Science.gov

Sample records for copy integration events

  1. Integrated Reproduction of Human Motion Components by Motion Copying System

    NASA Astrophysics Data System (ADS)

    Tsunashima, Noboru; Katsura, Seiichiro

    Currently, the development of leading-edge technology for recording and loading human motion on the basis of haptic information is required in the field of manufacturing and human support. Human movement is an assembly of motion components. Since human movements should be supported by a robot in real time, it is necessary to integrate the morion components, which were saved earlier. Once such motion integration is realized, future technology for use in daily human life is developed. This paper proposes the integrated reproduction of the decomposed components of human motion by using a motion copying system. This system is the key technology for the realization of the acquisition, saving and reproduction of the real-world haptic information. By the proposed method, it is possible not only to achieve expert skill acquisition, skill transfer to robots, and power assist for each motion component but also to open up new areas of applications.

  2. Strategies to improve low copy transgenic events in Agrobacterium-mediated transformation of maize.

    PubMed

    Sivamani, Elumalai; Li, Xianggan; Nalapalli, Samson; Barron, Yoshimi; Prairie, Anna; Bradley, David; Doyle, Michele; Que, Qiudeng

    2015-12-01

    Transgenic plants containing low copy transgene insertion free of vector backbone are highly desired for many biotechnological applications. We have investigated two different strategies for increasing the percentage of low copy events in Agrobacterium-mediated transformation experiments in maize. One of the strategies is to use a binary vector with two separate T-DNAs, one T-DNA containing an intact E.coli manA gene encoding phosphomannose isomerase (PMI) as selectable marker gene cassette and another T-DNA containing an RNAi cassette of PMI sequences. By using this strategy, low copy transgenic events containing the transgenes were increased from 43 to 60 % in maize. An alternate strategy is using selectable marker gene cassettes containing regulatory or coding sequences derived from essential plant genes such as 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) or MADS box transcription factor. In this paper we demonstrate that higher percentage of low copy transgenic events can be obtained in Agrobacterium-mediated maize transformation experiments using both strategies. We propose that the above two strategies can be used independently or in combination to increase transgenic events that contain low copy transgene insertion in Agrobacterium-mediated transformation experiments.

  3. Three Course Connections: Integrated Event Design

    ERIC Educational Resources Information Center

    Johnson, Corey W.; Pate, Joseph A.

    2013-01-01

    Integrated Event Design (IED) capitalizes on three distinct courses to achieve a blended course delivery: Event Management, Research and Evaluation (for undergraduate students), and Experiential Education (for graduate students). Through the use of an event management company metaphor that fully integrates the diverse curricular concepts, course…

  4. Three Course Connections: Integrated Event Design

    ERIC Educational Resources Information Center

    Johnson, Corey W.; Pate, Joseph A.

    2013-01-01

    Integrated Event Design (IED) capitalizes on three distinct courses to achieve a blended course delivery: Event Management, Research and Evaluation (for undergraduate students), and Experiential Education (for graduate students). Through the use of an event management company metaphor that fully integrates the diverse curricular concepts, course…

  5. Integrating Events Across Levels of Consciousness

    PubMed Central

    Henke, Katharina; Reber, Thomas P.; Duss, Simone B.

    2013-01-01

    Our knowledge grows as we integrate events experienced at different points in time. We may or may not become aware of events, their integration, and their impact on our knowledge and decisions. But can we mentally integrate two events, if they are experienced at different time points and at different levels of consciousness? In this study, an event consisted of the presentation of two unrelated words. In the stream of events, half of events shared one component (“tree desk” … “desk fish”) to facilitate event integration. We manipulated the amount of time and trials that separated two corresponding events. The contents of one event were presented subliminally (invisible) and the contents of the corresponding overlapping event supraliminally (visible). Hence, event integration required the binding of contents between consciousness levels and between time points. At the final test of integration, participants judged whether two supraliminal test words (“tree fish”) fit together semantically or not. Unbeknown to participants, half of test words were episodically related through an overlap (“desk”; experimental condition) and half were not (control condition). Participants judged episodically related test words to be closer semantically than unrelated test words. This subjective decrease in the semantic distance between test words was both independent of whether the invisible event was encoded first or second in order and independent of the number of trials and the time that separated two corresponding events. Hence, conscious and unconscious memories were mentally integrated into a linked mnemonic representation. PMID:23785318

  6. Integrative genome-wide analysis reveals a robust genomic glioblastoma signature associated with copy number driving changes in gene expression.

    PubMed

    de Tayrac, Marie; Etcheverry, Amandine; Aubry, Marc; Saïkali, Stephan; Hamlat, Abderrahmane; Quillien, Veronique; Le Treut, André; Galibert, Marie-Dominique; Mosser, Jean

    2009-01-01

    Glioblastoma multiforme shows multiple chromosomal aberrations, the impact of which on gene expression remains unclear. To investigate this relationship and to identify putative initiating genomic events, we integrated a paired copy number and gene expression survey in glioblastoma using whole human genome arrays. Loci of recurrent copy number alterations were combined with gene expression profiles obtained on the same tumor samples. We identified a set of 406 "cis-acting DNA targeted genes" corresponding to genomic aberrations with direct copy-number-driving changes in gene expression, defined as genes with either significantly concordant or correlated changes in DNA copy number and expression. Functional annotation revealed that these genes participate in key processes of cancer cell biology, providing insights into the genetic mechanisms driving glioblastoma. The robustness of the gene selection was validated on an external microarray data set including 81 glioblastomas and 23 non-neoplastic brain samples. The integration of array CGH and gene expression data highlights a robust cis-acting DNA targeted genes signature that may be critical for glioblastoma progression, with two tumor suppressor genes PCDH9 and STARD13 that could be involved in tumor invasiveness and resistance to etoposide.

  7. Copy number gains in EGFR and copy number losses in PTEN are common events in osteosarcoma tumors.

    PubMed

    Freeman, Serena S; Allen, Steven W; Ganti, Ramapriya; Wu, Jianrong; Ma, Jing; Su, Xiaoping; Neale, Geoff; Dome, Jeffrey S; Daw, Najat C; Khoury, Joseph D

    2008-09-15

    Osteosarcoma cell lines and tumors have been shown to express epidermal growth factor receptor (EGFR) and harbor amplifications at the EGFR locus. In this study, the authors further analyzed the genomic features of EGFR in osteosarcoma tumors and investigated whether they correlate with phosphatase and tensin homolog (PTEN) expression and copy number status. EGFR and PTEN expression was assessed by immunohistochemistry (n = 28), and copy number alterations at the EGFR and PTEN loci were surveyed using Affymetrix (Santa Clara, Calif) 50K single nucleotide polymorphism (SNP) arrays (n = 31) and fluorescence in situ hybridization (FISH) (n = 27). The EGFR tyrosine kinase domain was sequenced to survey for activating mutations (n = 34). In addition, EGFRvIII expression was assessed using reverse transcriptase polymerase chain reaction (n = 24). Results were correlated with available clinical information on 59 patients, with a median age of 14.1 years (range, 5-23 years) and median follow-up of 4.4 years. EGFR expression was detected in the majority of osteosarcoma tumors surveyed (23 of 28; 82%). SNP arrays revealed evidence of frequent copy number gains at 7p11.2 and losses at 10q23.21. A sizeable subset (16 of 27 cases; 59%) showed gains at the EGFR locus using FISH (amplification in 4 of 27 [15%] and balanced chromosome 7 polysomy in 12 of 27 [44%]), and 12 cases showed deletions at the PTEN locus (biallelic deletions in 4 of 27 [15%] and monoallelic deletion in 9 of 27 [33%]). No activating mutations in the EGFR tyrosine kinase domain, EGFRvIII expression, or association with clinical findings were detected. EGFR expression and genomic gains at the EGFR locus are prevalent in osteosarcoma tumors, which also commonly harbor deletions at the PTEN locus. (c) 2008 American Cancer Society.

  8. Adaptive Control of Event Integration

    ERIC Educational Resources Information Center

    Akyurek, Elkan G.; Toffanin, Paolo; Hommel, Bernhard

    2008-01-01

    Identifying 2 target stimuli in a rapid stream of visual symbols is much easier if the 2nd target appears immediately after the 1st target (i.e., at Lag 1) than if distractor stimuli intervene. As this phenomenon comes with a strong tendency to confuse the order of the targets, it seems to be due to the integration of both targets into the same…

  9. Adaptive Control of Event Integration

    ERIC Educational Resources Information Center

    Akyurek, Elkan G.; Toffanin, Paolo; Hommel, Bernhard

    2008-01-01

    Identifying 2 target stimuli in a rapid stream of visual symbols is much easier if the 2nd target appears immediately after the 1st target (i.e., at Lag 1) than if distractor stimuli intervene. As this phenomenon comes with a strong tendency to confuse the order of the targets, it seems to be due to the integration of both targets into the same…

  10. Identification of candidate growth promoting genes in ovarian cancer through integrated copy number and expression analysis.

    PubMed

    Ramakrishna, Manasa; Williams, Louise H; Boyle, Samantha E; Bearfoot, Jennifer L; Sridhar, Anita; Speed, Terence P; Gorringe, Kylie L; Campbell, Ian G

    2010-04-08

    Ovarian cancer is a disease characterised by complex genomic rearrangements but the majority of the genes that are the target of these alterations remain unidentified. Cataloguing these target genes will provide useful insights into the disease etiology and may provide an opportunity to develop novel diagnostic and therapeutic interventions. High resolution genome wide copy number and matching expression data from 68 primary epithelial ovarian carcinomas of various histotypes was integrated to identify genes in regions of most frequent amplification with the strongest correlation with expression and copy number. Regions on chromosomes 3, 7, 8, and 20 were most frequently increased in copy number (> 40% of samples). Within these regions, 703/1370 (51%) unique gene expression probesets were differentially expressed when samples with gain were compared to samples without gain. 30% of these differentially expressed probesets also showed a strong positive correlation (r > or =0.6) between expression and copy number. We also identified 21 regions of high amplitude copy number gain, in which 32 known protein coding genes showed a strong positive correlation between expression and copy number. Overall, our data validates previously known ovarian cancer genes, such as ERBB2, and also identified novel potential drivers such as MYNN, PUF60 and TPX2.

  11. Identification of Candidate Growth Promoting Genes in Ovarian Cancer through Integrated Copy Number and Expression Analysis

    PubMed Central

    Ramakrishna, Manasa; Williams, Louise H.; Boyle, Samantha E.; Bearfoot, Jennifer L.; Sridhar, Anita; Speed, Terence P.; Gorringe, Kylie L.; Campbell, Ian G.

    2010-01-01

    Ovarian cancer is a disease characterised by complex genomic rearrangements but the majority of the genes that are the target of these alterations remain unidentified. Cataloguing these target genes will provide useful insights into the disease etiology and may provide an opportunity to develop novel diagnostic and therapeutic interventions. High resolution genome wide copy number and matching expression data from 68 primary epithelial ovarian carcinomas of various histotypes was integrated to identify genes in regions of most frequent amplification with the strongest correlation with expression and copy number. Regions on chromosomes 3, 7, 8, and 20 were most frequently increased in copy number (>40% of samples). Within these regions, 703/1370 (51%) unique gene expression probesets were differentially expressed when samples with gain were compared to samples without gain. 30% of these differentially expressed probesets also showed a strong positive correlation (r≥0.6) between expression and copy number. We also identified 21 regions of high amplitude copy number gain, in which 32 known protein coding genes showed a strong positive correlation between expression and copy number. Overall, our data validates previously known ovarian cancer genes, such as ERBB2, and also identified novel potential drivers such as MYNN, PUF60 and TPX2. PMID:20386695

  12. TAGCNA: A Method to Identify Significant Consensus Events of Copy Number Alterations in Cancer

    PubMed Central

    Yuan, Xiguo; Zhang, Junying; Yang, Liying; Zhang, Shengli; Chen, Baodi; Geng, Yaojun; Wang, Yue

    2012-01-01

    Somatic copy number alteration (CNA) is a common phenomenon in cancer genome. Distinguishing significant consensus events (SCEs) from random background CNAs in a set of subjects has been proven to be a valuable tool to study cancer. In order to identify SCEs with an acceptable type I error rate, better computational approaches should be developed based on reasonable statistics and null distributions. In this article, we propose a new approach named TAGCNA for identifying SCEs in somatic CNAs that may encompass cancer driver genes. TAGCNA employs a peel-off permutation scheme to generate a reasonable null distribution based on a prior step of selecting tag CNA markers from the genome being considered. We demonstrate the statistical power of TAGCNA on simulated ground truth data, and validate its applicability using two publicly available cancer datasets: lung and prostate adenocarcinoma. TAGCNA identifies SCEs that are known to be involved with proto-oncogenes (e.g. EGFR, CDK4) and tumor suppressor genes (e.g. CDKN2A, CDKN2B), and provides many additional SCEs with potential biological relevance in these data. TAGCNA can be used to analyze the significance of CNAs in various cancers. It is implemented in R and is freely available at http://tagcna.sourceforge.net/. PMID:22815924

  13. Temporal Proximity Promotes Integration of Overlapping Events.

    PubMed

    Zeithamova, Dagmar; Preston, Alison R

    2017-03-02

    Events with overlapping elements can be encoded as two separate representations or linked into an integrated representation; yet, we know little about the conditions that promote one form of representation over the other. Here, we tested the hypothesis that the proximity of overlapping events would increase the probability of integration. Participants first established memories for house-object and face-object pairs; half of the pairs were learned 24 hr before a fMRI session, and the other half 30 min before the session. During scanning, participants encoded object-object pairs that overlapped with the initial pairs acquired on the same or prior day. Participants were also scanned as they made inference judgments about the relationships among overlapping pairs learned on the same or different day. Participants were more accurate and faster when inferring relationships among memories learned on the same day relative to those acquired across days, suggesting that temporal proximity promotes integration. Evidence for reactivation of existing memories-as measured by a visual content classifier-was equivalent during encoding of overlapping pairs from the two temporal conditions. In contrast, evidence for integration-as measured by a mnemonic strategy classifier from an independent study [Richter, F. R., Chanales, A. J. H., & Kuhl, B. A. Predicting the integration of overlapping memories by decoding mnemonic processing states during learning. Neuroimage, 124, 323-335, 2016]-was greater for same-day overlapping events, paralleling the behavioral results. During inference itself, activation patterns further differentiated when participants were making inferences about events acquired on the same day versus across days. These findings indicate that temporal proximity of events promotes integration and further influences the neural mechanisms engaged during inference.

  14. A rapid and reliable strategy for chromosomal integration of gene(s) with multiple copies

    PubMed Central

    Gu, Pengfei; Yang, Fan; Su, Tianyuan; Wang, Qian; Liang, Quanfeng; Qi, Qingsheng

    2015-01-01

    Direct optimization of the metabolic pathways on the chromosome requires tools that can fine tune the overexpression of a desired gene or optimize the combination of multiple genes. Although plasmid-dependent overexpression has been used for this task, fundamental issues concerning its genetic stability and operational repeatability have not been addressed. Here, we describe a rapid and reliable strategy for chromosomal integration of gene(s) with multiple copies (CIGMC), which uses the flippase from the yeast 2-μm plasmid. Using green fluorescence protein as a model, we verified that the fluorescent intensity was in accordance with the integration copy number of the target gene. When a narrow-host-range replicon, R6K, was used in the integrative plasmid, the maximum integrated copy number of Escherichia coli reached 15. Applying the CIGMC method to optimize the overexpression of single or multiple genes in amino acid biosynthesis, we successfully improved the product yield and stability of the production. As a flexible strategy, CIGMC can be used in various microorganisms other than E. coli. PMID:25851494

  15. Integrity Verification for Multiple Data Copies in Cloud Storage Based on Spatiotemporal Chaos

    NASA Astrophysics Data System (ADS)

    Long, Min; Li, You; Peng, Fei

    Aiming to strike for a balance between the security, efficiency and availability of the data verification in cloud storage, a novel integrity verification scheme based on spatiotemporal chaos is proposed for multiple data copies. Spatiotemporal chaos is implemented for node calculation of the binary tree, and the location of the data in the cloud is verified. Meanwhile, dynamic operation can be made to the data. Furthermore, blind information is used to prevent a third-party auditor (TPA) leakage of the users’ data privacy in a public auditing process. Performance analysis and discussion indicate that it is secure and efficient, and it supports dynamic operation and the integrity verification of multiple copies of data. It has a great potential to be implemented in cloud storage services.

  16. Genomic landscape of copy number variation and copy neutral loss of heterozygosity events in equine sarcoids reveals increased instability of the sarcoid genome.

    PubMed

    Pawlina-Tyszko, Klaudia; Gurgul, Artur; Szmatoła, Tomasz; Ropka-Molik, Katarzyna; Semik-Gurgul, Ewelina; Klukowska-Rötzler, Jolanta; Koch, Christoph; Mählmann, Kathrin; Bugno-Poniewierska, Monika

    2017-09-01

    Although they are the most common neoplasms in equids, sarcoids are not fully characterized at the molecular level. Therefore, the objective of this study was to characterize the landscape of structural rearrangements, such as copy number variation (CNV) and copy neutral loss of heterozygosity (cnLOH), in the genomes of sarcoid tumor cells. This information will not only broaden our understanding of the characteristics of this genome but will also improve the general knowledge of this tumor and the mechanisms involved in its generation. To this end, Equine SNP64K Illumina microarrays were applied along with bioinformatics tools dedicated for signal intensity analysis. The analysis revealed increased instability of the genome of sarcoid cells compared with unaltered skin tissue samples, which was manifested by the prevalence of CNV and cnLOH events. Many of the identified CNVs overlapped with the other research results, but the simultaneously observed variability in the number and sizes of detected aberrations indicated a need for further studies and the development of more reliable bioinformatics algorithms. The functional analysis of genes co-localized with the identified aberrations revealed that these genes are engaged in vital cellular processes. In addition, a number of these genes directly contribute to neoplastic transformation. Furthermore, large numbers of cnLOH events identified in the sarcoids suggested that they may play no less significant roles than CNVs in the carcinogenesis of this tumor. Thus, our results indicate the importance of cnLOH and CNV in equine sarcoid oncogenesis and present a direction of future research. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  17. Integrative Analysis of Transcriptional Regulatory Network and Copy Number Variation in Intrahepatic Cholangiocarcinoma

    PubMed Central

    Li, Ling; Lian, Baofeng; Li, Chao; Li, Wei; Li, Jing; Zhang, Yuannv; He, Xianghuo; Li, Yixue; Xie, Lu

    2014-01-01

    Background Transcriptional regulatory network (TRN) is used to study conditional regulatory relationships between transcriptional factors and genes. However few studies have tried to integrate genomic variation information such as copy number variation (CNV) with TRN to find causal disturbances in a network. Intrahepatic cholangiocarcinoma (ICC) is the second most common hepatic carcinoma with high malignancy and poor prognosis. Research about ICC is relatively limited comparing to hepatocellular carcinoma, and there are no approved gene therapeutic targets yet. Method We first constructed TRN of ICC (ICC-TRN) using forward-and-reverse combined engineering method, and then integrated copy number variation information with ICC-TRN to select CNV-related modules and constructed CNV-ICC-TRN. We also integrated CNV-ICC-TRN with KEGG signaling pathways to investigate how CNV genes disturb signaling pathways. At last, unsupervised clustering method was applied to classify samples into distinct classes. Result We obtained CNV-ICC-TRN containing 33 modules which were enriched in ICC-related signaling pathways. Integrated analysis of the regulatory network and signaling pathways illustrated that CNV might interrupt signaling through locating on either genomic sites of nodes or regulators of nodes in a signaling pathway. In the end, expression profiles of nodes in CNV-ICC-TRN were used to cluster the ICC patients into two robust groups with distinct biological function features. Conclusion Our work represents a primary effort to construct TRN in ICC, also a primary effort to try to identify key transcriptional modules based on their involvement of genetic variations shown by gene copy number variations (CNV). This kind of approach may bring the traditional studies of TRN based only on expression data one step further to genetic disturbance. Such kind of approach can easily be extended to other disease samples with appropriate data. PMID:24897108

  18. Integrated Historical Tsunami Event and Deposit Database

    NASA Astrophysics Data System (ADS)

    Dunbar, P. K.; McCullough, H. L.

    2010-12-01

    The National Geophysical Data Center (NGDC) provides integrated access to historical tsunami event, deposit, and proxy data. The NGDC tsunami archive initially listed tsunami sources and locations with observed tsunami effects. Tsunami frequency and intensity are important for understanding tsunami hazards. Unfortunately, tsunami recurrence intervals often exceed the historic record. As a result, NGDC expanded the archive to include the Global Tsunami Deposits Database (GTD_DB). Tsunami deposits are the physical evidence left behind when a tsunami impacts a shoreline or affects submarine sediments. Proxies include co-seismic subsidence, turbidite deposits, changes in biota following an influx of marine water in a freshwater environment, etc. By adding past tsunami data inferred from the geologic record, the GTD_DB extends the record of tsunamis backward in time. Although the best methods for identifying tsunami deposits and proxies in the geologic record remain under discussion, developing an overall picture of where tsunamis have affected coasts, calculating recurrence intervals, and approximating runup height and inundation distance provides a better estimate of a region’s true tsunami hazard. Tsunami deposit and proxy descriptions in the GTD_DB were compiled from published data found in journal articles, conference proceedings, theses, books, conference abstracts, posters, web sites, etc. The database now includes over 1,200 descriptions compiled from over 1,100 citations. Each record in the GTD_DB is linked to its bibliographic citation where more information on the deposit can be found. The GTD_DB includes data for over 50 variables such as: event description (e.g., 2010 Chile Tsunami), geologic time period, year, deposit location name, latitude, longitude, country, associated body of water, setting during the event (e.g., beach, lake, river, deep sea), upper and lower contacts, underlying and overlying material, etc. If known, the tsunami source mechanism

  19. Construction of plasmids with tunable copy numbers in Saccharomyces cerevisiae and their applications in pathway optimization and multiplex genome integration.

    PubMed

    Lian, Jiazhang; Jin, Run; Zhao, Huimin

    2016-11-01

    The CEN/ARS-based low-copy plasmids and 2 μ-based high-copy plasmids have been broadly used for both fundamental studies and practical applications in Saccharomyces cerevisiae. However, the relative low copy numbers and narrow dynamic range limit their applications in many cases. In this study, the expression level of the selection marker proteins was engineered to increase the plasmid copy numbers. A series of plasmids with step-wise increased copy numbers were constructed. The copy number of the plasmids with engineered dominant markers (5-100 copies per cell) showed a positive correlation with the concentration of antibiotics supplemented to the growth media. Based on this finding, we developed a simple yet highly efficient strategy, named Pathway Optimization by Tuning Antibiotic Concentrations (POTAC) to rapidly balance the flux of multi-gene pathways at the DNA level in S. cerevisiae. As proof of concept, POTAC was used to optimize the lycopene and n-butanol biosynthetic pathways, increasing the production of lycopene and n-butanol by 10- and 100-fold, respectively. Additionally, multiplex genome integration with controllable copy numbers was attempted by combining the engineered dominant markers with the CRISPR/Cas9 system. Biotechnol. Bioeng. 2016;113: 2462-2473. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  20. Inverse PCR and Quantitative PCR as Alternative Methods to Southern Blotting Analysis to Assess Transgene Copy Number and Characterize the Integration Site in Transgenic Woody Plants.

    PubMed

    Stefano, Biricolti; Patrizia, Bogani; Matteo, Cerboneschi; Massimo, Gori

    2016-06-01

    One of the major unanswered questions with respect to the commercial use of genetic transformation in woody plants is the stability of the transgene expression over several decades within the same individual. Gene expression is strongly affected by the copy number which has been integrated into the plant genome and by the local DNA features close to the integration sites. Because woody plants cannot be subjected to selfing or backcrossing to modify the transgenic allelic structure without affecting the valuable traits of the cultivar, molecular characterization of the transformation event is therefore crucial. After assessing the transgene copy number of a set of apple transgenic clones with Southern blotting, we describe two alternative methods: the first is based on inverse PCR (i-PCR) and the second on the quantitative PCR (q-PCR). The methods produced comparable results with the exception of the data regarding a high copy number clone, but while the q-PCR-based system is rapid and easily adaptable to high throughput systems, the i-PCR-based method can provide information regarding the transformation event and the characteristics of the sequences flanking the transgenic construct.

  1. Integrated genomic, transcriptomic, and RNA-interference analysis of genes in somatic copy number gains in pancreatic ductal adenocarcinoma.

    PubMed

    Samuel, Nardin; Sayad, Azin; Wilson, Gavin; Lemire, Mathieu; Brown, Kevin R; Muthuswamy, Lakshmi; Hudson, Thomas J; Moffat, Jason

    2013-08-01

    This study used an integrated analysis of copy number, gene expression, and RNA interference screens for identification of putative driver genes harbored in somatic copy number gains in pancreatic ductal adenocarcinoma (PDAC). Somatic copy number gain data on 60 PDAC genomes were extracted from public data sets to identify genomic loci that are recurrently gained. Array-based data from a panel of 29 human PDAC cell lines were used to quantify associations between copy number and gene expression for the set of genes found in somatic copy number gains. The most highly correlated genes were assessed in a compendium of pooled short hairpin RNA screens on 27 of the same human PDAC cell lines. A catalog of 710 protein-coding and 46 RNA genes mapping to 20 recurrently gained genomic loci were identified. The gene set was further refined through stringent integration of copy number, gene expression, and RNA interference screening data to uncover 34 candidate driver genes. Among the candidate genes from the integrative analysis, ECT2 was found to have significantly higher essentiality in specific PDAC cell lines with genomic gains at the 3q26.3 locus, which harbors this gene, suggesting that ECT2 may play an oncogenic role in the PDAC neoplastic process.

  2. iGC-an integrated analysis package of gene expression and copy number alteration.

    PubMed

    Lai, Yi-Pin; Wang, Liang-Bo; Wang, Wei-An; Lai, Liang-Chuan; Tsai, Mong-Hsun; Lu, Tzu-Pin; Chuang, Eric Y

    2017-01-14

    With the advancement in high-throughput technologies, researchers can simultaneously investigate gene expression and copy number alteration (CNA) data from individual patients at a lower cost. Traditional analysis methods analyze each type of data individually and integrate their results using Venn diagrams. Challenges arise, however, when the results are irreproducible and inconsistent across multiple platforms. To address these issues, one possible approach is to concurrently analyze both gene expression profiling and CNAs in the same individual. We have developed an open-source R/Bioconductor package (iGC). Multiple input formats are supported and users can define their own criteria for identifying differentially expressed genes driven by CNAs. The analysis of two real microarray datasets demonstrated that the CNA-driven genes identified by the iGC package showed significantly higher Pearson correlation coefficients with their gene expression levels and copy numbers than those genes located in a genomic region with CNA. Compared with the Venn diagram approach, the iGC package showed better performance. The iGC package is effective and useful for identifying CNA-driven genes. By simultaneously considering both comparative genomic and transcriptomic data, it can provide better understanding of biological and medical questions. The iGC package's source code and manual are freely available at https://www.bioconductor.org/packages/release/bioc/html/iGC.html .

  3. Agrobacterium tumefaciens-mediated creeping bentgrass (Agrostis stolonifera L.) transformation using phosphinothricin selection results in a high frequency of single-copy transgene integration.

    PubMed

    Luo, H; Hu, Q; Nelson, K; Longo, C; Kausch, A P; Chandlee, J M; Wipff, J K; Fricker, C R

    2004-04-01

    Genetic transformation of creeping bentgrass mediated by Agrobacterium tumefaciens has been achieved. Embryogenic callus initiated from seeds (cv. Penn-A-4) was infected with an A. tumefaciens strain (LBA4404) harboring a super-binary vector that contained an herbicide-resistant bar gene driven either by the CaMV 35S promoter or a rice ubiquitin promoter. Plants were regenerated from 219 independent transformation events. The overall stable transformation efficiency ranged from 18% to 45%. Southern blot and genetic analysis confirmed transgene integration in the creeping bentgrass genome and normal transmission and stable expression of the transgene in the T1 generation. All independent transformation events carried one to three copies of the transgene, and a majority (60-65%) contained only a single copy of the foreign gene with no apparent rearrangements. We report here the successful use of Agrobacterium for the large-scale production of transgenic creeping bentgrass plants with a high frequency of a single-copy transgene insertion that exhibit stable inheritance patterns.

  4. Integrated small copy number variations and epigenome maps of disorders of sex development

    PubMed Central

    Amarillo, Ina E; Nievera, Isabelle; Hagan, Andrew; Huchthagowder, Vishwa; Heeley, Jennifer; Hollander, Abby; Koenig, Joel; Austin, Paul; Wang, Ting

    2016-01-01

    Small copy number variations (CNVs) have typically not been analyzed or reported in clinical settings and hence have remained underrepresented in databases and the literature. Here, we focused our investigations on these small CNVs using chromosome microarray analysis (CMA) data previously obtained from patients with atypical characteristics or disorders of sex development (DSD). Using our customized CMA track targeting 334 genes involved in the development of urogenital and reproductive structures and a less stringent analysis filter, we uncovered small genes with recurrent and overlapping CNVs as small as 1 kb, and small regions of homozygosity (ROHs), imprinting and position effects. Detailed analysis of these high-resolution data revealed CNVs and ROHs involving structural and functional domains, repeat elements, active transcription sites and regulatory regions. Integration of these genomic data with DNA methylation, histone modification and predicted RNA expression profiles in normal testes and ovaries suggested spatiotemporal and tissue-specific gene regulation. This study emphasized a DSD-specific and gene-targeted CMA approach that uncovered previously unanalyzed or unreported small genes and CNVs, contributing to the growing resources on small CNVs and facilitating the narrowing of the genomic gap for identifying candidate genes or regions. This high-resolution analysis tool could improve the diagnostic utility of CMA, not only in patients with DSD but also in other clinical populations. These integrated data provided a better genomic-epigenomic landscape of DSD and greater opportunities for downstream research. PMID:27340555

  5. Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

    PubMed Central

    Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.

    1990-01-01

    Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

  6. Organellar genome copy number variation and integrity during moderate maturation of roots and leaves of maize seedlings.

    PubMed

    Ma, Jin; Li, Xiu-Qing

    2015-11-01

    Little information is available about organellar genome copy numbers and integrity in plant roots, although it was reported recently that the plastid and mitochondrial genomes were damaged under light, resulting in non-functional fragments in green seedling leaves in a maize line. In the present study, we investigated organellar genome copy numbers and integrity, after assessing the cellular ploidy, in seedling leaves and roots of two elite maize (Zea mays) cultivars using both long-fragment polymerase chain reaction (long-PCR) and real-time quantitative polymerase chain reaction (qPCR, a type of short-PCR). Since maize leaf and root cells are mainly diploid according to chromosome number counting and the literature, the DNA amount ratio between the organellar genomes and the nuclear genome could be used to estimate average organellar genome copy numbers per cell. In the present study, both long-PCR and qPCR analyses found that green leaves had dramatically more plastid DNA and less mitochondrial DNA than roots had in both cultivars. The similarity in results from long-PCR and qPCR suggests that green leaves and roots during moderate maturation have largely intact plastid and mitochondrial genomes. The high resolution of qPCR led to the detection of an increase in copies in the plastid genome and a decrease in copies in the analyzed mitochondrial sub-genomes during the moderate maturation of seedling leaves and roots. These results suggest that green seedling leaves and roots of these two maize cultivars during moderate maturation had essentially intact organellar genomes, an increased copy number of the plastid genome, and decreased copy numbers of certain mitochondrial sub-genomes.

  7. Integrated analysis of copy number variation and genome-wide expression profiling in colorectal cancer tissues.

    PubMed

    Ali Hassan, Nur Zarina; Mokhtar, Norfilza Mohd; Kok Sin, Teow; Mohamed Rose, Isa; Sagap, Ismail; Harun, Roslan; Jamal, Rahman

    2014-01-01

    Integrative analyses of multiple genomic datasets for selected samples can provide better insight into the overall data and can enhance our knowledge of cancer. The objective of this study was to elucidate the association between copy number variation (CNV) and gene expression in colorectal cancer (CRC) samples and their corresponding non-cancerous tissues. Sixty-four paired CRC samples from the same patients were subjected to CNV profiling using the Illumina HumanOmni1-Quad assay, and validation was performed using multiplex ligation probe amplification method. Genome-wide expression profiling was performed on 15 paired samples from the same group of patients using the Affymetrix Human Gene 1.0 ST array. Significant genes obtained from both array results were then overlapped. To identify molecular pathways, the data were mapped to the KEGG database. Whole genome CNV analysis that compared primary tumor and non-cancerous epithelium revealed gains in 1638 genes and losses in 36 genes. Significant gains were mostly found in chromosome 20 at position 20q12 with a frequency of 45.31% in tumor samples. Examples of genes that were associated at this cytoband were PTPRT, EMILIN3 and CHD6. The highest number of losses was detected at chromosome 8, position 8p23.2 with 17.19% occurrence in all tumor samples. Among the genes found at this cytoband were CSMD1 and DLC1. Genome-wide expression profiling showed 709 genes to be up-regulated and 699 genes to be down-regulated in CRC compared to non-cancerous samples. Integration of these two datasets identified 56 overlapping genes, which were located in chromosomes 8, 20 and 22. MLPA confirmed that the CRC samples had the highest gains in chromosome 20 compared to the reference samples. Interpretation of the CNV data in the context of the transcriptome via integrative analyses may provide more in-depth knowledge of the genomic landscape of CRC.

  8. ParseCNV integrative copy number variation association software with quality tracking.

    PubMed

    Glessner, Joseph T; Li, Jin; Hakonarson, Hakon

    2013-03-01

    A number of copy number variation (CNV) calling algorithms exist; however, comprehensive software tools for CNV association studies are lacking. We describe ParseCNV, unique software that takes CNV calls and creates probe-based statistics for CNV occurrence in both case-control design and in family based studies addressing both de novo and inheritance events, which are then summarized based on CNV regions (CNVRs). CNVRs are defined in a dynamic manner to allow for a complex CNV overlap while maintaining precise association region. Using this approach, we avoid failure to converge and non-monotonic curve fitting weaknesses of programs, such as CNVtools and CNVassoc, and although Plink is easy to use, it only provides combined CNV state probe-based statistics, not state-specific CNVRs. Existing CNV association methods do not provide any quality tracking information to filter confident associations, a key issue which is fully addressed by ParseCNV. In addition, uncertainty in CNV calls underlying CNV associations is evaluated to verify significant results, including CNV overlap profiles, genomic context, number of probes supporting the CNV and single-probe intensities. When optimal quality control parameters are followed using ParseCNV, 90% of CNVs validate by polymerase chain reaction, an often problematic stage because of inadequate significant association review. ParseCNV is freely available at http://parsecnv.sourceforge.net.

  9. Deconvolving tumor purity and ploidy by integrating copy number alterations and loss of heterozygosity.

    PubMed

    Li, Yi; Xie, Xiaohui

    2014-08-01

    Next-generation sequencing (NGS) has revolutionized the study of cancer genomes. However, the reads obtained from NGS of tumor samples often consist of a mixture of normal and tumor cells, which themselves can be of multiple clonal types. A prominent problem in the analysis of cancer genome sequencing data is deconvolving the mixture to identify the reads associated with tumor cells or a particular subclone of tumor cells. Solving the problem is, however, challenging because of the so-called 'identifiability problem', where different combinations of tumor purity and ploidy often explain the sequencing data equally well. We propose a new model to resolve the identifiability problem by integrating two types of sequencing information-somatic copy number alterations and loss of heterozygosity-within a unified probabilistic framework. We derive algorithms to solve our model, and implement them in a software package called PyLOH. We benchmark the performance of PyLOH using both simulated data and 12 breast cancer sequencing datasets and show that PyLOH outperforms existing methods in disambiguating the identifiability problem and estimating tumor purity. The PyLOH package is written in Python and is publicly available at https://github.com/uci-cbcl/PyLOH. xhx@ics.uci.edu Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. Systematic Prioritization and Integrative Analysis of Copy Number Variations in Schizophrenia Reveal Key Schizophrenia Susceptibility Genes

    PubMed Central

    Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin

    2014-01-01

    Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and

  11. Systematic prioritization and integrative analysis of copy number variations in schizophrenia reveal key schizophrenia susceptibility genes.

    PubMed

    Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin

    2014-11-01

    Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and

  12. Integrative analysis of gene expression and copy number alterations using canonical correlation analysis

    PubMed Central

    2010-01-01

    Background With the rapid development of new genetic measurement methods, several types of genetic alterations can be quantified in a high-throughput manner. While the initial focus has been on investigating each data set separately, there is an increasing interest in studying the correlation structure between two or more data sets. Multivariate methods based on Canonical Correlation Analysis (CCA) have been proposed for integrating paired genetic data sets. The high dimensionality of microarray data imposes computational difficulties, which have been addressed for instance by studying the covariance structure of the data, or by reducing the number of variables prior to applying the CCA. In this work, we propose a new method for analyzing high-dimensional paired genetic data sets, which mainly emphasizes the correlation structure and still permits efficient application to very large data sets. The method is implemented by translating a regularized CCA to its dual form, where the computational complexity depends mainly on the number of samples instead of the number of variables. The optimal regularization parameters are chosen by cross-validation. We apply the regularized dual CCA, as well as a classical CCA preceded by a dimension-reducing Principal Components Analysis (PCA), to a paired data set of gene expression changes and copy number alterations in leukemia. Results Using the correlation-maximizing methods, regularized dual CCA and PCA+CCA, we show that without pre-selection of known disease-relevant genes, and without using information about clinical class membership, an exploratory analysis singles out two patient groups, corresponding to well-known leukemia subtypes. Furthermore, the variables showing the highest relevance to the extracted features agree with previous biological knowledge concerning copy number alterations and gene expression changes in these subtypes. Finally, the correlation-maximizing methods are shown to yield results which are more

  13. Integrative analysis of copy number and transcriptional expression profiles in esophageal cancer to identify a novel driver gene for therapy

    PubMed Central

    Dong, Gaochao; Mao, Qixing; Yu, Decai; Zhang, Yi; Qiu, Mantang; Dong, Gaoyue; Chen, Qiang; Xia, Wenjie; Wang, Jie; Xu, Lin; Jiang, Feng

    2017-01-01

    An increasing amount of evidence has highlighted the critical roles that copy number variants play in cancer progression. Here, we systematically analyzed the copy number alterations and differentially transcribed genes. Integrative analysis of the association between copy number variants and differential gene expression suggested that copy number variants will lead to aberrant expression of the corresponding genes. We performed a KEGG pathway and GO analysis, which revealed that cell cycle may have an effective role in the progression of esophageal cancer. FAM60A was then screened out as a potential prognostic factor through survival analysis and correlation analysis with clinical-pathological parameters. We subsequently showed that silencing of FAM60A could inhibit esophageal carcinoma tumor cell growth, migration and invasion in vitro. Through the bioinformatic analysis, we predict that FAM60A may act as a transcriptional factor to regulate genes that are correlated with each cell cycle. In summary, we comprehensively analyzed copy number segments and transcriptional expression profiles, which provided a novel approach to identify clinical biomarkers and therapeutic targets of esophageal carcinoma. PMID:28169357

  14. SRBreak: A Read-Depth and Split-Read Framework to Identify Breakpoints of Different Events Inside Simple Copy-Number Variable Regions

    PubMed Central

    Nguyen, Hoang T.; Boocock, James; Merriman, Tony R.; Black, Michael A.

    2016-01-01

    Copy-number variation (CNV) has been associated with increased risk of complex diseases. High-throughput sequencing (HTS) technologies facilitate the detection of copy-number variable regions (CNVRs) and their breakpoints. This helps in understanding genome structure as well as their evolution process. Various approaches have been proposed for detecting CNV breakpoints, but currently it is still challenging for tools based on a single analysis method to identify breakpoints of CNVs. It has been shown, however, that pipelines which integrate multiple approaches are able to report more reliable breakpoints. Here, based on HTS data, we have developed a pipeline to identify approximate breakpoints (±10 bp) relating to different ancestral events within a specific CNVR. The pipeline combines read-depth and split-read information to infer breakpoints, using information from multiple samples to allow an imputation approach to be taken. The main steps involve using a normal mixture model to cluster samples into different groups, followed by simple kernel-based approaches to maximize information obtained from read-depth and split-read approaches, after which common breakpoints of groups are inferred. The pipeline uses split-read information directly from CIGAR strings of BAM files, without using a re-alignment step. On simulated data sets, it was able to report breakpoints for very low-coverage samples including those for which only single-end reads were available. When applied to three loci from existing human resequencing data sets (NEGR1, LCE3, IRGM) the pipeline obtained good concordance with results from the 1000 Genomes Project (92, 100, and 82%, respectively). The package is available at https://github.com/hoangtn/SRBreak, and also as a docker-based application at https://registry.hub.docker.com/u/hoangtn/srbreak/. PMID:27695476

  15. SRBreak: A Read-Depth and Split-Read Framework to Identify Breakpoints of Different Events Inside Simple Copy-Number Variable Regions.

    PubMed

    Nguyen, Hoang T; Boocock, James; Merriman, Tony R; Black, Michael A

    2016-01-01

    Copy-number variation (CNV) has been associated with increased risk of complex diseases. High-throughput sequencing (HTS) technologies facilitate the detection of copy-number variable regions (CNVRs) and their breakpoints. This helps in understanding genome structure as well as their evolution process. Various approaches have been proposed for detecting CNV breakpoints, but currently it is still challenging for tools based on a single analysis method to identify breakpoints of CNVs. It has been shown, however, that pipelines which integrate multiple approaches are able to report more reliable breakpoints. Here, based on HTS data, we have developed a pipeline to identify approximate breakpoints (±10 bp) relating to different ancestral events within a specific CNVR. The pipeline combines read-depth and split-read information to infer breakpoints, using information from multiple samples to allow an imputation approach to be taken. The main steps involve using a normal mixture model to cluster samples into different groups, followed by simple kernel-based approaches to maximize information obtained from read-depth and split-read approaches, after which common breakpoints of groups are inferred. The pipeline uses split-read information directly from CIGAR strings of BAM files, without using a re-alignment step. On simulated data sets, it was able to report breakpoints for very low-coverage samples including those for which only single-end reads were available. When applied to three loci from existing human resequencing data sets (NEGR1, LCE3, IRGM) the pipeline obtained good concordance with results from the 1000 Genomes Project (92, 100, and 82%, respectively). The package is available at https://github.com/hoangtn/SRBreak, and also as a docker-based application at https://registry.hub.docker.com/u/hoangtn/srbreak/.

  16. Single Event Transients in Linear Integrated Circuits

    NASA Technical Reports Server (NTRS)

    Buchner, Stephen; McMorrow, Dale

    2005-01-01

    On November 5, 2001, a processor reset occurred on board the Microwave Anisotropy Probe (MAP), a NASA mission to measure the anisotropy of the microwave radiation left over from the Big Bang. The reset caused the spacecraft to enter a safehold mode from which it took several days to recover. Were that to happen regularly, the entire mission would be compromised, so it was important to find the cause of the reset and, if possible, to mitigate it. NASA assembled a team of engineers that included experts in radiation effects to tackle the problem. The first clue was the observation that the processor reset occurred during a solar event characterized by large increases in the proton and heavy ion fluxes emitted by the sun. To the radiation effects engineers on the team, this strongly suggested that particle radiation might be the culprit, particularly when it was discovered that the reset circuit contained three voltage comparators (LM139). Previous testing revealed that large voltage transients, or glitches appeared at the output of the LM139 when it was exposed to a beam of heavy ions [NI96]. The function of the reset circuit was to monitor the supply voltage and to issue a reset command to the processor should the voltage fall below a reference of 2.5 V [PO02]. Eventually, the team of engineers concluded that ionizing particle radiation from the solar event produced a negative voltage transient on the output of one of the LM139s sufficiently large to reset the processor on MAP. Fortunately, as of the end of 2004, only two such resets have occurred. The reset on MAP was not the first malfunction on a spacecraft attributed to a transient. That occurred shortly after the launch of NASA s TOPEX/Poseidon satellite in 1992. It was suspected, and later confirmed, that an anomaly in the Earth Sensor was caused by a transient in an operational amplifier (OP-15) [KO93]. Over the next few years, problems on TDRS, CASSINI, [PR02] SOHO [HA99,HA01] and TERRA were also attributed

  17. Integration of DNA Copy Number Alterations and Transcriptional Expression Analysis in Human Gastric Cancer

    PubMed Central

    Coral, Ho; Yuen, Siu Tsan; Chu, Kent Man; Law, Simon; Zhang, Lianhai; Ji, Jiafu; Leung, Suet Yi; Chen, Xin

    2012-01-01

    Background Genomic instability with frequent DNA copy number alterations is one of the key hallmarks of carcinogenesis. The chromosomal regions with frequent DNA copy number gain and loss in human gastric cancer are still poorly defined. It remains unknown how the DNA copy number variations contributes to the changes of gene expression profiles, especially on the global level. Principal Findings We analyzed DNA copy number alterations in 64 human gastric cancer samples and 8 gastric cancer cell lines using bacterial artificial chromosome (BAC) arrays based comparative genomic hybridization (aCGH). Statistical analysis was applied to correlate previously published gene expression data obtained from cDNA microarrays with corresponding DNA copy number variation data to identify candidate oncogenes and tumor suppressor genes. We found that gastric cancer samples showed recurrent DNA copy number variations, including gains at 5p, 8q, 20p, 20q, and losses at 4q, 9p, 18q, 21q. The most frequent regions of amplification were 20q12 (7/72), 20q12–20q13.1 (12/72), 20q13.1–20q13.2 (11/72) and 20q13.2–20q13.3 (6/72). The most frequent deleted region was 9p21 (8/72). Correlating gene expression array data with aCGH identified 321 candidate oncogenes, which were overexpressed and showed frequent DNA copy number gains; and 12 candidate tumor suppressor genes which were down-regulated and showed frequent DNA copy number losses in human gastric cancers. Three networks of significantly expressed genes in gastric cancer samples were identified by ingenuity pathway analysis. Conclusions This study provides insight into DNA copy number variations and their contribution to altered gene expression profiles during human gastric cancer development. It provides novel candidate driver oncogenes or tumor suppressor genes for human gastric cancer, useful pathway maps for the future understanding of the molecular pathogenesis of this malignancy, and the construction of new therapeutic

  18. Auditory event files: integrating auditory perception and action planning.

    PubMed

    Zmigrod, Sharon; Hommel, Bernhard

    2009-02-01

    The features of perceived objects are processed in distinct neural pathways, which call for mechanisms that integrate the distributed information into coherent representations (the binding problem). Recent studies of sequential effects have demonstrated feature binding not only in perception, but also across (visual) perception and action planning. We investigated whether comparable effects can be obtained in and across auditory perception and action. The results from two experiments revealed effects indicative of spontaneous integration of auditory features (pitch and loudness, pitch and location), as well as evidence for audio-manual stimulus-response integration. Even though integration takes place spontaneously, features related to task-relevant stimulus or response dimensions are more likely to be integrated. Moreover, integration seems to follow a temporal overlap principle, with features coded close in time being more likely to be bound together. Taken altogether, the findings are consistent with the idea of episodic event files integrating perception and action plans.

  19. PROCESS MONITORING FOR SAFEGUARDS VIA EVENT GENERATION, INTEGRATION, AND INTERPRETATION

    SciTech Connect

    Humberto E. Garcia; Wen-Chiao Lin; Tae-Sic Yoo

    2010-07-01

    There is a recognized safeguards benefit from using process monitoring (PM) on nuclear facilities to complement nuclear materials accountancy. We introduce a model-based approach for PM in which the assessment regarding the state of the monitored system is conducted at a system-centric level. The proposed architecture integrates both time-driven and event-driven data integration and analysis for decision-making. While the time-driven layers of the proposed architecture encompass more traditional PM methods based on time series data and analysis, the event-driven layers encompass operation monitoring methods based on discrete event data integration and analysis. By integrating process- and operation-related information and methodologies within an unified modeling and monitoring framework that includes not only current but also past plant behaviors, the task of anomaly detection is greatly improved because this decision-making approach can benefit from not only known time-series relationships among measured signals but also from known event sequence relationships among generated events. Building from the proposed system-centric PM architecture, we briefly introduce methods that can be used to implement its different components. The application of the proposed approach is then demonstrated via simulation experiments.

  20. Integrated Analysis of Genome-Wide Copy Number Alterations and Gene Expression Profiling of Lung Cancer in Xuanwei, China

    PubMed Central

    Zhang, Yanliang; Xue, Qiuyue; Pan, Guoqing; Meng, Qing H.; Tuo, Xiaoyu; Cai, Xuemei; Chen, Zhenghui; Li, Ya; Huang, Tao; Duan, Xincen; Duan, Yong

    2017-01-01

    Objectives Lung cancer in Xuanwei (LCXW), China, is known throughout the world for its distinctive characteristics, but little is known about its pathogenesis. The purpose of this study was to screen potential novel “driver genes” in LCXW. Methods Genome-wide DNA copy number alterations (CNAs) were detected by array-based comparative genomic hybridization and differentially expressed genes (DEGs) by gene expression microarrays in 8 paired LCXW and non-cancerous lung tissues. Candidate driver genes were screened by integrated analysis of CNAs and DEGs. The candidate genes were further validated by real-time quantitative polymerase chain reaction. Results Large numbers of CNAs and DEGs were detected, respectively. Some of the most frequently occurring CNAs included gains at 5p15.33-p15.32, 5p15.1-p14.3, and 5p14.3-p14.2 and losses at 11q24.3, 21q21.1, 21q22.12-q22.13, and 21q22.2. Integrated analysis of CNAs and DEGs identified 24 candidate genes with frequent copy number gains and concordant upregulation, which were considered potential oncogenes, including CREB3L4, TRIP13, and CCNE2. In addition, the analysis identified 19 candidate genes with a negative association between copy number change and expression change, considered potential tumor suppressor genes, including AHRR, NKD2, and KLF10. One of the most studied oncogenes, MYC, may not play a carcinogenic role in LCXW. Conclusions This integrated analysis of CNAs and DEGs identified several potential novel LCXW-related genes, laying an important foundation for further research on the pathogenesis of LCXW and identification of novel biomarkers or therapeutic targets. PMID:28056099

  1. [R1 and R2 retrotransposons of German cockroach Blattella germanica: comparative analysis of 5' truncated copies integrated into genome].

    PubMed

    Kagramanova, A S; Kapelinskaia, T V; Korolev, A L; Mukha, D V

    2007-01-01

    This is the first report providing results on identification, cloning, and sequencing of extended fragments (5'-truncated copies) of R1 and R2 retrotransposons integrated into Blattella germanica genome. Comparative structural analysis of the received clones revealed two distinct subfamilies of R1 elements. However, all B. germanica R1 clones have two common features: poly(T) tails and similar target site duplications. Nucleotide structure and organization of five sequenced R2 fragments was similar. Analysis of R2 nucleotide sequences revealed typical deletions at the 3'end of target sites and lack of homopolynucleotides tails.

  2. The Influence of Sourcing and Relatedness on Event Integration

    ERIC Educational Resources Information Center

    Kim, Hyun-Jeong Joyce; Millis, Keith

    2006-01-01

    This study investigated the influence of sourcing and relatedness on the integration of events embedded in simple stories. Participants read pairs of "breaking news stories" from either 1 or 2 news agencies that were believed to be from the Internet. The stories within each pair were either related by virtue of shared situational dimensions (e.g.,…

  3. The Influence of Sourcing and Relatedness on Event Integration

    ERIC Educational Resources Information Center

    Kim, Hyun-Jeong Joyce; Millis, Keith

    2006-01-01

    This study investigated the influence of sourcing and relatedness on the integration of events embedded in simple stories. Participants read pairs of "breaking news stories" from either 1 or 2 news agencies that were believed to be from the Internet. The stories within each pair were either related by virtue of shared situational dimensions (e.g.,…

  4. High copy and stable expression of the xylanase XynHB in Saccharomyces cerevisiae by rDNA-mediated integration.

    PubMed

    Fang, Cheng; Wang, Qinhong; Selvaraj, Jonathan Nimal; Zhou, Yuling; Ma, Lixin; Zhang, Guimin; Ma, Yanhe

    2017-08-18

    Xylanase is a widely-used additive in baking industry for enhancing dough and bread quality. Several xylanases used in baking industry were expressed in different systems, but their expression in antibiotic free vector system is highly essential and safe. In the present study, an alternative rDNA-mediated technology was developed to increase the copy number of target gene by integrating it into Saccharomyces cerevisiae genome. A xylanase-encoding gene xynHB from Bacillus sp. was cloned into pHBM367H and integrated into S. cerevisiae genome through rDNA-mediated recombination. Exogenous XynHB expressed by recombinant S. cerevisiae strain A13 exhibited higher degradation activity towards xylan than other transformants. The real-time PCR analysis on A13 genome revealed the presence of 13.64 copies of xynHB gene. Though no antibiotics have been used, the genetic stability and the xylanase activity of xynHB remained stable up to 1,011 generations of cultivation. S. cerevisiae strain A13 expressing xylanase reduced the required kneading time and increased the height and diameter of the dough size, which would be safe and effective in baking industry as no antibiotics-resistance risk. The new effective rDNA-mediated technology without using antibiotics here provides a way to clone other food related industrial enzymes for applications.

  5. Integration of copy number and transcriptomics provides risk stratification in prostate cancer: A discovery and validation cohort study

    PubMed Central

    Ross-Adams, H.; Lamb, A.D.; Dunning, M.J.; Halim, S.; Lindberg, J.; Massie, C.M.; Egevad, L.A.; Russell, R.; Ramos-Montoya, A.; Vowler, S.L.; Sharma, N.L.; Kay, J.; Whitaker, H.; Clark, J.; Hurst, R.; Gnanapragasam, V.J.; Shah, N.C.; Warren, A.Y.; Cooper, C.S.; Lynch, A.G.; Stark, R.; Mills, I.G.; Grönberg, H.; Neal, D.E.

    2015-01-01

    Background Understanding the heterogeneous genotypes and phenotypes of prostate cancer is fundamental to improving the way we treat this disease. As yet, there are no validated descriptions of prostate cancer subgroups derived from integrated genomics linked with clinical outcome. Methods In a study of 482 tumour, benign and germline samples from 259 men with primary prostate cancer, we used integrative analysis of copy number alterations (CNA) and array transcriptomics to identify genomic loci that affect expression levels of mRNA in an expression quantitative trait loci (eQTL) approach, to stratify patients into subgroups that we then associated with future clinical behaviour, and compared with either CNA or transcriptomics alone. Findings We identified five separate patient subgroups with distinct genomic alterations and expression profiles based on 100 discriminating genes in our separate discovery and validation sets of 125 and 103 men. These subgroups were able to consistently predict biochemical relapse (p = 0.0017 and p = 0.016 respectively) and were further validated in a third cohort with long-term follow-up (p = 0.027). We show the relative contributions of gene expression and copy number data on phenotype, and demonstrate the improved power gained from integrative analyses. We confirm alterations in six genes previously associated with prostate cancer (MAP3K7, MELK, RCBTB2, ELAC2, TPD52, ZBTB4), and also identify 94 genes not previously linked to prostate cancer progression that would not have been detected using either transcript or copy number data alone. We confirm a number of previously published molecular changes associated with high risk disease, including MYC amplification, and NKX3-1, RB1 and PTEN deletions, as well as over-expression of PCA3 and AMACR, and loss of MSMB in tumour tissue. A subset of the 100 genes outperforms established clinical predictors of poor prognosis (PSA, Gleason score), as well as previously published gene

  6. What makes an event: temporal integration of stimuli or actions?

    PubMed

    Fournier, Lisa R; Gallimore, Jonathan M

    2013-08-01

    In this article, we ask what serves as the "glue" that temporarily links information to form an event in an active observer. We examined whether forming a single action event in an active observer is contingent on the temporal presentation of the stimuli (hence, on the temporal availability of the action information associated with these stimuli), or on the learned temporal execution of the actions associated with the stimuli, or on both. A partial-repetition paradigm was used to assess the boundaries of an event for which the temporal properties of the stimuli (i.e., presented either simultaneously or temporally separate) and the intended execution of the actions associated with these stimuli (i.e., executed as one, temporally integrated, response or as two temporally separate responses) were manipulated. The results showed that the temporal features of action execution determined whether one or more events were constructed; the temporal presentation of the stimuli (and hence the availability of their associated actions) did not. This suggests that the action representation, or "task goal," served as the "glue" in forming an event in an active observer. These findings emphasize the importance of action planning in event construction in an active observer.

  7. Integrated genomic analyses identify frequent gene fusion events and VHL inactivation in gastrointestinal stromal tumors

    PubMed Central

    Sun, Choong-Hyun; Park, Inho; Lee, Seungmook; Kwon, Jekeun; Do, Ingu; Hong, Min Eui; Van Vrancken, Michael; Lee, Jeeyun; Park, Joon Oh; Cho, Jeonghee; Kim, Kyoung-Mee; Sohn, Tae Sung

    2016-01-01

    Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal tumors of the gastrointestinal tract. We sequenced nine exomes and transcriptomes, and two genomes of GISTs for integrated analyses. We detected 306 somatic variants in nine GISTs and recurrent protein-altering mutations in 29 genes. Transcriptome sequencing revealed 328 gene fusions, and the most frequently involved fusion events were associated with IGF2 fused to several partner genes including CCND1, FUS, and LASP1. We additionally identified three recurrent read-through fusion transcripts: POLA2-CDC42EP2, C8orf42-FBXO25, and STX16-NPEPL1. Notably, we found intragenic deletions in one of three exons of the VHL gene and increased mRNAs of VEGF, PDGF-β, and IGF-1/2 in 56% of GISTs, suggesting a mechanistic link between VHL inactivation and overexpression of hypoxia-inducible factor target genes in the absence of hypoxia. We also identified copy number gain and increased mRNA expression of AMACR, CRIM1, SKP2, and CACNA1E. Mapping of copy number and gene expression results to the KEGG pathways revealed activation of the JAK-STAT pathway in small intestinal GISTs and the MAPK pathway in wild-type GISTs. These observations will allow us to determine the genetic basis of GISTs and will facilitate further investigation to develop new therapeutic options. PMID:25987131

  8. Integrated genomic analyses identify frequent gene fusion events and VHL inactivation in gastrointestinal stromal tumors.

    PubMed

    Kang, Guhyun; Yun, Hongseok; Sun, Choong-Hyun; Park, Inho; Lee, Seungmook; Kwon, Jekeun; Do, Ingu; Hong, Min Eui; Van Vrancken, Michael; Lee, Jeeyun; Park, Joon Oh; Cho, Jeonghee; Kim, Kyoung-Mee; Sohn, Tae Sung

    2016-02-09

    Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal tumors of the gastrointestinal tract. We sequenced nine exomes and transcriptomes, and two genomes of GISTs for integrated analyses. We detected 306 somatic variants in nine GISTs and recurrent protein-altering mutations in 29 genes. Transcriptome sequencing revealed 328 gene fusions, and the most frequently involved fusion events were associated with IGF2 fused to several partner genes including CCND1, FUS, and LASP1. We additionally identified three recurrent read-through fusion transcripts: POLA2-CDC42EP2, C8orf42-FBXO25, and STX16-NPEPL1. Notably, we found intragenic deletions in one of three exons of the VHL gene and increased mRNAs of VEGF, PDGF-β, and IGF-1/2 in 56% of GISTs, suggesting a mechanistic link between VHL inactivation and overexpression of hypoxia-inducible factor target genes in the absence of hypoxia. We also identified copy number gain and increased mRNA expression of AMACR, CRIM1, SKP2, and CACNA1E. Mapping of copy number and gene expression results to the KEGG pathways revealed activation of the JAK-STAT pathway in small intestinal GISTs and the MAPK pathway in wild-type GISTs. These observations will allow us to determine the genetic basis of GISTs and will facilitate further investigation to develop new therapeutic options.

  9. Impact of copy number variations burden on coding genome in humans using integrated high resolution arrays.

    PubMed

    Veerappa, Avinash M; Lingaiah, Kusuma; Vishweswaraiah, Sangeetha; Murthy, Megha N; Suresh, Raviraj V; Manjegowda, Dinesh S; Ramachandra, Nallur B

    2014-12-16

    Copy number variations (CNVs) alter the transcriptional and translational levels of genes by disrupting the coding structure and this burden of CNVs seems to be a significant contributor to phenotypic variations. Therefore it was necessary to assess the complexities of CNV burden on the coding genome. A total of 1715 individuals from 12 populations were used for CNV analysis in the present investigation. Analysis was performed using Affymetrix Genome-Wide Human SNP Array 6·0 chip and CytoScan High-Density arrays. CNVs were more frequently observed in the coding region than in the non-coding region. CNVs were observed vastly more frequently in the coding region than the non-coding region. CNVs were found to be enriched in the regions containing functional genes (83-96%) compared with the regions containing pseudogenes (4-17%). CNVs across the genome of an individual showed multiple hits across many genes, whose proteins interact physically and function under the same pathway. We identified varying numbers of proteins and degrees of interactions within protein complexes of single individual genomes. This study represents the first draft of a population-specific CNV genes map as well as a cross-populational map. The complex relationship of CNVs on genes and their physically interacting partners unravels many complexities involved in phenotype expression. This study identifies four mechanisms contributing to the complexities caused by the presence of multiple CNVs across many genes in the coding part of the genome.

  10. Seventeen copies of the human 37 kDa laminin receptor precursor/p40 ribosome-associated protein gene are processed pseudogenes arisen from retropositional events.

    PubMed

    Jackers, P; Clausse, N; Fernandez, M; Berti, A; Princen, F; Wewer, U; Sobel, M E; Castronovo, V

    1996-02-07

    A cDNA coding for a 37 kDa polypeptide has been identified in several species as both the potential precursor of the 67 kDa laminin receptor (37LRP) and a putative ribosome-associated protein (p40). Interestingly, increased expression of this polypeptide (37LRP/p40) is consistently observed in invasive and metastatic cancer cells and is associated with poor prognosis. Southern-blot analysis of human genomic DNA predicted multiple copies of the 37LRP/p40 gene. In this study, we report that the number of copies of this sequence in the human genome is 26 +/- 2. We have sequenced and analyzed 19 genomic clones corresponding to the 37LRP/p40 gene and found that they were all processed pseudogenes. They all lack intronic sequences and show multiple genetic alterations leading in some cases to the appearance of stop codons. Moreover, they all bear characteristic features of retroposons as the presence of a poly(A)-tail at their 3' end and short direct repeated flanking DNA sequences. None of the pseudogenes analyzed present cis-elements in their 5' flanking region such as TATA or GC boxes. Our date reveal that over 50% of the 37LRP/p40 gene copies are pseudogenes most probably generated by retropositional events. The finding of multiple pseudogenes for the 37LRP/p40 suggests that the accumulation of several copies of this gene might have given a survival advantage to the cell in the course of evolution.

  11. [Length polymorphism of integrated copies of R1 and R2 retrotransposons in the German cockroach (Blattella germanica) as a potential marker for population and phylogenetic studies].

    PubMed

    Kagramanova, A S; Korolev, A L; Schal, C; Mukha, D V

    2006-04-01

    Using polymerase chain reaction technique with primers flanking target sites of retrotransposons R1 and R2, integrated copies of these transposable elements were amplified in various cockroach species (Blattodea). It was shown that each species has a unique pattern of "5'-undertranscripts" with the definite set of amplified fragments of different lengths. Intraspecies polymorphism was revealed in analysis of German cockroach specimens obtained upon individual mating. This is the first report providing results of identifying, cloning, and sequencing extended fragments (5'-truncated copies) of Blatella germanica R1 and R2 retrotransposons. It may be assumed that patterns of 5'-truncated copies of R1 and R2 elements can be used as markers in population and phylogenetic studies. Moreover, cloned and sequenced fragments will be employed in our further studies for screening of the German cockroach genomic library in order to detect full-length copies in this class transposable elements.

  12. A highly efficient single-step, markerless strategy for multi-copy chromosomal integration of large biochemical pathways in Saccharomyces cerevisiae.

    PubMed

    Shi, Shuobo; Liang, Youyun; Zhang, Mingzi M; Ang, Ee Lui; Zhao, Huimin

    2016-01-01

    Despite recent advances in genome editing capabilities for the model organism Saccharomyces cerevisiae, the chromosomal integration of large biochemical pathways for stable industrial production remains challenging. In this work, we developed a simple platform for high-efficiency, single-step, markerless, multi-copy chromosomal integration of full biochemical pathways in Saccharomyces cerevisiae. In this Di-CRISPR (delta integration CRISPR-Cas) platform based on the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated systems (Cas), we specifically designed guide RNA sequences to target multiple delta sites in the yeast genome. The generation of double stranded breaks at the delta sites allowed simultaneous integration of multiple copies of linearized donor DNA containing large biochemical pathways. With our newly developed Di-CRISPR platform, we were able to attain highly efficient and markerless integration of large biochemical pathways and achieve an unprecedented 18-copy genomic integration of a 24 kb combined xylose utilization and (R,R)-2,3-butanediol (BDO) production pathway in a single step, thus generating a strain that was able to produce BDO directly from xylose. The simplicity and high efficiency of the Di-CRISPR platform could provide a superior alternative to high copy plasmids and would render this platform an invaluable tool for genome editing and metabolic engineering in S. cerevisiae. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  13. Multiple proviral integration events after virological synapse-mediated HIV-1 spread

    SciTech Connect

    Russell, Rebecca A.; Martin, Nicola; Mitar, Ivonne; Jones, Emma; Sattentau, Quentin J.

    2013-08-15

    HIV-1 can move directly between T cells via virological synapses (VS). Although aspects of the molecular and cellular mechanisms underlying this mode of spread have been elucidated, the outcomes for infection of the target cell remain incompletely understood. We set out to determine whether HIV-1 transfer via VS results in productive, high-multiplicity HIV-1 infection. We found that HIV-1 cell-to-cell spread resulted in nuclear import of multiple proviruses into target cells as seen by fluorescence in-situ hybridization. Proviral integration into the target cell genome was significantly higher than that seen in a cell-free infection system, and consequent de novo viral DNA and RNA production in the target cell detected by quantitative PCR increased over time. Our data show efficient proviral integration across VS, implying the probability of multiple integration events in target cells that drive productive T cell infection. - Highlights: • Cell-to-cell HIV-1 infection delivers multiple vRNA copies to the target cell. • Cell-to-cell infection results in productive infection of the target cell. • Cell-to-cell transmission is more efficient than cell-free HIV-1 infection. • Suggests a mechanism for recombination in cells infected with multiple viral genomes.

  14. Modeling of single-event upset in bipolar integrated circuits

    NASA Technical Reports Server (NTRS)

    Zoutendyk, J. A.

    1983-01-01

    The results of work done on the quantitative characterization of single-event upset (SEU) in bipolar random-access memories (RAMs) have been obtained through computer simulation of SEU in RAM cells that contain circuit models for bipolar transistors. The models include current generators that emulate the charge collected from ion tracks. The computer simulation results are compared with test data obtained from a RAM in a bipolar microprocessor chip. This methodology is applicable to other bipolar integrated circuit constructions in addition to RAM cells.

  15. Integrative analysis of DNA copy number, DNA methylation and gene expression in multiple myeloma reveals alterations related to relapse

    PubMed Central

    Krzeminski, Patryk; Corchete, Luis A.; García, Juan L.; López-Corral, Lucía; Fermiñán, Encarna; García, Eva M.; Martín, Ana A.; Hernández-Rivas, Jesús M.; García-Sanz, Ramón; Miguel, Jesús F. San; Gutiérrez, Norma C.

    2016-01-01

    Multiple myeloma (MM) remains incurable despite the introduction of novel agents, and a relapsing course is observed in most patients. Although the development of genomic technologies has greatly improved our understanding of MM pathogenesis, the mechanisms underlying relapse have been less thoroughly investigated. In this study, an integrative analysis of DNA copy number, DNA methylation and gene expression was conducted in matched diagnosis and relapse samples from MM patients. Overall, the acquisition of abnormalities at relapse was much more frequent than the loss of lesions present at diagnosis, and DNA losses were significantly more frequent in relapse than in diagnosis samples. Interestingly, copy number abnormalities involving more than 100 Mb of DNA at relapse significantly affect the gene expression of these samples, provoking a particular deregulation of the IL-8 pathway. On the other hand, no significant modifications of gene expression were observed in those samples with less than 100 Mb affected by chromosomal changes. Although several statistical approaches were used to identify genes whose abnormal expression at relapse was regulated by methylation, only two genes that were significantly deregulated in relapse samples (SORL1 and GLT1D1) showed a negative correlation between methylation and expression. Further analysis revealed that DNA methylation was involved in regulating SORL1 expression in MM. Finally, relevant changes in gene expression observed in relapse samples, such us downregulation of CD27 and P2RY8, were most likely not preceded by alterations in the corresponding DNA. Taken together, these results suggest that the genomic heterogeneity described at diagnosis remains at relapse. PMID:27811368

  16. Integrative analysis of DNA copy number, DNA methylation and gene expression in multiple myeloma reveals alterations related to relapse.

    PubMed

    Krzeminski, Patryk; Corchete, Luis A; García, Juan L; López-Corral, Lucía; Fermiñán, Encarna; García, Eva M; Martín, Ana A; Hernández-Rivas, Jesús M; García-Sanz, Ramón; San Miguel, Jesús F; Gutiérrez, Norma C

    2016-12-06

    Multiple myeloma (MM) remains incurable despite the introduction of novel agents, and a relapsing course is observed in most patients. Although the development of genomic technologies has greatly improved our understanding of MM pathogenesis, the mechanisms underlying relapse have been less thoroughly investigated. In this study, an integrative analysis of DNA copy number, DNA methylation and gene expression was conducted in matched diagnosis and relapse samples from MM patients. Overall, the acquisition of abnormalities at relapse was much more frequent than the loss of lesions present at diagnosis, and DNA losses were significantly more frequent in relapse than in diagnosis samples. Interestingly, copy number abnormalities involving more than 100 Mb of DNA at relapse significantly affect the gene expression of these samples, provoking a particular deregulation of the IL-8 pathway. On the other hand, no significant modifications of gene expression were observed in those samples with less than 100 Mb affected by chromosomal changes. Although several statistical approaches were used to identify genes whose abnormal expression at relapse was regulated by methylation, only two genes that were significantly deregulated in relapse samples (SORL1 and GLT1D1) showed a negative correlation between methylation and expression. Further analysis revealed that DNA methylation was involved in regulating SORL1 expression in MM. Finally, relevant changes in gene expression observed in relapse samples, such us downregulation of CD27 and P2RY8, were most likely not preceded by alterations in the corresponding DNA. Taken together, these results suggest that the genomic heterogeneity described at diagnosis remains at relapse.

  17. CLIPS, AppleEvents, and AppleScript: Integrating CLIPS with commercial software

    NASA Technical Reports Server (NTRS)

    Compton, Michael M.; Wolfe, Shawn R.

    1994-01-01

    Many of today's intelligent systems are comprised of several modules, perhaps written in different tools and languages, that together help solve the user's problem. These systems often employ a knowledge-based component that is not accessed directly by the user, but instead operates 'in the background' offering assistance to the user as necessary. In these types of modular systems, an efficient, flexible, and eady-to-use mechanism for sharing data between programs is crucial. To help permit transparent integration of CLIPS with other Macintosh applications, the AI Research Branch at NASA Ames Research Center has extended CLIPS to allow it to communicate transparently with other applications through two popular data-sharing mechanisms provided by the Macintosh operating system: Apple Events (a 'high-level' event mechanism for program-to-program communication), and AppleScript, a recently-released scripting language for the Macintosh. This capability permits other applications (running on either the same or a remote machine) to send a command to CLIPS, which then responds as if the command were typed into the CLIPS dialog window. Any result returned by the command is then automatically returned to the program that sent it. Likewise, CLIPS can send several types of Apple Events directly to other local or remote applications. This CLIPS system has been successfully integrated with a variety of commercial applications, including data collection programs, electronics forms packages, DBMS's, and email programs. These mechanisms can permit transparent user access to the knowledge base from within a commercial application, and allow a single copy of the knowledge base to service multiple users in a networked environment.

  18. The COG and COPI complexes interact to control the abundance of GEARs, a subset of Golgi integral membrane proteins.

    PubMed

    Oka, Toshihiko; Ungar, Daniel; Hughson, Frederick M; Krieger, Monty

    2004-05-01

    The conserved oligomeric Golgi (COG) complex is a soluble hetero-octamer associated with the cytoplasmic surface of the Golgi. Mammalian somatic cell mutants lacking the Cog1 (ldlB) or Cog2 (ldlC) subunits exhibit pleiotropic defects in Golgi-associated glycoprotein and glycolipid processing that suggest COG is involved in the localization, transport, and/or function of multiple Golgi processing proteins. We have identified a set of COG-sensitive, integral membrane Golgi proteins called GEARs (mannosidase II, GOS-28, GS15, GPP130, CASP, giantin, and golgin-84) whose abundances were reduced in the mutant cells and, in some cases, increased in COG-overexpressing cells. In the mutants, some GEARs were abnormally localized in the endoplasmic reticulum and were degraded by proteasomes. The distributions of the GEARs were altered by small interfering RNA depletion of epsilon-COP in wild-type cells under conditions in which COG-insensitive proteins were unaffected. Furthermore, synthetic phenotypes arose in mutants deficient in both epsilon-COP and either Cog1 or Cog2. COG and COPI may work in concert to ensure the proper retention or retrieval of a subset of proteins in the Golgi, and COG helps prevent the endoplasmic reticulum accumulation and degradation of some GEARs.

  19. Integrated immunohistochemical and DNA copy number profiling analysis provides insight into the molecular pathogenesis of canine follicular lymphoma.

    PubMed

    Thomas, R; Demeter, Z; Kennedy, K A; Borst, L; Singh, K; Valli, V E; Le Boedec, K; Breen, M

    2017-09-01

    Follicular lymphomas (FLs) typically exhibit a chromosome translocation that induces constitutive expression of the anti-apoptotic bcl2 protein and accumulation of additional molecular defects. This rearrangement offers a promising therapeutic target, but its nature as a fundamental driver of FL pathogenesis remains unclear as 15% of cases lack the translocation. We performed an integrated immunohistochemical and genomic investigation of 10 naturally occurring FL cases from domestic dogs, showing that, as with human tumours, they exhibit marked heterogeneity in the frequency and intensity of bcl2 protein expression. Genomic copy number aberrations were infrequent and broadly consistent with those of other canine B-cell lymphoma subtypes. None of the canine FL specimens exhibited a rearrangement consistent with the hallmark translocation of human FL, despite their remarkable histomorphologic similarity. Parallel exploration of canine and human cases may reveal alternative tumour-initiating mechanisms other than BCL2 disruption, yielding a more complete definition of the molecular pathogenesis of FL. © 2016 John Wiley & Sons Ltd.

  20. Integration event induced changes in recombinant protein productivity in Pichia pastoris discovered by whole genome sequencing and derived vector optimization.

    PubMed

    Schwarzhans, Jan-Philipp; Wibberg, Daniel; Winkler, Anika; Luttermann, Tobias; Kalinowski, Jörn; Friehs, Karl

    2016-05-20

    The classic AOX1 replacement approach is still one of the most often used techniques for expression of recombinant proteins in the methylotrophic yeast Pichia pastoris. Although this approach is largely successful, it frequently delivers clones with unpredicted production characteristics and a work-intense screening process is required to find the strain with desired productivity. In this project 845 P. pastoris clones, transformed with a GFP expression cassette, were analyzed for their methanol-utilization (Mut)-phenotypes, GFP gene expression levels and gene copy numbers. Several groups of strains with irregular features were identified. Such features include GFP expression that is markedly higher or lower than expected based on gene copy number as well as strains that grew under selective conditions but where the GFP gene cassette and its expression could not be detected. From these classes of strains 31 characteristic clones were selected and their genomes sequenced. By correlating the assembled genome data with the experimental phenotypes novel insights were obtained. These comprise a clear connection between productivity and cassette-to-cassette orientation in the genome, the occurrence of false-positive clones due to a secondary recombination event, and lower total productivity due to the presence of untransformed cells within the isolates were discovered. To cope with some of these problems, the original vector was optimized by replacing the AOX1 terminator, preventing the occurrence of false-positive clones due to the secondary recombination event. Standard methods for transformation of P. pastoris led to a multitude of unintended and sometimes detrimental integration events, lowering total productivity. By documenting the connections between productivity and integration event we obtained a deeper understanding of the genetics of mutation in P. pastoris. These findings and the derived improved mutagenesis and transformation procedures and tools will help

  1. Chopping Copy.

    ERIC Educational Resources Information Center

    Bush, Don

    1994-01-01

    Discusses ways an editor can cut out words to help the reader understand quickly. Discusses dead wood, redundancy, redundancy in thought, smothered verbs, false precision, editing and academia, and making copy smoother. (SR)

  2. An integrated system for hydrological analysis of flood events

    NASA Astrophysics Data System (ADS)

    Katsafados, Petros; Chalkias, Christos; Karymbalis, Efthymios; Gaki-Papanastassiou, Kalliopi; Mavromatidis, Elias; Papadopoulos, Anastasios

    2010-05-01

    The significant increase of extreme flood events during recent decades has led to an urgent social and economic demand for improve prediction and sustainable prevention. Remedial actions require accurate estimation of the spatiotemporal variability of runoff volume and local peaks, which can be analyzed through integrated simulation tools. Despite the fact that such advanced modeling systems allow the investigation of the dynamics controlling the behavior of those complex processes they can also be used as early warning systems. Moreover, simulation is assuming as the appropriate method to derive quantitative estimates of various atmospheric and hydrologic parameters especially in cases of absence reliable and accurate measurements of precipitation and flow rates. Such sophisticated techniques enable the flood risk assessment and improve the decision-making support on protection actions. This study presents an integrated system for the simulation of the essential atmospheric and soil parameters in the context of hydrological flood modeling. The system is consisted of two main cores: a numerical weather prediction model coupled with a geographical information system for the accurate simulation of groundwater advection and rainfall runoff estimation. Synoptic and mesoscale atmospheric motions are simulated with a non-hydrostatic limited area model on a very high resolution domain of integration. The model includes advanced schemes for the microphysics and the surface layer physics description as well as the longwave and sortwave radiation budget estimation. It is also fully coupled with a land-surface model in order to resolve the surface heat fluxes and the simulation of the air-land energy exchange processes. Detailed atmospheric and soil parameters derived from the atmospheric model are used as input data for the GIS-based runoff modeling. Geographical information system (GIS) technology is used for further hydrological analysis and estimation of direct

  3. Additional Copies of the Proteolipid Protein Gene Causing Pelizaeus-Merzbacher Disease Arise by Separate Integration into the X Chromosome

    PubMed Central

    Hodes, M. E.; Woodward, Karen; Spinner, Nancy B.; Emanuel, Beverly S.; Enrico-Simon, Agnes; Kamholz, John; Stambolian, Dwight; Zackai, Elaine H.; Pratt, Victoria M.; Thomas, I. T.; Crandall, Kerry; Dlouhy, Stephen R.; Malcolm, Sue

    2000-01-01

    The proteolipid protein gene (PLP) is normally present at chromosome Xq22. Mutations and duplications of this gene are associated with Pelizaeus-Merzbacher disease (PMD). Here we describe two new families in which males affected with PMD were found to have a copy of PLP on the short arm of the X chromosome, in addition to a normal copy on Xq22. In the first family, the extra copy was first detected by the presence of heterozygosity of the AhaII dimorphism within the PLP gene. The results of FISH analysis showed an additional copy of PLP in Xp22.1, although no chromosomal rearrangements could be detected by standard karyotype analysis. Another three affected males from the family had similar findings. In a second unrelated family with signs of PMD, cytogenetic analysis showed a pericentric inversion of the X chromosome. In the inv(X) carried by several affected family members, FISH showed PLP signals at Xp11.4 and Xq22. A third family has previously been reported, in which affected members had an extra copy of the PLP gene detected at Xq26 in a chromosome with an otherwise normal banding pattern. The identification of three separate families in which PLP is duplicated at a noncontiguous site suggests that such duplications could be a relatively common but previously undetected cause of genetic disorders. PMID:10827108

  4. Additional copies of the proteolipid protein gene causing Pelizaeus-Merzbacher disease arise by separate integration into the X chromosome.

    PubMed

    Hodes, M E; Woodward, K; Spinner, N B; Emanuel, B S; Enrico-Simon, A; Kamholz, J; Stambolian, D; Zackai, E H; Pratt, V M; Thomas, I T; Crandall, K; Dlouhy, S R; Malcolm, S

    2000-07-01

    The proteolipid protein gene (PLP) is normally present at chromosome Xq22. Mutations and duplications of this gene are associated with Pelizaeus-Merzbacher disease (PMD). Here we describe two new families in which males affected with PMD were found to have a copy of PLP on the short arm of the X chromosome, in addition to a normal copy on Xq22. In the first family, the extra copy was first detected by the presence of heterozygosity of the AhaII dimorphism within the PLP gene. The results of FISH analysis showed an additional copy of PLP in Xp22.1, although no chromosomal rearrangements could be detected by standard karyotype analysis. Another three affected males from the family had similar findings. In a second unrelated family with signs of PMD, cytogenetic analysis showed a pericentric inversion of the X chromosome. In the inv(X) carried by several affected family members, FISH showed PLP signals at Xp11.4 and Xq22. A third family has previously been reported, in which affected members had an extra copy of the PLP gene detected at Xq26 in a chromosome with an otherwise normal banding pattern. The identification of three separate families in which PLP is duplicated at a noncontiguous site suggests that such duplications could be a relatively common but previously undetected cause of genetic disorders.

  5. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    PubMed

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  6. Integrated DNA methylation and copy-number profiling identify three clinically and biologically relevant groups of anaplastic glioma.

    PubMed

    Wiestler, Benedikt; Capper, David; Sill, Martin; Jones, David T W; Hovestadt, Volker; Sturm, Dominik; Koelsche, Christian; Bertoni, Anna; Schweizer, Leonille; Korshunov, Andrey; Weiß, Elisa K; Schliesser, Maximilian G; Radbruch, Alexander; Herold-Mende, Christel; Roth, Patrick; Unterberg, Andreas; Hartmann, Christian; Pietsch, Torsten; Reifenberger, Guido; Lichter, Peter; Radlwimmer, Bernhard; Platten, Michael; Pfister, Stefan M; von Deimling, Andreas; Weller, Michael; Wick, Wolfgang

    2014-10-01

    The outcome of patients with anaplastic gliomas varies considerably. Whether a molecular classification of anaplastic gliomas based on large-scale genomic or epigenomic analyses is superior to histopathology for reflecting distinct biological groups, predicting outcomes and guiding therapy decisions has yet to be determined. Epigenome-wide DNA methylation analysis, using a platform which also allows the detection of copy-number aberrations, was performed in a cohort of 228 patients with anaplastic gliomas (astrocytomas, oligoastrocytomas, and oligodendrogliomas), including 115 patients of the NOA-04 trial. We further compared these tumors with a group of 55 glioblastomas. Unsupervised clustering of DNA methylation patterns revealed two main groups correlated with IDH status: CpG island methylator phenotype (CIMP) positive (77.5 %) or negative (22.5 %). CIMP(pos) (IDH mutant) tumors showed a further separation based on copy-number status of chromosome arms 1p and 19q. CIMP(neg) (IDH wild type) tumors showed hallmark copy-number alterations of glioblastomas, and clustered together with CIMP(neg) glioblastomas without forming separate groups based on WHO grade. Notably, there was no molecular evidence for a distinct biological entity representing anaplastic oligoastrocytoma. Tumor classification based on CIMP and 1p/19q status was significantly associated with survival, allowing a better prediction of outcome than the current histopathological classification: patients with CIMP(pos) tumors with 1p/19q codeletion (CIMP-codel) had the best prognosis, followed by patients with CIMP(pos) tumors but intact 1p/19q status (CIMP-non-codel). Patients with CIMP(neg) anaplastic gliomas (GBM-like) had the worst prognosis. Collectively, our data suggest that anaplastic gliomas can be grouped by IDH and 1p/19q status into three molecular groups that show clear links to underlying biology and a significant association with clinical outcome in a prospective trial cohort.

  7. The predictive integration method for dynamics of infrequent events

    NASA Astrophysics Data System (ADS)

    Cubuk, Ekin; Waterland, Amos; Kaxiras, Efthimios

    2012-02-01

    With the increasing prominence and availability of multi-processor computers, recasting problems in a form amenable to parallel solution is becoming a critical step in effective scientific computation. We present a method for parallelizing molecular dynamics simulations in time scale, by using predictive integration. Our method is closely related to Voter's parallel replica method, but goes beyond that approach in that it involves speculatively initializing processors in more than one basin. Our predictive integration method requires predicting possible future configurations while it does not suffer from restrictions due to correlation time after transitions between basins.

  8. Integrated Seismic Event Detection and Location by Advanced Array Processing

    SciTech Connect

    Kvaerna, T; Gibbons, S J; Ringdal, F; Harris, D B

    2007-02-09

    The principal objective of this two-year study is to develop and test a new advanced, automatic approach to seismic detection/location using array processing. We address a strategy to obtain significantly improved precision in the location of low-magnitude events compared with current fully-automatic approaches, combined with a low false alarm rate. We have developed and evaluated a prototype automatic system which uses as a basis regional array processing with fixed, carefully calibrated, site-specific parameters in conjuction with improved automatic phase onset time estimation. We have in parallel developed tools for Matched Field Processing for optimized detection and source-region identification of seismic signals. This narrow-band procedure aims to mitigate some of the causes of difficulty encountered using the standard array processing system, specifically complicated source-time histories of seismic events and shortcomings in the plane-wave approximation for seismic phase arrivals at regional arrays.

  9. Indico central - events organisation, ergonomics and collaboration tools integration

    NASA Astrophysics Data System (ADS)

    Benito Gonzélez López, José; Ferreira, José Pedro; Baron, Thomas

    2010-04-01

    While the remote collaboration services at CERN slowly aggregate around the Indico event management software, its new version which is the result of a careful maturation process includes improvements which will set a new reference in its domain. The presentation will focus on the description of the new features of the tool, the user feedback process which resulted in a new record of usability. We will also describe the interactions with the worldwide community of users and server administrators and the impact this has had on our development process, as well as the tools set in place to streamline the work between the different collaborating sites. A last part will be dedicated to the use of Indico as a central hub for operating other local services around the event organisation (registration epayment, audiovisual recording, webcast, room booking, and videoconference support)

  10. Identification of Novel Breast Cancer Subtype-Specific Biomarkers by Integrating Genomics Analysis of DNA Copy Number Aberrations and miRNA-mRNA Dual Expression Profiling.

    PubMed

    Li, Dongguo; Xia, Hong; Li, Zhen-ya; Hua, Lin; Li, Lin

    2015-01-01

    Breast cancer is a heterogeneous disease with well-defined molecular subtypes. Currently, comparative genomic hybridization arrays (aCGH) techniques have been developed rapidly, and recent evidences in studies of breast cancer suggest that tumors within gene expression subtypes share similar DNA copy number aberrations (CNA) which can be used to further subdivide subtypes. Moreover, subtype-specific miRNA expression profiles are also proposed as novel signatures for breast cancer classification. The identification of mRNA or miRNA expression-based breast cancer subtypes is considered an instructive means of prognosis. Here, we conducted an integrated analysis based on copy number aberrations data and miRNA-mRNA dual expression profiling data to identify breast cancer subtype-specific biomarkers. Interestingly, we found a group of genes residing in subtype-specific CNA regions that also display the corresponding changes in mRNAs levels and their target miRNAs' expression. Among them, the predicted direct correlation of BRCA1-miR-143-miR-145 pairs was selected for experimental validation. The study results indicated that BRCA1 positively regulates miR-143-miR-145 expression and miR-143-miR-145 can serve as promising novel biomarkers for breast cancer subtyping. In our integrated genomics analysis and experimental validation, a new frame to predict candidate biomarkers of breast cancer subtype is provided and offers assistance in order to understand the potential disease etiology of the breast cancer subtypes.

  11. Correlations of scores on the developmental test of visual-motor integration and copying test in a South African multi-ethnic preschool sample.

    PubMed

    Dunn, Munita; Loxton, Helene; Naidoo, Anthony

    2006-12-01

    This study assessed the intercorrelations of scores on the Developmental Test of Visual-Motor Integration, the locally standardized Copying Test, and teachers' ratings of scholastic skills in a South African multi-ethnic preschool sample. The study also investigated whether cultural and socioeconomic factors might influence test data. Participants were 71 Black, 101 Coloured, and 66 White children attending preschools in a semirural district. Participants' ages ranged from 4 yr., 9 mo. to 7yr., 0 mo. (M=5.8 yr., SD= 0.3 yr.). Analysis yielded a correlation of .75 between the test scores and supports the suitability of the widely used Developmental Test of Visual-Motor Integration in a multi-ethnic sample. Scores on the Copying Test correlated higher with teachers' ratings. However, significant differences in test performance among groups by race and socioeconomic status suggest the rate of perceptual-motor development may be related to cultural factors. Normative data are reported for groups by race and socioeconomic status.

  12. Integrative analysis of copy number and gene expression in breast cancer using formalin-fixed paraffin-embedded core biopsy tissue: a feasibility study.

    PubMed

    Iddawela, Mahesh; Rueda, Oscar; Eremin, Jenny; Eremin, Oleg; Cowley, Jed; Earl, Helena M; Caldas, Carlos

    2017-07-11

    An absence of reliable molecular markers has hampered individualised breast cancer treatments, and a major limitation for translational research is the lack of fresh tissue. There are, however, abundant banks of formalin-fixed paraffin-embedded (FFPE) tissue. This study evaluated two platforms available for the analysis of DNA copy number and gene expression using FFPE samples. The cDNA-mediated annealing, selection, extension, and ligation assay (DASL™) has been developed for gene expression analysis and the Molecular Inversion Probes assay (Oncoscan™), were used for copy number analysis using FFPE tissues. Gene expression and copy number were evaluated in core-biopsy samples from patients with breast cancer undergoing neoadjuvant chemotherapy (NAC). Forty-three core-biopsies were evaluated and characteristic copy number changes in breast cancers, gains in 1q, 8q, 11q, 17q and 20q and losses in 6q, 8p, 13q and 16q, were confirmed. Regions that frequently exhibited gains in tumours showing a pathological complete response (pCR) to NAC were 1q (55%), 8q (40%) and 17q (40%), whereas 11q11 (37%) gain was the most frequent change in non-pCR tumours. Gains associated with poor survival were 11q13 (62%), 8q24 (54%) and 20q (47%). Gene expression assessed by DASL correlated with immunohistochemistry (IHC) analysis for oestrogen receptor (ER) [area under the curve (AUC) = 0.95], progesterone receptor (PR)(AUC = 0.90) and human epidermal growth factor type-2 receptor (HER-2) (AUC = 0.96). Differential expression analysis between ER+ and ER- cancers identified over-expression of TTF1, LAF-4 and C-MYB (p ≤ 0.05), and between pCR vs non-pCRs, over-expression of CXCL9, AREG, B-MYB and under-expression of ABCG2. This study was an integrative analysis of copy number and gene expression using FFPE core biopsies and showed that molecular marker data from FFPE tissues were consistent with those in previous studies using fresh-frozen samples. FFPE tissue can provide

  13. Integrating natural language processing expertise with patient safety event review committees to improve the analysis of medication events.

    PubMed

    Fong, Allan; Harriott, Nicole; Walters, Donna M; Foley, Hanan; Morrissey, Richard; Ratwani, Raj R

    2017-08-01

    Many healthcare providers have implemented patient safety event reporting systems to better understand and improve patient safety. Reviewing and analyzing these reports is often time consuming and resource intensive because of both the quantity of reports and length of free-text descriptions in the reports. Natural language processing (NLP) experts collaborated with clinical experts on a patient safety committee to assist in the identification and analysis of medication related patient safety events. Different NLP algorithmic approaches were developed to identify four types of medication related patient safety events and the models were compared. Well performing NLP models were generated to categorize medication related events into pharmacy delivery delays, dispensing errors, Pyxis discrepancies, and prescriber errors with receiver operating characteristic areas under the curve of 0.96, 0.87, 0.96, and 0.81 respectively. We also found that modeling the brief without the resolution text generally improved model performance. These models were integrated into a dashboard visualization to support the patient safety committee review process. We demonstrate the capabilities of various NLP models and the use of two text inclusion strategies at categorizing medication related patient safety events. The NLP models and visualization could be used to improve the efficiency of patient safety event data review and analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Understanding Oceanic Anoxic Events: An Integrated Geochemical Approach

    NASA Astrophysics Data System (ADS)

    Cohen, A. S.; Coe, A. L.; Kemp, D. B.; Pearce, C. R.

    2007-12-01

    Discrete intervals of widespread organic carbon accumulation, termed Oceanic Anoxic Events (OAEs), occurred at a few relatively brief intervals during the Mesozoic. Recent studies have shown that these events took place at the same time as other substantial environmental changes that included global warming, ocean acidification, and unusually high levels of species extinctions. However, many factors relating to the behaviour of the Earth System during OAEs remain unclear. These include: The primary driving mechanism(s) - was there one common mechanism or were OAEs the result of different processes; the spatial and temporal extent of seawater anoxia during OAEs; the precise effects on marine and terrestrial biota; variations in atmospheric CO2 and global temperature; and the mechanism and timescale of Earth's recovery process. The records of environmental change during OAEs are best preserved in marine deposits, with continental shelf sections being particularly well studied. The combined use of geochemical, sedimentological and palaeontological observations indicates a complex interplay of factors. Significant advances in our understanding of OAEs have taken place in the last decade or so using new geochemical and isotopic proxies and a high- resolution, multidisciplinary approach. For example, Sr- and Os-isotope data indicate that rates of chemical weathering increased markedly during the Toarcian (Early Jurassic) OAE, whilst Mo-isotope data suggest that the areal extent of seawater anoxia fluctuated during the OAE despite the persistence of euxinic conditions in some regions. The pattern of Mo-isotope data for the Toarcian contrasts strongly with new Mo-isotope results from the Kimmeridge Clay Formation (Late Jurassic), when anoxic conditions were confined to European epicontinental seas and were likely to have resulted from very different primary causes. Cyclostratigraphic analysis has been used to provide a temporal framework for the timescale of OAEs at sub

  15. Integrating event detection system operation characteristics into sensor placement optimization.

    SciTech Connect

    Hart, William Eugene; McKenna, Sean Andrew; Phillips, Cynthia Ann; Murray, Regan Elizabeth; Hart, David Blaine

    2010-05-01

    We consider the problem of placing sensors in a municipal water network when we can choose both the location of sensors and the sensitivity and specificity of the contamination warning system. Sensor stations in a municipal water distribution network continuously send sensor output information to a centralized computing facility, and event detection systems at the control center determine when to signal an anomaly worthy of response. Although most sensor placement research has assumed perfect anomaly detection, signal analysis software has parameters that control the tradeoff between false alarms and false negatives. We describe a nonlinear sensor placement formulation, which we heuristically optimize with a linear approximation that can be solved as a mixed-integer linear program. We report the results of initial experiments on a real network and discuss tradeoffs between early detection of contamination incidents, and control of false alarms.

  16. Integrative analysis of DNA copy number and gene expression in metastatic oral squamous cell carcinoma identifies genes associated with poor survival

    PubMed Central

    2010-01-01

    Background Lymphotropism in oral squamous cell carcinoma (OSCC) is one of the most important prognostic factors of 5-year survival. In an effort to identify genes that may be responsible for the initiation of OSCC lymphotropism, we examined DNA copy number gains and losses and corresponding gene expression changes from tumor cells in metastatic lymph nodes of patients with OSCC. Results We performed integrative analysis of DNA copy number alterations (CNA) and corresponding mRNA expression from OSCC cells isolated from metastatic lymph nodes of 20 patients using Affymetrix 250 K Nsp I SNP and U133 Plus 2.0 arrays, respectively. Overall, genome CNA accounted for expression changes in 31% of the transcripts studied. Genome region 11q13.2-11q13.3 shows the highest correlation between DNA CNA and expression. With a false discovery rate < 1%, 530 transcripts (461 genes) demonstrated a correlation between CNA and expression. Among these, we found two subsets that were significantly associated with OSCC (n = 122) when compared to controls, and with survival (n = 27), as tested using an independent dataset with genome-wide expression profiles for 148 primary OSCC and 45 normal oral mucosa. We fit Cox models to calculate a principal component analysis-derived risk-score for these two gene sets ('122-' or '27-transcript PC'). The models combining the 122- or 27-transcript PC with stage outperformed the model using stage alone in terms of the Area Under the Curve (AUC = 0.82 or 0.86 vs. 0.72, with p = 0.044 or 0.011, respectively). Conclusions Genes exhibiting CNA-correlated expression may have biological impact on carcinogenesis and cancer progression in OSCC. Determination of copy number-associated transcripts associated with clinical outcomes in tumor cells with an aggressive phenotype (i.e., cells metastasized to the lymph nodes) can help prioritize candidate transcripts from high-throughput data for further studies. PMID:20537188

  17. Integration of mRNA expression profile, copy number alterations, and microRNA expression levels in breast cancer to improve grade definition.

    PubMed

    Cava, Claudia; Bertoli, Gloria; Ripamonti, Marilena; Mauri, Giancarlo; Zoppis, Italo; Della Rosa, Pasquale Anthony; Gilardi, Maria Carla; Castiglioni, Isabella

    2014-01-01

    Defining the aggressiveness and growth rate of a malignant cell population is a key step in the clinical approach to treating tumor disease. The correct grading of breast cancer (BC) is a fundamental part in determining the appropriate treatment. Biological variables can make it difficult to elucidate the mechanisms underlying BC development. To identify potential markers that can be used for BC classification, we analyzed mRNAs expression profiles, gene copy numbers, microRNAs expression and their association with tumor grade in BC microarray-derived datasets. From mRNA expression results, we found that grade 2 BC is most likely a mixture of grade 1 and grade 3 that have been misclassified, being described by the gene signature of either grade 1 or grade 3. We assessed the potential of the new approach of integrating mRNA expression profile, copy number alterations, and microRNA expression levels to select a limited number of genomic BC biomarkers. The combination of mRNA profile analysis and copy number data with microRNA expression levels led to the identification of two gene signatures of 42 and 4 altered genes (FOXM1, KPNA4, H2AFV and DDX19A) respectively, the latter obtained through a meta-analytical procedure. The 42-based gene signature identifies 4 classes of up- or down-regulated microRNAs (17 microRNAs) and of their 17 target mRNA, and the 4-based genes signature identified 4 microRNAs (Hsa-miR-320d, Hsa-miR-139-5p, Hsa-miR-567 and Hsa-let-7c). These results are discussed from a biological point of view with respect to pathological features of BC. Our identified mRNAs and microRNAs were validated as prognostic factors of BC disease progression, and could potentially facilitate the implementation of assays for laboratory validation, due to their reduced number.

  18. Competency Based Competitive Events. Integrating DECA into the DE Instructional Program.

    ERIC Educational Resources Information Center

    Cosgrove, Glenna; Moore, Harold W.

    Designed to be integrated into a competency-based distributive education program, these competitive DECA (Distributive Education Clubs of America) events were developed, utilized, and evaluated by distributive education and cooperative education coordinators in Arkansas. These events are organized under the following occupational categories: food…

  19. Integrated analysis of somatic mutations and focal copy-number changes identifies key genes and pathways in hepatocellular carcinoma

    PubMed Central

    Guichard, Cécile; Amaddeo, Giuliana; Imbeaud, Sandrine; Ladeiro, Yannick; Pelletier, Laura; Maad, Ichrafe Ben; Calderaro, Julien; Bioulac-Sage, Paulette; Letexier, Mélanie; Degos, Françoise; Clément, Bruno; Balabaud, Charles; Chevet, Eric; Laurent, Alexis; Couchy, Gabrielle; Letouzé, Eric; Calvo, Fabien; Zucman-Rossi, Jessica

    2012-01-01

    Hepatocellular carcinoma (HCC) is the most common primary liver malignancy. High-resolution copy number analysis of 125 tumors of which 24 were subjected to whole-exome sequencing identified 135 homozygous deletions and 994 somatic gene mutations with predicted functional consequences. We identified new recurrent alterations in 6 genes (ARID1A, RPS6KA3, NFE2L2, IRF2, CDH8 and PROKR2) not previously described in HCC. Functional analyses demonstrated tumor suppressor properties for IRF2 whose inactivation, exclusively found in hepatitis B virus related tumors, leads to impaired TP53 function. Alternatively, inactivation of proteins involved in chromatin remodeling was frequent and predominant in alcohol related tumors. Moreover, activation of the oxidative stress metabolism and inactivation of RPS6KA3 were new pathways associated with WNT/β-catenin activation, thereby suggesting a cooperative effect in tumorigenesis. This study shows the dramatic somatic genetic diversity in HCC, it reveals interactions between oncogene and tumor suppressor gene mutations markedly related to specific risk factors. PMID:22561517

  20. Conceptual Integration of Arithmetic Operations with Real-World Knowledge: Evidence from Event-Related Potentials

    ERIC Educational Resources Information Center

    Guthormsen, Amy M.; Fisher, Kristie J.; Bassok, Miriam; Osterhout, Lee; DeWolf, Melissa; Holyoak, Keith J.

    2016-01-01

    Research on language processing has shown that the disruption of conceptual integration gives rise to specific patterns of event-related brain potentials (ERPs)--N400 and P600 effects. Here, we report similar ERP effects when adults performed cross-domain conceptual integration of analogous semantic and mathematical relations. In a problem-solving…

  1. Conceptual Integration of Arithmetic Operations with Real-World Knowledge: Evidence from Event-Related Potentials

    ERIC Educational Resources Information Center

    Guthormsen, Amy M.; Fisher, Kristie J.; Bassok, Miriam; Osterhout, Lee; DeWolf, Melissa; Holyoak, Keith J.

    2016-01-01

    Research on language processing has shown that the disruption of conceptual integration gives rise to specific patterns of event-related brain potentials (ERPs)--N400 and P600 effects. Here, we report similar ERP effects when adults performed cross-domain conceptual integration of analogous semantic and mathematical relations. In a problem-solving…

  2. Integrating optical finger motion tracking with surface touch events.

    PubMed

    MacRitchie, Jennifer; McPherson, Andrew P

    2015-01-01

    This paper presents a method of integrating two contrasting sensor systems for studying human interaction with a mechanical system, using piano performance as the case study. Piano technique requires both precise small-scale motion of fingers on the key surfaces and planned large-scale movement of the hands and arms. Where studies of performance often focus on one of these scales in isolation, this paper investigates the relationship between them. Two sensor systems were installed on an acoustic grand piano: a monocular high-speed camera tracking the position of painted markers on the hands, and capacitive touch sensors attach to the key surfaces which measure the location of finger-key contacts. This paper highlights a method of fusing the data from these systems, including temporal and spatial alignment, segmentation into notes and automatic fingering annotation. Three case studies demonstrate the utility of the multi-sensor data: analysis of finger flexion or extension based on touch and camera marker location, timing analysis of finger-key contact preceding and following key presses, and characterization of individual finger movements in the transitions between successive key presses. Piano performance is the focus of this paper, but the sensor method could equally apply to other fine motor control scenarios, with applications to human-computer interaction.

  3. Integrating optical finger motion tracking with surface touch events

    PubMed Central

    MacRitchie, Jennifer; McPherson, Andrew P.

    2015-01-01

    This paper presents a method of integrating two contrasting sensor systems for studying human interaction with a mechanical system, using piano performance as the case study. Piano technique requires both precise small-scale motion of fingers on the key surfaces and planned large-scale movement of the hands and arms. Where studies of performance often focus on one of these scales in isolation, this paper investigates the relationship between them. Two sensor systems were installed on an acoustic grand piano: a monocular high-speed camera tracking the position of painted markers on the hands, and capacitive touch sensors attach to the key surfaces which measure the location of finger-key contacts. This paper highlights a method of fusing the data from these systems, including temporal and spatial alignment, segmentation into notes and automatic fingering annotation. Three case studies demonstrate the utility of the multi-sensor data: analysis of finger flexion or extension based on touch and camera marker location, timing analysis of finger-key contact preceding and following key presses, and characterization of individual finger movements in the transitions between successive key presses. Piano performance is the focus of this paper, but the sensor method could equally apply to other fine motor control scenarios, with applications to human-computer interaction. PMID:26082732

  4. Single-Event Upset and Snapback in Silicon-on-Insulator Devices and Integrated Circuits

    SciTech Connect

    DODD,PAUL E.; SHANEYFELT,MARTY R.; WALSH,DAVID S.; SCHWANK,JAMES R.; HASH,GERALD L.; LOEMKER,RHONDA ANN; DRAPER,BRUCE L.; WINOKUR,PETER S.

    2000-08-15

    The characteristics Of ion-induced charge collection and single-event upset are studied in SOI transistors and circuits with various body tie structures. Impact ionization effects including single-event snapback are shown to be very important. Focused ion microbeam experiments are used to find single-event snapback drain voltage thresholds in n-channel SOI transistors as a function of device width. Three-Dimensional device simulations are used to determine single-event upset and snapback thresholds in SOI SRAMS, and to study design tradeoffs for various body-tie structures. A window of vulnerability to single-event snapback is shown to exist below the single-event upset threshold. The presence of single-event snapback in commercial SOI SRAMS is confirmed through broadbeam ion testing, and implications for hardness assurance testing of SOI integrated circuits are discussed.

  5. The single-event effect evaluation technology for nano integrated circuits

    NASA Astrophysics Data System (ADS)

    Hongchao, Zheng; Yuanfu, Zhao; Suge, Yue; Long, Fan; Shougang, Du; Maoxin, Chen; Chunqing, Yu

    2015-11-01

    Single-event effects of nano scale integrated circuits are investigated. Evaluation methods for single-event transients, single-event upsets, and single-event functional interrupts in nano circuits are summarized and classified in detail. The difficulties in SEE testing are discussed as well as the development direction of test technology, with emphasis placed on the experimental evaluation of a nano circuit under heavy ion, proton, and laser irradiation. The conclusions in this paper are based on many years of testing at accelerator facilities and our present understanding of the mechanisms for SEEs, which have been well verified experimentally.

  6. Human telomeres that carry an integrated copy of human herpesvirus 6 are often short and unstable, facilitating release of the viral genome from the chromosome.

    PubMed

    Huang, Yan; Hidalgo-Bravo, Alberto; Zhang, Enjie; Cotton, Victoria E; Mendez-Bermudez, Aaron; Wig, Gunjan; Medina-Calzada, Zahara; Neumann, Rita; Jeffreys, Alec J; Winney, Bruce; Wilson, James F; Clark, Duncan A; Dyer, Martin J; Royle, Nicola J

    2014-01-01

    Linear chromosomes are stabilized by telomeres, but the presence of short dysfunctional telomeres triggers cellular senescence in human somatic tissues, thus contributing to ageing. Approximately 1% of the population inherits a chromosomally integrated copy of human herpesvirus 6 (CI-HHV-6), but the consequences of integration for the virus and for the telomere with the insertion are unknown. Here we show that the telomere on the distal end of the integrated virus is frequently the shortest measured in somatic cells but not the germline. The telomere carrying the CI-HHV-6 is also prone to truncations that result in the formation of a short telomere at a novel location within the viral genome. We detected extra-chromosomal circular HHV-6 molecules, some surprisingly comprising the entire viral genome with a single fully reconstituted direct repeat region (DR) with both terminal cleavage and packaging elements (PAC1 and PAC2). Truncated CI-HHV-6 and extra-chromosomal circular molecules are likely reciprocal products that arise through excision of a telomere-loop (t-loop) formed within the CI-HHV-6 genome. In summary, we show that the CI-HHV-6 genome disrupts stability of the associated telomere and this facilitates the release of viral sequences as circular molecules, some of which have the potential to become fully functioning viruses.

  7. Expression of a chromosomally integrated, single-copy GFP gene in Candida albicans, and its use as a reporter of gene regulation.

    PubMed

    Morschhäuser, J; Michel, S; Hacker, J

    1998-02-01

    Genetically engineered versions of the GFP gene, which encodes the green fluorescent protein of Aequorea victoria, were placed under the control of the constitutively active Candida albicans ACT1 promoter and integrated in single copy into the genome of this pathogenic yeast. Integrative transformants in which one of the two ACT1 alleles had been replaced by a GFP gene exhibited a homogeneous, constitutive fluorescent phenotype. Cells expressing GFP with the wild-type chromophore exhibited very weak fluorescence compared to those GFP proteins with the S65T or S65A, V68L, S72A (GFPmut2) chromophore mutations. Substitution of the CTG codon, which specifies serine instead of leucine in C. albicans, by TTG was absolutely necessary for GFP expression. Although GFP mRNA levels in cells containing a GFP gene with the CTG codon were comparable to those of transformants containing GFP with the TTG substitution, only the latter produced GFP protein, as detected by Western blotting, suggesting that the frequent failure to express heterologous genes in C. albicans is principally due to the noncanonical codon usage. Transformants expressing the modified GFP gene from the promoter of the SAP2 gene, which encodes one of the secreted acid proteinases of C. albicans, showed fluorescence only under conditions which promote proteinase expression, thereby demonstrating the utility of stable, chromosomally integrated GFP reporter genes for the study of gene activation in C. albicans.

  8. Genomic integration of oncogenic HPV and gain of the human telomerase gene TERC at 3q26 are strongly associated events in the progression of uterine cervical dysplasia to invasive cancer.

    PubMed

    Hopman, A H N; Theelen, W; Hommelberg, P P H; Kamps, M A F; Herrington, C S; Morrison, L E; Speel, E-J M; Smedts, F; Ramaekers, F C S

    2006-12-01

    Recently proposed events associated with the progression of cervical intraepithelial neoplasia (CIN) 2/3 to cervical carcinoma include integration of human papillomavirus (HPV) into the host genome, genomic instability, and an increase in chromosome 3q copy number. In particular, the gene coding for the RNA component of telomerase (TERC) at 3q26 has been implicated as a possible candidate gene. Since it is not known to date how these events are temporally related during cervical carcinogenesis, the aim of the present study was to assess the correlation between TERC gene copy number and the physical status of HPV during progression in cervical neoplasia. Solitary precursor lesions of the uterine cervix (CIN 2/3, n = 17), lesions associated with a micro-invasive carcinoma (CIN 3&mCA, n = 13), and advanced invasive carcinomas (invCA, n = 7) were analysed by fluorescence in situ hybridization (FISH) to determine the physical status of the virus and TERC gene copy number. The TERC gene was increasingly gained with progression of CIN 2/3 (3 of 17) through CIN 3&mCA (7 of 13) to invCA (5 of 7). In the lesions exhibiting gain of TERC, the virus was predominantly integrated. This was seen in eight of ten diploid lesions, indicating that these events can occur prior to aneuploidization and are strongly associated with the progression of CIN 3 to mCA and invCA (p < 0.001). With progression to carcinoma, a number of these lesions show polyploidization, resulting in aneuploidy and high TERC gene copy numbers. In conclusion, genomic integration of oncogenic HPV and gain of the human telomerase gene TERC appear to be important associated genetic events in the progression of uterine cervical dysplasia to invasive cancer.

  9. Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

    PubMed

    Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

    2009-11-25

    Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

  10. Integrative genomics identifies distinct molecular classes of neuroblastoma and shows that multiple genes are targeted by regional alterations in DNA copy number.

    PubMed

    Wang, Qun; Diskin, Sharon; Rappaport, Eric; Attiyeh, Edward; Mosse, Yael; Shue, Daniel; Seiser, Eric; Jagannathan, Jayanti; Shusterman, Suzanne; Bansal, Manisha; Khazi, Deepa; Winter, Cynthia; Okawa, Erin; Grant, Gregory; Cnaan, Avital; Zhao, Huaqing; Cheung, Nai-Kong; Gerald, William; London, Wendy; Matthay, Katherine K; Brodeur, Garrett M; Maris, John M

    2006-06-15

    Neuroblastoma is remarkable for its clinical heterogeneity and is characterized by genomic alterations that are strongly correlated with tumor behavior. The specific genes that influence neuroblastoma biology and are targeted by genomic alterations remain largely unknown. We quantified mRNA expression in a highly annotated series of 101 prospectively collected diagnostic neuroblastoma primary tumors using an oligonucleotide-based microarray. Genomic copy number status at the prognostically relevant loci 1p36, 2p24 (MYCN), 11q23, and 17q23 was determined by PCR and was aberrant in 26, 20, 40, and 38 cases, respectively. In addition, 72 diagnostic neuroblastoma primary tumors assayed in a different laboratory were used as an independent validation set. Unsupervised hierarchical clustering showed that gene expression was highly correlated with genomic alterations and clinical markers of tumor behavior. The vast majority of samples with MYCN amplification and 1p36 loss of heterozygosity (LOH) clustered together on a terminal node of the sample dendrogram, whereas the majority of samples with 11q deletion clustered separately and both of these were largely distinct from the copy number neutral group of tumors. Genes involved in neurodevelopment were broadly overrepresented in the more benign tumors, whereas genes involved in RNA processing and cellular proliferation were highly represented in the most malignant cases. By combining transcriptomic and genomic data, we showed that LOH at 1p and 11q was associated with significantly decreased expression of 122 (61%) and 88 (27%) of the genes mapping to 1p35-36 and all of 11q, respectively, suggesting that multiple genes may be targeted by LOH events. A total of 71 of the 1p35-36 genes were also differentially expressed in the independent validation data set, providing a prioritized list of candidate neuroblastoma suppressor genes. Taken together, these data are consistent with the hypotheses that the neuroblastoma

  11. Event based self-supervised temporal integration for multimodal sensor data.

    PubMed

    Barakova, Emilia I; Lourens, Tino

    2005-06-01

    A method for synergistic integration of multimodal sensor data is proposed in this paper. This method is based on two aspects of the integration process: (1) achieving synergistic integration of two or more sensory modalities, and (2) fusing the various information streams at particular moments during processing. Inspired by psychophysical experiments, we propose a self-supervised learning method for achieving synergy with combined representations. Evidence from temporal registration and binding experiments indicates that different cues are processed individually at specific time intervals. Therefore, an event-based temporal co-occurrence principle is proposed for the integration process. This integration method was applied to a mobile robot exploring unfamiliar environments. Simulations showed that integration enhanced route recognition with many perceptual similarities; moreover, they indicate that a perceptual hierarchy of knowledge about instant movement contributes significantly to short-term navigation, but that visual perceptions have bigger impact over longer intervals.

  12. Asynchronous Periodic Edge-Event Triggered Control for Double-Integrator Networks With Communication Time Delays.

    PubMed

    Duan, Gaopeng; Xiao, Feng; Wang, Long

    2017-01-23

    This paper focuses on the average consensus of double-integrator networked systems based on the asynchronous periodic edge-event triggered control. The asynchronous property lies in the edge event-detecting procedure. For different edges, their event detections are performed at different times and the corresponding events occur independently of each other. When an event is activated, the two adjacent agents connected by the corresponding link sample their relative state information and update their controllers. The application of incidence matrix facilitates the transformation of control objects from the agent-based to the edge-based. Practically, due to the constraints of network bandwidth and communication distance, agents usually cannot receive the instantaneous information of some others, which has an impact on the system performance. Hence, it is necessary to investigate the presence of communication time delays. For double-integrator multiagent systems with and without communication time delays, the average state consensus can be asynchronously achieved by designing appropriate parameters under the proposed event-detecting rules. The presented results specify the relationship among the maximum allowable time delays, interaction topologies, and event-detecting periods. Furthermore, the proposed protocols have the advantages of reduced communication costs and controller-updating costs. Simulation examples are given to illustrate the proposed theoretical results.

  13. An integrated graphic data display improves detection and identification of critical events during anesthesia.

    PubMed

    Michels, P; Gravenstein, D; Westenskow, D R

    1997-07-01

    To show that an integrated graphic data display can shorten the time taken to detect and correctly identify critical events during anesthesia. We developed a graphic display which presents 30 anesthesia-related physiologic variables as shapes and colors, rather than traditional digits and waveforms. To evaluate the new display, we produced four critical events on a computer-based anesthesia simulator and asked two groups of five anesthesiologists to identify the events as quickly as possible. One group observed the new display while the other group viewed a traditional cardiovascular monitor with digital and waveform displays. The group which observed the integrated graphic display saw changes caused by inadequate paralysis 2.4 min sooner, and changes caused by a cuff leak 3.1 min sooner than those observing the traditional display. The integrated display group correctly identified the reason for the change 2.8 min sooner for inadequate paralysis, 3.1 min sooner for cuff leak and 3.1 min sooner for bleeding. These differences were all statistically significant. The results show that some simulated critical events are detected and correctly identified sooner, when an anesthesiologist views an integrated graphic display, rather than a traditional digital/waveform monitor.

  14. Event-Related Potential Indicators of Text Integration across Sentence Boundaries

    ERIC Educational Resources Information Center

    Yang, Chin Lung; Perfetti, Charles A.; Schmalhofer, Franz

    2007-01-01

    An event-related potentials (ERPs) study examined word-to-text integration processes across sentence boundaries. In a two-sentence passage, the accessibility of a referent for the first content word of the second sentence (the target word) was varied by the wording of the first sentence in one of the following ways: lexically (explicitly using…

  15. Non-canonical integration events in Pichia pastoris encountered during standard transformation analysed with genome sequencing

    PubMed Central

    Schwarzhans, Jan-Philipp; Wibberg, Daniel; Winkler, Anika; Luttermann, Tobias; Kalinowski, Jörn; Friehs, Karl

    2016-01-01

    The non-conventional yeast Pichia pastoris is a popular host for recombinant protein production in scientific research and industry. Typically, the expression cassette is integrated into the genome via homologous recombination. Due to unknown integration events, a large clonal variability is often encountered consisting of clones with different productivities as well as aberrant morphological or growth characteristics. In this study, we analysed several clones with abnormal colony morphology and discovered unpredicted integration events via whole genome sequencing. These include (i) the relocation of the locus targeted for replacement to another chromosome (ii) co-integration of DNA from the E. coli plasmid host and (iii) the disruption of untargeted genes affecting colony morphology. Most of these events have not been reported so far in literature and present challenges for genetic engineering approaches in this yeast. Especially, the presence and independent activity of E. coli DNA elements in P. pastoris is of concern. In our study, we provide a deeper insight into these events and their potential origins. Steps preventing or reducing the risk for these phenomena are proposed and will help scientists working on genetic engineering of P. pastoris or similar non-conventional yeast to better understand and control clonal variability. PMID:27958335

  16. 19 CFR 133.42 - Infringing copies or phonorecords.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ...) Referral to the U.S. Attorney. In the event that phonorecords or copies of motion pictures arrive in the U... trafficking in counterfeit labels for phonorecords or copies of motion pictures or other audiovisual works...

  17. Acquired copy-neutral loss of heterozygosity of chromosome 1p as a molecular event associated with marrow fibrosis in MPL-mutated myeloproliferative neoplasms.

    PubMed

    Rumi, Elisa; Pietra, Daniela; Guglielmelli, Paola; Bordoni, Roberta; Casetti, Ilaria; Milanesi, Chiara; Sant'Antonio, Emanuela; Ferretti, Virginia; Pancrazzi, Alessandro; Rotunno, Giada; Severgnini, Marco; Pietrelli, Alessandro; Astori, Cesare; Fugazza, Elena; Pascutto, Cristiana; Boveri, Emanuela; Passamonti, Francesco; De Bellis, Gianluca; Vannucchi, Alessandro; Cazzola, Mario

    2013-05-23

    We studied mutations of MPL exon 10 in patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF), first investigating a cohort of 892 consecutive patients. MPL mutation scanning was performed on granulocyte genomic DNA by using a high-resolution melt assay, and the mutant allele burden was evaluated by using deep sequencing. Somatic mutations of MPL, all but one involving codon W515, were detected in 26/661 (4%) patients with ET, 10/187 (5%) with PMF, and 7/44 (16%) patients with post-ET myelofibrosis. Comparison of JAK2 (V617F)-mutated and MPL-mutated patients showed only minor phenotypic differences. In an extended group of 62 MPL-mutated patients, the granulocyte mutant allele burden ranged from 1% to 95% and was significantly higher in patients with PMF or post-ET myelofibrosis compared with those with ET. Patients with higher mutation burdens had evidence of acquired copy-neutral loss of heterozygosity (CN-LOH) of chromosome 1p in granulocytes, consistent with a transition from heterozygosity to homozygosity for the MPL mutation in clonal cells. A significant association was found between MPL-mutant allele burden greater than 50% and marrow fibrosis. These observations suggest that acquired CN-LOH of chromosome 1p involving the MPL location may represent a molecular mechanism of fibrotic transformation in MPL-mutated myeloproliferative neoplasms.

  18. Acquired copy-neutral loss of heterozygosity of chromosome 1p as a molecular event associated with marrow fibrosis in MPL-mutated myeloproliferative neoplasms

    PubMed Central

    Pietra, Daniela; Guglielmelli, Paola; Bordoni, Roberta; Casetti, Ilaria; Milanesi, Chiara; Sant’Antonio, Emanuela; Ferretti, Virginia; Pancrazzi, Alessandro; Rotunno, Giada; Severgnini, Marco; Pietrelli, Alessandro; Astori, Cesare; Fugazza, Elena; Pascutto, Cristiana; Boveri, Emanuela; Passamonti, Francesco; De Bellis, Gianluca; Vannucchi, Alessandro; Cazzola, Mario

    2013-01-01

    We studied mutations of MPL exon 10 in patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF), first investigating a cohort of 892 consecutive patients. MPL mutation scanning was performed on granulocyte genomic DNA by using a high-resolution melt assay, and the mutant allele burden was evaluated by using deep sequencing. Somatic mutations of MPL, all but one involving codon W515, were detected in 26/661 (4%) patients with ET, 10/187 (5%) with PMF, and 7/44 (16%) patients with post-ET myelofibrosis. Comparison of JAK2 (V617F)–mutated and MPL-mutated patients showed only minor phenotypic differences. In an extended group of 62 MPL-mutated patients, the granulocyte mutant allele burden ranged from 1% to 95% and was significantly higher in patients with PMF or post-ET myelofibrosis compared with those with ET. Patients with higher mutation burdens had evidence of acquired copy-neutral loss of heterozygosity (CN-LOH) of chromosome 1p in granulocytes, consistent with a transition from heterozygosity to homozygosity for the MPL mutation in clonal cells. A significant association was found between MPL-mutant allele burden greater than 50% and marrow fibrosis. These observations suggest that acquired CN-LOH of chromosome 1p involving the MPL location may represent a molecular mechanism of fibrotic transformation in MPL-mutated myeloproliferative neoplasms. PMID:23575445

  19. Copy number gain of chromosome 3q is a recurrent event in patients with intraductal papillary mucinous neoplasm (IPMN) associated with disease progression

    PubMed Central

    Astolfi, Annalisa; Grassi, Elisa; Casadei, Riccardo; Santini, Donatella; Panzacchi, Riccardo; Ricci, Claudio; Serravalle, Salvatore; Tarantino, Giuseppe; Falconi, Mirella; Teti, Gabriella; Indio, Valentina; Pession, Andrea; Minni, Francesco; Biasco, Guido; Di Marco, Mariacristina

    2016-01-01

    Background Intraductal papillary mucinous neoplasm (IPMN) is the most common cystic preneoplastic lesion of pancreatic cancer. We used an approach coupling high resolution cytogenetic analysis (Affymetrix Oncoscan FFPE Array) with clinically-oriented bioinformatic interpretation of data to understand the most relevant alterations of precursor lesions at different stages to identify new diagnostic markers. Results We identified multiple copy number alterations, particularly in lesions with severe dysplasia, with 7 IPMN with low-intermediate dysplasia carrying a nearly normal karyotype and 13 IPMN with complex Karyotype (> 4 alterations), showing high grade dysplasia. A specific gain of chromosome arm 3q was found in IPMN with complex Karyotype (92%). This gain of 3q is particularly interesting for the presence of oncogenes such as PIK3CA, GATA2 and TERC that are part of pathways that deregulate cell growth and promote disease progression. Quantitative PCR and FISH analysis confirmed the data. Further demonstration of the overexpression of the PIK3CA gene supports the identification of this alteration as a possible biomarker in the early identification of patients with IPMN at higher risk for disease progression. Materials and methods High resolution cytogenetic analysis was performed in 20 formalin fixed paraffin embedded samples of IPMN by Oncoscan FFPE assay. Results were validated by qPCR and FISH analysis. Conclusions The identification of these markers at an early stage of disease onset could help to identify patients at risk for cancer progression and new candidates for a more specific targeted therapy. PMID:27566563

  20. GPHMM: an integrated hidden Markov model for identification of copy number alteration and loss of heterozygosity in complex tumor samples using whole genome SNP arrays

    PubMed Central

    Li, Ao; Liu, Zongzhi; Lezon-Geyda, Kimberly; Sarkar, Sudipa; Lannin, Donald; Schulz, Vincent; Krop, Ian; Winer, Eric; Harris, Lyndsay; Tuck, David

    2011-01-01

    There is an increasing interest in using single nucleotide polymorphism (SNP) genotyping arrays for profiling chromosomal rearrangements in tumors, as they allow simultaneous detection of copy number and loss of heterozygosity with high resolution. Critical issues such as signal baseline shift due to aneuploidy, normal cell contamination, and the presence of GC content bias have been reported to dramatically alter SNP array signals and complicate accurate identification of aberrations in cancer genomes. To address these issues, we propose a novel Global Parameter Hidden Markov Model (GPHMM) to unravel tangled genotyping data generated from tumor samples. In contrast to other HMM methods, a distinct feature of GPHMM is that the issues mentioned above are quantitatively modeled by global parameters and integrated within the statistical framework. We developed an efficient EM algorithm for parameter estimation. We evaluated performance on three data sets and show that GPHMM can correctly identify chromosomal aberrations in tumor samples containing as few as 10% cancer cells. Furthermore, we demonstrated that the estimation of global parameters in GPHMM provides information about the biological characteristics of tumor samples and the quality of genotyping signal from SNP array experiments, which is helpful for data quality control and outlier detection in cohort studies. PMID:21398628

  1. Integrated Copy Number and Expression Analysis Identifies Profiles of Whole-Arm Chromosomal Alterations and Subgroups with Favorable Outcome in Ovarian Clear Cell Carcinomas

    PubMed Central

    Uehara, Yuriko; Oda, Katsutoshi; Ikeda, Yuji; Koso, Takahiro; Tsuji, Shingo; Yamamoto, Shogo; Asada, Kayo; Sone, Kenbun; Kurikawa, Reiko; Makii, Chinami; Hagiwara, Otoe; Tanikawa, Michihiro; Maeda, Daichi; Hasegawa, Kosei; Nakagawa, Shunsuke; Wada-Hiraike, Osamu; Kawana, Kei; Fukayama, Masashi; Fujiwara, Keiichi; Yano, Tetsu; Osuga, Yutaka; Fujii, Tomoyuki; Aburatani, Hiroyuki

    2015-01-01

    Ovarian clear cell carcinoma (CCC) is generally associated with chemoresistance and poor clinical outcome, even with early diagnosis; whereas high-grade serous carcinomas (SCs) and endometrioid carcinomas (ECs) are commonly chemosensitive at advanced stages. Although an integrated genomic analysis of SC has been performed, conclusive views on copy number and expression profiles for CCC are still limited. In this study, we performed single nucleotide polymorphism analysis with 57 epithelial ovarian cancers (31 CCCs, 14 SCs, and 12 ECs) and microarray expression analysis with 55 cancers (25 CCCs, 16 SCs, and 14 ECs). We then evaluated PIK3CA mutations and ARID1A expression in CCCs. SNP array analysis classified 13% of CCCs into a cluster with high frequency and focal range of copy number alterations (CNAs), significantly lower than for SCs (93%, P < 0.01) and ECs (50%, P = 0.017). The ratio of whole-arm to all CNAs was higher in CCCs (46.9%) than SCs (21.7%; P < 0.0001). SCs with loss of heterozygosity (LOH) of BRCA1 (85%) also had LOH of NF1 and TP53, and LOH of BRCA2 (62%) coexisted with LOH of RB1 and TP53. Microarray analysis classified CCCs into three clusters. One cluster (CCC-2, n = 10) showed more favorable prognosis than the CCC-1 and CCC-3 clusters (P = 0.041). Coexistent alterations of PIK3CA and ARID1A were more common in CCC-1 and CCC-3 (7/11, 64%) than in CCC-2 (0/10, 0%; P < 0.01). Being in cluster CCC-2 was an independent favorable prognostic factor in CCC. In conclusion, CCC was characterized by a high ratio of whole-arm CNAs; whereas CNAs in SC were mainly focal, but preferentially caused LOH of well-known tumor suppressor genes. As such, expression profiles might be useful for sub-classification of CCC, and might provide useful information on prognosis. PMID:26043110

  2. Motivation and intention to integrate physical activity into daily school life: the JAM World Record event.

    PubMed

    Vazou, Spyridoula; Vlachopoulos, Symeon P

    2014-11-01

    Research on the motivation of stakeholders to integrate physical activity into daily school life is limited. The purpose was to examine the motivation of stakeholders to participate in a world record physical activity event and whether motivation was associated with future intention to use activity breaks during the daily school life and future participation in a similar event. After the 2012 JAM (Just-a-Minute) World Record event, 686 adults (591 women; 76.1% participated for children <10 years) completed measures of motivational regulations and future intention to (a) use the activity breaks and (b) participate in the event. High intrinsic motivation and low extrinsic motivation and amotivation for participation in the next event were reported. Hierarchical regression analysis, controlling for age, gender, and occupation, showed that intrinsic forms of motivation positively predicted, whereas amotivation negatively predicted, future intention to participate in the event and use the activity breaks. Multivariate analyses of variance revealed that school-related participants were more intrinsically motivated and intended to use the activity breaks and repeat the event more than those who were not affiliated with a school. Nonschool participants reported higher extrinsic motivation and amotivation than school-related participants.

  3. Asymptotic Effectiveness of the Event-Based Sampling according to the Integral Criterion

    PubMed Central

    Miskowicz, Marek

    2007-01-01

    A rapid progress in intelligent sensing technology creates new interest in a development of analysis and design of non-conventional sampling schemes. The investigation of the event-based sampling according to the integral criterion is presented in this paper. The investigated sampling scheme is an extension of the pure linear send-on-delta/level-crossing algorithm utilized for reporting the state of objects monitored by intelligent sensors. The motivation of using the event-based integral sampling is outlined. The related works in adaptive sampling are summarized. The analytical closed-form formulas for the evaluation of the mean rate of event-based traffic, and the asymptotic integral sampling effectiveness, are derived. The simulation results verifying the analytical formulas are reported. The effectiveness of the integral sampling is compared with the related linear send-on-delta/level-crossing scheme. The calculation of the asymptotic effectiveness for common signals, which model the state evolution of dynamic systems in time, is exemplified.

  4. Breaking and Entering: Copying and Copy Protection.

    ERIC Educational Resources Information Center

    Westlake, Wayne; And Others

    1985-01-01

    Describes several commercially-available computer programs which allow users to make copies of "protected" software. Current costs, program features, and ordering information are provided for these "encryption" programs. Also describes a monthly journal (The HARDCORE Computist) which focuses on unlocking copy-protected…

  5. Breaking and Entering: Copying and Copy Protection.

    ERIC Educational Resources Information Center

    Westlake, Wayne; And Others

    1985-01-01

    Describes several commercially-available computer programs which allow users to make copies of "protected" software. Current costs, program features, and ordering information are provided for these "encryption" programs. Also describes a monthly journal (The HARDCORE Computist) which focuses on unlocking copy-protected…

  6. Integral-based event triggering controller design for stochastic LTI systems via convex optimisation

    NASA Astrophysics Data System (ADS)

    Mousavi, S. H.; Marquez, H. J.

    2016-07-01

    The presence of measurement noise in the event-based systems can lower system efficiency both in terms of data exchange rate and performance. In this paper, an integral-based event triggering control system is proposed for LTI systems with stochastic measurement noise. We show that the new mechanism is robust against noise and effectively reduces the flow of communication between plant and controller, and also improves output performance. Using a Lyapunov approach, stability in the mean square sense is proved. A simulated example illustrates the properties of our approach.

  7. Neural bases of event knowledge and syntax integration in comprehension of complex sentences.

    PubMed

    Malaia, Evie; Newman, Sharlene

    2015-01-01

    Comprehension of complex sentences is necessarily supported by both syntactic and semantic knowledge, but what linguistic factors trigger a readers' reliance on a specific system? This functional neuroimaging study orthogonally manipulated argument plausibility and verb event type to investigate cortical bases of the semantic effect on argument comprehension during reading. The data suggest that telic verbs facilitate online processing by means of consolidating the event schemas in episodic memory and by easing the computation of syntactico-thematic hierarchies in the left inferior frontal gyrus. The results demonstrate that syntax-semantics integration relies on trade-offs among a distributed network of regions for maximum comprehension efficiency.

  8. Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

    PubMed

    Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

    2005-11-30

    Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.

  9. An integrated logit model for contamination event detection in water distribution systems.

    PubMed

    Housh, Mashor; Ostfeld, Avi

    2015-05-15

    The problem of contamination event detection in water distribution systems has become one of the most challenging research topics in water distribution systems analysis. Current attempts for event detection utilize a variety of approaches including statistical, heuristics, machine learning, and optimization methods. Several existing event detection systems share a common feature in which alarms are obtained separately for each of the water quality indicators. Unifying those single alarms from different indicators is usually performed by means of simple heuristics. A salient feature of the current developed approach is using a statistically oriented model for discrete choice prediction which is estimated using the maximum likelihood method for integrating the single alarms. The discrete choice model is jointly calibrated with other components of the event detection system framework in a training data set using genetic algorithms. The fusing process of each indicator probabilities, which is left out of focus in many existing event detection system models, is confirmed to be a crucial part of the system which could be modelled by exploiting a discrete choice model for improving its performance. The developed methodology is tested on real water quality data, showing improved performances in decreasing the number of false positive alarms and in its ability to detect events with higher probabilities, compared to previous studies.

  10. Telematics integrated system to perform drugs prescription and administration reducing adverse drug events.

    PubMed

    Iadanza, E; Pettenati, M C; Bianchi, L; Turchi, S; Ciofi, L; Pirri, F; Biffi Gentili, G; Giuli, D

    2012-01-01

    In this paper we present PHARMA 2.0 a telematics integrated system aimed at reducing Adverse Drug Events (ADEs) in the phases of drug prescription, transcription, distribution and administration. The proposed system is grounded on three sub-systems: a CPOE (Computerized Prescription Order Entry), an RFID-based drug container and dispenser and a middleware system. The visualization and management of prescription and administration data are handled through a web application designed to comply with international usability regulation.

  11. Increased frequency of de novo copy number variants in congenital heart disease by integrative analysis of single nucleotide polymorphism array and exome sequence data.

    PubMed

    Glessner, Joseph T; Bick, Alexander G; Ito, Kaoru; Homsy, Jason; Rodriguez-Murillo, Laura; Fromer, Menachem; Mazaika, Erica; Vardarajan, Badri; Italia, Michael; Leipzig, Jeremy; DePalma, Steven R; Golhar, Ryan; Sanders, Stephan J; Yamrom, Boris; Ronemus, Michael; Iossifov, Ivan; Willsey, A Jeremy; State, Matthew W; Kaltman, Jonathan R; White, Peter S; Shen, Yufeng; Warburton, Dorothy; Brueckner, Martina; Seidman, Christine; Goldmuntz, Elizabeth; Gelb, Bruce D; Lifton, Richard; Seidman, Jonathan; Hakonarson, Hakon; Chung, Wendy K

    2014-10-24

    Congenital heart disease (CHD) is among the most common birth defects. Most cases are of unknown pathogenesis. To determine the contribution of de novo copy number variants (CNVs) in the pathogenesis of sporadic CHD. We studied 538 CHD trios using genome-wide dense single nucleotide polymorphism arrays and whole exome sequencing. Results were experimentally validated using digital droplet polymerase chain reaction. We compared validated CNVs in CHD cases with CNVs in 1301 healthy control trios. The 2 complementary high-resolution technologies identified 63 validated de novo CNVs in 51 CHD cases. A significant increase in CNV burden was observed when comparing CHD trios with healthy trios, using either single nucleotide polymorphism array (P=7×10(-5); odds ratio, 4.6) or whole exome sequencing data (P=6×10(-4); odds ratio, 3.5) and remained after removing 16% of de novo CNV loci previously reported as pathogenic (P=0.02; odds ratio, 2.7). We observed recurrent de novo CNVs on 15q11.2 encompassing CYFIP1, NIPA1, and NIPA2 and single de novo CNVs encompassing DUSP1, JUN, JUP, MED15, MED9, PTPRE SREBF1, TOP2A, and ZEB2, genes that interact with established CHD proteins NKX2-5 and GATA4. Integrating de novo variants in whole exome sequencing and CNV data suggests that ETS1 is the pathogenic gene altered by 11q24.2-q25 deletions in Jacobsen syndrome and that CTBP2 is the pathogenic gene in 10q subtelomeric deletions. We demonstrate a significantly increased frequency of rare de novo CNVs in CHD patients compared with healthy controls and suggest several novel genetic loci for CHD. © 2014 American Heart Association, Inc.

  12. Increased Frequency of De Novo Copy Number Variations in Congenital Heart Disease by Integrative Analysis of SNP Array and Exome Sequence Data

    PubMed Central

    Rodriguez-Murillo, Laura; Fromer, Menachem; Mazaika, Erica; Vardarajan, Badri; Italia, Michael; Leipzig, Jeremy; DePalma, Steven R.; Golhar, Ryan; Sanders, Stephan J.; Yamrom, Boris; Ronemus, Michael; Iossifov, Ivan; Willsey, A. Jeremy; State, Matthew W.; Kaltman, Jonathan R.; White, Peter S.; Shen, Yufeng; Warburton, Dorothy; Brueckner, Martina; Seidman, Christine; Goldmuntz, Elizabeth; Gelb, Bruce D.; Lifton, Richard; Seidman, Jonathan; Hakonarson, Hakon; Chung, Wendy K.

    2014-01-01

    Rationale Congenital heart disease (CHD) is among the most common birth defects. Most cases are of unknown etiology. Objective To determine the contribution of de novo copy number variants (CNVs) in the etiology of sporadic CHD. Methods and Results We studied 538 CHD trios using genome-wide dense single nucleotide polymorphism (SNP) arrays and/or whole exome sequencing (WES). Results were experimentally validated using digital droplet PCR. We compared validated CNVs in CHD cases to CNVs in 1,301 healthy control trios. The two complementary high-resolution technologies identified 63 validated de novo CNVs in 51 CHD cases. A significant increase in CNV burden was observed when comparing CHD trios with healthy trios, using either SNP array (p=7x10−5, Odds Ratio (OR)=4.6) or WES data (p=6x10−4, OR=3.5) and remained after removing 16% of de novo CNV loci previously reported as pathogenic (p=0.02, OR=2.7). We observed recurrent de novo CNVs on 15q11.2 encompassing CYFIP1, NIPA1, and NIPA2 and single de novo CNVs encompassing DUSP1, JUN, JUP, MED15, MED9, PTPRE SREBF1, TOP2A, and ZEB2, genes that interact with established CHD proteins NKX2-5 and GATA4. Integrating de novo variants in WES and CNV data suggests that ETS1 is the pathogenic gene altered by 11q24.2-q25 deletions in Jacobsen syndrome and that CTBP2 is the pathogenic gene in 10q sub-telomeric deletions. Conclusions We demonstrate a significantly increased frequency of rare de novo CNVs in CHD patients compared with healthy controls and suggest several novel genetic loci for CHD. PMID:25205790

  13. Temporal integration of sequential auditory events: silent period in sound pattern activates human planum temporale.

    PubMed

    Mustovic, Henrietta; Scheffler, Klaus; Di Salle, Francesco; Esposito, Fabrizio; Neuhoff, John G; Hennig, Jürgen; Seifritz, Erich

    2003-09-01

    Temporal integration is a fundamental process that the brain carries out to construct coherent percepts from serial sensory events. This process critically depends on the formation of memory traces reconciling past with present events and is particularly important in the auditory domain where sensory information is received both serially and in parallel. It has been suggested that buffers for transient auditory memory traces reside in the auditory cortex. However, previous studies investigating "echoic memory" did not distinguish between brain response to novel auditory stimulus characteristics on the level of basic sound processing and a higher level involving matching of present with stored information. Here we used functional magnetic resonance imaging in combination with a regular pattern of sounds repeated every 100 ms and deviant interspersed stimuli of 100-ms duration, which were either brief presentations of louder sounds or brief periods of silence, to probe the formation of auditory memory traces. To avoid interaction with scanner noise, the auditory stimulation sequence was implemented into the image acquisition scheme. Compared to increased loudness events, silent periods produced specific neural activation in the right planum temporale and temporoparietal junction. Our findings suggest that this area posterior to the auditory cortex plays a critical role in integrating sequential auditory events and is involved in the formation of short-term auditory memory traces. This function of the planum temporale appears to be fundamental in the segregation of simultaneous sound sources.

  14. Sounds can boost the awareness of visual events through attention without cross-modal integration

    PubMed Central

    Pápai, Márta Szabina; Soto-Faraco, Salvador

    2017-01-01

    Cross-modal interactions can lead to enhancement of visual perception, even for visual events below awareness. However, the underlying mechanism is still unclear. Can purely bottom-up cross-modal integration break through the threshold of awareness? We used a binocular rivalry paradigm to measure perceptual switches after brief flashes or sounds which, sometimes, co-occurred. When flashes at the suppressed eye coincided with sounds, perceptual switches occurred the earliest. Yet, contrary to the hypothesis of cross-modal integration, this facilitation never surpassed the assumption of probability summation of independent sensory signals. A follow-up experiment replicated the same pattern of results using silent gaps embedded in continuous noise, instead of sounds. This manipulation should weaken putative sound-flash integration, although keep them salient as bottom-up attention cues. Additional results showed that spatial congruency between flashes and sounds did not determine the effectiveness of cross-modal facilitation, which was again not better than probability summation. Thus, the present findings fail to fully support the hypothesis of bottom-up cross-modal integration, above and beyond the independent contribution of two transient signals, as an account for cross-modal enhancement of visual events below level of awareness. PMID:28139712

  15. Optimized breeding strategies for multiple trait integration: I. Minimizing linkage drag in single event introgression.

    PubMed

    Peng, Ting; Sun, Xiaochun; Mumm, Rita H

    2014-01-01

    From a breeding standpoint, multiple trait integration (MTI) is a four-step process of converting an elite variety/hybrid for value-added traits (e.g. transgenic events) using backcross breeding, ultimately regaining the performance attributes of the target hybrid along with reliable expression of the value-added traits. In the light of the overarching goal of recovering equivalent performance in the finished conversion, this study focuses on the first step of MTI, single event introgression, exploring the feasibility of marker-aided backcross conversion of a target maize hybrid for 15 transgenic events, incorporating eight events into the female hybrid parent and seven into the male parent. Single event introgression is conducted in parallel streams to convert the recurrent parent (RP) for individual events, with the primary objective of minimizing residual non-recurrent parent (NRP) germplasm, especially in the chromosomal proximity to the event (i.e. linkage drag). In keeping with a defined lower limit of 96.66 % overall RP germplasm recovery (i.e. ≤120 cM NRP germplasm given a genome size of 1,788 cM), a breeding goal for each of the 15 single event conversions was developed: <8 cM of residual NRP germplasm across the genome with ~1 cM in the 20 cM region flanking the event. Using computer simulation, we aimed to identify optimal breeding strategies for single event introgression to achieve this breeding goal, measuring efficiency in terms of number of backcross generations required, marker data points needed, and total population size across generations. Various selection schemes classified as three-stage, modified two-stage, and combined selection conducted from BC1 through BC3, BC4, or BC5 were compared. The breeding goal was achieved with a selection scheme involving five generations of marker-aided backcrossing, with BC1 through BC3 selected for the event of interest and minimal linkage drag at population size of 600, and BC4 and BC5 selected for

  16. Optimized breeding strategies for multiple trait integration: II. Process efficiency in event pyramiding and trait fixation.

    PubMed

    Peng, Ting; Sun, Xiaochun; Mumm, Rita H

    2014-01-01

    Multiple trait integration (MTI) is a multi-step process of converting an elite variety/hybrid for value-added traits (e.g. transgenic events) through backcross breeding. From a breeding standpoint, MTI involves four steps: single event introgression, event pyramiding, trait fixation, and version testing. This study explores the feasibility of marker-aided backcross conversion of a target maize hybrid for 15 transgenic events in the light of the overall goal of MTI of recovering equivalent performance in the finished hybrid conversion along with reliable expression of the value-added traits. Using the results to optimize single event introgression (Peng et al. Optimized breeding strategies for multiple trait integration: I. Minimizing linkage drag in single event introgression. Mol Breed, 2013) which produced single event conversions of recurrent parents (RPs) with ≤8 cM of residual non-recurrent parent (NRP) germplasm with ~1 cM of NRP germplasm in the 20 cM regions flanking the event, this study focused on optimizing process efficiency in the second and third steps in MTI: event pyramiding and trait fixation. Using computer simulation and probability theory, we aimed to (1) fit an optimal breeding strategy for pyramiding of eight events into the female RP and seven in the male RP, and (2) identify optimal breeding strategies for trait fixation to create a 'finished' conversion of each RP homozygous for all events. In addition, next-generation seed needs were taken into account for a practical approach to process efficiency. Building on work by Ishii and Yonezawa (Optimization of the marker-based procedures for pyramiding genes from multiple donor lines: I. Schedule of crossing between the donor lines. Crop Sci 47:537-546, 2007a), a symmetric crossing schedule for event pyramiding was devised for stacking eight (seven) events in a given RP. Options for trait fixation breeding strategies considered selfing and doubled haploid approaches to achieve homozygosity

  17. Escherichia coli O157:H7 Strains Isolated from High-Event Period Beef Contamination Have Strong Biofilm-Forming Ability and Low Sanitizer Susceptibility, Which Are Associated with High pO157 Plasmid Copy Number.

    PubMed

    Wang, Rong; Luedtke, Brandon E; Bosilevac, Joseph M; Schmidt, John W; Kalchayanand, Norasak; Arthur, Terrance M

    2016-11-01

    In the meat industry, a high-event period (HEP) is defined as a time period when beef processing establishments experience an increased occurrence of product contamination by Escherichia coli O157:H7. Our previous studies suggested that bacterial biofilm formation and sanitizer resistance might contribute to HEPs. We conducted the present study to further characterize E. coli O157:H7 strains isolated during HEPs for their potential to cause contamination and to investigate the genetic basis for their strong biofilm-forming ability and high sanitizer resistance. Our results show that, compared with the E. coli O157:H7 diversity control panel strains, the HEP strains had a significantly higher biofilm-forming ability on contact surfaces and a lower susceptibility to common sanitizers. No difference in the presence of disinfectant-resistant genes or the prevalence of antibiotic resistance was observed between the HEP and control strains. However, the HEP strains retained significantly higher copy numbers of the pO157 plasmid. A positive correlation was observed among a strain's high plasmid copy number, strong biofilm-forming ability, low sanitizer susceptibility, and high survival and recovery capability after sanitization, suggesting that these specific phenotypes could be either directly correlated to gene expression on the pO157 plasmid or indirectly regulated via chromosomal gene expression influenced by the presence of the plasmid. Our data highlight the potential risk of biofilm formation and sanitizer resistance in HEP contamination by E. coli O157:H7, and our results call for increased attention to proper and effective sanitization practices in meat processing facilities.

  18. An exploratory event-related potential study of multisensory integration in sensory over-responsive children.

    PubMed

    Brett-Green, Barbara A; Miller, Lucy J; Schoen, Sarah A; Nielsen, Darci M

    2010-03-19

    Children who are over-responsive to sensation have defensive and "fight or flight" reactions to ordinary levels of sensory stimulation in the environment. Based on clinical observations, sensory over-responsivity is hypothesized to reflect atypical neural integration of sensory input. To examine a possible underlying neural mechanism of the disorder, integration of simultaneous multisensory auditory and somatosensory stimulation was studied in twenty children with sensory over-responsivity (SOR) using event-related potentials (ERPs). Three types of sensory stimuli were presented and ERPs were recorded from thirty-two scalp electrodes while participants watched a silent cartoon: bilateral auditory clicks, right somatosensory median nerve electrical pulses, or both simultaneously. The paradigm was passive; no behavioral responses were required. To examine integration, responses to simultaneous multisensory auditory-somatosensory stimulation were compared to the sum of unisensory auditory plus unisensory somatosensory responses in four time-windows: (60-80 ms, 80-110 ms, 110-150 ms, and 180-220 ms). Specific midline and lateral electrode sites were examined over scalp regions where auditory-somatosensory integration was expected based on previous studies. Midline electrode sites (Fz, Cz, and Pz) showed significant integration during two time-windows: 60-80 ms and 180-220 ms. Significant integration was also found at contralateral electrode site (C3) for the time-window between 180 and 220 ms. At ipsilateral electrode sites (C4 and CP6), no significant integration was found during any of the time-windows (i.e. the multisensory ERP was not significantly different from the summed unisensory ERP). These results demonstrate that MSI can be reliably measured in children with SOR and provide evidence that multisensory auditory-somatosensory input is integrated during both early and later stages of sensory information processing, mainly over fronto-central scalp regions.

  19. The Mu Transposable Elements of Maize: Evidence for Transposition and Copy Number Regulation during Development

    PubMed Central

    Alleman, Mary; Freeling, Michael

    1986-01-01

    The Mu transposon of maize exists in a highly mutagenic strain called Robertson's Mutator. Plants of this strain contain 10–50 copies of the Mu element, whereas most maize strains and other plants have none. When Mutator plants are crossed to plants of the inbred line 1S2P, which does not have copies of Mu, the progeny plants have approximately the same number of Mu sequences as did their Mutator parent. Approximately one-half of these copies have segregated from their parent and one-half have arisen by transposition and are integrated into new positions in the genome. This maintenance of copy number can be accounted for by an extremely high rate of transposition of the Mu elements (10–15 transpositions per gamete per generation). When Mutator plants are self-pollinated, the progeny double their Mu copy number in the first generation, but maintain a constant number of Mu sequences with subsequent self-pollinations. Transposition of Mu and the events that lead to copy number maintenance occur very late in the development of the germ cells but before fertilization. A larger version of the Mu element transposes but is not necessary for transposition of the Mu sequences. The progeny of crosses with a Mutator plant occasionally lack Mutator activity; these strains retain copies of the Mu element, but these elements no longer transpose. PMID:3002907

  20. Partitioning of integrated energy fluxes in four tail reconnection events observed by Cluster

    NASA Astrophysics Data System (ADS)

    Tyler, Evan; Cattell, Cynthia; Thaller, Scott; Wygant, John; Gurgiolo, Chris; Goldstein, Melvyn; Mouikis, Christopher

    2016-12-01

    We present the partitioning of integrated energy flux from four tail reconnection events observed by Cluster, focusing on the relative contributions of Poynting flux, electron, H+ and O+ enthalpy, and kinetic energy flux in the tailward and earthward directions in order to study temporal and spatial features of each event. We further subdivide the Poynting flux into three frequency bands to examine the possible structures and waves that contribute most significantly to the total Poynting flux from the reconnection region. Our results indicate that H+ enthalpy flux is often dominant, but O+ enthalpy, electron enthalpy, Poynting flux, and H+ kinetic energy flux can contribute significant or greater total energy flux depending on spacecraft location with respect the current sheet, flow direction, temporal scale, and local conditions. We observe integrated H+ enthalpy fluxes that differ by factors of 3-4 between satellites, even over ion inertial length scales. We observe strong differences in behavior between H+ and O+ enthalpy fluxes in all events, highlighting the importance of species-specific energization mechanisms. We find tailward-earthward asymmetry in H+ enthalpy flux, possibly indicative of the influence of the closed earthward boundary of the magnetotail system. Frequency filtering of the Poynting flux shows that current sheet surface waves and structures on the timescale of current sheet flapping contribute significantly, while large-scale structure contributions are relatively small. We observe that the direction and behavior of the Poynting flux differs between bands, indicating that the observed flux originates from multiple distinct sources or processes.

  1. Technical note: Efficient online source identification algorithm for integration within a contamination event management system

    NASA Astrophysics Data System (ADS)

    Deuerlein, Jochen; Meyer-Harries, Lea; Guth, Nicolai

    2017-07-01

    Drinking water distribution networks are part of critical infrastructures and are exposed to a number of different risks. One of them is the risk of unintended or deliberate contamination of the drinking water within the pipe network. Over the past decade research has focused on the development of new sensors that are able to detect malicious substances in the network and early warning systems for contamination. In addition to the optimal placement of sensors, the automatic identification of the source of a contamination is an important component of an early warning and event management system for security enhancement of water supply networks. Many publications deal with the algorithmic development; however, only little information exists about the integration within a comprehensive real-time event detection and management system. In the following the analytical solution and the software implementation of a real-time source identification module and its integration within a web-based event management system are described. The development was part of the SAFEWATER project, which was funded under FP 7 of the European Commission.

  2. How Distance Affects Semantic Integration in Discourse: Evidence from Event-Related Potentials

    PubMed Central

    Yang, Xiaohong; Chen, Shuang; Chen, Xuhai; Yang, Yufang

    2015-01-01

    Event-related potentials were used to investigate whether semantic integration in discourse is influenced by the number of intervening sentences between the endpoints of integration. Readers read discourses in which the last sentence contained a critical word that was either congruent or incongruent with the information introduced in the first sentence. Furthermore, for the short discourses, the first and last sentence were intervened by only one sentence while for the long discourses, they were intervened by three sentences. We found that the incongruent words elicited an N400 effect for both the short and long discourses. However, a P600 effect was only observed for the long discourses, but not for the short ones. These results suggest that although readers can successfully integrate upcoming words into the existing discourse representation, the effort required for this integration process is modulated by the number of intervening sentences. Thus, discourse distance as measured by the number of intervening sentences should be taken as an important factor for semantic integration in discourse. PMID:26569606

  3. 37 CFR 1.13 - Copies and certified copies.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Copies and certified copies... Patent and Trademark Office § 1.13 Copies and certified copies. (a) Non-certified copies of patents, and... States Patent and Trademark Office to any person, and copies of other records or papers will be furnished...

  4. Mines Systems Safety Improvement Using an Integrated Event Tree and Fault Tree Analysis

    NASA Astrophysics Data System (ADS)

    Kumar, Ranjan; Ghosh, Achyuta Krishna

    2017-04-01

    Mines systems such as ventilation system, strata support system, flame proof safety equipment, are exposed to dynamic operational conditions such as stress, humidity, dust, temperature, etc., and safety improvement of such systems can be done preferably during planning and design stage. However, the existing safety analysis methods do not handle the accident initiation and progression of mine systems explicitly. To bridge this gap, this paper presents an integrated Event Tree (ET) and Fault Tree (FT) approach for safety analysis and improvement of mine systems design. This approach includes ET and FT modeling coupled with redundancy allocation technique. In this method, a concept of top hazard probability is introduced for identifying system failure probability and redundancy is allocated to the system either at component or system level. A case study on mine methane explosion safety with two initiating events is performed. The results demonstrate that the presented method can reveal the accident scenarios and improve the safety of complex mine systems simultaneously.

  5. Mines Systems Safety Improvement Using an Integrated Event Tree and Fault Tree Analysis

    NASA Astrophysics Data System (ADS)

    Kumar, Ranjan; Ghosh, Achyuta Krishna

    2016-06-01

    Mines systems such as ventilation system, strata support system, flame proof safety equipment, are exposed to dynamic operational conditions such as stress, humidity, dust, temperature, etc., and safety improvement of such systems can be done preferably during planning and design stage. However, the existing safety analysis methods do not handle the accident initiation and progression of mine systems explicitly. To bridge this gap, this paper presents an integrated Event Tree (ET) and Fault Tree (FT) approach for safety analysis and improvement of mine systems design. This approach includes ET and FT modeling coupled with redundancy allocation technique. In this method, a concept of top hazard probability is introduced for identifying system failure probability and redundancy is allocated to the system either at component or system level. A case study on mine methane explosion safety with two initiating events is performed. The results demonstrate that the presented method can reveal the accident scenarios and improve the safety of complex mine systems simultaneously.

  6. Statistical tools for transgene copy number estimation based on real-time PCR.

    PubMed

    Yuan, Joshua S; Burris, Jason; Stewart, Nathan R; Mentewab, Ayalew; Stewart, C Neal

    2007-11-01

    As compared with traditional transgene copy number detection technologies such as Southern blot analysis, real-time PCR provides a fast, inexpensive and high-throughput alternative. However, the real-time PCR based transgene copy number estimation tends to be ambiguous and subjective stemming from the lack of proper statistical analysis and data quality control to render a reliable estimation of copy number with a prediction value. Despite the recent progresses in statistical analysis of real-time PCR, few publications have integrated these advancements in real-time PCR based transgene copy number determination. Three experimental designs and four data quality control integrated statistical models are presented. For the first method, external calibration curves are established for the transgene based on serially-diluted templates. The Ct number from a control transgenic event and putative transgenic event are compared to derive the transgene copy number or zygosity estimation. Simple linear regression and two group T-test procedures were combined to model the data from this design. For the second experimental design, standard curves were generated for both an internal reference gene and the transgene, and the copy number of transgene was compared with that of internal reference gene. Multiple regression models and ANOVA models can be employed to analyze the data and perform quality control for this approach. In the third experimental design, transgene copy number is compared with reference gene without a standard curve, but rather, is based directly on fluorescence data. Two different multiple regression models were proposed to analyze the data based on two different approaches of amplification efficiency integration. Our results highlight the importance of proper statistical treatment and quality control integration in real-time PCR-based transgene copy number determination. These statistical methods allow the real-time PCR-based transgene copy number estimation

  7. Two Neurocognitive Mechanisms of Semantic Integration during the Comprehension of Visual Real-world Events

    PubMed Central

    Sitnikova, Tatiana; Holcomb, Phillip J.; Kiyonaga, Kristi A.; Kuperberg, Gina R.

    2009-01-01

    How do comprehenders build up overall meaning representations of visual real-world events? This question was examined by recording event-related potentials (ERPs) while participants viewed short, silent movie clips depicting everyday events. In two experiments, it was demonstrated that presentation of the contextually inappropriate information in the movie endings evoked an anterior negativity. This effect was similar to the N400 component whose amplitude has been previously reported to inversely correlate with the strength of semantic relationship between the context and the eliciting stimulus in word and static picture paradigms. However, a second, somewhat later, ERP component—a posterior late positivity—was evoked specifically when target objects presented in the movie endings violated goal-related requirements of the action constrained by the scenario context (e.g., an electric iron that does not have a sharp-enough edge was used in place of a knife in a cutting bread scenario context). These findings suggest that comprehension of the visual real world might be mediated by two neurophysiologically distinct semantic integration mechanisms. The first mechanism, reflected by the anterior N400-like negativity, maps the incoming information onto the connections of various strengths between concepts in semantic memory. The second mechanism, reflected by the posterior late positivity, evaluates the incoming information against the discrete requirements of real-world actions. We suggest that there may be a tradeoff between these mechanisms in their utility for integrating across people, objects, and actions during event comprehension, in which the first mechanism is better suited for familiar situations, and the second mechanism is better suited for novel situations. PMID:18416681

  8. Reprogrammable field programmable gate array with integrated system for mitigating effects of single event upsets

    NASA Technical Reports Server (NTRS)

    Ng, Tak-kwong (Inventor); Herath, Jeffrey A. (Inventor)

    2010-01-01

    An integrated system mitigates the effects of a single event upset (SEU) on a reprogrammable field programmable gate array (RFPGA). The system includes (i) a RFPGA having an internal configuration memory, and (ii) a memory for storing a configuration associated with the RFPGA. Logic circuitry programmed into the RFPGA and coupled to the memory reloads a portion of the configuration from the memory into the RFPGA's internal configuration memory at predetermined times. Additional SEU mitigation can be provided by logic circuitry on the RFPGA that monitors and maintains synchronized operation of the RFPGA's digital clock managers.

  9. Online integrated solution to collect data, generate information and manage events in the human biomonitoring field.

    PubMed

    Reis, M Fátima; Tedim, João; Aguiar, Pedro; Miguel, J Pereira; Casteleyn, Ludwine; Joas, Reinhard; Van Tongelen, Birgit

    2007-05-01

    In the ambit of Work Package 1 of the ESBIO Project, an online integrated solution to collect data, to generate information, and to manage mainly information-sharing events related with human biomonitoring within Europe has been designed and is being implemented. The present paper summarises the methodological approaches used by the authors as proposers, general promoters and disseminators of this strategic concept, as well as the first outcomes and future actions to be taken, in the short and longer term, to face present and future challenges to make this innovative solution happen.

  10. Cognitive conflict in audiovisual integration: an event-related potential study.

    PubMed

    Yin, Qinqing; Qiu, Jiang; Zhang, Qinglin; Wen, Xiaohui

    2008-03-26

    This study used event-related potentials (ERPs) to investigate the electrophysiological correlates of cognitive conflict in audiovisual integration during an audiovisual task. ERP analyses revealed: (i) the anterior N1 and P1 were elicited in both matched and mismatched conditions and (ii) audiovisual mismatched answers elicited a more negative ERP deflection at 490 ms (N490) than matched answers. Dipole analysis of the difference wave (mismatched minus matched) localized the generator of the N490 to the posterior cingulate cortex, which may be involved in the control and modulation of conflict processing of Chinese characters when visual and auditory information is mismatched.

  11. Heavy-ion induced single-event upset in integrated circuits

    NASA Technical Reports Server (NTRS)

    Zoutendyk, J. A.

    1991-01-01

    The cosmic ray environment in space can affect the operation of Integrated Circuit (IC) devices via the phenomenon of Single Event Upset (SEU). In particular, heavy ions passing through an IC can induce sufficient integrated current (charge) to alter the state of a bistable circuit, for example a memory cell. The SEU effect is studied in great detail in both static and dynamic memory devices, as well as microprocessors fabricated from bipolar, Complementary Metal Oxide Semiconductor (CMOS) and N channel Metal Oxide Semiconductor (NMOS) technologies. Each device/process reflects its individual characteristics (minimum scale geometry/process parameters) via a unique response to the direct ionization of electron hole pairs by heavy ion tracks. A summary of these analytical and experimental SEU investigations is presented.

  12. Heavy-ion induced single-event upset in integrated circuits

    NASA Technical Reports Server (NTRS)

    Zoutendyk, J. A.

    1991-01-01

    The cosmic ray environment in space can affect the operation of Integrated Circuit (IC) devices via the phenomenon of Single Event Upset (SEU). In particular, heavy ions passing through an IC can induce sufficient integrated current (charge) to alter the state of a bistable circuit, for example a memory cell. The SEU effect is studied in great detail in both static and dynamic memory devices, as well as microprocessors fabricated from bipolar, Complementary Metal Oxide Semiconductor (CMOS) and N channel Metal Oxide Semiconductor (NMOS) technologies. Each device/process reflects its individual characteristics (minimum scale geometry/process parameters) via a unique response to the direct ionization of electron hole pairs by heavy ion tracks. A summary of these analytical and experimental SEU investigations is presented.

  13. Integrating the meaning of person names into discourse context: an event-related potential study.

    PubMed

    Wang, Lin; Yang, Yufang

    2013-01-01

    The meaning of person names is determined by their associated information. This study used event related potentials to investigate the time course of integrating the newly constructed meaning of person names into discourse context. The meaning of person names was built by two-sentence descriptions of the names. Then we manipulated the congruence of person names relative to discourse context in a way that the meaning of person names either matched or did not match the previous context. ERPs elicited by the names were compared between the congruent and the incongruent conditions. We found that the incongruent names elicited a larger N400 as well as a larger P600 compared to the congruent names. The results suggest that the meaning of unknown names can be effectively constructed from short linguistic descriptions and that the established meaning can be rapidly retrieved and integrated into contexts.

  14. Integrating the Meaning of Person Names into Discourse Context: An Event-Related Potential Study

    PubMed Central

    Wang, Lin; Yang, Yufang

    2013-01-01

    The meaning of person names is determined by their associated information. This study used event related potentials to investigate the time course of integrating the newly constructed meaning of person names into discourse context. The meaning of person names was built by two-sentence descriptions of the names. Then we manipulated the congruence of person names relative to discourse context in a way that the meaning of person names either matched or did not match the previous context. ERPs elicited by the names were compared between the congruent and the incongruent conditions. We found that the incongruent names elicited a larger N400 as well as a larger P600 compared to the congruent names. The results suggest that the meaning of unknown names can be effectively constructed from short linguistic descriptions and that the established meaning can be rapidly retrieved and integrated into contexts. PMID:24349462

  15. Impact of induced seismic events on seal integrity, Texas Gulf Coast

    DOE PAGES

    Nicot, Jean-Philippe; Meckel, Timothy A.; Carr, David A.; ...

    2014-12-31

    Recent publications have suggested that large-scale CO2 injection could trigger earthquakes and that even small- to moderate-sized earthquakes may threaten the seal integrity of the injection zone, and potentially damage buildings and other surface structures. In this study, we compared seal thickness to estimated fault displacement due to a single hypothetical seismic event in a selected area of the Texas Gulf Coast comprising an offshore strip of state waters along two Texas counties. To evaluate the slip generated by a single seismic event, we compiled well log information on shale/sand sequences and seismic information on fault geometric characteristics of amore » section of Lower Miocene age. The section is thousands of feet thick and is overlain and underlain by marine shales (Amph. B and Anahuac, respectively) that are relatively easy to correlate between wells. The Amph. B. shale is the secondary and ultimate seal for all injection intervals in the Lower Miocene. Given its thickness, no realistic seismic event or small series of seismic events will offset it significantly. However, this may not be true of smaller local primary seals. An analysis of geophysical logs of a total of 71 wells yielded a total of 2,871 sand / shale binary intervals. An analysis of the dedicated 3D seismic survey counted 723 fault traces at five roughly horizontal horizons within the Lower Miocene Fault displacement estimated using the product of the fault length times an uncertain multiplier coefficient assumed to follow a triangular distribution with a 10-3 to 10-5 range and a mode of 8 × 10-5. We then compared estimated single-event fault displacements to seal thicknesses by means of a Monte-Carlo analysis. Only 1.8% of thickness/displacement pairs display a displacement greater than 20% of the seal thickness. Only 0.26% of the pairs result in a displacement of half the seal thickness and only 0.05% of thickness/displacement pairs result in a clear seal rupture. The next step

  16. Impact of induced seismic events on seal integrity, Texas Gulf Coast

    SciTech Connect

    Nicot, Jean-Philippe; Meckel, Timothy A.; Carr, David A.; Oldenburg, Curtis M.

    2014-12-31

    Recent publications have suggested that large-scale CO2 injection could trigger earthquakes and that even small- to moderate-sized earthquakes may threaten the seal integrity of the injection zone, and potentially damage buildings and other surface structures. In this study, we compared seal thickness to estimated fault displacement due to a single hypothetical seismic event in a selected area of the Texas Gulf Coast comprising an offshore strip of state waters along two Texas counties. To evaluate the slip generated by a single seismic event, we compiled well log information on shale/sand sequences and seismic information on fault geometric characteristics of a section of Lower Miocene age. The section is thousands of feet thick and is overlain and underlain by marine shales (Amph. B and Anahuac, respectively) that are relatively easy to correlate between wells. The Amph. B. shale is the secondary and ultimate seal for all injection intervals in the Lower Miocene. Given its thickness, no realistic seismic event or small series of seismic events will offset it significantly. However, this may not be true of smaller local primary seals. An analysis of geophysical logs of a total of 71 wells yielded a total of 2,871 sand / shale binary intervals. An analysis of the dedicated 3D seismic survey counted 723 fault traces at five roughly horizontal horizons within the Lower Miocene Fault displacement estimated using the product of the fault length times an uncertain multiplier coefficient assumed to follow a triangular distribution with a 10-3 to 10-5 range and a mode of 8 × 10-5. We then compared estimated single-event fault displacements to seal thicknesses by means of a Monte-Carlo analysis. Only 1.8% of thickness/displacement pairs display a displacement greater than 20% of the seal thickness. Only 0.26% of the pairs result in a displacement of half the seal thickness and only 0.05% of thickness/displacement pairs result in

  17. Copy-left and Copy-right

    NASA Astrophysics Data System (ADS)

    VanderPlas, Jacob

    2015-01-01

    Any discussion of open licensing almost invariably devolves into a debate between copy-left licenses and permissive licenses, both sides defending their views with a nearly religious fervor. Copy-left licenses, typified by the GPL family of licenses, require all derived products to maintain the open, GPL license. Permissive licenses, typified by the BSD family of licenses, do not impose such requirements. I'll briefly explore the common arguments put forth in favor of either approach, and discuss some concrete examples of where these approaches have helped or hindered the software packages that used them.

  18. INTEGRAL upper limits on gamma-ray emission associated with the gravitational wave event GW150914

    NASA Astrophysics Data System (ADS)

    Savchenko, V.; Ferrigno, C.; Mereghetti, S.; Natalucci, L.; Kuulkers, E.

    2016-06-01

    Using observations of the INTErnational Gamma-Ray Astrophysics Laboratory (INTEGRAL), we put tight upper limits on the gamma-ray and hard X-ray prompt emission associated with the gravitational wave event GW150914, discovered by the LIGO/Virgo collaboration. The omni-directional view of the INTEGRAL/SPI-ACS has allowed us to constrain the fraction of energy emitted in the hard X-ray electromagnetic component for the full high-probability sky region of LIGO/Virgo trigger. Our upper limits on the hard X-ray fluence at the time of the event range from F_{γ}=2 × 10^{-8} erg cm^{-2} to F_{γ}=10^{-6} erg cm^{-2} in the 75 keV - 2 MeV energy range for typical spectral models. Our results constrain the ratio of the energy promptly released in gamma-rays in the direction of the observer to the gravitational wave energy E_γ/E_{GW}<10^{-6}. We discuss the implication of gamma-ray limits on the characteristics of the gravitational wave source, based on the available predictions for prompt electromagnetic emission. This work has been possible thanks to a Memorandum of Understanding with the LIGO-Virgo scientific collaboration and is presented on behalf of a larger collaboration.

  19. Unusual features of the sequences of copies of the 16S-23S rRNA internal transcribed spacer regions of Acinetobacter bereziniae, Acinetobacter guillouiae and Acinetobacter baylyi arise from horizontal gene transfer events.

    PubMed

    Maslunka, Christopher; Gürtler, Volker; Seviour, Robert

    2015-02-01

    The highly variable nature of the internal transcribed spacer region (ITS) has been claimed to represent an ideal target for designing species-specific probes/primers capable of differentiating between closely related Acinetobacter species. However, several Acinetobacter species contain multiple ITS copies of variable lengths, and these include Acinetobacter bereziniae, Acinetobacter guillouiae and Acinetobacter baylyi. This study shows these length variations result from inter-genomic insertion/deletion events (indels) involving horizontal transfer of ITS fragments of other Acinetobacter species and possibly unrelated bacteria, as shown previously by us. In some instances, indel incorporation results in the loss of probe target sites in the recipient cell ITS. In other cases, some indel sequences contain target sites for probes designed from a single ITS sequence to target other Acinetobacter species. Hence, these can generate false positives. The largest of the indels that remove probe sites is 683 bp (labelled bay/i1-0), and it derives from the horizontal transfer of a complete ITS between A. bereziniae BCRC15423(T) and A. baylyi strain ADP1. As a consequence, ITS sequencing or fingerprinting cannot be used to distinguish between the 683 bp ITS in these two strains.

  20. Analysis of Severe Weather Events by Integration of Civil Protection Operation Data

    NASA Astrophysics Data System (ADS)

    Heisterkamp, Tobias; Kox, Thomas

    2015-04-01

    In Germany, winter storms belong to those natural hazards responsible for the largest damages (GDV 2014). This is a huge challenge for the civil protection, especially in metropolitan areas like Berlin. Nowadays, large-scale storm events are generally well predictable, but detailed forecasts on urban district or even street level are still out of range. Fire brigades, as major stakeholder covering severe weather consequences, operate on this small scale and in the whole area due to their juris-diction. For forensic investigation of disasters this presentation offers an additional approach by using the documentation of fire brigade operations as a new data source. Hazard dimensions and conse-quences of severe weather events are reconstructed via GIS-based analyses of these operations. Local case studies of recent storms are used as a comparison and as an additional information to three WMO weather stations in Berlin. Thus, hot spots of these selected events can be identified by operation site accumulations. Further indicators for Berlin are added to detect aspects that de-termine vulnerabilities. The conclusion discusses the potential of this approach as well as possible benefits of integration into warning systems.

  1. Replication protein A safeguards genome integrity by controlling NER incision events

    PubMed Central

    Overmeer, René M.; Moser, Jill; Volker, Marcel; Kool, Hanneke; Tomkinson, Alan E.; van Zeeland, Albert A.

    2011-01-01

    Single-stranded DNA gaps that might arise by futile repair processes can lead to mutagenic events and challenge genome integrity. Nucleotide excision repair (NER) is an evolutionarily conserved repair mechanism, essential for removal of helix-distorting DNA lesions. In the currently prevailing model, NER operates through coordinated assembly of repair factors into pre- and post-incision complexes; however, its regulation in vivo is poorly understood. Notably, the transition from dual incision to repair synthesis should be rigidly synchronized as it might lead to accumulation of unprocessed repair intermediates. We monitored NER regulatory events in vivo using sequential UV irradiations. Under conditions that allow incision yet prevent completion of repair synthesis or ligation, preincision factors can reassociate with new damage sites. In contrast, replication protein A remains at the incomplete NER sites and regulates a feedback loop from completion of DNA repair synthesis to subsequent damage recognition, independently of ATR signaling. Our data reveal an important function for replication protein A in averting further generation of DNA strand breaks that could lead to mutagenic and recombinogenic events. PMID:21282463

  2. Humans can integrate feedback of discrete events in their sensorimotor control of a robotic hand

    PubMed Central

    Segil, Jacob L.; Clemente, Francesco; Weir, Richard F. ff; Edin, Benoni

    2015-01-01

    Providing functionally effective sensory feedback to users of prosthetics is a largely unsolved challenge. Traditional solutions require high band-widths for providing feedback for the control of manipulation and yet have been largely unsuccessful. In this study, we have explored a strategy that relies on temporally discrete sensory feedback that is technically simple to provide. According to the Discrete Event-driven Sensory feedback Control (DESC) policy, motor tasks in humans are organized in phases delimited by means of sensory encoded discrete mechanical events. To explore the applicability of DESC for control, we designed a paradigm in which healthy humans operated an artificial robot hand to lift and replace an instrumented object, a task that can readily be learned and mastered under visual control. Assuming that the central nervous system of humans naturally organizes motor tasks based on a strategy akin to DESC, we delivered short-lasting vibrotactile feedback related to events that are known to forcefully affect progression of the grasp-lift-and-hold task. After training, we determined whether the artificial feedback had been integrated with the sensorimotor control by introducing short delays and we indeed observed that the participants significantly delayed subsequent phases of the task. This study thus gives support to the DESC policy hypothesis. Moreover, it demonstrates that humans can integrate temporally discrete sensory feedback while controlling an artificial hand and invites further studies in which inexpensive, noninvasive technology could be used in clever ways to provide physiologically appropriate sensory feedback in upper limb prosthetics with much lower band-width requirements than with traditional solutions. PMID:24992899

  3. Effects of Sound Frequency on Audiovisual Integration: An Event-Related Potential Study.

    PubMed

    Yang, Weiping; Yang, Jingjing; Gao, Yulin; Tang, Xiaoyu; Ren, Yanna; Takahashi, Satoshi; Wu, Jinglong

    2015-01-01

    A combination of signals across modalities can facilitate sensory perception. The audiovisual facilitative effect strongly depends on the features of the stimulus. Here, we investigated how sound frequency, which is one of basic features of an auditory signal, modulates audiovisual integration. In this study, the task of the participant was to respond to a visual target stimulus by pressing a key while ignoring auditory stimuli, comprising of tones of different frequencies (0.5, 1, 2.5 and 5 kHz). A significant facilitation of reaction times was obtained following audiovisual stimulation, irrespective of whether the task-irrelevant sounds were low or high frequency. Using event-related potential (ERP), audiovisual integration was found over the occipital area for 0.5 kHz auditory stimuli from 190-210 ms, for 1 kHz stimuli from 170-200 ms, for 2.5 kHz stimuli from 140-200 ms, 5 kHz stimuli from 100-200 ms. These findings suggest that a higher frequency sound signal paired with visual stimuli might be early processed or integrated despite the auditory stimuli being task-irrelevant information. Furthermore, audiovisual integration in late latency (300-340 ms) ERPs with fronto-central topography was found for auditory stimuli of lower frequencies (0.5, 1 and 2.5 kHz). Our results confirmed that audiovisual integration is affected by the frequency of an auditory stimulus. Taken together, the neurophysiological results provide unique insight into how the brain processes a multisensory visual signal and auditory stimuli of different frequencies.

  4. Topic Structure Affects Semantic Integration: Evidence from Event-Related Potentials

    PubMed Central

    Yang, Xiaohong; Chen, Xuhai; Chen, Shuang; Xu, Xiaoying; Yang, Yufang

    2013-01-01

    This study investigated whether semantic integration in discourse context could be influenced by topic structure using event-related brain potentials. Participants read discourses in which the last sentence contained a critical word that was either congruent or incongruent with the topic established in the first sentence. The intervening sentences between the first and the last sentence of the discourse either maintained or shifted the original topic. Results showed that incongruent words in topic-maintained discourses elicited an N400 effect that was broadly distributed over the scalp while those in topic-shifted discourses elicited an N400 effect that was lateralized to the right hemisphere and localized over central and posterior areas. Moreover, a late positivity effect was only elicited by incongruent words in topic-shifted discourses, but not in topic-maintained discourses. This suggests an important role for discourse structure in semantic integration, such that compared with topic-maintained discourses, the complexity of discourse structure in topic-shifted condition reduces the initial stage of semantic integration and enhances the later stage in which a mental representation is updated. PMID:24348994

  5. Conceptual Integration of Arithmetic Operations with Real-World Knowledge: Evidence from Event-Related Potentials

    PubMed Central

    Guthormsen, Amy M.; Fisher, Kristie J.; Bassok, Miriam; Osterhout, Lee; DeWolf, Melissa; Holyoak, Keith J.

    2015-01-01

    Research on language processing has shown that the disruption of conceptual integration gives rise to specific patterns of event-related brain potentials (ERPs)—N400 and P600 effects. Here we report similar ERP effects when adults performed cross-domain conceptual integration of analogous semantic and mathematical relations. In a problem-solving task, when participants generated labeled answers to semantically aligned and misaligned arithmetic problems (e.g., 6 roses + 2 tulips = ? vs. 6 roses + 2 vases = ?), the second object label in misaligned problems yielded an N400 effect for addition (but not division) problems. In a verification task, when participants judged arithmetically-correct but semantically misaligned problem sentences to be “unacceptable”, the second object label in misaligned sentences elicited a P600 effect. Thus depending on task constraints, misaligned problems can show either of two ERP signatures of conceptual disruption. These results show that well-educated adults can integrate mathematical and semantic relations on the rapid timescale of within-domain ERP effects by a process akin to analogical mapping. PMID:25864403

  6. Conceptual Integration of Arithmetic Operations With Real-World Knowledge: Evidence From Event-Related Potentials.

    PubMed

    Guthormsen, Amy M; Fisher, Kristie J; Bassok, Miriam; Osterhout, Lee; DeWolf, Melissa; Holyoak, Keith J

    2016-04-01

    Research on language processing has shown that the disruption of conceptual integration gives rise to specific patterns of event-related brain potentials (ERPs)-N400 and P600 effects. Here, we report similar ERP effects when adults performed cross-domain conceptual integration of analogous semantic and mathematical relations. In a problem-solving task, when participants generated labeled answers to semantically aligned and misaligned arithmetic problems (e.g., 6 roses + 2 tulips = ? vs. 6 roses + 2 vases = ?), the second object label in misaligned problems yielded an N400 effect for addition (but not division) problems. In a verification task, when participants judged arithmetically correct but semantically misaligned problem sentences to be "unacceptable," the second object label in misaligned sentences elicited a P600 effect. Thus, depending on task constraints, misaligned problems can show either of two ERP signatures of conceptual disruption. These results show that well-educated adults can integrate mathematical and semantic relations on the rapid timescale of within-domain ERP effects by a process akin to analogical mapping. Copyright © 2015 Cognitive Science Society, Inc.

  7. Altered semantic integration in autism beyond language: a cross-modal event-related potentials study.

    PubMed

    Ribeiro, Tatiane C; Valasek, Claudia A; Minati, Ludovico; Boggio, Paulo S

    2013-05-29

    Autism spectrum disorders (ASDs) are characterized by impaired communication, particularly pragmatic and semantic language, resulting in verbal comprehension deficits. Semantic processing in these conditions has been studied extensively, but mostly limited only to linguistic material. Emerging evidence, however, suggests that semantic integration deficits may extend beyond the verbal domain. Here, we explored cross-modal semantic integration using visual targets preceded by musical and linguistic cues. Particularly, we have recorded the event-related potentials to evaluate whether the N400 and late positive potential (LPP) components, two widely studied electrophysiological markers of semantic processing, are differently sensitive to congruence with respect to typically developing children. Seven ASD patients and seven neurotypical participants matched by age, education and intelligence quotient provided usable data. Neuroelectric activity was recorded in response to visual targets that were related or unrelated to a preceding spoken sentence or musical excerpt. The N400 was sensitive to semantic congruence in the controls but not the patients, whereas the LPP showed a complementary pattern. These results suggest that semantic processing in ASD children is also altered in the context of musical and visual stimuli, and point to a functional decoupling between the generators of the N400 and LPP, which may indicate delayed semantic processing. These novel findings underline the importance of exploring semantic integration across multiple modalities in ASDs and provide motivation for further investigation in large clinical samples.

  8. Integrated Genome-wide DNA Copy Number and Expression Analysis Identifies Distinct Mechanisms of Primary Chemo-resistance in Ovarian Carcinomas

    PubMed Central

    Etemadmoghadam, Dariush; deFazio, Anna; Beroukhim, Rameen; Mermel, Craig; George, Joshy; Getz, Gaddy; Tothill, Richard; Okamoto, Aikou; Raeder, Maria B; Harnett, Paul; Lade, Stephen; Akslen, Lars A; Tinker, Anna; Locandro, Bianca; Alsop, Kathryn; Chiew, Yoke-Eng; Traficante, Nadia; Fereday, Sian; Johnson, Daryl; Fox, Stephen; Sellers, William; Urashima, Mitsuyoshi; Salvesen, Helga B; Meyerson, Matthew; Bowtell, David

    2009-01-01

    Purpose A significant number of women with serous ovarian cancer are intrinsically refractory to platinum-taxol based treatment. We analyzed somatic DNA copy number variation (CNV) and gene expression data to identify key mechanisms associated with primary resistance in advanced-stage serous cancers. Experimental Design Genome-wide CNV was measured in 118 ovarian tumors using high-resolution oligonucleotide microarrays. A well-defined subset of 85 advanced-stage serous tumors was then used to relate CNV to primary resistance to treatment. The discovery-based approach was complemented by quantitative-PCR copy number analysis of twelve candidate genes as independent validation of previously reported associations with clinical outcome. Likely CNV targets and tumor molecular subtypes were further characterized by gene expression profiling. Results Amplification of 19q12, containing Cyclin E (CCNE1) and 20q11.22-q13.12, mapping immediately adjacent to the steroid receptor co-activator NCOA3, were significantly associated with poor response to primary treatment. Other genes previously associated with CNV and clinical outcome in ovarian cancer were not associated with primary treatment resistance. Chemoresistant tumors with high CCNE1 copy number and protein expression were associated with increased cellular proliferation but so too were a subset of treatment responsive patients, suggesting a cell-cycle independent role for CCNE1 in modulating chemoresponse. Patients with a poor clinical outcome without CCNE1 amplification over expressed genes involved in extracellular matrix deposition. Conclusions We have identified two distinct mechanisms of primary treatment failure in serous ovarian cancer, involving CCNE1 amplification and enhanced extracellular matrix deposition. CCNE1 copy number is validated as a dominant marker of patient outcome in ovarian cancer. PMID:19193619

  9. 7 CFR 97.179 - Copies and certified copies.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Copies and certified copies. 97.179 Section 97.179... PLANT VARIETY AND PROTECTION Fees and Charges § 97.179 Copies and certified copies. (a) Upon request, copies of applications, certificates, or of any records, books, papers, drawings, or photographs in the...

  10. An event-related potential examination of contour integration deficits in schizophrenia.

    PubMed

    Butler, Pamela D; Abeles, Ilana Y; Silverstein, Steven M; Dias, Elisa C; Weiskopf, Nicole G; Calderone, Daniel J; Sehatpour, Pejman

    2013-01-01

    Perceptual organization, which refers to the ability to integrate fragments of stimuli to form a representation of a whole edge, part, or object, is impaired in schizophrenia. A contour integration paradigm, involving detection of a set of Gabor patches forming an oval contour pointing to the right or left embedded in a field of randomly oriented Gabors, has been developed for use in clinical trials of schizophrenia. The purpose of the present study was to assess contributions of early and later stages of processing to deficits in contour integration, as well as to develop an event-related potential (ERP) analog of this task. Twenty-one patients with schizophrenia and 28 controls participated. The Gabor elements forming the contours were given a low or high degree of orientational jitter, making it either easy or difficult to identify the direction in which the contour was pointing. ERP results showed greater negative peaks at ~165 (N1 component) and ~270 ms for the low-jitter versus the high-jitter contours, with a much greater difference between jitter conditions at 270 ms. This later ERP component was previously termed Ncl for closure negativity. Source localization identified the Ncl in the lateral occipital object recognition area. Patients showed a significant decrease in the Ncl, but not N1, compared to controls, and this was associated with impaired behavioral ability to identify contours. In addition, an earlier negative peak was found at ~120 ms (termed N120) that differentiated jitter conditions, had a dorsal stream source, and differed between patients and controls. Patients also showed a deficit in the dorsal stream sensory P1 component. These results are in accord with impairments in distributed circuitry contributing to perceptual organization deficits and provide an ERP analog to the behavioral contour integration task.

  11. A prediction technique for single-event effects on complex integrated circuits

    NASA Astrophysics Data System (ADS)

    Yuanfu, Zhao; Chunqing, Yu; Long, Fan; Suge, Yue; Maoxin, Chen; Shougang, Du; Hongchao, Zheng

    2015-11-01

    The sensitivity of complex integrated circuits to single-event effects is investigated. Sensitivity depends not only on the cross section of physical modules but also on the behavior of data patterns running on the system. A method dividing the main functional modules is proposed. The intrinsic cross section and the duty cycles of different sensitive modules are obtained during the execution of data patterns. A method for extracting the duty cycle is presented and a set of test patterns with different duty cycles are implemented experimentally. By combining the intrinsic cross section and the duty cycle of different sensitive modules, a universal method to predict SEE sensitivities of different test patterns is proposed, which is verified by experiments based on the target circuit of a microprocessor. Experimental results show that the deviation between prediction and experiment is less than 20%.

  12. Three-dimensional recognition of photon-starved events using computational integral imaging and statistical sampling.

    PubMed

    Moon, Inkyu; Javidi, Bahram

    2009-03-15

    We present a statistical approach to recognize three-dimensional (3D) objects with a small number of photons captured by using integral imaging (II). For 3D recognition of the events, the photon-limited elemental image set of a 3D object is obtained using the II technique. A computational geometrical ray propagation algorithm and the parametric maximum likelihood estimator are applied to the photon-limited elemental image set to reconstruct the irradiance of the original 3D scene voxels. The sampling distributions for the statistical parameters of the reconstructed image are determined. Finally, hypothesis testing for the equality of the statistical parameters between reference and input data sets is performed for statistical classification of populations on the basis of sampling distribution information. It is shown that large data sets of photon-limited 3D images can be converted into sampling distributions with their own statistical parameters, resulting in a substantial data dimensionality reduction for processing.

  13. Integrated survival analysis using an event-time approach in a Bayesian framework

    USGS Publications Warehouse

    Walsh, Daniel P.; Dreitz, VJ; Heisey, Dennis M.

    2015-01-01

    Event-time or continuous-time statistical approaches have been applied throughout the biostatistical literature and have led to numerous scientific advances. However, these techniques have traditionally relied on knowing failure times. This has limited application of these analyses, particularly, within the ecological field where fates of marked animals may be unknown. To address these limitations, we developed an integrated approach within a Bayesian framework to estimate hazard rates in the face of unknown fates. We combine failure/survival times from individuals whose fates are known and times of which are interval-censored with information from those whose fates are unknown, and model the process of detecting animals with unknown fates. This provides the foundation for our integrated model and permits necessary parameter estimation. We provide the Bayesian model, its derivation, and use simulation techniques to investigate the properties and performance of our approach under several scenarios. Lastly, we apply our estimation technique using a piece-wise constant hazard function to investigate the effects of year, age, chick size and sex, sex of the tending adult, and nesting habitat on mortality hazard rates of the endangered mountain plover (Charadrius montanus) chicks. Traditional models were inappropriate for this analysis because fates of some individual chicks were unknown due to failed radio transmitters. Simulations revealed biases of posterior mean estimates were minimal (≤ 4.95%), and posterior distributions behaved as expected with RMSE of the estimates decreasing as sample sizes, detection probability, and survival increased. We determined mortality hazard rates for plover chicks were highest at <5 days old and were lower for chicks with larger birth weights and/or whose nest was within agricultural habitats. Based on its performance, our approach greatly expands the range of problems for which event-time analyses can be used by eliminating the

  14. Integrated survival analysis using an event-time approach in a Bayesian framework

    PubMed Central

    Walsh, Daniel P; Dreitz, Victoria J; Heisey, Dennis M

    2015-01-01

    Event-time or continuous-time statistical approaches have been applied throughout the biostatistical literature and have led to numerous scientific advances. However, these techniques have traditionally relied on knowing failure times. This has limited application of these analyses, particularly, within the ecological field where fates of marked animals may be unknown. To address these limitations, we developed an integrated approach within a Bayesian framework to estimate hazard rates in the face of unknown fates. We combine failure/survival times from individuals whose fates are known and times of which are interval-censored with information from those whose fates are unknown, and model the process of detecting animals with unknown fates. This provides the foundation for our integrated model and permits necessary parameter estimation. We provide the Bayesian model, its derivation, and use simulation techniques to investigate the properties and performance of our approach under several scenarios. Lastly, we apply our estimation technique using a piece-wise constant hazard function to investigate the effects of year, age, chick size and sex, sex of the tending adult, and nesting habitat on mortality hazard rates of the endangered mountain plover (Charadrius montanus) chicks. Traditional models were inappropriate for this analysis because fates of some individual chicks were unknown due to failed radio transmitters. Simulations revealed biases of posterior mean estimates were minimal (≤ 4.95%), and posterior distributions behaved as expected with RMSE of the estimates decreasing as sample sizes, detection probability, and survival increased. We determined mortality hazard rates for plover chicks were highest at <5 days old and were lower for chicks with larger birth weights and/or whose nest was within agricultural habitats. Based on its performance, our approach greatly expands the range of problems for which event-time analyses can be used by eliminating the

  15. 32 CFR 1662.5 - Inspection, copying, and obtaining copies.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... SYSTEM FREEDOM OF INFORMATION ACT (FOIA) PROCEDURES § 1662.5 Inspection, copying, and obtaining copies... may make an appointment to inspect or copy the materials requested during regular business hours by...

  16. iGEMS: an integrated model for identification of alternative exon usage events

    PubMed Central

    Sood, Sanjana; Szkop, Krzysztof J.; Nakhuda, Asif; Gallagher, Iain J.; Murie, Carl; Brogan, Robert J.; Kaprio, Jaakko; Kainulainen, Heikki; Atherton, Philip J.; Kujala, Urho M.; Gustafsson, Thomas; Larsson, Ola; Timmons, James A.

    2016-01-01

    DNA microarrays and RNAseq are complementary methods for studying RNA molecules. Current computational methods to determine alternative exon usage (AEU) using such data require impractical visual inspection and still yield high false-positive rates. Integrated Gene and Exon Model of Splicing (iGEMS) adapts a gene-level residuals model with a gene size adjusted false discovery rate and exon-level analysis to circumvent these limitations. iGEMS was applied to two new DNA microarray datasets, including the high coverage Human Transcriptome Arrays 2.0 and performance was validated using RT-qPCR. First, AEU was studied in adipocytes treated with (n = 9) or without (n = 8) the anti-diabetes drug, rosiglitazone. iGEMS identified 555 genes with AEU, and robust verification by RT-qPCR (∼90%). Second, in a three-way human tissue comparison (muscle, adipose and blood, n = 41) iGEMS identified 4421 genes with at least one AEU event, with excellent RT-qPCR verification (95%, n = 22). Importantly, iGEMS identified a variety of AEU events, including 3′UTR extension, as well as exon inclusion/exclusion impacting on protein kinase and extracellular matrix domains. In conclusion, iGEMS is a robust method for identification of AEU while the variety of exon usage between human tissues is 5–10 times more prevalent than reported by the Genotype-Tissue Expression consortium using RNA sequencing. PMID:27095197

  17. Developing clinical competency in crisis event management: an integrated simulation problem-based learning activity.

    PubMed

    Liaw, S Y; Chen, F G; Klainin, P; Brammer, J; O'Brien, A; Samarasekera, D D

    2010-08-01

    This study aimed to evaluate the integration of a simulation based learning activity on nursing students' clinical crisis management performance in a problem-based learning (PBL) curriculum. It was hypothesized that the clinical performance of first year nursing students who participated in a simulated learning activity during the PBL session would be superior to those who completed the conventional problem-based session. The students were allocated into either simulation with problem-based discussion (SPBD) or problem-based discussion (PBD) for scenarios on respiratory and cardiac distress. Following completion of each scenario, students from both groups were invited to sit an optional individual test involving a systematic assessment and immediate management of a simulated patient facing a crisis event. A total of thirty students participated in the first post test related to a respiratory scenario and thirty-three participated in the second post test related to a cardiac scenario. Their clinical performances were scored using a checklist. Mean test scores for students completing the SPBD were significantly higher than those who completing the PBD for both the first post test (SPBD 20.08, PBD 18.19) and second post test (SPBD 27.56, PBD 23.07). Incorporation of simulation learning activities into problem-based discussion appeared to be an effective educational strategy for teaching nursing students to assess and manage crisis events.

  18. Double Power Laws in the Event-integrated Solar Energetic Particle Spectrum

    NASA Astrophysics Data System (ADS)

    Zhao, Lulu; Zhang, Ming; Rassoul, Hamid K.

    2016-04-01

    A double power law or a power law with exponential rollover at a few to tens of MeV nucleon-1 of the event-integrated differential spectra has been reported in many solar energetic particle (SEP) events. The rollover energies per nucleon of different elements correlate with a particle's charge-to-mass ratio (Q/A). The probable causes are suggested as residing in shock finite lifetimes, shock finite sizes, shock geometry, and an adiabatic cooling effect. In this work, we conduct a numerical simulation to investigate a particle's transport process in the inner heliosphere. We solve the focused transport equation using a time-backward Markov stochastic approach. The convection, magnetic focusing, adiabatic cooling effect, and pitch-angle scattering are included. The effects that the interplanetary turbulence imposes on the shape of the resulting SEP spectra are examined. By assuming a pure power-law differential spectrum at the Sun, a perfect double-power-law feature with a break energy ranging from 10 to 120 MeV nucleon-1 is obtained at 1 au. We found that the double power law of the differential energy spectrum is a robust result of SEP interplanetary propagation. It works for many assumptions of interplanetary turbulence spectra that give various forms of momentum dependence of a particle's mean free path. The different spectral shapes in low-energy and high-energy ends are not just a transition from the convection-dominated propagation to diffusion-dominated propagation.

  19. Non-parametric frequency analysis of extreme values for integrated disaster management considering probable maximum events

    NASA Astrophysics Data System (ADS)

    Takara, K. T.

    2015-12-01

    This paper describes a non-parametric frequency analysis method for hydrological extreme-value samples with a size larger than 100, verifying the estimation accuracy with a computer intensive statistics (CIS) resampling such as the bootstrap. Probable maximum values are also incorporated into the analysis for extreme events larger than a design level of flood control. Traditional parametric frequency analysis methods of extreme values include the following steps: Step 1: Collecting and checking extreme-value data; Step 2: Enumerating probability distributions that would be fitted well to the data; Step 3: Parameter estimation; Step 4: Testing goodness of fit; Step 5: Checking the variability of quantile (T-year event) estimates by the jackknife resampling method; and Step_6: Selection of the best distribution (final model). The non-parametric method (NPM) proposed here can skip Steps 2, 3, 4 and 6. Comparing traditional parameter methods (PM) with the NPM, this paper shows that PM often underestimates 100-year quantiles for annual maximum rainfall samples with records of more than 100 years. Overestimation examples are also demonstrated. The bootstrap resampling can do bias correction for the NPM and can also give the estimation accuracy as the bootstrap standard error. This NPM has advantages to avoid various difficulties in above-mentioned steps in the traditional PM. Probable maximum events are also incorporated into the NPM as an upper bound of the hydrological variable. Probable maximum precipitation (PMP) and probable maximum flood (PMF) can be a new parameter value combined with the NPM. An idea how to incorporate these values into frequency analysis is proposed for better management of disasters that exceed the design level. The idea stimulates more integrated approach by geoscientists and statisticians as well as encourages practitioners to consider the worst cases of disasters in their disaster management planning and practices.

  20. Translational use of event-related potentials to assess circuit integrity in ASD.

    PubMed

    Modi, Meera E; Sahin, Mustafa

    2017-03-01

    Deficits in social cognition are the defining characteristic of autism spectrum disorder (ASD). Social cognition requires the integration of several neural circuits in a time-sensitive fashion, so impairments in social interactions could arise as a result of alterations in network connectivity. Electroencephalography (EEG) has revealed abnormalities in event related potentials (ERPs) evoked by auditory and visual sensory stimuli in humans with ASD, indicating disruption of neural connectivity. Similar abnormalities in sensory-evoked ERPs have been observed in animal models of ASD, suggesting that ERPs have the potential to provide a translational biomarker of the disorder. People with ASD also have abnormal ERPs in response to auditory and visual social stimuli, demonstrating functional disruption of the social circuit. To assess the integrity of the social circuit and characterize biomarkers of circuit dysfunction, novel EEG paradigms that use social stimuli to induce ERPs should be developed for use in animal models. The identification of a socially-relevant ERP that is consistent in animal models and humans would facilitate the development of pharmacological treatment strategies for the social impairments in ASD and other neuropsychiatric disorders.

  1. Exact event-driven implementation for recurrent networks of stochastic perfect integrate-and-fire neurons.

    PubMed

    Taillefumier, Thibaud; Touboul, Jonathan; Magnasco, Marcelo

    2012-12-01

    In vivo cortical recording reveals that indirectly driven neural assemblies can produce reliable and temporally precise spiking patterns in response to stereotyped stimulation. This suggests that despite being fundamentally noisy, the collective activity of neurons conveys information through temporal coding. Stochastic integrate-and-fire models delineate a natural theoretical framework to study the interplay of intrinsic neural noise and spike timing precision. However, there are inherent difficulties in simulating their networks' dynamics in silico with standard numerical discretization schemes. Indeed, the well-posedness of the evolution of such networks requires temporally ordering every neuronal interaction, whereas the order of interactions is highly sensitive to the random variability of spiking times. Here, we answer these issues for perfect stochastic integrate-and-fire neurons by designing an exact event-driven algorithm for the simulation of recurrent networks, with delayed Dirac-like interactions. In addition to being exact from the mathematical standpoint, our proposed method is highly efficient numerically. We envision that our algorithm is especially indicated for studying the emergence of polychronized motifs in networks evolving under spike-timing-dependent plasticity with intrinsic noise.

  2. Integrating physically based simulators with Event Detection Systems: Multi-site detection approach.

    PubMed

    Housh, Mashor; Ohar, Ziv

    2017-03-01

    The Fault Detection (FD) Problem in control theory concerns of monitoring a system to identify when a fault has occurred. Two approaches can be distinguished for the FD: Signal processing based FD and Model-based FD. The former concerns of developing algorithms to directly infer faults from sensors' readings, while the latter uses a simulation model of the real-system to analyze the discrepancy between sensors' readings and expected values from the simulation model. Most contamination Event Detection Systems (EDSs) for water distribution systems have followed the signal processing based FD, which relies on analyzing the signals from monitoring stations independently of each other, rather than evaluating all stations simultaneously within an integrated network. In this study, we show that a model-based EDS which utilizes a physically based water quality and hydraulics simulation models, can outperform the signal processing based EDS. We also show that the model-based EDS can facilitate the development of a Multi-Site EDS (MSEDS), which analyzes the data from all the monitoring stations simultaneously within an integrated network. The advantage of the joint analysis in the MSEDS is expressed by increased detection accuracy (higher true positive alarms and fewer false alarms) and shorter detection time. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Event triggered state estimation techniques for power systems with integrated variable energy resources.

    PubMed

    Francy, Reshma C; Farid, Amro M; Youcef-Toumi, Kamal

    2015-05-01

    For many decades, state estimation (SE) has been a critical technology for energy management systems utilized by power system operators. Over time, it has become a mature technology that provides an accurate representation of system state under fairly stable and well understood system operation. The integration of variable energy resources (VERs) such as wind and solar generation, however, introduces new fast frequency dynamics and uncertainties into the system. Furthermore, such renewable energy is often integrated into the distribution system thus requiring real-time monitoring all the way to the periphery of the power grid topology and not just the (central) transmission system. The conventional solution is two fold: solve the SE problem (1) at a faster rate in accordance with the newly added VER dynamics and (2) for the entire power grid topology including the transmission and distribution systems. Such an approach results in exponentially growing problem sets which need to be solver at faster rates. This work seeks to address these two simultaneous requirements and builds upon two recent SE methods which incorporate event-triggering such that the state estimator is only called in the case of considerable novelty in the evolution of the system state. The first method incorporates only event-triggering while the second adds the concept of tracking. Both SE methods are demonstrated on the standard IEEE 14-bus system and the results are observed for a specific bus for two difference scenarios: (1) a spike in the wind power injection and (2) ramp events with higher variability. Relative to traditional state estimation, the numerical case studies showed that the proposed methods can result in computational time reductions of 90%. These results were supported by a theoretical discussion of the computational complexity of three SE techniques. The work concludes that the proposed SE techniques demonstrate practical improvements to the computational complexity of

  4. Integrating Legacy Data to Understand Agroecosystem Regional Dynamics to Catastrophic Events

    NASA Astrophysics Data System (ADS)

    Peters, D. P. C.; Burruss, N. D.; Yao, J.; Okin, G.; Hatfield, J.; Scroggs, S. L. P.; Monger, H. C.; Havstad, K.

    2016-12-01

    Multi-year extreme drought events are part of the history of the Earth system. Legacy data on the climate drivers, geomorphic features, and agroecosystem responses across a dynamically changing landscape throughout a region can provide important insights to a future where large-scale catastrophic events may occur more frequently. One of the most devastating multi-year droughts occurred in the central grasslands region of North America in the 1930s. This regional-scale climatic event combined with land management practices to result in broad-scale plant mortality and massive dust storms that impacted the entire continent. However, not all areas were affected similarly, even across relatively short distances with similar climate, soils, and land management. Spatial discontinuities in impacts occurred across a 100-km transition from high plant mortality and high rates of soil erosion in eastern Nebraska to areas in western Iowa with reductions in grass cover and biomass, but low rates of plant mortality and erosion. Because this time period preceded modern agriculture and the extensive tillage of native tallgrass prairie, the landscape was composed of both native prairie grassland and cropland. Responses were compared during the drought to responses for the same region in the 1920s (pre-drought) and the 1940s (post-drought). A large number of legacy datasets from the U.S. Department of Agriculture and other sources were spatially integrated to test two hypotheses: (1) local factors of climate and soil properties explained agroecosystem responses in the pre- and post-drought periods, (2) local factors were insufficient to explain agroecosystem responses during the multi-year drought. Analyses supported these hypotheses and found that landscape features, such as large alluvial plains that reduced connectivity by sand and deposition by wind, were more important than local factors to explain different responses along the gradient during the drought. Similar results were

  5. BioContext: an integrated text mining system for large-scale extraction and contextualization of biomolecular events.

    PubMed

    Gerner, Martin; Sarafraz, Farzaneh; Bergman, Casey M; Nenadic, Goran

    2012-08-15

    Although the amount of data in biology is rapidly increasing, critical information for understanding biological events like phosphorylation or gene expression remains locked in the biomedical literature. Most current text mining (TM) approaches to extract information about biological events are focused on either limited-scale studies and/or abstracts, with data extracted lacking context and rarely available to support further research. Here we present BioContext, an integrated TM system which extracts, extends and integrates results from a number of tools performing entity recognition, biomolecular event extraction and contextualization. Application of our system to 10.9 million MEDLINE abstracts and 234 000 open-access full-text articles from PubMed Central yielded over 36 million mentions representing 11.4 million distinct events. Event participants included over 290 000 distinct genes/proteins that are mentioned more than 80 million times and linked where possible to Entrez Gene identifiers. Over a third of events contain contextual information such as the anatomical location of the event occurrence or whether the event is reported as negated or speculative. The BioContext pipeline is available for download (under the BSD license) at http://www.biocontext.org, along with the extracted data which is also available for online browsing.

  6. DOUBLE POWER LAWS IN THE EVENT-INTEGRATED SOLAR ENERGETIC PARTICLE SPECTRUM

    SciTech Connect

    Zhao, Lulu; Zhang, Ming; Rassoul, Hamid K.

    2016-04-10

    A double power law or a power law with exponential rollover at a few to tens of MeV nucleon{sup −1} of the event-integrated differential spectra has been reported in many solar energetic particle (SEP) events. The rollover energies per nucleon of different elements correlate with a particle's charge-to-mass ratio (Q/A). The probable causes are suggested as residing in shock finite lifetimes, shock finite sizes, shock geometry, and an adiabatic cooling effect. In this work, we conduct a numerical simulation to investigate a particle's transport process in the inner heliosphere. We solve the focused transport equation using a time-backward Markov stochastic approach. The convection, magnetic focusing, adiabatic cooling effect, and pitch-angle scattering are included. The effects that the interplanetary turbulence imposes on the shape of the resulting SEP spectra are examined. By assuming a pure power-law differential spectrum at the Sun, a perfect double-power-law feature with a break energy ranging from 10 to 120 MeV nucleon{sup −1} is obtained at 1 au. We found that the double power law of the differential energy spectrum is a robust result of SEP interplanetary propagation. It works for many assumptions of interplanetary turbulence spectra that give various forms of momentum dependence of a particle's mean free path. The different spectral shapes in low-energy and high-energy ends are not just a transition from the convection-dominated propagation to diffusion-dominated propagation.

  7. Characterization of aerosol events based on the column integrated optical aerosol properties and polarimetric measurements

    NASA Astrophysics Data System (ADS)

    Mandija, Florian; Markowicz, Krzysztof; Zawadzka, Olga

    2016-12-01

    Aerosol optical properties are very useful tools for analyzing their radiative effects, which are directly or indirectly related to the global radiation budget. Investigation of column-integrated aerosol optical properties is a worldwide and well-accepted method. The introduction of new methodologies, like those of operation with polarimetric measurements, represent a new challenge to interpret the measurement data and give more detailed information about the aerosol events and their characteristics. Aerosol optical properties during the period June - August 2015 in AERONET Strzyzow station in Poland were analyzed. The aerosol properties like aerosol optical depth, Ångström exponent, fine mode fraction, fine mode contribution on AOD, asymmetry parameter, single scattering angle are analyzed synergistically with the polarimetric measurements of the degree of polarization in different solar zenith and zenith viewing angles at several wavelengths. The overall results show that aerosol events in Strzyzow were characterized mostly by fine mode aerosols. Backward-trajectories suggest that the majority of air masses come from the west. The principal component of the aerosol load was urban/industrial contamination, especially from the inner part of the continent. Additionally, the maximal values of the degree of linear polarization were found to be dependent on the solar zenith and zenith viewing angles and aerosol optical properties like aerosol optical depth and Ångström exponent. These dependencies were further analyzed in a specific case with very high mean values of AOD500 (0.59) and AE440-870 (1.91). The diurnal variations of aerosol optical properties investigated during this special case, suggest that biomass burning products are the main cause of that aerosol load over the stations.

  8. An integrated biomarker, isotopic and palaeoenvironmental study through the Late Permian event at Lusitaniadalen, Spitsbergen

    NASA Astrophysics Data System (ADS)

    Nabbefeld, Birgit; Grice, Kliti; Twitchett, Richard J.; Summons, Roger E.; Hays, Lindsay; Böttcher, Michael E.; Asif, Muhammad

    2010-03-01

    The largest extinction of the Phanerozoic occurred near the Permian/Triassic (P/Tr) boundary some 252 Ma ago. Several scenarios and drivers have been proposed for this event. Here we report for the first time an integrated study comprising sedimentological data, biomarker distributions/abundances and selected stable carbon and hydrogen isotopes along with bulk isotopes (δ 34S pyrite, δ 13C carb, δ 13C org) for a Late Permian section from Lusitaniadalen, Spitsbergen, Norway. Sedimentological and geochemical data support a marine transgression and collapse of the marine ecosystem in the Late Permian. Strong evidence for waxing and waning of photic zone euxinia throughout the Late Permian is provided by Chlorobiaceae-derived biomarkers (including δ 13C data) and δ 34S pyrite, implying multiple phases of H 2S outgassing and potentially several pulses of extinction. A rapid decrease in abundance of various land-plant biomarkers prior to the marine collapse event indicates a dramatic decline of land-plants during the Late Permian and/or increasing distance from palaeoshoreline as a consequence of sea level rise. Changes in δD of selected biomarkers also suggest a change in source of organic matter (OM) or sea level rise. We also found biomarker and isotopic evidence for a phytoplanktonic bloom triggered by eutrophication as a consequence of the marine collapse. Compound specific isotope analyses (CSIA) of algal and land-plant-derived biomarkers, as well as δ 13C of carbonate and bulk OM provide strong evidence for synchronous changes in δ 13C of marine and atmospheric CO 2, attributed to a 13C-depleted source. The source could be associated with isotopically depleted methane released from the melting of gas clathrates and/or from respired OM, due to collapse of the marine ecosystem.

  9. Neural correlates of event clusters in past and future thoughts: How the brain integrates specific episodes with autobiographical knowledge.

    PubMed

    Demblon, Julie; Bahri, Mohamed Ali; D'Argembeau, Arnaud

    2016-02-15

    When remembering the past or envisioning the future, events often come to mind in organized sequences or stories rather than in isolation from one another. The aim of the present fMRI study was to investigate the neural correlates of such event clusters. Participants were asked to consider pairs of specific past or future events: in one condition, the two events were part of the same event cluster (i.e., they were thematically and/or causally related to each other), whereas in another condition the two events only shared a surface feature (i.e., their location); a third condition was also included, in which the two events were unrelated to each other. The results showed that the processing of past and future events that were part of a same cluster was associated with higher activation in the medial prefrontal cortex (PFC), rostrolateral PFC, and left lateral temporal and parietal regions, compared to the two other conditions. Furthermore, functional connectivity analyses revealed an increased coupling between these cortical regions. These findings suggest that largely similar processes are involved in organizing events in clusters for the past and the future. The medial and rostrolateral PFC might play a pivotal role in mediating the integration of specific events with conceptual autobiographical knowledge 'stored' in more posterior regions. Through this integrative process, this set of brain regions might contribute to the attribution of an overarching meaning to representations of specific past and future events, by contextualizing them with respect to personal goals and general knowledge about one's life story.

  10. An Integrated Cyberenvironment for Event-Driven Environmental Observatory Research and Education

    NASA Astrophysics Data System (ADS)

    Myers, J.; Minsker, B.; Butler, R.

    2006-12-01

    National environmental observatories will soon provide large-scale data from diverse sensor networks and community models. While much attention is focused on piping data from sensors to archives and users, truly integrating these resources into the everyday research activities of scientists and engineers across the community, and enabling their results and innovations to be brought back into the observatory, also critical to long-term success of the observatories, is often neglected. This talk will give an overview of the Environmental Cyberinfrastructure Demonstrator (ECID) Cyberenvironment for observatory-centric environmental research and education, under development at the National Center for Supercomputing Applications (NCSA), which is designed to address these issues. Cyberenvironments incorporate collaboratory and grid technologies, web services, and other cyberinfrastructure into an overall framework that balances needs for efficient coordination and the ability to innovate. They are designed to support the full scientific lifecycle both in terms of individual experiments moving from data to workflows to publication and at the macro level where new discoveries lead to additional data, models, tools, and conceptual frameworks that augment and evolve community-scale systems such as observatories. The ECID cyberenvironment currently integrates five major components a collaborative portal, workflow engine, event manager, metadata repository, and social network personalization capabilities - that have novel features inspired by the Cyberenvironment concept and enabling powerful environmental research scenarios. A summary of these components and the overall cyberenvironment will be given in this talk, while other posters will give details on several of the components. The summary will be presented within the context of environmental use case scenarios created in collaboration with researchers from the WATERS (WATer and Environmental Research Systems) Network, a

  11. The influence of temporal asynchrony on multisensory integration in the processing of asynchronous audio-visual stimuli of real-world events: an event-related potential study.

    PubMed

    Liu, B; Jin, Z; Wang, Z; Gong, C

    2011-03-10

    In this study, we manipulated the temporal asynchrony between auditory and visual inputs, and contrasted event-related potentials (ERPs) evoked by multisensory stimuli with the summation of the ERPs evoked by unisensory-auditory (A) and unisensory-visual (V) stimuli with the same temporal asynchrony. Our goal was to investigate the influence of temporal asynchrony on multisensory integration. In our experiment, the auditory and visual inputs in the multisensory stimuli had a stimulus onset asynchrony (SOA) of -300 ms, 0 ms, or 300 ms. The results suggested that when the auditory and visual inputs were synchronous, multisensory integrations would occur in the time windows of 110-160 ms, 210-250 ms and 300-350 ms after auditory onset. When the auditory onset preceded the critical action onset by 300 ms, multisensory integrations were involved in the time windows of 110-160 ms and 300-350 ms after auditory onset. When the critical action onset preceded the auditory onset by 300 ms, multisensory integrations would occur in the time windows of 110-160 ms, 210-250 ms, 290-320 ms and 350-400 ms after auditory onset. In addition, in the time windows of 110-160 ms and 210-250 ms, the integrations were stronger when the auditory and visual inputs were synchronous, and in the time window of 250-400 ms, multisensory integrations would be different as the SOAs were different. It was suggested that multisensory integration would occur regardless of the asynchrony between auditory and visual inputs, and multisensory integration could be influenced by temporal asynchrony.

  12. Integration of hard copy and soft copy exploitation

    NASA Astrophysics Data System (ADS)

    Fultz, Roy C., Jr.

    1996-11-01

    Exploitation of remotely sensed and aerially derived imagery has, in the past, been primarily performed through the use of analog light tables, by displaying individual pieces or rolls of imagery over a brightly lit surface to allow light through the nonopaque surface of the film medium. The interpreter would then peer through optical viewing scopes allowing him (or her) to analyze the imagery. Over the course of the last two decades, digital data, or as it is better known, "softcopy imagery," has for many become the desired path which technology has dictated. Softcopy imagery offers many benefits, such as the ability to manipulate imagery in ways analog workstations cannot and were never designed to do. Functions which can be performed on softcopy imagery are endless and growing constantly: image spatial rectification, pixel manipulation, image contrast, and brightness enhancements. All are performed by the running of algorithmic equations to manipulate the digital data. It has become evident that in the future a large portion of imagery analysis will be performed by softcopy. However, studies indicate that aerial imagery will continue to be acquired via hardcopy means for many civil, educational, and commercial applications in the foreseeable future, making it clear that any large scale transformation from hardcopy to softcopy will not be feasible for a long time to come. A major issue dictating the slow-down in this transition is the over 35 years of hardcopy imagery archived and housed in facilities throughout the world, including the recently declassified "Corona" satellite imagery which will provide a wealth of hardcopy data for use by ecologists and conservationists. Yes, the technology to transfer hardcopy to softcopy exists, but the time and cost required to complete this task would be phenomenal and, in many cases, when digitization and storage become affordable, it still may prove beneficial to retain the imagery in a hardcopy form for retention of the highest quality resolution. An analogy which I feel best portrays this dilemma is the automobile-eventually all automobiles will be electric or hydrogen driven but the time and cost involved in the transformation predicts a slow progression. Since a predominate amount of imagery analysis, especially in the intelligence community, is the comparison ofnew imagery data to that of archived imagery in order to detect changes or to monitor progressions, it is conceivable that the majority of imagery analysts will be using a combination of hardcopy and softcopy workstations in order to facilitate analysis. The incorporation of hardcopy and softcopy functions into one workstation is the most cost effective and time essential means in which in-depth analysis can be performed.

  13. The Knowledge-Integrated Network Biomarkers Discovery for Major Adverse Cardiac Events

    PubMed Central

    Jin, Guangxu; Zhou, Xiaobo; Wang, Honghui; Zhao, Hong; Cui, Kemi; Zhang, Xiang-Sun; Chen, Luonan; Hazen, Stanley L.; Li, King; Wong, Stephen T. C.

    2010-01-01

    The mass spectrometry (MS) technology in clinical proteomics is very promising for discovery of new biomarkers for diseases management. To overcome the obstacles of data noises in MS analysis, we proposed a new approach of knowledge-integrated biomarker discovery using data from Major Adverse Cardiac Events (MACE) patients. We first built up a cardiovascular-related network based on protein information coming from protein annotations in Uniprot, protein–protein interaction (PPI), and signal transduction database. Distinct from the previous machine learning methods in MS data processing, we then used statistical methods to discover biomarkers in cardiovascular-related network. Through the tradeoff between known protein information and data noises in mass spectrometry data, we finally could firmly identify those high-confident biomarkers. Most importantly, aided by protein–protein interaction network, that is, cardiovascular-related network, we proposed a new type of biomarkers, that is, network biomarkers, composed of a set of proteins and the interactions among them. The candidate network biomarkers can classify the two groups of patients more accurately than current single ones without consideration of biological molecular interaction. PMID:18665624

  14. Integrated Approach to Reduce Perinatal Adverse Events: Standardized Processes, Interdisciplinary Teamwork Training, and Performance Feedback.

    PubMed

    Riley, William; Begun, James W; Meredith, Les; Miller, Kristi K; Connolly, Kathy; Price, Rebecca; Muri, Janet H; McCullough, Mac; Davis, Stanley

    2016-12-01

    To improve safety practices and reduce adverse events in perinatal units of acute care hospitals. Primary data collected from perinatal units of 14 hospitals participating in the intervention between 2008 and 2012. Baseline secondary data collected from the same hospitals between 2006 and 2007. A prospective study involving 342,754 deliveries was conducted using a quality improvement collaborative that supported three primary interventions. Primary measures include adoption of three standardized care processes and four measures of outcomes. Chart audits were conducted to measure the implementation of standardized care processes. Outcome measures were collected and validated by the National Perinatal Information Center. The hospital perinatal units increased use of all three care processes, raising consolidated overall use from 38 to 81 percent between 2008 and 2012. The harms measured by the Adverse Outcome Index decreased 14 percent, and a run chart analysis revealed two special causes associated with the interventions. This study demonstrates the ability of hospital perinatal staff to implement efforts to reduce perinatal harm using a quality improvement collaborative. Findings help inform the relationship between the use of standardized care processes, teamwork training, and improved perinatal outcomes, and suggest that a multiplicity of integrated strategies, rather than a single intervention, may be essential to achieve high reliability. © Health Research and Educational Trust.

  15. Differential Effects of Motor Efference Copies and Proprioceptive Information on Response Evaluation Processes

    PubMed Central

    Stock, Ann-Kathrin; Wascher, Edmund; Beste, Christian

    2013-01-01

    It is well-kown that sensory information influences the way we execute motor responses. However, less is known about if and how sensory and motor information are integrated in the subsequent process of response evaluation. We used a modified Simon Task to investigate how these streams of information are integrated in response evaluation processes, applying an in-depth neurophysiological analysis of event-related potentials (ERPs), time-frequency decomposition and sLORETA. The results show that response evaluation processes are differentially modulated by afferent proprioceptive information and efference copies. While the influence of proprioceptive information is mediated via oscillations in different frequency bands, efference copy based information about the motor execution is specifically mediated via oscillations in the theta frequency band. Stages of visual perception and attention were not modulated by the interaction of proprioception and motor efference copies. Brain areas modulated by the interactive effects of proprioceptive and efference copy based information included the middle frontal gyrus and the supplementary motor area (SMA), suggesting that these areas integrate sensory information for the purpose of response evaluation. The results show how motor response evaluation processes are modulated by information about both the execution and the location of a response. PMID:23658624

  16. Differential effects of motor efference copies and proprioceptive information on response evaluation processes.

    PubMed

    Stock, Ann-Kathrin; Wascher, Edmund; Beste, Christian

    2013-01-01

    It is well-kown that sensory information influences the way we execute motor responses. However, less is known about if and how sensory and motor information are integrated in the subsequent process of response evaluation. We used a modified Simon Task to investigate how these streams of information are integrated in response evaluation processes, applying an in-depth neurophysiological analysis of event-related potentials (ERPs), time-frequency decomposition and sLORETA. The results show that response evaluation processes are differentially modulated by afferent proprioceptive information and efference copies. While the influence of proprioceptive information is mediated via oscillations in different frequency bands, efference copy based information about the motor execution is specifically mediated via oscillations in the theta frequency band. Stages of visual perception and attention were not modulated by the interaction of proprioception and motor efference copies. Brain areas modulated by the interactive effects of proprioceptive and efference copy based information included the middle frontal gyrus and the supplementary motor area (SMA), suggesting that these areas integrate sensory information for the purpose of response evaluation. The results show how motor response evaluation processes are modulated by information about both the execution and the location of a response.

  17. Methods for external event screening quantification: Risk Methods Integration and Evaluation Program (RMIEP) methods development

    SciTech Connect

    Ravindra, M.K.; Banon, H.

    1992-07-01

    In this report, the scoping quantification procedures for external events in probabilistic risk assessments of nuclear power plants are described. External event analysis in a PRA has three important goals; (1) the analysis should be complete in that all events are considered; (2) by following some selected screening criteria, the more significant events are identified for detailed analysis; (3) the selected events are analyzed in depth by taking into account the unique features of the events: hazard, fragility of structures and equipment, external-event initiated accident sequences, etc. Based on the above goals, external event analysis may be considered as a three-stage process: Stage I: Identification and Initial Screening of External Events; Stage II: Bounding Analysis; Stage III: Detailed Risk Analysis. In the present report, first, a review of published PRAs is given to focus on the significance and treatment of external events in full-scope PRAs. Except for seismic, flooding, fire, and extreme wind events, the contributions of other external events to plant risk have been found to be negligible. Second, scoping methods for external events not covered in detail in the NRC`s PRA Procedures Guide are provided. For this purpose, bounding analyses for transportation accidents, extreme winds and tornadoes, aircraft impacts, turbine missiles, and chemical release are described.

  18. Methods for external event screening quantification: Risk Methods Integration and Evaluation Program (RMIEP) methods development

    SciTech Connect

    Ravindra, M.K.; Banon, H. )

    1992-07-01

    In this report, the scoping quantification procedures for external events in probabilistic risk assessments of nuclear power plants are described. External event analysis in a PRA has three important goals; (1) the analysis should be complete in that all events are considered; (2) by following some selected screening criteria, the more significant events are identified for detailed analysis; (3) the selected events are analyzed in depth by taking into account the unique features of the events: hazard, fragility of structures and equipment, external-event initiated accident sequences, etc. Based on the above goals, external event analysis may be considered as a three-stage process: Stage I: Identification and Initial Screening of External Events; Stage II: Bounding Analysis; Stage III: Detailed Risk Analysis. In the present report, first, a review of published PRAs is given to focus on the significance and treatment of external events in full-scope PRAs. Except for seismic, flooding, fire, and extreme wind events, the contributions of other external events to plant risk have been found to be negligible. Second, scoping methods for external events not covered in detail in the NRC's PRA Procedures Guide are provided. For this purpose, bounding analyses for transportation accidents, extreme winds and tornadoes, aircraft impacts, turbine missiles, and chemical release are described.

  19. Screening somatic cell nuclear transfer parameters for generation of transgenic cloned cattle with intragenomic integration of additional gene copies that encode bovine adipocyte-type fatty acid-binding protein (A-FABP).

    PubMed

    Guo, Yong; Li, Hejuan; Wang, Ying; Yan, Xingrong; Sheng, Xihui; Chang, Di; Qi, Xiaolong; Wang, Xiangguo; Liu, Yunhai; Li, Junya; Ni, Hemin

    2017-02-01

    Somatic cell nuclear transfer (SCNT) is frequently used to produce transgenic cloned livestock, but it is still associated with low success rates. To our knowledge, we are the first to report successful production of transgenic cattle that overexpress bovine adipocyte-type fatty acid binding proteins (A-FABPs) with the aid of SCNT. Intragenomic integration of additional A-FABP gene copies has been found to be positively correlated with the intramuscular fat content in different farm livestock species. First, we optimized the cloning parameters to produce bovine embryos integrated with A-FABP by SCNT, such as applied voltage field strength and pulse duration for electrofusion, morphology and size of donor cells, and number of donor cells passages. Then, bovine fibroblast cells from Qinchuan cattle were transfected with A-FABP and used as donor cells for SCNT. Hybrids of Simmental and Luxi local cattle were selected as the recipient females for A-FABP transgenic SCNT-derived embryos. The results showed that a field strength of 2.5 kV/cm with two 10-μs duration electrical pulses was ideal for electrofusion, and 4-6th generation circular smooth type donor cells with diameters of 15-25 μm were optimal for producing transgenic bovine embryos by SCNT, and resulted in higher fusion (80%), cleavage (73%), and blastocyst (27%) rates. In addition, we obtained two transgenic cloned calves that expressed additional bovine A-FABP gene copies, as detected by PCR-amplified cDNA sequencing. We proposed a set of optimal protocols to produce transgenic SCNT-derived cattle with intragenomic integration of ectopic A-FABP-inherited exon sequences.

  20. Business Process Design Method Based on Business Event Model for Enterprise Information System Integration

    NASA Astrophysics Data System (ADS)

    Kobayashi, Takashi; Komoda, Norihisa

    The traditional business process design methods, in which the usecase is the most typical, have no useful framework to design the activity sequence with. Therefore, the design efficiency and quality vary widely according to the designer’s experience and skill. In this paper, to solve this problem, we propose the business events and their state transition model (a basic business event model) based on the language/action perspective, which is the result in the cognitive science domain. In the business process design, using this model, we decide event occurrence conditions so that every event synchronizes with each other. We also propose the design pattern to decide the event occurrence condition (a business event improvement strategy). Lastly, we apply the business process design method based on the business event model and the business event improvement strategy to the credit card issue process and estimate its effect.

  1. An integrative approach to investigate the respective roles of single-nucleotide variants and copy-number variants in Attention-Deficit/Hyperactivity Disorder

    PubMed Central

    de Araújo Lima, Leandro; Feio-dos-Santos, Ana Cecília; Belangero, Sintia Iole; Gadelha, Ary; Bressan, Rodrigo Affonseca; Salum, Giovanni Abrahão; Pan, Pedro Mario; Moriyama, Tais Silveira; Graeff-Martins, Ana Soledade; Tamanaha, Ana Carina; Alvarenga, Pedro; Krieger, Fernanda Valle; Fleitlich-Bilyk, Bacy; Jackowski, Andrea Parolin; Brietzke, Elisa; Sato, João Ricardo; Polanczyk, Guilherme Vanoni; Mari, Jair de Jesus; Manfro, Gisele Gus; do Rosário, Maria Conceição; Miguel, Eurípedes Constantino; Puga, Renato David; Tahira, Ana Carolina; Souza, Viviane Neri; Chile, Thais; Gouveia, Gisele Rodrigues; Simões, Sérgio Nery; Chang, Xiao; Pellegrino, Renata; Tian, Lifeng; Glessner, Joseph T.; Hashimoto, Ronaldo Fumio; Rohde, Luis Augusto; Sleiman, Patrick M.A.; Hakonarson, Hakon; Brentani, Helena

    2016-01-01

    Many studies have attempted to investigate the genetic susceptibility of Attention-Deficit/Hyperactivity Disorder (ADHD), but without much success. The present study aimed to analyze both single-nucleotide and copy-number variants contributing to the genetic architecture of ADHD. We generated exome data from 30 Brazilian trios with sporadic ADHD. We also analyzed a Brazilian sample of 503 children/adolescent controls from a High Risk Cohort Study for the Development of Childhood Psychiatric Disorders, and also previously published results of five CNV studies and one GWAS meta-analysis of ADHD involving children/adolescents. The results from the Brazilian trios showed that cases with de novo SNVs tend not to have de novo CNVs and vice-versa. Although the sample size is small, we could also see that various comorbidities are more frequent in cases with only inherited variants. Moreover, using only genes expressed in brain, we constructed two “in silico” protein-protein interaction networks, one with genes from any analysis, and other with genes with hits in two analyses. Topological and functional analyses of genes in this network uncovered genes related to synapse, cell adhesion, glutamatergic and serotoninergic pathways, both confirming findings of previous studies and capturing new genes and genetic variants in these pathways. PMID:26947246

  2. An integrative approach to investigate the respective roles of single-nucleotide variants and copy-number variants in Attention-Deficit/Hyperactivity Disorder.

    PubMed

    Lima, Leandro de Araújo; Feio-dos-Santos, Ana Cecília; Belangero, Sintia Iole; Gadelha, Ary; Bressan, Rodrigo Affonseca; Salum, Giovanni Abrahão; Pan, Pedro Mario; Moriyama, Tais Silveira; Graeff-Martins, Ana Soledade; Tamanaha, Ana Carina; Alvarenga, Pedro; Krieger, Fernanda Valle; Fleitlich-Bilyk, Bacy; Jackowski, Andrea Parolin; Brietzke, Elisa; Sato, João Ricardo; Polanczyk, Guilherme Vanoni; Mari, Jair de Jesus; Manfro, Gisele Gus; do Rosário, Maria Conceição; Miguel, Eurípedes Constantino; Puga, Renato David; Tahira, Ana Carolina; Souza, Viviane Neri; Chile, Thais; Gouveia, Gisele Rodrigues; Simões, Sérgio Nery; Chang, Xiao; Pellegrino, Renata; Tian, Lifeng; Glessner, Joseph T; Hashimoto, Ronaldo Fumio; Rohde, Luis Augusto; Sleiman, Patrick M A; Hakonarson, Hakon; Brentani, Helena

    2016-03-07

    Many studies have attempted to investigate the genetic susceptibility of Attention-Deficit/Hyperactivity Disorder (ADHD), but without much success. The present study aimed to analyze both single-nucleotide and copy-number variants contributing to the genetic architecture of ADHD. We generated exome data from 30 Brazilian trios with sporadic ADHD. We also analyzed a Brazilian sample of 503 children/adolescent controls from a High Risk Cohort Study for the Development of Childhood Psychiatric Disorders, and also previously published results of five CNV studies and one GWAS meta-analysis of ADHD involving children/adolescents. The results from the Brazilian trios showed that cases with de novo SNVs tend not to have de novo CNVs and vice-versa. Although the sample size is small, we could also see that various comorbidities are more frequent in cases with only inherited variants. Moreover, using only genes expressed in brain, we constructed two "in silico" protein-protein interaction networks, one with genes from any analysis, and other with genes with hits in two analyses. Topological and functional analyses of genes in this network uncovered genes related to synapse, cell adhesion, glutamatergic and serotoninergic pathways, both confirming findings of previous studies and capturing new genes and genetic variants in these pathways.

  3. PennCNV: An integrated hidden Markov model designed for high-resolution copy number variation detection in whole-genome SNP genotyping data

    PubMed Central

    Wang, Kai; Li, Mingyao; Hadley, Dexter; Liu, Rui; Glessner, Joseph; Grant, Struan F.A.; Hakonarson, Hakon; Bucan, Maja

    2007-01-01

    Comprehensive identification and cataloging of copy number variations (CNVs) is required to provide a complete view of human genetic variation. The resolution of CNV detection in previous experimental designs has been limited to tens or hundreds of kilobases. Here we present PennCNV, a hidden Markov model (HMM) based approach, for kilobase-resolution detection of CNVs from Illumina high-density SNP genotyping data. This algorithm incorporates multiple sources of information, including total signal intensity and allelic intensity ratio at each SNP marker, the distance between neighboring SNPs, the allele frequency of SNPs, and the pedigree information where available. We applied PennCNV to genotyping data generated for 112 HapMap individuals; on average, we detected ∼27 CNVs for each individual with a median size of ∼12 kb. Excluding common rearrangements in lymphoblastoid cell lines, the fraction of CNVs in offspring not detected in parents (CNV-NDPs) was 3.3%. Our results demonstrate the feasibility of whole-genome fine-mapping of CNVs via high-density SNP genotyping. PMID:17921354

  4. Integrated stratigraphy of the Cenomanian-Turonian boundary interval: improving understanding of Oceanic Anoxic Events

    NASA Astrophysics Data System (ADS)

    Jarvis, Ian

    2014-05-01

    The Cenomanian-Turonian boundary (CTB) interval ~ 94 Ma represented a period of major global palaeoenvironmental change. Increasingly detailed multidisciplinary studies integrating sedimentological, palaeontological and geochemical data from multiple basins, are enabling the development of refined but complex models that aid understanding of the mechanisms driving changes in ocean productivity and climate. This paper reviews some of the exciting new developments in this field. Facies change characterizes the CTB interval in most areas. In the Chalk seas of northern Europe, a widespead hiatus was followed by the deposition of clay-rich organic-lean beds of the Plenus Marl and its equivalents, and then nodular chalks. In the North Sea basin and its onshore extension in eastern England and northern Germany, black shales of the Black Band (Blodøks Formation, Hasseltal Formation) occur. Similarly, in northern Tethys, a brief interval of black shale accumulation within a predominantly carbonate succession, is exemplified by the Niveau Thomel in the Vocontian Basin (SE France), and the Livello Bonarelli in Italy. Widespread deposition of organic-rich marine sediments during CTB times led to 12C depletion in surface carbon reservoirs (oceans, atmosphere, biosphere), and a large positive global δ13C excursion preserved in marine carbonates and both marine and terrestrial organic matter (Oceanic Anoxic Event 2). Significant biotic turnover characterises the boundary interval, and inter-regional correlation may be achieved at high resolution using integrated biostratigraphy employing macrofossils (ammonites, inoceramid bivalves), microfossils (planktonic foraminifera, dinoflagellate cysts) and calcareous nannofossils. Correlations can be tested against those based on comparison of δ13C profiles - carbon isotope chemostratigraphy, supplemented by oxygen isotope and elemental data. Interpretation of paired carbonate - organic matter δ13C data from multiple CTB sections

  5. Integrated Analysis of Genetic and Proteomic Data Identifies Biomarkers Associated with Adverse Events Following Smallpox Vaccination

    PubMed Central

    Reif, David M.; Motsinger-Reif, Alison A.; McKinney, Brett A.; Rock, Michael T.; Crowe, James E.; Moore, Jason H.

    2009-01-01

    Complex clinical outcomes, such as adverse reaction to vaccination, arise from the concerted interactions among the myriad components of a biological system. Therefore, comprehensive etiological models can be developed only through the integrated study of multiple types of experimental data. In this study, we apply this paradigm to high-dimensional genetic and proteomic data collected to elucidate the mechanisms underlying development of adverse events (AEs) in patients following smallpox vaccination. Since vaccination was successful in all of the patients under study, the AE outcomes reported likely represent the result of interactions among immune system components that result in excessive or prolonged immune stimulation. In the current study, we examined 1442 genetic variables (SNPs) and 108 proteomic variables (serum cytokine concentrations) to model AE risk. To accomplish this daunting analytical task, we employed the Random Forests™ (RF) method to filter out the most important attributes, then we used the selected attributes to build a final decision tree model. This strategy is well-suited to integrated analysis, as relevant attributes may be selected from categorical or continuous data. Importantly, RF is a natural approach for studying the type of gene-gene, gene-protein, and protein-protein interactions we hypothesize to be involved in development of clinical AEs. RF importance scores for particular attributes take interactions into account, and there may be interactions across data types. Combining information from previous studies on AEs related to smallpox vaccination with the genetic and proteomic attributes identified by RF, we built a comprehensive model of AE development that includes the cytokines ICAM-1 (CD54), IL-10, and CSF-3 (G-CSF), and a genetic polymorphism in the cyokine gene IL4. The biological factors included in the model support our hypothesized mechanism for the development of AEs involving prolonged stimulation of inflammatory

  6. Copy Machine Art.

    ERIC Educational Resources Information Center

    Sommer, Jean

    1984-01-01

    Images created with copy machines make children feel successful, as their work acquires the authority of being printed. Students can learn advanced processes like electrostatic image-making and can get involved in projects like making collages. They acquire an appreciation of design and of two-dimensional composition. (CS)

  7. Polycomb repressive complex 1 provides a molecular explanation for repeat copy number dependency in FSHD muscular dystrophy.

    PubMed

    Casa, Valentina; Runfola, Valeria; Micheloni, Stefano; Aziz, Arif; Dilworth, F Jeffrey; Gabellini, Davide

    2016-12-30

    Repression of repetitive elements is crucial to preserve genome integrity and has been traditionally ascribed to constitutive heterochromatin pathways. FacioScapuloHumeral Muscular Dystrophy (FSHD), one of the most common myopathies, is characterized by a complex interplay of genetic and epigenetic events. The main FSHD form is linked to a reduced copy number of the D4Z4 macrosatellite repeat on 4q35, causing loss of silencing and aberrant expression of the D4Z4-embedded DUX4 gene leading to disease. By an unknown mechanism, D4Z4 copy-number correlates with FSHD phenotype. Here we show that the DUX4 proximal promoter (DUX4p) is sufficient to nucleate the enrichment of both constitutive and facultative heterochromatin components and to mediate a copy-number dependent gene silencing. We found that both the CpG/GC dense DNA content and the repetitive nature of DUX4p arrays are important for their repressive ability. We showed that DUX4p mediates a copy number-dependent Polycomb Repressive Complex 1 (PRC1) recruitment, which is responsible for the copy-number dependent gene repression. Overall, we directly link genetic and epigenetic defects in FSHD by proposing a novel molecular explanation for the copy number-dependency in FSHD pathogenesis, and offer insight into the molecular functions of repeats in chromatin regulation.

  8. The influence of matching degrees of synchronous auditory and visual information in videos of real-world events on cognitive integration: an event-related potential study.

    PubMed

    Liu, B; Wang, Z; Li, J

    2011-10-27

    In this article, we aim to study the influence of matching degrees of synchronous natural auditory and visual information on cognitive integration. Videos with matched, moderately matched, and mismatched audio-visual information were used as stimuli. The results showed that videos with moderately matched audio-visual information could elicit N400, P600, and late negativity (LN) effects, while videos with mismatched audio-visual information could elicit N400 and late negativity effects as compared with those with matched audio-visual information. It was further proven that N400 might reflect the connection process during multisensory integration, and P600 was more related to the evaluation process on the matching degrees of the audio-visual information in videos. Late negativity under the mismatched condition might be the combination of late frontal negativity (LFN) and late posterior negativity (LPN), which reflected the attention reallocating process and the recognition process, while late negativity under the moderately matched condition might be the LPN, which was related to the recognition process in the human brain. It was demonstrated that cognitive integration of synchronous audio-visual information would be modulated by different matching degrees of audio-visual information as indexed by different event-related potential (ERP) effects.

  9. Temperature control system for the study of single event effects in integrated circuits using a cyclotron accelerator

    NASA Astrophysics Data System (ADS)

    Bakerenkov, A. S.; Belyakov, V. V.; Kozyukov, A. E.; Pershenkov, V. S.; Solomatin, A. V.; Shurenkov, V. V.

    2015-02-01

    The temperature control system for the study of single event disruptions produced by hard ion impacts in integrated circuits is described. Heating and cooling of the irradiated device are achieved using thermoelectric modules (Peltier modules). The thermodynamic performance of the system is estimated. The technique for the numerical estimation of the main parameters of the temperature control system for cooling and heating is considered. The results of a test of the system in a vacuum cell of an accelerator are presented.

  10. Reporting Clinical End Points and Safety Events in an Acute Coronary Syndrome Trial: Results With Integrated Collection.

    PubMed

    Guimarães, Patrícia O; Lopes, Renato D; Stevens, Susanna R; Zimerman, André; Wruck, Lisa; James, Stefan K; Haque, Ghazala; Giraldez, Roberto Rocha C V; Alexander, John H; Alexander, Karen P

    2017-04-24

    End points and adverse events (AEs) are collected separately in clinical trials, yet regulatory requirements for serious AE reporting vary across regions, so classifying end points according to seriousness criteria can be useful in global trials. In the Apixaban for Prevention of Acute Ischemic Events 2 (APPRAISE-2) trial, patients with a recent acute coronary syndrome were randomized to apixaban or placebo for the prevention of recurrent ischemic events. Suspected end points (myocardial infarction, stroke, or bleeding) were adjudicated by an independent clinical events classification committee. Safety criteria were collected for suspected end points and AEs. Patient-level event rates per 100 patient-days of follow-up, modeled using Poisson regression, explored the influence of region and patient characteristics on event reporting. Overall, 13 909 events were reported by 858 sites in 39 countries; 8.4% (n=1166) were suspected end points, and 91.6% (n=12 743) were AEs. Overall, 66.0% of suspected end points were confirmed by the clinical events classification committee. Most clinical events classification committee-confirmed end points met criteria to be classified as serious (94.0%); many clinical events classification committee-negated end points also did (63.2%), but fewer AEs met seriousness criteria (17.9%). The most common seriousness criterion was hospitalization (79.9%, n=2594). Region explained 28.7% of end point- and 26.4% of serious AE-reporting variation, and patient characteristics explained an additional 25.4% of end point and 13.4% of serious AE variation. Nonserious AE-reporting variation was not explained by adjustment. An integrated collection of end points and serious AEs is feasible in a multinational trial and illustrates the shared characteristics of events. Tailoring event collection to fit the phase and purpose of the trial is achievable and informative. URL: http://www.clinicaltrials.gov. Unique identifier: NCT00831441. © 2017 The

  11. Method for critical software event execution reliability in high integrity software

    SciTech Connect

    Kidd, M.E.

    1997-11-01

    This report contains viewgraphs on a method called SEER, which provides a high level of confidence that critical software driven event execution sequences faithfully exceute in the face of transient computer architecture failures in both normal and abnormal operating environments.

  12. Vy-PER: eliminating false positive detection of virus integration events in next generation sequencing data

    PubMed Central

    Forster, Michael; Szymczak, Silke; Ellinghaus, David; Hemmrich, Georg; Rühlemann, Malte; Kraemer, Lars; Mucha, Sören; Wienbrandt, Lars; Stanulla, Martin; Franke, Andre

    2015-01-01

    Several pathogenic viruses such as hepatitis B and human immunodeficiency viruses may integrate into the host genome. These virus/host integrations are detectable using paired-end next generation sequencing. However, the low number of expected true virus integrations may be difficult to distinguish from the noise of many false positive candidates. Here, we propose a novel filtering approach that increases specificity without compromising sensitivity for virus/host chimera detection. Our detection pipeline termed Vy-PER (Virus integration detection bY Paired End Reads) outperforms existing similar tools in speed and accuracy. We analysed whole genome data from childhood acute lymphoblastic leukemia (ALL), which is characterised by genomic rearrangements and usually associated with radiation exposure. This analysis was motivated by the recently reported virus integrations at genomic rearrangement sites and association with chromosomal instability in liver cancer. However, as expected, our analysis of 20 tumour and matched germline genomes from ALL patients finds no significant evidence for integrations by known viruses. Nevertheless, our method eliminates 12,800 false positives per genome (80× coverage) and only our method detects singleton human-phiX174-chimeras caused by optical errors of the Illumina HiSeq platform. This high accuracy is useful for detecting low virus integration levels as well as non-integrated viruses. PMID:26166306

  13. Audiovisual Speech Integration in Pervasive Developmental Disorder: Evidence from Event-Related Potentials

    ERIC Educational Resources Information Center

    Magnee, Maurice J. C. M.; de Gelder, Beatrice; van Engeland, Herman; Kemner, Chantal

    2008-01-01

    Background: Integration of information from multiple sensory sources is an important prerequisite for successful social behavior, especially during face-to-face conversation. It has been suggested that communicative impairments among individuals with pervasive developmental disorders (PDD) might be caused by an inability to integrate synchronously…

  14. Vy-PER: eliminating false positive detection of virus integration events in next generation sequencing data.

    PubMed

    Forster, Michael; Szymczak, Silke; Ellinghaus, David; Hemmrich, Georg; Rühlemann, Malte; Kraemer, Lars; Mucha, Sören; Wienbrandt, Lars; Stanulla, Martin; Franke, Andre

    2015-07-13

    Several pathogenic viruses such as hepatitis B and human immunodeficiency viruses may integrate into the host genome. These virus/host integrations are detectable using paired-end next generation sequencing. However, the low number of expected true virus integrations may be difficult to distinguish from the noise of many false positive candidates. Here, we propose a novel filtering approach that increases specificity without compromising sensitivity for virus/host chimera detection. Our detection pipeline termed Vy-PER (Virus integration detection bY Paired End Reads) outperforms existing similar tools in speed and accuracy. We analysed whole genome data from childhood acute lymphoblastic leukemia (ALL), which is characterised by genomic rearrangements and usually associated with radiation exposure. This analysis was motivated by the recently reported virus integrations at genomic rearrangement sites and association with chromosomal instability in liver cancer. However, as expected, our analysis of 20 tumour and matched germline genomes from ALL patients finds no significant evidence for integrations by known viruses. Nevertheless, our method eliminates 12,800 false positives per genome (80× coverage) and only our method detects singleton human-phiX174-chimeras caused by optical errors of the Illumina HiSeq platform. This high accuracy is useful for detecting low virus integration levels as well as non-integrated viruses.

  15. Audiovisual Speech Integration in Pervasive Developmental Disorder: Evidence from Event-Related Potentials

    ERIC Educational Resources Information Center

    Magnee, Maurice J. C. M.; de Gelder, Beatrice; van Engeland, Herman; Kemner, Chantal

    2008-01-01

    Background: Integration of information from multiple sensory sources is an important prerequisite for successful social behavior, especially during face-to-face conversation. It has been suggested that communicative impairments among individuals with pervasive developmental disorders (PDD) might be caused by an inability to integrate synchronously…

  16. The spatial reliability of task-irrelevant sounds modulates bimodal audiovisual integration: An event-related potential study.

    PubMed

    Li, Qi; Yu, Hongtao; Wu, Yan; Gao, Ning

    2016-08-26

    The integration of multiple sensory inputs is essential for perception of the external world. The spatial factor is a fundamental property of multisensory audiovisual integration. Previous studies of the spatial constraints on bimodal audiovisual integration have mainly focused on the spatial congruity of audiovisual information. However, the effect of spatial reliability within audiovisual information on bimodal audiovisual integration remains unclear. In this study, we used event-related potentials (ERPs) to examine the effect of spatial reliability of task-irrelevant sounds on audiovisual integration. Three relevant ERP components emerged: the first at 140-200ms over a wide central area, the second at 280-320ms over the fronto-central area, and a third at 380-440ms over the parieto-occipital area. Our results demonstrate that ERP amplitudes elicited by audiovisual stimuli with reliable spatial relationships are larger than those elicited by stimuli with inconsistent spatial relationships. In addition, we hypothesized that spatial reliability within an audiovisual stimulus enhances feedback projections to the primary visual cortex from multisensory integration regions. Overall, our findings suggest that the spatial linking of visual and auditory information depends on spatial reliability within an audiovisual stimulus and occurs at a relatively late stage of processing. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  17. Estimation of integrated public risks for nonseismic external events affecting the Savannah River Site

    SciTech Connect

    Durant, W.S.; robinette, R.J.; Kirchner, J.R.

    1994-03-01

    In essence, this study was envisioned as the ``combination`` of existing accident dose and risk calculations from safety analyses of individual facilities. However, because of the extended time period over which the safety analyses were prepared, calculational assumptions and methodologies differed between the analyses. The scope of this study therefore included the standardization of assumptions and calculations as necessary to insure that the analytical logic was consistent for all the facilities. Each of the nonseismic external events considered in the analyses are addressed in individual sections in this report. In Section 2, extreme straight-line winds are examined. Section 3 addresses tornadoes, and Section 4 addresses other external events [floods, other extreme weather events (lightning, hail, and extremes in temperature or precipitation), vehicle impact, accidents involving adjacent facilities, aircraft impact, and meteorite impact]. Section 5 provides a summary of the general conclusions of the report.

  18. Virus transcript levels and cell growth rates after naturally occurring HPV16 integration events in basal cervical keratinocytes.

    PubMed

    Scarpini, Cinzia G; Groves, Ian J; Pett, Mark R; Ward, Dawn; Coleman, Nicholas

    2014-07-01

    Cervical carcinogenesis is characterized by a clonal selection process in which the high-risk human papillomavirus (HRHPV) genome usually changes from the extra-chromosomal (episomal) state seen in productive infections to DNA that is integrated into host chromosomes. However, it is not clear whether all HRHPV integration events provide cells with a selective growth advantage compared with the episome-containing cells from which they originate. It is also unclear whether selection of cells containing a particular integrant from a mixed population simply reflects the highest levels of virus oncogene expression or has additional determinants. These early events in cervical carcinogenesis cannot readily be addressed by cross-sectional studies of clinical samples. We used the W12 model system to generate a panel of cervical squamous cell clones that were derived from an identical background under non-competitive conditions and differed only by the genomic site of HPV16 integration. Compared with the 'baseline' episome-containing cells from which they were isolated, only 9/17 clones (53%) showed significantly greater growth rates and only 7/17 (41%) showed significantly greater expression of the major virus oncogenes E7/E6. There were significant variations in levels of HPV16 transcription per DNA template, changes that were associated with histone modifications in the integrated virus chromatin. Cell growth rates showed only weak and non-significant associations with protein and mRNA levels for E7, E6, and the mean E7/E6 values. We conclude that HPV16 integration in basal cervical cells does not necessarily lead to increased levels of virus oncogenes, or to a competitive growth advantage, when compared with the initiating episome-containing cells.

  19. Integrated Analysis of Genetic and Proteomic Data Identifies Biomarkers Associated with Adverse Events Following Smallpox Vaccination

    EPA Science Inventory

    Complex clinical outcomes, such as adverse reaction to vaccination, arise from the concerted interactions among the myriad components of a biological system. Therefore, comprehensive etiological models can be developed only through the integrated study of multiple types of experi...

  20. Integrated Analysis of Genetic and Proteomic Data Identifies Biomarkers Associated with Adverse Events Following Smallpox Vaccination

    EPA Science Inventory

    Complex clinical outcomes, such as adverse reaction to vaccination, arise from the concerted interactions among the myriad components of a biological system. Therefore, comprehensive etiological models can be developed only through the integrated study of multiple types of experi...

  1. Integrating legacy data to understand agroecosystem regional dynamics to catastrophic events

    USDA-ARS?s Scientific Manuscript database

    Multi-year extreme drought events are part of the history of the Earth system. Legacy data on the climate drivers, geomorphic features, and agroecosystem responses across a dynamically changing landscape throughout a region can provide important insights to a future where large-scale catastrophic ev...

  2. Final Scientific Report, Integrated Seismic Event Detection and Location by Advanced Array Processing

    SciTech Connect

    Kvaerna, T.; Gibbons. S.J.; Ringdal, F; Harris, D.B.

    2007-01-30

    In the field of nuclear explosion monitoring, it has become a priority to detect, locate, and identify seismic events down to increasingly small magnitudes. The consideration of smaller seismic events has implications for a reliable monitoring regime. Firstly, the number of events to be considered increases greatly; an exponential increase in naturally occurring seismicity is compounded by large numbers of seismic signals generated by human activity. Secondly, the signals from smaller events become more difficult to detect above the background noise and estimates of parameters required for locating the events may be subject to greater errors. Thirdly, events are likely to be observed by a far smaller number of seismic stations, and the reliability of event detection and location using a very limited set of observations needs to be quantified. For many key seismic stations, detection lists may be dominated by signals from routine industrial explosions which should be ascribed, automatically and with a high level of confidence, to known sources. This means that expensive analyst time is not spent locating routine events from repeating seismic sources and that events from unknown sources, which could be of concern in an explosion monitoring context, are more easily identified and can be examined with due care. We have obtained extensive lists of confirmed seismic events from mining and other artificial sources which have provided an excellent opportunity to assess the quality of existing fully-automatic event bulletins and to guide the development of new techniques for online seismic processing. Comparing the times and locations of confirmed events from sources in Fennoscandia and NW Russia with the corresponding time and location estimates reported in existing automatic bulletins has revealed substantial mislocation errors which preclude a confident association of detected signals with known industrial sources. The causes of the errors are well understood and are

  3. Integrating Sentence-Structural and Event Information in Early Verb Learning

    ERIC Educational Resources Information Center

    Yuan, Sylvia Hsin Wei

    2009-01-01

    Children use syntax as well as observations of events to learn verb meanings. This is known as syntactic bootstrapping. This dissertation investigated the origins and mechanisms of syntactic bootstrapping. Prior evidence suggested that two-year-olds, but not younger children, could use aspects of sentence structure to assign different…

  4. Magellan: a web based system for the integrated analysis of heterogeneous biological data and annotations; application to DNA copy number and expression data in ovarian cancer.

    PubMed

    Kingsley, Chris B; Kuo, Wen-Lin; Polikoff, Daniel; Berchuck, Andy; Gray, Joe W; Jain, Ajay N

    2007-02-05

    Recent advances in high throughput biological methods allow researchers to generate enormous amounts of data from a single experiment. In order to extract meaningful conclusions from this tidal wave of data, it will be necessary to develop analytical methods of sufficient power and utility. It is particularly important that biologists themselves be able to perform many of these analyses, such that their background knowledge of the experimental system under study can be used to interpret results and direct further inquiries. We have developed a web-based system, Magellan, which allows the upload, storage, and analysis of multivariate data and textual or numerical annotations. Data and annotations are treated as abstract entities, to maximize the different types of information the system can store and analyze. Annotations can be used in analyses/visualizations, as a means of subsetting data to reduce dimensionality, or as a means of projecting variables from one data type or data set to another. Analytical methods are deployed within Magellan such that new functionalities can be added in a straightforward fashion. Using Magellan, we performed an integrated analysis of genome-wide comparative genomic hybridization (CGH), mRNA expression, and clinical data from ovarian tumors. Analyses included the use of permutation-based methods to identify genes whose mRNA expression levels correlated with patient survival, a nearest neighbor classifier to predict patient survival from CGH data, and curated annotations such as genomic position and derived annotations such as statistical computations to explore the quantitative relationship between CGH and mRNA expression data.

  5. 11. Photographic copy of copy of Twin Lakes Outlet Works ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    11. Photographic copy of copy of Twin Lakes Outlet Works construction drawing dated January 15, 1951. Drawn by W.A. Doe for the Twin Lakes Reservoir and Canal Co. (copy in possession of Bureau of Reclamation, location of original unknown) 'AS CONSTRUCTED' PLANS OF 1949-1950, REHABILITATION OF TWIN LAKES RESERVOIR OUTLET WORKS, DETAILS OF UPSTREAM WING WALLS. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

  6. 12. Photographic copy of copy of Twin Lakes Outlet Works ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. Photographic copy of copy of Twin Lakes Outlet Works construction drawing dated January 15, 1951. Drawn by W.A. Doe for the Twin Lakes Reservoir and Canal Co. (copy in possession of Bureau of Reclamation, location of original unknown) 'AS CONSTRUCTED' PLANS OF 1949-50, REHABILITATION OF TWIN LAKES RESERVOIR OUTLET WORKS, DETAILS OF DISCHARGE BASIN. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

  7. Detecting specific health-related events using an integrated sensor system for vital sign monitoring.

    PubMed

    Adnane, Mourad; Jiang, Zhongwei; Choi, Samjin; Jang, Hoyoung

    2009-01-01

    In this paper, a new method for the detection of apnea/hypopnea periods in physiological data is presented. The method is based on the intelligent combination of an integrated sensor system for long-time cardiorespiratory signal monitoring and dedicated signal-processing packages. Integrated sensors are a PVDF film and conductive fabric sheets. The signal processing package includes dedicated respiratory cycle (RC) and QRS complex detection algorithms and a new method using the respiratory cycle variability (RCV) for detecting apnea/hypopnea periods in physiological data. Results show that our method is suitable for online analysis of long time series data.

  8. Bayesian Analysis for Risk Assessment of Selected Medical Events in Support of the Integrated Medical Model Effort

    NASA Technical Reports Server (NTRS)

    Gilkey, Kelly M.; Myers, Jerry G.; McRae, Michael P.; Griffin, Elise A.; Kallrui, Aditya S.

    2012-01-01

    The Exploration Medical Capability project is creating a catalog of risk assessments using the Integrated Medical Model (IMM). The IMM is a software-based system intended to assist mission planners in preparing for spaceflight missions by helping them to make informed decisions about medical preparations and supplies needed for combating and treating various medical events using Probabilistic Risk Assessment. The objective is to use statistical analyses to inform the IMM decision tool with estimated probabilities of medical events occurring during an exploration mission. Because data regarding astronaut health are limited, Bayesian statistical analysis is used. Bayesian inference combines prior knowledge, such as data from the general U.S. population, the U.S. Submarine Force, or the analog astronaut population located at the NASA Johnson Space Center, with observed data for the medical condition of interest. The posterior results reflect the best evidence for specific medical events occurring in flight. Bayes theorem provides a formal mechanism for combining available observed data with data from similar studies to support the quantification process. The IMM team performed Bayesian updates on the following medical events: angina, appendicitis, atrial fibrillation, atrial flutter, dental abscess, dental caries, dental periodontal disease, gallstone disease, herpes zoster, renal stones, seizure, and stroke.

  9. Developing Clinical Competency in Crisis Event Management: An Integrated Simulation Problem-Based Learning Activity

    ERIC Educational Resources Information Center

    Liaw, S. Y.; Chen, F. G.; Klainin, P.; Brammer, J.; O'Brien, A.; Samarasekera, D. D.

    2010-01-01

    This study aimed to evaluate the integration of a simulation based learning activity on nursing students' clinical crisis management performance in a problem-based learning (PBL) curriculum. It was hypothesized that the clinical performance of first year nursing students who participated in a simulated learning activity during the PBL session…

  10. Developing Clinical Competency in Crisis Event Management: An Integrated Simulation Problem-Based Learning Activity

    ERIC Educational Resources Information Center

    Liaw, S. Y.; Chen, F. G.; Klainin, P.; Brammer, J.; O'Brien, A.; Samarasekera, D. D.

    2010-01-01

    This study aimed to evaluate the integration of a simulation based learning activity on nursing students' clinical crisis management performance in a problem-based learning (PBL) curriculum. It was hypothesized that the clinical performance of first year nursing students who participated in a simulated learning activity during the PBL session…

  11. Using OSUS and node red to integrate IoT devices based on events

    NASA Astrophysics Data System (ADS)

    Klawon, Kevin; Ryan, Pat; Gold, Joshua

    2017-05-01

    The Army Research Lab's Open Standard for Unattended Sensors (OSUS) is an extensible vendor-neutral sensor controller. OSUS provides a simple user interface for connecting to sensors and a rudimentary data processing capability. Integrating Open Source Internet of Things (IoT) technology such as Node Red can greatly extend the capabilities of OSUS and improve the User Experience.

  12. Method and apparatus for increasing resistance of bipolar buried layer integrated circuit devices to single-event upsets

    NASA Technical Reports Server (NTRS)

    Zoutendyk, John A. (Inventor)

    1991-01-01

    Bipolar transistors fabricated in separate buried layers of an integrated circuit chip are electrically isolated with a built-in potential barrier established by doping the buried layer with a polarity opposite doping in the chip substrate. To increase the resistance of the bipolar transistors to single-event upsets due to ionized particle radiation, the substrate is biased relative to the buried layer with an external bias voltage selected to offset the built-in potential just enough (typically between about +0.1 to +0.2 volt) to prevent an accumulation of charge in the buried-layer-substrate junction.

  13. Experimental determination of single-event upset (SEU) as a function of collected charge in bipolar integrated circuits

    NASA Technical Reports Server (NTRS)

    Zoutendyk, J. A.; Malone, C. J.; Smith, L. S.

    1984-01-01

    Single-Event Upset (SEU) in bipolar integrated circuits (ICs) is caused by charge collection from ion tracks in various regions of a bipolar transistor. This paper presents experimental data which have been obtained wherein the range-energy characteristics of heavy ions (Br) have been utilized to determine the cross section for soft-error generation as a function of charge collected from single-particle tracks which penetrate a bipolar static RAM. The results of this work provide a basis for the experimental verification of circuit-simulation SEU modeling in bipolar ICs.

  14. Using Discrete Event Simulation to Model Integrated Commodities Consumption for a Launch Campaign of the Space Launch System

    NASA Technical Reports Server (NTRS)

    Leonard, Daniel; Parsons, Jeremy W.; Cates, Grant

    2014-01-01

    In May 2013, NASA's GSDO Program requested a study to develop a discrete event simulation (DES) model that analyzes the launch campaign process of the Space Launch System (SLS) from an integrated commodities perspective. The scope of the study includes launch countdown and scrub turnaround and focuses on four core launch commodities: hydrogen, oxygen, nitrogen, and helium. Previously, the commodities were only analyzed individually and deterministically for their launch support capability, but this study was the first to integrate them to examine the impact of their interactions on a launch campaign as well as the effects of process variability on commodity availability. The study produced a validated DES model with Rockwell Arena that showed that Kennedy Space Center's ground systems were capable of supporting a 48-hour scrub turnaround for the SLS. The model will be maintained and updated to provide commodity consumption analysis of future ground system and SLS configurations.

  15. Integration of scheduling and discrete event simulation systems to improve production flow planning

    NASA Astrophysics Data System (ADS)

    Krenczyk, D.; Paprocka, I.; Kempa, W. M.; Grabowik, C.; Kalinowski, K.

    2016-08-01

    The increased availability of data and computer-aided technologies such as MRPI/II, ERP and MES system, allowing producers to be more adaptive to market dynamics and to improve production scheduling. Integration of production scheduling and computer modelling, simulation and visualization systems can be useful in the analysis of production system constraints related to the efficiency of manufacturing systems. A integration methodology based on semi-automatic model generation method for eliminating problems associated with complexity of the model and labour-intensive and time-consuming process of simulation model creation is proposed. Data mapping and data transformation techniques for the proposed method have been applied. This approach has been illustrated through examples of practical implementation of the proposed method using KbRS scheduling system and Enterprise Dynamics simulation system.

  16. Propensity and risk assessment for solar particle events: Consideration of integral fluence at high proton energies

    NASA Astrophysics Data System (ADS)

    Kim, Myung-Hee; Hayat, Matthew; Feiveson, Alan; Cucinotta, Francis A.

    For future space missions with longer duration, exposure to large solar particle events (SPEs) with high energy levels is the major concern during extra-vehicular activities (EVAs) on the lunar and Mars surface. The propensity for SPE occurrence with large proton fluence was estimated as a function of time within a solar cycle from a non-homogeneous Poisson model using the historical database for measurements of protons with energy >30 MeV, Φ30 . The database includes a continuous data set for the past 5 solar cycles. The resultant SPE risk analysis for a specific mission period was made for blood forming organ (BFO) dose ranging from its 5th to 95th percentile. In addition to the total particle intensity of SPEs, the detailed energy spectra of protons, especially at high energy levels, were recognized as extremely important for assessing the cancer risk associated with energetic particles for large events. Using all the recorded proton fluence of SPEs for energies >60 and >100 MeV, Φ60 and Φ100 , respectively, the expected numbers of SPEs abundant with high energy protons were estimated from the same non-homogeneous Poisson model and the representative cancer risk was analyzed. The dependencies of risk with different energy spectra, for e.g. between soft and hard SPEs, were evaluated. Finally, we describe approaches to improve radiation protection of astronauts and optimize mission planning for future space missions.

  17. Propensity and Risk Assessment for Solar Particle Events: Consideration of Integral Fluence at High Proton Energies

    NASA Technical Reports Server (NTRS)

    Kim, Myung-Hee; Hayat, Matthew J.; Feiveson, alan H.; Cucinotta, Francis A.

    2008-01-01

    For future space missions with longer duration, exposure to large solar particle events (SPEs) with high energy levels is the major concern during extra-vehicular activities (EVAs) on the lunar and Mars surface. The expected SPE propensity for large proton fluence was estimated from a non-homogeneous Poisson model using the historical database for measurements of protons with energy > 30 MeV, Phi(sub 30). The database includes a continuous data set for the past 5 solar cycles. The resultant SPE risk analysis for a specific mission period was made including the 95% confidence level. In addition to total particle intensity of SPE, the detailed energy spectra of protons especially at high energy levels were recognized as extremely important parameter for the risk assessment, since there remains a significant cancer risks from those energetic particles for large events. Using all the recorded proton fluence of SPEs for energies >60 and >100 MeV, Phi(sub 60) and Phi(sub 100), respectively, the expected propensities of SPEs abundant with high energy protons were estimated from the same non-homogeneous Poisson model and the representative cancer risk was analyzed. The dependencies of risk with different energy spectra, for e.g. between soft and hard SPEs, were evaluated. Finally, we describe approaches to improve radiation protection of astronauts and optimize mission planning for future space missions.

  18. Propensity and Risk Assessment for Solar Particle Events: Consideration of Integral Fluence at High Proton Energies

    NASA Technical Reports Server (NTRS)

    Kim, Myung-Hee; Hayat, Matthew J.; Feiveson, alan H.; Cucinotta, Francis A.

    2008-01-01

    For future space missions with longer duration, exposure to large solar particle events (SPEs) with high energy levels is the major concern during extra-vehicular activities (EVAs) on the lunar and Mars surface. The expected SPE propensity for large proton fluence was estimated from a non-homogeneous Poisson model using the historical database for measurements of protons with energy > 30 MeV, Phi(sub 30). The database includes a continuous data set for the past 5 solar cycles. The resultant SPE risk analysis for a specific mission period was made including the 95% confidence level. In addition to total particle intensity of SPE, the detailed energy spectra of protons especially at high energy levels were recognized as extremely important parameter for the risk assessment, since there remains a significant cancer risks from those energetic particles for large events. Using all the recorded proton fluence of SPEs for energies >60 and >100 MeV, Phi(sub 60) and Phi(sub 100), respectively, the expected propensities of SPEs abundant with high energy protons were estimated from the same non-homogeneous Poisson model and the representative cancer risk was analyzed. The dependencies of risk with different energy spectra, for e.g. between soft and hard SPEs, were evaluated. Finally, we describe approaches to improve radiation protection of astronauts and optimize mission planning for future space missions.

  19. 37 CFR 2.201 - Copies and certified copies.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Copies and certified copies. 2.201 Section 2.201 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE RULES OF PRACTICE IN TRADEMARK CASES Trademark Records and Files of the Patent and...

  20. 10. Photographic copy of copy of original construction drawing, dated ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. Photographic copy of copy of original construction drawing, dated 1899?. Original in possession of Twin Lakes Reservoir and Canal Company, Ordway, Colorado. PLAN OF DAM AND HEAD GATES FOR THE TWIN LAKES RESERVOIR. - Twin Lakes Dam & Outlet Works, Beneath Twin Lakes Reservoir, T11S, R80W, S22, Twin Lakes, Lake County, CO

  1. Photocopy of copy of 1922 map, revised in 1936. Copy ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Photocopy of copy of 1922 map, revised in 1936. Copy in the Fitzsimons Army Medical Center Directorate of Public Works, building 118. - Fitzsimons General Hospital, Bounded by East Colfax to south, Peoria Street to west, Denver City/County & Adams County Line to north, & U.S. Route 255 to east, Aurora, Adams County, CO

  2. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 13(2), February 29, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-002 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $ 1.

  3. An integrated and coordinated approach to preventing recurrent coronary heart disease events in Australia.

    PubMed

    Briffa, Tom G; Kinsman, Leigh; Maiorana, Andrew J; Zecchin, Robert; Redfern, Julie; Davidson, Patricia M; Paull, Glenn; Nagle, Amanda; Denniss, A Robert

    2009-06-15

    Implementing existing knowledge about cardiac rehabilitation (CR) and heart failure management could markedly reduce mortality after acute coronary syndromes and revascularisation therapy. Contemporary CR and secondary prevention programs are cost-effective, safe and beneficial for patients of all ages, leading to improved survival, fewer revascularisation procedures and reduced rehospitalisation. Despite the proven benefits attributed to these secondary prevention interventions, they are not well attended by patients. Modern programs must be flexible, culturally safe, multifaceted and integrated with the patient's primary health care provider to achieve optimal and sustainable benefits for most patients.

  4. Toward an Integrated Assessment of the Impacts of Extreme Wind Events on Barrow, Alaska.

    NASA Astrophysics Data System (ADS)

    Lynch, A. H.; Curry, J. A.; Brunner, R. D.; Maslanik, J. A.

    2004-02-01

    Warming of the arctic climate is having a substantial impact on the Alaskan North Slope coastal region. The warming is associated with increasing amounts of open water in the arctic seas, rising sea level, and thawing permafrost. Coastal geography and increasing development along the coastline are contributing to increased vulnerability of infrastructure, utilities, and supplies of food and gasoline to storms, flooding, and coastal erosion. Secondary impacts of coastal flooding may include harm to animals and their land or sea habitats, if pollutants are released. Further, Inupiat subsistence harvesting of marine sources of food, offshore resource extraction, and marine transportation may be affected. This paper describes a project to understand, support, and enhance the local decision-making process on the North Slope of Alaska on socioeconomic issues that are influenced by warming, climate variability, and extreme weather events.

  5. Mechanisms of COPI vesicle formation

    PubMed Central

    Hsu, Victor W.; Yang, Jia-Shu

    2009-01-01

    Coat Protein I (COPI) is one of the most intensely investigated coat complexes. Numerous studies have contributed to a general understanding of how coat proteins act to initiate intracellular vesicular transport. This review highlights key recent findings that have shaped our current understanding of how COPI vesicles are formed. PMID:19854177

  6. Counting copy number and calories.

    PubMed

    White, Stefan

    2015-08-01

    Copy number variation (CNV) at several genomic loci has been associated with different human traits and diseases, but in many cases the findings could not be replicated. A new study provides insights into the degree of variation present at the amylase locus and calls into question a previous association between amylase copy number and body mass index.

  7. Event-triggered logical flow control for comprehensive process integration of multi-step assays on centrifugal microfluidic platforms.

    PubMed

    Kinahan, David J; Kearney, Sinéad M; Dimov, Nikolay; Glynn, Macdara T; Ducrée, Jens

    2014-07-07

    The centrifugal "lab-on-a-disc" concept has proven to have great potential for process integration of bioanalytical assays, in particular where ease-of-use, ruggedness, portability, fast turn-around time and cost efficiency are of paramount importance. Yet, as all liquids residing on the disc are exposed to the same centrifugal field, an inherent challenge of these systems remains the automation of multi-step, multi-liquid sample processing and subsequent detection. In order to orchestrate the underlying bioanalytical protocols, an ample palette of rotationally and externally actuated valving schemes has been developed. While excelling with the level of flow control, externally actuated valves require interaction with peripheral instrumentation, thus compromising the conceptual simplicity of the centrifugal platform. In turn, for rotationally controlled schemes, such as common capillary burst valves, typical manufacturing tolerances tend to limit the number of consecutive laboratory unit operations (LUOs) that can be automated on a single disc. In this paper, a major advancement on recently established dissolvable film (DF) valving is presented; for the very first time, a liquid handling sequence can be controlled in response to completion of preceding liquid transfer event, i.e. completely independent of external stimulus or changes in speed of disc rotation. The basic, event-triggered valve configuration is further adapted to leverage conditional, large-scale process integration. First, we demonstrate a fluidic network on a disc encompassing 10 discrete valving steps including logical relationships such as an AND-conditional as well as serial and parallel flow control. Then we present a disc which is capable of implementing common laboratory unit operations such as metering and selective routing of flows. Finally, as a pilot study, these functions are integrated on a single disc to automate a common, multi-step lab protocol for the extraction of total RNA from

  8. Molluscan biozones, event/cycle chronostratigraphy, and sealevel history; a new integrated Cretaceous chronology for Northern South America

    SciTech Connect

    Villamil, T.; Johnson, C.C.; Kauffman, E.G. )

    1993-02-01

    The Cretaceous marine basins of northern South America, in their evolution, record a dynamic interplay between regional and plate tectonics, sealevel history, changing paleo-ocean/paleoclimate systems, and the rates/patterns of sedimentation driven by both allocyclic and autocyclic processes. Regional interpretation of these complex interactions; and the evolution of the South American passive margin, requires a high-resolution stratigraphic system of dating and correlation. Because short-term events and dynamic processes shape the stratigraphic record, this chronology must have a resolution of <1 million years, ideally 10's-100's of ka correlation units. This resolution does not currently exist in South America, where Cretaceous radiometric dates and paleomagnetic analyses are few, event/cycle chronostratigraphy and sequence stratigraphy are not yet well developed and where current biostratigraphic resolution based on mollusks averages 1- > 2 Ma/biozone. New efforts to establish a more refined chronology for South America involve: (a) High-resolution (cm-scale) event/cycle chronostratigraphic analyses of key Colombian and Venezuelan sections; (b) search for datable ash/bentonite beds; (c) detailed paleontologic collecting to firmly establish biostratigraphic ranges of mollusks and microplankton with high biostratigraphic potential, and to formulate regional assemblage zones; and (d) integration of these diverse data through graphic correlation to provide a new chronologic standard for the region. Initial results are presented: Middle Cretaceous biozones are now resolved to <500 ka/zone; a fine-scale sequence stratigraphy and sealevel history has been determined; numerous regional physical and chemostratigraphic event beds are identified; and climate-driven cyclostratigraphy has been resolved to at least 50 ka within the passive margin sequences of Colombia and Venezuela.

  9. Escherichia coli O157:H7 strains isolated from High-Event Period beef contamination have strong biofilm-forming ability and low sanitizer susceptibility, which are associated with high pO157 plasmid copy number

    USDA-ARS?s Scientific Manuscript database

    In the meat industry, a “High Event Period” (HEP) is defined as a time period when beef processing establishments experience an increased occurrence of product contamination by E. coli O157:H7. Our previous studies suggested that bacterial biofilm formation and sanitizer resistance might contribute...

  10. Dispositional mindfulness and semantic integration of emotional words: Evidence from event-related brain potentials.

    PubMed

    Dorjee, Dusana; Lally, Níall; Darrall-Rew, Jonathan; Thierry, Guillaume

    2015-08-01

    Initial research shows that mindfulness training can enhance attention and modulate the affective response. However, links between mindfulness and language processing remain virtually unexplored despite the prominent role of overt and silent negative ruminative speech in depressive and anxiety-related symptomatology. Here, we measured dispositional mindfulness and recorded participants' event-related brain potential responses to positive and negative target words preceded by words congruent or incongruent with the targets in terms of semantic relatedness and emotional valence. While the low mindfulness group showed similar N400 effect pattern for positive and negative targets, high dispositional mindfulness was associated with larger N400 effect to negative targets. This result suggests that negative meanings are less readily accessible in people with high dispositional mindfulness. Furthermore, high dispositional mindfulness was associated with reduced P600 amplitudes to emotional words, suggesting less post-analysis and attentional effort which possibly relates to a lower inclination to ruminate. Overall, these findings provide initial evidence on associations between modifications in language systems and mindfulness.

  11. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7

    PubMed Central

    Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization. PMID:27379683

  12. Causal Factors and Adverse Events of Aviation Accidents and Incidents Related to Integrated Vehicle Health Management

    NASA Technical Reports Server (NTRS)

    Reveley, Mary S.; Briggs, Jeffrey L.; Evans, Joni K.; Jones, Sharon M.; Kurtoglu, Tolga; Leone, Karen M.; Sandifer, Carl E.

    2011-01-01

    Causal factors in aviation accidents and incidents related to system/component failure/malfunction (SCFM) were examined for Federal Aviation Regulation Parts 121 and 135 operations to establish future requirements for the NASA Aviation Safety Program s Integrated Vehicle Health Management (IVHM) Project. Data analyzed includes National Transportation Safety Board (NSTB) accident data (1988 to 2003), Federal Aviation Administration (FAA) incident data (1988 to 2003), and Aviation Safety Reporting System (ASRS) incident data (1993 to 2008). Failure modes and effects analyses were examined to identify possible modes of SCFM. A table of potential adverse conditions was developed to help evaluate IVHM research technologies. Tables present details of specific SCFM for the incidents and accidents. Of the 370 NTSB accidents affected by SCFM, 48 percent involved the engine or fuel system, and 31 percent involved landing gear or hydraulic failure and malfunctions. A total of 35 percent of all SCFM accidents were caused by improper maintenance. Of the 7732 FAA database incidents affected by SCFM, 33 percent involved landing gear or hydraulics, and 33 percent involved the engine and fuel system. The most frequent SCFM found in ASRS were turbine engine, pressurization system, hydraulic main system, flight management system/flight management computer, and engine. Because the IVHM Project does not address maintenance issues, and landing gear and hydraulic systems accidents are usually not fatal, the focus of research should be those SCFMs that occur in the engine/fuel and flight control/structures systems as well as power systems.

  13. Integration of Early Warnings Systems to Enhance Emergency Response to Severe Weather Events

    NASA Astrophysics Data System (ADS)

    Wanik, D. W.; Anagnostou, E. N.; Hartman, B.; Astitha, M.

    2016-12-01

    The choice to shelter-in-place or evacuate due to an upcoming storm can change based on an individual's past experiences, risk tolerance and quantity and quality of warnings they receive. In this session, we present how integrated models of power outage predictions and the estimated time to restore power can be used to communicate the impact of an upcoming storm to the general public. Each individual model provides insight to utilities that must pre-stage crews and equipment to restore power efficiently (which they subsequently use to decide whether or not outside crews are needed to restore power). In addition, each model has uncertainty that must be quantified and effectively communicated such that the predicted impact is not to be viewed as alarmist or passive. This predictions can be useful to the general public who are wondering how long they can expect to be without power, and to electric utilities who must provide reliable estimates of when they expect power will be restored.

  14. Effects of Auditory Stimuli in the Horizontal Plane on Audiovisual Integration: An Event-Related Potential Study

    PubMed Central

    Yang, Weiping; Li, Qi; Ochi, Tatsuya; Yang, Jingjing; Gao, Yulin; Tang, Xiaoyu; Takahashi, Satoshi; Wu, Jinglong

    2013-01-01

    This article aims to investigate whether auditory stimuli in the horizontal plane, particularly originating from behind the participant, affect audiovisual integration by using behavioral and event-related potential (ERP) measurements. In this study, visual stimuli were presented directly in front of the participants, auditory stimuli were presented at one location in an equidistant horizontal plane at the front (0°, the fixation point), right (90°), back (180°), or left (270°) of the participants, and audiovisual stimuli that include both visual stimuli and auditory stimuli originating from one of the four locations were simultaneously presented. These stimuli were presented randomly with equal probability; during this time, participants were asked to attend to the visual stimulus and respond promptly only to visual target stimuli (a unimodal visual target stimulus and the visual target of the audiovisual stimulus). A significant facilitation of reaction times and hit rates was obtained following audiovisual stimulation, irrespective of whether the auditory stimuli were presented in the front or back of the participant. However, no significant interactions were found between visual stimuli and auditory stimuli from the right or left. Two main ERP components related to audiovisual integration were found: first, auditory stimuli from the front location produced an ERP reaction over the right temporal area and right occipital area at approximately 160–200 milliseconds; second, auditory stimuli from the back produced a reaction over the parietal and occipital areas at approximately 360–400 milliseconds. Our results confirmed that audiovisual integration was also elicited, even though auditory stimuli were presented behind the participant, but no integration occurred when auditory stimuli were presented in the right or left spaces, suggesting that the human brain might be particularly sensitive to information received from behind than both sides. PMID:23799097

  15. Effects of auditory stimuli in the horizontal plane on audiovisual integration: an event-related potential study.

    PubMed

    Yang, Weiping; Li, Qi; Ochi, Tatsuya; Yang, Jingjing; Gao, Yulin; Tang, Xiaoyu; Takahashi, Satoshi; Wu, Jinglong

    2013-01-01

    This article aims to investigate whether auditory stimuli in the horizontal plane, particularly originating from behind the participant, affect audiovisual integration by using behavioral and event-related potential (ERP) measurements. In this study, visual stimuli were presented directly in front of the participants, auditory stimuli were presented at one location in an equidistant horizontal plane at the front (0°, the fixation point), right (90°), back (180°), or left (270°) of the participants, and audiovisual stimuli that include both visual stimuli and auditory stimuli originating from one of the four locations were simultaneously presented. These stimuli were presented randomly with equal probability; during this time, participants were asked to attend to the visual stimulus and respond promptly only to visual target stimuli (a unimodal visual target stimulus and the visual target of the audiovisual stimulus). A significant facilitation of reaction times and hit rates was obtained following audiovisual stimulation, irrespective of whether the auditory stimuli were presented in the front or back of the participant. However, no significant interactions were found between visual stimuli and auditory stimuli from the right or left. Two main ERP components related to audiovisual integration were found: first, auditory stimuli from the front location produced an ERP reaction over the right temporal area and right occipital area at approximately 160-200 milliseconds; second, auditory stimuli from the back produced a reaction over the parietal and occipital areas at approximately 360-400 milliseconds. Our results confirmed that audiovisual integration was also elicited, even though auditory stimuli were presented behind the participant, but no integration occurred when auditory stimuli were presented in the right or left spaces, suggesting that the human brain might be particularly sensitive to information received from behind than both sides.

  16. Functionally integrated neural processing of linguistic and talker information: An event-related fMRI and ERP study

    PubMed Central

    Zhang, Caicai; Pugh, Kenneth R.; Mencl, W. Einar; Molfese, Peter J.; Frost, Stephen J.; Magnuson, James S.; Peng, Gang; Wang, William S-Y

    2016-01-01

    Speech signals contain information of both linguistic content and a talker’s voice. Conventionally, linguistic and talker processing are thought to be mediated by distinct neural systems in the left and right hemispheres respectively, but there is growing evidence that linguistic and talker processing interact in many ways. Previous studies suggest that talker-related vocal tract changes are processed integrally with phonetic changes in the bilateral posterior superior temporal gyrus/superior temporal sulcus (STG/STS), because the vocal tract parameter influences the perception of phonetic information. It is yet unclear whether the bilateral STG are also activated by the integral processing of another parameter – pitch, which influences the perception of lexical tone information and are related to talker differences in tone languages. In this study, we conducted separate functional magnetic resonance imaging (fMRI) and event-related potential (ERP) experiments to examine the spatial and temporal loci of interactions of lexical tone and talker-related pitch processing in Cantonese. We found that the STG was activated bilaterally during the processing of talker changes when listeners attended to lexical tone changes in the stimuli and during the processing of lexical tone changes when listeners attended to talker changes, suggesting that lexical tone and talker processing are functionally integrated in the bilateral STG. It extends the previous study, providing evidence for a general neural mechanism of integral phonetic and talker processing in the bilateral STG. The ERP results show interactions of lexical tone and talker processing 500–800 ms after auditory word onset (a simultaneous posterior P3b and a frontal negativity). Moreover, there is some asymmetry in the interaction, such that unattended talker changes affect linguistic processing more than vice versa, which may be related to the ambiguity that talker changes cause in speech perception and

  17. Multiple Events of Allopolyploidy in the Evolution of the Racemose Lineages in Prunus (Rosaceae) Based on Integrated Evidence from Nuclear and Plastid Data

    PubMed Central

    Zuo, Yun-juan; Liu, Xiao-Lin; Chin, Siew-Wai; Haberle, Rosemarie; Potter, Daniel; Chang, Zhao-Yang; Wen, Jun

    2016-01-01

    Prunus is an economically important genus well-known for cherries, plums, almonds, and peaches. The genus can be divided into three major groups based on inflorescence structure and ploidy levels: (1) the diploid solitary-flower group (subg. Prunus, Amygdalus and Emplectocladus); (2) the diploid corymbose group (subg. Cerasus); and (3) the polyploid racemose group (subg. Padus, subg. Laurocerasus, and the Maddenia group). The plastid phylogeny suggests three major clades within Prunus: Prunus-Amygdalus-Emplectocladus, Cerasus, and Laurocerasus-Padus-Maddenia, while nuclear ITS trees resolve Laurocerasus-Padus-Maddenia as a paraphyletic group. In this study, we employed sequences of the nuclear loci At103, ITS and s6pdh to explore the origins and evolution of the racemose group. Two copies of the At103 gene were identified in Prunus. One copy is found in Prunus species with solitary and corymbose inflorescences as well as those with racemose inflorescences, while the second copy (II) is present only in taxa with racemose inflorescences. The copy I sequences suggest that all racemose species form a paraphyletic group composed of four clades, each of which is definable by morphology and geography. The tree from the combined At103 and ITS sequences and the tree based on the single gene s6pdh had similar general topologies to the tree based on the copy I sequences of At103, with the combined At103-ITS tree showing stronger support in most clades. The nuclear At103, ITS and s6pdh data in conjunction with the plastid data are consistent with the hypothesis that multiple independent allopolyploidy events contributed to the origins of the racemose group. A widespread species or lineage may have served as the maternal parent for multiple hybridizations involving several paternal lineages. This hypothesis of the complex evolutionary history of the racemose group in Prunus reflects a major step forward in our understanding of diversification of the genus and has important

  18. Integrating Remote Sensing Data, Hybrid-Cloud Computing, and Event Notifications for Advanced Rapid Imaging & Analysis (Invited)

    NASA Astrophysics Data System (ADS)

    Hua, H.; Owen, S. E.; Yun, S.; Lundgren, P.; Fielding, E. J.; Agram, P.; Manipon, G.; Stough, T. M.; Simons, M.; Rosen, P. A.; Wilson, B. D.; Poland, M. P.; Cervelli, P. F.; Cruz, J.

    2013-12-01

    Space-based geodetic measurement techniques such as Interferometric Synthetic Aperture Radar (InSAR) and Continuous Global Positioning System (CGPS) are now important elements in our toolset for monitoring earthquake-generating faults, volcanic eruptions, hurricane damage, landslides, reservoir subsidence, and other natural and man-made hazards. Geodetic imaging's unique ability to capture surface deformation with high spatial and temporal resolution has revolutionized both earthquake science and volcanology. Continuous monitoring of surface deformation and surface change before, during, and after natural hazards improves decision-making from better forecasts, increased situational awareness, and more informed recovery. However, analyses of InSAR and GPS data sets are currently handcrafted following events and are not generated rapidly and reliably enough for use in operational response to natural disasters. Additionally, the sheer data volumes needed to handle a continuous stream of InSAR data sets also presents a bottleneck. It has been estimated that continuous processing of InSAR coverage of California alone over 3-years would reach PB-scale data volumes. Our Advanced Rapid Imaging and Analysis for Monitoring Hazards (ARIA-MH) science data system enables both science and decision-making communities to monitor areas of interest with derived geodetic data products via seamless data preparation, processing, discovery, and access. We will present our findings on the use of hybrid-cloud computing to improve the timely processing and delivery of geodetic data products, integrating event notifications from USGS to improve the timely processing for response, as well as providing browse results for quick looks with other tools for integrative analysis.

  19. Integrative network analysis reveals time-dependent molecular events underlying left ventricular remodeling in post-myocardial infarction patients.

    PubMed

    Pinet, Florence; Cuvelliez, Marie; Kelder, Thomas; Amouyel, Philippe; Radonjic, Marijana; Bauters, Christophe

    2017-02-03

    To elucidate the time-resolved molecular events underlying the LV remodeling (LVR) process, we developed a large-scale network model that integrates the 24 molecular variables (plasma proteins and non-coding RNAs) collected in the REVE-2 study at four time points (baseline, 1month, 3months and 1year) after MI. The REVE-2 network model was built by extending the set of REVE-2 variables with their mechanistic context based on known molecular interactions (1310 nodes and 8639 edges). Changes in the molecular variables between the group of patients with high LVR (>20%) and low LVR (<20%) were used to identify active network modules within the clusters associated with progression of LVR, enabling assessment of time-resolved molecular changes. Although the majority of molecular changes occur at the baseline, two network modules specifically show an increasing number of active molecules throughout the post-MI follow up: one involved in muscle filament sliding, containing the major troponin forms and tropomyosin proteins, and the other associated with extracellular matrix disassembly, including matrix metalloproteinases, tissue inhibitors of metalloproteinases and laminin proteins. For the first time, integrative network analysis of molecular variables collected in REVE-2 patients with known molecular interactions allows insight into time-dependent mechanisms associated with LVR following MI, linking specific processes with LV structure alteration. In addition, the REVE-2 network model provides a shortlist of prioritized putative novel biomarker candidates for detection of LVR after MI event associated with a high risk of heart failure and is a valuable resource for further hypothesis generation.

  20. Gene copy number and cell cycle arrest

    NASA Astrophysics Data System (ADS)

    Ghosh, Bhaswar; Bose, Indrani

    2006-03-01

    The cell cycle is an orderly sequence of events which ultimately lead to the division of a single cell into two daughter cells. In the case of DNA damage by radiation or chemicals, the damage checkpoints in the G1 and G2 phases of the cell cycle are activated. This results in an arrest of the cell cycle so that the DNA damage can be repaired. Once this is done, the cell continues with its usual cycle of activity. We study a mathematical model of the DNA damage checkpoint in the G2 phase which arrests the transition from the G2 to the M (mitotic) phase of the cell cycle. The tumor suppressor protein p53 plays a key role in activating the pathways leading to cell cycle arrest in mammalian systems. If the DNA damage is severe, the p53 proteins activate other pathways which bring about apoptosis, i.e., programmed cell death. Loss of the p53 gene results in the proliferation of cells containing damaged DNA, i.e., in the growth of tumors which may ultimately become cancerous. There is some recent experimental evidence which suggests that the mutation of a single copy of the p53 gene (in the normal cell each gene has two identical copies) is sufficient to trigger the formation of tumors. We study the effect of reducing the gene copy number of the p53 and two other genes on cell cycle arrest and obtain results consistent with experimental observations.

  1. Integrative transcriptome sequencing identifies trans-splicing events with important roles in human embryonic stem cell pluripotency

    PubMed Central

    Wu, Chan-Shuo; Yu, Chun-Ying; Chuang, Ching-Yu; Hsiao, Michael; Kao, Cheng-Fu; Kuo, Hung-Chih; Chuang, Trees-Juen

    2014-01-01

    Trans-splicing is a post-transcriptional event that joins exons from separate pre-mRNAs. Detection of trans-splicing is usually severely hampered by experimental artifacts and genetic rearrangements. Here, we develop a new computational pipeline, TSscan, which integrates different types of high-throughput long-/short-read transcriptome sequencing of different human embryonic stem cell (hESC) lines to effectively minimize false positives while detecting trans-splicing. Combining TSscan screening with multiple experimental validation steps revealed that most chimeric RNA products were platform-dependent experimental artifacts of RNA sequencing. We successfully identified and confirmed four trans-spliced RNAs, including the first reported trans-spliced large intergenic noncoding RNA (“tsRMST”). We showed that these trans-spliced RNAs were all highly expressed in human pluripotent stem cells and differentially expressed during hESC differentiation. Our results further indicated that tsRMST can contribute to pluripotency maintenance of hESCs by suppressing lineage-specific gene expression through the recruitment of NANOG and the PRC2 complex factor, SUZ12. Taken together, our findings provide important insights into the role of trans-splicing in pluripotency maintenance of hESCs and help to facilitate future studies into trans-splicing, opening up this important but understudied class of post-transcriptional events for comprehensive characterization. PMID:24131564

  2. Integrative transcriptome sequencing identifies trans-splicing events with important roles in human embryonic stem cell pluripotency.

    PubMed

    Wu, Chan-Shuo; Yu, Chun-Ying; Chuang, Ching-Yu; Hsiao, Michael; Kao, Cheng-Fu; Kuo, Hung-Chih; Chuang, Trees-Juen

    2014-01-01

    Trans-splicing is a post-transcriptional event that joins exons from separate pre-mRNAs. Detection of trans-splicing is usually severely hampered by experimental artifacts and genetic rearrangements. Here, we develop a new computational pipeline, TSscan, which integrates different types of high-throughput long-/short-read transcriptome sequencing of different human embryonic stem cell (hESC) lines to effectively minimize false positives while detecting trans-splicing. Combining TSscan screening with multiple experimental validation steps revealed that most chimeric RNA products were platform-dependent experimental artifacts of RNA sequencing. We successfully identified and confirmed four trans-spliced RNAs, including the first reported trans-spliced large intergenic noncoding RNA ("tsRMST"). We showed that these trans-spliced RNAs were all highly expressed in human pluripotent stem cells and differentially expressed during hESC differentiation. Our results further indicated that tsRMST can contribute to pluripotency maintenance of hESCs by suppressing lineage-specific gene expression through the recruitment of NANOG and the PRC2 complex factor, SUZ12. Taken together, our findings provide important insights into the role of trans-splicing in pluripotency maintenance of hESCs and help to facilitate future studies into trans-splicing, opening up this important but understudied class of post-transcriptional events for comprehensive characterization.

  3. Elevated Gene Copy Number Does Not Always Explain Elevated Amylase Activities in Fishes.

    PubMed

    German, Donovan P; Foti, Dolly M; Heras, Joseph; Amerkhanian, Hooree; Lockwood, Brent L

    2016-01-01

    Amylase activity variation in the guts of several model organisms appears to be explained by amylase gene copy number variation. We tested the hypothesis that amylase gene copy number is always elevated in animals with high amylolytic activity. We therefore sequenced the amylase genes and examined amylase gene copy number in prickleback fishes (family Stichaeidae) with different diets including two species of convergently evolved herbivores with the elevated amylase activity phenotype. We found elevated amylase gene copy number (six haploid copies) with sequence variation among copies in one herbivore (Cebidichthys violaceus) and modest gene copy number (two to three haploid copies) with little sequence variation in the remaining taxa, which included herbivores, omnivores, and a carnivore. Few functional differences in amylase biochemistry were observed, and previous investigations showed similar digestibility among the convergently evolved herbivores with differing amylase genetics. Hence, the phenotype of elevated amylase activity can be achieved by different mechanisms (i.e., elevated expression of fewer genes, increased gene copy number, or expression of more efficient amylase proteins) with similar results. Phylogenetic and comparative genomic analyses of available fish amylase genes show mostly lineage-specific duplication events leading to gene copy number variation, although a whole-genome duplication event or chromosomal translocation may have produced multiple amylase copies in the Ostariophysi, again showing multiple routes to the same result.

  4. Integrative omics connects N-glycoproteome-wide alterations with pathways and regulatory events in induced pluripotent stem cells

    PubMed Central

    Sudhir, Putty-Reddy; Kumari, Madireddy Pavana; Hsu, Wei-Ting; Chen, Chein-Hung; Kuo, Hung-Chih; Chen, Chung-Hsuan

    2016-01-01

    Molecular-level differences ranging from genomes to proteomes, but not N-glycoproteomes, between human induced pluripotent stem cells (hiPSCs) and embryonic stem cells (hESCs) have been assessed to gain insights into cell reprogramming and induced pluripotency. Our multiplexed quantitative N-glycoproteomics study identified altered N-glycoproteins that significantly regulate cell adhesion processes in hiPSCs compared to hESCs. The integrative proteomics and functional network analyses of the altered N-glycoproteins revealed their significant interactions with known PluriNet (pluripotency-associated network) proteins. We found that these interactions potentially regulate various signaling pathways including focal adhesion, PI3K-Akt signaling, regulation of actin cytoskeleton, and spliceosome. Furthermore, the integrative transcriptomics analysis revealed that imperfectly reprogrammed subunits of the oligosaccharyltransferase (OST) and dolichol-phosphate-mannose synthase (DPM) complexes were potential candidate regulatory events for the altered N-glycoprotein levels. Together, the results of our study suggest that imperfect reprogramming of the protein complexes linked with the N-glycosylation process may result in N-glycoprotein alterations that affect induced pluripotency through their functional protein interactions. PMID:27808266

  5. Semantic integration of audio-visual information of polyphonic characters in a sentence context: an event-related potential study.

    PubMed

    Liu, Hong; Zhang, Gaoyan; Liu, Baolin

    2017-04-01

    In the Chinese language, a polyphone is a kind of special character that has more than one pronunciation, with each pronunciation corresponding to a different meaning. Here, we aimed to reveal the cognitive processing of audio-visual information integration of polyphones in a sentence context using the event-related potential (ERP) method. Sentences ending with polyphones were presented to subjects simultaneously in both an auditory and a visual modality. Four experimental conditions were set in which the visual presentations were the same, but the pronunciations of the polyphones were: the correct pronunciation; another pronunciation of the polyphone; a semantically appropriate pronunciation but not the pronunciation of the polyphone; or a semantically inappropriate pronunciation but also not the pronunciation of the polyphone. The behavioral results demonstrated significant differences in response accuracies when judging the semantic meanings of the audio-visual sentences, which reflected the different demands on cognitive resources. The ERP results showed that in the early stage, abnormal pronunciations were represented by the amplitude of the P200 component. Interestingly, because the phonological information mediated access to the lexical semantics, the amplitude and latency of the N400 component changed linearly across conditions, which may reflect the gradually increased semantic mismatch in the four conditions when integrating the auditory pronunciation with the visual information. Moreover, the amplitude of the late positive shift (LPS) showed a significant correlation with the behavioral response accuracies, demonstrating that the LPS component reveals the demand of cognitive resources for monitoring and resolving semantic conflicts when integrating the audio-visual information.

  6. CONTRA: copy number analysis for targeted resequencing

    PubMed Central

    Li, Jason; Lupat, Richard; Amarasinghe, Kaushalya C.; Thompson, Ella R.; Doyle, Maria A.; Ryland, Georgina L.; Tothill, Richard W.; Halgamuge, Saman K.; Campbell, Ian G.; Gorringe, Kylie L.

    2012-01-01

    Motivation: In light of the increasing adoption of targeted resequencing (TR) as a cost-effective strategy to identify disease-causing variants, a robust method for copy number variation (CNV) analysis is needed to maximize the value of this promising technology. Results: We present a method for CNV detection for TR data, including whole-exome capture data. Our method calls copy number gains and losses for each target region based on normalized depth of coverage. Our key strategies include the use of base-level log-ratios to remove GC-content bias, correction for an imbalanced library size effect on log-ratios, and the estimation of log-ratio variations via binning and interpolation. Our methods are made available via CONTRA (COpy Number Targeted Resequencing Analysis), a software package that takes standard alignment formats (BAM/SAM) and outputs in variant call format (VCF4.0), for easy integration with other next-generation sequencing analysis packages. We assessed our methods using samples from seven different target enrichment assays, and evaluated our results using simulated data and real germline data with known CNV genotypes. Availability and implementation: Source code and sample data are freely available under GNU license (GPLv3) at http://contra-cnv.sourceforge.net/ Contact: Jason.Li@petermac.org Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22474122

  7. Disintegration/dissolution profiles of copies of Fosamax (alendronate).

    PubMed

    Epstein, S; Cryer, B; Ragi, S; Zanchetta, J R; Walliser, J; Chow, J; Johnson, M A; Leyes, A E

    2003-01-01

    Poor quality has been reported for some generics and other copies of original products. We performed a pilot study to compare the disintegration/dissolution profiles of FOSAMAX (alendronate) 70 mg tablets with those of copies of FOSAMAX that were manufactured outside the United States. We used the standard United States Pharmacopeia (USP) disintegration method to evaluate FOSAMAX 70 mg tablets and 13 copies. At least 12 (n = 12) dosage units were tested for each product (except Fosmin, n = 10). The dissolution profiles of FOSAMAX and one representative copy were also compared. Nine copies (Osteomax, Defixal, Fosmin, Endronax, Osteomix, Genalmen, Fixopan, Osteoplus, and Fosval) disintegrated two- to ten-fold faster than FOSAMAX. Three other copies (Neobon, Regenesis, and Ostenan) disintegrated at least five-fold slower than FOSAMAX. Neobon is a softgel capsule, so special consideration was given to this different dosage form. One copy (Arendal) did not fall into either category but exhibited potentially large inter- and intra-lot variability. Dissolution of alendronate from Regenesis lagged behind that from FOSAMAX. Slower disintegration may reduce efficacy because bisphosphonates must be taken in the fasting state and contact with food or even certain beverages severely reduces bioavailability. Faster disintegration (or the use of gel-caps or other alterations to the drug formulation) could increase the risk of esophagitis, an adverse event associated with prolonged contact of the esophagus with bisphosphonates. These disintegration and dissolution results suggest that important differences may exist between FOSAMAX and its copies with regard to bioavailability, pharmacokinetics, and clinical efficacy and safety profiles. Additional testing is warranted to evaluate the pharmacokinetics and clinical safety of these copies.

  8. Human copy number variation and complex genetic disease.

    PubMed

    Girirajan, Santhosh; Campbell, Catarina D; Eichler, Evan E

    2011-01-01

    Copy number variants (CNVs) play an important role in human disease and population diversity. Advancements in technology have allowed for the analysis of CNVs in thousands of individuals with disease in addition to thousands of controls. These studies have identified rare CNVs associated with neuropsychiatric diseases such as autism, schizophrenia, and intellectual disability. In addition, copy number polymorphisms (CNPs) are present at higher frequencies in the population, show high diversity in copy number, sequence, and structure, and have been associated with multiple phenotypes, primarily related to immune or environmental response. However, the landscape of copy number variation still remains largely unexplored, especially for smaller CNVs and those embedded within complex regions of the human genome. An integrated approach including characterization of single nucleotide variants and CNVs in a large number of individuals with disease and normal genomes holds the promise of thoroughly elucidating the genetic basis of human disease and diversity.

  9. Basic psychological needs and neurophysiological responsiveness to decisional conflict: an event-related potential study of integrative self processes.

    PubMed

    Di Domenico, Stefano I; Le, Ada; Liu, Yichuan; Ayaz, Hasan; Fournier, Marc A

    2016-10-01

    Fulfillment of the basic psychological needs for competence, relatedness, and autonomy is believed to facilitate people's integrative tendencies to process psychological conflicts and develop a coherent sense of self. The present study therefore used event-related potentials (ERPs) to examine the relation between need fulfillment and the amplitude of conflict negativity (CN), a neurophysiological measure of conflict during personal decision making. Participants completed a decision-making task in which they made a series of forced choices according to their personal preferences. Three types of decision-making situations were created on the basis of participants' unique preference ratings, which were obtained prior to ERP recording: low-conflict situations (choosing between an attractive and an unattractive option), high-conflict approach-approach situations (choosing between two similarly attractive options), and high-conflict avoidance-avoidance situations (choosing between two similarly unattractive options). As expected, CN amplitudes were larger in high- relative to low-conflict situations, and source localization analyses suggested that the anterior cingulate cortex was the generating structure of the CN. Most importantly, people reporting higher need fulfillment exhibited larger CN amplitudes in avoidance-avoidance situations relative to low-conflict situations; to a lesser extent, they also exhibited larger CN amplitudes in approach-approach situations relative to low-conflict situations. By contrast, people reporting lower need fulfillment exhibited CN amplitudes that poorly discriminated the three decision situations. These results suggest that need fulfillment may promote self-coherent functioning by increasing people's receptivity to and processing of events that challenge their abilities to make efficient, self-congruent choices.

  10. The landscape of somatic chromosomal copy number aberrations in GEM models of prostate carcinoma.

    PubMed

    Bianchi-Frias, Daniella; Hernandez, Susana A; Coleman, Roger; Wu, Hong; Nelson, Peter S

    2015-02-01

    Human prostate cancer is known to harbor recurrent genomic aberrations consisting of chromosomal losses, gains, rearrangements, and mutations that involve oncogenes and tumor suppressors. Genetically engineered mouse (GEM) models have been constructed to assess the causal role of these putative oncogenic events and provide molecular insight into disease pathogenesis. While GEM models generally initiate neoplasia by manipulating a single gene, expression profiles of GEM tumors typically comprise hundreds of transcript alterations. It is unclear whether these transcriptional changes represent the pleiotropic effects of single oncogenes, and/or cooperating genomic or epigenomic events. Therefore, it was determined whether structural chromosomal alterations occur in GEM models of prostate cancer and whether the changes are concordant with human carcinomas. Whole genome array-based comparative genomic hybridization (CGH) was used to identify somatic chromosomal copy number aberrations (SCNA) in the widely used TRAMP, Hi-Myc, Pten-null, and LADY GEM models. Interestingly, very few SCNAs were identified and the genomic architecture of Hi-Myc, Pten-null, and LADY tumors were essentially identical to the germline. TRAMP neuroendocrine carcinomas contained SCNAs, which comprised three recurrent aberrations including a single copy loss of chromosome 19 (encoding Pten). In contrast, cell lines derived from the TRAMP, Hi-Myc, and Pten-null tumors were notable for numerous SCNAs that included copy gains of chromosome 15 (encoding Myc) and losses of chromosome 11 (encoding p53). Chromosomal alterations are not a prerequisite for tumor formation in GEM prostate cancer models and cooperating events do not naturally occur by mechanisms that recapitulate changes in genomic integrity as observed in human prostate cancer. ©2014 American Association for Cancer Research.

  11. Integration of sensory information precedes the sensation of vection: a combined behavioral and event-related brain potential (ERP) study.

    PubMed

    Keshavarz, Behrang; Berti, Stefan

    2014-02-01

    Illusory self-motion (known as vection) describes the sensation of ego-motion in the absence of physical movement. Vection typically occurs in stationary observers being exposed to visual information that suggest self-motion (e.g. simulators, virtual reality). In the present study, we tested whether sensory integration of visual information triggers vection: participants (N=13) perceived patterns of moving altered black-and-white vertical stripes on a screen that was divided into a central and a surrounding peripheral visual field. In both fields the pattern was either moving or stationary, resulting in four combinations of central and peripheral motions: (1) central and peripheral stripes moved into the same direction, (2) central and peripheral stripes moved in opposite directions, or (3) either the central or (4) the peripheral stripes were stable while the other stripes were in motion. This stimulation induced vection: Results showed significantly higher vection ratings when the stationary center of the pattern was surrounded by a moving periphery. Event-related potentials mirrored this finding: The occipital N2 was largest with stationary central and moving peripheral stripes. Our findings suggest that sensory integration of peripheral and central visual information triggers the perception of vection. Furthermore, we found evidence that neural processes precede the subjective perception of vection strength prior to the actual onset of vection. We will discuss our findings with respect to the role of stimulus eccentricity, stimulus' depth, and neural correlates involved during the genesis of vection. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Zero-Copy Objects System

    NASA Technical Reports Server (NTRS)

    Burleigh, Scott C.

    2011-01-01

    Zero-Copy Objects System software enables application data to be encapsulated in layers of communication protocol without being copied. Indirect referencing enables application source data, either in memory or in a file, to be encapsulated in place within an unlimited number of protocol headers and/or trailers. Zero-copy objects (ZCOs) are abstract data access representations designed to minimize I/O (input/output) in the encapsulation of application source data within one or more layers of communication protocol structure. They are constructed within the heap space of a Simple Data Recorder (SDR) data store to which all participating layers of the stack must have access. Each ZCO contains general information enabling access to the core source data object (an item of application data), together with (a) a linked list of zero or more specific extents that reference portions of this source data object, and (b) linked lists of protocol header and trailer capsules. The concatenation of the headers (in ascending stack sequence), the source data object extents, and the trailers (in descending stack sequence) constitute the transmitted data object constructed from the ZCO. This scheme enables a source data object to be encapsulated in a succession of protocol layers without ever having to be copied from a buffer at one layer of the protocol stack to an encapsulating buffer at a lower layer of the stack. For large source data objects, the savings in copy time and reduction in memory consumption may be considerable.

  13. 1 CFR 18.5 - Certified copies.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Certified copies. 18.5 Section 18.5 General... DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.5 Certified copies. The certified copies or duplicate originals of each document must be submitted with the original. Each copy or duplicate...

  14. Integral probability of auroral electron flux events from SSJ/4 DMSP F9 electron measurements. Interim report

    SciTech Connect

    Hardy, D.A.; Bounar, K.H.

    1992-05-18

    A study has been completed to determine the probability of observing different levels of auroral electron precipitation both within fixed spatial elements in magnetic local time and corrected geomagnetic latitude, and within spatial elements when the magnetic local time is fixed but the latitude range can be varied. The auroral electron precipitation probability is defined for a series of thresholds in electron average energy and electron energy flux as a function of geomagnetic activity. The study provides the capability to determine the probability of observation of an auroral electron precipitation event for any specified threshold in average energy, energy flux, and level of geomagnetic activity for any location in the auroral region or for any line of sight through the auroral region. The input for the study is one year of data from the SSJ/4 electron and proton spectrometer flown on the F9 satellite of the Defense Meteorological Satellite Program (DMSP) comprising approximately 10, 141 hemispheric passes through the auroral region. The binning technique used to determine these probabilities is presented and some results are discussed. The operation of the software package to display the probability results is described. Defense Meteorological Satellite Program (DMSP), Aurora, Precipitating electrons, Geomagnetic Kp index, Integral probability.

  15. Using the Integration of Discrete Event and Agent-Based Simulation to Enhance Outpatient Service Quality in an Orthopedic Department

    PubMed Central

    Kittipittayakorn, Cholada

    2016-01-01

    Many hospitals are currently paying more attention to patient satisfaction since it is an important service quality index. Many Asian countries' healthcare systems have a mixed-type registration, accepting both walk-in patients and scheduled patients. This complex registration system causes a long patient waiting time in outpatient clinics. Different approaches have been proposed to reduce the waiting time. This study uses the integration of discrete event simulation (DES) and agent-based simulation (ABS) to improve patient waiting time and is the first attempt to apply this approach to solve this key problem faced by orthopedic departments. From the data collected, patient behaviors are modeled and incorporated into a massive agent-based simulation. The proposed approach is an aid for analyzing and modifying orthopedic department processes, allows us to consider far more details, and provides more reliable results. After applying the proposed approach, the total waiting time of the orthopedic department fell from 1246.39 minutes to 847.21 minutes. Thus, using the correct simulation model significantly reduces patient waiting time in an orthopedic department. PMID:27195606

  16. Efficient Integration of Old and New Research Tools for Automating the Identification and Analysis of Seismic Reference Events

    SciTech Connect

    Wagner, Robert; Rivers, Wilmer

    2005-01-25

    any single computer program for seismic data analysis will not have all the capabilities needed to study reference events, since hese detailed studies will be highly specialized. It may be necessary to develop and test new algorithms, and then these special ;odes must be integrated with existing software to use their conventional data-processing routines. We have investigated two neans of establishing communications between the legacy and new codes: CORBA and XML/SOAP Web services. We have nvestigated making new Java code communicate with a legacy C-language program, geotool, running under Linux. Both methods vere successful, but both were difficult to implement. C programs on UNIX/Linux are poorly supported for Web services, compared vith the Java and .NET languages and platforms. Easier-to-use middleware will be required for scientists to construct distributed applications as easily as stand-alone ones. Considerable difficulty was encountered in modifying geotool, and this problem shows he need to use component-based user interfaces instead of large C-language codes where changes to one part of the program nay introduce side effects into other parts. We have nevertheless made bug fixes and enhancements to that legacy program, but t remains difficult to expand it through communications with external software.

  17. A New Approach for Copy-Move Detection Based on Improved Weber Local Descriptor.

    PubMed

    Saadat, Shabnam; Moghaddam, Mohsen Ebrahimi; Mohammadi, Mohsen

    2015-11-01

    One of the most common image tampering techniques is copy-move; in this technique, one or more parts of the image are copied and pasted in another area of the image. Recently, various methods have been proposed for copy-move detection; however, many of these techniques are not robust to additional changes like geometric transformation, and they are failed to be useful for detecting small copied areas. In this paper, a new method based on point descriptors which are derived from the integration of textural feature-based Weber law and statistical features of the image is presented. In this proposed approach, modified multiscale version of Weber local descriptor is presented to make the method robust versus geometric transformation and detect small copied areas. The results of the experiments showed that our method can detect small copied areas and copy-move tampered images which are influenced by rotation, scaling, noise addition, compression, blurring, and mirroring.

  18. To Copy-Protect or Not to Copy-Protect?

    ERIC Educational Resources Information Center

    Sacks, Jonathan

    1985-01-01

    Discusses the issues of software piracy, why people illegally copy software, protection afforded software developers by copyright laws, and current and future methods of disk-based protection built into software by developers and the problems these methods have created. (MBR)

  19. Chromatic adaptation in hard copy/soft copy comparisons

    NASA Astrophysics Data System (ADS)

    Fairchild, Mark D.

    1993-06-01

    The human visual system has evolved with a sophisticated set of mechanisms to produce stable perceptions of object colors across changes in illumination. This phenomenon is typically referred to as chromatic adaptation or color constancy. When viewing scenes or hard-copy reproductions, it is generally assumed that one adapts almost completely to the color and luminance of the prevailing light source. This is likely not the case when soft-copy image displays are viewed. Differences in the degree of chromatic adaptation to hard-copy and soft- copy displays point to two types of chromatic-adaptation mechanisms: sensory and cognitive. Sensory mechanisms are those that act automatically in response to the stimulus, such as retinal gain control. Cognitive mechanisms are those that rely on observers' knowledge of scene content. A series of experiments that measured the spatial, temporal, and chromatic properties of chromatic-adaptation mechanisms are reviewed and a mathematical model for predicting these chromatic adaptation effects is briefly described along with some practical recommendations, based on psychophysical experiments, on how to approach these problems in typical cross-media color reproduction situations.

  20. Accurate measure of transgene copy number in crop plants using droplet digital PCR

    USDA-ARS?s Scientific Manuscript database

    Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy numb...

  1. 26 CFR 301.6223(f)-1 - Duplicate copy of final partnership administrative adjustment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 18 2011-04-01 2011-04-01 false Duplicate copy of final partnership... In General § 301.6223(f)-1 Duplicate copy of final partnership administrative adjustment. (a) In... the notice of final partnership administrative adjustment (for example, in the event the...

  2. 26 CFR 301.6223(f)-1 - Duplicate copy of final partnership administrative adjustment.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 18 2014-04-01 2014-04-01 false Duplicate copy of final partnership... In General § 301.6223(f)-1 Duplicate copy of final partnership administrative adjustment. (a) In... the notice of final partnership administrative adjustment (for example, in the event the...

  3. 26 CFR 301.6223(f)-1 - Duplicate copy of final partnership administrative adjustment.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 18 2013-04-01 2013-04-01 false Duplicate copy of final partnership... In General § 301.6223(f)-1 Duplicate copy of final partnership administrative adjustment. (a) In... the notice of final partnership administrative adjustment (for example, in the event the...

  4. 26 CFR 301.6223(f)-1 - Duplicate copy of final partnership administrative adjustment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 18 2010-04-01 2010-04-01 false Duplicate copy of final partnership... In General § 301.6223(f)-1 Duplicate copy of final partnership administrative adjustment. (a) In... the notice of final partnership administrative adjustment (for example, in the event the...

  5. 26 CFR 301.6223(f)-1 - Duplicate copy of final partnership administrative adjustment.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 18 2012-04-01 2012-04-01 false Duplicate copy of final partnership... In General § 301.6223(f)-1 Duplicate copy of final partnership administrative adjustment. (a) In... the notice of final partnership administrative adjustment (for example, in the event the...

  6. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 13 (6), June 30, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-005 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $ 1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid. SEAN Bulletin is available on Kosmos. Type CHECK SEAN on Part A of Kosmos.

  7. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 25(10), October 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-010 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $ 1 . Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid. SEAN Bulletin is available on Kosmos. Type CHECK SEAN on Part A of Kosmos

  8. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 13(3), March 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-002 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid.

  9. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 13 (7), July 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-007 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid. SEAN Bulletin is available on Kosmos. Type CHECK SEAN on Part A of Kosmos.

  10. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 13 (1), January 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-001 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $ 1. Subscriptions to SEAN Bulletin are also available from AGU Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid.

  11. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 13(9), September 30, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-013 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid. SEAN Bulletin is available on Kosmos. Type CHECK SEAN on Part A of Kosmos.

  12. Geophysical events

    NASA Astrophysics Data System (ADS)

    This is a summary of SEAN Bulletin, 13 (5), May 31, 1988, a publication of the Smithsonian Institution's Scientific Event Alert Network. The complete bulletin is available in the microfiche edition of Eos as a microfiche supplement or as a paper reprint. For the microfiche, order document E88-004 at $2.50 (U.S.) by writing to AGU Orders, 2000 Florida Avenue, N.W., Washington, DC 20009 or by calling toll free on 800-424-2488. For the paper reprint, order SEAN Bulletin (giving volume and issue numbers and issue date) through the same address; the price is $3.50 for one copy of each issue number for those who do not have a deposit account, $2 for those who do; additional copies of each issue number are $ 1. Subscriptions to SEAN Bulletin are also available from AGU-Orders; the price is $18 for 12 monthly issues mailed to a U.S. address, $28 if mailed elsewhere, and must be prepaid. SEAN Bulletin is available on Kosmos. Type CHECK SEAN on Part A of Kosmos.

  13. Using Copy Change with Trade Books to Teach Earth Science

    ERIC Educational Resources Information Center

    Bintz, William P.; Wright, Pam; Sheffer, Julie

    2010-01-01

    Developing and implementing relevant, challenging, integrative, and exploratory curriculum is critical at all levels of schooling. This article describes one attempt to develop and implement an instance of interdisciplinary curriculum by using copy change with trade books to teach earth science. Specifically, it introduces trade books as a way to…

  14. Using Copy Change with Trade Books to Teach Earth Science

    ERIC Educational Resources Information Center

    Bintz, William P.; Wright, Pam; Sheffer, Julie

    2010-01-01

    Developing and implementing relevant, challenging, integrative, and exploratory curriculum is critical at all levels of schooling. This article describes one attempt to develop and implement an instance of interdisciplinary curriculum by using copy change with trade books to teach earth science. Specifically, it introduces trade books as a way to…

  15. Gain of a New Exon by a Lineage-Specific Alu Element-Integration Event in the BCS1L Gene during Primate Evolution

    PubMed Central

    Park, Sang-Je; Kim, Young-Hyun; Lee, Sang-Rae; Choe, Se-Hee; Kim, Myung-Jin; Kim, Sun-Uk; Kim, Ji-Su; Sim, Bo-Woong; Song, Bong-Seok; Jeong, Kang-Jin; Jin, Yeung-Bae; Lee, Youngjeon; Park, Young-Ho; Park, Young Il; Huh, Jae-Won; Chang, Kyu-Tae

    2015-01-01

    BCS1L gene encodes mitochondrial protein and is a member of conserved AAA protein family. This gene is involved in the incorporation of Rieske FeS and Qcr10p into complex III of respiratory chain. In our previous study, AluYRa2-derived alternative transcript in rhesus monkey genome was identified. However, this transcript has not been reported in human genome. In present study, we conducted evolutionary analysis of AluYRa2-exonized transcript with various primate genomic DNAs and cDNAs from humans, rhesus monkeys, and crab-eating monkeys. Remarkably, our results show that AluYRa2 element has only been integrated into genomes of Macaca species. This Macaca lineage-specific integration of AluYRa2 element led to exonization event in the first intron region of BCS1L gene by producing a conserved 3′ splice site. Intriguingly, in rhesus and crab-eating monkeys, more diverse transcript variants by alternative splicing (AS) events, including exon skipping and different 5′ splice sites from humans, were identified. Alignment of amino acid sequences revealed that AluYRa2-exonized transcript has short N-terminal peptides. Therefore, AS events play a major role in the generation of various transcripts and proteins during primate evolution. In particular, lineage-specific integration of Alu elements and species-specific Alu-derived exonization events could be important sources of gene diversification in primates. PMID:26537194

  16. qPCR for quantification of transgene expression and determination of transgene copy number.

    PubMed

    Fletcher, Stephen J

    2014-01-01

    Quantitative real-time PCR (qPCR) is a mature technology that can be used to accurately quantify the number of copies of a target nucleic acid in a sample. Here, we describe a method for using this technology to determine the copy number of a transgene stably integrated into a plant's genome and to ascertain the level of transgene expression.

  17. COPI acts in both vesicular and tubular transport

    PubMed Central

    Yang, Jia-Shu; Valente, Carmen; Polishchuk, Roman S.; Turacchio, Gabriele; Layre, Emilie; Moody, D. Branch; Leslie, Christina C.; Gelb, Michael H.; Brown, William J.; Corda, Daniela; Luini, Alberto; Hsu, Victor W.

    2011-01-01

    Intracellular transport is now appreciated to occur through two general types of carriers, either vesicles 1, 2 or tubules 3, 4. Coat proteins act as the core machinery that initiates vesicle formation 1, 2, but the counterpart that initiates tubule formation has been unclear. Here, we find that the Coat Protein I (COPI) complex initially drives the formation of Golgi buds. Subsequently, a set of opposing lipid enzymatic activities determines whether these buds become vesicles or tubules. Lysophosphatidic acid (LPA) acyltransferase type γ (LPAAT–γ) promotes COPI vesicle fission for retrograde vesicular transport. In contrast, cytosolic phospholipase A2 type α (cPLA2–α) inhibits this fission event to induce COPI tubules, which act in anterograde intra-Golgi transport and Golgi ribbon formation. These findings not only advance a molecular understanding of how COPI vesicle fission is achieved, but also shed new insight into how COPI acts in intra-Golgi transport and reveal an unexpected mechanistic relationship between vesicular and tubular transport. PMID:21725317

  18. What Triggered the Recent Melt Event at Summit, Greenland? Insights from an Integrated Suite of Ground-Based Observations

    NASA Astrophysics Data System (ADS)

    Miller, N.; Pettersen, C.; Walden, V. P.; Turner, D. D.; Shupe, M.; Bennartz, R.; Neff, W. D.; Cox, C.; Kulie, M.; Castellani, B.

    2012-12-01

    The melt extent of the Greenland Ice Sheet (GIS) has been increasing in recent decades. According to a NASA press release, satellite observations show that the GIS melt extent was an anomalously high 97% in mid-July 2012, including rare melting at high altitude locations such as Summit, Greenland. This event was also captured by ground-based observations at Summit, collected by the ICECAPS (Integrated Characterization of Energy, Clouds, Atmospheric State, and Precipitation at Summit) project. The observational data also recorded increased variability in the atmospheric state for July 2012 compared to the July 2010 and 2011. One of the outliers on 11 July 2012 produced ice melt temperatures at Summit, Greenland for the first time since observational records began. The origin of the warm airmass that affected Summit on 11 July 2012 was traced to the central United States on 1 July 2012. Instead of flowing around the southern tip of Greenland, the airmass was forced over central Greenland and thus lifted to over 3200m by the thickness of the GIS. Temperature retrievals from a microwave radiometer (MWR) observed a warm front arriving on 10 July 2012, which included RH values close to saturation as recorded by a NOAA met tower. Elevated precipitable water vapor levels suggest ripe conditions for liquid water clouds. A low level liquid cloud was observed by a micropulse lidar (MPL) and a millimeter cloud radar (MMCR) from 10-11 July 2012 with elevated liquid water content retrieved from the MWRs. Observations from an infrared spectrometer (PAERI) instrument indicate increased downwelling longwave fluxes during this time. The liquid water cloud effectively traps the heat thus limiting the surface's ability to cool radiatively. Surface-based inversions are common during clear sky scenes but liquid bearing clouds often weaken these inversions. In combination with solar heating, this can create surface temperatures warmer than the air aloft. A conceptual surface energy

  19. 48 CFR 3401.105-3 - Copies.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... GENERAL ED ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 3401.105-3 Copies. Copies of the... EDAR is available for viewing at: http://www.ed.gov/policy/fund/reg/clibrary/edar.html....

  20. 48 CFR 3401.105-3 - Copies.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... GENERAL ED ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 3401.105-3 Copies. Copies of the... EDAR is available for viewing at: http://www.ed.gov/policy/fund/reg/clibrary/edar.html....

  1. 48 CFR 3401.105-3 - Copies.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... GENERAL ED ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 3401.105-3 Copies. Copies of the... EDAR is available for viewing at: http://www.ed.gov/policy/fund/reg/clibrary/edar.html....

  2. 48 CFR 3401.105-3 - Copies.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... GENERAL ED ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 3401.105-3 Copies. Copies of the... EDAR is available for viewing at: http://www.ed.gov/policy/fund/reg/clibrary/edar.html....

  3. 49 CFR 7.8 - Copies

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Copies 7.8 Section 7.8 Transportation Office of... Public by DOT § 7.8 Copies Copies of any material covered by this subpart that is not published and... § 7.10. Copies will be certified upon request and payment of the fee prescribed in § 7.43(f). ...

  4. Multiple functionally divergent and conserved copies of alpha tubulin in bdelloid rotifers.

    PubMed

    Eyres, Isobel; Frangedakis, Eftychios; Fontaneto, Diego; Herniou, Elisabeth A; Boschetti, Chiara; Carr, Adrian; Micklem, Gos; Tunnacliffe, Alan; Barraclough, Timothy G

    2012-08-17

    Bdelloid rotifers are microscopic animals that have apparently survived without sex for millions of years and are able to survive desiccation at all life stages through a process called anhydrobiosis. Both of these characteristics are believed to have played a role in shaping several unusual features of bdelloid genomes discovered in recent years. Studies into the impact of asexuality and anhydrobiosis on bdelloid genomes have focused on understanding gene copy number. Here we investigate copy number and sequence divergence in alpha tubulin. Alpha tubulin is conserved and normally present in low copy numbers in animals, but multiplication of alpha tubulin copies has occurred in animals adapted to extreme environments, such as cold-adapted Antarctic fish. Using cloning and sequencing we compared alpha tubulin copy variation in four species of bdelloid rotifers and four species of monogonont rotifers, which are facultatively sexual and cannot survive desiccation as adults. Results were verified using transcriptome data from one bdelloid species, Adineta ricciae. In common with the typical pattern for animals, monogonont rotifers contain either one or two copies of alpha tubulin, but bdelloid species contain between 11 and 13 different copies, distributed across five classes. Approximately half of the copies form a highly conserved group that vary by only 1.1% amino acid pairwise divergence with each other and with the monogonont copies. The other copies have divergent amino acid sequences that evolved significantly faster between classes than within them, relative to synonymous changes, and vary in predicted biochemical properties. Copies of each class were expressed under the laboratory conditions used to construct the transcriptome. Our findings are consistent with recent evidence that bdelloids are degenerate tetraploids and that functional divergence of ancestral copies of genes has occurred, but show how further duplication events in the ancestor of bdelloids

  5. Using the R Package crlmm for Genotyping and Copy Number Estimation

    PubMed Central

    Scharpf, Robert B.; Irizarry, Rafael A.; Ritchie, Matthew E.; Carvalho, Benilton; Ruczinski, Ingo

    2011-01-01

    Genotyping platforms such as Affymetrix can be used to assess genotype-phenotype as well as copy number-phenotype associations at millions of markers. While genotyping algorithms are largely concordant when assessed on HapMap samples, tools to assess copy number changes are more variable and often discordant. One explanation for the discordance is that copy number estimates are susceptible to systematic differences between groups of samples that were processed at different times or by different labs. Analysis algorithms that do not adjust for batch effects are prone to spurious measures of association. The R package crlmm implements a multilevel model that adjusts for batch effects and provides allele-specific estimates of copy number. This paper illustrates a workflow for the estimation of allele-specific copy number and integration of the marker-level estimates with complimentary Bioconductor software for inferring regions of copy number gain or loss. All analyses are performed in the statistical environment R. PMID:22523482

  6. 48 CFR 2001.104-3 - Copies.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 6 2014-10-01 2014-10-01 false Copies. 2001.104-3 Section 2001.104-3 Federal Acquisition Regulations System NUCLEAR REGULATORY COMMISSION GENERAL NUCLEAR REGULATORY COMMISSION ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 2001.104-3 Copies. Copies...

  7. 48 CFR 2001.104-3 - Copies.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false Copies. 2001.104-3 Section 2001.104-3 Federal Acquisition Regulations System NUCLEAR REGULATORY COMMISSION GENERAL NUCLEAR REGULATORY COMMISSION ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 2001.104-3 Copies. Copies...

  8. 48 CFR 2001.104-3 - Copies.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 6 2013-10-01 2013-10-01 false Copies. 2001.104-3 Section 2001.104-3 Federal Acquisition Regulations System NUCLEAR REGULATORY COMMISSION GENERAL NUCLEAR REGULATORY COMMISSION ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 2001.104-3 Copies. Copies...

  9. 48 CFR 2001.104-3 - Copies.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 6 2012-10-01 2012-10-01 false Copies. 2001.104-3 Section 2001.104-3 Federal Acquisition Regulations System NUCLEAR REGULATORY COMMISSION GENERAL NUCLEAR REGULATORY COMMISSION ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 2001.104-3 Copies. Copies...

  10. 48 CFR 2001.104-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Copies. 2001.104-3 Section 2001.104-3 Federal Acquisition Regulations System NUCLEAR REGULATORY COMMISSION GENERAL NUCLEAR REGULATORY COMMISSION ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 2001.104-3 Copies. Copies...

  11. 36 CFR 703.20 - File copies.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false File copies. 703.20 Section... Is Not a Party § 703.20 File copies. The Office of the General Counsel will maintain the official file of copies of all demands served on the Library and deciding officials' responses....

  12. 48 CFR 3401.104-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Copies. 3401.104-3 Section 3401.104-3 Federal Acquisition Regulations System DEPARTMENT OF EDUCATION ACQUISITION REGULATION GENERAL ED ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 3401.104-3 Copies. Copies of...

  13. 22 CFR 92.76 - Copying documents.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Copying documents. 92.76 Section 92.76 Foreign Relations DEPARTMENT OF STATE LEGAL AND RELATED SERVICES NOTARIAL AND RELATED SERVICES Copying, Recording, Translating and Procuring Documents § 92.76 Copying documents. (a) Consular authority. The consular officer is...

  14. 48 CFR 401.105-3 - Copies.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 4 2011-10-01 2011-10-01 false Copies. 401.105-3 Section 401.105-3 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL AGRICULTURE ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 401.105-3 Copies. Copies of the AGAR published in...

  15. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 14 Aeronautics and Space 3 2014-01-01 2014-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents and for affixation of the seal for a certification or validation are the same as those provided in...

  16. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 14 Aeronautics and Space 3 2013-01-01 2013-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents and for affixation of the seal for a certification or validation are the same as those provided in...

  17. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 14 Aeronautics and Space 3 2011-01-01 2011-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents and for affixation of the seal for a certification or validation are the same as those provided in...

  18. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents and for affixation of the seal for a certification or validation are the same as those provided in...

  19. 14 CFR 187.7 - Copies; seal.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 14 Aeronautics and Space 3 2012-01-01 2012-01-01 false Copies; seal. 187.7 Section 187.7... REGULATIONS FEES § 187.7 Copies; seal. The fees for furnishing photostatic or similar copies of documents and for affixation of the seal for a certification or validation are the same as those provided in...

  20. 48 CFR 401.105-3 - Copies.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 4 2014-10-01 2014-10-01 false Copies. 401.105-3 Section 401.105-3 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL AGRICULTURE ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 401.105-3 Copies. Copies of the AGAR published in...

  1. 48 CFR 401.105-3 - Copies.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 4 2012-10-01 2012-10-01 false Copies. 401.105-3 Section 401.105-3 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL AGRICULTURE ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 401.105-3 Copies. Copies of the AGAR published in...

  2. 48 CFR 401.105-3 - Copies.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 4 2013-10-01 2013-10-01 false Copies. 401.105-3 Section 401.105-3 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL AGRICULTURE ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 401.105-3 Copies. Copies of the AGAR published in...

  3. 48 CFR 401.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Copies. 401.105-3 Section 401.105-3 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL AGRICULTURE ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 401.105-3 Copies. Copies of the AGAR published in...

  4. Patterns, Correlates, and Reduction of Homework Copying

    ERIC Educational Resources Information Center

    Palazzo, David J.; Lee, Young-Jin; Warnakulasooriya, Rasil; Pritchard, David E.

    2010-01-01

    Submissions to an online homework tutor were analyzed to determine whether they were copied. The fraction of copied submissions increased rapidly over the semester, as each weekly deadline approached and for problems later in each assignment. The majority of students, who copied less than 10% of their problems, worked steadily over the three days…

  5. 48 CFR 1401.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Copies. 1401.105-3 Section 1401.105-3 Federal Acquisition Regulations System DEPARTMENT OF THE INTERIOR GENERAL DEPARTMENT OF THE INTERIOR ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 1401.105-3 Copies. Copies of the...

  6. 48 CFR 1.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Copies. 1.105-3 Section 1.105-3 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION GENERAL FEDERAL ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 1.105-3 Copies. Copies of the FAR in Federal...

  7. 48 CFR 901.104-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Copies. 901.104-3 Section 901.104-3 Federal Acquisition Regulations System DEPARTMENT OF ENERGY GENERAL FEDERAL ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 901.104-3 Copies. Copies of the DEAR published in the Federal...

  8. 48 CFR 1001.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Copies. 1001.105-3 Section 1001.105-3 Federal Acquisition Regulations System DEPARTMENT OF THE TREASURY GENERAL DEPARTMENT OF THE TREASURY ACQUISITION REGULATORY (DTAR) SYSTEM Purpose, Authority, Issuance 1001.105-3 Copies. Copies of the...

  9. 44 CFR 6.81 - Additional copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Additional copies. 6.81... HOMELAND SECURITY GENERAL IMPLEMENTATION OF THE PRIVACY ACT OF 1974 Fees § 6.81 Additional copies. A reasonable number of additional copies shall be provided for the applicable fee to a requestor who indicates...

  10. 14 CFR 1206.207 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Copies. 1206.207 Section 1206.207 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION AVAILABILITY OF AGENCY RECORDS TO MEMBERS OF THE PUBLIC Records Available § 1206.207 Copies. The furnishing of a single copy of the requested...

  11. Copyright and Fee-based Copying Services.

    ERIC Educational Resources Information Center

    Heller, James S.

    1986-01-01

    This article discusses the effect of the Copyright Act of 1976 upon fee-based library copying services. Highlights include commercial advantage, open collection, notice of copyright, articles and small excerpts, multiple or systematic copying, purpose of fair use, the Williams and Wilkins case, and large-scale copying operations. Forty-four…

  12. 22 CFR 401.13 - Copies required.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Copies required. 401.13 Section 401.13 Foreign Relations INTERNATIONAL JOINT COMMISSION, UNITED STATES AND CANADA RULES OF PROCEDURE Applications § 401.13 Copies required. (a) Subject to paragraph (c) of this section, two duplicate originals and fifty copies...

  13. 48 CFR 1401.105-3 - Copies.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 5 2013-10-01 2013-10-01 false Copies. 1401.105-3 Section 1401.105-3 Federal Acquisition Regulations System DEPARTMENT OF THE INTERIOR GENERAL DEPARTMENT OF THE INTERIOR ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 1401.105-3 Copies. Copies of...

  14. 48 CFR 1401.105-3 - Copies.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 5 2014-10-01 2014-10-01 false Copies. 1401.105-3 Section 1401.105-3 Federal Acquisition Regulations System DEPARTMENT OF THE INTERIOR GENERAL DEPARTMENT OF THE INTERIOR ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 1401.105-3 Copies. Copies of...

  15. 48 CFR 1401.105-3 - Copies.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 5 2011-10-01 2011-10-01 false Copies. 1401.105-3 Section 1401.105-3 Federal Acquisition Regulations System DEPARTMENT OF THE INTERIOR GENERAL DEPARTMENT OF THE INTERIOR ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 1401.105-3 Copies. Copies of...

  16. 48 CFR 1301.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Copies. 1301.105-3 Section 1301.105-3 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE GENERAL DEPARTMENT OF COMMERCE ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 1301.105-3 Copies. (a) Copies of the CAR in...

  17. 48 CFR 2901.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Copies. 2901.105-3 Section 2901.105-3 Federal Acquisition Regulations System DEPARTMENT OF LABOR GENERAL DEPARTMENT OF LABOR ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 2901.105-3 Copies. Copies of the DOLAR published in...

  18. Excess pressure integral predicts cardiovascular events independent of other risk factors in the conduit artery functional evaluation substudy of Anglo-Scandinavian Cardiac Outcomes Trial.

    PubMed

    Davies, Justin E; Lacy, Peter; Tillin, Therese; Collier, David; Cruickshank, J Kennedy; Francis, Darrel P; Malaweera, Anura; Mayet, Jamil; Stanton, Alice; Williams, Bryan; Parker, Kim H; McG Thom, Simon A; Hughes, Alun D

    2014-07-01

    Excess pressure integral (XSPI), a new index of surplus work performed by the left ventricle, can be calculated from blood pressure waveforms and may indicate circulatory dysfunction. We investigated whether XSPI predicted future cardiovascular events and target organ damage in treated hypertensive individuals. Radial blood pressure waveforms were acquired by tonometry in 2069 individuals (aged, 63±8 years) in the Conduit Artery Functional Evaluation (CAFE) substudy of the Anglo-Scandinavian Cardiac Outcomes Trial (ASCOT). Measurements of left ventricular mass index (n=862) and common carotid artery intima media thickness (n=923) were also performed. XSPI and the integral of reservoir pressure were lower in people treated with amlodipine±perindopril than in those treated with atenolol±bendroflumethiazide, although brachial systolic blood pressure was similar. A total of 134 cardiovascular events accrued during a median 3.4 years of follow-up; XSPI was a significant predictor of cardiovascular events after adjustment for age and sex, and this relationship was unaffected by adjustment for conventional cardiovascular risk factors or Framingham risk score. XSPI, central systolic blood pressure, central augmentation pressure, central pulse pressure, and integral of reservoir pressure were correlated with left ventricular mass index, but only XSPI, augmentation pressure, and central pulse pressure were associated positively with carotid artery intima media thickness. Associations between left ventricular mass index, XSPI, and integral of reservoir pressure and carotid artery intima media thickness and XSPI were unaffected by multivariable adjustment for other covariates. XSPI is a novel indicator of cardiovascular dysfunction and independently predicts cardiovascular events and targets organ damage in a prospective clinical trial.

  19. Copying and Evolution of Neuronal Topology

    PubMed Central

    Fernando, Chrisantha; Karishma, K. K.; Szathmáry, Eörs

    2008-01-01

    We propose a mechanism for copying of neuronal networks that is of considerable interest for neuroscience for it suggests a neuronal basis for causal inference, function copying, and natural selection within the human brain. To date, no model of neuronal topology copying exists. We present three increasingly sophisticated mechanisms to demonstrate how topographic map formation coupled with Spike-Time Dependent Plasticity (STDP) can copy neuronal topology motifs. Fidelity is improved by error correction and activity-reverberation limitation. The high-fidelity topology-copying operator is used to evolve neuronal topologies. Possible roles for neuronal natural selection are discussed. PMID:19020662

  20. Creating an integrated historical record of extreme particulate air pollution events in Australian cities from 1994 to 2007.

    PubMed

    Johnston, Fay H; Hanigan, Ivan C; Henderson, Sarah B; Morgan, Geoffrey G; Portner, Talia; Williamson, Grant J; Bowman, David M J S

    2011-04-01

    Epidemiological studies of exposure to vegetation fire smoke are often limited by the availability of accurate exposure data. This paper describes a systematic framework for retrospectively identifying the cause of air pollution events to facilitate a long, multicenter analysis of the public health effects of vegetation fire smoke pollution in Australia. Pollution events were statistically defined as any day at or above the 95th percentile of the 24-hr average concentration of particulate matter (PM). These were identified for six cities from three distinct ecoclimatic regions of Australia. The dates of each event were then crosschecked against a range of information sources, including online newspaper archives, government and research agency records, satellite imagery, and aerosol optical thickness measures to identify the cause for the excess particulate pollution. Pollution events occurred most frequently during summer for cities in subtropical and arid regions and during winter for cities in temperate regions. A cause for high PM on 67% of days examined in the city of Sydney was found, and 94% of these could be attributed to landscape fire smoke. Results were similar for cities in other subtropical and arid locations. Identification of the cause of pollution events was much lower in colder temperate regions where fire activity is less frequent. Bushfires were the most frequent cause of extreme pollution events in cities located in subtropical and arid regions of Australia. Although identification of pollution episodes was greatly improved by the use of multiple sources of information, satellite imagery was the most useful tool for identifying bushfire smoke pollution events.

  1. Economic burden related to chemotherapy-related adverse events in patients with metastatic breast cancer in an integrated health care system

    PubMed Central

    Rashid, Nazia; Koh, Han A; Baca, Hilda C; Lin, Kathy J; Malecha, Susan E; Masaquel, Anthony

    2016-01-01

    Background Breast cancer is treated with many different modalities, including chemotherapy that can be given as a single agent or in combination. Patients often experience adverse events from chemotherapy during the cycles of treatment which can lead to economic burden. Objective The objective of this study was to evaluate costs related to chemotherapy-related adverse events in patients with metastatic breast cancer (mBC) in an integrated health care delivery system. Methods Patients with mBC newly initiated on chemotherapy were identified and the first infusion was defined as the index date. Patients were ≥18 years old at time of index date, had at least 6 months of health plan membership and drug eligibility prior to their index date. The chemotherapy adverse events were identified after the index date and during first line of chemotherapy. Episodes of care (EOC) were created using healthcare visits. Chart review was conducted to establish whether the adverse events were related to chemotherapy. Costs were calculated for each visit, including medications related to the adverse events, and aggregated to calculate the total EOC cost. Results A total of 1,682 patients with mBC were identified after applying study criteria; 54% of these patients had one or more adverse events related to chemotherapy. After applying the EOC method, there were a total of 5,475 episodes (4,185 single episodes [76.4%] and 1,290 multiple episodes [23.6%]) related to chemotherapy-related adverse events. Within single episodes, hematological (1,387 EOC, 33.1%), musculoskeletal/pain related (1,070 EOC, 25.6%), and gastrointestinal (775 EOC, 18.5%) were the most frequent adverse events. Patients with adverse events related to single EOC with anemia and neutropenia had the highest total outpatient costs with 901 EOC ($81,991) and 187 EOC ($17,017); these patients also had highest total inpatient costs with 46 EOC ($542,798) and 16 EOC ($136,768). However, within multiple episodes

  2. Local copying of orthogonal entangled quantum states

    NASA Astrophysics Data System (ADS)

    Anselmi, Fabio; Chefles, Anthony; Plenio, Martin B.

    2004-11-01

    In classical information theory one can, in principle, produce a perfect copy of any input state. In quantum information theory, the no cloning theorem prohibits exact copying of non-orthogonal states. Moreover, if we wish to copy multiparticle entangled states and can perform only local operations and classical communication (LOCC), then further restrictions apply. We investigate the problem of copying orthogonal, entangled quantum states with an entangled blank state under the restriction to LOCC. Throughout, the subsystems have finite dimension D. We show that if all of the states to be copied are non-maximally entangled, then novel LOCC copying procedures based on entanglement catalysis are possible. We then study in detail the LOCC copying problem where both the blank state and at least one of the states to be copied are maximally entangled. For this to be possible, we find that all the states to be copied must be maximally entangled. We obtain a necessary and sufficient condition for LOCC copying under these conditions. For two orthogonal, maximally entangled states, we provide the general solution to this condition. We use it to show that for D = 2, 3, any pair of orthogonal, maximally entangled states can be locally copied using a maximally entangled blank state. However, we also show that for any D which is not prime, one can construct pairs of such states for which this is impossible.

  3. Aluminum tolerance in maize is associated with higher MATE1 gene copy number

    PubMed Central

    Maron, Lyza G.; Guimarães, Claudia T.; Kirst, Matias; Albert, Patrice S.; Birchler, James A.; Bradbury, Peter J.; Buckler, Edward S.; Coluccio, Alison E.; Danilova, Tatiana V.; Kudrna, David; Magalhaes, Jurandir V.; Piñeros, Miguel A.; Schatz, Michael C.; Wing, Rod A.; Kochian, Leon V.

    2013-01-01

    Genome structure variation, including copy number variation and presence/absence variation, comprises a large extent of maize genetic diversity; however, its effect on phenotypes remains largely unexplored. Here, we describe how copy number variation underlies a rare allele that contributes to maize aluminum (Al) tolerance. Al toxicity is the primary limitation for crop production on acid soils, which make up 50% of the world’s potentially arable lands. In a recombinant inbred line mapping population, copy number variation of the Al tolerance gene multidrug and toxic compound extrusion 1 (MATE1) is the basis for the quantitative trait locus of largest effect on phenotypic variation. This expansion in MATE1 copy number is associated with higher MATE1 expression, which in turn results in superior Al tolerance. The three MATE1 copies are identical and are part of a tandem triplication. Only three maize inbred lines carrying the three-copy allele were identified from maize and teosinte diversity panels, indicating that copy number variation for MATE1 is a rare, and quite likely recent, event. These maize lines with higher MATE1 copy number are also Al-tolerant, have high MATE1 expression, and originate from regions of highly acidic soils. Our findings show a role for copy number variation in the adaptation of maize to acidic soils in the tropics and suggest that genome structural changes may be a rapid evolutionary response to new environments. PMID:23479633

  4. Application of droplet digital PCR to determine copy number of endogenous genes and transgenes in sugarcane.

    PubMed

    Sun, Yue; Joyce, Priya Aiyar

    2017-08-28

    Droplet digital PCR combined with the low copy ACT allele as endogenous reference gene, makes accurate and rapid estimation of gene copy number in Q208 (A) and Q240 (A) attainable. Sugarcane is an important cultivated crop with both high polyploidy and aneuploidy in its 10 Gb genome. Without a known copy number reference gene, it is difficult to accurately estimate the copy number of any gene of interest by PCR-based methods in sugarcane. Recently, a new technology, known as droplet digital PCR (ddPCR) has been developed which can measure the absolute amount of the target DNA in a given sample. In this study, we deduced the true copy number of three endogenous genes, actin depolymerizing factor (ADF), adenine phosphoribosyltransferase (APRT) and actin (ACT) in three Australian sugarcane varieties, using ddPCR by comparing the absolute amounts of the above genes with a transgene of known copy number. A single copy of the ACT allele was detected in Q208 (A) , two copies in Q240 (A) , but was absent in Q117. Copy number variation was also observed for both APRT and ADF, and ranged from 9 to 11 in the three tested varieties. Using this newly developed ddPCR method, transgene copy number was successfully determined in 19 transgenic Q208 (A) and Q240 (A) events using ACT as the reference endogenous gene. Our study demonstrates that ddPCR can be used for high-throughput genetic analysis and is a quick, accurate and reliable alternative method for gene copy number determination in sugarcane. This discovered ACT allele would be a suitable endogenous reference gene for future gene copy number variation and dosage studies of functional genes in Q208 (A) and Q240 (A) .

  5. GeneBreak: detection of recurrent DNA copy number aberration-associated chromosomal breakpoints within genes.

    PubMed

    van den Broek, Evert; van Lieshout, Stef; Rausch, Christian; Ylstra, Bauke; van de Wiel, Mark A; Meijer, Gerrit A; Fijneman, Remond J A; Abeln, Sanne

    2016-01-01

    Development of cancer is driven by somatic alterations, including numerical and structural chromosomal aberrations. Currently, several computational methods are available and are widely applied to detect numerical copy number aberrations (CNAs) of chromosomal segments in tumor genomes. However, there is lack of computational methods that systematically detect structural chromosomal aberrations by virtue of the genomic location of CNA-associated chromosomal breaks and identify genes that appear non-randomly affected by chromosomal breakpoints across (large) series of tumor samples. 'GeneBreak' is developed to systematically identify genes recurrently affected by the genomic location of chromosomal CNA-associated breaks by a genome-wide approach, which can be applied to DNA copy number data obtained by array-Comparative Genomic Hybridization (CGH) or by (low-pass) whole genome sequencing (WGS). First, 'GeneBreak' collects the genomic locations of chromosomal CNA-associated breaks that were previously pinpointed by the segmentation algorithm that was applied to obtain CNA profiles. Next, a tailored annotation approach for breakpoint-to-gene mapping is implemented. Finally, dedicated cohort-based statistics is incorporated with correction for covariates that influence the probability to be a breakpoint gene. In addition, multiple testing correction is integrated to reveal recurrent breakpoint events. This easy-to-use algorithm, 'GeneBreak', is implemented in R ( www.cran.r-project.org) and is available from Bioconductor ( www.bioconductor.org/packages/release/bioc/html/GeneBreak.html).

  6. An operational integrated short-term warning solution for solar radiation storms: introducing the Forecasting Solar Particle Events and Flares (FORSPEF) system

    NASA Astrophysics Data System (ADS)

    Anastasiadis, Anastasios; Sandberg, Ingmar; Papaioannou, Athanasios; Georgoulis, Manolis; Tziotziou, Kostas; Jiggens, Piers; Hilgers, Alain

    2015-04-01

    We present a novel integrated prediction system, of both solar flares and solar energetic particle (SEP) events, which is in place to provide short-term warnings for hazardous solar radiation storms. FORSPEF system provides forecasting of solar eruptive events, such as solar flares with a projection to coronal mass ejections (CMEs) (occurrence and velocity) and the likelihood of occurrence of a SEP event. It also provides nowcasting of SEP events based on actual solar flare and CME near real-time alerts, as well as SEP characteristics (peak flux, fluence, rise time, duration) per parent solar event. The prediction of solar flares relies on a morphological method which is based on the sophisticated derivation of the effective connected magnetic field strength (Beff) of potentially flaring active-region (AR) magnetic configurations and it utilizes analysis of a large number of AR magnetograms. For the prediction of SEP events a new reductive statistical method has been implemented based on a newly constructed database of solar flares, CMEs and SEP events that covers a large time span from 1984-2013. The method is based on flare location (longitude), flare size (maximum soft X-ray intensity), and the occurrence (or not) of a CME. Warnings are issued for all > C1.0 soft X-ray flares. The warning time in the forecasting scheme extends to 24 hours with a refresh rate of 3 hours while the respective warning time for the nowcasting scheme depends on the availability of the near real-time data and falls between 15-20 minutes. We discuss the modules of the FORSPEF system, their interconnection and the operational set up. The dual approach in the development of FORPSEF (i.e. forecasting and nowcasting scheme) permits the refinement of predictions upon the availability of new data that characterize changes on the Sun and the interplanetary space, while the combined usage of solar flare and SEP forecasting methods upgrades FORSPEF to an integrated forecasting solution. This

  7. Patterns, correlates, and reduction of homework copying

    NASA Astrophysics Data System (ADS)

    Palazzo, David J.; Lee, Young-Jin; Warnakulasooriya, Rasil; Pritchard, David E.

    2010-06-01

    Submissions to an online homework tutor were analyzed to determine whether they were copied. The fraction of copied submissions increased rapidly over the semester, as each weekly deadline approached and for problems later in each assignment. The majority of students, who copied less than 10% of their problems, worked steadily over the three days prior to the deadline, whereas repetitive copiers (those who copied >30% of their submitted problems) exerted little effort early. Importantly, copying homework problems that require an analytic answer correlates with a 2(σ) decline over the semester in relative score for similar problems on exams but does not significantly correlate with the amount of conceptual learning as measured by pretesting and post-testing. An anonymous survey containing questions used in many previous studies of self-reported academic dishonesty showed ˜1/3 less copying than actually was detected. The observed patterns of copying, free response questions on the survey, and interview data suggest that time pressure on students who do not start their homework in a timely fashion is the proximate cause of copying. Several measures of initial ability in math or physics correlated with copying weakly or not at all. Changes in course format and instructional practices that previous self-reported academic dishonesty surveys and/or the observed copying patterns suggested would reduce copying have been accompanied by more than a factor of 4 reduction of copying from ˜11% of all electronic problems to less than 3%. As expected (since repetitive copiers have approximately three times the chance of failing), this was accompanied by a reduction in the overall course failure rate. Survey results indicate that students copy almost twice as much written homework as online homework and show that students nationally admit to more academic dishonesty than MIT students.

  8. Complexity and algorithms for copy-number evolution problems.

    PubMed

    El-Kebir, Mohammed; Raphael, Benjamin J; Shamir, Ron; Sharan, Roded; Zaccaria, Simone; Zehavi, Meirav; Zeira, Ron

    2017-01-01

    Cancer is an evolutionary process characterized by the accumulation of somatic mutations in a population of cells that form a tumor. One frequent type of mutations is copy number aberrations, which alter the number of copies of genomic regions. The number of copies of each position along a chromosome constitutes the chromosome's copy-number profile. Understanding how such profiles evolve in cancer can assist in both diagnosis and prognosis. We model the evolution of a tumor by segmental deletions and amplifications, and gauge distance from profile [Formula: see text] to [Formula: see text] by the minimum number of events needed to transform [Formula: see text] into [Formula: see text]. Given two profiles, our first problem aims to find a parental profile that minimizes the sum of distances to its children. Given k profiles, the second, more general problem, seeks a phylogenetic tree, whose k leaves are labeled by the k given profiles and whose internal vertices are labeled by ancestral profiles such that the sum of edge distances is minimum. For the former problem we give a pseudo-polynomial dynamic programming algorithm that is linear in the profile length, and an integer linear program formulation. For the latter problem we show it is NP-hard and give an integer linear program formulation that scales to practical problem instance sizes. We assess the efficiency and quality of our algorithms on simulated instances. https://github.com/raphael-group/CNT-ILP.

  9. A spatio-temporal reconstruction of sea surface temperature during Dansgaard-Oeschger events from model-data integration

    NASA Astrophysics Data System (ADS)

    Jensen, Mari F.; Nummelin, Aleksi; Borg Nielsen, Søren; Sadatzki, Henrik; Sessford, Evangeline; Kleppin, Hannah; Risebrobakken, Bjørg; Born, Andreas

    2016-04-01

    Proxy data suggests a large variability in the North Atlantic sea surface temperature (SST) and sea ice cover during the Dansgaard Oeschger (DO) events of the last glacial. However, the mechanisms behind these changes are still debated. It is not clear whether the ocean temperatures are controlled by forced changes in the northward ocean heat transport or by local surface fluxes, or if, instead, the SST changes can be explained by internal variability. We address these questions by analyzing a full DO event using proxy-surrogate reconstructions. This method provides a means to extrapolate the temporally accurate information from scarce proxy reconstructions with the spatial and physical consistency of climate models. Model simulations are treated as a pool of possible ocean states from which the closest match to the reconstructions, e.g., one model year, is selected based on an objective cost function. The original chronology of the model is replaced by that of the proxy data. Repeating this algorithm for each proxy time step yields a comprehensive four-dimensional dataset that is consistent with reconstructed data. In addition, the solution also includes variables and locations for which no reconstructions exist. We show that by only using climate model data from the preindustrial control simulations, we are able to reconstruct the SST variability in the subpolar gyre region over the DO event. In the eastern Nordic Seas, on the other hand, we lack the amplitude of the variations while capturing the temporal pattern. Based on our analysis, we suggest that the variability of the subpolar gyre during the analyzed DO event can be explained by internal variability of the climate system alone. Further research is needed to explain whether the lacking amplitude in the Nordic Seas is due to the model deficiencies or if external forcing or some feedback mechanisms could give rise to larger SST variability.

  10. An Integrated Approach to Seismic Event Location. 1. Evaluating How Method of Location Affects the Volume of Groups of Hypocenters

    DTIC Science & Technology

    1992-11-12

    1985: and Pujol , 1988). 3) Methods for evaluating errors in event locations. The classical approach to error analysis utilizes a formal statistical...minimum volume polyhedron as a practical enclosure for a set of points has not been suggested previously in the seismological or geological literature. 4 2...Set of Points in Space Background: There exist’numerous applications in seismology and geology where it is useful to define a volume in space which

  11. A Framework of Knowledge Integration and Discovery for Supporting Pharmacogenomics Target Predication of Adverse Drug Events: A Case Study of Drug-Induced Long QT Syndrome

    PubMed Central

    Jiang, Guoqian; Wang, Chen; Zhu, Qian; Chute, Christopher G.

    2013-01-01

    Knowledge-driven text mining is becoming an important research area for identifying pharmacogenomics target genes. However, few of such studies have been focused on the pharmacogenomics targets of adverse drug events (ADEs). The objective of the present study is to build a framework of knowledge integration and discovery that aims to support pharmacogenomics target predication of ADEs. We integrate a semantically annotated literature corpus Semantic MEDLINE with a semantically coded ADE knowledgebase known as ADEpedia using a semantic web based framework. We developed a knowledge discovery approach combining a network analysis of a protein-protein interaction (PPI) network and a gene functional classification approach. We performed a case study of drug-induced long QT syndrome for demonstrating the usefulness of the framework in predicting potential pharmacogenomics targets of ADEs. PMID:24303306

  12. Copy Number Variation in the Horse Genome

    PubMed Central

    Ghosh, Sharmila; Qu, Zhipeng; Das, Pranab J.; Fang, Erica; Juras, Rytis; Cothran, E. Gus; McDonell, Sue; Kenney, Daniel G.; Lear, Teri L.; Adelson, David L.; Chowdhary, Bhanu P.; Raudsepp, Terje

    2014-01-01

    We constructed a 400K WG tiling oligoarray for the horse and applied it for the discovery of copy number variations (CNVs) in 38 normal horses of 16 diverse breeds, and the Przewalski horse. Probes on the array represented 18,763 autosomal and X-linked genes, and intergenic, sub-telomeric and chrY sequences. We identified 258 CNV regions (CNVRs) across all autosomes, chrX and chrUn, but not in chrY. CNVs comprised 1.3% of the horse genome with chr12 being most enriched. American Miniature horses had the highest and American Quarter Horses the lowest number of CNVs in relation to Thoroughbred reference. The Przewalski horse was similar to native ponies and draft breeds. The majority of CNVRs involved genes, while 20% were located in intergenic regions. Similar to previous studies in horses and other mammals, molecular functions of CNV-associated genes were predominantly in sensory perception, immunity and reproduction. The findings were integrated with previous studies to generate a composite genome-wide dataset of 1476 CNVRs. Of these, 301 CNVRs were shared between studies, while 1174 were novel and require further validation. Integrated data revealed that to date, 41 out of over 400 breeds of the domestic horse have been analyzed for CNVs, of which 11 new breeds were added in this study. Finally, the composite CNV dataset was applied in a pilot study for the discovery of CNVs in 6 horses with XY disorders of sexual development. A homozygous deletion involving AKR1C gene cluster in chr29 in two affected horses was considered possibly causative because of the known role of AKR1C genes in testicular androgen synthesis and sexual development. While the findings improve and integrate the knowledge of CNVs in horses, they also show that for effective discovery of variants of biomedical importance, more breeds and individuals need to be analyzed using comparable methodological approaches. PMID:25340504

  13. Copy number variation in the horse genome.

    PubMed

    Ghosh, Sharmila; Qu, Zhipeng; Das, Pranab J; Fang, Erica; Juras, Rytis; Cothran, E Gus; McDonell, Sue; Kenney, Daniel G; Lear, Teri L; Adelson, David L; Chowdhary, Bhanu P; Raudsepp, Terje

    2014-10-01

    We constructed a 400K WG tiling oligoarray for the horse and applied it for the discovery of copy number variations (CNVs) in 38 normal horses of 16 diverse breeds, and the Przewalski horse. Probes on the array represented 18,763 autosomal and X-linked genes, and intergenic, sub-telomeric and chrY sequences. We identified 258 CNV regions (CNVRs) across all autosomes, chrX and chrUn, but not in chrY. CNVs comprised 1.3% of the horse genome with chr12 being most enriched. American Miniature horses had the highest and American Quarter Horses the lowest number of CNVs in relation to Thoroughbred reference. The Przewalski horse was similar to native ponies and draft breeds. The majority of CNVRs involved genes, while 20% were located in intergenic regions. Similar to previous studies in horses and other mammals, molecular functions of CNV-associated genes were predominantly in sensory perception, immunity and reproduction. The findings were integrated with previous studies to generate a composite genome-wide dataset of 1476 CNVRs. Of these, 301 CNVRs were shared between studies, while 1174 were novel and require further validation. Integrated data revealed that to date, 41 out of over 400 breeds of the domestic horse have been analyzed for CNVs, of which 11 new breeds were added in this study. Finally, the composite CNV dataset was applied in a pilot study for the discovery of CNVs in 6 horses with XY disorders of sexual development. A homozygous deletion involving AKR1C gene cluster in chr29 in two affected horses was considered possibly causative because of the known role of AKR1C genes in testicular androgen synthesis and sexual development. While the findings improve and integrate the knowledge of CNVs in horses, they also show that for effective discovery of variants of biomedical importance, more breeds and individuals need to be analyzed using comparable methodological approaches.

  14. The impact of global events in the Deep Sea biosphere: An integrated ichnological, geochemical and stratigraphical approach

    NASA Astrophysics Data System (ADS)

    Cummings, John; Hodgson, David; Jeffery-Abt, Charlotte; Worden, Richard

    2010-05-01

    Keywords: Ichnology, Palaeocene-Eocene Thermal Maximum, Clay mineralogy, SGR, Basque Basin Here the effects of the K-Pg event and the PETM on benthic macrofauna communities are constrained using an ichnological approach. In most basins, the mass extinction witnessed at the K-Pg boundary is not recognised in deep sea trace fossil communities. On a global scale, trace fossil diversity actually experiences a diversity burst following the K-Pg event, culminating in a Phanerozoic peak in diversity during the earliest Eocene. This diversity peak of deep sea trace fossil communities is inconsistent with the Palaeocene - Eocene boundary extinction of 50% of benthic foraminifera taxa. . Initial climate cooling following the K-Pg event was soon replaced by a disorderly period in the Earth's climate history whereby the background ‘greenhouse' conditions were punctuated by a number of rapid, transient hyperthermal events. The most prominent of these events was the Palaeocene-Eocene Thermal Maximum (PETM). Sea surface temperatures and bottom temperatures soared by as much as 10°C in as little as 1000 years. Extensive research has been published concerning the biotic and geochemical effect of the PETM. Detailed ichnological data obtained from 9 localities in the Basque basin, northeast Spain, spanning the mid Palaeocene-early Eocene is presented here. This data not only allows the effects of the PETM on benthic macrofauna communities to be measured but also allows rigorous testing of the utility of trace fossil assemblages in determining submarine fan environments of deposition during periods of climatic extremes. The Basque Basin provides an ideal natural laboratory to study this period of Earth's history as there are many K-Pg and PETM outcrops, usually rich in trace fossils. High resolution clay mineralogical analyses have been conducted utilising XRD, FT-IR and field based spectral gamma ray (SGR) measurements to provide an insight into weathering patterns on the

  15. Development of an integrated electronic platform for patient self-report and management of adverse events during cancer treatment.

    PubMed

    Holch, P; Warrington, L; Bamforth, L C A; Keding, A; Ziegler, L E; Absolom, K; Hector, C; Harley, C; Johnson, O; Hall, G; Morris, C; Velikova, G

    2017-09-01

    Significant adverse events (AE) during cancer therapy disrupt treatment and escalate to emergency admissions. Approaches to improve the timeliness and accuracy of AE reporting may improve safety and reduce health service costs. Reporting AE via patient reported outcomes (PROs), can improve clinician-patient communication and making data available to clinicians in 'real-time' using electronic PROs (ePROs) could potentially transform clinical practice by providing easily accessible records to guide treatment decisions. This manuscript describes the development of eRAPID (electronic patient self-Reporting of Adverse-events: Patient Information and aDvice) is a National Institute for Health Research-funded programme, a system for patients to self-report and manage AE online during and after cancer treatment. A multidisciplinary team of IT experts, staff and patients developed using agile principles a secure web application interface (QStore) between an existing online questionnaire builder (QTool) displaying real-time ePRO data to clinicians in the electronic patient record at Leeds Teaching Hospitals NHS Trust. Hierarchical algorithms were developed corresponding to Common Terminology Criteria for Adverse Events grading using the QTool question dependency function. Patient advocates (N = 9), patients (N = 13), and staff (N = 19) usability tested the system reporting combinations of AE. The eRAPID system allows patients to report AE from home on PC, tablet or any web enabled device securely during treatment. The system generates immediate self-management advice for low or moderate AE and for severe AE advice to contact the hospital immediately. Clinicians can view patient AE data in the electronic patient record and receive email notifications when patients report severe AE. Evaluation of the system in a randomised controlled trial in breast, gynaecological and colorectal cancer patients undergoing systemic therapy is currently underway. To adapt eRAPID for

  16. Time-stratigraphic reconstruction and integration of paleopedologic, sedimentologic, and biotic events (Willwood Formation, Lower Eocene, northwest Wyoming, USA)

    USGS Publications Warehouse

    Bown, T.M.; Kraus, M.J.

    1993-01-01

    An empirically-based model is advanced using paleosol maturities to estimate the relative geologic time separating any stratigraphic levels within the lower Eocene Willwood Formation. The reviewed Willwood time stratigraphy from this analysis helps evaluate the nature, tempo, and possible causes of three major episodes of mammalian appearance and disappearance. These faunal events are directly correlated with certain apects of paleosol evolution in the Willwood Formation. That evolution is tied directly to climatic changes and to varying sediment accumulation rates in response to tectonism. -from Authors

  17. [Integrity].

    PubMed

    Gómez Rodríguez, Rafael Ángel

    2014-01-01

    To say that someone possesses integrity is to claim that that person is almost predictable about responses to specific situations, that he or she can prudentially judge and to act correctly. There is a closed interrelationship between integrity and autonomy, and the autonomy rests on the deeper moral claim of all humans to integrity of the person. Integrity has two senses of significance for medical ethic: one sense refers to the integrity of the person in the bodily, psychosocial and intellectual elements; and in the second sense, the integrity is the virtue. Another facet of integrity of the person is la integrity of values we cherish and espouse. The physician must be a person of integrity if the integrity of the patient is to be safeguarded. The autonomy has reduced the violations in the past, but the character and virtues of the physician are the ultimate safeguard of autonomy of patient. A field very important in medicine is the scientific research. It is the character of the investigator that determines the moral quality of research. The problem arises when legitimate self-interests are replaced by selfish, particularly when human subjects are involved. The final safeguard of moral quality of research is the character and conscience of the investigator. Teaching must be relevant in the scientific field, but the most effective way to teach virtue ethics is through the example of the a respected scientist.

  18. The oscillatory activities and its synchronization in auditory-visual integration as revealed by event-related potentials to bimodal stimuli

    NASA Astrophysics Data System (ADS)

    Guo, Jia; Xu, Peng; Yao, Li; Shu, Hua; Zhao, Xiaojie

    2012-03-01

    Neural mechanism of auditory-visual speech integration is always a hot study of multi-modal perception. The articulation conveys speech information that helps detect and disambiguate the auditory speech. As important characteristic of EEG, oscillations and its synchronization have been applied to cognition research more and more. This study analyzed the EEG data acquired by unimodal and bimodal stimuli using time frequency and phase synchrony approach, investigated the oscillatory activities and its synchrony modes behind evoked potential during auditory-visual integration, in order to reveal the inherent neural integration mechanism under these modes. It was found that beta activity and its synchronization differences had relationship with gesture N1-P2, which happened in the earlier stage of speech coding to pronouncing action. Alpha oscillation and its synchronization related with auditory N1-P2 might be mainly responsible for auditory speech process caused by anticipation from gesture to sound feature. The visual gesture changing enhanced the interaction of auditory brain regions. These results provided explanations to the power and connectivity change of event-evoked oscillatory activities which matched ERPs during auditory-visual speech integration.

  19. Reconstruction of multiple tectonic events in continental margins by integrated tectonostratigraphic and geochronological analysis: the Mesozoic to Paleogene Caribbean-South American interaction in northeastern Colombia

    NASA Astrophysics Data System (ADS)

    Cardona, Agustin; Montes, Camilo; Bayona, German; Valencia, Victor; Ramirez, Diego; Zapata, Sebastian; Lara, Mario; Lopez-Martinez, Margarita; Thomson, Stuart; Weber, Marion

    2013-04-01

    Although the older record and successive tectonic scenarios experienced by a continental margin is commonly fragmentary, integrated field, petrological and geochronological analysis can reconstruct the long term tectonic evolution of continental margins and characterized major controls on the orogenic style. We present new geochronological constraints from igneous and low to very low grade metasedimentary rocks from the Caribbean continental margin of northeastern Colombia (Guajira region) in order to reconstruct the different tectonic events recorded by the margin before, during and following the arc-continent collision with the front of the Caribbean plate. Zircon U-Pb LA-ICP-MS geochronology results from leucogranites associated with garnet amphibolites, tonalites and volcanic rocks that made the continental basement of northeastern Colombia reveals and Early to Middle Mesozoic tectonic activity with peaks at ca. 220-230 Ma and 170-180 Ma. This magmatic record is related to a collisional belt link to the final agglutination of Pangea and was followed by an overimposed far field back-arc setting associated to the subduction of the Pacific (Farrallon) plate under the Pangea supercontinent. Muscovite and biotite Ar-Ar geochronology from basement rocks and low grade Mesozoic metasediments also reveals the existence of Middle Jurassic to Early Cretaceous thermal events link to the final opening of the proto-Caribbean ocean. The South American continental margin was subsequently affected by an arc-continent collisional event with the front of the Caribbean plate. This event is recorded by the growth of a Banda-type collisional melange that mixed South American continental margin sediments with mafic and ultramafic blocks of intra-oceanic arc origin, the formation of a coherent metasedimentary belt also made of South American margin sediments, and the mylonitization of the continental basement. Ar-Ar temporal constraints on the low grade metasedimentary rocks and

  20. Integration of Harvest and Time-to-Event Data Used to Estimate Demographic Parameters for White-tailed Deer

    NASA Astrophysics Data System (ADS)

    Norton, Andrew S.

    An integral component of managing game species is an understanding of population dynamics and relative abundance. Harvest data are frequently used to estimate abundance of white-tailed deer. Unless harvest age-structure is representative of the population age-structure and harvest vulnerability remains constant from year to year, these data alone are of limited value. Additional model structure and auxiliary information has accommodated this shortcoming. Specifically, integrated age-at-harvest (AAH) state-space population models can formally combine multiple sources of data, and regularization via hierarchical model structure can increase flexibility of model parameters. I collected known fates data, which I evaluated and used to inform trends in survival parameters for an integrated AAH model. I used temperature and snow depth covariates to predict survival outside of the hunting season, and opening weekend temperature and percent of corn harvest covariates to predict hunting season survival. When auxiliary empirical data were unavailable for the AAH model, moderately informative priors provided sufficient information for convergence and parameter estimates. The AAH model was most sensitive to errors in initial abundance, but this error was calibrated after 3 years. Among vital rates, the AAH model was most sensitive to reporting rates (percentage of mortality during the hunting season related to harvest). The AAH model, using only harvest data, was able to track changing abundance trends due to changes in survival rates even when prior models did not inform these changes (i.e. prior models were constant when truth varied). I also compared AAH model results with estimates from the Wisconsin Department of Natural Resources (WIDNR). Trends in abundance estimates from both models were similar, although AAH model predictions were systematically higher than WIDNR estimates in the East study area. When I incorporated auxiliary information (i.e. integrated AAH model

  1. Hacking DNA copy number for circuit engineering.

    PubMed

    Wu, Feilun; You, Lingchong

    2017-07-27

    DNA copy number represents an essential parameter in the dynamics of synthetic gene circuits but typically is not explicitly considered. A new study demonstrates how dynamic control of DNA copy number can serve as an effective strategy to program robust oscillations in gene expression circuits.

  2. 48 CFR 601.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Copies. 601.105-3 Section 601.105-3 Federal Acquisition Regulations System DEPARTMENT OF STATE GENERAL DEPARTMENT OF STATE ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 601.105-3 Copies. The DOSAR is available through...

  3. 22 CFR 401.13 - Copies required.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 22 Foreign Relations 2 2012-04-01 2009-04-01 true Copies required. 401.13 Section 401.13 Foreign Relations INTERNATIONAL JOINT COMMISSION, UNITED STATES AND CANADA RULES OF PROCEDURE Applications § 401.13... additional copies of the documents mentioned therein as may be requested by the Commission shall be...

  4. 22 CFR 401.13 - Copies required.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 22 Foreign Relations 2 2014-04-01 2014-04-01 false Copies required. 401.13 Section 401.13 Foreign Relations INTERNATIONAL JOINT COMMISSION, UNITED STATES AND CANADA RULES OF PROCEDURE Applications § 401.13... additional copies of the documents mentioned therein as may be requested by the Commission shall be...

  5. 22 CFR 401.13 - Copies required.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 22 Foreign Relations 2 2013-04-01 2009-04-01 true Copies required. 401.13 Section 401.13 Foreign Relations INTERNATIONAL JOINT COMMISSION, UNITED STATES AND CANADA RULES OF PROCEDURE Applications § 401.13... additional copies of the documents mentioned therein as may be requested by the Commission shall be...

  6. 22 CFR 401.13 - Copies required.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 22 Foreign Relations 2 2011-04-01 2009-04-01 true Copies required. 401.13 Section 401.13 Foreign Relations INTERNATIONAL JOINT COMMISSION, UNITED STATES AND CANADA RULES OF PROCEDURE Applications § 401.13... additional copies of the documents mentioned therein as may be requested by the Commission shall be...

  7. 48 CFR 3001.105-3 - Copies.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 7 2014-10-01 2014-10-01 false Copies. 3001.105-3 Section 3001.105-3 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND SECURITY....105-3 Copies. Official versions of the HSAR are available in the Code of Federal Regulations,...

  8. 48 CFR 3001.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ....105-3 Copies. The HSAR is available in the Federal Register and electronically at http://www.dhs.gov... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Copies. 3001.105-3 Section 3001.105-3 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND...

  9. 48 CFR 3001.105-3 - Copies.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 7 2013-10-01 2012-10-01 true Copies. 3001.105-3 Section 3001.105-3 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND SECURITY....105-3 Copies. Official versions of the HSAR are available in the Code of Federal Regulations,...

  10. 48 CFR 3001.105-3 - Copies.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ....105-3 Copies. The HSAR is available in the Federal Register and electronically at http://www.dhs.gov... 48 Federal Acquisition Regulations System 7 2011-10-01 2011-10-01 false Copies. 3001.105-3 Section 3001.105-3 Federal Acquisition Regulations System DEPARTMENT OF HOMELAND SECURITY, HOMELAND...

  11. 48 CFR 501.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Copies. 501.105-3 Section 501.105-3 Federal Acquisition Regulations System GENERAL SERVICES ADMINISTRATION GENERAL GENERAL SERVICES ADMINISTRATION ACQUISITION REGULATION SYSTEM Purpose, Authority, Issuance 501.105-3 Copies. The...

  12. 48 CFR 201.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Copies. 201.105-3 Section 201.105-3 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE GENERAL FEDERAL ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 201.105-3 Copies....

  13. 48 CFR 1501.105-3 - Copies.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Copies. 1501.105-3 Section 1501.105-3 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY GENERAL GENERAL... 20402. Copies of loose-leaf EPAAR are distributed within EPA and may be obtained from the EPA...

  14. A "concrete view" of aging: event related potentials reveal age-related changes in basic integrative processes in language.

    PubMed

    Huang, Hsu-Wen; Meyer, Aaron M; Federmeier, Kara D

    2012-01-01

    Normal aging is accompanied by changes in both structural and functional cerebral organization. Although verbal knowledge seems to be relatively stable across the lifespan, there are age-related changes in the rapid use of that knowledge during on-line language processing. In particular, aging has been linked to reduce effectiveness in preparing for upcoming words and building an integrated sentence-level representation. The current study assessed whether such age-related changes extend even to much simpler language units, such as modification relations between a centrally presented adjective and a lateralized noun. Adjectives were used to elicit concrete and abstract meanings of the same, polysemous lexical items (e.g., "green book" vs. "interesting book"). Consistent with findings that lexical information is preserved with age, older adults, like younger adults, exhibited concreteness effects at the adjectives, with more negative responses to concrete adjectives over posterior (300-500 ms; N400) and frontal (300-900 ms) channels. However, at the noun, younger adults exhibited concreteness-based predictability effects linked to left hemisphere processing and imagery effects linked to right hemisphere processing, contingent on whether the adjectives and nouns formed a cohesive conceptual unit. In contrast, older adults showed neither effect, suggesting that they were less able to rapidly link the adjective-noun meaning to form an integrated conceptual representation. Age-related changes in language processing may thus be more pervasive than previously realized. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Integrating Cutting-edge Approaches to Describe and Interpret the Timing of Physical and Biological events: A Leap Forward for Monitoring Global Change Across Scales

    NASA Astrophysics Data System (ADS)

    Sadinski, W.; Gallant, A.; Thompson, D.; Houlahan, J.; Roth, M.; Brisco, B.; Kaya, S.; Gage, S.; Brininger, W.; Mushet, D.; Petersen, D.; Tessler, D.; Snively, M.; Jones, P. M.; Tate, D. P.; Morton, J. M.; Brodman, R.; Muths, E.; Brown, J. F.; Pauli, B.; Rosenberry, D. O.

    2010-12-01

    Our ability to integrate measures of phenological events across methods and scales has taken a significant step forward with recent advances in recording and analyzing sounds. For example, we now can measure bird and amphibian responses to climate/global change extensively and intensively from the ground and relate them to other landscape responses measured via satellite, airborne, and ground-based sensors. Thus, we can document changes in the timing of related biotic and abiotic events and understand the ramifications for biodiversity-related ecosystem services more fully. We designed and continue to expand the Terrestrial Wetland Global Change Research Network based upon this new potential to describe and interpret the impacts of global change and to provide stakeholders vital information on the specific nature and relevance of those impacts. We began implementing field research in 2008 and continue to add new research nodes across portions of Alaska, Canada, and the conterminous U.S. by leveraging resources across multiple organizations. Our standardized approach enables us to compare phenological responses in wetland-upland landscape matrices across local, regional, and continental scales and along several physical and ecological gradients. The power of this approach is evident in comparisons of calling events for individual species or entire soundscapes with other biotic and abiotic conditions and demonstrates a significant step forward in our ability to describe and interpret the impacts of global change on interconnected wetlands and uplands.

  16. Application of a fully integrated surface-subsurface physically based flow model for evaluating groundwater recharge from a flash flood event

    NASA Astrophysics Data System (ADS)

    Pino, Cristian; Herrera, Paulo; Therrien, René

    2017-04-01

    In many arid regions around the world groundwater recharge occurs during flash floods. This transient spatially and temporally concentrated flood-recharge process takes place through the variably saturated zone between surface and usually the deep groundwater table. These flood events are characterized by rapid and extreme changes in surface flow depth and velocity and soil moisture conditions. Infiltration rates change over time controlled by the hydraulic gradients and the unsaturated hydraulic conductivity at the surface-subsurface interface. Today is a challenge to assess the spatial and temporal distribution of groundwater recharge from flash flood events under real field conditions at different scales in arid areas. We apply an integrated surface-subsurface variably saturated physically-based flow model at the watershed scale to assess the recharge process during and after a flash flood event registered in an arid fluvial valley in Northern Chile. We are able to reproduce reasonably well observed groundwater levels and surface flow discharges during and after the flood with a calibrated model. We also investigate the magnitude and spatio-temporal distribution of recharge and the response of the system to variations of different surface and subsurface parameters, initial soil moisture content and groundwater table depths and surface flow conditions. We demonstrate how an integrated physically based model allows the exploration of different spatial and temporal system states, and that the analysis of the results of the simulations help us to improve our understanding of the recharge processes in similar type of systems that are common to many arid areas around the world.

  17. Integration

    ERIC Educational Resources Information Center

    Kalyn, Brenda

    2006-01-01

    Integrated learning is an exciting adventure for both teachers and students. It is not uncommon to observe the integration of academic subjects such as math, science, and language arts. However, educators need to recognize that movement experiences in physical education also can be linked to academic curricula and, may even lead the…

  18. Metastable dark matter mechanisms for INTEGRAL 511 keV {gamma} rays and DAMA/CoGeNT events

    SciTech Connect

    Cline, James M.; Frey, Andrew R.; Chen, Fang

    2011-04-15

    We explore dark matter mechanisms that can simultaneously explain the galactic 511 keV gamma rays observed by INTEGRAL/SPI, the DAMA/LIBRA annual modulation, and the excess of low-recoil dark matter candidates observed by CoGeNT. It requires three nearly degenerate states of dark matter in the 4-7 GeV mass range, with splittings, respectively, of order MeV and a few keV. The top two states have the small mass gap and transitions between them, either exothermic or endothermic, and can account for direct detections. Decays from one of the top states to the ground state produce low-energy positrons in the Galaxy whose associated 511 keV gamma rays are seen by INTEGRAL. This decay can happen spontaneously, if the excited state is metastable (longer lived than the age of the Universe), or it can be triggered by inelastic scattering of the metastable states into the shorter-lived ones. We focus on a simple model where the dark matter is a triplet of an SU(2) hidden sector gauge symmetry, broken at the scale of a few GeV, giving masses of order < or approx. 1 GeV to the dark gauge bosons, which mix kinetically with the standard model hypercharge. The purely decaying scenario can give the observed angular dependence of the 511 keV signal with no positron diffusion, while the inelastic scattering mechanism requires transport of the positrons over distances {approx}1 kpc before annihilating. We note that an x-ray line of several keV in energy, due to single-photon decays involving the top dark matter states, could provide an additional component to the diffuse x-ray background. The model is testable by proposed low-energy fixed-target experiments.

  19. GeoMedStat: an integrated spatial surveillance system to track air pollution and associated healthcare events.

    PubMed

    Faruque, Fazlay S; Li, Hui; Williams, Worth B; Waller, Lance A; Brackin, Bruce T; Zhang, Lei; Grimes, Kim A; Finley, Richard W

    2014-12-01

    Air pollutants, such as particulate matter with a diameter ≤2.5 microns (PM2.5) and ozone (O3), are known to exacerbate asthma and other respiratory diseases. An integrated surveillance system that tracks such air pollutants and associated disease incidence can assist in risk assessment, healthcare preparedness and public awareness. However, the implementation of such an integrated environmental health surveillance system is a challenge due to the disparate sources of many types of data and the implementation becomes even more complicated for a spatial and real-time system due to lack of standardised technological components and data incompatibility. In addition, accessing and utilising health data that are considered as Protected Health Information (PHI) require maintaining stringent protocols, which have to be supported by the system. This paper aims to illustrate the development of a spatial surveillance system (GeoMedStat) that is capable of tracking daily environmental pollutants along with both daily and historical patient encounter data. It utilises satellite data and the groundmonitor data from the US National Aeronautics and Space Administration (NASA) and the US Environemental Protection Agenecy (EPA), rspectively as inputs estimating air pollutants and is linked to hospital information systems for accessing chief complaints and disease classification codes. The components, developmental methods, functionality of GeoMedStat and its use as a real-time environmental health surveillance system for asthma and other respiratory syndromes in connection with with PM2.5 and ozone are described. It is expected that the framework presented will serve as an example to others developing real-time spatial surveillance systems for pollutants and hospital visits.

  20. High EGFR gene copy number predicts poor outcome in triple-negative breast cancer.

    PubMed

    Park, Heae Surng; Jang, Min Hye; Kim, Eun Joo; Kim, Hyun Jeong; Lee, Hee Jin; Kim, Yu Jung; Kim, Jee Hyun; Kang, Eunyoung; Kim, Sung-Won; Kim, In Ah; Park, So Yeon

    2014-09-01

    Epidermal growth factor receptor (EGFR) is frequently overexpressed in triple-negative breast cancer and is emerging as a therapeutic target. EGFR gene copy number alteration and mutation are highly variable and scientists have been challenged to define their prognostic significance in triple-negative breast cancer. We examined EGFR protein expression, EGFR gene copy number alteration and mutation of exon 18 to 21 in 151 cases of triple-negative breast cancer and correlated these findings with clinical outcomes. In addition, intratumoral agreement of EGFR protein overexpression and gene copy number alteration was evaluated. EGFR overexpression was found in 97 of 151 cases (64%) and high EGFR gene copy number was detected in 50 cases (33%), including 3 gene amplification (2%) and 47 high polysomy (31%). Five EGFR mutations were detected in 4 of 151 cases (3%) and included G719A in exon 18 (n=1), V786M in exon 20 (n=1), and L858R in exon 21 (n=3). One case had two mutations (G719A and L858R). High EGFR copy number, but not EGFR mutation, correlated with EGFR protein overexpression. Intratumoral heterogeneity of EGFR protein overexpression and EGFR copy number alteration was not significant. In survival analyses, high EGFR copy number was found to be an independent prognostic factor for poor disease-free survival in patients with triple-negative breast cancer. Our findings showed that EGFR mutation was a rare event, but high EGFR copy number was relatively frequent and correlated with EGFR overexpression in triple-negative breast cancer. Moreover, high EGFR copy number was associated with poor clinical outcome in triple-negative breast cancer, suggesting that evaluation of EGFR copy number may be useful for predicting outcomes in patients with triple-negative breast cancer and for selecting patients for anti-EGFR-targeted therapy.

  1. ATRX and IDH1-R132H immunohistochemistry with subsequent copy number analysis and IDH sequencing as a basis for an "integrated" diagnostic approach for adult astrocytoma, oligodendroglioma and glioblastoma.

    PubMed

    Reuss, David E; Sahm, Felix; Schrimpf, Daniel; Wiestler, Benedikt; Capper, David; Koelsche, Christian; Schweizer, Leonille; Korshunov, Andrey; Jones, David T W; Hovestadt, Volker; Mittelbronn, Michel; Schittenhelm, Jens; Herold-Mende, Christel; Unterberg, Andreas; Platten, Michael; Weller, Michael; Wick, Wolfgang; Pfister, Stefan M; von Deimling, Andreas

    2015-01-01

    Diffuse gliomas are represented in the 2007 WHO classification as astrocytomas, oligoastrocytomas and oligodendrogliomas of grades II and III and glioblastomas WHO grade IV. Molecular data on these tumors have a major impact on prognosis and therapy of the patients. Consequently, the inclusion of molecular parameters in the WHO definition of brain tumors is being planned and has been forwarded as the "ISN-Haarlem" consensus. We, here, analyze markers of special interest including ATRX, IDH and 1p/19q codeletion in a series of 405 adult patients. Among the WHO 2007 classified tumors were 152 astrocytomas, 61 oligodendrogliomas, 63 oligoastrocytomas and 129 glioblastomas. Following the concepts of the "ISN-Haarlem", we rediagnosed the series to obtain "integrated" diagnoses with 155 tumors being astrocytomas, 100 oligodendrogliomas and 150 glioblastomas. In a subset of 100 diffuse gliomas from the NOA-04 trial with long-term follow-up data available, the "integrated" diagnosis had a significantly greater prognostic power for overall and progression-free survival compared to WHO 2007. Based on the "integrated" diagnoses, loss of ATRX expression was close to being mutually exclusive to 1p/19q codeletion, with only 2 of 167 ATRX-negative tumors exhibiting 1p/19q codeletion. All but 4 of 141 patients with loss of ATRX expression and diffuse glioma carried either IDH1 or IDH2 mutations. Interestingly, the majority of glioblastoma patients with loss of ATRX expression but no IDH mutations exhibited an H3F3A mutation. Further, all patients with 1p/19 codeletion carried a mutation in IDH1 or IDH2. We present an algorithm based on stepwise analysis with initial immunohistochemistry for ATRX and IDH1-R132H followed by 1p/19q analysis followed by IDH sequencing which reduces the number of molecular analyses and which has a far better association with patient outcome than WHO 2007.

  2. Emotional Processing and Attention Control Impairments in Children with Anxiety: An Integrative Review of Event-Related Potentials Findings

    PubMed Central

    Wauthia, Erika; Rossignol, Mandy

    2016-01-01

    Anxiety disorders in adults have been associated with biased processing of emotional information which may be due to a deficit in attentional control. This deficit leads to an hypervigilance and a selective attention toward threatening information. Event-related potentials (ERPs) have been used to study this topic in anxious adults. Similar biases have been reported in children with anxiety but researches investigating the ERPs components underpinning these biases are more scarce. However, the understanding of the neural correlates of attentional biases in anxious children seem quite important since they could play a role in the etiology and the maintenance of this disorder. This review summarizes the results of researches having used ERPs to index emotional processing and attention control in children suffering from anxiety. We will focus on the P1, indexing basic visual perceptual processing, the N2, thought to reflect cognitive control process, the P3 typically associated with response inhibition, and the late positive potential (LPP) that indicates sustained attention toward motivationally salient stimuli. We will also examine the error-related negativity (ERN) that indexes monitoring system for detecting errors. Electro-physiological studies generally reported increased amplitudes of these components in anxious children, even when they did not differ from typically developing children at a behavioral level. These results suggest diminished cognitive control that influences children's selective attention mechanisms toward threatening information. Theoretical perspectives and implications for future researches will be discussed in the framework of current models of childhood anxiety. PMID:27199802

  3. Time-to-event analysis with artificial neural networks: an integrated analytical and rule-based study for breast cancer.

    PubMed

    Lisboa, Paulo J G; Etchells, Terence A; Jarman, Ian H; Hane Aung, M S; Chabaud, Sylvie; Bachelot, Thomas; Perol, David; Gargi, Thérèse; Bourdès, Valérie; Bonnevay, Stéphane; Négrier, Sylvie

    2008-01-01

    This paper presents an analysis of censored survival data for breast cancer specific mortality and disease-free survival. There are three stages to the process, namely time-to-event modelling, risk stratification by predicted outcome and model interpretation using rule extraction. Model selection was carried out using the benchmark linear model, Cox regression but risk staging was derived with Cox regression and with Partial Logistic Regression Artificial Neural Networks regularised with Automatic Relevance Determination (PLANN-ARD). This analysis compares the two approaches showing the benefit of using the neural network framework especially for patients at high risk. The neural network model also has results in a smooth model of the hazard without the need for limiting assumptions of proportionality. The model predictions were verified using out-of-sample testing with the mortality model also compared with two other prognostic models called TNG and the NPI rule model. Further verification was carried out by comparing marginal estimates of the predicted and actual cumulative hazards. It was also observed that doctors seem to treat mortality and disease-free models as equivalent, so a further analysis was performed to observe if this was the case. The analysis was extended with automatic rule generation using Orthogonal Search Rule Extraction (OSRE). This methodology translates analytical risk scores into the language of the clinical domain, enabling direct validation of the operation of the Cox or neural network model. This paper extends the existing OSRE methodology to data sets that include continuous-valued variables.

  4. Integrating data and mashup concepts in Hydro-Meteorological Research: the torrential rainfall event in Genoa (4th November 2011) case study.

    NASA Astrophysics Data System (ADS)

    Bedrina, T.; Parodi, A.; Quarati, A.; Clematis, A.; Rebora, N.; Laiosa, D.

    2012-04-01

    One of the critical issues in Hydro-Meteorological Research (HMR) is a better exploitation of data archives according to a multidisciplinary perspective. Different Earth science databases offer a huge amount of observational data, which often need to be assembled, processed, combined accordingly HM scientists needs. The cooperation between scientists active in HMR and Information and Communication Technologies (ICT) is essential in the development of innovative tools and applications for manipulating, aggregating and re-arranging heterogeneous information in flexible way. In this paper it is described an application devoted to the collection and integration of HM datasets, originated by public or private sources, freely exposed via Web services API. This application uses the mashup, recently become very popular in many fields, (Chow S.-W., 2007) technology concepts. Such methodology means combination of data and/or programs published by external online sources into an integrated experience. Mashup seems to be a promising methodology to respond to the multiple data-related activities into which HM researchers are daily involved (e.g. finding and retrieving high volume data; learning formats and developing readers; extracting parameters; performing filtering and mask; developing analysis and visualization tools). The specific case study of the recent extreme rainfall event, occurred over Genoa in Italy on the 4th November 2011 is shown through the integration of semi-professional weather observational networks as free available data source in addition to official weather networks.

  5. Final Scientific/Technical Report, DE-FG02-06ER64171, Integrated Nucleic Acid System for In-Field Monitoring of Microbial Community Dynamics and Metabolic Activity – Subproject to Co-PI Eric E. Roden

    SciTech Connect

    Eric E. Roden

    2009-07-08

    This report summarizes research conducted in conjunction with a project entitled “Integrated Nucleic Acid System for In-Field Monitoring of Microbial Community Dynamics and Metabolic Activity”, which was funded through the Integrative Studies Element of the former NABIR Program (now the Environmental Remediation Sciences Program) within the Office of Biological and Environmental Research. Dr. Darrell Chandler (originally at Argonne National Laboratory, now with Akonni Biosystems) was the overall PI/PD for the project. The overall project goals were to (1) apply a model iron-reducer and sulfate-reducer microarray and instrumentation systems to sediment and groundwater samples from the Scheibe et al. FRC Area 2 field site, UMTRA sediments, and other DOE contaminated sites; (2) continue development and expansion of a 16S rRNA/rDNA¬-targeted probe suite for microbial community dynamics as new sequences are obtained from DOE-relevant sites; and (3) address the fundamental molecular biology and analytical chemistry associated with the extraction, purification and analysis of functional genes and mRNA in environmental samples. Work on the UW subproject focused on conducting detailed batch and semicontinuous culture reactor experiments with uranium-contaminated FRC Area 2 sediment. The reactor experiments were designed to provide coherent geochemical and microbiological data in support of microarray analyses of microbial communities in Area 2 sediments undergoing biostimulation with ethanol. A total of four major experiments were conducted (one batch and three semicontinuous culture), three of which (the batch and two semicontinuous culture) provided samples for DNA microarray analysis. A variety of other molecular analyses (clone libraries, 16S PhyloChip, RT-PCR, and T-RFLP) were conducted on parallel samples from the various experiments in order to provide independent information on microbial community response to biostimulation.

  6. HPV integration detection in CaSki and SiHa using detection of integrated papillomavirus sequences and restriction-site PCR.

    PubMed

    Raybould, Rachel; Fiander, Alison; Wilkinson, Gavin W G; Hibbitts, Sam

    2014-09-01

    Human Papillomavirus (HPV) infection is the primary cause of cervical neoplasia. HPV DNA is integrated into the human genome in the majority of cervical cancers. The nature of integration may differ with integration incorporating a single copy of HPV or occurring in concatenated form. Our understanding of HPV tumorigenesis is largely based on studies using characterised cell lines with defined integration sites; these cell lines provide an invaluable standard for validation of diagnostic assays. Cell lines also further understanding of integration mechanisms in clinical samples. The objective of this study was to explore integration assays and to investigate integration events in cell lines where HPV is integrated in concatenated form. Restriction site PCR and detection of integrated papillomavirus sequences were performed on DNA from SiHa and CaSki. A novel integration site on Xq27.3 and HPV genome rearrangements were detected in CaSki DNA. However, where integration was previously detected by FISH in CaSki, and reported to be integrated in concatenated form, integration was not detected by DIPS or RS-PCR. The data presented illustrate that HPV copy number can hinder integration detection; this needs consideration when interpreting results from tests applied to clinical samples.

  7. Allele-specific copy number profiling by next-generation DNA sequencing.

    PubMed

    Chen, Hao; Bell, John M; Zavala, Nicolas A; Ji, Hanlee P; Zhang, Nancy R

    2015-02-27

    The progression and clonal development of tumors often involve amplifications and deletions of genomic DNA. Estimation of allele-specific copy number, which quantifies the number of copies of each allele at each variant loci rather than the total number of chromosome copies, is an important step in the characterization of tumor genomes and the inference of their clonal history. We describe a new method, falcon, for finding somatic allele-specific copy number changes by next generation sequencing of tumors with matched normals. falcon is based on a change-point model on a bivariate mixed Binomial process, which explicitly models the copy numbers of the two chromosome haplotypes and corrects for local allele-specific coverage biases. By using the Binomial distribution rather than a normal approximation, falcon more effectively pools evidence from sites with low coverage. A modified Bayesian information criterion is used to guide model selection for determining the number of copy number events. Falcon is evaluated on in silico spike-in data and applied to the analysis of a pre-malignant colon tumor sample and late-stage colorectal adenocarcinoma from the same individual. The allele-specific copy number estimates obtained by falcon allows us to draw detailed conclusions regarding the clonal history of the individual's colon cancer.

  8. Does testing with feedback improve adult spelling skills relative to copying and reading?

    PubMed

    Pan, Steven C; Rubin, Benjamin R; Rickard, Timothy C

    2015-12-01

    We examined testing's ability to enhance adult spelling acquisition, relative to copying and reading. Across 3 experiments in which testing with feedback was compared with copying, the spelling improvement after testing matched that following the same amount of time spent copying. A potent testing advantage, however, was observed for spelling words free-recalled. In the fourth experiment, a large testing advantage for both word free recall and spelling was observed, versus reading. Subjects also generally preferred testing and rated it as more effective than copying or reading. The equivalent performance of testing and copying for spelling contrasts with prior work involving children and suggests that retrieval practice may not be the only effective mechanism for spelling skill acquisition. Rather, we suggest that the critical learning event for spelling is focused study on phoneme-to-grapheme mappings for previously unlearned letter sequences. For adults with extensive spelling expertise, focused study is more automatic during both copying and testing with feedback than for individuals with beginning spelling skills. Reading, however, would not be expected to produce efficient focused study of phoneme-to-grapheme mappings, regardless of expertise level. Overall, adult spelling skill acquisition benefits both from testing and copying, and substantially less from reading.

  9. Droplet digital PCR-aided screening and characterization of Pichia pastoris multiple gene copy strains.

    PubMed

    Cámara, Elena; Albiol, Joan; Ferrer, Pau

    2016-07-01

    Pichia (syn. Komagataella) pastoris is a widely used yeast platform for heterologous protein production. Expression cassettes are usually stably integrated into the genome of this host via homologous recombination. Although increasing gene dosage is a powerful strategy to improve recombinant protein production, an excess in the number of gene copies often leads to decreased product yields and increased metabolic burden, particularly for secreted proteins. We have constructed a series of strains harboring different copy numbers of a Rhizopus oryzae lipase gene (ROL), aiming to find the optimum gene dosage for secreted Rol production. In order to accurately determine ROL gene dosage, we implemented a novel protocol based on droplet digital PCR (ddPCR), and cross validated it with conventional real-time PCR. Gene copy number determination based on ddPCR allowed for an accurate ranking of transformants according to their ROL gene dosage. Results indicated that ddPCR was particularly superior at lower gene dosages (one to five copies) over quantitative real-time PCR (qPCR). This facilitated the determination of the optimal ROL gene dosage as low as two copies. The ranking of ROL gene dosage versus Rol yield was consistent at both small scale and bioreactor chemostat cultures, thereby easing clone characterization in terms of gene dosage dependent physiological effects, which could be discriminated even among strains differing by only one ROL copy. A selected two-copy strain showed twofold increase in Rol specific production in a chemostat culture over the single copy strain. Conversely, strains harboring more than two copies of the ROL gene showed decreased product and biomass yields, as well as altered substrate consumption specific rates, compared to the reference (one-copy) strain. Biotechnol. Bioeng. 2016;113: 1542-1551. © 2015 Wiley Periodicals, Inc.

  10. Genome Architecture and Its Roles in Human Copy Number Variation

    PubMed Central

    Chen, Lu; Zhou, Weichen; Zhang, Ling

    2014-01-01

    Besides single-nucleotide variants in the human genome, large-scale genomic variants, such as copy number variations (CNVs), are being increasingly discovered as a genetic source of human diversity and the pathogenic factors of diseases. Recent experimental findings have shed light on the links between different genome architectures and CNV mutagenesis. In this review, we summarize various genomic features and discuss their contributions to CNV formation. Genomic repeats, including both low-copy and high-copy repeats, play important roles in CNV instability, which was initially known as DNA recombination events. Furthermore, it has been found that human genomic repeats can also induce DNA replication errors and consequently result in CNV mutations. Some recent studies showed that DNA replication timing, which reflects the high-order information of genomic organization, is involved in human CNV mutations. Our review highlights that genome architecture, from DNA sequence to high-order genomic organization, is an important molecular factor in CNV mutagenesis and human genomic instability. PMID:25705150

  11. The physics of a single-event upset in integrated circuits: A review and critique of analytical models for charge collection

    NASA Technical Reports Server (NTRS)

    Vonroos, O.; Zoutendyk, J.

    1983-01-01

    When an energetic particle (kinetic energy 0.5 MeV) originating from a radioactive decay or a cosmic ray transverse the active regions of semiconductor devices used in integrated circuit (IC) chips, it leaves along its track a high density electron hole plasma. The subsequent decay of this plasma by drift and diffusion leads to charge collection at the electrodes large enough in most cases to engender a false reading, hence the name single-event upset (SEU). The problem of SEU's is particularly severe within the harsh environment of Jupiter's radiation belts and constitutes therefore a matter of concern for the Galileo mission. The physics of an SEU event is analyzed in some detail. Owing to the predominance of nonlinear space charge effects and the fact that positive (holes) and negative (electrons) charges must be treated on an equal footing, analytical models for the ionized-charge collection and their corresponding currents as a function of time prove to be inadequate even in the simplest case of uniformly doped, abrupt p-n junctions in a one-dimensional geometry. The necessity for full-fledged computer simulation of the pertinent equations governing the electron-hole plasma therefore becomes imperative.

  12. Integrated geophysics reveals a steep lithologic boundary and Moho offset at the western Idaho shear zone that strongly influenced later tectonic events

    NASA Astrophysics Data System (ADS)

    Davenport, K. K.; Ghanekar, S.; Stanciu, A. C.; Bremner, P. M.; Hole, J. A.; Tikoff, B.; Russo, R. M.

    2016-12-01

    Multiple geophysical data sets from the EarthScope Idaho-Oregon (IDOR) project were integrated to examine crustal structure and composition across the boundary between accreted terranes and the Precambrian craton in Idaho and Oregon. New results from controlled-source seismic S-wave data and gravity data are incorporated with previous results from controlled-source seismic P-waves, broadband seismic receiver functions, and broadband ambient noise surface waves. The geophysical data constrain the deeper structure of the western Idaho shear zone (WISZ), imaging a near-vertical, through-going structure that juxtaposes different seismic velocities and densities throughout the crust and offsets the Moho by 7-8 km. Previous work suggested that the WISZ, which formed when transpressional deformation overprinted the original terrane-craton suture, was less steep at depth or was offset within the crust. West of the WISZ, the crust of the Blue Mountains Province oceanic accreted terranes is characterized by faster seismic velocities and higher densities, intermediate lithology with a mafic lower crust, and a shallower, 30 km deep Moho. East of the WISZ the crust of the Precambrian craton and the Idaho batholith has slower seismic velocities, lower densities, felsic lithology with an intermediate-composition lower crust, and a deeper 35-40 km Moho. The juxtaposition of crustal blocks with distinctly contrasting lithologies created a fundamental rheologic boundary that strongly influenced the response of the crust to subsequent tectonic events, including emplacement of the Idaho batholith and the Columbia River basalts, and Basin and Range extension. The strong contrast across the WISZ restricted these tectonic events to primarily one side or the other, and has likely contributed to the survival of this steep vertical boundary and Moho offset through the later tectonic and heating events.

  13. ACTA Technology Presents EPA with Patent Copy

    EPA Pesticide Factsheets

    US EPA SBIR awardee, ACTA Technology, presented James H. Johnson, Director of the US EPA National Center for Environmental Research, and April Richards, Program Manager of the US EPA's SBIR Program, with a copy of their Red Ribbon patent.

  14. Line copy presentation slides with Kodalith.

    PubMed

    Kraushar, M F; Bailey, B A

    1978-08-01

    Line copy presentation slides with white letters on a blue background can be produced with a two-step process. The slides are more permanent than diazo slides, and the process is faster and less expensive.

  15. Kinetic versus Energetic Discrimination in Biological Copying

    NASA Astrophysics Data System (ADS)

    Sartori, Pablo; Pigolotti, Simone

    2013-05-01

    We study stochastic copying schemes in which discrimination between a right and a wrong match is achieved via different kinetic barriers or different binding energies of the two matches. We demonstrate that, in single-step reactions, the two discrimination mechanisms are strictly alternative and cannot be mixed to further reduce the error fraction. Close to the lowest error limit, kinetic discrimination results in a diverging copying velocity and dissipation per copied bit. On the other hand, energetic discrimination reaches its lowest error limit in an adiabatic regime where dissipation and velocity vanish. By analyzing experimentally measured kinetic rates of two DNA polymerases, T7 and Polγ, we argue that one of them operates in the kinetic and the other in the energetic regime. Finally, we show how the two mechanisms can be combined in copying schemes implementing error correction through a proofreading pathway.

  16. Copy Number Variation across European Populations

    PubMed Central

    Chen, Wanting; Hayward, Caroline; Wright, Alan F.; Hicks, Andrew A.; Vitart, Veronique; Knott, Sara; Wild, Sarah H.; Pramstaller, Peter P.; Wilson, James F.; Rudan, Igor; Porteous, David J.

    2011-01-01

    Genome analysis provides a powerful approach to test for evidence of genetic variation within and between geographical regions and local populations. Copy number variants which comprise insertions, deletions and duplications of genomic sequence provide one such convenient and informative source. Here, we investigate copy number variants from genome wide scans of single nucleotide polymorphisms in three European population isolates, the island of Vis in Croatia, the islands of Orkney in Scotland and the South Tyrol in Italy. We show that whereas the overall copy number variant frequencies are similar between populations, their distribution is highly specific to the population of origin, a finding which is supported by evidence for increased kinship correlation for specific copy number variants within populations. PMID:21829696

  17. Headline Ideas from Reporters Help Copy Editors.

    ERIC Educational Resources Information Center

    Haber, Marian Wynne

    1984-01-01

    Presents a method that has student reporters write headline suggestions on their stories before submission to avoid nonsignificant headlines. This technique was judged worthwhile by three professional copy editors. (CRH)

  18. NASA printing, duplicating, and copying management handbook

    NASA Technical Reports Server (NTRS)

    1993-01-01

    This handbook provides information and procedures for the implementation of NASA policy and applicable laws and regulations relating to printing, duplicating, and copying. The topics addressed include a description of relevant laws and regulations, authorizations required, and responsible entities for NASA printing, duplicating, and copying. The policy of NASA is to ensure understanding and application of authority and responsibility on printing matters. Where necessary, the handbook clarifies the intent of basic laws and regulations applicable to NASA.

  19. Copy Number Profiling of Brazilian Astrocytomas

    PubMed Central

    Bidinotto, Lucas Tadeu; Torrieri, Raul; Mackay, Alan; Almeida, Gisele Caravina; Viana-Pereira, Marta; Cruvinel-Carloni, Adriana; Spina, Maria Luisa; Campanella, Nathalia Cristina; Pereira de Menezes, Weder; Clara, Carlos Afonso; Becker, Aline Paixão; Jones, Chris; Reis, Rui Manuel

    2016-01-01

    Copy number alterations (CNA) are one of the driving mechanisms of glioma tumorigenesis, and are currently used as important biomarkers in the routine setting. Therefore, we performed CNA profiling of 65 astrocytomas of distinct malignant grades (WHO grade I–IV) of Brazilian origin, using array-CGH and microsatellite instability analysis (MSI), and investigated their correlation with TERT and IDH1 mutational status and clinico-pathological features. Furthermore, in silico analysis using the Oncomine database was performed to validate our findings and extend the findings to gene expression level. We found that the number of genomic alterations increases in accordance with glioma grade. In glioblastomas (GBM), the most common alterations were gene amplifications (PDGFRA, KIT, KDR, EGFR, and MET) and deletions (CDKN2A and PTEN). Log-rank analysis correlated EGFR amplification and/or chr7 gain with better survival of the patients. MSI was observed in 11% of GBMs. A total of 69% of GBMs presented TERT mutation, whereas IDH1 mutation was most frequent in diffuse (85.7%) and anaplastic (100%) astrocytomas. The combination of 1p19q deletion and TERT and IDH1 mutational status separated tumor groups that showed distinct age of diagnosis and outcome. In silico validation pointed to less explored genes that may be worthy of future investigation, such as CDK2, DMRTA1, and MTAP. Herein, using an extensive integrated analysis, we indicated potentially important genes, not extensively studied in gliomas, that could be further explored to assess their biological and clinical impact in astrocytomas. PMID:27172220

  20. Ontology-based Vaccine and Drug Adverse Event Representation and Theory-guided Systematic Causal Network Analysis toward Integrative Pharmacovigilance Research.

    PubMed

    He, Yongqun

    2016-06-01

    Compared with controlled terminologies (e.g., MedDRA, CTCAE, and WHO-ART), the community-based Ontology of AEs (OAE) has many advantages in adverse event (AE) classifications. The OAE-derived Ontology of Vaccine AEs (OVAE) and Ontology of Drug Neuropathy AEs (ODNAE) serve as AE knowledge bases and support data integration and analysis. The Immune Response Gene Network Theory explains molecular mechanisms of vaccine-related AEs. The OneNet Theory of Life treats the whole process of a life of an organism as a single complex and dynamic network (i.e., OneNet). A new "OneNet effectiveness" tenet is proposed here to expand the OneNet theory. Derived from the OneNet theory, the author hypothesizes that one human uses one single genotype-rooted mechanism to respond to different vaccinations and drug treatments, and experimentally identified mechanisms are manifestations of the OneNet blueprint mechanism under specific conditions. The theories and ontologies interact together as semantic frameworks to support integrative pharmacovigilance research.

  1. Minimal Information for Neural Electromagnetic Ontologies (MINEMO): A standards-compliant method for analysis and integration of event-related potentials (ERP) data

    PubMed Central

    Frishkoff, Gwen; Sydes, Jason; Mueller, Kurt; Frank, Robert; Curran, Tim; Connolly, John; Kilborn, Kerry; Molfese, Dennis; Perfetti, Charles; Malony, Allen

    2011-01-01

    We present MINEMO (Minimal Information for Neural ElectroMagnetic Ontologies), a checklist for the description of event-related potentials (ERP) studies. MINEMO extends MINI (Minimal Information for Neuroscience Investigations)to the ERP domain. Checklist terms are explicated in NEMO, a formal ontology that is designed to support ERP data sharing and integration. MINEMO is also linked to an ERP database and web application (the NEMO portal). Users upload their data and enter MINEMO information through the portal. The database then stores these entries in RDF (Resource Description Framework), along with summary metrics, i.e., spatial and temporal metadata. Together these spatial, temporal, and functional metadata provide a complete description of ERP data and the context in which these data were acquired. The RDF files then serve as inputs to ontology-based labeling and meta-analysis. Our ultimate goal is to represent ERPs using a rich semantic structure, so results can be queried at multiple levels, to stimulate novel hypotheses and to promote a high-level, integrative account of ERP results across diverse study methods and paradigms. PMID:22180824

  2. Ontology-based Vaccine and Drug Adverse Event Representation and Theory-guided Systematic Causal Network Analysis toward Integrative Pharmacovigilance Research

    PubMed Central

    He, Yongqun

    2016-01-01

    Compared with controlled terminologies (e.g., MedDRA, CTCAE, and WHO-ART), the community-based Ontology of AEs (OAE) has many advantages in adverse event (AE) classifications. The OAE-derived Ontology of Vaccine AEs (OVAE) and Ontology of Drug Neuropathy AEs (ODNAE) serve as AE knowledge bases and support data integration and analysis. The Immune Response Gene Network Theory explains molecular mechanisms of vaccine-related AEs. The OneNet Theory of Life treats the whole process of a life of an organism as a single complex and dynamic network (i.e., OneNet). A new “OneNet effectiveness” tenet is proposed here to expand the OneNet theory. Derived from the OneNet theory, the author hypothesizes that one human uses one single genotype-rooted mechanism to respond to different vaccinations and drug treatments, and experimentally identified mechanisms are manifestations of the OneNet blueprint mechanism under specific conditions. The theories and ontologies interact together as semantic frameworks to support integrative pharmacovigilance research. PMID:27458549

  3. A method for calling copy number polymorphism using haplotypes

    PubMed Central

    Ho Jang, Gun; Christie, Jason D.; Feng, Rui

    2013-01-01

    Single nucleotide polymorphism (SNP) and copy number variation (CNV) are both widespread characteristic of the human genome, but are often called separately on common genotyping platforms. To capture integrated SNP and CNV information, methods have been developed for calling allelic specific copy numbers or so called copy number polymorphism (CNP), using limited inter-marker correlation. In this paper, we proposed a haplotype-based maximum likelihood method to call CNP, which takes advantage of the valuable multi-locus linkage disequilibrium (LD) information in the population. We also developed a computationally efficient algorithm to estimate haplotype frequencies and optimize individual CNP calls iteratively, even at presence of missing data. Through simulations, we demonstrated our model is more sensitive and accurate in detecting various CNV regions, compared with commonly-used CNV calling methods including PennCNV, another hidden Markov model (HMM) using CNP, a scan statistic, segCNV, and cnvHap. Our method often performs better in the regions with higher LD, in longer CNV regions, and in common CNV than the opposite. We implemented our method on the genotypes of 90 HapMap CEU samples and 23 patients with acute lung injury (ALI). For each ALI patient the genotyping was performed twice. The CNPs from our method show good consistency and accuracy comparable to others. PMID:24069028

  4. Single copy DNA homology in sea stars.

    PubMed

    Smith, M J; Nicholson, R; Stuerzl, M; Lui, A

    1982-01-01

    The sequence homology in the single copy DNA of sea stars has been measured. Labeled single copy DNA from Pisaster ochraceus was reannealed with excess genomic DNA from P. brevispinus, Evasterias troschelii, Pycnopodia helianthoides, Solaster stimpsoni, and Dermasterias imbricata. Reassociation reactions were performed under two criteria of salt and temperature. The extent of reassociation and thermal denaturation characteristics of hybrid single copy DNA molecules follow classical taxonomic lines. P. brevispinus DNA contains essentially all of the sequences present in P. ochraceus single copy tracer while Evasterias and Pycnopodia DNAs contain 52% and 46% of such sequences respectively. Reciprocal reassociation reactions with labeled Evasterias single copy DNA confirm the amount and fidelity of the sequence homology. There is a small definite reaction of uncertain homology between P. ochraceus single copy DNA and Solaster or Dermasterias DNA. Similarly Solaster DNA contains sequences homologous to approximately 18% of Dermasterias unique DNA. The thermal denaturation temperatures of heteroduplexes indicate that the genera Pisaster and Evasterias diverged shortly after the divergence of the subfamilies Pycnopodiinae and Asteriinae. The two Pisaster species diverged more recently, probably in the most recent quarter of the interval since the separation of the genera Pisaster and Evasterias.

  5. COPI Is Required for Enterovirus 71 Replication

    PubMed Central

    Wang, Jianmin; Wu, Zhiqiang; Jin, Qi

    2012-01-01

    Enterovirus 71 (EV71), a member of the Picornaviridae family, is found in Asian countries where it causes a wide range of human diseases. No effective therapy is available for the treatment of these infections. Picornaviruses undergo RNA replication in association with membranes of infected cells. COPI and COPII have been shown to be involved in the formation of picornavirus-induced vesicles. Replication of several picornaviruses, including poliovirus and Echovirus 11 (EV11), is dependent on COPI or COPII. Here, we report that COPI, but not COPII, is required for EV71 replication. Replication of EV71 was inhibited by brefeldin A and golgicide A, inhibitors of COPI activity. Furthermore, we found EV71 2C protein interacted with COPI subunits by co-immunoprecipitation and GST pull-down assay, indicating that COPI coatomer might be directed to the viral replication complex through viral 2C protein. Additionally, because the pathway is conserved among different species of enteroviruses, it may represent a novel target for antiviral therapies. PMID:22662263

  6. Discussion on copy constructor in C++ programming language

    NASA Astrophysics Data System (ADS)

    Luo, Fafen; Du, Ruiqing

    2011-12-01

    C++ is a widely used object-orientated programming language in the software industry. The purpose of this paper is to discuss concept and application of the copy constructor, a special constructor in C++. As fundamental knowledge, constructor and destructor were introduced at first. Several examples of copy constructor were presented to illustrate concept of copy constructor and its use. Shallow copy and deep copy were also presented. After discussions on copy constructor by analyzing all the examples of copy constructor, the conclusion was made about that how to define a copy constructor and how to use it properly.

  7. Development of a system for multicopy gene integration in Saccharomyces cerevisiae.

    PubMed

    Semkiv, Marta V; Dmytruk, Kostyantyn V; Sibirny, Andriy A

    2016-01-01

    In this study we describe construction and evaluation of a vector for multicopy integration in yeast Saccharomyces cerevisiae. In this vector a modified selective marker and a reporter gene PHO8 (encoding alkaline phosphatase) were flanked with delta sequences of the Ty1 transposon. Modified by error-prone PCR version of selection marker kanMX4 was obtained from Escherichia coli clone with impaired geneticin (G418) resistance. The attenuation of kanMX4 gene provides an opportunity to select for explicitly multicopy integration of the module in S. cerevisiae using moderate (200 mg L(-1)) antibiotic concentrations. The developed system provided integration of 3-10 copies of the module in the genome of S. cerevisiae. High copy integration events were confirmed by qRT-PCR, Southern hybridization and reporter enzyme activity measurements. Copyright © 2015. Published by Elsevier B.V.

  8. Copy number alterations and copy number variation in cancer: close encounters of the bad kind.

    PubMed

    Speleman, F; Kumps, C; Buysse, K; Poppe, B; Menten, B; De Preter, K

    2008-01-01

    Recent studies have unveiled copy number variants (CNVs) as an important source of genetic variation. Many of these CNVs contain coding sequences, which have been shown to be dosage sensitive. Evidence is accumulating that certain CNVs have impact on susceptibility to human diseases such as HIV infection and autoimmune diseases, as well as on adaptability to environmental conditions or nutrition. The possible role and impact of CNVs on cancer development and progression is only now emerging. In this review we look into the role of CNVs and their associated genomic structural features in relation to the formation of chromosome alterations in cancer cells and evolutionary genomic plasticity, as well as the de novo occurrence of known or putative CNVs as somatic events during oncogenesis. The role of germline CNVs in cancer predisposition is still largely unexplored. A number of observations seem to warrant the importance of further studies to elucidate the impact of these variants in the early steps of carcinogenesis. Copyright 2009 S. Karger AG, Basel.

  9. Characterization and event specific-detection by quantitative real-time PCR of T25 maize insert.

    PubMed

    Collonnier, Cécile; Schattner, Alexandra; Berthier, Georges; Boyer, Francine; Coué-Philippe, Géraldine; Diolez, Annick; Duplan, Marie-Noëlle; Fernandez, Sophie; Kebdani, Naïma; Kobilinsky, André; Romaniuk, Marcel; de Beuckeleer, Marc; de Loose, Marc; Windels, Pieter; Bertheau, Yves

    2005-01-01

    T25 is one of the 4 maize transformation events from which commercial lines have so far been authorized in Europe. It was created by polyethylene glycol-mediated transformation using a construct bearing one copy of the synthetic pat gene associated with both promoter and terminator of the 35S ribosomal gene from cauliflower mosaic virus. In this article, we report the sequencing of the whole T25 insert and the characterization of its integration site by using a genome walking strategy. Our results confirmed that one intact copy of the initial construct had been integrated in the plant genome. They also revealed, at the 5' junction of the insert, the presence of a second truncated 35S promoter, probably resulting from rearrangements which may have occurred before or during integration of the plasmid DNA. The analysis of the junction fragments showed that the integration site of the insert presented high homologies with the Huck retrotransposon family. By using one primer annealing in the maize genome and the other in the 5' end of the integrated DNA, we developed a reliable event-specific detection system for T25 maize. To provide means to comply with the European regulation, a real-time PCR test was designed for specific quantitation of T25 event by using Taqman chemistry.

  10. Estimating Copy Number and Allelic Variation at the Immunoglobulin Heavy Chain Locus Using Short Reads.

    PubMed

    Luo, Shishi; Yu, Jane A; Song, Yun S

    2016-09-01

    The study of genomic regions that contain gene copies and structural variation is a major challenge in modern genomics. Unlike variation involving single nucleotide changes, data on the variation of copy number is difficult to collect and few tools exist for analyzing the variation between individuals. The immunoglobulin heavy variable (IGHV) locus, which plays an integral role in the adaptive immune response, is an example of a complex genomic region that varies in gene copy number. Lack of standard methods to genotype this region prevents it from being included in association studies and is holding back the growing field of antibody repertoire analysis. Here we develop a method that takes short reads from high-throughput sequencing and outputs a genetic profile of the IGHV locus with the read coverage depth and a putative nucleotide sequence for each operationally defined gene cluster. Our operationally defined gene clusters aim to address a major challenge in studying the IGHV locus: the high sequence similarity between gene segments in different genomic locations. Tests on simulated data demonstrate that our approach can accurately determine the presence or absence of a gene cluster from reads as short as 70 bp. More detailed resolution on the copy number of gene clusters can be obtained from read coverage depth using longer reads (e.g., ≥ 100 bp). Detail at the nucleotide resolution of single copy genes (genes present in one copy per haplotype) can be determined with 250 bp reads. For IGHV genes with more than one copy, accurate nucleotide-resolution reconstruction is currently beyond the means of our approach. When applied to a family of European ancestry, our pipeline outputs genotypes that are consistent with the family pedigree, confirms existing multigene variants and suggests new copy number variants. This study paves the way for analyzing population-level patterns of variation in IGHV gene clusters in larger diverse datasets and for quantitatively

  11. Accurate measurement of transgene copy number in crop plants using droplet digital PCR

    USDA-ARS?s Scientific Manuscript database

    Technical abstract: Genetic transformation is a powerful means for the improvement of crop plants, but requires labor and resource intensive methods. An efficient method for identifying single copy transgene insertion events from a population of independent transgenic lines is desirable. Currently ...

  12. Copy number analysis of ductal carcinoma in situ with and without recurrence.

    PubMed

    Gorringe, Kylie L; Hunter, Sally M; Pang, Jia-Min; Opeskin, Ken; Hill, Prue; Rowley, Simone M; Choong, David Y H; Thompson, Ella R; Dobrovic, Alexander; Fox, Stephen B; Mann, G Bruce; Campbell, Ian G

    2015-09-01

    Ductal carcinoma in situ (DCIS) is a non-obligate precursor of invasive breast cancer and a frequent mammographic finding requiring treatment. Up to 25% of DCIS can recur and half of recurrences are invasive, but there are no reliable biomarkers for recurrence. We hypothesised that copy number aberrations could predict likelihood of recurrence. We analysed a cohort of pure DCIS cases treated only with wide local excision for genome-wide copy number and loss of heterozygosity using Affymetrix OncoScan MIP arrays. Cases included those without recurrence within 7 years (n = 25) and with recurrence between 1 and 5 years after diagnosis (n = 15). Pure DCIS were broadly similar in copy number changes compared with invasive breast cancer, with the consistent exception of a greater frequency of ERBB2 amplification in DCIS. There were no significant differences in age or ER status between the cases with a recurrence vs those without. Overall, the DCIS cases with recurrence had more copy number events than the DCIS without recurrence. The increased copy number appeared non-random with several genomic regions showing an increase in frequency in recurrent cases, including 20 q gain, ERBB2 amplification and 15q loss. Copy number changes may provide prognostic information for DCIS recurrence, but validation in additional cohorts is required.

  13. 22. Photographic copy enlargement from a 4x5 copy negative of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. Photographic copy enlargement from a 4x5 copy negative of a print. (Original print located on abandoned NASA site, currently owned by the City of Downey, Downey, California). 1954 USAF PLANT 16 AERIAL BUILDING 41 NORTH TO SOUTH. - NASA Industrial Plant, Missile Research Laboratory, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

  14. 15. Photographic copy englargement from a 4x5 copy negative (Original ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    15. Photographic copy englargement from a 4x5 copy negative (Original drawing located on abandoned NASA site, currently owned by the City of Downey, Downey, California). 1980 BLDG 10, BLDG 42 FLOOR PLAN, NASA MARCH 15 1980. - NASA Industrial Plant, Maintenance Facility, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

  15. 9. Photographic copy enlargement from a 4x5 copy negative. (Original ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. Photographic copy enlargement from a 4x5 copy negative. (Original drawing located on abandoned NASA site, currently owned by the City of Downey, Downey, California). 1976 BLDGS.25, 41 SITE PLAN. - NASA Industrial Plant, Storage Facility, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

  16. 14. Photographic copy englargement from a 4x5 copy negative (Original ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. Photographic copy englargement from a 4x5 copy negative (Original photograph by original photographer located on abandoned NASA site, currently owned by the City of Downey, Downey, California). AERIAL PHOTOGRAPH 1935-1936 CONSOLIDATED VULTEE AIRCRAFT CORPORATION FROM WEST TO EAST - NASA Industrial Plant, Maintenance Facility, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

  17. 23. Photographic copy enlargement from a 4x5 copy negative of ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    23. Photographic copy enlargement from a 4x5 copy negative of a drawing (Original drawing located on abandoned NASA site, currently owned by the City of Downey, Downey, Calfornia). JANUARY 1960 USAF PLANT 16 MASTER PLOT AND GRID PLAN. - NASA Industrial Plant, Missile Research Laboratory, 12214 Lakewood Boulevard, Downey, Los Angeles County, CA

  18. 40 CFR 121.11 - Copies of documents.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Copies of documents. 121.11 Section....11 Copies of documents. (a) Upon receipt from an applicant of an application for a license or permit... copy of the application to the appropriate certifying agency and two copies to the Regional...

  19. 27 CFR 22.165 - Photographic copies of records.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Photographic copies of... Transactions § 22.165 Photographic copies of records. (a) General. Permittees may record, copy, or reproduce... a durable medium for reproducing and preserving the original record. (b) Copies of records treated...

  20. 27 CFR 31.192 - Photographic copies of records.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Photographic copies of... Records and Files § 31.192 Photographic copies of records. (a) General. Dealers may record, copy, or... record and that forms a durable medium for preserving the original record. (b) Copies of records treated...

  1. 27 CFR 20.268 - Photographic copies of records.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Photographic copies of... Reports § 20.268 Photographic copies of records. (a) General. Permittees may record, copy, or reproduce... a durable medium for reproducing and preserving the original record. (b) Copies of records treated...

  2. 18 CFR 33.8 - Number of copies.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Number of copies. 33.8... Number of copies. An original and eight copies of the application under this part must be submitted. If... for privileged treatment), the original and at least three of the eight copies must be of the non...

  3. 22 CFR 1423.6 - Filing and service of copies.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Filing and service of copies. 1423.6 Section... LABOR PRACTICE PROCEEDINGS § 1423.6 Filing and service of copies. (a) An original and four (4) copies of the charge together with one copy for each additional charged party named shall be filed with the...

  4. 49 CFR 1310.6 - Furnishing copies of tariff publications.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 9 2010-10-01 2010-10-01 false Furnishing copies of tariff publications. 1310.6... REQUIREMENTS FOR HOUSEHOLD GOODS CARRIERS § 1310.6 Furnishing copies of tariff publications. (a) Copies of... copies of tariff publications to interested persons. If a charge is made, the charge must be reasonable...

  5. 43 CFR 4.437 - Copies of transcript.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Copies of transcript. 4.437 Section 4.437... Fact § 4.437 Copies of transcript. Each party shall pay for any copies of the transcript obtained by him. Unless a summary of the evidence is stipulated to, the Government will file the original copy of...

  6. 19 CFR 210.56 - Notice accompanying service copies.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Notice accompanying service copies. 210.56 Section... copies. (a) Each service copy of the complaint and motion for temporary relief shall be accompanied by a... Federal Register pursuant to 19 CFR 210.10(b). If an investigation is instituted, copies of the complaint...

  7. 33 CFR 401.94 - Keeping copies of regulations.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Keeping copies of regulations..., DEPARTMENT OF TRANSPORTATION SEAWAY REGULATIONS AND RULES Regulations General § 401.94 Keeping copies of regulations. (a) A copy of these Regulations (subpart A of part 401), a copy of the vessel's valid Vessel...

  8. 22 CFR 1471.4 - Copies and service.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Copies and service. 1471.4 Section 1471.4... SERVICE IMPASSE DISPUTES PANEL PROCEDURES OF THE PANEL § 1471.4 Copies and service. Any party submitting a... file an original and one copy with the Panel, shall serve a copy promptly on the other party to the...

  9. The Energy of COPI for Budding Membranes.

    PubMed

    Thiam, Abdou Rachid; Pincet, Frédéric

    2015-01-01

    As a major actor of cellular trafficking, COPI coat proteins assemble on membranes and locally bend them to bud 60 nm-size coated particles. Budding requires the energy of the coat assembly to overcome the one necessary to deform the membrane which primarily depends on the bending modulus and surface tension, γ. Using a COPI-induced oil nanodroplet formation approach, we modulated the budding of nanodroplets using various amounts and types of surfactant. We found a Heaviside-like dependence between the budding efficiency and γ: budding was only dependent on γ and occurred beneath 1.3 mN/m. With the sole contribution of γ to the membrane deformation energy, we assessed that COPI supplies ~1500 kBT for budding particles from membranes, which is consistent with common membrane deformation energies. Our results highlight how a simple remodeling of the composition of membranes could mechanically modulate budding in cells.

  10. The Energy of COPI for Budding Membranes

    PubMed Central

    Thiam, Abdou Rachid; Pincet, Frédéric

    2015-01-01

    As a major actor of cellular trafficking, COPI coat proteins assemble on membranes and locally bend them to bud 60 nm-size coated particles. Budding requires the energy of the coat assembly to overcome the one necessary to deform the membrane which primarily depends on the bending modulus and surface tension, γ. Using a COPI-induced oil nanodroplet formation approach, we modulated the budding of nanodroplets using various amounts and types of surfactant. We found a Heaviside-like dependence between the budding efficiency and γ: budding was only dependent on γ and occurred beneath 1.3 mN/m. With the sole contribution of γ to the membrane deformation energy, we assessed that COPI supplies ~1500 kBT for budding particles from membranes, which is consistent with common membrane deformation energies. Our results highlight how a simple remodeling of the composition of membranes could mechanically modulate budding in cells. PMID:26218078

  11. Mechanisms of change in gene copy number.

    PubMed

    Hastings, P J; Lupski, James R; Rosenberg, Susan M; Ira, Grzegorz

    2009-08-01

    Deletions and duplications of chromosomal segments (copy number variants, CNVs) are a major source of variation between individual humans and are an underlying factor in human evolution and in many diseases, including mental illness, developmental disorders and cancer. CNVs form at a faster rate than other types of mutation, and seem to do so by similar mechanisms in bacteria, yeast and humans. Here we review current models of the mechanisms that cause copy number variation. Non-homologous end-joining mechanisms are well known, but recent models focus on perturbation of DNA replication and replication of non-contiguous DNA segments. For example, cellular stress might induce repair of broken replication forks to switch from high-fidelity homologous recombination to non-homologous repair, thus promoting copy number change.

  12. Role of COPI in phagosome maturation.

    PubMed

    Botelho, R J; Hackam, D J; Schreiber, A D; Grinstein, S

    2000-05-26

    Phagosomes mature by sequentially fusing with endosomes and lysosomes. Vesicle budding is presumed to occur concomitantly, mediating the retrieval of plasmalemmal components and the regulation of phagosomal size. We analyzed whether fission of vesicles from phagosomes requires COPI, a multimeric complex known to be involved in budding from the Golgi and endosomes. The role of COPI was studied using ldlF cells, that harbor a temperature-sensitive mutation in epsilon-COP, a subunit of the coatomer complex. These cells were made phagocytic toward IgG-opsonized particles by heterologous expression of human FcgammaRIIA receptors. Following incubation at the restrictive temperature, epsilon-COP was degraded in these cells and their Golgi complex dispersed. Nevertheless, phagocytosis persisted for hours in cells devoid of epsilon-COP. Retrieval of transferrin receptors from phagosomes became inefficient in the absence of epsilon-COP, while clearance of the FcgammaRIIA receptors was unaffected. This indicates that fission of vesicles from the phagosomal membrane involves at least two mechanisms, one of which requires intact COPI. Traffic of fluid-phase markers and aggregated IgG-receptor complexes along the endocytic pathway was abnormal in epsilon-COP-deficient cells. In contrast, phagosome fusion with endosomes and lysosomes was unimpaired. Moreover, the resulting phagolysosomes were highly acidic. Similar results were obtained in RAW264.7 macrophages treated with brefeldin A, which precludes COPI assembly by interfering with the activation of adenosine ribosylation factor. These data indicate that neither phagosome formation nor maturation are absolutely dependent on COPI. Our findings imply that phagosomal maturation differs from endosomal progression, which appears to be more dependent on COPI-mediated formation of carrier vesicles.

  13. Evolution of ribosomal RNA gene copy number on the sex chromosomes of Drosophila melanogaster.

    PubMed

    Lyckegaard, E M; Clark, A G

    1991-07-01

    A diverse array of cellular and evolutionary forces--including unequal crossing-over, magnification, compensation, and natural selection--is at play modulating the number of copies of ribosomal RNA (rRNA) genes on the X and Y chromosomes of Drosophila. Accurate estimates of naturally occurring distributions of copy numbers on both the X and Y chromosomes are needed in order to explore the evolutionary end result of these forces. Estimates of relative copy numbers of the ribosomal DNA repeat, as well as of the type I and type II inserts, were obtained for a series of 96 X chromosomes and 144 Y chromosomes by using densitometric measurements of slot blots of genomic DNA from adult D. melanogaster bearing appropriate deficiencies that reveal chromosome-specific copy numbers. Estimates of copy number were put on an absolute scale with slot blots having serial dilutions both of the repeat and of genomic DNA from nonpolytene larval brain and imaginal discs. The distributions of rRNA copy number are decidedly skewed, with a long tail toward higher copy numbers. These distributions were fitted by a population genetic model that posits three different types of exchange events--sister-chromatid exchange, intrachromatid exchange, and interchromosomal crossing-over. In addition, the model incorporates natural selection, because experimental evidence shows that there is a minimum number of functional elements necessary for survival. Adequate fits of the model were found, indicating that either natural selection also eliminates chromosomes with high copy number or that the rate of intrachromatid exchange exceeds the rate of interchromosomal exchange.

  14. Topics in library technology: copying techniques.

    PubMed

    Rauch, J S

    1966-01-01

    Photocopying applications in the library include the combining of previously separate material, the separation of a single item into two or more of its parts, and the selection of parts of existent material by the use of overlays. The production of catalog cards, the creation of sheet material (new book lists, reference bibliographies) from card-form materials, an Index Medicus-derived alerting service, and overdue notices copied from charge cards are among the applications exemplifying these general types. Larger-scale operations employing microfilm are noted. The distinction between copying and printing, in the light of equipment advances, is discussed.

  15. Gene copy number and malaria biology

    PubMed Central

    Anderson, Tim J.C.; Patel, Jigar; Ferdig, Michael T.

    2010-01-01

    Alteration in gene copy number provides a simple way to change expression levels and alter phenotype. This was fully appreciated by bacteriologists more than 25 years ago, but the extent and implications of copy number polymorphism (CNP) have only recently become apparent in other organisms. New methods demonstrate the ubiquity of CNPs in eukaryotes and their medical importance in humans. CNP is also widespread in the Plasmodium falciparum genome and has an important and underappreciated role in determining phenotype. In this review, we summarize the distribution of CNP, its evolutionary dynamics within populations, its functional importance and its mode of evolution. PMID:19559648

  16. Topics in Library Technology: Copying Techniques *

    PubMed Central

    Rauch, Jerome S.

    1966-01-01

    Photocopying applications in the library include the combining of previously separate material, the separation of a single item into two or more of its parts, and the selection of parts of existent material by the use of overlays. The production of catalog cards, the creation of sheet material (new book lists, reference bibliographies) from card-form materials, an Index Medicus-derived alerting service, and overdue notices copied from charge cards are among the applications exemplifying these general types. Larger-scale operations employing microfilm are noted. The distinction between copying and printing, in the light of equipment advances, is discussed. Images PMID:5901356

  17. Factors predictive of treatment-emergent adverse events of prucalopride: an integrated analysis of four randomized, double-blind, placebo-controlled trials.

    PubMed

    Leelakusolvong, Somchai; Ke, MeiYun; Zou, Duowu; Choi, Suck Chei; Tack, Jan; Quigley, Eamonn M M; Liu, Andy; Kim, Jin Yong

    2015-03-01

    This integrated analysis aimed to identify the factors associated with the most frequently re-ported treatment-emergent adverse events (TEAEs) in Asian and non-Asian patients with chronic constipation (CC) who receive prucalopride or placebo over 12 weeks. Pooled data from four randomized, double-blind, placebo-controlled, multicenter, phase III studies (NCT00488137, NCT00483886, NCT00485940, and NCT01116206) on pa-tients treated with prucalopride 2 mg or placebo were ana-lyzed. The associations between predictors and TEAEs were evaluated based on a logistic regression model. Overall, 1,821 patients (Asian, 26.1%; non-Asian, 73.9%) were analyzed. Prucalopride treatment was significantly as-sociated with diarrhea, headache, and nausea (p<0.001), but not with abdominal pain, compared with placebo. Differ-ences in the prevalence of TEAEs between prucalopride and placebo decreased greatly after the first day of treatment. Compared with non-Asians, Asians were more likely to expe-rience diarrhea and less likely to develop abdominal pain, headache, and nausea. Prior laxative use, CC duration, and body weight were not predictive of any of these TEAEs. Con-clusions Prucalopride treatment was positively associated with diarrhea, headache, and nausea. Asian patients tended to have a higher frequency of diarrhea but lower frequencies of headache, abdominal pain, and nausea compared with non-Asians. (Gut Liver, 2015;9208-213).

  18. IFN-λ inhibits HIV-1 integration and post-transcriptional events in vitro, but there is only limited in vivo repression of viral production.

    PubMed

    Tian, Ren-Rong; Guo, Hong-Xiong; Wei, Ji-Fu; Yang, Chuan-Kun; He, Shao-Heng; Wang, Jian-Hua

    2012-07-01

    The lambda interferons (IL-28a, 28b, and IL-29) inhibit the replication of many viruses, but their role in the inhibition of HIV-1 infection remains unclear. During this study, we monitored IL-29 production in HIV-1 infected individuals and analyzed the in vitro and in vivo inhibition of HIV-1 production. Prior treatment with IL-28a or IL-29 induced an antiviral state in cultured primary T-cells, which suppressed HIV-1 integration and post-transcriptional events. The antiviral factors MxA, OAS, and PKR were up-regulated. In HIV-1 infected patients, IL-29 level was increased along with the depletion of CD4⁺ T-cells in peripheral blood, while the elevated IL-29 did not show a significantly negative correlation with viral load. Further analysis of HIV-1 infected individuals showed that IL-29 was positively correlated with IFN-β and anti-inflammatory cytokine IL-10, and was negatively correlated with IFN-γ, which might suggest that IFN-λ participates in modulating antiviral immune responses during HIV-1 infection in vivo. Together, although IFN-λ impeded HIV-1 infection of T-cells in vitro, IFN-λ showed only limited in vivo repression of viral production. The modulation of IFN-λ on inflammatory factors might be worthy for further concentrating on for better understanding the host immune response during HIV-1 infection. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. A HIERARCHICAL BAYESIAN MODEL FOR INFERENCE OF COPY NUMBER VARIANTS AND THEIR ASSOCIATION TO GENE EXPRESSION

    PubMed Central

    Cassese, Alberto; Guindani, Michele; Tadesse, Mahlet G.; Falciani, Francesco; Vannucci, Marina

    2014-01-01

    A number of statistical models have been successfully developed for the analysis of high-throughput data from a single source, but few methods are available for integrating data from different sources. Here we focus on integrating gene expression levels with comparative genomic hybridization (CGH) array measurements collected on the same subjects. We specify a measurement error model that relates the gene expression levels to latent copy number states which, in turn, are related to the observed surrogate CGH measurements via a hidden Markov model. We employ selection priors that exploit the dependencies across adjacent copy number states and investigate MCMC stochastic search techniques for posterior inference. Our approach results in a unified modeling framework for simultaneously inferring copy number variants (CNV) and identifying their significant associations with mRNA transcripts abundance. We show performance on simulated data and illustrate an application to data from a genomic study on human cancer cell lines. PMID:24834139

  20. Inducible Amplification of Gene Copy Number and Heterologous Protein Production in the Yeast Kluyveromyces lactis

    PubMed Central

    Morlino, Giovanni B.; Tizzani, Lorenza; Fleer, Reinhard; Frontali, Laura; Bianchi, Michele M.

    1999-01-01

    Heterologous protein production can be doubled by increasing the copy number of the corresponding heterologous gene. We constructed a host-vector system in the yeast Kluyveromyces lactis that was able to induce copy number amplification of pKD1 plasmid-based vectors upon expression of an integrated copy of the plasmid recombinase gene. We increased the production and secretion of two heterologous proteins, glucoamylase from the yeast Arxula adeninivorans and mammalian interleukin-1β, following gene dosage amplification when the heterologous genes were carried by pKD1-based vectors. The choice of the promoters for expression of the integrated recombinase gene and of the episomal heterologous genes are critical for the mitotic stability of the host-vector system. PMID:10543790

  1. Inducible amplification of gene copy number and heterologous protein production in the yeast Kluyveromyces lactis.

    PubMed

    Morlino, G B; Tizzani, L; Fleer, R; Frontali, L; Bianchi, M M

    1999-11-01

    Heterologous protein production can be doubled by increasing the copy number of the corresponding heterologous gene. We constructed a host-vector system in the yeast Kluyveromyces lactis that was able to induce copy number amplification of pKD1 plasmid-based vectors upon expression of an integrated copy of the plasmid recombinase gene. We increased the production and secretion of two heterologous proteins, glucoamylase from the yeast Arxula adeninivorans and mammalian interleukin-1beta, following gene dosage amplification when the heterologous genes were carried by pKD1-based vectors. The choice of the promoters for expression of the integrated recombinase gene and of the episomal heterologous genes are critical for the mitotic stability of the host-vector system.

  2. PCR-Based Detection of DNA Copy Number Variation.

    PubMed

    Mehrotra, Meenakshi

    2016-01-01

    Copy number variations are important polymorphisms that can influence gene expression within and close to the rearranged region, and results in phenotypic variation. Techniques that detect abnormalities in DNA copy number are therefore useful for studying the associations between DNA aberrations and disease phenotype and for locating critical genes. PCR-based detection of copy number of target gene using TaqMan copy number assay offers a reliable method to measure copy number variation in human genome.

  3. The Effects of Answer Copying on the Ability Level Estimates of Cheater Examinees in Answer Copying Pairs

    ERIC Educational Resources Information Center

    Zopluoglu, Cengiz; Davenport, Ernest C., Jr.

    2011-01-01

    The purpose of this study was to examine the effects of answer copying on the ability level estimates of cheater examinees in answer copying pairs. The study generated answer copying pairs for each of 1440 conditions, source ability (12) x cheater ability (12) x amount of copying (10). The average difference between the ability level estimates…

  4. The Tnt1 family member Retrosol copy number and structure disclose retrotransposon diversification in different Solanum species.

    PubMed

    Manetti, M E; Rossi, M; Nakabashi, M; Grandbastien, M A; Van Sluys, Marie Anne

    2009-03-01

    Eukaryotic genome expansion/retraction caused by LTR-retrotransposon activity is dependent on the expression of full length copies to trigger efficient transposition and recombination-driven events. The Tnt1 family of retrotransposons has served as a model to evaluate the diversity among closely related elements within Solanaceae species and found that members of the family vary mainly in their U3 region of the long terminal repeats (LTRs). Recovery of a full length genomic copy of Retrosol was performed through a PCR-based approach from wild potato, Solanum oplocense. Further characterization focusing on both LTR sequences of the amplified copy allowed estimating an approximate insertion time at 2 million years ago thus supporting the occurrence of transposition cycles after genus divergence. Copy number of Tnt1-like elements in Solanum species were determined through genomic quantitative PCR whereby results sustain that Retrosol in Solanum species is a low copy number retrotransposon (1-4 copies) while Retrolyc1 has an intermediate copy number (38 copies) in S. peruvianum. Comparative analysis of retrotransposon content revealed no correlation between genome size or ploidy level and Retrosol copy number. The tetraploid cultivated potato with a cellular genome size of 1,715 Mbp harbours similar copy number per monoploid genome than other diploid Solanum species (613-884 Mbp). Conversely, S. peruvianum genome (1,125 Mbp) has a higher copy number. These results point towards a lineage specific dynamic flux regarding the history of amplification/activity of Tnt1-like elements in the genome of Solanum species.

  5. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants.

    PubMed

    Kwan, Elizabeth X; Wang, Xiaobin S; Amemiya, Haley M; Brewer, Bonita J; Raghuraman, M K

    2016-09-08

    The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. Copyright © 2016 Kwan et al.

  6. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants

    PubMed Central

    Kwan, Elizabeth X.; Wang, Xiaobin S.; Amemiya, Haley M.; Brewer, Bonita J.; Raghuraman, M. K.

    2016-01-01

    The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. PMID:27449518

  7. Viremia Copy-Years Predicts Mortality Among Treatment-Naive HIV-Infected Patients Initiating Antiretroviral Therapy

    PubMed Central

    Napravnik, Sonia; Cole, Stephen R.; Eron, Joseph J.; Lau, Bryan; Crane, Heidi M.; Kitahata, Mari M.; Willig, James H.; Moore, Richard D.; Deeks, Steven G.; Saag, Michael S.

    2011-01-01

    Background. Cross-sectional plasma human immunodeficiency virus (HIV) viral load (VL) measures have proven invaluable for clinical and research purposes. However, cross-sectional VL measures fail to capture cumulative plasma HIV burden longitudinally. We evaluated the cumulative effect of exposure to HIV replication on mortality following initiation of combination antiretroviral therapy (ART). Methods. We included treatment-naive HIV-infected patients starting ART from 2000 to 2008 at 8 Center for AIDS Research Network of Integrated Clinical Systems sites. Viremia copy-years, a time-varying measure of cumulative plasma HIV exposure, were determined for each patient using the area under the VL curve. Multivariable Cox models were used to evaluate the independent association of viremia copy-years for all-cause mortality. Results. Among 2027 patients contributing 6579 person-years of follow-up, the median viremia copy-years was 5.3 log10 copy × y/mL (interquartile range: 4.9–6.3 log10 copy × y/mL), and 85 patients (4.2%) died. When evaluated separately, viremia copy-years (hazard ratio [HR] = 1.81 per log10 copy × y/mL; 95% confidence interval [CI], 1.51–2.18 per log10 copy × y/mL), 24-week VL (1.74 per log10 copies/mL; 95% CI, 1.48–2.04 per log10 copies/mL), and most recent VL (HR = 1.89 per log10 copies/mL; 95% CI: 1.63–2.20 per log10 copies/mL) were associated with increased mortality. When simultaneously evaluating VL measures and controlling for other covariates, viremia copy-years increased mortality risk (HR = 1.44 per log10 copy × y/mL; 95% CI, 1.07–1.94 per log10 copy × y/mL), whereas no cross-sectional VL measure was independently associated with mortality. Conclusions. Viremia copy-years predicted all-cause mortality independent of traditional, cross-sectional VL measures and time-updated CD4+ T-lymphocyte count in ART-treated patients, suggesting cumulative HIV replication causes harm independent of its effect on the degree of

  8. Integrated system checkout report

    SciTech Connect

    Not Available

    1991-08-14

    The planning and preparation phase of the Integrated Systems Checkout Program (ISCP) was conducted from October 1989 to July 1991. A copy of the ISCP, DOE-WIPP 90--002, is included in this report as an appendix. The final phase of the Checkout was conducted from July 10, 1991, to July 23, 1991. This phase exercised all the procedures and equipment required to receive, emplace, and retrieve contact handled transuranium (CH TRU) waste filled dry bins. In addition, abnormal events were introduced to simulate various equipment failures, loose surface radioactive contamination events, and personnel injury. This report provides a detailed summary of each days activities during this period. Qualification of personnel to safely conduct the tasks identified in the procedures and the abnormal events were verified by observers familiar with the Bin-Scale CH TRU Waste Test requirements. These observers were members of the staffs of Westinghouse WID Engineering, QA, Training, Health Physics, Safety, and SNL. Observers representing a number of DOE departments, the state of new Mexico, and the Defense Nuclear Facilities Safety Board observed those Checkout activities conducted during the period from July 17, 1991, to July 23, 1991. Observer comments described in this report are those obtained from the staff member observers. 1 figs., 1 tab.

  9. CNVkit: Genome-Wide Copy Number Detection and Visualization from Targeted DNA Sequencing

    PubMed Central

    Shain, A. Hunter; Botton, Thomas; Bastian, Boris C.

    2016-01-01

    Germline copy number variants (CNVs) and somatic copy number alterations (SCNAs) are of significant importance in syndromic conditions and cancer. Massively parallel sequencing is increasingly used to infer copy number information from variations in the read depth in sequencing data. However, this approach has limitations in the case of targeted re-sequencing, which leaves gaps in coverage between the regions chosen for enrichment and introduces biases related to the efficiency of target capture and library preparation. We present a method for copy number detection, implemented in the software package CNVkit, that uses both the targeted reads and the nonspecifically captured off-target reads to infer copy number evenly across the genome. This combination achieves both exon-level resolution in targeted regions and sufficient resolution in the larger intronic and intergenic regions to identify copy number changes. In particular, we successfully inferred copy number at equivalent to 100-kilobase resolution genome-wide from a platform targeting as few as 293 genes. After normalizing read counts to a pooled reference, we evaluated and corrected for three sources of bias that explain most of the extraneous variability in the sequencing read depth: GC content, target footprint size and spacing, and repetitive sequences. We compared the performance of CNVkit to copy number changes identified by array comparative genomic hybridization. We packaged the components of CNVkit so that it is straightforward to use and provides visualizations, detailed reporting of significant features, and export options for integration into existing analysis pipelines. CNVkit is freely available from https://github.com/etal/cnvkit. PMID:27100738

  10. How best practices are copied, transferred, or translated between health care facilities: A conceptual framework.

    PubMed

    Guzman, Gustavo; Fitzgerald, Janna Anneke; Fulop, Liz; Hayes, Kathryn; Poropat, Arthur; Avery, Mark; Campbell, Steve; Fisher, Ron; Gapp, Rod; Herington, Carmel; McPhail, Ruth; Vecchio, Nerina

    2015-01-01

    In spite of significant investment in quality programs and activities, there is a persistent struggle to achieve quality outcomes and performance improvements within the constraints and support of sociopolitical parsimonies. Equally, such constraints have intensified the need to better understand the best practice methods for achieving quality improvements in health care organizations over time.This study proposes a conceptual framework to assist with strategies for the copying, transferring, and/or translation of best practice between different health care facilities. Applying a deductive logic, the conceptual framework was developed by blending selected theoretical lenses drawn from the knowledge management and organizational learning literatures. The proposed framework highlighted that (a) major constraints need to be addressed to turn best practices into everyday practices and (b) double-loop learning is an adequate learning mode to copy and to transfer best practices and deuteron learning mode is a more suitable learning mode for translating best practice. We also found that, in complex organizations, copying, transferring, and translating new knowledge is more difficult than in smaller, less complex organizations. We also posit that knowledge translation cannot happen without transfer and copy, and transfer cannot happen without copy of best practices. Hence, an integration of all three learning processes is required for knowledge translation (copy best practice-transfer knowledge about best practice-translation of best practice into new context). In addition, the higher the level of complexity of the organization, the more best practice is tacit oriented and, in this case, the higher the level of K&L capabilities are required to successfully copy, transfer, and/or translate best practices between organizations. The approach provides a framework for assessing organizational context and capabilities to guide copy/transfer/translation of best practices. A

  11. CNVkit: Genome-Wide Copy Number Detection and Visualization from Targeted DNA Sequencing.

    PubMed

    Talevich, Eric; Shain, A Hunter; Botton, Thomas; Bastian, Boris C

    2016-04-01

    Germline copy number variants (CNVs) and somatic copy number alterations (SCNAs) are of significant importance in syndromic conditions and cancer. Massively parallel sequencing is increasingly used to infer copy number information from variations in the read depth in sequencing data. However, this approach has limitations in the case of targeted re-sequencing, which leaves gaps in coverage between the regions chosen for enrichment and introduces biases related to the efficiency of target capture and library preparation. We present a method for copy number detection, implemented in the software package CNVkit, that uses both the targeted reads and the nonspecifically captured off-target reads to infer copy number evenly across the genome. This combination achieves both exon-level resolution in targeted regions and sufficient resolution in the larger intronic and intergenic regions to identify copy number changes. In particular, we successfully inferred copy number at equivalent to 100-kilobase resolution genome-wide from a platform targeting as few as 293 genes. After normalizing read counts to a pooled reference, we evaluated and corrected for three sources of bias that explain most of the extraneous variability in the sequencing read depth: GC content, target footprint size and spacing, and repetitive sequences. We compared the performance of CNVkit to copy number changes identified by array comparative genomic hybridization. We packaged the components of CNVkit so that it is straightforward to use and provides visualizations, detailed reporting of significant features, and export options for integration into existing analysis pipelines. CNVkit is freely available from https://github.com/etal/cnvkit.

  12. Teaching Ad Copy--I and II.

    ERIC Educational Resources Information Center

    Welty, Ward; Vanden Bergh, Bruce G.

    1981-01-01

    Ward Welty notes that the standard advertising course could be improved by including a unit of study in rhetoric, especially Aristotelian rhetoric. Bruce Vanden Bergh reports on research on the differences in creating advertising copy for radio versus the visual media of magazines, newspapers, and television. (RL)

  13. Genomic characteristics of cattle copy number variations

    USDA-ARS?s Scientific Manuscript database

    We performed a systematic analysis of cattle copy number variations (CNVs) using the Bovine HapMap SNP genotyping data, including 539 animals of 21 modern cattle breeds and 6 outgroups. After correcting genomic waves and considering the trio information, we identified 682 candidate CNV regions (CNVR...

  14. Teaching Ad Copy--I and II.

    ERIC Educational Resources Information Center

    Welty, Ward; Vanden Bergh, Bruce G.

    1981-01-01

    Ward Welty notes that the standard advertising course could be improved by including a unit of study in rhetoric, especially Aristotelian rhetoric. Bruce Vanden Bergh reports on research on the differences in creating advertising copy for radio versus the visual media of magazines, newspapers, and television. (RL)

  15. Mechanisms of copying behaviour in zebra finches.

    PubMed

    Guillette, Lauren M; Healy, Susan D

    2014-10-01

    When an individual is faced with choosing between unfamiliar food options, it may benefit initially by choosing the option chosen by other animals so avoiding potentially poisonous food. It is not clear which cues the naïve forager learns from the demonstrator for choosing between food options. To determine firstly which birds (zebra finches, Taeniopygia guttata) would copy a demonstrator's choice, in Experiment 1 we presented each observer with a demonstrator feeding from one of two differently coloured feeders and then tested the observer's feeder colour preference. Of the same-sex/mixed-sex demonstrator-observer pairs tested only females copied male demonstrators. In Experiment 2, birds did not prefer either feeder colour in the absence of demonstrators confirming the social learning effect observed in Experiment 1. In Experiment 3, copying females fed significantly more at the feeder of the demonstrated colour, rather than at the location of the demonstrated feeder. These data point not just to the identity of the individual to be copied but also to the kind of information learned. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Copies of clinic letters to the family.

    PubMed

    Bartle, D G; Diskin, L; Finlay, F

    2004-11-01

    In April 2004 guidelines were introduced advising that letters to the GP should be copied to parents of young people. A study was carried out to ascertain the views of young people and their parents as to who they felt should receive correspondence after an outpatient appointment.

  17. Copy to contiguous example using C descriptor

    SciTech Connect

    Rasmussen, Craig E

    2011-01-18

    In N1838-2 there is an example of how to use the CFI-cdesc-t type in a C implementation of a BIND (C) interface. This paper provides another example of using the CFI-cdesc-t type in C. This new example provides code to copy an array (possibly noncontiguous) into a contiguous buffer.

  18. 36 CFR 703.20 - File copies.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 703.20 Parks, Forests, and Public Property LIBRARY OF CONGRESS DISCLOSURE OR PRODUCTION OF RECORDS OR INFORMATION Testimony by Employees and Production of Documents in Certain Legal Proceedings Where the Library... file of copies of all demands served on the Library and deciding officials' responses....

  19. 36 CFR 703.20 - File copies.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 703.20 Parks, Forests, and Public Property LIBRARY OF CONGRESS DISCLOSURE OR PRODUCTION OF RECORDS OR INFORMATION Testimony by Employees and Production of Documents in Certain Legal Proceedings Where the Library... file of copies of all demands served on the Library and deciding officials' responses....

  20. 36 CFR 703.20 - File copies.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 703.20 Parks, Forests, and Public Property LIBRARY OF CONGRESS DISCLOSURE OR PRODUCTION OF RECORDS OR INFORMATION Testimony by Employees and Production of Documents in Certain Legal Proceedings Where the Library... file of copies of all demands served on the Library and deciding officials' responses....

  1. Dissecting Loss of Heterozygosity (LOH) in Neurofibromatosis Type 1-Associated Neurofibromas: Importance of Copy Neutral LOH

    PubMed Central

    Garcia-Linares, Carles; Fernández-Rodríguez, Juana; Terribas, Ernest; Mercadé, Jaume; Pros, Eva; Benito, Llúcia; Benavente, Yolanda; Capellà, Gabriel; Ravella, Anna; Blanco, Ignacio; Kehrer-Sawatzki, Hildegard; Lázaro, Conxi; Serra, Eduard

    2011-01-01

    Dermal neurofibromas (dNFs) are benign tumors of the peripheral nervous system typically associated with Neurofibromatosis type 1 (NF1) patients. Genes controlling the integrity of the DNA are likely to influence the number of neurofibromas developed because dNFs are caused by somatic mutational inactivation of the NF1 gene, frequently evidenced by loss of heterozygosity (LOH). We performed a comprehensive analysis of the prevalence and mechanisms of LOH in dNFs. Our study included 518 dNFs from 113 patients. LOH was detected in 25% of the dNFs (N = 129). The most frequent mechanism causing LOH was mitotic recombination, which was observed in 62% of LOH-tumors (N = 80), and which does not reduce the number of NF1 gene copies. All events were generated by a single crossover located between the centromere and the NF1 gene, resulting in isodisomy of 17q. LOH due to the loss of the NF1 gene accounted for a 38% of dNFs with LOH (N = 49), with deletions ranging in size from ∼80 kb to ∼8 Mb within 17q. In one tumor we identified the first example of a neurofibroma-associated second-hit type-2 NF1 deletion. Analysis of the prevalence of mechanisms causing LOH in dNFs in individual patients (possibly under genetic control) will elucidate whether there exist interindividual variation. Hum Mutat 32:78–90, 2011. © 2010 Wiley-Liss, Inc. PMID:21031597

  2. Genomic pathology of SLE-associated copy-number variation at the FCGR2C/FCGR3B/FCGR2B locus.

    PubMed

    Mueller, Michael; Barros, Paula; Witherden, Abigail S; Roberts, Amy L; Zhang, Zhou; Schaschl, Helmut; Yu, Chack-Yung; Hurles, Matthew E; Schaffner, Catherine; Floto, R Andres; Game, Laurence; Steinberg, Karyn Meltz; Wilson, Richard K; Graves, Tina A; Eichler, Evan E; Cook, H Terence; Vyse, Timothy J; Aitman, Timothy J

    2013-01-10

    Reduced FCGR3B copy number is associated with increased risk of systemic lupus erythematosus (SLE). The five FCGR2/FCGR3 genes are arranged across two highly paralogous genomic segments on chromosome 1q23. Previous studies have suggested mechanisms for structural rearrangements at the FCGR2/FCGR3 locus and have proposed mechanisms whereby altered FCGR3B copy number predisposes to autoimmunity, but the high degree of sequence similarity between paralogous segments has prevented precise definition of the molecular events and their functional consequences. To pursue the genomic pathology associated with FCGR3B copy-number variation, we integrated sequencing data from fosmid and bacterial artificial chromosome clones and sequence-captured DNA from FCGR3B-deleted genomes to establish a detailed map of allelic and paralogous sequence variation across the FCGR2/FCGR3 locus. This analysis identified two highly paralogous 24.5 kb blocks within the FCGR2C/FCGR3B/FCGR2B locus that are devoid of nonpolymorphic paralogous sequence variations and that define the limits of the genomic regions in which nonallelic homologous recombination leads to FCGR2C/FCGR3B copy-number variation. Further, the data showed evidence of swapping of haplotype blocks between these highly paralogous blocks that most likely arose from sequential ancestral recombination events across the region. Functionally, we found by flow cytometry, immunoblotting and cDNA sequencing that individuals with FCGR3B-deleted alleles show ectopic presence of FcγRIIb on natural killer (NK) cells. We conclude that FCGR3B deletion juxtaposes the 5'-regulatory sequences of FCGR2C with the coding sequence of FCGR2B, creating a chimeric gene that results in an ectopic accumulation of FcγRIIb on NK cells and provides an explanation for SLE risk associated with reduced FCGR3B gene copy number. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  3. 37 CFR 202.21 - Deposit of identifying material instead of copies.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... is an integral part of a motion picture, identifying material deposited in lieu of an actual copy of the motion picture shall consist of: (1) A transcription of the entire work, or a reproduction of the entire work on a phonorecord; and (2) Photographs or other reproductions from the motion picture...

  4. 37 CFR 202.21 - Deposit of identifying material instead of copies.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... is an integral part of a motion picture, identifying material deposited in lieu of an actual copy of the motion picture shall consist of: (1) A transcription of the entire work, or a reproduction of the entire work on a phonorecord; and (2) Photographs or other reproductions from the motion picture showing...

  5. 37 CFR 202.21 - Deposit of identifying material instead of copies.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... embodied in a soundtrack that is an integral part of a motion picture, identifying material deposited in lieu of an actual copy of the motion picture shall consist of: (1) A transcription of the entire work... from the motion picture showing the title of the motion picture, the soundtrack credits, and the...

  6. Systems analysis programs for hands-on integrated reliability evaluations (SAPHIRE) Version 5.0. Fault tree, event tree, and piping & instrumentation diagram (FEP) editors reference manual: Volume 7

    SciTech Connect

    McKay, M.K.; Skinner, N.L.; Wood, S.T.

    1994-07-01

    The Systems Analysis Programs for Hands-on Integrated Reliability Evaluations (SAPHIRE) refers to a set of several microcomputer programs that were developed to create and analyze probabilistic risk assessments (PRAs), primarily for nuclear power plants. The Fault Tree, Event Tree, and Piping and Instrumentation Diagram (FEP) editors allow the user to graphically build and edit fault trees, and event trees, and piping and instrumentation diagrams (P and IDs). The software is designed to enable the independent use of the graphical-based editors found in the Integrated Reliability and Risk Assessment System (IRRAS). FEP is comprised of three separate editors (Fault Tree, Event Tree, and Piping and Instrumentation Diagram) and a utility module. This reference manual provides a screen-by-screen guide of the entire FEP System.

  7. COPI selectively drives maturation of the early Golgi

    DOE PAGES

    Papanikou, Effrosyni; Day, Kasey J.; Austin, Jotham; ...

    2015-12-28

    COPI coated vesicles carry material between Golgi compartments, but the role of COPI in the secretory pathway has been ambiguous. Previous studies of thermosensitive yeast COPI mutants yielded the surprising conclusion that COPI was dispensable both for the secretion of certain proteins and for Golgi cisternal maturation. To revisit these issues, we optimized the anchor-away method, which allows peripheral membrane proteins such as COPI to be sequestered rapidly by adding rapamycin. Video fluorescence microscopy revealed that COPI inactivation causes an early Golgi protein to remain in place while late Golgi proteins undergo cycles of arrival and departure. These dynamics generatemore » partially functional hybrid Golgi structures that contain both early and late Golgi proteins, explaining how secretion can persist when COPI has been inactivated. Our findings suggest that cisternal maturation involves a COPI-dependent pathway that recycles early Golgi proteins, followed by multiple COPI-independent pathways that recycle late Golgi proteins.« less

  8. Integrating multidisciplinary science, modelling and impact data into evolving, syn-event volcanic hazard mapping and communication: A case study from the 2012 Tongariro eruption crisis, New Zealand

    NASA Astrophysics Data System (ADS)

    Leonard, Graham S.; Stewart, Carol; Wilson, Thomas M.; Procter, Jonathan N.; Scott, Bradley J.; Keys, Harry J.; Jolly, Gill E.; Wardman, Johnny B.; Cronin, Shane J.; McBride, Sara K.

    2014-10-01

    New Zealand's Tongariro National Park volcanoes produce hazardous eruptions every few years to decades. On 6 August 2012 the Te Maari vent of Tongariro Volcano erupted, producing a series of explosions and a fine ash of minor volume which was dispersed rapidly to the east. This manuscript presents a summary of the eruption impacts and the way these supported science communication during the crisis, particularly in terms of hazard map development. The most significant proximal impact was damage from pyroclastic surges and ballistics to the popular and economically-important Tongariro Alpine Crossing track. The only hazard to affect the medial impact zone was a few mms of ashfall with minor impacts. Field testing indicated that the Te Maari ash had extremely low resistivity when wetted, implying a very high potential to cause disruption to nationally-important power transmission networks via the mechanism of insulator flashover. This was not observed, presumably due to insufficient ash accumulation on insulators. Virtually no impacts from distal ashfall were reported. Post-event analysis of PM10 data demonstrates the additional value of regional air quality monitoring networks in quantifying population exposure to airborne respirable ash. While the eruption was minor, it generated a high level of public interest and a demand for information on volcanic hazards and impacts from emergency managers, the public, critical infrastructure managers, health officials, and the agriculture sector. Meeting this demand fully taxed available resources. We present here aspects of the New Zealand experience which may have wider applicability in moving towards improved integration of hazard impact information, mapping, and communication. These include wide use of a wiki technical clearinghouse and email listservs, a focus on multi-agency consistent messages, and a recently developed environment of collaboration and alignment of both research funding and technical science advice

  9. Punctuated Copy Number Evolution and Clonal Stasis in Triple-Negative Breast Cancer

    PubMed Central

    Gao, Ruli; Davis, Alexander; McDonald, Thomas O.; Sei, Emi; Shi, Xiuqing; Wang, Yong; Tsai, Pei-Ching; Casasent, Anna; Waters, Jill; Zhang, Hong; Meric-Bernstam, Funda; Michor, Franziska; Navin, Nicholas E.

    2016-01-01

    Aneuploidy is a hallmark of breast cancer; however, our knowledge of how these complex genomic rearrangements evolve during tumorigenesis is limited. In this study we developed a highly multiplexed single-nucleus-sequencing method to investigate copy number evolution in triple-negative breast cancer patients. We sequenced 1000 single cells from 12 patients and identified 1–3 major clonal subpopulations in each tumor that shared a common evolutionary lineage. We also identified a minor subpopulation of non-clonal cells that were classified as: 1) metastable, 2) pseudo-diploid, or 3) chromazemic. Phylogenetic analysis and mathematical modeling suggest that these data are unlikely to be explained by the gradual accumulation of copy number events over time. In contrast, our data challenge the paradigm of gradual evolution, showing that the majority of copy number aberrations are acquired at the earliest stages of tumor evolution, in short punctuated bursts, followed by stable clonal expansions that form the tumor mass. PMID:27526321

  10. Comparison of Soft-copy and Hard-copy Reading for Full-Field Digital Mammography

    PubMed Central

    Nishikawa, Robert M.; Acharyya, Suddhasatta; Gatsonis, Constantine; Pisano, Etta D.; Cole, Elodia B.; Marques, Helga S.; D'Orsi, Carl J.; Farria, Dione M.; Kanal, Kalpana M.; Mahoney, Mary C.; Rebner, Murray; Staiger, Melinda J.

    2009-01-01

    Purpose: To compare radiologists' performance in detecting breast cancer when reading full-field digital mammographic (FFDM) images either displayed on monitors or printed on film. Materials and Methods: This study received investigational review board approval and was HIPAA compliant, with waiver of informed consent. A reader study was conducted in which 26 radiologists read screening FFDM images displayed on high-resolution monitors (soft-copy digital) and printed on film (hard-copy digital). Three hundred thirty-three cases were selected from the Digital Mammography Image Screening Trial screening study (n = 49 528). Of these, 117 were from patients who received a diagnosis of breast cancer within 15 months of undergoing screening mammography. The digital mammograms were displayed on mammographic workstations and printed on film according to the manufacturer's specifications. Readers read both hard-copy and soft-copy images 6 weeks apart. Each radiologist read a subset of the total images. Twenty-two readers were assigned to evaluate images from one of three FFDM systems, and four readers were assigned to evaluate images from two mammographic systems. Each radiologist assigned a malignancy score on the basis of overall impression by using a seven-point scale, where 1 = definitely not malignant and 7 = definitely malignant. Results: There were no significant differences in the areas under the receiver operating characteristic curves (AUCs) for the primary comparison. The AUCs for soft-copy and hard-copy were 0.75 and 0.76, respectively (95% confidence interval: −0.04, 0.01; P = .36). Secondary analyses showed no significant differences in AUCs on the basis of manufacturer type, lesion type, or breast density. Conclusion: Soft-copy reading does not provide an advantage in the interpretation of digital mammograms. However, the display formats were not optimized and display software remains an evolving process, particularly for soft-copy reading. © RSNA, 2009

  11. 10 CFR 73.71 - Reporting of safeguards events.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Reporting of safeguards events. 73.71 Section 73.71 Energy... § 73.71 Reporting of safeguards events. (a)(1) Each licensee subject to the provisions of §§ 73.25, 73... revised information. Each licensee shall maintain a copy of the written report of an event submitted...

  12. 10 CFR 73.71 - Reporting of safeguards events.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Reporting of safeguards events. 73.71 Section 73.71 Energy... § 73.71 Reporting of safeguards events. (a)(1) Each licensee subject to the provisions of §§ 73.25, 73... revised information. Each licensee shall maintain a copy of the written report of an event submitted...

  13. 10 CFR 73.71 - Reporting of safeguards events.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Reporting of safeguards events. 73.71 Section 73.71 Energy... § 73.71 Reporting of safeguards events. (a)(1) Each licensee subject to the provisions of §§ 73.25, 73... revised information. Each licensee shall maintain a copy of the written report of an event submitted...

  14. 10 CFR 73.71 - Reporting of safeguards events.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Reporting of safeguards events. 73.71 Section 73.71 Energy... § 73.71 Reporting of safeguards events. (a)(1) Each licensee subject to the provisions of §§ 73.25, 73... revised information. Each licensee shall maintain a copy of the written report of an event submitted...

  15. 10 CFR 73.71 - Reporting of safeguards events.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Reporting of safeguards events. 73.71 Section 73.71 Energy... § 73.71 Reporting of safeguards events. (a)(1) Each licensee subject to the provisions of §§ 73.25, 73... revised information. Each licensee shall maintain a copy of the written report of an event submitted...

  16. Accurate measurement of transgene copy number in crop plants using droplet digital PCR.

    PubMed

    Collier, Ray; Dasgupta, Kasturi; Xing, Yan-Ping; Hernandez, Bryan Tarape; Shao, Min; Rohozinski, Dominica; Kovak, Emma; Lin, Jeanie; de Oliveira, Maria Luiza P; Stover, Ed; McCue, Kent F; Harmon, Frank G; Blechl, Ann; Thomson, James G; Thilmony, Roger

    2017-02-23

    Genetic transformation is a powerful means for the improvement of crop plants, but requires labor and resource intensive methods. An efficient method for identifying single copy transgene insertion events from a population of independent transgenic lines is desirable. Currently transgene copy number is estimated by either Southern blot hybridization analyses or quantitative polymerase chain reaction (qPCR) experiments. Southern hybridization is a convincing and reliable method, but it also is expensive, time-consuming and often requires a large amount of genomic DNA and radioactively labeled probes. Alternatively, qPCR requires less DNA and is potentially simpler to perform, but its results can lack the accuracy and precision needed to confidently distinguish between one and two copy events in transgenic plants with large genomes. To address this need, we developed a droplet digital PCR (dPCR)-based method for transgene copy number measurement in an array of crops: rice, citrus, potato, maize, tomato, and wheat. The method utilizes specific primers to amplify target transgenes, and endogenous reference genes in a single duplexed reaction containing thousands of droplets. Endpoint amplicon production in the droplets is detected and quantified using sequence-specific fluorescently labeled probes. The results demonstrate that this approach can generate confident copy number measurements in independent transgenic lines in these crop species. This method and the compendium of probes and primers will be a useful resource for the plant research community, enabling the simple and accurate determination of transgene copy number in these six important crop species. This article is protected by copyright. All rights reserved.

  17. Confirmed rare copy number variants implicate novel genes in schizophrenia.

    PubMed

    Tam, Gloria W C; van de Lagemaat, Louie N; Redon, Richard; Strathdee, Karen E; Croning, Mike D R; Malloy, Mary P; Muir, Walter J; Pickard, Ben S; Deary, Ian J; Blackwood, Douglas H R; Carter, Nigel P; Grant, Seth G N

    2010-04-01

    Understanding how cognitive processes including learning, memory, decision making and ideation are encoded by the genome is a key question in biology. Identification of sets of genes underlying human mental disorders is a path towards this objective. Schizophrenia is a common disease with cognitive symptoms, high heritability and complex genetics. We have identified genes involved with schizophrenia by measuring differences in DNA copy number across the entire genome in 91 schizophrenia cases and 92 controls in the Scottish population. Our data reproduce rare and common variants observed in public domain data from >3000 schizophrenia cases, confirming known disease loci as well as identifying novel loci. We found copy number variants in PDE10A (phosphodiesterase 10A), CYFIP1 [cytoplasmic FMR1 (Fragile X mental retardation 1)-interacting protein 1], K(+) channel genes KCNE1 and KCNE2, the Down's syndrome critical region 1 gene RCAN1 (regulator of calcineurin 1), cell-recognition protein CHL1 (cell adhesion molecule with homology with L1CAM), the transcription factor SP4 (specificity protein 4) and histone deacetylase HDAC9, among others (see http://www.genes2cognition.org/SCZ-CNV). Integrating the function of these many genes into a coherent model of schizophrenia and cognition is a major unanswered challenge.

  18. Importance of rare gene copy number alterations for personalized tumor characterization and survival analysis.

    PubMed

    Seifert, Michael; Friedrich, Betty; Beyer, Andreas

    2016-10-03

    It has proven exceedingly difficult to ascertain rare copy number alterations (CNAs) that may have strong effects in individual tumors. We show that a regulatory network inferred from gene expression and gene copy number data of 768 human cancer cell lines can be used to quantify the impact of patient-specific CNAs on survival signature genes. A focused analysis of tumors from six tissues reveals that rare patient-specific gene CNAs often have stronger effects on signature genes than frequent gene CNAs. Further comparison to a related network-based approach shows that the integration of indirectly acting gene CNAs significantly improves the survival analysis.

  19. Genome-wide copy number profiling using high-density SNP array in chickens.

    PubMed

    Yi, G; Qu, L; Chen, S; Xu, G; Yang, N

    2015-04-01

    Phenotypic diversity is a direct consequence resulting mainly from the impact of underlying genetic variation, and recent studies have shown that copy number variation (CNV) is emerging as an important contributor to both phenotypic variability and disease susceptibility. Herein, we performed a genome-wide CNV scan in 96 chickens from 12 diversified breeds, benefiting from the high-density Affymetrix 600 K SNP arrays. We identified a total of 231 autosomal CNV regions (CNVRs) encompassing 5.41 Mb of the chicken genome and corresponding to 0.59% of the autosomal sequence. The length of these CNVRs ranged from 2.6 to 586.2 kb with an average of 23.4 kb, including 130 gain, 93 loss and eight both gain and loss events. These CNVRs, especially deletions, had lower GC content and were located particularly in gene deserts. In particular, 102 CNVRs harbored 128 chicken genes, most of which were enriched in immune responses. We obtained 221 autosomal CNVRs after converting probe coordinates to Galgal3, and comparative analysis with previous studies illustrated that 153 of these CNVRs were regarded as novel events. Furthermore, qPCR assays were designed for 11 novel CNVRs, and eight (72.73%) were validated successfully. In this study, we demonstrated that the high-density 600 K SNP array can capture CNVs with higher efficiency and accuracy and highlighted the necessity of integrating multiple technologies and algorithms. Our findings provide a pioneering exploration of chicken CNVs based on a high-density SNP array, which contributes to a more comprehensive understanding of genetic variation in the chicken genome and is beneficial to unearthing potential CNVs underlying important traits of chickens. © 2015 Stichting International Foundation for Animal Genetics.

  20. Safe Practices for Copy and Paste in the EHR. Systematic Review, Recommendations, and Novel Model for Health IT Collaboration.

    PubMed

    Tsou, Amy Y; Lehmann, Christoph U; Michel, Jeremy; Solomon, Ronni; Possanza, Lorraine; Gandhi, Tejal

    2017-01-11

    Copy and paste functionality can support efficiency during clinical documentation, but may promote inaccurate documentation with risks for patient safety. The Partnership for Health IT Patient Safety was formed to gather data, conduct analysis, educate, and disseminate safe practices for safer care using health information technology (IT). To characterize copy and paste events in clinical care, identify safety risks, describe existing evidence, and develop implementable practice recommendations for safe reuse of information via copy and paste. The Partnership 1) reviewed 12 reported safety events, 2) solicited expert input, and 3) performed a systematic literature review (2010 to January 2015) to identify publications addressing frequency, perceptions/attitudes, patient safety risks, existing guidance, and potential interventions and mitigation practices. The literature review identified 51 publications that were included. Overall, 66% to 90% of clinicians routinely use copy and paste. One study of diagnostic errors found that copy and paste led to 2.6% of errors in which a missed diagnosis required patients to seek additional unplanned care. Copy and paste can promote note bloat, internal inconsistencies, error propagation, and documentation in the wrong patient chart. Existing guidance identified specific responsibilities for authors, organizations, and electronic health record (EHR) developers. Analysis of 12 reported copy and paste safety events was congruent with problems identified from the literature review. Despite regular copy and paste use, evidence regarding direct risk to patient safety remains sparse, with significant study limitations. Drawing on existing evidence, the Partnership developed four safe practice recommendations: 1) Provide a mechanism to make copy and paste material easily identifiable; 2) Ensure the provenance of copy and paste material is readily available; 3) Ensure adequate staff training and education; 4) Ensure copy and paste

  1. Low-level copy number changes of MYC genes have a prognostic impact in medulloblastoma.

    PubMed

    Zitterbart, Karel; Filkova, Hana; Tomasikova, Lenka; Necesalova, Eva; Zambo, Iva; Kantorova, Dagmar; Slamova, Iva; Vranova, Vladimira; Zezulkova, Dita; Pesakova, Martina; Pavelka, Zdenek; Veselska, Renata; Kuglik, Petr; Sterba, Jaroslav

    2011-03-01

    High-level amplifications of MYC genes are associated with poor outcomes in childhood medulloblastoma (MB). However, the occurrence of MYCN and MYCC copy number increases below the intense amplification pattern is rarely reported, and its clinical impact has not yet been determined. Here, we describe this phenomenon and its prognostic significance in a cohort of 29 MB patients. Using interphase fluorescence in situ hybridization (I-FISH), low-level copy number alterations, i.e. gain of MYCN, were shown in 5/27 (19%) samples, whereas amplification was revealed in only 1/27 (4%) samples. MYCC gain was revealed in 6/29 (21%) MB, while amplification was disclosed in only 2/29 (7%). Hyperploidy and co-incidence of gains in both MYC loci were frequently observed in samples with copy number aberrations. Survival analysis has clearly shown that MYC copy number increases are associated with lowered event-free survival and overall survival in MB. In the case of MYCN, this negative correlation was statistically significant. We conclude that limited numerical alterations in loci 2p24 (MYCN) and 8q24 (MYCC), as assessed by I-FISH, are present in MB with a higher frequency than high-level amplifications. Poor prognoses were observed in patients with copy number increases in MYC genes. Our data illustrate the importance of further investigations in multicenter trials to better refine the emerging genomic-based prognostic stratification in MB.

  2. Laser thermographic technologies for hard copy recording

    NASA Astrophysics Data System (ADS)

    Bessmel'tsev, Viktor P.; Baev, Sergej G.

    1995-04-01

    Methods of hard copies recording based on thermal interaction of the beam from CO2 or YAG lasers with various kinds of films on any substrates have been developed. The recording processes are single-step and require no additional development. Among them are: (1) Laser thermodestruction of thin mask layers or of a material surface on any kinds of substrates. (2) Laser thermochemical reactions of thermal decomposition of metal salts in solid state phase on a surface of various hygroscopic substrates. The laser recording devices using the methods, described above have been developed and are manufactured now; they allow one to record hard copies with a size of up to 27 X 31 inches, a resolution of 4000 dpi.

  3. Thermodynamics of Computational Copying in Biochemical Systems

    NASA Astrophysics Data System (ADS)

    Ouldridge, Thomas E.; Govern, Christopher C.; ten Wolde, Pieter Rein

    2017-04-01

    Living cells use readout molecules to record the state of receptor proteins, similar to measurements or copies in typical computational devices. But is this analogy rigorous? Can cells be optimally efficient, and if not, why? We show that, as in computation, a canonical biochemical readout network generates correlations; extracting no work from these correlations sets a lower bound on dissipation. For general input, the biochemical network cannot reach this bound, even with arbitrarily slow reactions or weak thermodynamic driving. It faces an accuracy-dissipation trade-off that is qualitatively distinct from and worse than implied by the bound, and more complex steady-state copy processes cannot perform better. Nonetheless, the cost remains close to the thermodynamic bound unless accuracy is extremely high. Additionally, we show that biomolecular reactions could be used in thermodynamically optimal devices under exogenous manipulation of chemical fuels, suggesting an experimental system for testing computational thermodynamics.

  4. Colour hard-copy from workstation screens

    NASA Astrophysics Data System (ADS)

    Clayton, C. A.

    It is possible to produce a colour print on the DEC LJ250 inkjet printer of either the entire screen or a portion of the screen from VAXstations, DECstations, SUN workstations and the IKON image display. This document describes how to achieve this with each of the above workstations. The IKONPAINT software which is used to produce colour hard-copy from the IKON screen on the inkjet printer is fully documented in SUN/71 and is not described here.

  5. Program Verification for Optimized Byte Copy

    DTIC Science & Technology

    1994-07-01

    with advice from Matthias Felleisen and Robert Harper, produced a transformational proof similar to those described by Mason [6]. The program has been...AD-A283 915 lii M~lii IMRI nl~ltlllrl Program Verification for Optimized Byte Copy EC Accesion For Edoardo S. Biagioni NTIS CRA&I July 1994 - DTIC...Dist Special Carnegie Mellon University Pittsburgh, PA 15213 00 SCW) Also published as Fox Memorandum CMU-CS-FOX-94-06 ( Abstract We present a program

  6. Digital authentication with copy-detection patterns

    NASA Astrophysics Data System (ADS)

    Picard, Justin

    2004-06-01

    Technologies for making high-quality copies of documents are getting more available, cheaper, and more efficient. As a result, the counterfeiting business engenders huge losses, ranging to 5% to 8% of worldwide sales of brand products, and endangers the reputation and value of the brands themselves. Moreover, the growth of the Internet drives the business of counterfeited documents (fake IDs, university diplomas, checks, and so on), which can be bought easily and anonymously from hundreds of companies on the Web. The incredible progress of digital imaging equipment has put in question the very possibility of verifying the authenticity of documents: how can we discern genuine documents from seemingly "perfect" copies? This paper proposes a solution based on creating digital images with specific properties, called a Copy-detection patterns (CDP), that is printed on arbitrary documents, packages, etc. CDPs make an optimal use of an "information loss principle": every time an imae is printed or scanned, some information is lost about the original digital image. That principle applies even for the highest quality scanning, digital imaging, printing or photocopying equipment today, and will likely remain true for tomorrow. By measuring the amount of information contained in a scanned CDP, the CDP detector can take a decision on the authenticity of the document.

  7. Modeling genetic inheritance of copy number variations

    PubMed Central

    Wang, Kai; Chen, Zhen; Tadesse, Mahlet G.; Glessner, Joseph; Grant, Struan F. A.; Hakonarson, Hakon; Bucan, Maja

    2008-01-01

    Copy number variations (CNVs) are being used as genetic markers or functional candidates in gene-mapping studies. However, unlike single nucleotide polymorphism or microsatellite genotyping techniques, most CNV detection methods are limited to detecting total copy numbers, rather than copy number in each of the two homologous chromosomes. To address this issue, we developed a statistical framework for intensity-based CNV detection platforms using family data. Our algorithm identifies CNVs for a family simultaneously, thus avoiding the generation of calls with Mendelian inconsistency while maintaining the ability to detect de novo CNVs. Applications to simulated data and real data indicate that our method significantly improves both call rates and accuracy of boundary inference, compared to existing approaches. We further illustrate the use of Mendelian inheritance to infer SNP allele compositions in each of the two homologous chromosomes in CNV regions using real data. Finally, we applied our method to a set of families genotyped using both the Illumina HumanHap550 and Affymetrix genome-wide 5.0 arrays to demonstrate its performance on both inherited and de novo CNVs. In conclusion, our method produces accurate CNV calls, gives probabilistic estimates of CNV transmission and builds a solid foundation for the development of linkage and association tests utilizing CNVs. PMID:18832372

  8. 19 CFR 151.64 - Extra copy of entry summary.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate per...

  9. 19 CFR 151.64 - Extra copy of entry summary.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate per...

  10. 19 CFR 151.64 - Extra copy of entry summary.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate...

  11. 19 CFR 151.64 - Extra copy of entry summary.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate...

  12. 19 CFR 151.64 - Extra copy of entry summary.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... TREASURY (CONTINUED) EXAMINATION, SAMPLING, AND TESTING OF MERCHANDISE Wool and Hair § 151.64 Extra copy of entry summary. One extra copy of the entry summary covering wool or hair subject to duty at a rate...

  13. 17 CFR 230.402 - Number of copies; binding; signatures.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... copy shall be bound, in one or more parts, without stiff covers. The binding shall be made on the side... filed with the Commission. Each copy shall be bound, in one or more parts, without stiff covers....

  14. 40 CFR 262.22 - Number of copies.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner... returned to the generator. ...

  15. 40 CFR 262.22 - Number of copies.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner... returned to the generator. ...

  16. 40 CFR 262.22 - Number of copies.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner... returned to the generator. ...

  17. 40 CFR 262.22 - Number of copies.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner... returned to the generator. ...

  18. 40 CFR 262.22 - Number of copies.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE The Manifest § 262.22 Number of copies. The manifest consists of at least the number of copies which will provide the generator, each transporter, and the owner... returned to the generator. ...

  19. 9. Photocopy of measured drawing (from a copy of the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    9. Photocopy of measured drawing (from a copy of the original; copy in accompanying field records, location of original unknown) Adolf Scherrer, architect ca. 1906 'CROSS SECTION' - Maennerchor Building, 102 West Michigan Street, Indianapolis, Marion County, IN

  20. Most Cancers Caused by Random DNA Copying Errors

    MedlinePlus

    ... fullstory_164252.html Most Cancers Caused by Random DNA Copying Errors While habits, environment can be key ... factors, genes inherited from parents, or simply random DNA copying errors. From their calculations, the researchers now ...

  1. 1. Historic American Buildings Survey Charles E. Peterson, Photographer Copied ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. Historic American Buildings Survey Charles E. Peterson, Photographer Copied July 29, 1940 Copied from old photograph - Joseph R. Brown House, Sam Brown Memorial Park (moved from Dakota Territory), Browns Valley, Traverse County, MN

  2. 37. Photographic copy of architects plan, no date, (original in ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    37. Photographic copy of architects plan, no date, (original in possession of Montana State University, Bozeman, Montana.) PHOTOGRAPHIC COPY OF ORIGINAL DRAWING - Hardin City Water Works, 101 East Fourth Street, Hardin, Big Horn County, MT

  3. Chloroplast DNA Copy Number Changes during Plant Development in Organelle DNA Polymerase Mutants

    PubMed Central

    Morley, Stewart A.; Nielsen, Brent L.

    2016-01-01

    Chloroplast genome copy number is very high in leaf tissue, with upwards of 10,000 or more copies of the chloroplast DNA (ctDNA) per leaf cell. This is often promoted as a major advantage for engineering the plastid genome, as it provides high gene copy number and thus is expected to result in high expression of foreign proteins from integrated genes. However, it is also known that ctDNA copy number and ctDNA integrity decrease as cells age. Quantitative PCR (qPCR) allows measurement of organelle DNA levels relative to a nuclear gene target. We have used this approach to determine changes in copy number of ctDNA relative to the nuclear genome at different ages of Arabidopsis plant growth and in organellar DNA polymerase mutants. The mutant plant lines have T-DNA insertions in genes encoding the two organelle localized DNA polymerases (PolIA and PolIB). Each of these mutant lines exhibits some delay in plant growth and development as compared to wild-type plants, with the PolIB plants having a more pronounced delay. Both mutant lines develop to maturity and produce viable seeds. Mutants for both proteins were observed to have a reduction in ctDNA and mtDNA copy number relative to wild type plants at all time points as measured by qPCR. Both DNA polymerase mutants had a fairly similar decrease in ctDNA copy number, while the PolIB mutant had a greater effect of reduction in mtDNA levels. However, despite similar decreases in genome copy number, RT-PCR analysis of PolIA mutants show that PolIB expression remains unchanged, suggesting that PolIA may not be essential to plant survival. Furthermore, genotypic analysis of plants from heterozygous parents display a strong pressure to maintain two functioning copies of PolIB. These results indicate that the two DNA polymerases are both important in ctDNA replication, and they are not fully redundant to each other, suggesting each has a specific function in plant organelles. PMID:26870072

  4. Chloroplast DNA Copy Number Changes during Plant Development in Organelle DNA Polymerase Mutants.

    PubMed

    Morley, Stewart A; Nielsen, Brent L

    2016-01-01

    Chloroplast genome copy number is very high in leaf tissue, with upwards of 10,000 or more copies of the chloroplast DNA (ctDNA) per leaf cell. This is often promoted as a major advantage for engineering the plastid genome, as it provides high gene copy number and thus is expected to result in high expression of foreign proteins from integrated genes. However, it is also known that ctDNA copy number and ctDNA integrity decrease as cells age. Quantitative PCR (qPCR) allows measurement of organelle DNA levels relative to a nuclear gene target. We have used this approach to determine changes in copy number of ctDNA relative to the nuclear genome at different ages of Arabidopsis plant growth and in organellar DNA polymerase mutants. The mutant plant lines have T-DNA insertions in genes encoding the two organelle localized DNA polymerases (PolIA and PolIB). Each of these mutant lines exhibits some delay in plant growth and development as compared to wild-type plants, with the PolIB plants having a more pronounced delay. Both mutant lines develop to maturity and produce viable seeds. Mutants for both proteins were observed to have a reduction in ctDNA and mtDNA copy number relative to wild type plants at all time points as measured by qPCR. Both DNA polymerase mutants had a fairly similar decrease in ctDNA copy number, while the PolIB mutant had a greater effect of reduction in mtDNA levels. However, despite similar decreases in genome copy number, RT-PCR analysis of PolIA mutants show that PolIB expression remains unchanged, suggesting that PolIA may not be essential to plant survival. Furthermore, genotypic analysis of plants from heterozygous parents display a strong pressure to maintain two functioning copies of PolIB. These results indicate that the two DNA polymerases are both important in ctDNA replication, and they are not fully redundant to each other, suggesting each has a specific function in plant organelles.

  5. Conditionally amplifiable BACs: switching from single-copy to high-copy vectors and genomic clones.

    PubMed

    Wild, Jadwiga; Hradecna, Zdenka; Szybalski, Waclaw

    2002-09-01

    The widely used, very-low-copy BAC (bacterial artificial chromosome) vectors are the mainstay of present genomic research. The principal advantage of BACs is the high stability of inserted clones, but an important disadvantage is the low yield of DNA, both for vectors alone and when carrying genomic inserts. We describe here a novel class of single-copy/high-copy (SC/HC) pBAC/oriV vectors that retain all the advantages of low-copy BAC vectors, but are endowed with a conditional and tightly controlled oriV/TrfA amplification system that allows: (1) a yield of ~100 copies of the vector per host cell when conditionally induced with L-arabinose, and (2) analogous DNA amplification (only upon induction and with copy number depending on the insert size) of pBAC/oriV clones carrying >100-kb inserts. Amplifiable clones and libraries facilitate high-throughput DNA sequencing and other applications requiring HC plasmid DNA. To turn on DNA amplification, which is driven by the oriV origin of replication, we used copy-up mutations in the gene trfA whose expression was very tightly controlled by the araC-P(araBAD) promoter/regulator system. This system is inducible by L-arabinose, and could be further regulated by glucose and fucose. Amplification of DNA upon induction with L-arabinose and its modulation by glucose are robust and reliable. Furthermore, we discovered that addition of 0.2% D-glucose to the growth medium helped toward the objective of obtaining a real SC state for all BAC systems, thus enhancing the stability of their maintenance, which became equivalent to cloning into the host chromosome

  6. A Double-Layered Mixture Model for the Joint Analysis of DNA Copy Number and Gene Expression Data

    PubMed Central

    Choi, Hyungwon; Qin, Zhaohui S.

    2010-01-01

    Abstract Copy number aberration is a common form of genomic instability in cancer. Gene expression is closely tied to cytogenetic events by the central dogma of molecular biology, and serves as a mediator of copy number changes in disease phenotypes. Accordingly, it is of interest to develop proper statistical methods for jointly analyzing copy number and gene expression data. This work describes a novel Bayesian inferential approach for a double-layered mixture model (DLMM) which directly models the stochastic nature of copy number data and identifies abnormally expressed genes due to aberrant copy number. Simulation studies were conducted to illustrate the robustness of DLMM under various settings of copy number aberration frequency, confounding effects, and signal-to-noise ratio in gene expression data. Analysis of a real breast cancer data shows that DLMM is able to identify expression changes specifically attributable to copy number aberration in tumors and that a sample-specific index built based on the selected genes is correlated with relevant clinical information. PMID:20170400

  7. Defects in coatomer protein I (COPI) transport cause blood feeding-induced mortality in Yellow Fever mosquitoes.

    PubMed

    Isoe, Jun; Collins, Jennifer; Badgandi, Hemant; Day, W Anthony; Miesfeld, Roger L

    2011-06-14

    Blood feeding by vector mosquitoes provides the entry point for disease pathogens and presents an acute metabolic challenge that must be overcome to complete the gonotrophic cycle. Based on recent data showing that coatomer protein I (COPI) vesicle transport is involved in cellular processes beyond Golgi-endoplasmic reticulum retrograde protein trafficking, we disrupted COPI functions in the Yellow Fever mosquito Aedes aegypti to interfere with blood meal digestion. Surprisingly, we found that decreased expression of the γCOPI coatomer protein led to 89% mortality in blood-fed mosquitoes by 72 h postfeeding compared with 0% mortality in control dsRNA-injected blood-fed mosquitoes and 3% mortality in γCOPI dsRNA-injected sugar-fed mosquitoes. Similar results were obtained using dsRNA directed against five other COPI coatomer subunits (α, β, β', δ, and ζ). We also examined midgut tissues by EM, quantitated heme in fecal samples, and characterized feeding-induced protein expression in midgut, fat body, and ovary tissues of COPI-deficient mosquitoes. We found that COPI defects disrupt epithelial cell membrane integrity, stimulate premature blood meal excretion, and block induced expression of several midgut protease genes. To study the role of COPI transport in ovarian development, we injected γCOPI dsRNA after blood feeding and found that, although blood digestion was normal, follicles in these mosquitoes were significantly smaller by 48 h postinjection and lacked eggshell proteins. Together, these data show that COPI functions are critical to mosquito blood digestion and egg maturation, a finding that could also apply to other blood-feeding arthropod vectors.

  8. Syllables as Functional Units in a Copying Task

    ERIC Educational Resources Information Center

    Kandel, Sonia; Valdois, Sylviane

    2006-01-01

    This research used a copying task to study spelling acquisition from a perception and action perspective. First to fifth graders copied words and pseudo-words on a digitiser. Simultaneously, a camera registered the children's gaze lifts. First and second graders copied the first syllable and then produced a gaze lift to obtain information on the…

  9. Writing Wrongs: Copying as a Strategy for Underachieving EFL Writers.

    ERIC Educational Resources Information Center

    Porte, Graeme K.

    1995-01-01

    This paper reports on a small-scale study of the outcomes generated by 15 underachieving English-as-a-Foreign-Language university writers copying text displayed on a computer monitor under pressure of time. Analysis of student's copied texts showed that various inaccuracies that were not in the original had passed into the copied version,…

  10. 1 CFR 18.1 - Original and copies required.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Original and copies required. 18.1 Section 18.1... PROCESSING OF DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.1 Original and copies... two duplicate originals or certified copies. 1 However, if the document is printed or processed...

  11. 1 CFR 18.1 - Original and copies required.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 1 General Provisions 1 2011-01-01 2011-01-01 false Original and copies required. 18.1 Section 18.1... PROCESSING OF DOCUMENTS PREPARATION AND TRANSMITTAL OF DOCUMENTS GENERALLY § 18.1 Original and copies... two duplicate originals or certified copies. 1 However, if the document is printed or processed...

  12. Readability as a Factor in Magazine Ad Copy Recall.

    ERIC Educational Resources Information Center

    Wesson, David A.

    1989-01-01

    Examines the relationship between advertising copy readability and advertising effectiveness. Finds that recall is improved when the copy style is either fairly easy or fairly hard to read. Suggests the value of considering copy readability as a potential contributor, though a minor one, to the success of magazine advertising. (RS)

  13. Syllables as Functional Units in a Copying Task

    ERIC Educational Resources Information Center

    Kandel, Sonia; Valdois, Sylviane

    2006-01-01

    This research used a copying task to study spelling acquisition from a perception and action perspective. First to fifth graders copied words and pseudo-words on a digitiser. Simultaneously, a camera registered the children's gaze lifts. First and second graders copied the first syllable and then produced a gaze lift to obtain information on the…

  14. 40 CFR 35.935-10 - Copies of contract documents.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Copies of contract documents. 35.935-10... Copies of contract documents. In addition to the notification of project changes under § 30.900 of this chapter, a grantee must promptly submit to the Regional Administrator a copy of any prime contract or...

  15. 46 CFR 67.539 - Copies of instruments and documents.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Copies of instruments and documents. 67.539 Section 67... VESSELS DOCUMENTATION OF VESSELS Fees § 67.539 Copies of instruments and documents. The fee charged for furnishing a copy of any instrument or document is calculated in the same manner as described in 49 CFR 7.95. ...

  16. 34 CFR 5.52 - Copies of records.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Copies of records. 5.52 Section 5.52 Education Office.... L. 90-23 (Eff. until 7-14-10) Procedures for Requesting Access to Records § 5.52 Copies of records. Copies of available records shall be produced as promptly as possible upon receipt of the fee therefor...

  17. 45 CFR 1309.40 - Copies of documents.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false Copies of documents. 1309.40 Section 1309.40 Public Welfare Regulations Relating to Public Welfare (Continued) OFFICE OF HUMAN DEVELOPMENT SERVICES... § 1309.40 Copies of documents. Certified copies of the deed, lease, loan instrument, mortgage, and any...

  18. 33 CFR 72.01-40 - Single copies.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Single copies. 72.01-40 Section 72.01-40 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY AIDS TO NAVIGATION MARINE INFORMATION Notices to Mariners § 72.01-40 Single copies. Single copies of the “Notice to...

  19. 46 CFR 502.168 - Copies of data or evidence.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 9 2010-10-01 2010-10-01 false Copies of data or evidence. 502.168 Section 502.168... Hearings; Presiding Officers; Evidence § 502.168 Copies of data or evidence. Every person compelled to submit data or evidence shall be entitled to retain or, on payment of proper costs, procure a copy of...

  20. 47 CFR 95.673 - Copy of rules.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Copy of rules. 95.673 Section 95.673... SERVICES Technical Regulations Additional Certification Requirements for Cb Transmitters § 95.673 Copy of rules. A copy of part 95, subpart D, of the FCC Rules, current at the time of packing of the transmitter...