Forsell, Mattias N E; Dey, Barna; Mörner, Andreas; Svehla, Krisha; O'dell, Sijy; Högerkorp, Carl-Magnus; Voss, Gerald; Thorstensson, Rigmor; Shaw, George M; Mascola, John R; Karlsson Hedestam, Gunilla B; Wyatt, Richard T
2008-10-03
The surface HIV-1 exterior envelope glycoprotein, gp120, binds to CD4 on the target cell surface to induce the co-receptor binding site on gp120 as the initial step in the entry process. The binding site is comprised of a highly conserved region on the gp120 core, as well as elements of the third variable region (V3). Antibodies against the co-receptor binding site are abundantly elicited during natural infection of humans, but the mechanism of elicitation has remained undefined. In this study, we investigate the requirements for elicitation of co-receptor binding site antibodies by inoculating rabbits, monkeys and human-CD4 transgenic (huCD4) rabbits with envelope glycoprotein (Env) trimers possessing high affinity for primate CD4. A cross-species comparison of the antibody responses showed that similar HIV-1 neutralization breadth was elicited by Env trimers in monkeys relative to wild-type (WT) rabbits. In contrast, antibodies against the co-receptor site on gp120 were elicited only in monkeys and huCD4 rabbits, but not in the WT rabbits. This was supported by the detection of high-titer co-receptor antibodies in all sera from a set derived from human volunteers inoculated with recombinant gp120. These findings strongly suggest that complexes between Env and (high-affinity) primate CD4 formed in vivo are responsible for the elicitation of the co-receptor-site-directed antibodies. They also imply that the naïve B cell receptor repertoire does not recognize the gp120 co-receptor site in the absence of CD4 and illustrate that conformational stabilization, imparted by primary receptor interaction, can alter the immunogenicity of a type 1 viral membrane protein.
Functional impact of HIV coreceptor-binding site mutations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biscone, Mark J.; Miamidian, John L.; Muchiri, John M.
2006-07-20
The bridging sheet region of the gp120 subunit of the HIV-1 Env protein interacts with the major virus coreceptors, CCR5 and CXCR4. We examined the impact of mutations in and adjacent to the bridging sheet region of an X4 tropic HIV-1 on membrane fusion and entry inhibitor susceptibility. When the V3-loop of this Env was changed so that CCR5 was used, the effects of these same mutations on CCR5 use were assayed as well. We found that coreceptor-binding site mutations had greater effects on CXCR4-mediated fusion and infection than when CCR5 was used as a coreceptor, perhaps related to differencesmore » in coreceptor affinity. The mutations also reduced use of the alternative coreceptors CCR3 and CCR8 to varying degrees, indicating that the bridging sheet region is important for the efficient utilization of both major and minor HIV coreceptors. As seen before with a primary R5 virus strain, bridging sheet mutations increased susceptibility to the CCR5 inhibitor TAK-779, which correlated with CCR5 binding efficiency. Bridging sheet mutations also conferred increased susceptibility to the CXCR4 ligand AMD-3100 in the context of the X4 tropic Env. However, these mutations had little effect on the rate of membrane fusion and little effect on susceptibility to enfuvirtide, a membrane fusion inhibitor whose activity is dependent in part on the rate of Env-mediated membrane fusion. Thus, mutations that reduce coreceptor binding and enhance susceptibility to coreceptor inhibitors can affect fusion and enfuvirtide susceptibility in an Env context-dependent manner.« less
Boliar, Saikat; Patil, Shilpa; Shukla, Brihaspati N; Ghobbeh, Ali; Deshpande, Suprit; Chen, Weizao; Guenaga, Javier; Dimitrov, Dimiter S; Wyatt, Richard T; Chakrabarti, Bimal K
2018-06-01
HIV-1 virus entry into target cells requires the envelope glycoprotein (Env) to first bind the primary receptor, CD4 and subsequently the co-receptor. Antibody access to the co-receptor binding site (CoRbs) in the pre-receptor-engaged state, prior to cell attachment, remains poorly understood. Here, we have demonstrated that for tier-1 Envs, the CoRbs is directly accessible to full-length CD4-induced (CD4i) antibodies even before primary receptor engagement, indicating that on these Envs the CoRbs site is either preformed or can conformationally sample post-CD4-bound state. Tier-2 and tier-3 Envs, which are resistant to full-length CD4i antibody, are neutralized by m36.4, a lower molecular mass of CD4i-directed domain antibody. In some tier-2 and tier-3 Envs, CoRbs is accessible to m36.4 even prior to cellular attachment in an Env-specific manner independent of their tier category. These data suggest differential structural arrangements of CoRbs and varied masking of ligand access to the CoRbs in different Env isolates. Copyright © 2018 Elsevier Inc. All rights reserved.
Stenmark, Pål; Dupuy, Jérôme; Imamura, Akihiro; Kiso, Makoto; Stevens, Raymond C
2008-08-15
Botulinum neurotoxins have a very high affinity and specificity for their target cells requiring two different co-receptors located on the neuronal cell surface. Different toxin serotypes have different protein receptors; yet, most share a common ganglioside co-receptor, GT1b. We determined the crystal structure of the botulinum neurotoxin serotype A binding domain (residues 873-1297) alone and in complex with a GT1b analog at 1.7 A and 1.6 A, respectively. The ganglioside GT1b forms several key hydrogen bonds to conserved residues and binds in a shallow groove lined by Tryptophan 1266. GT1b binding does not induce any large structural changes in the toxin; therefore, it is unlikely that allosteric effects play a major role in the dual receptor recognition. Together with the previously published structures of botulinum neurotoxin serotype B in complex with its protein co-receptor, we can now generate a detailed model of botulinum neurotoxin's interaction with the neuronal cell surface. The two branches of the GT1b polysaccharide, together with the protein receptor site, impose strict geometric constraints on the mode of interaction with the membrane surface and strongly support a model where one end of the 100 A long translocation domain helix bundle swing into contact with the membrane, initiating the membrane anchoring event.
Brelot, A; Heveker, N; Montes, M; Alizon, M
2000-08-04
CXCR4 is a G-coupled receptor for the stromal cell-derived factor (SDF-1) chemokine, and a CD4-associated human immunodeficiency virus type 1 (HIV-1) coreceptor. These functions were studied in a panel of CXCR4 mutants bearing deletions in the NH(2)-terminal extracellular domain (NT) or substitutions in the NT, the extracellular loops (ECL), or the transmembrane domains (TMs). The coreceptor activity of CXCR4 was markedly impaired by mutations of two Tyr residues in NT (Y7A/Y12A) or at a single Asp residue in ECL2 (D193A), ECL3 (D262A), or TMII (D97N). These acidic residues could engage electrostatical interactions with basic residues of the HIV-1 envelope protein gp120, known to contribute to the selectivity for CXCR4. The ability of CXCR4 mutants to bind SDF-1 and mediate cell signal was consistent with the two-site model of chemokine-receptor interaction. Site I involved in SDF-1 binding but not signaling was located in NT with particular importance of Glu(14) and/or Glu(15) and Tyr(21). Residues required for both SDF-1 binding and signaling, and thus probably part of site II, were identified in ECL2 (Asp(187)), TMII (Asp(97)), and TMVII (Glu(288)). The first residues () of NT also seem required for SDF-1 binding and signaling. A deletion in the third intracellular loop abolished signaling, probably by disrupting the coupling with G proteins. The identification of CXCR4 residues involved in the interaction with both SDF-1 and HIV-1 may account for the signaling activity of gp120 and has implications for the development of antiviral compounds.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stenmark, P.; Dupuy, J.; Inamura, A.
2009-05-26
Botulinum neurotoxins have a very high affinity and specificity for their target cells requiring two different co-receptors located on the neuronal cell surface. Different toxin serotypes have different protein receptors; yet, most share a common ganglioside co-receptor, GT1b. We determined the crystal structure of the botulinum neurotoxin serotype A binding domain (residues 873-1297) alone and in complex with a GT1b analog at 1.7 A and 1.6 A, respectively. The ganglioside GT1b forms several key hydrogen bonds to conserved residues and binds in a shallow groove lined by Tryptophan 1266. GT1b binding does not induce any large structural changes in themore » toxin; therefore, it is unlikely that allosteric effects play a major role in the dual receptor recognition. Together with the previously published structures of botulinum neurotoxin serotype B in complex with its protein co-receptor, we can now generate a detailed model of botulinum neurotoxin's interaction with the neuronal cell surface. The two branches of the GT1b polysaccharide, together with the protein receptor site, impose strict geometric constraints on the mode of interaction with the membrane surface and strongly support a model where one end of the 100 A long translocation domain helix bundle swing into contact with the membrane, initiating the membrane anchoring event.« less
Hu, Guiqing; Liu, Jun; Roux, Kenneth H; Taylor, Kenneth A
2017-08-15
The human immunodeficiency virus type 1 (HIV-1)/simian immunodeficiency virus (SIV) envelope spike (Env) mediates viral entry into host cells. The V3 loop of the gp120 component of the Env trimer contributes to the coreceptor binding site and is a target for neutralizing antibodies. We used cryo-electron tomography to visualize the binding of CD4 and the V3 loop monoclonal antibody (MAb) 36D5 to gp120 of the SIV Env trimer. Our results show that 36D5 binds gp120 at the base of the V3 loop and suggest that the antibody exerts its neutralization effect by blocking the coreceptor binding site. The antibody does this without altering the dynamics of the spike motion between closed and open states when CD4 is bound. The interaction between 36D5 and SIV gp120 is similar to the interaction between some broadly neutralizing anti-V3 loop antibodies and HIV-1 gp120. Two conformations of gp120 bound with CD4 are revealed, suggesting an intrinsic dynamic nature of the liganded Env trimer. CD4 binding substantially increases the binding of 36D5 to gp120 in the intact Env trimer, consistent with CD4-induced changes in the conformation of gp120 and the antibody binding site. Binding by MAb 36D5 does not substantially alter the proportions of the two CD4-bound conformations. The position of MAb 36D5 at the V3 base changes little between conformations, indicating that the V3 base serves as a pivot point during the transition between these two states. IMPORTANCE Glycoprotein spikes on the surfaces of SIV and HIV are the sole targets available to the immune system for antibody neutralization. Spikes evade the immune system by a combination of a thick layer of polysaccharide on the surface (the glycan shield) and movement between spike domains that masks the epitope conformation. Using SIV virions whose spikes were "decorated" with the primary cellular receptor (CD4) and an antibody (36D5) at part of the coreceptor binding site, we visualized multiple conformations trapped by the rapid freezing step, which were separated using statistical analysis. Our results show that the CD4-induced conformational dynamics of the spike enhances binding of the antibody. Copyright © 2017 American Society for Microbiology.
Guan, Yongjun; Pazgier, Marzena; Sajadi, Mohammad M.; ...
2012-12-13
The HIV-1 envelope glycoprotein (Env) undergoes conformational transitions consequent to CD4 binding and coreceptor engagement during viral entry. The physical steps in this process are becoming defined, but less is known about their significance as targets of antibodies potentially protective against HIV-1 infection. Here we probe the functional significance of transitional epitope exposure by characterizing 41 human mAbs specific for epitopes exposed on trimeric Env after CD4 engagement. These mAbs recognize three epitope clusters: cluster A, the gp120 face occluded by gp41 in trimeric Env; cluster B, a region proximal to the coreceptor-binding site (CoRBS) and involving the V1/V2 domain;more » and cluster C, the coreceptor-binding site. The mAbs were evaluated functionally by antibody-dependent, cell-mediated cytotoxicity (ADCC) and for neutralization of Tiers 1 and 2 pseudoviruses. All three clusters included mAbs mediating ADCC. However, there was a strong potency bias for cluster A, which harbors at least three potent ADCC epitopes whose cognate mAbs have electropositive paratopes. Cluster A epitopes are functional ADCC targets during viral entry in an assay format using virion-sensitized target cells. In contrast, only cluster C contained epitopes that were recognized by neutralizing mAbs. There was significant diversity in breadth and potency that correlated with epitope fine specificity. In contrast, ADCC potency had no relationship with neutralization potency or breadth for any epitope cluster. In conclusion, Fc-mediated effector function and neutralization coselect with specificity in anti-Env antibody responses, but the nature of selection is distinct for these two antiviral activities.« less
Identification of the platelet-derived chemokine CXCL4/PF-4 as a broad-spectrum HIV-1 inhibitor
Auerbach, David J.; Lin, Yin; Miao, Huiyi; Cimbro, Raffaello; DiFiore, Michelle J.; Gianolini, Monica E.; Furci, Lucinda; Biswas, Priscilla; Fauci, Anthony S.; Lusso, Paolo
2012-01-01
The natural history of HIV-1 infection is highly variable in different individuals, spanning from a rapidly progressive course to a long-term asymptomatic infection. A major determinant of the pace of disease progression is the in vivo level of HIV-1 replication, which is regulated by a complex network of cytokines and chemokines expressed by immune and inflammatory cells. The chemokine system is critically involved in the control of HIV-1 replication by virtue of the role played by specific chemokine receptors, most notably CCR5 and CXCR4, as cell-surface coreceptors for HIV-1 entry; hence, the chemokines that naturally bind such coreceptors act as endogenous inhibitors of HIV-1. Here, we show that the CXC chemokine CXCL4 (PF-4), the most abundant protein contained within the α-granules of platelets, is a broad-spectrum inhibitor of HIV-1 infection. Unlike other known HIV-suppressive chemokines, CXCL4 inhibits infection by the majority of primary HIV-1 isolates regardless of their coreceptor-usage phenotype or genetic subtype. Consistent with the lack of viral phenotype specificity, blockade of HIV-1 infection occurs at the level of virus attachment and entry via a unique mechanism that involves direct interaction of CXCL4 with the major viral envelope glycoprotein, gp120. The binding site for CXCL4 was mapped to a region of the gp120 outer domain proximal to the CD4-binding site. The identification of a platelet-derived chemokine as an endogenous antiviral factor may have relevance for the pathogenesis and treatment of HIV-1 infection. PMID:22645343
Identification of the platelet-derived chemokine CXCL4/PF-4 as a broad-spectrum HIV-1 inhibitor.
Auerbach, David J; Lin, Yin; Miao, Huiyi; Cimbro, Raffaello; Difiore, Michelle J; Gianolini, Monica E; Furci, Lucinda; Biswas, Priscilla; Fauci, Anthony S; Lusso, Paolo
2012-06-12
The natural history of HIV-1 infection is highly variable in different individuals, spanning from a rapidly progressive course to a long-term asymptomatic infection. A major determinant of the pace of disease progression is the in vivo level of HIV-1 replication, which is regulated by a complex network of cytokines and chemokines expressed by immune and inflammatory cells. The chemokine system is critically involved in the control of HIV-1 replication by virtue of the role played by specific chemokine receptors, most notably CCR5 and CXCR4, as cell-surface coreceptors for HIV-1 entry; hence, the chemokines that naturally bind such coreceptors act as endogenous inhibitors of HIV-1. Here, we show that the CXC chemokine CXCL4 (PF-4), the most abundant protein contained within the α-granules of platelets, is a broad-spectrum inhibitor of HIV-1 infection. Unlike other known HIV-suppressive chemokines, CXCL4 inhibits infection by the majority of primary HIV-1 isolates regardless of their coreceptor-usage phenotype or genetic subtype. Consistent with the lack of viral phenotype specificity, blockade of HIV-1 infection occurs at the level of virus attachment and entry via a unique mechanism that involves direct interaction of CXCL4 with the major viral envelope glycoprotein, gp120. The binding site for CXCL4 was mapped to a region of the gp120 outer domain proximal to the CD4-binding site. The identification of a platelet-derived chemokine as an endogenous antiviral factor may have relevance for the pathogenesis and treatment of HIV-1 infection.
Functional Mimetics of the HIV-1 CCR5 Co-Receptor Displayed on the Surface of Magnetic Liposomes.
Kuzmina, Alona; Vaknin, Karin; Gdalevsky, Garik; Vyazmensky, Maria; Marks, Robert S; Taube, Ran; Engel, Stanislav
2015-01-01
Chemokine G protein coupled receptors, principally CCR5 or CXCR4, function as co-receptors for HIV-1 entry into CD4+ T cells. Initial binding of the viral envelope glycoprotein (Env) gp120 subunit to the host CD4 receptor induces a cascade of structural conformational changes that lead to the formation of a high-affinity co-receptor-binding site on gp120. Interaction between gp120 and the co-receptor leads to the exposure of epitopes on the viral gp41 that mediates fusion between viral and cell membranes. Soluble CD4 (sCD4) mimetics can act as an activation-based inhibitor of HIV-1 entry in vitro, as it induces similar structural changes in gp120, leading to increased virus infectivity in the short term but to virus Env inactivation in the long term. Despite promising clinical implications, sCD4 displays low efficiency in vivo, and in multiple HIV strains, it does not inhibit viral infection. This has been attributed to the slow kinetics of the sCD4-induced HIV Env inactivation and to the failure to obtain sufficient sCD4 mimetic levels in the serum. Here we present uniquely structured CCR5 co-receptor mimetics. We hypothesized that such mimetics will enhance sCD4-induced HIV Env inactivation and inhibition of HIV entry. Co-receptor mimetics were derived from CCR5 gp120-binding epitopes and functionalized with a palmitoyl group, which mediated their display on the surface of lipid-coated magnetic beads. CCR5-peptidoliposome mimetics bound to soluble gp120 and inhibited HIV-1 infectivity in a sCD4-dependent manner. We concluded that CCR5-peptidoliposomes increase the efficiency of sCD4 to inhibit HIV infection by acting as bait for sCD4-primed virus, catalyzing the premature discharge of its fusion potential.
Functional Mimetics of the HIV-1 CCR5 Co-Receptor Displayed on the Surface of Magnetic Liposomes
Kuzmina, Alona; Vaknin, Karin; Gdalevsky, Garik; Vyazmensky, Maria; Marks, Robert S.; Taube, Ran
2015-01-01
Chemokine G protein coupled receptors, principally CCR5 or CXCR4, function as co-receptors for HIV-1 entry into CD4+ T cells. Initial binding of the viral envelope glycoprotein (Env) gp120 subunit to the host CD4 receptor induces a cascade of structural conformational changes that lead to the formation of a high-affinity co-receptor-binding site on gp120. Interaction between gp120 and the co-receptor leads to the exposure of epitopes on the viral gp41 that mediates fusion between viral and cell membranes. Soluble CD4 (sCD4) mimetics can act as an activation-based inhibitor of HIV-1 entry in vitro, as it induces similar structural changes in gp120, leading to increased virus infectivity in the short term but to virus Env inactivation in the long term. Despite promising clinical implications, sCD4 displays low efficiency in vivo, and in multiple HIV strains, it does not inhibit viral infection. This has been attributed to the slow kinetics of the sCD4-induced HIV Env inactivation and to the failure to obtain sufficient sCD4 mimetic levels in the serum. Here we present uniquely structured CCR5 co-receptor mimetics. We hypothesized that such mimetics will enhance sCD4-induced HIV Env inactivation and inhibition of HIV entry. Co-receptor mimetics were derived from CCR5 gp120-binding epitopes and functionalized with a palmitoyl group, which mediated their display on the surface of lipid-coated magnetic beads. CCR5-peptidoliposome mimetics bound to soluble gp120 and inhibited HIV-1 infectivity in a sCD4-dependent manner. We concluded that CCR5-peptidoliposomes increase the efficiency of sCD4 to inhibit HIV infection by acting as bait for sCD4-primed virus, catalyzing the premature discharge of its fusion potential. PMID:26629902
Poli, G
2001-09-01
PRO-140, a monoclonal antibody against the HIV coreceptor CCR5, is under investigation by Progenics and the Aaron Diamond AIDS Research Center (ADARC) as a potential treatment for HIV infection [211441], [286246], [286247]. Phase I/II trials were expected to commence during 2001 [395621], [409142], despite being initially planned for 2000 [322637], [361819], [365216], [375598], [408483]. In January 1998, ADARC and Progenics reported that the HIV binding site on the CCR5 coreceptor is distinct from betachemokine binding domains, which they claimed may allow for the development of therapeutics with fewer side effects [273391], 421256]. In vitro studies have shown PRO-140 potently blocked all of 17 primary HIV isolates that use CCR5 as a fusion coreceptor [342173]. In October 2000, Progenics was awarded an SBIR grant to fund a 2-year project exploring the breadth, potency and durability of PRO-140 therapy in laboratory and animal models of HIV infection. This project was a collaboration between Progenics, Weill Medical College of Cornell University and the Scripps Research Institute [385982]. In May 1999, the company entered into an agreement with Protein Design Labs (PDL) for the humanization by PDL of PRO-140 [325445]. In November 1997, Progenics was awarded a 600,000 dollars grant from the NIAID for the examination of new approaches to HIV vaccine design based on CCR5 [268407].
Structure of the CCR5 Chemokine Receptor-HIV Entry Inhibitor Maraviroc Complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tan, Qiuxiang; Zhu, Ya; Li, Jian
2013-10-21
The CCR5 chemokine receptor acts as a co-receptor for HIV-1 viral entry. Here we report the 2.7 angstrom–resolution crystal structure of human CCR5 bound to the marketed HIV drug maraviroc. The structure reveals a ligand-binding site that is distinct from the proposed major recognition sites for chemokines and the viral glycoprotein gp120, providing insights into the mechanism of allosteric inhibition of chemokine signaling and viral entry. A comparison between CCR5 and CXCR4 crystal structures, along with models of co-receptor–gp120-V3 complexes, suggests that different charge distributions and steric hindrances caused by residue substitutions may be major determinants of HIV-1 co-receptor selectivity.more » These high-resolution insights into CCR5 can enable structure-based drug discovery for the treatment of HIV-1 infection.« less
Adeno-associated virus-2 and its primary cellular receptor-Cryo-EM structure of a heparin complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
O'Donnell, Jason; Taylor, Kenneth A.; Chapman, Michael S.
2009-03-15
Adeno-associated virus serotype 2 (AAV-2) is a leading candidate vector for gene therapy. Cell entry starts with attachment to a primary receptor, Heparan Sulfate Proteoglycan (HSPG) before binding to a co-receptor. Here, cryo-electron microscopy provides direct visualization of the virus-HSPG interactions. Single particle analysis was performed on AAV-2 complexed with a 17 kDa heparin fragment at 8.3 A resolution. Heparin density covers the shoulder of spikes surrounding viral 3-fold symmetry axes. Previously implicated, positively charged residues R{sub 448/585}, R{sub 451/588} and R{sub 350/487} from another subunit cluster at the center of the heparin footprint. The footprint is much more extensivemore » than apparent through mutagenesis, including R{sub 347/484}, K{sub 395/532} and K{sub 390/527} that are more conserved, but whose roles have been controversial. It also includes much of a region proposed as a co-receptor site, because prior studies had not revealed heparin interactions. Heparin density bridges over the viral 3-fold axes, indicating multi-valent attachment to symmetry-related binding sites.« less
Ma, Xiaochu; Lu, Maolin; Gorman, Jason; Terry, Daniel S; Hong, Xinyu; Zhou, Zhou; Zhao, Hong; Altman, Roger B; Arthos, James; Blanchard, Scott C; Kwong, Peter D; Munro, James B; Mothes, Walther
2018-03-21
HIV-1 entry into cells requires binding of the viral envelope glycoprotein (Env) to receptor CD4 and coreceptor. Imaging of individual Env molecules on native virions shows Env trimers to be dynamic, spontaneously transitioning between three distinct well-populated conformational states: a pre-triggered Env (State 1), a default intermediate (State 2) and a three-CD4-bound conformation (State 3), which can be stabilized by binding of CD4 and coreceptor-surrogate antibody 17b. Here, using single-molecule Fluorescence Resonance Energy Transfer (smFRET), we show the default intermediate configuration to be asymmetric, with individual protomers adopting distinct conformations. During entry, this asymmetric intermediate forms when a single CD4 molecule engages the trimer. The trimer can then transition to State 3 by binding additional CD4 molecules and coreceptor.
Salzwedel, Karl; Smith, Erica D.; Dey, Barna; Berger, Edward A.
2000-01-01
We devised an experimental system to examine sequential events by which the human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein (Env) interacts with CD4 and coreceptor to induce membrane fusion. Recombinant soluble CD4 (sCD4) activated fusion between effector cells expressing Env and target cells expressing coreceptor (CCR5 or CXCR4) but lacking CD4. sCD4-activated fusion was dose dependent, occurred comparably with two- and four-domain proteins, and demonstrated Env-coreceptor specificities parallel to those reported in conventional fusion and infectivity systems. Fusion activation occurred upon sCD4 preincubation and washing of the Env-expressing effector cells but not the coreceptor-bearing target cells, thereby demonstrating that sCD4 exerts its effects by acting on Env. These findings provide direct functional evidence for a sequential two-step model of Env-receptor interactions, whereby gp120 binds first to CD4 and becomes activated for subsequent functional interaction with coreceptor, leading to membrane fusion. We used the sCD4-activated system to explore neutralization by the anti-gp120 human monoclonal antibodies 17b and 48d. These antibodies reportedly bind conserved CD4-induced epitopes involved in coreceptor interactions but neutralize HIV-1 infection only weakly. We found that 17b and 48d had minimal effects in the standard cell fusion system using target cells expressing both CD4 and coreceptor but potently blocked sCD4-activated fusion with target cells expressing coreceptor alone. Both antibodies strongly inhibited sCD4-activated fusion by Envs from genetically diverse HIV-1 isolates. Thus, the sCD4-activated system reveals conserved Env-blocking epitopes that are masked in native Env and hence not readily detected by conventional systems. PMID:10590121
Boschert, V.; Frisch, C.; Back, J. W.; van Pee, K.; Weidauer, S. E.; Muth, E.-M.; Schmieder, P.; Beerbaum, M.; Knappik, A.; Timmerman, P.
2016-01-01
The glycoprotein sclerostin has been identified as a negative regulator of bone growth. It exerts its function by interacting with the Wnt co-receptor LRP5/6, blocks the binding of Wnt factors and thereby inhibits Wnt signalling. Neutralizing anti-sclerostin antibodies are able to restore Wnt activity and enhance bone growth thereby presenting a new osteoanabolic therapy approach for diseases such as osteoporosis. We have generated various Fab antibodies against human and murine sclerostin using a phage display set-up. Biochemical analyses have identified one Fab developed against murine sclerostin, AbD09097 that efficiently neutralizes sclerostin's Wnt inhibitory activity. In vitro interaction analysis using sclerostin variants revealed that this neutralizing Fab binds to sclerostin's flexible second loop, which has been shown to harbour the LRP5/6 binding motif. Affinity maturation was then applied to AbD09097, providing a set of improved neutralizing Fab antibodies which particularly bind human sclerostin with enhanced affinity. Determining the crystal structure of AbD09097 provides first insights into how this antibody might recognize and neutralize sclerostin. Together with the structure–function relationship derived from affinity maturation these new data will foster the rational design of new and highly efficient anti-sclerostin antibodies for the therapy of bone loss diseases such as osteoporosis. PMID:27558933
WC1 is a hybrid γδ TCR coreceptor and pattern recognition receptor for pathogenic bacteria.
Hsu, Haoting; Chen, Chuang; Nenninger, Ariel; Holz, Lauren; Baldwin, Cynthia L; Telfer, Janice C
2015-03-01
WC1 proteins are uniquely expressed on γδ T cells and belong to the scavenger receptor cysteine-rich (SRCR) superfamily. While present in variable, and sometimes high, numbers in the genomes of mammals and birds, in cattle there are 13 distinct genes (WC1-1 to WC1-13). All bovine WC1 proteins can serve as coreceptors for the TCR in a tyrosine phosphorylation dependent manner, and some are required for the γδ T cell response to Leptospira. We hypothesized that individual WC1 receptors encode Ag specificity via coligation of bacteria with the γδ TCR. SRCR domain binding was directly correlated with γδ T cell response, as WC1-3 SRCR domains from Leptospira-responsive cells, but not WC1-4 SRCR domains from Leptospira-nonresponsive cells, bound to multiple serovars of two Leptospira species, L. borgpetersenii, and L. interrogans. Three to five of eleven WC1-3 SRCR domains, but none of the eleven WC1-4 SRCR domains, interacted with Leptospira spp. and Borrelia burgdorferi, but not with Escherichia coli or Staphylococcus aureus. Mutational analysis indicated that the active site for bacterial binding in one of the SRCR domains is composed of amino acids in three discontinuous regions. Recombinant WC1 SRCR domains with the ability to bind leptospires inhibited Leptospira growth. Our data suggest that WC1 gene arrays play a multifaceted role in the γδ T cell response to bacteria, including acting as hybrid pattern recognition receptors and TCR coreceptors, and they may function as antimicrobials. Copyright © 2015 by The American Association of Immunologists, Inc.
Energetics of Endotoxin Recognition in the Toll-Like Receptor 4 Innate Immune Response.
Paramo, Teresa; Tomasio, Susana M; Irvine, Kate L; Bryant, Clare E; Bond, Peter J
2015-12-09
Bacterial outer membrane lipopolysaccharide (LPS) potently stimulates the mammalian innate immune system, and can lead to sepsis, the primary cause of death from infections. LPS is sensed by Toll-like receptor 4 (TLR4) in complex with its lipid-binding coreceptor MD-2, but subtle structural variations in LPS can profoundly modulate the response. To better understand the mechanism of LPS-induced stimulation and bacterial evasion, we have calculated the binding affinity to MD-2 of agonistic and antagonistic LPS variants including lipid A, lipid IVa, and synthetic antagonist Eritoran, and provide evidence that the coreceptor is a molecular switch that undergoes ligand-induced conformational changes to appropriately activate or inhibit the receptor complex. The plasticity of the coreceptor binding cavity is shown to be essential for distinguishing between ligands, whilst similar calculations for a model bacterial LPS bilayer reveal the "membrane-like" nature of the protein cavity. The ability to predict the activity of LPS variants should facilitate the rational design of TLR4 therapeutics.
Energetics of Endotoxin Recognition in the Toll-Like Receptor 4 Innate Immune Response
Paramo, Teresa; Tomasio, Susana M.; Irvine, Kate L.; Bryant, Clare E.; Bond, Peter J.
2015-01-01
Bacterial outer membrane lipopolysaccharide (LPS) potently stimulates the mammalian innate immune system, and can lead to sepsis, the primary cause of death from infections. LPS is sensed by Toll-like receptor 4 (TLR4) in complex with its lipid-binding coreceptor MD-2, but subtle structural variations in LPS can profoundly modulate the response. To better understand the mechanism of LPS-induced stimulation and bacterial evasion, we have calculated the binding affinity to MD-2 of agonistic and antagonistic LPS variants including lipid A, lipid IVa, and synthetic antagonist Eritoran, and provide evidence that the coreceptor is a molecular switch that undergoes ligand-induced conformational changes to appropriately activate or inhibit the receptor complex. The plasticity of the coreceptor binding cavity is shown to be essential for distinguishing between ligands, whilst similar calculations for a model bacterial LPS bilayer reveal the “membrane-like” nature of the protein cavity. The ability to predict the activity of LPS variants should facilitate the rational design of TLR4 therapeutics. PMID:26647780
Lefty Blocks a Subset of TGFβ Signals by Antagonizing EGF-CFC Coreceptors
Cheng, Simon K; Olale, Felix; Brivanlou, Ali H
2004-01-01
Members of the EGF-CFC family play essential roles in embryonic development and have been implicated in tumorigenesis. The TGFβ signals Nodal and Vg1/GDF1, but not Activin, require EGF-CFC coreceptors to activate Activin receptors. We report that the TGFβ signaling antagonist Lefty also acts through an EGF-CFC-dependent mechanism. Lefty inhibits Nodal and Vg1 signaling, but not Activin signaling. Lefty genetically interacts with EGF-CFC proteins and competes with Nodal for binding to these coreceptors. Chimeras between Activin and Nodal or Vg1 identify a 14 amino acid region that confers independence from EGF-CFC coreceptors and resistance to Lefty. These results indicate that coreceptors are targets for both TGFβ agonists and antagonists and suggest that subtle sequence variations in TGFβ signals result in greater ligand diversity. PMID:14966532
EMMPRIN/CD147 is a novel coreceptor of VEGFR-2 mediating its activation by VEGF.
Khayati, Farah; Pérez-Cano, Laura; Maouche, Kamel; Sadoux, Aurélie; Boutalbi, Zineb; Podgorniak, Marie-Pierre; Maskos, Uwe; Setterblad, Niclas; Janin, Anne; Calvo, Fabien; Lebbé, Céleste; Menashi, Suzanne; Fernandez-Recio, Juan; Mourah, Samia
2015-01-01
EMMPRIN/CD147 is mainly known for its protease inducing function but a role in promoting tumor angiogenesis has also been demonstrated. This study provides evidence that EMMPRIN is a new coreceptor for the VEGFR-2 tyrosine kinase receptor in both endothelial and tumor cells, as it directly interacts with it and regulates its activation by its VEGF ligand, signalling and functional consequences both in vitro and in vivo. Computational docking analyses and mutagenesis studies identified a molecular binding site in the extracellular domain of EMMPRIN located close to the cell membrane and containing the amino acids 195/199. EMMPRIN is overexpressed in cancer and hence is able to further potentiate VEGFR-2 activation, suggesting that a combinatory therapy of an antiangiogenic drug together with an inhibitor of EMMPRIN/VEGFR-2 interaction may have a greater impact on inhibiting angiogenesis and malignancy.
EMMPRIN/CD147 is a novel coreceptor of VEGFR-2 mediating its activation by VEGF
Khayati, Farah; Pérez-Cano, Laura; Maouche, Kamel; Sadoux, Aurélie; Boutalbi, Zineb; Podgorniak, Marie-Pierre; Maskos, Uwe; Setterblad, Niclas; Janin, Anne; Calvo, Fabien; Lebbé, Céleste; Menashi, Suzanne; Fernandez-Recio, Juan; Mourah, Samia
2015-01-01
EMMPRIN/CD147 is mainly known for its protease inducing function but a role in promoting tumor angiogenesis has also been demonstrated. This study provides evidence that EMMPRIN is a new coreceptor for the VEGFR-2 tyrosine kinase receptor in both endothelial and tumor cells, as it directly interacts with it and regulates its activation by its VEGF ligand, signalling and functional consequences both in vitro and in vivo. Computational docking analyses and mutagenesis studies identified a molecular binding site in the extracellular domain of EMMPRIN located close to the cell membrane and containing the amino acids 195/199. EMMPRIN is overexpressed in cancer and hence is able to further potentiate VEGFR-2 activation, suggesting that a combinatory therapy of an antiangiogenic drug together with an inhibitor of EMMPRIN/VEGFR-2 interaction may have a greater impact on inhibiting angiogenesis and malignancy. PMID:25825981
Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.
2015-01-01
Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613
Negatively Cooperative Binding of High Density Lipoprotein to the HDL Receptor SR-BI†
Nieland, Thomas J.F.; Xu, Shangzhe; Penman, Marsha; Krieger, Monty
2011-01-01
Scavenger receptor class B, type I (SR-BI) is a high-density lipoprotein (HDL) receptor, which also binds low density lipoprotein (LDL), and mediates the cellular selective uptake of cholesteryl esters from lipoproteins. SR-BI also is a co-receptor for hepatitis C virus and a signaling receptor that regulates cell metabolism. Many investigators have reported that lipoproteins bind to SR-BI via a single class of independent (not interacting), high affinity binding sites (one site model). We have re-investigated the ligand concentration dependence of 125I-HDL binding to SR-BI and SR-BI-mediated specific uptake of [3H]CE from [3H]CE-HDL using an expanded range of ligand concentrations (<1 µg protein/ml, lower than previously reported). Scatchard and non-linear least squares model fitting analyses of the binding and uptake data were both inconsistent with a single class of independent binding sites binding univalent lipoprotein ligands. The data are best fit by models in which SR-BI has either two independent classes of binding sites, or one class of sites exhibiting negative cooperativity due to either classic allostery or ensemble effects (‘ lattice model’). Similar results were observed for LDL. Application of the ‘infinite dilution’ dissociation rate method established that the binding of 125I-HDL to SR-BI at 4 °C exhibits negative cooperativity. The unexpected complexity of the interactions of lipoproteins with SR-BI should be taken into account when interpreting the results of experiments that explore the mechanism(s) by which SR-BI mediates ligand binding, lipid transport and cell signaling. PMID:21254782
Richard, Jonathan; Pacheco, Beatriz; Gohain, Neelakshi; Veillette, Maxime; Ding, Shilei; Alsahafi, Nirmin; Tolbert, William D; Prévost, Jérémie; Chapleau, Jean-Philippe; Coutu, Mathieu; Jia, Manxue; Brassard, Nathalie; Park, Jongwoo; Courter, Joel R; Melillo, Bruno; Martin, Loïc; Tremblay, Cécile; Hahn, Beatrice H; Kaufmann, Daniel E; Wu, Xueling; Smith, Amos B; Sodroski, Joseph; Pazgier, Marzena; Finzi, Andrés
2016-10-01
Human immunodeficiency virus type 1 (HIV-1) has evolved a sophisticated strategy to conceal conserved epitopes of its envelope glycoproteins (Env) recognized by antibody-dependent cellular cytotoxicity (ADCC)-mediating antibodies. These antibodies, which are present in the sera of most HIV-1-infected individuals, preferentially recognize Env in its CD4-bound conformation. Accordingly, recent studies showed that small CD4-mimetics (CD4mc) able to "push" Env into this conformation sensitize HIV-1-infected cells to ADCC mediated by HIV+ sera. Here we test whether CD4mc also expose epitopes recognized by anti-cluster A monoclonal antibodies such as A32, thought to be responsible for the majority of ADCC activity present in HIV+ sera and linked to decreased HIV-1 transmission in the RV144 trial. We made the surprising observation that CD4mc are unable to enhance recognition of HIV-1-infected cells by this family of antibodies in the absence of antibodies such as 17b, which binds a highly conserved CD4-induced epitope overlapping the co-receptor binding site (CoRBS). Our results indicate that CD4mc initially open the trimeric Env enough to allow the binding of CoRBS antibodies but not anti-cluster A antibodies. CoRBS antibody binding further opens the trimeric Env, allowing anti-cluster A antibody interaction and sensitization of infected cells to ADCC. Therefore, ADCC responses mediated by cluster A antibodies in HIV-positive sera involve a sequential opening of the Env trimer on the surface of HIV-1-infected cells. The understanding of the conformational changes required to expose these vulnerable Env epitopes might be important in the design of new strategies aimed at fighting HIV-1. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
P2X1 Receptor Antagonists Inhibit HIV-1 Fusion by Blocking Virus-Coreceptor Interactions
Giroud, Charline; Marin, Mariana; Hammonds, Jason; Spearman, Paul
2015-01-01
ABSTRACT HIV-1 Env glycoprotein-mediated fusion is initiated upon sequential binding of Env to CD4 and the coreceptor CXCR4 or CCR5. Whereas these interactions are thought to be necessary and sufficient to promote HIV-1 fusion, other host factors can modulate this process. Previous studies reported potent inhibition of HIV-1 fusion by selective P2X1 receptor antagonists, including NF279, and suggested that these receptors play a role in HIV-1 entry. Here we investigated the mechanism of antiviral activity of NF279 and found that this compound does not inhibit HIV-1 fusion by preventing the activation of P2X1 channels but effectively blocks the binding of the virus to CXCR4 or CCR5. The notion of an off-target effect of NF279 on HIV-1 fusion is supported by the lack of detectable expression of P2X1 receptors in cells used in fusion experiments and by the fact that the addition of ATP or the enzymatic depletion of ATP in culture medium does not modulate viral fusion. Importantly, NF279 fails to inhibit HIV-1 fusion with cell lines and primary macrophages when added at an intermediate stage downstream of Env-CD4-coreceptor engagement. Conversely, in the presence of NF279, HIV-1 fusion is arrested downstream of CD4 binding but prior to coreceptor engagement. NF279 also antagonizes the signaling function of CCR5, CXCR4, and another chemokine receptor, as evidenced by the suppression of calcium responses elicited by specific ligands and by recombinant gp120. Collectively, our results demonstrate that NF279 is a dual HIV-1 coreceptor inhibitor that interferes with the functional engagement of CCR5 and CXCR4 by Env. IMPORTANCE Inhibition of P2X receptor activity suppresses HIV-1 fusion and replication, suggesting that P2X signaling is involved in HIV-1 entry. However, mechanistic experiments conducted in this study imply that P2X1 receptor is not expressed in target cells or involved in viral fusion. Instead, we found that inhibition of HIV-1 fusion by a specific P2X1 receptor antagonist, NF279, is due to the blocking of virus interactions with both the CXCR4 and CCR5 coreceptors. The ability of NF279 to abrogate cellular calcium signaling induced by the respective chemokines showed that this compound acts as a dual-coreceptor antagonist. P2X1 receptor antagonists could thus represent a new class of dual-coreceptor inhibitors with a structure and a mechanism of action that are distinct from those of known HIV-1 coreceptor antagonists. PMID:26136569
P2X1 Receptor Antagonists Inhibit HIV-1 Fusion by Blocking Virus-Coreceptor Interactions.
Giroud, Charline; Marin, Mariana; Hammonds, Jason; Spearman, Paul; Melikyan, Gregory B
2015-09-01
HIV-1 Env glycoprotein-mediated fusion is initiated upon sequential binding of Env to CD4 and the coreceptor CXCR4 or CCR5. Whereas these interactions are thought to be necessary and sufficient to promote HIV-1 fusion, other host factors can modulate this process. Previous studies reported potent inhibition of HIV-1 fusion by selective P2X1 receptor antagonists, including NF279, and suggested that these receptors play a role in HIV-1 entry. Here we investigated the mechanism of antiviral activity of NF279 and found that this compound does not inhibit HIV-1 fusion by preventing the activation of P2X1 channels but effectively blocks the binding of the virus to CXCR4 or CCR5. The notion of an off-target effect of NF279 on HIV-1 fusion is supported by the lack of detectable expression of P2X1 receptors in cells used in fusion experiments and by the fact that the addition of ATP or the enzymatic depletion of ATP in culture medium does not modulate viral fusion. Importantly, NF279 fails to inhibit HIV-1 fusion with cell lines and primary macrophages when added at an intermediate stage downstream of Env-CD4-coreceptor engagement. Conversely, in the presence of NF279, HIV-1 fusion is arrested downstream of CD4 binding but prior to coreceptor engagement. NF279 also antagonizes the signaling function of CCR5, CXCR4, and another chemokine receptor, as evidenced by the suppression of calcium responses elicited by specific ligands and by recombinant gp120. Collectively, our results demonstrate that NF279 is a dual HIV-1 coreceptor inhibitor that interferes with the functional engagement of CCR5 and CXCR4 by Env. Inhibition of P2X receptor activity suppresses HIV-1 fusion and replication, suggesting that P2X signaling is involved in HIV-1 entry. However, mechanistic experiments conducted in this study imply that P2X1 receptor is not expressed in target cells or involved in viral fusion. Instead, we found that inhibition of HIV-1 fusion by a specific P2X1 receptor antagonist, NF279, is due to the blocking of virus interactions with both the CXCR4 and CCR5 coreceptors. The ability of NF279 to abrogate cellular calcium signaling induced by the respective chemokines showed that this compound acts as a dual-coreceptor antagonist. P2X1 receptor antagonists could thus represent a new class of dual-coreceptor inhibitors with a structure and a mechanism of action that are distinct from those of known HIV-1 coreceptor antagonists. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Coreceptor use in nonhuman primate models of HIV infection.
Sina, Silvana Tasca; Ren, Wuze; Cheng-Mayer, Cecilia
2011-01-27
SIV or SHIV infection of nonhuman primates (NHP) has been used to investigate the impact of coreceptor usage on the composition and dynamics of the CD4+ T cell compartment, mechanisms of disease induction and development of clinical syndrome. As the entire course of infection can be followed, with frequent access to tissue compartments, infection of rhesus macaques with CCR5-tropic SHIVs further allows for study of HIV-1 coreceptor switch after intravenous and mucosal inoculation, with longitudinal and systemic analysis to determine the timing, anatomical sites and cause for the change in envelope glycoprotein and coreceptor preference. Here, we review our current understanding of coreceptor use in NHPs and their impact on the pathobiological characteristics of the infection, and discuss recent advances in NHP studies to uncover the underlying selective pressures for the change in coreceptor preference in vivo.
Wang, Liwen; Qin, Yali; Ilchenko, Serguei; Bohon, Jen; Shi, Wuxian; Cho, Michael W.; Takamoto, Keiji; Chance, Mark R.
2010-01-01
Structural characterization of the HIV envelope protein gp120 is very important to provide an understanding of the protein's immunogenicity and it's binding to cell receptors. So far, crystallographic structure determination of gp120 with an intact V3 loop (in the absence of CD4 co-receptor or antibody) has not been achieved. The third variable region (V3) of the gp120 is immunodominant and contains glycosylation signatures that are essential for co-receptor binding and viral entry to T-cells. In this study, we characterized the structure of the outer domain of gp120 with an intact V3 loop (gp120-OD8) purified from Drosophila S2 cells utilizing mass spectrometry-based approaches. We mapped the glycosylation sites and calculated glycosylation occupancy of gp120-OD8; eleven sites from fifteen glycosylation motifs were determined as having high mannose or hybrid glycosylation structures. The specific glycan moieties of nine glycosylation sites from eight unique glycopeptides were determined by a combination of ECD and CID MS approaches. Hydroxyl radical-mediated protein footprinting coupled with mass spectrometry analysis was employed to provide detailed information on protein structure of gp120-OD8 by directly identifying accessible and hydroxyl radical-reactive side chain residues. Comparison of gp120-OD8 experimental footprinting data with a homology model derived from the ligated CD4/ gp120-OD8 crystal structure revealed a flexible V3 loop structure where the V3 tip may provide contacts with the rest of the protein while residues in the V3 base remain solvent accessible. In addition, the data illustrate interactions between specific sugar moieties and amino acid side chains potentially important to the gp120-OD8 structure. PMID:20825246
Analysis of Physicochemical and Structural Properties Determining HIV-1 Coreceptor Usage
Bozek, Katarzyna; Lengauer, Thomas; Sierra, Saleta; Kaiser, Rolf; Domingues, Francisco S.
2013-01-01
The relationship of HIV tropism with disease progression and the recent development of CCR5-blocking drugs underscore the importance of monitoring virus coreceptor usage. As an alternative to costly phenotypic assays, computational methods aim at predicting virus tropism based on the sequence and structure of the V3 loop of the virus gp120 protein. Here we present a numerical descriptor of the V3 loop encoding its physicochemical and structural properties. The descriptor allows for structure-based prediction of HIV tropism and identification of properties of the V3 loop that are crucial for coreceptor usage. Use of the proposed descriptor for prediction results in a statistically significant improvement over the prediction based solely on V3 sequence with 3 percentage points improvement in AUC and 7 percentage points in sensitivity at the specificity of the 11/25 rule (95%). We additionally assessed the predictive power of the new method on clinically derived ‘bulk’ sequence data and obtained a statistically significant improvement in AUC of 3 percentage points over sequence-based prediction. Furthermore, we demonstrated the capacity of our method to predict therapy outcome by applying it to 53 samples from patients undergoing Maraviroc therapy. The analysis of structural features of the loop informative of tropism indicates the importance of two loop regions and their physicochemical properties. The regions are located on opposite strands of the loop stem and the respective features are predominantly charge-, hydrophobicity- and structure-related. These regions are in close proximity in the bound conformation of the loop potentially forming a site determinant for the coreceptor binding. The method is available via server under http://structure.bioinf.mpi-inf.mpg.de/. PMID:23555214
EGF-CFC proteins are essential coreceptors for the TGF-β signals Vg1 and GDF1
Cheng, Simon K.; Olale, Felix; Bennett, James T.; Brivanlou, Ali H.; Schier, Alexander F.
2003-01-01
The TGF-β signals Nodal, Activin, GDF1, and Vg1 have been implicated in mesoderm induction and left-right patterning. Nodal and Activin both activate Activin receptors, but only Nodal requires EGF-CFC coreceptors for signaling. We report that Vg1 and GDF1 signaling in zebrafish also depends on EGF-CFC proteins, but not on Nodal signals. Correspondingly, we find that in Xenopus Vg1 and GDF1 bind to and signal through Activin receptors only in the presence of EGF-CFC proteins. These results establish that multiple TGF-β signals converge on Activin receptor/EGF-CFC complexes and suggest a more widespread requirement for coreceptors in TGF-β signaling than anticipated previously. PMID:12514096
Whitcomb, Jeannette M.; Huang, Wei; Fransen, Signe; Limoli, Kay; Toma, Jonathan; Wrin, Terri; Chappey, Colombe; Kiss, Linda D. B.; Paxinos, Ellen E.; Petropoulos, Christos J.
2007-01-01
Most human immunodeficiency virus type 1 (HIV-1) strains require either the CXCR4 or CCR5 chemokine receptor to efficiently enter cells. Blocking viral binding to these coreceptors is an attractive therapeutic target. Currently, several coreceptor antagonists are being evaluated in clinical trials that require characterization of coreceptor tropism for enrollment. In this report, we describe the development of an automated and accurate procedure for determining HIV-1 coreceptor tropism (Trofile) and its validation for routine laboratory testing. HIV-1 pseudoviruses are generated using full-length env genes derived from patient virus populations. Coreceptor tropism is determined by measuring the abilities of these pseudovirus populations to efficiently infect CD4+/U87 cells expressing either the CXCR4 or CCR5 coreceptor. Viruses exclusively and efficiently infecting CXCR4+/CD4+/U87 cells are designated X4-tropic. Conversely, viruses exclusively and efficiently infecting CCR5+/CD4+/U87 cells are designated R5-tropic. Viruses capable of infecting both CXCR4+/CD4+/U87 and CCR5+/CD4+/U87 cells are designated dual/mixed-tropic. Assay accuracy and reproducibility were established by evaluating the tropisms of well-characterized viruses and the variability among replicate results from samples tested repeatedly. The viral subtype, hepatitis B virus or hepatitis C virus coinfection, and the plasma viral load did not affect assay performance. Minority subpopulations with alternate tropisms were reliably detected when present at 5 to 10%. The plasma viral load above which samples can be amplified efficiently in the Trofile assay is 1,000 copies per ml of plasma. Trofile has been automated for high-throughput use; it can be used to identify patients most likely to benefit from treatment regimens that include a coreceptor inhibitor and to monitor patients on treatment for the emergence of resistant virus populations that switch coreceptor tropism. PMID:17116663
In vivo emergence of HIV-1 highly sensitive to neutralizing antibodies.
Aasa-Chapman, Marlén M I; Cheney, Kelly M; Hué, Stéphane; Forsman, Anna; O'Farrell, Stephen; Pellegrino, Pierre; Williams, Ian; McKnight, Áine
2011-01-01
The rapid and continual viral escape from neutralizing antibodies is well documented in HIV-1 infection. Here we report in vivo emergence of viruses with heightened sensitivity to neutralizing antibodies, sometimes paralleling the development of neutralization escape. Sequential viral envs were amplified from seven HIV-1 infected men monitored from seroconversion up to 5 years after infection. Env-recombinant infectious molecular clones were generated and tested for coreceptor use, macrophage tropism and neutralization sensitivity to homologous and heterologous serum, soluble CD4 and monoclonal antibodies IgG1b12, 2G12 and 17b. We found that HIV-1 evolves sensitivity to contemporaneous neutralizing antibodies during infection. Neutralization sensitive viruses grow out even when potent autologous neutralizing antibodies are present in patient serum. Increased sensitivity to neutralization was associated with susceptibility of the CD4 binding site or epitopes induced after CD4 binding, and mediated by complex envelope determinants including V3 and V4 residues. The development of neutralization sensitive viruses occurred without clinical progression, coreceptor switch or change in tropism for primary macrophages. We propose that an interplay of selective forces for greater virus replication efficiency without the need to resist neutralizing antibodies in a compartment protected from immune surveillance may explain the temporal course described here for the in vivo emergence of HIV-1 isolates with high sensitivity to neutralizing antibodies.
Prediction of HIV-1 coreceptor usage (tropism) by sequence analysis using a genotypic approach.
Sierra, Saleta; Kaiser, Rolf; Lübke, Nadine; Thielen, Alexander; Schuelter, Eugen; Heger, Eva; Däumer, Martin; Reuter, Stefan; Esser, Stefan; Fätkenheuer, Gerd; Pfister, Herbert; Oette, Mark; Lengauer, Thomas
2011-12-01
Maraviroc (MVC) is the first licensed antiretroviral drug from the class of coreceptor antagonists. It binds to the host coreceptor CCR5, which is used by the majority of HIV strains in order to infect the human immune cells (Fig. 1). Other HIV isolates use a different coreceptor, the CXCR4. Which receptor is used, is determined in the virus by the Env protein (Fig. 2). Depending on the coreceptor used, the viruses are classified as R5 or X4, respectively. MVC binds to the CCR5 receptor inhibiting the entry of R5 viruses into the target cell. During the course of disease, X4 viruses may emerge and outgrow the R5 viruses. Determination of coreceptor usage (also called tropism) is therefore mandatory prior to administration of MVC, as demanded by EMA and FDA. The studies for MVC efficiency MOTIVATE, MERIT and 1029 have been performed with the Trofile assay from Monogram, San Francisco, U.S.A. This is a high quality assay based on sophisticated recombinant tests. The acceptance for this test for daily routine is rather low outside of the U.S.A., since the European physicians rather tend to work with decentralized expert laboratories, which also provide concomitant resistance testing. These laboratories have undergone several quality assurance evaluations, the last one being presented in 2011. For several years now, we have performed tropism determinations based on sequence analysis from the HIV env-V3 gene region (V3). This region carries enough information to perform a reliable prediction. The genotypic determination of coreceptor usage presents advantages such as: shorter turnover time (equivalent to resistance testing), lower costs, possibility to adapt the results to the patients' needs and possibility of analysing clinical samples with very low or even undetectable viral load (VL), particularly since the number of samples analysed with VL < 1000 copies/μl roughly increased in the last years (Fig. 3). The main steps for tropism testing (Fig. 4) demonstrated in this video: Collection of a blood sample Isolation of the HIV RNA from the plasma and/or HIV proviral DNA from blood mononuclear cells Amplification of the env region Amplification of the V3 region Sequence reaction of the V3 amplicon Purification of the sequencing samples Sequencing the purified samples Sequence editing Sequencing data interpretation and tropism prediction.
Shin, Jeong-Oh; Ankamreddy, Harinarayana; Jakka, Naga Mahesh; Lee, Seokwon; Kim, Un-Kyung; Bok, Jinwoong
2017-01-01
The mammalian inner ear is a complex organ responsible for balance and hearing. Sonic hedgehog (Shh), a member of the Hedgehog (Hh) family of secreted proteins, has been shown to play important roles in several aspects of inner ear development, including dorsoventral axial specification, cochlear elongation, tonotopic patterning, and hair cell differentiation. Hh proteins initiate a downstream signaling cascade by binding to the Patched 1 (Ptch1) receptor. Recent studies have revealed that other types of co-receptors can also mediate Hh signaling, including growth arrest-specific 1 (Gas1), cell-adhesion molecules-related/down-regulated by oncogenes (Cdon), and biregional Cdon binding protein (Boc). However, little is known about the role of these Hh co-receptors in inner ear development. In this study, we examined the expression patterns of Gas1, Cdon, and Boc, as well as that of Ptch1, in the developing mouse inner ear from otocyst (embryonic day (E) 9.5) until birth and in the developing middle ear at E15.5. Ptch1, a readout of Hh signaling, was expressed in a graded pattern in response to Shh signaling throughout development. Expression patterns of Gas1, Cdon, and Boc differed from that of Ptch1, and each Hh co-receptor was expressed in specific cells and domains in the developing inner and middle ear. These unique and differential expression patterns of Hh co-receptors suggest their roles in mediating various time- and space-specific functions of Shh during ear development.
Diestel, Uschi; Resch, Marcus; Meinhardt, Kathrin; Weiler, Sigrid; Hellmann, Tina V.; Mueller, Thomas D.; Nickel, Joachim; Eichler, Jutta; Muller, Yves A.
2013-01-01
The zona pellucida (ZP) domain is present in extracellular proteins such as the zona pellucida proteins and tectorins and participates in the formation of polymeric protein networks. However, the ZP domain also occurs in the cytokine signaling co-receptor transforming growth factor β (TGF-β) receptor type 3 (TGFR-3, also known as betaglycan) where it contributes to cytokine ligand recognition. Currently it is unclear how the ZP domain architecture enables this dual functionality. Here, we identify a novel major TGF-β-binding site in the FG loop of the C-terminal subdomain of the murine TGFR-3 ZP domain (ZP-C) using protein crystallography, limited proteolysis experiments, surface plasmon resonance measurements and synthetic peptides. In the murine 2.7 Å crystal structure that we are presenting here, the FG-loop is disordered, however, well-ordered in a recently reported homologous rat ZP-C structure. Surprisingly, the adjacent external hydrophobic patch (EHP) segment is registered differently in the rat and murine structures suggesting that this segment only loosely associates with the remaining ZP-C fold. Such a flexible and temporarily-modulated association of the EHP segment with the ZP domain has been proposed to control the polymerization of ZP domain-containing proteins. Our findings suggest that this flexibility also extends to the ZP domain of TGFR-3 and might facilitate co-receptor ligand interaction and presentation via the adjacent FG-loop. This hints that a similar C-terminal region of the ZP domain architecture possibly regulates both the polymerization of extracellular matrix proteins and cytokine ligand recognition of TGFR-3. PMID:23826237
Role of RGM coreceptors in bone morphogenetic protein signaling
Halbrooks, Peter J; Ding, Ru; Wozney, John M; Bain, Gerard
2007-01-01
Background The repulsive guidance molecule (RGM) proteins, originally discovered for their roles in neuronal development, have been recently identified as co-receptors in the bone morphogenetic protein (BMP) signaling pathway. BMPs are members of the TGFβ superfamily of signaling cytokines, and serve to regulate many aspects of cellular growth and differentiation. Results Here, we investigate whether RGMa, RGMb, and RGMc play required roles in BMP and TGFβ signaling in the mouse myoblast C2C12 cell line. These cells are responsive to BMPs and are frequently used to study BMP/TGFβ signaling pathways. Using siRNA reagents to specifically knock down each RGM protein, we show that the RGM co-receptors are required for significant BMP signaling as reported by two cell-based BMP activity assays: endogenous alkaline phosphatase activity and a luciferase-based BMP reporter assay. Similar cell-based assays using a TGFβ-induced luciferase reporter show that the RGM co-receptors are not required for TGFβ signaling. The binding interaction of each RGM co-receptor to each of BMP2 and BMP12 is observed and quantified, and equilibrium dissociation constants in the low nanomolar range are reported. Conclusion Our results demonstrate that the RGMs play a significant role in BMP signaling and reveal that these molecules cannot functionally compensate for one another. PMID:17615080
A look at plant immunity through the window of the multitasking coreceptor BAK1.
Yasuda, Shigetaka; Okada, Kentaro; Saijo, Yusuke
2017-08-01
Recognition of microbe- and danger-associated molecular patterns (MAMPs and DAMPs, respectively) by pattern recognition receptors (PRRs) is central to innate immunity in both plants and animals. The plant PRRs described to date are all cell surface-localized receptors. According to their ligand-binding ectodomains, each PRR engages a specific coreceptor or adaptor kinase in its signaling complexes to regulate defense signaling. With a focus on the coreceptor RLK BRI1-ASSOCIATED RECEPTOR KINASE1 (BAK1) and related SOMATIC EMBRYOGENESIS RECEPTOR KINASEs (SERKs), here we review the increasing inventory of BAK1 partners and their functions in plant immunity. We also discuss the significance of autoimmunity triggered by BAK1/SERK4 disintegration in shaping the strategies for attenuation of PRR signaling by infectious microbes and host plants. Copyright © 2017 Elsevier Ltd. All rights reserved.
Tonsil Epithelial Factors May Influence Oropharyngeal Human Immunodeficiency Virus Transmission
Moutsopoulos, Niki M.; Nares, Salvador; Nikitakis, Nikolaos; Rangel, Zoila; Wen, Jie; Munson, Peter; Sauk, John; Wahl, Sharon M.
2007-01-01
Tonsil epithelium has been implicated in human immunodeficiency virus (HIV) pathogenesis, but its role in oral transmission remains controversial. To study characteristics of this tissue, which may influence susceptibility or resistance to HIV, we performed microarray analysis of the tonsil epithelium. Our data revealed that genes related to immune functions such as antibody production and antigen processing were increasingly expressed in tonsil compared with the epithelium of another oropharyngeal site, the gingival epithelium. Importantly, tonsil epithelium highly expressed genes associated with HIV entrapment and/or transmission, including the HIV co-receptor CXCR4 and the potential HIV-binding molecules FcRγIII, complement receptor 2, and various complement components. Immunohistochemical staining confirmed the increased presence of CXCR4 in the tonsil epithelium compared with multiple oral epithelial sites, particularly in basal and parabasal layers. This increased expression of molecules involved in viral recognition, binding, and entry may favor virus-epithelium interactions in an environment with reduced innate antiviral mechanisms. Specifically, secretory leukocyte protease inhibitor, an innate molecule with anti-HIV activity, was minimal in the tonsil epithelium, in contrast to oral mucosa. Collectively, our data suggest that increased expression of molecules associated with HIV binding and entry coupled with decreased innate antiviral factors may render the tonsil a potential site for oral transmission. PMID:17620369
HIV and Drug Resistance: Hitting a Moving Target | Center for Cancer Research
Prior research revealed how HIV-1 makes its destructive entry into the target cell by fusing together the cholesterol-rich lipid bilayer of the viral envelope—made with key glycoproteins gp120 and gp41—and the host cell’s plasma membrane. Cell-viral interactions begin with the binding of gp120 to the CD4 receptor molecule on the target cell, followed by gp120 binding to coreceptors. These coreceptors likely reside in structures called lipid rafts—areas in the cell plasma membrane that are rich in cholesterol, saturated fatty acids, and certain proteins that facilitate the entry of viruses into host cells. Finally, sequences in gp41 trigger the fusion of the viral and cellular lipid bilayers. The lipid rafts are then involved in the production of new viral particles.
Left-right axis asymmetry determining human Cryptic gene is transcriptionally repressed by Snail.
Gupta, Kartik; Pilli, Vijaya Satish Sekhar; Aradhyam, Gopala Krishna
2016-10-28
Establishment of the left-right axis is important for positioning organs asymmetrically in the developing vertebrate-embryo. A number of factors like maternally deposited molecules have emerged essential in initiating the specification of the axis; the downstream events, however, are regulated by signal-transduction and gene-expression changes identifying which remains a crucial challenge. The EGF-CFC family member Cryptic, that functions as a co-receptor for some TGF-beta ligands, is developmentally expressed in higher mammals and mutations in the gene cause loss or change in left-right axis asymmetry. Despite the strong phenotype, no transcriptional-regulator of this gene is known till date. Using promoter-analyses tools, we found strong evidence that the developmentally essential transcription factor Snail binds to the human Cryptic-promoter. We cloned the promoter-region of human Cryptic in a reporter gene and observed decreased Cryptic-promoter activation upon increasing Snail expression. Further, the expression of Cryptic is down-regulated upon exogenous Snail expression, validating the reporter assays and the previously identified role of Snail as a transcriptional repressor. Finally, we demonstrate using gel-shift assay that Snail in nuclear extract of PANC1 cells interacts with the promoter-construct bearing putative Snail binding sites and confirm this finding using chromatin immunoprecipitation assay. Snail represses the expression of human Cryptic and therefore, might affect the signaling via Nodal that has previously been demonstrated to specify the left-right axis using the EGF-CFC co-receptors.
The molecular determinants of CD8 co-receptor function.
Cole, David K; Laugel, Bruno; Clement, Mathew; Price, David A; Wooldridge, Linda; Sewell, Andrew K
2012-10-01
CD8(+) T cells respond to signals mediated through a specific interaction between the T-cell receptor (TCR) and a composite antigen in the form of an epitopic peptide bound between the polymorphic α1 and α2 helices of an MHC class I (MHCI) molecule. The CD8 glycoprotein 'co-receives' antigen by binding to an invariant region of the MHCI molecule and can enhance ligand recognition by up to 1 million-fold. In recent years, a number of structural and biophysical investigations have shed light on the role of the CD8 co-receptor during T-cell antigen recognition. Here, we provide a collated resource for these data, and discuss how the structural and biophysical parameters governing CD8 co-receptor function further our understanding of T-cell cross-reactivity and the productive engagement of low-affinity antigenic ligands. © 2012 The Authors. Immunology © 2012 Blackwell Publishing Ltd.
Calvanese, Luisa; Focà, Annalia; Sandomenico, Annamaria; Focà, Giuseppina; Caporale, Andrea; Doti, Nunzianna; Iaccarino, Emanuela; Leonardi, Antonio; D'Auria, Gabriella; Ruvo, Menotti; Falcigno, Lucia
2017-12-15
Nodal is a growth factor expressed during early embryonic development, but reactivated in several advanced-stage cancers. Targeting of Nodal signaling, which occurs via the binding to Cripto-1 co-receptor, results in inhibition of cell aggressiveness and reduced tumor growth. The Nodal binding region to Cripto-1 was identified and targeted with a high affinity monoclonal antibody (3D1). By STD-NMR technique, we investigated the interaction of Nodal fragments with 3D1 with the aim to elucidate at atomic level the interaction surface. Data indicate with high accuracy the antibody-antigen contact atoms and confirm the information previously obtained by immune-enzymatic methods. Main residues contacted by 3D1 are P46, V47, E49 and E50, which belong to the Nodal loop involved in the interaction with the co-receptor. Copyright © 2017 Elsevier Ltd. All rights reserved.
Identification of a D-amino acid decapeptide HIV-1 entry inhibitor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boggiano, Cesar; Jiang Shibo; Lu Hong
2006-09-08
Entry of human immunodeficiency virus type 1 (HIV-1) virion into host cells involves three major steps, each being a potential target for the development of entry inhibitors: gp120 binding to CD4, gp120-CD4 complex interacting with a coreceptor, and gp41 refolding to form a six-helix bundle. Using a D-amino acid decapeptide combinatorial library, we identified peptide DC13 as having potent HIV-1 fusion inhibitory activity, and effectively inhibiting infection by several laboratory-adapted and primary HIV-1 strains. While DC13 did not block binding of gp120 to CD4, nor disrupt the gp41 six-helix bundle formation, it effectively blocked the binding of an anti-CXCR4 monoclonalmore » antibody and chemokine SDF-1{alpha} to CXCR4-expressing cells. However, because R5-using primary viruses were also neutralized, the antiviral activity of DC13 implies additional mode(s) of action. These results suggest that DC13 is a useful HIV-1 coreceptor antagonist for CXCR4 and, due to its biostability and simplicity, may be of value for developing a new class of HIV-1 entry inhibitors.« less
2000-01-01
to sites of inflammation. They may have additional functions. For example analysis of CXCR4 knockout mice show that CXCR4, which is chemotactic for... mice had similar phenotypes (195). Homozygous knockout of CXCR4 or SDF-1 results in embyonic lethality. Though CCR5 appears to be dispensable, other...chemokine receptors have vital functions. CXCR5 knockout mice have B-cell homing defects (118), and CXCR2 knockout mice overproduce B-cells and
2000-01-01
various organs and to sites of inflammation. They may have additional functions. For example analysis of CXCR4 knockout mice show that CXCR4, which...SDF-1 knockout mice had similar phenotypes (195). Homozygous knockout of CXCR4 or SDF-1 results in embyonic lethality. Though CCR5 appears to be...dispensable, other chemokine receptors have vital functions. CXCR5 knockout mice have B-cell homing defects (118), and CXCR2 knockout mice
Dey, Antu K.; Burke, Brian; Sun, Yide; Sirokman, Klara; Nandi, Avishek; Hartog, Karin; Lian, Ying; Geonnotti, Anthony R.; Montefiori, David; Franti, Michael; Martin, Grégoire; Carfi, Andrea; Kessler, Pascal; Martin, Loïc; Srivastava, Indresh K.; Barnett, Susan W.
2012-01-01
The identification of HIV-1 envelope glycoprotein (Env) structures that can generate broadly neutralizing antibodies (BNAbs) is pivotal to the development of a successful vaccine against HIV-1 aimed at eliciting effective humoral immune responses. To that end, the production of novel Env structure(s) that might induce BNAbs by presentation of conserved epitopes, which are otherwise occluded, is critical. Here, we focus on a structure that stabilizes Env in a conformation representative of its primary (CD4) receptor-bound state, thereby exposing highly conserved “CD4 induced” (CD4i) epitope(s) known to be important for co-receptor binding and subsequent virus infection. A CD4-mimetic miniprotein, miniCD4 (M64U1-SH), was produced and covalently complexed to recombinant, trimeric gp140 envelope glycoprotein (gp140) using site-specific disulfide linkages. The resulting gp140-miniCD4 (gp140-S-S-M64U1) complex was recognized by CD4i antibodies and the HIV-1 co-receptor, CCR5. The gp140-miniCD4 complex elicited the highest titers of CD4i binding antibodies as well as enhanced neutralizing antibodies against Tier 1 viruses as compared to gp140 protein alone following immunization of rabbits. Neutralization against HIV-27312/V434M and additional serum mapping confirm the specific elicitation of antibodies directed to the CD4i epitope(s). These results demonstrate the utility of structure-based approach in improving immunogenic response against specific region, such as the CD4i epitope(s) here, and its potential role in vaccine application. PMID:22291921
Honemann-Capito, Mona; Brechtel-Curth, Katja; Hedderich, Marie; Wodarz, Andreas
2014-01-01
Wnt proteins regulate many developmental processes and are required for tissue homeostasis in adult animals. The cellular responses to Wnts are manifold and are determined by the respective Wnt ligand and its specific receptor complex in the plasma membrane. Wnt receptor complexes contain a member of the Frizzled family of serpentine receptors and a co-receptor, which commonly is a single-pass transmembrane protein. Vertebrate protein tyrosine kinase 7 (PTK7) was identified as a Wnt co-receptor required for control of planar cell polarity (PCP) in frogs and mice. We found that flies homozygous for a complete knock-out of the Drosophila PTK7 homolog off track (otk) are viable and fertile and do not show PCP phenotypes. We discovered an otk paralog (otk2, CG8964), which is co-expressed with otk throughout embryonic and larval development. Otk and Otk2 bind to each other and form complexes with Frizzled, Frizzled2 and Wnt2, pointing to a function as Wnt co-receptors. Flies lacking both otk and otk2 are viable but male sterile due to defective morphogenesis of the ejaculatory duct. Overexpression of Otk causes female sterility due to malformation of the oviduct, indicating that Otk and Otk2 are specifically involved in the sexually dimorphic development of the genital tract. PMID:25010066
Linnemannstöns, Karen; Ripp, Caroline; Honemann-Capito, Mona; Brechtel-Curth, Katja; Hedderich, Marie; Wodarz, Andreas
2014-07-01
Wnt proteins regulate many developmental processes and are required for tissue homeostasis in adult animals. The cellular responses to Wnts are manifold and are determined by the respective Wnt ligand and its specific receptor complex in the plasma membrane. Wnt receptor complexes contain a member of the Frizzled family of serpentine receptors and a co-receptor, which commonly is a single-pass transmembrane protein. Vertebrate protein tyrosine kinase 7 (PTK7) was identified as a Wnt co-receptor required for control of planar cell polarity (PCP) in frogs and mice. We found that flies homozygous for a complete knock-out of the Drosophila PTK7 homolog off track (otk) are viable and fertile and do not show PCP phenotypes. We discovered an otk paralog (otk2, CG8964), which is co-expressed with otk throughout embryonic and larval development. Otk and Otk2 bind to each other and form complexes with Frizzled, Frizzled2 and Wnt2, pointing to a function as Wnt co-receptors. Flies lacking both otk and otk2 are viable but male sterile due to defective morphogenesis of the ejaculatory duct. Overexpression of Otk causes female sterility due to malformation of the oviduct, indicating that Otk and Otk2 are specifically involved in the sexually dimorphic development of the genital tract.
Structure of a Potential Therapeutic Antibody Bound to Interleukin-16 (IL-16)
Hall, Gareth; Cullen, Eilish; Sawmynaden, Kovilen; Arnold, Joanne; Fox, Simon; Cowan, Richard; Muskett, Frederick W.; Matthews, David; Merritt, Andrew; Kettleborough, Catherine; Cruikshank, William; Taylor, Debra; Bayliss, Richard; Carr, Mark D.
2016-01-01
Interleukin-16 (IL-16) is reported to be a chemoattractant cytokine and modulator of T-cell activation, and has been proposed as a ligand for the co-receptor CD4. The secreted active form of IL-16 has been detected at sites of TH1-mediated inflammation, such as those seen in autoimmune diseases, ischemic reperfusion injury (IRI), and tissue transplant rejection. Neutralization of IL-16 recruitment to its receptor, using an anti-IL16 antibody, has been shown to significantly attenuate inflammation and disease pathology in IRI, as well as in some autoimmune diseases. The 14.1 antibody is a monoclonal anti-IL-16 antibody, which when incubated with CD4+ cells is reported to cause a reduction in the TH1-type inflammatory response. Secreted IL-16 contains a characteristic PDZ domain. PDZ domains are typically characterized by a defined globular structure, along with a peptide-binding site located in a groove between the αB and βB structural elements and a highly conserved carboxylate-binding loop. In contrast to other reported PDZ domains, the solution structure previously reported for IL-16 reveals a tryptophan residue obscuring the recognition groove. We have solved the structure of the 14.1Fab fragment in complex with IL-16, revealing that binding of the antibody requires a conformational change in the IL-16 PDZ domain. This involves the rotation of the αB-helix, accompanied movement of the peptide groove obscuring tryptophan residue, and consequent opening up of the binding site for interaction. Our study reveals a surprising mechanism of action for the antibody and identifies new opportunities for the development of IL-16-targeted therapeutics, including small molecules that mimic the interaction of the antibody. PMID:27231345
Jasmonate perception by inositol-phosphate-potentiated COI1-JAZ co-receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sheard, Laura B; Tan, Xu; Mao, Haibin
2011-11-07
Jasmonates are a family of plant hormones that regulate plant growth, development and responses to stress. The F-box protein CORONATINE INSENSITIVE 1 (COI1) mediates jasmonate signalling by promoting hormone-dependent ubiquitylation and degradation of transcriptional repressor JAZ proteins. Despite its importance, the mechanism of jasmonate perception remains unclear. Here we present structural and pharmacological data to show that the true Arabidopsis jasmonate receptor is a complex of both COI1 and JAZ. COI1 contains an open pocket that recognizes the bioactive hormone (3R,7S)-jasmonoyl-l-isoleucine (JA-Ile) with high specificity. High-affinity hormone binding requires a bipartite JAZ degron sequence consisting of a conserved {alpha}-helix formore » COI1 docking and a loop region to trap the hormone in its binding pocket. In addition, we identify a third critical component of the jasmonate co-receptor complex, inositol pentakisphosphate, which interacts with both COI1 and JAZ adjacent to the ligand. Our results unravel the mechanism of jasmonate perception and highlight the ability of F-box proteins to evolve as multi-component signalling hubs.« less
Binding of HBGA-expressing bacteria does not protect Tulane virus from acute heat stress
USDA-ARS?s Scientific Manuscript database
Human noroviruses (HuNoVs) are the major cause of gastroenteritis outbreaks worldwide. Human noroviruses can interact with histo-blood group antigens (HBGAs) on the surface of mammalian cells as well as bacterial cells. HBGAs have been considered as putative receptors or co-receptors for HuNoVs in m...
Analysis of the Subunit Stoichiometries in Viral Entry
Magnus, Carsten; Regoes, Roland R.
2012-01-01
Virions of the Human Immunodeficiency Virus (HIV) infect cells by first attaching with their surface spikes to the CD4 receptor on target cells. This leads to conformational changes in the viral spikes, enabling the virus to engage a coreceptor, commonly CCR5 or CXCR4, and consecutively to insert the fusion peptide into the cellular membrane. Finally, the viral and the cellular membranes fuse. The HIV spike is a trimer consisting of three identical heterodimers composed of the gp120 and gp41 envelope proteins. Each of the gp120 proteins in the trimer is capable of attaching to the CD4 receptor and the coreceptor, and each of the three gp41 units harbors a fusion domain. It is still under debate how many of the envelope subunits within a given trimer have to bind to the CD4 receptors and to the coreceptors, and how many gp41 protein fusion domains are required for fusion. These numbers are referred to as subunit stoichiometries. We present a mathematical framework for estimating these parameters individually by analyzing infectivity assays with pseudotyped viruses. We find that the number of spikes that are engaged in mediating cell entry and the distribution of the spike number play important roles for the estimation of the subunit stoichiometries. Our model framework also shows why it is important to subdivide the question of the number of functional subunits within one trimer into the three different subunit stoichiometries. In a second step, we extend our models to study whether the subunits within one trimer cooperate during receptor binding and fusion. As an example for how our models can be applied, we reanalyze a data set on subunit stoichiometries. We find that two envelope proteins have to engage with CD4-receptors and coreceptors and that two fusion proteins must be revealed within one trimer for viral entry. Our study is motivated by the mechanism of HIV entry but the experimental technique and the model framework can be extended to other viral systems as well. PMID:22479399
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Weizao, E-mail: chenw3@mail.nih.gov; Feng, Yang; Wang, Yanping
Highlights: Black-Right-Pointing-Pointer Some recombinant HIV-1 gp120s do not preserve their conformations on gp140s. Black-Right-Pointing-Pointer We hypothesize that CD4i antibodies could induce conformational changes in gp120. Black-Right-Pointing-Pointer CD4i antibodies enhance binding of CD4 and CD4bs antibodies to gp120. Black-Right-Pointing-Pointer CD4i antibody-gp120 fusion proteins could have potential as vaccine immunogens. -- Abstract: Development of successful AIDS vaccine immunogens continues to be a major challenge. One of the mechanisms by which HIV-1 evades antibody-mediated neutralizing responses is the remarkable conformational flexibility of its envelope glycoprotein (Env) gp120. Some recombinant gp120s do not preserve their conformations on gp140s and functional viral spikes, and exhibitmore » decreased recognition by CD4 and neutralizing antibodies. CD4 binding induces conformational changes in gp120 leading to exposure of the coreceptor-binding site (CoRbs). In this study, we test our hypothesis that CD4-induced (CD4i) antibodies, which target the CoRbs, could also induce conformational changes in gp120 leading to better exposed conserved neutralizing antibody epitopes including the CD4-binding site (CD4bs). We found that a mixture of CD4i antibodies with gp120 only weakly enhanced CD4 binding. However, such interactions in single-chain fusion proteins resulted in gp120 conformations which bound to CD4 and CD4bs antibodies better than the original or mutagenically stabilized gp120s. Moreover, the two molecules in the fusion proteins synergized with each other in neutralizing HIV-1. Therefore, fusion proteins of gp120 with CD4i antibodies could have potential as components of HIV-1 vaccines and inhibitors of HIV-1 entry, and could be used as reagents to explore the conformational flexibility of gp120 and mechanisms of entry and immune evasion.« less
Döring, Matthias; Borrego, Pedro; Büch, Joachim; Martins, Andreia; Friedrich, Georg; Camacho, Ricardo Jorge; Eberle, Josef; Kaiser, Rolf; Lengauer, Thomas; Taveira, Nuno; Pfeifer, Nico
2016-12-20
CCR5-coreceptor antagonists can be used for treating HIV-2 infected individuals. Before initiating treatment with coreceptor antagonists, viral coreceptor usage should be determined to ensure that the virus can use only the CCR5 coreceptor (R5) and cannot evade the drug by using the CXCR4 coreceptor (X4-capable). However, until now, no online tool for the genotypic identification of HIV-2 coreceptor usage had been available. Furthermore, there is a lack of knowledge on the determinants of HIV-2 coreceptor usage. Therefore, we developed a data-driven web service for the prediction of HIV-2 coreceptor usage from the V3 loop of the HIV-2 glycoprotein and used the tool to identify novel discriminatory features of X4-capable variants. Using 10 runs of tenfold cross validation, we selected a linear support vector machine (SVM) as the model for geno2pheno[coreceptor-hiv2], because it outperformed the other SVMs with an area under the ROC curve (AUC) of 0.95. We found that SVMs were highly accurate in identifying HIV-2 coreceptor usage, attaining sensitivities of 73.5% and specificities of 96% during tenfold nested cross validation. The predictive performance of SVMs was not significantly different (p value 0.37) from an existing rules-based approach. Moreover, geno2pheno[coreceptor-hiv2] achieved a predictive accuracy of 100% and outperformed the existing approach on an independent data set containing nine new isolates with corresponding phenotypic measurements of coreceptor usage. geno2pheno[coreceptor-hiv2] could not only reproduce the established markers of CXCR4-usage, but also revealed novel markers: the substitutions 27K, 15G, and 8S were significantly predictive of CXCR4 usage. Furthermore, SVMs trained on the amino-acid sequences of the V1 and V2 loops were also quite accurate in predicting coreceptor usage (AUCs of 0.84 and 0.65, respectively). In this study, we developed geno2pheno[coreceptor-hiv2], the first online tool for the prediction of HIV-2 coreceptor usage from the V3 loop. Using our method, we identified novel amino-acid markers of X4-capable variants in the V3 loop and found that HIV-2 coreceptor usage is also influenced by the V1/V2 region. The tool can aid clinicians in deciding whether coreceptor antagonists such as maraviroc are a treatment option and enables epidemiological studies investigating HIV-2 coreceptor usage. geno2pheno[coreceptor-hiv2] is freely available at http://coreceptor-hiv2.geno2pheno.org .
Zhang, Mei-Yun; Yuan, Tingting; Li, Jingjing; Rosa Borges, Andrew; Watkins, Jennifer D.; Guenaga, Javier; Yang, Zheng; Wang, Yanping; Wilson, Richard; Li, Yuxing; Polonis, Victoria R.; Pincus, Seth H.; Ruprecht, Ruth M.; Dimitrov, Dimiter S.
2012-01-01
Identification of broadly cross-reactive HIV-1-neutralizing antibodies (bnAbs) may assist vaccine immunogen design. Here we report a novel human monoclonal antibody (mAb), designated m43, which co-targets the gp120 and gp41 subunits of the HIV-1 envelope glycoprotein (Env). M43 bound to recombinant gp140 s from various primary isolates, to membrane-associated Envs on transfected cells and HIV-1 infected cells, as well as to recombinant gp120 s and gp41 fusion intermediate structures containing N-trimer structure, but did not bind to denatured recombinant gp140 s and the CD4 binding site (CD4bs) mutant, gp120 D368R, suggesting that the m43 epitope is conformational and overlaps the CD4bs on gp120 and the N-trimer structure on gp41. M43 neutralized 34% of the HIV-1 primary isolates from different clades and all the SHIVs tested in assays based on infection of peripheral blood mononuclear cells (PBMCs) by replication-competent virus, but was less potent in cell line-based pseudovirus assays. In contrast to CD4, m43 did not induce Env conformational changes upon binding leading to exposure of the coreceptor binding site, enhanced binding of mAbs 2F5 and 4E10 specific for the membrane proximal external region (MPER) of gp41 Envs, or increased gp120 shedding. The overall modest neutralization activity of m43 is likely due to the limited binding of m43 to functional Envs which could be increased by antibody engineering if needed. M43 may represent a new class of bnAbs targeting conformational epitopes overlapping structures on both gp120 and gp41. Its novel epitope and possibly new mechanism(s) of neutralization could helpdesign improved vaccine immunogens and candidate therapeutics. PMID:22970187
THE RGM/DRAGON FAMILY OF BMP CO-RECEPTORS
Corradini, Elena; Babitt, Jodie L.; Lin, Herbert Y.
2013-01-01
The BMP signaling pathway controls a number of cell processes during development and in adult tissues. At the cellular level, ligands of the BMP family act by binding a hetero-tetrameric signaling complex, composed of two type I and two type II receptors. BMP ligands make use of a limited number of receptors, which in turn activate a common signal transduction cascade at the intracellular level. A complex regulatory network is required in order to activate the signaling cascade at proper times and locations, and to generate specific downstream effects in the appropriate cellular context. One such regulatory mechanism is the repulsive guidance molecule (RGM) family of BMP co-receptors. This article reviews the current knowledge regarding the structure, regulation, and function of RGMs, focusing on known and potential roles of RGMs in physiology and pathophysiology. PMID:19897400
Insect odorant receptors are molecular targets of the insect repellent DEET.
Ditzen, Mathias; Pellegrino, Maurizio; Vosshall, Leslie B
2008-03-28
DEET (N,N-diethyl-meta-toluamide) is the world's most widely used topical insect repellent, with broad effectiveness against most insects. Its mechanism of action and molecular target remain unknown. Here, we show that DEET blocks electrophysiological responses of olfactory sensory neurons to attractive odors in Anopheles gambiae and Drosophila melanogaster. DEET inhibits behavioral attraction to food odors in Drosophila, and this inhibition requires the highly conserved olfactory co-receptor OR83b. DEET inhibits odor-evoked currents mediated by the insect odorant receptor complex, comprising a ligand-binding subunit and OR83b. We conclude that DEET masks host odor by inhibiting subsets of heteromeric insect odorant receptors that require the OR83b co-receptor. The identification of candidate molecular targets for the action of DEET may aid in the design of safer and more effective insect repellents.
Pan, Ruimin; Chen, Yuxin; Vaine, Michael; ...
2015-07-15
The fourth conserved region (C4) in the HIV-1 envelope glycoprotein (Env) gp120 is a structural element that is important for its function, as it binds to both the receptor CD4 and the co-receptor CCR5/CXCR4. It has long been known that this region is highly immunogenic and that it harbors B-cell as well as T-cell epitopes. It is the target of a number of antibodies in animal studies, which are called CD4-blockers. However, the mechanism by which the virus shields itself from such antibody responses is not known. Here, we determined the crystal structure of R53 in complex with its epitopemore » peptide using a novel anti-C4 rabbit monoclonal antibody R53. Our data show that although the epitope of R53 covers a highly conserved sequence 433AMYAPPI 439, it is not available in the gp120 trimer and in the CD4-bound conformation. Our results suggest a masking mechanism to explain how HIV-1 protects this critical region from the human immune system.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pan, Ruimin; Chen, Yuxin; Vaine, Michael
The fourth conserved region (C4) in the HIV-1 envelope glycoprotein (Env) gp120 is a structural element that is important for its function, as it binds to both the receptor CD4 and the co-receptor CCR5/CXCR4. It has long been known that this region is highly immunogenic and that it harbors B-cell as well as T-cell epitopes. It is the target of a number of antibodies in animal studies, which are called CD4-blockers. However, the mechanism by which the virus shields itself from such antibody responses is not known. Here, we determined the crystal structure of R53 in complex with its epitopemore » peptide using a novel anti-C4 rabbit monoclonal antibody R53. Our data show that although the epitope of R53 covers a highly conserved sequence 433AMYAPPI 439, it is not available in the gp120 trimer and in the CD4-bound conformation. Our results suggest a masking mechanism to explain how HIV-1 protects this critical region from the human immune system.« less
USDA-ARS?s Scientific Manuscript database
BRI1 becomes highly phosphorylated in vivo upon perception of the ligand, brassinolide, as a result of autophosphorylation and transphosphorylation by its co-receptor kinase, BAK1. Important autophosphorylation sites include those involved in activation of kinase activity and those that are inhibito...
Falkowska, Emilia; Ramos, Alejandra; Feng, Yu; Zhou, Tongqing; Moquin, Stephanie; Walker, Laura M.; Wu, Xueling; Seaman, Michael S.; Wrin, Terri; Kwong, Peter D.; Wyatt, Richard T.; Mascola, John R.; Poignard, Pascal
2012-01-01
Recently, several broadly neutralizing monoclonal antibodies (bnMAbs) directed to the CD4-binding site (CD4bs) of gp120 have been isolated from HIV-1-positive donors. These include VRC01, 3BNC117, and NIH45-46, all of which are capable of neutralizing about 90% of circulating HIV-1 isolates and all of which induce conformational changes in the HIV-1 gp120 monomer similar to those induced by the CD4 receptor. In this study, we characterize PGV04 (also known as VRC-PG04), a MAb with potency and breadth that rivals those of the prototypic VRC01 and 3BNC117. When screened on a large panel of viruses, the neutralizing profile of PGV04 was distinct from those of CD4, b12, and VRC01. Furthermore, the ability of PGV04 to neutralize pseudovirus containing single alanine substitutions exhibited a pattern distinct from those of the other CD4bs MAbs. In particular, substitutions D279A, I420A, and I423A were found to abrogate PGV04 neutralization. In contrast to VRC01, PGV04 did not enhance the binding of 17b or X5 to their epitopes (the CD4-induced [CD4i] site) in the coreceptor region on the gp120 monomer. Furthermore, in contrast to CD4, none of the anti-CD4bs MAbs induced the expression of the 17b epitope on cell surface-expressed cleaved Env trimers. We conclude that potent CD4bs bnMAbs can display differences in the way they recognize and access the CD4bs and that mimicry of CD4, as assessed by inducing conformational changes in monomeric gp120 that lead to enhanced exposure of the CD4i site, is not uniquely correlated with effective neutralization at the site of CD4 binding on HIV-1. PMID:22345481
THE STRUCTURAL BIOLOGY OF THE FGF19 SUBFAMILY
Beenken, Andrew; Mohammadi, Moosa
2013-01-01
The ability of the Fibroblast Growth Factor (FGF) 19 subfamily to signal in an endocrine fashion sets this subfamily apart from the remaining five FGF subfamilies known for their paracrine functions during embryonic development. Compared to the members of paracrine FGF subfamiles, the three members of the FGF 19 subfamily, namely FGF19, FGF21 and FGF23, have poor affinity for heparan sulfate (HS) and therefore can diffuse freely in the HS-rich extracellular matrix to enter into the bloodstream. In further contrast to paracrine FGFs, FGF 19 subfamily members have unusually poor affinity for their cognate FGF receptors (FGFRs) and therefore cannot bind and activate them in a solely HS-dependent fashion. As a result, the FGF 19 subfamily requires α/βklotho coreceptor proteins in order to bind, dimerize and activate their cognate FGFRs. This klotho-dependency also determines the tissue specificity of endocrine FGFs. Recent structural and biochemical studies have begun to shed light onto the molecular basis for the klotho-dependent endocrine mode of action of the FGF 19 subfamily. Crystal structures of FGF 19 and FGF23 show that the topology of the HS binding site (HBS) of FGF19 subfamily members deviates drastically from the common topology adopted by the paracrine FGFs. The distinct topologies of the HBS of FGF 19 and FGF23 prevent HS from direct hydrogen bonding with the backbone atoms of the HBS of these ligands and accordingly decrease the HS binding affinity of this subfamily. Recent biochemical data reveal that the αklotho ectodomain binds avidly to the ectodomain of FGFR1c, the main cognate FGFR of FGF23, creating a de novo high affinity binding site for the C-terminal tail of FGF23. The isolated FGF23 C-terminus can be used to effectively inhibit the formation of the FGF23-FGFR1c-αklotho complex and alleviate hypophosphatemia in renal phosphate disorders due to elevated levels of FGF23. PMID:22396159
[Companion Diagnostics for Selecting Antiretroviral Drugs against HIV-1].
Fukutake, Katsuyuki
2015-11-01
Currently, the treatment of human immunodeficiency virus involves combination therapy, as antiretroviral therapy(ART). The treatment has improved steadily since the advent of potent combination therapy in 1996. New drugs that offer new mechanisms of action, improvements in potency and activity even against multidrug-resistant viruses, dosing convenience, and tolerability have been approved. Among ART with useful drugs, there are two important examinations before starting the treatment using the two kinds of drug. CCR5 co-receptor antagonists, maraviroc, prevent HIV entry into target cells by binding to CCR5 receptors. Genotypic assays have been developed that can determine or predict the co-receptor tropism(i.e., CCR5, CXCR4, or both) of the patient's dominant virus population. The assay for HIV-1 co-receptor usage should be performed whenever the use of a CCR5 antagonist is being considered. One of the nucleoside/nucleotide reverse transcriptase inhibitors (NRTIs), abacavir, is an important agent to develop recommended regimens for antiretroviral therapy. Serious and sometimes fatal hypersensitivity reactions have been associated with abacavir-containing products, ZIAGEN, Epzicom, and Triumeq. Patients who carry the HLA-B*5701 allele are at high-risk of a hypersensitivity reaction to abacavir. Prior to initiating therapy with abacavir, performing a screening test for the HLA-B*5701 allele is recommended. [Review].
Williams, Chad M.; Schonnesen, Alexandra A.; Zhang, Shu-Qi; Ma, Ke-Yue; He, Chenfeng; Yamamoto, Tori; Eckhardt, S. Gail; Klebanoff, Christopher A.; Jiang, Ning
2017-01-01
The discovery of naturally occurring T cell receptors (TCRs) that confer specific, high-affinity recognition of pathogen and cancer-associated antigens remains a major goal in cellular immunotherapies. The contribution of the CD8 co-receptor to the interaction between the TCR and peptide-bound major histocompatibility complex (pMHC) has previously been correlated with the activation and responsiveness of CD8+ T cells. However, these studies have been limited to model systems of genetically engineered hybridoma TCRs or transgenic mouse TCRs against either a single epitope or an array of altered peptide ligands. CD8 contribution in a native human antigen-specific T cell response remains elusive. Here, using Hepatitis C Virus-specific precursor CTLs spanning a large range of TCR affinities, we discovered that the functional responsiveness of any given TCR correlated with the contribution of CD8 to TCR/pMHC binding. Furthermore, we found that CD8 contribution to TCR/pMHC binding in the two-dimensional (2D) system was more accurately reflected by normalized synergy (CD8 cooperation normalized by total TCR/pMHC bonds) rather than synergy (total CD8 cooperation) alone. While synergy showed an increasing trend with TCR affinity, normalized synergy was demonstrated to decrease with the increase of TCR affinity. Critically, normalized synergy was shown to correlate with CTL functionality and peptide sensitivity, corroborating three-dimensional (3D) analysis of CD8 contribution with respect to TCR affinity. In addition, we identified TCRs that were independent of CD8 for TCR/pMHC binding. Our results resolve the current discrepancy between 2D and 3D analysis on CD8 contribution to TCR/pMHC binding, and demonstrate that naturally occurring high-affinity TCRs are more capable of CD8-independent interactions that yield greater functional responsiveness even with CD8 blocking. Taken together, our data suggest that addition of the normalized synergy parameter to our previously established TCR discovery platform using 2D TCR affinity and sequence test would allow for selection of TCRs specific to any given antigen with the desirable attributes of high TCR affinity, CD8 co-receptor independence and functional superiority. Utilizing TCRs with less CD8 contribution could be beneficial for adoptive cell transfer immunotherapies using naturally occurring or genetically engineered T cells against viral or cancer-associated antigens. PMID:28804489
The virus–receptor interaction in the replication of feline immunodeficiency virus (FIV)☆
Willett, Brian J; Hosie, Margaret J
2013-01-01
The feline and human immunodeficiency viruses (FIV and HIV) target helper T cells selectively, and in doing so they induce a profound immune dysfunction. The primary determinant of HIV cell tropism is the expression pattern of the primary viral receptor CD4 and co-receptor(s), such as CXCR4 and CCR5. FIV employs a distinct strategy to target helper T cells; a high affinity interaction with CD134 (OX40) is followed by binding of the virus to its sole co-receptor, CXCR4. Recent studies have demonstrated that the way in which FIV interacts with its primary receptor, CD134, alters as infection progresses, changing the cell tropism of the virus. This review examines the contribution of the virus–receptor interaction to replication in vivo as well as the significance of these findings to the development of vaccines and therapeutics. PMID:23992667
Visualizing High-Efficiency HIV Transfer | Center for Cancer Research
The Human Immunodeficiency Virus (HIV), the causative agent of Acquired Immunodeficiency Syndrome (AIDS), infects and eventually kills CD4 receptor-expressing T cells, which are critical for proper immune system function. The gp120 protein on the surface of HIV particles is known to bind CD4 and a co-receptor, either CCR5 or CXCR4, leading to fusion of the virus and T cell
Karlsson, Ulf; Antonsson, Liselotte; Repits, Johanna; Medstrand, Patrik; Owman, Christer; Kidd-Ljunggren, Karin; Hagberg, Lars; Svennerholm, Bo; Jansson, Marianne; Gisslén, Magnus; Ljungberg, Bengt
2009-12-01
Through the use of chimeric CXCR4/CCR5 receptors we have previously shown that CCR5-tropic (R5) HIV-1 isolates acquire a more flexible receptor use over time, and that this links to a reduced viral susceptibility to inhibition by the CCR5 ligand RANTES. These findings may have relevance with regards to the efficacy of antiretroviral compounds that target CCR5/virus interactions. Compartmentalized discrepancies in coreceptor use may occur, which could also affect the efficacy of these compounds at specific anatomical sites, such as within the CNS. In this cross-sectional study we have used wild-type CCR5 and CXCR4 as well as chimeric CXCR4/CCR5 receptors to characterize coreceptor use by paired plasma and cerebrospinal fluid (CSF) isolates from 28 HIV-1-infected individuals. Furthermore, selected R5 isolates, with varying chimeric receptor use, were tested for sensitivity to inhibition by the CCR5 antagonist TAK-779. Discordant CSF/plasma virus coreceptor use was found in 10/28 patients. Low CD4+ T cell counts correlated strongly with a more flexible mode of R5 virus CCR5 usage, as disclosed by an increased ability to utilize chimeric CXCR4/CCR5 receptors, specifically receptor FC-2. Importantly, an elevated ability to utilize chimeric receptors correlated with a reduced susceptibility to inhibition by TAK-779. Our findings show that a discordant CSF and plasma virus coreceptor use is not uncommon. Furthermore, we provide support for an emerging paradigm, where the acquisition of a more flexible mode of CCR5 usage is a key event in R5 virus pathogenesis. This may, in turn, negatively impact the efficacy of CCR5 antagonist treatment in late stage HIV-1 disease.
RXR is an essential component of the oncogenic PML/RARA complex in vivo.
Zhu, Jun; Nasr, Rihab; Pérès, Laurent; Riaucoux-Lormière, Florence; Honoré, Nicole; Berthier, Caroline; Kamashev, Dmitrii; Zhou, Jun; Vitoux, Dominique; Lavau, Catherine; de Thé, Hugues
2007-07-01
Although PML-enforced RARA homodimerization allows PML/RARA to bind DNA independently of its coreceptor RXR, the latter was identified within the PML/RARA complex. We demonstrate that a PML/RARA mutant defective for RXR binding fails to trigger APL development in transgenic mice, although it still transforms primary hematopoietic progenitors ex vivo. RXR enhances PML/RARA binding to DNA and is required for rexinoid-induced APL differentiation. In RA-treated PML/RARA-transformed cells, the absence of RXR binding results in monocytic, rather than granulocytic, differentiation. PML/RARA enhances posttranslational modifications of RXRA, including its sumoylation, suggesting that PML-bound sumoylation enzymes target RXRA and possibly other PML/RARA-bound chromatin proteins, further contributing to deregulated transcription. Thus, unexpectedly, RXR contributes to several critical aspects of in vivo transformation.
Bernard, D J; Woodruff, T K
2001-04-01
Inhibin binding protein (InhBP) and the transforming growth factor-beta (TGF beta) type III receptor, beta glycan, have been identified as putative inhibin coreceptors. Here we cloned the InhBP cDNA in rats and predict that it encodes a large membrane-spanning protein that is part of the Ig superfamily, as has been described for humans. Two abundant InhBP transcripts (4.4 and 1.8 kb) were detected in the adult rat pituitary. The larger transcript encodes the full-length protein while the 1.8-kb transcript (InhBP-short or InhBP-S) corresponds to a splice variant of the receptor. This truncated isoform contains only the N-terminal signal peptide and first two (of 12) Ig-like domains observed in the full-length InhBP (InhBP-long or InhBP-L). InhBP-S does not contain a transmembrane domain and is predicted to be a soluble protein. Beta glycan was also detected in the pituitary; however, it was most abundant within the intermediate lobe. Although we also observed beta glycan immunopositive cells in the anterior pituitary, they rarely colocalized with FSH beta-producing cells. We next examined physiological regulation of the coreceptors across the rat estrous cycle. Like circulating inhibin A and inhibin B levels, pituitary InhBP-L and InhBP-S mRNA levels were dynamically regulated across the cycle and were negatively correlated with serum FSH levels. Expression of both forms of InhBP was also positively correlated with serum inhibin B, but not inhibin A, levels. These data are particularly interesting in light of our in vitro observations that InhBP may function as an inhibin B-specific coreceptor. Pituitary beta glycan mRNA levels did not fluctuate across the cycle nor did they correlate with serum FSH. These observations, coupled with its pattern of expression within the pituitary, indicate that beta glycan likely functions as more than merely an inhibin coreceptor within the pituitary. A direct role for InhBP or beta glycan in regulation of pituitary FSH by inhibin in vivo has yet to be determined, but the demonstration of dynamic regulation of pituitary InhBP and its negative relation to serum FSH across the estrous cycle is an important step in this direction.
Wetzel, Katherine S.; Yi, Yanjie; Elliott, Sarah T. C.; Romero, Dino; Jacquelin, Beatrice; Hahn, Beatrice H.; Muller-Trutwin, Michaela; Apetrei, Cristian; Pandrea, Ivona
2016-01-01
ABSTRACT African green monkeys (AGM) and sooty mangabeys (SM) are well-studied natural hosts of simian immunodeficiency virus (SIV) that do not progress to AIDS when infected with their species-specific viruses. Natural hosts of SIV express very low levels of the canonical entry coreceptor CCR5, and recent studies have shown that CCR5 is dispensable for SIV infection of SM in vivo and that blocking of CCR5 does not prevent ex vivo infection of peripheral blood mononuclear cells (PBMC) from SM or vervet AGM. In both hosts, CXCR6 is an efficient entry pathway in vitro. Here we investigated the use of species-matched CXCR6 and other alternative coreceptors by SIVagmSab, which infects sabaeus AGM. We cloned sabaeus CD4 and 10 candidate coreceptors. Species-matched CXCR6, CCR5, and GPR15 mediated robust entry into transfected cells by pseudotypes carrying SIVagmSab92018ivTF Env, with lower-level entry through GPR1 and APJ. We cloned genetically divergent env genes from the plasma of two wild-infected sabaeus AGM and found similar patterns of coreceptor use. Titration experiments showed that CXCR6 and CCR5 were more efficient than other coreceptors when tested at limiting CD4/coreceptor levels. Finally, blocking of CXCR6 with its ligand CXCL16 significantly inhibited SIVagmSab replication in sabaeus PBMC and had a greater impact than did the CCR5 blocker maraviroc, confirming the use of CXCR6 in primary lymphocyte infection. These data suggest a new paradigm for SIV infection of natural host species, whereby a shared outcome of virus-host coevolution is the use of CXCR6 or other alternative coreceptors for entry, which may direct SIV toward CD4+ T cell subsets and anatomical sites that support viral replication without disrupting immune homeostasis and function. IMPORTANCE Natural hosts of SIV do not progress to AIDS, in stark contrast to pathogenic human immunodeficiency virus type 1 (HIV-1)-human and SIVmac-macaque infections. Identifying how natural hosts avoid immunodeficiency can elucidate key mechanisms of pathogenesis. It is known that despite high viral loads, natural hosts have a low frequency of CD4+ cells expressing the SIV coreceptor CCR5. In this study, we demonstrate the efficient use of the coreceptor CXCR6 by SIVagmSab to infect sabaeus African green monkey lymphocytes. In conjunction with studies of SIVsmm, which infects sooty mangabeys, and SIVagmVer, which infects vervet monkeys, our data suggest a unifying model whereby in natural hosts, in which the CCR5 expression level is low, the use of CXCR6 or other coreceptors to mediate infection may target SIV toward distinct cell populations that are able to support high-level viral replication without causing a loss of CD4+ T cell homeostasis and lymphoid tissue damage that lead to AIDS in HIV-1 and SIVmac infections. PMID:27903799
Wetzel, Katherine S; Yi, Yanjie; Elliott, Sarah T C; Romero, Dino; Jacquelin, Beatrice; Hahn, Beatrice H; Muller-Trutwin, Michaela; Apetrei, Cristian; Pandrea, Ivona; Collman, Ronald G
2017-02-15
African green monkeys (AGM) and sooty mangabeys (SM) are well-studied natural hosts of simian immunodeficiency virus (SIV) that do not progress to AIDS when infected with their species-specific viruses. Natural hosts of SIV express very low levels of the canonical entry coreceptor CCR5, and recent studies have shown that CCR5 is dispensable for SIV infection of SM in vivo and that blocking of CCR5 does not prevent ex vivo infection of peripheral blood mononuclear cells (PBMC) from SM or vervet AGM. In both hosts, CXCR6 is an efficient entry pathway in vitro Here we investigated the use of species-matched CXCR6 and other alternative coreceptors by SIVagmSab, which infects sabaeus AGM. We cloned sabaeus CD4 and 10 candidate coreceptors. Species-matched CXCR6, CCR5, and GPR15 mediated robust entry into transfected cells by pseudotypes carrying SIVagmSab92018ivTF Env, with lower-level entry through GPR1 and APJ. We cloned genetically divergent env genes from the plasma of two wild-infected sabaeus AGM and found similar patterns of coreceptor use. Titration experiments showed that CXCR6 and CCR5 were more efficient than other coreceptors when tested at limiting CD4/coreceptor levels. Finally, blocking of CXCR6 with its ligand CXCL16 significantly inhibited SIVagmSab replication in sabaeus PBMC and had a greater impact than did the CCR5 blocker maraviroc, confirming the use of CXCR6 in primary lymphocyte infection. These data suggest a new paradigm for SIV infection of natural host species, whereby a shared outcome of virus-host coevolution is the use of CXCR6 or other alternative coreceptors for entry, which may direct SIV toward CD4 + T cell subsets and anatomical sites that support viral replication without disrupting immune homeostasis and function. Natural hosts of SIV do not progress to AIDS, in stark contrast to pathogenic human immunodeficiency virus type 1 (HIV-1)-human and SIVmac-macaque infections. Identifying how natural hosts avoid immunodeficiency can elucidate key mechanisms of pathogenesis. It is known that despite high viral loads, natural hosts have a low frequency of CD4 + cells expressing the SIV coreceptor CCR5. In this study, we demonstrate the efficient use of the coreceptor CXCR6 by SIVagmSab to infect sabaeus African green monkey lymphocytes. In conjunction with studies of SIVsmm, which infects sooty mangabeys, and SIVagmVer, which infects vervet monkeys, our data suggest a unifying model whereby in natural hosts, in which the CCR5 expression level is low, the use of CXCR6 or other coreceptors to mediate infection may target SIV toward distinct cell populations that are able to support high-level viral replication without causing a loss of CD4 + T cell homeostasis and lymphoid tissue damage that lead to AIDS in HIV-1 and SIVmac infections. Copyright © 2017 American Society for Microbiology.
Multifaceted Mechanisms of HIV-1 Entry Inhibition by Human α-Defensin*♦
Demirkhanyan, Lusine H.; Marin, Mariana; Padilla-Parra, Sergi; Zhan, Changyou; Miyauchi, Kosuke; Jean-Baptiste, Maikha; Novitskiy, Gennadiy; Lu, Wuyuan; Melikyan, Gregory B.
2012-01-01
The human neutrophil peptide 1 (HNP-1) is known to block the human immunodeficiency virus type 1 (HIV-1) infection, but the mechanism of inhibition is poorly understood. We examined the effect of HNP-1 on HIV-1 entry and fusion and found that, surprisingly, this α-defensin inhibited multiple steps of virus entry, including: (i) Env binding to CD4 and coreceptors; (ii) refolding of Env into the final 6-helix bundle structure; and (iii) productive HIV-1 uptake but not internalization of endocytic markers. Despite its lectin-like properties, HNP-1 could bind to Env, CD4, and other host proteins in a glycan- and serum-independent manner, whereas the fusion inhibitory activity was greatly attenuated in the presence of human or bovine serum. This demonstrates that binding of α-defensin to molecules involved in HIV-1 fusion is necessary but not sufficient for blocking the virus entry. We therefore propose that oligomeric forms of defensin, which may be disrupted by serum, contribute to the anti-HIV-1 activity perhaps through cross-linking virus and/or host glycoproteins. This notion is supported by the ability of HNP-1 to reduce the mobile fraction of CD4 and coreceptors in the plasma membrane and to precipitate a core subdomain of Env in solution. The ability of HNP-1 to block HIV-1 uptake without interfering with constitutive endocytosis suggests a novel mechanism for broad activity against this and other viruses that enter cells through endocytic pathways. PMID:22733823
Carraher, Colm; Authier, Astrid; Steinwender, Bernd; Newcomb, Richard D.
2012-01-01
In insects, odorant receptors detect volatile cues involved in behaviours such as mate recognition, food location and oviposition. We have investigated the evolution of three odorant receptors from five species within the moth genera Ctenopseustis and Planotrotrix, family Tortricidae, which fall into distinct clades within the odorant receptor multigene family. One receptor is the orthologue of the co-receptor Or83b, now known as Orco (OR2), and encodes the obligate ion channel subunit of the receptor complex. In comparison, the other two receptors, OR1 and OR3, are ligand-binding receptor subunits, activated by volatile compounds produced by plants - methyl salicylate and citral, respectively. Rates of sequence evolution at non-synonymous sites were significantly higher in OR1 compared with OR2 and OR3. Within the dataset OR1 contains 109 variable amino acid positions that are distributed evenly across the entire protein including transmembrane helices, loop regions and termini, while OR2 and OR3 contain 18 and 16 variable sites, respectively. OR2 shows a high level of amino acid conservation as expected due to its essential role in odour detection; however we found unexpected differences in the rate of evolution between two ligand-binding odorant receptors, OR1 and OR3. OR3 shows high sequence conservation suggestive of a conserved role in odour reception, whereas the higher rate of evolution observed in OR1, particularly at non-synonymous sites, may be suggestive of relaxed constraint, perhaps associated with the loss of an ancestral role in sex pheromone reception. PMID:22701634
Singh, A; Yi, Y; Isaacs, S N; Kolson, D L; Collman, R G
2001-07-01
There is considerable diversity among HIV-1 strains in terms of their ability to use entry coreceptors on macrophages, especially CXCR4, but it is not known whether virus-specific differences exist among related members of a viral swarm. Defining how entry coreceptors on primary target cells are utilized by the spectrum of HIV-1 variants that emerge in vivo is important for understanding the relationship between coreceptor selectivity and pathogenesis. HIV-1 89.6(PI) is a dual-tropic primary isolate, and the prototype 89.6-cloned R5X4 Env uses both CXCR4 and CCR5 on macrophages. We generated a panel of env clones from the 89.6(PI) quasispecies and found a mixture of R5, R5X4, and X4 variants on the basis of fusion and infection of coreceptor-transfected cell lines. Here we address the use of macrophage coreceptors by these related Envs by analyzing fusion and infection of primary monocyte-derived macrophages mediated specifically through each coreceptor. All R5X4 Envs utilized both CXCR4 and CCR5 on macrophages, while R5 variants used CCR5 only. One variant characterized in cell lines as X4 used both CXCR4 and CCR5 on macrophages. No Env variant fused with macrophages through alternative coreceptor pathways. Thus, there was heterogeneity in coreceptor use among the related Env variants, but use of each coreceptor specifically in macrophages was consistent among members of the viral swarm. Coreceptor use in transfected cells generally predicted use in primary macrophages, although for some Envs macrophages may be a more sensitive indicator of CCR5 use than transfected cell lines.
Lamers, S L; Fogel, G B; Liu, E S; Nolan, D J; Salemi, M; Barbier, A E; Rose, R; Singer, E J; McGrath, M S
2017-07-01
HIV cure research is increasingly focused on anatomical tissues as sites for residual HIV replication during combined antiretroviral therapy (cART). Tissue-based HIV could contribute to low-level immune activation and viral rebound over the course of infection and could also influence the development of diseases, such as atherosclerosis, neurological disorders and cancers. cART-treated subjects have a decreased and irregular presence of HIV among tissues, which has resulted in a paucity of actual evidence concerning how or if HIV persists, replicates and evolves in various anatomical sites during therapy. In this study, we pooled 1806 HIV envelope V3 loop sequences from twenty-six tissue types (seventy-one total tissues) of six pre-cART subjects, four subjects with an unknown cART history who died with profound AIDS, and five subjects who died while on cART with an undetectable plasma viral load. A computational approach was used to assess sequences for their ability to utilize specific cellular coreceptors (R5, R5 and X4, or X4). We found that autopsied tissues obtained from virally suppressed cART+ subjects harbored both integrated and expressed viruses with similar coreceptor usage profiles to subjects with no or ineffective cART therapy (i.e., significant plasma viral load at death). The study suggests that tissue microenvironments provide a sanctuary for the continued evolution of HIV despite cART. Copyright © 2017 Elsevier B.V. All rights reserved.
Fibronectin regulates Wnt7a signaling and satellite cell expansion
Bentzinger, C. Florian; Wang, Yu Xin; von Maltzahn, Julia; Soleimani, Vahab D.; Yin, Hang; Rudnicki, Michael A.
2012-01-01
SUMMARY The influence of the extracellular matrix (ECM) within the stem cell niche remains poorly understood. We found that Syndecan-4 (Sdc4) and Frizzled-7 (Fzd7) form a co-receptor complex in satellite cells and that binding of the ECM glycoprotein Fibronectin (FN) to Sdc4 stimulates the ability of Wnt7a to induce the symmetric expansion of satellite stem cells. Newly activated satellite cells dynamically remodel their niche by transient high-level expression of FN. Knockdown of FN in prospectively isolated satellite cells severely impaired their ability to repopulate the satellite cell niche. Conversely, in vivo over-expression of FN with Wnt7a dramatically stimulated the expansion of satellite stem cells in regenerating muscle. Therefore, activating satellite cells remodel their niche through autologous expression of FN that provides feedback to stimulate Wnt7a signaling through the Fzd7/Sdc4 co-receptor complex. Thus, FN and Wnt7a together regulate the homeostatic levels of satellite stem cells and satellite myogenic cells during regenerative myogenesis. PMID:23290138
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Sun Hong; Kyeong, Min Sik; Hwang, Yuri
Highlights: Black-Right-Pointing-Pointer 1-Dehydro-10-gingerdione (1D10G) from ginger inhibits LPS binding to MD-2. Black-Right-Pointing-Pointer 1D10G suppresses MyD88- or TRIF-dependent signaling in LPS-activated macrophages. Black-Right-Pointing-Pointer 1D10G down-regulates the expression of NF-{kappa}B-, AP1- or IRF3-target genes. Black-Right-Pointing-Pointer MD-2 is a molecular target in the anti-inflammatory action of 1D10G. -- Abstract: Myeloid differentiation protein 2 (MD-2) is a co-receptor of toll-like receptor 4 (TLR4) for innate immunity. Here, we delineated a new mechanism of 1-dehydro-10-gingerdione (1D10G), one of pungent isolates from ginger (Zingiber officinale), in the suppression of lipopolysaccharide (LPS)-induced gene expression of inflammatory cytokines. 1D10G inhibited LPS binding to MD-2 with higher affinity thanmore » gingerol and shogaol from dietary ginger. Moreover, 1D10G down-regulated TLR4-mediated expression of nuclear factor-{kappa}B (NF-{kappa}B) or activating protein 1 (AP1)-target genes such as tumor necrosis factor {alpha} (TNF-{alpha}) and interleukin-1{beta}, as well as those of interferon (IFN) regulatory factor 3 (IRF3)-target IFN-{beta} gene and IFN-{gamma} inducible protein 10 (IP-10) in LPS-activated macrophages. Taken together, MD-2 is a molecular target in the anti-inflammatory action of 1D10G.« less
MET-activating Residues in the B-repeat of the Listeria monocytogenes Invasion Protein InlB*
Bleymüller, Willem M.; Lämmermann, Nina; Ebbes, Maria; Maynard, Daniel; Geerds, Christina; Niemann, Hartmut H.
2016-01-01
The facultative intracellular pathogen Listeria monocytogenes causes listeriosis, a rare but life-threatening disease. Host cell entry begins with activation of the human receptor tyrosine kinase MET through the bacterial invasion protein InlB, which contains an internalin domain, a B-repeat, and three GW domains. The internalin domain is known to bind MET, but no interaction partner is known for the B-repeat. Adding the B-repeat to the internalin domain potentiates MET activation and is required to stimulate Madin-Darby canine kidney (MDCK) cell scatter. Therefore, it has been hypothesized that the B-repeat may bind a co-receptor on host cells. To test this hypothesis, we mutated residues that might be important for binding an interaction partner. We identified two adjacent residues in strand β2 of the β-grasp fold whose mutation abrogated induction of MDCK cell scatter. Biophysical analysis indicated that these mutations do not alter protein structure. We then tested these mutants in human HT-29 cells that, in contrast to the MDCK cells, were responsive to the internalin domain alone. These assays revealed a dominant negative effect, reducing the activity of a construct of the internalin domain and mutated B-repeat below that of the individual internalin domain. Phosphorylation assays of MET and its downstream targets AKT and ERK confirmed the dominant negative effect. Attempts to identify a host cell receptor for the B-repeat were not successful. We conclude that there is limited support for a co-receptor hypothesis and instead suggest that the B-repeat contributes to MET activation through low affinity homodimerization. PMID:27789707
Shimizu, Nobuaki; Tanaka, Atsushi; Jinno-Oue, Atsushi; Mori, Takahisa; Ohtsuki, Takahiro; Hoshino, Hiroo
2010-03-01
More than 10 G protein-coupled receptors (GPCRs) work as coreceptors for human and simian immunodeficiency viruses (HIVs/SIVs); however, structural features critical for coreceptor activity have not been identified. Our objective was to elucidate the structural requirement of coreceptor activities. Amino-terminal regions (NTRs), extracellular loops (ECLs), and the undecapeptidyl arch (UPA) in the second ECL have been shown to be important for coreceptor function. We made chimeric coreceptors for these regions between CCR5 and GPR1, which is genetically distant from CCR5, and analyzed their activities. The coreceptor activity and specificity of CCR5 were maintained when its NTR or UPA was replaced with GPR1. In contrast, the GPR1 chimera with CCR5 NTR was used by HIV-1 strains that can use only CCR5, but not both CCR5 and CXCR4, or GPR1. GPR1 chimera with CCR5 UPA almost lost activity. All ECL chimeras could hardly maintain activity. Thus, CCR5 is more flexibly acceptable to heterologous NTR and UPA than GPR1, suggesting the existence of conformational differences made by the integration of multiple extracellular regions. This conformation may specifically interact with HIV-1 in a strain-dependent manner. Identification of a factor that is critical to make this conformation will contribute to understanding the mechanism of coreceptor function of GPCRs. For this, the coreceptor activity of GPR1, which is genetically distant from CCR5, will be a useful tool.
Taniuchi, Ichiro; Osato, Motomi; Egawa, Takeshi; Sunshine, Mary Jean; Bae, Suk Chul; Komori, Toshihisa; Ito, Yoshiaki; Littman, Dan R
2002-11-27
T lymphocytes differentiate in discrete stages within the thymus. Immature thymocytes lacking CD4 and CD8 coreceptors differentiate into double-positive cells (CD4(+)CD8(+)), which are selected to become either CD4(+)CD8(-)helper cells or CD4(-)CD8(+) cytotoxic cells. A stage-specific transcriptional silencer regulates expression of CD4 in both immature and CD4(-)CD8(+) thymocytes. We show here that binding sites for Runt domain transcription factors are essential for CD4 silencer function at both stages, and that different Runx family members are required to fulfill unique functions at each stage. Runx1 is required for active repression in CD4(-)CD8(-) thymocytes whereas Runx3 is required for establishing epigenetic silencing in cytotoxic lineage thymocytes. Runx3-deficient cytotoxic T cells, but not helper cells, have defective responses to antigen, suggesting that Runx proteins have critical functions in lineage specification and homeostasis of CD8-lineage T lymphocytes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Herrera, Carolina; Klasse, Per Johan; Kibler, Christopher W.
2006-07-20
The human immunodeficiency virus type 1 (HIV-1) envelope (Env) glycoprotein forms trimers that mediate interactions with the CD4 receptor and a co-receptor on the target cell surface, thereby triggering viral fusion with the cell membrane. Cleavage of Env into its surface, gp120, and transmembrane, gp41, moieties is necessary for activation of its fusogenicity. Here, we produced pseudoviruses with phenotypically mixed wild-type (Wt) and mutant, cleavage-incompetent Env in order to quantify the effects of incorporating uncleaved Env on virion infectivity, antigenicity and neutralization sensitivity. We modeled the relative infectivity of three such phenotypically mixed viral strains, JR-FL, HXBc2 and a derivativemore » of the latter, 3.2P, as a function of the relative amount of Wt Env. The data were fit very closely (R {sup 2} > 0.99) by models which assumed that only Wt homotrimers were functional, with different approximate thresholds of critical numbers of functional trimers per virion for the three strains. We also produced 3.2P pseudoviruses containing both a cleavage-competent Env that is defective for binding the neutralizing monoclonal antibody (NAb) 2G12, and a cleavage-incompetent Env that binds 2G12. The 2G12 NAb was not able to reduce the infectivity of these pseudoviruses detectably. Their neutralization by the CD4-binding site-directed agents CD4-IgG2 and NAb b12 was also unaffected by 2G12 binding to uncleaved Env. These results further strengthen the conclusion that only homotrimers consisting of cleaved Env are functional. They also imply that the function of a trimer is unaffected sterically by the binding of an antibody to an adjacent trimer.« less
Using Ultradeep Pyrosequencing to Study HIV-1 Coreceptor Usage in Primary and Dual Infection
Wagner, Gabriel A.; Pacold, Mary E.; Vigil, Edgar; Caballero, Gemma; Morris, Sheldon R.; Kosakovsky Pond, Sergei L.; Little, Susan J.; Richman, Douglas D.; Gianella, Sara; Smith, Davey M.
2013-01-01
HIV-1 dual infection (DI) and CXCR4 (X4) coreceptor usage are associated with accelerated disease progression but frequency and dynamics of coreceptor usage during DI is unknown. Ultradeep sequencing was used to interrogate for DI and infer coreceptor usage in longitudinal blood samples of 102 subjects. At baseline, X4 usage was high (23 subjects harbored X4 variants) and was not associated with infection duration or DI. Coreceptor usage changed over time in 12 of 47 participants, and X4 usage emerged in 4 of 41 monoinfections vs 2 of 5 superinfections (P = .12), suggesting a weak statistical trend toward occurrence of superinfection and acquiring X4 usage. PMID:23599311
Xu, Shuting; Ducroux, Aurélie; Ponnurangam, Aparna; Vieyres, Gabrielle; Franz, Sergej; Müsken, Mathias; Zillinger, Thomas; Malassa, Angelina; Ewald, Ellen; Hornung, Veit; Barchet, Winfried; Häussler, Susanne; Pietschmann, Thomas; Goffinet, Christine
2016-10-12
Upon sensing cytoplasmic retroviral DNA in infected cells, cyclic GMP-AMP (cGAMP) synthase (cGAS) produces the cyclic dinucleotide cGAMP, which activates STING to trigger a type I interferon (IFN) response. We find that membrane fusion-inducing contact between donor cells expressing the HIV envelope (Env) and primary macrophages endogenously expressing the HIV receptor CD4 and coreceptor enable intercellular transfer of cGAMP. This cGAMP exchange results in STING-dependent antiviral IFN responses in target macrophages and protection from HIV infection. Furthermore, under conditions allowing cell-to-cell transmission of HIV-1, infected primary T cells, but not cell-free virions, deliver cGAMP to autologous macrophages through HIV-1 Env and CD4/coreceptor-mediated membrane fusion sites and induce a STING-dependent, but cGAS-independent, IFN response in target cells. Collectively, these findings identify an infection-specific mode of horizontal transfer of cGAMP between primary immune cells that may boost antiviral responses, particularly in infected tissues in which cell-to-cell transmission of virions exceeds cell-free infection. Copyright © 2016 Elsevier Inc. All rights reserved.
Structural basis of JAZ repression of MYC transcription factors in jasmonate signalling
Zhang, Feng; Yao, Jian; Ke, Jiyuan; ...
2015-08-10
The plant hormone jasmonate plays crucial roles in regulating plant responses to herbivorous insects and microbial pathogens and is an important regulator of plant growth and development. Key mediators of jasmonate signalling include MYC transcription factors, which are repressed by jasmonate ZIM-domain (JAZ) transcriptional repressors in the resting state. In the presence of active jasmonate, JAZ proteins function as jasmonate co-receptors by forming a hormone-dependent complex with COI1, the F-box subunit of an SCF-type ubiquitin E3 ligase. The hormone-dependent formation of the COI1–JAZ co-receptor complex leads to ubiquitination and proteasome-dependent degradation of JAZ repressors and release of MYC proteins frommore » transcriptional repression. The mechanism by which JAZ proteins repress MYC transcription factors and how JAZ proteins switch between the repressor function in the absence of hormone and the co-receptor function in the presence of hormone remain enigmatic. In this paper, we show that Arabidopsis MYC3 undergoes pronounced conformational changes when bound to the conserved Jas motif of the JAZ9 repressor. The Jas motif, previously shown to bind to hormone as a partly unwound helix, forms a complete α-helix that displaces the amino (N)-terminal helix of MYC3 and becomes an integral part of the MYC N-terminal fold. In this position, the Jas helix competitively inhibits MYC3 interaction with the MED25 subunit of the transcriptional Mediator complex. Finally, our structural and functional studies elucidate a dynamic molecular switch mechanism that governs the repression and activation of a major plant hormone pathway.« less
Jin, Lian; Qin, Qingqing; Wang, Yu; Pu, Yingying; Liu, Lifang; Wen, Xing; Ji, Shaoyi; Wu, Jianguo; Wei, Chunhong; Li, Yi
2016-01-01
The phytohormone auxin plays critical roles in regulating myriads of plant growth and developmental processes. Microbe infection can disturb auxin signaling resulting in defects in these processes, but the underlying mechanisms are poorly understood. Auxin signaling begins with perception of auxin by a transient co-receptor complex consisting of an F-box transport inhibitor response 1/auxin signaling F-box (TIR1/AFB) protein and an auxin/indole-3-acetic acid (Aux/IAA) protein. Auxin binding to the co-receptor triggers ubiquitination and 26S proteasome degradation of the Aux/IAA proteins, leading to subsequent events, including expression of auxin-responsive genes. Here we report that Rice dwarf virus (RDV), a devastating pathogen of rice, causes disease symptoms including dwarfing, increased tiller number and short crown roots in infected rice as a result of reduced sensitivity to auxin signaling. The RDV capsid protein P2 binds OsIAA10, blocking the interaction between OsIAA10 and OsTIR1 and inhibiting 26S proteasome-mediated OsIAA10 degradation. Transgenic rice plants overexpressing wild-type or a dominant-negative (degradation-resistant) mutant of OsIAA10 phenocopy RDV symptoms are more susceptible to RDV infection; however, knockdown of OsIAA10 enhances the resistance of rice to RDV infection. Our findings reveal a previously unknown mechanism of viral protein reprogramming of a key step in auxin signaling initiation that enhances viral infection and pathogenesis. PMID:27606959
The roles played by highly truncated splice variants of G protein-coupled receptors
2012-01-01
Alternative splicing of G protein-coupled receptor (GPCR) genes greatly increases the total number of receptor isoforms which may be expressed in a cell-dependent and time-dependent manner. This increased diversity of cell signaling options caused by the generation of splice variants is further enhanced by receptor dimerization. When alternative splicing generates highly truncated GPCRs with less than seven transmembrane (TM) domains, the predominant effect in vitro is that of a dominant-negative mutation associated with the retention of the wild-type receptor in the endoplasmic reticulum (ER). For constitutively active (agonist-independent) GPCRs, their attenuated expression on the cell surface, and consequent decreased basal activity due to the dominant-negative effect of truncated splice variants, has pathological consequences. Truncated splice variants may conversely offer protection from disease when expression of co-receptors for binding of infectious agents to cells is attenuated due to ER retention of the wild-type co-receptor. In this review, we will see that GPCRs retained in the ER can still be functionally active but also that highly truncated GPCRs may also be functionally active. Although rare, some truncated splice variants still bind ligand and activate cell signaling responses. More importantly, by forming heterodimers with full-length GPCRs, some truncated splice variants also provide opportunities to generate receptor complexes with unique pharmacological properties. So, instead of assuming that highly truncated GPCRs are associated with faulty transcription processes, it is time to reassess their potential benefit to the host organism. PMID:22938630
Artemin Crystal Structure Reveals Insights into Heparan Sulfate Binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Silvian,L.; Jin, P.; Carmillo, P.
2006-01-01
Artemin (ART) promotes the growth of developing peripheral neurons by signaling through a multicomponent receptor complex comprised of a transmembrane tyrosine kinase receptor (cRET) and a specific glycosylphosphatidylinositol-linked co-receptor (GFR{alpha}3). Glial cell line-derived neurotrophic factor (GDNF) signals through a similar ternary complex but requires heparan sulfate proteoglycans (HSPGs) for full activity. HSPG has not been demonstrated as a requirement for ART signaling. We crystallized ART in the presence of sulfate and solved its structure by isomorphous replacement. The structure reveals ordered sulfate anions bound to arginine residues in the pre-helix and amino-terminal regions that were organized in a triad arrangementmore » characteristic of heparan sulfate. Three residues in the pre-helix were singly or triply substituted with glutamic acid, and the resulting proteins were shown to have reduced heparin-binding affinity that is partly reflected in their ability to activate cRET. This study suggests that ART binds HSPGs and identifies residues that may be involved in HSPG binding.« less
Rational design of micro-RNA-like bifunctional siRNAs targeting HIV and the HIV coreceptor CCR5.
Ehsani, Ali; Saetrom, Pål; Zhang, Jane; Alluin, Jessica; Li, Haitang; Snøve, Ola; Aagaard, Lars; Rossi, John J
2010-04-01
Small-interfering RNAs (siRNAs) and micro-RNAs (miRNAs) are distinguished by their modes of action. SiRNAs serve as guides for sequence-specific cleavage of complementary mRNAs and the targets can be in coding or noncoding regions of the target transcripts. MiRNAs inhibit translation via partially complementary base-pairing to 3' untranslated regions (UTRs) and are generally ineffective when targeting coding regions of a transcript. In this study, we deliberately designed siRNAs that simultaneously direct cleavage and translational suppression of HIV RNAs, or cleavage of the mRNA encoding the HIV coreceptor CCR5 and suppression of translation of HIV. These bifunctional siRNAs trigger inhibition of HIV infection and replication in cell culture. The design principles have wide applications throughout the genome, as about 90% of genes harbor sites that make the design of bifunctional siRNAs possible.
Protection of macaques from vaginal SHIV challenge by an orally delivered CCR5 inhibitor.
Veazey, Ronald S; Springer, Martin S; Marx, Preston A; Dufour, Jason; Klasse, Per Johan; Moore, John P
2005-12-01
Pre-exposure oral prophylaxis with antiviral drugs is a potential method for preventing transmission of human immunodeficiency virus type 1 (HIV-1). We show that oral delivery of CMPD167, a small molecule that binds to the CCR5 coreceptor, for 10-14 d can protect a substantial proportion of macaques from vaginal infection with a CCR5-using virus (SHIV-162P3). The macaques that became infected despite receiving CMPD167 had reduced plasma viremia levels during the earliest stages of infection.
Discovery and Validation of a New Class of Small Molecule Toll-Like Receptor 4 (TLR4) Inhibitors
Neal, Matthew D.; Jia, Hongpeng; Eyer, Benjamin; Good, Misty; Guerriero, Christopher J.; Sodhi, Chhinder P.; Afrazi, Amin; Prindle, Thomas; Ma, Congrong; Branca, Maria; Ozolek, John; Brodsky, Jeffrey L.; Wipf, Peter; Hackam, David J.
2013-01-01
Many inflammatory diseases may be linked to pathologically elevated signaling via the receptor for lipopolysaccharide (LPS), toll-like receptor 4 (TLR4). There has thus been great interest in the discovery of TLR4 inhibitors as potential anti-inflammatory agents. Recently, the structure of TLR4 bound to the inhibitor E5564 was solved, raising the possibility that novel TLR4 inhibitors that target the E5564-binding domain could be designed. We utilized a similarity search algorithm in conjunction with a limited screening approach of small molecule libraries to identify compounds that bind to the E5564 site and inhibit TLR4. Our lead compound, C34, is a 2-acetamidopyranoside (MW 389) with the formula C17H27NO9, which inhibited TLR4 in enterocytes and macrophages in vitro, and reduced systemic inflammation in mouse models of endotoxemia and necrotizing enterocolitis. Molecular docking of C34 to the hydrophobic internal pocket of the TLR4 co-receptor MD-2 demonstrated a tight fit, embedding the pyran ring deep inside the pocket. Strikingly, C34 inhibited LPS signaling ex-vivo in human ileum that was resected from infants with necrotizing enterocolitis. These findings identify C34 and the β-anomeric cyclohexyl analog C35 as novel leads for small molecule TLR4 inhibitors that have potential therapeutic benefit for TLR4-mediated inflammatory diseases. PMID:23776545
Molecular basis of human CD22 function and therapeutic targeting.
Ereño-Orbea, June; Sicard, Taylor; Cui, Hong; Mazhab-Jafari, Mohammad T; Benlekbir, Samir; Guarné, Alba; Rubinstein, John L; Julien, Jean-Philippe
2017-10-02
CD22 maintains a baseline level of B-cell inhibition to keep humoral immunity in check. As a B-cell-restricted antigen, CD22 is targeted in therapies against dysregulated B cells that cause autoimmune diseases and blood cancers. Here we report the crystal structure of human CD22 at 2.1 Å resolution, which reveals that specificity for α2-6 sialic acid ligands is dictated by a pre-formed β-hairpin as a unique mode of recognition across sialic acid-binding immunoglobulin-type lectins. The CD22 ectodomain adopts an extended conformation that facilitates concomitant CD22 nanocluster formation on B cells and binding to trans ligands to avert autoimmunity in mammals. We structurally delineate the CD22 site targeted by the therapeutic antibody epratuzumab at 3.1 Å resolution and determine a critical role for CD22 N-linked glycosylation in antibody engagement. Our studies provide molecular insights into mechanisms governing B-cell inhibition and valuable clues for the design of immune modulators in B-cell dysfunction.The B-cell-specific co-receptor CD22 is a therapeutic target for depleting dysregulated B cells. Here the authors structurally characterize the ectodomain of CD22 and present its crystal structure with the bound therapeutic antibody epratuzumab, which gives insights into the mechanism of inhibition of B-cell activation.
Unique Ganglioside Recognition Strategies for Clostridial Neurotoxins
DOE Office of Scientific and Technical Information (OSTI.GOV)
Benson, Marc A.; Fu, Zhuji; Kim, Jung-Ja P.
2012-03-15
Botulinum neurotoxins (BoNTs) and tetanus neurotoxin are the causative agents of the paralytic diseases botulism and tetanus, respectively. The potency of the clostridial neurotoxins (CNTs) relies primarily on their highly specific binding to nerve terminals and cleavage of SNARE proteins. Although individual CNTs utilize distinct proteins for entry, they share common ganglioside co-receptors. Here, we report the crystal structure of the BoNT/F receptor-binding domain in complex with the sugar moiety of ganglioside GD1a. GD1a binds in a shallow groove formed by the conserved peptide motif E ... H ... SXWY ... G, with additional stabilizing interactions provided by two argininemore » residues. Comparative analysis of BoNT/F with other CNTs revealed several differences in the interactions of each toxin with ganglioside. Notably, exchange of BoNT/F His-1241 with the corresponding lysine residue of BoNT/E resulted in increased affinity for GD1a and conferred the ability to bind ganglioside GM1a. Conversely, BoNT/E was not able to bind GM1a, demonstrating a discrete mechanism of ganglioside recognition. These findings provide a structural basis for ganglioside binding among the CNTs and show that individual toxins utilize unique ganglioside recognition strategies.« less
NEUROTROPHIN SELECTIVITY IN ORGANIZING TOPOGRAPHIC REGENERATION OF NOCICEPTIVE AFFERENTS
Kelamangalath, Lakshmi; Tang, Xiaoqing; Bezik, Kathleen; Sterling, Noelle; Son, Young-Jin; Smith, George M.
2015-01-01
Neurotrophins represent some of the best candidates to enhance regeneration. In the current study, we investigated the effects of artemin, a member of the glial derived neurotrophic factor (GDNF) family, on sensory axon regeneration following a lumbar dorsal root injury and compared these effects with that observed after either NGF or GDNF expression in the rat spinal cord. Unlike previously published data, artemin failed to induce regeneration of large-diameter myelinated sensory afferents when expressed within either the spinal cord or DRG. However, artemin or NGF induced regeneration of calcitonin gene related peptide positive (CGRP+) axons only when expressed within the spinal cord. Accordingly, artemin or NGF enhanced recovery of only nociceptive behavior and showed a cFos distribution similar to the topography of regenerating axons. Artemin and GDNF signaling requires binding to different co-receptors (GFRα3 or GFRα1, respectively) prior to binding to the signaling receptor, cRet. Approximately 70% of DRG neurons express cRet, but only 35% express either co-receptor. To enhance artemin-induced regeneration, we co-expressed artemin with either GFRα3 or GDNF. Co-expression of artemin and GFRα3 only slightly enhanced regeneration of IB4+ non-peptidergic nociceptive axons, but not myelinated axons. Interestingly, this co-expression also disrupted the ability of artemin to produce topographic targeting and lead to significant increases in cFos immunoreactivity within the deep dorsal laminae. This study failed to demonstrate artemin-induced regeneration of myelinated axons, even with co-expression of GFR-α3, which only promoted mistargeted regeneration. PMID:26054884
Neurotrophin selectivity in organizing topographic regeneration of nociceptive afferents.
Kelamangalath, Lakshmi; Tang, Xiaoqing; Bezik, Kathleen; Sterling, Noelle; Son, Young-Jin; Smith, George M
2015-09-01
Neurotrophins represent some of the best candidates to enhance regeneration. In the current study, we investigated the effects of artemin, a member of the glial derived neurotrophic factor (GDNF) family, on sensory axon regeneration following a lumbar dorsal root injury and compared these effects with that observed after either NGF or GDNF expression in the rat spinal cord. Unlike previously published data, artemin failed to induce regeneration of large-diameter myelinated sensory afferents when expressed within either the spinal cord or DRG. However, artemin or NGF induced regeneration of calcitonin gene related peptide positive (CGRP(+)) axons only when expressed within the spinal cord. Accordingly, artemin or NGF enhanced recovery of only nociceptive behavior and showed a cFos distribution similar to the topography of regenerating axons. Artemin and GDNF signaling requires binding to different co-receptors (GFRα3 or GFRα1, respectively) prior to binding to the signaling receptor, cRet. Approximately 70% of DRG neurons express cRet, but only 35% express either co-receptor. To enhance artemin-induced regeneration, we co-expressed artemin with either GFRα3 or GDNF. Co-expression of artemin and GFRα3 only slightly enhanced regeneration of IB4(+) non-peptidergic nociceptive axons, but not myelinated axons. Interestingly, this co-expression also disrupted the ability of artemin to produce topographic targeting and lead to significant increases in cFos immunoreactivity within the deep dorsal laminae. This study failed to demonstrate artemin-induced regeneration of myelinated axons, even with co-expression of GFRα3, which only promoted mistargeted regeneration. Copyright © 2015 Elsevier Inc. All rights reserved.
Determination of HIV-1 co-receptor usage.
Cavarelli, Mariangela; Scarlatti, Gabriella
2014-01-01
Human immunodeficiency virus type I (HIV-1) infects target cells through interaction with the CD4 molecule and chemokine receptors, mainly the β-chemokine receptor 5 (CCR5) and the α-chemokine receptor 4 (CXCR4). Viral isolates can be phenotypically classified based on the co-receptor they utilize to infect target cells. In this chapter, methods to determine the co-receptor usage of HIV-1 variants are described.
Nedellec, Rebecca; Herbeck, Joshua T; Hunt, Peter W; Deeks, Steven G; Mullins, James I; Anton, Elizabeth D; Reeves, Jacqueline D; Mosier, Donald E
2017-03-01
Coreceptor switching from CCR5 to CXCR4 is common during chronic HIV-1 infection, but is even more common in individuals who have failed antiretroviral therapy (ART). Prior studies have suggested rapid mutation and/or recombination of HIV-1 envelope (env) genes during coreceptor switching. We compared the functional and genotypic changes in env of viruses from viremic subjects who had failed ART just before and after coreceptor switching and compared those to viruses from matched subjects without coreceptor switching. Analysis of multiple unique functional env clones from each subject revealed extensive diversity at both sample time points and rapid diversification of sequences during the 4-month interval in viruses from both 9 subjects with coreceptor switching and 15 control subjects. Only two subjects had envs with evidence of recombination. Three findings distinguished env clones from subjects with coreceptor switching from controls: (1) lower entry efficiency via CCR5; (2) longer V1/V2 regions; and (3), lower nadir CD4 T cell counts during prior years of infection. Most of these subjects harbored virus with lower replicative capacity associated with protease (PR) and/or reverse transcriptase inhibitor resistance mutations, and the extensive diversification tended to lead either to improved entry efficiency via CCR5 or the gain of entry function via CXCR4. These results suggest that R5X4 or X4 variants emerge from a diverse, low-fitness landscape shaped by chronic infection, multiple ART resistance mutations, the availability of target cells, and reduced entry efficiency via CCR5.
Phenotypic assays for the determination of coreceptor tropism in HIV-1 infected individuals.
Braun, Patrick; Wiesmann, Frank
2007-10-15
Coreceptor tropism antagonists represent a new class of antiretrovirals for the treatment of HIV infection. The knowledge of patients' viral population tropism before the initiation of and during therapy with such compounds may be critical in order to optimize treatment strategies. In this review we focus on the characteristics of phenotypic assays for the determination of HIV coreceptor tropism. Beside traditional phenotypic assays, there are at least four phenotypic recombinant virus assays (RVA) available to predict coreceptor usage: Trofile (Monogram Biosciences), Phenoscript (VIRalliance), XtrackC/ PhenX-R (inPheno) and a platform developed by Virco. Trofile and Phenoscript represent single-cycle assays and are able to determine coreceptor tropism without cocultivation of HIV particles in cell culture. Trofile offers the most clinically validated data with currently about 25,000 analysed samples. The detection of minority variants is a limitation of all population-based assays and varies between 1 and 10%, depending on the assay used. XtrackC/PhenX-R and Virco's platform combine genotypic and phenotypic assays to analyze a patient's sample for tropism. Although all assays are validated for the assessment of coreceptor tropism in different HIV-1 subtypes, there is still a need for further evaluations. Furthermore, the establishment of cut-offs for X4 minority species will be difficult, and is affected by many factors like patient sample quality, the input volume, viral load, the detection limits and PCR variations. Overall, RVAs confirm efficiency and accuracy thus making them suitable for the clinical management of HIV infected individuals treated with coreceptor antagonists.
Wise, a context-dependent activator and inhibitor of Wnt signalling.
Itasaki, Nobue; Jones, C Michael; Mercurio, Sara; Rowe, Alison; Domingos, Pedro M; Smith, James C; Krumlauf, Robb
2003-09-01
We have isolated a novel secreted molecule, Wise, by a functional screen for activities that alter the anteroposterior character of neuralised Xenopus animal caps. Wise encodes a secreted protein capable of inducing posterior neural markers at a distance. Phenotypes arising from ectopic expression or depletion of Wise resemble those obtained when Wnt signalling is altered. In animal cap assays, posterior neural markers can be induced by Wnt family members, and induction of these markers by Wise requires components of the canonical Wnt pathway. This indicates that in this context Wise activates the Wnt signalling cascade by mimicking some of the effects of Wnt ligands. Activation of the pathway was further confirmed by nuclear accumulation of beta-catenin driven by Wise. By contrast, in an assay for secondary axis induction, extracellularly Wise antagonises the axis-inducing ability of Wnt8. Thus, Wise can activate or inhibit Wnt signalling in a context-dependent manner. The Wise protein physically interacts with the Wnt co-receptor, lipoprotein receptor-related protein 6 (LRP6), and is able to compete with Wnt8 for binding to LRP6. These activities of Wise provide a new mechanism for integrating inputs through the Wnt coreceptor complex to modulate the balance of Wnt signalling.
The emerging role of class-3 semaphorins and their neuropilin receptors in oncology
Nasarre, Patrick; Gemmill, Robert M; Drabkin, Harry A
2014-01-01
The semaphorins, discovered over 20 years ago, are a large family of secreted or transmembrane and glycophosphatidylinositol -anchored proteins initially identified as axon guidance molecules crucial for the development of the nervous system. It has now been established that they also play important roles in organ development and function, especially involving the immune, respiratory, and cardiovascular systems, and in pathological disorders, including cancer. During tumor progression, semaphorins can have both pro- and anti-tumor functions, and this has created complexities in our understanding of these systems. Semaphorins may affect tumor growth and metastases by directly targeting tumor cells, as well as indirectly by interacting with and influencing cells from the micro-environment and vasculature. Mechanistically, semaphorins, through binding to their receptors, neuropilins and plexins, affect pathways involved in cell adhesion, migration, invasion, proliferation, and survival. Importantly, neuropilins also act as co-receptors for several growth factors and enhance their signaling activities, while class 3 semaphorins may interfere with this. In this review, we focus on the secreted class 3 semaphorins and their neuropilin co-receptors in cancer, including aspects of their signaling that may be clinically relevant. PMID:25285016
Veazey, Ronald S; Ketas, Thomas J; Dufour, Jason; Moroney-Rasmussen, Terri; Green, Linda C; Klasse, P J; Moore, John P
2010-09-01
An effective vaginal microbicide could reduce human immunodeficiency virus type 1 (HIV-1) transmission to women. Among microbicide candidates in clinical development is Maraviroc (MVC), a small-molecule drug that binds the CCR5 co-receptor and impedes HIV-1 entry into cells. Delivered systemically, MVC reduces viral load in HIV-1-infected individuals, but its ability to prevent transmission is untested. We have now evaluated MVC as a vaginal microbicide with use of a stringent model that involves challenge of rhesus macaques with a high-dose of a CCR5-using virus, SHIV-162P3. Gel-formulated, prescription-grade MVC provided dose-dependent protection, half-maximally at 0.5 mM (0.25 mg/mL). The duration of protection was transient; the longer the delay between MVC application and virus challenge, the less protection (half life of approximately 4 h). As expected, MVC neither protected against challenge with a CXCR4-using virus, SHIV-KU1, nor exacerbated postinfection viremia. These findings validate MVC development as a vaginal microbicide for women and should guide clinical programs.
Veazey, Ronald S.; Ketas, Thomas J.; Dufour, Jason; Moroney-Rasmussen, Terri; Green, Linda C.; Klasse, P.J.; Moore, John P.
2010-01-01
An effective vaginal microbicide could reduce human immunodeficiency virus type 1 (HIV-1) transmission to women. Among microbicide candidates in clinical development is Maraviroc (MVC), a small molecule drug that binds the CCR5 co-receptor and impedes HIV-1 entry into cells. Delivered systemically, MVC reduces viral load in HIV-1-infected people, but its ability to prevent transmission is untested. We have now evaluated MVC as a vaginal microbicide, using a stringent model involving challenge of rhesus macaques with a high-dose of a CCR5-using virus, SHIV-162P3. Gel-formulated, prescription-grade MVC provided dose-dependent protection, half-maximally at 0.5 mM (0.25 mg/ml). The duration of protection was transient; the longer the delay between MVC application and virus challenge, the less protection (T1/2 ~ 4 h). As expected, MVC neither protected against challenge with a CXCR4-using virus, SHIV-KU1, nor exacerbated post-infection viremia. These findings validate MVC development as a vaginal microbicide for women, and should guide clinical programs. PMID:20629537
Low, Andrew J; Dong, Winnie; Chan, Dennison; Sing, Tobias; Swanstrom, Ronald; Jensen, Mark; Pillai, Satish; Good, Benjamin; Harrigan, P Richard
2007-09-12
Integrating CCR5 antagonists into clinical practice would benefit from accurate assays of co-receptor usage (CCR5 versus CXCR4) with fast turnaround and low cost. Published HIV V3-loop based predictors of co-receptor usage were compared with actual phenotypic tropism results in a large cohort of antiretroviral naive individuals to determine accuracy on clinical samples and identify areas for improvement. Aligned HIV envelope V3 loop sequences (n = 977), derived by bulk sequencing were analyzed by six methods: the 11/25 rule; a neural network (NN), two support vector machines, and two subtype-B position specific scoring matrices (PSSM). Co-receptor phenotype results (Trofile Co-receptor Phenotype Assay; Monogram Biosciences) were stratified by CXCR4 relative light unit (RLU) readout and CD4 cell count. Co-receptor phenotype was available for 920 clinical samples with V3 genotypes having fewer than seven amino acid mixtures (n = 769 R5; n = 151 X4-capable). Sensitivity and specificity for predicting X4 capacity were evaluated for the 11/25 rule (30% sensitivity/93% specificity), NN (44%/88%), PSSM(sinsi) (34%/96%), PSSM(x4r5) (24%/97%), SVMgenomiac (22%/90%) and SVMgeno2pheno (50%/89%). Quantitative increases in sensitivity could be obtained by optimizing the cut-off for methods with continuous output (PSSM methods), and/or integrating clinical data (CD4%). Sensitivity was directly proportional to strength of X4 signal in the phenotype assay (P < 0.05). Current default implementations of co-receptor prediction algorithms are inadequate for predicting HIV X4 co-receptor usage in clinical samples, particularly those X4 phenotypes with low CXCR4 RLU signals. Significant improvements can be made to genotypic predictors, including training on clinical samples, using additional data to improve predictions and optimizing cutoffs and increasing genotype sensitivity.
Macauley, Matthew S.; Kawasaki, Norihito; Peng, Wenjie; Wang, Shui-Hua; He, Yuan; Arlian, Britni M.; McBride, Ryan; Kannagi, Reiji; Khoo, Kay-Hooi; Paulson, James C.
2015-01-01
CD22 is an inhibitory B-cell co-receptor whose function is modulated by sialic acid (Sia)-bearing glycan ligands. Glycan remodeling in the germinal center (GC) alters CD22 ligands, with as yet no ascribed biological consequence. Here, we show in both mice and humans that loss of high affinity ligands on GC B-cells unmasks the binding site of CD22 relative to naive and memory B-cells, promoting recognition of trans ligands. The conserved modulation of CD22 ligands on GC B-cells is striking because high affinity glycan ligands of CD22 are species-specific. In both species, the high affinity ligand is based on the sequence Siaα2–6Galβ1–4GlcNAc, which terminates N-glycans. The human ligand has N-acetylneuraminic acid (Neu5Ac) as the sialic acid, and the high affinity ligand on naive B-cells contains 6-O-sulfate on the GlcNAc. On human GC B-cells, this sulfate modification is lost, giving rise to lower affinity CD22 ligands. Ligands of CD22 on naive murine B-cells do not contain the 6-O-sulfate modification. Instead, the high affinity ligand for mouse CD22 has N-glycolylneuraminic acid (Neu5Gc) as the sialic acid, which is replaced on GC B-cells with Neu5Ac. Human naive and memory B-cells express sulfated glycans as high affinity CD22 ligands, which are lost on GC B-cells. In mice, Neu5Gc-containing glycans serve as high affinity CD22 ligands that are replaced by Neu5Ac-containing glycans on GC B-cells. Our results demonstrate that loss of high affinity CD22 ligands on GC B-cells occurs in both mice and humans through alternative mechanisms, unmasking CD22 relative to naive and memory B-cells. PMID:26507663
Macauley, Matthew S; Kawasaki, Norihito; Peng, Wenjie; Wang, Shui-Hua; He, Yuan; Arlian, Britni M; McBride, Ryan; Kannagi, Reiji; Khoo, Kay-Hooi; Paulson, James C
2015-12-11
CD22 is an inhibitory B-cell co-receptor whose function is modulated by sialic acid (Sia)-bearing glycan ligands. Glycan remodeling in the germinal center (GC) alters CD22 ligands, with as yet no ascribed biological consequence. Here, we show in both mice and humans that loss of high affinity ligands on GC B-cells unmasks the binding site of CD22 relative to naive and memory B-cells, promoting recognition of trans ligands. The conserved modulation of CD22 ligands on GC B-cells is striking because high affinity glycan ligands of CD22 are species-specific. In both species, the high affinity ligand is based on the sequence Siaα2-6Galβ1-4GlcNAc, which terminates N-glycans. The human ligand has N-acetylneuraminic acid (Neu5Ac) as the sialic acid, and the high affinity ligand on naive B-cells contains 6-O-sulfate on the GlcNAc. On human GC B-cells, this sulfate modification is lost, giving rise to lower affinity CD22 ligands. Ligands of CD22 on naive murine B-cells do not contain the 6-O-sulfate modification. Instead, the high affinity ligand for mouse CD22 has N-glycolylneuraminic acid (Neu5Gc) as the sialic acid, which is replaced on GC B-cells with Neu5Ac. Human naive and memory B-cells express sulfated glycans as high affinity CD22 ligands, which are lost on GC B-cells. In mice, Neu5Gc-containing glycans serve as high affinity CD22 ligands that are replaced by Neu5Ac-containing glycans on GC B-cells. Our results demonstrate that loss of high affinity CD22 ligands on GC B-cells occurs in both mice and humans through alternative mechanisms, unmasking CD22 relative to naive and memory B-cells. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Huang, Wei; Eshleman, Susan H.; Toma, Jonathan; Fransen, Signe; Stawiski, Eric; Paxinos, Ellen E.; Whitcomb, Jeannette M.; Young, Alicia M.; Donnell, Deborah; Mmiro, Francis; Musoke, Philippa; Guay, Laura A.; Jackson, J. Brooks; Parkin, Neil T.; Petropoulos, Christos J.
2007-01-01
In human immunodeficiency virus type 1 (HIV-1) subtype B, CXCR4 coreceptor use ranges from ∼20% in early infection to ∼50% in advanced disease. Coreceptor use by non-subtype B HIV is less well characterized. We studied coreceptor tropism of subtype A and D HIV-1 collected from 68 pregnant, antiretroviral drug-naive Ugandan women (HIVNET 012 trial). None of 33 subtype A or 10 A/D-recombinant viruses used the CXCR4 coreceptor. In contrast, nine (36%) of 25 subtype D viruses used both CXCR4 and CCR5 coreceptors. Clonal analyses of the nine subtype D samples with dual or mixed tropism revealed heterogeneous viral populations comprised of X4-, R5-, and dual-tropic HIV-1 variants. In five of the six samples with dual-tropic strains, V3 loop sequences of dual-tropic clones were identical to those of cocirculating R5-tropic clones, indicating the presence of CXCR4 tropism determinants outside of the V3 loop. These dual-tropic variants with R5-tropic-like V3 loops, which we designated “dual-R,” use CCR5 much more efficiently than CXCR4, in contrast to dual-tropic clones with X4-tropic-like V3 loops (“dual-X”). These observations have implications for pathogenesis and treatment of subtype D-infected individuals, for the association between V3 sequence and coreceptor tropism phenotype, and for understanding potential mechanisms of evolution from exclusive CCR5 use to efficient CXCR4 use by subtype D HIV-1. PMID:17507467
Nedellec, Rebecca; Herbeck, Joshua T.; Hunt, Peter W.; Deeks, Steven G.; Mullins, James I.; Anton, Elizabeth D.; Reeves, Jacqueline D.
2017-01-01
Abstract Coreceptor switching from CCR5 to CXCR4 is common during chronic HIV-1 infection, but is even more common in individuals who have failed antiretroviral therapy (ART). Prior studies have suggested rapid mutation and/or recombination of HIV-1 envelope (env) genes during coreceptor switching. We compared the functional and genotypic changes in env of viruses from viremic subjects who had failed ART just before and after coreceptor switching and compared those to viruses from matched subjects without coreceptor switching. Analysis of multiple unique functional env clones from each subject revealed extensive diversity at both sample time points and rapid diversification of sequences during the 4-month interval in viruses from both 9 subjects with coreceptor switching and 15 control subjects. Only two subjects had envs with evidence of recombination. Three findings distinguished env clones from subjects with coreceptor switching from controls: (1) lower entry efficiency via CCR5; (2) longer V1/V2 regions; and (3), lower nadir CD4 T cell counts during prior years of infection. Most of these subjects harbored virus with lower replicative capacity associated with protease (PR) and/or reverse transcriptase inhibitor resistance mutations, and the extensive diversification tended to lead either to improved entry efficiency via CCR5 or the gain of entry function via CXCR4. These results suggest that R5X4 or X4 variants emerge from a diverse, low-fitness landscape shaped by chronic infection, multiple ART resistance mutations, the availability of target cells, and reduced entry efficiency via CCR5. PMID:27604829
Entry inhibitors in the treatment of HIV-1 infection.
Tilton, John C; Doms, Robert W
2010-01-01
Infection of target cells by HIV is a complex, multi-stage process involving attachment to host cells and CD4 binding, coreceptor binding, and membrane fusion. Drugs that block HIV entry are collectively known as entry inhibitors, but comprise a complex group of drugs with multiple mechanisms of action depending on the stage of the entry process at which they act. Two entry inhibitors, maraviroc and enfuvirtide, have been approved for the treatment of HIV-1 infection, and a number of agents are in development. This review covers the entry inhibitors and their use in the management of HIV-1 infection. This article forms part of a special issue of Antiviral Research marking the 25th anniversary of antiretroviral drug discovery and development, Vol 85, issue 1, 2010. Copyright 2009 Elsevier B.V. All rights reserved.
Empty conformers of HLA-B preferentially bind CD8 and regulate CD8+ T cell function.
Geng, Jie; Altman, John D; Krishnakumar, Sujatha; Raghavan, Malini
2018-05-09
When complexed with antigenic peptides, human leukocyte antigen (HLA) class I (HLA-I) molecules initiate CD8 + T cell responses via interaction with the T cell receptor (TCR) and co-receptor CD8. Peptides are generally critical for the stable cell surface expression of HLA-I molecules. However, for HLA-I alleles such as HLA-B*35:01, peptide-deficient (empty) heterodimers are thermostable and detectable on the cell surface. Additionally, peptide-deficient HLA-B*35:01 tetramers preferentially bind CD8 and to a majority of blood-derived CD8 + T cells via a CD8-dependent binding mode. Further functional studies reveal that peptide-deficient conformers of HLA-B*35:01 do not directly activate CD8 + T cells, but accumulate at the immunological synapse in antigen-induced responses, and enhance cognate peptide-induced cell adhesion and CD8 + T cell activation. Together, these findings indicate that HLA-I peptide occupancy influences CD8 binding affinity, and reveal a new set of regulators of CD8 + T cell activation, mediated by the binding of empty HLA-I to CD8. © 2018, Geng et al.
Lei, Beilei; Liu, Jiyuan; Yao, Xiaojun
2015-12-01
Brassinosteroid (BR) phytohormones play indispensable roles in plant growth and development. Brassinolide (BL) and 24-epibrassinolide (24-epiBL) are the most active ones among the BRs reported thus far. Unfortunately, the extremely low natural content and intricate synthesis process limit their popularization in agricultural production. Earlier reports to discover alternative compounds have resulted in molecules with nearly same scaffold structure and without diversity in chemical space. In the present study, receptors structure based BRs regulation mechanism was analyzed. First, we examined the detailed binding interactions and their dynamic stability between BL and its receptor BRI1 and co-receptor BAK1. Then, the binding modes and binding free energies for 24-epiBL and a series of representative BRs binding with BRI1 and BRI1-BAK1 were carried out by molecular docking, energy minimization and MM-PBSA free energy calculation. The obtained binding structures and energetic results provided vital insights into the structural factors affecting the activity from both receptors and BRs aspects. Subsequently, the obtained knowledge will serve as valuable guidance to build pharmacophore models for rational screening of new scaffold alternative BRs. Copyright © 2015 Elsevier Inc. All rights reserved.
Yokoyama, Masaru; Nomaguchi, Masako; Doi, Naoya; Kanda, Tadahito; Adachi, Akio; Sato, Hironori
2016-01-01
Variable V1/V2 and V3 loops on human immunodeficiency virus type 1 (HIV-1) envelope-gp120 core play key roles in modulating viral competence to recognize two infection receptors, CD4 and chemokine-receptors. However, molecular bases for the modulation largely remain unclear. To address these issues, we constructed structural models for a full-length gp120 in CD4-free and -bound states. The models showed topologies of gp120 surface loop that agree with those in reported structural data. Molecular dynamics simulation showed that in the unliganded state, V1/V2 loop settled into a thermodynamically stable arrangement near V3 loop for conformational masking of V3 tip, a potent neutralization epitope. In the CD4-bound state, however, V1/V2 loop was rearranged near the bound CD4 to support CD4 binding. In parallel, cell-based adaptation in the absence of anti-viral antibody pressures led to the identification of amino acid substitutions that individually enhance viral entry and growth efficiencies in association with reduced sensitivity to CCR5 antagonist TAK-779. Notably, all these substitutions were positioned on the receptors binding surfaces in V1/V2 or V3 loop. In silico structural studies predicted some physical changes of gp120 by substitutions with alterations in viral replication phenotypes. These data suggest that V1/V2 loop is critical for creating a gp120 structure that masks co-receptor binding site compatible with maintenance of viral infectivity, and for tuning a functional balance of gp120 between immune escape ability and infectivity to optimize HIV-1 replication fitness. PMID:26903989
The Effects of the Recombinant CCR5 T4 Lysozyme Fusion Protein on HIV-1 Infection.
Jin, Qingwen; Chen, Hong; Wang, Xingxia; Zhao, Liandong; Xu, Qingchen; Wang, Huijuan; Li, Guanyu; Yang, Xiaofan; Ma, Hongming; Wu, Haoquan; Ji, Xiaohui
2015-01-01
Insertion of T4 lysozyme (T4L) into the GPCR successfully enhanced GPCR protein stability and solubilization. However, the biological functions of the recombinant GPCR protein have not been analyzed. We engineered the CCR5-T4L mutant and expressed and purified the soluble recombinant protein using an E.coli expression system. The antiviral effects of this recombinant protein in THP-1 cell lines, primary human macrophages, and PBMCs from different donors were investigated. We also explored the possible mechanisms underlying the observed antiviral effects. Our data showed the biphasic inhibitory and promotion effects of different concentrations of soluble recombinant CCR5-T4L protein on R5 tropic human immunodeficiency virus-1 (HIV-1) infection in THP-1 cell lines, human macrophages, and PBMCs from clinical isolates. We demonstrated that soluble recombinant CCR5-T4L acts as a HIV-1 co-receptor, interacts with wild type CCR5, down-regulates the surface CCR5 expression in human macrophages, and interacts with CCL5 to inhibit macrophage migration. Using binding assays, we further determined that recombinant CCR5-T4L and [125I]-CCL5 compete for the same binding site on wild type CCR5. Our results suggest that recombinant CCR5-T4L protein marginally promotes HIV-1 infection at low concentrations and markedly inhibits infection at higher concentrations. This recombinant protein may be helpful in the future development of anti-HIV-1 therapeutic agents.
T Cell Calcium Signaling Regulation by the Co-Receptor CD5
Freitas, Claudia M. Tellez
2018-01-01
Calcium influx is critical for T cell effector function and fate. T cells are activated when T cell receptors (TCRs) engage peptides presented by antigen-presenting cells (APC), causing an increase of intracellular calcium (Ca2+) concentration. Co-receptors stabilize interactions between the TCR and its ligand, the peptide-major histocompatibility complex (pMHC), and enhance Ca2+ signaling and T cell activation. Conversely, some co-receptors can dampen Ca2+ signaling and inhibit T cell activation. Immune checkpoint therapies block inhibitory co-receptors, such as cytotoxic T-lymphocyte associated antigen 4 (CTLA-4) and programmed death 1 (PD-1), to increase T cell Ca2+ signaling and promote T cell survival. Similar to CTLA-4 and PD-1, the co-receptor CD5 has been known to act as a negative regulator of T cell activation and to alter Ca2+ signaling and T cell function. Though much is known about the role of CD5 in B cells, recent research has expanded our understanding of CD5 function in T cells. Here we review these recent findings and discuss how our improved understanding of CD5 Ca2+ signaling regulation could be useful for basic and clinical research. PMID:29701673
Shaw, Stevan; Bourne, Tim; Meier, Chris; Carrington, Bruce; Gelinas, Rich; Henry, Alistair; Popplewell, Andrew; Adams, Ralph; Baker, Terry; Rapecki, Steve; Marshall, Diane; Moore, Adrian; Neale, Helen; Lawson, Alastair
2014-01-01
Interleukin-6 (IL-6) is a critical regulator of the immune system and has been widely implicated in autoimmune disease. Here, we describe the discovery and characterization of olokizumab, a humanized antibody to IL-6. Data from structural biology, cell biology and primate pharmacology demonstrate the therapeutic potential of targeting IL-6 at "Site 3", blocking the interaction with the signaling co-receptor gp130.
Chan, Kevin Ka Ming; Seetharaman, Ashwin; Bagg, Rachel; Selman, Guillermo; Zhang, Yuqian; Kim, Joowan; Roy, Peter J
2014-08-01
We recently discovered a secreted and diffusible midline cue called MADD-4 (an ADAMTSL) that guides migrations along the dorsoventral axis of the nematode Caenorhabditis elegans. We showed that the transmembrane receptor, UNC-40 (DCC), whose canonical ligand is the UNC-6 (netrin) guidance cue, is required for extension towards MADD-4. Here, we demonstrate that MADD-4 interacts with an EVA-1/UNC-40 co-receptor complex to attract cell extensions. EVA-1 is a conserved transmembrane protein with predicted galactose-binding lectin domains. EVA-1 functions in the same pathway as MADD-4, physically interacts with both MADD-4 and UNC-40, and enhances UNC-40's sensitivity to the MADD-4 cue. This enhancement is especially important in the presence of UNC-6. In EVA-1's absence, UNC-6 interferes with UNC-40's responsiveness to MADD-4; in UNC-6's absence, UNC-40's responsiveness to MADD-4 is less dependent on EVA-1. By enabling UNC-40 to respond to MADD-4 in the presence of UNC-6, EVA-1 may increase the precision by which UNC-40-directed processes can reach their MADD-4-expressing targets within a field of the UNC-6 guidance cue.
Bagg, Rachel; Selman, Guillermo; Zhang, Yuqian; Kim, Joowan; Roy, Peter J.
2014-01-01
We recently discovered a secreted and diffusible midline cue called MADD-4 (an ADAMTSL) that guides migrations along the dorsoventral axis of the nematode Caenorhabditis elegans. We showed that the transmembrane receptor, UNC-40 (DCC), whose canonical ligand is the UNC-6 (netrin) guidance cue, is required for extension towards MADD-4. Here, we demonstrate that MADD-4 interacts with an EVA-1/UNC-40 co-receptor complex to attract cell extensions. EVA-1 is a conserved transmembrane protein with predicted galactose-binding lectin domains. EVA-1 functions in the same pathway as MADD-4, physically interacts with both MADD-4 and UNC-40, and enhances UNC-40's sensitivity to the MADD-4 cue. This enhancement is especially important in the presence of UNC-6. In EVA-1's absence, UNC-6 interferes with UNC-40's responsiveness to MADD-4; in UNC-6's absence, UNC-40's responsiveness to MADD-4 is less dependent on EVA-1. By enabling UNC-40 to respond to MADD-4 in the presence of UNC-6, EVA-1 may increase the precision by which UNC-40-directed processes can reach their MADD-4-expressing targets within a field of the UNC-6 guidance cue. PMID:25122090
Duri, Kerina; Soko, White; Gumbo, Felicity; Kristiansen, Knut; Mapingure, Munyaradzi; Stray-Pedersen, Babill; Muller, Fredrik
2011-04-01
We sought to predict virus coreceptor utilization using a simple bioinformatics method based on genotypic analysis of human immunodeficiency virus types 1 (HIV-1) env V3 loop sequences of 28 infected but drug-naive women during pregnancy and their infected infants and to better understand coreceptor usage in vertical transmission dynamics. The HIV-1 env V3 loop was sequenced from plasma samples and analyzed for viral coreceptor usage and subtype in a cohort of HIV-1-infected pregnant women. Predicted maternal frequencies of the X4, R5X4, and R5 genotypes were 7%, 11%, and 82%, respectively. Antenatal plasma viral load was higher, with a mean log(10) (SD) of 4.8 (1.6) and 3.6 (1.2) for women with the X4 and R5 genotypes, respectively, p = 0.078. Amino acid substitution from the conserved V3 loop crown motif GPGQ to GPGR and lymphadenopathy were associated with the X4 genotype, p = 0.031 and 0.043, respectively. The maternal viral coreceptor genotype was generally preserved in vertical transmission and was predictive of the newborn's viral genotype. Infants born to mothers with X4 genotypes were more likely to have lower birth weights relative to those born to mothers with the R5 genotype, with a mean weight (SD) of 2870 (±332) and 3069 (±300) g, respectively. These data show that at least in HIV-1 subtype C, R5 coreceptor usage is the most predominant genotype, which is generally preserved following vertical transmission and is associated with the V3 GPGQ crown motif. Therefore, antiretroviral-naive pregnant women and their infants can benefit from ARV combination therapies that include R5 entry inhibitors following prediction of their coreceptor genotype using simple bioinformatics methods.
Visualizing High-Efficiency HIV Transfer | Center for Cancer Research
The Human Immunodeficiency Virus (HIV), the causative agent of Acquired Immunodeficiency Syndrome (AIDS), infects and eventually kills CD4 receptor-expressing T cells, which are critical for proper immune system function. The gp120 protein on the surface of HIV particles is known to bind CD4 and a co-receptor, either CCR5 or CXCR4, leading to fusion of the virus and T cell membranes and infection of the cell. The most efficient means of viral infection occurs when an uninfected T cell interacts with a dendritic cell (DC) that has previously come in contact with HIV. Antigen presenting cells, such as DCs, normally circulate throughout the body binding or engulfing foreign material and presenting it to T cells to initiate an immune response. HIV takes advantage of this close cell-cell association to propagate, so knowing the cells’ spatial arrangement during viral transmission could elucidate novel modes of treatment.
Lu, Wenyan; Liu, Chia-Chen; Thottassery, Jaideep V.; Bu, Guojun; Li, Yonghe
2010-01-01
Mesd is a specialized chaperone for the low-density lipoprotein receptor-related protein-5 (LRP5) and LRP6. In our previous studies, we found that Mesd binds to mature LRP6 on the cell surface and blocks the binding of Wnt antagonist Dickkopf-1(Dkk1) to LRP6. Herein, we demonstrated that Mesd also binds to LRP5 with a high affinity, and is a universal inhibitor of LRP5/6 ligands. Mesd not only blocks Wnt antagonists Dkk1 and Sclerostin binding to LRP5/6, but also inhibits Wnt3A and Rspondin1-induced Wnt/β-catenin signaling in LRP5/6 expressing cells. We also found that Mesd, Dkk1 and Sclerostin compete with one another for binding to LRP5 and LRP6 at the cell surface. More importantly, we demonstrated that Mesd is able to suppress LRP6 phosphorylation and Wnt/β-catenin signaling in prostate cancer PC-3 cells, and inhibits PC-3 cell proliferation. Our results indicate that recombinant Mesd protein is a useful tool for studying Wnt/β-catenin signaling on the cell surface, and has a potential therapeutic role in Wnt-dependent cancers. PMID:20446724
Recordon-Pinson, Patricia; Soulié, Cathia; Flandre, Philippe; Descamps, Diane; Lazrek, Mouna; Charpentier, Charlotte; Montes, Brigitte; Trabaud, Mary-Anne; Cottalorda, Jacqueline; Schneider, Véronique; Morand-Joubert, Laurence; Tamalet, Catherine; Desbois, Delphine; Macé, Muriel; Ferré, Virginie; Vabret, Astrid; Ruffault, Annick; Pallier, Coralie; Raymond, Stéphanie; Izopet, Jacques; Reynes, Jacques; Marcelin, Anne-Geneviève; Masquelier, Bernard
2010-08-01
Genotypic algorithms for prediction of HIV-1 coreceptor usage need to be evaluated in a clinical setting. We aimed at studying (i) the correlation of genotypic prediction of coreceptor use in comparison with a phenotypic assay and (ii) the relationship between genotypic prediction of coreceptor use at baseline and the virological response (VR) to a therapy including maraviroc (MVC). Antiretroviral-experienced patients were included in the MVC Expanded Access Program if they had an R5 screening result with Trofile (Monogram Biosciences). V3 loop sequences were determined at screening, and coreceptor use was predicted using 13 genotypic algorithms or combinations of algorithms. Genotypic predictions were compared to Trofile; dual or mixed (D/M) variants were considered as X4 variants. Both genotypic and phenotypic results were obtained for 189 patients at screening, with 54 isolates scored as X4 or D/M and 135 scored as R5 with Trofile. The highest sensitivity (59.3%) for detection of X4 was obtained with the Geno2pheno algorithm, with a false-positive rate set up at 10% (Geno2pheno10). In the 112 patients receiving MVC, a plasma viral RNA load of <50 copies/ml was obtained in 68% of cases at month 6. In multivariate analysis, the prediction of the X4 genotype at baseline with the Geno2pheno10 algorithm including baseline viral load and CD4 nadir was independently associated with a worse VR at months 1 and 3. The baseline weighted genotypic sensitivity score was associated with VR at month 6. There were strong arguments in favor of using genotypic coreceptor use assays for determining which patients would respond to CCR5 antagonist.
Genotypic tropism testing by massively parallel sequencing: qualitative and quantitative analysis.
Däumer, Martin; Kaiser, Rolf; Klein, Rolf; Lengauer, Thomas; Thiele, Bernhard; Thielen, Alexander
2011-05-13
Inferring viral tropism from genotype is a fast and inexpensive alternative to phenotypic testing. While being highly predictive when performed on clonal samples, sensitivity of predicting CXCR4-using (X4) variants drops substantially in clinical isolates. This is mainly attributed to minor variants not detected by standard bulk-sequencing. Massively parallel sequencing (MPS) detects single clones thereby being much more sensitive. Using this technology we wanted to improve genotypic prediction of coreceptor usage. Plasma samples from 55 antiretroviral-treated patients tested for coreceptor usage with the Monogram Trofile Assay were sequenced with standard population-based approaches. Fourteen of these samples were selected for further analysis with MPS. Tropism was predicted from each sequence with geno2pheno[coreceptor]. Prediction based on bulk-sequencing yielded 59.1% sensitivity and 90.9% specificity compared to the trofile assay. With MPS, 7600 reads were generated on average per isolate. Minorities of sequences with high confidence in CXCR4-usage were found in all samples, irrespective of phenotype. When using the default false-positive-rate of geno2pheno[coreceptor] (10%), and defining a minority cutoff of 5%, the results were concordant in all but one isolate. The combination of MPS and coreceptor usage prediction results in a fast and accurate alternative to phenotypic assays. The detection of X4-viruses in all isolates suggests that coreceptor usage as well as fitness of minorities is important for therapy outcome. The high sensitivity of this technology in combination with a quantitative description of the viral population may allow implementing meaningful cutoffs for predicting response to CCR5-antagonists in the presence of X4-minorities.
Loss of CXCR6 coreceptor usage characterizes pathogenic lentiviruses
Wetzel, Katherine S.; Yi, Yanjie; Bauer, Anya M.; Bibollet-Ruche, Frederic; Hahn, Beatrice H.; Paiardini, Mirko; Silvestri, Guido; Peeters, Martine; Collman, Ronald G.
2018-01-01
Pandemic HIV-1 originated from the cross-species transmission of SIVcpz, which infects chimpanzees, while SIVcpz itself emerged following the cross-species transmission and recombination of monkey SIVs, with env contributed by the SIVgsn/mus/mon lineage that infects greater spot-nosed, mustached and mona monkeys. SIVcpz and HIV-1 are pathogenic in their respective hosts, while the phenotype of their SIVgsn/mus/mon ancestors is unknown. However, two well-studied SIV infected natural hosts, sooty mangabeys (SMs) and African green monkeys (AGMs), typically remain healthy despite high viral loads; these species express low levels of the canonical coreceptor CCR5, and recent work shows that CXCR6 is a major coreceptor for SIV in these hosts. It is not known what coreceptors were used by the precursors of SIVcpz, whether coreceptor use changed during emergence of the SIVcpz/HIV-1 lineage, and what T cell subsets express CXCR6 in natural hosts. Using species-matched coreceptors and CD4, we show here that SIVcpz uses only CCR5 for entry and, like HIV-1, cannot use CXCR6. In contrast, SIVmus efficiently uses both CXCR6 and CCR5. Coreceptor selectivity was determined by Env, with CXCR6 use abrogated by Pro326 in the V3 crown, which is absent in monkey SIVs but highly conserved in SIVcpz/HIV-1. To characterize which cells express CXCR6, we generated a novel antibody that recognizes CXCR6 of multiple primate species. Testing lymphocytes from SM, the best-studied natural host, we found that CXCR6 is restricted to CD4+ effector memory cells, and is expressed by a sub-population distinct from those expressing CCR5. Thus, efficient CXCR6 use, previously identified in SM and AGM infection, also characterizes a member of the SIV lineage that gave rise to SIVcpz/HIV-1. Loss of CXCR6 usage by SIVcpz may have altered its cell tropism, shifting virus from CXCR6-expressing cells that may support replication without disrupting immune function or homeostasis, towards CCR5-expressing cells with pathogenic consequences. PMID:29659623
Loss of CXCR6 coreceptor usage characterizes pathogenic lentiviruses.
Wetzel, Katherine S; Yi, Yanjie; Yadav, Anjana; Bauer, Anya M; Bello, Ezekiel A; Romero, Dino C; Bibollet-Ruche, Frederic; Hahn, Beatrice H; Paiardini, Mirko; Silvestri, Guido; Peeters, Martine; Collman, Ronald G
2018-04-01
Pandemic HIV-1 originated from the cross-species transmission of SIVcpz, which infects chimpanzees, while SIVcpz itself emerged following the cross-species transmission and recombination of monkey SIVs, with env contributed by the SIVgsn/mus/mon lineage that infects greater spot-nosed, mustached and mona monkeys. SIVcpz and HIV-1 are pathogenic in their respective hosts, while the phenotype of their SIVgsn/mus/mon ancestors is unknown. However, two well-studied SIV infected natural hosts, sooty mangabeys (SMs) and African green monkeys (AGMs), typically remain healthy despite high viral loads; these species express low levels of the canonical coreceptor CCR5, and recent work shows that CXCR6 is a major coreceptor for SIV in these hosts. It is not known what coreceptors were used by the precursors of SIVcpz, whether coreceptor use changed during emergence of the SIVcpz/HIV-1 lineage, and what T cell subsets express CXCR6 in natural hosts. Using species-matched coreceptors and CD4, we show here that SIVcpz uses only CCR5 for entry and, like HIV-1, cannot use CXCR6. In contrast, SIVmus efficiently uses both CXCR6 and CCR5. Coreceptor selectivity was determined by Env, with CXCR6 use abrogated by Pro326 in the V3 crown, which is absent in monkey SIVs but highly conserved in SIVcpz/HIV-1. To characterize which cells express CXCR6, we generated a novel antibody that recognizes CXCR6 of multiple primate species. Testing lymphocytes from SM, the best-studied natural host, we found that CXCR6 is restricted to CD4+ effector memory cells, and is expressed by a sub-population distinct from those expressing CCR5. Thus, efficient CXCR6 use, previously identified in SM and AGM infection, also characterizes a member of the SIV lineage that gave rise to SIVcpz/HIV-1. Loss of CXCR6 usage by SIVcpz may have altered its cell tropism, shifting virus from CXCR6-expressing cells that may support replication without disrupting immune function or homeostasis, towards CCR5-expressing cells with pathogenic consequences.
In vivo evolution of HIV-1 co-receptor usage and sensitivity to chemokine-mediated suppression.
Scarlatti, G; Tresoldi, E; Björndal, A; Fredriksson, R; Colognesi, C; Deng, H K; Malnati, M S; Plebani, A; Siccardi, A G; Littman, D R; Fenyö, E M; Lusso, P
1997-11-01
Following the identification of the C-C chemokines RANTES, MIP-1alpha and MIP-1beta as major human immunodeficiency virus (HIV)-suppressive factors produced by CD8+ T cells, several chemokine receptors were found to serve as membrane co-receptors for primate immunodeficiency lentiretroviruses. The two most widely used co-receptors thus far recognized, CCR5 and CXCR4, are expressed by both activated T lymphocytes and mononuclear phagocytes. CCR5, a specific RANTES, MIP-1alpha and MIP-1 receptor, is used preferentially by non-MT2-tropic HIV-1 and HIV-2 strains and by simian immunodeficiency virus (SIV), whereas CXCR4, a receptor for the C-X-C chemokine SDF-1, is used by MT2-tropic HIV-1 and HIV-2, but not by SIV. Other receptors with a more restricted cellular distribution, such as CCR2b, CCR3 and STRL33, can also function as co-receptors for selected viral isolates. The third variable region (V3) of the gp120 envelope glycoprotein of HIV-1 has been fingered as a critical determinant of the co-receptor choice. Here, we document a consistent pattern of evolution of viral co-receptor usage and sensitivity to chemokine-mediated suppression in a longitudinal follow-up of children with progressive HIV-1 infection. Viral isolates obtained during the asymptomatic stages generally used only CCR5 as a co-receptor and were inhibited by RANTES, MIP-1alpha and MIP-1beta, but not by SDF-1. By contrast, the majority of the isolates derived after the progression of the disease were resistant to C-C chemokines, having acquired the ability to use CXCR4 and, in some cases, CCR3, while gradually losing CCR5 usage. Surprisingly, most of these isolates were also insensitive to SDF-1, even when used in combination with RANTES. An early acquisition of CXCR4 usage predicted a poor prognosis. In children who progressed to AIDS without a shift to CXCR4 usage, all the sequential isolates were CCR5-dependent but showed a reduced sensitivity to C-C chemokines. Discrete changes in the V3 domain of gp120 were associated with the loss of sensitivity to C-C chemokines and the shift in co-receptor usage. These results suggest an adaptive evolution of HIV-1 in vivo, leading to escape from the control of the antiviral C-C chemokines.
Hill, Heather E; Pioszak, Augen A
2013-03-01
Adrenomedullin (AM) is a peptide hormone that is a potent vasodilator and is essential for vascular development. The AM receptor is a heterodimeric cell surface receptor composed of the calcitonin receptor-like receptor (CLR), a class B G protein-coupled receptor, in association with either of two receptor activity modifying protein (RAMP) coreceptors, RAMP2 or -3. The extracellular domains (ECDs) of CLR and the RAMPs form the primary AM binding site. Here, we present novel methodology for expression and purification of a heterodimeric AM receptor ECD complex as an MBP-CLR ECD fusion protein in association with the RAMP2 ECD. Co-expression of the RAMP2 ECD with the disulfide bond isomerase DsbC in the oxidizing cytoplasm of E. coli trxB gor enabled proper disulfide formation in vivo. The isolated RAMP2 ECD was purified to homogeneity. Co-expression of a soluble MBP-CLR ECD fusion protein with DsbC in E. coli trxB gor yielded a heterogeneous mixture of species with misfolded ECD. Incubation of affinity-purified MBP-CLR ECD in vitro with purified RAMP2 ECD, DsbC, and glutathione redox buffer promoted proper folding of the CLR ECD and formation of a stable MBP-CLR ECD:RAMP2 ECD complex that was purified by size-exclusion chromatography and which exhibited specific AM binding. Approximately 40mg of highly purified complex was obtained starting with 6L bacterial cultures for each protein. The methodology reported here will facilitate structure/function studies of the AM receptor. Copyright © 2012 Elsevier Inc. All rights reserved.
Crystal structure of a complete ternary complex of T-cell receptor, peptide-MHC, and CD4
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yin, Yiyuan; Wang, Xin Xiang; Mariuzza, Roy A
2012-07-11
Adaptive immunity depends on specific recognition by a T-cell receptor (TCR) of an antigenic peptide bound to a major histocompatibility complex (pMHC) molecule on an antigen-presenting cell (APC). In addition, T-cell activation generally requires binding of this same pMHC to a CD4 or CD8 coreceptor. Here, we report the structure of a complete TCR-pMHC-CD4 ternary complex involving a human autoimmune TCR, a myelin-derived self-peptide bound to HLA-DR4, and CD4. The complex resembles a pointed arch in which TCR and CD4 are each tilted ~65° relative to the T-cell membrane. By precluding direct contacts between TCR and CD4, the structure explainsmore » how TCR and CD4 on the T cell can simultaneously, yet independently, engage the same pMHC on the APC. The structure, in conjunction with previous mutagenesis data, places TCR-associated CD3εγ and CD3εδ subunits, which transmit activation signals to the T cell, inside the TCR-pMHC-CD4 arch, facing CD4. By establishing anchor points for TCR and CD4 on the T-cell membrane, the complex provides a basis for understanding how the CD4 coreceptor focuses TCR on MHC to guide TCR docking on pMHC during thymic T-cell selection.« less
Evolution of coreceptor utilization to escape CCR5 antagonist therapy.
Zhang, Jie; Gao, Xiang; Martin, John; Rosa, Bruce; Chen, Zheng; Mitreva, Makedonka; Henrich, Timothy; Kuritzkes, Daniel; Ratner, Lee
2016-07-01
The HIV-1 envelope interacts with coreceptors CCR5 and CXCR4 in a dynamic, multi-step process, its molecular details not clearly delineated. Use of CCR5 antagonists results in tropism shift and therapeutic failure. Here we describe a novel approach using full-length patient-derived gp160 quasispecies libraries cloned into HIV-1 molecular clones, their separation based on phenotypic tropism in vitro, and deep sequencing of the resultant variants for structure-function analyses. Analysis of functionally validated envelope sequences from patients who failed CCR5 antagonist therapy revealed determinants strongly associated with coreceptor specificity, especially at the gp120-gp41 and gp41-gp41 interaction surfaces that invite future research on the roles of subunit interaction and envelope trimer stability in coreceptor usage. This study identifies important structure-function relationships in HIV-1 envelope, and demonstrates proof of concept for a new integrated analysis method that facilitates laboratory discovery of resistant mutants to aid in development of other therapeutic agents. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Trouplin, Virginie; Salvatori, Francesca; Cappello, Fanny; Obry, Veronique; Brelot, Anne; Heveker, Nikolaus; Alizon, Marc; Scarlatti, Gabriella; Clavel, François; Mammano, Fabrizio
2001-01-01
We developed a recombinant virus technique to determine the coreceptor usage of human immunodeficiency virus type 1 (HIV-1) from plasma samples, the source expected to represent the most actively replicating virus population in infected subjects. This method is not subject to selective bias associated with virus isolation in culture, a step required for conventional tropism determination procedures. The addition of a simple subcloning step allowed semiquantitative evaluation of virus populations with a different coreceptor (CCR5 or CXCR4) usage specificity present in each plasma sample. This procedure detected mixtures of CCR5- and CXCR4-exclusive virus populations as well as dualtropic viral variants, in variable proportions. Sequence analysis of dualtropic clones indicated that changes in the V3 loop are necessary for the use of CXCR4 as a coreceptor, but the overall context of the V1-V3 region is important to preserve the capacity to use CCR5. This convenient technique can greatly assist the study of virus evolution and compartmentalization in infected individuals. PMID:11119595
Fusion Stage of HIV-1 Entry Depends on Virus-Induced Cell Surface Exposure of Phosphatidylserine.
Zaitseva, Elena; Zaitsev, Eugene; Melikov, Kamran; Arakelyan, Anush; Marin, Mariana; Villasmil, Rafael; Margolis, Leonid B; Melikyan, Gregory B; Chernomordik, Leonid V
2017-07-12
HIV-1 entry into host cells starts with interactions between the viral envelope glycoprotein (Env) and cellular CD4 receptors and coreceptors. Previous work has suggested that efficient HIV entry also depends on intracellular signaling, but this remains controversial. Here we report that formation of the pre-fusion Env-CD4-coreceptor complexes triggers non-apoptotic cell surface exposure of the membrane lipid phosphatidylserine (PS). HIV-1-induced PS redistribution depends on Ca 2+ signaling triggered by Env-coreceptor interactions and involves the lipid scramblase TMEM16F. Externalized PS strongly promotes Env-mediated membrane fusion and HIV-1 infection. Blocking externalized PS or suppressing TMEM16F inhibited Env-mediated fusion. Exogenously added PS promoted fusion, with fusion dependence on PS being especially strong for cells with low surface density of coreceptors. These findings suggest that cell-surface PS acts as an important cofactor that promotes the fusogenic restructuring of pre-fusion complexes and likely focuses the infection on cells conducive to PS signaling. Published by Elsevier Inc.
Clearance of PML/RARA-bound promoters suffice to initiate APL differentiation.
Vitaliano-Prunier, Adeline; Halftermeyer, Juliane; Ablain, Julien; de Reynies, Aurélien; Peres, Laurent; Le Bras, Morgane; Metzger, Daniel; de Thé, Hugues
2014-12-11
PML/RARA, a potent transcriptional inhibitor of nuclear receptor signaling, represses myeloid differentiation genes and drives acute promyelocytic leukemia (APL). Association of the retinoid X receptor-α (RXRA) coreceptor to PML/RARA is required for transformation, with RXRA promoting its efficient DNA binding. APL is exquisitely sensitive to retinoic acid (RA) and arsenic trioxide (arsenic), which both trigger cell differentiation in vivo. Whereas RA elicits transcriptional activation of PML/RARA targets, how arsenic triggers differentiation remains unclear. Here we demonstrate that extinction of PML/RARA triggers terminal differentiation in vivo. Similarly, ablation of retinoid X receptors loosens PML/RARA DNA binding, inducing terminal differentiation of APL cells ex vivo or in vivo. RXRA sumoylation directly contributes to PML/RARA-dependent transformation ex vivo, presumably by enhancing transcriptional repression. Thus, APL differentiation is a default program triggered by clearance of PML/RARA-bound promoters, rather than obligatory active transcriptional activation, explaining how arsenic elicits APL maturation through PML/RARA degradation. © 2014 by The American Society of Hematology.
Anti-HIV-1 activity of a tripodal receptor that recognizes mannose oligomers.
Rivero-Buceta, Eva; Carrero, Paula; Casanova, Elena; Doyagüez, Elisa G; Madrona, Andrés; Quesada, Ernesto; Peréz-Pérez, María Jesús; Mateos, Raquel; Bravo, Laura; Mathys, Leen; Noppen, Sam; Kiselev, Evgeny; Marchand, Christophe; Pommier, Yves; Liekens, Sandra; Balzarini, Jan; Camarasa, María José; San-Félix, Ana
2015-12-01
The glycoprotein gp120 of the HIV-1 viral envelope has a high content in mannose residues, particularly α-1,2-mannose oligomers. Compounds that interact with these high-mannose type glycans may disturb the interaction between gp120 and its (co)receptors and are considered potential anti-HIV agents. Previously, we demonstrated that a tripodal receptor (1), with a central scaffold of 1,3,5-triethylbenzene substituted with three 2,3,4-trihydroxybenzoyl groups, selectively recognizes α-1,2-mannose polysaccharides. Here we present additional studies to determine the anti-HIV-1 activity and the mechanism of antiviral activity of this compound. Our studies indicate that 1 shows anti-HIV-1 activity in the low micromolar range and has pronounced gp120 binding and HIV-1 integrase inhibitory capacity. However, gp120 binding rather than integrase inhibition seems to be the primary mechanism of antiviral activity of 1. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Barroso-González, Jonathan; El Jaber-Vazdekis, Nabil; García-Expósito, Laura; Machado, José-David; Zárate, Rafael; Ravelo, Ángel G.; Estévez-Braun, Ana; Valenzuela-Fernández, Agustín
2009-01-01
The existence of drug-resistant human immunodeficiency virus (HIV) viruses in patients receiving antiretroviral treatment urgently requires the characterization and development of new antiretroviral drugs designed to inhibit resistant viruses and to complement the existing antiretroviral strategies against AIDS. We assayed several natural or semi-synthetic lupane-type pentacyclic triterpenes in their ability to inhibit HIV-1 infection in permissive cells. We observed that the 30-oxo-calenduladiol triterpene, compound 1, specifically impaired R5-tropic HIV-1 envelope-mediated viral infection and cell fusion in permissive cells, without affecting X4-tropic virus. This lupane derivative competed for the binding of a specific anti-CCR5 monoclonal antibody or the natural CCL5 chemokine to the CCR5 viral coreceptor with high affinity. 30-Oxo-calenduladiol seems not to interact with the CD4 antigen, the main HIV receptor, or the CXCR4 viral coreceptor. Our results suggest that compound 1 is a specific CCR5 antagonist, because it binds to the CCR5 receptor without triggering cell signaling or receptor internalization, and inhibits RANTES (regulated on activation normal T cell expressed and secreted)-mediated CCR5 internalization, intracellular calcium mobilization, and cell chemotaxis. Furthermore, compound 1 appeared not to interact with β-chemokine receptors CCR1, CCR2b, CCR3, or CCR4. Thereby, the 30-oxo-calenduladiol-associated anti-HIV-1 activity against R5-tropic virus appears to rely on the selective occupancy of the CCR5 receptor to inhibit CCR5-mediated HIV-1 infection. Therefore, it is plausible that the chemical structure of 30-oxo-calenduladiol or other related dihydroxylated lupane-type triterpenes could represent a good model to develop more potent anti-HIV-1 molecules to inhibit viral infection by interfering with early fusion and entry steps in the HIV life cycle. PMID:19386595
The Odorant Receptor Co-Receptor from the Bed Bug, Cimex lectularius L
Hansen, Immo A.; Rodriguez, Stacy D.; Drake, Lisa L.; Price, David P.; Blakely, Brittny N.; Hammond, John I.; Tsujimoto, Hitoshi; Monroy, Erika Y.; Maio, William A.; Romero, Alvaro
2014-01-01
Recently, the bed bug, Cimex lectularius L. has re-emerged as a serious and growing problem in many parts of the world. Presence of resistant bed bugs and the difficulty to eliminate them has renewed interest in alternative control tactics. Similar to other haematophagous arthropods, bed bugs rely on their olfactory system to detect semiochemicals in the environment. Previous studies have morphologically characterized olfactory organs of bed bugs’ antenna and have physiologically evaluated the responses of olfactory receptor neurons (ORNs) to host-derived chemicals. To date, odorant binding proteins (OBPs) and odorant receptors (ORs) associated with these olfaction processes have not been studied in bed bugs. Chemoreception in insects requires formation of heteromeric complexes of ORs and a universal OR coreceptor (Orco). Orco is the constant chain of every odorant receptor in insects and is critical for insect olfaction but does not directly bind to odorants. Orco agonists and antagonists have been suggested as high-value targets for the development of novel insect repellents. In this study, we have performed RNAseq of bed bug sensory organs and identified several odorant receptors as well as Orco. We characterized Orco expression and investigated the effect of chemicals targeting Orco on bed bug behavior and reproduction. We have identified partial cDNAs of six C. lectularius OBPs and 16 ORs. Full length bed bug Orco was cloned and sequenced. Orco is widely expressed in different parts of the bed bug including OR neurons and spermatozoa. Treatment of bed bugs with the agonist VUAA1 changed bed bug pheromone-induced aggregation behavior and inactivated spermatozoa. We have described and characterized for the first time OBPs, ORs and Orco in bed bugs. Given the importance of these molecules in chemoreception of this insect they are interesting targets for the development of novel insect behavior modifiers. PMID:25411789
The odorant receptor co-receptor from the bed bug, Cimex lectularius L.
Hansen, Immo A; Rodriguez, Stacy D; Drake, Lisa L; Price, David P; Blakely, Brittny N; Hammond, John I; Tsujimoto, Hitoshi; Monroy, Erika Y; Maio, William A; Romero, Alvaro
2014-01-01
Recently, the bed bug, Cimex lectularius L. has re-emerged as a serious and growing problem in many parts of the world. Presence of resistant bed bugs and the difficulty to eliminate them has renewed interest in alternative control tactics. Similar to other haematophagous arthropods, bed bugs rely on their olfactory system to detect semiochemicals in the environment. Previous studies have morphologically characterized olfactory organs of bed bugs' antenna and have physiologically evaluated the responses of olfactory receptor neurons (ORNs) to host-derived chemicals. To date, odorant binding proteins (OBPs) and odorant receptors (ORs) associated with these olfaction processes have not been studied in bed bugs. Chemoreception in insects requires formation of heteromeric complexes of ORs and a universal OR coreceptor (Orco). Orco is the constant chain of every odorant receptor in insects and is critical for insect olfaction but does not directly bind to odorants. Orco agonists and antagonists have been suggested as high-value targets for the development of novel insect repellents. In this study, we have performed RNAseq of bed bug sensory organs and identified several odorant receptors as well as Orco. We characterized Orco expression and investigated the effect of chemicals targeting Orco on bed bug behavior and reproduction. We have identified partial cDNAs of six C. lectularius OBPs and 16 ORs. Full length bed bug Orco was cloned and sequenced. Orco is widely expressed in different parts of the bed bug including OR neurons and spermatozoa. Treatment of bed bugs with the agonist VUAA1 changed bed bug pheromone-induced aggregation behavior and inactivated spermatozoa. We have described and characterized for the first time OBPs, ORs and Orco in bed bugs. Given the importance of these molecules in chemoreception of this insect they are interesting targets for the development of novel insect behavior modifiers.
Palomo, Jennifer; Dietrich, Damien; Martin, Praxedis; Palmer, Gaby; Gabay, Cem
2015-11-01
The interleukin (IL)-1 family of cytokines comprises 11 members, including 7 pro-inflammatory agonists (IL-1α, IL-1β, IL-18, IL-33, IL-36α, IL-36β, IL-36γ) and 4 defined or putative antagonists (IL-1R antagonist (IL-1Ra), IL-36Ra, IL-37, and IL-38) exerting anti-inflammatory activities. Except for IL-1Ra, IL-1 cytokines do not possess a leader sequence and are secreted via an unconventional pathway. In addition, IL-1β and IL-18 are produced as biologically inert pro-peptides that require cleavage by caspase-1 in their N-terminal region to generate active proteins. N-terminal processing is also required for full activity of IL-36 cytokines. The IL-1 receptor (IL-1R) family comprises 10 members and includes cytokine-specific receptors, co-receptors and inhibitory receptors. The signaling IL-1Rs share a common structure with three extracellular immunoglobulin (Ig) domains and an intracellular Toll-like/IL-1R (TIR) domain. IL-1 cytokines bind to their specific receptor, which leads to the recruitment of a co-receptor and intracellular signaling. IL-1 cytokines induce potent inflammatory responses and their activity is tightly controlled at the level of production, protein processing and maturation, receptor binding and post-receptor signaling by naturally occurring inhibitors. Some of these inhibitors are IL-1 family antagonists, while others are IL-1R family members acting as membrane-bound or soluble decoy receptors. An imbalance between agonist and antagonist levels can lead to exaggerated inflammatory responses. Several genetic modifications or mutations associated with dysregulated IL-1 activity and autoinflammatory disorders were identified in mouse models and in patients. These findings paved the road to the successful use of IL-1 inhibitors in diseases that were previously considered as untreatable. Copyright © 2015 Elsevier Ltd. All rights reserved.
T-cell receptor accessory and co-receptor molecules in channel catfish
USDA-ARS?s Scientific Manuscript database
T cell receptor (TCR) associated invariant chains CD3gamma/delta,epsilon, and zeta as well as TCR co-receptors CD8alpha and CD8beta were isolated from the channel catfish, Ictalurus punctatus, at both the gene and cDNA levels. All of catfish CD3 sequences encode for proteins that resemble their resp...
Bardhi, Ariola; Wu, Yanling; Chen, Weizao; Li, Wei; Zhu, Zhongyu; Zheng, Jian Hua; Wong, Hing; Jeng, Emily; Jones, Jennifer; Ochsenbauer, Christina; Kappes, John C.; Dimitrov, Dimiter S.; Ying, Tianlei
2017-01-01
ABSTRACT Antibodies bound to human immunodeficiency virus type 1 (HIV-1) envelope protein expressed by infected cells mobilize antibody-dependent cellular cytotoxicity (ADCC) to eliminate the HIV-1-infected cells and thereby suppress HIV-1 infection and delay disease progression. Studies treating HIV-1-infected individuals with latency reactivation agents to reduce their latent HIV-1 reservoirs indicated that their HIV-1-specific immune responses were insufficient to effectively eliminate the reactivated latent HIV-1-infected T cells. Mobilization of ADCC may facilitate elimination of reactivated latent HIV-1-infected cells to deplete the HIV-1 reservoir and contribute to a functional HIV-1 cure. The most effective antibodies for controlling and eradicating HIV-1 infection would likely have the dual capacities of potently neutralizing a broad range of HIV-1 isolates and effectively mobilizing HIV-1-specific ADCC to eliminate HIV-1-infected cells. For this purpose, we constructed LSEVh-LS-F, a broadly neutralizing, defucosylated hexavalent fusion protein specific for both the CD4 and coreceptor gp120-binding sites. LSEVh-LS-F potently inhibited in vivo HIV-1 and simian-human immunodeficiency virus (SHIV) infection in humanized mouse and macaque models, respectively, including in vivo neutralization of HIV-1 strains resistant to the broadly neutralizing antibodies VRC01 and 3BNC117. We developed a novel humanized mouse model to evaluate in vivo human NK cell-mediated elimination of HIV-1-infected cells by ADCC and utilized it to demonstrate that LSEVh-LS-F rapidly mobilized NK cells to eliminate >80% of HIV-1-infected cells in vivo 1 day after its administration. The capacity of LSEVh-LS-F to eliminate HIV-1-infected cells via ADCC combined with its broad neutralization activity supports its potential use as an immunotherapeutic agent to eliminate reactivated latent cells and deplete the HIV-1 reservoir. IMPORTANCE Mobilization of antibody-dependent cellular cytotoxicity (ADCC) to eliminate reactivated latent HIV-1-infected cells is a strategy which may contribute to depleting the HIV-1 reservoir and achieving a functional HIV-1 cure. To more effectively mobilize ADCC, we designed and constructed LSEVh-LS-F, a broadly neutralizing, defucosylated hexavalent fusion protein specific for both the CD4 and coreceptor gp120-binding sites. LSEVh-LS-F potently inhibited in vivo HIV-1 and SHIV infection in humanized mouse and macaque models, respectively, including in vivo neutralization of an HIV-1 strain resistant to the broadly neutralizing antibodies VRC01 and 3BNC117. Using a novel humanized mouse model, we demonstrated that LSEVh-LS-F rapidly mobilized NK cells to eliminate >80% of HIV-1-infected cells in vivo 1 day after its administration. The capacity of LSEVh-LS-F to eliminate HIV-1-infected cells via ADCC combined with its broad neutralization activity supports its potential use as an immunotherapeutic agent to eliminate reactivated latent cells and deplete the HIV-1 reservoir. PMID:28794022
Bardhi, Ariola; Wu, Yanling; Chen, Weizao; Li, Wei; Zhu, Zhongyu; Zheng, Jian Hua; Wong, Hing; Jeng, Emily; Jones, Jennifer; Ochsenbauer, Christina; Kappes, John C; Dimitrov, Dimiter S; Ying, Tianlei; Goldstein, Harris
2017-10-15
Antibodies bound to human immunodeficiency virus type 1 (HIV-1) envelope protein expressed by infected cells mobilize antibody-dependent cellular cytotoxicity (ADCC) to eliminate the HIV-1-infected cells and thereby suppress HIV-1 infection and delay disease progression. Studies treating HIV-1-infected individuals with latency reactivation agents to reduce their latent HIV-1 reservoirs indicated that their HIV-1-specific immune responses were insufficient to effectively eliminate the reactivated latent HIV-1-infected T cells. Mobilization of ADCC may facilitate elimination of reactivated latent HIV-1-infected cells to deplete the HIV-1 reservoir and contribute to a functional HIV-1 cure. The most effective antibodies for controlling and eradicating HIV-1 infection would likely have the dual capacities of potently neutralizing a broad range of HIV-1 isolates and effectively mobilizing HIV-1-specific ADCC to eliminate HIV-1-infected cells. For this purpose, we constructed LSEVh-LS-F, a broadly neutralizing, defucosylated hexavalent fusion protein specific for both the CD4 and coreceptor gp120-binding sites. LSEVh-LS-F potently inhibited in vivo HIV-1 and simian-human immunodeficiency virus (SHIV) infection in humanized mouse and macaque models, respectively, including in vivo neutralization of HIV-1 strains resistant to the broadly neutralizing antibodies VRC01 and 3BNC117. We developed a novel humanized mouse model to evaluate in vivo human NK cell-mediated elimination of HIV-1-infected cells by ADCC and utilized it to demonstrate that LSEVh-LS-F rapidly mobilized NK cells to eliminate >80% of HIV-1-infected cells in vivo 1 day after its administration. The capacity of LSEVh-LS-F to eliminate HIV-1-infected cells via ADCC combined with its broad neutralization activity supports its potential use as an immunotherapeutic agent to eliminate reactivated latent cells and deplete the HIV-1 reservoir. IMPORTANCE Mobilization of antibody-dependent cellular cytotoxicity (ADCC) to eliminate reactivated latent HIV-1-infected cells is a strategy which may contribute to depleting the HIV-1 reservoir and achieving a functional HIV-1 cure. To more effectively mobilize ADCC, we designed and constructed LSEVh-LS-F, a broadly neutralizing, defucosylated hexavalent fusion protein specific for both the CD4 and coreceptor gp120-binding sites. LSEVh-LS-F potently inhibited in vivo HIV-1 and SHIV infection in humanized mouse and macaque models, respectively, including in vivo neutralization of an HIV-1 strain resistant to the broadly neutralizing antibodies VRC01 and 3BNC117. Using a novel humanized mouse model, we demonstrated that LSEVh-LS-F rapidly mobilized NK cells to eliminate >80% of HIV-1-infected cells in vivo 1 day after its administration. The capacity of LSEVh-LS-F to eliminate HIV-1-infected cells via ADCC combined with its broad neutralization activity supports its potential use as an immunotherapeutic agent to eliminate reactivated latent cells and deplete the HIV-1 reservoir. Copyright © 2017 American Society for Microbiology.
Ng, Wy Ching; Liong, Stella; Tate, Michelle D.; Irimura, Tatsuro; Denda-Nagai, Kaori; Brooks, Andrew G.; Londrigan, Sarah L.
2014-01-01
Specific protein receptors that mediate internalization and entry of influenza A virus (IAV) have not been identified for any cell type. Sialic acid (SIA), the primary attachment factor for IAV hemagglutinin, is expressed by numerous cell surface glycoproteins and glycolipids, confounding efforts to identify specific receptors involved in virus infection. Lec1 Chinese hamster ovary (CHO) epithelial cells express cell surface SIA and bind IAV yet are largely resistant to infection. Here, we demonstrate that expression of the murine macrophage galactose-type lectin 1 (MGL1) by Lec1 cells enhanced Ca2+-dependent IAV binding and restored permissivity to infection. Lec1 cells expressing MGL1 were infected in the presence or absence of cell surface SIA, indicating that MGL1 can act as a primary receptor or as a coreceptor with SIA. Lec1 cells expressing endocytosis-deficient MGL1 mediated Ca2+-dependent IAV binding but were less sensitive to IAV infection, indicating that direct internalization via MGL1 can result in cellular infection. Together, these studies identify MGL1 as a cell surface glycoprotein that can act as an authentic receptor for both attachment and infectious entry of IAV. PMID:24257596
Antigenic and 3D structural characterization of soluble X4 and hybrid X4-R5 HIV-1 Env trimers
2014-01-01
Background HIV-1 is decorated with trimeric glycoprotein spikes that enable infection by engaging CD4 and a chemokine coreceptor, either CCR5 or CXCR4. The variable loop 3 (V3) of the HIV-1 envelope protein (Env) is the main determinant for coreceptor usage. The predominant CCR5 using (R5) HIV-1 Env has been intensively studied in function and structure, whereas the trimeric architecture of the less frequent, but more cytopathic CXCR4 using (X4) HIV-1 Env is largely unknown, as are the consequences of sequence changes in and near V3 on antigenicity and trimeric Env structure. Results Soluble trimeric gp140 Env constructs were used as immunogenic mimics of the native spikes to analyze their antigenic properties in the context of their overall 3D structure. We generated soluble, uncleaved, gp140 trimers from a prototypic T-cell line-adapted (TCLA) X4 HIV-1 strain (NL4-3) and a hybrid (NL4-3/ADA), in which the V3 spanning region was substituted with that from the primary R5 isolate ADA. Compared to an ADA (R5) gp140, the NL4-3 (X4) construct revealed an overall higher antibody accessibility, which was most pronounced for the CD4 binding site (CD4bs), but also observed for mAbs against CD4 induced (CD4i) epitopes and gp41 mAbs. V3 mAbs showed significant binding differences to the three constructs, which were refined by SPR analysis. Of interest, the NL4-3/ADA construct with the hybrid NL4-3/ADA CD4bs showed impaired CD4 and CD4bs mAb reactivity despite the presence of the essential elements of the CD4bs epitope. We obtained 3D reconstructions of the NL4-3 and the NL4-3/ADA gp140 trimers via electron microscopy and single particle analysis, which indicates that both constructs inherit a propeller-like architecture. The first 3D reconstruction of an Env construct from an X4 TCLA HIV-1 strain reveals an open conformation, in contrast to recently published more closed structures from R5 Env. Exchanging the X4 V3 spanning region for that of R5 ADA did not alter the open Env architecture as deduced from its very similar 3D reconstruction. Conclusions 3D EM analysis showed an apparent open trimer configuration of X4 NL4-3 gp140 that is not modified by exchanging the V3 spanning region for R5 ADA. PMID:24884925
Toro Nieves, Dianedis M; Plaud, Marinés; Wojna, Valerie; Skolasky, Richard; Meléndez, Loyda M
2009-01-01
Human immunodeficiency virus type 1 (HIV-1) tropism plays an important role in HIV-associated dementia. In this study, aimed at determining if the tropism and coreceptor usage of circulating viruses correlates with cognitive function, the authors isolated and characterized HIV from the peripheral blood of 21 Hispanic women using antiretroviral therapy. Macrophage tropism was determined by inoculation of HIV isolates onto monocyte-derived macrophages and lymphocyte cultures. To define coreceptor usage, the HIV isolates were inoculated onto the U87.CD4 glioma cell lines with specific CCR5 and CXCR4 coreceptors. HIV isolates from cognitively impaired patients showed higher levels of replication in mitogen-stimulated peripheral blood mononuclear cells than did isolates from patients with normal cognition (P < .05). The viral growth of HIV primary isolates in macrophages and lymphocytes did not differ between patients with and those without cognitive impairment. However, isolates from the cognitively impaired women preferentially used the X4 coreceptor (P < .05). These phenotypic studies suggest that cognitively impaired HIV-infected women receiving treatment may have a more highly replicating and more pathogenic X4 virus in the circulation that could contribute to their neuropathogenesis. PMID:17849315
Lopez-Casillas, Fernando; Riquelme, Cecilia; Perez-Kato, Yoshiaki; Ponce-Castaneda, M Veronica; Osses, Nelson; Esparza-Lopez, Jose; Gonzalez-Nunez, Gerardo; Cabello-Verrugio, Claudio; Mendoza, Valentin; Troncoso, Victor; Brandan, Enrique
2003-01-03
Betaglycan is a membrane-anchored proteoglycan co-receptor that binds transforming growth factor beta (TGF-beta) via its core protein and basic fibroblast growth factor through its glycosaminoglycan chains. In this study we evaluated the expression of betaglycan during the C(2)C(12) skeletal muscle differentiation. Betaglycan expression, as determined by Northern and Western blot, was up-regulated during the conversion of myoblasts to myotubes. The mouse betaglycan gene promoter was cloned, and its sequence showed putative binding sites for SP1, Smad3, Smad4, muscle regulatory factor elements such as MyoD and MEF2, and retinoic acid receptor. Transcriptional activity of the mouse betaglycan promoter reporter was also up-regulated in differentiating C(2)C(12) cells. We found that MyoD, but not myogenin, stimulated this transcriptional activity even in the presence of high serum. Betaglycan promoter activity was increased by RA and inhibited by the three isoforms of TGF-beta. On the other hand, basic fibroblast growth factor, BMP-2, and hepatocyte growth factor/scatter factor, which are inhibitors of myogenesis, had little effect. In myotubes, up-regulated betaglycan was also detectable by TGF-beta affinity labeling and immunofluorescence microscopy studies. The latter indicated that betaglycan was localized both on the cell surface and in the ECM. Forced expression of betaglycan in C(2)C(12) myoblasts increases their responsiveness to TGF-beta2, suggesting that it performs a TGF-beta presentation function in this cell lineage. These results indicate that betaglycan expression is up-regulated during myogenesis and that MyoD and RA modulate its expression by a mechanism that is independent of myogenin.
Shimoni, Moria; Herschhorn, Alon; Britan-Rosich, Yelena; Kotler, Moshe; Benhar, Itai
2013-01-01
Abstract Selecting for antibodies against specific cell-surface proteins is a difficult task due to many unrelated proteins that are expressed on the cell surface. Here, we describe a method to screen antibody-presenting phage libraries against native cell-surface proteins. We applied this method to isolate antibodies that selectively recognize CCR5, which is the major co-receptor for HIV entry (consequently, playing a pivotal role in HIV transmission and pathogenesis). We employed a phage screening strategy by using cells that co-express GFP and CCR5, along with an excess of control cells that do not express these proteins (and are otherwise identical to the CCR5-expressing cells). These control cells are intended to remove most of the phages that bind the cells nonspecifically; thus leading to an enrichment of the phages presenting anti-CCR5-specific antibodies. Subsequently, the CCR5-presenting cells were quantitatively sorted by flow cytometry, and the bound phages were eluted, amplified, and used for further successive selection rounds. Several different clones of human single-chain Fv antibodies that interact with CCR5-expressing cells were identified. The most specific monoclonal antibody was converted to a full-length IgG and bound the second extracellular loop of CCR5. The experimental approach presented herein for screening for CCR5-specific antibodies can be applicable to screen antibody-presenting phage libraries against any cell-surface expressed protein of interest. PMID:23941674
Tetraspanin-3 is an organizer of the multi-subunit Nogo-A signaling complex.
Thiede-Stan, Nina K; Tews, Björn; Albrecht, David; Ristic, Zorica; Ewers, Helge; Schwab, Martin E
2015-10-01
To ensure precision and specificity of ligand-receptor-induced signaling, co-receptors and modulatory factors play important roles. The membrane-bound ligand Nogo-A (an isoform encoded by RTN4) induces inhibition of neurite outgrowth, cell spreading, adhesion and migration through multi-subunit receptor complexes. Here, we identified the four-transmembrane-spanning protein tetraspanin-3 (TSPAN3) as a new modulatory co-receptor for the Nogo-A inhibitory domain Nogo-A-Δ20. Single-molecule tracking showed that TSPAN3 molecules in the cell membrane reacted to binding of Nogo-A with elevated mobility, which was followed by association with the signal-transducing Nogo-A receptor sphingosine-1-phosphate receptor 2 (S1PR2). Subsequently, TSPAN3 was co-internalized as part of the Nogo-A-ligand-receptor complex into early endosomes, where it subsequently separated from Nogo-A and S1PR2 to be recycled to the cell surface. The functional importance of the Nogo-A-TSPAN3 interaction is shown by the fact that knockdown of TSPAN3 strongly reduced the Nogo-A-induced S1PR2 clustering, RhoA activation, cell spreading and neurite outgrowth inhibition. In addition to the modulatory functions of TSPAN3 on Nogo-A-S1PR2 signaling, these results illustrate the very dynamic spatiotemporal reorganizations of membrane proteins during ligand-induced receptor complex organization. © 2015. Published by The Company of Biologists Ltd.
Wetzel, Katherine S; Elliott, Sarah T C; Collman, Ronald G
2018-01-01
Pathogenic HIV-1 infection of humans and SIVmac infection of macaques are the result of zoonotic transfer of primate immunodeficiency viruses from their natural hosts into non-natural host species. Natural host infections do not result in pathogenesis despite high levels of virus replication, and evidence suggests that differences in anatomical location and specific subsets of CD4+ T cells infected may underlie distinct outcomes from infection. The coreceptor CCR5 has long been considered the sole pathway for SIV entry and the key determinant of CD4+ cell targeting, but it has also been known that natural hosts express exceedingly low levels of CCR5 despite maintaining high levels of virus replication. This review details emerging data indicating that in multiple natural host species, CCR5 is dispensable for SIV infection ex vivo and/or in vivo and, contrary to the established dogma, alternative coreceptors, particularly CXCR6, play a central role in infection and cell targeting. Infections of non-natural hosts, however, are characterized by CCR5-exclusive entry. These findings suggest that alternative coreceptor-mediated cell targeting in natural hosts, combined with low CCR5 expression, may direct the virus to distinct populations of cells that are dispensable for immune homeostasis, particularly extralymphoid and more differentiated CD4+ T cells. In contrast, CCR5-mediated entry in non-natural hosts results in targeting of CD4+ T cells that are located in lymphoid tissues, critical for immune homeostasis, or necessary for gut barrier integrity. Thus, fundamental differences in viral entry coreceptor use may be central determinants of infection outcome. These findings redefine the normal SIV/host relationship in natural host species, shed new light on key features linked to zoonotic immunodeficiency virus transfer, and highlight important questions regarding how and why this coreceptor bottleneck occurs and the coevolutionary equilibrium is lost following cross-species transfer that results in AIDS. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Hu, Qin-xue; Barry, Ashley Perkins; Wang, Zi-xuan; Connolly, Shanon M.; Peiper, Stephen C.; Greenberg, Michael L.
2000-01-01
The evolution of human immunodeficiency virus type 1 infection is associated with a shift in the target cell population, driven by variability in coreceptor utilization resulting from diversity in env. To elucidate the potential consequences of these changes for Env-mediated fusion over the course of AIDS, we examined the biological properties of serial viral isolates and determined coreceptor utilization by the products of env cloned from two individuals, followed from the detection of seroconversion throughout the course of their infection. One had a typical course, and the other had an accelerated progression. Early isolates were non-syncytium inducing, and the corresponding Env exclusively utilized CCR5, whereas Env from late phases of infection showed restricted utilization of CXCR4 in both patients. Env from subject SC24, who had a standard progression, demonstrated multitropism, manifested by utilization of CCR3, CXCR4, and CCR5 in the intervening period. In contrast, Env from patient SC51, who experienced early conversion to the syncytium-inducing phenotype, developed dualtropic coreceptor utilization of CCR5 and CXCR4. Genetic analysis of env from each isolate revealed that those with an X4 phenotype formed a distinct subcluster within each subject. Analysis of chimeras constructed from R5 and multispecific env from patient SC24 demonstrated that while the V3 domain played a dominant role in determining coreceptor utilization, sequences in the V4–V5 region also contributed to the latter phenotype. Immunoprecipitation experiments confirmed that the hybrid Env proteins were expressed at similar levels. These experiments demonstrate that progression from the R5 to X4 phenotype may occur through a multi- or dual-tropic intermediate and that multiple domains contribute to this process. PMID:11090186
HIV type 1 chemokine receptor usage in mother-to-child transmission.
Salvatori, F; Scarlatti, G
2001-07-01
To investigate the role of the HIV-1 phenotype in mother-to-child HIV-1 transmission, we evaluated coreceptor usage and replication kinetics in chemokine receptor-expressing U87MG.CD4 cells of primary isolates from 32 HIV-1-infected mothers of Italian origin, none under preventive antiretroviral therapy, and from their infected infants. Five of 15 mothers of infected children and 2 of 17 mothers of uninfected children harbored viruses able to use CXCR4 as coreceptor. However, all isolates used CCR5, alone or in association with CXCR4. The replicative capacity in coreceptor-expressing cells of the viral isolates did not differ between the two groups of mothers. All mothers with an R5 virus transmitted a virus with the same coreceptor usage, whereas those four with a multitropic virus transmitted such a virus in one case. Although the presence of a mixed viral population was documented in the mothers, we did not observe transmission solely of X4 viruses. Interestingly, the only child infected with a multitropic virus carried a defective CCR5 allele. Analysis of the env V3 region of the provirus from this child revealed infection with multiple viral variants with a predominance of R5-type over X4-type sequences. These findings show that CCR5 usage of a viral isolate is not a discriminating risk factor for vertical transmission. Furthermore, X4 viruses can be transmitted to the newborn, although less frequently. In particular, we document the transmission of multiple viral variants with different coreceptor usage in a Delta32 CCR5 heterozygous child, and demonstrate that the heterozygous genotype per se does not contribute to the restriction of R5-type virus spread.
Karlsson, Ulf; Antonsson, Liselotte; Ljungberg, Bengt; Medstrand, Patrik; Esbjörnsson, Joakim; Jansson, Marianne; Gisslen, Magnus
2012-09-10
To study the use of major and alternative coreceptors by HIV-1 isolates obtained from paired plasma and cerebrospinal fluid (CSF) samples. Paired plasma and CSF isolates from HIV-1-infected individuals with varying clinical, virologic, and immunologic parameters were assessed for the ability to infect indicator cells expressing a panel of coreceptors with documented expression in the central nervous system (CNS). HIV-1 isolates obtained from plasma and CSF in 28 individuals with varying viral load, CD4 T-cell counts, and with or without AIDS-defining disease were analyzed for the ability to infect NP2.CD4 cells stably expressing a panel of HIV coreceptors (CCR5, CXCR4, CCR3, CXCR6, GPR1, APJ, ChemR23, RDC-1 or BLT1). All isolates from both plasma and CSF utilized CCR5 and/or CXCR4. However, the ability to use both CCR3 and CCR5 (R3R5) was more pronounced in CSF isolates and correlated with high CSF viral load and low CD4 T-cell count. Notably, four out of five CSF isolates of subtype C origin exhibited CXCR6 use, which coincided with high CSF viral load despite preserved CD4 T-cell counts. The use of other alternative coreceptors was less pronounced. Dual-tropic R3R5 HIV-1 isolates in CSF coincide with high CSF viral load and low CD4 T-cell counts. Frequent CXCR6 use by CSF-derived subtype C isolates indicates that subtype-specific differences in coreceptor use may exist that will not be acknowledged when assessing plasma virus isolates. The findings may also bare relevance for HIV-1 replication within the CNS, and consequently, for the neuropathogenesis of AIDS.
Evolution of HIV-1 coreceptor usage and coreceptor switching during pregnancy.
Ransy, Doris G; Motorina, Alena; Merindol, Natacha; Akouamba, Bertine S; Samson, Johanne; Lie, Yolanda; Napolitano, Laura A; Lapointe, Normand; Boucher, Marc; Soudeyns, Hugo
2014-03-01
Coreceptor switch from CCR5 to CXCR4 is associated with HIV disease progression. To document the evolution of coreceptor tropism during pregnancy, a longitudinal study of envelope gene sequences was performed in a group of pregnant women infected with HIV-1 of clade B (n=10) or non-B (n=9). Polymerase chain reaction (PCR) amplification of the V1-V3 region was performed on plasma viral RNA, followed by cloning and sequencing. Using geno2pheno and PSSMX4R5, the presence of X4 variants was predicted in nine of 19 subjects (X4 subjects) independent of HIV-1 clade. Six of nine X4 subjects exhibited CD4(+) T cell counts <200 cells/mm(3), and the presence of X4-capable virus was confirmed using a recombinant phenotypic assay in four of seven cases where testing was successful. In five of nine X4 subjects, a statistically significant decline in the geno2pheno false-positive rate was observed during the course of pregnancy, invariably accompanied by progressive increases in the PSSMX4R5 score, the net charge of V3, and the relative representation of X4 sequences. Evolution toward X4 tropism was also echoed in the primary structure of V2, as an accumulation of substitutions associated with CXCR4 tropism was seen in X4 subjects. Results from these experiments provide the first evidence of the ongoing evolution of coreceptor utilization from CCR5 to CXCR4 during pregnancy in a significant fraction of HIV-infected women. These results inform changes in host-pathogen interactions that lead to a directional shaping of viral populations and viral tropism during pregnancy, and provide insights into the biology of HIV transmission from mother to child.
Coreceptors and Their Ligands in Epithelial γδ T Cell Biology
Witherden, Deborah A.; Johnson, Margarete D.; Havran, Wendy L.
2018-01-01
Epithelial tissues line the body providing a protective barrier from the external environment. Maintenance of these epithelial barrier tissues critically relies on the presence of a functional resident T cell population. In some tissues, the resident T cell population is exclusively comprised of γδ T cells, while in others γδ T cells are found together with αβ T cells and other lymphocyte populations. Epithelial-resident γδ T cells function not only in the maintenance of the epithelium, but are also central to the repair process following damage from environmental and pathogenic insults. Key to their function is the crosstalk between γδ T cells and neighboring epithelial cells. This crosstalk relies on multiple receptor–ligand interactions through both the T cell receptor and accessory molecules leading to temporal and spatial regulation of cytokine, chemokine, growth factor, and extracellular matrix protein production. As antigens that activate epithelial γδ T cells are largely unknown and many classical costimulatory molecules and coreceptors are not used by these cells, efforts have focused on identification of novel coreceptors and ligands that mediate pivotal interactions between γδ T cells and their neighbors. In this review, we discuss recent advances in the understanding of functions for these coreceptors and their ligands in epithelial maintenance and repair processes. PMID:29686687
Abnormal B cell memory subsets dominate HIV-specific responses in infected individuals
Kardava, Lela; Moir, Susan; Shah, Naisha; Wang, Wei; Wilson, Richard; Buckner, Clarisa M.; Santich, Brian H.; Kim, Leo J.Y.; Spurlin, Emily E.; Nelson, Amy K.; Wheatley, Adam K.; Harvey, Christopher J.; McDermott, Adrian B.; Wucherpfennig, Kai W.; Chun, Tae-Wook; Tsang, John S.; Li, Yuxing; Fauci, Anthony S.
2014-01-01
Recently, several neutralizing anti-HIV antibodies have been isolated from memory B cells of HIV-infected individuals. Despite extensive evidence of B cell dysfunction in HIV disease, little is known about the cells from which these rare HIV-specific antibodies originate. Accordingly, we used HIV envelope gp140 and CD4 or coreceptor (CoR) binding site (bs) mutant probes to evaluate HIV-specific responses in peripheral blood B cells of HIV-infected individuals at various stages of infection. In contrast to non-HIV responses, HIV-specific responses against gp140 were enriched within abnormal B cells, namely activated and exhausted memory subsets, which are largely absent in the blood of uninfected individuals. Responses against the CoRbs, which is a poorly neutralizing epitope, arose early, whereas those against the well-characterized neutralizing epitope CD4bs were delayed and infrequent. Enrichment of the HIV-specific response within resting memory B cells, the predominant subset in uninfected individuals, did occur in certain infected individuals who maintained low levels of plasma viremia and immune activation with or without antiretroviral therapy. The distribution of HIV-specific responses among memory B cell subsets was corroborated by transcriptional analyses. Taken together, our findings provide valuable insight into virus-specific B cell responses in HIV infection and demonstrate that memory B cell abnormalities may contribute to the ineffectiveness of the antibody response in infected individuals. PMID:24892810
Holland, Christopher J.; Dolton, Garry; Scurr, Martin; Ladell, Kristin; Schauenburg, Andrea J.; Miners, Kelly; Madura, Florian; Sewell, Andrew K.; Price, David A.
2015-01-01
Fluorochrome-conjugated peptide–MHC (pMHC) class I multimers are staple components of the immunologist’s toolbox, enabling reliable quantification and analysis of Ag-specific CD8+ T cells irrespective of functional outputs. In contrast, widespread use of the equivalent pMHC class II (pMHC-II) reagents has been hindered by intrinsically weaker TCR affinities for pMHC-II, a lack of cooperative binding between the TCR and CD4 coreceptor, and a low frequency of Ag-specific CD4+ T cell populations in the peripheral blood. In this study, we show that peptide flanking regions, extending beyond the central nonamer core of MHC-II–bound peptides, can enhance TCR–pMHC-II binding and T cell activation without loss of specificity. Consistent with these findings, pMHC-II multimers incorporating peptide flanking residue modifications proved superior for the ex vivo detection, characterization, and manipulation of Ag-specific CD4+ T cells, highlighting an unappreciated feature of TCR–pMHC-II interactions. PMID:26553072
Phenotype Variation in Human Immunodeficiency virus Type 1 Transmission and Disease Progression
Cavarelli, Mariangela; Scarlatti, Gabriella
2009-01-01
Human immunodeficiency virus type I (HIV-1) infects target cells through interaction with the CD4 molecule and chemokine receptors, mainly CCR5 and CXCR4. Viral isolates can be phenotypically classified based on the co-receptor they utilize to infect target cells. Thus, R5 and X4 virus use respectively CCR5 and CXCR4, whereas R5X4 virus can use either CCR5 or CXCR4. This review describes the central role played by co-receptor expression and usage for HIV-1 cell tropism, transmission and pathogenesis. We discuss various hypotheses proposed to explain the preferential transmission of R5 viruses and the mechanisms driving the change of HIV-1 co-receptor usage in the course of infection. Recent insights in the intrinsic variability of R5 viruses and their role in influencing disease progression in both adults and children are also discussed. PMID:19893208
Phenotype variation in human immunodeficiency virus type 1 transmission and disease progression.
Cavarelli, Mariangela; Scarlatti, Gabriella
2009-01-01
Human immunodeficiency virus type I (HIV-1) infects target cells through interaction with the CD4 molecule and chemokine receptors, mainly CCR5 and CXCR4. Viral isolates can be phenotypically classified based on the co-receptor they utilize to infect target cells. Thus, R5 and X4 virus use respectively CCR5 and CXCR4, whereas R5X4 virus can use either CCR5 or CXCR4. This review describes the central role played by co-receptor expression and usage for HIV-1 cell tropism, transmission and pathogenesis. We discuss various hypotheses proposed to explain the preferential transmission of R5 viruses and the mechanisms driving the change of HIV-1 co-receptor usage in the course of infection. Recent insights in the intrinsic variability of R5 viruses and their role in influencing disease progression in both adults and children are also discussed.
Ganaie, Safder S; Chen, Aaron Yun; Huang, Chun; Xu, Peng; Kleiboeker, Steve; Du, Aifang; Qiu, Jianming
2018-04-15
Human parvovirus B19 (B19V) expresses a single precursor mRNA (pre-mRNA), which undergoes alternative splicing and alternative polyadenylation to generate 12 viral mRNA transcripts that encode two structural proteins (VP1 and VP2) and three nonstructural proteins (NS1, 7.5-kDa protein, and 11-kDa protein). Splicing at the second 5' donor site (D2 site) of the B19V pre-mRNA is essential for the expression of VP2 and the 11-kDa protein. We previously identified that cis -acting intronic splicing enhancer 2 (ISE2) that lies immediately after the D2 site facilitates the recognition of the D2 donor for its efficient splicing. In this study, we report that ISE2 is critical for the expression of the 11-kDa viral nonstructural protein. We found that ISE2 harbors a consensus RNA binding motif protein 38 (RBM38) binding sequence, 5'-UGUGUG-3'. RBM38 is expressed during the middle stage of erythropoiesis. We first confirmed that RBM38 binds specifically with the ISE2 element in vitro The knockdown of RBM38 significantly decreases the level of spliced mRNA at D2 that encodes the 11-kDa protein but not that of the D2-spliced mRNA that encodes VP2. Importantly, we found that the 11-kDa protein enhances viral DNA replication and virion release. Accordingly, the knockdown of RBM38 decreases virus replication via downregulating 11-kDa protein expression. Taken together, these results suggest that the 11-kDa protein facilitates B19V DNA replication and that RBM38 is an essential host factor for B19V pre-mRNA splicing and for the expression of the 11-kDa protein. IMPORTANCE B19V is a human pathogen that can cause fifth disease, arthropathy, anemia in immunocompromised patients and sickle cell disease patients, myocarditis, and hydrops fetalis in pregnant women. Human erythroid progenitor cells (EPCs) are most susceptible to B19V infection and fully support viral DNA replication. The exclusive tropism of B19V for erythroid-lineage cells is dependent not only on the expression of viral receptors and coreceptors on the cell surface but also on the intracellular host factors that support B19V replication. Our present study shows that B19V uses a host factor, RNA binding motif protein 38 (RBM38), for the processing of its pre-mRNA during virus replication. Specifically, RBM38 interacts with the intronic splicing enhancer 2 (ISE2) element of B19V pre-mRNA and promotes 11-kDa protein expression, thereby regulating the 11-kDa protein-mediated augmentation of B19V replication. The identification of this novel host-pathogen interaction will provide mechanistic insights into B19V replication and aid in finding new targets for anti-B19V therapeutics. Copyright © 2018 American Society for Microbiology.
Goetz, Mathew Bidwell; Leduc, Robert; Skowron, Gail; Su, Zhaohui; Chan, Ellen S.; Heera, Jayyant; Chapman, Doug; Spritzler, John; Reeves, Jacqueline D.; Gulick, Roy M.; Coakley, Eoin
2011-01-01
The enhanced-sensitivity Trofile assay (TF-ES; Monogram Biosciences) was used to retest coreceptor tropism samples from 4 different cohorts of HIV-1–infected patients. Nine percent to 26% of patients with CCR5-tropic virus by the original Trofile assay had CXCR4-using virus by TF-ES. Lower CD4 cell counts were associated with CXCR4-using virus in all cohorts. PMID:21427401
Association between HIV-1 coreceptor usage and resistance to broadly neutralizing antibodies.
Pfeifer, Nico; Walter, Hauke; Lengauer, Thomas
2014-10-01
Recently discovered broadly neutralizing antibodies have revitalized hopes of developing a universal vaccine against HIV-1. Mainly responsible for new infections are variants only using CCR5 for cell entry, whereas CXCR4-using variants can become dominant in later infection stages. We performed a statistical analysis on two different previously published data sets. The first data set was a panel of 199 diverse HIV-1 isolates for which IC50 neutralization titers were determined for the broadly neutralizing antibodies VRC01, VRC-PG04, PG9, and PG16. The second data set contained env sequences of viral variants extracted from HIV-1-infected humanized mice treated with the antibody PGT128 and from untreated control mice. For the panel of 199 diverse HIV-1 isolates, we found a statistically significant association between viral resistance to PG9 and PG16 and CXCR4 coreceptor usage (P = 0.0011 and P = 0.0010, respectively). Our analysis of viral variants from HIV-1-infected humanized mice under treatment with the broadly neutralizing antibody PGT128 indicated that certain antibodies might drive a viral population toward developing CXCR4 coreceptor usage capability (P = 0.0011 for the comparison between PGT128 and control measurement). These analyses highlight the importance of accounting for a possible coreceptor usage bias pertaining to the effectiveness of an HIV vaccine and to passive antibody transfer as therapeutic approach.
Lintern, Katherine B; Guidato, Sonia; Rowe, Alison; Saldanha, José W; Itasaki, Nobue
2009-08-21
Cross-talk of BMP and Wnt signaling pathways has been implicated in many aspects of biological events during embryogenesis and in adulthood. A secreted protein Wise and its orthologs (Sostdc1, USAG-1, and Ectodin) have been shown to modulate Wnt signaling and also inhibit BMP signals. Modulation of Wnt signaling activity by Wise is brought about by an interaction with the Wnt co-receptor LRP6, whereas BMP inhibition is by binding to BMP ligands. Here we have investigated the mode of action of Wise on Wnt and BMP signals. It was found that Wise binds LRP6 through one of three loops formed by the cystine knot. The Wise deletion construct lacking the LRP6-interacting loop domain nevertheless binds BMP4 and inhibits BMP signals. Moreover, BMP4 does not interfere with Wise-LRP6 binding, suggesting separate domains for the physical interaction. Functional assays also show that the ability of Wise to block Wnt1 activity through LRP6 is not impeded by BMP4. In contrast, the ability of Wise to inhibit BMP4 is prevented by additional LRP6, implying a preference of Wise in binding LRP6 over BMP4. In addition to the interaction of Wise with BMP4 and LRP6, the molecular characteristics of Wise, such as glycosylation and association with heparan sulfate proteoglycans on the cell surface, are suggested. This study helps to understand the multiple functions of Wise at the molecular level and suggests a possible role for Wise in balancing Wnt and BMP signals.
Michael, N L; Nelson, J A; KewalRamani, V N; Chang, G; O'Brien, S J; Mascola, J R; Volsky, B; Louder, M; White, G C; Littman, D R; Swanstrom, R; O'Brien, T R
1998-07-01
Individuals who are homozygous for the 32-bp deletion in the gene coding for the chemokine receptor and major human immunodeficiency virus type 1 (HIV-1) coreceptor CCR5 (CCR5 -/-) lack functional cell surface CCR5 molecules and are relatively resistant to HIV-1 infection. HIV-1 infection in CCR5 -/- individuals, although rare, has been increasingly documented. We now report that the viral quasispecies from one such individual throughout disease is homogenous, T cell line tropic, and phenotypically syncytium inducing (SI); exclusively uses CXCR4; and replicates well in CCR5 -/- primary T cells. The recently discovered coreceptors BOB and Bonzo are not used. Although early and persistent SI variants have been described in longitudinal studies, this is the first demonstration of exclusive and persistent CXCR4 usage. With the caveat that the earliest viruses available from this subject were from approximately 4 years following primary infection, these data suggest that HIV-1 infection can be mediated and persistently maintained by viruses which exclusively utilize CXCR4. The lack of evolution toward the available minor coreceptors in this subject underscores the dominant biological roles of the major coreceptors CCR5 and CXCR4. This and two similar subjects (R. Biti, R. Ffrench, J. Young, B. Bennetts, G. Stewart, and T. Liang, Nat. Med. 3:252-253, 1997; I. Theodoreu, L. Meyer, M. Magierowska, C. Katlama, and C. Rouzioux, Lancet 349:1219-1220, 1997) showed relatively rapid CD4+ T-cell declines despite average or low initial viral RNA load. Since viruses which use CXCR4 exclusively cannot infect macrophages, these data have implications for the relative infection of the T-cell compartment versus the macrophage compartment in vivo and for the development of CCR5-based therapeutics.
Riddick, Nadeene E; Wu, Fan; Matsuda, Kenta; Whitted, Sonya; Ourmanov, Ilnour; Goldstein, Simoy; Goeken, Robert M; Plishka, Ronald J; Buckler-White, Alicia; Brenchley, Jason M; Hirsch, Vanessa M
2015-12-09
African green monkeys (AGM) are natural hosts of simian immunodeficiency virus (SIV), and infection in these animals is generally nonpathogenic, whereas infection of nonnatural hosts, such as rhesus macaques (RM), is commonly pathogenic. CCR5 has been described as the primary entry coreceptor for SIV in vivo, while human-derived CXCR6 and GPR15 also appear to be used in vitro. However, sooty mangabeys that are genetically deficient in CCR5 due to an out-of-frame deletion are infectible with SIVsmm, indicating that SIVsmm can use alternative coreceptors in vivo. In this study, we examined the CCR5 dependence of SIV strains derived from vervet AGM (SIVagmVer) and the ability of AGM-derived GPR15 and CXCR6 to serve as potential entry coreceptors. We found that SIVagmVer replicated efficiently in AGM and RM peripheral blood mononuclear cells (PBMC) in the presence of the CCR5 antagonist maraviroc, despite the fact that maraviroc was capable of blocking the CCR5-tropic strains SIVmac239, SIVsmE543-3, and simian-human immunodeficiency virus SHIV-AD8 in RM PBMC. We also found that AGM CXCR6 and AGM GPR15, to a lesser extent, supported entry of pseudotype viruses bearing SIVagm envelopes, including SIVagm transmitted/founder envelopes. Lastly, we found that CCR5, GPR15, and CXCR6 mRNAs were detected in AGM and RM memory CD4(+) T cells. These results suggest that GPR15 and CXCR6 are expressed on AGM CD4(+) T cells and are potential alternative coreceptors for SIVagm use in vivo. These data suggest that the use of non-CCR5 entry pathways may be a common feature of SIV replication in natural host species, with the potential to contribute to nonpathogenicity in these animals. African green monkeys (AGM) are natural hosts of SIV, and infection in these animals generally does not cause AIDS, whereas SIV-infected rhesus macaques (RM) typically develop AIDS. Although it has been reported that SIV generally uses CD4 and CCR5 to enter target cells in vivo, other molecules, such as GPR15 and CXCR6, also function as SIV coreceptors in vitro. In this study, we investigated whether SIV from vervet AGM can use non-CCR5 entry pathways, as has been observed in sooty mangabeys. We found that SIVagmVer efficiently replicated in AGM and RM peripheral blood mononuclear cells in the presence of the CCR5 antagonist maraviroc, suggesting that non-CCR5 entry pathways can support SIVagm entry. We found that AGM-derived GPR15 and CXCR6 support SIVagmVer entry in vitro and may serve as entry coreceptors for SIVagm in vivo, since their mRNAs were detected in AGM memory CD4(+) T cells, the preferred target cells of SIV. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Riddick, Nadeene E.; Wu, Fan; Matsuda, Kenta; Whitted, Sonya; Ourmanov, Ilnour; Goldstein, Simoy; Goeken, Robert M.; Plishka, Ronald J.; Buckler-White, Alicia; Brenchley, Jason M.
2015-01-01
ABSTRACT African green monkeys (AGM) are natural hosts of simian immunodeficiency virus (SIV), and infection in these animals is generally nonpathogenic, whereas infection of nonnatural hosts, such as rhesus macaques (RM), is commonly pathogenic. CCR5 has been described as the primary entry coreceptor for SIV in vivo, while human-derived CXCR6 and GPR15 also appear to be used in vitro. However, sooty mangabeys that are genetically deficient in CCR5 due to an out-of-frame deletion are infectible with SIVsmm, indicating that SIVsmm can use alternative coreceptors in vivo. In this study, we examined the CCR5 dependence of SIV strains derived from vervet AGM (SIVagmVer) and the ability of AGM-derived GPR15 and CXCR6 to serve as potential entry coreceptors. We found that SIVagmVer replicated efficiently in AGM and RM peripheral blood mononuclear cells (PBMC) in the presence of the CCR5 antagonist maraviroc, despite the fact that maraviroc was capable of blocking the CCR5-tropic strains SIVmac239, SIVsmE543-3, and simian-human immunodeficiency virus SHIV-AD8 in RM PBMC. We also found that AGM CXCR6 and AGM GPR15, to a lesser extent, supported entry of pseudotype viruses bearing SIVagm envelopes, including SIVagm transmitted/founder envelopes. Lastly, we found that CCR5, GPR15, and CXCR6 mRNAs were detected in AGM and RM memory CD4+ T cells. These results suggest that GPR15 and CXCR6 are expressed on AGM CD4+ T cells and are potential alternative coreceptors for SIVagm use in vivo. These data suggest that the use of non-CCR5 entry pathways may be a common feature of SIV replication in natural host species, with the potential to contribute to nonpathogenicity in these animals. IMPORTANCE African green monkeys (AGM) are natural hosts of SIV, and infection in these animals generally does not cause AIDS, whereas SIV-infected rhesus macaques (RM) typically develop AIDS. Although it has been reported that SIV generally uses CD4 and CCR5 to enter target cells in vivo, other molecules, such as GPR15 and CXCR6, also function as SIV coreceptors in vitro. In this study, we investigated whether SIV from vervet AGM can use non-CCR5 entry pathways, as has been observed in sooty mangabeys. We found that SIVagmVer efficiently replicated in AGM and RM peripheral blood mononuclear cells in the presence of the CCR5 antagonist maraviroc, suggesting that non-CCR5 entry pathways can support SIVagm entry. We found that AGM-derived GPR15 and CXCR6 support SIVagmVer entry in vitro and may serve as entry coreceptors for SIVagm in vivo, since their mRNAs were detected in AGM memory CD4+ T cells, the preferred target cells of SIV. PMID:26656714
Toll-like receptors (TLRs) and immune disorders.
Akashi-Takamura, Sachiko; Miyake, Kensuke
2006-10-01
Upon the invasion of pathogens, the immune system needs to mount defense responses immediately. Over the past 10 years, Toll-like receptors (TLRs) have been discovered in mammals and defined as pathogen sensors. TLRs are considered to bind directly to ligands, discriminate them immediately, and induce defense responses when appropriate. We here review microbial recognition by TLRs, downstream signaling, and the relationship of TLRs to susceptibility to infectious diseases and immune disorders. Recent reports have revealed a requirement for co-receptors in TLR responses. A TLR signaling pathway is required for protection against infectious diseases, but excessive signaling may lead to allergies, autoimmune diseases, or atherosclerosis. In humans, several deficiencies of signaling molecules downstream of TLRs, and TLR polymorphisms that affect recognition or signaling, were reported to cause immunodeficiencies. It is important to understand how TLR signaling is controlled.
Wnt-Lrp5 Signaling Regulates Fatty Acid Metabolism in the Osteoblast
Frey, Julie L.; Li, Zhu; Ellis, Jessica M.; Zhang, Qian; Farber, Charles R.; Aja, Susan; Wolfgang, Michael J.; Clemens, Thomas L.
2015-01-01
The Wnt coreceptors Lrp5 and Lrp6 are essential for normal postnatal bone accrual and osteoblast function. In this study, we identify a previously unrecognized skeletal function unique to Lrp5 that enables osteoblasts to oxidize fatty acids. Mice lacking the Lrp5 coreceptor specifically in osteoblasts and osteocytes exhibit the expected reductions in postnatal bone mass but also exhibit an increase in body fat with corresponding reductions in energy expenditure. Conversely, mice expressing a high bone mass mutant Lrp5 allele are leaner with reduced plasma triglyceride and free fatty acid levels. In this context, Wnt-initiated signals downstream of Lrp5, but not the closely related Lrp6 coreceptor, regulate the activation of β-catenin and thereby induce the expression of key enzymes required for fatty acid β-oxidation. These results suggest that Wnt-Lrp5 signaling regulates basic cellular activities beyond those associated with fate specification and differentiation in bone and that the skeleton influences global energy homeostasis via mechanisms independent of osteocalcin and glucose metabolism. PMID:25802278
Esseili, Malak A.
2012-01-01
Norovirus (NoV) genogroup II genotype 4 (GII.4) strains are the dominant cause of the majority of food-borne outbreaks, including those that involve leafy greens, such as lettuce. Since human NoVs use carbohydrates of histo-blood group antigens as receptors/coreceptors, we examined the role of carbohydrates in the attachment of NoV to lettuce leaves by using virus-like particles (VLPs) of a human NoV/GII.4 strain. Immunofluorescence analysis showed that the VLPs attached to the leaf surface, especially to cut edges, stomata, and along minor veins. Binding was quantified using enzyme-linked immunosorbent assay (ELISA) performed on cell wall materials (CWM) from innermost younger leaves and outermost lamina of older leaves. The binding to CWM of older leaves was significantly (P < 0.05) higher (1.5- to 2-fold) than that to CWM of younger leaves. Disrupting the carbohydrates of CWM or porcine gastric mucin (PGM) (a carbohydrate control) using 100 mM sodium periodate (NaIO4) significantly decreased the binding an average of 17% in younger leaves, 43% in older leaves, and 92% for PGM. In addition, lectins recognizing GalNAc, GlcNAc, and sialic acid at 100 μg/ml significantly decreased the binding an average of 41%, 33%, and 20% on CWM of older leaves but had no effect on younger leaves. Lectins recognizing α-d-Gal, α-d-Man/α-d-Glc, and α-l-Fuc showed significant inhibition on CWM of older leaves as well as that of younger leaves. All lectins, except for the lectin recognizing α-d-Gal, significantly inhibited NoV VLP binding to PGM. Collectively, our results indicate that NoV VLPs bind to lettuce CWM by utilizing multiple carbohydrate moieties. This binding may enhance virus persistence on the leaf surface and prevent effective decontamination. PMID:22138991
Pace of Coreceptor Tropism Switch in HIV-1-Infected Individuals after Recent Infection.
Arif, Muhammad Shoaib; Hunter, James; Léda, Ana Rachel; Zukurov, Jean Paulo Lopes; Samer, Sadia; Camargo, Michelle; Galinskas, Juliana; Kallás, Esper Georges; Komninakis, Shirley Vasconcelos; Janini, Luiz Mario; Sucupira, Maria Cecilia; Diaz, Ricardo Sobhie
2017-10-01
HIV-1 entry into target cells influences several aspects of HIV-1 pathogenesis, including viral tropism, HIV-1 transmission and disease progression, and response to entry inhibitors. The evolution from CCR5- to CXCR4-using strains in a given human host is still unpredictable. Here we analyzed timing and predictors for coreceptor evolution among recently HIV-1-infected individuals. Proviral DNA was longitudinally evaluated in 66 individuals using Geno2pheno [coreceptor] Demographics, viral load, CD4 + and CD8 + T cell counts, CCR5Δ32 polymorphisms, GB virus C (GBV-C) coinfection, and HLA profiles were also evaluated. Ultradeep sequencing was performed on initial samples from 11 selected individuals. A tropism switch from CCR5- to CXCR4-using strains was identified in 9/49 (18.4%) individuals. Only a low baseline false-positive rate (FPR) was found to be a significant tropism switch predictor. No minor CXCR4-using variants were identified in initial samples of 4 of 5 R5/non-R5 switchers. Logistic regression analysis showed that patients with an FPR of >40.6% at baseline presented a stable FPR over time whereas lower FPRs tend to progressively decay, leading to emergence of CXCR4-using strains, with a mean evolution time of 27.29 months (range, 8.90 to 64.62). An FPR threshold above 40.6% determined by logistic regression analysis may make it unnecessary to further determine tropism for prediction of disease progression related to emergence of X4 strains or use of CCR5 antagonists. The detection of variants with intermediate FPRs and progressive FPR decay over time not only strengthens the power of Geno2pheno in predicting HIV tropism but also indirectly confirms a continuous evolution from earlier R5 variants toward CXCR4-using strains. IMPORTANCE The introduction of CCR5 antagonists in the antiretroviral arsenal has sparked interest in coreceptors utilized by HIV-1. Despite concentrated efforts, viral and human host features predicting tropism switch are still poorly understood. Limited longitudinal data are available to assess the influence that these factors have on predicting tropism switch and disease progression. The present study describes longitudinal tropism evolution in a group of recently HIV-infected individuals to determine the prevalence and potential correlates of tropism switch. We demonstrated here that a low baseline FPR determined by the Geno2pheno [coreceptor] algorithm can predict tropism evolution from CCR5 to CXCR4 coreceptor use. Copyright © 2017 American Society for Microbiology.
Dalton, Jane E; Howell, Gareth; Pearson, Jayne; Scott, Phillip; Carding, Simon R
2004-09-15
Gammadelta T cells have a direct role in resolving the host immune response to infection by eliminating populations of activated macrophages. Macrophage reactivity resides within the Vgamma1/Vdelta6.3 subset of gammadelta T cells, which have the ability to kill activated macrophages following infection with Listeria monocytogenes (Lm). However, it is not known how gammadelta T cell macrophage cytocidal activity is regulated, or what effector mechanisms gammadelta T cells use to kill activated macrophages. Using a macrophage-T cell coculture system in which peritoneal macrophages from naive or Lm-infected TCRdelta-/- mice were incubated with splenocytes from wild-type and Fas ligand (FasL)-deficient mice (gld), the ability of Vgamma1 T cells to bind macrophages was shown to be dependent upon Fas-FasL interactions. Combinations of anti-TCR and FasL Abs completely abolished binding to and killing of activated macrophages by Vgamma1 T cells. In addition, confocal microscopy showed that Fas and the TCR colocalized on Vgamma1 T cells at points of contact with macrophages. Collectively, these studies identify an accessory or coreceptor-like function for Fas-FasL that is essential for the interaction of Vgamma1 T cells with activated macrophages and their elimination during the resolution stage of pathogen-induced immune responses. Copyright 2004 The American Association of Immunologists, Inc.
Girard, Tanya; Gaucher, Denis; El-Far, Mohamed; Breton, Gaëlle; Sékaly, Rafick-Pierre
2014-09-01
CD86 and CD80, the ligands for the co-stimulatory molecules CD28 and CTLA-4, are members of the Ig superfamily. Their structure includes Ig variable-like (IgV) domains, Ig constant-like (IgC) domains and intracellular domains. Although crystallographic studies have clearly identified the IgV domain to be responsible for receptor interactions, earlier studies suggested that both Ig domains are required for full co-signaling function. Herein, we have used deletion and chimeric human CD80 and CD86 molecules in co-stimulation assays to study the impact of the multimeric state of IgV and IgC domains on receptor binding properties and on co-stimulatory function in a peptide-specific T cell activation model. We report for the first time the presence of CD80 dimers and CD86 monomers in living cells. Moreover, we show that the IgC domain of both molecules inhibits multimer formation and greatly affects binding to the co-receptors CD28 and CTLA-4. Finally, both IgC and intracellular domains are required for full co-signaling function. These findings reveal the distinct but complementary roles of CD80 and CD86 IgV and IgC domains in T cell activation. Copyright © 2014 Elsevier B.V. All rights reserved.
Massa, Fabienne; Devader, Christelle; Béraud-Dufour, Sophie; Brau, Frédéric; Coppola, Thierry; Mazella, Jean
2013-05-01
The neurotensin (NT) receptor-3 (NTSR3), also called sortilin, is thought to display several functions including a role as a receptor or a co-receptor, in the sorting to plasma membrane and to lysosomes, and in the regulated secretion. The aim of this study was to investigate the function of the soluble form of NTSR3 (sNTSR3) released from several cell lines including colonic cancer cells. The human adenocarcinoma epithelial cell line HT29 has been used to monitor the release, the binding and internalization of sNTSR3 by radioreceptor assays and confocal microscopy. The modulation of the intracellular signaling pathways by the protein has been investigated by using Fura-2 fluorescence calcium imaging microscopy and Western blots analysis. We demonstrated that sNTSR3 specifically binds and internalizes into HT29 cells. This binding, independent from the transactivation of the epidermal growth factor receptor, leads to the increase of intracellular calcium concentration and to the activation of a FAK/Src-dependent activation of the PI3 kinase pathway. In conclusion, sNTSR3 released from the membrane bound NTSR3 is a functional protein able to activate intracellular pathways involved in cell survival but probably not in cell growth. Copyright © 2013 Elsevier Ltd. All rights reserved.
Fortress, Ashley M.; Buhusi, Mona; Helke, Kris L.; Granholm, Ann-Charlotte E.
2011-01-01
Learning and memory impairments occurring with Alzheimer's disease (AD) are associated with degeneration of the basal forebrain cholinergic neurons (BFCNs). BFCNs extend their axons to the hippocampus where they bind nerve growth factor (NGF) which is retrogradely transported to the cell body. While NGF is necessary for BFCN survival and function via binding to the high-affinity receptor TrkA, its uncleaved precursor, pro-NGF has been proposed to induce neurodegeneration via binding to the p75NTR and its coreceptor sortilin. Basal forebrain TrkA and NGF are downregulated with aging while pro-NGF is increased. Given these data, the focus of this paper was to determine a mechanism for how pro-NGF accumulation may induce BFCN degeneration. Twenty-four hours after a single injection of pro-NGF into hippocampus, we found increased hippocampal p75NTR levels, decreased hippocampal TrkA levels, and cholinergic degeneration. The data suggest that the increase in p75NTR with AD may be mediated by elevated pro-NGF levels as a result of decreased cleavage, and that pro-NGF may be partially responsible for age-related degenerative changes observed in the basal forebrain. This paper is the first in vivo evidence that pro-NGF can affect BFCNs and may do so by regulating expression of p75NTR neurotrophin receptors. PMID:21785728
Roche, Michael; Borm, Katharina; Flynn, Jacqueline K; Lewin, Sharon R; Churchill, Melissa J; Gorry, Paul R
2016-01-01
Human immunodeficiency virus type 1 (HIV-1) enters host cells through the binding of its envelope glycoproteins (Env) to the host cell receptor CD4 and then subsequent binding to a chemokine coreceptor, either CCR5 or CXCR4. CCR5 antagonists are a relatively recent class addition to the armamentarium of anti-HIV-1 drugs. These compounds act by binding to a hydrophobic pocket formed by the transmembrane helices of CCR5 and altering the conformation of the extracellular domains, such that they are no longer recognized by Env. Maraviroc is the first drug within this class to be licenced for use in HIV-1 therapy regimens. HIV resistance to CCR5 antagonists occurs either through outgrowth of pre-existing CXCR4-using viruses, or through acquisition of the ability of CCR5-using HIV-1 to use the antagonist bound form of CCR5. In the latter scenario, the mechanism underlying resistance is through complex alterations in the way that resistant Envs engage CCR5. These significant changes are unlikely to occur without consequence to the viral entry phenotype and may also open up new avenues to target CCR5 antagonist resistant viruses. This review discusses the mechanism of action of CCR5 antagonists, how HIV resistance to CCR5 antagonists occurs, and the subsequent effects on Env function.
High affinity soluble ILT2 receptor: a potent inhibitor of CD8(+) T cell activation.
Moysey, Ruth K; Li, Yi; Paston, Samantha J; Baston, Emma E; Sami, Malkit S; Cameron, Brian J; Gavarret, Jessie; Todorov, Penio; Vuidepot, Annelise; Dunn, Steven M; Pumphrey, Nicholas J; Adams, Katherine J; Yuan, Fang; Dennis, Rebecca E; Sutton, Deborah H; Johnson, Andy D; Brewer, Joanna E; Ashfield, Rebecca; Lissin, Nikolai M; Jakobsen, Bent K
2010-12-01
Using directed mutagenesis and phage display on a soluble fragment of the human immunoglobulin super-family receptor ILT2 (synonyms: LIR1, MIR7, CD85j), we have selected a range of mutants with binding affinities enhanced by up to 168,000-fold towards the conserved region of major histocompatibility complex (MHC) class I molecules. Produced in a dimeric form, either by chemical cross-linking with bivalent polyethylene glycol (PEG) derivatives or as a genetic fusion with human IgG Fc-fragment, the mutants exhibited a further increase in ligand-binding strength due to the avidity effect, with resident half-times (t(1/2)) on the surface of MHC I-positive cells of many hours. The novel compounds antagonized the interaction of CD8 co-receptor with MHC I in vitro without affecting the peptide-specific binding of T-cell receptors (TCRs). In both cytokine-release assays and cell-killing experiments the engineered receptors inhibited the activation of CD8(+) cytotoxic T lymphocytes (CTLs) in the presence of their target cells, with subnanomolar potency and in a dose-dependent manner. As a selective inhibitor of CD8(+) CTL responses, the engineered high affinity ILT2 receptor presents a new tool for studying the activation mechanism of different subsets of CTLs and could have potential for the development of novel autoimmunity therapies.
Wilkin, Timothy J; Goetz, Mathew Bidwell; Leduc, Robert; Skowron, Gail; Su, Zhaohui; Chan, Ellen S; Heera, Jayyant; Chapman, Doug; Spritzler, John; Reeves, Jacqueline D; Gulick, Roy M; Coakley, Eoin
2011-04-01
The enhanced-sensitivity Trofile assay (TF-ES; Monogram Biosciences) was used to retest coreceptor tropism samples from 4 different cohorts of HIV-1-infected patients. Nine percent to 26% of patients with CCR5-tropic virus by the original Trofile assay had CXCR4-using virus by TF-ES. Lower CD4 cell counts were associated with CXCR4-using virus in all cohorts. © The Author 2011. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved.
Petit, Sarah J; Chayen, Naomi E; Pease, James E
2008-08-01
Chemokine receptor CXCR6 mediates the chemotaxis and adhesion of leukocytes to soluble and membrane-anchored forms of CXCL16, and is an HIV-1 co-receptor. Here, we describe the effects of mutation of acidic extracellular CXCR6 residues on receptor function. Although most CXCR6 mutants examined were expressed at levels similar to wild-type (WT) CXCR6, an N-terminal E3Q mutant was poorly expressed, which may explain previously reported protective effects of a similar single nucleotide polymorphism, with respect to late-stage HIV-1 infection. In contrast to several other chemokine receptors, mutation of the CXCR6 N terminus and inhibition of post-translational modifications of this region were without effect on receptor function. Likewise, N-terminal extension of CXCL16 resulted in a protein with decent potency and efficacy in chemotaxis and not, as anticipated, a CXCR6 antagonist. D176N and E274Q CXCR6 mutants were unable to interact with soluble CXCL16, suggesting a critical role for D176 and E274 in ligand binding. Intriguingly, although unable to interact with soluble CXCL16, the E274Q mutant could promote robust adhesion to membrane-anchored CXCL16, suggesting that soluble and membrane-bound forms of CXCL16 possess distinct conformations. Collectively, our data suggest a novel paradigm for the CXCR6:CXCL16 interaction, a finding which may impact the discovery of small-molecule antagonists of CXCR6.
Tilton, John C.; Wilen, Craig B.; Didigu, Chukwuka A.; Sinha, Rohini; Harrison, Jessamina E.; Agrawal-Gamse, Caroline; Henning, Elizabeth A.; Bushman, Frederick D.; Martin, Jeffrey N.; Deeks, Steven G.; Doms, Robert W.
2010-01-01
CCR5 antagonists inhibit HIV entry by binding to a coreceptor and inducing changes in the extracellular loops (ECLs) of CCR5. In this study, we analyzed viruses from 11 treatment-experienced patients who experienced virologic failure on treatment regimens containing the CCR5 antagonist maraviroc (MVC). Viruses from one patient developed high-level resistance to MVC during the course of treatment. Although resistance to one CCR5 antagonist is often associated with broad cross-resistance to other agents, these viruses remained sensitive to most other CCR5 antagonists, including vicriviroc and aplaviroc. MVC resistance was dependent upon mutations within the V3 loop of the viral envelope (Env) protein and was modulated by additional mutations in the V4 loop. Deep sequencing of pretreatment plasma viral RNA indicated that resistance appears to have occurred by evolution of drug-bound CCR5 use, despite the presence of viral sequences predictive of CXCR4 use. Envs obtained from this patient before and during MVC treatment were able to infect cells expressing very low CCR5 levels, indicating highly efficient use of a coreceptor. In contrast to previous reports in which CCR5 antagonist-resistant viruses interact predominantly with the N terminus of CCR5, these MVC-resistant Envs were also dependent upon the drug-modified ECLs of CCR5 for entry. Our results suggest a model of CCR5 cross-resistance whereby viruses that predominantly utilize the N terminus are broadly cross-resistant to multiple CCR5 antagonists, whereas viruses that require both the N terminus and antagonist-specific ECL changes demonstrate a narrow cross-resistance profile. PMID:20702642
FGF23 Actions on Target Tissues—With and Without Klotho
Richter, Beatrice; Faul, Christian
2018-01-01
Fibroblast growth factor (FGF) 23 is a phosphaturic hormone whose physiologic actions on target tissues are mediated by FGF receptors (FGFR) and klotho, which functions as a co-receptor that increases the binding affinity of FGF23 for FGFRs. By stimulating FGFR/klotho complexes in the kidney and parathyroid gland, FGF23 reduces renal phosphate uptake and secretion of parathyroid hormone, respectively, thereby acting as a key regulator of phosphate metabolism. Recently, it has been shown that FGF23 can also target cell types that lack klotho. This unconventional signaling event occurs in an FGFR-dependent manner, but involves other downstream signaling pathways than in “classic” klotho-expressing target organs. It appears that klotho-independent signaling mechanisms are only activated in the presence of high FGF23 concentrations and result in pathologic cellular changes. Therefore, it has been postulated that massive elevations in circulating levels of FGF23, as found in patients with chronic kidney disease, contribute to associated pathologies by targeting cells and tissues that lack klotho. This includes the induction of cardiac hypertrophy and fibrosis, the elevation of inflammatory cytokine expression in the liver, and the inhibition of neutrophil recruitment. Here, we describe the signaling and cellular events that are caused by FGF23 in tissues lacking klotho, and we discuss FGF23’s potential role as a hormone with widespread pathologic actions. Since the soluble form of klotho can function as a circulating co-receptor for FGF23, we also discuss the potential inhibitory effects of soluble klotho on FGF23-mediated signaling which might—at least partially—underlie the pleiotropic tissue-protective functions of klotho. PMID:29770125
Role of Abl kinase and the Wave2 signaling complex in HIV-1 entry at a post-hemifusion step.
Harmon, Brooke; Campbell, Nancy; Ratner, Lee
2010-06-17
Entry of human immunodeficiency virus type 1 (HIV-1) commences with binding of the envelope glycoprotein (Env) to the receptor CD4, and one of two coreceptors, CXCR4 or CCR5. Env-mediated signaling through coreceptor results in Galphaq-mediated Rac activation and actin cytoskeleton rearrangements necessary for fusion. Guanine nucleotide exchange factors (GEFs) activate Rac and regulate its downstream protein effectors. In this study we show that Env-induced Rac activation is mediated by the Rac GEF Tiam-1, which associates with the adaptor protein IRSp53 to link Rac to the Wave2 complex. Rac and the tyrosine kinase Abl then activate the Wave2 complex and promote Arp2/3-dependent actin polymerization. Env-mediated cell-cell fusion, virus-cell fusion and HIV-1 infection are dependent on Tiam-1, Abl, IRSp53, Wave2, and Arp3 as shown by attenuation of fusion and infection in cells expressing siRNA targeted to these signaling components. HIV-1 Env-dependent cell-cell fusion, virus-cell fusion and infection were also inhibited by Abl kinase inhibitors, imatinib, nilotinib, and dasatinib. Treatment of cells with Abl kinase inhibitors did not affect cell viability or surface expression of CD4 and CCR5. Similar results with inhibitors and siRNAs were obtained when Env-dependent cell-cell fusion, virus-cell fusion or infection was measured, and when cell lines or primary cells were the target. Using membrane curving agents and fluorescence microscopy, we showed that inhibition of Abl kinase activity arrests fusion at the hemifusion (lipid mixing) step, suggesting a role for Abl-mediated actin remodeling in pore formation and expansion. These results suggest a potential utility of Abl kinase inhibitors to treat HIV-1 infected patients.
Wu, Chien-Huang; Wang, Chuan-Jen; Chang, Chun-Ping; Cheng, Yung-Chi; Song, Jen-Shin; Jan, Jiing-Jyh; Chou, Ming-Chen; Ke, Yi-Yu; Ma, Jing; Wong, Ying-Chieh; Hsieh, Tsung-Chih; Tien, Yun-Chen; Gullen, Elizabeth A; Lo, Chen-Fu; Cheng, Chia-Yi; Liu, Yu-Wei; Sadani, Amit A; Tsai, Chia-Hua; Hsieh, Hsin-Pang; Tsou, Lun K; Shia, Kak-Shan
2015-02-12
Motivated by the pivotal role of CXCR4 as an HIV entry co-receptor, we herein report a de novo hit-to-lead effort on the identification of subnanomolar purine-based CXCR4 antagonists against HIV-1 infection. Compound 24, with an EC50 of 0.5 nM against HIV-1 entry into host cells and an IC50 of 16.4 nM for inhibition of radioligand stromal-derived factor-1α (SDF-1α) binding to CXCR4, was also found to be highly selective against closely related chemokine receptors. We rationalized that compound 24 complementarily interacted with the critical CXCR4 residues that are essential for binding to HIV-1 gp120 V3 loop and subsequent viral entry. Compound 24 showed a 130-fold increase in anti-HIV activity compared to that of the marketed CXCR4 antagonist, AMD3100 (Plerixafor), whereas both compounds exhibited similar potency in mobilization of CXCR4(+)/CD34(+) stem cells at a high dose. Our study offers insight into the design of anti-HIV therapeutics devoid of major interference with SDF-1α function.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harrison, Stephen C., E-mail: harrison@crystal.harvard.edu
2015-05-15
Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formedmore » draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. - Highlights: • Viral fusion proteins overcome the high energy barrier to lipid bilayer merger. • Different molecular structures but the same catalytic mechanism. • Review describes properties of three known fusion-protein structural classes. • Single-virion fusion experiments elucidate mechanism.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weir, M. Lynn; Oppizzi, Maria Luisa; Henry, Michael D.
2006-02-17
Precise contact between epithelial cells and their underlying basement membrane is critical to the maintenance of tissue architecture and function. To understand the role that the laminin receptor dystroglycan (DG) plays in these processes, we assayed cell responses to laminin-111 following conditional ablation of DG expression in cultured mammary epithelial cells (MECs). Strikingly, DG loss disrupted laminin-111-induced polarity and {beta}-casein production, and abolished laminin assembly at the step of laminin binding to the cell surface. DG re-expression restored these deficiencies. Investigations of mechanism revealed that DG cytoplasmic sequences were not necessary for laminin assembly and signaling, and only when themore » entire mucin domain of extracellular DG was deleted did laminin assembly not occur. These results demonstrate that DG is essential as a laminin-111 co-receptor in MECs that functions by mediating laminin anchoring to the cell surface, a process that allows laminin polymerization, tissue polarity, and {beta}-casein induction. The observed loss of laminin-111 assembly and signaling in DG-/-MECs provides insights into the signaling changes occurring in breast carcinomas and other cancers, where DG's laminin-binding function is frequently defective.« less
El-Diwany, Ramy; Cohen, Valerie J; Mankowski, Madeleine C; Wasilewski, Lisa N; Brady, Jillian K; Snider, Anna E; Osburn, William O; Murrell, Ben; Ray, Stuart C; Bailey, Justin R
2017-02-01
Broadly-neutralizing monoclonal antibodies (bNAbs) may guide vaccine development for highly variable viruses including hepatitis C virus (HCV), since they target conserved viral epitopes that could serve as vaccine antigens. However, HCV resistance to bNAbs could reduce the efficacy of a vaccine. HC33.4 and AR4A are two of the most potent anti-HCV human bNAbs characterized to date, binding to highly conserved epitopes near the amino- and carboxy-terminus of HCV envelope (E2) protein, respectively. Given their distinct epitopes, it was surprising that these bNAbs showed similar neutralization profiles across a panel of natural HCV isolates, suggesting that some viral polymorphisms may confer resistance to both bNAbs. To investigate this resistance, we developed a large, diverse panel of natural HCV envelope variants and a novel computational method to identify bNAb resistance polymorphisms in envelope proteins (E1 and E2). By measuring neutralization of a panel of HCV pseudoparticles by 10 μg/mL of each bNAb, we identified E1E2 variants with resistance to one or both bNAbs, despite 100% conservation of the AR4A binding epitope across the panel. We discovered polymorphisms outside of either binding epitope that modulate resistance to both bNAbs by altering E2 binding to the HCV co-receptor, scavenger receptor B1 (SR-B1). This study is focused on a mode of neutralization escape not addressed by conventional analysis of epitope conservation, highlighting the contribution of extra-epitopic polymorphisms to bNAb resistance and presenting a novel mechanism by which HCV might persist even in the face of an antibody response targeting multiple conserved epitopes.
Schwalbe, Birco; Schreiber, Michael
2015-01-01
HIV-1 infection is characterized by an ongoing replication leading to T-lymphocyte decline which is paralleled by the switch from CCR5 to CXCR4 coreceptor usage. To predict coreceptor usage, several computer algorithms using gp120 V3 loop sequence data have been developed. In these algorithms an occupation of the V3 positions 11 and 25, by one of the amino acids lysine (K) or arginine (R), is an indicator for CXCR4 usage. Amino acids R and K dominate at these two positions, but can also be identified at positions 9 and 10. Generally, CXCR4-viruses possess V3 sequences, with an overall positive charge higher than the V3 sequences of R5-viruses. The net charge is calculated by subtracting the number of negatively charged amino acids (D, aspartic acid and E, glutamic acid) from the number of positively charged ones (K and R). In contrast to D and E, which are very similar in their polar and acidic properties, the characteristics of the R guanidinium group differ significantly from the K ammonium group. However, in coreceptor predictive computer algorithms R and K are both equally rated. The study was conducted to analyze differences in infectivity and coreceptor usage because of R-to-K mutations at the V3 positions 9, 10 and 11. V3 loop mutants with all possible RRR-to-KKK triplets were constructed and analyzed for coreceptor usage, infectivity and neutralization by SDF-1α and RANTES. Virus mutants R9R10R11 showed the highest infectivity rates, and were inhibited more efficiently in contrast to the K9K10K11 viruses. They also showed higher efficiency in a virus-gp120 paired infection assay. Especially V3 loop position 9 was relevant for a switch to higher infectivity when occupied by R. Thus, K-to-R exchanges play a role for enhanced viral entry efficiency and should therefore be considered when the viral phenotype is predicted based on V3 sequence data.
Schwalbe, Birco; Schreiber, Michael
2015-01-01
HIV-1 infection is characterized by an ongoing replication leading to T-lymphocyte decline which is paralleled by the switch from CCR5 to CXCR4 coreceptor usage. To predict coreceptor usage, several computer algorithms using gp120 V3 loop sequence data have been developed. In these algorithms an occupation of the V3 positions 11 and 25, by one of the amino acids lysine (K) or arginine (R), is an indicator for CXCR4 usage. Amino acids R and K dominate at these two positions, but can also be identified at positions 9 and 10. Generally, CXCR4-viruses possess V3 sequences, with an overall positive charge higher than the V3 sequences of R5-viruses. The net charge is calculated by subtracting the number of negatively charged amino acids (D, aspartic acid and E, glutamic acid) from the number of positively charged ones (K and R). In contrast to D and E, which are very similar in their polar and acidic properties, the characteristics of the R guanidinium group differ significantly from the K ammonium group. However, in coreceptor predictive computer algorithms R and K are both equally rated. The study was conducted to analyze differences in infectivity and coreceptor usage because of R-to-K mutations at the V3 positions 9, 10 and 11. V3 loop mutants with all possible RRR-to-KKK triplets were constructed and analyzed for coreceptor usage, infectivity and neutralization by SDF-1α and RANTES. Virus mutants R9R10R11 showed the highest infectivity rates, and were inhibited more efficiently in contrast to the K9K10K11 viruses. They also showed higher efficiency in a virus-gp120 paired infection assay. Especially V3 loop position 9 was relevant for a switch to higher infectivity when occupied by R. Thus, K-to-R exchanges play a role for enhanced viral entry efficiency and should therefore be considered when the viral phenotype is predicted based on V3 sequence data. PMID:25785610
HIV coreceptor phenotyping in the clinical setting.
Low, Andrew J; Swenson, Luke C; Harrigan, P Richard
2008-01-01
The introduction of CCR5 antagonists increases the options available for constructing antiretroviral regimens. However, this option is coupled with the caveat that patients should be tested for HIV coreceptor tropism prior to initiating CCR5 antagonist-based therapy. Failure to screen for CXCR4 usage increases the risk of using an ineffective drug, thus reducing the likelihood of viral suppression and increasing their risk for developing antiretroviral resistance. This review discusses current and future methods of determining HIV tropism, with a focus on their utility in the clinical setting for screening purposes. Some of these methods include recombinant phenotypic tests, such as the Monogram Trofile assay, as well as genotype-based predictors, heteroduplex tracking assays, and flow cytometry based methods. Currently, the best evidence supports the use of phenotypic methods, although other methods of screening for HIV coreceptor usage prior to the administration of CCR5 antagonists may reduce costs and increase turnaround time over phenotypic methods. The presence of low levels of X4 virus is a challenge to all assay methods, resulting in reduced sensitivity in clinical, patient-derived samples when compared to clonally derived samples. Gaining a better understanding of the output of these assays and correlating them with clinical progression and therapy response will provide some indication on how both genotype-based, and phenotypic assays for determining HIV coreceptor usage can be improved. In addition, leveraging new technologies capable of detecting low-level minority species may provide the most significant advances in ensuring that individuals with low levels of dual/mixed tropic virus are not inadvertently prescribed CCR5 antagonists.
Conserved Structural Elements in the V3 Crown of HIV-1 gp120
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang, X.; Burke, V; Totrov, M
2010-01-01
Binding of the third variable region (V3) of the HIV-1 envelope glycoprotein gp120 to the cell-surface coreceptors CCR5 or CXCR4 during viral entry suggests that there are conserved structural elements in this sequence-variable region. These conserved elements could serve as epitopes to be targeted by a vaccine against HIV-1. Here we perform a systematic structural analysis of representative human anti-V3 monoclonal antibodies in complex with V3 peptides, revealing that the crown of V3 has four conserved structural elements: an arch, a band, a hydrophobic core and the peptide backbone. These are either unaffected by or are subject to minimal sequencemore » variation. As these regions are targeted by cross-clade neutralizing human antibodies, they provide a blueprint for the design of vaccine immunogens that could elicit broadly cross-reactive protective antibodies.« less
Kumar, Santosh; Choi, Won-Tak; Dong, Chang-Zhi; Madani, Navid; Tian, Shaomin; Liu, Dongxiang; Wang, Youli; Pesavento, James; Wang, Jun; Fan, Xuejun; Yuan, Jian; Fritzsche, Wayne R; An, Jing; Sodroski, Joseph G; Richman, Douglas D; Huang, Ziwei
2006-01-01
Chemokines and their receptors play important roles in numerous physiological and pathological processes. To develop natural chemokines into receptor probes and inhibitors of pathological processes, the lack of chemokine-receptor selectivity must be overcome. Here, we apply chemical synthesis and the concept of modular modifications to generate unnatural synthetically and modularly modified (SMM)-chemokines that have high receptor selectivity and affinity, and reduced toxicity. A proof of the concept was shown by transforming the nonselective viral macrophage inflammatory protein-II into new analogs with enhanced selectivity and potency for CXCR4 or CCR5, two principal coreceptors for human immunodeficiency virus (HIV)-1 entry. These new analogs provided insights into receptor binding and signaling mechanisms and acted as potent HIV-1 inhibitors. These results support the concept of SMM-chemokines for studying and controlling the function of other chemokine receptors.
Fleming, Michael S; Vysochan, Anna; Paixão, Sόnia; Niu, Jingwen; Klein, Rüdiger; Savitt, Joseph M; Luo, Wenqin
2015-01-01
RET can be activated in cis or trans by its co-receptors and ligands in vitro, but the physiological roles of trans signaling are unclear. Rapidly adapting (RA) mechanoreceptors in dorsal root ganglia (DRGs) express Ret and the co-receptor Gfrα2 and depend on Ret for survival and central projection growth. Here, we show that Ret and Gfrα2 null mice display comparable early central projection deficits, but Gfrα2 null RA mechanoreceptors recover later. Loss of Gfrα1, the co-receptor implicated in activating RET in trans, causes no significant central projection or cell survival deficit, but Gfrα1;Gfrα2 double nulls phenocopy Ret nulls. Finally, we demonstrate that GFRα1 produced by neighboring DRG neurons activates RET in RA mechanoreceptors. Taken together, our results suggest that trans and cis RET signaling could function in the same developmental process and that the availability of both forms of activation likely enhances but not diversifies outcomes of RET signaling. DOI: http://dx.doi.org/10.7554/eLife.06828.001 PMID:25838128
Trofile HIV co-receptor usage assay.
Low, Andrew J; McGovern, Rachel A; Harrigan, P Richard
2009-03-01
The introduction of CCR5 antagonists increases the options available for constructing therapeutic drug regimens for HIV-positive patients. However, as these drugs do not inhibit HIV variants that use the CXCR4 co-receptor, a pretreatment test is required to determine accurately HIV co-receptor usage (tropism) before initiating CCR5 antagonist-based therapy. To discuss the Monogram Trofile assay as a diagnostic tool for determining HIV tropism by critically reviewing reported literature and available data. Monogram Trofile has become, largely by default, the de facto standard for HIV tropism assay. However, there is significant room for improvement in the speed, cost and availability of the test. Furthermore, the test is not quantitative, requires high-input HIV RNA viral loads, and produces results that are less biologically stable than expected. These technical considerations may limit the use of CCR5 antagonists in therapy. Nevertheless, this test is likely to remain the most widely used tropism diagnostic for the short term. We expect that a more practical and possibly more accurate method for measuring HIV tropism can be developed.
Structural Biology and Evolution of the TGF-β Family
Hinck, Andrew P.; Mueller, Thomas D.; Springer, Timothy A.
2017-01-01
We review the evolution and structure of members of the transforming growth factor β (TGF-β) family, antagonistic or agonistic modulators, and receptors that regulate TGF-β signaling in extracellular environments. The growth factor (GF) domain common to all family members and many of their antagonists evolved from a common cystine knot growth factor (CKGF) domain. The CKGF superfamily comprises six distinct families in primitive metazoans, including the TGF-β and Dan families. Compared with Wnt/Frizzled and Notch/Delta families that also specify body axes, cell fate, tissues, and other families that contain CKGF domains that evolved in parallel, the TGF-β family was the most fruitful in evolution. Complexes between the prodomains and GFs of the TGF-β family suggest a new paradigm for regulating GF release by conversion from closed- to open-arm procomplex conformations. Ternary complexes of the final step in extracellular signaling show how TGF-β GF dimers bind type I and type II receptors on the cell surface, and enable understanding of much of the specificity and promiscuity in extracellular signaling. However, structures suggest that when GFs bind repulsive guidance molecule (RGM) family coreceptors, type I receptors do not bind until reaching an intracellular, membrane-enveloped compartment, blurring the line between extra- and intracellular signaling. Modulator protein structures show how structurally diverse antagonists including follistatins, noggin, and members of the chordin family bind GFs to regulate signaling; complexes with the Dan family remain elusive. Much work is needed to understand how these molecular components assemble to form signaling hubs in extracellular environments in vivo. PMID:27638177
Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.
1991-01-01
Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less
NASA Astrophysics Data System (ADS)
Lengyel, Iván M.; Morelli, Luis G.
2017-04-01
Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.
Wysocka, Jolanta; Zelazowska-Rutkowska, Beata; Ratomski, Karol; Skotnicka, Bozena; Hassmann-Poznańska, Elzbieta
2009-01-01
In hypertrophied adenoid lymphocytes B make up about 60% all lymphocytes. When the lymphocytes B come in interaction with antigens this membranes signal be passed through their receptor (BCR) to interior of cell. This signal affect modulation on gene expression, activation from which depends activation, anergy or apoptosis of lymphocyte B. Accompany BCR co-receptors regulate his functions influence stimulate or inhibitive. To the most important co-receptors stepping out on lymphocyte B belong: CD40, CD22, CD72. The aim of study was evaluation of lymphocytes B (CD19) with co-expression with CD72 and CD40 receptors in hypertrophied adenoid with at children with otitis media with effusion. An investigation was executed in hypertrophied adenoids with or without otitis media with effusion. By flow cytometry percentage of lymphocytes B with co-receptors CD 40, CD22 and CD72 in was analyzed. The percentages of CD19+CD72+ lymphocytes in the group of children with adenoid hypertrophy and exudative otitis media were lower as compared to the reference group. However, the percentages of CD19+CD22+, CD19+CD40+ in the study group was approximate to the reference group. The lower percentage of lymphocytes B CD72 + near approximate percentages of lymphocytes B CD40+ and BCD22+ at children with otitis media with effusion can be the cause of incorrect humoral response in hypertrophied adenoid at children. Maybe it is cause reduced spontaneous production IgA and IgG through lymphocyte at children with otitis media with effusion.
Ashokkumar, Manickam; Aralaguppe, Shambhu G; Tripathy, Srikanth P; Hanna, Luke Elizabeth; Neogi, Ujjwal
2018-05-01
Adequate information on the precise molecular and biological composition of the viral strains that establish HIV infection in the human host will provide effective means of immunization against HIV infection. In an attempt to identify the transmitted founder (TF) virus and differentiate the biological properties and infectious potential of the TF virus from those of the population of the early transmitted viruses, 250 patient-derived gp120 envelope glycoproteins were cloned in pMN-K7-Luc-IRESs-NefΔgp120 to obtain chimeric viruses. Samples were obtained from eight infants who had recently become infected with HIV through mother-to-child transmission (MTCT) and two adults who acquired infection through the heterosexual route and were in the chronic stage of infection. Among the 250 clones tested, 65 chimeric viruses were infectious, and all belonged to HIV-1 subtype C. The 65 clones were analyzed for molecular features of the envelope, per-infectious-particle infectivity, coreceptor tropism, drug sensitivity, and sensitivity to broadly neutralizing antibodies. Based on genotypic and phenotypic analysis of the viral clones, we identified 10 TF viruses from the eight infants. The TF viruses were characterized by shorter V1V2 regions, a reduced number of potential N-linked glycosylation sites, and a higher infectivity titer compared to the virus variants from the adults in the chronic stage of infection. CXCR6 coreceptor usage, in addition to that of the CCR5 coreceptor, which was used by all 65 chimeric viruses, was identified in 13 viruses. The sensitivity of the TF variants to maraviroc and a standard panel of neutralizing monoclonal antibodies (VRC01, PG09, PG16, and PGT121) was found to be much lower than that of the virus variants from the adults in the chronic stage of infection. IMPORTANCE Tremendous progress has been made during the last three and half decades of HIV research, but some significant gaps continue to exist. One of the frontier areas of HIV research which has not seen a breakthrough yet is vaccine research, which is because of the enormous genetic diversity of HIV-1 and the unique infectious fitness of the virus. Among the repertoire of viral variants, the virus that establishes successful infection (transmitted founder [TF] virus) has not been well characterized yet. An insight into the salient features of the TF virus would go a long way toward helping with the design of an effective vaccine against HIV. Here we studied the biological properties of recently transmitted viruses isolated from infants who acquired infection from the mother and have come up with unique characterizations for the TF virus that establishes infection in the human host. Copyright © 2018 American Society for Microbiology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sloan, J.W.
1984-01-01
These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less
Glycosaminoglycan-Mediated Downstream Signaling of CXCL8 Binding to Endothelial Cells
Derler, Rupert; Weber, Corinna; Strutzmann, Elisabeth; Miller, Ingrid; Kungl, Andreas
2017-01-01
The recruitment of leukocytes, mediated by endothelium bound chemokine gradients, is a vital process in inflammation. The highly negatively charged, unbranched polysaccharide family of glycosaminoglycans (GAGs), such as heparan sulfate and chondroitin sulfate mediate chemokine immobilization. Specifically the binding of CXCL8 (interleukin 8) to GAGs on endothelial cell surfaces is known to regulate neutrophil recruitment. Currently, it is not clear if binding of CXCL8 to GAGs leads to endothelial downstream signaling in addition to the typical CXCR1/CXCR2 (C-X-C motif chemokine receptor 1 and 2)-mediated signaling which activates neutrophils. Here we have investigated the changes in protein expression of human microvascular endothelial cells induced by CXCL8. Tumor necrosis factor alpha (TNFα) stimulation was used to mimic an inflammatory state which allowed us to identify syndecan-4 (SDC4) as the potential proteoglycan co-receptor of CXCL8 by gene array, real-time PCR and flow cytometry experiments. Enzymatic GAG depolymerization via heparinase III and chondroitinase ABC was used to emulate the effect of glycocalyx remodeling on CXCL8-induced endothelial downstream signaling. Proteomic analyses showed changes in the expression pattern of a number of endothelial proteins such as Zyxin and Caldesmon involved in cytoskeletal organization, cell adhesion and cell mobility. These results demonstrate for the first time a potential role of GAG-mediated endothelial downstream signaling in addition to the well-known CXCL8-CXCR1/CXCR2 signaling pathways in neutrophils. PMID:29207576
Trkola, Alexandra; Matthews, Jamie; Gordon, Cynthia; Ketas, Tom; Moore, John P.
1999-01-01
We describe here a cell line-based assay for the evaluation of human immunodeficiency virus type 1 (HIV-1) neutralization. The assay is based on CEM.NKR cells, transfected to express the HIV-1 coreceptor CCR5 to supplement the endogenous expression of CD4 and the CXCR4 coreceptor. The resulting CEM.NKR-CCR5 cells efficiently replicate primary HIV-1 isolates of both R5 and X4 phenotypes. A comparison of the CEM.NKR-CCR5 cells with mitogen-activated peripheral blood mononuclear cells (PBMC) in neutralization assays with sera from HIV-1-infected individuals or specific anti-HIV-1 monoclonal antibodies shows that the sensitivity of HIV-1 neutralization is similar in the two cell types. The CEM.NKR-CCR5 cell assay, however, is more convenient to perform and eliminates the donor-to-donor variation in HIV-1 replication efficiency, which is one of the principal drawbacks of the PBMC-based neutralization assay. We suggest that this new assay is suitable for the general measurement of HIV-1 neutralization by antibodies. PMID:10516002
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
Tsuchiya, Kiyoto; Ode, Hirotaka; Hayashida, Tsunefusa; Kakizawa, Junko; Sato, Hironori; Oka, Shinichi; Gatanaga, Hiroyuki
2013-01-01
The third variable region (V3) of HIV-1 envelope glycoprotein gp120 plays a key role in determination of viral coreceptor usage (tropism). However, which combinations of mutations in V3 confer a tropism shift is still unclear. A unique pattern of mutations in antiretroviral therapy-naive HIV-1 patient was observed associated with the HIV-1 tropism shift CCR5 to CXCR4. The insertion of arginine at position 11 and the loss of the N-linked glycosylation site were indispensable for acquiring pure CXCR4-tropism, which were confirmed by cell-cell fusion assay and phenotype analysis of recombinant HIV-1 variants. The same pattern of mutations in V3 and the associated tropism shift were identified in two of 53 other patients (3.8%) with CD4+ cell count <200/mm3. The combination of arginine insertion and loss of N-linked glycosylation site usually confers CXCR4-tropism. Awareness of this rule will help to confirm the tropism prediction from V3 sequences by conventional rules. PMID:23925152
Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing
Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric
2017-01-01
AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457
Distinct Requirements for HIV-Cell Fusion and HIV-mediated Cell-Cell Fusion*
Kondo, Naoyuki; Marin, Mariana; Kim, Jeong Hwa; Desai, Tanay M.; Melikyan, Gregory B.
2015-01-01
Whether HIV-1 enters cells by fusing with the plasma membrane or with endosomes is a subject of active debate. The ability of HIV-1 to mediate fusion between adjacent cells, a process referred to as “fusion-from-without” (FFWO), shows that this virus can fuse with the plasma membrane. To compare FFWO occurring at the cell surface with HIV-cell fusion through a conventional entry route, we designed an experimental approach that enabled the measurements of both processes in the same sample. The following key differences were observed. First, a very small fraction of viruses fusing with target cells participated in FFWO. Second, whereas HIV-1 fusion with adherent cells was insensitive to actin inhibitors, post-CD4/coreceptor binding steps during FFWO were abrogated. A partial dependence of HIV-cell fusion on actin remodeling was observed in CD4+ T cells, but this effect appeared to be due to the actin dependence of virus uptake. Third, deletion of the cytoplasmic tail of HIV-1 gp41 dramatically enhanced the ability of the virus to promote FFWO, while having a modest effect on virus-cell fusion. Distinct efficiencies and actin dependences of FFWO versus HIV-cell fusion are consistent with the notion that, except for a minor fraction of particles that mediate fusion between the plasma membranes of adjacent cells, HIV-1 enters through an endocytic pathway. We surmise, however, that cell-cell contacts enabling HIV-1 fusion with the plasma membrane could be favored at the sites of high density of target cells, such as lymph nodes. PMID:25589785
Han, Xinbing; Li, Xin; Yue, Simon C.; Anandaiah, Asha; Hashem, Falah; Reinach, Peter S.; Koziel, Henry; Tachado, Souvenir D.
2012-01-01
Human macrophages at mucosal sites are essential targets for acute HIV infection. During the chronic phase of infection, they are persistent reservoirs for the AIDS virus. HIV virions gain entry into macrophages following ligation of surface CD4-CCR5 co-receptors, which leads to the release of two copies of HIV ssRNA. These events lead to reverse transcription and viral replication initiation. Toll-like receptors TLR7 and TLR8 recognize specific intracellular viral ssRNA sequences, but in human alveolar macrophages, their individual roles in TLR-mediated HIV ssRNA recognition are unclear. In the current study, HIV-1 ssRNA induced TNFα release in a dose-dependent manner in adherent human macrophages expressing both intracellular TLR7 and TLR8. This response was reduced by inhibiting either endocytosis (50 μm dynasore) or endosomal acidification (1 μg/ml chloroquine). Either MYD88 or TLR8 gene knockdown with relevant siRNA reduced HIV-1 ssRNA-mediated TNFα release, but silencing TLR7 had no effect on this response. Furthermore, HIV-1 ssRNA induced histone 4 acetylation at the TNFα promoter as well as trimethylation of histone 3 at lysine 4, whereas TLR8 gene knockdown reduced these effects. Taken together in human macrophages, TLR8 binds and internalizes HIV ssRNA, leading to endosomal acidification, chromatin remodeling, and increases in TNFα release. Drugs targeting macrophage TLR8-linked signaling pathways may modulate the innate immune response to acute HIV infection by reducing viral replication. PMID:22393042
Liu, Xiaochen; Zhang, Bin; McBride, Jeffrey D.; Zhou, Kevin; Lee, Kyungwon; Zhou, Yueping; Liu, Zuguo; Ma, Jian-xing
2013-01-01
Kallistatin is a member of the serine proteinase inhibitor superfamily. Kallistatin levels have been shown to be decreased in the vitreous while increased in the circulation of patients with diabetic retinopathy (DR). Overactivation of the Wnt pathway is known to play pathogenic roles in DR. To investigate the role of kallistatin in DR and in Wnt pathway activation, we generated kallistatin transgenic (kallistatin-TG) mice overexpressing kallistatin in multiple tissues including the retina. In the oxygen-induced retinopathy (OIR) model, kallistatin overexpression attenuated ischemia-induced retinal neovascularization. In diabetic kallistatin-TG mice, kallistatin overexpression ameliorated retinal vascular leakage, leukostasis, and overexpression of vascular endothelial growth factor and intracellular adhesion molecule. Furthermore, kallistatin overexpression also suppressed Wnt pathway activation in the retinas of the OIR and diabetic models. In diabetic Wnt reporter (BAT-gal) mice, kallistatin overexpression suppressed retinal Wnt reporter activity. In cultured retinal cells, kallistatin blocked Wnt pathway activation induced by high glucose and by Wnt ligand. Coprecipitation and ligand-binding assays both showed that kallistatin binds to a Wnt coreceptor LRP6 with high affinity (Kd = 4.5 nmol/L). These observations suggest that kallistatin is an endogenous antagonist of LRP6 and inhibitor of Wnt signaling. The blockade of Wnt signaling may represent a mechanism for its antiangiogenic and antineuroinflammatory effects. PMID:23884893
Holdsworth, Gill; Slocombe, Patrick; Doyle, Carl; Sweeney, Bernadette; Veverka, Vaclav; Le Riche, Kelly; Franklin, Richard J.; Compson, Joanne; Brookings, Daniel; Turner, James; Kennedy, Jeffery; Garlish, Rachael; Shi, Jiye; Newnham, Laura; McMillan, David; Muzylak, Mariusz; Carr, Mark D.; Henry, Alistair J.; Ceska, Thomas; Robinson, Martyn K.
2012-01-01
LRP5 and LRP6 are proteins predicted to contain four six-bladed β-propeller domains and both bind the bone-specific Wnt signaling antagonist sclerostin. Here, we report the crystal structure of the amino-terminal region of LRP6 and using NMR show that the ability of sclerostin to bind to this molecule is mediated by the central core of sclerostin and does not involve the amino- and carboxyl-terminal flexible arm regions. We show that this structured core region interacts with LRP5 and LRP6 via an NXI motif (found in the sequence PNAIG) within a flexible loop region (loop 2) within the central core region. This sequence is related closely to a previously identified motif in laminin that mediates its interaction with the β-propeller domain of nidogen. However, the NXI motif is not involved in the interaction of sclerostin with LRP4 (another β-propeller containing protein in the LRP family). A peptide derived from the loop 2 region of sclerostin blocked the interaction of sclerostin with LRP5/6 and also inhibited Wnt1 but not Wnt3A or Wnt9B signaling. This suggests that these Wnts interact with LRP6 in different ways. PMID:22696217
Tóth, Beáta; Garabuczi, Eva; Sarang, Zsolt; Vereb, György; Vámosi, György; Aeschlimann, Daniel; Blaskó, Bernadett; Bécsi, Bálint; Erdõdi, Ferenc; Lacy-Hulbert, Adam; Zhang, Ailiang; Falasca, Laura; Birge, Raymond B; Balajthy, Zoltán; Melino, Gerry; Fésüs, László; Szondy, Zsuzsa
2009-02-15
Transglutaminase 2 (TG2), a protein cross-linking enzyme with many additional biological functions, acts as coreceptor for integrin beta(3). We have previously shown that TG2(-/-) mice develop an age-dependent autoimmunity due to defective in vivo clearance of apoptotic cells. Here we report that TG2 on the cell surface and in guanine nucleotide-bound form promotes phagocytosis. Besides being a binding partner for integrin beta(3), a receptor known to mediate the uptake of apoptotic cells via activating Rac1, we also show that TG2 binds MFG-E8 (milk fat globulin EGF factor 8), a protein known to bridge integrin beta(3) to apoptotic cells. Finally, we report that in wild-type macrophages one or two engulfing portals are formed during phagocytosis of apoptotic cells that are characterized by accumulation of integrin beta(3) and Rac1. In the absence of TG2, integrin beta(3) cannot properly recognize the apoptotic cells, is not accumulated in the phagocytic cup, and its signaling is impaired. As a result, the formation of the engulfing portals, as well as the portals formed, is much less efficient. We propose that TG2 has a novel function to stabilize efficient phagocytic portals.
Candidate Chemosensory Genes in the Stemborer Sesamia nonagrioides
Glaser, Nicolas; Gallot, Aurore; Legeai, Fabrice; Montagné, Nicolas; Poivet, Erwan; Harry, Myriam; Calatayud, Paul-André; Jacquin-Joly, Emmanuelle
2013-01-01
The stemborer Sesamia nonagrioides is an important pest of maize in the Mediterranean Basin. Like other moths, this noctuid uses its chemosensory system to efficiently interact with its environment. However, very little is known on the molecular mechanisms that underlie chemosensation in this species. Here, we used next-generation sequencing (454 and Illumina) on different tissues from adult and larvae, including chemosensory organs and female ovipositors, to describe the chemosensory transcriptome of S. nonagrioides and identify key molecular components of the pheromone production and detection systems. We identified a total of 68 candidate chemosensory genes in this species, including 31 candidate binding-proteins and 23 chemosensory receptors. In particular, we retrieved the three co-receptors Orco, IR25a and IR8a necessary for chemosensory receptor functioning. Focusing on the pheromonal communication system, we identified a new pheromone-binding protein in this species, four candidate pheromone receptors and 12 carboxylesterases as candidate acetate degrading enzymes. In addition, we identified enzymes putatively involved in S. nonagrioides pheromone biosynthesis, including a ∆11-desaturase and different acetyltransferases and reductases. RNAseq analyses and RT-PCR were combined to profile gene expression in different tissues. This study constitutes the first large scale description of chemosensory genes in S. nonagrioides. PMID:23781142
Identification of dual-tropic HIV-1 using evolved neural networks.
Fogel, Gary B; Lamers, Susanna L; Liu, Enoch S; Salemi, Marco; McGrath, Michael S
2015-11-01
Blocking the binding of the envelope HIV-1 protein to immune cells is a popular concept for development of anti-HIV therapeutics. R5 HIV-1 binds CCR5, X4 HIV-1 binds CXCR4, and dual-tropic HIV-1 can bind either coreceptor for cellular entry. R5 viruses are associated with early infection and over time can evolve to X4 viruses that are associated with immune failure. Dual-tropic HIV-1 is less studied; however, it represents functional antigenic intermediates during the transition of R5 to X4 viruses. Viral tropism is linked partly to the HIV-1 envelope V3 domain, where the amino acid sequence helps dictate the receptor a particular virus will target; however, using V3 sequence information to identify dual-tropic HIV-1 isolates has remained difficult. Our goal in this study was to elucidate features of dual-tropic HIV-1 isolates that assist in the biological understanding of dual-tropism and develop an approach for their detection. Over 1559 HIV-1 subtype B sequences with known tropisms were analyzed. Each sequence was represented by 73 structural, biochemical and regional features. These features were provided to an evolved neural network classifier and evaluated using balanced and unbalanced data sets. The study resolved R5X4 viruses from R5 with an accuracy of 81.8% and from X4 with an accuracy of 78.8%. The approach also identified a set of V3 features (hydrophobicity, structural and polarity) that are associated with tropism transitions. The ability to distinguish R5X4 isolates will improve computational tropism decisions for R5 vs. X4 and assist in HIV-1 research and drug development efforts. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
An Electrostatic Funnel in the GABA-Binding Pathway
Lightstone, Felice C.
2016-01-01
The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953
Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.
2013-01-01
Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283
A tool for calculating binding-site residues on proteins from PDB structures.
Hu, Jing; Yan, Changhui
2009-08-03
In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.
Ryden, T A; de Mars, M; Beemon, K
1993-01-01
Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280
The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.
Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried
2017-06-01
Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.
NASA Technical Reports Server (NTRS)
Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.
2000-01-01
Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.
New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase
NASA Astrophysics Data System (ADS)
Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian
2016-08-01
Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.
New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.
Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian
2016-08-05
Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
NASA Astrophysics Data System (ADS)
D'Aquino, J. Alejandro; Ringe, Dagmar
2006-08-01
The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.
Allosteric binding sites in Rab11 for potential drug candidates
2018-01-01
Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rosier, A.M.; Vandesande, F.; Orban, G.A.
1991-03-08
The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less
Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A
1999-01-01
A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
NASA Astrophysics Data System (ADS)
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.
2013-01-01
Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386
Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites
Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot
2013-01-01
Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958
A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.
Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L
1997-03-11
We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.
Koo, Jung Eun; Park, Zee-Yong; Kim, Nam Doo; Lee, Joo Young
2013-05-10
Toll-like receptors (TLRs) are key pattern-recognition receptors that recognize invading pathogens and non-microbial endogenous molecules to induce innate and adaptive immune responses. Since activation of TLRs is deeply implicated in the pathological progress of autoimmune diseases, sepsis, metabolic diseases, and cancer, modulation of TLR activity is considered one of the most important therapeutic approaches. Lipopolysaccharide (LPS), an endotoxin of gram-negative bacteria, is a well-known agonist for TLR4 triggering inflammation and septic shock. LPS interacts with TLR4 through binding to a hydrophobic pocket in myeloid differentiation 2 (MD2), a co-receptor of TLR4. In this study, we showed that sulforaphane (SFN) interfered with the binding of LPS to MD2 as determined by in vitro binding assay and co-immunoprecipitation of MD2 and LPS in a cell system. The inhibitory effect of SFN on the interaction of LPS and MD2 was reversed by thiol supplementation with N-acetyl-L-cysteine or dithiothreitol showing that the inhibitory effect of SFN is dependent on its thiol-modifying activity. Indeed, micro LC-MS/MS analysis showed that SFN preferentially formed adducts with Cys133 in the hydrophobic pocket of MD2, but not with Cys95 and Cys105. Molecular modeling showed that SFN bound to Cys133 blocks the engagement of LPS and lipid IVa to hydrophobic pocket of MD2. Our results demonstrate that SFN interrupts LPS engagement to TLR4/MD2 complex by direct binding to Cys133 in MD2. Our data suggest a novel mechanism for the anti-inflammatory activity of SFN, and provide a novel target for the regulation of TLR4-mediated inflammatory and immune responses by phytochemicals. Copyright © 2013 Elsevier Inc. All rights reserved.
The GM2 Glycan Serves as a Functional Coreceptor for Serotype 1 Reovirus
Liu, Yan; Blaum, Bärbel S.; Reiter, Dirk M.; Feizi, Ten; Dermody, Terence S.; Stehle, Thilo
2012-01-01
Viral attachment to target cells is the first step in infection and also serves as a determinant of tropism. Like many viruses, mammalian reoviruses bind with low affinity to cell-surface carbohydrate receptors to initiate the infectious process. Reoviruses disseminate with serotype-specific tropism in the host, which may be explained by differential glycan utilization. Although α2,3-linked sialylated oligosaccharides serve as carbohydrate receptors for type 3 reoviruses, neither a specific glycan bound by any reovirus serotype nor the function of glycan binding in type 1 reovirus infection was known. We have identified the oligosaccharide portion of ganglioside GM2 (the GM2 glycan) as a receptor for the attachment protein σ1 of reovirus strain type 1 Lang (T1L) using glycan array screening. The interaction of T1L σ1 with GM2 in solution was confirmed using NMR spectroscopy. We established that GM2 glycan engagement is required for optimal infection of mouse embryonic fibroblasts (MEFs) by T1L. Preincubation with GM2 specifically inhibited type 1 but not type 3 reovirus infection of MEFs. To provide a structural basis for these observations, we defined the mode of receptor recognition by determining the crystal structure of T1L σ1 in complex with the GM2 glycan. GM2 binds in a shallow groove in the globular head domain of T1L σ1. Both terminal sugar moieties of the GM2 glycan, N-acetylneuraminic acid and N-acetylgalactosamine, form contacts with the protein, providing an explanation for the observed specificity for GM2. Viruses with mutations in the glycan-binding domain display diminished hemagglutination capacity, a property dependent on glycan binding, and reduced capacity to infect MEFs. Our results define a novel mode of virus-glycan engagement and provide a mechanistic explanation for the serotype-dependent differences in glycan utilization by reovirus. PMID:23236285
The GM2 glycan serves as a functional coreceptor for serotype 1 reovirus.
Reiss, Kerstin; Stencel, Jennifer E; Liu, Yan; Blaum, Bärbel S; Reiter, Dirk M; Feizi, Ten; Dermody, Terence S; Stehle, Thilo
2012-01-01
Viral attachment to target cells is the first step in infection and also serves as a determinant of tropism. Like many viruses, mammalian reoviruses bind with low affinity to cell-surface carbohydrate receptors to initiate the infectious process. Reoviruses disseminate with serotype-specific tropism in the host, which may be explained by differential glycan utilization. Although α2,3-linked sialylated oligosaccharides serve as carbohydrate receptors for type 3 reoviruses, neither a specific glycan bound by any reovirus serotype nor the function of glycan binding in type 1 reovirus infection was known. We have identified the oligosaccharide portion of ganglioside GM2 (the GM2 glycan) as a receptor for the attachment protein σ1 of reovirus strain type 1 Lang (T1L) using glycan array screening. The interaction of T1L σ1 with GM2 in solution was confirmed using NMR spectroscopy. We established that GM2 glycan engagement is required for optimal infection of mouse embryonic fibroblasts (MEFs) by T1L. Preincubation with GM2 specifically inhibited type 1 but not type 3 reovirus infection of MEFs. To provide a structural basis for these observations, we defined the mode of receptor recognition by determining the crystal structure of T1L σ1 in complex with the GM2 glycan. GM2 binds in a shallow groove in the globular head domain of T1L σ1. Both terminal sugar moieties of the GM2 glycan, N-acetylneuraminic acid and N-acetylgalactosamine, form contacts with the protein, providing an explanation for the observed specificity for GM2. Viruses with mutations in the glycan-binding domain display diminished hemagglutination capacity, a property dependent on glycan binding, and reduced capacity to infect MEFs. Our results define a novel mode of virus-glycan engagement and provide a mechanistic explanation for the serotype-dependent differences in glycan utilization by reovirus.
Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok
2017-07-01
Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.
Xavier, Guilherme M.; Seppala, Maisa; Papageorgiou, Spyridon N.; Fan, Chen-Ming; Cobourne, Martyn T.
2016-01-01
Abnormal regulation of Sonic hedgehog (Shh) signaling has been described in a variety of human cancers and developmental anomalies, which highlights the essential role of this signaling molecule in cell cycle regulation and embryonic development. Gas1 and Boc are membrane co-receptors for Shh, which demonstrate overlapping domains of expression in the early face. This study aims to investigate potential interactions between these co-receptors during formation of the secondary palate. Mice with targeted mutation in Gas1 and Boc were used to generate Gas1; Boc compound mutants. The expression of key Hedgehog signaling family members was examined in detail during palatogenesis via radioactive in situ hybridization. Morphometric analysis involved computational quantification of BrdU-labeling and cell packing; whilst TUNEL staining was used to assay cell death. Ablation of Boc in a Gas1 mutant background leads to reduced Shh activity in the palatal shelves and an increase in the penetrance and severity of cleft palate, associated with failed elevation, increased proliferation and reduced cell death. Our findings suggest a dual requirement for Boc and Gas1 during early development of the palate, mediating cell cycle regulation during growth and subsequent fusion of the palatal shelves. PMID:27811357
Neuropilins: expression and roles in the epithelium
Wild, Jonathan R L; Staton, Carolyn A; Chapple, Keith; Corfe, Bernard M
2012-01-01
Summary Initially found expressed in neuronal and then later in endothelial cells, it is well established that the transmembrane glycoproteins neuropilin-1 (NRP1) and neuropilin-2 (NRP2) play essential roles in axonal growth and guidance and in physiological and pathological angiogenesis. Neuropilin expression and function in epithelial cells has received little attention when compared with neuronal and endothelial cells. Overexpression of NRPs is shown to enhance growth, correlate with invasion and is associated with poor prognosis in various tumour types, especially those of epithelial origin. The contribution of NRP and its ligands to tumour growth and metastasis has spurred a strong interest in NRPs as novel chemotherapy drug targets. Given NRP’s role as a multifunctional co-receptor with an ability to bind with disparate ligand families, this has sparked new areas of research implicating NRPs in diverse biological functions. Here, we review the growing body of research demonstrating NRP expression and role in the normal and neoplastic epithelium. PMID:22414290
Membrane organization of virus and target cell plays a role in HIV entry.
Dumas, Fabrice; Preira, Pascal; Salomé, Laurence
2014-12-01
The initial steps of the Human Immunodeficiency Virus (HIV) replication cycle play a crucial role that arbitrates viral tropism and infection efficiency. Before the release of its genome into the host cell cytoplasm, viruses operate a complex sequence of events that take place at the plasma membrane of the target cell. The first step is the binding of the HIV protein envelope (Env) to the cellular receptor CD4. This triggers conformational changes of the gp120 viral protein that allow its interaction with a co-receptor that can be either CCR5 or CXCR4, defining the tropism of the virus entering the cell. This sequential interaction finally drives the fusion of the viral and host cell membrane or to the endocytosis of the viruses. Here, we discuss how the membrane composition and organization of both the virus and the target cell can affect these steps and thus influence the capability of the viruses to infect cells. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Internalization and Axonal Transport of the HIV Glycoprotein gp120
Berth, Sarah; Caicedo, Hector Hugo; Sarma, Tulika; Morfini, Gerardo
2015-01-01
The HIV glycoprotein gp120, a neurotoxic HIV glycoprotein that is overproduced and shed by HIV-infected macrophages, is associated with neurological complications of HIV such as distal sensory polyneuropathy, but interactions of gp120 in the peripheral nervous system remain to be characterized. Here, we demonstrate internalization of extracellular gp120 in a manner partially independent of binding to its coreceptor CXCR4 by F11 neuroblastoma cells and cultured dorsal root ganglion neurons. Immunocytochemical and pharmacological experiments indicate that gp120 does not undergo trafficking through the endolysosomal pathway. Instead, gp120 is mainly internalized through lipid rafts in a cholesterol-dependent manner, with a minor fraction being internalized by fluid phase pinocytosis. Experiments using compartmentalized microfluidic chambers further indicate that, after internalization, endocytosed gp120 selectively undergoes retrograde but not anterograde axonal transport from axons to neuronal cell bodies. Collectively, these studies illuminate mechanisms of gp120 internalization and axonal transport in peripheral nervous system neurons, providing a novel framework for mechanisms for gp120 neurotoxicity. PMID:25636314
Functional architecture of olfactory ionotropic glutamate receptors.
Abuin, Liliane; Bargeton, Benoîte; Ulbrich, Maximilian H; Isacoff, Ehud Y; Kellenberger, Stephan; Benton, Richard
2011-01-13
Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that mediate chemical communication between neurons at synapses. A variant iGluR subfamily, the Ionotropic Receptors (IRs), was recently proposed to detect environmental volatile chemicals in olfactory cilia. Here, we elucidate how these peripheral chemosensors have evolved mechanistically from their iGluR ancestors. Using a Drosophila model, we demonstrate that IRs act in combinations of up to three subunits, comprising individual odor-specific receptors and one or two broadly expressed coreceptors. Heteromeric IR complex formation is necessary and sufficient for trafficking to cilia and mediating odor-evoked electrophysiological responses in vivo and in vitro. IRs display heterogeneous ion conduction specificities related to their variable pore sequences, and divergent ligand-binding domains function in odor recognition and cilia localization. Our results provide insights into the conserved and distinct architecture of these olfactory and synaptic ion channels and offer perspectives into the use of IRs as genetically encoded chemical sensors. Copyright © 2011 Elsevier Inc. All rights reserved.
CCR5 adopts three homodimeric conformations that control cell surface delivery.
Jin, Jun; Momboisse, Fanny; Boncompain, Gaelle; Koensgen, Florian; Zhou, Zhicheng; Cordeiro, Nelia; Arenzana-Seisdedos, Fernando; Perez, Franck; Lagane, Bernard; Kellenberger, Esther; Brelot, Anne
2018-05-08
Biophysical methods and x-ray crystallography have revealed that class A G protein-coupled receptors (GPCRs) can form homodimers. We combined computational approaches with receptor cross-linking, energy transfer, and a newly developed functional export assay to characterize the residues involved in the dimerization interfaces of the chemokine receptor CCR5, the major co-receptor for HIV-1 entry into cells. We provide evidence of three distinct CCR5 dimeric organizations, involving residues of transmembrane helix 5. Two dimeric states corresponded to unliganded receptors, whereas the binding of the inverse agonist maraviroc stabilized a third state. We found that CCR5 dimerization was required for targeting the receptor to the plasma membrane. These data suggest that dimerization contributes to the conformational diversity of inactive class A GPCRs and may provide new opportunities to investigate the cellular entry of HIV-1 and mechanisms for its inhibition. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Intermittent IL-7 Signaling Essential for T cell Homeostasis | Center for Cancer Research
In order for the immune system to mount an appropriate response to foreign antigens throughout a person’s life, the body must maintain a sufficient population of circulating mature, naïve T cells, a process known as T cell homeostasis. Previous studies revealed that this process depends upon signaling from the cytokine interleukin-7 (IL-7) as well as from the T cell antigen receptor (TCR). Intriguingly, signals from each pathway affect the other and lead to their alternating activation: IL-7 binding to its receptor leads to increasing expression of the TCR co-receptor CD8; sufficient CD8 expression allows TCRs to signal when bound to self-ligands, blocking IL-7 signaling; suppressed IL-7 signals lead to down-regulation of CD8 and ligand disengagement, which allows T cells to again respond to IL-7. Alfred Singer, M.D., and his colleagues in CCR’s Experimental Immunology Branch set out to understand how this intricate pathway promotes T cell survival.
RIPK4 phosphorylates Dishevelled proteins to regulate canonical Wnt signaling
Huang, XiaoDong; McGann, James C.; Liu, Bob Y.; Hannoush, Rami N.; Lill, Jennie R.; Pham, Victoria; Newton, Kim; Kakunda, Michael; Liu, Jinfeng; Yu, Christine; Hymowitz, Sarah G.; Hongo, Jo-Anne; Wynshaw-Boris, Anthony; Polakis, Paul; Harland, Richard M.; Dixit, Vishva M.
2014-01-01
Receptor interacting protein kinase 4 (RIPK4) is required for epidermal differentiation (1–4) and is mutated in Bartsocas-Papas syndrome (5, 6). While RIPK4 binds protein kinase C (5, 6), RIPK4 signaling mechanisms are largely unknown. We show that ectopic RIPK4 induces cytosolic β-catenin accumulation and a transcriptional program similar to Wnt3a, whereas kinase-defective or Bartsocas-Papas syndrome RIPK4 mutants do not. Ectopic ripk4 synergized with Wnt family member xwnt8 in Xenopus, whereas ripk4 morpholinos or kinase-defective RIPK4 antagonized Wnt signaling. Mechanistically, RIKP4 interacted constitutively with the Wnt adaptor protein DVL2 and, after Wnt3a stimulation, with the co-receptor LRP6. Phosphorylation of DVL2 at Ser298 and Ser480 by RIPK4 favored canonical Wnt signaling. Growth of a Wnt-dependent N-Tera2 xenograft tumor model was suppressed by RIPK4 knockdown, suggesting that RIPK4 overexpression may contribute to the growth of certain tumor types. PMID:23371553
Wilson, Nicole H; Stoeckli, Esther T
2013-08-07
Upon reaching their intermediate target, the floorplate, commissural axons acquire responsiveness to repulsive guidance cues, allowing the axons to exit the midline and adopt a contralateral, longitudinal trajectory. The molecular mechanisms that regulate this switch from attraction to repulsion remain poorly defined. Here, we show that the heparan sulfate proteoglycan Glypican1 (GPC1) is required as a coreceptor for the Shh-dependent induction of Hedgehog-interacting protein (Hhip) in commissural neurons. In turn, Hhip is required for postcrossing axons to respond to a repulsive anteroposterior Shh gradient. Thus, Shh is a cue with dual function. In precrossing axons it acts as an attractive guidance molecule in a transcription-independent manner. At the same time, Shh binds to GPC1 to induce the expression of its own receptor, Hhip, which mediates the repulsive response of postcrossing axons to Shh. Our study characterizes a molecular mechanism by which navigating axons switch their responsiveness at intermediate targets. Copyright © 2013 Elsevier Inc. All rights reserved.
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.
2005-01-01
The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less
Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*
Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei
2015-01-01
The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883
Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L
2013-07-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.
Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.
2013-01-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967
Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordonez, E.; Thiyagarajan, S.; Cook, J.D.
2009-05-22
Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less
NASA Astrophysics Data System (ADS)
Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong
2013-08-01
The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rothman, R.B.; Jacobson, A.E.; Rice, K.C.
1987-11-01
Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less
Complexity and dynamics of HIV-1 chemokine receptor usage in a multidrug-resistant adolescent.
Cavarelli, Mariangela; Mainetti, Lara; Pignataro, Angela Rosa; Bigoloni, Alba; Tolazzi, Monica; Galli, Andrea; Nozza, Silvia; Castagna, Antonella; Sampaolo, Michela; Boeri, Enzo; Scarlatti, Gabriella
2014-12-01
Maraviroc (MVC) is licensed in clinical practice for patients with R5 virus and virological failure; however, in anecdotal reports, dual/mixed viruses were also inhibited. We retrospectively evaluated the evolution of HIV-1 coreceptor tropism in plasma and peripheral blood mononuclear cells (PBMCs) of an infected adolescent with a CCR5/CXCR4 Trofile profile who experienced an important but temporary immunological and virological response during a 16-month period of MVC-based therapy. Coreceptor usage of biological viral clones isolated from PBMCs was investigated in U87.CD4 cells expressing wild-type or chimeric CCR5 and CXCR4. Plasma and PBMC-derived viral clones were sequenced to predict coreceptor tropism using the geno2pheno algorithm from the V3 envelope sequence and pol gene-resistant mutations. From start to 8.5 months of MVC treatment only R5X4 viral clones were observed, whereas at 16 months the phenotype enlarged to also include R5 and X4 clones. Chimeric receptor usage suggested the preferential usage of the CXCR4 coreceptor by the R5X4 biological clones. According to phenotypic data, R5 viruses were susceptible, whereas R5X4 and X4 viruses were resistant to RANTES and MVC in vitro. Clones at 16 months, but not at baseline, showed an amino acidic resistance pattern in protease and reverse transcription genes, which, however, did not drive their tropisms. The geno2pheno algorithm predicted at baseline R5 viruses in plasma, and from 5.5 months throughout follow-up only CXCR4-using viruses. An extended methodological approach is needed to unravel the complexity of the phenotype and variation of viruses resident in the different compartments of an infected individual. The accurate evaluation of the proportion of residual R5 viruses may guide therapeutic intervention in highly experienced patients with limited therapeutic options.
Complexity and Dynamics of HIV-1 Chemokine Receptor Usage in a Multidrug-Resistant Adolescent
Mainetti, Lara; Pignataro, Angela Rosa; Bigoloni, Alba; Tolazzi, Monica; Galli, Andrea; Nozza, Silvia; Castagna, Antonella; Sampaolo, Michela; Boeri, Enzo; Scarlatti, Gabriella
2014-01-01
Abstract Maraviroc (MVC) is licensed in clinical practice for patients with R5 virus and virological failure; however, in anecdotal reports, dual/mixed viruses were also inhibited. We retrospectively evaluated the evolution of HIV-1 coreceptor tropism in plasma and peripheral blood mononuclear cells (PBMCs) of an infected adolescent with a CCR5/CXCR4 Trofile profile who experienced an important but temporary immunological and virological response during a 16-month period of MVC-based therapy. Coreceptor usage of biological viral clones isolated from PBMCs was investigated in U87.CD4 cells expressing wild-type or chimeric CCR5 and CXCR4. Plasma and PBMC-derived viral clones were sequenced to predict coreceptor tropism using the geno2pheno algorithm from the V3 envelope sequence and pol gene-resistant mutations. From start to 8.5 months of MVC treatment only R5X4 viral clones were observed, whereas at 16 months the phenotype enlarged to also include R5 and X4 clones. Chimeric receptor usage suggested the preferential usage of the CXCR4 coreceptor by the R5X4 biological clones. According to phenotypic data, R5 viruses were susceptible, whereas R5X4 and X4 viruses were resistant to RANTES and MVC in vitro. Clones at 16 months, but not at baseline, showed an amino acidic resistance pattern in protease and reverse transcription genes, which, however, did not drive their tropisms. The geno2pheno algorithm predicted at baseline R5 viruses in plasma, and from 5.5 months throughout follow-up only CXCR4-using viruses. An extended methodological approach is needed to unravel the complexity of the phenotype and variation of viruses resident in the different compartments of an infected individual. The accurate evaluation of the proportion of residual R5 viruses may guide therapeutic intervention in highly experienced patients with limited therapeutic options. PMID:25275490
Use of four next-generation sequencing platforms to determine HIV-1 coreceptor tropism.
Archer, John; Weber, Jan; Henry, Kenneth; Winner, Dane; Gibson, Richard; Lee, Lawrence; Paxinos, Ellen; Arts, Eric J; Robertson, David L; Mimms, Larry; Quiñones-Mateu, Miguel E
2012-01-01
HIV-1 coreceptor tropism assays are required to rule out the presence of CXCR4-tropic (non-R5) viruses prior treatment with CCR5 antagonists. Phenotypic (e.g., Trofile™, Monogram Biosciences) and genotypic (e.g., population sequencing linked to bioinformatic algorithms) assays are the most widely used. Although several next-generation sequencing (NGS) platforms are available, to date all published deep sequencing HIV-1 tropism studies have used the 454™ Life Sciences/Roche platform. In this study, HIV-1 co-receptor usage was predicted for twelve patients scheduled to start a maraviroc-based antiretroviral regimen. The V3 region of the HIV-1 env gene was sequenced using four NGS platforms: 454™, PacBio® RS (Pacific Biosciences), Illumina®, and Ion Torrent™ (Life Technologies). Cross-platform variation was evaluated, including number of reads, read length and error rates. HIV-1 tropism was inferred using Geno2Pheno, Web PSSM, and the 11/24/25 rule and compared with Trofile™ and virologic response to antiretroviral therapy. Error rates related to insertions/deletions (indels) and nucleotide substitutions introduced by the four NGS platforms were low compared to the actual HIV-1 sequence variation. Each platform detected all major virus variants within the HIV-1 population with similar frequencies. Identification of non-R5 viruses was comparable among the four platforms, with minor differences attributable to the algorithms used to infer HIV-1 tropism. All NGS platforms showed similar concordance with virologic response to the maraviroc-based regimen (75% to 80% range depending on the algorithm used), compared to Trofile (80%) and population sequencing (70%). In conclusion, all four NGS platforms were able to detect minority non-R5 variants at comparable levels suggesting that any NGS-based method can be used to predict HIV-1 coreceptor usage.
Irlbeck, David M; Amrine-Madsen, Heather; Kitrinos, Kathryn M; Labranche, Celia C; Demarest, James F
2008-07-31
HIV-1 utilizes CD4 and either chemokine (C-C motif) receptor 5 (CCR5) or chemokine (C-X-C motif) receptor 4 (CXCR4) to gain entry into host cells. Small molecule CCR5 antagonists are currently being developed for the treatment of HIV-1 infection. Because HIV-1 may also use CXCR4 for entry, the use of CCR5 entry inhibitors is controversial for patients harboring CCR5-using and CXCR4-using (dual/mixed-tropic) viruses. The goal of the present study was to determine the proportion of CCR5-tropic and CXCR4-tropic viruses in dual/mixed-tropic virus isolates from drug-naïve patients and the phenotypic and genotypic relationships of viruses that use CCR5 or CXCR4 or both. Fourteen antiretroviral-naive HIV-1-infected patients were identified as having population coreceptor tropism readout of dual/mixed-tropic viruses. Intrapatient comparisons of coreceptor tropism and genotype of env clones were conducted on plasma virus from each patient. Population HIV-1 envelope tropism and susceptibility to the CCR5 entry inhibitor, aplaviroc, were performed using the Monogram Biosciences Trofile Assay. Twelve env clones from each patient were analyzed for coreceptor tropism, aplaviroc sensitivity, genotype, and intrapatient phylogenetic relationships. Viral populations from antiretroviral-naive patients with dual/mixed-tropic virus are composed primarily of CCR5-tropic env clones mixed with those that use both coreceptors (R5X4-tropic) and, occasionally, CXCR4-tropic env clones. Interestingly, the efficiency of CXCR4 use by R5X4-tropic env clones varied with their genetic relationships to CCR5-tropic env clones from the same patient. These data show that the majority of viruses in these dual/mixed-tropic populations use CCR5 and suggest that antiretroviral-naive patients may benefit from combination therapy that includes CCR5 entry inhibitors.
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh
2013-01-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh
2013-09-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.
Reducing V3 Antigenicity and Immunogenicity on Soluble, Native-Like HIV-1 Env SOSIP Trimers.
Ringe, Rajesh P; Ozorowski, Gabriel; Rantalainen, Kimmo; Struwe, Weston B; Matthews, Katie; Torres, Jonathan L; Yasmeen, Anila; Cottrell, Christopher A; Ketas, Thomas J; LaBranche, Celia C; Montefiori, David C; Cupo, Albert; Crispin, Max; Wilson, Ian A; Ward, Andrew B; Sanders, Rogier W; Klasse, P J; Moore, John P
2017-08-01
Native-like trimers of the SOSIP design are being developed as immunogens in human immunodeficiency virus type 1 (HIV-1) vaccine development programs. These trimers display the epitopes for multiple broadly neutralizing antibodies (bNAbs) but can also expose binding sites for some types of nonneutralizing antibodies (non-NAbs). Among the latter are epitopes in the gp120 V3 region that are highly immunogenic when SOSIP trimers are evaluated in animal models. It is presently uncertain whether antibodies against V3 can interfere with the induction of NAbs, but there are good arguments in favor of suppressing such "off-target" immune responses. Accordingly, we have assessed how to minimize the exposure of V3 non-NAb epitopes and thereby reduce their immunogenicity by introducing N -glycans within the V3 region of BG505 SOSIP trimers. We found that inserting glycans at positions 306 and 314 (termed M1 and M7) markedly reduced V3 antigenicity while improving the presentation of trimer apex bNAb epitopes. Both added glycans were shown to be predominantly of the Man 6 GlcNAc 2 form. The additional introduction of the E64K ground-state stabilizing substitution markedly reduced or ablated soluble CD4 (sCD4) induction of non-NAb epitopes in V3 and/or associated with the coreceptor binding site. When a V3 glycan- and E64K-modified trimer variant, BG505 SOSIP.664-E64K.M1M7, was tested in rabbits, V3 immunogenicity was eliminated while the autologous NAb response was unchanged. IMPORTANCE Trimeric proteins are being developed for future HIV-1 vaccine trials in humans, with the goal of eliciting broadly active neutralizing antibodies (NAbs) that are active against a wide variety of circulating strains. In animal models, the present generation of native-like trimer immunogens, exemplified by the BG505 SOSIP.664 construct, induces narrow-specificity antibodies against the neutralization-resistant (tier-2), sequence-matched virus and more broadly active antibodies against sequence-divergent atypically neutralization-sensitive (tier-1) viruses. A concern in the trimer immunogen design field has been whether the latter off-target antibodies might interfere with the induction of the more desired responses to tier-2 epitopes. Here, we have inserted two glycans into the dominant site for tier-1 NAbs, the gp120 V3 region, to block the induction of off-target antibodies. We characterized the new trimers, tested them as immunogens in rabbits, and found that the blocking glycans eliminated the induction of tier-1 NAbs to V3-epitopes. Copyright © 2017 Ringe et al.
Reducing V3 Antigenicity and Immunogenicity on Soluble, Native-Like HIV-1 Env SOSIP Trimers
Ringe, Rajesh P.; Ozorowski, Gabriel; Rantalainen, Kimmo; Struwe, Weston B.; Matthews, Katie; Torres, Jonathan L.; Yasmeen, Anila; Cottrell, Christopher A.; Ketas, Thomas J.; LaBranche, Celia C.; Montefiori, David C.; Cupo, Albert; Crispin, Max; Wilson, Ian A.; Ward, Andrew B.; Sanders, Rogier W.; Klasse, P. J.
2017-01-01
ABSTRACT Native-like trimers of the SOSIP design are being developed as immunogens in human immunodeficiency virus type 1 (HIV-1) vaccine development programs. These trimers display the epitopes for multiple broadly neutralizing antibodies (bNAbs) but can also expose binding sites for some types of nonneutralizing antibodies (non-NAbs). Among the latter are epitopes in the gp120 V3 region that are highly immunogenic when SOSIP trimers are evaluated in animal models. It is presently uncertain whether antibodies against V3 can interfere with the induction of NAbs, but there are good arguments in favor of suppressing such “off-target” immune responses. Accordingly, we have assessed how to minimize the exposure of V3 non-NAb epitopes and thereby reduce their immunogenicity by introducing N-glycans within the V3 region of BG505 SOSIP trimers. We found that inserting glycans at positions 306 and 314 (termed M1 and M7) markedly reduced V3 antigenicity while improving the presentation of trimer apex bNAb epitopes. Both added glycans were shown to be predominantly of the Man6GlcNAc2 form. The additional introduction of the E64K ground-state stabilizing substitution markedly reduced or ablated soluble CD4 (sCD4) induction of non-NAb epitopes in V3 and/or associated with the coreceptor binding site. When a V3 glycan- and E64K-modified trimer variant, BG505 SOSIP.664-E64K.M1M7, was tested in rabbits, V3 immunogenicity was eliminated while the autologous NAb response was unchanged. IMPORTANCE Trimeric proteins are being developed for future HIV-1 vaccine trials in humans, with the goal of eliciting broadly active neutralizing antibodies (NAbs) that are active against a wide variety of circulating strains. In animal models, the present generation of native-like trimer immunogens, exemplified by the BG505 SOSIP.664 construct, induces narrow-specificity antibodies against the neutralization-resistant (tier-2), sequence-matched virus and more broadly active antibodies against sequence-divergent atypically neutralization-sensitive (tier-1) viruses. A concern in the trimer immunogen design field has been whether the latter off-target antibodies might interfere with the induction of the more desired responses to tier-2 epitopes. Here, we have inserted two glycans into the dominant site for tier-1 NAbs, the gp120 V3 region, to block the induction of off-target antibodies. We characterized the new trimers, tested them as immunogens in rabbits, and found that the blocking glycans eliminated the induction of tier-1 NAbs to V3-epitopes. PMID:28539451
Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben
2017-03-28
Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less
Elliott, Sarah T C; Wetzel, Katherine S; Francella, Nicholas; Bryan, Steven; Romero, Dino C; Riddick, Nadeene E; Shaheen, Farida; Vanderford, Thomas; Derdeyn, Cynthia A; Silvestri, Guido; Paiardini, Mirko; Collman, Ronald G
2015-09-01
Natural-host sooty mangabeys (SM) infected with simian immunodeficiency virus (SIV) exhibit high viral loads but do not develop disease, whereas infection of rhesus macaques (RM) causes CD4(+) T cell loss and AIDS. Several mechanisms have been proposed to explain these divergent outcomes, including differences in cell targeting, which have been linked to low expression of the canonical SIV entry receptor CCR5 on CD4(+) T cells of SM and other natural hosts. We previously showed that infection and high-level viremia occur even in a subset of SM that genetically lack functional CCR5, which indicates that alternative entry coreceptors are used by SIV in vivo in these animals. We also showed that SM CXCR6 is a robust coreceptor for SIVsmm in vitro. Here we identify CXCR6 as a principal entry pathway for SIV in SM primary lymphocytes. We show that ex vivo SIV infection of lymphocytes from CCR5 wild-type SM is mediated by both CXCR6 and CCR5. In contrast, infection of RM lymphocytes is fully dependent on CCR5. These data raise the possibility that CXCR6-directed tropism in CCR5-low natural hosts may alter CD4(+) T cell subset targeting compared with that in nonnatural hosts, enabling SIV to maintain high-level replication without leading to widespread CD4(+) T cell loss. Natural hosts of SIV, such as sooty mangabeys, sustain high viral loads but do not develop disease, while nonnatural hosts, like rhesus macaques, develop AIDS. Understanding this difference may help elucidate mechanisms of pathogenesis. Natural hosts have very low levels of the SIV entry coreceptor CCR5, suggesting that restricted entry may limit infection of certain target cells, although it is unclear how the virus replicates so robustly. Here we show that in sooty mangabey lymphocytes, infection is mediated by the alternative entry coreceptor CXCR6, as well as CCR5. In rhesus macaque lymphocytes, however, infection occurs entirely through CCR5. The use of CXCR6 for entry, combined with very low CCR5 levels, may redirect the virus to different cell targets in natural hosts. It is possible that differential targeting may favor infection of nonessential cells and limit infection of critical cells in natural hosts, thus contributing to benign outcome of infection. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Elliott, Sarah T. C.; Wetzel, Katherine S.; Francella, Nicholas; Bryan, Steven; Romero, Dino C.; Riddick, Nadeene E.; Shaheen, Farida; Vanderford, Thomas; Derdeyn, Cynthia A.; Silvestri, Guido; Paiardini, Mirko
2015-01-01
ABSTRACT Natural-host sooty mangabeys (SM) infected with simian immunodeficiency virus (SIV) exhibit high viral loads but do not develop disease, whereas infection of rhesus macaques (RM) causes CD4+ T cell loss and AIDS. Several mechanisms have been proposed to explain these divergent outcomes, including differences in cell targeting, which have been linked to low expression of the canonical SIV entry receptor CCR5 on CD4+ T cells of SM and other natural hosts. We previously showed that infection and high-level viremia occur even in a subset of SM that genetically lack functional CCR5, which indicates that alternative entry coreceptors are used by SIV in vivo in these animals. We also showed that SM CXCR6 is a robust coreceptor for SIVsmm in vitro. Here we identify CXCR6 as a principal entry pathway for SIV in SM primary lymphocytes. We show that ex vivo SIV infection of lymphocytes from CCR5 wild-type SM is mediated by both CXCR6 and CCR5. In contrast, infection of RM lymphocytes is fully dependent on CCR5. These data raise the possibility that CXCR6-directed tropism in CCR5-low natural hosts may alter CD4+ T cell subset targeting compared with that in nonnatural hosts, enabling SIV to maintain high-level replication without leading to widespread CD4+ T cell loss. IMPORTANCE Natural hosts of SIV, such as sooty mangabeys, sustain high viral loads but do not develop disease, while nonnatural hosts, like rhesus macaques, develop AIDS. Understanding this difference may help elucidate mechanisms of pathogenesis. Natural hosts have very low levels of the SIV entry coreceptor CCR5, suggesting that restricted entry may limit infection of certain target cells, although it is unclear how the virus replicates so robustly. Here we show that in sooty mangabey lymphocytes, infection is mediated by the alternative entry coreceptor CXCR6, as well as CCR5. In rhesus macaque lymphocytes, however, infection occurs entirely through CCR5. The use of CXCR6 for entry, combined with very low CCR5 levels, may redirect the virus to different cell targets in natural hosts. It is possible that differential targeting may favor infection of nonessential cells and limit infection of critical cells in natural hosts, thus contributing to benign outcome of infection. PMID:26109719
Synergistic Blockade of Mitotic Exit by Two Chemical Inhibitors of the APC/C
Sackton, Katharine L.; Dimova, Nevena; Zeng, Xing; Tian, Wei; Zhang, Mengmeng; Sackton, Timothy B.; Meaders, Johnathan; Pfaff, Kathleen L.; Sigoillot, Frederic; Yu, Hongtao; Luo, Xuelian; King, Randall W.
2014-01-01
Summary Protein machines are multi-subunit protein complexes that orchestrate highly regulated biochemical tasks. An example is the Anaphase-Promoting Complex/Cyclosome (APC/C), a thirteen-subunit ubiquitin ligase that initiates the metaphase-anaphase transition and mitotic exit by targeting proteins such as securin and cyclin B1 for ubiquitin-dependent destruction by the proteasome1,2. Because blocking mitotic exit is an effective approach for inducing tumor cell death3,4, the APC/C represents a potential novel target for cancer therapy. APC/C activation in mitosis requires binding of Cdc205, which forms a co-receptor with the APC/C to recognize substrates containing a Destruction box (D-box)6-14. Here we demonstrate that we can synergistically inhibit APC/C-dependent proteolysis and mitotic exit by simultaneously disrupting two protein-protein interactions within the APC/C-Cdc20-substrate ternary complex. We identified a small molecule, called apcin (APC inhibitor), which binds to Cdc20 and competitively inhibits the ubiquitylation of D-box-containing substrates. Analysis of the crystal structure of the apcin-Cdc20 complex suggests that apcin occupies the D-box-binding pocket on the side face of the WD40-domain. The ability of apcin to block mitotic exit is synergistically amplified by co-addition of tosyl-L-arginine methyl ester (TAME), a small molecule that blocks the APC/C-Cdc20 interaction15,16. This work suggests that simultaneous disruption of multiple, weak protein-protein interactions is an effective approach for inactivating a protein machine. PMID:25156254
Mechanisms of JAK/STAT pathway negative regulation by the short coreceptor Eye Transformer/Latran.
Fisher, Katherine H; Stec, Wojciech; Brown, Stephen; Zeidler, Martin P
2016-02-01
Transmembrane receptors interact with extracellular ligands to transduce intracellular signaling cascades, modulate target gene expression, and regulate processes such as proliferation, apoptosis, differentiation, and homeostasis. As a consequence, aberrant signaling events often underlie human disease. Whereas the vertebrate JAK/STAT signaling cascade is transduced via multiple receptor combinations, the Drosophila pathway has only one full-length signaling receptor, Domeless (Dome), and a single negatively acting receptor, Eye Transformer/Latran (Et/Lat). Here we investigate the molecular mechanisms underlying Et/Lat activity. We demonstrate that Et/Lat negatively regulates the JAK/STAT pathway activity and can bind to Dome, thus reducing Dome:Dome homodimerization by creating signaling-incompetent Dome:Et/Lat heterodimers. Surprisingly, we find that Et/Lat is able to bind to both JAK and STAT92E but, despite the presence of putative cytokine-binding motifs, does not detectably interact with pathway ligands. We find that Et/Lat is trafficked through the endocytic machinery for lysosomal degradation but at a much slower rate than Dome, a difference that may enhance its ability to sequester Dome into signaling-incompetent complexes. Our data offer new insights into the molecular mechanism and regulation of Et/Lat in Drosophila that may inform our understanding of how short receptors function in other organisms. © 2016 Fisher et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Rapid Activation of Bone Morphogenic Protein 9 by Receptor-mediated Displacement of Pro-domains*
Kienast, Yvonne; Jucknischke, Ute; Scheiblich, Stefan; Thier, Martina; de Wouters, Mariana; Haas, Alexander; Lehmann, Christian; Brand, Verena; Bernicke, Dirk; Honold, Konrad; Lorenz, Stefan
2016-01-01
By non-covalent association after proteolytic cleavage, the pro-domains modulate the activities of the mature growth factor domains across the transforming growth factor-β family. In the case of bone morphogenic protein 9 (BMP9), however, the pro-domains do not inhibit the bioactivity of the growth factor, and the BMP9·pro-domain complexes have equivalent biological activities as the BMP9 mature ligand dimers. By using real-time surface plasmon resonance, we could demonstrate that either binding of pro-domain-complexed BMP9 to type I receptor activin receptor-like kinase 1 (ALK1), type II receptors, co-receptor endoglin, or to mature BMP9 domain targeting antibodies leads to immediate and complete displacement of the pro-domains from the complex. Vice versa, pro-domain binding by an anti-pro-domain antibody results in release of the mature BMP9 growth factor. Based on these findings, we adjusted ELISA assays to measure the protein levels of different BMP9 variants. Although mature BMP9 and inactive precursor BMP9 protein were directly detectable by ELISA, BMP9·pro-domain complex could only be measured indirectly as dissociated fragments due to displacement of mature growth factor and pro-domains after antibody binding. Our studies provide a model in which BMP9 can be readily activated upon getting into contact with its receptors. This increases the understanding of the underlying biology of BMP9 activation and also provides guidance for ELISA development for the detection of circulating BMP9 variants. PMID:26677222
Abou-Zied, Osama K
2015-01-01
Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.
Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.
Pikler, G M; Webster, R A; Spelsberg, T C
1976-01-01
Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147
Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo
NASA Astrophysics Data System (ADS)
Schwartz, Rochelle D.; Kellar, Kenneth J.
1983-04-01
Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.
Substance P binding sites in the nucleus tractus solitarius of the cat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maley, B.E.; Sasek, C.A.; Seybold, V.S.
1988-11-01
Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less
Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun
2018-06-16
Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.
Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.
1991-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985
Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul
2008-11-21
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.
Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G
1992-05-05
Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.
Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC
2008-01-01
Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135
Kawasaki, Kazuyoshi; Ogawa, Seturou
2003-01-01
NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.
CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.
Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar
2017-09-01
Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.
Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)
Das, Sourav; Kokardekar, Arshad
2009-01-01
Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089
Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine
Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.
2015-01-01
Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408
DOE Office of Scientific and Technical Information (OSTI.GOV)
Poat, J.A.; Cripps, H.E.; Iversen, L.L.
1988-05-01
Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCann, D.J.; Su, T.P.
1991-05-01
The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less
Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.
Suzuki, N; Mihashi, K
1991-01-01
The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luthin, G.R.; Wolfe, B.B.
The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less
Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H
1997-02-28
The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.
Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok
2003-07-05
Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.
Existence of three subtypes of bradykinin B2 receptors in guinea pig.
Seguin, L; Widdowson, P S; Giesen-Crouse, E
1992-12-01
We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)
Denys, A; Allain, F; Carpentier, M; Spik, G
1998-12-15
Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.
Nguyen, T V; Juorio, A V
1989-10-01
The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.
Targeting of CD22-positive B-cell lymphoma cells by synthetic divalent sialic acid analogues.
Schweizer, Astrid; Wöhner, Miriam; Prescher, Horst; Brossmer, Reinhard; Nitschke, Lars
2012-10-01
CD22 is an inhibitory co-receptor of the B-cell receptor (BCR) on B cells. Since CD22 is ubiquitously expressed in the B-cell lineage and CD22 endocytosis can be triggered efficiently, antibodies and antibody-based immunotoxins against CD22 are used to target B cells both in B-cell lymphomas and leukemias, as well as in autoimmune diseases. CD22 recognizes α2,6-linked sialic acids as endogenous ligands. We have developed new synthetic sialosides as ligands for human CD22. These sialosides bind CD22 on human B cells with high affinity and can efficiently enhance IgM-triggered Ca(2+) signaling. We coupled these sialosides to Pseudomonas exotoxin A to generate a novel CD22 ligand-based immunotoxin. This sialoside-exotoxin-A construct can specifically kill CD22-positive B-cell lymphoma cells. It binds specifically to CD22-positive B-cell lymphoma cells and is dominant over endogenous cis-ligands on the B-cell surface. The sialoside-exotoxin-A construct is efficiently internalized by endocytosis into B-cell lymphoma cell lines. Thus we show the development of a new therapeutic compound for targeting CD22 on human B cells, both for B-cell lymphoma, as well as for B-cell-mediated autoimmune diseases. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Impact of germline and somatic missense variations on drug binding sites.
Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R
2017-03-01
Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.
SEMA3A, a Gene Involved in Axonal Pathfinding, Is Mutated in Patients with Kallmann Syndrome
Parkash, Jyoti; Espy, Cécile; Fouveaut, Corinne; Leroy, Chrystel; Baron, Stéphanie; Campagne, Céline; Vanacker, Charlotte; Collier, Francis; Cruaud, Corinne; Meyer, Vincent; García-Piñero, Alfons; Dewailly, Didier; Cortet-Rudelli, Christine; Gersak, Ksenija; Metz, Chantal; Chabrier, Gérard; Pugeat, Michel; Young, Jacques; Hardelin, Jean-Pierre; Prevot, Vincent; Dodé, Catherine
2012-01-01
Kallmann syndrome (KS) associates congenital hypogonadism due to gonadotropin-releasing hormone (GnRH) deficiency and anosmia. The genetics of KS involves various modes of transmission, including oligogenic inheritance. Here, we report that Nrp1 sema/sema mutant mice that lack a functional semaphorin-binding domain in neuropilin-1, an obligatory coreceptor of semaphorin-3A, have a KS–like phenotype. Pathohistological analysis of these mice indeed showed abnormal development of the peripheral olfactory system and defective embryonic migration of the neuroendocrine GnRH cells to the basal forebrain, which results in increased mortality of newborn mice and reduced fertility in adults. We thus screened 386 KS patients for the presence of mutations in SEMA3A (by Sanger sequencing of all 17 coding exons and flanking splice sites) and identified nonsynonymous mutations in 24 patients, specifically, a frameshifting small deletion (D538fsX31) and seven different missense mutations (R66W, N153S, I400V, V435I, T688A, R730Q, R733H). All the mutations were found in heterozygous state. Seven mutations resulted in impaired secretion of semaphorin-3A by transfected COS-7 cells (D538fsX31, R66W, V435I) or reduced signaling activity of the secreted protein in the GN11 cell line derived from embryonic GnRH cells (N153S, I400V, T688A, R733H), which strongly suggests that these mutations have a pathogenic effect. Notably, mutations in other KS genes had already been identified, in heterozygous state, in five of these patients. Our findings indicate that semaphorin-3A signaling insufficiency contributes to the pathogenesis of KS and further substantiate the oligogenic pattern of inheritance in this developmental disorder. PMID:22927827
SEMA3A, a gene involved in axonal pathfinding, is mutated in patients with Kallmann syndrome.
Hanchate, Naresh Kumar; Giacobini, Paolo; Lhuillier, Pierre; Parkash, Jyoti; Espy, Cécile; Fouveaut, Corinne; Leroy, Chrystel; Baron, Stéphanie; Campagne, Céline; Vanacker, Charlotte; Collier, Francis; Cruaud, Corinne; Meyer, Vincent; García-Piñero, Alfons; Dewailly, Didier; Cortet-Rudelli, Christine; Gersak, Ksenija; Metz, Chantal; Chabrier, Gérard; Pugeat, Michel; Young, Jacques; Hardelin, Jean-Pierre; Prevot, Vincent; Dodé, Catherine
2012-08-01
Kallmann syndrome (KS) associates congenital hypogonadism due to gonadotropin-releasing hormone (GnRH) deficiency and anosmia. The genetics of KS involves various modes of transmission, including oligogenic inheritance. Here, we report that Nrp1(sema/sema) mutant mice that lack a functional semaphorin-binding domain in neuropilin-1, an obligatory coreceptor of semaphorin-3A, have a KS-like phenotype. Pathohistological analysis of these mice indeed showed abnormal development of the peripheral olfactory system and defective embryonic migration of the neuroendocrine GnRH cells to the basal forebrain, which results in increased mortality of newborn mice and reduced fertility in adults. We thus screened 386 KS patients for the presence of mutations in SEMA3A (by Sanger sequencing of all 17 coding exons and flanking splice sites) and identified nonsynonymous mutations in 24 patients, specifically, a frameshifting small deletion (D538fsX31) and seven different missense mutations (R66W, N153S, I400V, V435I, T688A, R730Q, R733H). All the mutations were found in heterozygous state. Seven mutations resulted in impaired secretion of semaphorin-3A by transfected COS-7 cells (D538fsX31, R66W, V435I) or reduced signaling activity of the secreted protein in the GN11 cell line derived from embryonic GnRH cells (N153S, I400V, T688A, R733H), which strongly suggests that these mutations have a pathogenic effect. Notably, mutations in other KS genes had already been identified, in heterozygous state, in five of these patients. Our findings indicate that semaphorin-3A signaling insufficiency contributes to the pathogenesis of KS and further substantiate the oligogenic pattern of inheritance in this developmental disorder.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valley, Cary T.; Porter, Douglas F.; Qiu, Chen
2012-06-28
mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less
Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.
Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A
2011-05-31
Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dissanayake, V.U.; Hughes, J.; Hunter, J.C.
The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less
Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki
2018-06-01
Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.
Distinct p53 genomic binding patterns in normal and cancer-derived human cells
McCorkle, Sean R; McCombie, WR; Dunn, John J
2011-01-01
Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205
Ethylene binding site affinity in ripening apples
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blankenship, S.M.; Sisler, E.C.
1993-09-01
Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less
NASA Technical Reports Server (NTRS)
D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.
2002-01-01
Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.
Functional identification and characterization of sodium binding sites in Na symporters
Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.
2013-01-01
Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006
Navé, Jean-François; Benveniste, Pierre
1984-01-01
The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499
Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris
2015-01-01
The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415
Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.
The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less
Autoradiographic localization of endothelin-1 binding sites in porcine skin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Y.D.; Springall, D.R.; Wharton, J.
Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less
Withey, Jeffrey H; DiRita, Victor J
2005-05-01
The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.
Loss-of-Function Mutations in the WNT Co-receptor LRP6 Cause Autosomal-Dominant Oligodontia.
Massink, Maarten P G; Créton, Marijn A; Spanevello, Francesca; Fennis, Willem M M; Cune, Marco S; Savelberg, Sanne M C; Nijman, Isaäc J; Maurice, Madelon M; van den Boogaard, Marie-José H; van Haaften, Gijs
2015-10-01
Tooth agenesis is one of the most common developmental anomalies in man. Oligodontia, a severe form of tooth agenesis, occurs both as an isolated anomaly and as a syndromal feature. We performed exome sequencing on 20 unrelated individuals with apparent non-syndromic oligodontia and failed to detect mutations in genes previously associated with oligodontia. In three of the probands, we detected heterozygous variants in LRP6, and sequencing of additional oligodontia-affected individuals yielded one additional mutation in LRP6. Three mutations (c.1144_1145dupAG [p.Ala383Glyfs(∗)8], c.1779dupT [p.Glu594(∗)], and c.2224_2225dupTT [p.Leu742Phefs(∗)7]) are predicted to truncate the protein, whereas the fourth (c.56C>T [p.Ala19Val]) is a missense variant of a conserved residue located at the cleavage site of the protein's signal peptide. All four affected individuals harboring a LRP6 mutation had a family history of tooth agenesis. LRP6 encodes a transmembrane cell-surface protein that functions as a co-receptor with members from the Frizzled protein family in the canonical Wnt/β-catenin signaling cascade. In this same pathway, WNT10A was recently identified as a major contributor in the etiology of non-syndromic oligodontia. We show that the LRP6 missense variant (c.56C>T) results in altered glycosylation and improper subcellular localization of the protein, resulting in abrogated activation of the Wnt pathway. Our results identify LRP6 variants as contributing to the etiology of non-syndromic autosomal-dominant oligodontia and suggest that this gene is a candidate for screening in DNA diagnostics. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Loss-of-Function Mutations in the WNT Co-receptor LRP6 Cause Autosomal-Dominant Oligodontia
Massink, Maarten P.G.; Créton, Marijn A.; Spanevello, Francesca; Fennis, Willem M.M.; Cune, Marco S.; Savelberg, Sanne M.C.; Nijman, Isaäc J.; Maurice, Madelon M.; van den Boogaard, Marie-José H.; van Haaften, Gijs
2015-01-01
Tooth agenesis is one of the most common developmental anomalies in man. Oligodontia, a severe form of tooth agenesis, occurs both as an isolated anomaly and as a syndromal feature. We performed exome sequencing on 20 unrelated individuals with apparent non-syndromic oligodontia and failed to detect mutations in genes previously associated with oligodontia. In three of the probands, we detected heterozygous variants in LRP6, and sequencing of additional oligodontia-affected individuals yielded one additional mutation in LRP6. Three mutations (c.1144_1145dupAG [p.Ala383Glyfs∗8], c.1779dupT [p.Glu594∗], and c.2224_2225dupTT [p.Leu742Phefs∗7]) are predicted to truncate the protein, whereas the fourth (c.56C>T [p.Ala19Val]) is a missense variant of a conserved residue located at the cleavage site of the protein’s signal peptide. All four affected individuals harboring a LRP6 mutation had a family history of tooth agenesis. LRP6 encodes a transmembrane cell-surface protein that functions as a co-receptor with members from the Frizzled protein family in the canonical Wnt/β-catenin signaling cascade. In this same pathway, WNT10A was recently identified as a major contributor in the etiology of non-syndromic oligodontia. We show that the LRP6 missense variant (c.56C>T) results in altered glycosylation and improper subcellular localization of the protein, resulting in abrogated activation of the Wnt pathway. Our results identify LRP6 variants as contributing to the etiology of non-syndromic autosomal-dominant oligodontia and suggest that this gene is a candidate for screening in DNA diagnostics. PMID:26387593
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.
2004-10-28
We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.
Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V
2017-02-07
Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.
Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei
2012-01-01
Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Amato, R.J.; Largent, B.L.; Snowman, A.M.
1987-07-01
Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less
Jiang, Peng; Singh, Mona; Coller, Hilary A
2013-01-01
Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.
Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M
2013-03-19
Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.
Tam, S W; Cook, L
1984-01-01
The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851
Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.
Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M
2007-05-01
The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu
2012-02-05
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S.
2012-05-24
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Location of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.
Locations of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.
Discovering amino acid patterns on binding sites in protein complexes
Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng
2011-01-01
Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838
Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P
2005-04-01
Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.
Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa
2013-01-01
Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.
Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin
Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.
2011-01-01
Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.
Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes
Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624
Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.
Dubois, B W; Cherian, S F; Evers, A S
1993-01-01
There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659
Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.
The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less
In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites
Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent
2017-01-01
In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biegon, A.; Rainbow, T.C.
1983-05-01
The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less
Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael
2017-01-01
The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023
Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors
NASA Astrophysics Data System (ADS)
Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír
2017-01-01
Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.
STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY
Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.
2008-01-01
The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palacios, J.M.; Chinaglia, G.; Rigo, M.
1991-02-01
Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less
n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.
Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu
2014-01-01
We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.
High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them
Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha
2011-01-01
Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449
Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R
1996-10-11
In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.
Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya
The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less
Binding Leverage as a Molecular Basis for Allosteric Regulation
Mitternacht, Simon; Berezovsky, Igor N.
2011-01-01
Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347
Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi
2016-12-15
The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.
2011-01-01
Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852
Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.
Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G
2016-11-01
Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-01-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-11-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.
Position specific variation in the rate of evolution in transcription factor binding sites
Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B
2003-01-01
Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zoghbi, M. E.; Altenberg, G. A.
The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less
Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R
2003-01-01
Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471
Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.
Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F
1986-08-15
The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.
Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude
2017-10-01
While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
RBind: computational network method to predict RNA binding sites.
Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie
2018-04-26
Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.
Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten
2017-04-01
BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.
A novel substance P binding site in bovine adrenal medulla.
Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E
1990-05-04
Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tam, S.W.; Cook, L.
1984-09-01
The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less
Tan, M P; Dolton, G M; Gerry, A B; Brewer, J E; Bennett, A D; Pumphrey, N J; Jakobsen, B K; Sewell, A K
2017-01-01
CD4 + T helper cells are a valuable component of the immune response towards cancer. Unfortunately, natural tumour-specific CD4 + T cells occur in low frequency, express relatively low-affinity T cell receptors (TCRs) and show poor reactivity towards cognate antigen. In addition, the lack of human leucocyte antigen (HLA) class II expression on most cancers dictates that these cells are often unable to respond to tumour cells directly. These deficiencies can be overcome by transducing primary CD4 + T cells with tumour-specific HLA class I-restricted TCRs prior to adoptive transfer. The lack of help from the co-receptor CD8 glycoprotein in CD4 + cells might result in these cells requiring a different optimal TCR binding affinity. Here we compared primary CD4 + and CD8 + T cells expressing wild-type and a range of affinity-enhanced TCRs specific for the HLA A*0201-restricted NY-ESO-1- and gp100 tumour antigens. Our major findings are: (i) redirected primary CD4 + T cells expressing TCRs of sufficiently high affinity exhibit a wide range of effector functions, including cytotoxicity, in response to cognate peptide; and (ii) optimal TCR binding affinity is higher in CD4 + T cells than CD8 + T cells. These results indicate that the CD4 + T cell component of current adoptive therapies using TCRs optimized for CD8 + T cells is below par and that there is room for substantial improvement. © 2016 The Authors. Clinical & Experimental Immunology published by John Wiley & Sons Ltd on behalf of British Society for Immunology.
van der Voort, R; Keehnen, R M; Beuling, E A; Spaargaren, M; Pals, S T
2000-10-16
Recently, biochemical, cell biological, and genetic studies have converged to reveal that integral membrane heparan sulfate proteoglycans (HSPGs) are critical regulators of growth and differentiation of epithelial and connective tissues. As a large number of cytokines involved in lymphoid tissue homeostasis or inflammation contain potential HS-binding domains, HSPGs presumably also play important roles in the regulation of the immune response. In this report, we explored the expression, regulation, and function of HSPGs on B lymphocytes. We demonstrate that activation of the B cell antigen receptor (BCR) and/or CD40 induces a strong transient expression of HSPGs on human tonsillar B cells. By means of these HSPGs, the activated B cells can bind hepatocyte growth factor (HGF), a cytokine that regulates integrin-mediated B cell adhesion and migration. This interaction with HGF is highly selective since the HSPGs did not bind the chemokine stromal cell-derived factor (SDF)-1 alpha, even though the affinities of HGF and SDF-1alpha for heparin are similar. On the activated B cells, we observed induction of a specific HSPG isoform of CD44 (CD44-HS), but not of other HSPGs such as syndecans or glypican-1. Interestingly, the expression of CD44-HS on B cells strongly promotes HGF-induced signaling, resulting in an HS-dependent enhanced phosphorylation of Met, the receptor tyrosine kinase for HGF, as well as downstream signaling molecules including Grb2-associated binder 1 (Gab1) and Akt/protein kinase B (PKB). Our results demonstrate that the BCR and CD40 control the expression of HSPGs, specifically CD44-HS. These HSPGs act as functional coreceptors that selectively promote cytokine signaling in B cells, suggesting a dynamic role for HSPGs in antigen-specific B cell differentiation.
In vitro reconstitution of T cell receptor-mediated segregation of the CD45 phosphatase
Carbone, Catherine B.; Fernandes, Ricardo A.; Hui, Enfu; Su, Xiaolei; Garcia, K. Christopher; Vale, Ronald D.
2017-01-01
T cell signaling initiates upon the binding of peptide-loaded MHC (pMHC) on an antigen-presenting cell to the T cell receptor (TCR) on a T cell. TCR phosphorylation in response to pMHC binding is accompanied by segregation of the transmembrane phosphatase CD45 away from TCR–pMHC complexes. The kinetic segregation hypothesis proposes that CD45 exclusion shifts the local kinase–phosphatase balance to favor TCR phosphorylation. Spatial partitioning may arise from the size difference between the large CD45 extracellular domain and the smaller TCR–pMHC complex, although parsing potential contributions of extracellular protein size, actin activity, and lipid domains is difficult in living cells. Here, we reconstitute segregation of CD45 from bound receptor–ligand pairs using purified proteins on model membranes. Using a model receptor–ligand pair (FRB–FKBP), we first test physical and computational predictions for protein organization at membrane interfaces. We then show that the TCR–pMHC interaction causes partial exclusion of CD45. Comparing two developmentally regulated isoforms of CD45, the larger RABC variant is excluded more rapidly and efficiently (∼50%) than the smaller R0 isoform (∼20%), suggesting that CD45 isotypes could regulate signaling thresholds in different T cell subtypes. Similar to the sensitivity of T cell signaling, TCR–pMHC interactions with Kds of ≤15 µM were needed to exclude CD45. We further show that the coreceptor PD-1 with its ligand PD-L1, immunotherapy targets that inhibit T cell signaling, also exclude CD45. These results demonstrate that the binding energies of physiological receptor–ligand pairs on the T cell are sufficient to create spatial organization at membrane–membrane interfaces. PMID:29042512
Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A
1996-01-04
In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.
Accurate and sensitive quantification of protein-DNA binding affinity.
Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J
2018-04-17
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.
Accurate and sensitive quantification of protein-DNA binding affinity
Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.
2018-01-01
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332
Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul
2012-01-01
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259
Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U
2014-06-02
The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.
Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu
2014-01-01
Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ford, K.A.; LaBarbera, A.R.
1988-11-01
The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less
Warfield, Becka M.
2017-01-01
RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473
Conformational Rearrangement Within the Soluble Domains of the CD4 Receptor is Ligand-Specific
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ashish,F.; Juncadella, I.; Garg, R.
2008-01-01
Ligand binding induces shape changes within the four modular ectodomains (D1-D4) of the CD4 receptor, an important receptor in immune signaling. Small angle x-ray scattering (SAXS) on both a two-domain and a four-domain construct of the soluble CD4 (sCD4) is consistent with known crystal structures demonstrating a bilobal and a semi-extended tetralobal Z conformation in solution, respectively. Detection of conformational changes within sCD4 as a result of ligand binding was followed by SAXS on sCD4 bound to two different glycoprotein ligands: the tick saliva immunosuppressor Salp15 and the HIV-1 envelope protein gp120. Ab initio modeling of these data showed thatmore » both Salp15 and gp120 bind to the D1 domain of sCD4 and yet induce drastically different structural rearrangements. Upon binding, Salp15 primarily distorts the characteristic lobal architecture of the sCD4 without significantly altering the semi-extended shape of the sCD4 receptor. In sharp contrast, the interaction of gp120 with sCD4 induces a shape change within sCD4 that can be described as a Z-to-U bi-fold closure of the four domains across its flexible D2-D3 linker. Placement of known crystal structures within the boundaries of the SAXS-derived models suggests that the ligand-induced shape changes could be a result of conformational changes within this D2-D3 linker. Functionally, the observed shape changes in CD4 receptor causes dissociation of lymphocyte kinase from the cytoplasmic domain of Salp15-bound CD4 and facilitates an interaction between the exposed V3 loops of CD4-bound gp120 molecule to the extracellular loops of its co-receptor, a step essential for HIV-1 viral entry.« less
Case, S S; Huber, P; Lloyd, J A
1999-11-01
A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.
Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A
2013-01-01
Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571
Wei, Qing; La, David; Kihara, Daisuke
2017-01-01
Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .
Computational Optimization and Characterization of Molecularly Imprinted Polymers
NASA Astrophysics Data System (ADS)
Terracina, Jacob J.
Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.
NASA Astrophysics Data System (ADS)
Poornima, C. S.; Dean, P. M.
1995-12-01
Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sultatos, L.G.; Kaushik, R.
2008-08-01
The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less
The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.
Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki
2017-01-01
Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boyd, S.K.
1987-01-01
Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less
Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther
2011-05-01
The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cosman, M; Zeller, L; Lightstone, F C
2002-01-01
The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less
Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.
Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.
1993-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620
Influence of sulfhydryl sites on metal binding by bacteria
NASA Astrophysics Data System (ADS)
Nell, Ryan M.; Fein, Jeremy B.
2017-02-01
The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.
Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.
Liaw, S. H.; Kuo, I.; Eisenberg, D.
1995-01-01
Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen P.
2006-10-17
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen
2000-01-01
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
Acceleration of Binding Site Comparisons by Graph Partitioning.
Krotzky, Timo; Klebe, Gerhard
2015-08-01
The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
GenProBiS: web server for mapping of sequence variants to protein binding sites.
Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka
2017-07-03
Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe
2011-01-01
Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967
Interaction between phloretin and the red blood cell membrane
1976-01-01
Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575
A peek into tropomyosin binding and unfolding on the actin filament.
Singh, Abhishek; Hitchcock-Degregori, Sarah E
2009-07-24
Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.
sc-PDB: a 3D-database of ligandable binding sites--10 years on.
Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther
2015-01-01
The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Ahmed, Ahmed H; Oswald, Robert E
2010-03-11
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.
Ahmed, Ahmed H.; Oswald, Robert E.
2010-01-01
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115
Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.
Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta
2013-07-01
Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.
Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.
Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin
2017-09-14
U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.
Oral CCR5 inhibitors: will they make it through?
Biswas, Priscilla; Nozza, Silvia; Scarlatti, Gabriella; Lazzarin, Adriano; Tambussi, Giuseppe
2006-05-01
The therapeutic armamentarium against HIV has recently gained a drug belonging to a novel class of antiretrovirals, the entry inhibitors. The last decade has driven an in-depth knowledge of the HIV entry process, unravelling the multiple engagements of the HIV envelope proteins with the cellular receptorial complex that is composed of a primary receptor (CD4) and a co-receptor (CCR5 or CXCR4). The vast majority of HIV-infected subjects exhibit biological viral variants that use CCR5 as a co-receptor. Individuals with a mutated CCR5 gene, both homo- and heterozygotes, appear to be healthy. For these and other reasons, CCR5 represents an appealing target for treatment intervention, although certain challenges can not be ignored. Promising small-molecule, orally bioavailable CCR5 antagonists are under development for the treatment of HIV-1 infection.
Su, Zhaohui; Gulick, Roy M.; Krambrink, Amy; Coakley, Eoin; Hughes, Michael D.; Han, Dong; Flexner, Charles; Wilkin, Timothy J.; Skolnik, Paul R.; Greaves, Wayne L.; Kuritzkes, Daniel R.; Reeves, Jacqueline D.
2009-01-01
The enhanced sensitivity Trofile assay was used to re-test co-receptor usage at study screening and entry for the 118 ACTG A5211 treatment-experienced subjects who had CCR5-tropic (R5) virus by the original Trofile assay at study screening. Among 90 vicriviroc recipients, a significantly (P<0.001) greater mean reduction in HIV-1 RNA was observed in 72 subjects with R5 virus versus 15 subjects reclassified with dual/mixed-tropic viruses at screening: −1.11 vs. −0.09 (day 14), −1.91 vs. −0.57 (week 24) log10 copies/mL, respectively. Results suggest that the enhanced sensitivity assay is a better screening tool for determining patient eligibility for CCR5 antagonist therapy. PMID:19874179
Woodham, Andrew W; Skeate, Joseph G; Sanna, Adriana M; Taylor, Julia R; Da Silva, Diane M; Cannon, Paula M; Kast, W Martin
2016-07-01
In the last three decades, extensive research on human immunodeficiency virus (HIV) has highlighted its capability to exploit a variety of strategies to enter and infect immune cells. Although CD4(+) T cells are well known as the major HIV target, with infection occurring through the canonical combination of the cluster of differentiation 4 (CD4) receptor and either the C-C chemokine receptor type 5 (CCR5) or C-X-C chemokine receptor type 4 (CXCR4) coreceptors, HIV has also been found to enter other important immune cell types such as macrophages, dendritic cells, Langerhans cells, B cells, and granulocytes. Interestingly, the expression of distinct cellular cofactors partially regulates the rate in which HIV infects each distinct cell type. Furthermore, HIV can benefit from the acquisition of new proteins incorporated into its envelope during budding events. While several publications have investigated details of how HIV manipulates particular cell types or subtypes, an up-to-date comprehensive review on HIV tropism for different immune cells is lacking. Therefore, this review is meant to focus on the different receptors, coreceptors, and cofactors that HIV exploits to enter particular immune cells. Additionally, prophylactic approaches that have targeted particular molecules associated with HIV entry and infection of different immune cells will be discussed. Unveiling the underlying cellular receptors and cofactors that lead to HIV preference for specific immune cell populations is crucial in identifying novel preventative/therapeutic targets for comprehensive strategies to eliminate viral infection.
Woodham, Andrew W.; Skeate, Joseph G.; Sanna, Adriana M.; Taylor, Julia R.; Da Silva, Diane M.; Cannon, Paula M.
2016-01-01
Abstract In the last three decades, extensive research on human immunodeficiency virus (HIV) has highlighted its capability to exploit a variety of strategies to enter and infect immune cells. Although CD4+ T cells are well known as the major HIV target, with infection occurring through the canonical combination of the cluster of differentiation 4 (CD4) receptor and either the C-C chemokine receptor type 5 (CCR5) or C-X-C chemokine receptor type 4 (CXCR4) coreceptors, HIV has also been found to enter other important immune cell types such as macrophages, dendritic cells, Langerhans cells, B cells, and granulocytes. Interestingly, the expression of distinct cellular cofactors partially regulates the rate in which HIV infects each distinct cell type. Furthermore, HIV can benefit from the acquisition of new proteins incorporated into its envelope during budding events. While several publications have investigated details of how HIV manipulates particular cell types or subtypes, an up-to-date comprehensive review on HIV tropism for different immune cells is lacking. Therefore, this review is meant to focus on the different receptors, coreceptors, and cofactors that HIV exploits to enter particular immune cells. Additionally, prophylactic approaches that have targeted particular molecules associated with HIV entry and infection of different immune cells will be discussed. Unveiling the underlying cellular receptors and cofactors that lead to HIV preference for specific immune cell populations is crucial in identifying novel preventative/therapeutic targets for comprehensive strategies to eliminate viral infection. PMID:27410493
Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng
2018-05-10
CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.
Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly
2014-01-01
microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.
LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.
Marshall, J C; Shakespear, R A; Odell, W D
1976-11-01
Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strauch, Eva-Maria; Bernard, Steffen M.; La, David
Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less
An alternate binding site for PPARγ ligands
Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.
2014-01-01
PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063
Concerted formation of macromolecular Suppressor–mutator transposition complexes
Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina
1998-01-01
Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711
Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew
2015-11-01
Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.
Oligomycin frames a common drug-binding site in the ATP synthase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric
We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less
Nisius, Britta; Gohlke, Holger
2012-09-24
Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.
Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L
2008-12-09
Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.
Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.
2009-01-01
Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330
Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.
Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael
2013-01-01
Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome
Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274
[3H]MK-801 binding sites in post-mortem human frontal cortex.
Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P
1989-03-29
The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.
Smith, Gina A.; Fearnley, Gareth W.; Tomlinson, Darren C.; Harrison, Michael A.; Ponnambalam, Sreenivasan
2015-01-01
VEGFs (vascular endothelial growth factors) are a family of conserved disulfide-linked soluble secretory glycoproteins found in higher eukaryotes. VEGFs mediate a wide range of responses in different tissues including metabolic homoeostasis, cell proliferation, migration and tubulogenesis. Such responses are initiated by VEGF binding to soluble and membrane-bound VEGFRs (VEGF receptor tyrosine kinases) and co-receptors. VEGF and receptor splice isoform diversity further enhances complexity of membrane protein assembly and function in signal transduction pathways that control multiple cellular responses. Different signal transduction pathways are simultaneously activated by VEGFR–VEGF complexes with membrane trafficking along the endosome–lysosome network further modulating signal output from multiple enzymatic events associated with such pathways. Balancing VEGFR–VEGF signal transduction with trafficking and proteolysis is essential in controlling the intensity and duration of different intracellular signalling events. Dysfunction in VEGF-regulated signal transduction is important in chronic disease states including cancer, atherosclerosis and blindness. This family of growth factors and receptors is an important model system for understanding human disease pathology and developing new therapeutics for treating such ailments. PMID:26285805
Processing of hemojuvelin requires retrograde trafficking to the Golgi in HepG2 cells.
Maxson, Julia E; Enns, Caroline A; Zhang, An-Sheng
2009-02-19
Hemojuvelin (HJV) was recently identified as a critical regulator of iron homeostasis. It is either associated with cell membranes through a glycosylphosphatidylinositol anchor or released as a soluble form. Membrane-anchored HJV acts as a coreceptor for bone morphogenetic proteins and activates the transcription of hepcidin, a hormone that regulates iron efflux from cells. Soluble HJV antagonizes bone morphogenetic protein signaling and suppresses hepcidin expression. In this study, we examined the trafficking and processing of HJV. Cellular HJV reached the plasma membrane without obtaining complex oligosaccharides, indicating that HJV avoided Golgi processing. Secreted HJV, in contrast, has complex oligosaccharides and can be derived from HJV with high-mannose oligosaccharides at the plasma membrane. Our results support a model in which retrograde trafficking of HJV before cleavage is the predominant processing pathway. Release of HJV requires it to bind to the transmembrane receptor neogenin. Neogenin does not, however, play a role in HJV trafficking to the cell surface, suggesting that it could be involved either in retrograde trafficking of HJV or in cleavage leading to HJV release.
Processing of hemojuvelin requires retrograde trafficking to the Golgi in HepG2 cells
Maxson, Julia E.; Enns, Caroline A.
2009-01-01
Hemojuvelin (HJV) was recently identified as a critical regulator of iron homeostasis. It is either associated with cell membranes through a glycosylphosphatidylinositol anchor or released as a soluble form. Membrane-anchored HJV acts as a coreceptor for bone morphogenetic proteins and activates the transcription of hepcidin, a hormone that regulates iron efflux from cells. Soluble HJV antagonizes bone morphogenetic protein signaling and suppresses hepcidin expression. In this study, we examined the trafficking and processing of HJV. Cellular HJV reached the plasma membrane without obtaining complex oligosaccharides, indicating that HJV avoided Golgi processing. Secreted HJV, in contrast, has complex oligosaccharides and can be derived from HJV with high-mannose oligosaccharides at the plasma membrane. Our results support a model in which retrograde trafficking of HJV before cleavage is the predominant processing pathway. Release of HJV requires it to bind to the transmembrane receptor neogenin. Neogenin does not, however, play a role in HJV trafficking to the cell surface, suggesting that it could be involved either in retrograde trafficking of HJV or in cleavage leading to HJV release. PMID:19029439
p27 Nuclear localization and growth arrest caused by perlecan knockdown in human endothelial cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sakai, Katsuya; Oka, Kiyomasa; Matsumoto, Kunio
2010-02-12
Perlecan, a secreted heparan sulfate proteoglycan, is a major component of the vascular basement membrane and participates in angiogenesis. Here, we used small interference RNA-mediated knockdown of perlecan expression to investigate the regulatory function of perlecan in the growth of human vascular endothelial cells. Basic fibroblast growth factor (bFGF)-induced ERK phosphorylation and cyclin D1 expression were unchanged by perlecan deficiency in endothelial cells; however, perlecan deficiency inhibited the Rb protein phosphorylation and DNA synthesis induced by bFGF. By contrast to cytoplasmic localization of the cyclin-dependent kinase inhibitor p27 in control endothelial cells, p27 was localized in the nucleus and itsmore » expression increased in perlecan-deficient cells, which suggests that p27 mediates inhibition of Rb phosphorylation. In addition to the well-characterized function of perlecan as a co-receptor for heparin-binding growth factors such as bFGF, our results suggest that perlecan plays an indispensible role in endothelial cell proliferation and acts through a mechanism that involves subcellular localization of p27.« less
LRP6 acts as a scaffold protein in cardiac gap junction assembly
Li, Jun; Li, Changming; Liang, Dandan; Lv, Fei; Yuan, Tianyou; The, Erlinda; Ma, Xiue; Wu, Yahan; Zhen, Lixiao; Xie, Duanyang; Wang, Shiyi; Liu, Yuan; Huang, Jian; Shi, Jingyi; Liu, Yi; Shi, Dan; Xu, Liang; Lin, Li; Peng, Luying; Cui, Jianmin; Zhu, Weidong; Chen, Yi-Han
2016-01-01
Low-density lipoprotein receptor-related protein 6 (LRP6) is a Wnt co-receptor in the canonical Wnt/β-catenin signalling. Here, we report the scaffold function of LRP6 in gap junction formation of cardiomyocytes. Cardiac LRP6 is spatially restricted to intercalated discs and binds to gap junction protein connexin 43 (Cx43). A deficiency in LRP6 disrupts Cx43 gap junction formation and thereby impairs the cell-to-cell coupling, which is independent of Wnt/β-catenin signalling. The defect in Cx43 gap junction resulting from LRP6 reduction is attributable to the defective traffic of de novo Cx43 proteins from the endoplasmic reticulum to the Golgi apparatus, leading to the lysosomal degradation of Cx43 proteins. Accordingly, the hearts of conditional cardiac-specific Lrp6-knockout mice consistently exhibit overt reduction of Cx43 gap junction plaques without any abnormality in Wnt signalling and are predisposed to lethal arrhythmias. These findings uncover a distinct role of LRP6 as a platform for intracellular protein trafficking. PMID:27250245
ERM proteins regulate growth cone responses to Sema3A.
Mintz, C David; Carcea, Ioana; McNickle, Daniel G; Dickson, Tracey C; Ge, Yongchao; Salton, Stephen R J; Benson, Deanna L
2008-10-01
Axonal growth cones initiate and sustain directed growth in response to cues in their environment. A variety of events such as receptor internalization, kinase activation, and actin rearrangement can be stimulated by guidance cues and are essential for mediating targeted growth cone behavior. Surprisingly little is known about how such disparate actions are coordinated. Our data suggest that ezrin, radixin, and moesin (ERMs), a family of highly homologous, multifunctional proteins may be able to coordinate growth cone responses to the guidance cue Semaphorin 3A (Sema3A). We show that active ERMs concentrate asymmetrically in neocortical growth cones, are rapidly and transiently inactivated by Sema3A, and are required for Sema3A-mediated growth cone collapse and guidance. The FERM domain of active ERMs regulates internalization of the Sema3A receptor, Npn1, and its coreceptor, L1CAM, while the ERM C-terminal domain binds and caps F-actin. Our data support a model in which ERMs can coordinate membrane and actin dynamics in response to Sema3A.
Sialylated multivalent antigens engage CD22 in trans and inhibit B cell activation.
Courtney, Adam H; Puffer, Erik B; Pontrello, Jason K; Yang, Zhi-Qiang; Kiessling, Laura L
2009-02-24
CD22 is an inhibitory coreceptor on the surface of B cells that attenuates B cell antigen receptor (BCR) signaling and, therefore, B cell activation. Elucidating the molecular mechanisms underlying the inhibitory activity of CD22 is complicated by the ubiquity of CD22 ligands. Although antigens can display CD22 ligands, the receptor is known to bind to sialylated glycoproteins on the cell surface. The propinquity of CD22 and cell-surface glycoprotein ligands has led to the conclusion that the inhibitory properties of the receptor are due to cis interactions. Here, we examine the functional consequences of trans interactions by employing sialylated multivalent antigens that can engage both CD22 and the BCR. Exposure of B cells to sialylated antigens results in the inhibition of key steps in BCR signaling. These results reveal that antigens bearing CD22 ligands are powerful suppressors of B cell activation. The ability of sialylated antigens to inhibit BCR signaling through trans CD22 interactions reveals a previously unrecognized role for the Siglec-family of receptors as modulators of immune signaling.
Chemokine Receptor CCR5 Antagonist Maraviroc: Medicinal Chemistry and Clinical Applications
Xu, Guoyan G.; Guo, Jia; Wu, Yuntao
2015-01-01
The human immunodeficiency virus (HIV) causes acquired immumodeficiency syndrome (AIDS), one of the worst global pandemic. The virus infects human CD4 T cells and macrophages, and causes CD4 depletion. HIV enters target cells through the binding of the viral envelope glycoprotein to CD4 and the chemokine coreceptor, CXCR4 or CCR5. In particular, the CCR5-utilizing viruses predominate in the blood during the disease course. CCR5 is expressed on the surface of various immune cells including macrophages, monocytes, microglia, dendric cells, and active memory CD4 T cells. In the human population, the CCR5 genomic mutation, CCR5Δ32, is associated with relative resistance to HIV. These findings paved the way for the discovery and development of CCR5 inhibitors to block HIV transmission and replication. Maraviroc, discovered as a CCR5 antagonist, is the only CCR5 inhibitor that has been approved by both US FDA and the European Medicines Agency (EMA) for treating HIV/AIDS patients. In this review, we summarize the medicinal chemistry and clinical studies of Maraviroc. PMID:25159165
The Human Immunodeficiency Virus (HIV) infects and eventually kills CD4-expressing T cells, which are essential for the immune system to function appropriately. Loss of significant numbers of T cells leads to Acquired Immunodeficiency Syndrome (AIDS), a disease that kills over two million people around the world every year. HIV infection depends on two proteins expressed on the virus surface: gp41, which sits in the virus membrane, and gp120, which sits on top of gp41. Three copies, or trimers, of each gp41/gp120 pair make up the envelope glycoprotein, Env. Env coats the virus surface and interacts with its receptor, CD4, and a co-receptor, either CCR5 or CXCR4, on the T cell. Binding to the receptors is thought to cause a structural reorganization of Env, which exposes a fusion peptide that inserts into the T cell membrane and actually forces the virus and host membranes together, initiating an infection. However, the structural details of this process are lacking.
Smad7 enables STAT3 activation and promotes pluripotency independent of TGF-β signaling
Yu, Yi; Gu, Shuchen; Li, Wenjian; Sun, Chuang; Chen, Fenfang; Xiao, Mu; Wang, Lei; Xu, Dewei; Li, Ye; Ding, Chen; Xia, Zongping; Li, Yi; Ye, Sheng; Xu, Pinglong; Zhao, Bin; Qin, Jun; Chen, Ye-Guang; Lin, Xia; Feng, Xin-Hua
2017-01-01
Smad7 is a negative feedback product of TGF-β superfamily signaling and fine tunes a plethora of pleiotropic responses induced by TGF-β ligands. However, its noncanonical functions independent of TGF-β signaling remain to be elucidated. Here, we show that Smad7 activates signal transducers and activators of transcription 3 (STAT3) signaling in maintaining mouse embryonic stem cell pluripotency in a manner independent of the TGF-β receptors, yet dependent on the leukemia inhibitory factor (LIF) coreceptor glycoprotein 130 (gp130). Smad7 directly binds to the intracellular domain of gp130 and disrupts the SHP2–gp130 or SOCS3–gp130 complex, thereby amplifying STAT3 activation. Consequently, Smad7 facilitates LIF-mediated self-renewal of mouse ESCs and is also critical for induced pluripotent stem cell reprogramming. This finding illustrates an uncovered role of the Smad7–STAT3 interplay in maintaining cell pluripotency and also implicates a mechanism involving Smad7 underlying cytokine-dependent regulation of cancer and inflammation. PMID:28874583
Molecular Mechanisms of Fibroblast Growth Factor Signaling in Physiology and Pathology
Belov, Artur A.; Mohammadi, Moosa
2013-01-01
Fibroblast growth factors (FGFs) signal in a paracrine or endocrine fashion to mediate a myriad of biological activities, ranging from issuing developmental cues, maintaining tissue homeostasis, and regulating metabolic processes. FGFs carry out their diverse functions by binding and dimerizing FGF receptors (FGFRs) in a heparan sulfate (HS) cofactor- or Klotho coreceptor-assisted manner. The accumulated wealth of structural and biophysical data in the past decade has transformed our understanding of the mechanism of FGF signaling in human health and development, and has provided novel concepts in receptor tyrosine kinase (RTK) signaling. Among these contributions are the elucidation of HS-assisted receptor dimerization, delineation of the molecular determinants of ligand–receptor specificity, tyrosine kinase regulation, receptor cis-autoinhibition, and tyrosine trans-autophosphorylation. These structural studies have also revealed how disease-associated mutations highjack the physiological mechanisms of FGFR regulation to contribute to human diseases. In this paper, we will discuss the structurally and biophysically derived mechanisms of FGF signaling, and how the insights gained may guide the development of therapies for treatment of a diverse array of human diseases. PMID:23732477
Molecular mechanisms of fibroblast growth factor signaling in physiology and pathology.
Belov, Artur A; Mohammadi, Moosa
2013-06-01
Fibroblast growth factors (FGFs) signal in a paracrine or endocrine fashion to mediate a myriad of biological activities, ranging from issuing developmental cues, maintaining tissue homeostasis, and regulating metabolic processes. FGFs carry out their diverse functions by binding and dimerizing FGF receptors (FGFRs) in a heparan sulfate (HS) cofactor- or Klotho coreceptor-assisted manner. The accumulated wealth of structural and biophysical data in the past decade has transformed our understanding of the mechanism of FGF signaling in human health and development, and has provided novel concepts in receptor tyrosine kinase (RTK) signaling. Among these contributions are the elucidation of HS-assisted receptor dimerization, delineation of the molecular determinants of ligand-receptor specificity, tyrosine kinase regulation, receptor cis-autoinhibition, and tyrosine trans-autophosphorylation. These structural studies have also revealed how disease-associated mutations highjack the physiological mechanisms of FGFR regulation to contribute to human diseases. In this paper, we will discuss the structurally and biophysically derived mechanisms of FGF signaling, and how the insights gained may guide the development of therapies for treatment of a diverse array of human diseases.
Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J
1999-09-24
We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.
Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T
2018-09-01
Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.
Garate, Jose Antonio; Stöckl, Johannes; del Carmen Fernández-Alonso, María; Artner, Daniel; Haegman, Mira; Oostenbrink, Chris; Jiménez-Barbero, Jesús; Beyaert, Rudi; Heine, Holger; Kosma, Paul
2015-01-01
Interfering with LPS binding by the co-receptor protein myeloid differentiation factor 2 (MD-2) represents a useful approach for down-regulation of MD-2·TLR4-mediated innate immune signaling, which is implicated in the pathogenesis of a variety of human diseases, including sepsis syndrome. The antagonistic activity of a series of novel synthetic tetraacylated bis-phosphorylated glycolipids based on the βGlcN(1↔1)αGlcN scaffold was assessed in human monocytic macrophage-like cell line THP-1, dendritic cells and human epithelial cells. Two compounds were shown to inhibit efficiently the LPS-induced inflammatory signaling by down-regulation of the expression of TNF-α, IL-6, IL-8, IL-10 and IL-12 to background levels. The binding of the tetraacylated by (R)-3-hydroxy-fatty acids (2 × C12, 2 × C14), 4,4′-bisphosphorylated βGlcN(1↔1)αGlcN-based lipid A mimetic DA193 to human MD-2 was calculated to be 20-fold stronger than that of Escherichia coli lipid A. Potent antagonistic activity was related to a specific molecular shape induced by the β,α(1↔1)-diglucosamine backbone. ‘Co-planar’ relative arrangement of the GlcN rings was inflicted by the double exo-anomeric conformation around both glycosidic torsions in the rigid β,α(1↔1) linkage, which was ascertained using NOESY NMR experiments and confirmed by molecular dynamics simulation. In contrast to the native lipid A ligands, the binding affinity of βGlcN(1↔1)αGlcN-based lipid A mimetics to human MD-2 was independent on the orientation of the diglucosamine backbone of the synthetic antagonist within the binding pocket of hMD-2 (rotation by 180°) allowing for two equally efficient binding modes as shown by molecular dynamics simulation. PMID:25394365
Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.
Rostagno, A A; Schwarzbauer, J E; Gold, L I
1999-03-01
Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.
Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.
Rostagno, A A; Schwarzbauer, J E; Gold, L I
1999-01-01
Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513
sc-PDB: a 3D-database of ligandable binding sites—10 years on
Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther
2015-01-01
The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483
Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A
2018-05-29
Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.
2008-01-01
The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368
Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level
Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.
2012-01-01
Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804
OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.
Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry
2014-01-01
We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.
Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando
2018-03-23
The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.
Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning
NASA Astrophysics Data System (ADS)
Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay
2018-02-01
Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.
Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M
2011-01-01
Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less
NASA Astrophysics Data System (ADS)
Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh
2017-06-01
In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.
A deep learning framework for modeling structural features of RNA-binding protein targets
Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang
2016-01-01
RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480
Hoffmann, Jana; Altenbuchner, Josef
2015-01-01
A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762
Middendorf, Thomas R.
2017-01-01
A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951
Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.
Mizuno, S; Ogawa, N; Mori, A
1982-12-01
Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.
Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.
Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda
2008-05-01
The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.
Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng
2014-03-01
Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.
Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.
Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry
2006-07-01
High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.
Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo
2010-01-01
The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860
Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard
2017-07-05
Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.
Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.
Streiff, John H; Jones, Keith A
2008-10-01
The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.
Gold, Nicola D; Jackson, Richard M
2006-02-03
The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.
Analysis of functional importance of binding sites in the Drosophila gap gene network model.
Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria
2015-01-01
The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.
Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E
2011-01-01
CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.
Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.
Dudev, Todor; Chang, Li-Ying; Lim, Carmay
2005-03-23
Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.
Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M
2005-04-19
The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.
Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.
Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua
2013-11-01
The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.
Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny
2012-11-01
The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.
Urokinase and its Receptors in Chronic Kidney Disease
Zhang, Guoqiang; Eddy, Allison A.
2011-01-01
Since the recognition that plasminogen activator inhibitor-1 (PAI-1) is a powerful profibrotic molecule, there has been considerable interest in deciphering the extent to which this effect is mediated by its ability to inhibit serine proteases with downstream effects on fibrogenesis. This review will summarize current knowledge about the serine protease urokinase-type plasminogen activator and its high affinity receptor uPAR/CD87 as it pertains to chronic kidney disease (CKD) progression. An emerging theme is that the effects of PAI-1 and uPAR appear to be organ- and site-specific. Normal kidney tubules produce a large quantity of uPA that is secreted into the urinary space. Activity levels increase during CKD presumably due to new sources of production by macrophages and fibroblasts. By activating hepatocyte growth factor and degrading fibrinogen uPA may have anti-fibrotic effects. However CKD severity after experimental ureteral obstruction is not altered by endogenous uPA deficiency. Beneficial effects of exogenous uPA have been reported in experimental models of fibrosis in the lung and liver but CKD awaits exploration. Absent in normal kidneys uPAR is expressed by both renal parenchymal cells and inflammatory cells in a variety of pathological states. Such expression appears beneficial based on studies performed in uPAR-deficient mice. The uPAR promotes bacterial clearance in infectious diseases. In CKD uPAR expression is associated with high uPA activity but its most important effect appears to be due to scavenging activities and effects on cell recruitment and migration. Although uPAR itself is a non-signaling receptor, it interacts with a variety of co-receptors to modify cellular behavior. Best known are interactions with the low-density lipoprotein receptor-related protein (LRP-1) that lead to PAI-1 endocytosis and degradation, and interactions with several integrins to regulate matrix-dependent cell migration. Contacts with the receptor for the complement C5a component and the interleukin −6 receptor gp130 are examples of other recently recognized interactions. In addition to uPA, vitronectin and high molecular weight kininogen are alternate uPAR ligands that could be implicated in CKD progression. uPAR may also be shed from cell membranes. This soluble form (suPAR) has been detected in plasma and urine and is known to be a chemoattractant for leukocytes that express the formyl-peptide-receptor-like receptor 1/lipoxin A4 receptor. In addition to uPAR several other receptors, including some of the uPAR co-receptors, may also bind directly to uPA and activate cell signaling pathways. The roles of these newer uPAR ligands and uPA receptors are just beginning to be investigated. Since many of them are expressed in the kidney, their potential participation in CKD pathogenesis will be of interest. PMID:18508599
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giannopoulos, G.; Jackson, K.; Kredentser, J.
The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less
Hwang, Daniel H; Kim, Jeong-A; Lee, Joo Young
2016-08-15
Saturated fatty acids can activate Toll-like receptor 2 (TLR2) and TLR4 but polyunsaturated fatty acids, particularly docosahexaenoic acid (DHA) inhibit the activation. Lipopolysaccharides (LPS) and lipopetides, ligands for TLR4 and TLR2, respectively, are acylated by saturated fatty acids. Removal of these fatty acids results in loss of their ligand activity suggesting that the saturated fatty acyl moieties are required for the receptor activation. X-ray crystallographic studies revealed that these saturated fatty acyl groups of the ligands directly occupy hydrophobic lipid binding domains of the receptors (or co-receptor) and induce the dimerization which is prerequisite for the receptor activation. Saturated fatty acids also induce the dimerization and translocation of TLR4 and TLR2 into lipid rafts in plasma membrane and this process is inhibited by DHA. Whether saturated fatty acids induce the dimerization of the receptors by interacting with these lipid binding domains is not known. Many experimental results suggest that saturated fatty acids promote the formation of lipid rafts and recruitment of TLRs into lipid rafts leading to ligand independent dimerization of the receptors. Such a mode of ligand independent receptor activation defies the conventional concept of ligand induced receptor activation; however, this may enable diverse non-microbial molecules with endogenous and dietary origins to modulate TLR-mediated immune responses. Emerging experimental evidence reveals that TLRs play a key role in bridging diet-induced endocrine and metabolic changes to immune responses. Published by Elsevier B.V.
Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.
Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain
2014-11-18
Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.
Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies
NASA Astrophysics Data System (ADS)
Pang, Yuan-Ping; Kozikowski, Alan P.
1994-12-01
We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.
The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less
Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki
2016-06-01
Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Energetics and kinetics of cooperative cofilin-actin filament interactions.
Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M
2006-08-11
We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.
Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.
2008-08-19
Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less
Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC
Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei
2010-01-01
Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sakisaka, Yukihiko; Kanaya, Sousuke; Liason Center for Innovative Dentistry, Tohoku University Graduate School of Dentistry, Sendai 980-8575
Wnt3a is a secreted glycoprotein that activates the glycogen synthase kinase-3β (GSK3β)/β-catenin signaling pathway through low-density-lipoprotein receptor-related protein (LRP)5/6 co-receptors. Wnt3a has been implicated in periodontal development and homeostasis, as well as in cementum formation. Recently, we have reported that Wnt3a increases alkaline phosphatase expression through the induction of osterix (Osx) expression in dental follicle cells, a precursor of cementoblasts. However, the molecular mechanism by which Wnt3a induces Osx expression is still unknown. In this study, we show that Wnt3a-induced Osx expression was inhibited in the presence of p38 mitogen-activated protein kinase (MAPK) inhibitors (SB203580 and SB202190) at gene andmore » protein levels, as assessed by real-time PCR and immunocytohistochemistry, respectively. Pretreatment of cells with Dickkopf-1, a potent canonical Wnt antagonist binding to LRP5/6 co-receptors, did not influence Wnt3a-mediated p38 MAPK phosphorylation, suggesting that Wnt3a activates p38 MAPK through LRP5/6-independent signaling. On the other hand, pretreatment with p38 MAPK inhibitors had no effects on the phosphorylated status of GSK3β and β-catenin as well as β-catenin nuclear translocation, but inhibited Wnt3a-mediated β-catenin transcriptional activity. These findings suggest that p38 MAPK modulates canonical Wnt signaling at the β-catenin transcriptional level without any crosstalk with the Wnt3a-mediated LRP5/6-GSK3β signaling axis and subsequent β-catenin nuclear translocation. These findings expand our knowledge of the mechanisms controlling periodontal development and regeneration. - Highlights: • Wnt3a induces Osx expression via p38 MAPK signaling in dental follicle cells. • p38 MAPK has no crosstalk with Wnt3a-mediated LRP5/6 and GSK3β signaling. • p38 MAPK is required for Wnt signaling at the β-catenin transcriptional level.« less
ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.
Konc, Janez; Janežič, Dušanka
2014-07-01
The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trong, I.Le; Stenkamp, R.E.; Ibarra, C.
2005-08-22
Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less
Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing
Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav
2007-01-01
In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418
Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.
Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F
1994-10-27
Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.
Anisotropic energy flow and allosteric ligand binding in albumin
NASA Astrophysics Data System (ADS)
Li, Guifeng; Magana, Donny; Dyer, R. Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.
Anisotropic energy flow and allosteric ligand binding in albumin.
Li, Guifeng; Magana, Donny; Dyer, R Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.
Anisotropic energy flow and allosteric ligand binding in albumin
Li, Guifeng; Magana, Donny; Dyer, R. Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265
Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.
2012-01-01
An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049
Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E
2017-01-01
Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.
Morley, B J; Garner, L L
1990-06-11
Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.
NASA Astrophysics Data System (ADS)
Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie
Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.
Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales
NASA Astrophysics Data System (ADS)
Qian, Long; Kussell, Edo
The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.
Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose
Jalak, Jürgen; Väljamäe, Priit
2014-01-01
Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511
Gibbons, R. J.; Moreno, E. C.; Etherden, I.
1983-01-01
The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416
DOE Office of Scientific and Technical Information (OSTI.GOV)
Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.
1990-01-01
Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less
The Structural Basis of ATP as an Allosteric Modulator
Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian
2014-01-01
Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773
Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy
Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming
2014-01-01
A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048
Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok
2012-06-01
In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.
Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.
Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E
2018-02-01
Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.
Elimination of a ligand gating site generates a supersensitive olfactory receptor.
Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I
2016-06-21
Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.
Elimination of a ligand gating site generates a supersensitive olfactory receptor
Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.
2016-01-01
Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish
2009-06-08
The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less
Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart
1999-01-01
Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456
Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants
Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander
2013-01-01
Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254
Architecture of a Fur Binding Site: a Comparative Analysis
Lavrrar, Jennifer L.; McIntosh, Mark A.
2003-01-01
Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489
Su, Zhaohui; Gulick, Roy M; Krambrink, Amy; Coakley, Eoin; Hughes, Michael D; Han, Dong; Flexner, Charles; Wilkin, Timothy J; Skolnik, Paul R; Greaves, Wayne L; Kuritzkes, Daniel R; Reeves, Jacqueline D
2009-12-01
The enhanced-sensitivity Trofile assay (Monogram Biosciences) was used to retest coreceptor use at both study screening and study entry for 118 treatment-experienced subjects in AIDS Clinical Trials Group A5211 who had CCR5-tropic (R5) virus detected by the original Trofile assay at study screening. Among 90 recipients of vicriviroc, a significantly (P< .001) greater mean reduction in HIV-1 RNA was observed in 72 subjects with R5 virus versus 15 subjects reclassified as having dual/mixed-tropic viruses at screening: -1.11 versus -0.09 log(10) copies/mL at day 14 and -1.91 versus -0.57 log(10) copies/mL at week 24, respectively. Results suggest that the enhanced-sensitivity assay is a better screening tool for determining patient eligibility for CCR5 antagonist therapy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.
1988-05-01
Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less
Purification of L-( sup 3 H) Nicotine eliminates low affinity binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Romm, E.; Marks, M.J.; Collins, A.C.
1990-01-01
Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.
Binding of (/sup 3/H)Forskolin to rat brain membranes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seamon, K.B.; Vaillancourt, R.; Edwards, M.
1984-08-01
(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less
Biophysical Fitness Landscapes for Transcription Factor Binding Sites
Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.
2014-01-01
Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228
Yokoyama, Ken Daigoro; Pollock, David D
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.
Yokoyama, Ken Daigoro; Pollock, David D.
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068
Nucleotide-dependent bisANS binding to tubulin.
Chakraborty, S; Sarkar, N; Bhattacharyya, B
1999-07-13
Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.
2015-01-01
The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846
Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goldman, M.E.; Mallorga, P.; Pettibone, D.J.
1988-01-01
(/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less
Impact of disruption of secondary binding site S2 on dopamine transporter function.
Zhen, Juan; Reith, Maarten E A
2016-09-01
The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.
Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis
2011-11-14
The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.
Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter
2001-01-01
Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581
Palumbo, Michael J; Newberg, Lee A
2010-07-01
The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).
Autoradiographic demonstration of oxytocin-binding sites in the macula densa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stoeckel, M.E.; Freund-Mercier, M.J.
1989-08-01
Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less
High-affinity cannabinoid binding site in brain: A possible marijuana receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nye, J.S.
The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less
Gillard, Michel; Chatelain, Pierre; Fuks, Bruno
2006-04-24
A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.
The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.
positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average
Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP
Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas
2010-01-01
Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350
Pharmacophore screening of the protein data bank for specific binding site chemistry.
Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu
2010-03-22
A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less