potentials (ERPs)--N400 and P600 effects. Here, we report similar ERP effects when adults performed cross-domain conceptual integration of analogous semantic and mathematical relations. In a problem-solving…

  11. Integrated analysis of somatic mutations and focal copy-number changes identifies key genes and pathways in hepatocellular carcinoma

    PubMed Central

    Guichard, Cécile; Amaddeo, Giuliana; Imbeaud, Sandrine; Ladeiro, Yannick; Pelletier, Laura; Maad, Ichrafe Ben; Calderaro, Julien; Bioulac-Sage, Paulette; Letexier, Mélanie; Degos, Françoise; Clément, Bruno; Balabaud, Charles; Chevet, Eric; Laurent, Alexis; Couchy, Gabrielle; Letouzé, Eric; Calvo, Fabien; Zucman-Rossi, Jessica

    2012-01-01

    Hepatocellular carcinoma (HCC) is the most common primary liver malignancy. High-resolution copy number analysis of 125 tumors of which 24 were subjected to whole-exome sequencing identified 135 homozygous deletions and 994 somatic gene mutations with predicted functional consequences. We identified new recurrent alterations in 6 genes (ARID1A, RPS6KA3, NFE2L2, IRF2, CDH8 and PROKR2) not previously described in HCC. Functional analyses demonstrated tumor suppressor properties for IRF2 whose inactivation, exclusively found in hepatitis B virus related tumors, leads to impaired TP53 function. Alternatively, inactivation of proteins involved in chromatin remodeling was frequent and predominant in alcohol related tumors. Moreover, activation of the oxidative stress metabolism and inactivation of RPS6KA3 were new pathways associated with WNT/β-catenin activation, thereby suggesting a cooperative effect in tumorigenesis. This study shows the dramatic somatic genetic diversity in HCC, it reveals interactions between oncogene and tumor suppressor gene mutations markedly related to specific risk factors. PMID:22561517

  12. Integrating optical finger motion tracking with surface touch events

    PubMed Central

    MacRitchie, Jennifer; McPherson, Andrew P.

    2015-01-01

    This paper presents a method of integrating two contrasting sensor systems for studying human interaction with a mechanical system, using piano performance as the case study. Piano technique requires both precise small-scale motion of fingers on the key surfaces and planned large-scale movement of the hands and arms. Where studies of performance often focus on one of these scales in isolation, this paper investigates the relationship between them. Two sensor systems were installed on an acoustic grand piano: a monocular high-speed camera tracking the position of painted markers on the hands, and capacitive touch sensors attach to the key surfaces which measure the location of finger-key contacts. This paper highlights a method of fusing the data from these systems, including temporal and spatial alignment, segmentation into notes and automatic fingering annotation. Three case studies demonstrate the utility of the multi-sensor data: analysis of finger flexion or extension based on touch and camera marker location, timing analysis of finger-key contact preceding and following key presses, and characterization of individual finger movements in the transitions between successive key presses. Piano performance is the focus of this paper, but the sensor method could equally apply to other fine motor control scenarios, with applications to human-computer interaction. PMID:26082732

  13. Integrating optical finger motion tracking with surface touch events.

    PubMed

    MacRitchie, Jennifer; McPherson, Andrew P

    2015-01-01

    This paper presents a method of integrating two contrasting sensor systems for studying human interaction with a mechanical system, using piano performance as the case study. Piano technique requires both precise small-scale motion of fingers on the key surfaces and planned large-scale movement of the hands and arms. Where studies of performance often focus on one of these scales in isolation, this paper investigates the relationship between them. Two sensor systems were installed on an acoustic grand piano: a monocular high-speed camera tracking the position of painted markers on the hands, and capacitive touch sensors attach to the key surfaces which measure the location of finger-key contacts. This paper highlights a method of fusing the data from these systems, including temporal and spatial alignment, segmentation into notes and automatic fingering annotation. Three case studies demonstrate the utility of the multi-sensor data: analysis of finger flexion or extension based on touch and camera marker location, timing analysis of finger-key contact preceding and following key presses, and characterization of individual finger movements in the transitions between successive key presses. Piano performance is the focus of this paper, but the sensor method could equally apply to other fine motor control scenarios, with applications to human-computer interaction.

  14. The single-event effect evaluation technology for nano integrated circuits

    NASA Astrophysics Data System (ADS)

    Hongchao, Zheng; Yuanfu, Zhao; Suge, Yue; Long, Fan; Shougang, Du; Maoxin, Chen; Chunqing, Yu

    2015-11-01

    Single-event effects of nano scale integrated circuits are investigated. Evaluation methods for single-event transients, single-event upsets, and single-event functional interrupts in nano circuits are summarized and classified in detail. The difficulties in SEE testing are discussed as well as the development direction of test technology, with emphasis placed on the experimental evaluation of a nano circuit under heavy ion, proton, and laser irradiation. The conclusions in this paper are based on many years of testing at accelerator facilities and our present understanding of the mechanisms for SEEs, which have been well verified experimentally.

  15. Human telomeres that carry an integrated copy of human herpesvirus 6 are often short and unstable, facilitating release of the viral genome from the chromosome.

    PubMed

    Huang, Yan; Hidalgo-Bravo, Alberto; Zhang, Enjie; Cotton, Victoria E; Mendez-Bermudez, Aaron; Wig, Gunjan; Medina-Calzada, Zahara; Neumann, Rita; Jeffreys, Alec J; Winney, Bruce; Wilson, James F; Clark, Duncan A; Dyer, Martin J; Royle, Nicola J

    2014-01-01

    Linear chromosomes are stabilized by telomeres, but the presence of short dysfunctional telomeres triggers cellular senescence in human somatic tissues, thus contributing to ageing. Approximately 1% of the population inherits a chromosomally integrated copy of human herpesvirus 6 (CI-HHV-6), but the consequences of integration for the virus and for the telomere with the insertion are unknown. Here we show that the telomere on the distal end of the integrated virus is frequently the shortest measured in somatic cells but not the germline. The telomere carrying the CI-HHV-6 is also prone to truncations that result in the formation of a short telomere at a novel location within the viral genome. We detected extra-chromosomal circular HHV-6 molecules, some surprisingly comprising the entire viral genome with a single fully reconstituted direct repeat region (DR) with both terminal cleavage and packaging elements (PAC1 and PAC2). Truncated CI-HHV-6 and extra-chromosomal circular molecules are likely reciprocal products that arise through excision of a telomere-loop (t-loop) formed within the CI-HHV-6 genome. In summary, we show that the CI-HHV-6 genome disrupts stability of the associated telomere and this facilitates the release of viral sequences as circular molecules, some of which have the potential to become fully functioning viruses.

  16. Expression of a chromosomally integrated, single-copy GFP gene in Candida albicans, and its use as a reporter of gene regulation.

    PubMed

    Morschhäuser, J; Michel, S; Hacker, J

    1998-02-01

    Genetically engineered versions of the GFP gene, which encodes the green fluorescent protein of Aequorea victoria, were placed under the control of the constitutively active Candida albicans ACT1 promoter and integrated in single copy into the genome of this pathogenic yeast. Integrative transformants in which one of the two ACT1 alleles had been replaced by a GFP gene exhibited a homogeneous, constitutive fluorescent phenotype. Cells expressing GFP with the wild-type chromophore exhibited very weak fluorescence compared to those GFP proteins with the S65T or S65A, V68L, S72A (GFPmut2) chromophore mutations. Substitution of the CTG codon, which specifies serine instead of leucine in C. albicans, by TTG was absolutely necessary for GFP expression. Although GFP mRNA levels in cells containing a GFP gene with the CTG codon were comparable to those of transformants containing GFP with the TTG substitution, only the latter produced GFP protein, as detected by Western blotting, suggesting that the frequent failure to express heterologous genes in C. albicans is principally due to the noncanonical codon usage. Transformants expressing the modified GFP gene from the promoter of the SAP2 gene, which encodes one of the secreted acid proteinases of C. albicans, showed fluorescence only under conditions which promote proteinase expression, thereby demonstrating the utility of stable, chromosomally integrated GFP reporter genes for the study of gene activation in C. albicans.

  17. Genomic integration of oncogenic HPV and gain of the human telomerase gene TERC at 3q26 are strongly associated events in the progression of uterine cervical dysplasia to invasive cancer.

    PubMed

    Hopman, A H N; Theelen, W; Hommelberg, P P H; Kamps, M A F; Herrington, C S; Morrison, L E; Speel, E-J M; Smedts, F; Ramaekers, F C S

    2006-12-01

    Recently proposed events associated with the progression of cervical intraepithelial neoplasia (CIN) 2/3 to cervical carcinoma include integration of human papillomavirus (HPV) into the host genome, genomic instability, and an increase in chromosome 3q copy number. In particular, the gene coding for the RNA component of telomerase (TERC) at 3q26 has been implicated as a possible candidate gene. Since it is not known to date how these events are temporally related during cervical carcinogenesis, the aim of the present study was to assess the correlation between TERC gene copy number and the physical status of HPV during progression in cervical neoplasia. Solitary precursor lesions of the uterine cervix (CIN 2/3, n = 17), lesions associated with a micro-invasive carcinoma (CIN 3&mCA, n = 13), and advanced invasive carcinomas (invCA, n = 7) were analysed by fluorescence in situ hybridization (FISH) to determine the physical status of the virus and TERC gene copy number. The TERC gene was increasingly gained with progression of CIN 2/3 (3 of 17) through CIN 3&mCA (7 of 13) to invCA (5 of 7). In the lesions exhibiting gain of TERC, the virus was predominantly integrated. This was seen in eight of ten diploid lesions, indicating that these events can occur prior to aneuploidization and are strongly associated with the progression of CIN 3 to mCA and invCA (p < 0.001). With progression to carcinoma, a number of these lesions show polyploidization, resulting in aneuploidy and high TERC gene copy numbers. In conclusion, genomic integration of oncogenic HPV and gain of the human telomerase gene TERC appear to be important associated genetic events in the progression of uterine cervical dysplasia to invasive cancer.

  18. Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

    PubMed

    Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

    2009-11-25

    Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

  19. Integrative genomics identifies distinct molecular classes of neuroblastoma and shows that multiple genes are targeted by regional alterations in DNA copy number.

    PubMed

    Wang, Qun; Diskin, Sharon; Rappaport, Eric; Attiyeh, Edward; Mosse, Yael; Shue, Daniel; Seiser, Eric; Jagannathan, Jayanti; Shusterman, Suzanne; Bansal, Manisha; Khazi, Deepa; Winter, Cynthia; Okawa, Erin; Grant, Gregory; Cnaan, Avital; Zhao, Huaqing; Cheung, Nai-Kong; Gerald, William; London, Wendy; Matthay, Katherine K; Brodeur, Garrett M; Maris, John M

    2006-06-15

    Neuroblastoma is remarkable for its clinical heterogeneity and is characterized by genomic alterations that are strongly correlated with tumor behavior. The specific genes that influence neuroblastoma biology and are targeted by genomic alterations remain largely unknown. We quantified mRNA expression in a highly annotated series of 101 prospectively collected diagnostic neuroblastoma primary tumors using an oligonucleotide-based microarray. Genomic copy number status at the prognostically relevant loci 1p36, 2p24 (MYCN), 11q23, and 17q23 was determined by PCR and was aberrant in 26, 20, 40, and 38 cases, respectively. In addition, 72 diagnostic neuroblastoma primary tumors assayed in a different laboratory were used as an independent validation set. Unsupervised hierarchical clustering showed that gene expression was highly correlated with genomic alterations and clinical markers of tumor behavior. The vast majority of samples with MYCN amplification and 1p36 loss of heterozygosity (LOH) clustered together on a terminal node of the sample dendrogram, whereas the majority of samples with 11q deletion clustered separately and both of these were largely distinct from the copy number neutral group of tumors. Genes involved in neurodevelopment were broadly overrepresented in the more benign tumors, whereas genes involved in RNA processing and cellular proliferation were highly represented in the most malignant cases. By combining transcriptomic and genomic data, we showed that LOH at 1p and 11q was associated with significantly decreased expression of 122 (61%) and 88 (27%) of the genes mapping to 1p35-36 and all of 11q, respectively, suggesting that multiple genes may be targeted by LOH events. A total of 71 of the 1p35-36 genes were also differentially expressed in the independent validation data set, providing a prioritized list of candidate neuroblastoma suppressor genes. Taken together, these data are consistent with the hypotheses that the neuroblastoma

  20. Asynchronous Periodic Edge-Event Triggered Control for Double-Integrator Networks With Communication Time Delays.

    PubMed

    Duan, Gaopeng; Xiao, Feng; Wang, Long

    2017-01-23

    This paper focuses on the average consensus of double-integrator networked systems based on the asynchronous periodic edge-event triggered control. The asynchronous property lies in the edge event-detecting procedure. For different edges, their event detections are performed at different times and the corresponding events occur independently of each other. When an event is activated, the two adjacent agents connected by the corresponding link sample their relative state information and update their controllers. The application of incidence matrix facilitates the transformation of control objects from the agent-based to the edge-based. Practically, due to the constraints of network bandwidth and communication distance, agents usually cannot receive the instantaneous information of some others, which has an impact on the system performance. Hence, it is necessary to investigate the presence of communication time delays. For double-integrator multiagent systems with and without communication time delays, the average state consensus can be asynchronously achieved by designing appropriate parameters under the proposed event-detecting rules. The presented results specify the relationship among the maximum allowable time delays, interaction topologies, and event-detecting periods. Furthermore, the proposed protocols have the advantages of reduced communication costs and controller-updating costs. Simulation examples are given to illustrate the proposed theoretical results.

  1. Event based self-supervised temporal integration for multimodal sensor data.

    PubMed

    Barakova, Emilia I; Lourens, Tino

    2005-06-01

    A method for synergistic integration of multimodal sensor data is proposed in this paper. This method is based on two aspects of the integration process: (1) achieving synergistic integration of two or more sensory modalities, and (2) fusing the various information streams at particular moments during processing. Inspired by psychophysical experiments, we propose a self-supervised learning method for achieving synergy with combined representations. Evidence from temporal registration and binding experiments indicates that different cues are processed individually at specific time intervals. Therefore, an event-based temporal co-occurrence principle is proposed for the integration process. This integration method was applied to a mobile robot exploring unfamiliar environments. Simulations showed that integration enhanced route recognition with many perceptual similarities; moreover, they indicate that a perceptual hierarchy of knowledge about instant movement contributes significantly to short-term navigation, but that visual perceptions have bigger impact over longer intervals.

  2. 19 CFR 133.42 - Infringing copies or phonorecords.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...) Referral to the U.S. Attorney. In the event that phonorecords or copies of motion pictures arrive in the U... trafficking in counterfeit labels for phonorecords or copies of motion pictures or other audiovisual works...

  3. Non-canonical integration events in Pichia pastoris encountered during standard transformation analysed with genome sequencing

    PubMed Central

    Schwarzhans, Jan-Philipp; Wibberg, Daniel; Winkler, Anika; Luttermann, Tobias; Kalinowski, Jörn; Friehs, Karl

    2016-01-01

    The non-conventional yeast Pichia pastoris is a popular host for recombinant protein production in scientific research and industry. Typically, the expression cassette is integrated into the genome via homologous recombination. Due to unknown integration events, a large clonal variability is often encountered consisting of clones with different productivities as well as aberrant morphological or growth characteristics. In this study, we analysed several clones with abnormal colony morphology and discovered unpredicted integration events via whole genome sequencing. These include (i) the relocation of the locus targeted for replacement to another chromosome (ii) co-integration of DNA from the E. coli plasmid host and (iii) the disruption of untargeted genes affecting colony morphology. Most of these events have not been reported so far in literature and present challenges for genetic engineering approaches in this yeast. Especially, the presence and independent activity of E. coli DNA elements in P. pastoris is of concern. In our study, we provide a deeper insight into these events and their potential origins. Steps preventing or reducing the risk for these phenomena are proposed and will help scientists working on genetic engineering of P. pastoris or similar non-conventional yeast to better understand and control clonal variability. PMID:27958335

  4. Copy number gain of chromosome 3q is a recurrent event in patients with intraductal papillary mucinous neoplasm (IPMN) associated with disease progression

    PubMed Central

    Astolfi, Annalisa; Grassi, Elisa; Casadei, Riccardo; Santini, Donatella; Panzacchi, Riccardo; Ricci, Claudio; Serravalle, Salvatore; Tarantino, Giuseppe; Falconi, Mirella; Teti, Gabriella; Indio, Valentina; Pession, Andrea; Minni, Francesco; Biasco, Guido; Di Marco, Mariacristina

    2016-01-01

    Background Intraductal papillary mucinous neoplasm (IPMN) is the most common cystic preneoplastic lesion of pancreatic cancer. We used an approach coupling high resolution cytogenetic analysis (Affymetrix Oncoscan FFPE Array) with clinically-oriented bioinformatic interpretation of data to understand the most relevant alterations of precursor lesions at different stages to identify new diagnostic markers. Results We identified multiple copy number alterations, particularly in lesions with severe dysplasia, with 7 IPMN with low-intermediate dysplasia carrying a nearly normal karyotype and 13 IPMN with complex Karyotype (> 4 alterations), showing high grade dysplasia. A specific gain of chromosome arm 3q was found in IPMN with complex Karyotype (92%). This gain of 3q is particularly interesting for the presence of oncogenes such as PIK3CA, GATA2 and TERC that are part of pathways that deregulate cell growth and promote disease progression. Quantitative PCR and FISH analysis confirmed the data. Further demonstration of the overexpression of the PIK3CA gene supports the identification of this alteration as a possible biomarker in the early identification of patients with IPMN at higher risk for disease progression. Materials and methods High resolution cytogenetic analysis was performed in 20 formalin fixed paraffin embedded samples of IPMN by Oncoscan FFPE assay. Results were validated by qPCR and FISH analysis. Conclusions The identification of these markers at an early stage of disease onset could help to identify patients at risk for cancer progression and new candidates for a more specific targeted therapy. PMID:27566563

  5. Acquired copy-neutral loss of heterozygosity of chromosome 1p as a molecular event associated with marrow fibrosis in MPL-mutated myeloproliferative neoplasms.

    PubMed

    Rumi, Elisa; Pietra, Daniela; Guglielmelli, Paola; Bordoni, Roberta; Casetti, Ilaria; Milanesi, Chiara; Sant'Antonio, Emanuela; Ferretti, Virginia; Pancrazzi, Alessandro; Rotunno, Giada; Severgnini, Marco; Pietrelli, Alessandro; Astori, Cesare; Fugazza, Elena; Pascutto, Cristiana; Boveri, Emanuela; Passamonti, Francesco; De Bellis, Gianluca; Vannucchi, Alessandro; Cazzola, Mario

    2013-05-23

    We studied mutations of MPL exon 10 in patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF), first investigating a cohort of 892 consecutive patients. MPL mutation scanning was performed on granulocyte genomic DNA by using a high-resolution melt assay, and the mutant allele burden was evaluated by using deep sequencing. Somatic mutations of MPL, all but one involving codon W515, were detected in 26/661 (4%) patients with ET, 10/187 (5%) with PMF, and 7/44 (16%) patients with post-ET myelofibrosis. Comparison of JAK2 (V617F)-mutated and MPL-mutated patients showed only minor phenotypic differences. In an extended group of 62 MPL-mutated patients, the granulocyte mutant allele burden ranged from 1% to 95% and was significantly higher in patients with PMF or post-ET myelofibrosis compared with those with ET. Patients with higher mutation burdens had evidence of acquired copy-neutral loss of heterozygosity (CN-LOH) of chromosome 1p in granulocytes, consistent with a transition from heterozygosity to homozygosity for the MPL mutation in clonal cells. A significant association was found between MPL-mutant allele burden greater than 50% and marrow fibrosis. These observations suggest that acquired CN-LOH of chromosome 1p involving the MPL location may represent a molecular mechanism of fibrotic transformation in MPL-mutated myeloproliferative neoplasms.

  6. Acquired copy-neutral loss of heterozygosity of chromosome 1p as a molecular event associated with marrow fibrosis in MPL-mutated myeloproliferative neoplasms

    PubMed Central

    Pietra, Daniela; Guglielmelli, Paola; Bordoni, Roberta; Casetti, Ilaria; Milanesi, Chiara; Sant’Antonio, Emanuela; Ferretti, Virginia; Pancrazzi, Alessandro; Rotunno, Giada; Severgnini, Marco; Pietrelli, Alessandro; Astori, Cesare; Fugazza, Elena; Pascutto, Cristiana; Boveri, Emanuela; Passamonti, Francesco; De Bellis, Gianluca; Vannucchi, Alessandro; Cazzola, Mario

    2013-01-01

    We studied mutations of MPL exon 10 in patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF), first investigating a cohort of 892 consecutive patients. MPL mutation scanning was performed on granulocyte genomic DNA by using a high-resolution melt assay, and the mutant allele burden was evaluated by using deep sequencing. Somatic mutations of MPL, all but one involving codon W515, were detected in 26/661 (4%) patients with ET, 10/187 (5%) with PMF, and 7/44 (16%) patients with post-ET myelofibrosis. Comparison of JAK2 (V617F)–mutated and MPL-mutated patients showed only minor phenotypic differences. In an extended group of 62 MPL-mutated patients, the granulocyte mutant allele burden ranged from 1% to 95% and was significantly higher in patients with PMF or post-ET myelofibrosis compared with those with ET. Patients with higher mutation burdens had evidence of acquired copy-neutral loss of heterozygosity (CN-LOH) of chromosome 1p in granulocytes, consistent with a transition from heterozygosity to homozygosity for the MPL mutation in clonal cells. A significant association was found between MPL-mutant allele burden greater than 50% and marrow fibrosis. These observations suggest that acquired CN-LOH of chromosome 1p involving the MPL location may represent a molecular mechanism of fibrotic transformation in MPL-mutated myeloproliferative neoplasms. PMID:23575445

  7. Motivation and intention to integrate physical activity into daily school life: the JAM World Record event.

    PubMed

    Vazou, Spyridoula; Vlachopoulos, Symeon P

    2014-11-01

    Research on the motivation of stakeholders to integrate physical activity into daily school life is limited. The purpose was to examine the motivation of stakeholders to participate in a world record physical activity event and whether motivation was associated with future intention to use activity breaks during the daily school life and future participation in a similar event. After the 2012 JAM (Just-a-Minute) World Record event, 686 adults (591 women; 76.1% participated for children <10 years) completed measures of motivational regulations and future intention to (a) use the activity breaks and (b) participate in the event. High intrinsic motivation and low extrinsic motivation and amotivation for participation in the next event were reported. Hierarchical regression analysis, controlling for age, gender, and occupation, showed that intrinsic forms of motivation positively predicted, whereas amotivation negatively predicted, future intention to participate in the event and use the activity breaks. Multivariate analyses of variance revealed that school-related participants were more intrinsically motivated and intended to use the activity breaks and repeat the event more than those who were not affiliated with a school. Nonschool participants reported higher extrinsic motivation and amotivation than school-related participants.

  8. Rare Copy Number Variants

    PubMed Central

    Grozeva, Detelina; Kirov, George; Ivanov, Dobril; Jones, Ian R.; Jones, Lisa; Green, Elaine K.; St Clair, David M.; Young, Allan H.; Ferrier, Nicol; Farmer, Anne E.; McGuffin, Peter; Holmans, Peter A.; Owen, Michael J.; O’Donovan, Michael C.; Craddock, Nick

    2015-01-01

    Context Recent studies suggest that copy number variation in the human genome is extensive and may play an important role in susceptibility to disease, including neuropsychiatric disorders such as schizophrenia and autism. The possible involvement of copy number variants (CNVs) in bipolar disorder has received little attention to date. Objectives To determine whether large (>100 000 base pairs) and rare (found in <1% of the population) CNVs are associated with susceptibility to bipolar disorder and to compare with findings in schizophrenia. Design A genome-wide survey of large, rare CNVs in a case-control sample using a high-density microarray. Setting The Wellcome Trust Case Control Consortium. Participants There were 1697 cases of bipolar disorder and 2806 nonpsychiatric controls. All participants were white UK residents. Main Outcome Measures Overall load of CNVs and presence of rare CNVs. Results The burden of CNVs in bipolar disorder was not increased compared with controls and was significantly less than in schizophrenia cases. The CNVs previously implicated in the etiology of schizophrenia were not more common in cases with bipolar disorder. Conclusions Schizophrenia and bipolar disorder differ with respect to CNV burden in general and association with specific CNVs in particular. Our data are consistent with the possibility that possession of large, rare deletions may modify the phenotype in those at risk of psychosis: those possessing such events are more likely to be diagnosed as having schizophrenia, and those without them are more likely to be diagnosed as having bipolar disorder. PMID:20368508

  9. Asymptotic Effectiveness of the Event-Based Sampling according to the Integral Criterion

    PubMed Central

    Miskowicz, Marek

    2007-01-01

    A rapid progress in intelligent sensing technology creates new interest in a development of analysis and design of non-conventional sampling schemes. The investigation of the event-based sampling according to the integral criterion is presented in this paper. The investigated sampling scheme is an extension of the pure linear send-on-delta/level-crossing algorithm utilized for reporting the state of objects monitored by intelligent sensors. The motivation of using the event-based integral sampling is outlined. The related works in adaptive sampling are summarized. The analytical closed-form formulas for the evaluation of the mean rate of event-based traffic, and the asymptotic integral sampling effectiveness, are derived. The simulation results verifying the analytical formulas are reported. The effectiveness of the integral sampling is compared with the related linear send-on-delta/level-crossing scheme. The calculation of the asymptotic effectiveness for common signals, which model the state evolution of dynamic systems in time, is exemplified.

  10. Breaking and Entering: Copying and Copy Protection.

    ERIC Educational Resources Information Center

    Westlake, Wayne; And Others

    1985-01-01

    Describes several commercially-available computer programs which allow users to make copies of "protected" software. Current costs, program features, and ordering information are provided for these "encryption" programs. Also describes a monthly journal (The HARDCORE Computist) which focuses on unlocking copy-protected…

  11. Neural bases of event knowledge and syntax integration in comprehension of complex sentences.

    PubMed

    Malaia, Evie; Newman, Sharlene

    2015-01-01

    Comprehension of complex sentences is necessarily supported by both syntactic and semantic knowledge, but what linguistic factors trigger a readers' reliance on a specific system? This functional neuroimaging study orthogonally manipulated argument plausibility and verb event type to investigate cortical bases of the semantic effect on argument comprehension during reading. The data suggest that telic verbs facilitate online processing by means of consolidating the event schemas in episodic memory and by easing the computation of syntactico-thematic hierarchies in the left inferior frontal gyrus. The results demonstrate that syntax-semantics integration relies on trade-offs among a distributed network of regions for maximum comprehension efficiency.

  12. Integral-based event triggering controller design for stochastic LTI systems via convex optimisation

    NASA Astrophysics Data System (ADS)

    Mousavi, S. H.; Marquez, H. J.

    2016-07-01

    The presence of measurement noise in the event-based systems can lower system efficiency both in terms of data exchange rate and performance. In this paper, an integral-based event triggering control system is proposed for LTI systems with stochastic measurement noise. We show that the new mechanism is robust against noise and effectively reduces the flow of communication between plant and controller, and also improves output performance. Using a Lyapunov approach, stability in the mean square sense is proved. A simulated example illustrates the properties of our approach.

  13. An integrated logit model for contamination event detection in water distribution systems.

    PubMed

    Housh, Mashor; Ostfeld, Avi

    2015-05-15

    The problem of contamination event detection in water distribution systems has become one of the most challenging research topics in water distribution systems analysis. Current attempts for event detection utilize a variety of approaches including statistical, heuristics, machine learning, and optimization methods. Several existing event detection systems share a common feature in which alarms are obtained separately for each of the water quality indicators. Unifying those single alarms from different indicators is usually performed by means of simple heuristics. A salient feature of the current developed approach is using a statistically oriented model for discrete choice prediction which is estimated using the maximum likelihood method for integrating the single alarms. The discrete choice model is jointly calibrated with other components of the event detection system framework in a training data set using genetic algorithms. The fusing process of each indicator probabilities, which is left out of focus in many existing event detection system models, is confirmed to be a crucial part of the system which could be modelled by exploiting a discrete choice model for improving its performance. The developed methodology is tested on real water quality data, showing improved performances in decreasing the number of false positive alarms and in its ability to detect events with higher probabilities, compared to previous studies.

  14. Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

    PubMed

    Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

    2005-11-30

    Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.

  15. Optimized breeding strategies for multiple trait integration: I. Minimizing linkage drag in single event introgression.

    PubMed

    Peng, Ting; Sun, Xiaochun; Mumm, Rita H

    2014-01-01

    From a breeding standpoint, multiple trait integration (MTI) is a four-step process of converting an elite variety/hybrid for value-added traits (e.g. transgenic events) using backcross breeding, ultimately regaining the performance attributes of the target hybrid along with reliable expression of the value-added traits. In the light of the overarching goal of recovering equivalent performance in the finished conversion, this study focuses on the first step of MTI, single event introgression, exploring the feasibility of marker-aided backcross conversion of a target maize hybrid for 15 transgenic events, incorporating eight events into the female hybrid parent and seven into the male parent. Single event introgression is conducted in parallel streams to convert the recurrent parent (RP) for individual events, with the primary objective of minimizing residual non-recurrent parent (NRP) germplasm, especially in the chromosomal proximity to the event (i.e. linkage drag). In keeping with a defined lower limit of 96.66 % overall RP germplasm recovery (i.e. ≤120 cM NRP germplasm given a genome size of 1,788 cM), a breeding goal for each of the 15 single event conversions was developed: <8 cM of residual NRP germplasm across the genome with ~1 cM in the 20 cM region flanking the event. Using computer simulation, we aimed to identify optimal breeding strategies for single event introgression to achieve this breeding goal, measuring efficiency in terms of number of backcross generations required, marker data points needed, and total population size across generations. Various selection schemes classified as three-stage, modified two-stage, and combined selection conducted from BC1 through BC3, BC4, or BC5 were compared. The breeding goal was achieved with a selection scheme involving five generations of marker-aided backcrossing, with BC1 through BC3 selected for the event of interest and minimal linkage drag at population size of 600, and BC4 and BC5 selected for

  16. Sounds can boost the awareness of visual events through attention without cross-modal integration

    PubMed Central

    Pápai, Márta Szabina; Soto-Faraco, Salvador

    2017-01-01

    Cross-modal interactions can lead to enhancement of visual perception, even for visual events below awareness. However, the underlying mechanism is still unclear. Can purely bottom-up cross-modal integration break through the threshold of awareness? We used a binocular rivalry paradigm to measure perceptual switches after brief flashes or sounds which, sometimes, co-occurred. When flashes at the suppressed eye coincided with sounds, perceptual switches occurred the earliest. Yet, contrary to the hypothesis of cross-modal integration, this facilitation never surpassed the assumption of probability summation of independent sensory signals. A follow-up experiment replicated the same pattern of results using silent gaps embedded in continuous noise, instead of sounds. This manipulation should weaken putative sound-flash integration, although keep them salient as bottom-up attention cues. Additional results showed that spatial congruency between flashes and sounds did not determine the effectiveness of cross-modal facilitation, which was again not better than probability summation. Thus, the present findings fail to fully support the hypothesis of bottom-up cross-modal integration, above and beyond the independent contribution of two transient signals, as an account for cross-modal enhancement of visual events below level of awareness. PMID:28139712

  17. Escherichia coli O157:H7 Strains Isolated from High-Event Period Beef Contamination Have Strong Biofilm-Forming Ability and Low Sanitizer Susceptibility, Which Are Associated with High pO157 Plasmid Copy Number.

    PubMed

    Wang, Rong; Luedtke, Brandon E; Bosilevac, Joseph M; Schmidt, John W; Kalchayanand, Norasak; Arthur, Terrance M

    2016-11-01

    In the meat industry, a high-event period (HEP) is defined as a time period when beef processing establishments experience an increased occurrence of product contamination by Escherichia coli O157:H7. Our previous studies suggested that bacterial biofilm formation and sanitizer resistance might contribute to HEPs. We conducted the present study to further characterize E. coli O157:H7 strains isolated during HEPs for their potential to cause contamination and to investigate the genetic basis for their strong biofilm-forming ability and high sanitizer resistance. Our results show that, compared with the E. coli O157:H7 diversity control panel strains, the HEP strains had a significantly higher biofilm-forming ability on contact surfaces and a lower susceptibility to common sanitizers. No difference in the presence of disinfectant-resistant genes or the prevalence of antibiotic resistance was observed between the HEP and control strains. However, the HEP strains retained significantly higher copy numbers of the pO157 plasmid. A positive correlation was observed among a strain's high plasmid copy number, strong biofilm-forming ability, low sanitizer susceptibility, and high survival and recovery capability after sanitization, suggesting that these specific phenotypes could be either directly correlated to gene expression on the pO157 plasmid or indirectly regulated via chromosomal gene expression influenced by the presence of the plasmid. Our data highlight the potential risk of biofilm formation and sanitizer resistance in HEP contamination by E. coli O157:H7, and our results call for increased attention to proper and effective sanitization practices in meat processing facilities.

  18. Optimized breeding strategies for multiple trait integration: II. Process efficiency in event pyramiding and trait fixation.

    PubMed

    Peng, Ting; Sun, Xiaochun; Mumm, Rita H

    2014-01-01

    Multiple trait integration (MTI) is a multi-step process of converting an elite variety/hybrid for value-added traits (e.g. transgenic events) through backcross breeding. From a breeding standpoint, MTI involves four steps: single event introgression, event pyramiding, trait fixation, and version testing. This study explores the feasibility of marker-aided backcross conversion of a target maize hybrid for 15 transgenic events in the light of the overall goal of MTI of recovering equivalent performance in the finished hybrid conversion along with reliable expression of the value-added traits. Using the results to optimize single event introgression (Peng et al. Optimized breeding strategies for multiple trait integration: I. Minimizing linkage drag in single event introgression. Mol Breed, 2013) which produced single event conversions of recurrent parents (RPs) with ≤8 cM of residual non-recurrent parent (NRP) germplasm with ~1 cM of NRP germplasm in the 20 cM regions flanking the event, this study focused on optimizing process efficiency in the second and third steps in MTI: event pyramiding and trait fixation. Using computer simulation and probability theory, we aimed to (1) fit an optimal breeding strategy for pyramiding of eight events into the female RP and seven in the male RP, and (2) identify optimal breeding strategies for trait fixation to create a 'finished' conversion of each RP homozygous for all events. In addition, next-generation seed needs were taken into account for a practical approach to process efficiency. Building on work by Ishii and Yonezawa (Optimization of the marker-based procedures for pyramiding genes from multiple donor lines: I. Schedule of crossing between the donor lines. Crop Sci 47:537-546, 2007a), a symmetric crossing schedule for event pyramiding was devised for stacking eight (seven) events in a given RP. Options for trait fixation breeding strategies considered selfing and doubled haploid approaches to achieve homozygosity

  19. An exploratory event-related potential study of multisensory integration in sensory over-responsive children.

    PubMed

    Brett-Green, Barbara A; Miller, Lucy J; Schoen, Sarah A; Nielsen, Darci M

    2010-03-19

    Children who are over-responsive to sensation have defensive and "fight or flight" reactions to ordinary levels of sensory stimulation in the environment. Based on clinical observations, sensory over-responsivity is hypothesized to reflect atypical neural integration of sensory input. To examine a possible underlying neural mechanism of the disorder, integration of simultaneous multisensory auditory and somatosensory stimulation was studied in twenty children with sensory over-responsivity (SOR) using event-related potentials (ERPs). Three types of sensory stimuli were presented and ERPs were recorded from thirty-two scalp electrodes while participants watched a silent cartoon: bilateral auditory clicks, right somatosensory median nerve electrical pulses, or both simultaneously. The paradigm was passive; no behavioral responses were required. To examine integration, responses to simultaneous multisensory auditory-somatosensory stimulation were compared to the sum of unisensory auditory plus unisensory somatosensory responses in four time-windows: (60-80 ms, 80-110 ms, 110-150 ms, and 180-220 ms). Specific midline and lateral electrode sites were examined over scalp regions where auditory-somatosensory integration was expected based on previous studies. Midline electrode sites (Fz, Cz, and Pz) showed significant integration during two time-windows: 60-80 ms and 180-220 ms. Significant integration was also found at contralateral electrode site (C3) for the time-window between 180 and 220 ms. At ipsilateral electrode sites (C4 and CP6), no significant integration was found during any of the time-windows (i.e. the multisensory ERP was not significantly different from the summed unisensory ERP). These results demonstrate that MSI can be reliably measured in children with SOR and provide evidence that multisensory auditory-somatosensory input is integrated during both early and later stages of sensory information processing, mainly over fronto-central scalp regions.

  20. Partitioning of integrated energy fluxes in four tail reconnection events observed by Cluster

    NASA Astrophysics Data System (ADS)

    Tyler, Evan; Cattell, Cynthia; Thaller, Scott; Wygant, John; Gurgiolo, Chris; Goldstein, Melvyn; Mouikis, Christopher

    2016-12-01

    We present the partitioning of integrated energy flux from four tail reconnection events observed by Cluster, focusing on the relative contributions of Poynting flux, electron, H+ and O+ enthalpy, and kinetic energy flux in the tailward and earthward directions in order to study temporal and spatial features of each event. We further subdivide the Poynting flux into three frequency bands to examine the possible structures and waves that contribute most significantly to the total Poynting flux from the reconnection region. Our results indicate that H+ enthalpy flux is often dominant, but O+ enthalpy, electron enthalpy, Poynting flux, and H+ kinetic energy flux can contribute significant or greater total energy flux depending on spacecraft location with respect the current sheet, flow direction, temporal scale, and local conditions. We observe integrated H+ enthalpy fluxes that differ by factors of 3-4 between satellites, even over ion inertial length scales. We observe strong differences in behavior between H+ and O+ enthalpy fluxes in all events, highlighting the importance of species-specific energization mechanisms. We find tailward-earthward asymmetry in H+ enthalpy flux, possibly indicative of the influence of the closed earthward boundary of the magnetotail system. Frequency filtering of the Poynting flux shows that current sheet surface waves and structures on the timescale of current sheet flapping contribute significantly, while large-scale structure contributions are relatively small. We observe that the direction and behavior of the Poynting flux differs between bands, indicating that the observed flux originates from multiple distinct sources or processes.

  1. Mines Systems Safety Improvement Using an Integrated Event Tree and Fault Tree Analysis

    NASA Astrophysics Data System (ADS)

    Kumar, Ranjan; Ghosh, Achyuta Krishna

    2016-06-01

    Mines systems such as ventilation system, strata support system, flame proof safety equipment, are exposed to dynamic operational conditions such as stress, humidity, dust, temperature, etc., and safety improvement of such systems can be done preferably during planning and design stage. However, the existing safety analysis methods do not handle the accident initiation and progression of mine systems explicitly. To bridge this gap, this paper presents an integrated Event Tree (ET) and Fault Tree (FT) approach for safety analysis and improvement of mine systems design. This approach includes ET and FT modeling coupled with redundancy allocation technique. In this method, a concept of top hazard probability is introduced for identifying system failure probability and redundancy is allocated to the system either at component or system level. A case study on mine methane explosion safety with two initiating events is performed. The results demonstrate that the presented method can reveal the accident scenarios and improve the safety of complex mine systems simultaneously.

  2. Mines Systems Safety Improvement Using an Integrated Event Tree and Fault Tree Analysis

    NASA Astrophysics Data System (ADS)

    Kumar, Ranjan; Ghosh, Achyuta Krishna

    2017-04-01

    Mines systems such as ventilation system, strata support system, flame proof safety equipment, are exposed to dynamic operational conditions such as stress, humidity, dust, temperature, etc., and safety improvement of such systems can be done preferably during planning and design stage. However, the existing safety analysis methods do not handle the accident initiation and progression of mine systems explicitly. To bridge this gap, this paper presents an integrated Event Tree (ET) and Fault Tree (FT) approach for safety analysis and improvement of mine systems design. This approach includes ET and FT modeling coupled with redundancy allocation technique. In this method, a concept of top hazard probability is introduced for identifying system failure probability and redundancy is allocated to the system either at component or system level. A case study on mine methane explosion safety with two initiating events is performed. The results demonstrate that the presented method can reveal the accident scenarios and improve the safety of complex mine systems simultaneously.

  3. Two Neurocognitive Mechanisms of Semantic Integration during the Comprehension of Visual Real-world Events

    PubMed Central

    Sitnikova, Tatiana; Holcomb, Phillip J.; Kiyonaga, Kristi A.; Kuperberg, Gina R.

    2009-01-01

    How do comprehenders build up overall meaning representations of visual real-world events? This question was examined by recording event-related potentials (ERPs) while participants viewed short, silent movie clips depicting everyday events. In two experiments, it was demonstrated that presentation of the contextually inappropriate information in the movie endings evoked an anterior negativity. This effect was similar to the N400 component whose amplitude has been previously reported to inversely correlate with the strength of semantic relationship between the context and the eliciting stimulus in word and static picture paradigms. However, a second, somewhat later, ERP component—a posterior late positivity—was evoked specifically when target objects presented in the movie endings violated goal-related requirements of the action constrained by the scenario context (e.g., an electric iron that does not have a sharp-enough edge was used in place of a knife in a cutting bread scenario context). These findings suggest that comprehension of the visual real world might be mediated by two neurophysiologically distinct semantic integration mechanisms. The first mechanism, reflected by the anterior N400-like negativity, maps the incoming information onto the connections of various strengths between concepts in semantic memory. The second mechanism, reflected by the posterior late positivity, evaluates the incoming information against the discrete requirements of real-world actions. We suggest that there may be a tradeoff between these mechanisms in their utility for integrating across people, objects, and actions during event comprehension, in which the first mechanism is better suited for familiar situations, and the second mechanism is better suited for novel situations. PMID:18416681

  4. Online integrated solution to collect data, generate information and manage events in the human biomonitoring field.

    PubMed

    Reis, M Fátima; Tedim, João; Aguiar, Pedro; Miguel, J Pereira; Casteleyn, Ludwine; Joas, Reinhard; Van Tongelen, Birgit

    2007-05-01

    In the ambit of Work Package 1 of the ESBIO Project, an online integrated solution to collect data, to generate information, and to manage mainly information-sharing events related with human biomonitoring within Europe has been designed and is being implemented. The present paper summarises the methodological approaches used by the authors as proposers, general promoters and disseminators of this strategic concept, as well as the first outcomes and future actions to be taken, in the short and longer term, to face present and future challenges to make this innovative solution happen.

  5. Cognitive conflict in audiovisual integration: an event-related potential study.

    PubMed

    Yin, Qinqing; Qiu, Jiang; Zhang, Qinglin; Wen, Xiaohui

    2008-03-26

    This study used event-related potentials (ERPs) to investigate the electrophysiological correlates of cognitive conflict in audiovisual integration during an audiovisual task. ERP analyses revealed: (i) the anterior N1 and P1 were elicited in both matched and mismatched conditions and (ii) audiovisual mismatched answers elicited a more negative ERP deflection at 490 ms (N490) than matched answers. Dipole analysis of the difference wave (mismatched minus matched) localized the generator of the N490 to the posterior cingulate cortex, which may be involved in the control and modulation of conflict processing of Chinese characters when visual and auditory information is mismatched.

  6. Reprogrammable field programmable gate array with integrated system for mitigating effects of single event upsets

    NASA Technical Reports Server (NTRS)

    Ng, Tak-kwong (Inventor); Herath, Jeffrey A. (Inventor)

    2010-01-01

    An integrated system mitigates the effects of a single event upset (SEU) on a reprogrammable field programmable gate array (RFPGA). The system includes (i) a RFPGA having an internal configuration memory, and (ii) a memory for storing a configuration associated with the RFPGA. Logic circuitry programmed into the RFPGA and coupled to the memory reloads a portion of the configuration from the memory into the RFPGA's internal configuration memory at predetermined times. Additional SEU mitigation can be provided by logic circuitry on the RFPGA that monitors and maintains synchronized operation of the RFPGA's digital clock managers.

  7. Impact of induced seismic events on seal integrity, Texas Gulf Coast

    DOE PAGES

    Nicot, Jean-Philippe; Meckel, Timothy A.; Carr, David A.; ...

    2014-12-31

    Recent publications have suggested that large-scale CO2 injection could trigger earthquakes and that even small- to moderate-sized earthquakes may threaten the seal integrity of the injection zone, and potentially damage buildings and other surface structures. In this study, we compared seal thickness to estimated fault displacement due to a single hypothetical seismic event in a selected area of the Texas Gulf Coast comprising an offshore strip of state waters along two Texas counties. To evaluate the slip generated by a single seismic event, we compiled well log information on shale/sand sequences and seismic information on fault geometric characteristics of amore » section of Lower Miocene age. The section is thousands of feet thick and is overlain and underlain by marine shales (Amph. B and Anahuac, respectively) that are relatively easy to correlate between wells. The Amph. B. shale is the secondary and ultimate seal for all injection intervals in the Lower Miocene. Given its thickness, no realistic seismic event or small series of seismic events will offset it significantly. However, this may not be true of smaller local primary seals. An analysis of geophysical logs of a total of 71 wells yielded a total of 2,871 sand / shale binary intervals. An analysis of the dedicated 3D seismic survey counted 723 fault traces at five roughly horizontal horizons within the Lower Miocene Fault displacement estimated using the product of the fault length times an uncertain multiplier coefficient assumed to follow a triangular distribution with a 10-3 to 10-5 range and a mode of 8 × 10-5. We then compared estimated single-event fault displacements to seal thicknesses by means of a Monte-Carlo analysis. Only 1.8% of thickness/displacement pairs display a displacement greater than 20% of the seal thickness. Only 0.26% of the pairs result in a displacement of half the seal thickness and only 0.05% of thickness/displacement pairs result in a clear seal rupture. The next step

  8. Impact of induced seismic events on seal integrity, Texas Gulf Coast

    SciTech Connect

    Nicot, Jean-Philippe; Meckel, Timothy A.; Carr, David A.; Oldenburg, Curtis M.

    2014-12-31

    Recent publications have suggested that large-scale CO2 injection could trigger earthquakes and that even small- to moderate-sized earthquakes may threaten the seal integrity of the injection zone, and potentially damage buildings and other surface structures. In this study, we compared seal thickness to estimated fault displacement due to a single hypothetical seismic event in a selected area of the Texas Gulf Coast comprising an offshore strip of state waters along two Texas counties. To evaluate the slip generated by a single seismic event, we compiled well log information on shale/sand sequences and seismic information on fault geometric characteristics of a section of Lower Miocene age. The section is thousands of feet thick and is overlain and underlain by marine shales (Amph. B and Anahuac, respectively) that are relatively easy to correlate between wells. The Amph. B. shale is the secondary and ultimate seal for all injection intervals in the Lower Miocene. Given its thickness, no realistic seismic event or small series of seismic events will offset it significantly. However, this may not be true of smaller local primary seals. An analysis of geophysical logs of a total of 71 wells yielded a total of 2,871 sand / shale binary intervals. An analysis of the dedicated 3D seismic survey counted 723 fault traces at five roughly horizontal horizons within the Lower Miocene Fault displacement estimated using the product of the fault length times an uncertain multiplier coefficient assumed to follow a triangular distribution with a 10-3 to 10-5 range and a mode of 8 × 10-5. We then compared estimated single-event fault displacements to seal thicknesses by means of a Monte-Carlo analysis. Only 1.8% of thickness/displacement pairs display a displacement greater than 20% of the seal thickness. Only 0.26% of the pairs result in a displacement of half the seal thickness and only 0.05% of thickness/displacement pairs result in

  9. Heavy-ion induced single-event upset in integrated circuits

    NASA Technical Reports Server (NTRS)

    Zoutendyk, J. A.

    1991-01-01

    The cosmic ray environment in space can affect the operation of Integrated Circuit (IC) devices via the phenomenon of Single Event Upset (SEU). In particular, heavy ions passing through an IC can induce sufficient integrated current (charge) to alter the state of a bistable circuit, for example a memory cell. The SEU effect is studied in great detail in both static and dynamic memory devices, as well as microprocessors fabricated from bipolar, Complementary Metal Oxide Semiconductor (CMOS) and N channel Metal Oxide Semiconductor (NMOS) technologies. Each device/process reflects its individual characteristics (minimum scale geometry/process parameters) via a unique response to the direct ionization of electron hole pairs by heavy ion tracks. A summary of these analytical and experimental SEU investigations is presented.

  10. Integrating the Meaning of Person Names into Discourse Context: An Event-Related Potential Study

    PubMed Central

    Wang, Lin; Yang, Yufang

    2013-01-01

    The meaning of person names is determined by their associated information. This study used event related potentials to investigate the time course of integrating the newly constructed meaning of person names into discourse context. The meaning of person names was built by two-sentence descriptions of the names. Then we manipulated the congruence of person names relative to discourse context in a way that the meaning of person names either matched or did not match the previous context. ERPs elicited by the names were compared between the congruent and the incongruent conditions. We found that the incongruent names elicited a larger N400 as well as a larger P600 compared to the congruent names. The results suggest that the meaning of unknown names can be effectively constructed from short linguistic descriptions and that the established meaning can be rapidly retrieved and integrated into contexts. PMID:24349462

  11. Copy-left and Copy-right

    NASA Astrophysics Data System (ADS)

    VanderPlas, Jacob

    2015-01-01

    Any discussion of open licensing almost invariably devolves into a debate between copy-left licenses and permissive licenses, both sides defending their views with a nearly religious fervor. Copy-left licenses, typified by the GPL family of licenses, require all derived products to maintain the open, GPL license. Permissive licenses, typified by the BSD family of licenses, do not impose such requirements. I'll briefly explore the common arguments put forth in favor of either approach, and discuss some concrete examples of where these approaches have helped or hindered the software packages that used them.

  12. Unusual features of the sequences of copies of the 16S-23S rRNA internal transcribed spacer regions of Acinetobacter bereziniae, Acinetobacter guillouiae and Acinetobacter baylyi arise from horizontal gene transfer events.

    PubMed

    Maslunka, Christopher; Gürtler, Volker; Seviour, Robert

    2015-02-01

    The highly variable nature of the internal transcribed spacer region (ITS) has been claimed to represent an ideal target for designing species-specific probes/primers capable of differentiating between closely related Acinetobacter species. However, several Acinetobacter species contain multiple ITS copies of variable lengths, and these include Acinetobacter bereziniae, Acinetobacter guillouiae and Acinetobacter baylyi. This study shows these length variations result from inter-genomic insertion/deletion events (indels) involving horizontal transfer of ITS fragments of other Acinetobacter species and possibly unrelated bacteria, as shown previously by us. In some instances, indel incorporation results in the loss of probe target sites in the recipient cell ITS. In other cases, some indel sequences contain target sites for probes designed from a single ITS sequence to target other Acinetobacter species. Hence, these can generate false positives. The largest of the indels that remove probe sites is 683 bp (labelled bay/i1-0), and it derives from the horizontal transfer of a complete ITS between A. bereziniae BCRC15423(T) and A. baylyi strain ADP1. As a consequence, ITS sequencing or fingerprinting cannot be used to distinguish between the 683 bp ITS in these two strains.

  13. INTEGRAL upper limits on gamma-ray emission associated with the gravitational wave event GW150914

    NASA Astrophysics Data System (ADS)

    Savchenko, V.; Ferrigno, C.; Mereghetti, S.; Natalucci, L.; Kuulkers, E.

    2016-06-01

    Using observations of the INTErnational Gamma-Ray Astrophysics Laboratory (INTEGRAL), we put tight upper limits on the gamma-ray and hard X-ray prompt emission associated with the gravitational wave event GW150914, discovered by the LIGO/Virgo collaboration. The omni-directional view of the INTEGRAL/SPI-ACS has allowed us to constrain the fraction of energy emitted in the hard X-ray electromagnetic component for the full high-probability sky region of LIGO/Virgo trigger. Our upper limits on the hard X-ray fluence at the time of the event range from F_{γ}=2 × 10^{-8} erg cm^{-2} to F_{γ}=10^{-6} erg cm^{-2} in the 75 keV - 2 MeV energy range for typical spectral models. Our results constrain the ratio of the energy promptly released in gamma-rays in the direction of the observer to the gravitational wave energy E_γ/E_{GW}<10^{-6}. We discuss the implication of gamma-ray limits on the characteristics of the gravitational wave source, based on the available predictions for prompt electromagnetic emission. This work has been possible thanks to a Memorandum of Understanding with the LIGO-Virgo scientific collaboration and is presented on behalf of a larger collaboration.

  14. Replication protein A safeguards genome integrity by controlling NER incision events

    PubMed Central

    Overmeer, René M.; Moser, Jill; Volker, Marcel; Kool, Hanneke; Tomkinson, Alan E.; van Zeeland, Albert A.

    2011-01-01

    Single-stranded DNA gaps that might arise by futile repair processes can lead to mutagenic events and challenge genome integrity. Nucleotide excision repair (NER) is an evolutionarily conserved repair mechanism, essential for removal of helix-distorting DNA lesions. In the currently prevailing model, NER operates through coordinated assembly of repair factors into pre- and post-incision complexes; however, its regulation in vivo is poorly understood. Notably, the transition from dual incision to repair synthesis should be rigidly synchronized as it might lead to accumulation of unprocessed repair intermediates. We monitored NER regulatory events in vivo using sequential UV irradiations. Under conditions that allow incision yet prevent completion of repair synthesis or ligation, preincision factors can reassociate with new damage sites. In contrast, replication protein A remains at the incomplete NER sites and regulates a feedback loop from completion of DNA repair synthesis to subsequent damage recognition, independently of ATR signaling. Our data reveal an important function for replication protein A in averting further generation of DNA strand breaks that could lead to mutagenic and recombinogenic events. PMID:21282463

  15. Analysis of Severe Weather Events by Integration of Civil Protection Operation Data

    NASA Astrophysics Data System (ADS)

    Heisterkamp, Tobias; Kox, Thomas

    2015-04-01

    In Germany, winter storms belong to those natural hazards responsible for the largest damages (GDV 2014). This is a huge challenge for the civil protection, especially in metropolitan areas like Berlin. Nowadays, large-scale storm events are generally well predictable, but detailed forecasts on urban district or even street level are still out of range. Fire brigades, as major stakeholder covering severe weather consequences, operate on this small scale and in the whole area due to their juris-diction. For forensic investigation of disasters this presentation offers an additional approach by using the documentation of fire brigade operations as a new data source. Hazard dimensions and conse-quences of severe weather events are reconstructed via GIS-based analyses of these operations. Local case studies of recent storms are used as a comparison and as an additional information to three WMO weather stations in Berlin. Thus, hot spots of these selected events can be identified by operation site accumulations. Further indicators for Berlin are added to detect aspects that de-termine vulnerabilities. The conclusion discusses the potential of this approach as well as possible benefits of integration into warning systems.

  16. Humans can integrate feedback of discrete events in their sensorimotor control of a robotic hand

    PubMed Central

    Segil, Jacob L.; Clemente, Francesco; Weir, Richard F. ff; Edin, Benoni

    2015-01-01

    Providing functionally effective sensory feedback to users of prosthetics is a largely unsolved challenge. Traditional solutions require high band-widths for providing feedback for the control of manipulation and yet have been largely unsuccessful. In this study, we have explored a strategy that relies on temporally discrete sensory feedback that is technically simple to provide. According to the Discrete Event-driven Sensory feedback Control (DESC) policy, motor tasks in humans are organized in phases delimited by means of sensory encoded discrete mechanical events. To explore the applicability of DESC for control, we designed a paradigm in which healthy humans operated an artificial robot hand to lift and replace an instrumented object, a task that can readily be learned and mastered under visual control. Assuming that the central nervous system of humans naturally organizes motor tasks based on a strategy akin to DESC, we delivered short-lasting vibrotactile feedback related to events that are known to forcefully affect progression of the grasp-lift-and-hold task. After training, we determined whether the artificial feedback had been integrated with the sensorimotor control by introducing short delays and we indeed observed that the participants significantly delayed subsequent phases of the task. This study thus gives support to the DESC policy hypothesis. Moreover, it demonstrates that humans can integrate temporally discrete sensory feedback while controlling an artificial hand and invites further studies in which inexpensive, noninvasive technology could be used in clever ways to provide physiologically appropriate sensory feedback in upper limb prosthetics with much lower band-width requirements than with traditional solutions. PMID:24992899

  17. Altered semantic integration in autism beyond language: a cross-modal event-related potentials study.

    PubMed

    Ribeiro, Tatiane C; Valasek, Claudia A; Minati, Ludovico; Boggio, Paulo S

    2013-05-29

    Autism spectrum disorders (ASDs) are characterized by impaired communication, particularly pragmatic and semantic language, resulting in verbal comprehension deficits. Semantic processing in these conditions has been studied extensively, but mostly limited only to linguistic material. Emerging evidence, however, suggests that semantic integration deficits may extend beyond the verbal domain. Here, we explored cross-modal semantic integration using visual targets preceded by musical and linguistic cues. Particularly, we have recorded the event-related potentials to evaluate whether the N400 and late positive potential (LPP) components, two widely studied electrophysiological markers of semantic processing, are differently sensitive to congruence with respect to typically developing children. Seven ASD patients and seven neurotypical participants matched by age, education and intelligence quotient provided usable data. Neuroelectric activity was recorded in response to visual targets that were related or unrelated to a preceding spoken sentence or musical excerpt. The N400 was sensitive to semantic congruence in the controls but not the patients, whereas the LPP showed a complementary pattern. These results suggest that semantic processing in ASD children is also altered in the context of musical and visual stimuli, and point to a functional decoupling between the generators of the N400 and LPP, which may indicate delayed semantic processing. These novel findings underline the importance of exploring semantic integration across multiple modalities in ASDs and provide motivation for further investigation in large clinical samples.

  18. Conceptual Integration of Arithmetic Operations With Real-World Knowledge: Evidence From Event-Related Potentials.

    PubMed

    Guthormsen, Amy M; Fisher, Kristie J; Bassok, Miriam; Osterhout, Lee; DeWolf, Melissa; Holyoak, Keith J

    2016-04-01

    Research on language processing has shown that the disruption of conceptual integration gives rise to specific patterns of event-related brain potentials (ERPs)-N400 and P600 effects. Here, we report similar ERP effects when adults performed cross-domain conceptual integration of analogous semantic and mathematical relations. In a problem-solving task, when participants generated labeled answers to semantically aligned and misaligned arithmetic problems (e.g., 6 roses + 2 tulips = ? vs. 6 roses + 2 vases = ?), the second object label in misaligned problems yielded an N400 effect for addition (but not division) problems. In a verification task, when participants judged arithmetically correct but semantically misaligned problem sentences to be "unacceptable," the second object label in misaligned sentences elicited a P600 effect. Thus, depending on task constraints, misaligned problems can show either of two ERP signatures of conceptual disruption. These results show that well-educated adults can integrate mathematical and semantic relations on the rapid timescale of within-domain ERP effects by a process akin to analogical mapping.

  19. Conceptual Integration of Arithmetic Operations with Real-World Knowledge: Evidence from Event-Related Potentials

    PubMed Central

    Guthormsen, Amy M.; Fisher, Kristie J.; Bassok, Miriam; Osterhout, Lee; DeWolf, Melissa; Holyoak, Keith J.

    2015-01-01

    Research on language processing has shown that the disruption of conceptual integration gives rise to specific patterns of event-related brain potentials (ERPs)—N400 and P600 effects. Here we report similar ERP effects when adults performed cross-domain conceptual integration of analogous semantic and mathematical relations. In a problem-solving task, when participants generated labeled answers to semantically aligned and misaligned arithmetic problems (e.g., 6 roses + 2 tulips = ? vs. 6 roses + 2 vases = ?), the second object label in misaligned problems yielded an N400 effect for addition (but not division) problems. In a verification task, when participants judged arithmetically-correct but semantically misaligned problem sentences to be “unacceptable”, the second object label in misaligned sentences elicited a P600 effect. Thus depending on task constraints, misaligned problems can show either of two ERP signatures of conceptual disruption. These results show that well-educated adults can integrate mathematical and semantic relations on the rapid timescale of within-domain ERP effects by a process akin to analogical mapping. PMID:25864403

  20. Integrated Genome-wide DNA Copy Number and Expression Analysis Identifies Distinct Mechanisms of Primary Chemo-resistance in Ovarian Carcinomas

    PubMed Central

    Etemadmoghadam, Dariush; deFazio, Anna; Beroukhim, Rameen; Mermel, Craig; George, Joshy; Getz, Gaddy; Tothill, Richard; Okamoto, Aikou; Raeder, Maria B; Harnett, Paul; Lade, Stephen; Akslen, Lars A; Tinker, Anna; Locandro, Bianca; Alsop, Kathryn; Chiew, Yoke-Eng; Traficante, Nadia; Fereday, Sian; Johnson, Daryl; Fox, Stephen; Sellers, William; Urashima, Mitsuyoshi; Salvesen, Helga B; Meyerson, Matthew; Bowtell, David

    2009-01-01

    Purpose A significant number of women with serous ovarian cancer are intrinsically refractory to platinum-taxol based treatment. We analyzed somatic DNA copy number variation (CNV) and gene expression data to identify key mechanisms associated with primary resistance in advanced-stage serous cancers. Experimental Design Genome-wide CNV was measured in 118 ovarian tumors using high-resolution oligonucleotide microarrays. A well-defined subset of 85 advanced-stage serous tumors was then used to relate CNV to primary resistance to treatment. The discovery-based approach was complemented by quantitative-PCR copy number analysis of twelve candidate genes as independent validation of previously reported associations with clinical outcome. Likely CNV targets and tumor molecular subtypes were further characterized by gene expression profiling. Results Amplification of 19q12, containing Cyclin E (CCNE1) and 20q11.22-q13.12, mapping immediately adjacent to the steroid receptor co-activator NCOA3, were significantly associated with poor response to primary treatment. Other genes previously associated with CNV and clinical outcome in ovarian cancer were not associated with primary treatment resistance. Chemoresistant tumors with high CCNE1 copy number and protein expression were associated with increased cellular proliferation but so too were a subset of treatment responsive patients, suggesting a cell-cycle independent role for CCNE1 in modulating chemoresponse. Patients with a poor clinical outcome without CCNE1 amplification over expressed genes involved in extracellular matrix deposition. Conclusions We have identified two distinct mechanisms of primary treatment failure in serous ovarian cancer, involving CCNE1 amplification and enhanced extracellular matrix deposition. CCNE1 copy number is validated as a dominant marker of patient outcome in ovarian cancer. PMID:19193619

  1. An event-related potential examination of contour integration deficits in schizophrenia.

    PubMed

    Butler, Pamela D; Abeles, Ilana Y; Silverstein, Steven M; Dias, Elisa C; Weiskopf, Nicole G; Calderone, Daniel J; Sehatpour, Pejman

    2013-01-01

    Perceptual organization, which refers to the ability to integrate fragments of stimuli to form a representation of a whole edge, part, or object, is impaired in schizophrenia. A contour integration paradigm, involving detection of a set of Gabor patches forming an oval contour pointing to the right or left embedded in a field of randomly oriented Gabors, has been developed for use in clinical trials of schizophrenia. The purpose of the present study was to assess contributions of early and later stages of processing to deficits in contour integration, as well as to develop an event-related potential (ERP) analog of this task. Twenty-one patients with schizophrenia and 28 controls participated. The Gabor elements forming the contours were given a low or high degree of orientational jitter, making it either easy or difficult to identify the direction in which the contour was pointing. ERP results showed greater negative peaks at ~165 (N1 component) and ~270 ms for the low-jitter versus the high-jitter contours, with a much greater difference between jitter conditions at 270 ms. This later ERP component was previously termed Ncl for closure negativity. Source localization identified the Ncl in the lateral occipital object recognition area. Patients showed a significant decrease in the Ncl, but not N1, compared to controls, and this was associated with impaired behavioral ability to identify contours. In addition, an earlier negative peak was found at ~120 ms (termed N120) that differentiated jitter conditions, had a dorsal stream source, and differed between patients and controls. Patients also showed a deficit in the dorsal stream sensory P1 component. These results are in accord with impairments in distributed circuitry contributing to perceptual organization deficits and provide an ERP analog to the behavioral contour integration task.

  2. A prediction technique for single-event effects on complex integrated circuits

    NASA Astrophysics Data System (ADS)

    Yuanfu, Zhao; Chunqing, Yu; Long, Fan; Suge, Yue; Maoxin, Chen; Shougang, Du; Hongchao, Zheng

    2015-11-01

    The sensitivity of complex integrated circuits to single-event effects is investigated. Sensitivity depends not only on the cross section of physical modules but also on the behavior of data patterns running on the system. A method dividing the main functional modules is proposed. The intrinsic cross section and the duty cycles of different sensitive modules are obtained during the execution of data patterns. A method for extracting the duty cycle is presented and a set of test patterns with different duty cycles are implemented experimentally. By combining the intrinsic cross section and the duty cycle of different sensitive modules, a universal method to predict SEE sensitivities of different test patterns is proposed, which is verified by experiments based on the target circuit of a microprocessor. Experimental results show that the deviation between prediction and experiment is less than 20%.

  3. Integrated survival analysis using an event-time approach in a Bayesian framework

    USGS Publications Warehouse

    Walsh, Daniel P.; Dreitz, VJ; Heisey, Dennis M.

    2015-01-01

    Event-time or continuous-time statistical approaches have been applied throughout the biostatistical literature and have led to numerous scientific advances. However, these techniques have traditionally relied on knowing failure times. This has limited application of these analyses, particularly, within the ecological field where fates of marked animals may be unknown. To address these limitations, we developed an integrated approach within a Bayesian framework to estimate hazard rates in the face of unknown fates. We combine failure/survival times from individuals whose fates are known and times of which are interval-censored with information from those whose fates are unknown, and model the process of detecting animals with unknown fates. This provides the foundation for our integrated model and permits necessary parameter estimation. We provide the Bayesian model, its derivation, and use simulation techniques to investigate the properties and performance of our approach under several scenarios. Lastly, we apply our estimation technique using a piece-wise constant hazard function to investigate the effects of year, age, chick size and sex, sex of the tending adult, and nesting habitat on mortality hazard rates of the endangered mountain plover (Charadrius montanus) chicks. Traditional models were inappropriate for this analysis because fates of some individual chicks were unknown due to failed radio transmitters. Simulations revealed biases of posterior mean estimates were minimal (≤ 4.95%), and posterior distributions behaved as expected with RMSE of the estimates decreasing as sample sizes, detection probability, and survival increased. We determined mortality hazard rates for plover chicks were highest at <5 days old and were lower for chicks with larger birth weights and/or whose nest was within agricultural habitats. Based on its performance, our approach greatly expands the range of problems for which event-time analyses can be used by eliminating the

  4. Integrated survival analysis using an event-time approach in a Bayesian framework

    PubMed Central

    Walsh, Daniel P; Dreitz, Victoria J; Heisey, Dennis M

    2015-01-01

    Event-time or continuous-time statistical approaches have been applied throughout the biostatistical literature and have led to numerous scientific advances. However, these techniques have traditionally relied on knowing failure times. This has limited application of these analyses, particularly, within the ecological field where fates of marked animals may be unknown. To address these limitations, we developed an integrated approach within a Bayesian framework to estimate hazard rates in the face of unknown fates. We combine failure/survival times from individuals whose fates are known and times of which are interval-censored with information from those whose fates are unknown, and model the process of detecting animals with unknown fates. This provides the foundation for our integrated model and permits necessary parameter estimation. We provide the Bayesian model, its derivation, and use simulation techniques to investigate the properties and performance of our approach under several scenarios. Lastly, we apply our estimation technique using a piece-wise constant hazard function to investigate the effects of year, age, chick size and sex, sex of the tending adult, and nesting habitat on mortality hazard rates of the endangered mountain plover (Charadrius montanus) chicks. Traditional models were inappropriate for this analysis because fates of some individual chicks were unknown due to failed radio transmitters. Simulations revealed biases of posterior mean estimates were minimal (≤ 4.95%), and posterior distributions behaved as expected with RMSE of the estimates decreasing as sample sizes, detection probability, and survival increased. We determined mortality hazard rates for plover chicks were highest at <5 days old and were lower for chicks with larger birth weights and/or whose nest was within agricultural habitats. Based on its performance, our approach greatly expands the range of problems for which event-time analyses can be used by eliminating the

  5. iGEMS: an integrated model for identification of alternative exon usage events

    PubMed Central

    Sood, Sanjana; Szkop, Krzysztof J.; Nakhuda, Asif; Gallagher, Iain J.; Murie, Carl; Brogan, Robert J.; Kaprio, Jaakko; Kainulainen, Heikki; Atherton, Philip J.; Kujala, Urho M.; Gustafsson, Thomas; Larsson, Ola; Timmons, James A.

    2016-01-01

    DNA microarrays and RNAseq are complementary methods for studying RNA molecules. Current computational methods to determine alternative exon usage (AEU) using such data require impractical visual inspection and still yield high false-positive rates. Integrated Gene and Exon Model of Splicing (iGEMS) adapts a gene-level residuals model with a gene size adjusted false discovery rate and exon-level analysis to circumvent these limitations. iGEMS was applied to two new DNA microarray datasets, including the high coverage Human Transcriptome Arrays 2.0 and performance was validated using RT-qPCR. First, AEU was studied in adipocytes treated with (n = 9) or without (n = 8) the anti-diabetes drug, rosiglitazone. iGEMS identified 555 genes with AEU, and robust verification by RT-qPCR (∼90%). Second, in a three-way human tissue comparison (muscle, adipose and blood, n = 41) iGEMS identified 4421 genes with at least one AEU event, with excellent RT-qPCR verification (95%, n = 22). Importantly, iGEMS identified a variety of AEU events, including 3′UTR extension, as well as exon inclusion/exclusion impacting on protein kinase and extracellular matrix domains. In conclusion, iGEMS is a robust method for identification of AEU while the variety of exon usage between human tissues is 5–10 times more prevalent than reported by the Genotype-Tissue Expression consortium using RNA sequencing. PMID:27095197

  6. Double Power Laws in the Event-integrated Solar Energetic Particle Spectrum

    NASA Astrophysics Data System (ADS)

    Zhao, Lulu; Zhang, Ming; Rassoul, Hamid K.

    2016-04-01

    A double power law or a power law with exponential rollover at a few to tens of MeV nucleon-1 of the event-integrated differential spectra has been reported in many solar energetic particle (SEP) events. The rollover energies per nucleon of different elements correlate with a particle's charge-to-mass ratio (Q/A). The probable causes are suggested as residing in shock finite lifetimes, shock finite sizes, shock geometry, and an adiabatic cooling effect. In this work, we conduct a numerical simulation to investigate a particle's transport process in the inner heliosphere. We solve the focused transport equation using a time-backward Markov stochastic approach. The convection, magnetic focusing, adiabatic cooling effect, and pitch-angle scattering are included. The effects that the interplanetary turbulence imposes on the shape of the resulting SEP spectra are examined. By assuming a pure power-law differential spectrum at the Sun, a perfect double-power-law feature with a break energy ranging from 10 to 120 MeV nucleon-1 is obtained at 1 au. We found that the double power law of the differential energy spectrum is a robust result of SEP interplanetary propagation. It works for many assumptions of interplanetary turbulence spectra that give various forms of momentum dependence of a particle's mean free path. The different spectral shapes in low-energy and high-energy ends are not just a transition from the convection-dominated propagation to diffusion-dominated propagation.

  7. Non-parametric frequency analysis of extreme values for integrated disaster management considering probable maximum events

    NASA Astrophysics Data System (ADS)

    Takara, K. T.

    2015-12-01

    This paper describes a non-parametric frequency analysis method for hydrological extreme-value samples with a size larger than 100, verifying the estimation accuracy with a computer intensive statistics (CIS) resampling such as the bootstrap. Probable maximum values are also incorporated into the analysis for extreme events larger than a design level of flood control. Traditional parametric frequency analysis methods of extreme values include the following steps: Step 1: Collecting and checking extreme-value data; Step 2: Enumerating probability distributions that would be fitted well to the data; Step 3: Parameter estimation; Step 4: Testing goodness of fit; Step 5: Checking the variability of quantile (T-year event) estimates by the jackknife resampling method; and Step_6: Selection of the best distribution (final model). The non-parametric method (NPM) proposed here can skip Steps 2, 3, 4 and 6. Comparing traditional parameter methods (PM) with the NPM, this paper shows that PM often underestimates 100-year quantiles for annual maximum rainfall samples with records of more than 100 years. Overestimation examples are also demonstrated. The bootstrap resampling can do bias correction for the NPM and can also give the estimation accuracy as the bootstrap standard error. This NPM has advantages to avoid various difficulties in above-mentioned steps in the traditional PM. Probable maximum events are also incorporated into the NPM as an upper bound of the hydrological variable. Probable maximum precipitation (PMP) and probable maximum flood (PMF) can be a new parameter value combined with the NPM. An idea how to incorporate these values into frequency analysis is proposed for better management of disasters that exceed the design level. The idea stimulates more integrated approach by geoscientists and statisticians as well as encourages practitioners to consider the worst cases of disasters in their disaster management planning and practices.

  8. Event triggered state estimation techniques for power systems with integrated variable energy resources.

    PubMed

    Francy, Reshma C; Farid, Amro M; Youcef-Toumi, Kamal

    2015-05-01

    For many decades, state estimation (SE) has been a critical technology for energy management systems utilized by power system operators. Over time, it has become a mature technology that provides an accurate representation of system state under fairly stable and well understood system operation. The integration of variable energy resources (VERs) such as wind and solar generation, however, introduces new fast frequency dynamics and uncertainties into the system. Furthermore, such renewable energy is often integrated into the distribution system thus requiring real-time monitoring all the way to the periphery of the power grid topology and not just the (central) transmission system. The conventional solution is two fold: solve the SE problem (1) at a faster rate in accordance with the newly added VER dynamics and (2) for the entire power grid topology including the transmission and distribution systems. Such an approach results in exponentially growing problem sets which need to be solver at faster rates. This work seeks to address these two simultaneous requirements and builds upon two recent SE methods which incorporate event-triggering such that the state estimator is only called in the case of considerable novelty in the evolution of the system state. The first method incorporates only event-triggering while the second adds the concept of tracking. Both SE methods are demonstrated on the standard IEEE 14-bus system and the results are observed for a specific bus for two difference scenarios: (1) a spike in the wind power injection and (2) ramp events with higher variability. Relative to traditional state estimation, the numerical case studies showed that the proposed methods can result in computational time reductions of 90%. These results were supported by a theoretical discussion of the computational complexity of three SE techniques. The work concludes that the proposed SE techniques demonstrate practical improvements to the computational complexity of

  9. Translational use of event-related potentials to assess circuit integrity in ASD.

    PubMed

    Modi, Meera E; Sahin, Mustafa

    2017-03-01

    Deficits in social cognition are the defining characteristic of autism spectrum disorder (ASD). Social cognition requires the integration of several neural circuits in a time-sensitive fashion, so impairments in social interactions could arise as a result of alterations in network connectivity. Electroencephalography (EEG) has revealed abnormalities in event related potentials (ERPs) evoked by auditory and visual sensory stimuli in humans with ASD, indicating disruption of neural connectivity. Similar abnormalities in sensory-evoked ERPs have been observed in animal models of ASD, suggesting that ERPs have the potential to provide a translational biomarker of the disorder. People with ASD also have abnormal ERPs in response to auditory and visual social stimuli, demonstrating functional disruption of the social circuit. To assess the integrity of the social circuit and characterize biomarkers of circuit dysfunction, novel EEG paradigms that use social stimuli to induce ERPs should be developed for use in animal models. The identification of a socially-relevant ERP that is consistent in animal models and humans would facilitate the development of pharmacological treatment strategies for the social impairments in ASD and other neuropsychiatric disorders.

  10. Exact event-driven implementation for recurrent networks of stochastic perfect integrate-and-fire neurons.

    PubMed

    Taillefumier, Thibaud; Touboul, Jonathan; Magnasco, Marcelo

    2012-12-01

    In vivo cortical recording reveals that indirectly driven neural assemblies can produce reliable and temporally precise spiking patterns in response to stereotyped stimulation. This suggests that despite being fundamentally noisy, the collective activity of neurons conveys information through temporal coding. Stochastic integrate-and-fire models delineate a natural theoretical framework to study the interplay of intrinsic neural noise and spike timing precision. However, there are inherent difficulties in simulating their networks' dynamics in silico with standard numerical discretization schemes. Indeed, the well-posedness of the evolution of such networks requires temporally ordering every neuronal interaction, whereas the order of interactions is highly sensitive to the random variability of spiking times. Here, we answer these issues for perfect stochastic integrate-and-fire neurons by designing an exact event-driven algorithm for the simulation of recurrent networks, with delayed Dirac-like interactions. In addition to being exact from the mathematical standpoint, our proposed method is highly efficient numerically. We envision that our algorithm is especially indicated for studying the emergence of polychronized motifs in networks evolving under spike-timing-dependent plasticity with intrinsic noise.

  11. Neural correlates of event clusters in past and future thoughts: How the brain integrates specific episodes with autobiographical knowledge.

    PubMed

    Demblon, Julie; Bahri, Mohamed Ali; D'Argembeau, Arnaud

    2016-02-15

    When remembering the past or envisioning the future, events often come to mind in organized sequences or stories rather than in isolation from one another. The aim of the present fMRI study was to investigate the neural correlates of such event clusters. Participants were asked to consider pairs of specific past or future events: in one condition, the two events were part of the same event cluster (i.e., they were thematically and/or causally related to each other), whereas in another condition the two events only shared a surface feature (i.e., their location); a third condition was also included, in which the two events were unrelated to each other. The results showed that the processing of past and future events that were part of a same cluster was associated with higher activation in the medial prefrontal cortex (PFC), rostrolateral PFC, and left lateral temporal and parietal regions, compared to the two other conditions. Furthermore, functional connectivity analyses revealed an increased coupling between these cortical regions. These findings suggest that largely similar processes are involved in organizing events in clusters for the past and the future. The medial and rostrolateral PFC might play a pivotal role in mediating the integration of specific events with conceptual autobiographical knowledge 'stored' in more posterior regions. Through this integrative process, this set of brain regions might contribute to the attribution of an overarching meaning to representations of specific past and future events, by contextualizing them with respect to personal goals and general knowledge about one's life story.

  12. Characterization of aerosol events based on the column integrated optical aerosol properties and polarimetric measurements

    NASA Astrophysics Data System (ADS)

    Mandija, Florian; Markowicz, Krzysztof; Zawadzka, Olga

    2016-12-01

    Aerosol optical properties are very useful tools for analyzing their radiative effects, which are directly or indirectly related to the global radiation budget. Investigation of column-integrated aerosol optical properties is a worldwide and well-accepted method. The introduction of new methodologies, like those of operation with polarimetric measurements, represent a new challenge to interpret the measurement data and give more detailed information about the aerosol events and their characteristics. Aerosol optical properties during the period June - August 2015 in AERONET Strzyzow station in Poland were analyzed. The aerosol properties like aerosol optical depth, Ångström exponent, fine mode fraction, fine mode contribution on AOD, asymmetry parameter, single scattering angle are analyzed synergistically with the polarimetric measurements of the degree of polarization in different solar zenith and zenith viewing angles at several wavelengths. The overall results show that aerosol events in Strzyzow were characterized mostly by fine mode aerosols. Backward-trajectories suggest that the majority of air masses come from the west. The principal component of the aerosol load was urban/industrial contamination, especially from the inner part of the continent. Additionally, the maximal values of the degree of linear polarization were found to be dependent on the solar zenith and zenith viewing angles and aerosol optical properties like aerosol optical depth and Ångström exponent. These dependencies were further analyzed in a specific case with very high mean values of AOD500 (0.59) and AE440-870 (1.91). The diurnal variations of aerosol optical properties investigated during this special case, suggest that biomass burning products are the main cause of that aerosol load over the stations.

  13. DOUBLE POWER LAWS IN THE EVENT-INTEGRATED SOLAR ENERGETIC PARTICLE SPECTRUM

    SciTech Connect

    Zhao, Lulu; Zhang, Ming; Rassoul, Hamid K.

    2016-04-10

    A double power law or a power law with exponential rollover at a few to tens of MeV nucleon{sup −1} of the event-integrated differential spectra has been reported in many solar energetic particle (SEP) events. The rollover energies per nucleon of different elements correlate with a particle's charge-to-mass ratio (Q/A). The probable causes are suggested as residing in shock finite lifetimes, shock finite sizes, shock geometry, and an adiabatic cooling effect. In this work, we conduct a numerical simulation to investigate a particle's transport process in the inner heliosphere. We solve the focused transport equation using a time-backward Markov stochastic approach. The convection, magnetic focusing, adiabatic cooling effect, and pitch-angle scattering are included. The effects that the interplanetary turbulence imposes on the shape of the resulting SEP spectra are examined. By assuming a pure power-law differential spectrum at the Sun, a perfect double-power-law feature with a break energy ranging from 10 to 120 MeV nucleon{sup −1} is obtained at 1 au. We found that the double power law of the differential energy spectrum is a robust result of SEP interplanetary propagation. It works for many assumptions of interplanetary turbulence spectra that give various forms of momentum dependence of a particle's mean free path. The different spectral shapes in low-energy and high-energy ends are not just a transition from the convection-dominated propagation to diffusion-dominated propagation.

  14. An integrated biomarker, isotopic and palaeoenvironmental study through the Late Permian event at Lusitaniadalen, Spitsbergen

    NASA Astrophysics Data System (ADS)

    Nabbefeld, Birgit; Grice, Kliti; Twitchett, Richard J.; Summons, Roger E.; Hays, Lindsay; Böttcher, Michael E.; Asif, Muhammad

    2010-03-01

    The largest extinction of the Phanerozoic occurred near the Permian/Triassic (P/Tr) boundary some 252 Ma ago. Several scenarios and drivers have been proposed for this event. Here we report for the first time an integrated study comprising sedimentological data, biomarker distributions/abundances and selected stable carbon and hydrogen isotopes along with bulk isotopes (δ 34S pyrite, δ 13C carb, δ 13C org) for a Late Permian section from Lusitaniadalen, Spitsbergen, Norway. Sedimentological and geochemical data support a marine transgression and collapse of the marine ecosystem in the Late Permian. Strong evidence for waxing and waning of photic zone euxinia throughout the Late Permian is provided by Chlorobiaceae-derived biomarkers (including δ 13C data) and δ 34S pyrite, implying multiple phases of H 2S outgassing and potentially several pulses of extinction. A rapid decrease in abundance of various land-plant biomarkers prior to the marine collapse event indicates a dramatic decline of land-plants during the Late Permian and/or increasing distance from palaeoshoreline as a consequence of sea level rise. Changes in δD of selected biomarkers also suggest a change in source of organic matter (OM) or sea level rise. We also found biomarker and isotopic evidence for a phytoplanktonic bloom triggered by eutrophication as a consequence of the marine collapse. Compound specific isotope analyses (CSIA) of algal and land-plant-derived biomarkers, as well as δ 13C of carbonate and bulk OM provide strong evidence for synchronous changes in δ 13C of marine and atmospheric CO 2, attributed to a 13C-depleted source. The source could be associated with isotopically depleted methane released from the melting of gas clathrates and/or from respired OM, due to collapse of the marine ecosystem.

  15. The influence of temporal asynchrony on multisensory integration in the processing of asynchronous audio-visual stimuli of real-world events: an event-related potential study.

    PubMed

    Liu, B; Jin, Z; Wang, Z; Gong, C

    2011-03-10

    In this study, we manipulated the temporal asynchrony between auditory and visual inputs, and contrasted event-related potentials (ERPs) evoked by multisensory stimuli with the summation of the ERPs evoked by unisensory-auditory (A) and unisensory-visual (V) stimuli with the same temporal asynchrony. Our goal was to investigate the influence of temporal asynchrony on multisensory integration. In our experiment, the auditory and visual inputs in the multisensory stimuli had a stimulus onset asynchrony (SOA) of -300 ms, 0 ms, or 300 ms. The results suggested that when the auditory and visual inputs were synchronous, multisensory integrations would occur in the time windows of 110-160 ms, 210-250 ms and 300-350 ms after auditory onset. When the auditory onset preceded the critical action onset by 300 ms, multisensory integrations were involved in the time windows of 110-160 ms and 300-350 ms after auditory onset. When the critical action onset preceded the auditory onset by 300 ms, multisensory integrations would occur in the time windows of 110-160 ms, 210-250 ms, 290-320 ms and 350-400 ms after auditory onset. In addition, in the time windows of 110-160 ms and 210-250 ms, the integrations were stronger when the auditory and visual inputs were synchronous, and in the time window of 250-400 ms, multisensory integrations would be different as the SOAs were different. It was suggested that multisensory integration would occur regardless of the asynchrony between auditory and visual inputs, and multisensory integration could be influenced by temporal asynchrony.

  16. The Knowledge-Integrated Network Biomarkers Discovery for Major Adverse Cardiac Events

    PubMed Central

    Jin, Guangxu; Zhou, Xiaobo; Wang, Honghui; Zhao, Hong; Cui, Kemi; Zhang, Xiang-Sun; Chen, Luonan; Hazen, Stanley L.; Li, King; Wong, Stephen T. C.

    2010-01-01

    The mass spectrometry (MS) technology in clinical proteomics is very promising for discovery of new biomarkers for diseases management. To overcome the obstacles of data noises in MS analysis, we proposed a new approach of knowledge-integrated biomarker discovery using data from Major Adverse Cardiac Events (MACE) patients. We first built up a cardiovascular-related network based on protein information coming from protein annotations in Uniprot, protein–protein interaction (PPI), and signal transduction database. Distinct from the previous machine learning methods in MS data processing, we then used statistical methods to discover biomarkers in cardiovascular-related network. Through the tradeoff between known protein information and data noises in mass spectrometry data, we finally could firmly identify those high-confident biomarkers. Most importantly, aided by protein–protein interaction network, that is, cardiovascular-related network, we proposed a new type of biomarkers, that is, network biomarkers, composed of a set of proteins and the interactions among them. The candidate network biomarkers can classify the two groups of patients more accurately than current single ones without consideration of biological molecular interaction. PMID:18665624

  17. Differential effects of motor efference copies and proprioceptive information on response evaluation processes.

    PubMed

    Stock, Ann-Kathrin; Wascher, Edmund; Beste, Christian

    2013-01-01

    It is well-kown that sensory information influences the way we execute motor responses. However, less is known about if and how sensory and motor information are integrated in the subsequent process of response evaluation. We used a modified Simon Task to investigate how these streams of information are integrated in response evaluation processes, applying an in-depth neurophysiological analysis of event-related potentials (ERPs), time-frequency decomposition and sLORETA. The results show that response evaluation processes are differentially modulated by afferent proprioceptive information and efference copies. While the influence of proprioceptive information is mediated via oscillations in different frequency bands, efference copy based information about the motor execution is specifically mediated via oscillations in the theta frequency band. Stages of visual perception and attention were not modulated by the interaction of proprioception and motor efference copies. Brain areas modulated by the interactive effects of proprioceptive and efference copy based information included the middle frontal gyrus and the supplementary motor area (SMA), suggesting that these areas integrate sensory information for the purpose of response evaluation. The results show how motor response evaluation processes are modulated by information about both the execution and the location of a response.

  18. Integration of hard copy and soft copy exploitation

    NASA Astrophysics Data System (ADS)

    Fultz, Roy C., Jr.

    1996-11-01

    Exploitation of remotely sensed and aerially derived imagery has, in the past, been primarily performed through the use of analog light tables, by displaying individual pieces or rolls of imagery over a brightly lit surface to allow light through the nonopaque surface of the film medium. The interpreter would then peer through optical viewing scopes allowing him (or her) to analyze the imagery. Over the course of the last two decades, digital data, or as it is better known, "softcopy imagery," has for many become the desired path which technology has dictated. Softcopy imagery offers many benefits, such as the ability to manipulate imagery in ways analog workstations cannot and were never designed to do. Functions which can be performed on softcopy imagery are endless and growing constantly: image spatial rectification, pixel manipulation, image contrast, and brightness enhancements. All are performed by the running of algorithmic equations to manipulate the digital data. It has become evident that in the future a large portion of imagery analysis will be performed by softcopy. However, studies indicate that aerial imagery will continue to be acquired via hardcopy means for many civil, educational, and commercial applications in the foreseeable future, making it clear that any large scale transformation from hardcopy to softcopy will not be feasible for a long time to come. A major issue dictating the slow-down in this transition is the over 35 years of hardcopy imagery archived and housed in facilities throughout the world, including the recently declassified "Corona" satellite imagery which will provide a wealth of hardcopy data for use by ecologists and conservationists. Yes, the technology to transfer hardcopy to softcopy exists, but the time and cost required to complete this task would be phenomenal and, in many cases, when digitization and storage become affordable, it still may prove beneficial to retain the imagery in a hardcopy form for retention of the highest quality resolution. An analogy which I feel best portrays this dilemma is the automobile-eventually all automobiles will be electric or hydrogen driven but the time and cost involved in the transformation predicts a slow progression. Since a predominate amount of imagery analysis, especially in the intelligence community, is the comparison ofnew imagery data to that of archived imagery in order to detect changes or to monitor progressions, it is conceivable that the majority of imagery analysts will be using a combination of hardcopy and softcopy workstations in order to facilitate analysis. The incorporation of hardcopy and softcopy functions into one workstation is the most cost effective and time essential means in which in-depth analysis can be performed.

  19. Business Process Design Method Based on Business Event Model for Enterprise Information System Integration

    NASA Astrophysics Data System (ADS)

    Kobayashi, Takashi; Komoda, Norihisa

    The traditional business process design methods, in which the usecase is the most typical, have no useful framework to design the activity sequence with. Therefore, the design efficiency and quality vary widely according to the designer’s experience and skill. In this paper, to solve this problem, we propose the business events and their state transition model (a basic business event model) based on the language/action perspective, which is the result in the cognitive science domain. In the business process design, using this model, we decide event occurrence conditions so that every event synchronizes with each other. We also propose the design pattern to decide the event occurrence condition (a business event improvement strategy). Lastly, we apply the business process design method based on the business event model and the business event improvement strategy to the credit card issue process and estimate its effect.

  20. Screening somatic cell nuclear transfer parameters for generation of transgenic cloned cattle with intragenomic integration of additional gene copies that encode bovine adipocyte-type fatty acid-binding protein (A-FABP).

    PubMed

    Guo, Yong; Li, Hejuan; Wang, Ying; Yan, Xingrong; Sheng, Xihui; Chang, Di; Qi, Xiaolong; Wang, Xiangguo; Liu, Yunhai; Li, Junya; Ni, Hemin

    2017-02-01

    Somatic cell nuclear transfer (SCNT) is frequently used to produce transgenic cloned livestock, but it is still associated with low success rates. To our knowledge, we are the first to report successful production of transgenic cattle that overexpress bovine adipocyte-type fatty acid binding proteins (A-FABPs) with the aid of SCNT. Intragenomic integration of additional A-FABP gene copies has been found to be positively correlated with the intramuscular fat content in different farm livestock species. First, we optimized the cloning parameters to produce bovine embryos integrated with A-FABP by SCNT, such as applied voltage field strength and pulse duration for electrofusion, morphology and size of donor cells, and number of donor cells passages. Then, bovine fibroblast cells from Qinchuan cattle were transfected with A-FABP and used as donor cells for SCNT. Hybrids of Simmental and Luxi local cattle were selected as the recipient females for A-FABP transgenic SCNT-derived embryos. The results showed that a field strength of 2.5 kV/cm with two 10-μs duration electrical pulses was ideal for electrofusion, and 4-6th generation circular smooth type donor cells with diameters of 15-25 μm were optimal for producing transgenic bovine embryos by SCNT, and resulted in higher fusion (80%), cleavage (73%), and blastocyst (27%) rates. In addition, we obtained two transgenic cloned calves that expressed additional bovine A-FABP gene copies, as detected by PCR-amplified cDNA sequencing. We proposed a set of optimal protocols to produce transgenic SCNT-derived cattle with intragenomic integration of ectopic A-FABP-inherited exon sequences.

  1. Integrated stratigraphy of the Cenomanian-Turonian boundary interval: improving understanding of Oceanic Anoxic Events

    NASA Astrophysics Data System (ADS)

    Jarvis, Ian

    2014-05-01

    The Cenomanian-Turonian boundary (CTB) interval ~ 94 Ma represented a period of major global palaeoenvironmental change. Increasingly detailed multidisciplinary studies integrating sedimentological, palaeontological and geochemical data from multiple basins, are enabling the development of refined but complex models that aid understanding of the mechanisms driving changes in ocean productivity and climate. This paper reviews some of the exciting new developments in this field. Facies change characterizes the CTB interval in most areas. In the Chalk seas of northern Europe, a widespead hiatus was followed by the deposition of clay-rich organic-lean beds of the Plenus Marl and its equivalents, and then nodular chalks. In the North Sea basin and its onshore extension in eastern England and northern Germany, black shales of the Black Band (Blodøks Formation, Hasseltal Formation) occur. Similarly, in northern Tethys, a brief interval of black shale accumulation within a predominantly carbonate succession, is exemplified by the Niveau Thomel in the Vocontian Basin (SE France), and the Livello Bonarelli in Italy. Widespread deposition of organic-rich marine sediments during CTB times led to 12C depletion in surface carbon reservoirs (oceans, atmosphere, biosphere), and a large positive global δ13C excursion preserved in marine carbonates and both marine and terrestrial organic matter (Oceanic Anoxic Event 2). Significant biotic turnover characterises the boundary interval, and inter-regional correlation may be achieved at high resolution using integrated biostratigraphy employing macrofossils (ammonites, inoceramid bivalves), microfossils (planktonic foraminifera, dinoflagellate cysts) and calcareous nannofossils. Correlations can be tested against those based on comparison of δ13C profiles - carbon isotope chemostratigraphy, supplemented by oxygen isotope and elemental data. Interpretation of paired carbonate - organic matter δ13C data from multiple CTB sections

  2. PennCNV: An integrated hidden Markov model designed for high-resolution copy number variation detection in whole-genome SNP genotyping data

    PubMed Central

    Wang, Kai; Li, Mingyao; Hadley, Dexter; Liu, Rui; Glessner, Joseph; Grant, Struan F.A.; Hakonarson, Hakon; Bucan, Maja

    2007-01-01

    Comprehensive identification and cataloging of copy number variations (CNVs) is required to provide a complete view of human genetic variation. The resolution of CNV detection in previous experimental designs has been limited to tens or hundreds of kilobases. Here we present PennCNV, a hidden Markov model (HMM) based approach, for kilobase-resolution detection of CNVs from Illumina high-density SNP genotyping data. This algorithm incorporates multiple sources of information, including total signal intensity and allelic intensity ratio at each SNP marker, the distance between neighboring SNPs, the allele frequency of SNPs, and the pedigree information where available. We applied PennCNV to genotyping data generated for 112 HapMap individuals; on average, we detected ∼27 CNVs for each individual with a median size of ∼12 kb. Excluding common rearrangements in lymphoblastoid cell lines, the fraction of CNVs in offspring not detected in parents (CNV-NDPs) was 3.3%. Our results demonstrate the feasibility of whole-genome fine-mapping of CNVs via high-density SNP genotyping. PMID:17921354

  3. An integrative approach to investigate the respective roles of single-nucleotide variants and copy-number variants in Attention-Deficit/Hyperactivity Disorder

    PubMed Central

    de Araújo Lima, Leandro; Feio-dos-Santos, Ana Cecília; Belangero, Sintia Iole; Gadelha, Ary; Bressan, Rodrigo Affonseca; Salum, Giovanni Abrahão; Pan, Pedro Mario; Moriyama, Tais Silveira; Graeff-Martins, Ana Soledade; Tamanaha, Ana Carina; Alvarenga, Pedro; Krieger, Fernanda Valle; Fleitlich-Bilyk, Bacy; Jackowski, Andrea Parolin; Brietzke, Elisa; Sato, João Ricardo; Polanczyk, Guilherme Vanoni; Mari, Jair de Jesus; Manfro, Gisele Gus; do Rosário, Maria Conceição; Miguel, Eurípedes Constantino; Puga, Renato David; Tahira, Ana Carolina; Souza, Viviane Neri; Chile, Thais; Gouveia, Gisele Rodrigues; Simões, Sérgio Nery; Chang, Xiao; Pellegrino, Renata; Tian, Lifeng; Glessner, Joseph T.; Hashimoto, Ronaldo Fumio; Rohde, Luis Augusto; Sleiman, Patrick M.A.; Hakonarson, Hakon; Brentani, Helena

    2016-01-01

    Many studies have attempted to investigate the genetic susceptibility of Attention-Deficit/Hyperactivity Disorder (ADHD), but without much success. The present study aimed to analyze both single-nucleotide and copy-number variants contributing to the genetic architecture of ADHD. We generated exome data from 30 Brazilian trios with sporadic ADHD. We also analyzed a Brazilian sample of 503 children/adolescent controls from a High Risk Cohort Study for the Development of Childhood Psychiatric Disorders, and also previously published results of five CNV studies and one GWAS meta-analysis of ADHD involving children/adolescents. The results from the Brazilian trios showed that cases with de novo SNVs tend not to have de novo CNVs and vice-versa. Although the sample size is small, we could also see that various comorbidities are more frequent in cases with only inherited variants. Moreover, using only genes expressed in brain, we constructed two “in silico” protein-protein interaction networks, one with genes from any analysis, and other with genes with hits in two analyses. Topological and functional analyses of genes in this network uncovered genes related to synapse, cell adhesion, glutamatergic and serotoninergic pathways, both confirming findings of previous studies and capturing new genes and genetic variants in these pathways. PMID:26947246

  4. An integrative approach to investigate the respective roles of single-nucleotide variants and copy-number variants in Attention-Deficit/Hyperactivity Disorder.

    PubMed

    Lima, Leandro de Araújo; Feio-dos-Santos, Ana Cecília; Belangero, Sintia Iole; Gadelha, Ary; Bressan, Rodrigo Affonseca; Salum, Giovanni Abrahão; Pan, Pedro Mario; Moriyama, Tais Silveira; Graeff-Martins, Ana Soledade; Tamanaha, Ana Carina; Alvarenga, Pedro; Krieger, Fernanda Valle; Fleitlich-Bilyk, Bacy; Jackowski, Andrea Parolin; Brietzke, Elisa; Sato, João Ricardo; Polanczyk, Guilherme Vanoni; Mari, Jair de Jesus; Manfro, Gisele Gus; do Rosário, Maria Conceição; Miguel, Eurípedes Constantino; Puga, Renato David; Tahira, Ana Carolina; Souza, Viviane Neri; Chile, Thais; Gouveia, Gisele Rodrigues; Simões, Sérgio Nery; Chang, Xiao; Pellegrino, Renata; Tian, Lifeng; Glessner, Joseph T; Hashimoto, Ronaldo Fumio; Rohde, Luis Augusto; Sleiman, Patrick M A; Hakonarson, Hakon; Brentani, Helena

    2016-03-07

    Many studies have attempted to investigate the genetic susceptibility of Attention-Deficit/Hyperactivity Disorder (ADHD), but without much success. The present study aimed to analyze both single-nucleotide and copy-number variants contributing to the genetic architecture of ADHD. We generated exome data from 30 Brazilian trios with sporadic ADHD. We also analyzed a Brazilian sample of 503 children/adolescent controls from a High Risk Cohort Study for the Development of Childhood Psychiatric Disorders, and also previously published results of five CNV studies and one GWAS meta-analysis of ADHD involving children/adolescents. The results from the Brazilian trios showed that cases with de novo SNVs tend not to have de novo CNVs and vice-versa. Although the sample size is small, we could also see that various comorbidities are more frequent in cases with only inherited variants. Moreover, using only genes expressed in brain, we constructed two "in silico" protein-protein interaction networks, one with genes from any analysis, and other with genes with hits in two analyses. Topological and functional analyses of genes in this network uncovered genes related to synapse, cell adhesion, glutamatergic and serotoninergic pathways, both confirming findings of previous studies and capturing new genes and genetic variants in these pathways.

  5. Copy Machine Art.

    ERIC Educational Resources Information Center

    Sommer, Jean

    1984-01-01

    Images created with copy machines make children feel successful, as their work acquires the authority of being printed. Students can learn advanced processes like electrostatic image-making and can get involved in projects like making collages. They acquire an appreciation of design and of two-dimensional composition. (CS)

  6. The influence of matching degrees of synchronous auditory and visual information in videos of real-world events on cognitive integration: an event-related potential study.

    PubMed

    Liu, B; Wang, Z; Li, J

    2011-10-27

    In this article, we aim to study the influence of matching degrees of synchronous natural auditory and visual information on cognitive integration. Videos with matched, moderately matched, and mismatched audio-visual information were used as stimuli. The results showed that videos with moderately matched audio-visual information could elicit N400, P600, and late negativity (LN) effects, while videos with mismatched audio-visual information could elicit N400 and late negativity effects as compared with those with matched audio-visual information. It was further proven that N400 might reflect the connection process during multisensory integration, and P600 was more related to the evaluation process on the matching degrees of the audio-visual information in videos. Late negativity under the mismatched condition might be the combination of late frontal negativity (LFN) and late posterior negativity (LPN), which reflected the attention reallocating process and the recognition process, while late negativity under the moderately matched condition might be the LPN, which was related to the recognition process in the human brain. It was demonstrated that cognitive integration of synchronous audio-visual information would be modulated by different matching degrees of audio-visual information as indexed by different event-related potential (ERP) effects.

  7. Polycomb repressive complex 1 provides a molecular explanation for repeat copy number dependency in FSHD muscular dystrophy.

    PubMed

    Casa, Valentina; Runfola, Valeria; Micheloni, Stefano; Aziz, Arif; Dilworth, F Jeffrey; Gabellini, Davide

    2016-12-30

    Repression of repetitive elements is crucial to preserve genome integrity and has been traditionally ascribed to constitutive heterochromatin pathways. FacioScapuloHumeral Muscular Dystrophy (FSHD), one of the most common myopathies, is characterized by a complex interplay of genetic and epigenetic events. The main FSHD form is linked to a reduced copy number of the D4Z4 macrosatellite repeat on 4q35, causing loss of silencing and aberrant expression of the D4Z4-embedded DUX4 gene leading to disease. By an unknown mechanism, D4Z4 copy-number correlates with FSHD phenotype. Here we show that the DUX4 proximal promoter (DUX4p) is sufficient to nucleate the enrichment of both constitutive and facultative heterochromatin components and to mediate a copy-number dependent gene silencing. We found that both the CpG/GC dense DNA content and the repetitive nature of DUX4p arrays are important for their repressive ability. We showed that DUX4p mediates a copy number-dependent Polycomb Repressive Complex 1 (PRC1) recruitment, which is responsible for the copy-number dependent gene repression. Overall, we directly link genetic and epigenetic defects in FSHD by proposing a novel molecular explanation for the copy number-dependency in FSHD pathogenesis, and offer insight into the molecular functions of repeats in chromatin regulation.

  8. Method for critical software event execution reliability in high integrity software

    SciTech Connect

    Kidd, M.E.

    1997-11-01

    This report contains viewgraphs on a method called SEER, which provides a high level of confidence that critical software driven event execution sequences faithfully exceute in the face of transient computer architecture failures in both normal and abnormal operating environments.

  9. Temperature control system for the study of single event effects in integrated circuits using a cyclotron accelerator

    NASA Astrophysics Data System (ADS)

    Bakerenkov, A. S.; Belyakov, V. V.; Kozyukov, A. E.; Pershenkov, V. S.; Solomatin, A. V.; Shurenkov, V. V.

    2015-02-01

    The temperature control system for the study of single event disruptions produced by hard ion impacts in integrated circuits is described. Heating and cooling of the irradiated device are achieved using thermoelectric modules (Peltier modules). The thermodynamic performance of the system is estimated. The technique for the numerical estimation of the main parameters of the temperature control system for cooling and heating is considered. The results of a test of the system in a vacuum cell of an accelerator are presented.

  10. Final Scientific Report, Integrated Seismic Event Detection and Location by Advanced Array Processing

    SciTech Connect

    Kvaerna, T.; Gibbons. S.J.; Ringdal, F; Harris, D.B.

    2007-01-30

    In the field of nuclear explosion monitoring, it has become a priority to detect, locate, and identify seismic events down to increasingly small magnitudes. The consideration of smaller seismic events has implications for a reliable monitoring regime. Firstly, the number of events to be considered increases greatly; an exponential increase in naturally occurring seismicity is compounded by large numbers of seismic signals generated by human activity. Secondly, the signals from smaller events become more difficult to detect above the background noise and estimates of parameters required for locating the events may be subject to greater errors. Thirdly, events are likely to be observed by a far smaller number of seismic stations, and the reliability of event detection and location using a very limited set of observations needs to be quantified. For many key seismic stations, detection lists may be dominated by signals from routine industrial explosions which should be ascribed, automatically and with a high level of confidence, to known sources. This means that expensive analyst time is not spent locating routine events from repeating seismic sources and that events from unknown sources, which could be of concern in an explosion monitoring context, are more easily identified and can be examined with due care. We have obtained extensive lists of confirmed seismic events from mining and other artificial sources which have provided an excellent opportunity to assess the quality of existing fully-automatic event bulletins and to guide the development of new techniques for online seismic processing. Comparing the times and locations of confirmed events from sources in Fennoscandia and NW Russia with the corresponding time and location estimates reported in existing automatic bulletins has revealed substantial mislocation errors which preclude a confident association of detected signals with known industrial sources. The causes of the errors are well understood and are

  11. Vy-PER: eliminating false positive detection of virus integration events in next generation sequencing data.

    PubMed

    Forster, Michael; Szymczak, Silke; Ellinghaus, David; Hemmrich, Georg; Rühlemann, Malte; Kraemer, Lars; Mucha, Sören; Wienbrandt, Lars; Stanulla, Martin; Franke, Andre

    2015-07-13

    Several pathogenic viruses such as hepatitis B and human immunodeficiency viruses may integrate into the host genome. These virus/host integrations are detectable using paired-end next generation sequencing. However, the low number of expected true virus integrations may be difficult to distinguish from the noise of many false positive candidates. Here, we propose a novel filtering approach that increases specificity without compromising sensitivity for virus/host chimera detection. Our detection pipeline termed Vy-PER (Virus integration detection bY Paired End Reads) outperforms existing similar tools in speed and accuracy. We analysed whole genome data from childhood acute lymphoblastic leukemia (ALL), which is characterised by genomic rearrangements and usually associated with radiation exposure. This analysis was motivated by the recently reported virus integrations at genomic rearrangement sites and association with chromosomal instability in liver cancer. However, as expected, our analysis of 20 tumour and matched germline genomes from ALL patients finds no significant evidence for integrations by known viruses. Nevertheless, our method eliminates 12,800 false positives per genome (80× coverage) and only our method detects singleton human-phiX174-chimeras caused by optical errors of the Illumina HiSeq platform. This high accuracy is useful for detecting low virus integration levels as well as non-integrated viruses.

  12. Vy-PER: eliminating false positive detection of virus integration events in next generation sequencing data

    PubMed Central

    Forster, Michael; Szymczak, Silke; Ellinghaus, David; Hemmrich, Georg; Rühlemann, Malte; Kraemer, Lars; Mucha, Sören; Wienbrandt, Lars; Stanulla, Martin; Franke, Andre

    2015-01-01

    Several pathogenic viruses such as hepatitis B and human immunodeficiency viruses may integrate into the host genome. These virus/host integrations are detectable using paired-end next generation sequencing. However, the low number of expected true virus integrations may be difficult to distinguish from the noise of many false positive candidates. Here, we propose a novel filtering approach that increases specificity without compromising sensitivity for virus/host chimera detection. Our detection pipeline termed Vy-PER (Virus integration detection bY Paired End Reads) outperforms existing similar tools in speed and accuracy. We analysed whole genome data from childhood acute lymphoblastic leukemia (ALL), which is characterised by genomic rearrangements and usually associated with radiation exposure. This analysis was motivated by the recently reported virus integrations at genomic rearrangement sites and association with chromosomal instability in liver cancer. However, as expected, our analysis of 20 tumour and matched germline genomes from ALL patients finds no significant evidence for integrations by known viruses. Nevertheless, our method eliminates 12,800 false positives per genome (80× coverage) and only our method detects singleton human-phiX174-chimeras caused by optical errors of the Illumina HiSeq platform. This high accuracy is useful for detecting low virus integration levels as well as non-integrated viruses. PMID:26166306

  13. Audiovisual Speech Integration in Pervasive Developmental Disorder: Evidence from Event-Related Potentials

    ERIC Educational Resources Information Center

    Magnee, Maurice J. C. M.; de Gelder, Beatrice; van Engeland, Herman; Kemner, Chantal

    2008-01-01

    Background: Integration of information from multiple sensory sources is an important prerequisite for successful social behavior, especially during face-to-face conversation. It has been suggested that communicative impairments among individuals with pervasive developmental disorders (PDD) might be caused by an inability to integrate synchronously…

  14. Estimation of integrated public risks for nonseismic external events affecting the Savannah River Site

    SciTech Connect

    Durant, W.S.; robinette, R.J.; Kirchner, J.R.

    1994-03-01

    In essence, this study was envisioned as the ``combination`` of existing accident dose and risk calculations from safety analyses of individual facilities. However, because of the extended time period over which the safety analyses were prepared, calculational assumptions and methodologies differed between the analyses. The scope of this study therefore included the standardization of assumptions and calculations as necessary to insure that the analytical logic was consistent for all the facilities. Each of the nonseismic external events considered in the analyses are addressed in individual sections in this report. In Section 2, extreme straight-line winds are examined. Section 3 addresses tornadoes, and Section 4 addresses other external events [floods, other extreme weather events (lightning, hail, and extremes in temperature or precipitation), vehicle impact, accidents involving adjacent facilities, aircraft impact, and meteorite impact]. Section 5 provides a summary of the general conclusions of the report.

  15. The spatial reliability of task-irrelevant sounds modulates bimodal audiovisual integration: An event-related potential study.

    PubMed

    Li, Qi; Yu, Hongtao; Wu, Yan; Gao, Ning

    2016-08-26

    The integration of multiple sensory inputs is essential for perception of the external world. The spatial factor is a fundamental property of multisensory audiovisual integration. Previous studies of the spatial constraints on bimodal audiovisual integration have mainly focused on the spatial congruity of audiovisual information. However, the effect of spatial reliability within audiovisual information on bimodal audiovisual integration remains unclear. In this study, we used event-related potentials (ERPs) to examine the effect of spatial reliability of task-irrelevant sounds on audiovisual integration. Three relevant ERP components emerged: the first at 140-200ms over a wide central area, the second at 280-320ms over the fronto-central area, and a third at 380-440ms over the parieto-occipital area. Our results demonstrate that ERP amplitudes elicited by audiovisual stimuli with reliable spatial relationships are larger than those elicited by stimuli with inconsistent spatial relationships. In addition, we hypothesized that spatial reliability within an audiovisual stimulus enhances feedback projections to the primary visual cortex from multisensory integration regions. Overall, our findings suggest that the spatial linking of visual and auditory information depends on spatial reliability within an audiovisual stimulus and occurs at a relatively late stage of processing.

  16. Virus transcript levels and cell growth rates after naturally occurring HPV16 integration events in basal cervical keratinocytes.

    PubMed

    Scarpini, Cinzia G; Groves, Ian J; Pett, Mark R; Ward, Dawn; Coleman, Nicholas

    2014-07-01

    Cervical carcinogenesis is characterized by a clonal selection process in which the high-risk human papillomavirus (HRHPV) genome usually changes from the extra-chromosomal (episomal) state seen in productive infections to DNA that is integrated into host chromosomes. However, it is not clear whether all HRHPV integration events provide cells with a selective growth advantage compared with the episome-containing cells from which they originate. It is also unclear whether selection of cells containing a particular integrant from a mixed population simply reflects the highest levels of virus oncogene expression or has additional determinants. These early events in cervical carcinogenesis cannot readily be addressed by cross-sectional studies of clinical samples. We used the W12 model system to generate a panel of cervical squamous cell clones that were derived from an identical background under non-competitive conditions and differed only by the genomic site of HPV16 integration. Compared with the 'baseline' episome-containing cells from which they were isolated, only 9/17 clones (53%) showed significantly greater growth rates and only 7/17 (41%) showed significantly greater expression of the major virus oncogenes E7/E6. There were significant variations in levels of HPV16 transcription per DNA template, changes that were associated with histone modifications in the integrated virus chromatin. Cell growth rates showed only weak and non-significant associations with protein and mRNA levels for E7, E6, and the mean E7/E6 values. We conclude that HPV16 integration in basal cervical cells does not necessarily lead to increased levels of virus oncogenes, or to a competitive growth advantage, when compared with the initiating episome-containing cells.

  17. Integrated Analysis of Genetic and Proteomic Data Identifies Biomarkers Associated with Adverse Events Following Smallpox Vaccination

    EPA Science Inventory

    Complex clinical outcomes, such as adverse reaction to vaccination, arise from the concerted interactions among the myriad components of a biological system. Therefore, comprehensive etiological models can be developed only through the integrated study of multiple types of experi...

  18. Integrating legacy data to understand agroecosystem regional dynamics to catastrophic events

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Multi-year extreme drought events are part of the history of the Earth system. Legacy data on the climate drivers, geomorphic features, and agroecosystem responses across a dynamically changing landscape throughout a region can provide important insights to a future where large-scale catastrophic ev...

  19. Magellan: a web based system for the integrated analysis of heterogeneous biological data and annotations; application to DNA copy number and expression data in ovarian cancer.

    PubMed

    Kingsley, Chris B; Kuo, Wen-Lin; Polikoff, Daniel; Berchuck, Andy; Gray, Joe W; Jain, Ajay N

    2007-02-05

    Recent advances in high throughput biological methods allow researchers to generate enormous amounts of data from a single experiment. In order to extract meaningful conclusions from this tidal wave of data, it will be necessary to develop analytical methods of sufficient power and utility. It is particularly important that biologists themselves be able to perform many of these analyses, such that their background knowledge of the experimental system under study can be used to interpret results and direct further inquiries. We have developed a web-based system, Magellan, which allows the upload, storage, and analysis of multivariate data and textual or numerical annotations. Data and annotations are treated as abstract entities, to maximize the different types of information the system can store and analyze. Annotations can be used in analyses/visualizations, as a means of subsetting data to reduce dimensionality, or as a means of projecting variables from one data type or data set to another. Analytical methods are deployed within Magellan such that new functionalities can be added in a straightforward fashion. Using Magellan, we performed an integrated analysis of genome-wide comparative genomic hybridization (CGH), mRNA expression, and clinical data from ovarian tumors. Analyses included the use of permutation-based methods to identify genes whose mRNA expression levels correlated with patient survival, a nearest neighbor classifier to predict patient survival from CGH data, and curated annotations such as genomic position and derived annotations such as statistical computations to explore the quantitative relationship between CGH and mRNA expression data.

  20. 11. Photographic copy of copy of Twin Lakes Outlet Works ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. Photographic copy of copy of Twin Lakes Outlet Works construction drawing dated January 15, 1951. Drawn by W.A. Doe for the Twin Lakes Reservoir and Canal Co. (copy in possession of Bureau of Reclamation, location of original unknown) 'AS CONSTRUCTED' PLANS OF 1949-1950, REHABILITATION OF TWIN LAKES RESERVOIR OUTLET WORKS, DETAILS OF UPSTREAM WING WALLS. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

  1. 12. Photographic copy of copy of Twin Lakes Outlet Works ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. Photographic copy of copy of Twin Lakes Outlet Works construction drawing dated January 15, 1951. Drawn by W.A. Doe for the Twin Lakes Reservoir and Canal Co. (copy in possession of Bureau of Reclamation, location of original unknown) 'AS CONSTRUCTED' PLANS OF 1949-50, REHABILITATION OF TWIN LAKES RESERVOIR OUTLET WORKS, DETAILS OF DISCHARGE BASIN. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

  2. Bayesian Analysis for Risk Assessment of Selected Medical Events in Support of the Integrated Medical Model Effort

    NASA Technical Reports Server (NTRS)

    Gilkey, Kelly M.; Myers, Jerry G.; McRae, Michael P.; Griffin, Elise A.; Kallrui, Aditya S.

    2012-01-01

    The Exploration Medical Capability project is creating a catalog of risk assessments using the Integrated Medical Model (IMM). The IMM is a software-based system intended to assist mission planners in preparing for spaceflight missions by helping them to make informed decisions about medical preparations and supplies needed for combating and treating various medical events using Probabilistic Risk Assessment. The objective is to use statistical analyses to inform the IMM decision tool with estimated probabilities of medical events occurring during an exploration mission. Because data regarding astronaut health are limited, Bayesian statistical analysis is used. Bayesian inference combines prior knowledge, such as data from the general U.S. population, the U.S. Submarine Force, or the analog astronaut population located at the NASA Johnson Space Center, with observed data for the medical condition of interest. The posterior results reflect the best evidence for specific medical events occurring in flight. Bayes theorem provides a formal mechanism for combining available observed data with data from similar studies to support the quantification process. The IMM team performed Bayesian updates on the following medical events: angina, appendicitis, atrial fibrillation, atrial flutter, dental abscess, dental caries, dental periodontal disease, gallstone disease, herpes zoster, renal stones, seizure, and stroke.

  3. Detecting specific health-related events using an integrated sensor system for vital sign monitoring.

    PubMed

    Adnane, Mourad; Jiang, Zhongwei; Choi, Samjin; Jang, Hoyoung

    2009-01-01

    In this paper, a new method for the detection of apnea/hypopnea periods in physiological data is presented. The method is based on the intelligent combination of an integrated sensor system for long-time cardiorespiratory signal monitoring and dedicated signal-processing packages. Integrated sensors are a PVDF film and conductive fabric sheets. The signal processing package includes dedicated respiratory cycle (RC) and QRS complex detection algorithms and a new method using the respiratory cycle variability (RCV) for detecting apnea/hypopnea periods in physiological data. Results show that our method is suitable for online analysis of long time series data.

  4. Developing Clinical Competency in Crisis Event Management: An Integrated Simulation Problem-Based Learning Activity

    ERIC Educational Resources Information Center

    Liaw, S. Y.; Chen, F. G.; Klainin, P.; Brammer, J.; O'Brien, A.; Samarasekera, D. D.

    2010-01-01

    This study aimed to evaluate the integration of a simulation based learning activity on nursing students' clinical crisis management performance in a problem-based learning (PBL) curriculum. It was hypothesized that the clinical performance of first year nursing students who participated in a simulated learning activity during the PBL session…

  5. Method and apparatus for increasing resistance of bipolar buried layer integrated circuit devices to single-event upsets

    NASA Technical Reports Server (NTRS)

    Zoutendyk, John A. (Inventor)

    1991-01-01

    Bipolar transistors fabricated in separate buried layers of an integrated circuit chip are electrically isolated with a built-in potential barrier established by doping the buried layer with a polarity opposite doping in the chip substrate. To increase the resistance of the bipolar transistors to single-event upsets due to ionized particle radiation, the substrate is biased relative to the buried layer with an external bias voltage selected to offset the built-in potential just enough (typically between about +0.1 to +0.2 volt) to prevent an accumulation of charge in the buried-layer-substrate junction.

  6. Experimental determination of single-event upset (SEU) as a function of collected charge in bipolar integrated circuits

    NASA Technical Reports Server (NTRS)

    Zoutendyk, J. A.; Malone, C. J.; Smith, L. S.

    1984-01-01

    Single-Event Upset (SEU) in bipolar integrated circuits (ICs) is caused by charge collection from ion tracks in various regions of a bipolar transistor. This paper presents experimental data which have been obtained wherein the range-energy characteristics of heavy ions (Br) have been utilized to determine the cross section for soft-error generation as a function of charge collected from single-particle tracks which penetrate a bipolar static RAM. The results of this work provide a basis for the experimental verification of circuit-simulation SEU modeling in bipolar ICs.

  7. Using Discrete Event Simulation to Model Integrated Commodities Consumption for a Launch Campaign of the Space Launch System

    NASA Technical Reports Server (NTRS)

    Leonard, Daniel; Parsons, Jeremy W.; Cates, Grant

    2014-01-01

    In May 2013, NASA's GSDO Program requested a study to develop a discrete event simulation (DES) model that analyzes the launch campaign process of the Space Launch System (SLS) from an integrated commodities perspective. The scope of the study includes launch countdown and scrub turnaround and focuses on four core launch commodities: hydrogen, oxygen, nitrogen, and helium. Previously, the commodities were only analyzed individually and deterministically for their launch support capability, but this study was the first to integrate them to examine the impact of their interactions on a launch campaign as well as the effects of process variability on commodity availability. The study produced a validated DES model with Rockwell Arena that showed that Kennedy Space Center's ground systems were capable of supporting a 48-hour scrub turnaround for the SLS. The model will be maintained and updated to provide commodity consumption analysis of future ground system and SLS configurations.

  8. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 13(2), February 29, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-002 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $ 1.

  9. Integration of scheduling and discrete event simulation systems to improve production flow planning

    NASA Astrophysics Data System (ADS)

    Krenczyk, D.; Paprocka, I.; Kempa, W. M.; Grabowik, C.; Kalinowski, K.

    2016-08-01

    The increased availability of data and computer-aided technologies such as MRPI/II, ERP and MES system, allowing producers to be more adaptive to market dynamics and to improve production scheduling. Integration of production scheduling and computer modelling, simulation and visualization systems can be useful in the analysis of production system constraints related to the efficiency of manufacturing systems. A integration methodology based on semi-automatic model generation method for eliminating problems associated with complexity of the model and labour-intensive and time-consuming process of simulation model creation is proposed. Data mapping and data transformation techniques for the proposed method have been applied. This approach has been illustrated through examples of practical implementation of the proposed method using KbRS scheduling system and Enterprise Dynamics simulation system.

  10. Propensity and risk assessment for solar particle events: Consideration of integral fluence at high proton energies

    NASA Astrophysics Data System (ADS)

    Kim, Myung-Hee; Hayat, Matthew; Feiveson, Alan; Cucinotta, Francis A.

    For future space missions with longer duration, exposure to large solar particle events (SPEs) with high energy levels is the major concern during extra-vehicular activities (EVAs) on the lunar and Mars surface. The propensity for SPE occurrence with large proton fluence was estimated as a function of time within a solar cycle from a non-homogeneous Poisson model using the historical database for measurements of protons with energy >30 MeV, Φ30 . The database includes a continuous data set for the past 5 solar cycles. The resultant SPE risk analysis for a specific mission period was made for blood forming organ (BFO) dose ranging from its 5th to 95th percentile. In addition to the total particle intensity of SPEs, the detailed energy spectra of protons, especially at high energy levels, were recognized as extremely important for assessing the cancer risk associated with energetic particles for large events. Using all the recorded proton fluence of SPEs for energies >60 and >100 MeV, Φ60 and Φ100 , respectively, the expected numbers of SPEs abundant with high energy protons were estimated from the same non-homogeneous Poisson model and the representative cancer risk was analyzed. The dependencies of risk with different energy spectra, for e.g. between soft and hard SPEs, were evaluated. Finally, we describe approaches to improve radiation protection of astronauts and optimize mission planning for future space missions.

  11. Propensity and Risk Assessment for Solar Particle Events: Consideration of Integral Fluence at High Proton Energies

    NASA Technical Reports Server (NTRS)

    Kim, Myung-Hee; Hayat, Matthew J.; Feiveson, alan H.; Cucinotta, Francis A.

    2008-01-01

    For future space missions with longer duration, exposure to large solar particle events (SPEs) with high energy levels is the major concern during extra-vehicular activities (EVAs) on the lunar and Mars surface. The expected SPE propensity for large proton fluence was estimated from a non-homogeneous Poisson model using the historical database for measurements of protons with energy > 30 MeV, Phi(sub 30). The database includes a continuous data set for the past 5 solar cycles. The resultant SPE risk analysis for a specific mission period was made including the 95% confidence level. In addition to total particle intensity of SPE, the detailed energy spectra of protons especially at high energy levels were recognized as extremely important parameter for the risk assessment, since there remains a significant cancer risks from those energetic particles for large events. Using all the recorded proton fluence of SPEs for energies >60 and >100 MeV, Phi(sub 60) and Phi(sub 100), respectively, the expected propensities of SPEs abundant with high energy protons were estimated from the same non-homogeneous Poisson model and the representative cancer risk was analyzed. The dependencies of risk with different energy spectra, for e.g. between soft and hard SPEs, were evaluated. Finally, we describe approaches to improve radiation protection of astronauts and optimize mission planning for future space missions.

  12. Photocopy of copy of 1922 map, revised in 1936. Copy ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photocopy of copy of 1922 map, revised in 1936. Copy in the Fitzsimons Army Medical Center Directorate of Public Works, building 118. - Fitzsimons General Hospital, Bounded by East Colfax to south, Peoria Street to west, Denver City/County & Adams County Line to north, & U.S. Route 255 to east, Aurora, Adams County, CO

  13. 10. Photographic copy of copy of original construction drawing, dated ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. Photographic copy of copy of original construction drawing, dated 1899?. Original in possession of Twin Lakes Reservoir and Canal Company, Ordway, Colorado. PLAN OF DAM AND HEAD GATES FOR THE TWIN LAKES RESERVOIR. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

  14. Toward an Integrated Assessment of the Impacts of Extreme Wind Events on Barrow, Alaska.

    NASA Astrophysics Data System (ADS)

    Lynch, A. H.; Curry, J. A.; Brunner, R. D.; Maslanik, J. A.

    2004-02-01

    Warming of the arctic climate is having a substantial impact on the Alaskan North Slope coastal region. The warming is associated with increasing amounts of open water in the arctic seas, rising sea level, and thawing permafrost. Coastal geography and increasing development along the coastline are contributing to increased vulnerability of infrastructure, utilities, and supplies of food and gasoline to storms, flooding, and coastal erosion. Secondary impacts of coastal flooding may include harm to animals and their land or sea habitats, if pollutants are released. Further, Inupiat subsistence harvesting of marine sources of food, offshore resource extraction, and marine transportation may be affected. This paper describes a project to understand, support, and enhance the local decision-making process on the North Slope of Alaska on socioeconomic issues that are influenced by warming, climate variability, and extreme weather events.

  15. Escherichia coli O157:H7 strains isolated from High-Event Period beef contamination have strong biofilm-forming ability and low sanitizer susceptibility, which are associated with high pO157 plasmid copy number

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In the meat industry, a “High Event Period” (HEP) is defined as a time period when beef processing establishments experience an increased occurrence of product contamination by E. coli O157:H7. Our previous studies suggested that bacterial biofilm formation and sanitizer resistance might contribute...

  16. Mechanisms of COPI vesicle formation

    PubMed Central

    Hsu, Victor W.; Yang, Jia-Shu

    2009-01-01

    Coat Protein I (COPI) is one of the most intensely investigated coat complexes. Numerous studies have contributed to a general understanding of how coat proteins act to initiate intracellular vesicular transport. This review highlights key recent findings that have shaped our current understanding of how COPI vesicles are formed. PMID:19854177

  17. Counting copy number and calories.

    PubMed

    White, Stefan

    2015-08-01

    Copy number variation (CNV) at several genomic loci has been associated with different human traits and diseases, but in many cases the findings could not be replicated. A new study provides insights into the degree of variation present at the amylase locus and calls into question a previous association between amylase copy number and body mass index.

  18. Event-triggered logical flow control for comprehensive process integration of multi-step assays on centrifugal microfluidic platforms.

    PubMed

    Kinahan, David J; Kearney, Sinéad M; Dimov, Nikolay; Glynn, Macdara T; Ducrée, Jens

    2014-07-07

    The centrifugal "lab-on-a-disc" concept has proven to have great potential for process integration of bioanalytical assays, in particular where ease-of-use, ruggedness, portability, fast turn-around time and cost efficiency are of paramount importance. Yet, as all liquids residing on the disc are exposed to the same centrifugal field, an inherent challenge of these systems remains the automation of multi-step, multi-liquid sample processing and subsequent detection. In order to orchestrate the underlying bioanalytical protocols, an ample palette of rotationally and externally actuated valving schemes has been developed. While excelling with the level of flow control, externally actuated valves require interaction with peripheral instrumentation, thus compromising the conceptual simplicity of the centrifugal platform. In turn, for rotationally controlled schemes, such as common capillary burst valves, typical manufacturing tolerances tend to limit the number of consecutive laboratory unit operations (LUOs) that can be automated on a single disc. In this paper, a major advancement on recently established dissolvable film (DF) valving is presented; for the very first time, a liquid handling sequence can be controlled in response to completion of preceding liquid transfer event, i.e. completely independent of external stimulus or changes in speed of disc rotation. The basic, event-triggered valve configuration is further adapted to leverage conditional, large-scale process integration. First, we demonstrate a fluidic network on a disc encompassing 10 discrete valving steps including logical relationships such as an AND-conditional as well as serial and parallel flow control. Then we present a disc which is capable of implementing common laboratory unit operations such as metering and selective routing of flows. Finally, as a pilot study, these functions are integrated on a single disc to automate a common, multi-step lab protocol for the extraction of total RNA from

  19. Molluscan biozones, event/cycle chronostratigraphy, and sealevel history; a new integrated Cretaceous chronology for Northern South America

    SciTech Connect

    Villamil, T.; Johnson, C.C.; Kauffman, E.G. )

    1993-02-01

    The Cretaceous marine basins of northern South America, in their evolution, record a dynamic interplay between regional and plate tectonics, sealevel history, changing paleo-ocean/paleoclimate systems, and the rates/patterns of sedimentation driven by both allocyclic and autocyclic processes. Regional interpretation of these complex interactions; and the evolution of the South American passive margin, requires a high-resolution stratigraphic system of dating and correlation. Because short-term events and dynamic processes shape the stratigraphic record, this chronology must have a resolution of <1 million years, ideally 10's-100's of ka correlation units. This resolution does not currently exist in South America, where Cretaceous radiometric dates and paleomagnetic analyses are few, event/cycle chronostratigraphy and sequence stratigraphy are not yet well developed and where current biostratigraphic resolution based on mollusks averages 1- > 2 Ma/biozone. New efforts to establish a more refined chronology for South America involve: (a) High-resolution (cm-scale) event/cycle chronostratigraphic analyses of key Colombian and Venezuelan sections; (b) search for datable ash/bentonite beds; (c) detailed paleontologic collecting to firmly establish biostratigraphic ranges of mollusks and microplankton with high biostratigraphic potential, and to formulate regional assemblage zones; and (d) integration of these diverse data through graphic correlation to provide a new chronologic standard for the region. Initial results are presented: Middle Cretaceous biozones are now resolved to <500 ka/zone; a fine-scale sequence stratigraphy and sealevel history has been determined; numerous regional physical and chemostratigraphic event beds are identified; and climate-driven cyclostratigraphy has been resolved to at least 50 ka within the passive margin sequences of Colombia and Venezuela.

  20. Dispositional mindfulness and semantic integration of emotional words: Evidence from event-related brain potentials.

    PubMed

    Dorjee, Dusana; Lally, Níall; Darrall-Rew, Jonathan; Thierry, Guillaume

    2015-08-01

    Initial research shows that mindfulness training can enhance attention and modulate the affective response. However, links between mindfulness and language processing remain virtually unexplored despite the prominent role of overt and silent negative ruminative speech in depressive and anxiety-related symptomatology. Here, we measured dispositional mindfulness and recorded participants' event-related brain potential responses to positive and negative target words preceded by words congruent or incongruent with the targets in terms of semantic relatedness and emotional valence. While the low mindfulness group showed similar N400 effect pattern for positive and negative targets, high dispositional mindfulness was associated with larger N400 effect to negative targets. This result suggests that negative meanings are less readily accessible in people with high dispositional mindfulness. Furthermore, high dispositional mindfulness was associated with reduced P600 amplitudes to emotional words, suggesting less post-analysis and attentional effort which possibly relates to a lower inclination to ruminate. Overall, these findings provide initial evidence on associations between modifications in language systems and mindfulness.

  1. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7

    PubMed Central

    Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  2. Causal Factors and Adverse Events of Aviation Accidents and Incidents Related to Integrated Vehicle Health Management

    NASA Technical Reports Server (NTRS)

    Reveley, Mary S.; Briggs, Jeffrey L.; Evans, Joni K.; Jones, Sharon M.; Kurtoglu, Tolga; Leone, Karen M.; Sandifer, Carl E.

    2011-01-01

    Causal factors in aviation accidents and incidents related to system/component failure/malfunction (SCFM) were examined for Federal Aviation Regulation Parts 121 and 135 operations to establish future requirements for the NASA Aviation Safety Program s Integrated Vehicle Health Management (IVHM) Project. Data analyzed includes National Transportation Safety Board (NSTB) accident data (1988 to 2003), Federal Aviation Administration (FAA) incident data (1988 to 2003), and Aviation Safety Reporting System (ASRS) incident data (1993 to 2008). Failure modes and effects analyses were examined to identify possible modes of SCFM. A table of potential adverse conditions was developed to help evaluate IVHM research technologies. Tables present details of specific SCFM for the incidents and accidents. Of the 370 NTSB accidents affected by SCFM, 48 percent involved the engine or fuel system, and 31 percent involved landing gear or hydraulic failure and malfunctions. A total of 35 percent of all SCFM accidents were caused by improper maintenance. Of the 7732 FAA database incidents affected by SCFM, 33 percent involved landing gear or hydraulics, and 33 percent involved the engine and fuel system. The most frequent SCFM found in ASRS were turbine engine, pressurization system, hydraulic main system, flight management system/flight management computer, and engine. Because the IVHM Project does not address maintenance issues, and landing gear and hydraulic systems accidents are usually not fatal, the focus of research should be those SCFMs that occur in the engine/fuel and flight control/structures systems as well as power systems.

  3. Functionally integrated neural processing of linguistic and talker information: An event-related fMRI and ERP study

    PubMed Central

    Zhang, Caicai; Pugh, Kenneth R.; Mencl, W. Einar; Molfese, Peter J.; Frost, Stephen J.; Magnuson, James S.; Peng, Gang; Wang, William S-Y

    2016-01-01

    Speech signals contain information of both linguistic content and a talker’s voice. Conventionally, linguistic and talker processing are thought to be mediated by distinct neural systems in the left and right hemispheres respectively, but there is growing evidence that linguistic and talker processing interact in many ways. Previous studies suggest that talker-related vocal tract changes are processed integrally with phonetic changes in the bilateral posterior superior temporal gyrus/superior temporal sulcus (STG/STS), because the vocal tract parameter influences the perception of phonetic information. It is yet unclear whether the bilateral STG are also activated by the integral processing of another parameter – pitch, which influences the perception of lexical tone information and are related to talker differences in tone languages. In this study, we conducted separate functional magnetic resonance imaging (fMRI) and event-related potential (ERP) experiments to examine the spatial and temporal loci of interactions of lexical tone and talker-related pitch processing in Cantonese. We found that the STG was activated bilaterally during the processing of talker changes when listeners attended to lexical tone changes in the stimuli and during the processing of lexical tone changes when listeners attended to talker changes, suggesting that lexical tone and talker processing are functionally integrated in the bilateral STG. It extends the previous study, providing evidence for a general neural mechanism of integral phonetic and talker processing in the bilateral STG. The ERP results show interactions of lexical tone and talker processing 500–800 ms after auditory word onset (a simultaneous posterior P3b and a frontal negativity). Moreover, there is some asymmetry in the interaction, such that unattended talker changes affect linguistic processing more than vice versa, which may be related to the ambiguity that talker changes cause in speech perception and

  4. Effects of Auditory Stimuli in the Horizontal Plane on Audiovisual Integration: An Event-Related Potential Study

    PubMed Central

    Yang, Weiping; Li, Qi; Ochi, Tatsuya; Yang, Jingjing; Gao, Yulin; Tang, Xiaoyu; Takahashi, Satoshi; Wu, Jinglong

    2013-01-01

    This article aims to investigate whether auditory stimuli in the horizontal plane, particularly originating from behind the participant, affect audiovisual integration by using behavioral and event-related potential (ERP) measurements. In this study, visual stimuli were presented directly in front of the participants, auditory stimuli were presented at one location in an equidistant horizontal plane at the front (0°, the fixation point), right (90°), back (180°), or left (270°) of the participants, and audiovisual stimuli that include both visual stimuli and auditory stimuli originating from one of the four locations were simultaneously presented. These stimuli were presented randomly with equal probability; during this time, participants were asked to attend to the visual stimulus and respond promptly only to visual target stimuli (a unimodal visual target stimulus and the visual target of the audiovisual stimulus). A significant facilitation of reaction times and hit rates was obtained following audiovisual stimulation, irrespective of whether the auditory stimuli were presented in the front or back of the participant. However, no significant interactions were found between visual stimuli and auditory stimuli from the right or left. Two main ERP components related to audiovisual integration were found: first, auditory stimuli from the front location produced an ERP reaction over the right temporal area and right occipital area at approximately 160–200 milliseconds; second, auditory stimuli from the back produced a reaction over the parietal and occipital areas at approximately 360–400 milliseconds. Our results confirmed that audiovisual integration was also elicited, even though auditory stimuli were presented behind the participant, but no integration occurred when auditory stimuli were presented in the right or left spaces, suggesting that the human brain might be particularly sensitive to information received from behind than both sides. PMID:23799097

  5. Multiple Events of Allopolyploidy in the Evolution of the Racemose Lineages in Prunus (Rosaceae) Based on Integrated Evidence from Nuclear and Plastid Data

    PubMed Central

    Zuo, Yun-juan; Liu, Xiao-Lin; Chin, Siew-Wai; Haberle, Rosemarie; Potter, Daniel; Chang, Zhao-Yang; Wen, Jun

    2016-01-01

    Prunus is an economically important genus well-known for cherries, plums, almonds, and peaches. The genus can be divided into three major groups based on inflorescence structure and ploidy levels: (1) the diploid solitary-flower group (subg. Prunus, Amygdalus and Emplectocladus); (2) the diploid corymbose group (subg. Cerasus); and (3) the polyploid racemose group (subg. Padus, subg. Laurocerasus, and the Maddenia group). The plastid phylogeny suggests three major clades within Prunus: Prunus-Amygdalus-Emplectocladus, Cerasus, and Laurocerasus-Padus-Maddenia, while nuclear ITS trees resolve Laurocerasus-Padus-Maddenia as a paraphyletic group. In this study, we employed sequences of the nuclear loci At103, ITS and s6pdh to explore the origins and evolution of the racemose group. Two copies of the At103 gene were identified in Prunus. One copy is found in Prunus species with solitary and corymbose inflorescences as well as those with racemose inflorescences, while the second copy (II) is present only in taxa with racemose inflorescences. The copy I sequences suggest that all racemose species form a paraphyletic group composed of four clades, each of which is definable by morphology and geography. The tree from the combined At103 and ITS sequences and the tree based on the single gene s6pdh had similar general topologies to the tree based on the copy I sequences of At103, with the combined At103-ITS tree showing stronger support in most clades. The nuclear At103, ITS and s6pdh data in conjunction with the plastid data are consistent with the hypothesis that multiple independent allopolyploidy events contributed to the origins of the racemose group. A widespread species or lineage may have served as the maternal parent for multiple hybridizations involving several paternal lineages. This hypothesis of the complex evolutionary history of the racemose group in Prunus reflects a major step forward in our understanding of diversification of the genus and has important

  6. Integrating Remote Sensing Data, Hybrid-Cloud Computing, and Event Notifications for Advanced Rapid Imaging & Analysis (Invited)

    NASA Astrophysics Data System (ADS)

    Hua, H.; Owen, S. E.; Yun, S.; Lundgren, P.; Fielding, E. J.; Agram, P.; Manipon, G.; Stough, T. M.; Simons, M.; Rosen, P. A.; Wilson, B. D.; Poland, M. P.; Cervelli, P. F.; Cruz, J.

    2013-12-01

    Space-based geodetic measurement techniques such as Interferometric Synthetic Aperture Radar (InSAR) and Continuous Global Positioning System (CGPS) are now important elements in our toolset for monitoring earthquake-generating faults, volcanic eruptions, hurricane damage, landslides, reservoir subsidence, and other natural and man-made hazards. Geodetic imaging's unique ability to capture surface deformation with high spatial and temporal resolution has revolutionized both earthquake science and volcanology. Continuous monitoring of surface deformation and surface change before, during, and after natural hazards improves decision-making from better forecasts, increased situational awareness, and more informed recovery. However, analyses of InSAR and GPS data sets are currently handcrafted following events and are not generated rapidly and reliably enough for use in operational response to natural disasters. Additionally, the sheer data volumes needed to handle a continuous stream of InSAR data sets also presents a bottleneck. It has been estimated that continuous processing of InSAR coverage of California alone over 3-years would reach PB-scale data volumes. Our Advanced Rapid Imaging and Analysis for Monitoring Hazards (ARIA-MH) science data system enables both science and decision-making communities to monitor areas of interest with derived geodetic data products via seamless data preparation, processing, discovery, and access. We will present our findings on the use of hybrid-cloud computing to improve the timely processing and delivery of geodetic data products, integrating event notifications from USGS to improve the timely processing for response, as well as providing browse results for quick looks with other tools for integrative analysis.

  7. Integrative network analysis reveals time-dependent molecular events underlying left ventricular remodeling in post-myocardial infarction patients.

    PubMed

    Pinet, Florence; Cuvelliez, Marie; Kelder, Thomas; Amouyel, Philippe; Radonjic, Marijana; Bauters, Christophe

    2017-02-03

    To elucidate the time-resolved molecular events underlying the LV remodeling (LVR) process, we developed a large-scale network model that integrates the 24 molecular variables (plasma proteins and non-coding RNAs) collected in the REVE-2 study at four time points (baseline, 1month, 3months and 1year) after MI. The REVE-2 network model was built by extending the set of REVE-2 variables with their mechanistic context based on known molecular interactions (1310 nodes and 8639 edges). Changes in the molecular variables between the group of patients with high LVR (>20%) and low LVR (<20%) were used to identify active network modules within the clusters associated with progression of LVR, enabling assessment of time-resolved molecular changes. Although the majority of molecular changes occur at the baseline, two network modules specifically show an increasing number of active molecules throughout the post-MI follow up: one involved in muscle filament sliding, containing the major troponin forms and tropomyosin proteins, and the other associated with extracellular matrix disassembly, including matrix metalloproteinases, tissue inhibitors of metalloproteinases and laminin proteins. For the first time, integrative network analysis of molecular variables collected in REVE-2 patients with known molecular interactions allows insight into time-dependent mechanisms associated with LVR following MI, linking specific processes with LV structure alteration. In addition, the REVE-2 network model provides a shortlist of prioritized putative novel biomarker candidates for detection of LVR after MI event associated with a high risk of heart failure and is a valuable resource for further hypothesis generation.

  8. Integration of sensory information precedes the sensation of vection: a combined behavioral and event-related brain potential (ERP) study.

    PubMed

    Keshavarz, Behrang; Berti, Stefan

    2014-02-01

    Illusory self-motion (known as vection) describes the sensation of ego-motion in the absence of physical movement. Vection typically occurs in stationary observers being exposed to visual information that suggest self-motion (e.g. simulators, virtual reality). In the present study, we tested whether sensory integration of visual information triggers vection: participants (N=13) perceived patterns of moving altered black-and-white vertical stripes on a screen that was divided into a central and a surrounding peripheral visual field. In both fields the pattern was either moving or stationary, resulting in four combinations of central and peripheral motions: (1) central and peripheral stripes moved into the same direction, (2) central and peripheral stripes moved in opposite directions, or (3) either the central or (4) the peripheral stripes were stable while the other stripes were in motion. This stimulation induced vection: Results showed significantly higher vection ratings when the stationary center of the pattern was surrounded by a moving periphery. Event-related potentials mirrored this finding: The occipital N2 was largest with stationary central and moving peripheral stripes. Our findings suggest that sensory integration of peripheral and central visual information triggers the perception of vection. Furthermore, we found evidence that neural processes precede the subjective perception of vection strength prior to the actual onset of vection. We will discuss our findings with respect to the role of stimulus eccentricity, stimulus' depth, and neural correlates involved during the genesis of vection.

  9. Integrative omics connects N-glycoproteome-wide alterations with pathways and regulatory events in induced pluripotent stem cells

    PubMed Central

    Sudhir, Putty-Reddy; Kumari, Madireddy Pavana; Hsu, Wei-Ting; Chen, Chein-Hung; Kuo, Hung-Chih; Chen, Chung-Hsuan

    2016-01-01

    Molecular-level differences ranging from genomes to proteomes, but not N-glycoproteomes, between human induced pluripotent stem cells (hiPSCs) and embryonic stem cells (hESCs) have been assessed to gain insights into cell reprogramming and induced pluripotency. Our multiplexed quantitative N-glycoproteomics study identified altered N-glycoproteins that significantly regulate cell adhesion processes in hiPSCs compared to hESCs. The integrative proteomics and functional network analyses of the altered N-glycoproteins revealed their significant interactions with known PluriNet (pluripotency-associated network) proteins. We found that these interactions potentially regulate various signaling pathways including focal adhesion, PI3K-Akt signaling, regulation of actin cytoskeleton, and spliceosome. Furthermore, the integrative transcriptomics analysis revealed that imperfectly reprogrammed subunits of the oligosaccharyltransferase (OST) and dolichol-phosphate-mannose synthase (DPM) complexes were potential candidate regulatory events for the altered N-glycoprotein levels. Together, the results of our study suggest that imperfect reprogramming of the protein complexes linked with the N-glycosylation process may result in N-glycoprotein alterations that affect induced pluripotency through their functional protein interactions. PMID:27808266

  10. Semantic integration of audio-visual information of polyphonic characters in a sentence context: an event-related potential study.

    PubMed

    Liu, Hong; Zhang, Gaoyan; Liu, Baolin

    2017-04-01

    In the Chinese language, a polyphone is a kind of special character that has more than one pronunciation, with each pronunciation corresponding to a different meaning. Here, we aimed to reveal the cognitive processing of audio-visual information integration of polyphones in a sentence context using the event-related potential (ERP) method. Sentences ending with polyphones were presented to subjects simultaneously in both an auditory and a visual modality. Four experimental conditions were set in which the visual presentations were the same, but the pronunciations of the polyphones were: the correct pronunciation; another pronunciation of the polyphone; a semantically appropriate pronunciation but not the pronunciation of the polyphone; or a semantically inappropriate pronunciation but also not the pronunciation of the polyphone. The behavioral results demonstrated significant differences in response accuracies when judging the semantic meanings of the audio-visual sentences, which reflected the different demands on cognitive resources. The ERP results showed that in the early stage, abnormal pronunciations were represented by the amplitude of the P200 component. Interestingly, because the phonological information mediated access to the lexical semantics, the amplitude and latency of the N400 component changed linearly across conditions, which may reflect the gradually increased semantic mismatch in the four conditions when integrating the auditory pronunciation with the visual information. Moreover, the amplitude of the late positive shift (LPS) showed a significant correlation with the behavioral response accuracies, demonstrating that the LPS component reveals the demand of cognitive resources for monitoring and resolving semantic conflicts when integrating the audio-visual information.

  11. CONTRA: copy number analysis for targeted resequencing

    PubMed Central

    Li, Jason; Lupat, Richard; Amarasinghe, Kaushalya C.; Thompson, Ella R.; Doyle, Maria A.; Ryland, Georgina L.; Tothill, Richard W.; Halgamuge, Saman K.; Campbell, Ian G.; Gorringe, Kylie L.

    2012-01-01

    Motivation: In light of the increasing adoption of targeted resequencing (TR) as a cost-effective strategy to identify disease-causing variants, a robust method for copy number variation (CNV) analysis is needed to maximize the value of this promising technology. Results: We present a method for CNV detection for TR data, including whole-exome capture data. Our method calls copy number gains and losses for each target region based on normalized depth of coverage. Our key strategies include the use of base-level log-ratios to remove GC-content bias, correction for an imbalanced library size effect on log-ratios, and the estimation of log-ratio variations via binning and interpolation. Our methods are made available via CONTRA (COpy Number Targeted Resequencing Analysis), a software package that takes standard alignment formats (BAM/SAM) and outputs in variant call format (VCF4.0), for easy integration with other next-generation sequencing analysis packages. We assessed our methods using samples from seven different target enrichment assays, and evaluated our results using simulated data and real germline data with known CNV genotypes. Availability and implementation: Source code and sample data are freely available under GNU license (GPLv3) at http://contra-cnv.sourceforge.net/ Contact: Jason.Li@petermac.org Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22474122

  12. Human copy number variation and complex genetic disease.

    PubMed

    Girirajan, Santhosh; Campbell, Catarina D; Eichler, Evan E

    2011-01-01

    Copy number variants (CNVs) play an important role in human disease and population diversity. Advancements in technology have allowed for the analysis of CNVs in thousands of individuals with disease in addition to thousands of controls. These studies have identified rare CNVs associated with neuropsychiatric diseases such as autism, schizophrenia, and intellectual disability. In addition, copy number polymorphisms (CNPs) are present at higher frequencies in the population, show high diversity in copy number, sequence, and structure, and have been associated with multiple phenotypes, primarily related to immune or environmental response. However, the landscape of copy number variation still remains largely unexplored, especially for smaller CNVs and those embedded within complex regions of the human genome. An integrated approach including characterization of single nucleotide variants and CNVs in a large number of individuals with disease and normal genomes holds the promise of thoroughly elucidating the genetic basis of human disease and diversity.

  13. Zero-Copy Objects System

    NASA Technical Reports Server (NTRS)

    Burleigh, Scott C.

    2011-01-01

    Zero-Copy Objects System software enables application data to be encapsulated in layers of communication protocol without being copied. Indirect referencing enables application source data, either in memory or in a file, to be encapsulated in place within an unlimited number of protocol headers and/or trailers. Zero-copy objects (ZCOs) are abstract data access representations designed to minimize I/O (input/output) in the encapsulation of application source data within one or more layers of communication protocol structure. They are constructed within the heap space of a Simple Data Recorder (SDR) data store to which all participating layers of the stack must have access. Each ZCO contains general information enabling access to the core source data object (an item of application data), together with (a) a linked list of zero or more specific extents that reference portions of this source data object, and (b) linked lists of protocol header and trailer capsules. The concatenation of the headers (in ascending stack sequence), the source data object extents, and the trailers (in descending stack sequence) constitute the transmitted data object constructed from the ZCO. This scheme enables a source data object to be encapsulated in a succession of protocol layers without ever having to be copied from a buffer at one layer of the protocol stack to an encapsulating buffer at a lower layer of the stack. For large source data objects, the savings in copy time and reduction in memory consumption may be considerable.

  14. Using the Integration of Discrete Event and Agent-Based Simulation to Enhance Outpatient Service Quality in an Orthopedic Department

    PubMed Central

    Kittipittayakorn, Cholada

    2016-01-01

    Many hospitals are currently paying more attention to patient satisfaction since it is an important service quality index. Many Asian countries' healthcare systems have a mixed-type registration, accepting both walk-in patients and scheduled patients. This complex registration system causes a long patient waiting time in outpatient clinics. Different approaches have been proposed to reduce the waiting time. This study uses the integration of discrete event simulation (DES) and agent-based simulation (ABS) to improve patient waiting time and is the first attempt to apply this approach to solve this key problem faced by orthopedic departments. From the data collected, patient behaviors are modeled and incorporated into a massive agent-based simulation. The proposed approach is an aid for analyzing and modifying orthopedic department processes, allows us to consider far more details, and provides more reliable results. After applying the proposed approach, the total waiting time of the orthopedic department fell from 1246.39 minutes to 847.21 minutes. Thus, using the correct simulation model significantly reduces patient waiting time in an orthopedic department. PMID:27195606

  15. Integral probability of auroral electron flux events from SSJ/4 DMSP F9 electron measurements. Interim report

    SciTech Connect

    Hardy, D.A.; Bounar, K.H.

    1992-05-18

    A study has been completed to determine the probability of observing different levels of auroral electron precipitation both within fixed spatial elements in magnetic local time and corrected geomagnetic latitude, and within spatial elements when the magnetic local time is fixed but the latitude range can be varied. The auroral electron precipitation probability is defined for a series of thresholds in electron average energy and electron energy flux as a function of geomagnetic activity. The study provides the capability to determine the probability of observation of an auroral electron precipitation event for any specified threshold in average energy, energy flux, and level of geomagnetic activity for any location in the auroral region or for any line of sight through the auroral region. The input for the study is one year of data from the SSJ/4 electron and proton spectrometer flown on the F9 satellite of the Defense Meteorological Satellite Program (DMSP) comprising approximately 10, 141 hemispheric passes through the auroral region. The binning technique used to determine these probabilities is presented and some results are discussed. The operation of the software package to display the probability results is described. Defense Meteorological Satellite Program (DMSP), Aurora, Precipitating electrons, Geomagnetic Kp index, Integral probability.

  16. Efficient Integration of Old and New Research Tools for Automating the Identification and Analysis of Seismic Reference Events

    SciTech Connect

    Wagner, Robert; Rivers, Wilmer

    2005-01-25

    any single computer program for seismic data analysis will not have all the capabilities needed to study reference events, since hese detailed studies will be highly specialized. It may be necessary to develop and test new algorithms, and then these special ;odes must be integrated with existing software to use their conventional data-processing routines. We have investigated two neans of establishing communications between the legacy and new codes: CORBA and XML/SOAP Web services. We have nvestigated making new Java code communicate with a legacy C-language program, geotool, running under Linux. Both methods vere successful, but both were difficult to implement. C programs on UNIX/Linux are poorly supported for Web services, compared vith the Java and .NET languages and platforms. Easier-to-use middleware will be required for scientists to construct distributed applications as easily as stand-alone ones. Considerable difficulty was encountered in modifying geotool, and this problem shows he need to use component-based user interfaces instead of large C-language codes where changes to one part of the program nay introduce side effects into other parts. We have nevertheless made bug fixes and enhancements to that legacy program, but t remains difficult to expand it through communications with external software.

  17. To Copy-Protect or Not to Copy-Protect?

    ERIC Educational Resources Information Center

    Sacks, Jonathan

    1985-01-01

    Discusses the issues of software piracy, why people illegally copy software, protection afforded software developers by copyright laws, and current and future methods of disk-based protection built into software by developers and the problems these methods have created. (MBR)

  18. A New Approach for Copy-Move Detection Based on Improved Weber Local Descriptor.

    PubMed

    Saadat, Shabnam; Moghaddam, Mohsen Ebrahimi; Mohammadi, Mohsen

    2015-11-01

    One of the most common image tampering techniques is copy-move; in this technique, one or more parts of the image are copied and pasted in another area of the image. Recently, various methods have been proposed for copy-move detection; however, many of these techniques are not robust to additional changes like geometric transformation, and they are failed to be useful for detecting small copied areas. In this paper, a new method based on point descriptors which are derived from the integration of textural feature-based Weber law and statistical features of the image is presented. In this proposed approach, modified multiscale version of Weber local descriptor is presented to make the method robust versus geometric transformation and detect small copied areas. The results of the experiments showed that our method can detect small copied areas and copy-move tampered images which are influenced by rotation, scaling, noise addition, compression, blurring, and mirroring.

  19. 26 CFR 301.6223(f)-1 - Duplicate copy of final partnership administrative adjustment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 18 2011-04-01 2011-04-01 false Duplicate copy of final partnership... In General § 301.6223(f)-1 Duplicate copy of final partnership administrative adjustment. (a) In... the notice of final partnership administrative adjustment (for example, in the event the...

  20. 26 CFR 301.6223(f)-1 - Duplicate copy of final partnership administrative adjustment.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 18 2014-04-01 2014-04-01 false Duplicate copy of final partnership... In General § 301.6223(f)-1 Duplicate copy of final partnership administrative adjustment. (a) In... the notice of final partnership administrative adjustment (for example, in the event the...

  1. 26 CFR 301.6223(f)-1 - Duplicate copy of final partnership administrative adjustment.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 18 2013-04-01 2013-04-01 false Duplicate copy of final partnership... In General § 301.6223(f)-1 Duplicate copy of final partnership administrative adjustment. (a) In... the notice of final partnership administrative adjustment (for example, in the event the...

  2. 26 CFR 301.6223(f)-1 - Duplicate copy of final partnership administrative adjustment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 18 2010-04-01 2010-04-01 false Duplicate copy of final partnership... In General § 301.6223(f)-1 Duplicate copy of final partnership administrative adjustment. (a) In... the notice of final partnership administrative adjustment (for example, in the event the...

  3. 26 CFR 301.6223(f)-1 - Duplicate copy of final partnership administrative adjustment.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 18 2012-04-01 2012-04-01 false Duplicate copy of final partnership... In General § 301.6223(f)-1 Duplicate copy of final partnership administrative adjustment. (a) In... the notice of final partnership administrative adjustment (for example, in the event the...

  4. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 13 (6), June 30, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-005 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $ 1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid. SEAN Bulletin is available on Kosmos. Type CHECK SEAN on Part A of Kosmos.

  5. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 25(10), October 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-010 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $ 1 . Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid. SEAN Bulletin is available on Kosmos. Type CHECK SEAN on Part A of Kosmos

  6. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 13(3), March 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-002 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid.

  7. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 13 (7), July 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-007 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid. SEAN Bulletin is available on Kosmos. Type CHECK SEAN on Part A of Kosmos.

  8. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 13 (1), January 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-001 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $ 1. Subscriptions to SEAN Bulletin are also available from AGU Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid.

  9. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 13(9), September 30, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-013 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid. SEAN Bulletin is available on Kosmos. Type CHECK SEAN on Part A of Kosmos.

  10. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 13 (5), May 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-004 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $ 1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid. SEAN Bulletin is available on Kosmos. Type CHECK SEAN on Part A of Kosmos.

  11. Using Copy Change with Trade Books to Teach Earth Science

    ERIC Educational Resources Information Center

    Bintz, William P.; Wright, Pam; Sheffer, Julie

    2010-01-01

    Developing and implementing relevant, challenging, integrative, and exploratory curriculum is critical at all levels of schooling. This article describes one attempt to develop and implement an instance of interdisciplinary curriculum by using copy change with trade books to teach earth science. Specifically, it introduces trade books as a way to…

  12. Gain of a New Exon by a Lineage-Specific Alu Element-Integration Event in the BCS1L Gene during Primate Evolution

    PubMed Central

    Park, Sang-Je; Kim, Young-Hyun; Lee, Sang-Rae; Choe, Se-Hee; Kim, Myung-Jin; Kim, Sun-Uk; Kim, Ji-Su; Sim, Bo-Woong; Song, Bong-Seok; Jeong, Kang-Jin; Jin, Yeung-Bae; Lee, Youngjeon; Park, Young-Ho; Park, Young Il; Huh, Jae-Won; Chang, Kyu-Tae

    2015-01-01

    BCS1L gene encodes mitochondrial protein and is a member of conserved AAA protein family. This gene is involved in the incorporation of Rieske FeS and Qcr10p into complex III of respiratory chain. In our previous study, AluYRa2-derived alternative transcript in rhesus monkey genome was identified. However, this transcript has not been reported in human genome. In present study, we conducted evolutionary analysis of AluYRa2-exonized transcript with various primate genomic DNAs and cDNAs from humans, rhesus monkeys, and crab-eating monkeys. Remarkably, our results show that AluYRa2 element has only been integrated into genomes of Macaca species. This Macaca lineage-specific integration of AluYRa2 element led to exonization event in the first intron region of BCS1L gene by producing a conserved 3′ splice site. Intriguingly, in rhesus and crab-eating monkeys, more diverse transcript variants by alternative splicing (AS) events, including exon skipping and different 5′ splice sites from humans, were identified. Alignment of amino acid sequences revealed that AluYRa2-exonized transcript has short N-terminal peptides. Therefore, AS events play a major role in the generation of various transcripts and proteins during primate evolution. In particular, lineage-specific integration of Alu elements and species-specific Alu-derived exonization events could be important sources of gene diversification in primates. PMID:26537194

  13. qPCR for quantification of transgene expression and determination of transgene copy number.

    PubMed

    Fletcher, Stephen J

    2014-01-01

    Quantitative real-time PCR (qPCR) is a mature technology that can be used to accurately quantify the number of copies of a target nucleic acid in a sample. Here, we describe a method for using this technology to determine the copy number of a transgene stably integrated into a plant's genome and to ascertain the level of transgene expression.

  14. What Triggered the Recent Melt Event at Summit, Greenland? Insights from an Integrated Suite of Ground-Based Observations

    NASA Astrophysics Data System (ADS)

    Miller, N.; Pettersen, C.; Walden, V. P.; Turner, D. D.; Shupe, M.; Bennartz, R.; Neff, W. D.; Cox, C.; Kulie, M.; Castellani, B.

    2012-12-01

    The melt extent of the Greenland Ice Sheet (GIS) has been increasing in recent decades. According to a NASA press release, satellite observations show that the GIS melt extent was an anomalously high 97% in mid-July 2012, including rare melting at high altitude locations such as Summit, Greenland. This event was also captured by ground-based observations at Summit, collected by the ICECAPS (Integrated Characterization of Energy, Clouds, Atmospheric State, and Precipitation at Summit) project. The observational data also recorded increased variability in the atmospheric state for July 2012 compared to the July 2010 and 2011. One of the outliers on 11 July 2012 produced ice melt temperatures at Summit, Greenland for the first time since observational records began. The origin of the warm airmass that affected Summit on 11 July 2012 was traced to the central United States on 1 July 2012. Instead of flowing around the southern tip of Greenland, the airmass was forced over central Greenland and thus lifted to over 3200m by the thickness of the GIS. Temperature retrievals from a microwave radiometer (MWR) observed a warm front arriving on 10 July 2012, which included RH values close to saturation as recorded by a NOAA met tower. Elevated precipitable water vapor levels suggest ripe conditions for liquid water clouds. A low level liquid cloud was observed by a micropulse lidar (MPL) and a millimeter cloud radar (MMCR) from 10-11 July 2012 with elevated liquid water content retrieved from the MWRs. Observations from an infrared spectrometer (PAERI) instrument indicate increased downwelling longwave fluxes during this time. The liquid water cloud effectively traps the heat thus limiting the surface's ability to cool radiatively. Surface-based inversions are common during clear sky scenes but liquid bearing clouds often weaken these inversions. In combination with solar heating, this can create surface temperatures warmer than the air aloft. A conceptual surface energy

  15. 48 CFR 3401.105-3 - Copies.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... GENERAL ED ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 3401.105-3 Copies. Copies of the... EDAR is available for viewing at: http://www.ed.gov/policy/fund/reg/clibrary/edar.html....

  16. 48 CFR 3401.105-3 - Copies.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... GENERAL ED ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 3401.105-3 Copies. Copies of the... EDAR is available for viewing at: http://www.ed.gov/policy/fund/reg/clibrary/edar.html....

  17. 48 CFR 3401.105-3 - Copies.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... GENERAL ED ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 3401.105-3 Copies. Copies of the... EDAR is available for viewing at: http://www.ed.gov/policy/fund/reg/clibrary/edar.html....

  18. 48 CFR 3401.105-3 - Copies.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... GENERAL ED ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 3401.105-3 Copies. Copies of the... EDAR is available for viewing at: http://www.ed.gov/policy/fund/reg/clibrary/edar.html....

  19. 48 CFR 1401.105-3 - Copies.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Copies. 1401.105-3 Section 1401.105-3 Federal Acquisition Regulations System DEPARTMENT OF THE INTERIOR GENERAL DEPARTMENT OF THE INTERIOR ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 1401.105-3 Copies. Copies of...

  20. 48 CFR 1401.105-3 - Copies.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false Copies. 1401.105-3 Section 1401.105-3 Federal Acquisition Regulations System DEPARTMENT OF THE INTERIOR GENERAL DEPARTMENT OF THE INTERIOR ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 1401.105-3 Copies. Copies of...

  1. 48 CFR 1401.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Copies. 1401.105-3 Section 1401.105-3 Federal Acquisition Regulations System DEPARTMENT OF THE INTERIOR GENERAL DEPARTMENT OF THE INTERIOR ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 1401.105-3 Copies. Copies of...

  2. 48 CFR 1401.105-3 - Copies.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 5 2011-10-01 2011-10-01 false Copies. 1401.105-3 Section 1401.105-3 Federal Acquisition Regulations System DEPARTMENT OF THE INTERIOR GENERAL DEPARTMENT OF THE INTERIOR ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 1401.105-3 Copies. Copies of...

  3. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 14 Aeronautics and Space 3 2014-01-01 2014-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents and for affixation of the seal for a certification or validation are the same as those provided in...

  4. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 14 Aeronautics and Space 3 2013-01-01 2013-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents and for affixation of the seal for a certification or validation are the same as those provided in...

  5. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 14 Aeronautics and Space 3 2011-01-01 2011-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents and for affixation of the seal for a certification or validation are the same as those provided in...

  6. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents and for affixation of the seal for a certification or validation are the same as those provided in...

  7. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 14 Aeronautics and Space 3 2012-01-01 2012-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents and for affixation of the seal for a certification or validation are the same as those provided in...

  8. 48 CFR 3401.104-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Copies. 3401.104-3 Section 3401.104-3 Federal Acquisition Regulations System DEPARTMENT OF EDUCATION ACQUISITION REGULATION GENERAL ED ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 3401.104-3 Copies. Copies of...

  9. 48 CFR 2001.104-3 - Copies.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 6 2014-10-01 2014-10-01 false Copies. 2001.104-3 Section 2001.104-3 Federal Acquisition Regulations System NUCLEAR REGULATORY COMMISSION GENERAL NUCLEAR REGULATORY COMMISSION ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 2001.104-3 Copies. Copies...

  10. 48 CFR 2001.104-3 - Copies.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false Copies. 2001.104-3 Section 2001.104-3 Federal Acquisition Regulations System NUCLEAR REGULATORY COMMISSION GENERAL NUCLEAR REGULATORY COMMISSION ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 2001.104-3 Copies. Copies...

  11. 48 CFR 2001.104-3 - Copies.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 6 2013-10-01 2013-10-01 false Copies. 2001.104-3 Section 2001.104-3 Federal Acquisition Regulations System NUCLEAR REGULATORY COMMISSION GENERAL NUCLEAR REGULATORY COMMISSION ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 2001.104-3 Copies. Copies...

  12. 48 CFR 2001.104-3 - Copies.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 6 2012-10-01 2012-10-01 false Copies. 2001.104-3 Section 2001.104-3 Federal Acquisition Regulations System NUCLEAR REGULATORY COMMISSION GENERAL NUCLEAR REGULATORY COMMISSION ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 2001.104-3 Copies. Copies...

  13. 48 CFR 2001.104-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Copies. 2001.104-3 Section 2001.104-3 Federal Acquisition Regulations System NUCLEAR REGULATORY COMMISSION GENERAL NUCLEAR REGULATORY COMMISSION ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 2001.104-3 Copies. Copies...

  14. 36 CFR 703.20 - File copies.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false File copies. 703.20 Section... Is Not a Party § 703.20 File copies. The Office of the General Counsel will maintain the official file of copies of all demands served on the Library and deciding officials' responses....

  15. Excess pressure integral predicts cardiovascular events independent of other risk factors in the conduit artery functional evaluation substudy of Anglo-Scandinavian Cardiac Outcomes Trial.

    PubMed

    Davies, Justin E; Lacy, Peter; Tillin, Therese; Collier, David; Cruickshank, J Kennedy; Francis, Darrel P; Malaweera, Anura; Mayet, Jamil; Stanton, Alice; Williams, Bryan; Parker, Kim H; McG Thom, Simon A; Hughes, Alun D

    2014-07-01

    Excess pressure integral (XSPI), a new index of surplus work performed by the left ventricle, can be calculated from blood pressure waveforms and may indicate circulatory dysfunction. We investigated whether XSPI predicted future cardiovascular events and target organ damage in treated hypertensive individuals. Radial blood pressure waveforms were acquired by tonometry in 2069 individuals (aged, 63±8 years) in the Conduit Artery Functional Evaluation (CAFE) substudy of the Anglo-Scandinavian Cardiac Outcomes Trial (ASCOT). Measurements of left ventricular mass index (n=862) and common carotid artery intima media thickness (n=923) were also performed. XSPI and the integral of reservoir pressure were lower in people treated with amlodipine±perindopril than in those treated with atenolol±bendroflumethiazide, although brachial systolic blood pressure was similar. A total of 134 cardiovascular events accrued during a median 3.4 years of follow-up; XSPI was a significant predictor of cardiovascular events after adjustment for age and sex, and this relationship was unaffected by adjustment for conventional cardiovascular risk factors or Framingham risk score. XSPI, central systolic blood pressure, central augmentation pressure, central pulse pressure, and integral of reservoir pressure were correlated with left ventricular mass index, but only XSPI, augmentation pressure, and central pulse pressure were associated positively with carotid artery intima media thickness. Associations between left ventricular mass index, XSPI, and integral of reservoir pressure and carotid artery intima media thickness and XSPI were unaffected by multivariable adjustment for other covariates. XSPI is a novel indicator of cardiovascular dysfunction and independently predicts cardiovascular events and targets organ damage in a prospective clinical trial.

  16. Copying and Evolution of Neuronal Topology

    PubMed Central

    Fernando, Chrisantha; Karishma, K. K.; Szathmáry, Eörs

    2008-01-01

    We propose a mechanism for copying of neuronal networks that is of considerable interest for neuroscience for it suggests a neuronal basis for causal inference, function copying, and natural selection within the human brain. To date, no model of neuronal topology copying exists. We present three increasingly sophisticated mechanisms to demonstrate how topographic map formation coupled with Spike-Time Dependent Plasticity (STDP) can copy neuronal topology motifs. Fidelity is improved by error correction and activity-reverberation limitation. The high-fidelity topology-copying operator is used to evolve neuronal topologies. Possible roles for neuronal natural selection are discussed. PMID:19020662

  17. Creating an integrated historical record of extreme particulate air pollution events in Australian cities from 1994 to 2007.

    PubMed

    Johnston, Fay H; Hanigan, Ivan C; Henderson, Sarah B; Morgan, Geoffrey G; Portner, Talia; Williamson, Grant J; Bowman, David M J S

    2011-04-01

    Epidemiological studies of exposure to vegetation fire smoke are often limited by the availability of accurate exposure data. This paper describes a systematic framework for retrospectively identifying the cause of air pollution events to facilitate a long, multicenter analysis of the public health effects of vegetation fire smoke pollution in Australia. Pollution events were statistically defined as any day at or above the 95th percentile of the 24-hr average concentration of particulate matter (PM). These were identified for six cities from three distinct ecoclimatic regions of Australia. The dates of each event were then crosschecked against a range of information sources, including online newspaper archives, government and research agency records, satellite imagery, and aerosol optical thickness measures to identify the cause for the excess particulate pollution. Pollution events occurred most frequently during summer for cities in subtropical and arid regions and during winter for cities in temperate regions. A cause for high PM on 67% of days examined in the city of Sydney was found, and 94% of these could be attributed to landscape fire smoke. Results were similar for cities in other subtropical and arid locations. Identification of the cause of pollution events was much lower in colder temperate regions where fire activity is less frequent. Bushfires were the most frequent cause of extreme pollution events in cities located in subtropical and arid regions of Australia. Although identification of pollution episodes was greatly improved by the use of multiple sources of information, satellite imagery was the most useful tool for identifying bushfire smoke pollution events.

  18. A spatio-temporal reconstruction of sea surface temperature during Dansgaard-Oeschger events from model-data integration

    NASA Astrophysics Data System (ADS)

    Jensen, Mari F.; Nummelin, Aleksi; Borg Nielsen, Søren; Sadatzki, Henrik; Sessford, Evangeline; Kleppin, Hannah; Risebrobakken, Bjørg; Born, Andreas

    2016-04-01

    Proxy data suggests a large variability in the North Atlantic sea surface temperature (SST) and sea ice cover during the Dansgaard Oeschger (DO) events of the last glacial. However, the mechanisms behind these changes are still debated. It is not clear whether the ocean temperatures are controlled by forced changes in the northward ocean heat transport or by local surface fluxes, or if, instead, the SST changes can be explained by internal variability. We address these questions by analyzing a full DO event using proxy-surrogate reconstructions. This method provides a means to extrapolate the temporally accurate information from scarce proxy reconstructions with the spatial and physical consistency of climate models. Model simulations are treated as a pool of possible ocean states from which the closest match to the reconstructions, e.g., one model year, is selected based on an objective cost function. The original chronology of the model is replaced by that of the proxy data. Repeating this algorithm for each proxy time step yields a comprehensive four-dimensional dataset that is consistent with reconstructed data. In addition, the solution also includes variables and locations for which no reconstructions exist. We show that by only using climate model data from the preindustrial control simulations, we are able to reconstruct the SST variability in the subpolar gyre region over the DO event. In the eastern Nordic Seas, on the other hand, we lack the amplitude of the variations while capturing the temporal pattern. Based on our analysis, we suggest that the variability of the subpolar gyre during the analyzed DO event can be explained by internal variability of the climate system alone. Further research is needed to explain whether the lacking amplitude in the Nordic Seas is due to the model deficiencies or if external forcing or some feedback mechanisms could give rise to larger SST variability.

  19. An Integrated Approach to Seismic Event Location. 1. Evaluating How Method of Location Affects the Volume of Groups of Hypocenters

    DTIC Science & Technology

    1992-11-12

    1985: and Pujol , 1988). 3) Methods for evaluating errors in event locations. The classical approach to error analysis utilizes a formal statistical...minimum volume polyhedron as a practical enclosure for a set of points has not been suggested previously in the seismological or geological literature. 4 2...Set of Points in Space Background: There exist’numerous applications in seismology and geology where it is useful to define a volume in space which

  20. The impact of global events in the Deep Sea biosphere: An integrated ichnological, geochemical and stratigraphical approach

    NASA Astrophysics Data System (ADS)

    Cummings, John; Hodgson, David; Jeffery-Abt, Charlotte; Worden, Richard

    2010-05-01

    Keywords: Ichnology, Palaeocene-Eocene Thermal Maximum, Clay mineralogy, SGR, Basque Basin Here the effects of the K-Pg event and the PETM on benthic macrofauna communities are constrained using an ichnological approach. In most basins, the mass extinction witnessed at the K-Pg boundary is not recognised in deep sea trace fossil communities. On a global scale, trace fossil diversity actually experiences a diversity burst following the K-Pg event, culminating in a Phanerozoic peak in diversity during the earliest Eocene. This diversity peak of deep sea trace fossil communities is inconsistent with the Palaeocene - Eocene boundary extinction of 50% of benthic foraminifera taxa. . Initial climate cooling following the K-Pg event was soon replaced by a disorderly period in the Earth's climate history whereby the background ‘greenhouse' conditions were punctuated by a number of rapid, transient hyperthermal events. The most prominent of these events was the Palaeocene-Eocene Thermal Maximum (PETM). Sea surface temperatures and bottom temperatures soared by as much as 10°C in as little as 1000 years. Extensive research has been published concerning the biotic and geochemical effect of the PETM. Detailed ichnological data obtained from 9 localities in the Basque basin, northeast Spain, spanning the mid Palaeocene-early Eocene is presented here. This data not only allows the effects of the PETM on benthic macrofauna communities to be measured but also allows rigorous testing of the utility of trace fossil assemblages in determining submarine fan environments of deposition during periods of climatic extremes. The Basque Basin provides an ideal natural laboratory to study this period of Earth's history as there are many K-Pg and PETM outcrops, usually rich in trace fossils. High resolution clay mineralogical analyses have been conducted utilising XRD, FT-IR and field based spectral gamma ray (SGR) measurements to provide an insight into weathering patterns on the

  1. A Framework of Knowledge Integration and Discovery for Supporting Pharmacogenomics Target Predication of Adverse Drug Events: A Case Study of Drug-Induced Long QT Syndrome

    PubMed Central

    Jiang, Guoqian; Wang, Chen; Zhu, Qian; Chute, Christopher G.

    2013-01-01

    Knowledge-driven text mining is becoming an important research area for identifying pharmacogenomics target genes. However, few of such studies have been focused on the pharmacogenomics targets of adverse drug events (ADEs). The objective of the present study is to build a framework of knowledge integration and discovery that aims to support pharmacogenomics target predication of ADEs. We integrate a semantically annotated literature corpus Semantic MEDLINE with a semantically coded ADE knowledgebase known as ADEpedia using a semantic web based framework. We developed a knowledge discovery approach combining a network analysis of a protein-protein interaction (PPI) network and a gene functional classification approach. We performed a case study of drug-induced long QT syndrome for demonstrating the usefulness of the framework in predicting potential pharmacogenomics targets of ADEs. PMID:24303306

  2. Copy number variation in the horse genome.

    PubMed

    Ghosh, Sharmila; Qu, Zhipeng; Das, Pranab J; Fang, Erica; Juras, Rytis; Cothran, E Gus; McDonell, Sue; Kenney, Daniel G; Lear, Teri L; Adelson, David L; Chowdhary, Bhanu P; Raudsepp, Terje

    2014-10-01

    We constructed a 400K WG tiling oligoarray for the horse and applied it for the discovery of copy number variations (CNVs) in 38 normal horses of 16 diverse breeds, and the Przewalski horse. Probes on the array represented 18,763 autosomal and X-linked genes, and intergenic, sub-telomeric and chrY sequences. We identified 258 CNV regions (CNVRs) across all autosomes, chrX and chrUn, but not in chrY. CNVs comprised 1.3% of the horse genome with chr12 being most enriched. American Miniature horses had the highest and American Quarter Horses the lowest number of CNVs in relation to Thoroughbred reference. The Przewalski horse was similar to native ponies and draft breeds. The majority of CNVRs involved genes, while 20% were located in intergenic regions. Similar to previous studies in horses and other mammals, molecular functions of CNV-associated genes were predominantly in sensory perception, immunity and reproduction. The findings were integrated with previous studies to generate a composite genome-wide dataset of 1476 CNVRs. Of these, 301 CNVRs were shared between studies, while 1174 were novel and require further validation. Integrated data revealed that to date, 41 out of over 400 breeds of the domestic horse have been analyzed for CNVs, of which 11 new breeds were added in this study. Finally, the composite CNV dataset was applied in a pilot study for the discovery of CNVs in 6 horses with XY disorders of sexual development. A homozygous deletion involving AKR1C gene cluster in chr29 in two affected horses was considered possibly causative because of the known role of AKR1C genes in testicular androgen synthesis and sexual development. While the findings improve and integrate the knowledge of CNVs in horses, they also show that for effective discovery of variants of biomedical importance, more breeds and individuals need to be analyzed using comparable methodological approaches.

  3. Time-stratigraphic reconstruction and integration of paleopedologic, sedimentologic, and biotic events (Willwood Formation, Lower Eocene, northwest Wyoming, USA)

    USGS Publications Warehouse

    Bown, T.M.; Kraus, M.J.

    1993-01-01

    An empirically-based model is advanced using paleosol maturities to estimate the relative geologic time separating any stratigraphic levels within the lower Eocene Willwood Formation. The reviewed Willwood time stratigraphy from this analysis helps evaluate the nature, tempo, and possible causes of three major episodes of mammalian appearance and disappearance. These faunal events are directly correlated with certain apects of paleosol evolution in the Willwood Formation. That evolution is tied directly to climatic changes and to varying sediment accumulation rates in response to tectonism. -from Authors

  4. The oscillatory activities and its synchronization in auditory-visual integration as revealed by event-related potentials to bimodal stimuli

    NASA Astrophysics Data System (ADS)

    Guo, Jia; Xu, Peng; Yao, Li; Shu, Hua; Zhao, Xiaojie

    2012-03-01

    Neural mechanism of auditory-visual speech integration is always a hot study of multi-modal perception. The articulation conveys speech information that helps detect and disambiguate the auditory speech. As important characteristic of EEG, oscillations and its synchronization have been applied to cognition research more and more. This study analyzed the EEG data acquired by unimodal and bimodal stimuli using time frequency and phase synchrony approach, investigated the oscillatory activities and its synchrony modes behind evoked potential during auditory-visual integration, in order to reveal the inherent neural integration mechanism under these modes. It was found that beta activity and its synchronization differences had relationship with gesture N1-P2, which happened in the earlier stage of speech coding to pronouncing action. Alpha oscillation and its synchronization related with auditory N1-P2 might be mainly responsible for auditory speech process caused by anticipation from gesture to sound feature. The visual gesture changing enhanced the interaction of auditory brain regions. These results provided explanations to the power and connectivity change of event-evoked oscillatory activities which matched ERPs during auditory-visual speech integration.

  5. Recent trends in microdialysis sampling integrated with conventional and microanalytical systems for monitoring biological events: A review

    PubMed Central

    Nandi, Pradyot; Lunte, Susan M.

    2013-01-01

    Microdialysis (MD) is a sampling technique that can be employed to monitor biological events both in vivo and in vitro. When it is coupled to an analytical system, microdialysis can provide near realtime information on the time-dependent concentration changes of analytes in the extracellular space or other aqueous environments. Online systems for the analysis of microdialysis samples enable fast, selective and sensitive analysis while preserving the temporal information. Analytical methods employed for online analysis include liquid chromatography (LC), capillary (CE) and microchip electrophoresis and flow-through biosensor devices. This review article provides an overview of microdialysis sampling and online analysis systems with emphasis on in vivo analysis. Factors that affect the frequency of analysis and, hence, the temporal resolution of these systems are also discussed. PMID:19733728

  6. 22 CFR 401.13 - Copies required.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 22 Foreign Relations 2 2012-04-01 2009-04-01 true Copies required. 401.13 Section 401.13 Foreign Relations INTERNATIONAL JOINT COMMISSION, UNITED STATES AND CANADA RULES OF PROCEDURE Applications § 401.13... additional copies of the documents mentioned therein as may be requested by the Commission shall be...

  7. 22 CFR 401.13 - Copies required.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 22 Foreign Relations 2 2014-04-01 2014-04-01 false Copies required. 401.13 Section 401.13 Foreign Relations INTERNATIONAL JOINT COMMISSION, UNITED STATES AND CANADA RULES OF PROCEDURE Applications § 401.13... additional copies of the documents mentioned therein as may be requested by the Commission shall be...

  8. 22 CFR 401.13 - Copies required.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Copies required. 401.13 Section 401.13 Foreign Relations INTERNATIONAL JOINT COMMISSION, UNITED STATES AND CANADA RULES OF PROCEDURE Applications § 401.13... additional copies of the documents mentioned therein as may be requested by the Commission shall be...

  9. 22 CFR 401.13 - Copies required.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 22 Foreign Relations 2 2013-04-01 2009-04-01 true Copies required. 401.13 Section 401.13 Foreign Relations INTERNATIONAL JOINT COMMISSION, UNITED STATES AND CANADA RULES OF PROCEDURE Applications § 401.13... additional copies of the documents mentioned therein as may be requested by the Commission shall be...

  10. 22 CFR 401.13 - Copies required.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 22 Foreign Relations 2 2011-04-01 2009-04-01 true Copies required. 401.13 Section 401.13 Foreign Relations INTERNATIONAL JOINT COMMISSION, UNITED STATES AND CANADA RULES OF PROCEDURE Applications § 401.13... additional copies of the documents mentioned therein as may be requested by the Commission shall be...

  11. 48 CFR 3001.105-3 - Copies.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 7 2014-10-01 2014-10-01 false Copies. 3001.105-3 Section 3001.105-3 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND SECURITY....105-3 Copies. Official versions of the HSAR are available in the Code of Federal Regulations,...

  12. 48 CFR 3001.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ....105-3 Copies. The HSAR is available in the Federal Register and electronically at http://www.dhs.gov... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Copies. 3001.105-3 Section 3001.105-3 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND...

  13. 48 CFR 3001.105-3 - Copies.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 7 2013-10-01 2012-10-01 true Copies. 3001.105-3 Section 3001.105-3 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND SECURITY....105-3 Copies. Official versions of the HSAR are available in the Code of Federal Regulations,...

  14. 48 CFR 3001.105-3 - Copies.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ....105-3 Copies. The HSAR is available in the Federal Register and electronically at http://www.dhs.gov... 48 Federal Acquisition Regulations System 7 2011-10-01 2011-10-01 false Copies. 3001.105-3 Section 3001.105-3 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND...

  15. 48 CFR 201.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Copies. 201.105-3 Section 201.105-3 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE GENERAL FEDERAL ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 201.105-3 Copies....

  16. 48 CFR 1501.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Copies. 1501.105-3 Section 1501.105-3 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY GENERAL GENERAL... 20402. Copies of loose-leaf EPAAR are distributed within EPA and may be obtained from the EPA...

  17. Integration of Harvest and Time-to-Event Data Used to Estimate Demographic Parameters for White-tailed Deer

    NASA Astrophysics Data System (ADS)

    Norton, Andrew S.

    An integral component of managing game species is an understanding of population dynamics and relative abundance. Harvest data are frequently used to estimate abundance of white-tailed deer. Unless harvest age-structure is representative of the population age-structure and harvest vulnerability remains constant from year to year, these data alone are of limited value. Additional model structure and auxiliary information has accommodated this shortcoming. Specifically, integrated age-at-harvest (AAH) state-space population models can formally combine multiple sources of data, and regularization via hierarchical model structure can increase flexibility of model parameters. I collected known fates data, which I evaluated and used to inform trends in survival parameters for an integrated AAH model. I used temperature and snow depth covariates to predict survival outside of the hunting season, and opening weekend temperature and percent of corn harvest covariates to predict hunting season survival. When auxiliary empirical data were unavailable for the AAH model, moderately informative priors provided sufficient information for convergence and parameter estimates. The AAH model was most sensitive to errors in initial abundance, but this error was calibrated after 3 years. Among vital rates, the AAH model was most sensitive to reporting rates (percentage of mortality during the hunting season related to harvest). The AAH model, using only harvest data, was able to track changing abundance trends due to changes in survival rates even when prior models did not inform these changes (i.e. prior models were constant when truth varied). I also compared AAH model results with estimates from the Wisconsin Department of Natural Resources (WIDNR). Trends in abundance estimates from both models were similar, although AAH model predictions were systematically higher than WIDNR estimates in the East study area. When I incorporated auxiliary information (i.e. integrated AAH model

  18. Integrating Cutting-edge Approaches to Describe and Interpret the Timing of Physical and Biological events: A Leap Forward for Monitoring Global Change Across Scales

    NASA Astrophysics Data System (ADS)

    Sadinski, W.; Gallant, A.; Thompson, D.; Houlahan, J.; Roth, M.; Brisco, B.; Kaya, S.; Gage, S.; Brininger, W.; Mushet, D.; Petersen, D.; Tessler, D.; Snively, M.; Jones, P. M.; Tate, D. P.; Morton, J. M.; Brodman, R.; Muths, E.; Brown, J. F.; Pauli, B.; Rosenberry, D. O.

    2010-12-01

    Our ability to integrate measures of phenological events across methods and scales has taken a significant step forward with recent advances in recording and analyzing sounds. For example, we now can measure bird and amphibian responses to climate/global change extensively and intensively from the ground and relate them to other landscape responses measured via satellite, airborne, and ground-based sensors. Thus, we can document changes in the timing of related biotic and abiotic events and understand the ramifications for biodiversity-related ecosystem services more fully. We designed and continue to expand the Terrestrial Wetland Global Change Research Network based upon this new potential to describe and interpret the impacts of global change and to provide stakeholders vital information on the specific nature and relevance of those impacts. We began implementing field research in 2008 and continue to add new research nodes across portions of Alaska, Canada, and the conterminous U.S. by leveraging resources across multiple organizations. Our standardized approach enables us to compare phenological responses in wetland-upland landscape matrices across local, regional, and continental scales and along several physical and ecological gradients. The power of this approach is evident in comparisons of calling events for individual species or entire soundscapes with other biotic and abiotic conditions and demonstrates a significant step forward in our ability to describe and interpret the impacts of global change on interconnected wetlands and uplands.

  19. A "concrete view" of aging: event related potentials reveal age-related changes in basic integrative processes in language.

    PubMed

    Huang, Hsu-Wen; Meyer, Aaron M; Federmeier, Kara D

    2012-01-01

    Normal aging is accompanied by changes in both structural and functional cerebral organization. Although verbal knowledge seems to be relatively stable across the lifespan, there are age-related changes in the rapid use of that knowledge during on-line language processing. In particular, aging has been linked to reduce effectiveness in preparing for upcoming words and building an integrated sentence-level representation. The current study assessed whether such age-related changes extend even to much simpler language units, such as modification relations between a centrally presented adjective and a lateralized noun. Adjectives were used to elicit concrete and abstract meanings of the same, polysemous lexical items (e.g., "green book" vs. "interesting book"). Consistent with findings that lexical information is preserved with age, older adults, like younger adults, exhibited concreteness effects at the adjectives, with more negative responses to concrete adjectives over posterior (300-500 ms; N400) and frontal (300-900 ms) channels. However, at the noun, younger adults exhibited concreteness-based predictability effects linked to left hemisphere processing and imagery effects linked to right hemisphere processing, contingent on whether the adjectives and nouns formed a cohesive conceptual unit. In contrast, older adults showed neither effect, suggesting that they were less able to rapidly link the adjective-noun meaning to form an integrated conceptual representation. Age-related changes in language processing may thus be more pervasive than previously realized.

  20. High EGFR gene copy number predicts poor outcome in triple-negative breast cancer.

    PubMed

    Park, Heae Surng; Jang, Min Hye; Kim, Eun Joo; Kim, Hyun Jeong; Lee, Hee Jin; Kim, Yu Jung; Kim, Jee Hyun; Kang, Eunyoung; Kim, Sung-Won; Kim, In Ah; Park, So Yeon

    2014-09-01

    Epidermal growth factor receptor (EGFR) is frequently overexpressed in triple-negative breast cancer and is emerging as a therapeutic target. EGFR gene copy number alteration and mutation are highly variable and scientists have been challenged to define their prognostic significance in triple-negative breast cancer. We examined EGFR protein expression, EGFR gene copy number alteration and mutation of exon 18 to 21 in 151 cases of triple-negative breast cancer and correlated these findings with clinical outcomes. In addition, intratumoral agreement of EGFR protein overexpression and gene copy number alteration was evaluated. EGFR overexpression was found in 97 of 151 cases (64%) and high EGFR gene copy number was detected in 50 cases (33%), including 3 gene amplification (2%) and 47 high polysomy (31%). Five EGFR mutations were detected in 4 of 151 cases (3%) and included G719A in exon 18 (n=1), V786M in exon 20 (n=1), and L858R in exon 21 (n=3). One case had two mutations (G719A and L858R). High EGFR copy number, but not EGFR mutation, correlated with EGFR protein overexpression. Intratumoral heterogeneity of EGFR protein overexpression and EGFR copy number alteration was not significant. In survival analyses, high EGFR copy number was found to be an independent prognostic factor for poor disease-free survival in patients with triple-negative breast cancer. Our findings showed that EGFR mutation was a rare event, but high EGFR copy number was relatively frequent and correlated with EGFR overexpression in triple-negative breast cancer. Moreover, high EGFR copy number was associated with poor clinical outcome in triple-negative breast cancer, suggesting that evaluation of EGFR copy number may be useful for predicting outcomes in patients with triple-negative breast cancer and for selecting patients for anti-EGFR-targeted therapy.

  1. GeoMedStat: an integrated spatial surveillance system to track air pollution and associated healthcare events.

    PubMed

    Faruque, Fazlay S; Li, Hui; Williams, Worth B; Waller, Lance A; Brackin, Bruce T; Zhang, Lei; Grimes, Kim A; Finley, Richard W

    2014-12-01

    Air pollutants, such as particulate matter with a diameter ≤2.5 microns (PM2.5) and ozone (O3), are known to exacerbate asthma and other respiratory diseases. An integrated surveillance system that tracks such air pollutants and associated disease incidence can assist in risk assessment, healthcare preparedness and public awareness. However, the implementation of such an integrated environmental health surveillance system is a challenge due to the disparate sources of many types of data and the implementation becomes even more complicated for a spatial and real-time system due to lack of standardised technological components and data incompatibility. In addition, accessing and utilising health data that are considered as Protected Health Information (PHI) require maintaining stringent protocols, which have to be supported by the system. This paper aims to illustrate the development of a spatial surveillance system (GeoMedStat) that is capable of tracking daily environmental pollutants along with both daily and historical patient encounter data. It utilises satellite data and the groundmonitor data from the US National Aeronautics and Space Administration (NASA) and the US Environemental Protection Agenecy (EPA), rspectively as inputs estimating air pollutants and is linked to hospital information systems for accessing chief complaints and disease classification codes. The components, developmental methods, functionality of GeoMedStat and its use as a real-time environmental health surveillance system for asthma and other respiratory syndromes in connection with with PM2.5 and ozone are described. It is expected that the framework presented will serve as an example to others developing real-time spatial surveillance systems for pollutants and hospital visits.

  2. Emotional Processing and Attention Control Impairments in Children with Anxiety: An Integrative Review of Event-Related Potentials Findings

    PubMed Central

    Wauthia, Erika; Rossignol, Mandy

    2016-01-01

    Anxiety disorders in adults have been associated with biased processing of emotional information which may be due to a deficit in attentional control. This deficit leads to an hypervigilance and a selective attention toward threatening information. Event-related potentials (ERPs) have been used to study this topic in anxious adults. Similar biases have been reported in children with anxiety but researches investigating the ERPs components underpinning these biases are more scarce. However, the understanding of the neural correlates of attentional biases in anxious children seem quite important since they could play a role in the etiology and the maintenance of this disorder. This review summarizes the results of researches having used ERPs to index emotional processing and attention control in children suffering from anxiety. We will focus on the P1, indexing basic visual perceptual processing, the N2, thought to reflect cognitive control process, the P3 typically associated with response inhibition, and the late positive potential (LPP) that indicates sustained attention toward motivationally salient stimuli. We will also examine the error-related negativity (ERN) that indexes monitoring system for detecting errors. Electro-physiological studies generally reported increased amplitudes of these components in anxious children, even when they did not differ from typically developing children at a behavioral level. These results suggest diminished cognitive control that influences children's selective attention mechanisms toward threatening information. Theoretical perspectives and implications for future researches will be discussed in the framework of current models of childhood anxiety. PMID:27199802

  3. ATRX and IDH1-R132H immunohistochemistry with subsequent copy number analysis and IDH sequencing as a basis for an "integrated" diagnostic approach for adult astrocytoma, oligodendroglioma and glioblastoma.

    PubMed

    Reuss, David E; Sahm, Felix; Schrimpf, Daniel; Wiestler, Benedikt; Capper, David; Koelsche, Christian; Schweizer, Leonille; Korshunov, Andrey; Jones, David T W; Hovestadt, Volker; Mittelbronn, Michel; Schittenhelm, Jens; Herold-Mende, Christel; Unterberg, Andreas; Platten, Michael; Weller, Michael; Wick, Wolfgang; Pfister, Stefan M; von Deimling, Andreas

    2015-01-01

    Diffuse gliomas are represented in the 2007 WHO classification as astrocytomas, oligoastrocytomas and oligodendrogliomas of grades II and III and glioblastomas WHO grade IV. Molecular data on these tumors have a major impact on prognosis and therapy of the patients. Consequently, the inclusion of molecular parameters in the WHO definition of brain tumors is being planned and has been forwarded as the "ISN-Haarlem" consensus. We, here, analyze markers of special interest including ATRX, IDH and 1p/19q codeletion in a series of 405 adult patients. Among the WHO 2007 classified tumors were 152 astrocytomas, 61 oligodendrogliomas, 63 oligoastrocytomas and 129 glioblastomas. Following the concepts of the "ISN-Haarlem", we rediagnosed the series to obtain "integrated" diagnoses with 155 tumors being astrocytomas, 100 oligodendrogliomas and 150 glioblastomas. In a subset of 100 diffuse gliomas from the NOA-04 trial with long-term follow-up data available, the "integrated" diagnosis had a significantly greater prognostic power for overall and progression-free survival compared to WHO 2007. Based on the "integrated" diagnoses, loss of ATRX expression was close to being mutually exclusive to 1p/19q codeletion, with only 2 of 167 ATRX-negative tumors exhibiting 1p/19q codeletion. All but 4 of 141 patients with loss of ATRX expression and diffuse glioma carried either IDH1 or IDH2 mutations. Interestingly, the majority of glioblastoma patients with loss of ATRX expression but no IDH mutations exhibited an H3F3A mutation. Further, all patients with 1p/19 codeletion carried a mutation in IDH1 or IDH2. We present an algorithm based on stepwise analysis with initial immunohistochemistry for ATRX and IDH1-R132H followed by 1p/19q analysis followed by IDH sequencing which reduces the number of molecular analyses and which has a far better association with patient outcome than WHO 2007.

  4. Integration

    ERIC Educational Resources Information Center

    Kalyn, Brenda

    2006-01-01

    Integrated learning is an exciting adventure for both teachers and students. It is not uncommon to observe the integration of academic subjects such as math, science, and language arts. However, educators need to recognize that movement experiences in physical education also can be linked to academic curricula and, may even lead the…

  5. Genome Architecture and Its Roles in Human Copy Number Variation

    PubMed Central

    Chen, Lu; Zhou, Weichen; Zhang, Ling

    2014-01-01

    Besides single-nucleotide variants in the human genome, large-scale genomic variants, such as copy number variations (CNVs), are being increasingly discovered as a genetic source of human diversity and the pathogenic factors of diseases. Recent experimental findings have shed light on the links between different genome architectures and CNV mutagenesis. In this review, we summarize various genomic features and discuss their contributions to CNV formation. Genomic repeats, including both low-copy and high-copy repeats, play important roles in CNV instability, which was initially known as DNA recombination events. Furthermore, it has been found that human genomic repeats can also induce DNA replication errors and consequently result in CNV mutations. Some recent studies showed that DNA replication timing, which reflects the high-order information of genomic organization, is involved in human CNV mutations. Our review highlights that genome architecture, from DNA sequence to high-order genomic organization, is an important molecular factor in CNV mutagenesis and human genomic instability. PMID:25705150

  6. Does testing with feedback improve adult spelling skills relative to copying and reading?

    PubMed

    Pan, Steven C; Rubin, Benjamin R; Rickard, Timothy C

    2015-12-01

    We examined testing's ability to enhance adult spelling acquisition, relative to copying and reading. Across 3 experiments in which testing with feedback was compared with copying, the spelling improvement after testing matched that following the same amount of time spent copying. A potent testing advantage, however, was observed for spelling words free-recalled. In the fourth experiment, a large testing advantage for both word free recall and spelling was observed, versus reading. Subjects also generally preferred testing and rated it as more effective than copying or reading. The equivalent performance of testing and copying for spelling contrasts with prior work involving children and suggests that retrieval practice may not be the only effective mechanism for spelling skill acquisition. Rather, we suggest that the critical learning event for spelling is focused study on phoneme-to-grapheme mappings for previously unlearned letter sequences. For adults with extensive spelling expertise, focused study is more automatic during both copying and testing with feedback than for individuals with beginning spelling skills. Reading, however, would not be expected to produce efficient focused study of phoneme-to-grapheme mappings, regardless of expertise level. Overall, adult spelling skill acquisition benefits both from testing and copying, and substantially less from reading.

  7. Allele-specific copy number profiling by next-generation DNA sequencing.

    PubMed

    Chen, Hao; Bell, John M; Zavala, Nicolas A; Ji, Hanlee P; Zhang, Nancy R

    2015-02-27

    The progression and clonal development of tumors often involve amplifications and deletions of genomic DNA. Estimation of allele-specific copy number, which quantifies the number of copies of each allele at each variant loci rather than the total number of chromosome copies, is an important step in the characterization of tumor genomes and the inference of their clonal history. We describe a new method, falcon, for finding somatic allele-specific copy number changes by next generation sequencing of tumors with matched normals. falcon is based on a change-point model on a bivariate mixed Binomial process, which explicitly models the copy numbers of the two chromosome haplotypes and corrects for local allele-specific coverage biases. By using the Binomial distribution rather than a normal approximation, falcon more effectively pools evidence from sites with low coverage. A modified Bayesian information criterion is used to guide model selection for determining the number of copy number events. Falcon is evaluated on in silico spike-in data and applied to the analysis of a pre-malignant colon tumor sample and late-stage colorectal adenocarcinoma from the same individual. The allele-specific copy number estimates obtained by falcon allows us to draw detailed conclusions regarding the clonal history of the individual's colon cancer.

  8. Droplet digital PCR-aided screening and characterization of Pichia pastoris multiple gene copy strains.

    PubMed

    Cámara, Elena; Albiol, Joan; Ferrer, Pau

    2016-07-01

    Pichia (syn. Komagataella) pastoris is a widely used yeast platform for heterologous protein production. Expression cassettes are usually stably integrated into the genome of this host via homologous recombination. Although increasing gene dosage is a powerful strategy to improve recombinant protein production, an excess in the number of gene copies often leads to decreased product yields and increased metabolic burden, particularly for secreted proteins. We have constructed a series of strains harboring different copy numbers of a Rhizopus oryzae lipase gene (ROL), aiming to find the optimum gene dosage for secreted Rol production. In order to accurately determine ROL gene dosage, we implemented a novel protocol based on droplet digital PCR (ddPCR), and cross validated it with conventional real-time PCR. Gene copy number determination based on ddPCR allowed for an accurate ranking of transformants according to their ROL gene dosage. Results indicated that ddPCR was particularly superior at lower gene dosages (one to five copies) over quantitative real-time PCR (qPCR). This facilitated the determination of the optimal ROL gene dosage as low as two copies. The ranking of ROL gene dosage versus Rol yield was consistent at both small scale and bioreactor chemostat cultures, thereby easing clone characterization in terms of gene dosage dependent physiological effects, which could be discriminated even among strains differing by only one ROL copy. A selected two-copy strain showed twofold increase in Rol specific production in a chemostat culture over the single copy strain. Conversely, strains harboring more than two copies of the ROL gene showed decreased product and biomass yields, as well as altered substrate consumption specific rates, compared to the reference (one-copy) strain. Biotechnol. Bioeng. 2016;113: 1542-1551. © 2015 Wiley Periodicals, Inc.

  9. Final Scientific/Technical Report, DE-FG02-06ER64171, Integrated Nucleic Acid System for In-Field Monitoring of Microbial Community Dynamics and Metabolic Activity – Subproject to Co-PI Eric E. Roden

    SciTech Connect

    Eric E. Roden

    2009-07-08

    This report summarizes research conducted in conjunction with a project entitled “Integrated Nucleic Acid System for In-Field Monitoring of Microbial Community Dynamics and Metabolic Activity”, which was funded through the Integrative Studies Element of the former NABIR Program (now the Environmental Remediation Sciences Program) within the Office of Biological and Environmental Research. Dr. Darrell Chandler (originally at Argonne National Laboratory, now with Akonni Biosystems) was the overall PI/PD for the project. The overall project goals were to (1) apply a model iron-reducer and sulfate-reducer microarray and instrumentation systems to sediment and groundwater samples from the Scheibe et al. FRC Area 2 field site, UMTRA sediments, and other DOE contaminated sites; (2) continue development and expansion of a 16S rRNA/rDNA¬-targeted probe suite for microbial community dynamics as new sequences are obtained from DOE-relevant sites; and (3) address the fundamental molecular biology and analytical chemistry associated with the extraction, purification and analysis of functional genes and mRNA in environmental samples. Work on the UW subproject focused on conducting detailed batch and semicontinuous culture reactor experiments with uranium-contaminated FRC Area 2 sediment. The reactor experiments were designed to provide coherent geochemical and microbiological data in support of microarray analyses of microbial communities in Area 2 sediments undergoing biostimulation with ethanol. A total of four major experiments were conducted (one batch and three semicontinuous culture), three of which (the batch and two semicontinuous culture) provided samples for DNA microarray analysis. A variety of other molecular analyses (clone libraries, 16S PhyloChip, RT-PCR, and T-RFLP) were conducted on parallel samples from the various experiments in order to provide independent information on microbial community response to biostimulation.

  10. HPV integration detection in CaSki and SiHa using detection of integrated papillomavirus sequences and restriction-site PCR.

    PubMed

    Raybould, Rachel; Fiander, Alison; Wilkinson, Gavin W G; Hibbitts, Sam

    2014-09-01

    Human Papillomavirus (HPV) infection is the primary cause of cervical neoplasia. HPV DNA is integrated into the human genome in the majority of cervical cancers. The nature of integration may differ with integration incorporating a single copy of HPV or occurring in concatenated form. Our understanding of HPV tumorigenesis is largely based on studies using characterised cell lines with defined integration sites; these cell lines provide an invaluable standard for validation of diagnostic assays. Cell lines also further understanding of integration mechanisms in clinical samples. The objective of this study was to explore integration assays and to investigate integration events in cell lines where HPV is integrated in concatenated form. Restriction site PCR and detection of integrated papillomavirus sequences were performed on DNA from SiHa and CaSki. A novel integration site on Xq27.3 and HPV genome rearrangements were detected in CaSki DNA. However, where integration was previously detected by FISH in CaSki, and reported to be integrated in concatenated form, integration was not detected by DIPS or RS-PCR. The data presented illustrate that HPV copy number can hinder integration detection; this needs consideration when interpreting results from tests applied to clinical samples.

  11. The physics of a single-event upset in integrated circuits: A review and critique of analytical models for charge collection

    NASA Technical Reports Server (NTRS)

    Vonroos, O.; Zoutendyk, J.

    1983-01-01

    When an energetic particle (kinetic energy 0.5 MeV) originating from a radioactive decay or a cosmic ray transverse the active regions of semiconductor devices used in integrated circuit (IC) chips, it leaves along its track a high density electron hole plasma. The subsequent decay of this plasma by drift and diffusion leads to charge collection at the electrodes large enough in most cases to engender a false reading, hence the name single-event upset (SEU). The problem of SEU's is particularly severe within the harsh environment of Jupiter's radiation belts and constitutes therefore a matter of concern for the Galileo mission. The physics of an SEU event is analyzed in some detail. Owing to the predominance of nonlinear space charge effects and the fact that positive (holes) and negative (electrons) charges must be treated on an equal footing, analytical models for the ionized-charge collection and their corresponding currents as a function of time prove to be inadequate even in the simplest case of uniformly doped, abrupt p-n junctions in a one-dimensional geometry. The necessity for full-fledged computer simulation of the pertinent equations governing the electron-hole plasma therefore becomes imperative.

  12. ACTA Technology Presents EPA with Patent Copy

    EPA Pesticide Factsheets

    US EPA SBIR awardee, ACTA Technology, presented James H. Johnson, Director of the US EPA National Center for Environmental Research, and April Richards, Program Manager of the US EPA's SBIR Program, with a copy of their Red Ribbon patent.

  13. Kinetic versus Energetic Discrimination in Biological Copying

    NASA Astrophysics Data System (ADS)

    Sartori, Pablo; Pigolotti, Simone

    2013-05-01

    We study stochastic copying schemes in which discrimination between a right and a wrong match is achieved via different kinetic barriers or different binding energies of the two matches. We demonstrate that, in single-step reactions, the two discrimination mechanisms are strictly alternative and cannot be mixed to further reduce the error fraction. Close to the lowest error limit, kinetic discrimination results in a diverging copying velocity and dissipation per copied bit. On the other hand, energetic discrimination reaches its lowest error limit in an adiabatic regime where dissipation and velocity vanish. By analyzing experimentally measured kinetic rates of two DNA polymerases, T7 and Polγ, we argue that one of them operates in the kinetic and the other in the energetic regime. Finally, we show how the two mechanisms can be combined in copying schemes implementing error correction through a proofreading pathway.

  14. Line copy presentation slides with Kodalith.

    PubMed

    Kraushar, M F; Bailey, B A

    1978-08-01

    Line copy presentation slides with white letters on a blue background can be produced with a two-step process. The slides are more permanent than diazo slides, and the process is faster and less expensive.

  15. NASA printing, duplicating, and copying management handbook

    NASA Technical Reports Server (NTRS)

    1993-01-01

    This handbook provides information and procedures for the implementation of NASA policy and applicable laws and regulations relating to printing, duplicating, and copying. The topics addressed include a description of relevant laws and regulations, authorizations required, and responsible entities for NASA printing, duplicating, and copying. The policy of NASA is to ensure understanding and application of authority and responsibility on printing matters. Where necessary, the handbook clarifies the intent of basic laws and regulations applicable to NASA.

  16. COPI Is Required for Enterovirus 71 Replication

    PubMed Central

    Wang, Jianmin; Wu, Zhiqiang; Jin, Qi

    2012-01-01

    Enterovirus 71 (EV71), a member of the Picornaviridae family, is found in Asian countries where it causes a wide range of human diseases. No effective therapy is available for the treatment of these infections. Picornaviruses undergo RNA replication in association with membranes of infected cells. COPI and COPII have been shown to be involved in the formation of picornavirus-induced vesicles. Replication of several picornaviruses, including poliovirus and Echovirus 11 (EV11), is dependent on COPI or COPII. Here, we report that COPI, but not COPII, is required for EV71 replication. Replication of EV71 was inhibited by brefeldin A and golgicide A, inhibitors of COPI activity. Furthermore, we found EV71 2C protein interacted with COPI subunits by co-immunoprecipitation and GST pull-down assay, indicating that COPI coatomer might be directed to the viral replication complex through viral 2C protein. Additionally, because the pathway is conserved among different species of enteroviruses, it may represent a novel target for antiviral therapies. PMID:22662263

  17. Single copy DNA homology in sea stars.

    PubMed

    Smith, M J; Nicholson, R; Stuerzl, M; Lui, A

    1982-01-01

    The sequence homology in the single copy DNA of sea stars has been measured. Labeled single copy DNA from Pisaster ochraceus was reannealed with excess genomic DNA from P. brevispinus, Evasterias troschelii, Pycnopodia helianthoides, Solaster stimpsoni, and Dermasterias imbricata. Reassociation reactions were performed under two criteria of salt and temperature. The extent of reassociation and thermal denaturation characteristics of hybrid single copy DNA molecules follow classical taxonomic lines. P. brevispinus DNA contains essentially all of the sequences present in P. ochraceus single copy tracer while Evasterias and Pycnopodia DNAs contain 52% and 46% of such sequences respectively. Reciprocal reassociation reactions with labeled Evasterias single copy DNA confirm the amount and fidelity of the sequence homology. There is a small definite reaction of uncertain homology between P. ochraceus single copy DNA and Solaster or Dermasterias DNA. Similarly Solaster DNA contains sequences homologous to approximately 18% of Dermasterias unique DNA. The thermal denaturation temperatures of heteroduplexes indicate that the genera Pisaster and Evasterias diverged shortly after the divergence of the subfamilies Pycnopodiinae and Asteriinae. The two Pisaster species diverged more recently, probably in the most recent quarter of the interval since the separation of the genera Pisaster and Evasterias.

  18. Copy Number Profiling of Brazilian Astrocytomas

    PubMed Central

    Bidinotto, Lucas Tadeu; Torrieri, Raul; Mackay, Alan; Almeida, Gisele Caravina; Viana-Pereira, Marta; Cruvinel-Carloni, Adriana; Spina, Maria Luisa; Campanella, Nathalia Cristina; Pereira de Menezes, Weder; Clara, Carlos Afonso; Becker, Aline Paixão; Jones, Chris; Reis, Rui Manuel

    2016-01-01

    Copy number alterations (CNA) are one of the driving mechanisms of glioma tumorigenesis, and are currently used as important biomarkers in the routine setting. Therefore, we performed CNA profiling of 65 astrocytomas of distinct malignant grades (WHO grade I–IV) of Brazilian origin, using array-CGH and microsatellite instability analysis (MSI), and investigated their correlation with TERT and IDH1 mutational status and clinico-pathological features. Furthermore, in silico analysis using the Oncomine database was performed to validate our findings and extend the findings to gene expression level. We found that the number of genomic alterations increases in accordance with glioma grade. In glioblastomas (GBM), the most common alterations were gene amplifications (PDGFRA, KIT, KDR, EGFR, and MET) and deletions (CDKN2A and PTEN). Log-rank analysis correlated EGFR amplification and/or chr7 gain with better survival of the patients. MSI was observed in 11% of GBMs. A total of 69% of GBMs presented TERT mutation, whereas IDH1 mutation was most frequent in diffuse (85.7%) and anaplastic (100%) astrocytomas. The combination of 1p19q deletion and TERT and IDH1 mutational status separated tumor groups that showed distinct age of diagnosis and outcome. In silico validation pointed to less explored genes that may be worthy of future investigation, such as CDK2, DMRTA1, and MTAP. Herein, using an extensive integrated analysis, we indicated potentially important genes, not extensively studied in gliomas, that could be further explored to assess their biological and clinical impact in astrocytomas. PMID:27172220

  19. A method for calling copy number polymorphism using haplotypes

    PubMed Central

    Ho Jang, Gun; Christie, Jason D.; Feng, Rui

    2013-01-01

    Single nucleotide polymorphism (SNP) and copy number variation (CNV) are both widespread characteristic of the human genome, but are often called separately on common genotyping platforms. To capture integrated SNP and CNV information, methods have been developed for calling allelic specific copy numbers or so called copy number polymorphism (CNP), using limited inter-marker correlation. In this paper, we proposed a haplotype-based maximum likelihood method to call CNP, which takes advantage of the valuable multi-locus linkage disequilibrium (LD) information in the population. We also developed a computationally efficient algorithm to estimate haplotype frequencies and optimize individual CNP calls iteratively, even at presence of missing data. Through simulations, we demonstrated our model is more sensitive and accurate in detecting various CNV regions, compared with commonly-used CNV calling methods including PennCNV, another hidden Markov model (HMM) using CNP, a scan statistic, segCNV, and cnvHap. Our method often performs better in the regions with higher LD, in longer CNV regions, and in common CNV than the opposite. We implemented our method on the genotypes of 90 HapMap CEU samples and 23 patients with acute lung injury (ALI). For each ALI patient the genotyping was performed twice. The CNPs from our method show good consistency and accuracy comparable to others. PMID:24069028

  20. Discussion on copy constructor in C++ programming language

    NASA Astrophysics Data System (ADS)

    Luo, Fafen; Du, Ruiqing

    2011-12-01

    C++ is a widely used object-orientated programming language in the software industry. The purpose of this paper is to discuss concept and application of the copy constructor, a special constructor in C++. As fundamental knowledge, constructor and destructor were introduced at first. Several examples of copy constructor were presented to illustrate concept of copy constructor and its use. Shallow copy and deep copy were also presented. After discussions on copy constructor by analyzing all the examples of copy constructor, the conclusion was made about that how to define a copy constructor and how to use it properly.

  1. Characterization and event specific-detection by quantitative real-time PCR of T25 maize insert.

    PubMed

    Collonnier, Cécile; Schattner, Alexandra; Berthier, Georges; Boyer, Francine; Coué-Philippe, Géraldine; Diolez, Annick; Duplan, Marie-Noëlle; Fernandez, Sophie; Kebdani, Naïma; Kobilinsky, André; Romaniuk, Marcel; de Beuckeleer, Marc; de Loose, Marc; Windels, Pieter; Bertheau, Yves

    2005-01-01

    T25 is one of the 4 maize transformation events from which commercial lines have so far been authorized in Europe. It was created by polyethylene glycol-mediated transformation using a construct bearing one copy of the synthetic pat gene associated with both promoter and terminator of the 35S ribosomal gene from cauliflower mosaic virus. In this article, we report the sequencing of the whole T25 insert and the characterization of its integration site by using a genome walking strategy. Our results confirmed that one intact copy of the initial construct had been integrated in the plant genome. They also revealed, at the 5' junction of the insert, the presence of a second truncated 35S promoter, probably resulting from rearrangements which may have occurred before or during integration of the plasmid DNA. The analysis of the junction fragments showed that the integration site of the insert presented high homologies with the Huck retrotransposon family. By using one primer annealing in the maize genome and the other in the 5' end of the integrated DNA, we developed a reliable event-specific detection system for T25 maize. To provide means to comply with the European regulation, a real-time PCR test was designed for specific quantitation of T25 event by using Taqman chemistry.

  2. Development of a system for multicopy gene integration in Saccharomyces cerevisiae.

    PubMed

    Semkiv, Marta V; Dmytruk, Kostyantyn V; Sibirny, Andriy A

    2016-01-01

    In this study we describe construction and evaluation of a vector for multicopy integration in yeast Saccharomyces cerevisiae. In this vector a modified selective marker and a reporter gene PHO8 (encoding alkaline phosphatase) were flanked with delta sequences of the Ty1 transposon. Modified by error-prone PCR version of selection marker kanMX4 was obtained from Escherichia coli clone with impaired geneticin (G418) resistance. The attenuation of kanMX4 gene provides an opportunity to select for explicitly multicopy integration of the module in S. cerevisiae using moderate (200 mg L(-1)) antibiotic concentrations. The developed system provided integration of 3-10 copies of the module in the genome of S. cerevisiae. High copy integration events were confirmed by qRT-PCR, Southern hybridization and reporter enzyme activity measurements.

  3. Copy number analysis of ductal carcinoma in situ with and without recurrence.

    PubMed

    Gorringe, Kylie L; Hunter, Sally M; Pang, Jia-Min; Opeskin, Ken; Hill, Prue; Rowley, Simone M; Choong, David Y H; Thompson, Ella R; Dobrovic, Alexander; Fox, Stephen B; Mann, G Bruce; Campbell, Ian G

    2015-09-01

    Ductal carcinoma in situ (DCIS) is a non-obligate precursor of invasive breast cancer and a frequent mammographic finding requiring treatment. Up to 25% of DCIS can recur and half of recurrences are invasive, but there are no reliable biomarkers for recurrence. We hypothesised that copy number aberrations could predict likelihood of recurrence. We analysed a cohort of pure DCIS cases treated only with wide local excision for genome-wide copy number and loss of heterozygosity using Affymetrix OncoScan MIP arrays. Cases included those without recurrence within 7 years (n = 25) and with recurrence between 1 and 5 years after diagnosis (n = 15). Pure DCIS were broadly similar in copy number changes compared with invasive breast cancer, with the consistent exception of a greater frequency of ERBB2 amplification in DCIS. There were no significant differences in age or ER status between the cases with a recurrence vs those without. Overall, the DCIS cases with recurrence had more copy number events than the DCIS without recurrence. The increased copy number appeared non-random with several genomic regions showing an increase in frequency in recurrent cases, including 20 q gain, ERBB2 amplification and 15q loss. Copy number changes may provide prognostic information for DCIS recurrence, but validation in additional cohorts is required.

  4. 23. Photographic copy enlargement from a 4x5 copy negative of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    23. Photographic copy enlargement from a 4x5 copy negative of a drawing (Original drawing located on abandoned NASA site, currently owned by the City of Downey, Downey, Calfornia). JANUARY 1960 USAF PLANT 16 MASTER PLOT AND GRID PLAN. - NASA Industrial Plant, Missile Research Laboratory, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

  5. 22. Photographic copy enlargement from a 4x5 copy negative of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. Photographic copy enlargement from a 4x5 copy negative of a print. (Original print located on abandoned NASA site, currently owned by the City of Downey, Downey, California). 1954 USAF PLANT 16 AERIAL BUILDING 41 NORTH TO SOUTH. - NASA Industrial Plant, Missile Research Laboratory, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

  6. 15. Photographic copy englargement from a 4x5 copy negative (Original ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    15. Photographic copy englargement from a 4x5 copy negative (Original drawing located on abandoned NASA site, currently owned by the City of Downey, Downey, California). 1980 BLDG 10, BLDG 42 FLOOR PLAN, NASA MARCH 15 1980. - NASA Industrial Plant, Maintenance Facility, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

  7. 9. Photographic copy enlargement from a 4x5 copy negative. (Original ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. Photographic copy enlargement from a 4x5 copy negative. (Original drawing located on abandoned NASA site, currently owned by the City of Downey, Downey, California). 1976 BLDGS.25, 41 SITE PLAN. - NASA Industrial Plant, Storage Facility, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

  8. 14. Photographic copy englargement from a 4x5 copy negative (Original ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. Photographic copy englargement from a 4x5 copy negative (Original photograph by original photographer located on abandoned NASA site, currently owned by the City of Downey, Downey, California). AERIAL PHOTOGRAPH 1935-1936 CONSOLIDATED VULTEE AIRCRAFT CORPORATION FROM WEST TO EAST - NASA Industrial Plant, Maintenance Facility, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

  9. Mechanisms of change in gene copy number.

    PubMed

    Hastings, P J; Lupski, James R; Rosenberg, Susan M; Ira, Grzegorz

    2009-08-01

    Deletions and duplications of chromosomal segments (copy number variants, CNVs) are a major source of variation between individual humans and are an underlying factor in human evolution and in many diseases, including mental illness, developmental disorders and cancer. CNVs form at a faster rate than other types of mutation, and seem to do so by similar mechanisms in bacteria, yeast and humans. Here we review current models of the mechanisms that cause copy number variation. Non-homologous end-joining mechanisms are well known, but recent models focus on perturbation of DNA replication and replication of non-contiguous DNA segments. For example, cellular stress might induce repair of broken replication forks to switch from high-fidelity homologous recombination to non-homologous repair, thus promoting copy number change.

  10. Evolution of ribosomal RNA gene copy number on the sex chromosomes of Drosophila melanogaster.

    PubMed

    Lyckegaard, E M; Clark, A G

    1991-07-01

    A diverse array of cellular and evolutionary forces--including unequal crossing-over, magnification, compensation, and natural selection--is at play modulating the number of copies of ribosomal RNA (rRNA) genes on the X and Y chromosomes of Drosophila. Accurate estimates of naturally occurring distributions of copy numbers on both the X and Y chromosomes are needed in order to explore the evolutionary end result of these forces. Estimates of relative copy numbers of the ribosomal DNA repeat, as well as of the type I and type II inserts, were obtained for a series of 96 X chromosomes and 144 Y chromosomes by using densitometric measurements of slot blots of genomic DNA from adult D. melanogaster bearing appropriate deficiencies that reveal chromosome-specific copy numbers. Estimates of copy number were put on an absolute scale with slot blots having serial dilutions both of the repeat and of genomic DNA from nonpolytene larval brain and imaginal discs. The distributions of rRNA copy number are decidedly skewed, with a long tail toward higher copy numbers. These distributions were fitted by a population genetic model that posits three different types of exchange events--sister-chromatid exchange, intrachromatid exchange, and interchromosomal crossing-over. In addition, the model incorporates natural selection, because experimental evidence shows that there is a minimum number of functional elements necessary for survival. Adequate fits of the model were found, indicating that either natural selection also eliminates chromosomes with high copy number or that the rate of intrachromatid exchange exceeds the rate of interchromosomal exchange.

  11. Gene copy number and malaria biology

    PubMed Central

    Anderson, Tim J.C.; Patel, Jigar; Ferdig, Michael T.

    2010-01-01

    Alteration in gene copy number provides a simple way to change expression levels and alter phenotype. This was fully appreciated by bacteriologists more than 25 years ago, but the extent and implications of copy number polymorphism (CNP) have only recently become apparent in other organisms. New methods demonstrate the ubiquity of CNPs in eukaryotes and their medical importance in humans. CNP is also widespread in the Plasmodium falciparum genome and has an important and underappreciated role in determining phenotype. In this review, we summarize the distribution of CNP, its evolutionary dynamics within populations, its functional importance and its mode of evolution. PMID:19559648

  12. Too many trees to see the forest: performance, event-related potential, and functional magnetic resonance imaging manifestations of integrative congenital prosopagnosia.

    PubMed

    Bentin, Shlomo; Degutis, Joseph M; D'Esposito, Mark; Robertson, Lynn C

    2007-01-01

    Neuropsychological, event-related potential (ERP), and functional magnetic resonance imaging (fMRI) methods were combined to provide a comprehensive description of performance and neurobiological profiles for K.W., a case of congenital prosopagnosia. We demonstrate that K.W.'s visual perception is characterized by almost unprecedented inability to identify faces, a large bias toward local features, and an extreme deficit in global/configural processing that is not confined to faces. This pattern could be appropriately labeled congenital integrative prosopagnosia, and accounts for some, albeit not all, cases of face recognition impairments without identifiable brain lesions. Absence of face selectivity is evident in both biological markers of face processing, fMRI (the fusiform face area [FFA]), and ERPs (N170). Nevertheless, these two neural signatures probably manifest different perceptual mechanisms. Whereas the N170 is triggered by the occurrence of physiognomic stimuli in the visual field, the deficient face-selective fMRI activation in the caudal brain correlates with the severity of global processing deficits. This correlation suggests that the FFA might be associated with global/configural computation, a crucial part of face identification.

  13. Inducible Amplification of Gene Copy Number and Heterologous Protein Production in the Yeast Kluyveromyces lactis

    PubMed Central

    Morlino, Giovanni B.; Tizzani, Lorenza; Fleer, Reinhard; Frontali, Laura; Bianchi, Michele M.

    1999-01-01

    Heterologous protein production can be doubled by increasing the copy number of the corresponding heterologous gene. We constructed a host-vector system in the yeast Kluyveromyces lactis that was able to induce copy number amplification of pKD1 plasmid-based vectors upon expression of an integrated copy of the plasmid recombinase gene. We increased the production and secretion of two heterologous proteins, glucoamylase from the yeast Arxula adeninivorans and mammalian interleukin-1β, following gene dosage amplification when the heterologous genes were carried by pKD1-based vectors. The choice of the promoters for expression of the integrated recombinase gene and of the episomal heterologous genes are critical for the mitotic stability of the host-vector system. PMID:10543790

  14. Inducible amplification of gene copy number and heterologous protein production in the yeast Kluyveromyces lactis.

    PubMed

    Morlino, G B; Tizzani, L; Fleer, R; Frontali, L; Bianchi, M M

    1999-11-01

    Heterologous protein production can be doubled by increasing the copy number of the corresponding heterologous gene. We constructed a host-vector system in the yeast Kluyveromyces lactis that was able to induce copy number amplification of pKD1 plasmid-based vectors upon expression of an integrated copy of the plasmid recombinase gene. We increased the production and secretion of two heterologous proteins, glucoamylase from the yeast Arxula adeninivorans and mammalian interleukin-1beta, following gene dosage amplification when the heterologous genes were carried by pKD1-based vectors. The choice of the promoters for expression of the integrated recombinase gene and of the episomal heterologous genes are critical for the mitotic stability of the host-vector system.

  15. A HIERARCHICAL BAYESIAN MODEL FOR INFERENCE OF COPY NUMBER VARIANTS AND THEIR ASSOCIATION TO GENE EXPRESSION

    PubMed Central

    Cassese, Alberto; Guindani, Michele; Tadesse, Mahlet G.; Falciani, Francesco; Vannucci, Marina

    2014-01-01

    A number of statistical models have been successfully developed for the analysis of high-throughput data from a single source, but few methods are available for integrating data from different sources. Here we focus on integrating gene expression levels with comparative genomic hybridization (CGH) array measurements collected on the same subjects. We specify a measurement error model that relates the gene expression levels to latent copy number states which, in turn, are related to the observed surrogate CGH measurements via a hidden Markov model. We employ selection priors that exploit the dependencies across adjacent copy number states and investigate MCMC stochastic search techniques for posterior inference. Our approach results in a unified modeling framework for simultaneously inferring copy number variants (CNV) and identifying their significant associations with mRNA transcripts abundance. We show performance on simulated data and illustrate an application to data from a genomic study on human cancer cell lines. PMID:24834139

  16. The Effects of Answer Copying on the Ability Level Estimates of Cheater Examinees in Answer Copying Pairs

    ERIC Educational Resources Information Center

    Zopluoglu, Cengiz; Davenport, Ernest C., Jr.

    2011-01-01

    The purpose of this study was to examine the effects of answer copying on the ability level estimates of cheater examinees in answer copying pairs. The study generated answer copying pairs for each of 1440 conditions, source ability (12) x cheater ability (12) x amount of copying (10). The average difference between the ability level estimates…

  17. Teaching Ad Copy--I and II.

    ERIC Educational Resources Information Center

    Welty, Ward; Vanden Bergh, Bruce G.

    1981-01-01

    Ward Welty notes that the standard advertising course could be improved by including a unit of study in rhetoric, especially Aristotelian rhetoric. Bruce Vanden Bergh reports on research on the differences in creating advertising copy for radio versus the visual media of magazines, newspapers, and television. (RL)

  18. Copies of clinic letters to the family.

    PubMed

    Bartle, D G; Diskin, L; Finlay, F

    2004-11-01

    In April 2004 guidelines were introduced advising that letters to the GP should be copied to parents of young people. A study was carried out to ascertain the views of young people and their parents as to who they felt should receive correspondence after an outpatient appointment.

  19. Genomic characteristics of cattle copy number variations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We performed a systematic analysis of cattle copy number variations (CNVs) using the Bovine HapMap SNP genotyping data, including 539 animals of 21 modern cattle breeds and 6 outgroups. After correcting genomic waves and considering the trio information, we identified 682 candidate CNV regions (CNVR...

  20. 36 CFR 703.20 - File copies.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 703.20 Parks, Forests, and Public Property LIBRARY OF CONGRESS DISCLOSURE OR PRODUCTION OF RECORDS OR INFORMATION Testimony by Employees and Production of Documents in Certain Legal Proceedings Where the Library... file of copies of all demands served on the Library and deciding officials' responses....

  1. 36 CFR 703.20 - File copies.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 703.20 Parks, Forests, and Public Property LIBRARY OF CONGRESS DISCLOSURE OR PRODUCTION OF RECORDS OR INFORMATION Testimony by Employees and Production of Documents in Certain Legal Proceedings Where the Library... file of copies of all demands served on the Library and deciding officials' responses....

  2. 36 CFR 703.20 - File copies.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 703.20 Parks, Forests, and Public Property LIBRARY OF CONGRESS DISCLOSURE OR PRODUCTION OF RECORDS OR INFORMATION Testimony by Employees and Production of Documents in Certain Legal Proceedings Where the Library... file of copies of all demands served on the Library and deciding officials' responses....

  3. Integrated system checkout report

    SciTech Connect

    Not Available

    1991-08-14

    The planning and preparation phase of the Integrated Systems Checkout Program (ISCP) was conducted from October 1989 to July 1991. A copy of the ISCP, DOE-WIPP 90--002, is included in this report as an appendix. The final phase of the Checkout was conducted from July 10, 1991, to July 23, 1991. This phase exercised all the procedures and equipment required to receive, emplace, and retrieve contact handled transuranium (CH TRU) waste filled dry bins. In addition, abnormal events were introduced to simulate various equipment failures, loose surface radioactive contamination events, and personnel injury. This report provides a detailed summary of each days activities during this period. Qualification of personnel to safely conduct the tasks identified in the procedures and the abnormal events were verified by observers familiar with the Bin-Scale CH TRU Waste Test requirements. These observers were members of the staffs of Westinghouse WID Engineering, QA, Training, Health Physics, Safety, and SNL. Observers representing a number of DOE departments, the state of new Mexico, and the Defense Nuclear Facilities Safety Board observed those Checkout activities conducted during the period from July 17, 1991, to July 23, 1991. Observer comments described in this report are those obtained from the staff member observers. 1 figs., 1 tab.

  4. CNVkit: Genome-Wide Copy Number Detection and Visualization from Targeted DNA Sequencing

    PubMed Central

    Shain, A. Hunter; Botton, Thomas; Bastian, Boris C.

    2016-01-01

    Germline copy number variants (CNVs) and somatic copy number alterations (SCNAs) are of significant importance in syndromic conditions and cancer. Massively parallel sequencing is increasingly used to infer copy number information from variations in the read depth in sequencing data. However, this approach has limitations in the case of targeted re-sequencing, which leaves gaps in coverage between the regions chosen for enrichment and introduces biases related to the efficiency of target capture and library preparation. We present a method for copy number detection, implemented in the software package CNVkit, that uses both the targeted reads and the nonspecifically captured off-target reads to infer copy number evenly across the genome. This combination achieves both exon-level resolution in targeted regions and sufficient resolution in the larger intronic and intergenic regions to identify copy number changes. In particular, we successfully inferred copy number at equivalent to 100-kilobase resolution genome-wide from a platform targeting as few as 293 genes. After normalizing read counts to a pooled reference, we evaluated and corrected for three sources of bias that explain most of the extraneous variability in the sequencing read depth: GC content, target footprint size and spacing, and repetitive sequences. We compared the performance of CNVkit to copy number changes identified by array comparative genomic hybridization. We packaged the components of CNVkit so that it is straightforward to use and provides visualizations, detailed reporting of significant features, and export options for integration into existing analysis pipelines. CNVkit is freely available from https://github.com/etal/cnvkit. PMID:27100738

  5. Systems analysis programs for hands-on integrated reliability evaluations (SAPHIRE) Version 5.0. Fault tree, event tree, and piping & instrumentation diagram (FEP) editors reference manual: Volume 7

    SciTech Connect

    McKay, M.K.; Skinner, N.L.; Wood, S.T.

    1994-07-01

    The Systems Analysis Programs for Hands-on Integrated Reliability Evaluations (SAPHIRE) refers to a set of several microcomputer programs that were developed to create and analyze probabilistic risk assessments (PRAs), primarily for nuclear power plants. The Fault Tree, Event Tree, and Piping and Instrumentation Diagram (FEP) editors allow the user to graphically build and edit fault trees, and event trees, and piping and instrumentation diagrams (P and IDs). The software is designed to enable the independent use of the graphical-based editors found in the Integrated Reliability and Risk Assessment System (IRRAS). FEP is comprised of three separate editors (Fault Tree, Event Tree, and Piping and Instrumentation Diagram) and a utility module. This reference manual provides a screen-by-screen guide of the entire FEP System.

  6. 37 CFR 202.19 - Deposit of published copies or phonorecords for the Library of Congress.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... case of a motion picture, a copy is “complete” if the reproduction of all of the visual and aural..., motion picture, phonorecord, publication, sound recording, useful article, and their variant forms, have... soundtrack that is an integral part of a motion picture. This category does not exempt the owner of...

  7. 37 CFR 202.21 - Deposit of identifying material instead of copies.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... is an integral part of a motion picture, identifying material deposited in lieu of an actual copy of the motion picture shall consist of: (1) A transcription of the entire work, or a reproduction of the entire work on a phonorecord; and (2) Photographs or other reproductions from the motion picture...

  8. COPI selectively drives maturation of the early Golgi

    DOE PAGES

    Papanikou, Effrosyni; Day, Kasey J.; Austin, Jotham; ...

    2015-12-28

    COPI coated vesicles carry material between Golgi compartments, but the role of COPI in the secretory pathway has been ambiguous. Previous studies of thermosensitive yeast COPI mutants yielded the surprising conclusion that COPI was dispensable both for the secretion of certain proteins and for Golgi cisternal maturation. To revisit these issues, we optimized the anchor-away method, which allows peripheral membrane proteins such as COPI to be sequestered rapidly by adding rapamycin. Video fluorescence microscopy revealed that COPI inactivation causes an early Golgi protein to remain in place while late Golgi proteins undergo cycles of arrival and departure. These dynamics generatemore » partially functional hybrid Golgi structures that contain both early and late Golgi proteins, explaining how secretion can persist when COPI has been inactivated. Our findings suggest that cisternal maturation involves a COPI-dependent pathway that recycles early Golgi proteins, followed by multiple COPI-independent pathways that recycle late Golgi proteins.« less

  9. Integrating multidisciplinary science, modelling and impact data into evolving, syn-event volcanic hazard mapping and communication: A case study from the 2012 Tongariro eruption crisis, New Zealand

    NASA Astrophysics Data System (ADS)

    Leonard, Graham S.; Stewart, Carol; Wilson, Thomas M.; Procter, Jonathan N.; Scott, Bradley J.; Keys, Harry J.; Jolly, Gill E.; Wardman, Johnny B.; Cronin, Shane J.; McBride, Sara K.

    2014-10-01

    New Zealand's Tongariro National Park volcanoes produce hazardous eruptions every few years to decades. On 6 August 2012 the Te Maari vent of Tongariro Volcano erupted, producing a series of explosions and a fine ash of minor volume which was dispersed rapidly to the east. This manuscript presents a summary of the eruption impacts and the way these supported science communication during the crisis, particularly in terms of hazard map development. The most significant proximal impact was damage from pyroclastic surges and ballistics to the popular and economically-important Tongariro Alpine Crossing track. The only hazard to affect the medial impact zone was a few mms of ashfall with minor impacts. Field testing indicated that the Te Maari ash had extremely low resistivity when wetted, implying a very high potential to cause disruption to nationally-important power transmission networks via the mechanism of insulator flashover. This was not observed, presumably due to insufficient ash accumulation on insulators. Virtually no impacts from distal ashfall were reported. Post-event analysis of PM10 data demonstrates the additional value of regional air quality monitoring networks in quantifying population exposure to airborne respirable ash. While the eruption was minor, it generated a high level of public interest and a demand for information on volcanic hazards and impacts from emergency managers, the public, critical infrastructure managers, health officials, and the agriculture sector. Meeting this demand fully taxed available resources. We present here aspects of the New Zealand experience which may have wider applicability in moving towards improved integration of hazard impact information, mapping, and communication. These include wide use of a wiki technical clearinghouse and email listservs, a focus on multi-agency consistent messages, and a recently developed environment of collaboration and alignment of both research funding and technical science advice

  10. 10 CFR 73.71 - Reporting of safeguards events.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Reporting of safeguards events. 73.71 Section 73.71 Energy... § 73.71 Reporting of safeguards events. (a)(1) Each licensee subject to the provisions of §§ 73.25, 73... revised information. Each licensee shall maintain a copy of the written report of an event submitted...

  11. 10 CFR 73.71 - Reporting of safeguards events.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Reporting of safeguards events. 73.71 Section 73.71 Energy... § 73.71 Reporting of safeguards events. (a)(1) Each licensee subject to the provisions of §§ 73.25, 73... revised information. Each licensee shall maintain a copy of the written report of an event submitted...

  12. 10 CFR 73.71 - Reporting of safeguards events.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Reporting of safeguards events. 73.71 Section 73.71 Energy... § 73.71 Reporting of safeguards events. (a)(1) Each licensee subject to the provisions of §§ 73.25, 73... revised information. Each licensee shall maintain a copy of the written report of an event submitted...

  13. 10 CFR 73.71 - Reporting of safeguards events.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Reporting of safeguards events. 73.71 Section 73.71 Energy... § 73.71 Reporting of safeguards events. (a)(1) Each licensee subject to the provisions of §§ 73.25, 73... revised information. Each licensee shall maintain a copy of the written report of an event submitted...

  14. 10 CFR 73.71 - Reporting of safeguards events.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Reporting of safeguards events. 73.71 Section 73.71 Energy... § 73.71 Reporting of safeguards events. (a)(1) Each licensee subject to the provisions of §§ 73.25, 73... revised information. Each licensee shall maintain a copy of the written report of an event submitted...

  15. Punctuated Copy Number Evolution and Clonal Stasis in Triple-Negative Breast Cancer

    PubMed Central

    Gao, Ruli; Davis, Alexander; McDonald, Thomas O.; Sei, Emi; Shi, Xiuqing; Wang, Yong; Tsai, Pei-Ching; Casasent, Anna; Waters, Jill; Zhang, Hong; Meric-Bernstam, Funda; Michor, Franziska; Navin, Nicholas E.

    2016-01-01

    Aneuploidy is a hallmark of breast cancer; however, our knowledge of how these complex genomic rearrangements evolve during tumorigenesis is limited. In this study we developed a highly multiplexed single-nucleus-sequencing method to investigate copy number evolution in triple-negative breast cancer patients. We sequenced 1000 single cells from 12 patients and identified 1–3 major clonal subpopulations in each tumor that shared a common evolutionary lineage. We also identified a minor subpopulation of non-clonal cells that were classified as: 1) metastable, 2) pseudo-diploid, or 3) chromazemic. Phylogenetic analysis and mathematical modeling suggest that these data are unlikely to be explained by the gradual accumulation of copy number events over time. In contrast, our data challenge the paradigm of gradual evolution, showing that the majority of copy number aberrations are acquired at the earliest stages of tumor evolution, in short punctuated bursts, followed by stable clonal expansions that form the tumor mass. PMID:27526321

  16. Accurate measurement of transgene copy number in crop plants using droplet digital PCR.

    PubMed

    Collier, Ray; Dasgupta, Kasturi; Xing, Yan-Ping; Hernandez, Bryan Tarape; Shao, Min; Rohozinski, Dominica; Kovak, Emma; Lin, Jeanie; de Oliveira, Maria Luiza P; Stover, Ed; McCue, Kent F; Harmon, Frank G; Blechl, Ann; Thomson, James G; Thilmony, Roger

    2017-02-23

    Genetic transformation is a powerful means for the improvement of crop plants, but requires labor and resource intensive methods. An efficient method for identifying single copy transgene insertion events from a population of independent transgenic lines is desirable. Currently transgene copy number is estimated by either Southern blot hybridization analyses or quantitative polymerase chain reaction (qPCR) experiments. Southern hybridization is a convincing and reliable method, but it also is expensive, time-consuming and often requires a large amount of genomic DNA and radioactively labeled probes. Alternatively, qPCR requires less DNA and is potentially simpler to perform, but its results can lack the accuracy and precision needed to confidently distinguish between one and two copy events in transgenic plants with large genomes. To address this need, we developed a droplet digital PCR (dPCR)-based method for transgene copy number measurement in an array of crops: rice, citrus, potato, maize, tomato, and wheat. The method utilizes specific primers to amplify target transgenes, and endogenous reference genes in a single duplexed reaction containing thousands of droplets. Endpoint amplicon production in the droplets is detected and quantified using sequence-specific fluorescently labeled probes. The results demonstrate that this approach can generate confident copy number measurements in independent transgenic lines in these crop species. This method and the compendium of probes and primers will be a useful resource for the plant research community, enabling the simple and accurate determination of transgene copy number in these six important crop species. This article is protected by copyright. All rights reserved.

  17. Confirmed rare copy number variants implicate novel genes in schizophrenia.

    PubMed

    Tam, Gloria W C; van de Lagemaat, Louie N; Redon, Richard; Strathdee, Karen E; Croning, Mike D R; Malloy, Mary P; Muir, Walter J; Pickard, Ben S; Deary, Ian J; Blackwood, Douglas H R; Carter, Nigel P; Grant, Seth G N

    2010-04-01

    Understanding how cognitive processes including learning, memory, decision making and ideation are encoded by the genome is a key question in biology. Identification of sets of genes underlying human mental disorders is a path towards this objective. Schizophrenia is a common disease with cognitive symptoms, high heritability and complex genetics. We have identified genes involved with schizophrenia by measuring differences in DNA copy number across the entire genome in 91 schizophrenia cases and 92 controls in the Scottish population. Our data reproduce rare and common variants observed in public domain data from >3000 schizophrenia cases, confirming known disease loci as well as identifying novel loci. We found copy number variants in PDE10A (phosphodiesterase 10A), CYFIP1 [cytoplasmic FMR1 (Fragile X mental retardation 1)-interacting protein 1], K(+) channel genes KCNE1 and KCNE2, the Down's syndrome critical region 1 gene RCAN1 (regulator of calcineurin 1), cell-recognition protein CHL1 (cell adhesion molecule with homology with L1CAM), the transcription factor SP4 (specificity protein 4) and histone deacetylase HDAC9, among others (see http://www.genes2cognition.org/SCZ-CNV). Integrating the function of these many genes into a coherent model of schizophrenia and cognition is a major unanswered challenge.

  18. Importance of rare gene copy number alterations for personalized tumor characterization and survival analysis.

    PubMed

    Seifert, Michael; Friedrich, Betty; Beyer, Andreas

    2016-10-03

    It has proven exceedingly difficult to ascertain rare copy number alterations (CNAs) that may have strong effects in individual tumors. We show that a regulatory network inferred from gene expression and gene copy number data of 768 human cancer cell lines can be used to quantify the impact of patient-specific CNAs on survival signature genes. A focused analysis of tumors from six tissues reveals that rare patient-specific gene CNAs often have stronger effects on signature genes than frequent gene CNAs. Further comparison to a related network-based approach shows that the integration of indirectly acting gene CNAs significantly improves the survival analysis.

  19. Laser thermographic technologies for hard copy recording

    NASA Astrophysics Data System (ADS)

    Bessmel'tsev, Viktor P.; Baev, Sergej G.

    1995-04-01

    Methods of hard copies recording based on thermal interaction of the beam from CO2 or YAG lasers with various kinds of films on any substrates have been developed. The recording processes are single-step and require no additional development. Among them are: (1) Laser thermodestruction of thin mask layers or of a material surface on any kinds of substrates. (2) Laser thermochemical reactions of thermal decomposition of metal salts in solid state phase on a surface of various hygroscopic substrates. The laser recording devices using the methods, described above have been developed and are manufactured now; they allow one to record hard copies with a size of up to 27 X 31 inches, a resolution of 4000 dpi.

  20. Colour hard-copy from workstation screens

    NASA Astrophysics Data System (ADS)

    Clayton, C. A.

    It is possible to produce a colour print on the DEC LJ250 inkjet printer of either the entire screen or a portion of the screen from VAXstations, DECstations, SUN workstations and the IKON image display. This document describes how to achieve this with each of the above workstations. The IKONPAINT software which is used to produce colour hard-copy from the IKON screen on the inkjet printer is fully documented in SUN/71 and is not described here.

  1. Modeling genetic inheritance of copy number variations

    PubMed Central

    Wang, Kai; Chen, Zhen; Tadesse, Mahlet G.; Glessner, Joseph; Grant, Struan F. A.; Hakonarson, Hakon; Bucan, Maja

    2008-01-01

    Copy number variations (CNVs) are being used as genetic markers or functional candidates in gene-mapping studies. However, unlike single nucleotide polymorphism or microsatellite genotyping techniques, most CNV detection methods are limited to detecting total copy numbers, rather than copy number in each of the two homologous chromosomes. To address this issue, we developed a statistical framework for intensity-based CNV detection platforms using family data. Our algorithm identifies CNVs for a family simultaneously, thus avoiding the generation of calls with Mendelian inconsistency while maintaining the ability to detect de novo CNVs. Applications to simulated data and real data indicate that our method significantly improves both call rates and accuracy of boundary inference, compared to existing approaches. We further illustrate the use of Mendelian inheritance to infer SNP allele compositions in each of the two homologous chromosomes in CNV regions using real data. Finally, we applied our method to a set of families genotyped using both the Illumina HumanHap550 and Affymetrix genome-wide 5.0 arrays to demonstrate its performance on both inherited and de novo CNVs. In conclusion, our method produces accurate CNV calls, gives probabilistic estimates of CNV transmission and builds a solid foundation for the development of linkage and association tests utilizing CNVs. PMID:18832372

  2. Digital authentication with copy-detection patterns

    NASA Astrophysics Data System (ADS)

    Picard, Justin

    2004-06-01

    Technologies for making high-quality copies of documents are getting more available, cheaper, and more efficient. As a result, the counterfeiting business engenders huge losses, ranging to 5% to 8% of worldwide sales of brand products, and endangers the reputation and value of the brands themselves. Moreover, the growth of the Internet drives the business of counterfeited documents (fake IDs, university diplomas, checks, and so on), which can be bought easily and anonymously from hundreds of companies on the Web. The incredible progress of digital imaging equipment has put in question the very possibility of verifying the authenticity of documents: how can we discern genuine documents from seemingly "perfect" copies? This paper proposes a solution based on creating digital images with specific properties, called a Copy-detection patterns (CDP), that is printed on arbitrary documents, packages, etc. CDPs make an optimal use of an "information loss principle": every time an imae is printed or scanned, some information is lost about the original digital image. That principle applies even for the highest quality scanning, digital imaging, printing or photocopying equipment today, and will likely remain true for tomorrow. By measuring the amount of information contained in a scanned CDP, the CDP detector can take a decision on the authenticity of the document.

  3. 19 CFR 151.64 - Extra copy of entry summary.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate...

  4. 19 CFR 151.64 - Extra copy of entry summary.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate...

  5. 19 CFR 151.64 - Extra copy of entry summary.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate...

  6. 19 CFR 151.64 - Extra copy of entry summary.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate...

  7. 19 CFR 151.64 - Extra copy of entry summary.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate...

  8. Most Cancers Caused by Random DNA Copying Errors

    MedlinePlus

    ... fullstory_164252.html Most Cancers Caused by Random DNA Copying Errors While habits, environment can be key ... factors, genes inherited from parents, or simply random DNA copying errors. From their calculations, the researchers now ...

  9. 9. Photocopy of measured drawing (from a copy of the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. Photocopy of measured drawing (from a copy of the original; copy in accompanying field records, location of original unknown) Adolf Scherrer, architect ca. 1906 'CROSS SECTION' - Maennerchor Building, 102 West Michigan Street, Indianapolis, Marion County, IN

  10. 17 CFR 230.402 - Number of copies; binding; signatures.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... copy shall be bound, in one or more parts, without stiff covers. The binding shall be made on the side... filed with the Commission. Each copy shall be bound, in one or more parts, without stiff covers....

  11. 40 CFR 262.22 - Number of copies.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner... returned to the generator....

  12. 40 CFR 262.22 - Number of copies.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner... returned to the generator....

  13. 40 CFR 262.22 - Number of copies.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner... returned to the generator....

  14. 40 CFR 262.22 - Number of copies.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner... returned to the generator....

  15. 40 CFR 262.22 - Number of copies.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner... returned to the generator....

  16. Chloroplast DNA Copy Number Changes during Plant Development in Organelle DNA Polymerase Mutants

    PubMed Central

    Morley, Stewart A.; Nielsen, Brent L.

    2016-01-01

    Chloroplast genome copy number is very high in leaf tissue, with upwards of 10,000 or more copies of the chloroplast DNA (ctDNA) per leaf cell. This is often promoted as a major advantage for engineering the plastid genome, as it provides high gene copy number and thus is expected to result in high expression of foreign proteins from integrated genes. However, it is also known that ctDNA copy number and ctDNA integrity decrease as cells age. Quantitative PCR (qPCR) allows measurement of organelle DNA levels relative to a nuclear gene target. We have used this approach to determine changes in copy number of ctDNA relative to the nuclear genome at different ages of Arabidopsis plant growth and in organellar DNA polymerase mutants. The mutant plant lines have T-DNA insertions in genes encoding the two organelle localized DNA polymerases (PolIA and PolIB). Each of these mutant lines exhibits some delay in plant growth and development as compared to wild-type plants, with the PolIB plants having a more pronounced delay. Both mutant lines develop to maturity and produce viable seeds. Mutants for both proteins were observed to have a reduction in ctDNA and mtDNA copy number relative to wild type plants at all time points as measured by qPCR. Both DNA polymerase mutants had a fairly similar decrease in ctDNA copy number, while the PolIB mutant had a greater effect of reduction in mtDNA levels. However, despite similar decreases in genome copy number, RT-PCR analysis of PolIA mutants show that PolIB expression remains unchanged, suggesting that PolIA may not be essential to plant survival. Furthermore, genotypic analysis of plants from heterozygous parents display a strong pressure to maintain two functioning copies of PolIB. These results indicate that the two DNA polymerases are both important in ctDNA replication, and they are not fully redundant to each other, suggesting each has a specific function in plant organelles. PMID:26870072

  17. Conditionally amplifiable BACs: switching from single-copy to high-copy vectors and genomic clones.

    PubMed

    Wild, Jadwiga; Hradecna, Zdenka; Szybalski, Waclaw

    2002-09-01

    The widely used, very-low-copy BAC (bacterial artificial chromosome) vectors are the mainstay of present genomic research. The principal advantage of BACs is the high stability of inserted clones, but an important disadvantage is the low yield of DNA, both for vectors alone and when carrying genomic inserts. We describe here a novel class of single-copy/high-copy (SC/HC) pBAC/oriV vectors that retain all the advantages of low-copy BAC vectors, but are endowed with a conditional and tightly controlled oriV/TrfA amplification system that allows: (1) a yield of ~100 copies of the vector per host cell when conditionally induced with L-arabinose, and (2) analogous DNA amplification (only upon induction and with copy number depending on the insert size) of pBAC/oriV clones carrying >100-kb inserts. Amplifiable clones and libraries facilitate high-throughput DNA sequencing and other applications requiring HC plasmid DNA. To turn on DNA amplification, which is driven by the oriV origin of replication, we used copy-up mutations in the gene trfA whose expression was very tightly controlled by the araC-P(araBAD) promoter/regulator system. This system is inducible by L-arabinose, and could be further regulated by glucose and fucose. Amplification of DNA upon induction with L-arabinose and its modulation by glucose are robust and reliable. Furthermore, we discovered that addition of 0.2% D-glucose to the growth medium helped toward the objective of obtaining a real SC state for all BAC systems, thus enhancing the stability of their maintenance, which became equivalent to cloning into the host chromosome

  18. Defects in coatomer protein I (COPI) transport cause blood feeding-induced mortality in Yellow Fever mosquitoes.

    PubMed

    Isoe, Jun; Collins, Jennifer; Badgandi, Hemant; Day, W Anthony; Miesfeld, Roger L

    2011-06-14

    Blood feeding by vector mosquitoes provides the entry point for disease pathogens and presents an acute metabolic challenge that must be overcome to complete the gonotrophic cycle. Based on recent data showing that coatomer protein I (COPI) vesicle transport is involved in cellular processes beyond Golgi-endoplasmic reticulum retrograde protein trafficking, we disrupted COPI functions in the Yellow Fever mosquito Aedes aegypti to interfere with blood meal digestion. Surprisingly, we found that decreased expression of the γCOPI coatomer protein led to 89% mortality in blood-fed mosquitoes by 72 h postfeeding compared with 0% mortality in control dsRNA-injected blood-fed mosquitoes and 3% mortality in γCOPI dsRNA-injected sugar-fed mosquitoes. Similar results were obtained using dsRNA directed against five other COPI coatomer subunits (α, β, β', δ, and ζ). We also examined midgut tissues by EM, quantitated heme in fecal samples, and characterized feeding-induced protein expression in midgut, fat body, and ovary tissues of COPI-deficient mosquitoes. We found that COPI defects disrupt epithelial cell membrane integrity, stimulate premature blood meal excretion, and block induced expression of several midgut protease genes. To study the role of COPI transport in ovarian development, we injected γCOPI dsRNA after blood feeding and found that, although blood digestion was normal, follicles in these mosquitoes were significantly smaller by 48 h postinjection and lacked eggshell proteins. Together, these data show that COPI functions are critical to mosquito blood digestion and egg maturation, a finding that could also apply to other blood-feeding arthropod vectors.

  19. 1 CFR 18.1 - Original and copies required.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Original and copies required. 18.1 Section 18.1... PROCESSING OF DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.1 Original and copies... two duplicate originals or certified copies. 1 However, if the document is printed or processed...

  20. 1 CFR 18.1 - Original and copies required.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 1 General Provisions 1 2011-01-01 2011-01-01 false Original and copies required. 18.1 Section 18.1... PROCESSING OF DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.1 Original and copies... two duplicate originals or certified copies. 1 However, if the document is printed or processed...

  1. 12 CFR 269b.730 - Number of copies; form.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 4 2013-01-01 2013-01-01 false Number of copies; form. 269b.730 Section 269b... SYSTEM (CONTINUED) CHARGES OF UNFAIR LABOR PRACTICES General Rules § 269b.730 Number of copies; form... filed with four copies in addition to the original. All matters filed shall be printed, typed,...

  2. 12 CFR 269b.730 - Number of copies; form.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 3 2011-01-01 2011-01-01 false Number of copies; form. 269b.730 Section 269b... SYSTEM CHARGES OF UNFAIR LABOR PRACTICES General Rules § 269b.730 Number of copies; form. Except as... copies in addition to the original. All matters filed shall be printed, typed, or otherwise...

  3. Writing Wrongs: Copying as a Strategy for Underachieving EFL Writers.

    ERIC Educational Resources Information Center

    Porte, Graeme K.

    1995-01-01

    This paper reports on a small-scale study of the outcomes generated by 15 underachieving English-as-a-Foreign-Language university writers copying text displayed on a computer monitor under pressure of time. Analysis of student's copied texts showed that various inaccuracies that were not in the original had passed into the copied version,…

  4. Syllables as Functional Units in a Copying Task

    ERIC Educational Resources Information Center

    Kandel, Sonia; Valdois, Sylviane

    2006-01-01

    This research used a copying task to study spelling acquisition from a perception and action perspective. First to fifth graders copied words and pseudo-words on a digitiser. Simultaneously, a camera registered the children's gaze lifts. First and second graders copied the first syllable and then produced a gaze lift to obtain information on the…

  5. Readability as a Factor in Magazine Ad Copy Recall.

    ERIC Educational Resources Information Center

    Wesson, David A.

    1989-01-01

    Examines the relationship between advertising copy readability and advertising effectiveness. Finds that recall is improved when the copy style is either fairly easy or fairly hard to read. Suggests the value of considering copy readability as a potential contributor, though a minor one, to the success of magazine advertising. (RS)

  6. 7 CFR 46.42 - Copies of records; how obtained.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Copies of records; how obtained. 46.42 Section 46.42 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards... Records § 46.42 Copies of records; how obtained. Copies of records pertaining to licensees under the...

  7. Copy-Number Gains of HUWE1 Due to Replication- and Recombination-Based Rearrangements

    PubMed Central

    Froyen, Guy; Belet, Stefanie; Martinez, Francisco; Santos-Rebouças, Cíntia Barros; Declercq, Matthias; Verbeeck, Jelle; Donckers, Lene; Berland, Siren; Mayo, Sonia; Rosello, Monica; Pimentel, Márcia Mattos Gonçalves; Fintelman-Rodrigues, Natalia; Hovland, Randi; Rodrigues dos Santos, Suely; Raymond, F. Lucy; Bose, Tulika; Corbett, Mark A.; Sheffield, Leslie; van Ravenswaaij-Arts, Conny M.A.; Dijkhuizen, Trijnie; Coutton, Charles; Satre, Veronique; Siu, Victoria; Marynen, Peter

    2012-01-01

    We previously reported on nonrecurrent overlapping duplications at Xp11.22 in individuals with nonsyndromic intellectual disability (ID) harboring HSD17B10, HUWE1, and the microRNAs miR-98 and let-7f-2 in the smallest region of overlap. Here, we describe six additional individuals with nonsyndromic ID and overlapping microduplications that segregate in the families. High-resolution mapping of the 12 copy-number gains reduced the minimal duplicated region to the HUWE1 locus only. Consequently, increased mRNA levels were detected for HUWE1, but not HSD17B10. Marker and SNP analysis, together with identification of two de novo events, suggested a paternally derived intrachromosomal duplication event. In four independent families, we report on a polymorphic 70 kb recurrent copy-number gain, which harbors part of HUWE1 (exon 28 to 3′ untranslated region), including miR-98 and let-7f-2. Our findings thus demonstrate that HUWE1 is the only remaining dosage-sensitive gene associated with the ID phenotype. Junction and in silico analysis of breakpoint regions demonstrated simple microhomology-mediated rearrangements suggestive of replication-based duplication events. Intriguingly, in a single family, the duplication was generated through nonallelic homologous recombination (NAHR) with the use of HUWE1-flanking imperfect low-copy repeats, which drive this infrequent NAHR event. The recurrent partial HUWE1 copy-number gain was also generated through NAHR, but here, the homologous sequences used were identified as TcMAR-Tigger DNA elements, a template that has not yet been reported for NAHR. In summary, we showed that an increased dosage of HUWE1 causes nonsyndromic ID and demonstrated that the Xp11.22 region is prone to recombination- and replication-based rearrangements. PMID:22840365

  8. Event Perception.

    PubMed

    Radvansky, Gabriel; Zacks, Jeffrey M

    2011-11-01

    Events are central elements of human experience. Formally, they can be individuated in terms of the entities that compose them, the features of those entities, and the relations amongst entities. Psychologically, representations of events capture their spatiotemporal location, the people and objects involved, and the relations between these elements. Here, we present an account of the nature of psychological representations of events and how they are constructed and updated. Event representations are like images in that they are isomorphic to the situations they represent. However, they are like models or language in that they are constructed of components rather than being holistic. Also, they are partial representations that leave out some elements and abstract others. Representations of individual events are informed by schematic knowledge about general classes of events. Event representations are constructed in a process that segments continuous activity into discrete events. The construction of a series of event representations forms a basis for predicting the future, planning for that future, and imagining alternatives.

  9. Event Perception

    PubMed Central

    Radvansky, Gabriel; Zacks, Jeffrey M.

    2012-01-01

    Events are central elements of human experience. Formally, they can be individuated in terms of the entities that compose them, the features of those entities, and the relations amongst entities. Psychologically, representations of events capture their spatiotemporal location, the people and objects involved, and the relations between these elements. Here, we present an account of the nature of psychological representations of events and how they are constructed and updated. Event representations are like images in that they are isomorphic to the situations they represent. However, they are like models or language in that they are constructed of components rather than being holistic. Also, they are partial representations that leave out some elements and abstract others. Representations of individual events are informed by schematic knowledge about general classes of events. Event representations are constructed in a process that segments continuous activity into discrete events. The construction of a series of event representations forms a basis for predicting the future, planning for that future, and imagining alternatives. PMID:23082236

  10. Copy Number Heterogeneity of JC Virus Standards

    PubMed Central

    Bateman, Allen C.; Atienza, Ederlyn E.; Wendt, Sharon; Makhsous, Negar; Jerome, Keith R.; Cook, Linda

    2016-01-01

    ABSTRACT Quantitative PCR is a diagnostic mainstay of clinical virology, and accurate quantitation of viral load among labs requires the use of international standards. However, the use of multiple passages of viral isolates to obtain sufficient material for international standards may result in genomic changes that complicate their use as quantitative standards. We performed next-generation sequencing to obtain single-nucleotide resolution and relative copy number of JC virus (JCV) clinical standards. Strikingly, the WHO international standard and the Exact v1/v2 prototype standards for JCV showed 8-fold and 4-fold variation in genomic coverage between different loci in the viral genome, respectively, due to large deletions in the large T antigen region. Intriguingly, several of the JCV standards sequenced in this study with large T antigen deletions were cultured in cell lines immortalized using simian virus 40 (SV40) T antigen, suggesting the possibility of transcomplementation in cell culture. Using a cutoff 5% allele fraction for junctional reads, 7 different rearrangements were present in the JC virus sequences present in the WHO standard across multiple library preparations and sequencing runs. Neither the copy number differences nor the rearrangements were observed in a clinical sample with a high copy number of JCV or a plasmid control. These results were also confirmed by the quantitative real-time PCR (qPCR), droplet digital PCR (ddPCR), and Sanger sequencing of multiple rearrangements. In summary, targeting different regions of the same international standard can result in up to an 8-fold difference in quantitation. We recommend the use of next-generation sequencing to validate standards in clinical virology. PMID:27974546

  11. Getting DNA copy numbers without control samples

    PubMed Central

    2012-01-01

    Background The selection of the reference to scale the data in a copy number analysis has paramount importance to achieve accurate estimates. Usually this reference is generated using control samples included in the study. However, these control samples are not always available and in these cases, an artificial reference must be created. A proper generation of this signal is crucial in terms of both noise and bias. We propose NSA (Normality Search Algorithm), a scaling method that works with and without control samples. It is based on the assumption that genomic regions enriched in SNPs with identical copy numbers in both alleles are likely to be normal. These normal regions are predicted for each sample individually and used to calculate the final reference signal. NSA can be applied to any CN data regardless the microarray technology and preprocessing method. It also finds an optimal weighting of the samples minimizing possible batch effects. Results Five human datasets (a subset of HapMap samples, Glioblastoma Multiforme (GBM), Ovarian, Prostate and Lung Cancer experiments) have been analyzed. It is shown that using only tumoral samples, NSA is able to remove the bias in the copy number estimation, to reduce the noise and therefore, to increase the ability to detect copy number aberrations (CNAs). These improvements allow NSA to also detect recurrent aberrations more accurately than other state of the art methods. Conclusions NSA provides a robust and accurate reference for scaling probe signals data to CN values without the need of control samples. It minimizes the problems of bias, noise and batch effects in the estimation of CNs. Therefore, NSA scaling approach helps to better detect recurrent CNAs than current methods. The automatic selection of references makes it useful to perform bulk analysis of many GEO or ArrayExpress experiments without the need of developing a parser to find the normal samples or possible batches within the data. The method is

  12. Stolen and lost copies of Vesalius's Fabrica.

    PubMed

    Steeno, Omer; Biesbrouck, Maurits

    2012-01-01

    Thefts and losses of precious books are not rare. Here we report several incidents concerning vesalius's Fabrica: the fire of the University Library of Leuven in Belgium, the fate of the collection of the Leopoldina Library of Halle in Germany, the thefts from the Crerar Library in Chicago and in Christ Church College in Oxford, the disappearance of an exceptionally beautiful 'royal' copy from the Castle of Argenteuil (Belgium), and other Fabrica's missing at the Franeker Library in the Netherlands and at the Library of oradea in West Romania. Finally the means of protecting precious book collections are discussed in short as well as the importance of book identification.

  13. On Making and Identifying a "Copy"; Building Safety Systems with Dynamic Disseminations of Multimedia Digital Objects; MOAC - A Report on Integrating Museum and Archive Access in the Online Archive of California; DSpace: An Open Source Dynamic Digital Repository; iVia Open Source Virtual Library System.

    ERIC Educational Resources Information Center

    Paskin, Norman; Canos, Jose H.; Jaen, Javier; Lorente, Juan C.; Perez, Jennifer; Rinehart, Richard; Smith, MacKenzie; Barton, Mary; Branschofsky, Margaret; McClellan, Greg; Walker, Julie Harford; Mass, Mick; Stuve, Dave; Tansley, Robert; Mitchell, Steve; Mooney, Margaret; Paynter, Gordon W.; Mason, Julie; Ruscheinski, Johannes; Kedzierski, Artur; Humphreys, Keith

    2003-01-01

    Includes five articles that discuss copies in terms of metadata and digital rights management; safety oriented systems, a new type of decision support systems; MOAC (Museums and the Online Archive of California); DSpace, an open source digital repository; and iVia, an open source Internet subject portal or virtual library system. (LRW)

  14. An integrated mBAND and submegabase resolution tiling set (SMRT) CGH array analysis of focal amplification, microdeletions, and ladder structures consistent with breakage-fusion-bridge cycle events in osteosarcoma.

    PubMed

    Lim, Gloria; Karaskova, Jana; Beheshti, Ben; Vukovic, Bisera; Bayani, Jane; Selvarajah, Shamini; Watson, Spencer K; Lam, Wan L; Zielenska, Maria; Squire, Jeremy A

    2005-04-01

    Osteosarcoma (OS) is characterized by chromosomal instability and high-copy-number gene amplification. The breakage-fusion-bridge (BFB) cycle is a well-established mechanism of genomic instability in tumors and in vitro models used to study the origins of complex chromosomal rearrangements and cancer genome amplification. However, until now, there have been no high-resolution cytogenetic or genomic array studies of BFB events in OS. In the present study, multicolor banding (mBAND) FISH and submegabase resolution tiling set (SMRT) array comparative genomic hybridization (CGH) were used to identify and map genomic signatures of BFB events in four OS cell lines and one patient tumor. The expected intermediates associated with BFB-dicentric chromosomes, inverted duplications, and intra- and interchromosomal amplifications-were identified. mBAND analysis provided detailed mapping of rearrangements in 1p, 6p, and 8q and showed that translocation junctions were often in close proximity to fragile sites. More detailed mBAND studies of OS cell line MG-63 revealed ladderlike FISH signals of equally spaced interchromosomal coamplifications of 6p21, 8q24, and 9p21-p22 in a homogeneously staining region (hsr). Focal amplifications that concordantly mapped to the hsr were localized to discrete genomic intervals by SMRT array CGH. The complex amplicon structure in this hsr suggests focal amplifications immediately adjacent to microdeletions. Moreover, the genomic regions in which there was deletion/amplification had a preponderance of fragile sites. In summary, this study has provided further support for the role of the BFB mechanism and fragile sites in facilitating gene amplification and chromosomal rearrangement in OS.

  15. MAR elements and transposons for improved transgene integration and expression.

    PubMed

    Ley, Déborah; Harraghy, Niamh; Le Fourn, Valérie; Bire, Solenne; Girod, Pierre-Alain; Regamey, Alexandre; Rouleux-Bonnin, Florence; Bigot, Yves; Mermod, Nicolas

    2013-01-01

    Reliable and long-term expression of transgenes remain significant challenges for gene therapy and biotechnology applications, especially when antibiotic selection procedures are not applicable. In this context, transposons represent attractive gene transfer vectors because of their ability to promote efficient genomic integration in a variety of mammalian cell types. However, expression from genome-integrating vectors may be inhibited by variable gene transcription and/or silencing events. In this study, we assessed whether inclusion of two epigenetic control elements, the human Matrix Attachment Region (MAR) 1-68 and X-29, in a piggyBac transposon vector, may lead to more reliable and efficient expression in CHO cells. We found that addition of the MAR 1-68 at the center of the transposon did not interfere with transposition frequency, and transgene expressing cells could be readily detected from the total cell population without antibiotic selection. Inclusion of the MAR led to higher transgene expression per integrated copy, and reliable expression could be obtained from as few as 2-4 genomic copies of the MAR-containing transposon vector. The MAR X-29-containing transposons was found to mediate elevated expression of therapeutic proteins in polyclonal or monoclonal CHO cell populations using a transposable vector devoid of selection gene. Overall, we conclude that MAR and transposable vectors can be used to improve transgene expression from few genomic transposition events, which may be useful when expression from a low number of integrated transgene copies must be obtained and/or when antibiotic selection cannot be applied.

  16. To Copy or Not to Copy for Teaching and Scholarship: What Shall I Tell My Client?

    ERIC Educational Resources Information Center

    Cardozo, Michael H.

    1976-01-01

    A clear description of what educators, administrators, or students may and may not copy under the various provisions of the Copyright Law Revision of 1976 is attempted, but the author concludes that the language of the law itself makes such a description impossible. (LBH)

  17. Imitation in Young Children: When Who Gets Copied Is More Important than What Gets Copied

    ERIC Educational Resources Information Center

    Nielsen, Mark; Blank, Cornelia

    2011-01-01

    Unlike other animals, human children will copy all of an adult's goal-directed actions, including ones that are clearly unnecessary for achieving the demonstrated goal. Here we highlight how social affiliation is key to this species-specific behavior. Preschoolers watched 2 adults retrieve a toy from a novel apparatus. One adult included…

  18. Event selection services in ATLAS

    NASA Astrophysics Data System (ADS)

    Cranshaw, J.; Cuhadar-Donszelmann, T.; Gallas, E.; Hrivnac, J.; Kenyon, M.; McGlone, H.; Malon, D.; Mambelli, M.; Nowak, M.; Viegas, F.; Vinek, E.; Zhang, Q.

    2010-04-01

    ATLAS has developed and deployed event-level selection services based upon event metadata records ("TAGS") and supporting file and database technology. These services allow physicists to extract events that satisfy their selection predicates from any stage of data processing and use them as input to later analyses. One component of these services is a web-based Event-Level Selection Service Interface (ELSSI). ELSSI supports event selection by integrating run-level metadata, luminosity-block-level metadata (e.g., detector status and quality information), and event-by-event information (e.g., triggers passed and physics content). The list of events that survive after some selection criterion is returned in a form that can be used directly as input to local or distributed analysis; indeed, it is possible to submit a skimming job directly from the ELSSI interface using grid proxy credential delegation. ELSSI allows physicists to explore ATLAS event metadata as a means to understand, qualitatively and quantitatively, the distributional characteristics of ATLAS data. In fact, the ELSSI service provides an easy interface to see the highest missing ET events or the events with the most leptons, to count how many events passed a given set of triggers, or to find events that failed a given trigger but nonetheless look relevant to an analysis based upon the results of offline reconstruction, and more. This work provides an overview of ATLAS event-level selection services, with an emphasis upon the interactive Event-Level Selection Service Interface.

  19. Convergent gene loss following gene and genome duplications creates single-copy families in flowering plants.

    PubMed

    De Smet, Riet; Adams, Keith L; Vandepoele, Klaas; Van Montagu, Marc C E; Maere, Steven; Van de Peer, Yves

    2013-02-19

    The importance of gene gain through duplication has long been appreciated. In contrast, the importance of gene loss has only recently attracted attention. Indeed, studies in organisms ranging from plants to worms and humans suggest that duplication of some genes might be better tolerated than that of others. Here we have undertaken a large-scale study to investigate the existence of duplication-resistant genes in the sequenced genomes of 20 flowering plants. We demonstrate that there is a large set of genes that is convergently restored to single-copy status following multiple genome-wide and smaller scale duplication events. We rule out the possibility that such a pattern could be explained by random gene loss only and therefore propose that there is selection pressure to preserve such genes as singletons. This is further substantiated by the observation that angiosperm single-copy genes do not comprise a random fraction of the genome, but instead are often involved in essential housekeeping functions that are highly conserved across all eukaryotes. Furthermore, single-copy genes are generally expressed more highly and in more tissues than non-single-copy genes, and they exhibit higher sequence conservation. Finally, we propose different hypotheses to explain their resistance against duplication.

  20. Accelerated evolution after gene duplication: a time-dependent process affecting just one copy.

    PubMed

    Pegueroles, Cinta; Laurie, Steve; Albà, M Mar

    2013-08-01

    Gene duplication is widely regarded as a major mechanism modeling genome evolution and function. However, the mechanisms that drive the evolution of the two, initially redundant, gene copies are still ill defined. Many gene duplicates experience evolutionary rate acceleration, but the relative contribution of positive selection and random drift to the retention and subsequent evolution of gene duplicates, and for how long the molecular clock may be distorted by these processes, remains unclear. Focusing on rodent genes that duplicated before and after the mouse and rat split, we find significantly increased sequence divergence after duplication in only one of the copies, which in nearly all cases corresponds to the novel daughter copy, independent of the mechanism of duplication. We observe that the evolutionary rate of the accelerated copy, measured as the ratio of nonsynonymous to synonymous substitutions, is on average 5-fold higher in the period spanning 4-12 My after the duplication than it was before the duplication. This increase can be explained, at least in part, by the action of positive selection according to the results of the maximum likelihood-based branch-site test. Subsequently, the rate decelerates until purifying selection completely returns to preduplication levels. Reversion to the original rates has already been accomplished 40.5 My after the duplication event, corresponding to a genetic distance of about 0.28 synonymous substitutions per site. Differences in tissue gene expression patterns parallel those of substitution rates, reinforcing the role of neofunctionalization in explaining the evolution of young gene duplicates.

  1. An integrated approach for identifying homogeneous regions of extreme rainfall events and estimating IDF curves in Southern Ontario, Canada: Incorporating radar observations

    NASA Astrophysics Data System (ADS)

    Paixao, Edson; Mirza, M. Monirul Qader; Shephard, Mark W.; Auld, Heather; Klaassen, Joan; Smith, Graham

    2015-09-01

    Reliable extreme rainfall information is required for many applications including infrastructure design, management of water resources, and planning for weather-related emergencies in urban and rural areas. In this study, in situ TBRG sub-daily rainfall rate observations have been supplemented with weather radar information to better capture the spatial and temporal variability of heavy rainfall events regionally. Comparison of extreme rainfall events show that the absolute differences between the rain gauge and radar generally increase with increasing rainfall. Better agreement between the two observations is found when comparing the collocated radar and TBRG annual maximum values. The median difference is <18% for the annual maximum rainfall values ⩽50 mm. The median of difference of IDF estimates obtained through the Gumbel distribution for 10-year return period values computed from TBRG and radar are also found to be 4%. The overall results of this analysis demonstrates the potential value of incorporating remotely sensed radar with traditional point source TBRG network observations to provide additional insight on extreme rainfall events regionally, especially in terms of identifying homogeneous regions of extreme rainfall. The radar observations are particularly useful in areas where there is insufficient TBRG station density to statistically capture the extreme rainfall events.

  2. The standardised copy of pentagons test

    PubMed Central

    2011-01-01

    Background The 'double-diamond copy' task is a simple paper and pencil test part of the Bender-Gestalt Test and the Mini Mental State Examination (MMSE). Although it is a widely used test, its method of scoring is crude and its psychometric properties are not adequately known. The aim of the present study was to develop a sensitive and reliable method of administration and scoring. Methods The study sample included 93 normal control subjects (53 women and 40 men) aged 35.87 ± 12.62 and 127 patients suffering from schizophrenia (54 women and 73 men) aged 34.07 ± 9.83. Results The scoring method was based on the frequencies of responses of healthy controls and proved to be relatively reliable with Cronbach's α equal to 0.61, test-retest correlation coefficient equal to 0.41 and inter-rater reliability equal to 0.52. The factor analysis produced two indices and six subscales of the Standardised Copy of Pentagons Test (SCPT). The total score as well as most of the individual items and subscales distinguished between controls and patients. The discriminant function correctly classified 63.44% of controls and 75.59% of patients. Discussion The SCPT seems to be a satisfactory, reliable and valid instrument, which is easy to administer, suitable for use in non-organic psychiatric patients and demands minimal time. Further research is necessary to test its psychometric properties and its usefulness and applications as a neuropsychological test. PMID:21481250

  3. Copy-move forgery detection in digital image

    NASA Astrophysics Data System (ADS)

    Alamro, Loai; Yusoff, Nooraini

    2016-08-01

    Copy-move is considered as one of the most popular kind of digital image tempering, in which one or more parts of a digital image are copied and pasted into different locations. Geometric transformation is among the major challenges in detecting copy-move forgery of a digital image. In such forgery, the copied and moved parts of a forged image are either rotated or/and re-scaled. Hence, in this study we propose a combination of Discrete Wavelet Transform (DWT) and Speeded Up Robust Features (SURF) to detect a copy-move activity. The experiments results prove that the proposed method is superior with overall accuracy 95%. The copy-move attacks in digital image has been successfully detected and the method is also can detect the fraud parts exposed to rotation and scaling issue.

  4. EVENT PLANNING USING FUNCTION ANALYSIS

    SciTech Connect

    Lori Braase; Jodi Grgich

    2011-06-01

    Event planning is expensive and resource intensive. Function analysis provides a solid foundation for comprehensive event planning (e.g., workshops, conferences, symposiums, or meetings). It has been used at Idaho National Laboratory (INL) to successfully plan events and capture lessons learned, and played a significant role in the development and implementation of the “INL Guide for Hosting an Event.” Using a guide and a functional approach to planning utilizes resources more efficiently and reduces errors that could be distracting or detrimental to an event. This integrated approach to logistics and program planning – with the primary focus on the participant – gives us the edge.

  5. 38 CFR 1.526 - Copies of records and papers.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... papers. 1.526 Section 1.526 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS... Copies of records and papers. (a) Any person desiring a copy of any record or document in the custody of... plain one-sided paper copies of a standard size (81/2″ × 11″; 81/2″ × 14″; 11″ × 14″) $0.15 per...

  6. 38 CFR 1.526 - Copies of records and papers.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... papers. 1.526 Section 1.526 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS... Copies of records and papers. (a) Any person desiring a copy of any record or document in the custody of... plain one-sided paper copies of a standard size (81/2″ × 11″; 81/2″ × 14″; 11″ × 14″) $0.15 per...

  7. 38 CFR 1.526 - Copies of records and papers.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... papers. 1.526 Section 1.526 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS... Copies of records and papers. (a) Any person desiring a copy of any record or document in the custody of... plain one-sided paper copies of a standard size (81/2″ × 11″; 81/2″ × 14″; 11″ × 14″) $0.15 per...

  8. 40 CFR 716.30 - Submission of copies of studies.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Submission of copies of studies. 716... SUBSTANCES CONTROL ACT HEALTH AND SAFETY DATA REPORTING General Provisions § 716.30 Submission of copies of studies. (a)(1) Except as provided in §§ 716.5, 716.20, and 716.50, persons must send to EPA copies of...

  9. COPI selectively drives maturation of the early Golgi

    PubMed Central

    Papanikou, Effrosyni; Day, Kasey J; Austin, Jotham; Glick, Benjamin S

    2015-01-01

    COPI coated vesicles carry material between Golgi compartments, but the role of COPI in the secretory pathway has been ambiguous. Previous studies of thermosensitive yeast COPI mutants yielded the surprising conclusion that COPI was dispensable both for the secretion of certain proteins and for Golgi cisternal maturation. To revisit these issues, we optimized the anchor-away method, which allows peripheral membrane proteins such as COPI to be sequestered rapidly by adding rapamycin. Video fluorescence microscopy revealed that COPI inactivation causes an early Golgi protein to remain in place while late Golgi proteins undergo cycles of arrival and departure. These dynamics generate partially functional hybrid Golgi structures that contain both early and late Golgi proteins, explaining how secretion can persist when COPI has been inactivated. Our findings suggest that cisternal maturation involves a COPI-dependent pathway that recycles early Golgi proteins, followed by multiple COPI-independent pathways that recycle late Golgi proteins. DOI: http://dx.doi.org/10.7554/eLife.13232.001 PMID:26709839

  10. Integrated orbital time scale of the Valanginian-Hauterivian (Early Cretaceous): Chronological relationships between Paraná-Etendeka LIP, Weissert and Faraoni events

    NASA Astrophysics Data System (ADS)

    Martinez, Mathieu; Deconinck, Jean-François; Pellenard, Pierre; Riquier, Laurent; Company, Miguel; Moiroud, Mathieu; Reboulet, Stéphane

    2014-05-01

    During the Valanginian and the Hauterivian stages, the Weissert and Faraoni Events recorded global perturbations of the carbon cycle, marine organic matter deposits and rapid ecosystem changes. Both events were successively attributed to the activity of the Paraná-Etendeka Large Igneous Province (LIP). However, due to the scarcity of the radiometric ages available for this time interval, the chronological relationships between these events and the activity of the Paraná-Etendeka LIP remain unclear. Recently, the duration of the Valanginian Stage was calculated using a cyclostratigraphic approach on GSSP candidates and stratotypes (Martinez et al., 2013), but could not be anchored on a radiometric age. Here, we propose a duration assessment of the Hauterivian Stage using a similar cyclostratigraphic approach on the hemipelagic marl-limestone alternations from the La Charce section (Hauterivian GSSP candidate; SE France) and the Río Argos section (Barremian GSSP candidate; SE Spain). This duration could be anchored on an U/Pb age from a tuff level precisely dated using calcareous nannofossils and chemostratigraphy, to provide a refined geological time scale for the Valanginian and the Hauterivian stages. A total of 2000 spectral gamma-ray measurements were performed with a constant 0.20-m sample step. Spectral analyses were performed on the gamma-ray series to detect any sedimentary cycle. The precession, obliquity, 100-kyr and 405-kyr eccentricity cycles were identified by comparing sedimentary to orbital period ratios. The duration of the Hauterivian Stage could be assessed at 5.9 myr, using the 405-kyr eccentricity cycle as a reference. By anchoring the U/Pb age of Aguirre-Urreta et al. (2008) on the orbital time scale provided for the Valanginian-Hauterivian stages, the base of the Valanginian Stage could be dated at -140.2 ± 1.5 Ma, the base of the Hauterivian at -135.1 ± 1.5 Ma and the base of the Barremian at -129.2 ± 1.5 Ma. In addition, the Weissert

  11. Esthetic Rehabilitation of Anterior Teeth with Copy-Milled Restorations: A Report of Two Cases

    PubMed Central

    Jain, Chandan; Mutneja, Parul; Verma, Mahesh

    2017-01-01

    Digitalization has become part and parcel of contemporary prosthodontics with the probability of most of the procedures being based on the digital techniques in the near future. This digital revolution started in the latter half of the 20th century by converting analog objects/signals into digital bits and bytes. Recent developments in all-ceramic materials and systems of computer-aided designing and computer-aided manufacturing (CAD/CAM), copy milling, and so forth offer excellent esthetics and superb biocompatibility. Copy milling system for ceramics enables milling of the zirconia cores of all-ceramic restorations precisely and also if this system is properly used the procedure for fabricating all-ceramic restorations can be substantially simplified. This case report presents fabrication of all-ceramic Maryland Bridge and post-core with a copy milling system for esthetics and preservation of integrity of tooth. For both of the patients, the use of biologic, all-ceramic, copy-milled restorations resulted in clinical success and recovered function and esthetics. PMID:28326203

  12. Amplification ratio control system for copy number variation genotyping

    PubMed Central

    Guthrie, Philip A. I.; Gaunt, Tom R.; Abdollahi, Mohammed R.; Rodriguez, Santiago; Lawlor, Debbie A.; Smith, George Davey; Day, Ian N. M.

    2011-01-01

    We describe a generic design for ratiometric analysis suitable for determination of copy number variation (CNV) class of a gene. Following two initial sequence-specific PCR priming cycles, both ends of both amplicons (one test and one reference) in a duplex reaction, are all primed by the same universal primer (UP). Following each amplification denaturation step, the UP target and its reverse complement (UP′) in each strand form a hairpin. The bases immediately beyond the 3′-end of the UP and 5′ of UP′ are chosen such as not to base pair in the hairpin (otherwise priming is ablated). This hairpin creates a single constant environment for priming events and chaperones free 3′-ends of amplicon strands. The resultant ‘amplification ratio control system’ (ARCS) permits ratiometric representation of amplicons relative to the original template into PCR plateau phase. These advantages circumvent the need for real-time PCR for quantitation. Choice of different %(G+C) content for the target and reference amplicons allows liquid phase thermal melt discrimination and quantitation of amplicons. The design is generic, simple to set up and economical. Comparisons with real-time PCR and other techniques are made and CNV assays demonstrated for haptoglobin duplicon and ‘chemokine (C-C motif) ligand 3-like 1’ gene. PMID:21300641

  13. Parameters of Semantic Multisensory Integration Depend on Timing and Modality Order among People on the Autism Spectrum: Evidence from Event-Related Potentials

    ERIC Educational Resources Information Center

    Russo, N.; Mottron, L.; Burack, J. A.; Jemel, B.

    2012-01-01

    Individuals with autism spectrum disorders (ASD) report difficulty integrating simultaneously presented visual and auditory stimuli (Iarocci & McDonald, 2006), albeit showing enhanced perceptual processing of unisensory stimuli, as well as an enhanced role of perception in higher-order cognitive tasks (Enhanced Perceptual Functioning (EPF) model;…

  14. EVENT SEGMENTATION

    PubMed Central

    Zacks, Jeffrey M.; Swallow, Khena M.

    2012-01-01

    One way to understand something is to break it up into parts. New research indicates that segmenting ongoing activity into meaningful events is a core component of ongoing perception, with consequences for memory and learning. Behavioral and neuroimaging data suggest that event segmentation is automatic and that people spontaneously segment activity into hierarchically organized parts and sub-parts. This segmentation depends on the bottom-up processing of sensory features such as movement, and on the top-down processing of conceptual features such as actors’ goals. How people segment activity affects what they remember later; as a result, those who identify appropriate event boundaries during perception tend to remember more and learn more proficiently. PMID:22468032

  15. Focal chromosomal copy number aberrations in cancer-Needles in a genome haystack.

    PubMed

    Krijgsman, Oscar; Carvalho, Beatriz; Meijer, Gerrit A; Steenbergen, Renske D M; Ylstra, Bauke

    2014-11-01

    The extent of focal chromosomal copy number aberrations (CNAs) in cancer has been uncovered through technical innovations, and this discovery has been critical for the identification of new cancer driver genes in genomics projects such as TCGA and ICGC. Unlike constitutive copy number variations (CNVs), focal CNAs are the result of many selection events during the evolution of cancer genomes. Therefore, it is possible that a single gene in a focal CNA gives the tumor a selective growth advantage. This concept has been instrumental in the discovery of new cancer driver genes. However, focal CNAs lack a consensus definition; therefore, we propose one based on pragmatic considerations. We also describe different strategies to identify focal CNAs and procedures to distinguish them from large CNAs and CNVs.

  16. Medical response to a radiologic/nuclear event: integrated plan from the Office of the Assistant Secretary for Preparedness and Response, Department of Health and Human Services.

    PubMed

    Coleman, C Norman; Hrdina, Chad; Bader, Judith L; Norwood, Ann; Hayhurst, Robert; Forsha, Joseph; Yeskey, Kevin; Knebel, Ann

    2009-02-01

    The end of the Cold War led to a reduced concern for a major nuclear event. However, the current threats from terrorism make a radiologic (dispersal or use of radioactive material) or nuclear (improvised nuclear device) event a possibility. The specter and enormousness of the catastrophe resulting from a state-sponsored nuclear attack and a sense of nihilism about the effectiveness of a response were such that there had been limited civilian medical response planning. Although the consequences of a radiologic dispersal device are substantial, and the detonation of a modest-sized (10 kiloton) improvised nuclear device is catastrophic, it is both possible and imperative that a medical response be planned. To meet this need, the Office of the Assistant Secretary for Preparedness and Response in the Department of Health and Human Services, in collaboration within government and with nongovernment partners, has developed a scientifically based comprehensive planning framework and Web-based "just-in-time" medical response information called Radiation Event Medical Management (available at http://www.remm.nlm.gov). The response plan includes (1) underpinnings from basic radiation biology, (2) tailored medical responses, (3) delivery of medical countermeasures for postevent mitigation and treatment, (4) referral to expert centers for acute treatment, and (5) long-term follow-up. Although continuing to evolve and increase in scope and capacity, current response planning is sufficiently mature that planners and responders should be aware of the basic premises, tools, and resources available. An effective response will require coordination, communication, and cooperation at an unprecedented level. The logic behind and components of this response are presented to allow for active collaboration among emergency planners and responders and federal, state, local, and tribal governments.

  17. Transformational Events

    ERIC Educational Resources Information Center

    Denning, Peter J.; Hiles, John E.

    2006-01-01

    Transformational Events is a new pedagogic pattern that explains how innovations (and other transformations) happened. The pattern is three temporal stages: an interval of increasingly unsatisfactory ad hoc solutions to a persistent problem (the "mess"), an offer of an invention or of a new way of thinking, and a period of widespread adoption and…

  18. Complex Event Recognition Architecture

    NASA Technical Reports Server (NTRS)

    Fitzgerald, William A.; Firby, R. James

    2009-01-01

    Complex Event Recognition Architecture (CERA) is the name of a computational architecture, and software that implements the architecture, for recognizing complex event patterns that may be spread across multiple streams of input data. One of the main components of CERA is an intuitive event pattern language that simplifies what would otherwise be the complex, difficult tasks of creating logical descriptions of combinations of temporal events and defining rules for combining information from different sources over time. In this language, recognition patterns are defined in simple, declarative statements that combine point events from given input streams with those from other streams, using conjunction, disjunction, and negation. Patterns can be built on one another recursively to describe very rich, temporally extended combinations of events. Thereafter, a run-time matching algorithm in CERA efficiently matches these patterns against input data and signals when patterns are recognized. CERA can be used to monitor complex systems and to signal operators or initiate corrective actions when anomalous conditions are recognized. CERA can be run as a stand-alone monitoring system, or it can be integrated into a larger system to automatically trigger responses to changing environments or problematic situations.

  19. Improved system for construction and analysis of single-copy beta-galactosidase operon fusions in Yersinia enterocolitica.

    PubMed

    Maxson, Michelle E; Darwin, Andrew J

    2005-09-01

    We report a significantly improved system for studying single-copy lacZ operon fusions in Yersinia enterocolitica: a simple procedure for the stable integration of lacZ operon fusions into the ara locus and a strain with a deletion mutation that abolishes the low level of endogenous beta-galactosidase activity.

  20. Comparative analyses across cattle breeds reveal the pitfalls caused by artificial and lineage-differential copy number variations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Copy number variations (CNV) are well known genomic variants, which often complicate structural and functional genomics studies. Here, we integrated the CNV region (CNVR) result detected from 1,682 Nellore cattle with the equivalent result derived from the Bovine HapMap samples. Through comparing CN...

  1. Schizophrenia copy number variants and associative learning.

    PubMed

    Clifton, N E; Pocklington, A J; Scholz, B; Rees, E; Walters, J T R; Kirov, G; O'Donovan, M C; Owen, M J; Wilkinson, L S; Thomas, K L; Hall, J

    2017-02-01

    Large-scale genomic studies have made major progress in identifying genetic risk variants for schizophrenia. A key finding from these studies is that there is an increased burden of genomic copy number variants (CNVs) in schizophrenia cases compared with controls. The mechanism through which these CNVs confer risk for the symptoms of schizophrenia, however, remains unclear. One possibility is that schizophrenia risk CNVs impact basic associative learning processes, abnormalities of which have long been associated with the disorder. To investigate whether genes in schizophrenia CNVs impact on specific phases of associative learning we combined human genetics with experimental gene expression studies in animals. In a sample of 11 917 schizophrenia cases and 16 416 controls, we investigated whether CNVs from patients with schizophrenia are enriched for genes expressed during the consolidation, retrieval or extinction of associative memories. We show that CNVs from cases are enriched for genes expressed during fear extinction in the hippocampus, but not genes expressed following consolidation or retrieval. These results suggest that CNVs act to impair inhibitory learning in schizophrenia, potentially contributing to the development of core symptoms of the disorder.

  2. Schizophrenia copy number variants and associative learning

    PubMed Central

    Clifton, N E; Pocklington, A J; Scholz, B; Rees, E; Walters, J T R; Kirov, G; O'Donovan, M C; Owen, M J; Wilkinson, L S; Thomas, K L; Hall, J

    2017-01-01

    Large-scale genomic studies have made major progress in identifying genetic risk variants for schizophrenia. A key finding from these studies is that there is an increased burden of genomic copy number variants (CNVs) in schizophrenia cases compared with controls. The mechanism through which these CNVs confer risk for the symptoms of schizophrenia, however, remains unclear. One possibility is that schizophrenia risk CNVs impact basic associative learning processes, abnormalities of which have long been associated with the disorder. To investigate whether genes in schizophrenia CNVs impact on specific phases of associative learning we combined human genetics with experimental gene expression studies in animals. In a sample of 11 917 schizophrenia cases and 16 416 controls, we investigated whether CNVs from patients with schizophrenia are enriched for genes expressed during the consolidation, retrieval or extinction of associative memories. We show that CNVs from cases are enriched for genes expressed during fear extinction in the hippocampus, but not genes expressed following consolidation or retrieval. These results suggest that CNVs act to impair inhibitory learning in schizophrenia, potentially contributing to the development of core symptoms of the disorder. PMID:27956746

  3. 48 CFR 6302.25 - Copies of papers (Rule 25).

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Copies of papers (Rule 25). 6302.25 Section 6302.25 Federal Acquisition Regulations System DEPARTMENT OF TRANSPORTATION BOARD OF CONTRACT APPEALS RULES OF PROCEDURE 6302.25 Copies of papers (Rule 25). When books, records, papers,...

  4. 1. Historic American Buildings Survey Copy photo: Albern Color Research, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. Historic American Buildings Survey Copy photo: Albern Color Research, Inc., Philadelphia, July 1960 COPY OF A PHOTOGRAPH TAKEN ca. 1904 SHOWING PART OF THE ENFIELD, NEW HAMPSHIRE SHAKER COMMUNITY WITH THE GREAT STONE HOUSE IN THE CENTER - Shaker Church Family General Views, State Route 4A, Enfield, Grafton County, NH

  5. An Evidence-Informed Picture of Course-Related Copying

    ERIC Educational Resources Information Center

    Graham, Rumi

    2016-01-01

    Recent changes in Canadian copyright law have prompted Canada's educational institutions to reexamine their need for a blanket copying license. Users' rights under the amended Copyright Act now include fair dealing for purposes of education, and the Supreme Court has established that copying short excerpts for classroom use can qualify as fair…

  6. 28. Photographic copy of original construction drawing, dated May 22, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    28. Photographic copy of original construction drawing, dated May 22, 1951 (from paper copy at Engineer Flight, Ellsworth Air Force Base, SD). Readiness hangar architectural : building sections & details. - Ellsworth Air Force Base, Readiness Hangar, Kenny Road, southeast corner of interstction with G Avenue, Blackhawk, Meade County, SD

  7. 48 CFR 6302.25 - Copies of papers (Rule 25).

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 7 2011-10-01 2011-10-01 false Copies of papers (Rule 25). 6302.25 Section 6302.25 Federal Acquisition Regulations System DEPARTMENT OF TRANSPORTATION BOARD OF CONTRACT APPEALS RULES OF PROCEDURE 6302.25 Copies of papers (Rule 25). When books, records, papers,...

  8. 7 CFR 510.2 - Public inspection, copying, and indexing.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 6 2010-01-01 2010-01-01 false Public inspection, copying, and indexing. 510.2 Section 510.2 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL RESEARCH SERVICE, DEPARTMENT OF AGRICULTURE PUBLIC INFORMATION § 510.2 Public inspection, copying, and indexing....

  9. 7 CFR 3701.2 - Public inspection, copying, and indexing.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Public inspection, copying, and indexing. 3701.2 Section 3701.2 Agriculture Regulations of the Department of Agriculture (Continued) ECONOMIC RESEARCH SERVICE, DEPARTMENT OF AGRICULTURE PUBLIC INFORMATION § 3701.2 Public inspection, copying, and indexing....

  10. 7 CFR 3404.2 - Public inspection, copying, and indexing.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Public inspection, copying, and indexing. 3404.2 Section 3404.2 Agriculture Regulations of the Department of Agriculture (Continued) COOPERATIVE STATE... inspection, copying, and indexing. 5 U.S.C. 552(a)(2) requires that certain materials be made available...

  11. 7 CFR 3801.2 - Public inspection, copying, and indexing.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Public inspection, copying, and indexing. 3801.2 Section 3801.2 Agriculture Regulations of the Department of Agriculture (Continued) WORLD AGRICULTURAL... inspection, copying, and indexing. 5 U.S.C. 552(a)(2) requires that certain materials be made available...

  12. 45 CFR 1703.404 - Copying and transcription charges.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 45 Public Welfare 4 2012-10-01 2012-10-01 false Copying and transcription charges. 1703.404... Copying and transcription charges. (a) The Commission will charge fees for furnishing records at the rate of ten cents per page for photocopies and at the actual cost of transcription. When the...

  13. 40 CFR 716.30 - Submission of copies of studies.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Submission of copies of studies. 716.30 Section 716.30 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT HEALTH AND SAFETY DATA REPORTING General Provisions § 716.30 Submission of copies...

  14. 37 CFR 1.95 - Copies of exhibits.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions Models, Exhibits, Specimens § 1.95 Copies of exhibits. Copies of models or other physical exhibits will not ordinarily be furnished by the Office, and any model or exhibit in an application or patent shall not be taken from...

  15. 37 CFR 1.95 - Copies of exhibits.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... COMMERCE GENERAL RULES OF PRACTICE IN PATENT CASES National Processing Provisions Models, Exhibits, Specimens § 1.95 Copies of exhibits. Copies of models or other physical exhibits will not ordinarily be furnished by the Office, and any model or exhibit in an application or patent shall not be taken from...

  16. 17. Photocopy of copy of drawing of Hangar 1301, dated ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. Photocopy of copy of drawing of Hangar 1301, dated June 15, 1944. Copy of drawing stored at 436 Civil Engineer Squadron, Design Management Element Cece, 600 8th Street, Dover Air Force Base, DE - Dover Air Force Base, Hangar No. 1301, Dover, Kent County, DE

  17. 18. Photocopy of copy of drawing of boiler plant and ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. Photocopy of copy of drawing of boiler plant and shops building, dated June 15, 1944. Copy of drawing stored at 436 Civil Engineer Squadron, Design Management Element Cece, 600 8th Street, Dover AFB, DE - Dover Air Force Base, Hangar No. 1301, Dover, Kent County, DE

  18. 30 CFR 47.72 - Cost for copies.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Cost for copies. 47.72 Section 47.72 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR EDUCATION AND TRAINING HAZARD COMMUNICATION (HazCom) Making HazCom Information Available § 47.72 Cost for copies. (a) The operator...

  19. 30 CFR 47.72 - Cost for copies.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Cost for copies. 47.72 Section 47.72 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR EDUCATION AND TRAINING HAZARD COMMUNICATION (HazCom) Making HazCom Information Available § 47.72 Cost for copies. (a) The operator...

  20. 30 CFR 47.72 - Cost for copies.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Cost for copies. 47.72 Section 47.72 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR EDUCATION AND TRAINING HAZARD COMMUNICATION (HazCom) Making HazCom Information Available § 47.72 Cost for copies. (a) The operator...

  1. 48 CFR 6302.25 - Copies of papers (Rule 25).

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 7 2014-10-01 2014-10-01 false Copies of papers (Rule 25). 6302.25 Section 6302.25 Federal Acquisition Regulations System DEPARTMENT OF TRANSPORTATION BOARD OF CONTRACT APPEALS RULES OF PROCEDURE 6302.25 Copies of papers (Rule 25). When books, records, papers,...

  2. 48 CFR 6302.25 - Copies of papers (Rule 25).

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 7 2012-10-01 2012-10-01 false Copies of papers (Rule 25). 6302.25 Section 6302.25 Federal Acquisition Regulations System DEPARTMENT OF TRANSPORTATION BOARD OF CONTRACT APPEALS RULES OF PROCEDURE 6302.25 Copies of papers (Rule 25). When books, records, papers,...

  3. 48 CFR 6302.25 - Copies of papers (Rule 25).

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 7 2013-10-01 2012-10-01 true Copies of papers (Rule 25). 6302.25 Section 6302.25 Federal Acquisition Regulations System DEPARTMENT OF TRANSPORTATION BOARD OF CONTRACT APPEALS RULES OF PROCEDURE 6302.25 Copies of papers (Rule 25). When books, records, papers,...

  4. Perceiving the Impossible: How Individuals with Autism Copy Paradoxical Figures

    ERIC Educational Resources Information Center

    Sheppard, Elizabeth; Ropar, Danielle; Mitchell, Peter

    2009-01-01

    Mottron and colleagues found that individuals with autism were less affected by geometric impossibility than comparison participants on a copying task. The current experiment sought to determine whether a local perceptual style could account for this. Participants with and without autism copied possible and impossible geometric figures. Geometric…

  5. 36 CFR 1254.60 - What are NARA's copying services?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false What are NARA's copying services? 1254.60 Section 1254.60 Parks, Forests, and Public Property NATIONAL ARCHIVES AND RECORDS ADMINISTRATION PUBLIC AVAILABILITY AND USE USING RECORDS AND DONATED HISTORICAL MATERIALS Copying...

  6. 36 CFR 1254.64 - Will NARA certify copies?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Will NARA certify copies? 1254.64 Section 1254.64 Parks, Forests, and Public Property NATIONAL ARCHIVES AND RECORDS ADMINISTRATION PUBLIC AVAILABILITY AND USE USING RECORDS AND DONATED HISTORICAL MATERIALS Copying...

  7. 36 CFR 1254.60 - What are NARA's copying services?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 36 Parks, Forests, and Public Property 3 2014-07-01 2014-07-01 false What are NARA's copying services? 1254.60 Section 1254.60 Parks, Forests, and Public Property NATIONAL ARCHIVES AND RECORDS ADMINISTRATION PUBLIC AVAILABILITY AND USE USING RECORDS AND DONATED HISTORICAL MATERIALS Copying...

  8. 36 CFR 1254.64 - Will NARA certify copies?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 36 Parks, Forests, and Public Property 3 2014-07-01 2014-07-01 false Will NARA certify copies? 1254.64 Section 1254.64 Parks, Forests, and Public Property NATIONAL ARCHIVES AND RECORDS ADMINISTRATION PUBLIC AVAILABILITY AND USE USING RECORDS AND DONATED HISTORICAL MATERIALS Copying...

  9. 25 CFR 571.13 - Copies of audit reports.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    .../or reports as a result of the audit setting forth the results of each fiscal year. The submission... 25 Indians 2 2010-04-01 2010-04-01 false Copies of audit reports. 571.13 Section 571.13 Indians... MONITORING AND INVESTIGATIONS Audits § 571.13 Copies of audit reports. (a) Each tribe shall prepare...

  10. 47 CFR 3.25 - Number of copies.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... AUTHORITIES IN MARITIME AND MARITIME MOBILE-SATELLITE RADIO SERVICES Application Procedures § 3.25 Number of copies. One original and one copy of FCC Form 44, “Application For Certification As An Accounting Authority” will be required. Only applications mailed to the Commission on official, Commission...

  11. 47 CFR 3.25 - Number of copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... AUTHORITIES IN MARITIME AND MARITIME MOBILE-SATELLITE RADIO SERVICES Application Procedures § 3.25 Number of copies. One original and one copy of FCC Form 44, “Application For Certification As An Accounting Authority” will be required. Only applications mailed to the Commission on official, Commission...

  12. 9. Photographic copy of USRS design drawing, April 1906 (from ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. Photographic copy of USRS design drawing, April 1906 (from duplicate copy on file at United States Bureau of Reclamation, Denver Service Center, Denver, Colorado). Main canal diversion weir from Salmon River - Salmon Creek Diversion Dam, Salmon Creek, Okanogan, Okanogan County, WA

  13. 7 CFR 3601.2 - Public inspection, copying, and indexing.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 15 2013-01-01 2013-01-01 false Public inspection, copying, and indexing. 3601.2 Section 3601.2 Agriculture Regulations of the Department of Agriculture (Continued) NATIONAL AGRICULTURAL STATISTICS SERVICE, DEPARTMENT OF AGRICULTURE PUBLIC INFORMATION § 3601.2 Public inspection, copying,...

  14. 7 CFR 3601.2 - Public inspection, copying, and indexing.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 15 2014-01-01 2014-01-01 false Public inspection, copying, and indexing. 3601.2 Section 3601.2 Agriculture Regulations of the Department of Agriculture (Continued) NATIONAL AGRICULTURAL STATISTICS SERVICE, DEPARTMENT OF AGRICULTURE PUBLIC INFORMATION § 3601.2 Public inspection, copying,...

  15. 7 CFR 3601.2 - Public inspection, copying, and indexing.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 15 2011-01-01 2011-01-01 false Public inspection, copying, and indexing. 3601.2 Section 3601.2 Agriculture Regulations of the Department of Agriculture (Continued) NATIONAL AGRICULTURAL STATISTICS SERVICE, DEPARTMENT OF AGRICULTURE PUBLIC INFORMATION § 3601.2 Public inspection, copying,...

  16. 8. PHOTOGRAPHIC COPY OF AERIAL PHOTOGRAPH, DATED CA. 19201925, FORT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. PHOTOGRAPHIC COPY OF AERIAL PHOTOGRAPH, DATED CA. 1920-1925, FORT BLISS, ARROW POINTS TO 7TH CAVALRY CANTONMENT, COPY ON FILE IN THE ENVIRONMENTAL MANAGEMENT OFFICE, FORT BLISS - Fort Bliss, 7th Cavalry Buildings, U.S. Army Air Defence Artillery Center & Fort Bliss, El Paso, El Paso County, TX

  17. 6. PHOTOGRAPHIC COPY OF ORIGINAL CONSTRUCTION DRAWING, DATED MAY 15, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. PHOTOGRAPHIC COPY OF ORIGINAL CONSTRUCTION DRAWING, DATED MAY 15, 1919, 7TH CAVALRY CANTONMENT POST EXCHANGE, WAR DEPARTMENT, CONSTRUCTION DIVISION, PLAN No. 357, COPY ON FILE IN THE ENVIRONMENTAL MANAGEMENT OFFICE, FORT BLISS - Fort Bliss, 7th Cavalry Buildings, U.S. Army Air Defence Artillery Center & Fort Bliss, El Paso, El Paso County, TX

  18. 5. PHOTOGRAPHIC COPY OF ORIGINAL CONSTRUCTION DRAWING, DATED JUNE 14, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. PHOTOGRAPHIC COPY OF ORIGINAL CONSTRUCTION DRAWING, DATED JUNE 14, 1919, 7TH CAVALRY CANTONMENT MESS BUILDING, WAR DEPARTMENT, CONSTRUCTION DIVISION, PLAN No. 316A, COPY ON FILE IN THE ENVIRONMENTAL MANAGEMENT OFFICE, FORT BLISS - Fort Bliss, 7th Cavalry Buildings, U.S. Army Air Defence Artillery Center & Fort Bliss, El Paso, El Paso County, TX

  19. 4. PHOTOGRAPHIC COPY OF ORIGINAL CONSTRUCTION DRAWING, DATED MAY 13, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    4. PHOTOGRAPHIC COPY OF ORIGINAL CONSTRUCTION DRAWING, DATED MAY 13, 1919, DETACHMENT BARRACK WITHOUT MESS, WAR DEPARTMENT, CONSTRUCTION DIVISION, PLAN # 353, COPY ON FILE IN THE ENVIRONMENTAL MANAGEMENT OFFICE, FORT BLISS - Fort Bliss, 7th Cavalry Buildings, U.S. Army Air Defence Artillery Center & Fort Bliss, El Paso, El Paso County, TX

  20. 52. Photocopy of copy of original Officers' Duplex Quarters drawing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    52. Photocopy of copy of original Officers' Duplex Quarters drawing by Copeland, 7 April 1932 (Original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Heating - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

  1. 20. Photographic copy of the original construction drawing, 193031, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. Photographic copy of the original construction drawing, 1930-31, by Sverdrup and Parcel, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. Truss stress diagram, and plans of laterals and sway braces - Gasconade Bridge, Spanning Gasconade River at State Route 100, Gasconade, Gasconade County, MO

  2. 41. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    41. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. STRESS SHEET - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  3. 37. Photographic copy of the original construction drawing, 1934, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    37. Photographic copy of the original construction drawing, 1934, by Sverdrup and Parcel, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department. Stress sheet, continuous span - Mark Twain Memorial Bridge, Spanning Mississippi River at US Route 36, Hannibal, Marion County, MO

  4. 53. Photocopy of copy of original Officers' Duplex Quarters drawing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    53. Photocopy of copy of original Officers' Duplex Quarters drawing by A.G.D., 7 April 1932 (original in possession of Veterans Administration, Wichita, Kansas, copy at Ablah Library, Wichita State University). Electrical - Veterans Administration Center, Officers Duplex Quarters, 5302 East Kellogg (Legal Address); 5500 East Kellogg (Common Address), Wichita, Sedgwick County, KS

  5. Vocal copying of individually distinctive signature whistles in bottlenose dolphins

    PubMed Central

    King, Stephanie L.; Sayigh, Laela S.; Wells, Randall S.; Fellner, Wendi; Janik, Vincent M.

    2013-01-01

    Vocal learning is relatively common in birds but less so in mammals. Sexual selection and individual or group recognition have been identified as major forces in its evolution. While important in the development of vocal displays, vocal learning also allows signal copying in social interactions. Such copying can function in addressing or labelling selected conspecifics. Most examples of addressing in non-humans come from bird song, where matching occurs in an aggressive context. However, in other animals, addressing with learned signals is very much an affiliative signal. We studied the function of vocal copying in a mammal that shows vocal learning as well as complex cognitive and social behaviour, the bottlenose dolphin (Tursiops truncatus). Copying occurred almost exclusively between close associates such as mother–calf pairs and male alliances during separation and was not followed by aggression. All copies were clearly recognizable as such because copiers consistently modified some acoustic parameters of a signal when copying it. We found no evidence for the use of copying in aggression or deception. This use of vocal copying is similar to its use in human language, where the maintenance of social bonds appears to be more important than the immediate defence of resources. PMID:23427174

  6. 6. Photo copy of photograph, (original owned by Mary Gaudineer, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. Photo copy of photograph, (original owned by Mary Gaudineer, Beckley, WV, copy at National Forest Office, Elkins, WV), Don Gaudineer, 1934. CONSTRUCTION OF FERNOW EXPERIMENTAL FOREST BUNKHOUSE AND GARAGE. (see also historic photograph WV-237-13) - Parsons Nursery, Fernow Experimental Forest Residence, South side of U.S. Route 219, Parsons, Tucker County, WV

  7. 48. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    48. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS L9 TO L12 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  8. 54. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    54. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS U13 TO U16 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  9. 49. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    49. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS L13 TO L16 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  10. 55. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    55. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS U17 TO U20 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  11. 47. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    47. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS L5 TO L8 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  12. 51. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    51. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS L0, U2 TO U4, PORTAL AT U2 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  13. 50. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    50. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS L17 TO L20 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  14. 53. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    53. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS U9 TO U12 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  15. 52. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    52. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS U5 TO U8 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  16. 46. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    46. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, JOINTS L1 TO L4 - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  17. 47 CFR 78.67 - Copies of rules.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Copies of rules. 78.67 Section 78.67 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES CABLE TELEVISION RELAY SERVICE General Operating Requirements § 78.67 Copies of rules. The licensee of a CARS station shall...

  18. 47 CFR 78.67 - Copies of rules.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 4 2011-10-01 2011-10-01 false Copies of rules. 78.67 Section 78.67 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES CABLE TELEVISION RELAY SERVICE General Operating Requirements § 78.67 Copies of rules. The licensee of a CARS station shall...

  19. 47 CFR 78.67 - Copies of rules.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 47 Telecommunication 4 2013-10-01 2013-10-01 false Copies of rules. 78.67 Section 78.67 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES CABLE TELEVISION RELAY SERVICE General Operating Requirements § 78.67 Copies of rules. The licensee of a CARS station shall...

  20. 47 CFR 78.67 - Copies of rules.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 47 Telecommunication 4 2014-10-01 2014-10-01 false Copies of rules. 78.67 Section 78.67 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES CABLE TELEVISION RELAY SERVICE General Operating Requirements § 78.67 Copies of rules. The licensee of a CARS station shall...

  1. 47 CFR 78.67 - Copies of rules.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 47 Telecommunication 4 2012-10-01 2012-10-01 false Copies of rules. 78.67 Section 78.67 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES CABLE TELEVISION RELAY SERVICE General Operating Requirements § 78.67 Copies of rules. The licensee of a CARS station shall...

  2. 44. Photographic copy of the original construction drawing, 192627, by ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    44. Photographic copy of the original construction drawing, 1926-27, by Harrington, Howard, and Ash, Consulting Engineers, from microfilm copy at Bridge Division, Missouri Highway and Transportation Department, Jefferson City, Missouri. 671 FT. SPAN, SHOES - Cape Girardeau Bridge, Spanning Mississippi River at State Highway 146, Cape Girardeau, Cape Girardeau County, MO

  3. 7 CFR 370.4 - Facilities for inspection and copying.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 370.4 Agriculture Regulations of the Department of Agriculture (Continued) ANIMAL AND PLANT HEALTH... copying. Facilities for public inspection and copying of the index and materials required to be made... Information Act Coordinator, Animal and Plant Health Inspection Service, Legislative and Public...

  4. Site-specific gene integration in rice genome mediated by the FLP-FRT recombination system.

    PubMed

    Nandy, Soumen; Srivastava, Vibha

    2011-08-01

    Plant transformation based on random integration of foreign DNA often generates complex integration structures. Precision in the integration process is necessary to ensure the formation of full-length, single-copy integration. Site-specific recombination systems are versatile tools for precise genomic manipulations such as DNA excision, inversion or integration. The yeast FLP-FRT recombination system has been widely used for DNA excision in higher plants. Here, we report the use of FLP-FRT system for efficient targeting of foreign gene into the engineered genomic site in rice. The transgene vector containing a pair of directly oriented FRT sites was introduced by particle bombardment into the cells containing the target locus. FLP activity generated by the co-bombarded FLP gene efficiently separated the transgene construct from the vector-backbone and integrated the backbone-free construct into the target site. Strong FLP activity, derived from the enhanced FLP protein, FLPe, was important for the successful site-specific integration (SSI). The majority of the transgenic events contained a precise integration and expressed the transgene. Interestingly, each transgenic event lacked the co-bombarded FLPe gene, suggesting reversion of the integration structure in the presence of the constitutive FLPe expression. Progeny of the precise transgenic lines inherited the stable SSI locus and expressed the transgene. This work demonstrates the application of FLP-FRT system for site-specific gene integration in plants using rice as a model.

  5. Mapping copy number variation by population-scale genome sequencing.

    PubMed

    Mills, Ryan E; Walter, Klaudia; Stewart, Chip; Handsaker, Robert E; Chen, Ken; Alkan, Can; Abyzov, Alexej; Yoon, Seungtai Chris; Ye, Kai; Cheetham, R Keira; Chinwalla, Asif; Conrad, Donald F; Fu, Yutao; Grubert, Fabian; Hajirasouliha, Iman; Hormozdiari, Fereydoun; Iakoucheva, Lilia M; Iqbal, Zamin; Kang, Shuli; Kidd, Jeffrey M; Konkel, Miriam K; Korn, Joshua; Khurana, Ekta; Kural, Deniz; Lam, Hugo Y K; Leng, Jing; Li, Ruiqiang; Li, Yingrui; Lin, Chang-Yun; Luo, Ruibang; Mu, Xinmeng Jasmine; Nemesh, James; Peckham, Heather E; Rausch, Tobias; Scally, Aylwyn; Shi, Xinghua; Stromberg, Michael P; Stütz, Adrian M; Urban, Alexander Eckehart; Walker, Jerilyn A; Wu, Jiantao; Zhang, Yujun; Zhang, Zhengdong D; Batzer, Mark A; Ding, Li; Marth, Gabor T; McVean, Gil; Sebat, Jonathan; Snyder, Michael; Wang, Jun; Ye, Kenny; Eichler, Evan E; Gerstein, Mark B; Hurles, Matthew E; Lee, Charles; McCarroll, Steven A; Korbel, Jan O

    2011-02-03

    Genomic structural variants (SVs) are abundant in humans, differing from other forms of variation in extent, origin and functional impact. Despite progress in SV characterization, the nucleotide resolution architecture of most SVs remains unknown. We constructed a map of unbalanced SVs (that is, copy number variants) based on whole genome DNA sequencing data from 185 human genomes, integrating evidence from complementary SV discovery approaches with extensive experimental validations. Our map encompassed 22,025 deletions and 6,000 additional SVs, including insertions and tandem duplications. Most SVs (53%) were mapped to nucleotide resolution, which facilitated analysing their origin and functional impact. We examined numerous whole and partial gene deletions with a genotyping approach and observed a depletion of gene disruptions amongst high frequency deletions. Furthermore, we observed differences in the size spectra of SVs originating from distinct formation mechanisms, and constructed a map of SV hotspots formed by common mechanisms. Our analytical framework and SV map serves as a resource for sequencing-based association studies.

  6. Expression of COPI components during development of Drosophila melanogaster.

    PubMed

    Grieder, Nicole C; Kloter, Urs; Gehring, Walter J

    2005-12-01

    In a P{lArB} enhancer detector collection, a line was found that showed upregulated expression within centrally to posteriorly located germarial cysts. It was inserted in the gammaCOP locus on chromosome 3R. GammaCOP is a component of the COPI coatomer involved in membrane traffic. Most of the other known components of the COPI coatomer also showed higher expression in the posterior half of the germarium. Not only meiotic germline cysts but also migrating follicle cells upregulate the COPI subunits. During embryonic and larval development, the COPI subunits are expressed ubiquitously as expected for genes required for cell viability. In addition, they are strongly expressed in the salivary glands and the proventriculus. Whether tissue-specific transcriptional upregulation of COPI subunits is required for the reorganization of membranous compartments that are needed for the developmental processes that confer cyst polarity and follicle maturation will have to be addressed in a genetic study.

  7. Protocols for Copying and Proofreading in Template-Assisted Polymerization

    NASA Astrophysics Data System (ADS)

    Pigolotti, Simone; Sartori, Pablo

    2016-03-01

    We discuss how information encoded in a template polymer can be stochastically copied into a copy polymer. We consider four different stochastic copy protocols of increasing complexity, inspired by building blocks of the mRNA translation pathway. In the first protocol, monomer incorporation occurs in a single stochastic transition. We then move to a more elaborate protocol in which an intermediate step can be used for error correction. Finally, we discuss the operating regimes of two kinetic proofreading protocols: one in which proofreading acts from the final copying step, and one in which it acts from an intermediate step. We review known results for these models and, in some cases, extend them to analyze all possible combinations of energetic and kinetic discrimination. We show that, in each of these protocols, only a limited number of these combinations leads to an improvement of the overall copying accuracy.

  8. Different Facets of Copy Number Changes: Permanent, Transient, and Adaptive

    PubMed Central

    Mishra, Sweta

    2016-01-01

    Chromosomal copy number changes are frequently associated with harmful consequences and are thought of as an underlying mechanism for the development of diseases. However, changes in copy number are observed during development and occur during normal biological processes. In this review, we highlight the causes and consequences of copy number changes in normal physiologic processes as well as cover their associations with cancer and acquired drug resistance. We discuss the permanent and transient nature of copy number gains and relate these observations to a new mechanism driving transient site-specific copy gains (TSSGs). Finally, we discuss implications of TSSGs in generating intratumoral heterogeneity and tumor evolution and how TSSGs can influence the therapeutic response in cancer. PMID:26755558

  9. Adverse events in an integrated home-based treatment program for MDR-TB and HIV in KwaZulu-Natal, South Africa.

    PubMed

    Brust, James C M; Shah, N Sarita; van der Merwe, Theo L; Bamber, Sheila; Ning, Yuming; Heo, Moonseong; Moll, Anthony P; Loveday, Marian; Lalloo, Umesh G; Friedland, Gerald H; Gandhi, Neel R

    2013-04-01

    Most patients with multidrug-resistant tuberculosis (MDR-TB) in South Africa are HIV-infected, but the safety and tolerability of cotreatment are unknown. The authors reviewed all adverse events (AEs) for patients with MDR-TB in a home-based treatment program in rural KwaZulu-Natal. Of 91 MDR-TB patients, 74 (81%) were HIV-positive and receiving antiretroviral therapy. AEs were common, but most were mild and did not require therapy modification. The most common severe AEs were hypothyroidism (36%) and psychosis (5%). Patients receiving concurrent antiretroviral therapy did not experience AEs more frequently than those on MDR-TB therapy alone. Concurrent treatment for MDR-TB/HIV can be safely administered in a home-based care setting.

  10. Alcohol, Intercourse, and Condom Use Among Women Recently Involved in the Criminal Justice System: Findings from Integrated Global-Frequency and Event-Level Methods

    PubMed Central

    Latkin, Carl A.

    2014-01-01

    The scientific literature on alcohol and sexual risk behavior is marked by multiple theoretical perspectives and inconsistent findings from global-frequency and event-level studies. Multilevel measures of alcohol use and multiple sexual risk outcomes can be used to evaluate these perspectives and resolve these inconsistencies. Among women recently involved in the criminal justice system in Portland, Oregon, daily alcohol use and sexual behavior were measured during four 30-day intervals over one year. In mixed effects models, person-level, month-level, and day-level alcohol use were significantly associated with the occurrence of intercourse but not with the use of condoms during intercourse. Findings are also reported for main, casual, and exchange partners. The relationships between alcohol use and sexual risk behavior are complex: No single theoretical perspective is sufficient to account for the study findings, and increased risk may be mediated through changes in intercourse rather than through changes in condom use. PMID:25100052

  11. Alcohol, Intercourse, and Condom Use Among Women Recently Involved in the Criminal Justice System: Findings from Integrated Global-Frequency and Event-Level Methods.

    PubMed

    Weir, Brian W; Latkin, Carl A

    2015-06-01

    The scientific literature on alcohol and sexual risk behavior is marked by multiple theoretical perspectives and inconsistent findings from global-frequency and event-level studies. Multilevel measures of alcohol use and multiple sexual risk outcomes can be used to evaluate these perspectives and resolve these inconsistencies. Among women recently involved in the criminal justice system in Portland, Oregon, daily alcohol use and sexual behavior were measured during four 30-day intervals over one year. In mixed effects models, person-level, month-level, and day-level alcohol use were significantly associated with the occurrence of intercourse but not with the use of condoms during intercourse. Findings are also reported for main, casual, and exchange partners. The relationships between alcohol use and sexual risk behavior are complex: No single theoretical perspective is sufficient to account for the study findings, and increased risk may be mediated through changes in intercourse rather than through changes in condom use.

  12. Events and event identity: under-explored topics in nursing.

    PubMed

    Lipscomb, Martin

    2010-04-01

    Theoretic interest in the nature of events and event identity is apparent across a wide range of fields. However, this interest has not yet made itself known in nursing. In this paper, it is asserted that nurse theoreticians and researchers should consider the problematic of events and event identity. It is suggested that engagement with these issues is important because the manner in which this component of explanation is integrated into argument has concrete implications for our understanding of healthcare practice. Indeed, refusal to engage with such issues may jeopardize explanatory coherence.

  13. Evaluation of epidemic intelligence systems integrated in the early alerting and reporting project for the detection of A/H5N1 influenza events.

    PubMed

    Barboza, Philippe; Vaillant, Laetitia; Mawudeku, Abla; Nelson, Noele P; Hartley, David M; Madoff, Lawrence C; Linge, Jens P; Collier, Nigel; Brownstein, John S; Yangarber, Roman; Astagneau, Pascal

    2013-01-01

    The objective of Web-based expert epidemic intelligence systems is to detect health threats. The Global Health Security Initiative (GHSI) Early Alerting and Reporting (EAR) project was launched to assess the feasibility and opportunity for pooling epidemic intelligence data from seven expert systems. EAR participants completed a qualitative survey to document epidemic intelligence strategies and to assess perceptions regarding the systems performance. Timeliness and sensitivity were rated highly illustrating the value of the systems for epidemic intelligence. Weaknesses identified included representativeness, completeness and flexibility. These findings were corroborated by the quantitative analysis performed on signals potentially related to influenza A/H5N1 events occurring in March 2010. For the six systems for which this information was available, the detection rate ranged from 31% to 38%, and increased to 72% when considering the virtual combined system. The effective positive predictive values ranged from 3% to 24% and F1-scores ranged from 6% to 27%. System sensitivity ranged from 38% to 72%. An average difference of 23% was observed between the sensitivities calculated for human cases and epizootics, underlining the difficulties in developing an efficient algorithm for a single pathology. However, the sensitivity increased to 93% when the virtual combined system was considered, clearly illustrating complementarities between individual systems. The average delay between the detection of A/H5N1 events by the systems and their official reporting by WHO or OIE was 10.2 days (95% CI: 6.7-13.8). This work illustrates the diversity in implemented epidemic intelligence activities, differences in system's designs, and the potential added values and opportunities for synergy between systems, between users and between systems and users.

  14. Mitochondrial DNA Copy Number Is Associated with Breast Cancer Risk

    PubMed Central

    Thyagarajan, Bharat; Wang, Renwei; Nelson, Heather; Barcelo, Helene; Koh, Woon-Puay; Yuan, Jian-Min

    2013-01-01

    Mitochondrial DNA (mtDNA) copy number in peripheral blood is associated with increased risk of several cancers. However, data from prospective studies on mtDNA copy number and breast cancer risk are lacking. We evaluated the association between mtDNA copy number in peripheral blood and breast cancer risk in a nested case-control study of 183 breast cancer cases with pre-diagnostic blood samples and 529 individually matched controls among participants of the Singapore Chinese Health Study. The mtDNA copy number was measured using real time PCR. Conditional logistic regression analyses showed that there was an overall positive association between mtDNA copy number and breast cancer risk (Ptrend = 0.01). The elevated risk for higher mtDNA copy numbers was primarily seen for women with <3 years between blood draw and cancer diagnosis; ORs (95% CIs) for 2nd, 3rd, 4th, and 5th quintile of mtDNA copy number were 1.52 (0.61, 3.82), 2.52 (1.03, 6.12), 3.12 (1.31, 7.43), and 3.06 (1.25, 7.47), respectively, compared with the 1st quintile (Ptrend = 0.004). There was no association between mtDNA copy number and breast cancer risk among women who donated a blood sample ≥3 years before breast cancer diagnosis (Ptrend = 0.41). This study supports a prospective association between increased mtDNA copy number and breast cancer risk that is dependent on the time interval between blood collection and breast cancer diagnosis. Future studies are warranted to confirm these findings and to elucidate the biological role of mtDNA copy number in breast cancer risk. PMID:23776581

  15. c-myc copy number gain is a powerful prognosticator of disease outcome in cervical dysplasia.

    PubMed

    Kübler, Kirsten; Heinenberg, Sally; Rudlowski, Christian; Keyver-Paik, Mignon-Denise; Abramian, Alina; Merkelbach-Bruse, Sabine; Büttner, Reinhard; Kuhn, Walther; Schildhaus, Hans-Ulrich

    2015-01-20

    Cervical carcinoma develops from preneoplasia by a multistep process. Although most low-grade dysplastic lesions will regress without intervention and even high-grade changes exhibit a substantial rate of regression, a small percentage of dysplasia will progress over time. Thus, indicators are needed to estimate the biological risk and to help avoid overtreatment in women who desire to preserve fertility. In addition to the classical biomarkers, PCR-ELISA-determined HPV genotype and immunohistochemically assessed p16INK4a and Ki-67 expression, cells with integrated HPV and copy number gain of TERC and c-myc were quantified in a panel of 104 benign, intraepithelial neoplastic (CIN I, II, III) and cancerous lesions using fluorescence in situ hybridization. Optimal cut-off values were calculated; Kaplan-Meier curves and a Cox proportional hazard regression model were used to evaluate prognostic signatures. The assay reliably identified HPV integration, TERC and c-myc copy number gain as determined by comparisons with established biomarkers. All biomarker levels increased with the progression of the disease. However, only c-myc copy number gain independently prognosticated a low probability of dysplastic regression. Our results suggest that c-myc plays a key role in the process of dysplastic transformation and might thus be exploited for treatment and follow-up decision-making of cervical dysplasia.

  16. Rare Events

    DTIC Science & Technology

    2009-10-01

    terrorists are likely to acquire and use WMDs over the next ten years. • Provide means to target areas, entities and persons facilitating adver - sary WMD...complicated and unpredictable to begin with, but also that human adver - saries (unlike physical disasters) will react and adapt to our planning to try to make...virulent vaccine strain (Keim et al., 2001). The latter might not be regarded as a bioterrorism event, even though it caused seven deaths and incited

  17. Eclipse period of R1 plasmids during downshift from elevated copy number: Nonrandom selection of copies for replication.

    PubMed

    Olsson, Jan A; Berg, Otto; Nordström, Kurt; Dasgupta, Santanu

    2012-03-01

    The classical Meselson-Stahl density-shift method was used to study replication of pOU71, a runaway-replication derivative of plasmid R1 in Escherichia coli. The miniplasmid maintained the normal low copy number of R1 during steady growth at 30°C, but as growth temperatures were raised above 34°C, the copy number of the plasmid increased to higher levels, and at 42°C, it replicated without control in a runaway replication mode with lethal consequences for the host. The eclipse periods (minimum time between successive replication of the same DNA) of the plasmid shortened with rising copy numbers at increasing growth temperatures (Olsson et al., 2003). In this work, eclipse periods were measured during downshifts in copy number of pOU71 after it had replicated at 39 and 42°C, resulting in 7- and 50-fold higher than normal plasmid copy number per cell, respectively. Eclipse periods for plasmid replication, measured during copy number downshift, suggested that plasmid R1, normally selected randomly for replication, showed a bias such that a newly replicated DNA had a higher probability of replication compared to the bulk of the R1 population. However, even the unexpected nonrandom replication followed the copy number kinetics such that every generation, the plasmids underwent the normal inherited number of replication, n, independent of the actual number of plasmid copies in a newborn cell.

  18. The Agrocybe aegerita mitochondrial genome contains two inverted repeats of the nad4 gene arisen by duplication on both sides of a linear plasmid integration site.

    PubMed

    Ferandon, C; Chatel, S El Kirat; Castandet, B; Castroviejo, M; Barroso, G

    2008-03-01

    The Agrocybe aegerita mitochondrial genome possesses two polB genes with linear plasmid origin. The cloning and sequencing of the regions flanking Aa-polB P1 revealed two large inverted repeats (higher than 2421 nt) separated by a single copy region of 5834 nt. Both repeats contain identical copies of the nad4 gene. The single copy region contains two disrupted genes with plasmid origin Aa-polB P1 and a small ORF homologous to a small gene described in two basidiomycete linear plasmids. The phylogenetic analyses argue in favor of a same plasmid origin for both genes but, surprisingly, these genes were separated by a mitochondrial tRNA-Met. Both strands of the complete region containing the two nad4 inverted copies and the tRNA-Met appear to be transcribed on large polycistronic mRNAs. A model summarizing the events that would have occurred is proposed: (1) capture of the tRNA by the plasmid before its integration in the mtDNA or acquisition of the tRNA gene by recombination after the plasmid integration, (2) integration of the plasmid in the mtDNA, accompanied by a large duplication containing the nad4 gene and (3) erosion of the plasmid sequences by large deletions and mutations.

  19. Selective regain of egfr gene copies in CD44+/CD24-/low breast cancer cellular model MDA-MB-468

    PubMed Central

    2010-01-01

    Background Increased transcription of oncogenes like the epidermal growth factor receptor (EGFR) is frequently caused by amplification of the whole gene or at least of regulatory sequences. Aim of this study was to pinpoint mechanistic parameters occurring during egfr copy number gains leading to a stable EGFR overexpression and high sensitivity to extracellular signalling. A deeper understanding of those marker events might improve early diagnosis of cancer in suspect lesions, early detection of cancer progression and the prediction of egfr targeted therapies. Methods The basal-like/stemness type breast cancer cell line subpopulation MDA-MB-468 CD44high/CD24-/low, carrying high egfr amplifications, was chosen as a model system in this study. Subclones of the heterogeneous cell line expressing low and high EGF receptor densities were isolated by cell sorting. Genomic profiling was carried out for these by means of SNP array profiling, qPCR and FISH. Cell cycle analysis was performed using the BrdU quenching technique. Results Low and high EGFR expressing MDA-MB-468 CD44+/CD24-/low subpopulations separated by cell sorting showed intermediate and high copy numbers of egfr, respectively. However, during cell culture an increase solely for egfr gene copy numbers in the intermediate subpopulation occurred. This shift was based on the formation of new cells which regained egfr gene copies. By two parametric cell cycle analysis clonal effects mediated through growth advantage of cells bearing higher egfr gene copy numbers could most likely be excluded for being the driving force. Subsequently, the detection of a fragile site distal to the egfr gene, sustaining uncapped telomere-less chromosomal ends, the ladder-like structure of the intrachromosomal egfr amplification and a broader range of egfr copy numbers support the assumption that dynamic chromosomal rearrangements, like breakage-fusion-bridge-cycles other than proliferation drive the gain of egfr copies. Conclusion

  20. Fast Bayesian Inference of Copy Number Variants using Hidden Markov Models with Wavelet Compression

    PubMed Central

    Wiedenhoeft, John; Brugel, Eric; Schliep, Alexander

    2016-01-01

    By integrating Haar wavelets with Hidden Markov Models, we achieve drastically reduced running times for Bayesian inference using Forward-Backward Gibbs sampling. We show that this improves detection of genomic copy number variants (CNV) in array CGH experiments compared to the state-of-the-art, including standard Gibbs sampling. The method concentrates computational effort on chromosomal segments which are difficult to call, by dynamically and adaptively recomputing consecutive blocks of observations likely to share a copy number. This makes routine diagnostic use and re-analysis of legacy data collections feasible; to this end, we also propose an effective automatic prior. An open source software implementation of our method is available at http://schlieplab.org/Software/HaMMLET/ (DOI: 10.5281/zenodo.46262). This paper was selected for oral presentation at RECOMB 2016, and an abstract is published in the conference proceedings. PMID:27177143

  1. Copy number variation in Thai population.

    PubMed

    Suktitipat, Bhoom; Naktang, Chaiwat; Mhuantong, Wuttichai; Tularak, Thitima; Artiwet, Paramita; Pasomsap, Ekawat; Jongjaroenprasert, Wallaya; Fuchareon, Suthat; Mahasirimongkol, Surakameth; Chantratita, Wasan; Yimwadsana, Boonsit; Charoensawan, Varodom; Jinawath, Natini

    2014-01-01

    Copy number variation (CNV) is a major genetic polymorphism contributing to genetic diversity and human evolution. Clinical application of CNVs for diagnostic purposes largely depends on sufficient population CNV data for accurate interpretation. CNVs from general population in currently available databases help classify CNVs of uncertain clinical significance, and benign CNVs. Earlier studies of CNV distribution in several populations worldwide showed that a significant fraction of CNVs are population specific. In this study, we characterized and analyzed CNVs in 3,017 unrelated Thai individuals genotyped with the Illumina Human610, Illumina HumanOmniexpress, or Illumina HapMap550v3 platform. We employed hidden Markov model and circular binary segmentation methods to identify CNVs, extracted 23,458 CNVs consistently identified by both algorithms, and cataloged these high confident CNVs into our publicly available Thai CNV database. Analysis of CNVs in the Thai population identified a median of eight autosomal CNVs per individual. Most CNVs (96.73%) did not overlap with any known chromosomal imbalance syndromes documented in the DECIPHER database. When compared with CNVs in the 11 HapMap3 populations, CNVs found in the Thai population shared several characteristics with CNVs characterized in HapMap3. Common CNVs in Thais had similar frequencies to those in the HapMap3 populations, and all high frequency CNVs (>20%) found in Thai individuals could also be identified in HapMap3. The majorities of CNVs discovered in the Thai population, however, were of low frequency, or uniquely identified in Thais. When performing hierarchical clustering using CNV frequencies, the CNV data were clustered into Africans, Europeans, and Asians, in line with the clustering performed with single nucleotide polymorphism (SNP) data. As CNV data are specific to origin of population, our population-specific reference database will serve as a valuable addition to the existing resources for

  2. Converting hard copy documents for electronic dissemination

    SciTech Connect

    Hoffman, F.

    1994-12-31

    Since the advent of computer systems, the goal of a paperless office, and even a paperless society, has been pursued. While the normal paper flow in an organization is far from totally automated, particularly for items requiring signatures or authorizations, electronic information dissemination is becoming an almost simple task. The reasons for providing on-line documents are many and include faster and easier access for everyone, elimination of printing costs, reduction of wasted shelf and desk space, and the security of having a centrally-located, always up-to-date document. New computer software even provides the user with the ability to annotate documents and to have bookmarks so that the old scribbled-in and dog-eared manual can be replaced without loosing this `customizability`. Moreover, new hypermedia capabilities mean that documents can be read in a non-linear fashion and can include color figures and photographs, audio, and even animation sequences, capabilities which exceed those of paper. The proliferation of network-based information servers, coupled with the growth of the Internet, has enticed academic, governmental, and even commercial organizations to provide increasing numbers of documents and data bases in electronic form via the network, not just to internal staff, but to the public as well. Much of this information, which includes everything from mundane company procedures to spiffy marketing brochures, was previously published only in hard copy. Converting existing documents to electronic form and producing only electronic versions of new documents poses some interesting challenges to the maintainer or author.

  3. Copy Number Variation in Familial Parkinson Disease

    PubMed Central

    Pankratz, Nathan; Dumitriu, Alexandra; Hetrick, Kurt N.; Sun, Mei; Latourelle, Jeanne C.; Wilk, Jemma B.; Halter, Cheryl; Doheny, Kimberly F.; Gusella, James F.; Nichols, William C.; Myers, Richard H.; Foroud, Tatiana; DeStefano, Anita L.

    2011-01-01

    Copy number variants (CNVs) are known to cause Mendelian forms of Parkinson disease (PD), most notably in SNCA and PARK2. PARK2 has a recessive mode of inheritance; however, recent evidence demonstrates that a single CNV in PARK2 (but not a single missense mutation) may increase risk for PD. We recently performed a genome-wide association study for PD that excluded individuals known to have either a LRRK2 mutation or two PARK2 mutations. Data from the Illumina370Duo arrays were re-clustered using only white individuals with high quality intensity data, and CNV calls were made using two algorithms, PennCNV and QuantiSNP. After quality assessment, the final sample included 816 cases and 856 controls. Results varied between the two CNV calling algorithms for many regions, including the PARK2 locus (genome-wide p = 0.04 for PennCNV and p = 0.13 for QuantiSNP). However, there was consistent evidence with both algorithms for two novel genes, USP32 and DOCK5 (empirical, genome-wide p-values<0.001). PARK2 CNVs tended to be larger, and all instances that were molecularly tested were validated. In contrast, the CNVs in both novel loci were smaller and failed to replicate using real-time PCR, MLPA, and gel electrophoresis. The DOCK5 variation is more akin to a VNTR than a typical CNV and the association is likely caused by artifact due to DNA source. DNA for all the cases was derived from whole blood, while the DNA for all controls was derived from lymphoblast cell lines. The USP32 locus contains many SNPs with low minor allele frequency leading to a loss of heterozygosity that may have been spuriously interpreted by the CNV calling algorithms as support for a deletion. Thus, only the CNVs within the PARK2 locus could be molecularly validated and associated with PD susceptibility. PMID:21829596

  4. 21 CFR 803.20 - How do I complete and submit an individual adverse event report?

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 3500A unless you are copying the information onto an electronic medium. If you are a manufacturer and..., nurses, risk managers, and biomedical engineers. You must keep in your MDR event files (described...

  5. Physical Mapping of Amplified Copies of the 5-Enolpyruvylshikimate-3-Phosphate Synthase Gene in Glyphosate-Resistant Amaranthus tuberculatus.

    PubMed

    Dillon, Andrew; Varanasi, Vijay K; Danilova, Tatiana V; Koo, Dal-Hoe; Nakka, Sridevi; Peterson, Dallas E; Tranel, Patrick J; Friebe, Bernd; Gill, Bikram S; Jugulam, Mithila

    2017-02-01

    Recent and rapid evolution of resistance to glyphosate, the most widely used herbicides, in several weed species, including common waterhemp (Amaranthus tuberculatus), poses a serious threat to sustained crop production. We report that glyphosate resistance in A tuberculatus was due to amplification of the 5-enolpyruvylshikimate-3-P synthase (EPSPS) gene, which encodes the molecular target of glyphosate. There was a positive correlation between EPSPS gene copies and its transcript expression. We analyzed the distribution of EPSPS copies in the genome of A tuberculatus using fluorescence in situ hybridization on mitotic metaphase chromosomes and interphase nuclei. Fluorescence in situ hybridization analysis mapped the EPSPS gene to pericentromeric regions of two homologous chromosomes in glyphosate sensitive A tuberculatus In glyphosate-resistant plants, a cluster of EPSPS genes on the pericentromeric region on one pair of homologous chromosomes was detected. Intriguingly, two highly glyphosate-resistant plants harbored an additional chromosome with several EPSPS copies besides the native chromosome pair with EPSPS copies. These results suggest that the initial event of EPSPS gene duplication may have occurred because of unequal recombination mediated by repetitive DNA. Subsequently, gene amplification may have resulted via several other mechanisms, such as chromosomal rearrangements, deletion/insertion, transposon-mediated dispersion, or possibly by interspecific hybridization. This report illustrates the physical mapping of amplified EPSPS copies in A tuberculatus.

  6. Event-specific quantitative detection of nine genetically modified maizes using one novel standard reference molecule.

    PubMed

    Yang, Litao; Guo, Jinchao; Pan, Aihu; Zhang, Haibo; Zhang, Kewei; Wang, Zhengming; Zhang, Dabing

    2007-01-10

    With the development of genetically modified organism (GMO) detection techniques, the Polymerase Chain Reaction (PCR) technique has been the mainstay for GMO detection, and real-time PCR is the most effective and important method for GMO quantification. An event-specific detection strategy based on the unique and specific integration junction sequences between the host plant genome DNA and the integrated gene is being developed for its high specificity. This study establishes the event-specific detection methods for TC1507 and CBH351 maizes. In addition, the event-specific TaqMan real-time PCR detection methods for another seven GM maize events (Bt11, Bt176, GA21, MON810, MON863, NK603, and T25) were systematically optimized and developed. In these PCR assays, the fluorescent quencher, TAMRA, was dyed on the T-base of the probe at the internal position to improve the intensity of the fluorescent signal. To overcome the difficulties in obtaining the certified reference materials of these GM maizes, one novel standard reference molecule containing all nine specific integration junction sequences of these GM maizes and the maize endogenous reference gene, zSSIIb, was constructed and used for quantitative analysis. The limits of detection of these methods were 20 copies for these different GM maizes, the limits of quantitation were about 20 copies, and the dynamic ranges for quantification were from 0.05 to 100% in 100 ng of DNA template. Furthermore, nine groups of the mixed maize samples of these nine GM maize events were quantitatively analyzed to evaluate the accuracy and precision. The accuracy expressed as bias varied from 0.67 to 28.00% for the nine tested groups of GM maize samples, and the precision expressed as relative standard deviations was from 0.83 to 26.20%. All of these indicated that the established event-specific real-time PCR detection systems and the reference molecule in this study are suitable for the identification and quantification of these GM

  7. Anticipating Words and Their Gender: An Event-related Brain Potential Study of Semantic Integration, Gender Expectancy, and Gender Agreement in Spanish Sentence Reading

    PubMed Central

    Wicha, Nicole Y. Y.; Moreno, Eva M.; Kutas, Marta

    2012-01-01

    Recent studies indicate that the human brain attends to and uses grammatical gender cues during sentence comprehension. Here, we examine the nature and time course of the effect of gender on word-by-word sentence reading. Event-related brain potentials were recorded to an article and noun, while native Spanish speakers read medium- to high-constraint Spanish sentences for comprehension. The noun either fit the sentence meaning or not, and matched the preceding article in gender or not; in addition, the preceding article was either expected or unexpected based on prior sentence context. Semantically anomalous nouns elicited an N400. Gender-disagreeing nouns elicited a posterior late positivity (P600), replicating previous findings for words. Gender agreement and semantic congruity interacted in both the N400 window—with a larger negativity frontally for double violations—and the P600 window—with a larger positivity for semantic anomalies, relative to the prestimulus baseline. Finally, unexpected articles elicited an enhanced positivity (500–700 msec post onset) relative to expected articles. Overall, our data indicate that readers anticipate and attend to the gender of both articles and nouns, and use gender in real time to maintain agreement and to build sentence meaning. PMID:15453979

  8. Integrated watershed modeling for simulation of radio-cesium migration after flood events in the catchment near the Fukushima Dai-ichi Nuclear Power Plant

    NASA Astrophysics Data System (ADS)

    Sakuma, K.; Kurikami, H.; Malins, A.; Yamada, S.; Funaki, H.; Niizato, T.; Machida, M.; Kitamura, A.

    2015-12-01

    The environments of Fukushima near the Fukushima Dai-ichi Nuclear Power Plant have been contaminated by the explosion accident of the plant caused by the Great East Japan Earthquake on 11 March 2011. The contamination level and air-dose rate behavior at present and in future are significant concern for the people used to live nearby. Most dominant radioactive material is 137Cs at present and its migration is considered to be driven by soil erosion and subsequent transport. To estimate the amount of soil sedimentation and the 137Cs migration, a three-dimensional hydrological model of the catchment was developed focused on the Ogi-no-sawa catchment, located 15 km southwest of the Fukushima Dai-ichi Nuclear Power Plant. Base on the developed hydrological model, top soil transport and resulting radio-cesium movement was simulated. For the modeling and simulation, physics based code the General-purpose terrestrial fluid-flow simulator GETFLOWS model, which is one of the tools for watershed modeling, was applied. The simulation results were compared with monitored data of the amount of water discharge and concentration of suspended solids for model testing. As a result of the study, the soil and 137Cs redistribution patterns at various scales of flood events could be predicted based on the results of modeling and simulation.

  9. A scale-space method for detecting recurrent DNA copy number changes with analytical false discovery rate control.

    PubMed

    van Dyk, Ewald; Reinders, Marcel J T; Wessels, Lodewyk F A

    2013-05-01

    Tumor formation is partially driven by DNA copy number changes, which are typically measured using array comparative genomic hybridization, SNP arrays and DNA sequencing platforms. Many techniques are available for detecting recurring aberrations across multiple tumor samples, including CMAR, STAC, GISTIC and KC-SMART. GISTIC is widely used and detects both broad and focal (potentially overlapping) recurring events. However, GISTIC performs false discovery rate control on probes instead of events. Here we propose Analytical Multi-scale Identification of Recurrent Events, a multi-scale Gaussian smoothing approach, for the detection of both broad and focal (potentially overlapping) recurring copy number alterations. Importantly, false discovery rate control is performed analytically (no need for permutations) on events rather than probes. The method does not require segmentation or calling on the input dataset and therefore reduces the potential loss of information due to discretization. An important characteristic of the approach is that the error rate is controlled across all scales and that the algorithm outputs a single profile of significant events selected from the appropriate scales. We perform extensive simulations and showcase its utility on a glioblastoma SNP array dataset. Importantly, ADMIRE detects focal events that are missed by GISTIC, including two events involving known glioma tumor-suppressor genes: CDKN2C and NF1.

  10. Mitochondrial DNA copy number in peripheral blood and melanoma risk.

    PubMed

    Shen, Jie; Gopalakrishnan, Vancheswaran; Lee, Jeffrey E; Fang, Shenying; Zhao, Hua

    2015-01-01

    Mitochondrial DNA (mtDNA) copy number in peripheral blood has been suggested as risk modifier in various types of cancer. However, its influence on melanoma risk is unclear. We evaluated the association between mtDNA copy number in peripheral blood and melanoma risk in 500 melanoma cases and 500 healthy controls from an ongoing melanoma study. The mtDNA copy number was measured using real-time polymerase chain reaction. Overall, mean mtDNA copy number was significantly higher in cases than in controls (1.15 vs 0.99, P<0.001). Increased mtDNA copy number was associated with a 1.45-fold increased risk of melanoma (95% confidence interval: 1.12-1.97). Significant joint effects between mtDNA copy number and variables related to pigmentation and history of sunlight exposure were observed. This study supports an association between increased mtDNA copy number and melanoma risk that is independent on the known melanoma risk factors (pigmentation and history of sunlight exposure).

  11. 22 CFR 92.79 - Procuring copies of foreign public documents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... foreign officials copies of birth, death, and marriage certificates, or copies of other public records... RELATED SERVICES Copying, Recording, Translating and Procuring Documents § 92.79 Procuring copies of... pay for copies of or extracts from foreign public records obtained at the request of private...

  12. Global copy number profiling of cancer genomes | Office of Cancer Genomics

    Cancer.gov

    In this article, we introduce a robust and efficient strategy for deriving global and allele-specific copy number alternations (CNA) from cancer whole exome sequencing data based on Log R ratios and B-allele frequencies. Applying the approach to the analysis of over 200 skin cancer samples, we demonstrate its utility for discovering distinct CNA events and for deriving ancillary information such as tumor purity. Availability and implementation: https://github.com/xfwang/CLOSE CONTACT: xuefeng.wang@stonybrook.edu or michael.krauthammer@yale.edu. (Publication Abstract)

  13. Copy number gain at Xp22.31 includes complex duplication rearrangements and recurrent triplications.

    PubMed

    Liu, Pengfei; Erez, Ayelet; Nagamani, Sandesh C Sreenath; Bi, Weimin; Carvalho, Claudia M B; Simmons, Alexandra D; Wiszniewska, Joanna; Fang, Ping; Eng, Patricia A; Cooper, M Lance; Sutton, V Reid; Roeder, Elizabeth R; Bodensteiner, John B; Delgado, Mauricio R; Prakash, Siddharth K; Belmont, John W; Stankiewicz, Pawel; Berg, Jonathan S; Shinawi, Marwan; Patel, Ankita; Cheung, Sau Wai; Lupski, James R

    2011-05-15

    Genomic instability is a feature of the human Xp22.31 region wherein deletions are associated with X-linked ichthyosis, mental retardation and attention deficit hyperactivity disorder. A putative homologous recombination hotspot motif is enriched in low copy repeats that mediate recurrent deletion at this locus. To date, few efforts have focused on copy number gain at Xp22.31. However, clinical testing revealed a high incidence of duplication of Xp22.31 in subjects ascertained and referred with neurobehavioral phenotypes. We systematically studied 61 unrelated subjects with rearrangements revealing gain in copy number, using multiple molecular assays. We detected not only the anticipated recurrent and simple nonrecurrent duplications, but also unexpectedly identified recurrent triplications and other complex rearrangements. Breakpoint analyses enabled us to surmise the mechanisms for many of these rearrangements. The clinical significance of the recurrent duplications and triplications were assessed using different approaches. We cannot find any evidence to support pathogenicity of the Xp22.31 duplication. However, our data suggest that the Xp22.31 duplication may serve as a risk factor for abnormal phenotypes. Our findings highlight the need for more robust Xp22.31 triplication detection in that such further gain may be more penetrant than the duplications. Our findings reveal the distribution of different mechanisms for genomic duplication rearrangements at a given locus, and provide insights into aspects of strand exchange events between paralogous sequences in the human genome.

  14. Thermochronological evolution of an intra-plate magmatic event inferred from an integrated modeling approach: A case study in the Westerwald, Germany

    NASA Astrophysics Data System (ADS)

    Tirone, M.; Rokitta, K.; Schreiber, U.

    2016-09-01

    A lava sample from the Tertiary Westerwald volcanic field was selected for a detailed study using various analytical techniques in combination with petrological, thermodynamic and diffusion modeling to extract information related to the thermochronological evolution of a magmatic event before eruption. The lava sample contains large olivine phenocrysts which are compositionally zoned and two coexisting but chemically distinct melts, a host melt with basaltic composition and small spherical pockets of a less abundant trachytic melt (globules). The sample was analyzed by electron microprobe, x-ray fluorescence (XRF) X-ray diffraction (XRD) and electron backscatter diffraction (EBSD). The primary melt of the host lava was determined using the program PRIMELT2.XLS. Partial fractional crystallization of olivine was modeled using the program alphaMELTS. Timescale and cooling rate were retrieved by fitting the measured Fe-Mg zoning along two directions in four olivine grains from the host lava using a 3-D numerical diffusion model. The measured variation of Ca is also consistent with a chemical diffusion process, while a numerical growth model applied to the same olivines does not appear to explain the Fe-Mg zoning. Chemical zoning of major elements in the melt globules were reproduced with a multicomponent diffusion model. The results of this study show that the host magma fractionated about 9% of olivine in a first stage, then the crystallization proceeded without further separation of mineral phases. Modeling of diffusion in the olivine crystals suggests that this second stage lasted at least 5 yrs and the temperature of the melt decreased from 1120-1150 °C to 1090 °C during this time. According to the results of the multicomponent diffusion model applied to the melt globules, the coexistence of the two melts was extremely short (less than few hours), possibly recording the assimilation of the globules during eruption or cooling of the whole system on the surface.

  15. Copy number gain of VCX, X-linked multi-copy gene, leads to cell proliferation and apoptosis during spermatogenesis

    PubMed Central

    Huang, Zhenyao; Zhang, Yan; Zhou, Ran; Song, Ling; Ling, Xiufeng; Hu, Zhibin; Miao, Dengshun; Shen, Hongbing; Xia, Yankai; Wang, Xinru; Lu, Chuncheng

    2016-01-01

    Male factor infertility affects one-sixth of couples worldwide, and non-obstructive azoospermia (NOA) is one of the most severe forms. In recent years there has been increasing evidence to implicate the participation of X chromosome in the process of spermatogenesis. To uncover the roles of X-linked multi-copy genes in spermatogenesis, we performed systematic analysis of X-linked gene copy number variations (CNVs) and Y chromosome haplogrouping in 447 idiopathic NOA patients and 485 healthy controls. Interestingly, the frequency of individuals with abnormal level copy of Variable charge, X-linked (VCX) was significantly different between cases and controls after multiple test correction (p = 5.10 × 10−5). To discriminate the effect of gain/loss copies in these genes, we analyzed the frequency of X-linked multi-copy genes in subjects among subdivided groups. Our results demonstrated that individuals with increased copy numbers of Nuclear RNA export factor 2 (NXF2) (p = 9.21 × 10−8) and VCX (p = 1.97 × 10−4) conferred the risk of NOA. In vitro analysis demonstrated that increasing copy number of VCX could upregulate the gene expression and regulate cell proliferation and apoptosis. Our study establishes a robust association between the VCX CNVs and NOA risk. PMID:27705943

  16. Molecular Characterization of Transgenic Events Using Next Generation Sequencing Approach

    PubMed Central

    Mammadov, Jafar; Ye, Liang; Soe, Khaing; Richey, Kimberly; Cruse, James; Zhuang, Meibao; Gao, Zhifang; Evans, Clive; Rounsley, Steve; Kumpatla, Siva P.

    2016-01-01

    Demand for the commercial use of genetically modified (GM) crops has been increasing in light of the projected growth of world population to nine billion by 2050. A prerequisite of paramount importance for regulatory submissions is the rigorous safety assessment of GM crops. One of the components of safety assessment is molecular characterization at DNA level which helps to determine the copy number, integrity and stability of a transgene; characterize the integration site within a host genome; and confirm the absence of vector DNA. Historically, molecular characterization has been carried out using Southern blot analysis coupled with Sanger sequencing. While this is a robust approach to characterize the transgenic crops, it is both time- and resource-consuming. The emergence of next-generation sequencing (NGS) technologies has provided highly sensitive and cost- and labor-effective alternative for molecular characterization compared to traditional Southern blot analysis. Herein, we have demonstrated the successful application of both whole genome sequencing and target capture sequencing approaches for the characterization of single and stacked transgenic events and compared the results and inferences with traditional method with respect to key criteria required for regulatory submissions. PMID:26908260

  17. Oculomotor learning revisited: a model of reinforcement learning in the basal ganglia incorporating an efference copy of motor actions

    PubMed Central

    Fee, Michale S.

    2012-01-01

    In its simplest formulation, reinforcement learning is based on the idea that if an action taken in a particular context is followed by a favorable outcome, then, in the same context, the tendency to produce that action should be strengthened, or reinforced. While reinforcement learning forms the basis of many current theories of basal ganglia (BG) function, these models do not incorporate distinct computational roles for signals that convey context, and those that convey what action an animal takes. Recent experiments in the songbird suggest that vocal-related BG circuitry receives two functionally distinct excitatory inputs. One input is from a cortical region that carries context information about the current “time” in the motor sequence. The other is an efference copy of motor commands from a separate cortical brain region that generates vocal variability during learning. Based on these findings, I propose here a general model of vertebrate BG function that combines context information with a distinct motor efference copy signal. The signals are integrated by a learning rule in which efference copy inputs gate the potentiation of context inputs (but not efference copy inputs) onto medium spiny neurons in response to a rewarded action. The hypothesis is described in terms of a circuit that implements the learning of visually guided saccades. The model makes testable predictions about the anatomical and functional properties of hypothesized context and efference copy inputs to the striatum from both thalamic and cortical sources. PMID:22754501

  18. Integrated Disease Investigations and Surveillance planning: a systems approach to strengthening national surveillance and detection of events of public health importance in support of the International Health Regulations.

    PubMed

    Taboy, Celine H; Chapman, Will; Albetkova, Adilya; Kennedy, Sarah; Rayfield, Mark A

    2010-12-03

    The international community continues to define common strategic themes of actions to improve global partnership and international collaborations in order to protect our populations. The International Health Regulations (IHR[2005]) offer one of these strategic themes whereby World Health Organization (WHO) Member States and global partners engaged in biosecurity, biosurveillance and public health can define commonalities and leverage their respective missions and resources to optimize interventions. The U.S. Defense Threat Reduction Agency's Cooperative Biological Engagement Program (CBEP) works with partner countries across clinical, veterinary, epidemiological, and laboratory communities to enhance national disease surveillance, detection, diagnostic, and reporting capabilities. CBEP, like many other capacity building programs, has wrestled with ways to improve partner country buy-in and ownership and to develop sustainable solutions that impact integrated disease surveillance outcomes. Designing successful implementation strategies represents a complex and challenging exercise and requires robust and transparent collaboration at the country level. To address this challenge, the Laboratory Systems Development Branch of the U.S. Centers for Disease Control and Prevention (CDC) and CBEP have partnered to create a set of tools that brings together key leadership of the surveillance system into a deliberate system design process. This process takes into account strengths and limitations of the existing system, how the components inter-connect and relate to one another, and how they can be systematically refined within the local context. The planning tools encourage cross-disciplinary thinking, critical evaluation and analysis of existing capabilities, and discussions across organizational and departmental lines toward a shared course of action and purpose. The underlying concepts and methodology of these tools are presented here.

  19. Lactobacillus brevis strain 1E1 administered to piglets through milk supplementation prior to weaning maintains intestinal integrity after the weaning event.

    PubMed

    Gebert, S; Davis, E; Rehberger, T; Maxwell, C V

    2011-03-01

    Early colonisation in the gastrointestinal tract by commensal microbes influences the progressive development and maturity of digestive and immune system functionality in the neonate. Application of strategically selected direct-fed microbials to neonatal pigs may provide an opportunity to dictate a portion of the intestinal microbial community and exert a beneficial influence on these developmental processes. Experiments were conducted to determine the effects of early administration of Lactobacillus brevis strain 1E1 to neonatal piglets (n=224) via a milk supplement system on gastrointestinal microbial counts, villous architecture, and immune cell phenotypes during the lactation phase and after weaning. Pigs administered the direct-fed microbial had lower Escherichia coli counts in the jejunum and ileum (P<0.05), and lower coliform counts in the jejunum compared to unsupplemented pigs (P<0.05). The villous height:crypt depth ratio was greater in the ileum at 9 days of age when pigs were provided L. brevis 1E1 compared to unsupplemented pigs (P<0.05), as well as in the duodenum of pigs supplemented with L. brevis 1E1 at 22 days of age (P<0.05). The number of leukocytes expressing CD2 (P<0.05), CD4 (P=0.07) and MHC-II (P=0.07) was lower in the jejunum of pigs administered L. brevis 1E1 compared to unsupplemented pigs, however direct-fed microbial treatment had no effect on the number of leukocytes expressing CD8, CD25 or SWC3. These data demonstrate that early colonisation of the porcine gastrointestinal tract with L. brevis strain 1E1 during the lactation phase influences the progression of intestinal structure, immune system development, and pathogen establishment, indicating a relationship between early microbial colonisation and development of intestinal maturity and integrity.

  20. Fluorescent in situ hybridization (FISH) assessment of chromosome copy number in sperm

    SciTech Connect

    Sheu, M.; Sigman, M.; Mark, H.F.L.

    1994-09-01

    Approximately 15% of all recognized pregnancies end in spontaneous abortions. The overall frequency of chromosome abnormalities in spontaneous abortions is approximately 50%. Thus aneuploidy is a significant cause of fetal wastage. In addition, structural and numerical abnormalities of chromosomes can also lead to birth defects, developmental delay, mental retardation and infertility. Conventional cytogenetic analysis via GTG- and other banding techniques is a powerful tool in the elucidation of the nature of chromosomal abnormalities. Fluorescent in situ hybridization (FISH) enables detection of numerical chromosomal abnormalities, especially trisomies, in intact cells. Using FISH and commercially available biotin-labeled probes, we have initiated a prospective study to assess specific chromosome copy number of preparations of unstained smears from men referred for a male infertility evaluation as well as smears from normal control males chosen randomly from the sample of sperm donors. A total of approximately 19,000 sperm nuclei have been examined thus far. Of those suitable for analysis, 7382 (38.75%) were normal possessing one copy of chromosome 8, 155 (0.81%) were disomic, and 15 (0.079%) had more than two copies of chromosome 8. Comparisons with data available in the literature will be discussed. Work is ongoing to increase the efficiency of hybridization using both reported and previously untried pretreatment and fixation protocols. We have also initiated studies using multicolor FISH with various chromosome enumeration probes. The assay described here is a potentially powerful tool for detecting rare events such as spontaneous germ cell aneuploidy, aneuploidy detected in semen from men with carcinoma in situ of the testis and aneuploidy induced by potential environmental genotoxicants. It can also be utilized for segregation analysis and for correlating chromosome copy number with germ cell morphology.

  1. IMP - INTEGRATED MISSION PROGRAM

    NASA Technical Reports Server (NTRS)

    Dauro, V. A.

    1994-01-01

    IMP is a simulation language that is used to model missions around the Earth, Moon, Mars, or other planets. It has been used to model missions for the Saturn Program, Apollo Program, Space Transportation System, Space Exploration Initiative, and Space Station Freedom. IMP allows a user to control the mission being simulated through a large event/maneuver menu. Up to three spacecraft may be used: a main, a target and an observer. The simulation may begin at liftoff, suborbital, or orbital. IMP incorporates a Fehlberg seventh order, thirteen evaluation Runge-Kutta integrator with error and step-size control to numerically integrate the equations of motion. The user may choose oblate or spherical gravity for the central body (Earth, Mars, Moon or other) while a spherical model is used for the gravity of an additional perturbing body. Sun gravity and pressure and Moon gravity effects are user-selectable. Earth/Mars atmospheric effects can be included. The optimum thrust guidance parameters are calculated automatically. Events/maneuvers may involve many velocity changes, and these velocity changes may be impulsive or of finite duration. Aerobraking to orbit is also an option. Other simulation options include line-of-sight communication guidelines, a choice of propulsion systems, a soft landing on the Earth or Mars, and rendezvous with a target vehicle. The input/output is in metric units, with the exception of thrust and weight which are in English units. Input is read from the user's input file to minimize real-time keyboard input. Output includes vehicle state, orbital and guide parameters, event and total velocity changes, and propellant usage. The main output is to the user defined print file, but during execution, part of the input/output is also displayed on the screen. An included FORTRAN program, TEKPLOT, will display plots on the VDT as well as generating a graphic file suitable for output on most laser printers. The code is double precision. IMP is written in

  2. Copy number variation and evolution in humans and chimpanzees

    PubMed Central

    Perry, George H.; Yang, Fengtang; Marques-Bonet, Tomas; Murphy, Carly; Fitzgerald, Tomas; Lee, Arthur S.; Hyland, Courtney; Stone, Anne C.; Hurles, Matthew E.; Tyler-Smith, Chris; Eichler, Evan E.; Carter, Nigel P.; Lee, Charles; Redon, Richard

    2008-01-01

    Copy number variants (CNVs) underlie many aspects of human phenotypic diversity and provide the raw material for gene duplication and gene family expansion. However, our understanding of their evolutionary significance remains limited. We performed comparative genomic hybridization on a single human microarray platform to identify CNVs among the genomes of 30 humans and 30 chimpanzees as well as fixed copy number differences between species. We found that human and chimpanzee CNVs occur in orthologous genomic regions far more often than expected by chance and are strongly associated with the presence of highly homologous intrachromosomal segmental duplications. By adapting population genetic analyses for use with copy number data, we identified functional categories of genes that have likely evolved under purifying or positive selection for copy number changes. In particular, duplications and deletions of genes with inflammatory response and cell proliferation functions may have been fixed by positive selection and involved in the adaptive phenotypic differentiation of humans and chimpanzees. PMID:18775914

  3. 5. Photographic copy of photograph (Source: Salt River Project Archives, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. Photographic copy of photograph (Source: Salt River Project Archives, Tempe, Lubken collection, #R-273) Transformer house under construction. View looking north. July 1, 1908. - Theodore Roosevelt Dam, Transformer House, Salt River, Tortilla Flat, Maricopa County, AZ

  4. 10. Photographic copy of drawing dated January 22, 1908 (Source: ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. Photographic copy of drawing dated January 22, 1908 (Source: Salt River Project) General plans, index to detail plans and sections, transformer house - Theodore Roosevelt Dam, Transformer House, Salt River, Tortilla Flat, Maricopa County, AZ

  5. 11. Photographic copy of drawing dated February 17, 1908 (Source: ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. Photographic copy of drawing dated February 17, 1908 (Source: Salt River Project) Transformer building, first floor plan and sections (Transformer floor) - Theodore Roosevelt Dam, Transformer House, Salt River, Tortilla Flat, Maricopa County, AZ

  6. 8. Photographic copy of photograph (Source: Salt River Project Archives, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    8. Photographic copy of photograph (Source: Salt River Project Archives, Tempe, Box 8040, File 29) View of transformer house looking north. No date. CA. 1920. - Theodore Roosevelt Dam, Transformer House, Salt River, Tortilla Flat, Maricopa County, AZ

  7. 6. Photographic copy of photograph (Source: Salt River Project Archives, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. Photographic copy of photograph (Source: Salt River Project Archives, Tempe, Lubken collection, #R-295) Transformer house under construction. View looking north. October 5, 1908. - Theodore Roosevelt Dam, Transformer House, Salt River, Tortilla Flat, Maricopa County, AZ

  8. 9. Photographic copy of drawing dated June 24, 1908 (Source: ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. Photographic copy of drawing dated June 24, 1908 (Source: Salt River Project) Transformer house, general drawing - Theodore Roosevelt Dam, Transformer House, Salt River, Tortilla Flat, Maricopa County, AZ

  9. 118. Photographic copy of historic photo, April 5, 1932 (original ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    118. Photographic copy of historic photo, April 5, 1932 (original print filed in Record Group 115, National Archives, Washington, D.C.). INVAR VOLUME METER, PANEL NO. 3, OWYHEE DAM. - Owyhee Dam, Across Owyhee River, Nyssa, Malheur County, OR

  10. 120. Photographic copy of historic photo, April 5, 1932 (original ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    120. Photographic copy of historic photo, April 5, 1932 (original print filed in Record Group 115, National Archives, Washington, D.C.). INVAR VOLUME METER IN PANEL NO. 3, OWYHEE DAM. - Owyhee Dam, Across Owyhee River, Nyssa, Malheur County, OR

  11. 119. Photographic copy of historic photo, April 5, 1932 (original ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    119. Photographic copy of historic photo, April 5, 1932 (original print filed in Record Group 115, National Archives, Washington, D.C.). INSTALLING INVAR METER IN PANEL NO. 4, OWYHEE DAM. - Owyhee Dam, Across Owyhee River, Nyssa, Malheur County, OR

  12. 21. Photographic copy of photograph, c. 1926 (print located at ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    21. Photographic copy of photograph, c. 1926 (print located at Lockmaster's House, Starved Rock Lock and Dam, near Utica, Illinois). EXCAVATION FOR LOCK. - Starved Rock Locks & Dam, Illinois Waterway River mile 231, Peru, La Salle County, IL

  13. 14. Photo copy of drawing, April 3, 1952, GREEN'S LEDGE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. Photo copy of drawing, April 3, 1952, GREEN'S LEDGE L/S MODERNIZATION. Drawing no. NY 1517, U.S. Coast Guard Civil Engineering Unit, Warwick, Rhode Island. - Green's Ledge Lighthouse, Long Island Sound, Norwalk, Fairfield County, CT

  14. 12. Photo copy of drawing, May 5, 1930. PENFIELD REEF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. Photo copy of drawing, May 5, 1930. PENFIELD REEF L/S MODERNIZATION. Drawing no. NY-1393, U.S. Coast GUard Civil Engineering Unit, Warwick, Rhode Island. - Penfield Reef Lighthouse, Long Island Sound, Bridgeport, Fairfield County, CT

  15. Intron analyses reveal multiple calmodulin copies in Littorina.

    PubMed

    Simpson, R J; Wilding, C S; Grahame, J

    2005-04-01

    Intron 3 and the flanking exons of the calmodulin gene have been amplified, cloned, and sequenced from 18 members of the gastropod genus Littorina. From the 48 sequences, at least five different gene copies have been identified and their functionality characterized using a strategy based upon the potential protein product predicted from flanking exon data. The functionality analyses suggest that four of the genes code for functional copies of calmodulin. All five copies have been identified across a wide range of littorinid species although not ubiquitously. Using this novel approach based on intron sequences, we have identified an unprecedented number of potential calmodulin copies in Littorina, exceeding that reported for any other invertebrate. This suggests a higher number of, and more ancient, gene duplications than previously detected in a single genus.

  16. 3. COPY OF A PHOTOGRAPH OF THE CATARACT MILLS, NEWBURGH, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. COPY OF A PHOTOGRAPH OF THE CATARACT MILLS, NEWBURGH, OHIO. Date unknown. Photographer: Berni Rich, Score Photographers, September 1986 - Alexander's Grist Mill, Lock 37 on Ohio & Erie Canal, South of Cleveland, Valley View, Cuyahoga County, OH

  17. Photographic copy of reproduced photograph dated 1942. Exterior view, west ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of reproduced photograph dated 1942. Exterior view, west elevation. Building camouflaged during World War II. - Grand Central Air Terminal, 1310 Air Way, Glendale, Los Angeles County, CA

  18. PHOTOGRAPHIC COPY OF PHOTOGRAPH (FROM GIFFORD PINCHOT NATIONAL FOREST COLLECTION, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    PHOTOGRAPHIC COPY OF PHOTOGRAPH (FROM GIFFORD PINCHOT NATIONAL FOREST COLLECTION, COPYRIGHT COLUMBIA NATIONAL FOREST. PHOTOGRAPHER UNKNOWN, DECEMBER 13, 1935. TROUT CREEK DAM FISHWAY UNDER CONSTRUCTION - Trout Creek Dam, River Mile 1.8 on Trout Creek, Carson, Skamania County, WA

  19. 1. Historic American Buildings Survey Copied by Alex Bush, Photographer, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. Historic American Buildings Survey Copied by Alex Bush, Photographer, March 15, 1935 OLD COLLEGE PAMPHLET. NOT COPYRIGHTED. FRONT AND SIDE VIEW S.E. (BEFORE ALTERATION). - Marion Female Seminary, Monroe & Centreville Streets, Marion, Perry County, AL

  20. 3. Historic American Buildings Survey (Copy) Nathaniel R. Ewan, Photographer ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. Historic American Buildings Survey (Copy) Nathaniel R. Ewan, Photographer November 15, 1937 INTERIOR - STRONG BOX From anniversary booklet printed by Farmers Trust Co. - not copyrighted. - Farmer's Trust Company Bank Building, 21 Mill Street, Mount Holly, Burlington County, NJ

  1. 1. Historic American Buildings Survey COPIED E. W. Russell, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. Historic American Buildings Survey COPIED - E. W. Russell, Photographer, August 31, 1936 75TH ANNIVERSARY YEARBOOK (NOT COPYRIGHT) - VIEW OF ORIGINAL BUILDING - Spring Hill College, Original Building, Old Shell Road, Spring Hill, Mobile County, AL

  2. 3. Historic American Buildings Survey, Copied by Survey Photographer. Taken ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    3. Historic American Buildings Survey, Copied by Survey Photographer. Taken before 1868. (f) Ext- Old Photo-- General view from N.W. - India Wharf Stores, 306-308 Atlantic Avenue, Boston, Suffolk County, MA

  3. 1. Historic American Buildings Survey Copied by Survey, Photographer, Old ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. Historic American Buildings Survey Copied by Survey, Photographer, Old Photo before 1880 (a) Ext-General view from Southwest. - Governor Thomas Prence House, King's Highway (U.S. Route 6), Eastham, Barnstable County, MA

  4. 2. Historic American Buildings Survey, Copied by Survey Photographer (e) ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. Historic American Buildings Survey, Copied by Survey Photographer (e) Ext-Old Photograph- Gen View North and East Elevations, (before 1868) - India Wharf Stores, 306-308 Atlantic Avenue, Boston, Suffolk County, MA

  5. Hotspots for copy number variation in chimpanzees and humans

    PubMed Central

    Perry, George H.; Tchinda, Joelle; McGrath, Sean D.; Zhang, Junjun; Picker, Simon R.; Cáceres, Angela M.; Iafrate, A. John; Tyler-Smith, Chris; Scherer, Stephen W.; Eichler, Evan E.; Stone, Anne C.; Lee, Charles

    2006-01-01

    Copy number variation is surprisingly common among humans and can be involved in phenotypic diversity and variable susceptibility to complex diseases, but little is known of the extent of copy number variation in nonhuman primates. We have used two array-based comparative genomic hybridization platforms to identify a total of 355 copy number variants (CNVs) in the genomes of 20 wild-born chimpanzees (Pan troglodytes) and have compared the identified chimpanzee CNVs to known human CNVs from previous studies. Many CNVs were observed in the corresponding regions in both chimpanzees and humans; especially those CNVs of higher frequency. Strikingly, these loci are enriched 20-fold for ancestral segmental duplications, which may facilitate CNV formation through nonallelic homologous recombination mechanisms. Therefore, some of these regions may be unstable “hotspots” for the genesis of copy number variation, with recurrent duplications and deletions occurring across and within species. PMID:16702545

  6. 11. Photographic copy of construction drawing, dated May 10, 1922, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. Photographic copy of construction drawing, dated May 10, 1922, in possession of SCIP, Coolidge, AZ. GENERAL PLAN - San Carlos Irrigation Project, Ashurst-Hayden Dam, Gila River, T4S R11E S7, Coolidge, Pinal County, AZ

  7. 17. Photographic copy of construction drawing, dated June, 1921, in ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. Photographic copy of construction drawing, dated June, 1921, in possession of SCIP, Coolidge, AZ. REGULATOR GATE ASSEMBLY - San Carlos Irrigation Project, Ashurst-Hayden Dam, Gila River, T4S R11E S7, Coolidge, Pinal County, AZ

  8. 140. Photograph of a copy of the original shop drawing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    140. Photograph of a copy of the original shop drawing for the lumber ports added in 1899. Original located at San Francisco Maritime National Historical Park. - Ship BALCLUTHA, 2905 Hyde Street Pier, San Francisco, San Francisco County, CA

  9. 33. Historic American Buildings Survey COPY OF PRELIMINARY STUDY FOR ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    33. Historic American Buildings Survey COPY OF PRELIMINARY STUDY FOR HEALY BUILDING, c. 1876 (COURTESY OF THE COMMISSION OF FINE ARTS) - Georgetown University, Healy Building, Thirty-seventh & O Streets, Northwest, Washington, District of Columbia, DC

  10. 13. Photographic copy of photograph (March 23, 1909, original print ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. Photographic copy of photograph (March 23, 1909, original print in possession of Montana Power Company, Butte, Montana). 'DRIVING THE LAST #85 RAIL' - Milltown Dam, Clark Fork River, 6 miles upstream from Missoula, Milltown, Missoula County, MT

  11. 19. COPY OF ENGRAVING OF 'WROUGHT IRON ARCH TRUSS BRIDGE,' ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    19. COPY OF ENGRAVING OF 'WROUGHT IRON ARCH TRUSS BRIDGE,' PAT. DEC. 10, 1867 BY OHIO BRIDGE COMPANY, CLEVELAND, OHIO. (COURTESY OF OHIO HISTORICAL SOCIETY ARCHIVES, COLUMBUS, OHIO) - Tioronda Bridge, South Avenue spanning Fishkill Creek, Beacon, Dutchess County, NY

  12. Photographic copy of photograph (original print in possession of William ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of photograph (original print in possession of William Langer Jewel Bearing Plant, Rolla, North Dakota). PASTING JEWEL BLANKS, PREPARATION FOR DRILLING. - Turtle Mountain Ordnance Plant, 213 First Street Northwest, Rolla, Rolette County, ND

  13. Photographic copy of photograph (original print in possession of William ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of photograph (original print in possession of William Langer Jewel Bearing Plant, Rolla, North Dakota). FINAL INSPECTION - Turtle Mountain Ordnance Plant, 213 First Street Northwest, Rolla, Rolette County, ND

  14. Photographic copy of photograph (original print in possession of William ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of photograph (original print in possession of William Langer Jewel Bearing Plant, Rolla, North Dakota). OLIVING - Turtle Mountain Ordnance Plant, 213 First Street Northwest, Rolla, Rolette County, ND

  15. Photographic copy of photograph (original print in possession of William ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of photograph (original print in possession of William Langer Jewel Bearing Plant, Rolla, North Dakota). DRILLING - Turtle Mountain Ordnance Plant, 213 First Street Northwest, Rolla, Rolette County, ND

  16. Photographic copy of photograph (original print in possession of William ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of photograph (original print in possession of William Langer Jewel Bearing Plant, Rolla, North Dakota). MACHINE SHOP - Turtle Mountain Ordnance Plant, 213 First Street Northwest, Rolla, Rolette County, ND

  17. Photographic copy of photograph (original print in possession of William ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photographic copy of photograph (original print in possession of William Langer Jewel Bearing Plant, Rolla, North Dakota). LARGE HOLE-OPENING - Turtle Mountain Ordnance Plant, 213 First Street Northwest, Rolla, Rolette County, ND

  18. Remote hard copy. Volume 3. Systems programming manual

    SciTech Connect

    Simons, R.W.

    1980-03-01

    The software used to operate and maintain the remote hard copy is described. All operating software that runs in the NOVA minicomputers is covered as are various utility and diagnostic programs used for creating and checking this software. 2 figures.

  19. 9. Historic American Buildings Survey Copy of c. 1894 Photograph ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. Historic American Buildings Survey Copy of c. 1894 Photograph of Excavation (from Private Collection of Leroy O. King, Georgetown) - Capital Traction Company Union Station, 3600 M Street Northwest, Washington, District of Columbia, DC

  20. 10. Historic American Buildings Survey Copy of c. 1894 Photograph ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. Historic American Buildings Survey Copy of c. 1894 Photograph of Excavation (from Private Collection of Leroy O. King, Georgetown) - Capital Traction Company Union Station, 3600 M Street Northwest, Washington, District of Columbia, DC