Science.gov

Sample records for costa dias joao

  1. Inversion of Seismic Cross-hole Data from Dom Joao Field, Reconcavo Basin, Brazil

    NASA Astrophysics Data System (ADS)

    Bassrei, A.; Oliveira, N. P. D.

    2014-12-01

    Seismic Tomography was incorporated in Reservoir Geophysics with the intention of providing high-resolution images of regions in the Earth's subsurface that are characterized as potential reservoirs. In this work, seismic traveltime tomography in the transmission mode was applied to real data from the Dom Joao Field, Reconcavo Basin, State of Bahia, Brazil. This basin represents a landmark of oil exploration in Brazil and has been intensively studied since the 1950s. Today, the Reconcavo Basin is still the principal oil producer in the State of Bahia, but there is a demand for new technologies, especially for mature fields, to improve hydrocarbon recovery. Acoustic ray tracing for the computation of traveltimes was used for forward modeling, and the conjugate gradient algorithm with regularization through derivative matrices was used as an inverse procedure. The tomographic inversion is an ill-posed problem because the existence, uniqueness and stability conditions are not completely satisfied. Mathematical techniques are commonly used with the intention of providing better conditioning for the numerical solution of such problems. The input data in the system are the traveltimes between the sources and the receivers and the distances propagated by each ray connecting such sources and receivers. Both inputs are provided through acoustic forward modeling. The linear system is regularized by derivative matrices derived to minimize the instability. This regularization procedure has a crucially important parameter called regularization parameter lambda. For the selection of lambda we used the L-module, which is based on the well-known L-curve. The estimated tomograms were consistent with previous geological knowledge of the area and the P-wave velocity range was consistent. The results showed that traveltime tomography is feasible for the characterization of reservoirs with a high rate of vertical change, similar to the Dom Joao Field.

  2. Costa Rica.

    PubMed

    1986-05-01

    This discussion of Costa Rica focuses on: geography, people and history, government, political conditions, the economy, defense, foreign relations, and relations between the US and Costa Rica. In 1985 the population totaled 2.6 million with an annual growth rate of 2.6%. The infant mortality rate is 15.2/1000; life expectancy is 67.5 years for men and 71.9 years for women. Costa Rica, the 2nd smallest Central American country, is located in a narrow strip between Panama and Nicaragua. Costa Ricans are overwhelmingly of European descent. Although preominantly Spanish, there also are many Costa Ricans of German, Dutch, and Swiss origin. The indigenous Indian population numbers about 20,000, 20% fewer than inhabited Costa Rica when the Spanish first settled in 1522. Blacks, descendants of 19th century Jamaican immigrant workers, constitute a significant English-speaking minority of 30,000. Costa Rica is a democratic republic with a strong systems of checks and balances. The president and 57 legislative assembly deputies are elected for 4-year terms. Costa Rica's political system has contrasted with that of its neighbors. The nation has steadily developed and maintained democratic institutions and an orderly, constitutional process of government succession. Costa Rica faces severe challenges to its economic stability, although traditionally it is one of the strongest nations in the region. Increases in government spending in the late 1970s and higher world prices for coffee and other important Costa Rican exports stimulated the economy, creating inflationary pressure. The government is pursuing a course of disciplined management. The country is an outsponken and active member of the international community. The cordial relationship between Costa Rica and the US is based on mutual respect for democratic traditions, common goals, and a relationship free from serious political disagreement.

  3. Costa Rica.

    PubMed

    1989-03-01

    The Republic of Costa Rica is one of the most stable and strongest countries in Central America. It is bordered by Nicaragua and Panama to the north and south and the Caribbean Sea and the Pacific ocean to the east and west and has a total land size slightly smaller than West Virginia. Costa Ricans enjoy a high life expectancy and literacy rate. As well, schools have an attendance rate of nearly 100%. The predominant ethnic group is white, and the predominant spoken language is Spanish. The work force is divided up as follows: 32% agriculture, 25% industry and commerce, 38% services and government, and 5% finance and banking. The country's climate is tropical and subtropical, and the geography of Costa Rica is composed of rugged terrain, mountains, large forest areas, some lowlands and 3 volcanic mountain ranges. The great majority of Costa Ricans are of European descent with only small numbers of the indigenous Indian population surviving today. The government of Costa Rica is democratic, holding periodic elections. The electoral process is monitored by the Supreme Electoral Tribunal. Other bodies of government include the Supreme Court of Justice and the Legislative Assembly. The National Liberation Party has been in power since 1948 and represents socialist ideals. Many factors such as: an influx of enlightened leaders and officials, flexible class lines, economic prosperity and the absence of military force have allowed Costa Rica to progress and maintain a stable economy and government amidst an unstable region. Costa Rica's relations with other countries and international organizations are excellent.

  4. On markets and morals--(re-)establishing independent decision making in healthcare: a reply to Joao Calinas-Correia.

    PubMed

    Sahm, Stephan

    2013-05-01

    Medical practitioners owe much of the significant progress made in the diagnosis and treatment of disease to industrial research. Hence, co-operation between providers of medical services, most notably medical practitioners, and the pharmaceutical industry is in the best interest of patients. Yet, empirical evidence shows how well-directed influence exerted by the pharmaceutical industry impacts physicians' decision-making. Profit-motivated inducement by the pharmaceutical industry may expose patients to considerable risks. Against what many think to be based on overwhelming evidence, Joao Calinas-Correia takes the view that the criticism levelled at the pharmaceutical industry as well as the call for transparency in the relationships between physicians and the industry are exaggerated. In his polemic he praises "Big Pharma" as a success and espouses the view that the undesired consequences of its activities are allegedly inherent in the underlying market environment shaped by politics. Moreover, he believes that the proposals made to control and eliminate such undesired effects will lead to mediocrity. Astonishingly, his polemic reaches out to contest the appropriateness of setting rules at all-even if being set by a democratic process. Calinas-Correia's assertions are based on the wrong premises. They fail to recognize that today individual civil rights and liberties often enough do not have to be defended against encroachments by governmental authorities. Rather, it is incumbent on the state to create rules designed to defend the individual against infringements by overly powerful non-governmental institutions, in our case the medical-industrial complex. Given the power exercised by physicians and the special nature of their role in public health, clear-cut rules have to be enacted and implemented with respect to their relationship to Big Pharma.

  5. Costa Rica.

    PubMed

    1981-11-01

    The focus in this discussion of Costa Rica is on the following: the history of the country's demographic situation; the government's overall approach to population problems; statistical systems and development planning; institutional arrangements for the integration of population within development planning; the government's view of the importance of population policy in achieving development objectives; population size, growth, and natural increase; morbidity and mortality; fertility; international migration; and spatial distribution. The government of Costa Rica does not advocate direct intervention to modify the rate of population growth, largely because of its rapid decline in fertility and its moderate rate of natural increase. 5 censuses have been conducted since 1892, and the most recent census was conducted in 1973. The registration for births and deaths is complete. A National Fertility Survey was conducted in 1976 in cooperation with the World Fertility Survey. An important government priority in recent years has been the development of an institutional framework for the further integration of population factors within development plans. A National Commission on Population Policy was established in 1978. Population policy is viewed as instrumental in realizing the government's political objectives and overall development goals. The National Commission on Population Policy approved the terms of reference for a comprehensive population policy in 1979. The government considers its rate of population growth to be unsatisfactory because it remains moderately high. The crude death rate was estimated to be slightly more than 4/1000 in 1977. The government considers levels and trends of mortality to be acceptable. The crude birthrate declined to about 22.0 in 1975. The government considers levels and trends of fertility to be unsatisfactory because they are too high. The government now considers levels and trends of emigration to be significant and unsatisfactory

  6. Costa Rica.

    PubMed

    1992-06-01

    Costa Rica is a country of 51,032 sq. km with 3 million inhabitants, of whom 93% are literate. Independence was gained on September 15, 1821. The terrain consists of eastern and western coastal plains separated by a rugged, central massif, with a climate ranging from tropical to subtropical. Spanish and a Jamaican dialect of English are spoken by European, black, and indigenous ethnic groups who are overwhelmingly of Roman Catholic faith. Life expectancy is approximately 70 years. The gross domestic product is $5.6 billion, growing at a rate of 1%. Per capita income is $1810. Hydroelectric power is a natural resource of the country. Food processing, textiles, construction materials, and fertilizer, as well as banana, coffee, beef, sugarcane, and grain agriculture are areas of economic production. Manufactured goods, machinery, transportation equipment, chemicals, fuel, food, and fertilizer are imported, and bananas, coffee, beef, sugarcane, and grain are exported. In-depth information is also given on the people and history, government and principal officials, political conditions, the economy, defense, foreign relations, relations with the US, and names of principal US officials in the country.

  7. Lessons from Costa Rica

    ERIC Educational Resources Information Center

    Borthwick, Arlene; Lobo, Irina

    2005-01-01

    Costa Rica has one of the highest concentrations of computers in the Americas and is regarded as a Central American pioneer in technology development. The authors of this article describe their trip to Costa Rica, which included visits to several schools as well as to the Foundation Omar Dengo (FOD) and the Ministry of Public Education (MEP),…

  8. Spotlight: Costa Rica.

    PubMed

    1998-03-01

    3.5 million people lived in Costa Rica as of mid-1997. There were 24 births and 4 deaths per 1000 population, respectively, contributing to the annual natural increase rate of 2.0%. Each woman in Costa Rica bears an average of 2.8 children during her reproductive lifespan and men and women were expected to live for 73 and 78 years, respectively. Costa Rica's low infant mortality rate and high literacy and life expectancy rates set it apart from the rest of Central America. Costa Rica is also the only country in the region which maintains no standing army. About 96% of the population is White or Mestizo, 3% is Black, and 1% is indigenous Indian. More than half of the country lives in San Jose and its metropolitan area, 6% of the country's total land area. Unemployment has run near 5% over the past 2 years, but much of the labor force is underemployed. Costa Rica's economy depends upon tourism and agricultural exports such as coffee, beef, and bananas. A large Intel factory opened in 1997. The government and Costa Rican environmentalists are planning a joint campaign to reconvert 80% of Costa Rica's pasture back to forest and tree crops. About 20% of the government's budget is spent upon education and the 93% literacy rate is the highest in the region. Government health services provide low-cost contraceptives to more than 75% of users and 75% of women use some form of family planning.

  9. Educacion Fisica in Costa Rica.

    ERIC Educational Resources Information Center

    Cleland, Donna

    1980-01-01

    The goal of Costa Rica's Department of Physical Education and Sports is the "utilization of sport, physical education, and recreation as instruments of socialization and contribution to the improved health of Costa Ricans." (JN)

  10. Educacion Fisica in Costa Rica.

    ERIC Educational Resources Information Center

    Cleland, Donna

    1980-01-01

    The goal of Costa Rica's Department of Physical Education and Sports is the "utilization of sport, physical education, and recreation as instruments of socialization and contribution to the improved health of Costa Ricans." (JN)

  11. Costa Rica. Spotlight.

    PubMed

    Haub, C; Adams, J

    1985-05-01

    Costa Rica's demographic and economic characteristics are highlighted. Costa Rica's demographic situation is unique in certain respects. Between the late 1950s and the late 1970s, the total fertility rate declined from about 7 to 4 and then stabilized instead of continuing to decline to 2 as expected. This is especially surprising since the level of contraceptive use is similar to that of most European countries. Approximately 2/3 of all couples practice contraception. It is possible that the rate will slowly decline to the expected level, but a delayed decline will ultimately produce a much larger population than initially expected. The demographic situation in Costa Rica is being carefully monitored for insights which might be useful in predicting future fertility patterns in other developing countries. The government of Costa Rica recognizes that family planning is a necessary component of maternal and child health care; however, most family planning services are provided by private organizations. In 1982, population size was 2.6 million, the crude birth rate was 30.7, the crude death rate was 3.9, infant mortality was 19.3, and the rate of natural increase was 2.7%. The population is predominantly Spanish, and the indigenous population totals only 20,000. 48% of the population is urban. Costa Rica has a relatively stable deomocratic government. It relationshiops with other countries are generally peaceful, but tensions between Nicaragua and Costa Rica are increasing. The country's economic situation deteriorated in recent years due primarily to a decline in the price of coffee, the country's principle export commodity. The trade deficit increased markedly, unemployment increased, and income fell sharply. The economic slowdown is now showing signs of a reversal. In 1983 exports, consisting primarily of coffee, bananas, beef, sugar, cane and cacao, totalled US$871 million, and imports, consisting mainly of manufactured goods and equipment, chemicals, fuel, food

  12. Staggered Costas signals

    NASA Astrophysics Data System (ADS)

    Freedman, Avraham; Levanon, Nadav

    1986-11-01

    A radar signal, based on coherent processing of a train of staggered Costas (1984) bursts is based on a minimum number of collocation of their individual ambiguity function sidelobe peaks. The resulting ambiguity function combines qualities of both 'thumbtack' and 'bed of nails' signals. Comparison with linear-FM, V-FM, and complementary phase coded signals is given, as well as comparison with hybrid signals consisting of both phase and frequency coding.

  13. Area Assessment. Costa Rica

    DTIC Science & Technology

    1984-01-01

    the U.S. and O.A.S, Ambassador to the U.N, Angel Eilraondo ^olano Calderon Francisco Morales Hernandez GuillerjTio Sandoval Aguilar Federfco...and Italian, Telephone; 2^4-1(3-38, 22-72-7l< and 23-63-95. 2I4) ROMERO PEREZ , Jorge Enrique; (Civil), educ. Law School, University of Costa Rica...34 Office address: Ave. Central Calles 8/10, Liberia, Gte, PUNTARENAS : PEREZ CASTRO ^ AnseL-no; Telephone; 𔄀l-^0𔃽^bU Office address 1 Calle 1 y

  14. AmeriFlux US-Dia Diablo

    SciTech Connect

    Wharton, Sonia

    2016-01-01

    This is the AmeriFlux version of the carbon flux data for the site US-Dia Diablo. Site Description - The site is on land owned by Lawrence Livermore National Laboratory (Site 300) and has no grazing or management history since the 1950's except for summer-time burning of selected acres for fire management (not included in the tower footprint).

  15. San Jose, Costa Rica

    NASA Technical Reports Server (NTRS)

    2007-01-01

    San Jose, capital city of Costa Rica, fills the valley between two steep mountain ranges. In this image made from data collected by the Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER) instrument on NASA's Terra satellite, visible, shortwave, and near-infrared wavelengths of light that the sensor observed have been combined to produce a false-color version of the scene in which vegetation is red, urban areas are silvery gray, water is dark blue, and clouds are white. The image was captured on February 8, 2007. San Jose is in the center of the image. The Rio Torres winds through downtown San Jose. Cartago, the much smaller colonial capital, sits in the lower right corner, while the city of Alajuela appears across the river, northwest of San Jose. The cities' manmade surfaces contrast sharply with the lushly vegetated landscape surrounding the city. Greenhouses are common in the region, and their glass roofs may be the brilliant white spots around the outer edges the cities. The long, straight runway of the Tobias Bolanos International Airport is visible as a dark line southeast of Alajuela. The landscape around the two cities shown here is rugged. Steep mountain peaks cast dark shadows across their leeward slopes. Patches of dark red vegetation on the mountains north of San Jose may be rainforest. Coffee plantations also cover the slopes of the mountains around the city. February is the dry season in Costa Rica. During the rainy season, from about April to November, clouds usually block the satellite's view of this tropical location. NASA image created by Jesse Allen, using data provided courtesy of Asaf Ullah and Tim Gubbels, SERVIR project.

  16. San Jose, Costa Rica

    NASA Technical Reports Server (NTRS)

    2007-01-01

    San Jose, capital city of Costa Rica, fills the valley between two steep mountain ranges. In this image made from data collected by the Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER) instrument on NASA's Terra satellite, visible, shortwave, and near-infrared wavelengths of light that the sensor observed have been combined to produce a false-color version of the scene in which vegetation is red, urban areas are silvery gray, water is dark blue, and clouds are white. The image was captured on February 8, 2007. San Jose is in the center of the image. The Rio Torres winds through downtown San Jose. Cartago, the much smaller colonial capital, sits in the lower right corner, while the city of Alajuela appears across the river, northwest of San Jose. The cities' manmade surfaces contrast sharply with the lushly vegetated landscape surrounding the city. Greenhouses are common in the region, and their glass roofs may be the brilliant white spots around the outer edges the cities. The long, straight runway of the Tobias Bolanos International Airport is visible as a dark line southeast of Alajuela. The landscape around the two cities shown here is rugged. Steep mountain peaks cast dark shadows across their leeward slopes. Patches of dark red vegetation on the mountains north of San Jose may be rainforest. Coffee plantations also cover the slopes of the mountains around the city. February is the dry season in Costa Rica. During the rainy season, from about April to November, clouds usually block the satellite's view of this tropical location. NASA image created by Jesse Allen, using data provided courtesy of Asaf Ullah and Tim Gubbels, SERVIR project.

  17. Area Handbook for Costa Rica.

    ERIC Educational Resources Information Center

    Blutstein, Howard I.; And Others

    This handbook is an attempt to provide an integrated exposition and analysis of the dominant social, political, and economic aspects of the Costa Rican society. It is designed to give readers an understanding of the dynamics of the component elements of the society and an insight into the ideas and goals of its people. Chapters contain material…

  18. Area Handbook for Costa Rica.

    ERIC Educational Resources Information Center

    Blutstein, Howard I.; And Others

    This handbook is an attempt to provide an integrated exposition and analysis of the dominant social, political, and economic aspects of the Costa Rican society. It is designed to give readers an understanding of the dynamics of the component elements of the society and an insight into the ideas and goals of its people. Chapters contain material…

  19. Differential interactions of the formins INF2, mDia1, and mDia2 with microtubules

    PubMed Central

    Gaillard, Jeremie; Ramabhadran, Vinay; Neumanne, Emmanuelle; Gurel, Pinar; Blanchoin, Laurent; Vantard, Marylin; Higgs, Henry N.

    2011-01-01

    A number of cellular processes use both microtubules and actin filaments, but the molecular machinery linking these two cytoskeletal elements remains to be elucidated in detail. Formins are actin-binding proteins that have multiple effects on actin dynamics, and one formin, mDia2, has been shown to bind and stabilize microtubules through its formin homology 2 (FH2) domain. Here we show that three formins, INF2, mDia1, and mDia2, display important differences in their interactions with microtubules and actin. Constructs containing FH1, FH2, and C-terminal domains of all three formins bind microtubules with high affinity (Kd < 100 nM). However, only mDia2 binds microtubules at 1:1 stoichiometry, with INF2 and mDia1 showing saturating binding at approximately 1:3 (formin dimer:tubulin dimer). INF2-FH1FH2C is a potent microtubule-bundling protein, an effect that results in a large reduction in catastrophe rate. In contrast, neither mDia1 nor mDia2 is a potent microtubule bundler. The C-termini of mDia2 and INF2 have different functions in microtubule interaction, with mDia2's C-terminus required for high-affinity binding and INF2's C-terminus required for bundling. mDia2's C-terminus directly binds microtubules with submicromolar affinity. These formins also differ in their abilities to bind actin and microtubules simultaneously. Microtubules strongly inhibit actin polymerization by mDia2, whereas they moderately inhibit mDia1 and have no effect on INF2. Conversely, actin monomers inhibit microtubule binding/bundling by INF2 but do not affect mDia1 or mDia2. These differences in interactions with microtubules and actin suggest differential function in cellular processes requiring both cytoskeletal elements. PMID:21998204

  20. [Costa acro-kerato-elastoidosis].

    PubMed

    Boudghène-Stambouli, O; Merad-Boudia, A; Benkalfat, M R; Khedim, A

    1993-01-01

    We report 2 cases of acrokeratoelastoidosis of Costa observed in two sisters born of unaffected first cousins. The lesions were lenticular papules, either white or of normal skin colour, which were isolated or arranged in groups of plaques crossed by the natural furrows and located on the thenar eminences, the lateral edges of the hands and fingers and the back of the interphalangeal joints. On the feet, the lesions, located on the lateral edges, the plantar arch and the heel, were much more keratotic and appeared to be translucent. Hyperhidrosis was noted in only one of the two patients. Histological examination showed, beneath an acanthotic and hyperkeratotic epidermis, a reduced elastic network with shorter and thinner fibres in the middle dermis. These are two typical but rough cases of acrokeratoelastoidosis of Costa. The mode of transmission of this disease (autosomal recessive?) seems to be unusual compared with the data found in the literature (dominant, or sporadic cases).

  1. The peats of Costa Rica

    SciTech Connect

    Thayer, G.R.

    1991-01-01

    Peat has been identified in Cost Rica, and an economic analysis of energy applications for peat has been done. About 1000 km{sup 2} of Cost Rica has the potential of being covered by peat. The Talamanca Mountains and the northeastern plains contain most of the Costa Rican peat. Specific bogs have been identified by the Medio Queso River in north-central Costa Rica and near El Cairo, Moin, and the Limon airport in northeastern Costa Rica. The Medio Queso bog, which is supplying peat for use as a carrier for nitrogen-fixing bacteria, and the El Cairo bog, which has been identified as a source of horticultural peat for nearby ornamental plant farms, are of special interest. The economics of three energy applications of peat were examined -- as a fuel in large boilers, as a fuel in small boilers, and as an oil substitute in a cement plant. A facility using coal would have the same total costs as one using peat if coal prices were $45 and $30 per metric ton (used for large boilers and a cement plant, respectively). A facility using Bunker C or diesel would have the same total cost as one using peat if oil prices were $0.11, $0.08, and $0.06 per liter (used for large boilers, small boilers, and a cement plant, respectively). In all three cases, the costs for peat were comparable or less than the costs for coal and oil at 1987 prices. 6 refs., 8 figs.

  2. Montezuma Formation of Costa Rica

    SciTech Connect

    McKee, W.H.; Sen Gupta, B.K.

    1985-01-01

    The Montezuma Formation of the Nicoya Peninsula is one of the better known Neogene stratigraphic units of the Pacific side of Costa Rica. Past workers have reported its age to be Miocene-Pliocene or Miocene-Quaternary, and its environment of deposition to be inner shelf. The planktonic foraminiferal record of the unit in the type locality, however, places it firmly in the Lower Pliocene (Globorotalia margaritae zones). Furthermore, benthic such as Bolivina interjuncta var. bicostata, Epistominella exigua, and E. pacifica indicate that the sedimentation occurred at depths no shallower than the outermost shelf. No drastic faunal turnovers are observed within the formation; a cluster analysis of various Neogene samples from the Nicoya Peninsula and other Pacific areas of Costa Rica demonstrate an overall uniformity of the Montezuma fauna. The frequency trends of certain species, particularly of Epistominella exigua, however, suggest a transgression, the assemblage in the upper part of the section definitely representing upper bathyal depths. Judging by the present elevation of Montezuma outcrops, this part of Costa Rica has been uplifted at least 300 meters in the past 5 m.y.

  3. European Upper Atmosphere Server DIAS - Final Conference/ Abstract

    DTIC Science & Technology

    2007-01-10

    offers real-time ionograms produced simultaneously from the most European operating ionospheric stations with autoscaling results • DIAS provides the... ionograms and electron density forecasting. 3. Summary of the users’ meeting (19 May 2006) This meeting was mainly addressed to the DIAS

  4. Mercury Contamination in Costa Rica

    NASA Astrophysics Data System (ADS)

    Varekamp, J. C.; Haynes, A.; Balcom, P. H.

    2012-12-01

    Recent measurements of Hg in air in the central valley of Costa Rica produced some remarkably high values (up to 700 ng Hg/m3;Castillo et al., 2011), raising concerns for public health. We made a broad assessment of Hg as an environmental contaminant in Costa Rica, and sampled and analyzed lake and wetland sediment and soils to derive atmospheric Hg deposition rates. We also measured Hg(0) in air in three locations, and sampled local fish that were analyzed for Hg. We set up a sampling program of Hg in hair of Costa Ricans, sampling hair from a broad crossection of the population, in combination with dietary and personal information. The lake sediments had Hg concentrations between 34 and 316 ppb Hg, with several lakes at common natural background concentrations (20-100 ppb Hg). Some lakes showed a Hg contamination component with concentrations well above simple background values. These sediments also were very rich in organic matter, and the high Hg concentrations may be a result of Hg focusing from the watersheds into the lake depositional environments. Deduced atmospheric deposition rates of Hg range from 0.16-0.25 ng Hg/cm2 per year, which is at the low end of the global range of measured wet atmospheric deposition rates. The observed Hg concentrations in sediment and soils thus can be characterized as natural background to mildly contaminated, but nothing that would indicate Hg inventories as expected from the reported high Hg air burdens. Some of our Hg(0) in air measurements were done at the same locations as those done earlier and yielded values between 0.6-4.2 ng Hg/m3; these values are similar to the low range measurements of Castillo et al. (their night time values), but we found no evidence in 2011 for their high daytime values. The range of a few ng Hg/m3 in air is compatible with global Hg dispersion modeling. Fish tissue of Trout and Tilapia gave a range of 68-112 ppb Hg (wet weight base), well below the 300 ppb Hg EPA alert level. Overall, these

  5. Counseling in Costa Rica: A Comparative Study

    ERIC Educational Resources Information Center

    Collier, Crystal

    2013-01-01

    With one of the world's most comprehensive universal healthcare systems, medical tourism in Costa Rica has increased significantly over the past few decades. American tourists save up to 80% of comparative costs for procedures, from heart surgery to root canal treatment. Although many Costa Rican healthcare professionals receive training in North…

  6. Counseling in Costa Rica: A Comparative Study

    ERIC Educational Resources Information Center

    Collier, Crystal

    2013-01-01

    With one of the world's most comprehensive universal healthcare systems, medical tourism in Costa Rica has increased significantly over the past few decades. American tourists save up to 80% of comparative costs for procedures, from heart surgery to root canal treatment. Although many Costa Rican healthcare professionals receive training in North…

  7. The peats of Costa Rica

    SciTech Connect

    Obando A, L.; Malavassi R, L.; Ramirez E, O. ); Cohen, A. . Dept. of Geological Sciences); Raymond, R. Jr.; Thayer, G.R. )

    1991-04-01

    The objectives of this investigation were: (1) to locate potential peat deposits in Costa Rica; (2) to estimate as closely as possible by representative sampling the amount of peat present in each deposit, and (3) to make a preliminary evaluation of the quality of the peat in each deposit. With information from soil maps and a 3-week survey of Costa Rica, it is estimated that a potential area of about 1000 km{sup 2} is covered by peat. Most of the peat area (about 830 km{sup 2}) is in northeastern Costa Rica in the Tortuguero area. An aerial survey identified the potential peat areas by the exclusive presence of the Yolillo palm. The next largest potential area of peat (about 175 km{sup 2}) is in the cloud-covered areas of the Talamanca Mountains. Some reconnaissance has been done in the Talamanca Mountains, and samples of the peat indicate that it is very similar to the sphagnum peat moss found in Canada and the northern US. Smaller bogs have been discovered at Medio Queso, El Cairo, Moin, and the Limon airport. Two bogs of immediate interest are Medio Queso and El Cairo. The Medio Queso bog has been extensively sampled and contains about 182,000 metric tons (dry) of highly decomposed peat, which is being used as a carrier for nitrogen-fixing bacteria. The El Cairo bog is sparsely sampled and contains about 1,300,000 metric tons of slightly decomposed dry peat. Plans are to use this peat in horticultural applications on nearby farms. 10 refs., 11 figs., 7 tabs.

  8. Costa Rica: Background and U.S. Relations

    DTIC Science & Technology

    2010-02-22

    innovative policies have done much to restore Costa Rica’s environment and ecotourism has provided a significant source of economic growth. Costa...policies have done much to restore Costa Rica’s environment and ecotourism has provided a significant source of economic growth. Costa Rica’s efforts also...destinations for ecotourism . More than one million people visit Costa Rica’s environmental attractions each year, generating $1.1 billion in foreign

  9. The peats of Costa Rica

    SciTech Connect

    Thayer, G.R.; Williamson, K.D. Jr. ); Ramirez, O. )

    1991-04-01

    The authors compare the competitive position of peat for energy with coal, oil, and cogenerative systems in gasifiers and solid-fuel boilers. They also explore the possibility for peat use in industry. To identify the major factors, they analyze costs using a Los Alamos levelized cost code, and they study parametric costs, comparing peat production in constant dollars with interest rates and return on investment. They consider costs of processing plant construction, sizes and kinds of boilers, retrofitting, peat drying, and mining methods. They examine mining requirements for Moin, Changuinola, and El Cairo and review wet mining and dewatering methods. Peat can, indeed, be competitive with other energy sources, but this depends on the ratio of fuel costs to boiler costs. This ratio is nearly constant in comparison with cogeneration in a steam-only production system. For grate boilers using Costa Rican high-ash peat, and for small nonautomatic boilers now used in Costa Rica, the authors recommend combustion tests. An appendix contains a preliminary mining plan and cost estimate for the El Cairo peat deposit. 8 refs., 43 figs., 19 tabs.

  10. Inverse Papular Acrokeratosis of Oswaldo Costa

    PubMed Central

    Marques, Lidiane Pereira; Trope, Beatriz Moritz; Pina, Juliana Carnevale; Cuzzi, Tullia

    2010-01-01

    Acrokeratoelastoidosis of Oswaldo Costa, or inverse papular acrokeratosis, is a rare genodermatosis first described in 1952 by Oswaldo Costa, a Brazilian dermatologist. It is characterized by flesh-colored papules on the lateral aspects of the palms and soles and dorsum of hands. The histological features are hyperkeratosis, hyalinized and homogenous collagen, and a decrease in and fragmentation of the elastic fibers (elastorrhexis). In the absence of elastic fiber fragmentation, a similar clinical presentation is diagnosed as focal acral hyperkeratosis. Many cases of inverse papular acrokeratosis of Oswaldo Costa may have been considered focal acral hyperkeratosis since it can be difficult to find the elastorrhexis. The authors report a case of a 51-year-old woman with inverse papular acrokeratosis of Oswaldo Costa with poor response to topical treatments. PMID:20725552

  11. Pesticide poisonings in Costa Rica.

    PubMed

    Wesseling, C; Castillo, L; Elinder, C G

    1993-08-01

    A descriptive epidemiologic study, conducted in Costa Rica, investigated the incidence of pesticide poisonings with special attention to agricultural workers and occupational exposure. Information from three national registers (occupational accident and disease reports, hospitalizations, and deaths) were used. During 1986, 1800 occupational accidents caused by pesticides were reported; between 1980 and 1986 altogether 3330 persons were hospitalized and 429 died. Cholinesterase inhibitors caused 71% of the reported occupational accidents, 63% of the hospitalizations, and 36% of the deaths. Paraquat caused 21% of the occupational accidents, 24% of the hospitalizations, and 60% of the deaths. Hospitalizations and deaths were 13 and 11 times, respectively, more frequent among agricultural workers than among the rest of the population. High-risk groups for occupational poisonings included agricultural workers aged 15-29 years, female workers, and banana plantation workers. The yearly incidence of symptomatic occupational pesticide poisonings among agricultural workers was estimated at 4.5%.

  12. Hydro development in Costa Rica

    SciTech Connect

    Young, C.F.

    1995-12-31

    The initial foreign thrust of private power activities was quite naturally by large companies acquiring existing government-owned facilities in relatively large countries. Only recently, it seems, people have discovered that there are countries in Latin America other than Argentina, Brazil, and Mexico, and that there is interest in having the private sector construct new (and often smaller) facilities, with an increasing emphasis on renewable energy. Costa Rica passed its private power law in 1991 and has clearly been the most progressive country in Central America in promoting greenfield development of private power projects. The country has not been exempt, however, from the cyclical nature of the support that governments, utilities and regulatory agencies give to private power producers. The initial enthusiasm and willingness to encourage private power producers inevitably give way to requirements and procedures which impair if not thwart the initial intentions of the private power laws.

  13. The McGill-Costa Rica Project

    PubMed Central

    Davis, M. William L.; Haggerty, Jeannie; Filion-Laporte, Liliane

    1992-01-01

    In 1987, health authorities in Costa Rica started a training program in family and community medicine and requested assistance from the Department of Family Medicine at McGill University. The authors outline the health care system in Costa Rica and the background of the project. The design, implementation, and progress of the project to date are discussed. The problems associated with this kind of project and its future are also discussed. Imagesp1152-a PMID:21221332

  14. 76 FR 70425 - Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-14

    ... Office of the Secretary Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board... discussions of classified information relating to DIA's intelligence operations including its support to... Advisory Board to discuss DIA operations and capabilities in support of current intelligence operations...

  15. 77 FR 2277 - Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-17

    ... of the Secretary Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed... discussions of classified information relating to DIA's intelligence operations including its support to... Advisory Board to discuss DIA operations and capabilities in support of current intelligence operations...

  16. Costa Rica saves infants' lives.

    PubMed

    Rosero-Bixby, L

    1988-01-01

    Even though Costa Rica is underdeveloped economically, life expectancy has been increasing over the past decade and the illiteracy rate was only 7% in 1984. Infant mortality rates have plummeted since 1972 when the 1st national health plan and social security were instituted (pre-1972: 2.3% annual reduction in infant mortality; 1972-1980: 13% decline annually). Decreased risk in the 1st postnatal month of life was responsible for 34% of the decrease from 1972-1980. Control of disease, especially diarrhea and acute respiratory infection, accounted for most of the decline (51%). Immunizations accounted for 8%, prevention of infectious diseases for 10%, control of malnutrition for 5%, and control of death due to premature birth for 14% of the decrease in mortality. Infant death due to pregnancy and delivery complications and congenital defects did not decrease during this period. Socioeconomic conditions normally influence survival rates strongly, but socioeconomic change in Costa Rica during 1970-1980 accounted for only 1/3 of the reduction in infant mortality. These improvements included an increase in the number of educated women, economic growth and decline in fertility (a decrease from 7.6 to 3.4 births between 1960-1980). The majority of the reduction stemmed from utilization of family planning techniques and the reduction of health risk factors. By 1980, the health program initiated in the 1970's provided primary care to 60% of the population, immunized 95% of the children against poliomyelitis, diptheria, pertussis, tetanus, and measles, and by 1984, provided almost all households with a sewage system. Analyses of the impact of socioeconomic development, fertility regulation, hospital care, outpatient services, and primary health care on infant mortality showed that, before 1970, those areas with better economies had a lower mortality rate, and after 1970, the economy and mortality rate had become independent variables. Furthermore, the introduction of health

  17. Isoform-selective chemical inhibition of mDia-mediated actin assembly

    PubMed Central

    Gauvin, Timothy J.; Fukui, Jami; Peterson, Jeffrey R.; Higgs, Henry N.

    2009-01-01

    Formins are potent actin assembly factors. Diaphanous formins, including mDia1, mDia2, and mDia3 in mammals, are implicated in mitosis and cytokinesis but no chemical interactors have been reported. We developed an in vitro screen for inhibitors of actin assembly by mDia1, and identified an inhibitor of mDia1 and mDia2 that does not inhibit mDia3 at the concentrations tested. These results establish the druggability of mDia formins and introduce a first generation inhibitor. PMID:19764708

  18. Dia de los Muertos: An Illustrated Essay and Bibliography.

    ERIC Educational Resources Information Center

    California Univ., Santa Barbara. University Library.

    Among Mexico's most original traditions is the holiday dedicated to honoring the dead, Dia de los Muertos, November 2. This tradition combines aspects that define the national spirit. At the same time that it is a solemn festivity to remember the dead, it becomes a fiesta in its own right. Death, more than a thing to be feared, becomes the motif…

  19. Dia de los Muertos: A Joyful Mexican Celebration

    ERIC Educational Resources Information Center

    Markello, Carrie; Bean, Kathy

    2005-01-01

    This brief article describes the history, traditions, and food of the Mexican holiday known as Dia de los Muertos, or the Day of the Day, and explores classroom and studio activities that teachers can do with their students. Teachers are urged to encourage students to explore the topic of the Day of the Dead, comparing it to other traditions and…

  20. Dia de los Muertos: A Joyful Mexican Celebration

    ERIC Educational Resources Information Center

    Markello, Carrie; Bean, Kathy

    2005-01-01

    This brief article describes the history, traditions, and food of the Mexican holiday known as Dia de los Muertos, or the Day of the Day, and explores classroom and studio activities that teachers can do with their students. Teachers are urged to encourage students to explore the topic of the Day of the Dead, comparing it to other traditions and…

  1. Dia de los Muertos: An Illustrated Essay and Bibliography.

    ERIC Educational Resources Information Center

    California Univ., Santa Barbara. University Library.

    Among Mexico's most original traditions is the holiday dedicated to honoring the dead, Dia de los Muertos, November 2. This tradition combines aspects that define the national spirit. At the same time that it is a solemn festivity to remember the dead, it becomes a fiesta in its own right. Death, more than a thing to be feared, becomes the motif…

  2. Rediscovery of Hyalinobatrachium chirripoi (Anura: Centrolenidae) in southeastern Costa Rica.

    PubMed

    Kubicki, Brian

    2004-03-01

    The Suretka glass frog, Hyalinobatrachium chirripoi, has been recently rediscovered in the southeastern region of Costa Rica. This species was last reported in Costa Rica in the 1950's. H. chirripoi is distinguished from H. colymbiphyllum, which appears to be its most closely Costa Rican related taxon, by having extensive webbing between fingers II-III.

  3. Let Book Joy Begin @ Your Library[R]!: Ten Years of El Dia de los Ninos/El Dia de los Libros

    ERIC Educational Resources Information Center

    Roy, Loriene

    2007-01-01

    Ten years ago, in 1996, poet and children's book author, Pat Mora began celebrating "book joy" by founding a children's book and reading day, El Dia de los Ninos/El Dia de los Libros or Children's Day/Book Day. Dia is modeled on National Children's Day Celebrations in Mexico held since 1925 when it was launched in conjunction with a…

  4. Let Book Joy Begin @ Your Library[R]!: Ten Years of El Dia de los Ninos/El Dia de los Libros

    ERIC Educational Resources Information Center

    Roy, Loriene

    2007-01-01

    Ten years ago, in 1996, poet and children's book author, Pat Mora began celebrating "book joy" by founding a children's book and reading day, El Dia de los Ninos/El Dia de los Libros or Children's Day/Book Day. Dia is modeled on National Children's Day Celebrations in Mexico held since 1925 when it was launched in conjunction with a…

  5. (Power sector efficiency analysis in Costa Rica). [Power Sector Efficiency Analysis in Costa Rica

    SciTech Connect

    Waddle, D.B.

    1990-04-10

    I traveled to San Jose, Costa Rica, to review the state of the electric power utility with a team of specialists, including a transmission and distribution specialist, a hydroelectric engineering specialist, and a thermal power plant specialist. The purpose of the mission was to determine the costs and benefits of efficiency improvements to supply side technologies employed by the Instituto Costarricense de Electricidad, the national power company in Costa Rica, and the potential contribution of these efficiency measures to the future electric power needs of Costa Rica.

  6. The European Server for Ionospheric Specification and Forecasting: Final Results from DIAS Project

    DTIC Science & Technology

    2006-06-01

    www.iono.noa.gr/DIAS) operates since May 2005 and the basic products that are delivered are real-time and historical ionograms from all DIAS...support DIAS, an information collector is installed at each station which uploads the ionograms and associated data to the central DIAS server...generate the maps of the ionospheric parameters and other information products. The DIAS products make use of the latest available ionogram data

  7. The Desmoteplase in Acute Ischemic Stroke (DIAS) clinical trial program.

    PubMed

    von Kummer, Rüdiger; Albers, Gregory W; Mori, Etsuro

    2012-10-01

    Desmoteplase is a novel, highly fibrin-specific thrombolytic agent in phase III of clinical development. In comparison to alteplase, it has high fibrin selectivity, is associated with minimal or no neurotoxicity, and has no apparent negative effect on the blood-brain barrier. The safety and efficacy of desmoteplase is being studied in the Desmoteplase in Acute Ischemic Stroke clinical trial program. Three studies (Dose Escalation Study of Desmoteplase in Acute Ischemic Stroke, Desmoteplase in Acute Ischemic Stroke, and Desmoteplase in Acute Ischemic Stroke-2) have been completed, two large randomized, double-blind, placebo-controlled, phase III trials are ongoing at >200 sites worldwide (Desmoteplase in Acute Ischemic Stroke-3 and Desmoteplase in Acute Ischemic Stroke-4, n = 800; DIAS-3 and DIAS-4), and a randomized, double-blind, placebo-controlled, dose-escalation phase II trial is ongoing in Japan (Desmoteplase in Acute Ischemic Stroke-Japan, n = 48; DIAS-J). The objective of DIAS-3 and DIAS-4 is to evaluate the safety and efficacy of a single IV bolus injection of 90 μg/kg desmoteplase given three- to nine-hours after onset of ischemic stroke (National Institutes of Health Stroke Scale 4-24, age 18-85 years). The objective of DIAS-J is to evaluate the safety and tolerability of desmoteplase 70 and 90 μg/kg three- to nine-hours after ischemic stroke onset in Japanese patients. Patients are included with occlusion or high-grade stenosis (thrombolysis in myocardial infarction 0-1) in proximal cerebral arteries on magnetic resonance or computed tomography angiography but excluded with extended ischemic edema on computed tomography or diffusion-weighted imaging. Desmoteplase is the only thrombolytic agent in late-stage development for acute ischemic stroke that is now tested in patients with proven stroke pathology. The results of the Desmoteplase in Acute Ischemic Stroke clinical trial program will show whether patients with major artery occlusions

  8. Neurobrucellosis in Stranded Dolphins, Costa Rica

    PubMed Central

    Hernández-Mora, Gabriela; González-Barrientos, Rocío; Morales, Juan-Alberto; Chaves-Olarte, Esteban; Guzmán-Verri, Caterina; Baquero-Calvo, Elías; De-Miguel, María-Jesús; Marín, Clara-María; Blasco, José-María

    2008-01-01

    Ten striped dolphins, Stenella coeruleoalba, stranded along the Costa Rican Pacific coast, had meningoencephalitis and antibodies against Brucella spp. Brucella ceti was isolated from cerebrospinal fluid of 6 dolphins and 1 fetus. S. coeruleoalba constitutes a highly susceptible host and a potential reservoir for B. ceti transmission. PMID:18760012

  9. Violent Reform: Costa Rica, Central America's Exception.

    ERIC Educational Resources Information Center

    Singer, Shelly

    1988-01-01

    Examines factors contributing to Costa Rica's peaceful status in a region of violent political conflict. Describes the country's political and educational systems, stating that its democratic government allows the country to withstand many problems typical of the region and that its high level of education allows it to maintain the highest per…

  10. Education in Costa Rica: An Overview.

    ERIC Educational Resources Information Center

    Wahab, Zaher

    Costa Rican education, although fairly successful compared to other Third World or Latin American countries, has serious problems needing action, including (1) large discrepancies between educational ideals and the realities of urban privilege, with regard to access and quality, and (2) a rote, narrow, superficial, impractical education. Other…

  11. Educational and Demographic Profile: Contra Costa County.

    ERIC Educational Resources Information Center

    California Postsecondary Education Commission, 2004

    2004-01-01

    This profile uniquely presents a variety of educational and socioeconomic information for Contra Costa County, nearby counties, and the state. The profile highlights the relationship between various factors that affect the economic well-being of individuals and communities. This presentation of information provides a framework for enhanced…

  12. Development Impact Assessment (DIA) Case Study. South Africa

    SciTech Connect

    Cox, Sadie; Nawaz, Kathleen; Sandor, Debra

    2015-05-19

    This case study reviews South Africa’s experience in considering the impacts of climate change action on development goals, focusing on the South African energy sector and development impact assessments (DIAs) that have and could be used to influence energy policy or inform the selection of energy activities. It includes a review of assessments—conducted by government ministries, technical partners, and academic institutes and non-governmental organizations (NGOs)—that consider employment, health, and water implications of possible energy sector actions, as well as multi-criteria impact assessments.

  13. Costa Rica turns to the world for help.

    PubMed

    1988-07-01

    Costa Rica's current financial crisis threatens to jeopardize recent gains in health indicators, especially among the low-income population. The increasing costs of developing health services and of providing social security coverage for marginal social groups can no longer be fully met by the Costa Rican government, which has steadily allocated a high percentage of the national budget to health. Given this situation, Costa Rica has appealed for international cooperation to help meet the most urgent health needs in the country. In 1985, Costa Rica's population stood at slightly under 2.6 million, with 36% aged 16 years and older. The country remains primarily rural; only 46% of the population is centered in urban areas. Costa Rica has been described as a country that maintains a strong tradition of peace and democracy. Given its political stability, Costa Rica has been the recipient of large waves of immigrants from other Central American countries in states of social political turmoil.

  14. 77 FR 62222 - Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-12

    ...; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting AGENCY: DIA, Department of Defense (DoD... DIA's intelligence operations including its support to current operations. DATES: The meeting will be... capabilities in support of current intelligence operations. Agenda October 29, 2012: [[Page 62223

  15. The DiaCog: A Prototype Tool for Visualizing Online Dialog Games' Interactions

    ERIC Educational Resources Information Center

    Yengin, Ilker; Lazarevic, Bojan

    2014-01-01

    This paper proposes and explains the design of a prototype learning tool named the DiaCog. The DiaCog visualizes dialog interactions within an online dialog game by using dynamically created cognitive maps. As a purposefully designed tool for enhancing learning effectiveness the DiaCog might be applicable to dialogs at discussion boards within a…

  16. Recent volcano monitoring in Costa Rica

    USGS Publications Warehouse

    Thorpe, R.; Brown, G.; Rymer, H.; Barritt, S.; Randal, M.

    1985-01-01

    The Costa Rican volacno Rincon de la Vieja is loosely but mysteriously translated as the "Old Lady's Corner." It consists of six volcanic centers that form a remote elongated ridge standing some 1300m above the surrounding terraine. Geologically speaking, the Guanacaste province of northern Costa Rica consists of a series of composite volcanic cones built on a shield of ignimbrites (welded and unwelded ash flows) of Pliocene-Pleistocene age (up to 2 million years old), that themselves lie on basement crust of Cretaceious-Tertiary age (up to 90 million years old). the active volcanoes are aligned on a northwest-southeast axis parallel to the Middle American oceanic trench in the Pacific Ocean that is the site of subduction of hte Cocos oceanic plate underneath Central America.  

  17. Direct Immersion Annealing (DIA) of Block Copolymer Thin Film

    NASA Astrophysics Data System (ADS)

    Modi, Arvind; Karim, Alamgir

    2014-03-01

    Solvent Vapor Annealing (SVA) methodologies of block copolymer (BCP) films have demonstrated excellent potential for control of nanostructures and morphologies. However, SVA designs require sophisticated instrumentation, and fine control of system parameters in batch processing mode which is relatively complex and limits its feasibility. We developed a faster and robust solvent immersion strategy for microphase separation and nanostructure control of as-cast BCP thin films with minimal sophistication. Our Direct Immersion Annealing (DIA) method requires immersion in a mixture of non-solvent and good solvent (for BCP) for annealing. A non-solvent component prevents dissolution of the film resting on substrate while a good solvent percolates through the film, plasticizes it, and shifts glass-transition below room temperature leading to microphase separation and ordering. Our study of PS-PMMA system demonstrates that a robust control over thin film ordering and transient swelling could be achieved through a fine control of solubility parameter of solvent mixture and temperature with no dead-time. Further, we exhibit the utility of DIA for alignment of BCP domains on topographically patterned substrates. University of Akron Research Foundation (UARF).

  18. [Costa Rica mangroves: the north Pacific].

    PubMed

    Zamora-Trejos, Priscilla; Cortés, Jorge

    2009-09-01

    Costa Rica has mangrove forests on both the Caribbean and Pacific coasts. The Pacific side has 99% of the mangrove area of the country. In this review we compile available information on the mangroves of the north Pacific coast of Costa Rica, from Bahía Salinas, on the border with Nicaragua, to the tip of the Peninsula de Nicoya at Cabo Blanco. We provide information on the location of the mangroves and all available information for each mangrove forest. These mangrove communities are smaller in extension and tree sizes, and have lower diversity compared to the mangroves on the southern section of the Pacific coast of Costa Rica. The dominant species are Rhizophora mangle and Rhizophora racemosa along the canal edges, backed by Avicennia germinans, and farther inland Avicennia bicolor, Laguncularia racemosa and Conocarpus erectus. At Potrero Grande a healthy population of Pelliciera rhizophorae, a rare species, has been reported. We recognized 38 mangrove communities in this part of the country, based on the National Wetland Inventory, published papers, field observations, theses, technical reports, and the national topographic maps (1:50,000, Instituto Geográfico Nacional). Relatively detailed information could be found for only five mangrove forests, for 14 more only prelimary and incomplete lists of plants and in some cases of animal species are available, for nine there is even less information, and for nine more only their location is known, which in some cases was not correct. Detail mapping, characterization of the vegetation and fauna, physiological studies, analyses of biogeochemical and physical processes, economic valuations, and determination of the health status of the mangrove of the northern Pacific coast, as well as for the rest of Costa Rica, are neccesary and urgent.

  19. [Current estate of biotechnology in Costa Rica].

    PubMed

    Valdez, Marta; López, Rebeca; Jiménez, Luis

    2004-09-01

    A study was carried out on the construction of indicators in biotechnology in Costa Rica as part of the project "SYMBIOSIS, Cooperative Program for the Construction of Indicators in Biotechnology adapted to Latin American and Caribbean countries, to motivate the application and transference of industrial technologies". The study focused on two units: researchers and research projects developed in Costa Rica, between 1998 and 2002. For researchers, information was collected about indicators related to sex, age, teaching activities, number of projects, academic degree, area of speciality and number of publications. For research projects we obtained information about: speciality, sector of application, duration of projects and number of researchers per project. Very interesting results include the high participation of the women in this area of investigation (54%); the low participation of young researchers (13% younger than 30), and a high proportion of the investigators that are responsible for 4 or more projects (42%). With relation to the specialities of the projects, the majority are in the category Bio-Agro (39%) whereas in Acuaculture only 1% was found. The sectors of application with the most number of projects are: Agriculture and Livestock (37%) and Human Health (35%). The main strengthts and limitatations for the development of biotechnology in Costa Rica are discussed.

  20. [Determinants of fertility in Costa Rica].

    PubMed

    Rosero, L

    1983-08-01

    An attempt to systematize variables or factors traditionally associated with fertility, this study is not intended as a theoretical framework. 2 periods in Costa Rican fertility are recognized: one before 1960 and one after 1960. Within these periods 4 stages, each with different "key" determinants, are recognized. Until 1960, high fertility rates prevailed, with more than 6 children as total. Fluctuations were due to voluntary factors such as nuptiality and breastfeeding, and involuntary factors such as demand for less children during economic recession. Between 1960 and 1975 fertility declined. It is believed that the "key" factors in this fertility decline were on the contraceptive "offert" side rather than on the children demand side. The participation of peasants and low socioeconomic groups in the fertility decline and governmental health and family planning services are also recognized as important factors. Since the mid 70's a new stage of relative stability has been reached with an apparent convergence towards a total fertility of 3 children. How close this level is reached in the near future will depend on the control of unwanted fertility. The possibility of a 2nd fertility decline in Costa Rica depends mainly on factors which determine why couples have a 3rd child. Consequently, investigation of these factors is suggested to anticipate the future course of Costa Rican fertility. Basic fertility data are given in tables and an appendix.

  1. Deformation of Olivine at Mantle Pressure using D-DIA

    SciTech Connect

    Li,L.

    2006-01-01

    Knowledge of the rheological properties of mantle materials is critical in modeling the dynamics of the Earth. The high-temperature flow law of olivine defined at mantle conditions is especially important since the pressure dependence of rheology may affect our estimation of the strength of olivine in the Earth's interior. In this study, steady-state high-temperature (up to 1473 K) deformation experiments of polycrystalline olivine (average grain size ? 10 ?m) at pressure up to 9.6 GPa, were conducted using a Deformation-DIA (D-DIA) high-pressure apparatus and synchrotron X-ray radiation. The oxygen fugacity (fo2) during the runs was in-between the iron-wustite and the Ni/NiO buffers' fo2. The water content of the polycrystalline samples was generally about 150 to 200 wt. ppm but was as low as 35 wt ppm. Typically, 30 % strain was generated during the uniaxial compression. Sample lengths during the deformation process as well as the differential stresses were monitored in situ by X-ray radiography and diffraction, respectively. The strain rate was derived with an accuracy of 10?6 s?1. Differential stress was measured at constant strain rate (?10?5 s?1) using a multi-element solid-state detector combined with a conical slit. Recovered specimens were investigated by optical and transmission electron microscopy (TEM). TEM shows that dislocation glide was the dominant deformation mechanism throughout the experiment. Evidence of dislocation climb and cross-slip as active mechanisms are also reported. Deformation data show little or no dependence of the dislocation creep flow with pressure, yielding to an activation volume V* of 0 {+-} 5 cm3/mol. These new data are consistent with the high-temperature rheological laws at lower pressures, as reported previously.

  2. Insects that feed on Miconia calvescens in Costa Rica

    Treesearch

    P. Hanson; K. Nishida; P. Allen; E Chacón; B. Reichert; A. Castillo; M. Alfaro; L. Madrigal; E. Rojas; F. Badenes-Perez; T. Johnson

    2010-01-01

    Research at the University of Costa Rica on potential biological control agents of Miconia calvescens was initiated in 2000. Although M. calvescens can be fairly common at certain sites, it is generally uncommon in Costa Rica and appears to be incapable of becoming established in forests with a closed canopy. Over fifty insect...

  3. Costa Rica's SINEM: A Perspective from Postcolonial Institutional Ethnography

    ERIC Educational Resources Information Center

    Rosabal-Coto, Guillermo

    2016-01-01

    In this article I suggest that SINEM--the Costa Rican version of Venezuela's El Sistema--articulates a development discourse which legitimates neoliberal policies that govern the twenty-first-century international market, in which Costa Rica figures only as a subaltern. I contend that such articulation contributes to perpetuating notions and…

  4. Costa Rica's SINEM: A Perspective from Postcolonial Institutional Ethnography

    ERIC Educational Resources Information Center

    Rosabal-Coto, Guillermo

    2016-01-01

    In this article I suggest that SINEM--the Costa Rican version of Venezuela's El Sistema--articulates a development discourse which legitimates neoliberal policies that govern the twenty-first-century international market, in which Costa Rica figures only as a subaltern. I contend that such articulation contributes to perpetuating notions and…

  5. Costa Rica: Background and U.S. Relations

    DTIC Science & Technology

    2009-05-22

    ecotourism . The United States and Costa Rica have long enjoyed close relations as a result of the countries’ shared commitments to strengthening...Costa Rica as the country has become one of the premier destinations for ecotourism . Uncontrolled development and overuse of protected areas, however

  6. Costa Rica: Background and U.S. Relations

    DTIC Science & Technology

    2009-07-21

    for ecotourism . The United States and Costa Rica have long enjoyed close relations as a result of the countries’ shared commitments to strengthening...Costa Rica as the country has become one of the premier destinations for ecotourism . Uncontrolled development and the overuse of some protected areas

  7. GPS Monitoring of Subduction Zone Deformation in Costa Rica

    NASA Technical Reports Server (NTRS)

    Lundgren, Paul

    1997-01-01

    The subduction of the Cocos plate beneath Costa Rica is among the highest convergence rates in the world. The high subduction rate and nearness of the Nicoya Peninsula, Costa Rica to the Middle America Trench (MAT) provide a unique opportunity to map variations in interseismic strain of the crust above the seismogenic zone in response to variations in seismic coupling.

  8. Sustainability and Peace in Costa Rica: The Case of University of Costa Rica

    ERIC Educational Resources Information Center

    Segreda, Alejandrina Mata

    2002-01-01

    This article describes initiatives at the University of Costa Rica, which, in combination with national programs, have strengthened the country's commitment to sustainable development over the past 15 years. It discusses the University's role in defining a national perspective on sustainability starting in 1987, as well as the evolution of the…

  9. Sustainability and Peace in Costa Rica: The Case of University of Costa Rica

    ERIC Educational Resources Information Center

    Segreda, Alejandrina Mata

    2002-01-01

    This article describes initiatives at the University of Costa Rica, which, in combination with national programs, have strengthened the country's commitment to sustainable development over the past 15 years. It discusses the University's role in defining a national perspective on sustainability starting in 1987, as well as the evolution of the…

  10. Epidemiology of Leptospirosis in Costa Rica 2011-2015.

    PubMed

    Carvajal, Marcelo Pérez; Fagerstrom, Kaila A

    2017-01-01

    Leptospirosis is a global spirochete causing chronic renal disease that is increasing in Costa Rica. This paper identifies the prevalence and risk factors of leptospirosis in Costa Rica between the years of 2011-2015. Clinical cases of leptospirosis in Costa Rica demonstrated various symptoms: from asymptomatic diseases to severe cases of kidney and liver failure. A variety of diagnostic methods with varying specificities and sensitivities were employed. In Costa Rica, prevention methods such as protective clothing, decreased contact with animals, and prophylaxis of close contacts continue to be the most important factors in reducing transmission of leptospirosis. In Costa Rica, the following populations should be aware of their increased risk: those living in the province of San José, Puntarenas, or Alajuela; being a male; being of productive years; and exposure to specific environmental factors.

  11. Dia-interacting protein modulates formin-mediated actin assembly at the cell cortex.

    PubMed

    Eisenmann, Kathryn M; Harris, Elizabeth S; Kitchen, Susan M; Holman, Holly A; Higgs, Henry N; Alberts, Arthur S

    2007-04-03

    Mammalian Diaphanous (mDia)-related formins and the N-WASP-activated Arp2/3 complex initiate the assembly of filamentous actin. Dia-interacting protein (DIP) binds via its amino-terminal SH3 domain to the proline-rich formin homology 1 (FH1) domain of mDia1 and mDia2 and to the N-WASp proline-rich region. Here, we investigated an interaction between a conserved leucine-rich region (LRR) in DIP and the mDia FH2 domain that nucleates, processively elongates, and bundles actin filaments. DIP binding to mDia2 was regulated by the same Rho-GTPase-controlled autoinhibitory mechanism modulating formin-mediated actin assembly. DIP was previously shown to interact with and stimulate N-WASp-dependent branched filament assembly via Arp2/3. Despite direct binding to both mDia1 and mDia2 FH2 domains, DIP LRR inhibited only mDia2-dependent filament assembly and bundling in vitro. DIP expression interfered with filopodia formation, consistent with a role for mDia2 in assembly of these structures. After filopodia retraction into the cell body, DIP expression induced excessive nonapoptotic membrane blebbing, a physiological process involved in both cytokinesis and amoeboid cell movement. DIP-induced blebbing was dependent on mDia2 but did not require the activities of either mDia1 or Arp2/3. These observations point to a pivotal role for DIP in the control of nonbranched and branched actin-filament assembly that is mediated by Diaphanous-related formins and activators of Arp2/3, respectively. The ability of DIP to trigger blebbing also suggests a role for mDia2 in the assembly of cortical actin necessary for maintaining plasma-membrane integrity.

  12. Occurrence of citrus viroids in Costa Rica.

    PubMed

    Villalobos, W; Rivera, C; Hammond, R W

    1997-09-01

    A survey for citrus viroids was conducted in the major citrus commercial growing areas in Costa Rica. Screening of 36 sweet orange and 12 lemon trees resulted in the detection of members of four of the five citrus viroid groups as determined by nucleic acid hybridization using specific RNA probes and polymerase chain reaction (PCR) using specific oligonucleotide primers. CEVd, CVd-IIa, CVD-IIb and CVd-III viroids were found to be widespread in the three main regions of commercial citrus production. CVd-Ib was only found in lemon in Nicoya.

  13. Novel Roles of Formin mDia2 in Lamellipodia and Filopodia Formation in Motile Cells

    PubMed Central

    Yang, Changsong; Czech, Lubov; Gerboth, Silke; Kojima, Shin-ichiro; Scita, Giorgio; Svitkina, Tatyana

    2007-01-01

    Actin polymerization-driven protrusion of the leading edge is a key element of cell motility. The important actin nucleators formins and the Arp2/3 complex are believed to have nonoverlapping functions in inducing actin filament bundles in filopodia and dendritic networks in lamellipodia, respectively. We tested this idea by investigating the role of mDia2 formin in leading-edge protrusion by loss-of-function and gain-of-function approaches. Unexpectedly, mDia2 depletion by short interfering RNA (siRNA) severely inhibited lamellipodia. Structural analysis of the actin network in the few remaining lamellipodia suggested an mDia2 role in generation of long filaments. Consistently, constitutively active mDia2 (ΔGBD-mDia2) induced accumulation of long actin filaments in lamellipodia and increased persistence of lamellipodial protrusion. Depletion of mDia2 also inhibited filopodia, whereas expression of ΔGBD-mDia2 promoted their formation. Correlative light and electron microscopy showed that ΔGBD-mDia2–induced filopodia were formed from lamellipodial network through gradual convergence of long lamellipodial filaments into bundles. Efficient filopodia induction required mDia2 targeting to the membrane, likely through a scaffolding protein Abi1. Furthermore, mDia2 and Abi1 interacted through the N-terminal regulatory sequences of mDia2 and the SH3-containing Abi1 sequences. We propose that mDia2 plays an important role in formation of lamellipodia by nucleating and/or protecting from capping lamellipodial actin filaments, which subsequently exhibit high tendency to converge into filopodia. PMID:18044991

  14. Studying Active Lakes of Costa Rica

    NASA Astrophysics Data System (ADS)

    Rouwet, Dmitri; Ohba, Takeshi

    2010-07-01

    7th Workshop of the IAVCEI Commission of Volcanic Lakes; Costa Rica, 10-19 March 2010; Volcanic lakes are surface manifestations of a volcano's deeper hydrothermal system. Insights into crater lake dynamics can be very useful in volcano monitoring programs (J. C. Varekamp and M. J. van Bergen (Eds.), Volcanic lakes and environmental impacts of volcanic fluids, J. Volcanol. Geotherm. Res., 178, 131-330, 2008). To bring together researchers with a variety of areas of expertise to study crater lake dynamics, the International Association of Volcanology and Chemistry of the Earth's Interior (IAVCEI) Commission of Volcanic Lakes (CVL) reunited in Costa Rica for its seventh workshop, almost 6 years after its last workshop, in Caviahue, Argentina. The main goal of CVL7 was to expand the multidisciplinary efforts of the scientific community. Quoting J. C. Varekamp, former CVL leader, volcanic lake science is “a special field with intertwined aspects of disciplines such as volcanology, limnology, geochemistry and biology/toxicology.” Considering that during the past decade, volcanic lake research was mainly focused on characterizing geochemical processes, an additional aim of the CVL7 workshop was to give renewed attention to the hazards posed by Nyos-type lakes, named for a lake in Cameroon that stores carbon dioxide in its bottom waters.

  15. Radiological dosimetry measurements in Costa Rica

    NASA Astrophysics Data System (ADS)

    León, M.; Santos, F.

    2016-07-01

    The main cause of human exposure to artificial radiation corresponds to medical applications, so it is essential to reduce the dose to patients, workers and consequently the entire population [1]. Although there is no dose limit for patients, is necessary to reduce it to a minimum possible while still getting all the necessary diagnostic information, taking economic and social factors into account [2]. Based on this proposal, agencies such as the International Atomic Energy Agency has been dedicated to providing guidelines levels, whose function is to serve as standards for the optimization of the medical exposure [3]. This research was created as a preliminary survey with the claim of eventually determine the guidance levels in Costa Rica for three different studies of general radiology: Lumbar Spine-AP, Chest - PA and Thoracic Spine - AP (for screens with speeds of 400 and 800), and cranio-caudal study in mammography, applied to Costa Rica's adult population, perform properly in the institutions of Caja Costarricense del Seguro Social (CCSS).

  16. [The health system of Costa Rica].

    PubMed

    Sáenz, María del Rocío; Acosta, Mónica; Muiser, Jorine; Bermúdez, Juan Luis

    2011-01-01

    This paper describes the Costa Rican health system which provides health, water and sanitation services. The health component of the system includes a public and a private sector. The public sector is dominated by the Caja Costarricense de Seguro Social (CCSS), an autonomous institution in charge of financing, purchasing and delivering most of the personal health services in Costa Rica. CCSS is financed with contributions of the affiliates, employers and the state, and manages three regimes: maternity and illness insurance, disability, old age and death insurance, and a non-contributive regime. CCSS provides services in its own facilities but also contracts with private providers. The private sector includes a broad set of services offering ambulatory and hospital care. These services are financed mostly out-of-pocket, but also with private insurance premiums. The Ministry of Health is the steward of the system, in charge of strategic planning, sanitary regulation, and research and technology development. Among the recent policy innovations we can mention the establishment of the basic teams for comprehensive health care (EBAIS), the de-concentration of hospitals and public clinics, the introduction of management agreements and the creation of the Health Boards.

  17. [Fresh water macroinvertebrates of Costa Rica I].

    PubMed

    Springer, Monika; Ramirez, Alonso; Hanson, Paul

    2010-12-01

    This is the first in a series of three volumes on the freshwater macroinvertebrates of Costa Rica. The present volume includes an introductory chapter summarizing the major types of freshwater environments, the biology of freshwater macroinvertebrates (habitats, food, respiration, osmoregulation, etc.), ecological and economic importance, conservation and a synopis of the major groups, followed by a simplified key. The next two chapters discuss collecting methods and biomonitoring. These are followed by chapters on mayflies (Ephemeroptera: 10 families), dragonflies (Odonata: 13 families), stoneflies (Plecoptera: 1 family) and caddisflies (Trichoptera: 15 families). Both in this volume and in those to follow, the chapters treating individual taxa include a summary of the natural history, importance, taxonomy, collecting methods, morphology and an illustrated key to the families; each family is discussed separately and an illustrated key to genera is provided; each chapter ends with a bibliography and a table listing all the genera with information on number of species, distribution, habitat and tolerance to water pollution. While the emphasis is on families and genera known from Costa Rica, additional taxa occurring elsewhere in Central America are mentioned. The present volume also includes numerous color plates of aquatic macroinvertebrates.

  18. Radiological dosimetry measurements in Costa Rica

    SciTech Connect

    León, M.; Santos, F.

    2016-07-07

    The main cause of human exposure to artificial radiation corresponds to medical applications, so it is essential to reduce the dose to patients, workers and consequently the entire population [1]. Although there is no dose limit for patients, is necessary to reduce it to a minimum possible while still getting all the necessary diagnostic information, taking economic and social factors into account [2]. Based on this proposal, agencies such as the International Atomic Energy Agency has been dedicated to providing guidelines levels, whose function is to serve as standards for the optimization of the medical exposure [3]. This research was created as a preliminary survey with the claim of eventually determine the guidance levels in Costa Rica for three different studies of general radiology: Lumbar Spine-AP, Chest - PA and Thoracic Spine - AP (for screens with speeds of 400 and 800), and cranio-caudal study in mammography, applied to Costa Rica’s adult population, perform properly in the institutions of Caja Costarricense del Seguro Social (CCSS).

  19. Development drop test results of the 15-ft-dia ribbon parachute and 73-ft-dia cross parachute for the US Army Natick Laboratory UHLCADS system

    SciTech Connect

    Pepper, W.B.

    1985-09-01

    During 1984 a series of 12 drop tests was conducted at the US Army Yuma Proving Ground near Yuma, Arizona to develop a new system to recover a 2200-lb resupply container from high altitude. The parachute system consists of a 15-ft-dia ribbon parachute reefed for 10 s and a 73-ft-dia cross parachute with no reefing. The system has been successfully demonstrated by flight tests. The impact velocity is 30 fps.

  20. Economics of health planning--Costa Rica as an example.

    PubMed

    Neuhauser, D

    1991-01-01

    Costa Rica has been unusually successful in providing high levels of health for its people given its economic resources. It is proposed that there are two reasons for its success. Having no military, Costa Rica has had resources to invest in health care. Having a relatively equal income and education distribution and a democratic government, it has been able to provide health care widely rather than just to the elites. This paper examines production functions for health and possible directions for appropriate management of health as Costa Rica confronts the chronic disease pattern of the developed world.

  1. Costa Rica, Central America as seen from STS-60

    NASA Image and Video Library

    1994-02-09

    STS060-85-000AD (3-11 Feb 1994) --- This photograph shows the Central American nations of Nicaragua, Costa Rica and parts of Panama. Lake Nicaragua defines the southern limits of the country of Nicaragua. The cloud-free portion of the photo shows Costa Rica, it's gulf and Peninsula of Nicoya. Agricultural land use is clearly seen around Nicoya and a few islands of tropical forests are seen at the edges. The capital city of San Jose, Costa Rica, is partly cloud-covered in this image.

  2. Novel immunoassay formats for integrated microfluidic circuits: diffusion immunoassays (DIA)

    NASA Astrophysics Data System (ADS)

    Weigl, Bernhard H.; Hatch, Anson; Kamholz, Andrew E.; Yager, Paul

    2000-03-01

    Novel designs of integrated fluidic microchips allow separations, chemical reactions, and calibration-free analytical measurements to be performed directly in very small quantities of complex samples such as whole blood and contaminated environmental samples. This technology lends itself to applications such as clinical diagnostics, including tumor marker screening, and environmental sensing in remote locations. Lab-on-a-Chip based systems offer many *advantages over traditional analytical devices: They consume extremely low volumes of both samples and reagents. Each chip is inexpensive and small. The sampling-to-result time is extremely short. They perform all analytical functions, including sampling, sample pretreatment, separation, dilution, and mixing steps, chemical reactions, and detection in an integrated microfluidic circuit. Lab-on-a-Chip systems enable the design of small, portable, rugged, low-cost, easy to use, yet extremely versatile and capable diagnostic instruments. In addition, fluids flowing in microchannels exhibit unique characteristics ('microfluidics'), which allow the design of analytical devices and assay formats that would not function on a macroscale. Existing Lab-on-a-chip technologies work very well for highly predictable and homogeneous samples common in genetic testing and drug discovery processes. One of the biggest challenges for current Labs-on-a-chip, however, is to perform analysis in the presence of the complexity and heterogeneity of actual samples such as whole blood or contaminated environmental samples. Micronics has developed a variety of Lab-on-a-Chip assays that can overcome those shortcomings. We will now present various types of novel Lab- on-a-Chip-based immunoassays, including the so-called Diffusion Immunoassays (DIA) that are based on the competitive laminar diffusion of analyte molecules and tracer molecules into a region of the chip containing antibodies that target the analyte molecules. Advantages of this

  3. Catalog of crater lakes from Costa Rica

    NASA Astrophysics Data System (ADS)

    Ramirez, C. J.; Mora-Amador, R.; González, G.

    2010-12-01

    Costa Rica has a diversity of volcanic crater lakes that can be classified into two groups: hot and cold lakes. The country contains at least 5% of the world's hot lakes. Costa Rica has 2 hot hyperacidic lakes, both of them on active volcanoes, the Rincón de la Vieja (38.0°C, pH = 0 - 1) and the Poás Laguna Caliente (36.1°C - 56°C, pH = 0.55 - 0.74), nowadays the Poás hot lake is the most active crater lake in the world, with more than 200 eruptions only on 2010. One of the most studied cold crater lakes is Irazú (13°C, pH = 3.5), that used to contain bubbling and clear areas of upwelling involving CO2 liberation and subaqueous fumaroles with temperatures up to 50°C, but since 2005 the lake presents an important descend until April 2010 when it disappeared. On February 9, 2003, Irazú's lake underwent a drastic change of color, from clear green to mustard with reddish loops, similar to the color of the waters of Lake Nyos after the gas burst of August 1986. Other studied cold lakes include Botos, Chato, and Tenorio, all at the summit of Quaternary volcanoes as well as Barva and Danta, located in recent pyroclastic cones. Some cold lakes are located in Holocene maar-type explosion craters, among them are Congo, Bosque Alegre, Hule, and Río Cuarto. These last two have undergone repeated rapid reddish color changes over the last 10 years, in association with fish kills and the liberation of apparently sulfurous scents. On March 2010, University of Costa Rica was the host of the 7th Workshop on Volcanic Lakes, part of the Commission of Volcanic Lakes of the IAVCEI, 51 participants from 14 countries attended the workshop; they presented 27 talks and 17 posters, also they visited and sample 4 of the lakes mentioned above (Botos, Irazú, Río Cuarto and Hule). Level of Study: 1: few or no data, 2: regular, 3: acceptable

  4. Dust Rotation Effects on DIA Surface Waves in a Semi-bounded Lorentzian Plasma

    SciTech Connect

    Lee, Myoung-Jae

    2008-09-07

    The dispersion relation for a dust ion-acoustic (DIA) surface wave is kinetically derived for the semi-bounded Lorentzian plasma containing elongated and rotating charged dust particles. The DIA surface wave frequency is found to be decreased as the dust rotational frequency increases.

  5. In Search of the Ideal Reader for Nonfiction Children's Books about el Dia de Los Muertos

    ERIC Educational Resources Information Center

    Davila, Denise

    2012-01-01

    In mainstream American culture, death is not usually talked about openly. It is discussed privately among adults because death is often regarded as a final ending. Nevertheless, many elementary school teachers discuss el Dia de los Muertos with their students. The celebration of el Dia de los Muertos, in contrast to dominant ideology, commemorates…

  6. Ubiquitin-mediated Degradation of the Formin mDia2 upon Completion of Cell Division*

    PubMed Central

    DeWard, Aaron D.; Alberts, Arthur S.

    2009-01-01

    Formins assemble non-branched actin filaments and modulate microtubule dynamics during cell migration and cell division. At the end of mitosis formins contribute to the generation of actin filaments that form the contractile ring. Rho small GTP-binding proteins activate mammalian diaphanous-related (mDia) formins by directly binding and disrupting an intramolecular autoinhibitory mechanism. Although the Rho-regulated activation mechanism is well characterized, little is known about how formins are switched off. Here we reveal a novel mechanism of formin regulation during cytokinesis based on the following observations; 1) mDia2 is degraded at the end of mitosis, 2) mDia2 is targeted for disposal by post-translational ubiquitin modification, 3) forced expression of activated mDia2 yields binucleate cells due to failed cytokinesis, and 4) the cytokinesis block is dependent upon mDia2-mediated actin assembly as versions of mDia2 incapable of nucleating actin but that still stabilize microtubules have no effect on cytokinesis. We propose that the tight control of mDia2 expression and ubiquitin-mediated degradation is essential for the completion of cell division. Because of the many roles for formins in cell morphology, we discuss the relevance of mDia protein turnover in other processes where ubiquitin-mediated proteolysis is an essential component. PMID:19457867

  7. Formin mDia1 mediates vascular remodeling via integration of oxidative and signal transduction pathways.

    PubMed

    Touré, Fatouma; Fritz, Günter; Li, Qing; Rai, Vivek; Daffu, Gurdip; Zou, Yu Shan; Rosario, Rosa; Ramasamy, Ravichandran; Alberts, Arthur S; Yan, Shi Fang; Schmidt, Ann Marie

    2012-05-11

    The mammalian diaphanous-related formin (mDia1), governs microtubule and microfilament dynamics while functioning as an effector for Rho small GTP-binding proteins during key cellular processes such as adhesion, cytokinesis, cell polarity, and morphogenesis. The cytoplasmic domain of the receptor for advanced glycation endproducts binds to the formin homology 1 domain of mDia1; mDia1 is required for receptor for advanced glycation endproducts ligand-induced cellular migration in transformed cells. Because a key mechanism in vascular remodeling is the induction of smooth muscle cell migration, we tested the role of mDia1 in this process. We report that endothelial denudation injury to the murine femoral artery significantly upregulates mDia1 mRNA transcripts and protein in the injured vessel, particularly in vascular smooth muscle cells within the expanding neointima. Loss of mDia1 expression significantly reduces pathological neointimal expansion consequent to injury. In primary murine aortic smooth muscle cells, mDia1 is required for receptor for advanced glycation endproducts ligand-induced membrane translocation of c-Src, which leads to Rac1 activation, redox phosphorylation of AKT/glycogen synthase kinase 3β, and consequent smooth muscle cell migration. We conclude that mDia1 integrates oxidative and signal transduction pathways triggered, at least in part, by receptor for advanced glycation endproducts ligands, thereby regulating pathological neointimal expansion.

  8. Ubiquitin-mediated degradation of the formin mDia2 upon completion of cell division.

    PubMed

    DeWard, Aaron D; Alberts, Arthur S

    2009-07-24

    Formins assemble non-branched actin filaments and modulate microtubule dynamics during cell migration and cell division. At the end of mitosis formins contribute to the generation of actin filaments that form the contractile ring. Rho small GTP-binding proteins activate mammalian diaphanous-related (mDia) formins by directly binding and disrupting an intramolecular autoinhibitory mechanism. Although the Rho-regulated activation mechanism is well characterized, little is known about how formins are switched off. Here we reveal a novel mechanism of formin regulation during cytokinesis based on the following observations; 1) mDia2 is degraded at the end of mitosis, 2) mDia2 is targeted for disposal by post-translational ubiquitin modification, 3) forced expression of activated mDia2 yields binucleate cells due to failed cytokinesis, and 4) the cytokinesis block is dependent upon mDia2-mediated actin assembly as versions of mDia2 incapable of nucleating actin but that still stabilize microtubules have no effect on cytokinesis. We propose that the tight control of mDia2 expression and ubiquitin-mediated degradation is essential for the completion of cell division. Because of the many roles for formins in cell morphology, we discuss the relevance of mDia protein turnover in other processes where ubiquitin-mediated proteolysis is an essential component.

  9. Dia de Dar Gracias. Modulo Nivel Primario. (Day to Give Thanks. Module Primary Level.)

    ERIC Educational Resources Information Center

    Espinoza, Delia; Lopez, Santiago, III

    Dia de Dar Gracias (Thanksgiving) is the subject of this primary level unit. The unit objectives are to: (1) know about El Dia de Dar Gracias as it is celebrated in the United States; (2) know how the Mayas celebrated it; (3) understand the context of the stories in the unit; (4) know about the main food used, the turkey; (5) distinguish other…

  10. In Search of the Ideal Reader for Nonfiction Children's Books about el Dia de Los Muertos

    ERIC Educational Resources Information Center

    Davila, Denise

    2012-01-01

    In mainstream American culture, death is not usually talked about openly. It is discussed privately among adults because death is often regarded as a final ending. Nevertheless, many elementary school teachers discuss el Dia de los Muertos with their students. The celebration of el Dia de los Muertos, in contrast to dominant ideology, commemorates…

  11. Aurora B Regulates Formin mDia3 in Achieving Metaphase Chromosome Alignment

    PubMed Central

    Cheng, Lina; Zhang, Jiayin; Ahmad, Sana; Rozier, Lorene; Yu, Haiqian; Deng, Haiteng; Mao, Yinghui

    2015-01-01

    SUMMARY Proper bipolar attachment of sister kinetochores to the mitotic spindle is critical for accurate chromosome segregation in mitosis. Here we show an essential role of the formin mDia3 in achieving metaphase chromosome alignment. This function is independent of mDia3 actin nucleation activity, but is attributable to EB1-binding by mDia3. Furthermore, the microtubule binding FH2 domain of mDia3 is phosphorylated by Aurora B kinase in vitro, and cells expressing the nonphosphorylatable mDia3 mutant cannot position chromosomes at the metaphase plate. Purified recombinant mDia3 phosphorylated by Aurora B exhibits reduced ability to bind microtubules and stabilize microtubules against cold-induced disassembly in vitro. Cells expressing the phosphomimetic mDia3 mutant do not form stable kinetochore microtubule fibers; despite they are able to congress chromosomes to the metaphase plate. These findings reveal a key role for mDia3 and its regulation by Aurora B phosphorylation in achieving proper stable kinetochore microtubule attachment. PMID:21397845

  12. Aurora B regulates formin mDia3 in achieving metaphase chromosome alignment.

    PubMed

    Cheng, Lina; Zhang, Jiayin; Ahmad, Sana; Rozier, Lorene; Yu, Haiqian; Deng, Haiteng; Mao, Yinghui

    2011-03-15

    Proper bipolar attachment of sister kinetochores to the mitotic spindle is critical for accurate chromosome segregation in mitosis. Here we show an essential role of the formin mDia3 in achieving metaphase chromosome alignment. This function is independent of mDia3 actin nucleation activity, but is attributable to EB1-binding by mDia3. Furthermore, the microtubule binding FH2 domain of mDia3 is phosphorylated by Aurora B kinase in vitro, and cells expressing the nonphosphorylatable mDia3 mutant cannot position chromosomes at the metaphase plate. Purified recombinant mDia3 phosphorylated by Aurora B exhibits reduced ability to bind microtubules and stabilize microtubules against cold-induced disassembly in vitro. Cells expressing the phosphomimetic mDia3 mutant do not form stable kinetochore microtubule fibers; despite they are able to congress chromosomes to the metaphase plate. These findings reveal a key role for mDia3 and its regulation by Aurora B phosphorylation in achieving proper stable kinetochore microtubule attachment. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. 77 FR 38041 - Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-26

    ... of the Secretary Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed... discussions of classified information relating to DIA's intelligence operations including its support to... intelligence operations. Agenda July 23, 2012 1 p.m.--Call to Order Mr. William Caniano, Designated Federal...

  14. 78 FR 295 - Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-03

    ... Intelligence Agency (DIA) Advisory Board; Closed Meeting AGENCY: DIA, Department of Defense (DoD). ACTION... intelligence operations including its support to current operations. DATES: The meeting will be held on January... capabilities in support of current intelligence operations. Agenda January 22, 2013: Ms. Ellen M. Ardrey...

  15. 77 FR 18797 - Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-28

    ... of the Secretary Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed... discussions of classified information relating to DIA's intelligence operations including its support to... intelligence operations. Agenda May 2, 2012 S 8:30 a.m Convene Advisory Board Meeting Mr. William Caniano...

  16. 77 FR 56192 - Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-12

    ... of the Secretary Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed... discussions of classified information relating to DIA's intelligence operations including its support to... intelligence operations. Agenda September 26, 2012: ] 8:30 a.m Call to Order........ Ms. Ellen M. Ardrey...

  17. The present state of DIA models and their impact on one point closures

    NASA Technical Reports Server (NTRS)

    Yoshizawa, Akira

    1992-01-01

    An outline is presented of the DIA model. Another outline is presented of TSDIA (two scale DIA) and some suggestions for turbulence modeling. Two proposals are made: helicity for the study of the effects of swirling flow and cross flow; and density variance for the study of highly compressed flows.

  18. Ecotourism and Interpretation in Costa Rica: Parallels and Peregrinations.

    ERIC Educational Resources Information Center

    Williams, Wayne E.

    1994-01-01

    Discusses the ecotourism industry in Costa Rica and some of the problems faced by its national park system, including megaparks, rapid increase in tourism, and interpretive services. Suggests alternatives for the problems. (MKR)

  19. Ten new species of Daidalotarsonemus (Prostigmata: Tarsonemidae) from Costa Rica

    USDA-ARS?s Scientific Manuscript database

    Ten new tarsonemid species of the genus Daidalotarsonemus found on native plants in Costa Rica are described herein: Daidalotarsonemus alas sp. n. Ochoa, Rezende & Lofego; Daidalotarsonemus azofeifai sp. n. Ochoa, Rezende & Lofego; Daidalotarsonemus bauchani sp. n. Rezende, Ochoa & Lofego; Daidalota...

  20. Rickettsia felis in Ctenocephalides felis from Guatemala and Costa Rica

    PubMed Central

    Troyo, Adriana; Álvarez, Danilo; Taylor, Lizeth; Abdalla, Gabriela; Calderón-Arguedas, Ólger; Zambrano, Maria L.; Dasch, Gregory A.; Lindblade, Kim; Hun, Laya; Eremeeva, Marina E.; Estévez, Alejandra

    2012-01-01

    Rickettsia felis is an emerging human pathogen associated primarily with the cat flea Ctenocephalides felis. In this study, we investigated the presence of Rickettsia felis in C. felis from Guatemala and Costa Rica. Ctenocephalides felis were collected directly from dogs and cats, and analyzed by polymerase chain reaction for Rickettsia-specific fragments of 17-kDa protein, OmpA, and citrate synthase genes. Rickettsia DNA was detected in 64% (55 of 86) and 58% (47 of 81) of flea pools in Guatemala and Costa Rica, respectively. Sequencing of gltA fragments identified R. felis genotype URRWXCal2 in samples from both countries, and genotype Rf2125 in Costa Rica. This is the first report of R. felis in Guatemala and of genotype Rf2125 in Costa Rica. The extensive presence of this pathogen in countries of Central America stresses the need for increased awareness and diagnosis. PMID:22665618

  1. Costa Rica: Achievements of a Heterodox Health Policy

    PubMed Central

    Unger, Jean-Pierre; De Paepe, Pierre; Buitrón, René; Soors, Werner

    2008-01-01

    Costa Rica is a middle-income country with a strong governmental emphasis on human development. For more than half a century, its health policies have applied the principles of equity and solidarity to strengthen access to care through public services and universal social health insurance. Costa Rica’s population measures of health service coverage, health service use, and health status are excellent, and in the Americas, life expectancy in Costa Rica is second only to that in Canada. Many of these outcomes can be linked to the performance of the public health care system. However, the current emphasis of international aid organizations on privatization of health services threatens the accomplishments and universality of the Costa Rican health care system. PMID:17901439

  2. Costa Rica: achievements of a heterodox health policy.

    PubMed

    Unger, Jean-Pierre; De Paepe, Pierre; Buitrón, René; Soors, Werner

    2008-04-01

    Costa Rica is a middle-income country with a strong governmental emphasis on human development. For more than half a century, its health policies have applied the principles of equity and solidarity to strengthen access to care through public services and universal social health insurance. Costa Rica's population measures of health service coverage, health service use, and health status are excellent, and in the Americas, life expectancy in Costa Rica is second only to that in Canada. Many of these outcomes can be linked to the performance of the public health care system. However, the current emphasis of international aid organizations on privatization of health services threatens the accomplishments and universality of the Costa Rican health care system.

  3. Costa Rican data synthesis indicates oil, gas potential

    SciTech Connect

    Barrientos, J.; Bottazzi, G.; Fernandez, A.; Barboza, G.

    1997-05-12

    The hydrocarbon exploration data base in Costa Rica, gathered through various recent periods, indicates promising hydrocarbon potential in the country. During 1980--94, Recope SA, the state petroleum company, performed a series of studies to evaluate the petroleum potential in the whole Costa Rican territory. As a first step, the information compiled during previous studies was re-evaluated, and later new information was collected with the aid of foreign governments and cooperating institutions. A new exploratory era began with the Costa Rican Congress` approval in 1994 of the Hydrocarbon Law, which allows private companies to participate in hydrocarbon exploration and exploitation. This article brings together some highlights about Costa Rica oil potential and gives basic information on future hydrocarbon exploration and development under the regulation of the new Hydrocarbon Law.

  4. Rickettsia felis in Ctenocephalides felis from Guatemala and Costa Rica.

    PubMed

    Troyo, Adriana; Álvarez, Danilo; Taylor, Lizeth; Abdalla, Gabriela; Calderón-Arguedas, Ólger; Zambrano, Maria L; Dasch, Gregory A; Lindblade, Kim; Hun, Laya; Eremeeva, Marina E; Estévez, Alejandra

    2012-06-01

    Rickettsia felis is an emerging human pathogen associated primarily with the cat flea Ctenocephalides felis. In this study, we investigated the presence of Rickettsia felis in C. felis from Guatemala and Costa Rica. Ctenocephalides felis were collected directly from dogs and cats, and analyzed by polymerase chain reaction for Rickettsia-specific fragments of 17-kDa protein, OmpA, and citrate synthase genes. Rickettsia DNA was detected in 64% (55 of 86) and 58% (47 of 81) of flea pools in Guatemala and Costa Rica, respectively. Sequencing of gltA fragments identified R. felis genotype URRWXCal(2) in samples from both countries, and genotype Rf2125 in Costa Rica. This is the first report of R. felis in Guatemala and of genotype Rf2125 in Costa Rica. The extensive presence of this pathogen in countries of Central America stresses the need for increased awareness and diagnosis.

  5. Ecotourism and Interpretation in Costa Rica: Parallels and Peregrinations.

    ERIC Educational Resources Information Center

    Williams, Wayne E.

    1994-01-01

    Discusses the ecotourism industry in Costa Rica and some of the problems faced by its national park system, including megaparks, rapid increase in tourism, and interpretive services. Suggests alternatives for the problems. (MKR)

  6. [Perception about biotechnology in university students in Costa Rica].

    PubMed

    Valdez, Marta; Rodríguez, Iris; Sittenfeld, Ana

    2004-09-01

    A survey was carried out to determine the perception and knowledge about biotechnology and genetically modified organisms (GMOs) in a sample (n=750) of university students from three public universities in Costa Rica: Universidad de Costa Rica, Universidad Nacional and Instituto Tecnológico de Costa Rica. The study revealed that 88% of the students showed a satisfactory level of knowledge about modem biotechnology and 79% of them reported a favorable opinion and good acceptance of this technology. Students would accept some risks associated to biotechnology if it represents an improvement to the competitiveness of Costa Rica. Some differences were detected in the opinions from students of the three universities that can be associated to the area of study. Students from social disciplines showed a higher percentage of negative acceptances to biotechnology and GMOs when their opinions were compared with those of students from life sciences and technologies.

  7. A new genus of Smiliini (Hemiptera: Membracidae) from Costa Rica

    USDA-ARS?s Scientific Manuscript database

    A new genus and species, Smilirhexia naranja, is described from Costa Rica, the southern limit of the tribe Smiliini, and represents a strong divergence from the morphology of the oak-feeding genera prevalent in North America....

  8. Specificity of Interactions between mDia Isoforms and Rho Proteins*

    PubMed Central

    Lammers, Michael; Meyer, Simon; Kühlmann, Dorothee; Wittinghofer, Alfred

    2008-01-01

    Formins are key regulators of actin nucleation and polymerization. They contain formin homology 1 (FH1) and 2 (FH2) domains as the catalytic machinery for the formation of linear actin cables. A subclass of formins constitutes the Diaphanous-related formins, members of which are regulated by the binding of a small GTP-binding protein of the Rho subfamily. Binding of these molecular switch proteins to the regulatory N-terminal mDiaN, including the GTPase-binding domain, leads to the release of auto-inhibition. From the three mDia isoforms, mDia1 is activated only by Rho (RhoA, -B, and -C), in contrast to mDia2 and -3, which is also activated by Rac and Cdc42. Little is known about the determinants of specificity. Here we report on the interactions of RhoA, Rac1, and Cdc42 with mDia1 and an mDia1 mutant (mDiaN-Thr-Ser-His (TSH)), which based on structural information should mimic mDia2 and -3. Specificity is analyzed by biochemical studies and a structural analysis of a complex between Cdc42·Gpp(NH)p and mDiaN-TSH. A triple NNN motif in mDia1 (amino acids 164-166), corresponding to the TSH motif in mDia2/3 (amino acids 183-185 and 190-192), and the epitope interacting with the Rho insert helix are essential for high affinity binding. The triple N motif of mDia1 allows tight interaction with Rho because of the presence of Phe-106, whereas the corresponding His-104 in Rac and Cdc42 forms a complementary interface with the TSH motif in mDia2/3. We also show that the F106H and H104F mutations drastically alter the affinities and thermodynamics of mDia interactions. PMID:18829452

  9. [The bathymetry of Coco's Island, Costa Rica].

    PubMed

    Lizano, O G

    2001-12-01

    The bathymetry of Coco's Island (UNESCO Natural and Cultural World Patrimony), located approximately 500 km from the Pacific coast of Costa Rica, is not well known. It has a high marine biodiversity and also represents a meeting site for many species traveling throughout the Pacific Ocean. The insular shelf is irregular in extension and also in bathymetric features. The northeast limit is defined by the 109.8-128.1 m contours (60-70 fathoms) while the 183 m contour (100 fathoms) practically defines the rest of the island, from which the depth gradient is steep. The maximum extension is to the northeast with a longitude of 13 km. In this context the present limits of the marine park (5 km), are insufficient to protect the whole insular shelf. Current regulation should be modified to prevent fishing activities less than 15 km from the Island.

  10. Da Costa's syndrome or neurocirculatory asthenia.

    PubMed Central

    Paul, O

    1987-01-01

    The syndrome variously called Da Costa's syndrome, effort syndrome, neurocirculatory asthenia, etc has been studied for more than 100 years by many distinguished physicians. Originally identified in men in wartime, it has been widely recognised as a common chronic condition in both sexes in civilian life. Although the symptoms may seem to appear after infections and various physical and psychological stresses, neurocirculatory asthenia is most often encountered as a familial disorder that is unrelated to these factors, although they may aggravate an existing tendency. Respiratory complaints (including breathlessness, with and without effort, and smothering sensations) are almost universal, and palpitation, chest discomfort, dizziness and faintness, and fatigue are common. The physical examination is normal. The aetiology is obscure but patients usually have a normal life span. Reassurance and measures to improve physical fitness are helpful. PMID:3314950

  11. A report from rural Costa Rica.

    PubMed

    Fishel, J

    1997-01-01

    This report provides findings from interviews conducted among single mothers and other community members from Monteverde, Costa Rica in 1995. Costa Rica has experienced recent, rapid fertility decline. The population still includes 33% who are under 15 years old and capable of adding to population increases. The sample of single mothers includes women who were never married, or those who were divorced, widowed, or separated. This group of mothers contends with primary headship and decision making in family affairs and with social stigma from being single mothers. Many employers discriminate against single mothers in hiring. Single mothers were concerned about making enough money to pay for basic items, such as rent, food, and child care. Some worried about the lack of a father's love and discipline. All sample respondents stated that it was important to plan the number and timing of childbearing. The single mothers were familiar with several modern and traditional methods of contraception. Few pregnancies were planned. Most were mistrustful of the effectiveness and safety of modern contraceptives. The negative attitudes were attributed to religious influences, misinformation, or lack of information. High school sex education provides information about biological reproduction, sexually transmitted diseases, and methods of contraception. One instructor said that she recommends rhythm as the safest and best method. The only other source of information about family planning is the clinic. Little information is directed to unmarried girls and or male responsibility. The community organization that sponsored the survey is working to empower women and decrease social discrimination against single mothers. The author recommends improved information dissemination on sexuality, reproductive health, and contraception and improved access of unmarried teens to contraceptives.

  12. Seroepidemiology of chlamydia in Costa Rica.

    PubMed Central

    Vetter, K M; Barnes, R C; Oberle, M W; Rosero-Bixby, L; Schachter, J

    1990-01-01

    A population-based study of the sero-epidemiology of chlamydia was performed among a nationally representative sample of 760 Costa Rican women aged 25 to 59 years. Interviews and sera collection were completed between September 1984 and February 1985. The overall seroprevalence of chlamydial antibodies among these women was 56.1%. Women 25 to 39 years of age had a seroprevalence of 51.1%, while women 40 to 59 years of age had a seroprevalence of 64.2%. Women who reported no prior sexual activity had a seroprevalence rate of 48.6%, compared with a seroprevalence rate of 80.7% among women who reported three or more lifetime sexual partners. The geometric mean titre (GMT) of seropositive women ranged from 34.4 among the women who reported no prior sexual activity to 155.0 among the women with three or more lifetime sexual partners. Sero-positivity was more consistently associated with sexual activity than with age. Women with serological evidence of past Herpes simplex virus type 2 (HSV-2) or syphilis infection were more likely to be seropositive than were women without evidence of exposure to these sexually transmitted diseases, even when controlled for age and the number of lifetime sexual partners. The seropositivity among never sexually active women indicates the probable presence of Chlamydia pneumoniae infections, while the high seroprevalence of chlamydial antibodies among the sexually active women suggests that sexually transmitted Chlamydia trachomatis infections represent a public health problem not previously quantified in Costa Rica. Further seroepidemiological and/or culture studies are warranted to determine the incidence and prevalence of sexually transmitted chlamydial infection among men and younger women. PMID:2370061

  13. The Exceptionally High Life Expectancy of Costa Rican Nonagenarians

    PubMed Central

    ROSERO-BIXBY, LUIS

    2008-01-01

    Robust data from a voter registry show that Costa Rican nonagenarians have an exceptionally high live expectancy. Mortality at age 90 in Costa Rica is at least 14% lower than an average of 13 high-income countries. This advantage increases with age by 1% per year. Males have an additional 12% advantage. Age-90 life expectancy for males is 4.4 years, one-half year more than any other country in the world. These estimates do not use problematic data on reported ages, but ages are computed from birth dates in the Costa Rican birth-registration ledgers. Census data confirm the exceptionally high survival of elderly Costa Ricans, especially males. Comparisons with the United States and Sweden show that the Costa Rican advantage comes mostly from reduced incidence of cardiovascular diseases, coupled with a low prevalence of obesity, as the only available explanatory risk factor. Costa Rican nonagenarians are survivors of cohorts that underwent extremely harsh health conditions when young, and their advantage might be just a heterogeneity in frailty effect that might disappear in more recent cohorts. The availability of reliable estimates for the oldest-old in low-income populations is extremely rare. These results may enlighten the debate over how harsh early-life health conditions affect older-age mortality. PMID:18939667

  14. Diamagnetic chemical exchange saturation transfer (diaCEST) liposomes: physicochemical properties and imaging applications.

    PubMed

    Chan, Kannie W Y; Bulte, Jeff W M; McMahon, Michael T

    2014-01-01

    Chemical exchange saturation transfer (CEST) is a new type of magnetic resonance imaging (MRI) contrast based on labile spins which rapidly exchange with solvent, resulting in an amplification of signal which allows detection of solute protons at millimolar to micromolar concentrations. An additional feature of these agents is that natural organic and biodegradable compounds can provide strong CEST contrast, allowing the development of diamagnetic CEST (diaCEST) MRI contrast agents. The sensitivity of the CEST approach per unit of agent increases further when diaCEST contrast agents are loaded into liposomes to become diaCEST liposomes. In this review, we will discuss the unique and favorable features of diaCEST liposomes which are well suited for in vivo imaging. diaCEST liposomes are nanocarriers which feature high concentrations of encapsulated contrast material, controlled release of payload, and an adjustable coating for passive or active tumor targeting. These liposomes have water permeable bilayers and both the interior and exterior can be fine-tuned for many biomedical applications. Furthermore, a number of liposome formulations are used in the clinic including Doxil™, which is an approved product for treating patients with cancer for decades, rapid translation of these materials can be envisaged. diaCEST liposomes have shown promise in imaging of cancer, and monitoring of chemotherapy and cell transplants. The unique features of diaCEST liposomes are discussed to provide an overview of the applications currently envisioned for this new technology and to provide an overall insight of their potential.

  15. Arbitrary Amplitude DIA and DA Solitary Waves in Adiabatic Dusty Plasmas

    SciTech Connect

    Mamun, A. A.; Jahan, N.; Shukla, P. K.

    2008-10-15

    The dust-ion-acoustic (DIA) as well as the dust-acoustic (DA) solitary waves (SWs) in an adiabatic dusty plasma are investigated by the pseudo-potential approach which is valid for arbitrary amplitude SWs. The role of the adiabaticity of electrons and ions in modifying the basic features (polarity, speed, amplitude and width) of arbitrary amplitude DIA and DA SWs are explicitly examined. It is found that the effects of the adiabaticity of electrons and ions significantly modify the basic features (polarity, speed, amplitude and width) of the DIA and DA SWs. The implications of our results in space and laboratory dusty plasmas are briefly discussed.

  16. A New Subgenus and Species of Neotropical Hylaeus from Costa Rica (Hymenoptera: Colletidae)

    USDA-ARS?s Scientific Manuscript database

    A new Neotropical subgenus of Hylaeus, Snellingella, is described, with Hylaeus amplus new species from Costa Rica as the type species. Characteristics to separate the new species from other Costa Rican Hylaeus are provided....

  17. The Spherical Tokamak MEDUSA for Costa Rica

    NASA Astrophysics Data System (ADS)

    Ribeiro, Celso; Vargas, Ivan; Guadamuz, Saul; Mora, Jaime; Ansejo, Jose; Zamora, Esteban; Herrera, Julio; Chaves, Esteban; Romero, Carlos

    2012-10-01

    The former spherical tokamak (ST) MEDUSA (Madison EDUcation Small Aspect.ratio tokamak, R<0.14m, a<0.10m, BT<0.5T, Ip<40kA, 3ms pulse)[1] is in a process of donation to Costa Rica Institute of Technology. The main objective of MEDUSA is to train students in plasma physics /technical related issues which will help all tasks of the very low aspect ratio stellarator SCR-1(A≡R/>=3.6, under design[2]) and also the ongoing activities in low temperature plasmas. Courses in plasma physics at undergraduate and post-graduate joint programme levels are regularly conducted. The scientific programme is intend to clarify several issues in relevant physics for conventional and mainly STs, including transport, heating and current drive via Alfv'en wave, and natural divertor STs with ergodic magnetic limiter[3,4]. [1] G.D.Garstka, PhD thesis, University of Wisconsin at Madison, 1997 [2] L.Barillas et al., Proc. 19^th Int. Conf. Nucl. Eng., Japan, 2011 [3] C.Ribeiro et al., IEEJ Trans. Electrical and Electronic Eng., 2012(accepted) [4] C.Ribeiro et al., Proc. 39^th EPS Conf. Contr. Fusion and Plasma Phys., Sweden, 2012

  18. [Education, modernity, and fertility in Costa Rica].

    PubMed

    Stycos, J M

    1980-01-01

    In an effort to identify the causal mechanisms involved in the relationship between education and fertility in Costa Rica, all married women who were interviewed in the National Fertility Survey were reinterviewed in 1977-78. Questions on modernity and attitudes toward family size were designed to measure the extent of their influence on fertility. Questions on modernity were grouped into 4 measures of mass communications/information, sex roles, husband's power, and "instrumental activism." The intercorrelation of the 4 measures was enough to justify their use as separate subscales but high enough to permit their combined use as a single measure of modernity. The correlation between the combined total and education was strong and positive at .68, while the correlation between education and the number of live births controlled for age was -.35. Results of a multiple regression analysis indicate that high levels of general information and exposure to mass media are responsible for the positive correlation between education and fertility. A variety of scales were developed to measure the extent to which predispositions toward family size, numerical preference, and desire for additional children were responsible for the relationship between general information and fertility. Modernity and education showed strong negative relationships to predisposition toward family size, moderate negative relationships to size preference, and almost no relationship to the desire for more children.

  19. Toxoplasma gondii in Costa Rican cats.

    PubMed

    Ruiz, A; Frenkel, J K

    1980-11-01

    Toxoplasma gondii infection of cats was studied in seven localities in Costa Rica. A total of 237 cats were tested for antibody by the dye test, and for oocysts by injection into mice. Toxoplasma was isolated from 55 (23%) and antibody was found in 109 (46%). Sixty percent of cats were infected as shown by shedding or antibody. Of the 55 isolations, 64% were from kittens without antibody and 36% from kittens with antibody. Almost half of the Toxoplasma isolations were made from the feces of kittens weighing less than 600 g, 35 cm in length, or under 2 months of age, of which 41% were shedding Toxoplasma. Six hundred and seventy-six homeowners in the seven towns were questioned about the number of owned and stray cats visiting their houses, the cats' pattern of roaming, food sources, types of food foraged, defecation sites outdoors and indoors, and location of fecal deposits in houses. Seventy-six percent of houses reported cats, which averaged 2.1 cats per house; about 80% were strays, and 99% lived outdoors part or all of the time. The cats visited from 5-12 (average 6) houses, foraging for food in garbage, hunting mice, rats, sparrows and insects. Of the 516 households reporting cats, 29% supplied some food in addition. In 14% of these houses cats defecated in the house, including the false attic and crawl space; they commonly defecated in front and backyards of houses, close to human habitation and accessible to intermediate hosts.

  20. A Case Study in Distance Learning Systems: Costa Rica's Universidad Estatal a Distancia.

    ERIC Educational Resources Information Center

    Rumble, G. W. S. V.

    A case study of Costa Rica's Universidad Estatal a Distancia, an Open University school with a distance learning system, is presented. Areas of discussion include characteristics of the country, the educational system of Costa Rica, and the university. Specific topics include: the physical setting of Costa Rica; the population; the economy;…

  1. Personality Traits Change in Adulthood: Reply to Costa and McCrae (2006)

    ERIC Educational Resources Information Center

    Roberts, Brent W.; Walton, Kate E.; Viechtbauer, Wolfgang

    2006-01-01

    In a response to comments by P. T. Costa, Jr., and R. R. McCrae on the current authors' original article, the authors show that Costa and McCrae's writings on personality suggest a belief in immutability of personality traits. The authors agree with Costa and McCrae that new personality trait models that provide an accurate lower order structure…

  2. Personality Traits Change in Adulthood: Reply to Costa and McCrae (2006)

    ERIC Educational Resources Information Center

    Roberts, Brent W.; Walton, Kate E.; Viechtbauer, Wolfgang

    2006-01-01

    In a response to comments by P. T. Costa, Jr., and R. R. McCrae on the current authors' original article, the authors show that Costa and McCrae's writings on personality suggest a belief in immutability of personality traits. The authors agree with Costa and McCrae that new personality trait models that provide an accurate lower order structure…

  3. Activation of TRPP2 through mDia1-dependent voltage gating

    PubMed Central

    Bai, Chang-Xi; Kim, Sehyun; Li, Wei-Ping; Streets, Andrew J; Ong, Albert C M; Tsiokas, Leonidas

    2008-01-01

    The TRPP2 cation channel is directly responsible for ∼15% of all cases of autosomal dominant polycystic kidney disease. However, the mechanisms underlying fundamental properties of TRPP2 regulation, such as channel gating and activation, are unknown. We have shown that TRPP2 was activated by EGF and physically interacted with the mammalian diaphanous-related formin 1 (mDia1), a downstream effector of RhoA. Now, we show that mDia1 regulates TRPP2 by specifically blocking its activity at negative but not positive potentials. The voltage-dependent unblock of TRPP2 by mDia1 at positive potentials is mediated through RhoA-induced molecular switching of mDia1 from its autoinhibited state at negative potentials to its activated state at positive potentials. Under physiological resting potentials, EGF activates TRPP2 by releasing the mDia1-dependent block through the activation of RhoA. Our data reveal a new role of mDia1 in the regulation of ion channels and suggest a molecular basis for the voltage-dependent gating of TRP channels. PMID:18388856

  4. Ena/VASP regulates mDia2-initiated filopodial length, dynamics, and function

    PubMed Central

    Barzik, Melanie; McClain, Leslie M.; Gupton, Stephanie L.; Gertler, Frank B.

    2014-01-01

    Filopodia are long plasma membrane extensions involved in the formation of adhesive, contractile, and protrusive actin-based structures in spreading and migrating cells. Whether filopodia formed by different molecular mechanisms equally support these cellular functions is unresolved. We used Enabled/vasodilator-stimulated phosphoprotein (Ena/VASP)–deficient MVD7 fibroblasts, which are also devoid of endogenous mDia2, as a model system to investigate how these different actin regulatory proteins affect filopodia morphology and dynamics independently of one another. Filopodia initiated by either Ena/VASP or mDia2 contained similar molecular inventory but differed significantly in parameters such as number, length, F-actin organization, lifetime, and protrusive persistence. Moreover, in the absence of Ena/VASP, filopodia generated by mDia2 did not support initiation of integrin-dependent signaling cascades required for adhesion and subsequent lamellipodial extension, thereby causing a defect in early cell spreading. Coexpression of VASP with constitutively active mDia2M/A rescued these early adhesion defects. We conclude that Ena/VASP and mDia2 support the formation of filopodia with significantly distinct properties and that Ena/VASP regulates mDia2-initiated filopodial morphology, dynamics, and function. PMID:24989797

  5. Enucleation of cultured mouse fetal erythroblasts requires Rac GTPases and mDia2.

    PubMed

    Ji, Peng; Jayapal, Senthil Raja; Lodish, Harvey F

    2008-03-01

    Mammalian erythroid cells undergo enucleation, an asymmetric cell division involving extrusion of a pycnotic nucleus enveloped by the plasma membrane. The mechanisms that power and regulate the enucleation process have remained obscure. Here, we show that deregulation of Rac GTPase during a late stage of erythropoiesis completely blocks enucleation of cultured mouse fetal erythroblasts without affecting their proliferation or differentiation. Formation of the contractile actin ring (CAR) on the plasma membrane of enucleating erythroblasts was disrupted by inhibition of Rac GTPases. Furthermore, we demonstrate that mDia2, a downstream effector of Rho GTPases and a formin protein required for nucleation of unbranched actin filaments, is also required for enucleation of mouse fetal erythroblasts. We show that Rac1 and Rac2 bind to mDia2 in a GTP-dependent manner and that downregulation of mDia2, but not mDia1, by small interfering RNA (siRNA) during the late stages of erythropoiesis blocked both CAR formation and erythroblast enucleation. Additionally, overexpression of a constitutively active mutant of mDia2 rescued the enucleation defects induced by the inhibition of Rac GTPases. These results reveal important roles for Rac GTPases and their effector mDia2 in enucleation of mammalian erythroblasts.

  6. Primary Health Care That Works: The Costa Rican Experience.

    PubMed

    Pesec, Madeline; Ratcliffe, Hannah L; Karlage, Ami; Hirschhorn, Lisa R; Gawande, Atul; Bitton, Asaf

    2017-03-01

    Long considered a paragon among low- and middle-income countries in its provision of primary health care, Costa Rica reformed its primary health care system in 1994 using a model that, despite its success, has been generally understudied: basic integrated health care teams. This case study provides a detailed description of Costa Rica's innovative implementation of four critical service delivery reforms and explains how those reforms supported the provision of the four essential functions of primary health care: first-contact access, coordination, continuity, and comprehensiveness. As countries around the world pursue high-quality universal health coverage to attain the Sustainable Development Goals, Costa Rica's experiences provide valuable lessons about both the types of primary health care reforms needed and potential mechanisms through which these reforms can be successfully implemented.

  7. Anthoathecatae and Leptothecatae hydroids from Costa Rica (Cnidaria: Hydrozoa).

    PubMed

    Kelmo, Francisco; Vargas, Rita

    2002-06-01

    This paper is the first taxonomic account of the hydroid orders Anthoathecatae and Leptothecatae from the Caribbean and Pacific coast of Costa Rica. All specimens are currently stored at the reference collection of the Museo de Zoología, Escuela de Biología, Universidad de Costa Rica. Sixteen hydroid species are recorded: Eudendrium carneum, Pennaria disticha, Acryptolaria longitheca, Plumularia floridana, Halopteris polymorpha, Aglaophenia dubia, Aglaophenia latecarinata, Lytocarpia tridentata, Macrorhynchia phillipina, Macrorhynchia sp., Clytia gracilis, Cnidoscyphus marginatus, Thyroscyphus ramosus, Dynamena disticha, Sertularella diaphana, and Tridentata distans. An extensive synonymy has been given for each species. A simplified taxonomic key is included, and illustrations and descriptions are provided for each species.

  8. Costa Rica's Chain of laterally collapsed volcanoes.

    NASA Astrophysics Data System (ADS)

    Duarte, E.; Fernandez, E.

    2007-05-01

    From the NW extreme to the SW end of Costa Rica's volcanic backbone, a number of laterally collapsed volcanoes can be observed. Due to several factors, attention has been given to active volcanoes disregarding the importance of collapsed features in terms of assessing volcanic hazards for future generations around inhabited volcanoes. In several cases the typical horseshoe shape amphitheater-like depression can be easily observed. In other cases due to erosion, vegetation, topography, seismic activity or drastic weather such characteristics are not easily recognized. In the order mentioned above appear: Orosi-Cacao, Miravalles, Platanar, Congo, Von Frantzius, Cacho Negro and Turrialba volcanoes. Due to limited studies on these structures it is unknown if sector collapse occurred in one or several phases. Furthermore, in the few studied cases no evidence has been found to relate collapses to actual eruptive episodes. Detailed studies on the deposits and materials composing dome-like shapes will shed light on unsolved questions about petrological and chemical composition. Volume, form and distance traveled by deposits are part of the questions surrounding most of these collapsed volcanoes. Although most of these mentioned structures are extinct, at least Irazú volcano (active volcano) has faced partial lateral collapses recently. It did presented strombolian activity in the early 60s. Collapse scars show on the NW flank show important mass removal in historic and prehistoric times. Moreover, in 1994 a minor hydrothermal explosion provoked the weakening of a deeply altered wall that holds a crater lake (150m diameter, 2.6x106 ). A poster will depict images of the collapsed volcanoes named above with mayor descriptive characteristics. It will also focus on the importance of deeper studies to assess the collapse potential of Irazú volcano with related consequences. Finally, this initiative will invite researchers interested in such topic to join future studies in

  9. Epaisseur de l'intima-média carotidienne et facteurs de risque cardio-vasculaires

    PubMed Central

    Herinirina, Nicolas Fanantenana; Rajaonarison, Lova Hasina Ny Ony Narindra; Herijoelison, Andry Roussel; Ahmad, Ahmad

    2015-01-01

    Introduction L’épaisseur intima-média de la carotide commune mesurée à l’échographie est un marqueur de risque cardio-vasculaire. L'objectif de ce travail est d’établir la corrélation entre l’épaisseur de l'intima-média carotidienne commune et les facteurs de risque cardio-vasculaire chez des sujets asymptomatiques. Méthodes Etude transversale descriptive et analytique portant sur 77 sujets de 40 ans et plus chez qui nous avons évalué les facteurs de risque cardio-vasculaire et analysé leur association avec l’épaisseur intima-média carotidienne commune. Résultats L’épaisseur intima-média augmentait avec l’âge. Les hommes avaient une épaisseur intima-média plus marquée que les femmes. L'hypertension artérielle, le diabète et la dyslipidémie sont corrélés à l’épaisseur de l'intima-média contrairement au tabagisme. Conclusion L’âge élevé et le sexe masculin sont les facteurs déterminants de la majoration de l’épaisseur intima-média carotidienne commune surtout si s'ajoutent l'hypertension artérielle, le diabète ou la dyslipidémie. PMID:26327990

  10. An investigation of habitual and incidental physical activity among Costa Rican and Costa Rican American teenage girls.

    PubMed

    D'Alonzo, Karen T; Cortese, Lauren B

    2007-07-01

    A comparative survey design was used to examine habitual and incidental physical activity among native Costa Rican (CR) and Costa Rican American (CRA) adolescent girls. The purposive sample included 17 girls (ages 12-19 years) living in Limon, Costa Rica (n = 11), and the metropolitan New York/New Jersey area (n = 6). Participants in the CR group had significantly higher levels of habitual (p = .04), incidental (p = .02), and combined (p = .03) physical activity as compared with those on the CRA group. Dance was a preferred form of activity for both groups. The relationship between habitual and incidental physical activity was not significant, underscoring the need to address both variables in assessment of total physical activity. The findings suggest a need to prioritize the promotion of physical activity among immigrant teenage girls using culturally valued methods.

  11. MetDIA: Targeted Metabolite Extraction of Multiplexed MS/MS Spectra Generated by Data-Independent Acquisition.

    PubMed

    Li, Hao; Cai, Yuping; Guo, Yuan; Chen, Fangfang; Zhu, Zheng-Jiang

    2016-09-06

    With recent advances in mass spectrometry, there is an increased interest in data-independent acquisition (DIA) techniques for metabolomics. With DIA technique, all metabolite ions are sequentially selected and isolated using a wide window to generate multiplexed MS/MS spectra. Therefore, DIA strategy enables a continuous and unbiased acquisition of all metabolites and increases the data dimensionality, but presents a challenge to data analysis due to the loss of the direct link between precursor ion and fragment ions. However, very few DIA data processing methods are developed for metabolomics application. Here, we developed a new DIA data analysis approach, namely, MetDIA, for targeted extraction of metabolites from multiplexed MS/MS spectra generated using DIA technique. MetDIA approach considers each metabolite in the spectral library as an analysis target. Ion chromatograms for each metabolite (both precursor ion and fragment ions) and MS(2) spectra are readily detected, extracted, and scored for metabolite identification, referred as metabolite-centric identification. A minimum metabolite-centric identification score responsible for 1% false positive rate of identification is determined as 0.8 using fully (13)C labeled biological extracts. Finally, the comparisons of our MetDIA method with data-dependent acquisition (DDA) method demonstrated that MetDIA could significantly detect more metabolites in biological samples, and is more accurate and sensitive for metabolite identifications. The MetDIA program and the metabolite spectral library is freely available on the Internet.

  12. Activation of the S-Phase Checkpoint Inhibits Degradation of the F-Box Protein Dia2 ▿

    PubMed Central

    Kile, Andrew C.; Koepp, Deanna M.

    2010-01-01

    A stable genome is critical to cell viability and proliferation. During DNA replication, the S-phase checkpoint pathway responds to replication stress. In budding yeast, the chromatin-bound F-box protein Dia2 is required to maintain genomic stability and may help replication complexes overcome sites of damaged DNA and natural fragile regions. SCF (Skp1/Cul1/F-box protein) complexes are modular ubiquitin ligases. We show here that Dia2 is itself targeted for ubiquitin-mediated proteolysis and that activation of the S-phase checkpoint pathway inhibits Dia2 protein degradation. S-phase checkpoint mutants fail to stabilize Dia2 in response to replication stress. Deletion of DIA2 from these checkpoint mutants exacerbates their sensitivity to hydroxyurea, suggesting that stabilization of Dia2 contributes to the replication stress response. Unlike the case for other F-box proteins, deletion of the F-box domain in Dia2 does not stabilize the protein. Rather, an N-terminal domain that is also required for nuclear localization is necessary for degradation. When a strong nuclear localization signal (NLS) is added to dia2 mutants lacking this domain, the Dia2 protein is both stable and nuclear. Together, our results suggest that Dia2 protein turnover does not involve an autocatalytic mechanism and that Dia2 proteolysis is inhibited by activation of the replication stress response. PMID:19858292

  13. Compressive and rarefactive DIA solitons beyond the KdV limit

    SciTech Connect

    Mamun, A. A.; Deeba, F.

    2012-04-15

    The modified Gardner equation (MGE), showing the existence of compressive and rarefactive dust-ion-acoustic (DIA) solitons in a nonplanar dusty plasma (containing inertial ions, Boltzmann electrons, and negatively charged stationary dust) beyond the KdV Korteweg-de Vries (KdV) limit, is derived and numerically solved. The basic features of the compressive and rarefactive cylindrical and spherical DIA solitons, which are found to exist beyond the KdV limit, i.e., exist for {mu} {approx} 2/3 (where {mu} = Z{sub n}n{sub d0}/n{sub i0}, z{sub d} is the number of electrons residing onto the dust grain surface, n{sub d0}(n{sub i0}) is the dust (ion) number density at equilibrium, and {mu} {approx} 2/3 means that {mu} is not equal to 2/3, but it is around 2/3) are identified. These solitons (which can be referred to as DIA Gardner solitons (DIA-GSs)) are completely different from the KdV solitons because {mu} = 2/3 corresponds to the vanishing of the nonlinear coefficient of the KdV equation, and {mu} {approx} 2/3 corresponds to extremely large amplitude KdV solitons for which the validity of the reductive perturbation method breaks down. It is also shown that the properties of the nonplanar (cylindrical and spherical) DIA-GSs are significantly different from those of the one dimensional planar ones.

  14. Diaphanous formin mDia2 regulates CENP-A levels at centromeres

    PubMed Central

    Liu, Chenshu

    2016-01-01

    Centromeres of higher eukaryotes are epigenetically defined by centromere protein A (CENP-A), a centromere-specific histone H3 variant. The incorporation of new CENP-A into centromeres to maintain the epigenetic marker after genome replication in S phase occurs in G1 phase; however, how new CENP-A is loaded and stabilized remains poorly understood. Here, we identify the formin mDia2 as essential for stable replenishment of new CENP-A at centromeres. Quantitative imaging, pulse-chase analysis, and high-resolution ratiometric live-cell studies demonstrate that mDia2 and its nuclear localization are required to maintain CENP-A levels at centromeres. Depletion of mDia2 results in a prolonged centromere association of holiday junction recognition protein (HJURP), the chaperone required for CENP-A loading. A constitutively active form of mDia2 rescues the defect in new CENP-A loading caused by depletion of male germ cell Rac GTPase-activating protein (MgcRacGAP), a component of the small GTPase pathway essential for CENP-A maintenance. Thus, the formin mDia2 functions downstream of the MgcRacGAP-dependent pathway in regulating assembly of new CENP-A containing nucleosomes at centromeres. PMID:27185834

  15. Rewriting Citizenship? Civic Education in Costa Rica and Argentina

    ERIC Educational Resources Information Center

    Suarez, David F.

    2008-01-01

    To what degree are nations "rewriting" citizenship by expanding discussions of human rights, diversity and cultural pluralism in modern civic education, and what explains variation between countries? This study addresses these issues by analysing the intended content of civic education in Costa Rica and Argentina. Over time, civic…

  16. Case Study: Transgenic Crop Controversy in Costa Rica

    ERIC Educational Resources Information Center

    Hague, Steve S.

    2009-01-01

    Costa Rica has rich ecological resources and has been a steady political force in turbulent Central America. Most recently, it has become a battleground between pro- and anti-genetically modified organism (GMO) political forces. This case study examines the roles of U.S.-based cotton ("Gossypium hirsutum" L.) seed companies, anti-GMO…

  17. Empowering Women through Photovoice: Women of La Carpio, Costa Rica

    ERIC Educational Resources Information Center

    Morgan, Mary Y.; Vardell, Rosemarie; Lower, Joanna K.; Kinter-Duffy, Ibarra, Laura C.; Victoria L.; Cecil-Dyrkacz, Joy E.

    2010-01-01

    The purpose of the project was to allow participants to document, critique, and change their family and community conditions through photographs and stories of their everyday lives. This study used photovoice, a participatory action research methodology, with 7 women from La Carpio, Costa Rica. The women were given cameras and asked to photograph…

  18. Contra Costa Community College District Transfer Education Report.

    ERIC Educational Resources Information Center

    Contra Costa Community Coll. District, Martinez, CA.

    This research report from Contra Costa Community College District (CCCCD), California, summarizes relevant findings from assessments of the performance of students receiving transfer education, and CCCCD's progress in meeting its Partnership for Excellence (PFE) goals in this area. Findings reported include the following: (1) Student Goal…

  19. Contra Costa Community College District Institutional Effectiveness Report.

    ERIC Educational Resources Information Center

    Contra Costa Community Coll. District, Martinez, CA. Office of District Research.

    This document addresses the 2000 institutional effectiveness report for Contra Costa Community College District. The document discusses the following ten indicators which are directly aligned with Partnership for Excellence (PFE) 2005-2006 Goals: (1) Student Goal Attainment; (2) Course Success/ Persistence/ Retention Rates; (3) Certificate/ Degree…

  20. The genus Neotherina Dognin (Geometridae, Ennominae) in Costa Rica

    PubMed Central

    Sullivan, J. Bolling; Chacón, Isidro

    2011-01-01

    Abstract So far, two species of Neotherina Dognin have been recorded in Costa Rica. Neotherina imperilla (Dognin) occurs primarily at altitudes between 1100 and 1700 meters and Neotherina callas (Druce) which is widely distributed above 1100 meters. A third, new species, Neotherina xanthosa Sullivan and Chacón is described from altitudes above 2400 meters. Heterogeneity of the genus is discussed. PMID:22207793

  1. CREADS, a Teacher Training Course on ESD in Costa Rica

    ERIC Educational Resources Information Center

    Jimenez-Elizondo, Alicia

    2010-01-01

    After the Costa Rican government signed a commitment to implement the UN Decade of Education for Sustainable Development (DESD), the challenge was how to put the commitment into action. Fortunately, an opportunity presented itself with an initiative called Peace with Nature (Iniciativa Paz con la Naturaleza-IPN), under which a teacher training…

  2. Case Study: Transgenic Crop Controversy in Costa Rica

    ERIC Educational Resources Information Center

    Hague, Steve S.

    2009-01-01

    Costa Rica has rich ecological resources and has been a steady political force in turbulent Central America. Most recently, it has become a battleground between pro- and anti-genetically modified organism (GMO) political forces. This case study examines the roles of U.S.-based cotton ("Gossypium hirsutum" L.) seed companies, anti-GMO…

  3. Disability and Rehabilitation in Rural Costa Rica. Occasional Paper 3.

    ERIC Educational Resources Information Center

    de Mezerville, Gaston

    To assist the Costa Rican Social Security Systems in designing a Rural Community Comprehensive Health Model, a study identified functional limitations among 1253 persons over age 7; assessed functional development of 293 children, ages 0-6; identified possible preventive factors of disability; and explored practices and resources in the districts…

  4. The Marine Education Programme and ESD Schools in Costa Rica

    ERIC Educational Resources Information Center

    Mata-Segreda, Alejandrina

    2010-01-01

    The purpose of this article is to share information about the Costa Rican Marine Education Programme in relation to the quality criteria for Education for Sustainable Development (ESD) Schools. We found that the application of these criteria is feasible, not only to the organisation and management of schools that are looking to become ESD Schools,…

  5. Situation of Drug Information Centers and Services in Costa Rica

    PubMed Central

    Hall, Victoria; Gomez, Carolina; Fernandez-Llimos, Fernando

    PAHO establishes guidelines that must be met by drug information centers (DIC) and the drug information services (DIS). Objective To describe the operations, activities, and resources of the DICs and the DISs affiliated with public institutions of Costa Rica, and their adjustment to the provisions set forth by the PAHO. Methods Descriptive study conducted in May 2003. The officers in charge of each of the seven public DICs or DISs in Costa Rica were interviewed, and inquiries were made regarding aspects of the structure and process of their centers. Results In Costa Rica there are seven public drug information units, that is, four DICs and three DISs. One of the DICs is located in this university, and the remaining six centers and services are in located in hospitals. Five of the centers do not have the primary sources required by the PAHO. Fifteen out of the 36 tertiary sources recommended are not available in any of the centers. 100% of the information units carry out four main activities: answering inquiries from the hospital community, answering inquiries from users outside the hospital, implementing education programs for patients and risk groups, and rotation programs for student training. Conclusions The activities developed by the DISs and the DICs in Costa Rica are similar to each other; they respond not only to the PAHO’s guidelines, but they also have similarities with the activities and operations of other DICs worldwide. Primary, secondary, and tertiary bibliographical support must be strengthened. PMID:25246999

  6. Costa Rica's Marine Protected Areas: status and perspectives.

    PubMed

    Alvarado, Juan José; Cortés, Jorge; Esquivel, María Fernanda; Salas, Eva

    2012-03-01

    With 51 100km2 of terrestrial area and 589 000km2 of national waters, Costa Rica is considered one of the countries with the greatest biodiversity. It has approximately 3.5% of the world marine species. In the last four decades, Costa Rica has done a considerable effort to create a representative system of Protected Areas (PA), mainly terrestrial. We present an assessment of the current situation of the Marine Protected Areas (MPA) in Costa Rica, through an historical analysis, and an evaluation of their distribution, coverage and management categories. Costa Rica has 166 protected areas covering 50% of the coastline; of these 20 are MPAs, classified as National Parks (90.6%), National Wildlife Refuges (6.6%), Wetlands (1.5%), Biological Reserves (1%), and one Absolute Natural Reserve (0.3%). According to IUCN criteria, 93.7% correspond to category II, 5% to IV and 1.3% to I. The marine protected surface is 5 296.5km2, corresponding to 17.5% of the territorial waters and 0.9% of the Exclusive Economic Zone. The median distance between MPAs is 22.4km in the Pacific and 32.9km along the Caribbean. The median size is close to 54km2. The main threats to MPAs are the lack of coordination between governmental agencies, limited economic resources, restricted patrolling and control, poor watershed management, and rampant coastal alteration.

  7. [Zooplankton of the Costa Rica Dome: taxonomy and biogeography].

    PubMed

    Vicencio Aguilar, M E; Fernández Alamo, M A

    1996-08-01

    A list of the species and taxa of some pelagic animals from a tropical upwelling region, based on collections made off the coast of Costa Rica is presented. The list includes a total of 224 species, 53 genera and 11 subspecific forms in Cnidaria, Annelida, Mollusca, Artropoda (Crustacea), Chaetognatha and Pisces.

  8. Science and Mathematics Education Research in Costa Rica.

    ERIC Educational Resources Information Center

    Berty, Rolando; Esquivel, Juan M.

    Increased emphasis on science and mathematics education research in Costa Rica since 1973 is reported. The majority of the studies carried out in the past 12 years have been diagnostic studies. General findings are listed, under the headings of certification, supervision, basic skills, teaching methods, attitudes, and curriculum. The diagnostic…

  9. [Migration and employment in the metropolitan area of Costa Rica].

    PubMed

    Maguid, A

    1986-04-01

    The relationship between rural-urban migration and employment in Costa Rica is explored. "The main purpose of this paper is to examine the conditions in which immigrants are absorbed in the labour market." The data are from the Survey on Migration and Employment in Metropolitan Areas carried out by the Ministry of Planning and Political Economics in 1982. (summary in ENG)

  10. Interdisciplinary Team Teaching on Sustainable Development in Costa Rica.

    ERIC Educational Resources Information Center

    Lessor, Roberta; Reeves, Margaret; Andrade, Enrique

    1997-01-01

    Describes the development and implementation of an interdisciplinary field course in Costa Rica focused on sustainable development. The semester-long curriculum integrated sociology, political economy, and agricultural ecology. The curriculum was empirically based and involved faculty members and students working collaboratively on different…

  11. CREADS, a Teacher Training Course on ESD in Costa Rica

    ERIC Educational Resources Information Center

    Jimenez-Elizondo, Alicia

    2010-01-01

    After the Costa Rican government signed a commitment to implement the UN Decade of Education for Sustainable Development (DESD), the challenge was how to put the commitment into action. Fortunately, an opportunity presented itself with an initiative called Peace with Nature (Iniciativa Paz con la Naturaleza-IPN), under which a teacher training…

  12. First report of Phakopsora pachyrhizi on soybean in Costa Rica

    USDA-ARS?s Scientific Manuscript database

    American soybean rust, caused by Phakopsora meibomiae, has been reported to occur in several legume species in the tropical regions of Central and South America. In Costa Rica, this pathogen was initially reported as P. pachyrhizi; however, to our knowledge P. pachyrhizi has not been detected in the...

  13. The Educational System of Costa Rica. Education Around the World.

    ERIC Educational Resources Information Center

    Gill, Clark C.

    This booklet reviews Costa Rica's educational system, with emphasis on finance, philosophy, administration, and teacher education. The basic educational system consists of a preschool level of at least one year; a general basic education level of nine years (divided into three cycles of three years duration each--the first two cycles represent…

  14. Environmental Education for Democracy and Social Justice in Costa Rica

    ERIC Educational Resources Information Center

    Locke, Steven

    2009-01-01

    This study focused on how democratic values and citizenship education are promoted through environmental education in Costa Rica. Data were collected through the examination of textbook and curriculum guides and interviews with classroom teachers. The qualitative study utilized Bowers' (2001) and Gruenewald's (2003) theories of eco-justice and…

  15. First 5 Contra Costa Report on Parent Involvement. Final Report

    ERIC Educational Resources Information Center

    Duffy, Sarah; Induni, Marta; Moiduddin, Emily

    2010-01-01

    This report presents the results of the Parental Involvement in Pre-School Telephone Interview study completed by Mathematica Policy Research for the First 5 Contra Costa Children and Families Commission. Parent involvement in children's preschool programs and learning experiences is proven to be positively associated with cognitive, academic,…

  16. Empowering Women through Photovoice: Women of La Carpio, Costa Rica

    ERIC Educational Resources Information Center

    Morgan, Mary Y.; Vardell, Rosemarie; Lower, Joanna K.; Kinter-Duffy, Ibarra, Laura C.; Victoria L.; Cecil-Dyrkacz, Joy E.

    2010-01-01

    The purpose of the project was to allow participants to document, critique, and change their family and community conditions through photographs and stories of their everyday lives. This study used photovoice, a participatory action research methodology, with 7 women from La Carpio, Costa Rica. The women were given cameras and asked to photograph…

  17. Rewriting Citizenship? Civic Education in Costa Rica and Argentina

    ERIC Educational Resources Information Center

    Suarez, David F.

    2008-01-01

    To what degree are nations "rewriting" citizenship by expanding discussions of human rights, diversity and cultural pluralism in modern civic education, and what explains variation between countries? This study addresses these issues by analysing the intended content of civic education in Costa Rica and Argentina. Over time, civic…

  18. Environmental Education for Democracy and Social Justice in Costa Rica

    ERIC Educational Resources Information Center

    Locke, Steven

    2009-01-01

    This study focused on how democratic values and citizenship education are promoted through environmental education in Costa Rica. Data were collected through the examination of textbook and curriculum guides and interviews with classroom teachers. The qualitative study utilized Bowers' (2001) and Gruenewald's (2003) theories of eco-justice and…

  19. Contra Costa Community College District Vocational Education Report.

    ERIC Educational Resources Information Center

    Contra Costa Community Coll. District, Martinez, CA. Office of District Research.

    This report provides an overview of the legislative and administrative context of Vocational Education and profiles Vocational Education nationally, statewide, and at Contra Costa Community College District (CCCCD). Certain national trends, economic trends, and labor market trends have created implications for vocational and technical education in…

  20. Inventory of Vocational Programs in Alameda and Contra Costa Counties.

    ERIC Educational Resources Information Center

    Banaghan, William F., Comp.

    The document presents a directory of vocationally oriented educational programs which already exist in Alameda and Contra Costa Counties, California. It is hoped that the inventory will permit improved planning for future programs and greater utilization and coordination of present ones. Listings include: Directory of Educational Agencies, with…

  1. Disability and Rehabilitation in Rural Costa Rica. Occasional Paper 3.

    ERIC Educational Resources Information Center

    de Mezerville, Gaston

    To assist the Costa Rican Social Security Systems in designing a Rural Community Comprehensive Health Model, a study identified functional limitations among 1253 persons over age 7; assessed functional development of 293 children, ages 0-6; identified possible preventive factors of disability; and explored practices and resources in the districts…

  2. The genus Neotherina Dognin (Geometridae, Ennominae) in Costa Rica.

    PubMed

    Sullivan, J Bolling; Chacón, Isidro

    2011-01-01

    So far, two species of Neotherina Dognin have been recorded in Costa Rica. Neotherina imperilla (Dognin) occurs primarily at altitudes between 1100 and 1700 meters and Neotherina callas (Druce) which is widely distributed above 1100 meters. A third, new species, Neotherina xanthosa Sullivan and Chacón is described from altitudes above 2400 meters. Heterogeneity of the genus is discussed.

  3. Electronic Invoice in Costa Rica: Challenges for Its Implementation

    ERIC Educational Resources Information Center

    Ramírez-Jiménez, Juan José; De La O-Selva, Mario; Cortés-Morales, Roberto

    2016-01-01

    This paper discusses the current situation that Costa Rica faces around fiscal issues and high evasion rates. Using actors and multidimensional analysis, it proposes the electronic invoice as an e-government strategic solution that will close the gap around tax evasion and the government incomes. The success achieved by Brazil in this area…

  4. Costa Rica: Background and U.S. Relations

    DTIC Science & Technology

    2009-06-02

    for ecotourism . The United States and Costa Rica have long enjoyed close relations as a result of the countries’ shared commitments to strengthening...for ecotourism . Uncontrolled development and the overuse of some protected areas, however, have drawn criticism from environmentalists.28 Although

  5. Citizenship, Wealth, and Whiteness in a Costa Rican High School

    ERIC Educational Resources Information Center

    Stocker, Karen

    2005-01-01

    This article addresses the democratic rhetoric taught in a Costa Rican High School and the ways in which that rhetoric clashed with school practices that revealed hierarchies based on race, ethnicity, class, and religion. This contradiction was rendered visible through student elections, the Independence Day celebration, and civic acts. Through…

  6. Oscar Costa-Mandry and posthurricane bacillary dysentery.

    PubMed

    Christenson, Bernard

    2006-06-01

    After the recent hurricanes Katrina and Rita, outbreaks of waterborne viral and bacterial diseases were expected. Dr. Oscar Costa-Mandry, a Puerto Rican bacteriologist and epidemiologist in the 1930s, identified the relationship between hurricanes and epidemic bacillary dysentery in townships that were directly affected by hurricanes.

  7. Data Integration and Analysis System (DIAS) Contributing to the Sustainable Development Goals (SDGs)

    NASA Astrophysics Data System (ADS)

    Koike, T.

    2014-12-01

    It has been said that scientists and experts usually use 80% of their research time for data management (DOE, 2002). Only 20% of research time is used for purely scientific activities. This ratio should be reversed by introducing computer science technology. To realize this goal, the Japanese government supported the development of a data system called "Data Integration and Analysis System (DIAS)," as one of the national key projects promoted by the Council for Science and Technology Policy (CSTP) from 2006 to 2010. A follow-up 5-year project is also ongoing. The essential aim for the DIAS was to create knowledge that would enable solutions to problems and generate socioeconomic benefits. DIAS mainly consists of four data components including data injection, management, integration, and interoperability. DIAS is now tackling a large increase in the diversity and volume of data from observing the Earth. Dictionaries have been developing an ontology system for technical and geographical terms, and a metadata design has been completed according to international standards. The volume of data stored has exponentially increased. Previously, almost all of the large-volume data came from satellites, but model outputs occupy the largest volume of our data storage nowadays. In collaboration with scientific and technological groups, DIAS can accelerate data archiving by including data loading, quality checking, metadata registration, and our system data-searching capability is being enriched. DIAS also enables us to perform integrated research and realize interdisciplinarity. Essentially, we are now working in the fields of climate, water resources, food, fisheries, and biodiversity by collaborating between different disciplines and trying to develop bases of contribution to Sustainable Development Goals (SDGs).

  8. Rights of the Child in Costa Rica: Report Concerning the Application of the Convention on the Rights of the Child by the Republic of Costa Rica.

    ERIC Educational Resources Information Center

    Melo, Luz Angela

    This report to the United Nations Committee on the Rights of the Child contains observations of the World Organisation Against Torture (OMCT) concerning the application of the U.N. Convention on the Rights of the Child by the nation of Costa Rica. The report's introduction notes that in addition to ratifying the Convention, Costa Rica's…

  9. Rho activation of mDia formins is modulated by an interaction with inverted formin 2 (INF2)

    PubMed Central

    Sun, Hua; Schlondorff, Johannes S.; Brown, Elizabeth J.; Higgs, Henry N.; Pollak, Martin R.

    2011-01-01

    Inverted formin 2 (INF2) encodes a member of the diaphanous subfamily of formin proteins. Mutations in INF2 cause human kidney disease characterized by focal and segmental glomerulosclerosis. Disease-causing mutations occur only in the diaphanous inhibitory domain (DID), suggesting specific roles for this domain in the pathogenesis of disease. In a yeast two-hybrid screen, we identified the diaphanous autoregulatory domains (DADs) of the mammalian diaphanous-related formins (mDias) mDia1, mDia2, and mDia 3 as INF2_DID-interacting partners. The mDias are Rho family effectors that regulate actin dynamics. We confirmed in vitro INF2_DID/mDia_DAD binding by biochemical assays, confirmed the in vivo interaction of these protein domains by coimmunoprecipitation, and observed colocalization of INF2 and mDias in glomerular podocytes. We investigated the influence of this INF2_DID/mDia_DAD interaction on mDia mediated actin polymerization and on serum response factor (SRF) activation. We find that the interaction of INF2_DID with mDia_DAD inhibited mDia-mediated, Rho-activated actin polymerization, as well as SRF-responsive gene transcriptional changes. Similar assays using the disease-causing E184K and R218Q mutations in INF2_DID showed a decreased effect on SRF activation and gene transcription. The binding of INF2_DID to mDia_DAD may serve as a negative regulatory mechanism for mDias’ function in actin-dependent cell processes. The effects of disease-causing INF2 mutations suggest an important role for this protein and its interaction with other formins in modulating glomerular podocyte phenotype and function. PMID:21278336

  10. El Dia de la Raza Module. Secondary Level. [The Day of the Race Module. Secondary Level.

    ERIC Educational Resources Information Center

    Herrera, Gloria; Lizcano, Jeanette

    "El Dia de la Raza", considered the birthday of the mestizo, is the topic of this unit for the secondary level. As unit objectives, the students are to demonstrate (1) their comprehension by stating 3 major areas of contributions the Indians and the Spaniards gave the mestizo culture and (2) their concept of mestizaje by participating in…

  11. El Dia de los Muertos -- Libreto. (The Day of the Dead -- Notebook.)

    ERIC Educational Resources Information Center

    Espinoza, Delia; Lopez, Santiago, III

    On November 2, all Mexican Americans remember their dead as Mexico does on that same day. Called "El Dia de los Muertos" (Day of the Dead), the dead are remembered posthumously with flowers, candles, music, prayers, chants, and wreaths. The people go to cemeteries to clean tombs, lay fresh or artificial flowers on them, and pray for…

  12. Los Dias de Los Muertos. The Days of the Dead. 1991 Edition.

    ERIC Educational Resources Information Center

    Lane, Sarah; Turkovich, Marilyn

    The Dias de los Muertos is a celebration of Mexico that is a recognition of mortality, transience, and death, and a celebration of life, hope, and resurrection. This curriculum activity book begins with a general introduction to the festival followed by sections of explanations and activities intended to engage the learner in various aspects of…

  13. Collaboration using open standards and open source software (examples of DIAS/CEOS Water Portal)

    NASA Astrophysics Data System (ADS)

    Miura, S.; Sekioka, S.; Kuroiwa, K.; Kudo, Y.

    2015-12-01

    The DIAS/CEOS Water Portal is a part of the DIAS (Data Integration and Analysis System, http://www.editoria.u-tokyo.ac.jp/projects/dias/?locale=en_US) systems for data distribution for users including, but not limited to, scientists, decision makers and officers like river administrators. One of the functions of this portal is to enable one-stop search and access variable water related data archived multiple data centers located all over the world. This portal itself does not store data. Instead, according to requests made by users on the web page, it retrieves data from distributed data centers on-the-fly and lets them download and see rendered images/plots. Our system mainly relies on the open source software GI-cat (http://essi-lab.eu/do/view/GIcat) and open standards such as OGC-CSW, Opensearch and OPeNDAP protocol to enable the above functions. Details on how it works will be introduced during the presentation. Although some data centers have unique meta data format and/or data search protocols, our portal's brokering function enables users to search across various data centers at one time. And this portal is also connected to other data brokering systems, including GEOSS DAB (Discovery and Access Broker). As a result, users can search over thousands of datasets, millions of files at one time. Users can access the DIAS/CEOS Water Portal system at http://waterportal.ceos.org/.

  14. From Yoknapatawpha to Piratininga and Beyond: Antônio Dutra's "Dias De Faulkner"

    ERIC Educational Resources Information Center

    Valente, Luiz Fernando

    2015-01-01

    By reimagining William Faulkner's 1954 visit to Brazil, Antônio Dutra's "Dias de Faulkner" (2008) establishes a creative dialogue with Faulkner's "oeuvre" while also inquiring into the author's enigmatic personality. In the process Dutra's narrative invites us to reflect on the complex and contradictory relationship between the…

  15. From Yoknapatawpha to Piratininga and Beyond: Antônio Dutra's "Dias De Faulkner"

    ERIC Educational Resources Information Center

    Valente, Luiz Fernando

    2015-01-01

    By reimagining William Faulkner's 1954 visit to Brazil, Antônio Dutra's "Dias de Faulkner" (2008) establishes a creative dialogue with Faulkner's "oeuvre" while also inquiring into the author's enigmatic personality. In the process Dutra's narrative invites us to reflect on the complex and contradictory relationship between the…

  16. Un Dia Nuevo for Schools. 2000 & Beyond: The Changing Face of American Schools.

    ERIC Educational Resources Information Center

    Zehr, Mary Ann

    2000-01-01

    This issue, the third in a series on the demographic forces shaping public education in the United States, examines the effect of the influx of Hispanic American and Indian immigrants. The first section, "Una Dia Nuevo for Schools," discusses how schools must adjust as Hispanic immigrants fan out to areas beyond those where they have…

  17. Health without wealth? Costa Rica's health system under economic crisis.

    PubMed

    Morgan, L M

    1987-01-01

    The recent history of Costa Rica's health system is reviewed, emphasizing the health-related effects of the economic crisis of the 1980s. This economic crisis has stopped and in some instances reversed the marked health improvements Costa Rica realized during the decade of the 1970s. The effects of the economic crisis emerge in 4 areas: deterioration in health status, as poverty contributed to higher disease rates; reductions in the government's ability to maintain public health and medical services; increased reliance on foreign aid to finance the health system; and growing national debate over the role of the state in health care. The result of the economic crisis was a reduction in health services and a questioning of the Costa Rican health model. This occurred following the implementation of an expensive health infrastructure and at a time when people most needed health services. During the 1941-70 period, domestic initiative can account for much of the expansion of Costa Rica's social security system, but also at this time international agencies such as the US Agency for International Development (USAID) and the Inter-American Development began to assist in the expansion of the health system. In 1971 a plan was initiated to create a nationalized health system. By 1980 the success of the health sector reorganization was evident in the statistics: marked improvements in life expectancy, infant mortality, and infectious disease mortality had surpassed the goals set by the Pan American Health Organization (PAHO) and the Ministry of Health. Costa Rica's success was a vindication of both policy goals and funding priorities, for it has been "proved" that primary health care was capable of improving health indices, particularly where the agencies had the active and conscientious support of the national government. By 1977, foreign contracts for aid had expired, and the Ministry declared that the rural health program would be supported totally by the government. The

  18. Diversity and levels of endemism of the Bromeliaceae of Costa Rica - an updated checklist.

    PubMed

    Cáceres González, Daniel A; Schulte, Katharina; Schmidt, Marco; Zizka, Georg

    2013-01-01

    An updated inventory of the Bromeliaceae for Costa Rica is presented including citations of representative specimens for each species. The family comprises 18 genera and 198 species in Costa Rica, 32 species being endemic to the country. Additional 36 species are endemic to Costa Rica and Panama. Only 4 of the 8 bromeliad subfamilies occur in Costa Rica, with a strong predominance of Tillandsioideae (7 genera/150 spp.; 75.7% of all bromeliad species in Costa Rica). 124 species (62.6%) grow exclusively epiphytic, additional 59 spp. (29.8%) are facultative epiphytes. The most diverse genus is Werauhia, with 59 species (29.8% of the Costa Rican bromeliad flora), followed by Tillandsia with 40 species (20.2%) and Guzmania with 28 spp. (8.6%).

  19. Diversity and levels of endemism of the Bromeliaceae of Costa Rica – an updated checklist

    PubMed Central

    Cáceres González, Daniel A.; Schulte, Katharina; Schmidt, Marco; Zizka, Georg

    2013-01-01

    Abstract An updated inventory of the Bromeliaceae for Costa Rica is presented including citations of representative specimens for each species. The family comprises 18 genera and 198 species in Costa Rica, 32 species being endemic to the country. Additional 36 species are endemic to Costa Rica and Panama. Only 4 of the 8 bromeliad subfamilies occur in Costa Rica, with a strong predominance of Tillandsioideae (7 genera/150 spp.; 75.7% of all bromeliad species in Costa Rica). 124 species (62.6%) grow exclusively epiphytic, additional 59 spp. (29.8%) are facultative epiphytes. The most diverse genus is Werauhia, with 59 species (29.8% of the Costa Rican bromeliad flora), followed by Tillandsia with 40 species (20.2%) and Guzmania with 28 spp. (8.6%). PMID:24399894

  20. HAN11 binds mDia1 and controls GLI1 transcriptional activity.

    PubMed

    Morita, Kazumasa; Lo Celso, Cristina; Spencer-Dene, Bradley; Zouboulis, Christos C; Watt, Fiona M

    2006-10-01

    The Hedgehog pathway is important in normal and diseased skin. One of the key transcription factors in the pathway is GLI1. GLI1-dependent transcription is positively regulated by DYRK1A, which is reported to bind HAN11. HAN11 is the human homologue of AN11, which controls flavonoid synthesis in plants. We wanted to identify other binding partners of HAN11 and investigate whether HAN11 regulates GLI1-dependent transcription. We used TAP-tag purification and GST pull down to identify protein-protein interactions and performed luciferase assays of transcriptional activity. We used immunofluorescence microscopy to examine the subcellular distribution of HAN11, mDia1 and GLI1. We performed in situ hybridisation to compare expression of HAN11 with GLI1 and patched in mouse embryos. We identified the cytoskeletal regulator mDia1 as a binding partner of HAN11. We showed that HAN11 binds the FH2 actin binding domain of mDia1 and confirmed that HAN11 also interacts with DYRK1A. Overexpression of mDia1 or active RhoA caused translocation of HAN11 from nucleus to cytoplasm. HAN11 and mDia1 repressed DYRK1A-dependent GLI1 transcriptional activity. HAN11 overexpression decreased SZ95 sebocyte proliferation and increased cytoplasmic GLI1. AN11 was highly expressed in E10.5 mouse embryo limb buds, in an overlapping pattern with Ptc and GLI1. These results suggest that AN11 may be a physiological regulator of GLI1 transcriptional activity.

  1. Diarrheagenic Escherichia coli in Children from Costa Rica

    PubMed Central

    Pérez, Cristian; Gómez-Duarte, Oscar G.; Arias, María L.

    2010-01-01

    More than 5,000 diarrheal cases per year receive medical care at the National Children's Hospital of Costa Rica, and nearly 5% of them require hospitalization. A total of 173 Escherichia coli strains isolated from children with diarrhea were characterized at the molecular, serologic, and phenotypic level. Multiplex and duplex polymerase chain reactions were used to detect the six categories of diarrheagenic E. coli. Thirty percent (n = 52) of the strains were positive, indicating a high prevalence among the pediatric population. Enteropathogenic E. coli and enteroinvasive E. coli pathotypes were the most prevalent (21% and 19%, respectively). Pathogenic strains were distributed among the four E. coli phylogenetic groups A, B1, B2, and D, with groups A and B1 the most commonly found. This study used molecular typing to evaluate the prevalence of diarrheagenic E. coli reported in Costa Rica and demonstrated the importance of these pathotypes in the pediatric population. PMID:20682870

  2. Agricultural "killing fields": the poisoning of Costa Rican banana workers.

    PubMed

    Sass, R

    2000-01-01

    The poisoning of Costa Rican banana workers by multinational corporations' excessive use of pesticides is not a local issue; it is embedded in a dominant ideology expressed by the phenomenon of globalization. This ideology seeps into every aspect of our social institutions--economic, political, and legal. The practice of this ideological perspective is evident in the industrialization of global agriculture and the shift from "developmentalism"--liberal welfarism, industrialization, and urbanization--to a dominant, undemocratic, global financial elite with "economism" and a neoliberal political agenda overriding the nation-state polis. A specific effect is to transform the agricultural workers of developing countries, such as Costa Rican banana workers, into politically superfluous flesh-and-blood human beings.

  3. [Abnormal haemoglobins in the newborn human population of Costa Rica].

    PubMed

    Abarca, Gabriela; Navarrete, Marta; Trejos, Rafael; de Céspedes, Carlos; Saborío, Manuel

    2008-09-01

    Hemoglobinopathies are hereditary autosomic recessive diseases. A total of 70 943 samples of whole blood collected by heel prick in filter paper (S&S 903) from throughout Costa Rica (October 2005-October 2006) were analyzed to detect variants of hemoglobin by the iso-electric focusing technique. Eight hundred ninety one cases presented some variant, for a frecuency of 1/79. Five cases are homozygous for hemoglobin S (sickle cell disease) and one shows the double heterozygous genotype SC. In this study the S and C variants of hemoglobin, although with some local differences, are widespread all over the country. Thus, the prevention of new cases is important through the testing of hemoglobin in the Costa Rican National Newborn Screening Program, together with a Interdisciplinary National Program of Education for the disease and carrier status (AS/AC) for patients, families and medicar personnel. This is the basis for proper genetic counseling, to improve treatment and to reduce morbi-mortality.

  4. MEDISE: A macroeconomic model for energy planning in Costa Rica

    SciTech Connect

    Booth, S.R. ); Leiva, C.L. . Direccion Sectorial de Energia)

    1991-08-01

    This report describes the development and results of MEDISE, an econometric macroeconomic model for energy planning in Costa Rica. The model is a simultaneous system of 19 equations that was constructed using ENERPLAN, an energy planning tool developed by the United Nations for use in developing countries. The equations were estimated using regression analysis on a data time series of 1966 to 1984. ENERPLAN's model solution package was used to obtain forecasts of 19 economic variables from 1985 to 2005. the modeling effort was conducted jointly by Los Alamos Central American Energy and Resources Project (CAP) personnel and the Energy Sector Directorate of Costa Rica during 1986. The CAP was funded by the US Agency for International Development. 6 refs., 3 figs., 11 tabs.

  5. Molecular Characterization of Two Major Dengue Outbreaks in Costa Rica.

    PubMed

    Soto-Garita, Claudio; Somogyi, Teresita; Vicente-Santos, Amanda; Corrales-Aguilar, Eugenia

    2016-07-06

    Dengue virus (DENV) (Flavivirus, Flaviviridae) is a reemerging arthropod-borne virus with a worldwide circulation, transmitted mainly by Aedes aegypti and Aedes albopictus mosquitoes. Since the first detection of its main transmitting vector in 1992 and the invasion of DENV-1 in 1993, Costa Rica has faced dengue outbreaks yearly. In 2007 and 2013, Costa Rica experienced two of the largest outbreaks in terms of total and severe cases. To provide genetic information about the etiologic agents producing these outbreaks, we conducted phylogenetic analysis of viruses isolated from human samples. A total of 23 DENV-1 and DENV-2 sequences were characterized. These analyses signaled that DENV-1 genotype V and DENV-2 American/Asian genotype were circulating in those outbreaks. Our results suggest that the 2007 and 2013 outbreak viral strains of DENV-1 and DENV-2 originated from nearby countries and underwent in situ microevolution. © The American Society of Tropical Medicine and Hygiene.

  6. Molecular Characterization of Two Major Dengue Outbreaks in Costa Rica

    PubMed Central

    Soto-Garita, Claudio; Somogyi, Teresita; Vicente-Santos, Amanda; Corrales-Aguilar, Eugenia

    2016-01-01

    Dengue virus (DENV) (Flavivirus, Flaviviridae) is a reemerging arthropod-borne virus with a worldwide circulation, transmitted mainly by Aedes aegypti and Aedes albopictus mosquitoes. Since the first detection of its main transmitting vector in 1992 and the invasion of DENV-1 in 1993, Costa Rica has faced dengue outbreaks yearly. In 2007 and 2013, Costa Rica experienced two of the largest outbreaks in terms of total and severe cases. To provide genetic information about the etiologic agents producing these outbreaks, we conducted phylogenetic analysis of viruses isolated from human samples. A total of 23 DENV-1 and DENV-2 sequences were characterized. These analyses signaled that DENV-1 genotype V and DENV-2 American/Asian genotype were circulating in those outbreaks. Our results suggest that the 2007 and 2013 outbreak viral strains of DENV-1 and DENV-2 originated from nearby countries and underwent in situ microevolution. PMID:27139442

  7. Benefit-cost assessment programs: Costa Rica case study

    SciTech Connect

    Clark, A.L. ); Trocki, L.K. )

    1991-01-01

    An assessment of mineral potential, in terms of types and numbers of deposits, approximate location and associated tonnage and grades, is a valuable input to a nation's economic planning and mineral policy development. This study provides a methodology for applying benefit-cost analysis to mineral resource assessment programs, both to determine the cost effectiveness of resource assessments and to ascertain future benefits to the nation. In a case study of Costa Rica, the benefit-cost ratio of a resource assessment program was computed to be a minimum of 4:1 ($10.6 million to $2.5 million), not including the economic benefits accuring from the creation of 800 mining sector and 1,200 support services jobs. The benefit-cost ratio would be considerably higher if presently proposed revisions of mineral policy were implemented and benefits could be defined for Costa Rica.

  8. The Orbiniidae (Annelida: Polychaeta) of Pacific Costa Rica.

    PubMed

    Dean, Harlan K; Blake, James A

    2015-05-08

    Seven species of Orbiniidae are described from the Pacific coast of Costa Rica including two new species. Leodamas hamatus n. sp., a commonly occurring species on the coast of Pacific Costa Rica, is described from 11‒18 m in the Gulf of Nicoya and Bahia Culebra. This species is unusual in that the neuropodial uncini differ morphologically from anterior to posterior in the thorax. Scoloplos cryptospinigerus n. sp. is described from 18-22 m in the Gulf of Nicoya and has only a few short, toothed spines amidst numerous capillary setae in most of the thoracic neuropodia. This arrangement of thoracic neurosetae is unusual and has been seen only in one other described species of Scoloplos from Australia.

  9. New records of fishes at Isla del Coco, Costa Rica

    USGS Publications Warehouse

    Garrison, V.H.

    1996-01-01

    Isla del Coco lies at 5 degrees 32'N latitude, 87 degrees 04'W longitude and is the sole peak of the Cocos Ridge exposed above sea level. This isolated island formed approximately 2 million years ago. It rises 575 m above the surface of the sea and covers 46 km2 (Castillo et aI., 1988). Five hundred km to the NNE is Costa Rica; 630 km SSW are the Galapagos Islands; 650 km to the E is Isla Malpelo, Colombia; and approximately 8,000 km W lie the Line Islands. Costa Rica claimed Isla del Coco in 1832 and declared it a National Park in 1978. The area of the park was increased to include the adjacent waters 5 km offshore in 1984 and 25 km offshore in 1991.

  10. Area Handbook Series: Costa Rica, a Country Study.

    DTIC Science & Technology

    1983-11-01

    largest source of Costa Rica’s imports. Other significant import sources were CACM, EEC, and Japan; since 1980 large imports of pet- roleum from Mexico ...the wealth in gold and silver of the sort the Spaniads exploited in Mexico and other parts of Latin America. Consequently, a pernment Spanish...native population, each family had to work in the fields to maintain itself. The col- ony’s relative isolation from the Spanish colonial centers in Mexico

  11. [Organochlorine pesticide residues in human adipose tissue in Costa Rica].

    PubMed

    Barquero, M; Constenla, M A

    1986-06-01

    Organochlorine pesticide residues were found in 82 samples of human adipose material from 82 surgical cases in 16 Costa Rica hospitals. Identification was made by gas-liquid chromatography. The highest pesticide concentration was that of DDT and its metabolites (33.16 micrograms/g). Residues of almost all commercial pesticides were also found. Concentrations of alpha-chlordane. Aldrin and Polychlorinated biphenyls were not significant.

  12. Contra Costa Community College District Enrollment Report, October 2000.

    ERIC Educational Resources Information Center

    Contra Costa Community Coll. District, Martinez, CA.

    This report analyzes enrollment figures for Contra Costa Community College District in 2000-2001. The data for 2002 is compared with the data from 1997-1998, 1998-1999, and 1999-2000. The following are some of the major findings of the report: (1) both resident and non-resident FTES totals have increased over 1995/1996 levels; (2) the growth…

  13. Population genetic data for 18 STR loci in Costa Rica.

    PubMed

    Rodríguez, A; Arrieta, G; Sanóu, I; Vargas, M C; García, O; Yurrebaso, I; Pérez, J A; Villalta, M; Espinoza, M

    2007-05-03

    Allele frequencies for 18 STR autosomal loci (D3S1358, VWA, FGA, D8S1179, D21S11, D18S51, D5S818, D13S317, D7S820, D16S539, TH01, TPOX, CSF1PO, Penta D, Penta E, D19S433, D2S1338 and SE33) were obtained from a sample of 191-500 unrelated individuals from Costa Rica, Central America.

  14. (Findings of the Costa Rica power sector efficiency study)

    SciTech Connect

    Waddle, D.B.

    1990-10-08

    To present findings of the Costa Rica Power Sector Efficiency Study to the Instituto Costarricense de Electridad, and to the Ministry of Energy, Natural Resources and Mining. To discuss the progress and plans for the Central American Rural Electrification Project with US Agency for International Development (USAID)/Regional Office Central American Program (ROCAP). I traveled to San Jose, Costa Rica to present the findings of the Costa Rica Power Sector Efficiency Study to our counterparts in the utility and the Ministry of Energy. Discussions were held with line level managers at Instituto Costarricensede Electricidad (ICE) and Ministry of Energy Mines and Natural Resources (MIRENEM), as well as a plan of action set for the final stage of the project. Discussions were held for a one day period with both the bilateral Agency for International Development (AID) and the regional AID mission regarding the need for a similar study in Guatemala and matters directly pertaining to the Central American Rural Electrification Study (CARES) project.

  15. Costa Rica regroups for sales kick-off.

    PubMed

    1985-01-01

    Cost Rica's contraceptive social marketing project is scheduled to be launched in March 1985. The project is run through a for-profit corporation, Asdecosta, which is owned by the Costa Rican International Planned Parenthood affiliate. Asdecosta was formed as a for-profit entity because Costa Rican law prohibits product sales by nonprofit groups. The US Agency for International Development (AID) will allocate US$1.2 million over a 5-year period, 1983-88. The project manager, Jorge Lopez, is an economist with considerable experience in marketing. The project has lined up a top national distributor, a packaging company, and an advertising agency for its 1st product, a condom manufactured in the US by Ansell. Asdecost's target market is projected to include 50,000-75,000 couples at its peak operating capacity. An estimated 65% of Costa Rican women have used a contraceptive method at some time. The condom, pill, and IUD are the most popular methods. Eventually, Asdecosta expects to expand its product line to include oral contraceptives. Another goal is to counter the high drop out rate among users of government and other family planning services.

  16. [Determinants of health care utilization in Costa Rica].

    PubMed

    Morera Salas, Melvin; Aparicio Llanos, Amada

    2010-01-01

    To analyze the determinants of health care utilization (visits to the doctor) in Costa Rica using an econometric approach. Data were drawn from the National Survey of Health for Costa Rica 2006. We modeled the Grossman approach to the demand for health services by using a standard negative binomial regression, and used a hurdle model for the principal-agent specification. The factors determining healthcare utilization were level of education, self-assessed health, number of declared chronic diseases and geographic region of residence. The number of outpatient visits to the doctor depends on the proxies for medical need, but we found no multivariate association between the use of outpatient visits and income or insurance status. This result suggests that there is no problem with access in the public - almost universal - Costa Rican health system. No conclusive results were obtained on the influence of the physician on the frequency of use of health care services, as postulated by the principal-agent model. Copyright © 2010 SESPAS. Published by Elsevier Espana. All rights reserved.

  17. A guide to the winged aphids (Homoptera) of Costa Rica.

    PubMed

    Voegtlin, David; Villalobos, William; Sánchez, Marco Vinicio; Saborio-R, Guido; Rivera, Carmen

    2003-05-01

    This guide is a compilation of limited morphological and biological information on the winged morphs of 60 species of aphids that have been collected in Costa Rica. It should not be viewed as a definitive taxonomic treatise on the aphids of Costa Rica, rather it is a tool that can be used to assist in research on the biology, host plant relationships, taxonomy, and virus transmission capabilities of aphids. Each species is covered in an identical manner. Morphological and biological information is provided in both Spanish and English as well as photographs of slide mounted specimens. Keys are provided to help the user in identifying the species. Most of the specimens examined were taken in traps associated with epidemiological studies. Limited field collecting has generated host records and these have been added to a list of the aphids of Central America that was compiled by Pamela Anderson and appended in the guide with her permission. The authors hope that this book will be useful to entomologists in Costa Rica and Central America.

  18. Arcobacter Isolation from Minced Beef Samples in Costa Rica.

    PubMed

    Córdoba-Calderón, Oscar; Redondo-Solano, Mauricio; Castro-Arias, Eduardo; Arias-EchandI, María Laura

    2017-04-03

    The presence of Arcobacter spp. in minced meat (including beef) samples has been well documented in different countries, with varying frequencies. Nevertheless, the only Latin American country reporting this bacterium in minced beef samples is Mexico, with a 28.8% frequency in 2003. Previous studies in Costa Rica have demonstrated the presence of Arcobacter species in samples taken from the poultry production chain, but still there are no studies performed in bovine meat. The aim of this study was to determine the frequency of this bacterium in 120 samples of minced beef acquired from the Central Valley region of Costa Rica and to describe the antibiotic sensitivity pattern of the isolates obtained. A total of 75 different Arcobacter strains were isolated from minced beef samples, for a final frequency of 48.3%. After species PCR identification, the strains were classified as A. butzleri (37.3%), A. cibarius (14.7%), A. thereius (12%), and Arcobacter spp. (36%). All samples were sensitive to gentamicin but were resistant to ampicillin, levofloxacin, nalidixic acid, and ciprofloxacin. The results obtained in this study show that the frequency of isolation of Arcobacter in minced beef samples is high and that there is a high resistance rate for antibiotics in common use. This suggests that Arcobacter represents a health risk for Costa Rica and that control measures should be developed to decrease its potential impact.

  19. Retinopathy of prematurity: screening and treatment in Costa Rica.

    PubMed

    Tabarez-Carvajal, Ana Catalina; Montes-Cantillo, Milagro; Unkrich, Kelly H; Trivedi, Rupal H; Peterseim, Mae Millicent Winfrey

    2017-04-12

    To determine the recent demographic data, risk factors and results of retinopathy of prematurity (ROP) screening and treatment in Costa Rica. The medical records of all preterm infants meeting ROP screening criteria (≤34 weeks' gestational age (GA) or birth weight (BW) ≤1750g, and those determined at risk by neonatologists) in the national healthcare system, Costa Rica, January 2010-December 2014, were retrospectively reviewed. The numbers and percentages of infants with ROP, risk factors, percentage of patients treated and treatment outcomes were determined. Comparison is made with screening criteria and literature reports of ROP incidence in other countries. The study population included 3018 preterm infants. Overall, 585 patients (585/3018, 19.4%) were found to have ROP. Of these, 15.4% (90 patients) required laser treatment, and 53% of those requiring treatment had BW <1000g. Five babies requiring treatment were ≥32 weeks' GA but with BW ≤1750g. Aggressive posterior disease was found in nine patients, and two infants of those screened (2/3018, 0.07%) suffered severe visual impairment during the 5-year study period. We provide comprehensive data of ROP care in Costa Rica allowing assessment and comparison of screening criteria and protocol. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  20. The Guanacaste Volcanic Arc Sliver of Northwestern Costa Rica.

    PubMed

    Montero, Walter; Lewis, Jonathan C; Araya, Maria Cristina

    2017-05-11

    Recent studies have shown that the Nicoya Peninsula of northwestern Costa Rica is moving northwestward ~11 mm a(-1) as part of a tectonic sliver. Toward the northwest in El Salvador the northern sliver boundary is marked by a dextral strike-slip fault system active since Late Pleistocene time. To the southeast there is no consensus on what constitutes the northern boundary of the sliver, although a system of active crustal faults has been described in central Costa Rica. Here we propose that the Haciendas-Chiripa fault system serves as the northeastern boundary for the sliver and that the sliver includes most of the Guanacaste volcanic arc, herein the Guanacaste Volcanic Arc Sliver. In this paper we provide constraints on the geometry and kinematics of the boundary of the Guanacaste Volcanic Arc Sliver that are timely and essential to any models aimed at resolving the driving mechanism for sliver motion. Our results are also critical for assessing geological hazards in northwestern Costa Rica.

  1. Canine Distemper Virus in Wild Felids of Costa Rica.

    PubMed

    Avendaño, Roberto; Barrueta, Flor; Soto-Fournier, Sofía; Chavarría, Max; Monge, Otto; Gutiérrez-Espeleta, Gustavo A; Chaves, Andrea

    2016-04-28

    Several highly infectious diseases can be transmitted through feces and cause elevated mortality among carnivore species. One such infectious agent, canine distemper virus (CDV; Paramyxoviridae: Morbillivirus), has been reported to affect wild carnivores, among them several felid species. We screened free-ranging and captive wild carnivores in Costa Rica for CDV. Between 2006 and 2012, we collected 306 fecal samples from 70 jaguars (Panther onca), 71 ocelots ( Leopardus pardalis ), five jaguarundis (Puma yaguaroundi), 105 pumas ( Puma concolor ), five margays ( Leopardus wiedii ), 23 coyotes ( Canis latrans ), and 27 undetermined Leopardus spp. We found CDV in six individuals: one captive jaguarundi (rescued in 2009), three free-ranging ocelots (samples collected in 2012), and two free-ranging pumas (samples collected in 2007). Phylogenetic analyses were performed using sequences of the phosphoprotein (P) gene. We provide evidence of CDV in wild carnivores in Costa Rica and sequence data from a Costa Rican CDV isolate, adding to the very few sequence data available for CDV isolates from wild Central American carnivores.

  2. Socioeconomic development, health interventions and mortality decline in Costa Rica.

    PubMed

    Rosero-Bixby, L

    1991-01-01

    Costa Rica, whose life expectancy was 74 years by 1985, has reached a health level comparable to a developed country. The health achievements of this country are product of political and socioeconomic circumstances as well as of right public health policies. Until about 1970 the features of Costa Rica mortality, although somewhat better than the Latin American average, evolved in a similar way to the rest of the region. In particular, the decades of 1940s and 1950s saw dramatic improvements in life expectancy, thanks mainly to the import of low-cost, high-effectiveness health technologies. In the 1970s, however, Costa Rica departed from a regional pattern of stagnation and managed to close the gap with developed countries in terms of mortality levels. A dramatic decline in the infant mortality rate from 60 to 19 per 1,000 took place in this decade. The main determinants of this breakthrough were health interventions, notably a primary health care program, even though favorable socioeconomic conditions and a reduced fertility also played a role. Ecological data and other evidence suggest that up to three fourths of the mortality decline was accounted for contemporary improvements in public health services, with about 40 percent attributable to primary health care interventions. Furthermore, by targeting interventions on the less privileged population, these interventions had the merit of reducing geographic and socioeconomic differentials in child mortality.

  3. The E-Learning Readiness of Cyprus Primary Teachers Ahead of Dias System Integration into Cyprus Schools

    ERIC Educational Resources Information Center

    Hadjiathanasiou, Panayiota

    2009-01-01

    This research study aimed to evaluate the e-learning readiness of Cyprus's primary teachers ahead of DIAS web-platform integration into Cyprus's schools. The Cyprus Ministry of Education and Culture (MOEC) aims through DIAS to enhance the integration of e-learning in all areas of the curriculum in primary and secondary education. As the effective…

  4. Simultaneous Quantification of Viral Antigen Expression Kinetics Using Data-Independent (DIA) Mass Spectrometry.

    PubMed

    Croft, Nathan P; de Verteuil, Danielle A; Smith, Stewart A; Wong, Yik Chun; Schittenhelm, Ralf B; Tscharke, David C; Purcell, Anthony W

    2015-05-01

    The generation of antigen-specific reagents is a significant bottleneck in the study of complex pathogens that express many hundreds to thousands of different proteins or to emerging or new strains of viruses that display potential pandemic qualities and therefore require rapid investigation. In these instances the development of antibodies for example can be prohibitively expensive to cover the full pathogen proteome, or the lead time may be unacceptably long in urgent cases where new highly pathogenic viral strains may emerge. Because genomic information on such pathogens can be rapidly acquired this opens up avenues using mass spectrometric approaches to study pathogen antigen expression, host responses and for screening the utility of therapeutics. In particular, data-independent acquisition (DIA) modalities on high-resolution mass spectrometers generate spectral information on all components of a complex sample providing depth of coverage hitherto only seen in genomic deep sequencing. The spectral information generated by DIA can be iteratively interrogated for potentially any protein of interest providing both evidence of protein expression and quantitation. Here we apply a solely DIA mass spectrometry based methodology to profile the viral antigen expression in cells infected with vaccinia virus up to 9 h post infection without the need for antigen specific antibodies or other reagents. We demonstrate deep coverage of the vaccinia virus proteome using a SWATH-MS acquisition approach, extracting quantitative kinetics of 100 virus proteins within a single experiment. The results highlight the complexity of vaccinia protein expression, complementing what is known at the transcriptomic level, and provide a valuable resource and technique for future studies of viral infection and replication kinetics. Furthermore, they highlight the utility of DIA and mass spectrometry in the dissection of host-pathogen interactions.

  5. DiAs User Interface: A Patient-Centric Interface for Mobile Artificial Pancreas Systems

    PubMed Central

    Keith-Hynes, Patrick; Guerlain, Stephanie; Mize, Benton; Hughes-Karvetski, Colleen; Khan, Momin; McElwee-Malloy, Molly; Kovatchev, Boris P.

    2013-01-01

    Background Recent in-hospital studies of artificial pancreas (AP) systems have shown promising results in improving glycemic control in patients with type 1 diabetes mellitus. The next logical step in AP development is to conduct transitional outpatient clinical trials with a mobile system that is controlled by the patient. In this article, we present the user interface (UI) of the Diabetes Assistant (DiAs), an experimental smartphone-based mobile AP system, and describe the reactions of a round of focus groups to the UI. This work is an initial inquiry involving a relatively small number of potential users, many of whom had never seen an AP system before, and the results should be understood in that light. Methods We began by considering how the UI of an AP system could be designed to make use of the familiar touch-based graphical UI of a consumer smartphone. After developing a working prototype UI, we enlisted a human factors specialist to perform a heuristic expert analysis. Next we conducted a formative evaluation of the UI through a series of three focus groups with N = 13 potential end users as participants. The UI was modified based upon the results of these studies, and the resulting DiAs system was used in transitional outpatient AP studies of adults in the United States and Europe. Results The DiAs UI was modified based on focus group feedback from potential users. The DiAs was subsequently used in JDRF- and AP@Home-sponsored transitional outpatient AP studies in the United States and Europe by 40 subjects for 2400 h with no adverse events. Conclusions Adult patients with type 1 diabetes mellitus are able to control an AP system successfully using a patient-centric UI on a commercial smartphone in a transitional outpatient environment. PMID:24351168

  6. Demography and development: the lessons of Costa Rica.

    PubMed

    Gallagher, C F

    1980-01-01

    Focus in this discussion is on demography and development in Costa Rica. In a 15-year period, during the 1960s and the 1st years of the 1970s, Costa Rica achieved the fastest and steepest fertility decline yet recorded in Latin America. The crude birthrate dropped from a high point in 1959 of 48.3/1000 to a low of 29.9/1000 in 1973. During the same period, the death rate declined from 9.2/1000 to 5.2/1000 by 1973. Because of this, the drop in the rate of natural increase, from 3.9% a year in 1959 to 2.47% in 1973, was not quite as pronounced in percentage terms. During those same years infant mortality dropped from 74/1000 to about 45/1000. The total fertility rate declined from 7.3 children in 1960 to 5.5 in 1968 and to just above 4 children in 1973. The major thrust of the decline originated primarily in popular perception of the imbalance between an unnecessarily high birthrate and changed socioeconomic conditions toward the end of the 1950s, of which improvements in health and general social care were among the most influential. It is not so much the economic performance of Costa Rica that distinguishes it from its neighbors as its social condition. What keeps Costa Rica from being a "banana republic" is its comparatively much higher level of social indicators: newspaper circulation per capita and the amount of newsprint consumption, the extraordinary number of bookstores in San Jose, the number of physicians and hospital beds per person, the number of teachers and students enrolled at all levels of education, and its extremely low mortality rate and very high longevity. The total fertility rate appears to have entered a period of stagnation or pause, with virtually no decline since 1974 and even a slight increase since 1976. In the 5-year period since 1973, the decline through 1978 amounted to only 5%. In the preceding 1968-73 period it wasmore than 26%. The number of births/1000 women in the 15-19 year old age group remains constant and is comparatively very

  7. The DIAS/CEOS Water Portal, distributed system using brokering architecture

    NASA Astrophysics Data System (ADS)

    Miura, Satoko; Sekioka, Shinichi; Kuroiwa, Kaori; Kudo, Yoshiyuki

    2015-04-01

    The DIAS/CEOS Water Portal is a one of the DIAS (Data Integration and Analysis System, http://www.editoria.u-tokyo.ac.jp/projects/dias/?locale=en_US) systems for data distribution for users including, but not limited to, scientists, decision makers and officers like river administrators. This portal has two main functions; one is to search and access data and the other is to register and share use cases which use datasets provided via this portal. This presentation focuses on the first function, to search and access data. The Portal system is distributed in the sense that, while the portal system is located in Tokyo, the data is located in archive centers which are globally distributed. For example, some in-situ data is archived at the National Center for Atmospheric Research (NCAR) Earth Observing Laboratory in Boulder, Colorado, USA. The NWP station time series and global gridded model output data is archived at the Max Planck Institute for Meteorology (MPIM) in cooperation with the World Data Center for Climate in Hamburg, Germany. Part of satellite data is archived at DIAS storage at the University of Tokyo, Japan. This portal itself does not store data. Instead, according to requests made by users on the web page, it retrieves data from distributed data centers on-the-fly and lets them download and see rendered images/plots. Although some data centers have unique meta data format and/or data search protocols, our portal's brokering function enables users to search across various data centers at one time, like one-stop shopping. And this portal is also connected to other data brokering systems, including GEOSS DAB (Discovery and Access Broker). As a result, users can search over thousands of datasets, millions of files at one time. Our system mainly relies on the open source software GI-cat (http://essi-lab.eu/do/view/GIcat), Opensearch protocol and OPeNDAP protocol to enable the above functions. Details on how it works will be introduced during the

  8. Discovery, Integration, and Analysis (DIA) Engine for Ontologically Registered Earth Science Data

    NASA Astrophysics Data System (ADS)

    Sinha, A.; Malik, Z.; Rezgui, A.; Dalton, A.; Lin, K.

    2006-12-01

    A newly developed DIA engine within the NSF supported GEON program utilizes an ontologic cyberinfrastructure framework for discovery, integration, and analysis of earth science data. Data discovery, is commonly challenging because of the use of personalized acronyms, notations, conventions, etc., but can be simplified through ontologic registration. Data integration enables users to extract new information, called data products, by jointly considering and correlating several ontologically registered data sets. We have developed ontology packages as well as accessed ontologies such as SWEET, which provide concepts, concept taxonomies, relationships between concepts, and properties, as an initial step towards the development of complete heavyweight ontologies (with axioms and constraints) for earth science. The primary objective is to allow researchers to associate ontology to their data, so that a unique and definite meaning is associated with each data item. This facilitates data discovery and integration by relating data items with similar semantics across various repositories. The DIA engine provides a Web accessible graphical user interface (GUI) comprising of map services and query menus. Users can specify a "geological region of interest" by making selections on geologic maps which are part of the GUI. Moreover, interactive menus enable filtering, discovery and integration of data (geospatial as well as aspatial), using many tools, including those developed by the community. We support the Web services technology to share these tools since web services hide the tool implementation details and only provide the required invocation details (input/output parameters, etc.). Thus, geoscientists can build tools that access ontologically registered data and provide invocation details publicly. Therefore, any tool that is developed as a Web service can be plugged in the DIA engine. The DIA engine supports dynamic data product creation which requires "on

  9. D-DIA High Pressure Facility at the Australian Synchrotron: First Results

    NASA Astrophysics Data System (ADS)

    Rushmer, T. A.; Wykes, J.

    2016-12-01

    The recent acquisition of a D-DIA type cubic multi-anvil apparatus for use at the Australian Synchrotron provides exciting opportunities for conducting a wide range of in situ experiments at high pressure and temperature. The MQ-AS D-DIA apparatus was designed as a mobile system capable of moving between beamlines. The apparatus was installed at the XAS beamline in May, 2016 and experiments performed since then include 1) a proof-of-concept in situ U and Th L3-edge XANES study of MORB liquid; 2) a proof-of-concept falling sphere viscometry of silicate liquid; and 3) room temperature transmission XANES in the high pressure assembly at energies as low as the Ga K-edge and as high as Sb K-edge. The MQ-AS D-DIA apparatus comprises a 350 ton ram in a four post press frame. The press is installed on a positioning table with motorised X-Y-Z-θ axes capable of positioning accuracy of <10 microns. The Rockland Research D-DIA module is equipped with 4 mm and 6 mm TEL anvils, capable of producing maximum sample pressure of 6 GPa. Stepper motors drive the main and differential ram hydraulic pressure generators in a control loop closed by pressure transducers. Samples are heated by graphite resistance furnaces driven by a Eurotherm 3504 PID controller driving a 5 V 200 A step down transformer via a phase angle power controller. Temperature is monitored via a thermocouple and power by true RMS voltage and current transducers. The XAS beamline at the Australian Synchrotron comprises a 1.9 T 40 pole wiggler, a bendable collimating mirror, a Si(111) / Si(311) DCM and a toroidal focussing mirror. Accessible energies are 5-34 keV with photon fluxes of 108-1012 photons/sec at the sample. Here we present an overview of our recent results. More detailed results of the in situ U and Th L3-edge XANES study are presented by Mallmann et al. (this meeting). In situ imaging and XRD experiments with the D-DIA apparatus on the AS Imaging and Medical Beamline are planned for the coming year.

  10. The Search for Value and Meaning in the Cocoa Supply Chain in Costa Rica

    Treesearch

    Jessica Haynes; Frederick Cubbage; D. Evan Mercer; Erin Sills

    2012-01-01

    Qualitative interviews with participants in the cocoa (Theobroma cacao) supply chain in Costa Rica and the United States were conducted and supplemented with an analysis of the marketing literature to examine the prospects of organic and Fairtrade certification for enhancing environmentally and socially responsible trade of cocoa from Costa Rica. Respondents were...

  11. Differences and Similarities between School Principals in Costa Rica and the United States

    ERIC Educational Resources Information Center

    Ballestero, Victor; Wright, Sam

    2008-01-01

    The need for effective school leadership is a global concern. This paper provides a comparison of the school principal in Costa Rica to the United States. Differences and similarities are described for principals in both nations. Major differences for principals in Costa Rica include administrative salaries, selection procedures, induction, no…

  12. Educational Change and Structural Adjustment: A Case Study of Costa Rica. [Working Document.

    ERIC Educational Resources Information Center

    Carnoy, Martin; Torres, Carlos

    In the 1960s and 1970s, steady economic growth helped the Costa Rican government expand its education system rapidly. The 1979 oil shocks, the U.S. 1981-82 recession, and other factors ended this prosperity and exposed the fragility of Costa Rica's late 1970s debt-financed development. To restore economic growth, new economic policies were…

  13. Incidence, distribution and association of Spongospora subterranea and Potato mop-top virus in Costa Rica

    USDA-ARS?s Scientific Manuscript database

    A survey was conducted in 39 potato (Solanum tuberosum L.) fields in Costa Rica to determine incidence and association of Spongospora subterranea f. sp. subterranea and Potato mop-top pomovirus (PMTV). The fields were located in Costa Rica’s two major potato production regions, and were further char...

  14. Costa Rica's Universidad Estatal a Distancia: A Case Study. DERG Papers, Number 4.

    ERIC Educational Resources Information Center

    Rumble, Greville

    Costa Rica's Universidad Estatal a Distancia (UNED), the education system in the country, and information on Costa Rica are considered. UNED is helping to equalize geographical inequalities of access to higher education. Overall, UNED's academic programs have been aimed at those who want to obtain professional qualifications. In the first semester…

  15. Teacher Expectations and Students from Low Socioeconomic Background: A Perspective from Costa Rica

    ERIC Educational Resources Information Center

    Regalla, Michele

    2013-01-01

    This study explores teachers' academic expectations of students from low socioeconomic status (SES) in Costa Rica for the purpose of cross-cultural comparison. A group of 17 teachers from two different elementary schools located in a small town in Costa Rica were questioned about their expectations of low SES students enrolled in their classes.…

  16. [A fish prey found in the coral snake Micrurus alleni (Serpentes: Elapidae) in Costa Rica].

    PubMed

    Solórzano, Alejandro

    2005-01-01

    A fish prey found in the coral snake Micrurus alleni (Serpentes: Elapidae) in Costa Rica. The presence of a small specimen of the swamp eel Synbranchus marmoratus (84 mm total length) in the stomach contents of an adult coral snake Micrurus alleni with 692 mm total length from the Caribbean versant of Costa Rica is reported. This eel was swallowed headfirst.

  17. Special Education and Severe Disabilities in Costa Rica: Developing Inclusion in a Developing Country.

    ERIC Educational Resources Information Center

    Stough, Laura M.

    2003-01-01

    An overview of special education in Costa Rica is provided. Costa Rica has promulgated four educational service models that extend special education expertise: consulting teachers, educational assistance teams, itinerant teams, and resource centers. Their educational classification system describes the level of modifications required by students.…

  18. The Impact of Post-Secondary Privatization: The Case of Costa Rica

    ERIC Educational Resources Information Center

    Espinosa, Lorelle L.; Santos, Jose L.

    2008-01-01

    Between 1985 and 2000, the Central American country of Costa Rica experienced rapid and unprecedented private university growth as part of an international movement towards post-secondary privatization. Costa Rica stands apart from other developing countries in that all 50 of the nation's private universities are proprietary, resulting in a…

  19. Quality Early Childhood Education in Costa Rica? Policy, Practice, Outcomes and Challenges

    ERIC Educational Resources Information Center

    San Francisco, Andrea Rolla; Arias, Melissa; Villers, Renata

    2005-01-01

    High-quality early childhood education has been shown to improve school outcomes in several developing and developed nations. The history of policy around pre-school education in Costa Rica is described as background to presenting cross-sectional data on the emergent literacy skills of low-income Costa Rican children in kindergarten, 1st and 2nd…

  20. Comparative study of general public owl knowledge in Costa Rica, Central America and Malawi, Africa

    Treesearch

    Paula A. Enriquez; Heimo Mikkola

    1997-01-01

    The public knowledge of owls in Central America and Africa was compared based on 162 interviews in Costa Rica and 147 in Malawi. General knowledge of owls included: species, common names, habitats, food, and calls, and was quite similar in both study areas. In Malawi, more than 90 percent of the respondents connected owls with bad luck, witchcraft, and death. In Costa...

  1. 75 FR 13301 - Los Vaqueros Reservoir Expansion, Contra Costa and Alameda Counties, CA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-19

    ... water supply reliability. A 60 TAF expansion option would expand the reservoir to 160 TAF. This second option would primarily be operated to improve Contra Costa Water District (CCWD) dry year water supply... Environmental Policy Act Federal lead agency, and the Contra Costa Water District, as the California...

  2. The Impact of Post-Secondary Privatization: The Case of Costa Rica

    ERIC Educational Resources Information Center

    Espinosa, Lorelle L.; Santos, Jose L.

    2008-01-01

    Between 1985 and 2000, the Central American country of Costa Rica experienced rapid and unprecedented private university growth as part of an international movement towards post-secondary privatization. Costa Rica stands apart from other developing countries in that all 50 of the nation's private universities are proprietary, resulting in a…

  3. Quality Early Childhood Education in Costa Rica? Policy, Practice, Outcomes and Challenges

    ERIC Educational Resources Information Center

    San Francisco, Andrea Rolla; Arias, Melissa; Villers, Renata

    2005-01-01

    High-quality early childhood education has been shown to improve school outcomes in several developing and developed nations. The history of policy around pre-school education in Costa Rica is described as background to presenting cross-sectional data on the emergent literacy skills of low-income Costa Rican children in kindergarten, 1st and 2nd…

  4. Crack cocaine use among persons with tuberculosis--Contra Costa County, California, 1987-1990.

    PubMed

    1991-07-26

    From January 1, 1987, through June 30, 1990, 44 cases of tuberculosis (TB) occurred among residents of Contra Costa County, California, who were known to use crack cocaine. To investigate a possible association between crack cocaine use and TB, local health officials conducted a retrospective study of TB cases among residents of Contra Costa County.

  5. Special Education and Severe Disabilities in Costa Rica: Developing Inclusion in a Developing Country.

    ERIC Educational Resources Information Center

    Stough, Laura M.

    2003-01-01

    An overview of special education in Costa Rica is provided. Costa Rica has promulgated four educational service models that extend special education expertise: consulting teachers, educational assistance teams, itinerant teams, and resource centers. Their educational classification system describes the level of modifications required by students.…

  6. Costa Rica's 'White legend': how racial narratives undermine its health care system.

    PubMed

    Campo-Engelstein, Lisa; Meagher, Karen

    2011-08-01

    A dominant cultural narrative within Costa Rica describes Costa Ricans not only as different from their Central American neighbours, but it also exalts them as better: specifically, as more white, peaceful, egalitarian and democratic. This notion of Costa Rican exceptionalism played a key role in the creation of their health care system, which is based on the four core principles of equity, universality, solidarity and obligation. While the political justification and design of the current health care system does, in part, realize this ideal, we argue that the narrative of Costa Rican exceptionalism prevents the full actualization of these principles by marginalizing and excluding disadvantaged groups, especially indigenous and black citizens and the substantial Nicaraguan minority. We offer three suggestions to mitigate the self-undermining effects of the dominant national narrative: 1) encouragement and development of counternarratives; 2) support of an emerging field of Costa Rican bioethics; and 3) decoupling health and national successes.

  7. New species of Edessa Fabricius, 1803 (Hemiptera: Pentatomidae) from Costa Rica.

    PubMed

    Fernandes, Jose Antonio Marin; Silva, Valeria Juliete Da; Correia, Andre Oliveira; Nunes, Benedito Mendes

    2015-08-12

    The edessines from Costa Rica are little known; only 18 species have been registered or described from this country so far. Mainly based in a large sample from Instituto Nacional de Biodiverdidad (INBio), Costa Rica, we decided to update the information concerning Edessinae from Costa Rica. We present a list of species from Costa Rica raising the number of known species from Costa Rica to 65. We are also describing nine new species: Edessa bella Fernandes & Silva, E. bruneolineata Fernandes & Correia, E. curvata Fernandes & Nunes, E. lewisi Fernandes & Silva, E. nigroangulata Fernandes & Silva, E. osae Fernandes & Nunes, E. oxcarti Fernandes & Correia, E. pallidoangulata Fernandes & Nunes and E. puravida Fernandes & Correia. Species were described, illustrated and photographed. Distribution maps for the species are also provided.

  8. Interaction between mDia1 and ROCK in Rho-induced migration and adhesion of human dental pulp cells.

    PubMed

    Cheng, L; Xu, J; Qian, Y Y; Pan, H Y; Yang, H; Shao, M Y; Cheng, R; Hu, T

    2017-01-01

    To investigate the effects of mammalian homologue of Drosophila diaphanous-1(mDia1) and Rho-associated coiled-coil-containing protein kinase (ROCK) on the migration and adhesion of dental pulp cells (DPCs). Lysophosphatidic acid (LPA) was used to activate Rho signalling. mDia1 and ROCK were inhibited by short interfering RNA and the specific inhibitor, Y-27632, respectively. The migration of DPCs was assessed using the transwell migration assay and scratch test. Formation of cytoskeleton and focal adhesions(FAs) was observed by confocal laser scanning microscopy. Cell adhesion and spreading assays were performed. Phosphorylation of focal adhesion kinase (FAK) and paxillin was detected by Western blotting, and the bands were analysed using Adobe Photoshop CS5 software. All experiments were performed at least three times, and data were analysed with one-way anova and a post hoc test. LPA-triggered activation of Rho and inhibition of ROCK significantly increased the cell migration rate. Cell migration was inhibited by silencing mDia1. mDia1 silencing and ROCK inhibition suppressed the LPA-induced formation of the cytoskeleton, FA and phosphorylation of FAK and paxillin. Inhibition of ROCK or mDia1 facilitated early cell adhesion and spreading; by contrast, the combined inhibition of ROCK and mDia1 neutralized these effects. mDia1 promoted RhoA-induced migration of DPCs, but ROCK had an opposite effect. Both mDia1 and ROCK participated in cytoskeleton formation and adhesion of DPCs. The interactions between mDia1 and ROCK might influence dental pulp repair by determining the migration and adhesion of DPCs. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  9. mapDIA: Preprocessing and statistical analysis of quantitative proteomics data from data independent acquisition mass spectrometry.

    PubMed

    Teo, Guoshou; Kim, Sinae; Tsou, Chih-Chiang; Collins, Ben; Gingras, Anne-Claude; Nesvizhskii, Alexey I; Choi, Hyungwon

    2015-11-03

    Data independent acquisition (DIA) mass spectrometry is an emerging technique that offers more complete detection and quantification of peptides and proteins across multiple samples. DIA allows fragment-level quantification, which can be considered as repeated measurements of the abundance of the corresponding peptides and proteins in the downstream statistical analysis. However, few statistical approaches are available for aggregating these complex fragment-level data into peptide- or protein-level statistical summaries. In this work, we describe a software package, mapDIA, for statistical analysis of differential protein expression using DIA fragment-level intensities. The workflow consists of three major steps: intensity normalization, peptide/fragment selection, and statistical analysis. First, mapDIA offers normalization of fragment-level intensities by total intensity sums as well as a novel alternative normalization by local intensity sums in retention time space. Second, mapDIA removes outlier observations and selects peptides/fragments that preserve the major quantitative patterns across all samples for each protein. Last, using the selected fragments and peptides, mapDIA performs model-based statistical significance analysis of protein-level differential expression between specified groups of samples. Using a comprehensive set of simulation datasets, we show that mapDIA detects differentially expressed proteins with accurate control of the false discovery rates. We also describe the analysis procedure in detail using two recently published DIA datasets generated for 14-3-3β dynamic interaction network and prostate cancer glycoproteome. The software was written in C++ language and the source code is available for free through SourceForge website http://sourceforge.net/projects/mapdia/.This article is part of a Special Issue entitled: Computational Proteomics. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Drug abuse in Costa Rica: a review of several studies.

    PubMed

    Alfaro Murillo, E

    1990-01-01

    This article provides a review of drug use surveys conducted by Costa Rica's Institute on Alcoholism and Drug Dependence during the years 1983-1987. These studies dealt with a wide range of subjects--residents of marginal neighborhoods, juvenile male and adult female detainees, and high school students--as well as with the general population. Overall, the studies indicated that the most commonly used illicit drug was marijuana, that the bulk of the drug users (excluding alcohol and tobacco users) were young males, that relevant levels of cocaine use were starting to occur, and that the country's general drug abuse picture poses a problem in need of immediate attention.

  11. Human Rabies: A Reemerging Disease in Costa Rica?

    PubMed Central

    Pérez-Herra, Victor; Quirós, Ligia; Morice, Ana; Jiménez, Edwin; Sáenz, Elizabeth; Salazar, Fernando; Fernández, Rodrigo; Orciari, Lillian; Yager, Pamela; Whitfield, Sylvia; Rupprecht, Charles E.

    2003-01-01

    Two human rabies cases caused by a bat-associated virus variant were identified in September 2001 in Costa Rica, after a 31-year absence of the disease in persons. Both patients lived in a rural area where cattle had a high risk for bat bites, but neither person had a definitive history of being bitten by a rabid animal. Characterization of the rabies viruses from the patients showed that the reservoir was the hematophagous Vampire Bat, Desmodus rotundus, and that a sick cat was the vector. PMID:12781014

  12. Hispines (Chrysomelidae, Cassidinae) of La Selva Biological Station, Costa Rica

    PubMed Central

    Staines, Charles L.

    2011-01-01

    Abstract Survey work from 1992–2001 identified 139 species of hispines at the lowland part of La Selva Biological Station, Costa Rica. The tribe Cephaloleiini was the most speciose with 58 species (41.7%) followed by the Chalepini with 55 (39.5%). The fauna is most closely related to that in South America but with some genera which are more speciose in the Nearctic Region. Plant associations are known for 88 (63.3%) of the species but many of these are merely collecting records, not host plant associations. The first plant associations are reported for Alurnus ornatus, Alurnus salvini, and Acentroptera nevermanni. PMID:22303103

  13. [The Purruja mangrove, Golfito, Costa Rica: a management model].

    PubMed

    Silva, Ana Margarita; Carrillo, Norma Natalia

    2004-12-01

    The Purruja mangrove (Golfito, Costa Rica) has an estimated area of 70 ha. A socio-biological research was the ground to set initial goals to manage the resources and to identify the mangrove biological condition. Community participation and the local organization were key factors in developing an integrated model for the management of natural resources. Constant monitoring and institutional networks were the other two factors to manage the mangrove. The constant profesional support was a tool to facilitate the acomplishment of goals and to establish an institucional network to promote local group iniciatives for collaborative management of the Purruja mangrove.

  14. Infant botulism in Costa Rica: first report from Central America.

    PubMed

    Hernández-de Mezerville, Marcela; Rojas-Solano, Mariela; Gutierrez-Mata, Alfonso; Hernández-Con, Laura; Ulloa-Gutierrez, Rolando

    2014-01-15

    Clostridium botulinum is known to cause descending paralysis in infants throughout the world. The subject of this study was a three-month-old Costa Rican boy who was hospitalized because of poor suction and feeding, hypotonia, and constipation. Clinical history and physical examination findings suggested infant botulism. Samples were sent to the Winnipeg Public Health Laboratory, where Clostridium botulinum toxin A was identified by PCR and culture from the stools, making this the first report of infant botulism in Central America. Although infant botulism is a known disease, the limitations in identifying it in Central America contributes to the misdiagnosis and under-reporting of this disease.

  15. Crystal Structure of the Formin mDia1 in Autoinhibited Conformation

    PubMed Central

    Otomo, Takanori; Tomchick, Diana R.; Otomo, Chinatsu; Machius, Mischa; Rosen, Michael K.

    2010-01-01

    Background Formin proteins utilize a conserved formin homology 2 (FH2) domain to nucleate new actin filaments. In mammalian diaphanous-related formins (DRFs) the FH2 domain is inhibited through an unknown mechanism by intramolecular binding of the diaphanous autoinhibitory domain (DAD) and the diaphanous inhibitory domain (DID). Methodology/Principal Findings Here we report the crystal structure of a complex between DID and FH2-DAD fragments of the mammalian DRF, mDia1 (mammalian diaphanous 1 also called Drf1 or p140mDia). The structure shows a tetrameric configuration (4 FH2 + 4 DID) in which the actin-binding sites on the FH2 domain are sterically occluded. However biochemical data suggest the full-length mDia1 is a dimer in solution (2 FH2 + 2 DID). Based on the crystal structure, we have generated possible dimer models and found that architectures of all of these models are incompatible with binding to actin filament but not to actin monomer. Furthermore, we show that the minimal functional monomeric unit in the FH2 domain, termed the bridge element, can be inhibited by isolated monomeric DID. NMR data on the bridge-DID system revealed that at least one of the two actin-binding sites on the bridge element is accessible to actin monomer in the inhibited state. Conclusions/Significance Our findings suggest that autoinhibition in the native DRF dimer involves steric hindrance with the actin filament. Although the structure of a full-length DRF would be required for clarification of the presented models, our work here provides the first structural insights into the mechanism of the DRF autoinhibition. PMID:20927343

  16. Control of myofibroblast differentiation by microtubule dynamics through a regulated localization of mDia2.

    PubMed

    Sandbo, Nathan; Ngam, Caitlyn; Torr, Elizabeth; Kregel, Steve; Kach, Jacob; Dulin, Nickolai

    2013-05-31

    Myofibroblast differentiation plays a critical role in wound healing and in the pathogenesis of fibrosis. We have previously shown that myofibroblast differentiation is mediated by the activity of serum response factor (SRF), which is tightly controlled by the actin polymerization state. In this study, we investigated the role of the microtubule cytoskeleton in modulating myofibroblast phenotype. Treatment of human lung fibroblasts with the microtubule-destabilizing agent, colchicine, resulted in a formation of numerous stress fibers and expression of myofibroblast differentiation marker proteins. These effects of colchicine were independent of Smad signaling but were mediated by Rho signaling and SRF, as they were attenuated by the Rho kinase inhibitor, Y27632, or by the SRF inhibitor, CCG-1423. TGF-β-induced myofibroblast differentiation was not accompanied by gross changes in the microtubule polymerization state. However, microtubule stabilization by paclitaxel attenuated TGF-β-induced myofibroblast differentiation. Paclitaxel had no effect on TGF-β-induced Smad activation and Smad-dependent gene transcription but inhibited actin polymerization, nuclear accumulation of megakaryoblastic leukemia-1 protein, and SRF activation. The microtubule-associated formin, mDIA2, localized to actin stress fibers upon treatment with TGF-β, and paclitaxel prevented this localization. Treatment with the formin inhibitor, SMI formin homology 2 domain, inhibited stress fiber formation and myofibroblast differentiation induced by TGF-β, without affecting Smad-phosphorylation or microtubule polymerization. Together, these data suggest that (a) TGF-β promotes association of mDia2 with actin stress fibers, which further drives stress fiber formation and myofibroblast differentiation, and (b) microtubule polymerization state controls myofibroblast differentiation through the regulation of mDia2 localization.

  17. Prevalence of diabetes and impaired fasting glucose in Costa Rica: Costa Rican National Cardiovascular Risk Factors Survey, 2010.

    PubMed

    Wong-McClure, Roy; Gregg, Edward W; Barcelo, Alberto; Sanabria-Lopez, Laura; Lee, Kahye; Abarca-Gomez, Leandra; Cervantes-Loaiza, Marvin; Luman, Elizabeth T

    2016-09-01

    The projected rising prevalence of diabetes and impaired fasting glucose (IFG) in developing countries warrants careful monitoring. The aim of this study was to present the results of the Costa Rican National Cardiovascular Risk Factors Surveillance System, which provides the first national estimates of diabetes and IFG prevalence among adults in Costa Rica. A cross-sectional survey of 3653 non-institutionalized adults aged ≥20 years (87.8% response rate) following the World Health Organization STEPwise approach was built on a probabilistic sample of the non-institutionalized population during 2010. Known diabetes was defined as self-reported diagnosis, the use of insulin, or hypoglycemic oral treatment as consequence of diabetes during at least the previous 2 weeks before the survey. Unknown diabetes was defined no self-reported diabetes but with venous blood concentrations of fasting glucose >125 mg/dL determined by laboratory testing. Impaired fasting glucose was defined as fasting glucose between 100 and 125 mg/dL among those without diabetes. The prevalence of diabetes and IFG prevalence was estimated according gender, body mass index (BMI), waist circumference (WC), educational level, and physical activity level. Overall diabetes prevalence was 10.8% (9.5% known and 1.3% unknown diabetes) and IFG prevalence was 16.5%. The prevalence of known diabetes was higher among women >65 years compared with men of the same age group. Both known and unknown diabetes were significantly associated with higher BMI, increased WC, and low education level (P = 0.01). The prevalence of diabetes and IFG in Costa Rica is comparable to that in developed countries and indicates an urgent need for effective preventive interventions. © 2015 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and Wiley Publishing Asia Pty Ltd.

  18. Brucellosis in mammals of Costa Rica: An epidemiological survey.

    PubMed

    Hernández-Mora, Gabriela; Bonilla-Montoya, Roberto; Barrantes-Granados, Osvaldo; Esquivel-Suárez, Andrea; Montero-Caballero, Danilo; González-Barrientos, Rocío; Fallas-Monge, Zeanne; Palacios-Alfaro, José David; Baldi, Mario; Campos, Elena; Chanto, Grettel; Barquero-Calvo, Elías; Chacón-Díaz, Carlos; Chaves-Olarte, Esteban; Guzmán Verri, Caterina; Romero-Zúñiga, Juan-José; Moreno, Edgardo

    2017-01-01

    Brucellosis has been an endemic disease of cattle and humans in Costa Rica since the beginning of XX century. However, brucellosis in sheep, goats, pigs, water buffaloes, horses and cetaceans, has not been reported in the country. We have performed a brucellosis survey in these host mammal species, from 1999-2016. In addition, we have documented the number of human brucellosis reported cases, from 2003-2016. The brucellosis seroprevalence in goat and sheep herds was 0.98% and 0.7% respectively, with no Brucella isolation. Antibodies against Brucella were not detected in feral or domestic pigs. Likewise, brucellosis seroprevalence in horse and water buffalo farms was estimated in 6.5% and 21.7%, respectively, with no Brucella isolation. Six cetacean species showed positive reactions against Brucella antigens, and B. ceti was isolated in 70% (n = 29) of striped dolphins (Stenella coeruleoalba). A steady increase in the diagnosis of human brucellosis cases was observed. Taking into account the prevalence of brucellosis in the various host mammals of Costa Rica, different measures are recommended.

  19. Workplace carcinogen and pesticide exposures in Costa Rica.

    PubMed

    Partanen, Timo; Chaves, Jorge; Wesseling, Catharina; Chaverri, Fabio; Monge, Patricia; Ruepert, Clemens; Aragón, Aurora; Kogevinas, Manolis; Hogstedt, Christer; Kauppinen, Timo

    2003-01-01

    The CAREX data system converts national workforce volumes and proportions of workers exposed to workplace carcinogens into numbers of exposed in 55 industrial categories. CAREX was adapted for Costa Rica for 27 carcinogens and seven groups of pesticides. Widespread workplace carcinogens in the 1.3 million workforce of Costa Rica are solar radiation (333,000 workers), diesel engine exhaust (278,000), environmental tobacco smoke (71,000), hexavalent chromium compounds (55,000), benzene (52,000), wood dust (32,000), silica dust (27,000), lead and inorganic lead compounds (19,000), and polycyclic aromatic compounds (17,000). The most ubiquitous pesticides were paraquat and diquat (175,000), mancozeb, maneb, and zineb (49,000), chlorothalonil (38,000), benomyl (19,000), and chlorophenoxy herbicides (11,000). Among women, formaldehyde, radon, and methylene chloride overrode pesticides, chromium, wood dust, and silica dust in numbers of exposed. High-risk sectors included agriculture, construction, personal and household services, land and water transport and allied services, pottery and similar industries, woodworks, mining, forestry and logging, fishing, manufacturing of electrical machinery, and bar and restaurant personnel.

  20. [Smoking tobacco in Costa Rica: susceptibility, consumption and dependence].

    PubMed

    Fonseca-Chaves, Sandra; Méndez-Muñoz, Jesús; Bejarano-Orozco, Julio; Guerrero-López, Carlos Manuel; Reynales-Shigematsu, Luz Myriam

    2017-01-01

    To identify factors associated with susceptibility, tobacco use and addiction in young people from 13 to 15 years of age, to determine conditions of risk and identify possible correlates to the development of public policies on smoking in Costa Rica. Information available from the four rounds of the Global Youth Tobacco Survey (GYTS) Costa Rica was used. It was based on a sample size of 11 540 youngsters from public and private schools. Indicators of interest and logistic regression models for smoking, susceptibility and addiction were estimated. The prevalence of current consumption shows a significant decrease over the 14 years of the study (17.3% in 1999 and 5.0% in 2013) and, to a lesser intensity, in the index of smoking susceptibility (19.3% in 1999 and 12.4% in 2013). The proportion of young people with addiction has shown a significant increase in the same period. The conditions that explained the significant reduction in smoking prevalence and less susceptibility must be maintained and deepened to achieve full compliance of the MPower measures.

  1. Smoking: attitudes of Costa Rican physicians and opportunities for intervention.

    PubMed Central

    Grossman, D. W.; Knox, J. J.; Nash, C.; Jiménez, J. G.

    1999-01-01

    The aim of this study was to obtain information, using a written questionnaire, on the knowledge, smoking behaviour, and attitudes of Costa Rican physicians about smoking as a health issue. A random sample of 650 physicians was chosen from a list of active physicians; 287 of them were covered by survey between August 1993 and October 1994, and 217 (76%) responded with data for the study. While 40% of the physicians who participated were ex-smokers, 19% were current smokers; 67% of these two groups combined reported smoking in the workplace. Only 49% believed that physicians could be a nonsmoking role model; the majority (87%) had asked patients about their smoking status. The only cessation technique consistently used (90%) was counselling about the dangers of smoking. Measures such as setting a date to quit smoking and nicotine replacement were rarely recommended (< or = 2%). Nearly all the physicians (99%) considered smoking to be a major health issue. These results showed a high prevalence of smoking among Costa Rican physicians, with little recognition of the need for them to set an example as a role model. While they were knowledgeable about the health risks of smoking, they did not recommend any of the proven techniques to help their patients to quit smoking. A clear consensus for more strict tobacco regulation exists, but to date little has been done to act on this. PMID:10327710

  2. Effect of fragmentation on the Costa Rican dry forest avifauna

    PubMed Central

    Barrantes, Gilbert; Ocampo, Diego; Ramírez-Fernández, José D.

    2016-01-01

    Deforestation and changes in land use have reduced the tropical dry forest to isolated forest patches in northwestern Costa Rica. We examined the effect of patch area and length of the dry season on nestedness of the entire avian community, forest fragment assemblages, and species occupancy across fragments for the entire native avifauna, and for a subset of forest dependent species. Species richness was independent of both fragment area and distance between fragments. Similarity in bird community composition between patches was related to habitat structure; fragments with similar forest structure have more similar avian assemblages. Size of forest patches influenced nestedness of the bird community and species occupancy, but not nestedness of assemblages across patches in northwestern Costa Rican avifauna. Forest dependent species (species that require large tracts of mature forest) and assemblages of these species were nested within patches ordered by a gradient of seasonality, and only occupancy of species was nested by area of patches. Thus, forest patches with a shorter dry season include more forest dependent species. PMID:27672498

  3. Brucellosis in mammals of Costa Rica: An epidemiological survey

    PubMed Central

    Hernández-Mora, Gabriela; Bonilla-Montoya, Roberto; Barrantes-Granados, Osvaldo; Esquivel-Suárez, Andrea; Montero-Caballero, Danilo; González-Barrientos, Rocío; Fallas-Monge, Zeanne; Palacios-Alfaro, José David; Baldi, Mario; Campos, Elena; Chanto, Grettel; Barquero-Calvo, Elías; Chacón-Díaz, Carlos; Chaves-Olarte, Esteban; Guzmán Verri, Caterina; Romero-Zúñiga, Juan-José

    2017-01-01

    Brucellosis has been an endemic disease of cattle and humans in Costa Rica since the beginning of XX century. However, brucellosis in sheep, goats, pigs, water buffaloes, horses and cetaceans, has not been reported in the country. We have performed a brucellosis survey in these host mammal species, from 1999–2016. In addition, we have documented the number of human brucellosis reported cases, from 2003–2016. The brucellosis seroprevalence in goat and sheep herds was 0.98% and 0.7% respectively, with no Brucella isolation. Antibodies against Brucella were not detected in feral or domestic pigs. Likewise, brucellosis seroprevalence in horse and water buffalo farms was estimated in 6.5% and 21.7%, respectively, with no Brucella isolation. Six cetacean species showed positive reactions against Brucella antigens, and B. ceti was isolated in 70% (n = 29) of striped dolphins (Stenella coeruleoalba). A steady increase in the diagnosis of human brucellosis cases was observed. Taking into account the prevalence of brucellosis in the various host mammals of Costa Rica, different measures are recommended. PMID:28793352

  4. Status and conservation of coral reefs in Costa Rica.

    PubMed

    Cortés, Jorge; Jiménez, Carlos E; Fonseca, Ana C; Alvarado, Juan José

    2010-05-01

    Costa Rica has coral communities and reefs on the Caribbean coast and on the Pacific along the coast and off-shore islands. The Southern section of the Caribbean coast has fringing and patch reefs, carbonate banks, and an incipient algal ridge. The Pacific coast has coral communities, reefs and isolated coral colonies. Coral reefs have been seriously impacted in the last 30 years, mainly by sediments (Caribbean coast and some Pacific reefs) and by El Niño warming events (both coasts). Monitoring is being carried out at three sites on each coast. Both coasts suffered significant reductions in live coral cover in the 1980's, but coral cover is now increasing in most sites. The government of Costa Rica is aware of the importance of coral reefs and marine environments in general, and in recent years decrees have been implemented (or are in the process of approval) to protect them, but limited resources endanger their proper management and conservation, including proper outreach to reef users and the general public.

  5. Box-Jenkins analysis for shark landings in Costa Rica.

    PubMed

    Bonilla, Roger; Chavarría, Juan B

    2004-12-01

    Sharks are highly vulnerable to intense and prolonged fishery extraction. This article analyzes the data on shark landings from the artisan fishing fleet on Costa Rica's Pacific coast between 1988 and 1997. The data come from an invoicing system administered by the Costa Rican Fisheries Institute (Instituto Costarricense de la Pesca y Acuacultura, INCOPESCA). Pacific coast shark fishing during the period under study represented approximately 20% of the total national fisheries volume. According to data from the invoicing system, the Northern Pacific region was the most productive, reporting 58% of the shark catch nationwide. Within this region, shark fishing in Papagayo Gulf represented 91% and 53% of the landings by fishery region and nationwide, respectively. The mid-sized and advanced (length of boat > 10 meters) artisan fishing fleets reported 96% of the shark catches in the zone. The study of shark fisheries in the Papagayo Gulf zone is crucial for an understanding of fishery dynamics for this resource at the national level. A monthly chronological series was constructed with the landings in the Papagayo Gulf zone, and a Univariate Box-Jenkins (UBJ) Model was estimated for first-order moving averages MA(1) with a seasonal component of the Yt = lamda(t-1) + gammaS12 + a(t) type.

  6. Mantle Xenoliths of Cerro Mercedes, Costa Rica, Central America

    NASA Astrophysics Data System (ADS)

    Lindsay, F. N.; Carr, M. J.; Herzberg, C. T.; Feigenson, M. D.

    2003-12-01

    Mantle peridotite occurs as xenoliths in lavas and bombs at Cerro Mercedes, a Plio-Quaternary potassic alkaline basalt volcano approximately 70 km behind the volcanic front of northern Costa Rica (Tournon and Alvarado, 1997). Mineral exploration led to the first discovery of abundant mantle xenoliths in Central America (Vargas and Alfaro, 1992). The compositions of 71 xenoliths recovered in January 2003 include dunite, harzburgite, lherzolite and olivine websterite. Twenty xenoliths have a diameter of at least 3 cm. The nodules are abundant in basalt outcrops and the rare bombs. In spite of substantial soil development in a rain forest environment, both xenoliths and host lava remain well preserved. Olivine, pyroxenes and spinel are common, plagioclase is present and garnet appears to be absent. There is no obvious shearing or deformation and several pyroxenes are as much as 1 cm in diameter. The mineralogy suggests a relatively shallow upper mantle source, within either the lithosphere or possibly the uppermost asthenosphere. Cerro Mercedes, at latitude 10° 58' N and longitude 82° 21' W, lies along the Rio San Juan, which is locally the border between Nicaragua and Costa Rica, Central America. This location approximately coincides with a boundary between dominantly depleted mantle to the northwest and OIB or Galapagos-like mantle to the southeast. We will use mineralogical data to better define the likely depths and oxidation states of representative nodules and isotopic data to define the type of mantle source.

  7. Neotropical Bats from Costa Rica harbour Diverse Coronaviruses.

    PubMed

    Moreira-Soto, A; Taylor-Castillo, L; Vargas-Vargas, N; Rodríguez-Herrera, B; Jiménez, C; Corrales-Aguilar, E

    2015-11-01

    Bats are hosts of diverse coronaviruses (CoVs) known to potentially cross the host-species barrier. For analysing coronavirus diversity in a bat species-rich country, a total of 421 anal swabs/faecal samples from Costa Rican bats were screened for CoV RNA-dependent RNA polymerase (RdRp) gene sequences by a pancoronavirus PCR. Six families, 24 genera and 41 species of bats were analysed. The detection rate for CoV was 1%. Individuals (n = 4) from four different species of frugivorous (Artibeus jamaicensis, Carollia perspicillata and Carollia castanea) and nectivorous (Glossophaga soricina) bats were positive for coronavirus-derived nucleic acids. Analysis of 440 nt. RdRp sequences allocated all Costa Rican bat CoVs to the α-CoV group. Several CoVs sequences clustered near previously described CoVs from the same species of bat, but were phylogenetically distant from the human CoV sequences identified to date, suggesting no recent spillover events. The Glossophaga soricina CoV sequence is sufficiently dissimilar (26% homology to the closest known bat CoVs) to represent a unique coronavirus not clustering near other CoVs found in the same bat species so far, implying an even higher CoV diversity than previously suspected.

  8. Labor force growth and the environment in Costa Rica.

    PubMed

    Abler, D G; Rodriguez, A G; Shortle, J S

    1998-10-01

    The introduction to this report of a study that examines the potential environmental impacts of labor force growth (LFG) in Costa Rica under LFG scenarios notes that LFG is an economically critical aspect of population growth that can affect the environment by expanding the economy's production possibilities frontier and/or by increasing consumption. The introduction also explains why Costa Rica is ideal for this study and identifies the study as unique because it constructs a computable general equilibrium (CGE) model using 10 environmental indicators and because it models uncertainty regarding the values of the economic parameters. The report continues by reviewing the literature linking population and environmental issues; detailing the CGE model; discussing the 10 environmental indicators (deforestation, erosion, pesticide use, overfishing, hazardous wastes, inorganic wastes, organic wastes, greenhouse gas emissions, air pollution, and water/sewer usage) used in the model; and explaining the method used to simulate the impacts of LFG. The major conclusions that emerged from the results of this study are that 1) the economy-wide impacts of LFG (and, thus, population growth) on the environment are important and vary significantly according to the amounts of physical and human capital present in the labor force and 2) the impacts of LFG vary substantially among environmental indicators.

  9. Costas loop lock detection in the advanced receiver

    NASA Technical Reports Server (NTRS)

    Mileant, A.; Hinedi, S.

    1989-01-01

    The advanced receiver currently being developed uses a Costas digital loop to demodulate the subcarrier. Previous analyses of lock detector algorithms for Costas loops have ignored the effects of the inherent correlation between the samples of the phase-error process. Accounting for this correlation is necessary to achieve the desired lock-detection probability for a given false-alarm rate. Both analysis and simulations are used to quantify the effects of phase correlation on lock detection for the square-law and the absolute-value type detectors. Results are obtained which depict the lock-detection probability as a function of loop signal-to-noise ratio for a given false-alarm rate. The mathematical model and computer simulation show that the square-law detector experiences less degradation due to phase jitter than the absolute-value detector and that the degradation in detector signal-to-noise ratio is more pronounced for square-wave than for sine-wave signals.

  10. [Mass screening for gastric cancer performed in Costa Rica].

    PubMed

    Sasagawa, Yumiko; Sasagawa, Tsuyoshi; Takasaki, Ken

    2002-06-01

    We performed mass screening for gastric cancer by means of X-ray in Costa Rica from 1996 through 1999. Screening was performed on 10,064 subjects and 69 gastric cancers were detected (screening group). During the same period 172 gastric cancer patients were referred to us (non-screening group). Results of screening in Japan (Japanese group) were quoted from the annual report of the Japanese Society of Gastroenterological Mass Survey. This study is a comparison of these 3 groups. The detection rate was 0.68% in the screening group, 0.11% in the Japanese group. The operability was 92.7%, 76.1%, 97.0%, the resectability 96.8%, 83.2%, 98.6%, the rate of early gastric cancer 64.5%, 30.3%, 65.9%, and the rate of curability A 79.0%, 38.5%. 82.6% in the screening group, non-screening group and Japanese group respectively. The results in the screening group were exactly equal to those in the Japanese group. These results show that the same results can be obtained in Costa Rica as in Japan, if screening is performed with the same diagnostic level and skill as in Japan.

  11. Willow Flycatcher nonbreeding territory defense behavior in Costa Rica

    USGS Publications Warehouse

    Sogge, M.K.; Koronkiewicz, T.J.; van Riper, Charles; Durst, S.L.

    2007-01-01

    We studied the intraspecific territorial defense behavior of wintering Willow Flycatchers (Empidonax traillii) in Costa Rica using a randomized playback experiment that exposed male and female birds to recordings of Willow Flycatcher songs and calls, Lesser Ground Cuckoo (Morococcyx erythropygius) vocalizations, and random noise. Flycatchers of both sexes responded most strongly to simulated conspecific territory intrusion, and the agonistic behaviors that we observed were similar to those seen during natural intraspecific encounters in winter. Both males and females engaged in song and aggressive behaviors in defense of territories, and there was no significant difference between the sexes in scored agonistic responses. The similarity between the sexes in intraspecific territorial defense behaviors and aggressiveness may account for both sexes of flycatchers using the same habitats at our study sites in Costa Rica, and wintering females defending territories against males. The Willow Flycatcher, a sexually monomorphic species, differs in this way from a number of sexually dimorphic passerines, in which behaviorally dominant males occur in more optimal winter habitats. ?? The Cooper Ornithological Society 2007.

  12. [Unnecessary premature and avoidable mortality in Costa Rica].

    PubMed

    Llorca Castro, Fernando; Ortún Rubio, Vicente

    2010-01-01

    With the intention of establishing economic inequities, the article analyzes the variations of the Unnecessarily Premature and Sanitarily Avoidable Mortality (MIPSE) of each of the 81 cantons of Costa Rica during 2000-2005. It is important to identify those inequities, to establish policies and strategies trying to mitigate them. It applies the MIPSE classification proposed by members of the Information and Studies Service, of the Catalunya's Sanitary Resources Headquarter, Spain. By an Indicator of Socioeconomic Development (IDSE) of a University of Costa Rica economist's team, it organised each canton in groups of quintiles (I for the richest, V for the poorest), previous people standardization. We found as a major causes of mortality MIPSE in the country: Heart Isquemic Disease (19,55% MIPSE causes), Traffic Accidents with Motor Vehicles (11,60%), Brain Vascular Disease (6,95%), Perinatal (6,92%) and Suicide (5,14%). The VIH infection - AIDS mortality, the Best Cancer in Women, Uterus Cancer, Skin Cancer and Hepatic Disease Secondary to Alcohol Consumption, affects more the cantons with better financial conditions and the Prostate Benign Hyperplasia mortality, Mothers mortality related with Pregnancy, Childbirth or Puerperal Stage and the Abdominal Hernia mortality, affects more to those with worst economic level. Two MIPSE groups were identified with similar inequality: Leukaemia and Congenital Cardiovascular Disease.

  13. Reconnaissance of selected PPCP compounds in Costa Rican surface waters.

    PubMed

    Spongberg, Alison L; Witter, Jason D; Acuña, Jenaro; Vargas, José; Murillo, Manuel; Umaña, Gerardo; Gómez, Eddy; Perez, Greivin

    2011-12-15

    Eighty-six water samples were collected in early 2009 from Costa Rican surface water and coastal locations for the analysis of 34 pharmaceutical and personal care product compounds (PPCPs). Sampling sites included areas receiving treated and untreated wastewaters, and urban and rural runoff. PPCPs were analyzed using a combination of solid phase extraction and liquid chromatography tandem mass spectrometry. The five most frequently detected compounds were doxycycline (77%), sulfadimethoxine (43%), salicylic acid (41%), triclosan (34%) and caffeine (29%). Caffeine had the maximum concentration of 1.1 mg L(-1), possibly due to coffee bean production facilities upstream. Other compounds found in high concentrations include: doxycycline (74 μg L(-1)), ibuprofen (37 μg L(-1)), gemfibrozil (17 μg L(-1)), acetominophen (13 μg L(-1)) and ketoprofen (10 μg L(-1)). The wastewater effluent collected from an oxidation pond had similar detection and concentrations of compounds compared to other studies reported in the literature. Waters receiving runoff from a nearby hospital showed higher concentrations than other areas for many PPCPs. Both caffeine and carbamazepine were found in low frequency compared to other studies, likely due to enhanced degradation and low usage, respectively. Overall concentrations of PPCPs in surface waters of Costa Rica are inline with currently reported occurrence data from around the world, with the exception of doxycycline.

  14. Effect of fragmentation on the Costa Rican dry forest avifauna.

    PubMed

    Barrantes, Gilbert; Ocampo, Diego; Ramírez-Fernández, José D; Fuchs, Eric J

    2016-01-01

    Deforestation and changes in land use have reduced the tropical dry forest to isolated forest patches in northwestern Costa Rica. We examined the effect of patch area and length of the dry season on nestedness of the entire avian community, forest fragment assemblages, and species occupancy across fragments for the entire native avifauna, and for a subset of forest dependent species. Species richness was independent of both fragment area and distance between fragments. Similarity in bird community composition between patches was related to habitat structure; fragments with similar forest structure have more similar avian assemblages. Size of forest patches influenced nestedness of the bird community and species occupancy, but not nestedness of assemblages across patches in northwestern Costa Rican avifauna. Forest dependent species (species that require large tracts of mature forest) and assemblages of these species were nested within patches ordered by a gradient of seasonality, and only occupancy of species was nested by area of patches. Thus, forest patches with a shorter dry season include more forest dependent species.

  15. Amerindian ancestry and extended longevity in Nicoya, Costa Rica.

    PubMed

    Azofeifa, Jorge; Ruiz-Narváez, Edward A; Leal, Alejandro; Gerlovin, Hanna; Rosero-Bixby, Luis

    2017-09-08

    The aim of this study was to address the hypothesis that Amerindian ancestry is associated with extended longevity in the admixed population of Nicoya, Costa Rica. The Nicoya Peninsula of Costa Rica has been considered a "longevity island," particularly for males. We estimated Amerindian ancestry using 464 ancestral informative markers in 20 old Nicoyans aged ≥99 years, and 20 younger Nicoyans (60-65 years). We used logistic regression to estimate odds ratio (OR) and 95% confidence interval (CI) of the association of Amerindian ancestry and longevity. Older Nicoyans had higher Amerindian ancestry compared to younger Nicoyans (43.3% vs 36.0%, P = .04). Each 10% increase of Amerindian ancestry was associated with more than twice the odds of being long-lived (OR = 2.32, 95% CI = 1.03-5.25). To our knowledge, this is the first time that ancestry is implicated as a likely determinant of extended longevity. Amerindian-specific alleles may protect against early mortality. The identification of these protective alleles should be the focus of future studies. © 2017 Wiley Periodicals, Inc.

  16. Forests of hope: Costa Rica. Restoring hope in the clouds.

    PubMed

    Bowen, L

    1996-01-01

    The rapid population growth in Central America has created pressure on the largest tract of cloud forest spanning the Talamanca Mountains in Costa Rica and Panama. Of immediate concern is restoring hope in the forest and improving the standard of living among local people. Such is the goal of the Amistad Conservation and Development (AMISCONDE) project in the communities of Cerro Punta, Panama, and San Rafael in Costa Rica. Through agriculture, forestry, animal husbandry, environmental education, and community development, AMISCONDE aims to restore the degraded lands in the reserve's buffer zone and improve the income of the people. All the local people, the farmers, women and children have benefited from the project. Some of the activities carried out to meet its objectives include helping the farmers improve the productivity and marketability of their products by teaching them new technologies and giving agricultural credits to farmers, women, and youth groups. In addition, AMISCONDE conducts training courses to address the economic, social and educational needs of women and communities. It is assured that the community and the group will be prepared to continue on their own after the official AMISCONDE office is gone.

  17. Loss of a Rho-regulated actin nucleator, mDia2, impairs cytokinesis during mouse fetal erythropoiesis.

    PubMed

    Watanabe, Sadanori; De Zan, Tihana; Ishizaki, Toshimasa; Yasuda, Shingo; Kamijo, Hiroshi; Yamada, Daisuke; Aoki, Tomohiro; Kiyonari, Hiroshi; Kaneko, Hiroshi; Shimizu, Ritsuko; Yamamoto, Masayuki; Goshima, Gohta; Narumiya, Shuh

    2013-11-27

    The small GTPase Rho and mDia2, a Rho-regulated actin nucleator, function as critical regulators of cytokinesis in cultured cells. However, their involvement in cytokinesis during mammalian development remains unknown. Here, we generated mice deficient in mDia2 and examined the role of Rho signaling in cytokinesis during development. mDia2-deficient mice survive until embryonic day 11.5 (E11.5), exhibit severe anemia with multinucleate erythroblasts, and die in utero by E12.5. mDia2-deficient erythroid cells differentiate normally, though in a delayed manner, but exhibit cytokinesis failure with decreased accumulation of F-actin in the cleavage furrow during late differentiation from proerythroblasts. On the other hand, inactivation of Rho induces cytokinesis failure from the earlier progenitor stage. mDia2-deficient erythroblasts, however, are able to enucleate their nuclei. Our findings have thus revealed that mDia2 functions critically in cytokinesis in vivo during erythropoiesis and further suggest that the cytokinesis mechanism in development diverges downstream of Rho. They also demonstrate that cytokinesis and enucleation utilize different mechanisms. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Costa Rica publications in the Science Citation Index Expanded: a bibliometric analysis for 1981-2010.

    PubMed

    Monge-Nájera, Julián; Ho, Yuh-Shan

    2012-12-01

    Despite of its small size, the Central American country of Costa Rica is internationally recognized as one of the world leaders in conservation and as the Central American leader in science. There have been no recent studies on the country's scientific production. The objective of this study was to analyze the Costa Rican scientific output as represented in the Science Citation Index Expanded. All documents with "Costa Rica" in the address field from 1981 to 2010 were included (total 6 801 publications). Articles (79%) were more frequent than other types of publication and were mostly in English (83%). Revista de Biología Tropical published the most articles (17%), followed by Toxicon and Turrialba (2.5%). The New England Journal of Medicine had the highest impact factor (53.484) with nine articles. Of 5 343 articles with known institutional address, 63%were internationally collaborative articles (most with the USA) with h index 91 and citation per publication 18. A total of 81% of all articles were inter-institutionally collaborative articles, led by the Universidad de Costa Rica. This reflects research and education agreements among these countries. Universidad de Costa Rica ranked top one in inter-institutionally collaborative articles, the rank of the total inter-institutionally collaborative articles, and the rank of first author articles and corresponding author articles. Studied subjects and journals in our sample are in agreement with dominant science fields and journals in Costa Rica. Articles with the highest citation were published in New England Journal of Medicine. The largest citation of medical articles reflects the general interest and wider readership of this subject. All corresponding and first authors of the high impact articles were not from Costa Rica. In conclusion, the scientific output of Costa Rican authors is strong in the areas related to conservation but the impact is higher for biomedical articles, and Costa Rican authors need to

  19. InDiaMed: A Comprehensive Database of Indian Medicinal plants for Diabetes

    PubMed Central

    Tota, Kumudini; Rayabarapu, Nihar; Moosa, Sowmya; Talla, Venu; Bhyravbhatla, Balaji; Rao, Srinivasa

    2013-01-01

    According to International Diabetes Federation (IDF), India has 62.4 million people with diabetes and by 2030 it is predicted that the number will rise to 100 million. Studies claim that there are around 410 experimentally proven Indian medicinal plants which have anti-diabetic activity, of which the mechanism of action of 109 plants has been elucidated or reported. So, the need of the hour is to explore the claims of Indian medicinal flora and open up the facets of many Indian plants which are being examined for their beneficial role in diabetes. So, we created a database (InDiaMed) of Indian medicinal plants that captures their role in anti-diabetic activity. InDiaMed's features include chemical, pharmacological, biochemical and geographical information of the medicinal plant, scientifically relevant information of the plant, and the coherent research done on it in the field of diabetes. The database also includes the list of poly-herbal formulations which are used for treatment of diabetes in India. Availability http://www.indiamed.info PMID:23750084

  20. Targeted proteomics coming of age - SRM, PRM and DIA performance evaluated from a core facility perspective.

    PubMed

    Kockmann, Tobias; Trachsel, Christian; Panse, Christian; Wahlander, Asa; Selevsek, Nathalie; Grossmann, Jonas; Wolski, Witold E; Schlapbach, Ralph

    2016-08-01

    Quantitative mass spectrometry is a rapidly evolving methodology applied in a large number of omics-type research projects. During the past years, new designs of mass spectrometers have been developed and launched as commercial systems while in parallel new data acquisition schemes and data analysis paradigms have been introduced. Core facilities provide access to such technologies, but also actively support the researchers in finding and applying the best-suited analytical approach. In order to implement a solid fundament for this decision making process, core facilities need to constantly compare and benchmark the various approaches. In this article we compare the quantitative accuracy and precision of current state of the art targeted proteomics approaches single reaction monitoring (SRM), parallel reaction monitoring (PRM) and data independent acquisition (DIA) across multiple liquid chromatography mass spectrometry (LC-MS) platforms, using a readily available commercial standard sample. All workflows are able to reproducibly generate accurate quantitative data. However, SRM and PRM workflows show higher accuracy and precision compared to DIA approaches, especially when analyzing low concentrated analytes.

  1. Urea removal by neonatal hemo(dia)filters in hyperazotemic rabbits.

    PubMed

    Gouyon, J B; Françoise, M; Semama, D S; Prévot, A; d'Athis, P; Lallemant, C

    1997-06-01

    Comparison of three neonatal hemo(dia)filters (FH22, Gambro; Minifilter Plus, Amicon; Miniflow 10, Hospal) for removal of urea by venovenous hemofiltration (HF) and venovenous hemodiafiltration (HDF). Filters were successively used for HF with two different blood flows (Qb = 8.3 and 16.6 ml/ min) and for HDF with the two different blood flows and four dialysate flows (Qd = 0.5, 1.0, 2.0, and 3.0 l/h). 21 anesthetized adult New Zealand White rabbits infused with urea. Urea clearance was significantly increased by HDF compared to HF regardless of blood flow, dialysate flow, and the hemo (dia)filter type except in the FH22 group, when blood flow was high and dialysate flow was 0.5 or 1.0 l/h. The FH22 filter allowed the best urea clearance during HF at high blood flow. During the HDF procedures, the Miniflow 10 allowed the highest urea clearance regardless of blood flow and dialysate flow.

  2. Preliminary deformation results to 12 GPa pressure using the Deformation-DIA

    NASA Astrophysics Data System (ADS)

    Mei, S.; Li, L.; Durham, W. B.; Wang, Y.; Uchita, T.; Getting, I. C.; Vaughan, M. T.; Weidner, D. J.; Burnley, P.

    2002-12-01

    High-pressure studies of the rheological behavior of Earth materials under high pressures are essential for understanding the dynamics of Earth's interior. However, outside of shock experiments and those in the diamond anvil cell, the highest working pressure for conventional deformation rigs (e.g., triaxial gas-medium apparatus, Griggs solid-medium apparatus) has been about 4 GPa. We report here first results from a new deformation apparatus called the deformation-DIA (D-DIA), a cubic-anvil, solid-medium apparatus specifically designed for constant-pressure deformation and capable of deforming samples at high temperatures (up to 2000 K) to pressures up to 15 GPa. Based on the cubic DIA apparatus, the D-DIA allows independent motion of the two vertical anvils to impose deformation on samples, and at the same time allows reverse motion on the four side anvils, thus preventing pressure from rising during deformation. Preliminary tests have been conducted on samples of NaCl, MgO, and olivine. The cold-pressed samples (1-2 mm in length and 1.2 mm in diameter), hard alumina pistons, and thermocouples form a 6-mm-long deformation column that is inserted into a graphite resistance heater within a 6-mm edge length cubic pressure medium, either pyrophyllite or boron epoxy. The cell is first squeezed hydrostatically to reach desired pressures and then deformed in compression at constant pressure. Experiments are carried out using synchrotron radiation, which makes it possible to measure sample length change and pressure in-situ to levels of <1 mm and ~10 MPa, respectively. To date we have carried out several constant displacement rate experiments at sample shortening rates of ~1 x 10-5 to 4 x 10-4 s-1 over shortening strains of 10 - 30% at temperatures of 500 - 1200°C and pressures of 5 - 12 GPa. Pressure is monitored by the location of diffraction peaks of a small amount of well-characterized proxy material (often MgO) in the deformation column. Pressure is controlled

  3. The DIAS Outreach Seismology in Schools (Seismeolaí­ocht sa Scoil) Pilot Programme

    NASA Astrophysics Data System (ADS)

    Blake, T.; Jones, A. G.; Campbell, G.

    2008-12-01

    Ireland has technology to thank for the 'Celtic Tiger' Revolution, yet over the last half decade fewer and fewer Irish students are completing high school with a science focus. To counter this trend, and to ensure a supply of Irish geophysicists for the future, it is important to engage and fascinate young minds with the wonders of physics and of the Earth we live on. The Geophysics Section of the School of Cosmic Physics in the Dublin Institute for Advanced Studies (DIAS) has been running an Outreach programme for some years, but there was a more general public orientation to the programme. In an effort to bring DIAS's science directly to the schools, we have launched a pilot programme, coincidentally and fortuitously during the International Year of Planet Earth (IYPE), in Seismology in Schools (Seismeolaíocht sa Scoil) that introduces young students to the world of seismology and earthquake research. The launch of DIAS's Seismology in Schools programme has been aided considerably through IRIS's (The Incorporated Institutes for Research Seismology) contributions of their AMASEIS software, that is used to display the data output from the seismometer, and educational posters and demonstration software used to teach Earth Science to students, and through BGS's design and development of the educational seismometer, which is a Lehman pattern horizontal motion seismometer using a garden-gate offset suspension pendulum. Initially, we planned for a very tentative pilot with just two seismometers rotating around local schools, but the Directors of the Educational Centres across Ireland (ATECI, Association of Teachers/Education Centres in Ireland) have become key players in this pilot by purchasing a further 34 seismometers and promoting this initiative among their school. In addition, Geological Survey of Ireland (GSI) has purchased a further four seismometers as part of their contribution to IYPE. Currently 36 schools are participating in the enlarged pilot programme

  4. Is Geriatric Medicine Possible in a Middle-Income Country? The Case of Costa Rica.

    PubMed

    Morales-Martínez, Fernando

    2017-08-01

    This article outlines the current and future-projected demographic data, organization, networks for the care of older people, and perspectives in Costa Rica in relation to the challenges resulting from exponential growth of the older adult population, most notably those aged 80 and older. It includes consideration of the Norms of Integrated Care of the Older Adult of Costa Rica's national social security system and contributions from other public and private institutions. It also makes note of commentaries on the need for ever-increasing efforts to manage the care of Costa Rica's burgeoning older adult population. © 2017, Copyright the Authors Journal compilation © 2017, The American Geriatrics Society.

  5. Hydraulic Model Investigation: Walnut Creek Flood-Control Project Contra Costa County, California.

    DTIC Science & Technology

    1987-10-01

    TECHNICAL REPORT HL-87-14 WALNUT CREEK FLOOD-CONTROL PROJECT CONTRA COSTA COUNTY, CALIFORNIA Hydraulic Model Investigation by W. G. Davis O11C tLE...34’ : AA Ii iA e d S O a :::: SCALE IN MILES 5 0 5 10 Figure 1. Vicinity map 4~ 4.. %- . " . " %____ WALNUT CREEK FLOOD-CONTROL PROJECT CONTRA COSTA COUNTY...Pleasant Hi-1, nd Martinez, California, on its way to the Suisin Bay. All of th.e planned imcrovements are located in Contra Costa County, California

  6. New species and new records of Manota Williston from Colombia, Brazilian Amazonia, and Costa Rica (Diptera, Mycetophilidae).

    PubMed

    Kurina, Olavi; Hippa, Heikki; Amorim, Dalton de Souza

    2017-01-01

    The following five species are described as new: Manota clavasp. n. (Colombia), Manota multilobatasp. n. (Colombia), Manota perplexasp. n. (Costa Rica), Manota setilobatasp. n. (Colombia) and Manota subaristatasp. n. (Colombia). In addition, new records for the following 11 species are presented: Manota acuminata Jaschhof & Hippa, 2005 (Costa Rica), Manota arenalensis Jaschhof & Hippa, 2005 (Costa Rica), Manota corcovado Jaschhof & Hippa, 2005 (Costa Rica), Manota costaricensis Jaschhof & Hippa, 2005 (Costa Rica), Manota diversiseta Jaschhof & Hippa, 2005 (Colombia, Brazilian Amazonia, Costa Rica), Manota minutula Hippa, Kurina & Sääksjärvi, 2017 (Brazilian Amazonia), Manota multisetosa Jaschhof & Hippa, 2005 (Costa Rica), Manota parva Jaschhof & Hippa, 2005 (Colombia, Costa Rica), Manota pisinna Hippa & Kurina, 2013 (Brazilian Amazonia), Manota spinosa Jaschhof & Hippa, 2005 (Colombia) and Manota squamulata Jaschhof & Hippa, 2005 (Costa Rica). Distribution patterns include (1) species known only locally in Costa Rica or Colombia, (2) distributions connecting Central America to west Andes lowlands, and (3) north-west Neotropical components, extending from Central America to Brazilian Amazonia. The possible biogeographical and taxonomical context of Manota species with a widespread distribution is considered.

  7. New species and new records of Manota Williston from Colombia, Brazilian Amazonia, and Costa Rica (Diptera, Mycetophilidae)

    PubMed Central

    Kurina, Olavi; Hippa, Heikki; Amorim, Dalton de Souza

    2017-01-01

    Abstract The following five species are described as new: Manota clava sp. n. (Colombia), Manota multilobata sp. n. (Colombia), Manota perplexa sp. n. (Costa Rica), Manota setilobata sp. n. (Colombia) and Manota subaristata sp. n. (Colombia). In addition, new records for the following 11 species are presented: Manota acuminata Jaschhof & Hippa, 2005 (Costa Rica), Manota arenalensis Jaschhof & Hippa, 2005 (Costa Rica), Manota corcovado Jaschhof & Hippa, 2005 (Costa Rica), Manota costaricensis Jaschhof & Hippa, 2005 (Costa Rica), Manota diversiseta Jaschhof & Hippa, 2005 (Colombia, Brazilian Amazonia, Costa Rica), Manota minutula Hippa, Kurina & Sääksjärvi, 2017 (Brazilian Amazonia), Manota multisetosa Jaschhof & Hippa, 2005 (Costa Rica), Manota parva Jaschhof & Hippa, 2005 (Colombia, Costa Rica), Manota pisinna Hippa & Kurina, 2013 (Brazilian Amazonia), Manota spinosa Jaschhof & Hippa, 2005 (Colombia) and Manota squamulata Jaschhof & Hippa, 2005 (Costa Rica). Distribution patterns include (1) species known only locally in Costa Rica or Colombia, (2) distributions connecting Central America to west Andes lowlands, and (3) north-west Neotropical components, extending from Central America to Brazilian Amazonia. The possible biogeographical and taxonomical context of Manota species with a widespread distribution is considered. PMID:28769645

  8. Involvement of the Rho–mDia1 pathway in the regulation of Golgi complex architecture and dynamics

    PubMed Central

    Zilberman, Yuliya; Alieva, Naila O.; Miserey-Lenkei, Stéphanie; Lichtenstein, Alexandra; Kam, Zvi; Sabanay, Helena; Bershadsky, Alexander

    2011-01-01

    In mammalian cells, the Golgi apparatus is a ribbon-like, compact structure composed of multiple membrane stacks connected by tubular bridges. Microtubules are known to be important to Golgi integrity, but the role of the actin cytoskeleton in the maintenance of Golgi architecture remains unclear. Here we show that an increase in Rho activity, either by treatment of cells with lysophosphatidic acid or by expression of constitutively active mutants, resulted in pronounced fragmentation of the Golgi complex into ministacks. Golgi dispersion required the involvement of mDia1 formin, a downstream target of Rho and a potent activator of actin polymerization; moreover, constitutively active mDia1, in and of itself, was sufficient for Golgi dispersion. The dispersion process was accompanied by formation of dynamic F-actin patches in the Golgi area. Experiments with cytoskeletal inhibitors (e.g., latrunculin B, blebbistatin, and Taxol) revealed that actin polymerization, myosin-II–driven contractility, and microtubule-based intracellular movement were all involved in the process of Golgi dispersion induced by Rho–mDia1 activation. Live imaging of Golgi recovery revealed that fusion of the small Golgi stacks into larger compartments was repressed in cells with active mDia1. Furthermore, the formation of Rab6-positive transport vesicles derived from the Golgi complex was enhanced upon activation of the Rho–mDia1 pathway. Transient localization of mDia1 to Rab6-positive vesicles was detected in cells expressing active RhoA. Thus, the Rho–mDia1 pathway is involved in regulation of the Golgi structure, affecting remodeling of Golgi membranes. PMID:21680709

  9. Diffusely infiltrated lymphoid areas of the bursa of Fabricius (DIA) and of the cloaca: an embryological study with morphological analogies.

    PubMed Central

    Dolfi, A; Lupetti, M; Bianchi, F; Michelucci, S

    1988-01-01

    The aim of the present experiment was to verify whether the origin of the DIA is ectodermal or endodermal. A rabbit serum against the epithelial cells of the final portion of the cloaca was prepared. The indirect immunofluorescence method was applied to strips obtained with a cryostat, carefully cut in such a way as to include a part of the cloaca, the burso-cloacal stalk, the DIA, and the bursal plicae. In this way, it was possible to demonstrate that the epithelium of the cloaca, of the burso-cloacal stalk, and of the DIA exhibited an intense fluorescence that could not be observed at the level of the epithelium of the bursal plicae. These findings would appear to indicate that the DIA, like the cloaca and the burso-cloacal stalk, is ectodermal in origin. Furthermore, histological study revealed that the DIA exhibits close structural analogies with the dorsal wall of the cloaca. In both areas, unorganized lymphoid infiltrations of the tunica propria can be seen, and the epithelium does not show any follicle-associated epithelial cells. The glands often assume the aspect of dilated crypts containing intestinal transit material. The epithelium of these glands reveals lymphoid infiltrations at various points, and it is not uncommon to detect accumulations of cells in their lumina. Several groups of eosinophilic granulocytes can also be observed in the tunica propria of these two areas, with a clear predominance at the level of the DIA. These similarities between the cloaca and the DIA might lead one to suppose the existence of a functional as well as a morphological correspondence. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 Fig. 8 Fig. 9 Fig. 10 Fig. 11 Fig. 12 PMID:3417544

  10. Distribution of DI*A and DI*B Allele Frequencies and Comparisons among Central Thai and Other Populations

    PubMed Central

    Nathalang, Oytip; Panichrum, Puangpaka; Intharanut, Kamphon; Thattanon, Phatchira; Nathalang, Siriporn

    2016-01-01

    Alloantibodies to the Diego (DI) blood group system, anti-Dia and anti-Dib are clinically significant in causing hemolytic transfusion reactions (HTRs) and hemolytic disease of the fetus and newborn (HDFN), especially in Asian populations with Mongolian ancestry. This study aimed to report the frequency of the DI*A and DI*B alleles in a Central Thai population and to compare them with those of other populations previously published. Altogether, 1,011 blood samples from unrelated healthy blood donors at the National Blood Centre, Thai Red Cross Society, Bangkok were included. Only 391 samples were tested with anti-Dia by conventional tube technique. All samples were genotyped for DI*A and DI*B alleles using an in-house polymerase chain reaction with sequence-specific primer (PCR-SSP) technique. The DI phenotyping and genotyping results were in 100% concordance. The DI*A and DI*B allele frequencies among 1,011 Central Thais were 0.0183 (37/2,022) and 0.9817 (1,985/2,022), respectively. Allele frequencies were compared between Central Thai and other populations. Our data shows that DI*A and DI*B allele frequencies are similar to Southeast Asian, Brazilian, Southern Brazilian and American Native populations; whereas, these frequencies significantly differ from those reported in East Asian, Italian, Alaska Native/Aleut, Hawaiian/Pacific Islander and Filipino populations (P<0.05), corresponding to the results of a matrix of geometric genetic distances. This study confirms that the prevalence of DI*A and DI*B alleles among Central Thais is similar to Southeast Asians and different to others populations of the world. A PCR-based identification of DI genotyping should overcome some of the serological limitations in transfusion medicine and provides a complementary tool for further population-genetic studies. PMID:27764238

  11. [Marine biodiversity of Costa Rica, the microcrustacea: Copepoda (Crustacea: Maxillopoda)].

    PubMed

    Morales-Ramírez, A

    2001-12-01

    This report is part of a series that summarizes the species and localities of Costa Rican marine taxa. A review of the literature on copepods, both pelagic and benthic for the Pacific and Caribbean coast of Costa Rica, includes eighty species. Sixty seven pelagic species have been found, distributed between sixteen calanoid, one cyclopoid, three harparticoid and four poecilostomatoid families. Moreover, thirteen benthonic species distributed into six families, all harparticoids, are reported. Among the pelagic families, Pontellidae has six species, while Paracalanidae and Eucalanidae had five each. Other families, like Calanidae, Pseudodiaptomidae and Acartiidae had four species and most families only one. Forty five species are reported only for the Pacific coast, thirteen for the Caribbean coast, only nine species occurred in both coasts; being a direct consequence of the more intensive research effort in the Pacific. Pelagic copepod biodiversity reflects different oceanographic conditions in both coasts. Typical estuarine species were found in the lower region of the Gulf of Nicoya, while a mixture of estuarine and oceanic species were found in Golfo Dulce. Diversity in the Caribbean, specially at the Cahuita coral reef is lower in comparison with the copepod diversity found in other regions in the Caribbean sea. This may be due to the high sediment resuspension rate characteristic of the Cahuita coral reef, which could affect the reproduction of many holozooplankters, specially copepods. Although sixty seven pelagic copepod species appears to be in low numbers, in terms of specific biodiversity it is as high when compared to numbers found in other tropical areas. Thirteen species are reported in the literature, all harparticoids. Five species, three sub-species and one genera were new to science. Balacopsylla is reported for the first time from a neotropical regions, while the genus Karllangia, represented by two coexisting species in the Caribbean coast

  12. Beyond the D-DIA: new initiatives for deformation experiments at higher pressure and temperature

    NASA Astrophysics Data System (ADS)

    Wang, Y.; Jing, Z.; Yu, T.; Hilairet, N.; Nishiyama, N.

    2011-12-01

    Advances in experimental high-pressure, high-temperature deformation have relied to a large extent on technological developments. From the pioneer work of F.D. Adams [1] in generating differential stress at high pressure to deform rocks plastically to Griggs' famous deformation apparatus [2], each new invention has enabled numerous scientific publications and brought our understanding of rock deformation to a new level. For the past few years, two major workhorses in deformation experiments above 3 GPa are the rotational deformation apparatus (RDA) [3] and the deformation DIA (D-DIA) [4]. These developments brought us to almost 20 GPa under controlled differential stress and strain rates. Several new initiatives are being undertaken at GSECARS aiming at further enhancing experimental capabilities to higher pressures, temperatures and better in situ characterization of the deforming samples. We constructed a modified RDA with microtomography capability at high pressure which is used to image, in situ and in 3D, fabric evolution in multi-phase composites under large shear strains, to shed lights on the physics of complex earth materials during deformation. A large version of D-DIA (DDIA-30) has also been developed taking advantages of the rigidity of large guide blocks for much improved alignment. A 6-6 multianvil cell (MA6-6) [5] is used for deformation experiments with various truncated edge lengths, without having to change the large first-stage anvils. This configuration has the potential to reach pressure conditions corresponding to the lower mantle. We present recent results of these developments, and their potential applications for understanding dynamic processes from the upper mantle to the lower mantle. [1] Adams, F. D. and J. T. Nicolson (1900) Phil. Trans. Roy. Soc. London. A, 195: 363-401. [2] Griggs, D.T. (1967) Geophys. J. Roy. Astr. Soc., 14:19-31. [3] Yamazaki, D., and S. Karato (2001) Rev. Sci. Instrum., 72:4207-4211. [4] Wang, Y., I. Getting, W

  13. Laryngeal malformations in the Richieri-Costa and Pereira form of acrofacial dysostosis.

    PubMed

    Tabith Júnior, A; Gonçalves, C G

    1996-12-30

    We report on laryngeal malformations in 5 subjects, 4 females and 1 male, with the autosomal-recessive Richieri-Costa and Pereira form of acrofacial dysostosis. Characteristics of the voice are described.

  14. Costa Rica's payment for environmental services program: intention, implementation, and impact.

    PubMed

    Sánchez-Azofeifa, G Arturo; Pfaff, Alexander; Robalino, Juan Andres; Boomhower, Judson P

    2007-10-01

    We evaluated the intention, implementation, and impact of Costa Rica's program of payments for environmental services (PSA), which was established in the late 1990s. Payments are given to private landowners who own land in forest areas in recognition of the ecosystem services their land provides. To characterize the distribution of PSA in Costa Rica, we combined remote sensing with geographic information system databases and then used econometrics to explore the impacts of payments on deforestation. Payments were distributed broadly across ecological and socioeconomic gradients, but the 1997-2000 deforestation rate was not significantly lower in areas that received payments. Other successful Costa Rican conservation policies, including those prior to the PSA program, may explain the current reduction in deforestation rates. The PSA program is a major advance in the global institutionalization of ecosystem investments because few, if any, other countries have such a conservation history and because much can be learned from Costa Rica's experiences.

  15. Heat exposure in sugarcane workers in Costa Rica during the non-harvest season

    PubMed Central

    Crowe, Jennifer; Moya-Bonilla, José Manuel; Román-Solano, Bryan; Robles-Ramírez, Andrés

    2010-01-01

    This observational pilot study was carried out at three sugarcane companies in Costa Rica. Its main objective was to determine the potential for heat stress conditions for workers in one sugarcane-growing region in Costa Rica during the maintenance (non-harvest) period. Wet bulb globe temperature (WBGT) variables were measured with a heat stress meter and threshold value limits and the Sweat Rate Indexes were calculated for each workplace. It was determined that workers in this study were in heat stress conditions. Costa Rica is likely to experience warmer temperatures and increased heat waves in the coming decades. It is therefore important to take action to decrease current and future heat-related risks for sugarcane workers in both harvest and non-harvest conditions and in all sugarcane growing regions in Costa Rica. It is also necessary to improve guidelines and occupational health standards for protecting worker health and productivity in the tropics. PMID:21139704

  16. Heat exposure in sugarcane workers in Costa Rica during the non-harvest season.

    PubMed

    Crowe, Jennifer; Moya-Bonilla, José Manuel; Román-Solano, Bryan; Robles-Ramírez, Andrés

    2010-11-29

    This observational pilot study was carried out at three sugarcane companies in Costa Rica. Its main objective was to determine the potential for heat stress conditions for workers in one sugarcane-growing region in Costa Rica during the maintenance (non-harvest) period.Wet bulb globe temperature (WBGT) variables were measured with a heat stress meter and threshold value limits and the Sweat Rate Indexes were calculated for each workplace. It was determined that workers in this study were in heat stress conditions. Costa Rica is likely to experience warmer temperatures and increased heat waves in the coming decades. It is therefore important to take action to decrease current and future heat-related risks for sugarcane workers in both harvest and non-harvest conditions and in all sugarcane growing regions in Costa Rica. It is also necessary to improve guidelines and occupational health standards for protecting worker health and productivity in the tropics.

  17. Personnel viewing posters showing how NASA activities have made an impact on Costa Rican people

    NASA Image and Video Library

    2004-03-03

    L-R; Jorge Andres Diaz, Director of the Costa Rican National Hangar for Airborne Research division of the National Center for High Technology(CENAT); NASA Administrator Sean O'Keefe; and Fernando Gutierrez, Costa Rican Minister of Science and Technology(MICIT), viewing posters showing how NASA activities have made an impact on Costa Rican people. Mr. O'Keefe was in Costa Rica to participate in the AirSAR 2004 Mesoamerica campaign, which used NASA DFRC's DC-8 airborne laboratory aircraft. AirSAR 2004 is a three-week expedition by an international team of scientists that will use an all-weather imaging tool, called the Airborne Synthetic Aperture Radar (AirSAR), in a mission ranging from the tropical rain forests of Central America to frigid Antarctica.

  18. A new species of Anastrepha (Diptera: Tephritidae) from Colombia, Costa Rica and Panama

    USDA-ARS?s Scientific Manuscript database

    Anastrepha woodi, new species, is described and illustrated based on specimens from Colombia and Costa Rica. It is compared with A. loewi Stone, the most similar species, which is also redescribed....

  19. Olfactory communication among Costa Rican squirrel monkeys: a field study.

    PubMed

    Boinski, S

    1992-01-01

    Behaviors with a possible role in olfactory communication among troop members were investigated as part of a field study on the reproductive and foraging ecology of squirrel monkeys (Saimiri oerstedi) in Costa Rica. All age classes engaged in the olfaction-related behaviors. Apart from olfactory investigation of female genitals by males during the mating season, no other potential olfaction-related behavior (urine wash, branch investigation, rump, chest, back rub and sneeze) exceeded 1% of mean behavioral samples. Assessment of reproduction condition appears to be the primary function of such olfactory investigation of the female genital region. The primary function of urine washing is suggested to be the general communication of reproductive status, possibly facilitating reproductive synchrony. Sneezing, rump, back and chest rubbing do not appear to deposit substances active in olfactory communication.

  20. Protected areas reduced poverty in Costa Rica and Thailand

    PubMed Central

    Andam, Kwaw S.; Ferraro, Paul J.; Sims, Katharine R. E.; Healy, Andrew; Holland, Margaret B.

    2010-01-01

    As global efforts to protect ecosystems expand, the socioeconomic impact of protected areas on neighboring human communities continues to be a source of intense debate. The debate persists because previous studies do not directly measure socioeconomic outcomes and do not use appropriate comparison groups to account for potential confounders. We illustrate an approach using comprehensive national datasets and quasi-experimental matching methods. We estimate impacts of protected area systems on poverty in Costa Rica and Thailand and find that although communities near protected areas are indeed substantially poorer than national averages, an analysis based on comparison with appropriate controls does not support the hypothesis that these differences can be attributed to protected areas. In contrast, the results indicate that the net impact of ecosystem protection was to alleviate poverty. PMID:20498058

  1. Chytridiomycosis in wild frogs from southern Costa Rica

    USGS Publications Warehouse

    Lips, Karen R.; Green, D.E.; Papendick, R.

    2003-01-01

    In 1993, the amphibian fauna of Las Tablas, Costa Rica, began to decline, and by 1998 approximately 50% of the species formerly present could no longer be found. Three years later, at the Reserva Forestal Fortuna, in western Panama, a site approximately 75 km east southeast of Las Tablas, KRL encountered a mass die-off of amphibians and a subsequent decline in abundance and species richness. The epidemiological features of the anuran population declines and die-offs at both sites were similar, suggesting a similar cause. Herein we document the presence of the fungus, Batrachochytrium dendrobatidis, in dead and dying wild frogs collected at Las Tablas just prior to population declines of several anuran species.

  2. Protected areas reduced poverty in Costa Rica and Thailand.

    PubMed

    Andam, Kwaw S; Ferraro, Paul J; Sims, Katharine R E; Healy, Andrew; Holland, Margaret B

    2010-06-01

    As global efforts to protect ecosystems expand, the socioeconomic impact of protected areas on neighboring human communities continues to be a source of intense debate. The debate persists because previous studies do not directly measure socioeconomic outcomes and do not use appropriate comparison groups to account for potential confounders. We illustrate an approach using comprehensive national datasets and quasi-experimental matching methods. We estimate impacts of protected area systems on poverty in Costa Rica and Thailand and find that although communities near protected areas are indeed substantially poorer than national averages, an analysis based on comparison with appropriate controls does not support the hypothesis that these differences can be attributed to protected areas. In contrast, the results indicate that the net impact of ecosystem protection was to alleviate poverty.

  3. Costa Rica Turrialba Volcano, Continued Activity seen by NASA Spacecraft

    NASA Image and Video Library

    2015-04-06

    The March, 2015 eruption of Turrialba Volcano in Costa Rica caught everyone by surprise as seen in this image from the ASTER instrument onboard NASA Terra spacecraft. Activity had greatly diminished when the Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER) instrument on NASA's Terra spacecraft acquired this nighttime thermal infrared image on April 2, 2015. The hot summit crater appears in white, indicating continued volcanic unrest. To the west, Poas Volcano's hot crater lake also appears white, though its temperature is considerably less than Turrialba's crater. The large image covers an area of 28 by 39 miles (45 by 63 kilometers); the insets 2 by 2 miles (3.1 by 3.1 kilometers). The image is centered at 10.1 degrees north, 84 degrees west. http://photojournal.jpl.nasa.gov/catalog/PIA19355

  4. The chemical and hydrologic structure of Poas volcano, Costa Rica

    USGS Publications Warehouse

    Rowe, G.L.; Brantley, S.L.; Fernandez, J.F.; Borgia, A.

    1995-01-01

    Comparison of the chemical characteristics of spring and river water draining the flanks of Poas Volcano, Costa Rica indicates that acid chloride sulfate springs of the northwestern flank of the volcano are derived by leakage and mixing of acid brines formed in the summit hydrothermal system with dilute flank groundwater. Acid chloride sulfate waters of the Rio Agrio drainage basin on the northwestern flank are the only waters on Poas that are affected by leakage of acid brines from the summit hydrothermal system. Acid sulfate waters found on the northwestern flank are produced by the interaction of surface and shallow groundwater with dry and wet acid deposition of SO2 and H2SO4 aerosols, respectively. The acid deposition is caused by a plume of acid gases that is released by a shallow magma body located beneath the active crater of Poas. -from Authors

  5. Arbutoid mycorrhizas of the genus Cortinarius from Costa Rica.

    PubMed

    Kühdorf, K; Münzenberger, B; Begerow, D; Gómez-Laurito, J; Hüttl, R F

    2016-08-01

    Arbutoid mycorrhizas of Comarostaphylis arbutoides (Arbutoidea, Ericaceae) from neotropical montane forests are rarely described. To date, only mycorrhizal associations with the fungal species Leccinum monticola, Leotia lubrica and Sebacina sp. are known from literature. The genus Cortinarius is one of the most species-rich ectomycorrhizal taxa with over 2000 assumed species. In this study, two sites in the Cordillera de Talamanca of Costa Rica were sampled, where Com. arbutoides is endemic and grows together with Quercus costaricensis. Using a combined method of rDNA sequence analysis and morphotyping, 33 sampled mycorrhizal systems of Cortinarius were assigned to the subgenera Dermocybe, Phlegmacium and Telamonia. Specific plant primers were used to identify the host plant. Here, we present the phylogenetic data of all found Cortinarii and describe four of the arbutoid mycorrhizal systems morphologically and anatomically.

  6. Ecosystem-Level Carbon Stocks in Costa Rican Mangrove Forests

    NASA Astrophysics Data System (ADS)

    Cifuentes, M.

    2012-12-01

    Tropical mangroves provide a wide variety of ecosystem services, including atmospheric carbon sequestration. Because of their high rates of carbon accumulation, the large expected size of their total stocks (from 2 to 5 times greater than those of upland tropical forests), and the alarming rates at which they are being converted to other uses (releasing globally from 0.02 to 0.12 Pg C yr-1), mangroves are receiving increasing attention as additional tools to mitigate climate change. However, data on whole ecosystem-level carbon in tropical mangroves is limited. Here I present the first estimate of ecosystem level carbon stocks in mangrove forests of Central America. I established 28, 125 m-long, sampling transects along the 4 main rivers draining the Térraba-Sierpe National Wetland in the southern Pacific coast of Costa Rica. This area represents 39% of all remaining mangroves in the country (48300 ha). A circular nested plot was placed every 25 m along each transect. Carbon stocks of standing trees, regeneration, the herbaceous layer, litter, and downed wood were measured following internationally-developed methods compatible with IPCC "Good Practice Guidelines". In addition, total soil carbon stocks were determined down to 1 m depth. Together, these carbon estimates represent the ecosystem-carbon stocks of these forests. The average aboveground carbon stocks were 72.5 ± 3.2 MgC ha-1 (range: 9 - 241 MgC ha-1), consistent with results elsewhere in the world. Between 74 and 92% of the aboveground carbon is stored in trees ≥ 5cm dbh. I found a significant correlation between basal area of trees ≥ 5cm dbh and total aboveground carbon. Soil carbon stocks to 1 m depth ranged between 141 y 593 MgC ha-1. Ecosystem-level carbon stocks ranged from 391 MgC ha-1 to 438 MgC ha-1, with a slight increase from south to north locations. Soil carbon stocks represent an average 76% of total ecosystem carbon stocks, while trees represent only 20%. These Costa Rican mangroves

  7. Contra Costa County's one-year experience with gasohol

    SciTech Connect

    Gibbs, L.M.; Gilbert, B.J.

    1981-01-01

    Starting August 1, 1979, a one-year gasohol test was conducted by Contra Costa County. A total of 30 county pool cars were on test - 15 on gasohol and 15 similar cars on gasoline as a control group. Findings were as follows. There were no fuel-related maintenance problems in either the gasohol or gasoline groups of cars. Cool weather driveability for the gasohol cars was the same or better than gasoline cars. No vapor lock or other hot driveability problems were reported for either fuel. Fuel economy of the gasohol cars was about 5% poorer than that of the gasoline cars. Fuel system deposits with gasohol were increased and differed in character compared to gasoline. Also, the gasohol carburetors showed more inlet needle valve tip wear. However, to date, the observed deposits and wear with gasohol have not caused any apparent problems.

  8. [Variation of thermohaline properties in the Nicoya Gulf, Costa Rica].

    PubMed

    Brenes, C L; Léon, S; Chaves, J

    2001-12-01

    The time-space behavior of thermohaline properties of the water masses in the Gulf of Nicoya, a tropical estuary in the Costa Rican Pacific coast, was studied by sampling monthly from April 1992 to April 1993. The saline field has a seasonal maximum during April, a month before the maximum temperature is observed. Minimun values were observed during October and November, in the rainy season. A defined surface saline front is located towards the east of Negritos Islands; it is produced by the interaction of freshwater from the Tarcoles River and the oceanic waters that enter through the occidental coast of the gulf. The vertical distribution of temperature and salinity indicates a gulf whose internal area is highly stratified in the rainy season, and much less stratified, or even well mixed in the dry season. The outer area of the Gulf is stratified throughout the year.

  9. The Phyllodonta latrata (Guenée) species group in Costa Rica (Geometridae, Ennominae)

    PubMed Central

    Sullivan, J. Bolling

    2014-01-01

    Abstract Historically, the name Phyllodonta latrata (Guenée) has been applied to what is a complex of three undescribed species in Costa Rica. They are very similar in maculation, but can be differentiated by genitalic characters and barcodes. P. alajuela Sullivan, sp. n. occurs at lower altitudes in the northwestern part of Costa Rica whereas P. intermediata Sullivan, sp. n. and P. esperanza Sullivan, sp. n. are found at partially overlapping altitudes in the central mountain ranges. PMID:25061377

  10. The Phyllodonta latrata (Guenée) species group in Costa Rica (Geometridae, Ennominae).

    PubMed

    Sullivan, J Bolling

    2014-01-01

    Historically, the name Phyllodonta latrata (Guenée) has been applied to what is a complex of three undescribed species in Costa Rica. They are very similar in maculation, but can be differentiated by genitalic characters and barcodes. P. alajuela Sullivan, sp. n. occurs at lower altitudes in the northwestern part of Costa Rica whereas P. intermediata Sullivan, sp. n. and P. esperanza Sullivan, sp. n. are found at partially overlapping altitudes in the central mountain ranges.

  11. [The importance of genealogy applied to genetic research in Costa Rica].

    PubMed

    Meléndez Obando, Mauricio O

    2004-09-01

    The extensive development of genealogical studies based on archival documents has provided powerful support for genetic research in Costa Rica over the past quarter century. As a result, several questions of population history have been answered, such as those involving hereditary illnesses, suggesting additional avenues and questions as well. Similarly, the preservation of massive amounts of historical documentation highlights the major advantages that the Costa Rican population offers to genetic research.

  12. Proposed Expansion of Acme Landfill Operations, Contra Costa, County, California. Volume 1.

    DTIC Science & Technology

    1983-06-01

    for example, plastic beverage bottles, cardboard, wood, yardwastes, textiles , rubber, and leather. In addition to traditional activities, a central...a 6000-foot-long dredged channel. The 200-acre parcel is crossed with a number of drainage ditches, constructed by the Contra Costa Mosquito ...incoming flow at the high tide. It is the only point of discharge for flood water and is maintained by the Contra Costa Mosquito Abatement District

  13. Electronic Dietary Intake Assessment (e-DIA): relative validity of a mobile phone application to measure intake of food groups.

    PubMed

    Rangan, Anna M; Tieleman, Laurissa; Louie, Jimmy C Y; Tang, Lie Ming; Hebden, Lana; Roy, Rajshri; Kay, Judy; Allman-Farinelli, Margaret

    2016-06-01

    Automation of dietary assessment can reduce limitations of established methodologies, by alleviating participant and researcher burden. Designed as a research tool, the electronic Dietary Intake Assessment (e-DIA) is a food record in mobile phone application format. The present study aimed to examine the relative validity of the e-DIA with the 24-h recall method to estimate intake of food groups. A sample of eighty university students aged 19-24 years recorded 5 d of e-DIA and 3 d of recall within this 5-d period. The three matching days of dietary data were used for analysis. Food intake data were disaggregated and apportioned to one of eight food groups. Median intakes of food groups were similar between the methods, and strong correlations were found (mean: 0·79, range: 0·69-0·88). Cross-classification by tertiles produced a high level of exact agreement (mean: 71 %, range: 65-75 %), and weighted κ values were moderate to good (range: 0·54-0·71). Although mean differences (e-DIA-recall) were small (range: -13 to 23 g), limits of agreement (LOA) were relatively large (e.g. for vegetables, mean difference: -4 g, LOA: -159 to 151 g). The Bland-Altman plots showed robust agreement, with minimum bias. This analysis supports the use of e-DIA as an alternative to the repeated 24-h recall method for ranking individuals' food group intake.

  14. WAVE and Arp2/3 jointly inhibit filopodium formation by entering into a complex with mDia2.

    PubMed

    Beli, Petra; Mascheroni, Debora; Xu, Dalu; Innocenti, Metello

    2008-07-01

    Lamellipodia/ruffles and filopodia are protruding organelles containing short and highly branched or long and unbranched actin filaments, respectively. The microscopic morphology, dynamic development and protein signature of both lamellipodia/ruffles and filopodia have been investigated; however, little is known about the mechanisms by which cells coordinate the formation of these actin-based extensions. Here, we show that WAVE holds mDia2 and the Arp2/3 complex in a multimolecular complex. WAVE- and Arp2/3-dependent ruffling induced by EGF does not require mDia2. Conversely, the emission of mDia2-dependent filopodia correlates with its disengagement from WAVE. Consistently, the ability of EGF, Cdc42 and serum to induce mDia2-dependent formation of filopodia is increased in the absence of either the WAVE/Abi1/Nap1/PIR121 (WANP) or the Arp2/3 complex. Reintroduction of WAVE2 into WANP-complex knockdown cells markedly reduces filopodia formation independently of actin polymerization. Thus, WAVE and the Arp2/3 complex jointly orchestrate different types of actin-based plasma membrane protrusions by promoting ruffling and inhibiting mDia2-induced filopodia.

  15. RhoB and the mammalian Diaphanous-related formin mDia2 in endosome trafficking.

    PubMed

    Wallar, Bradley J; Deward, Aaron D; Resau, James H; Alberts, Arthur S

    2007-02-01

    Rho GTPases and the dynamic assembly and disassembly of actin filaments have been shown to have critical roles in both the internalization and trafficking of growth factor receptors. While all three mammalian Diaphanous-related (mDia1/2/3) formin GTPase effector proteins have been localized on endosomes, a role for their actin nucleation, filament elongation, and/or bundling remains poorly understood in the context of intracellular trafficking. In a study of a functional relationship between RhoB, a GTPase known to associate with both early- and late-endosomes, and the formin mDia2, we show that 1) RhoB and mDia2 interact on endosomes; 2) GTPase activity-the ability to hydrolyze GTP to GDP-is required for the ability of RhoB to govern endosome dynamics; and 3) the actin dynamics controlled by RhoB and mDia2 is necessary for vesicle trafficking. These studies further suggest that Rho GTPases significantly influence the activity of mDia family formins in driving cellular membrane remodeling through the regulation of actin dynamics.

  16. mDia2 regulates actin and focal adhesion dynamics and organization in the lamella for efficient epithelial cell migration.

    PubMed

    Gupton, Stephanie L; Eisenmann, Kathryn; Alberts, Arthur S; Waterman-Storer, Clare M

    2007-10-01

    Cell migration requires spatial and temporal regulation of filamentous actin (F-actin) dynamics. This regulation is achieved by distinct actin-associated proteins, which mediate polymerization, depolymerization, severing, contraction, bundling or engagement to the membrane. Mammalian Diaphanous-related (mDia) formins, which nucleate, processively elongate, and in some cases bundle actin filaments, have been extensively studied in vitro, but their function in the cell has been less well characterized. Here we study the role of mDia2 activity in the dynamic organization of F-actin in migrating epithelial cells. We find that mDia2 localizes in the lamella of migrating epithelial cells, where it is involved in the formation of a stable pool of cortical actin and in maintenance of polymerization-competent free filament barbed ends at focal adhesions. Specific inhibition of mDia2 alters focal adhesion turnover and reduces migration velocity. We suggest that the regulation of filament assembly dynamics at focal adhesions may be necessary for the formation of a stable pool of cortical lamella actin and the proper assembly and disassembly dynamics of focal adhesions, making mDia2 an important factor in epithelial cell migration.

  17. Sustaining life in frontier land. Country report 2: Costa Rica.

    PubMed

    Prescott-allen, R

    1993-01-01

    The Community Development Association of the fishing village of Barra del Colorado populated by Blacks embraced the Conservation Strategy for the Sustainable Development of the Plains Tortuguero covering 419,000 hectares of lowland rain forest and wetlands along the Caribbean cost of northern Costa Rica. In 1985 the government established the Barra del Colorado Wildlife Refuge. The International Union for the Conservation of Nature (IUCN) team visited families and identified community problems. This resulted in the establishment of a communal bank; a community fisherman's association to help obtain a boat and fishing gear; assistance to help villagers obtain title to their land; a feasibility study of a public transport link to the rest of the country; new chairs for the school; and weekly instead of monthly visits by a doctor. The Tortuguero Strategy endeavors to establish 147,000 hectares of conservation area including the Tortuguero National Park. 5000 people live in the buffer zone and 132,000 live in the neighboring western area. The strategy strives to reverse deforestation in the buffer zone by restoring forest cover to 80% of the area by 2000. The Strategy has funded the Union of Small Agricultural Producers of the Atlantic to train people in ecotourism, forestry management, and growing and selling medicinal plants. The IUCN evaluated the environmental impact of expanding banana plantations and recommended ameliorative steps which have not been implemented. The preparation of the Tortuguero Strategy started in 1990 in concert with the Natural Resources Ministry, IUCN, and the European Community. A 1992 draft document based on biophysical, socioeconomic, and legal studies is waiting for official approval. Community strategies have been launched in 2 communities, self-sustaining financing is delayed, and a draft law setting up the conservation area awaits Costa Rican legislative authorization. The strategy is for the long term, but the experience of Barra del

  18. A radio voice for women. Organizing for change: Costa Rica.

    PubMed

    Suarez Toro, M

    1995-01-01

    The Feminist Radio Endeavor (FIRE) was organized in Costa Rica in 1991 and broadcasts in English and Spanish for two hours every day on its own short-wave radio station, Radio for Peace International. In January 1995, FIRE discovered that the Costa Rican government planned to create a huge garbage land-fill proximate to a unique forest reserve which is the last primary forest reserve near the city of San Jose. The 100 acres of forest rests in a transitional zone between the Pacific and Atlantic coasts and hosts a wide variety of flora and fauna. On one side of the forest, a small village is situated whose inhabitants have protected the forest for decades. On the other side, the indigenous Quitirisi continue their centuries-old protection of the forest. In February, FIRE staff traveled by horseback and used walkie-talkie radios to air a live Radio Eco-tour of the forest and its neighboring village. People from over 100 countries listened to the broadcast. Within days, the staff was broadcasting live from outside the municipal building where delegates were discussing the growing protest over the dump site. The delegates emerged to announce that they would oppose the use of the road for dump trucks. FIRE then invited call-ins to their broadcast, and the lines were flooded with people expressing fears and frustration with the delegates for refusing to discuss the issues. Callers from the US stated that hearing the voices of the people affected brought the issue to life for them. To FIRE, this is the essential element of global communications.

  19. Seismic reflection images of the accretionary wedge of Costa Rica

    SciTech Connect

    Shipley, T.H.; Stoffa, P.L. ); McIntosh, K.; Silver, E.A. )

    1990-05-01

    The large-scale structure of modern accretionary wedges is known almost entirely from seismic reflection investigations using single or grids of two-dimensional profiles. The authors will report on the first three-dimensional seismic reflection data volume collected of a wedge. This data set covers a 9-km-wide {times} 22-km-long {times} 6-km-thick volume of the accretionary wedge just arcward of the Middle America Trench off Costa Rica. The three-dimensional processing has improved the imaging ability of the multichannel data, and the data volume allows mapping of structures from a few hundred meters to kilometers in size. These data illustrate the relationships between the basement, the wedge shape, and overlying slope sedimentary deposits. Reflections from within the wedge define the gross structural features and tectonic processes active along this particular convergent margin. So far, the analysis shows that the subdued basement relief (horst and graben structures seldom have relief of more than a few hundred meters off Costa Rica) does affect the larger scale through going structural features within the wedge. The distribution of mud volcanoes and amplitude anomalies associated with the large-scale wedge structures suggests that efficient fluid migration paths may extend from the top of the downgoing slab at the shelf edge out into the lower and middle slope region at a distance of 50-100 km. Offscraping of the uppermost (about 45 m) sediment occurs within 4 km of the trench, creating a small pile of sediments near the trench lower slope. Underplating of parts of the 400-m-thick subducted sedimentary section begins at a very shallow structural level, 4-10 km arcward of the trench. Volumetrically, the most important accretionary process is underplating.

  20. Monitoring coral reefs, seagrasses and mangroves in Costa Rica (CARICOMP).

    PubMed

    Cortés, Jorge; Fonseca, Ana C; Nivia-Ruiz, Jaime; Nielsen-Muñoz, Vanessa; Samper-Villarreal, Jimena; Salas, Eva; Martínez, Solciré; Zamora-Trejos, Priscilla

    2010-10-01

    The coral reefs, seagrasses and mangroves from the Costa Rican Caribbean coast have been monitored since 1999 using the CARICOMP protocol. Live coral cover at Meager Shoal reef bank (7 to 10 m depth) at the Parque Nacional Cahuita (National Park), increased from 13.3% in 1999, to 28.2% in 2003, but decreased during the next 5 years to around 17.5%. Algal cover increased significantly since 2003 from 36.6% to 61.3% in 2008. The density of Diadema antillarum oscillated between 2 and 7ind/m2, while Echinometra viridis decreased significantly from 20 to 0.6ind/m2. Compared to other CARICOMP sites, live coral cover, fish diversity and density, and sea urchin density were low, and algal cover was intermediate. The seagrass site, also in the Parque Nacional Cahuita, is dominated by Thalassia testudinum and showed an intermediate productivity (2.7 +/- 1.15 g/m2/d) and biomass (822.8 +/- 391.84 g/m2) compared to other CARICOMP sites. Coral reefs and seagrasses at the Parque Nacional Cahuita continue to be impacted by high sediment loads from terrestrial origin. The mangrove forest at Gandoca, within the Refugio Nacional de Vida Silvestre Gandoca-Manzanillo (National Wildlife Refuge), surrounds a lagoon and it is dominated by the red mangrove, Rhizophora mangle. Productivity and flower production peak was in July. Biomass (14 kg/m2) and density (9.0 +/- 0.58 trees/100 m2) in Gandoca were relatively low compared to other CARICOMP sites, while productivity in July in Costa Rica (4 g/m2/d) was intermediate, similar to most CARICOMP sites. This mangrove is expanding and has low human impact thus far. Management actions should be taken to protect and preserve these important coastal ecosystems.

  1. Health care in Costa Rica: boom and crisis.

    PubMed

    Mesa-Lago, C

    1985-01-01

    In 1960-1980 Costa Rica experienced a health boom, achieving significant improvements which moved that country into the number two position in Latin America for indicators such as population coverage, infant mortality, life expectancy and health services. In addition, there was a gradual process of integration of health services. But in the same period, the cost of health care as a percentage of GNP increased almost 5-fold and in 1980 was the fourth highest in the region. The economic crisis of the 1980s aggravated the financial difficulties; to cope with them, the government introduced an austere program to reduce costs and plans to transform the current model of health care into a more efficient one capable of maintaining Costa Rica's high health standards in the future. The paper is divided into five sections: summary of the historical development of health care, and description of its current organization and of its gradual process of integration; estimation of population coverage and its trends, evaluation of inequalities in coverage, and identification of the non-covered group; analysis of health-care financing and its sources, as well of the recent financial desequilibrium, its causes and measures to restore the equilibrium; description of health care benefits and their differences among groups and regions, analysis of the country's advances in health-care facilities and standards, and measurement of the impact of the health care system in income distribution; and description of the rising cost of health care and the current crisis, analysis of the causes of both phenomena, and review of the measures that have been and should be implemented to solve these problems.

  2. Undeserving mothers? Shifting rationalities in the maternal healthcare of undocumented Nicaraguan migrants in Costa Rica.

    PubMed

    Dos Santos, Sara Leon Spesny

    2015-01-01

    The case of Nicaraguan migrants in Costa Rica is emblematic of the issues that immigration generates in host countries. Undocumented Nicaraguan women seeking maternal care constitute a key challenge to the universal coverage of Costa Rica's health system. Can the long-standing commitment to universality, solidarity and equality expressed in the legislation be translated into practice? Discourses of health professionals in Costa Rica reveal a contradiction between merit and prejudice in prenatal and delivery care. Here, I present qualitative research based on semi-structured interviews with physicians and nurses at a Costa Rican National Hospital. The data show that migrant women, rejected from primary care, do find help in emergency services, but not without difficulties, as they must engage in individual negotiations centred on their bodies. The discourses of health providers reflect an ambivalence between the perceived undeservingness of undocumented migrant women and the medical realisation that two lives are at risk. While the foetus often evokes compassion, the mother commonly provokes repression, as specific and shifting rationalities reflect new moral regimes that are applied to this population. Women are perceived as being 'illegal', 'immoral' and 'irrational', and the baby, although legally Costa Rican due to jus solis policy, embodies 'the other'. Ultimately, otherness frames perceptions of deservingness of maternal care for undocumented migrant women in Costa Rica.

  3. Nicaraguan migration and the prevalence of adolescent childbearing in Costa Rica.

    PubMed

    Sintonen, Heidi; Bonilla-Carrión, Roger Enrique; Ashorn, Per

    2013-02-01

    This study describes the dynamics of adolescent childbearing of Nicaraguan-born and Costa Rican-born adolescents in Costa Rica and examines the association between socio-demographic factors and adolescent childbearing in the country. We studied Nicaraguan-born and Costa Rican adolescents using the data of the 2000 Census. Multivariate logistic regression was used to analyze the association between country of origin and adolescent childbearing, while controlling for socio-demographic factors (age, education, union, urbanization and poverty). 26% of Nicaraguan-born migrants and 9.5% of Costa Ricans had given birth during adolescence. The migrants' increased odds of pregnancy decreased from 3.34 (CI 3.21, 3.48) to 1.88 (CI 1.79, 1.97) when controlling for socio-demographic factors. Age, low educational attainment, urban residence, poverty and union were all significant predictors of adolescent pregnancy. Nicaraguan-born status is associated with adolescent childbearing in Costa Rica. Further research is needed to understand what factors, other than socio-demographic indicators, contribute to the differing prevalence of adolescent childbearing in Costa Rica.

  4. Altitude and regional gradients in chronic kidney disease prevalence in Costa Rica: Data from the Costa Rican Longevity and Healthy Aging Study

    PubMed Central

    Harhay, Meera N.; Harhay, Michael O.; Coto-Yglesias, Fernando; Bixby, Luis Rosero

    2015-01-01

    Summary Objectives Recent studies in Central America indicate that mortality attributable to chronic kidney disease (CKD) is rising rapidly. We sought to determine the prevalence and regional variation of CKD and the relationship of biologic and socioeconomic factors to CKD risk in the older-adult population of Costa Rica. Methods We used data from the Costa Rican Longevity and Health Aging Study (CRELES). The cohort was comprised of 2657 adults born before 1946 in Costa Rica, chosen through a sampling algorithm to represent the national population of Costa Ricans >60 years of age. Participants answered questionnaire data and completed laboratory testing. The primary outcome of this study was CKD, defined as an estimated glomerular filtration rate (eGFR) <60 ml/min/1.73m2. Results The estimated prevalence of CKD for older Costa Ricans was 20% (95% CI 18.5 – 21.9%). In multivariable logistic regression, older age (adjusted odds ratio [aOR] 1.08 per year, 95%CI 1.07–1.10, p<0.001) was independently associated with CKD. For every 200 meters above sea level of residence, subjects’ odds of CKD increased 26% (aOR 1.26 95% CI 1.15–1.38, p<0.001). There was large regional variation in adjusted CKD prevalence, highest in Limon (40%, 95% CI 30%–50%) and Guanacaste (36%, 95% CI 26–46%) provinces. Regional and altitude effects remained robust after adjustment for socioeconomic status. Conclusions We observed large regional and altitude-related variations in CKD prevalence in Costa Rica, not explained by the distribution of traditional CKD risk factors. More studies are needed to explore the potential association of geographic and environmental exposures with the risk of CKD. PMID:26466575

  5. Altitude and regional gradients in chronic kidney disease prevalence in Costa Rica: Data from the Costa Rican Longevity and Healthy Aging Study.

    PubMed

    Harhay, Meera N; Harhay, Michael O; Coto-Yglesias, Fernando; Rosero Bixby, Luis

    2016-01-01

    Recent studies in Central America indicate that mortality attributable to chronic kidney disease (CKD) is rising rapidly. We sought to determine the prevalence and regional variation of CKD and the relationship of biologic and socio-economic factors to CKD risk in the older-adult population of Costa Rica. We used data from the Costa Rican Longevity and Health Aging Study (CRELES). The cohort was comprised of 2657 adults born before 1946 in Costa Rica, chosen through a sampling algorithm to represent the national population of Costa Ricans >60 years of age. Participants answered questionnaire data and completed laboratory testing. The primary outcome of this study was CKD, defined as an estimated glomerular filtration rate (eGFR) <60 ml/min/1.73 m(2) . The estimated prevalence of CKD for older Costa Ricans was 20% (95% CI 18.5-21.9%). In multivariable logistic regression, older age (adjusted odds ratio [aOR] 1.08 per year, 95% CI 1.07-1.10, P < 0.001) was independently associated with CKD. For every 200 m above sea level of residence, subjects' odds of CKD increased 26% (aOR 1.26 95% CI 1.15-1.38, P < 0.001). There was large regional variation in adjusted CKD prevalence, highest in Limon (40%, 95% CI 30-50%) and Guanacaste (36%, 95% CI 26-46%) provinces. Regional and altitude effects remained robust after adjustment for socio-economic status. We observed large regional and altitude-related variations in CKD prevalence in Costa Rica, not explained by the distribution of traditional CKD risk factors. More studies are needed to explore the potential association of geographic and environmental exposures with the risk of CKD. © 2015 John Wiley & Sons Ltd.

  6. Myeloproliferative defects following targeting of the Drf1 gene encoding the mammalian diaphanous related formin mDia1.

    PubMed

    Peng, Jun; Kitchen, Susan M; West, Richard A; Sigler, Robert; Eisenmann, Kathryn M; Alberts, Arthur S

    2007-08-15

    Rho GTPase-effector mammalian diaphanous (mDia)-related formins assemble nonbranched actin filaments as part of cellular processes, including cell division, filopodia assembly, and intracellular trafficking. Whereas recent efforts have led to thorough characterization of formins in cytoskeletal remodeling and actin assembly in vitro, little is known about the role of mDia proteins in vivo. To fill this knowledge gap, the Drf1 gene, which encodes the canonical formin mDia1, was targeted by homologous recombination. Upon birth, Drf1+/- and Drf1-/- mice were developmentally and morphologically indistinguishable from their wild-type littermates. However, both Drf1+/- and Drf1-/- developed age-dependent myeloproliferative defects. The phenotype included splenomegaly, fibrotic and hypercellular bone marrow, extramedullary hematopoiesis in both spleen and liver, and the presence of immature myeloid progenitor cells with high nucleus-to-cytoplasm ratios. Analysis of cell surface markers showed an age-dependent increase in the percentage of CD11b+-activated and CD14+-activated monocytes/macrophages in both spleen and bone marrow in Drf1+/- and Drf1-/- animals. Analysis of the erythroid compartment showed a significant increase in the proportion of splenic cells in S phase and an expansion of erythroid precursors (TER-119+ and CD71+) in Drf1-targeted mice. Overall, knocking out mDia1 expression in mice leads to a phenotype similar to human myeloproliferative syndrome (MPS) and myelodysplastic syndromes (MDS). These observations suggest that defective DRF1 expression or mDia1 function may contribute to myeloid malignancies and point to mDia1 as an attractive therapeutic target in MDS and MPS.

  7. G-actin regulates rapid induction of actin nucleation by mDia1 to restore cellular actin polymers.

    PubMed

    Higashida, Chiharu; Suetsugu, Shiro; Tsuji, Takahiro; Monypenny, James; Narumiya, Shuh; Watanabe, Naoki

    2008-10-15

    mDia1 belongs to the formin family of proteins that share FH1 and FH2 domains. Although formins play a critical role in the formation of many actin-based cellular structures, the physiological regulation of formin-mediated actin assembly within the cell is still unknown. Here we show that cells possess an acute actin polymer restoration mechanism involving mDia1. By using single-molecule live-cell imaging, we found that several treatments including low-dose G-actin-sequestering drugs and unpolymerizable actin mutants activate mDia1 to initiate fast directional movement. The FH2 region, the core domain for actin nucleation, is sufficient to respond to latrunculin B (LatB) to increase its actin nucleation frequency. Simulation analysis revealed an unexpected paradoxical effect of LatB that leads to a several fold increase in free G-actin along with an increase in total G-actin. These results indicate that in cells, the actin nucleation frequency of mDia1 is enhanced not only by Rho, but also strongly through increased catalytic efficiency of the FH2 domain. Consistently, frequent actin nucleation by mDia1 was found around sites of vigorous actin disassembly. Another major actin nucleator, the Arp2/3 complex, was not affected by the G-actin increase induced by LatB. Taken together, we propose that transient accumulation of G-actin works as a cue to promote mDia1-catalyzed actin nucleation to execute rapid reassembly of actin filaments.

  8. Ferromagnetic, dia-/paramagnetic and superparamagnetic components of Aral Sea sediments: significance for paleoenvironmental reconstruction

    NASA Astrophysics Data System (ADS)

    Kosareva, Lina; Nourgaliev, Danis; Kuzina, Dilyara; Spassov, Simo; Fattakhova, Leysan

    2015-04-01

    Modern lake sediments are a unique source of information for climate changes, regionally and globally, because all environmental variations are recorded by these sediments with high resolution. Magnetic minerals are hereby of particular interest, because they occur almost in any environment, because they are susceptible tracing environmental changes, which are closely related to their formation conditions, and because magnetic mineral concentrations in the ppm range can be detected. Our goal is to decipher the magnetic susceptibility signal in lake sediments by decomposing the bulk susceptibility signal of a lake sediment sequence into ferromagnetic (χf), dia-/paramagnetic (χp) and superparamagnetic (χsp) components. Each of these has a different origin: paramagnetic minerals are usually attributed to terrigenous sediment input, ferromagnetics are of biogenic origin, and superparamagnetic minerals may be of either biogenic or terrigenous origin. In sediments, paramagnetic components contribute most to the bulk susceptibility signal, because the ferromagnetic contributions are low. Most sediments of modern lakes contain a lot of organic material and water, which are both diamagnetic. High-field susceptibility changes reflect thus changes in terrigenous input. The latter increases with precipitation which augments the influx of terrigenous material carried by rivers into the lake, consequently the susceptibility increases sharply. However, under certain conditions, such for instance during shrinking water table or withering of tributaries, the lake biota grows stronger and the bacterial activity, including magnetotactic bacteria, increases. This results in an enhanced ferromagnetic component (χf). Superparamagnetic (SP) components may also be formed, but their magnetic grain size is much smaller, i.e. in the order of about 30-40 nm. This abstract presents a new method to discriminate and to quantify the contribution of dia- and paramagnetic, ferromagnetic and

  9. SRTM Perspective View with Landsat Overlay: Costa Rica Coastal Plain

    NASA Technical Reports Server (NTRS)

    2001-01-01

    This perspective view shows the northern coastal plain of Costa Rica with the Cordillera Central, composed of a number of active and dormant volcanoes, rising in the background. This view looks toward the south over the Rio San Juan, which marks the boundary between Costa Rica and Nicaragua. The smaller river joining Rio San Juan in the center of the image is Rio Sarapiqui, which is navigable upstream as far inland as Puerto Viejo (Old Port) de Sarapiqui at the mountain's base. This river was an important transportation route for those few hardy settlers who first moved into this region, although as recently as 1953 a mere three thatched-roof houses were all that comprised the village of Puerto Viejo.

    This coastal plain is a sedimentary basin formed about 50 million years ago composed of river alluvium and lahar (mud and ash flow) deposits from the volcanoes of the Cordillera Central. It comprises the province of Heredia (the smallest of Costa Rica's seven) and demonstrates a wide range of climatic conditions, from warm and humid lowlands to cool and damp highlands, and including the mild but seasonally wet and dry Central Valley.

    This image was generated in support of the Central American Commission for Environment and Development through an agreement with NASA. The Commission involves eight nations working to develop the Mesoamerican Biological Corridor, an effort to study and preserve some of the most biologically diverse regions of the planet.

    This three-dimensional perspective view was generated using topographic data from the Shuttle Radar Topography Mission (SRTM) and an enhanced false-color Landsat 7 satellite image. Colors are from Landsat bands 5, 4, and 2 as red, green and blue, respectively. Topographic expression is exaggerated 2X.

    Landsat has been providing visible and infrared views of the Earth since 1972. SRTM elevation data matches the 30-meter resolution of most Landsat images and will substantially help in analyses of the large

  10. SRTM Perspective View with Landsat Overlay: Costa Rica Coastal Plain

    NASA Technical Reports Server (NTRS)

    2001-01-01

    This perspective view shows the northern coastal plain of Costa Rica with the Cordillera Central, composed of a number of active and dormant volcanoes, rising in the background. This view looks toward the south over the Rio San Juan, which marks the boundary between Costa Rica and Nicaragua. The smaller river joining Rio San Juan in the center of the image is Rio Sarapiqui, which is navigable upstream as far inland as Puerto Viejo (Old Port) de Sarapiqui at the mountain's base. This river was an important transportation route for those few hardy settlers who first moved into this region, although as recently as 1953 a mere three thatched-roof houses were all that comprised the village of Puerto Viejo.

    This coastal plain is a sedimentary basin formed about 50 million years ago composed of river alluvium and lahar (mud and ash flow) deposits from the volcanoes of the Cordillera Central. It comprises the province of Heredia (the smallest of Costa Rica's seven) and demonstrates a wide range of climatic conditions, from warm and humid lowlands to cool and damp highlands, and including the mild but seasonally wet and dry Central Valley.

    This image was generated in support of the Central American Commission for Environment and Development through an agreement with NASA. The Commission involves eight nations working to develop the Mesoamerican Biological Corridor, an effort to study and preserve some of the most biologically diverse regions of the planet.

    This three-dimensional perspective view was generated using topographic data from the Shuttle Radar Topography Mission (SRTM) and an enhanced false-color Landsat 7 satellite image. Colors are from Landsat bands 5, 4, and 2 as red, green and blue, respectively. Topographic expression is exaggerated 2X.

    Landsat has been providing visible and infrared views of the Earth since 1972. SRTM elevation data matches the 30-meter resolution of most Landsat images and will substantially help in analyses of the large

  11. Crustal structure along the active Costa Rican volcanic arc

    NASA Astrophysics Data System (ADS)

    Lizarralde, D.; Holbrook, W. S.; van Avendonk, H. J.; Mora Fernandez, M.; Alvarado, G. E.; Harder, S. H.

    2010-12-01

    We present results from an explosion-source seismic refraction transect along the entire active Costa Rican volcanic arc. The seismic data were acquired in 2005 as part of the TICO-CAVA experiment with the goals of delineating the basic crustal architecture of this relatively young volcanic arc, understanding magmatic emplacement processes, and estimating the bulk composition and growth rates of arc crust. The seismic transect extends ~280 km along the axis of the arc and consists of 16 shots (200 - 1200 kg) recorded by 710 seismometers. The active Costa Rican arc consists of two segments with distinct morphologies, the Guanacaste Cordillera (GC) in the north and Central Cordillera (CC) in the south. This segmentation is linked to the subducting Cocos ridge, which occurs beneath the CC and has a northern boundary roughly coincident with the arc segment boundary. Volcanoes of the GC rise from a plateau of ~500 m elevation to maximum heights of ~1500 m, while the CC volcanoes rise from ~1500 m to heights of 3500 m. The crustal structure beneath these segments is distinctly different. The entire arc is covered by a ~5-km-thick carapace with velocities of 4.5-5.8 km/s that probably represent volcaniclastics, flows and small plutons. Beneath the GC, a 1- to 2-km-thick “grainitic” layer (6.0-6.1 km/s) lies beneath the carapace. Velocities below this granitic layer suggest a somewhat more mafic composition, but they increase slowly with depth from 6.2-6.3 km/s between 6-15 km depth. Total crustal thickness beneath the GC is ~40 km, but analysis of crustal thickness is ongoing. The crust beneath Guanacaste thus has a velocity structure very similar to average continental crust, though with slightly slower velocities, perhaps due to high temperatures beneath the arc. As the arc has only been active in this location for <5 m.y., this suggests that either the earlier Neogene arc to the west substantially modified the oceanic-plateau crustal foundation here or that the

  12. Rates of weathering rind formation on Costa Rican basalt

    NASA Astrophysics Data System (ADS)

    Sak, Peter B.; Fisher, Donald M.; Gardner, Thomas W.; Murphy, Katherine; Brantley, Susan L.

    2004-04-01

    Weathering rind thicknesses were measured on ˜ 200 basaltic clasts collected from three regionally extensive alluvial fill terraces (Qt 1, Qt 2, and Qt 3) preserved along the Pacific coast of Costa Rica. Mass balance calculations suggest that conversion of unweathered basaltic core minerals (plagioclase and augite) to authigenic minerals in the porous rind (kaolinite, allophane, gibbsite, Fe oxyhydroxides) is iso-volumetric and Ti and Zr are relatively immobile. The hierarchy of cation mobility (Ca ≈ Na > K ≈ Mg > Si > Al > Fe ≈ P) is similar to other tropical weathering profiles and is indicative of differential rates of mineral weathering (anorthite > albite ≈ hypersthene > orthoclase ≫ apatite). Alteration profiles across the cm-thick rinds document dissolution of plagioclase and augite and the growth of kaolinite, with subsequent dissolution of kaolinite and precipitation of gibbsite as weathering rinds age. The rate of weathering rind advance is evaluated using a diffusion-limited model which predicts a parabolic rate law for weathering rind thickness, r r, as a function of time, t( r r = κt), and an interface-limited model which predicts a linear rate law for weathering rind thickness as a function of time ( r r = k appt ). In these rate laws, κ is a diffusion parameter and k app is an apparent rate constant. The rate of advance is best fit by the interface model. Terrace exposures are confined to the lower reaches of streams draining the Pacific slope near the coast where the stream gradient is less than ˜3 m/km, and terrace deposition is influenced by eustatic sea level fluctuations. Geomorphological evidence is consistent with terrace deposition coincident with sea level maxima when the stream gradient would be lowest. Assigning the most weathered regionally extensive terrace Qt 1 (mean rind thickness 6.9 ± 0. 6cm) to oxygen isotope stage (OIS) 7 (ca. 240 ka), and assuming that at time = 0 rind thickness = 0, it is inferred that terrace Qt 2

  13. Que Sucede? Manual Informativo Sobre Rehabilitacion y Educacion Especial en Costa Rica (What's Happening? Informative Manual on Rehabilitation and Special Education in Costa Rica).

    ERIC Educational Resources Information Center

    de Mezerville, Gaston; And Others

    The manual, in Spanish, provides descriptions of rehabilitation, medical, and special education services; centers and institutions which offer physical and mental rehabilitation services; and lists of professionals and advocacy organizations in Costa Rica. Part 1 includes an overview of rehabilitation and special education, a short history of…

  14. Que Sucede? Manual Informativo Sobre Rehabilitacion y Educacion Especial en Costa Rica (What's Happening? Informative Manual on Rehabilitation and Special Education in Costa Rica).

    ERIC Educational Resources Information Center

    de Mezerville, Gaston; And Others

    The manual, in Spanish, provides descriptions of rehabilitation, medical, and special education services; centers and institutions which offer physical and mental rehabilitation services; and lists of professionals and advocacy organizations in Costa Rica. Part 1 includes an overview of rehabilitation and special education, a short history of…

  15. DIA2: Web-based Cyberinfrastructure for Visual Analysis of Funding Portfolios.

    PubMed

    Madhavan, Krishna; Elmqvist, Niklas; Vorvoreanu, Mihaela; Chen, Xin; Wong, Yuetling; Xian, Hanjun; Dong, Zhihua; Johri, Aditya

    2014-12-01

    We present a design study of the Deep Insights Anywhere, Anytime (DIA2) platform, a web-based visual analytics system that allows program managers and academic staff at the U.S. National Science Foundation to search, view, and analyze their research funding portfolio. The goal of this system is to facilitate users' understanding of both past and currently active research awards in order to make more informed decisions of their future funding. This user group is characterized by high domain expertise yet not necessarily high literacy in visualization and visual analytics-they are essentially casual experts-and thus require careful visual and information design, including adhering to user experience standards, providing a self-instructive interface, and progressively refining visualizations to minimize complexity. We discuss the challenges of designing a system for casual experts and highlight how we addressed this issue by modeling the organizational structure and workflows of the NSF within our system. We discuss each stage of the design process, starting with formative interviews, prototypes, and finally live deployments and evaluation with stakeholders.

  16. ANALYSIS OF THE PICO DOS DIAS SURVEY HERBIG Ae/Be CANDIDATES

    SciTech Connect

    Sartori, Marilia J.; Rodrigues, Claudia V.; Batalha, Celso

    2010-01-15

    A large sample of Herbig Ae/Be (HAeBe) candidates, distributed in different Galactic regions south to declination +30 deg., were identified by the Pico dos Dias Survey (a search for young stellar objects based on IRAS colors). Most of the candidates are nearby or associated with star-forming clouds, but several others are considered isolated objects. Aiming to verify the young nature of 93 HAeBe candidates, we searched for additional information that could be useful to confirm if they are pre-main-sequence (PMS) stars or evolved objects, which coincidentally show similar IRAS colors. By adopting a spectral index that is related to the amount of infrared excess and the shape of the spectral energy distribution, we have classified the sample according to three groups, which are analyzed on the basis of (1) circumstellar luminosity; (2) spatial distribution; (3) optical polarization; (4) near-infrared colors; (5) stellar parameters (mass, age, effective temperature); and (5) intensity of emission lines. Our analysis indicates that only 76% of the studied sample, mainly the group with intermediate to low levels of circumstellar emission, can be more confidently considered PMS stars. The nature of the remaining stars, which are in the other group that contains the highest levels of infrared excess, remains to be confirmed. They share the same characteristics of evolved objects, requiring complementary studies in order to correctly classify them. At least seven objects show characteristics typical of post-asymptotic giant branch or proto-planetary nebulae.

  17. A framework for MPEG-21 DIA based adaptation and perceptual encryption of H.264 video

    NASA Astrophysics Data System (ADS)

    Iqbal, Razib; Shirmohammadi, Shervin; El Saddik, Abdulmotaleb

    2007-01-01

    A ubiquitous computing concept permits end users to have access to multimedia and digital content anywhere, anytime and in any way they want. As a consequence, the importance of resource customization according to user preferences and device requirements set the primary challenge towards seamless access. Moreover, once a suitable customization approach has been decided (e.g. adaptation), deploying it in the existing network requires a generic and widely accepted standard applied to the process. With the advancement of time, performing encryption in the compressed domain should also be taken care of not only for serving sensitive digital contents but also for offering security as an embedded feature of the adaptation practice to ensure digital right management and confidentiality. In this paper, we present an architecture for temporal adaptation of ITU-T H.264 video conforming to ISO/IEC MPEG-21 DIA. In addition, we present a perceptual encryption scheme that is integrated in the system for video encryption. The framework enables video bitstreams to be adapted and encrypted in the compressed domain, eliminating cascaded adaptation (i.e. decoding - adaptation - encoding). The encryption framework is applied on the adapted video content, which reduces computational overhead compared to that on the original content. A prototype, based on the proposed architecture and experimental evaluations of the system as well as its performance supporting the architecture are also presented.

  18. Mammals of the Braulio Carrillo- La Selva Complex, Costa Rica

    USGS Publications Warehouse

    Timm, Robert M.; Wilson, Don E.; Clauson, Barbara L.; LaVal, Richard K.; Vaughan, Christopher S.

    1989-01-01

    Costa Rica's La Selva-Braulio Carrillo complex encompasses a 60-km protected corridor of Caribbean rain and cloud forest extending from 30 m at the La Selva Biological Station to 2,906 m at the top of Volcán Barva. The 52,000-ha complex covers four life zones and two transitional zones, including tropical wet forest, tropical wet forest cool-transition, tropical premontane wet-transition rain forest, tropical premontane rain forest, lower montane rain forest, and montane rain forest. Located in the northeastern part of the country, the area is representative of Central American Caribbean slope forests that extend from Mexico to Panama. The extensive elevational gradient of the complex provides protected habitat for a variety of altitudinal migrants. With support from the National Geographic Society and Rice Foundation, the Organization for Tropical Studies organized a biological survey of the complex in early 1986. The mammal team worked at six sites along the elevational transect established by the expedition: 300 m, 700 m, 1,000 m, 1,500 m, 2,050 m, and 2,600 m. We supplemented our collecting records with unpublished records made available by colleagues, records in the published literature, and specimens in museum collections. In addition, observations recorded by a variety of observers at the La Selva Biological Station are summarized. The mammal fauna of the complex comprises 142 species including 79 bats, 23 rodents, 15 carnivores, 7 marsupials, 6 edentates, 4 artiodactyls, 3 primates, 2 rabbits, 2 shrews, and 1 perissodactyl. At least 10 additional species are likely to occur there. The only species of mammal likely to have been extirpated from the area is the giant anteater. Recognizing the importance of the area to wildlife and to mankind in general, the government of Costa Rica added 13,500 ha to the complex on 13 April 1986. This area, previously known as the “Zona Protectora,” provided the mid-elevational link between the lowlands of the La Selva

  19. PITUITARY AND ADRENAL HORMONE RELEASE FOLLOWING in vitro EXPOSURE TO ATRAZINE AND ITS METABOLITE DEISOPROPYL-ATRAZINE (DIA)

    EPA Science Inventory

    Atrazine (ATR) is one of the most widely used herbicides in the United States, with current total annual use of approximately 76 million pounds of active ingredient. Previous work in our laboratory has shown that ATR and its metabolite deisopropyl-atrazine (DIA) induce a dose-dep...

  20. EFFECTS OF ATRAZINE (ATR), DEISOPROPYLATRAZINE (DIA), AND DIAMINOCHLOROTRIAZINE (DACT) ON THE HYPOTHALAMIC-PITUITARY-ADRENAL (HPA) AXIS IN FEMALE RATS

    EPA Science Inventory

    Previously we reported that a single dose of ATR herbicide stimulated HPA axis activation in the male rat while its primary metabolite, DACT, did so to a lesser extent. In this study, we evaluated the effects of ATR, DACT, and an intermediate metabolite, DIA, on adrenocorticotrop...

  1. PITUITARY AND ADRENAL HORMONE RELEASE FOLLOWING in vitro EXPOSURE TO ATRAZINE AND ITS METABOLITE DEISOPROPYL-ATRAZINE (DIA)

    EPA Science Inventory

    Atrazine (ATR) is one of the most widely used herbicides in the United States, with current total annual use of approximately 76 million pounds of active ingredient. Previous work in our laboratory has shown that ATR and its metabolite deisopropyl-atrazine (DIA) induce a dose-dep...

  2. 77 FR 68881 - DIAS Holding, Inc., EarthBlock Technologies, Inc., Ensurapet, Inc., FIIC Holdings, Inc., GeM...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-16

    ... SECURITIES AND EXCHANGE COMMISSION [File No. 500-1] DIAS Holding, Inc., EarthBlock Technologies, Inc., Ensurapet, Inc., FIIC Holdings, Inc., GeM Solutions, Inc., Gold Star Tutoring Services Inc., and... lack of current and accurate information concerning the securities of Gold Star Tutoring Services, Inc...

  3. EFFECTS OF ATRAZINE (ATR), DEISOPROPYLATRAZINE (DIA), AND DIAMINOCHLOROTRIAZINE (DACT) ON THE HYPOTHALAMIC-PITUITARY-ADRENAL (HPA) AXIS IN FEMALE RATS

    EPA Science Inventory

    Previously we reported that a single dose of ATR herbicide stimulated HPA axis activation in the male rat while its primary metabolite, DACT, did so to a lesser extent. In this study, we evaluated the effects of ATR, DACT, and an intermediate metabolite, DIA, on adrenocorticotrop...

  4. Small-molecule agonists of mammalian Diaphanous–related (mDia) formins reveal an effective glioblastoma anti-invasion strategy

    PubMed Central

    Arden, Jessica D.; Lavik, Kari I.; Rubinic, Kaitlin A.; Chiaia, Nicolas; Khuder, Sadik A.; Howard, Marthe J.; Nestor-Kalinoski, Andrea L.; Alberts, Arthur S.; Eisenmann, Kathryn M.

    2015-01-01

    The extensive invasive capacity of glioblastoma (GBM) makes it resistant to surgery, radiotherapy, and chemotherapy and thus makes it lethal. In vivo, GBM invasion is mediated by Rho GTPases through unidentified downstream effectors. Mammalian Diaphanous (mDia) family formins are Rho-directed effectors that regulate the F-actin cytoskeleton to support tumor cell motility. Historically, anti-invasion strategies focused upon mDia inhibition, whereas activation remained unexplored. The recent development of small molecules directly inhibiting or activating mDia-driven F-actin assembly that supports motility allows for exploration of their role in GBM. We used the formin inhibitor SMIFH2 and mDia agonists IMM-01/-02 and mDia2-DAD peptides, which disrupt autoinhibition, to examine the roles of mDia inactivation versus activation in GBM cell migration and invasion in vitro and in an ex vivo brain slice invasion model. Inhibiting mDia suppressed directional migration and spheroid invasion while preserving intrinsic random migration. mDia agonism abrogated both random intrinsic and directional migration and halted U87 spheroid invasion in ex vivo brain slices. Thus mDia agonism is a superior GBM anti-invasion strategy. We conclude that formin agonism impedes the most dangerous GBM component—tumor spread into surrounding healthy tissue. Formin activation impairs novel aspects of transformed cells and informs the development of anti-GBM invasion strategies. PMID:26354425

  5. Diversity of the free-living marine and freshwater Copepoda (Crustacea) in Costa Rica: a review.

    PubMed

    Morales-Ramírez, Álvaro; Suárez-Morales, Eduardo; Corrales-Ugalde, Marco; Garrote, Octavio Esquivel

    2014-01-01

    The studies on marine copepods of Costa Rica started in the 1990's and focused on the largest coastal-estuarine systems in the country, particularly along the Pacific coast. Diversity is widely variable among these systems: 40 species have been recorded in the Culebra Bay influenced by upwelling, northern Pacific coast, only 12 in the Gulf of Nicoya estuarine system, and 38 in Golfo Dulce, an anoxic basin in the southern Pacific coast of the country. Freshwater environments of Costa Rica are known to harbor a moderate diversity of continental copepods (25 species), which includes 6 calanoids, 17 cyclopoids and only two harpacticoids. Of the +100 freshwater species recorded in Central America, six are known only from Costa Rica, and one appears to be endemic to this country. The freshwater copepod fauna of Costa Rica is clearly the best known in Central America. Overall, six of the 10 orders of Copepoda are reported from Costa Rica. A previous summary by 2001 of the free-living copepod diversity in the country included 80 marine species (67 pelagic, 13 benthic). By 2009, the number of marine species increased to 209: 164 from the Pacific (49% of the copepod fauna from the Eastern Tropical Pacific) and 45 from the Caribbean coast (8% of species known from the Caribbean Basin). Both the Caribbean and Pacific species lists are growing. Additional collections of copepods at Cocos Island, an oceanic island 530 km away of the Pacific coast, have revealed many new records, including five new marine species from Costa Rica. Currently, the known diversity of marine copepods of Costa Rica is still in development and represents up to 52.6% of the total marine microcrustaceans recorded in the country. Future sampling and taxonomic efforts in the marine habitats should emphasize oceanic environments including deep waters but also littoral communities. Several Costa Rican records of freshwater copepods are likely to represent undescribed species. Also, the biogeographic relevance

  6. Diversity of the free-living marine and freshwater Copepoda (Crustacea) in Costa Rica: a review

    PubMed Central

    Morales-Ramírez, Álvaro; Suárez-Morales, Eduardo; Corrales-Ugalde, Marco; Garrote, Octavio Esquivel

    2014-01-01

    Abstract The studies on marine copepods of Costa Rica started in the 1990’s and focused on the largest coastal-estuarine systems in the country, particularly along the Pacific coast. Diversity is widely variable among these systems: 40 species have been recorded in the Culebra Bay influenced by upwelling, northern Pacific coast, only 12 in the Gulf of Nicoya estuarine system, and 38 in Golfo Dulce, an anoxic basin in the southern Pacific coast of the country. Freshwater environments of Costa Rica are known to harbor a moderate diversity of continental copepods (25 species), which includes 6 calanoids, 17 cyclopoids and only two harpacticoids. Of the +100 freshwater species recorded in Central America, six are known only from Costa Rica, and one appears to be endemic to this country. The freshwater copepod fauna of Costa Rica is clearly the best known in Central America. Overall, six of the 10 orders of Copepoda are reported from Costa Rica. A previous summary by 2001 of the free-living copepod diversity in the country included 80 marine species (67 pelagic, 13 benthic). By 2009, the number of marine species increased to 209: 164 from the Pacific (49% of the copepod fauna from the Eastern Tropical Pacific) and 45 from the Caribbean coast (8% of species known from the Caribbean Basin). Both the Caribbean and Pacific species lists are growing. Additional collections of copepods at Cocos Island, an oceanic island 530 km away of the Pacific coast, have revealed many new records, including five new marine species from Costa Rica. Currently, the known diversity of marine copepods of Costa Rica is still in development and represents up to 52.6% of the total marine microcrustaceans recorded in the country. Future sampling and taxonomic efforts in the marine habitats should emphasize oceanic environments including deep waters but also littoral communities. Several Costa Rican records of freshwater copepods are likely to represent undescribed species. Also, the

  7. The Galapagos-OIB signature of the central Costa Rican volcanic front: arc-hotspot interaction

    NASA Astrophysics Data System (ADS)

    Gazel, E.; Carr, M. J.; Hoernle, K.; Feigenson, M. D.; Hauff, F.; Szymanski, D.; van den Bogaard, P.

    2008-12-01

    Although most Central American magmas have a typical arc geochemical signature, magmas in southern Central America have isotopic and trace element compositions with an OIB affinity, similar to the Galapagos hotspot lavas. Our new data for Costa Rica suggest that this signature, unusual for a convergent margin, has a relatively recent origin (Late Miocene-Pliocene ca. 6 Ma). We also show that there was a transition from typical arc magmas (analogous to the modern Nicaraguan volcanic front) to OIB-like magmas. The geographic distribution of the Galapagos signature in recent lavas from southern Central America is present landward from the subduction of the Galapagos hotspot tracks (the Seamount Province and the Cocos/Coiba Ridges) at the Middle American Trench. The higher Pb isotopic ratios, relatively low Nd isotopic ratios and enriched geochemical signature of central Costa Rican magmas can be explained by arc-hotspot interaction. The isotopic ratios of central Costa Rican lavas require the subducting Seamount Province (Northern Galapagos Domain) component, whereas the isotopic ratios of the adakites and alkaline basalts from southern Costa Rica and Panama are in the geochemical range of the subducting Cocos/Coiba Ridges (Central Galapagos Domain). Geological, geochemical, and isotopic evidence collectively indicate that the relatively recent Galapagos-OIB signature in southern Central America represents a geochemical signal from subducting Galapagos hotspot tracks, which started to collide with the margin ~8 Ma ago. The Galapagos hotspot contribution decreases systematically along the volcanic front from central Costa Rica to NW Nicaragua.

  8. Hydro and geothermal electricity as an alternative for industrial petroleum consumption in Costa Rica

    SciTech Connect

    Mendis, M.; Park, W.; Sabadell, A.; Talib, A.

    1982-04-01

    This report assesses the potential for substitution of electricity for petroleum in the industrial/agro-industrial sector of Costa Rica. The study includes a preliminary estimate of the process energy needs in this sector, a survey of the principal petroleum consuming industries in Costa Rica, an assessment of the electrical technologies appropriate for substitution, and an analysis of the cost trade offs of alternative fuels and technologies. The report summarizes the total substitution potential both by technical feasibility and by cost effectiveness under varying fuel price scenarios and identifies major institutional constraints to the introduction of electric based technologies. Recommendations to the Government of Costa Rica are presented. The key to the success of a Costa Rican program for substitution of electricity for petroleum in industry rests in energy pricing policy. The report shows that if Costa Rica Bunker C prices are increased to compare equitably with Caribbean Bunker C prices, and increase at 3 percent per annum relative to a special industrial electricity rate structure, the entire substitution program, including both industrial and national electric investment, would be cost effective. The definition of these pricing structures and their potential impacts need to be assessed in depth.

  9. The fertility plateau in Costa Rica: a review of causes and remedies.

    PubMed

    Holl, K D; Daily, G C; Ehrlich, P R

    1993-01-01

    Costa Rica achieved a substantial reduction in its overall fertility rate in a very short period of time. The halving of the fertility rate which occurred in less than ten years in Costa Rica transpired over the course of 100 years in France and 170 in Sweden. The level of contraceptive use in Costa Rica is twice that in other Central American nations. The authors summarize the recent demographic history of Costa Rica and review factors influencing its remarkable fertility decline. They then discuss possible explanations for the ensuing fertility plateau and conclude by suggesting strategies for affecting a further decrease in fertility rates. With regard to the reasons for the fertility plateau, cultural factors, socioeconomic factors, declining government commitment and family planning services, education, and the Church are considered. To reduce the level of fertility even further, the authors recommend that the government adopt a clear population policy which could serve as a basis for other changes such as increased support of family planning programs, improvements in the educational system, increased women's status and employment opportunities, and extensive education in schools and through the mass media on the socioeconomic and environmental effects of overpopulation. It is important to increase Costa Ricans' understanding of the negative impacts of continued population growth and the role of individual family planning decisions in that growth.

  10. Population structure of Pseudocercospora fijiensis in Costa Rica reveals shared haplotype diversity with Southeast Asian populations.

    PubMed

    Saville, Amanda; Charles, Melodi; Chavan, Suchitra; Munoz, Miguel; Gomez-Alpizar, Luis; Ristaino, Jean B

    2017-08-18

    Pseudocercospora fijiensis Deighton is the causal pathogen of black Sigatoka, a devastating disease of banana that can cause 20-80% yield loss in the absence of fungicides in bananas. The genetic structure of populations of P. fijiensis in Costa Rica was examined and compared to Honduran and global populations to better understand migration patterns and inform management strategies. One hundred and eighteen isolates of P. fijiensis collected from Costa Rica and Honduras from 2010 to 2014 were analyzed using multilocus genotyping of six loci and compared to a previously published global dataset of populations of P. fijiensis. The Costa Rican and Honduran populations shared haplotype diversity with haplotypes from Southeast Asia, Oceania, and the Americas but not Africa for all but one of the six loci studied. Gene flow and shared haplotype diversity was found in Honduran and Costa Rican populations of the pathogen. The data indicate that the haplotypic diversity observed in Costa Rican populations of P. fijiensis is derived from dispersal from initial outbreak sources in Honduras and admixtures between genetically differentiated sources from Southeast Asia, Oceania, and the Americas.

  11. Challenges for implementing water quality monitoring and analysis on a small Costa Rican catchment

    NASA Astrophysics Data System (ADS)

    Golcher, Christian; Cernesson, Flavie; Tournoud, Marie-George; Bonin, Muriel; Suarez, Andrea

    2016-04-01

    The Costa Rican water regulatory framework (WRF) (2007), expresses the national concern about the degradation of surface water quality observed in the country since several years. Given the urgency of preserving and restoring the surface water bodies, and facing the need of defining a monitoring tool to classify surface water pollution, the Costa-Rican WRF relies on two water quality indexes: the so-called "Dutch Index" (D.I) and the Biological Monitoring Working Party adapted to Costa Rica (BMWP'CR), allowing an "easy" physicochemical and biological appraisal of the water quality and the ecological integrity of water bodies. Herein, we intend to evaluate whether the compound of water quality indexes imposed by Costa Rican legislation, is suitable to assess rivers local and global anthropogenic pressure and environmental conditions. We monitor water quality for 7 points of Liberia River (northern pacific region - Costa Rica) from March 2013 to July 2015. Anthropogenic pressures are characterized by catchment land use and riparian conditions. Environmental conditions are built from rainfall daily series. Our results show (i) the difficulties to monitor new sites following the recent implementation of the WRF; (ii) the statistical characteristics of each index; and (iii) a modelling tentative of relationships between water quality indexes and explanatory factors (land-use, riparian characteristics and climate conditions).

  12. Physical activity patterns and metabolic syndrome in Costa Rica.

    PubMed

    Hastert, Theresa A; Gong, Jian; Campos, Hannia; Baylin, Ana

    2015-01-01

    To examine whether total physical activity or activity patterns are associated with metabolic syndrome and its components. Participants include 1994 controls from a case-control study of non-fatal myocardial infarction in Costa Rica (1994-2004). Physical activity was assessed via self-administered questionnaire and patterns were identified using principal components analysis. Metabolic syndrome was assessed via blood samples and anthropometry measurements from in-home study visits. Prevalence ratios (PRs) and 95% confidence intervals (CIs) were calculated using log binomial regression. Adjusted least squares means of metabolic syndrome components were calculated by quintile of total activity and pattern scores. Four activity patterns were identified: rest/sleep, agricultural, light indoor activity, and manual labor. Total activity was not associated with metabolic syndrome. Metabolic syndrome prevalence was 20% lower in participants with the highest scores on the agricultural job pattern compared to those with the lowest (PR: 0.80, 95% CI: 0.68-0.94). Higher total activity was associated with lower triglycerides and lower HDL cholesterol. Higher scores on each pattern were inversely associated with metabolic syndrome components, particularly waist circumference and fasting blood glucose. Patterns or types of physical activity may be more strongly associated with metabolic syndrome and its components than total activity levels. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Habitat use by squirrel monkeys (Saimiri oerstedi) in Costa Rica.

    PubMed

    Boinski, S

    1987-01-01

    This paper analyses movement patterns, habitat preferences, activity schedules, and dispersion of troop members in squirrel monkeys (Saimiri oerstedi) in relation to seasonal changes in food abundance in a Costa Rican tropical wet forest. Secondary forest was the preferred habitat and use of primary forest and late successional forest was limited primarily to seasons when food availability was low. Range area differed between seasons, varying from 79 to 110 ha, and totaling 176 ha over 11 months. The number of hectares used, hourly rate of group movement, and proportion of time spent foraging each season were all negatively related to relative food abundance. There was a tendency to spend less time in foraging activities in the middle of the day and to spend more time exclusively in travel at dawn and dusk. In all seasons dispersion was least when the troop was travelling and it was generally greatest during seasons of low food abundance. Measures of the allocation of time by the troop to food-related activities and the extent of troop dispersion each season were consistent with estimates based on behavior sampling of individuals.

  14. Urban structure and dengue fever in Puntarenas, Costa Rica

    PubMed Central

    Troyo, Adriana; Fuller, Douglas O.; Calderón-Arguedas, Olger; Solano, Mayra E.; Beier, John C.

    2009-01-01

    Dengue is currently the most important arboviral disease globally and is usually associated with built environments in tropical areas. Remotely sensed information can facilitate the study of urban mosquito-borne diseases by providing multiple temporal and spatial resolutions appropriate to investigate urban structure and ecological characteristics associated with infectious disease. In this study, coarse, medium and fine resolution satellite imagery (Moderate Resolution Imaging Spectrometer, Advanced Spaceborne Thermal Emission and Reflection Radiometer and QuickBird respectively) and ground-based data were analyzed for the Greater Puntarenas area, Costa Rica for the years 2002–04. The results showed that the mean normalized difference vegetation index (NDVI) was generally higher in the localities with lower incidence of dengue fever during 2002, although the correlation was statistically significant only in the dry season (r=−0.40; p=0.03). Dengue incidence was inversely correlated to built area and directly correlated with tree cover (r=0.75, p=0.01). Overall, the significant correlations between dengue incidence and urban structural variables (tree cover and building density) suggest that properties of urban structure may be associated with dengue incidence in tropical urban settings. PMID:20161131

  15. The cervical cancer prevention programme in Costa Rica.

    PubMed

    Rojas, Ileana Quirós

    2015-01-01

    Cervical and uterine cancer continues to be an important issue for women around the world, although neoplasia has the greatest demonstrated potential for prevention. Costa Rica has achieved important advances in the reduction of the incidence and mortality of these cancers since the last century. This is the result of a series of policies, programmes, and plans, not only at the level of the health care system, but also in other areas. Increased access for women to care in health centres, fundamentally at the primary level, has been vital, as has ensuring the quality of cytology readings and access to diagnosis and treatment for precursor lesions for in situ and invasive cancers. Despite all of these achievements, there are still challenges to be overcome, which are widespread in many countries in Latin America and the Caribbean. It is important to learn from the experiences of other countries in order to improve women's health not only as a health objective, but also as an ethical imperative to promote the exercise of women's rights to life and health.

  16. Conversion or conservation? Understanding wetland change in northwest Costa Rica.

    PubMed

    Daniels, Amy E; Cumming, Graeme S

    2008-01-01

    Wetlands are more threatened than any other ecosystem type, with losses exceeding 50% of their original extent worldwide. Despite the small portion of the Earth's surface that they comprise, wetlands contribute significantly to global ecosystem services. In this study, we tested the hypothesis that the location and rate of change in wetland amount in the Tempisque Basin of northwest Costa Rica is predictable from landscape setting. Our results demonstrate that a strong potential exists for developing predictive models of wetland conversion based on an understanding of wetland location and surrounding trends of land use. We found that topography was the single most important predictor of wetland conversion in this area, entraining other conversion processes, and that spatial patterns of wetland loss could consistently be predicted from landscape-level variables. Areas with highest probabilities of conversion were found in the most accessible, non-protected regions of the landscape. While Palo Verde National Park made a substantial contribution to wetland conservation, our results highlight the dependence of lower-lying protected areas on upland processes, adding a little-addressed dimension of complexity to the dialogue about protected area management. Conservation strategies aimed at reducing wetland loss in tropical habitats will benefit from careful analysis of the dominant land use system(s) at a relatively broad scale, and the subsequent development of management and policy responses that take into account dynamic opportunities and constraints in the landscape.

  17. Phytoplankton production and grazing balances in the Costa Rica Dome.

    PubMed

    Landry, Michael R; Selph, Karen E; Décima, Moira; Gutiérrez-Rodríguez, Andrés; Stukel, Michael R; Taylor, Andrew G; Pasulka, Alexis L

    2016-03-01

    We investigated phytoplankton production rates and grazing fates in the Costa Rica Dome (CRD) during summer 2010 based on dilution depth profiles analyzed by flow cytometry and pigments and mesozooplankton grazing assessed by gut fluorescence. Three community production estimates, from (14)C uptake (1025 ± 113 mg C m(-2) day(-1)) and from dilution experiments analyzed for total Chla (990 ± 106 mg C m(-2) day(-1)) and flow cytometry populations (862 ± 71 mg C m(-2) day(-1)), exceeded regional ship-based values by 2-3-fold. Picophytoplankton accounted for 56% of community biomass and 39% of production. Production profiles extended deeper for Prochlorococcus (PRO) and picoeukaryotes than for Synechococcus (SYN) and larger eukaryotes, but 93% of total production occurred above 40 m. Microzooplankton consumed all PRO and SYN growth and two-third of total production. Positive net growth of larger eukaryotes in the upper 40 m was balanced by independently measured consumption by mesozooplankton. Among larger eukaryotes, diatoms contributed ∼3% to production. On the basis of this analysis, the CRD region is characterized by high production and grazing turnover, comparable with or higher than estimates for the eastern equatorial Pacific. The region nonetheless displays characteristics atypical of high productivity, such as picophytoplankton dominance and suppressed diatom roles.

  18. A clandestine burial in Costa Rica: prospection and excavation.

    PubMed

    Congram, Derek R

    2008-07-01

    This case report describes the search for a clandestine grave in Costa Rica for which the police sought the assistance of an archaeologist. An anonymous informant suggested that the victim had been kidnapped and murdered, placed in a shallow grave in the woods, then covered with lime and cement. A search of the area to detect conventional signs of burial (e.g., slumping, different plant growth) resulted in excavation of unrelated features of past disturbance. Different aspects of the grave including the deposition of cement powder over the body prevented its initial discovery. Improvisation of conventional archaeological excavation methods and use of police familiar with archaeological excavation resulted in the location of the grave and exhumation of the victim without loss of important contextual evidence that supported testimony on the cause of death. The taphonomic effects of high-lying ground water and lime in the tropical burial environment are briefly discussed. Recommendations such as the construction of a temporary sump to lower the ground water level in the grave during excavation are made to assist in similar investigations in the future.

  19. Meiofauna associated with a Pacific coral reef in Costa Rica

    NASA Astrophysics Data System (ADS)

    Guzmán, Héctor M.; Obando, Vilma L.; Cortés, Jorge

    1987-10-01

    The meiofauna of two coral reef habitats at Isla del Naño, Costa Rica was studied over a one year period. The dominant groups were: Foraminifera (21.2%), Copepoda (19.7%), Nematoda (19.1%), Gastropoda (16.5%), Polychaeta (7.2%) and Bivalvia (6.6%). The highest diversity was found in coarse, heterogeneous sands with the highest percentage of carbonates. The meiofauna showed a high degree of horizontal aggregation, which is a characteristic pattern for macro- and meiofauna in sediments of variable composition. No vertical variation in distribution was evident, probably due to the deep location of the Redox Potential Discontinuity layer. The total densities of organisms found in this study (99 to 575 ind/10 cm2) are low compared with densities in similar non-reefal sands (7 to 6116), and from fine sediments (80 to 17 000), but are comparable to densities found in other reef areas (39 to 609.5 ind/10 cm2). This is the first report on meiofauna from the eastern Pacific, and the first time that foraminiferans are the dominant group.

  20. Health insurance and child mortality in Costa Rica.

    PubMed

    Dow, William H; Schmeer, Kammi K

    2003-09-01

    This study uses a natural experiment approach to evaluate the effect of health insurance on infant and child mortality. In the 1970s Costa Rica adopted national health insurance, which expanded children's insurance coverage from 42 percent in 1973 to 73 percent by 1984. Aggregate infant and child mortality rates dropped rapidly during this period, but this trend had begun prior to the insurance expansion, and may be related to other changes during this period. We use county-level vital statistics and census data to isolate the causal insurance effect on mortality using county fixed effects models. We find that insurance increases are strongly related to mortality decreases at the county level before controlling for other time-varying factors. However, after controlling for changes in other correlated maternal, household, and community characteristics, fixed effects models indicate that the insurance expansion could have explained only a small portion of the mortality change. These results question the proposition that health insurance can lead to large improvements in infant and child mortality, and that expanding insurance to the poor can substantially narrow socioeconomic differentials in mortality.

  1. Physical activity patterns and metabolic syndrome in Costa Rica

    PubMed Central

    Hastert, Theresa A.; Gong, Jian; Campos, Hannia; Baylin, Ana

    2015-01-01

    Objective To examine whether total physical activity or activity patterns are associated with metabolic syndrome and its components. Methods Participants include 1,994 controls from a case-control study of non-fatal myocardial infarction in Costa Rica (1994–2004). Physical activity was assessed via self-administered questionnaire and patterns were identified using principal components analysis. Metabolic syndrome was assessed via blood samples and anthropometry measurements from in-home study visits. Prevalence ratios (PR) and 95% confidence intervals (CI) were calculated using log binomial regression. Adjusted least squares means of metabolic syndrome components were calculated by quintile of total activity and pattern scores. Results Four activity patterns were identified: rest/sleep, agricultural, light indoor activity, and manual labor. Total activity was not associated with metabolic syndrome. Metabolic syndrome prevalence was 20% lower in participants with the highest scores on the agricultural job pattern compared to those with the lowest (PR: 0.80, 95% CI: 0.68–0.94). Higher total activity was associated with lower triglycerides and lower HDL cholesterol. Higher scores on each pattern were inversely associated with metabolic syndrome components, particularly waist circumference and fasting blood glucose. Conclusions Patterns or types of physical activity may be more strongly associated with metabolic syndrome and its components than total activity levels. PMID:25445330

  2. Ocular disease in American crocodiles (Crocodylus acutus) in Costa Rica.

    PubMed

    Rainwater, Thomas R; Millichamp, Nicholas J; Barrantes, Luz Denia Barrantes; Barr, Brady R; Montero, Juan R Bolaños; Platt, Steven G; Abel, Mike T; Cobb, George P; Anderson, Todd A

    2011-04-01

    Beginning in early 2006, an ocular disease of unknown etiology was routinely observed in American crocodiles (Crocodylus acutus) inhabiting the highly polluted Tarcoles River in west-central Costa Rica. We examined the nature and incidence of ocular disease in Tarcoles crocodiles and assessed the possible association between the disease and accumulation of chemical pollutants in diseased individuals. During 12-15 September and 12-13 December 2007, crocodiles were captured and examined for ocular disease and sampled to determine environmental contaminant accumulation. Three of 11 (27.3%) crocodiles captured (all males) exhibited unilateral ocular disease, primarily characterized by corneal opacity and scarring, anterior synechia, and phthisis bulbi. Multiple pollutants were detected in crocodile caudal scutes (organochlorine pesticides [OCPs] and metals), crocodile blood (OCPs), and sediments (OCPs and metals) from the Tarcoles, but no associations were found between contaminant accumulation and the incidence of eye disease. On the basis of the limited number of diseased animals examined and the potential exposure of crocodiles to pathogens and other pollutants not targeted in this study, we cannot rule out infection or chemical toxicosis as causes of the eye lesions. However, circumstantial evidence suggests that the observed ocular disease is likely the result of injury-induced trauma (and possibly secondary infection) inflicted during aggressive encounters (e.g., territorial combat) among large adult crocodiles living at relatively high densities.

  3. The crustal structure of the Cocos ridge off Costa Rica

    NASA Astrophysics Data System (ADS)

    Walther, Christian H. E.

    2003-03-01

    The submarine Cocos ridge in the northwestern Panamá basin, a bathymetric feature more than 1000-km long and 250-500 km broad, is about 2 km shallower than the adjacent basin. It is generally interpreted as the trace of the Galápagos hot spot. Two 127- and 260-km long seismic wide-angle sections were recorded along and across this ridge, offshore the Osa peninsula, Costa Rica. Crustal thickening is seen everywhere along the sections. On the northwestern outer ridge flank, increased thickness is exclusively attributed to the upper crust and expressed by 2-km thick flow basalts. The Quepos plateau caps the upper crust in this area. Toward the center of the Cocos ridge, the Moho deepens from 11-12 to 21 km depth and crustal thickening is almost entirely attributed to the lower crust which makes up 80% of the crust and is three times the thickness of normal oceanic lower crust. It is homogeneously structured and the velocities which range from 6.5 km/s at the top to 7.35 km/s at the base are comparable to normal lower crust under these depth conditions and suggest no differences to a gabbroic rock composition. Similarities to the crustal velocity structure of Iceland, central Kerguelen plateau, and Broken ridge are consistent with a formation of this 13-15 Ma old Cocos ridge segment by excessive magmatism in a near-plate boundary setting.

  4. The distribution of fallout {sup 137}Cs in Costa Rica

    SciTech Connect

    Salazar, A.; Mora, P.

    1996-08-01

    Baseline levels of {sup 137}Cs on different sites throughout the Costa Rican territory are presented in this study from local and undisturbed soils. They are believed to represent the fallout input to the land surface. Seventy samples were collected from September 1991 to December 1993, and analyzed by gamma spectroscopy. The territory was divided in three regions, Caribbean, Pacific, and Central, based on meteorological and geographical conditions to study spatial distribution of cesium. The results show a higher activity in the Caribbean region perhaps due to the wind influence and higher rain precipitation throughout the year. No relevant time variation of the activity levels of reach location was found. The highest value of 17.6 Bq kg{sup {minus}1} of {sup 137}Cs is compared with it generalized derived limit, being only 1.97% of the generalized derived limit value. The mean country activity value ranges from 0.4 to 17.8 Bq kg{sup {minus}1} with an average of 3.7 Bq kg{sup {minus}1}. 10 refs., 4 figs., 1 tab.

  5. Light Diffusion in the Tropical Dry Forest of Costa Rica

    NASA Astrophysics Data System (ADS)

    Calvo-Rodriguez, S.; Sanchez-Azofeifa, G. A.

    2016-06-01

    Leaf Area Index (LAI) has been defined as the total leaf area (one-sided) in relation to the ground. LAI has an impact on tree growth and recruitment through the interception of light, which in turn affects primary productivity. Even though many instruments exist for estimating LAI from ground, they are often laborious and costly to run continuously. Measurements of LAI from the field using traditional sensors (e.g., LAI-2000) require multiple visits to the field under very specific sky conditions, making them unsuitable to operate in inaccessible areas and forests with dense vegetation, as well as areas where persistent sunny conditions are the norm like tropical dry forests. With this context, we proposed a methodology to characterize light diffusion based on NDVI and LAI measurements taken from the field in two successional stages in the tropical dry forest of Santa Rosa National Park in Costa Rica. We estimate a "K" coefficient to characterize light diffusion by the canopy, based on field NDVI measurements derived from optical phenology instruments and MODIS NDVI. From the coefficients determined, we estimated LAI values and compared them with ground measurements of LAI. In both successional stages ground measurements of LAI had no significant difference to the tower-derived LAI and the estimated LAI from MODIS NDVI.

  6. Volcanic gas impacts on vegetation at Turrialba Volcano, Costa Rica

    NASA Astrophysics Data System (ADS)

    Teasdale, R.; Jenkins, M.; Pushnik, J.; Houpis, J. L.; Brown, D. L.

    2010-12-01

    Turrialba volcano is an active composite stratovolcano that is located approximately 40 km east of San Jose, Costa Rica. Seismic activity and degassing have increased since 2005, and gas compositions reflect further increased activity since 2007 peaking in January 2010 with a phreatic eruption. Gas fumes dispersed by trade winds toward the west, northwest, and southwest flanks of Turrialba volcano have caused significant vegetation kill zones, in areas important to local agriculture, including dairy pastures and potato fields, wildlife and human populations. In addition to extensive vegetative degradation is the potential for soil and water contamination and soil erosion. Summit fumarole temperatures have been measured over 200 degrees C and gas emissions are dominated by SO2; gas and vapor plumes reach up to 2 km (fumaroles and gases are measured regularly by OVSICORI-UNA). A recent network of passive air sampling, monitoring of water temperatures of hydrothermal systems, and soil pH measurements coupled with measurement of the physiological status of surrounding plants using gas exchange and fluorescence measurements to: (1) identify physiological correlations between leaf-level gas exchange and chlorophyll fluorescence measurements of plants under long term stress induced by the volcanic gas emissions, and (2) use measurements in tandem with remotely sensed reflectance-derived fluorescence ratio indices to track natural photo inhibition caused by volcanic gas emissions, for use in monitoring plant stress and photosynthetic function. Results may prove helpful in developing potential land management strategies to maintain the biological health of the area.

  7. Anomalies in seasonal runoff patterns of Costa Rica

    NASA Astrophysics Data System (ADS)

    Krasovskaia, I.

    2009-04-01

    Knowledge about seasonal runoff patterns is indispensable for water management, for example, for sustainable hydropower regulation schemes. Seasonal runoff patterns have been identified for 56 27-years long monthly runoff series for Costa Rica. The high intrinsic dimensionality of many monthly runoff series analysed reveals high instability of their seasonal patterns suggesting differences in patterns demonstrated during individual years and the average seasonal pattern. In this study the focus was put on patterns observed during individual years and their relation to teleconnections. To match the scale of variations of these latter the analyses were performed on five grouped samples of monthly runoff that represent different geographical regions. In some of the groups there was a significant correlation between the presence of the seasonal patterns studied and individual teleconnections but the values of the correlation coefficient were rather low. Analyses of the contingency tables showing the phase (higher/lower than the mean) of teleconnection or their combinations and the frequency of seasonal patterns in a group with different lags showed that for certain combinations of phases these frequencies increase considerably. This finding opens for a possibility of probabilistic forecasts of seasonal patterns using information on teleconnections.

  8. [Trace metals in coastal sediments from Costa Rica].

    PubMed

    García-Céspedes, Jairo; Acuña-González, Jenaro; Vargas-Zamora, José A

    2004-12-01

    Marine sediment samples from four coastal ecosystems in Costa Rica were taken between the years 2000-2002 and their iron, lead, copper and zinc concentrations were determined by the atomic absorption technique with flame or graphite furnace. In the Pacific coast, Culebra Bay (Papagayo Gulf), Gulf of Nicoya, and Golfito Bay (Dulce Gulf), were selected as representative sites, and Moín Bay, at the Caribbean coast. Mean metal concentrations for all ecosystems followed the same pattern: Fe > Zn > Cu > Pb. No temporal pattern was found for any metal. Iron and copper mean concentrations were higher in Golfito Bay (5.8% and 87 microg/g, respectively) and lower in Moín Bay (3.4% and 52 microg/g, respectively). Zinc mean concentration was also higher in Golfito Bay (96 microg/g), but lower in Culebra Bay (66 microg/g). Lead mean concentration was higher in Moín Bay (6.4 microg/g) and lower in Culebra Bay (3.0 microg/g). Lead highest concentrations occurred in the Caribbean and in Golfito Bay, and for the rest of the elements the maximum values were found in Golfito Bay. On the basis of data obtained in this work, Culebra Bay was considered a relatively unpolluted location; Golfito Bay was more contaminated, and Moín Bay and the Gulf of Nicoya showed an intermediate condition.

  9. [The phytoplankton community of Punta Morales, Nicoya Gulf, Costa Rica ].

    PubMed

    Brugnoli Olivera, E; Morales Ramirez, A

    2001-12-01

    Three daily samplings of the phytoplankton community were made at two consecutive days in March, April, May, September, October, November and December 1997, at Punta Morales, Golfo de Nicoya, Costa Rica. Samples were collected during each tide at depths of 50% and 10% of light penetration using a Niskin bottle. A total of 43 taxa were identified. Centric diatoms, pennates and flagellates represented 90% of total phytoplankton abundance. In the phytoplankton fraction (cells > 30 microm), diatoms were the most abundant group, and Skeletonema costatum (32%) dominated. In nannophytoplankton (cells < 30 microm), Chaetoceros (23.7%) was the most abundant taxon, followed by flagellates (23%) and Cylindrotheca closterium (13.1%). These results agree with previous surveys and suggest that a typical net phytoplankton community persist through time in the Punta Morales zone. The number of nannophytoplankton fraction cells varied seasonally and suggests quantitative changes in species abundance, with possible modifications of cellular size or chain length in filamentous species. The codominance between S. costatum and Chaetoceros spp. during the rainy season suggested the ocurrence of an early ecological sucession, and nutrients could be the factor generating such population changes.

  10. [A biogeochemical model for the Gulf of Nicoya, Costa Rica].

    PubMed

    Tabash Blanco, Farid A

    2007-03-01

    In agreement with the Broecker and Penn two-boxes model, I generated a biogeochemical balance model for the Gulf of Nicoya (Guanacaste, Costa Rica) using two nutrient reservoirs: surface water and deep water. The mixing zone was located at a depth of 20 m. There is a balance between surface waters descending to the bottom and upwelling waters that carry nutrients and other chemical elements to the surface. The main source of nitrogen (nitrate), was the outlet of the Tempisque and Tárcoles rivers. The Gulf of Nicoya is a net source of Dissolved Inorganic Nitrogen (DIN) with an availability rate of 87 x 10(3) mol day(-1) in the dry season and 3044 x 10(3) mol day(-1)in the rainy season. Dissolved Inorganic Phosphate (DIP) was estimated in 27 mol day(-1) in the dry season and 207 mol day(-1) in the rainy season. The dynamics of these biolimited nutrients, in relation to runoff seasonal variations, fits the biological processes reported for the gulf, for example, for variations in primary productivity levels, and maturity and reproduction seasons for species with short and long life cycles.

  11. Anthropogenic impacts on Costa Rican bat parasitism are sex specific.

    PubMed

    Frank, Hannah K; Mendenhall, Chase D; Judson, Seth D; Daily, Gretchen C; Hadly, Elizabeth A

    2016-07-01

    While anthropogenic impacts on parasitism of wildlife are receiving growing attention, whether these impacts vary in a sex-specific manner remains little explored. Differences between the sexes in the effect of parasites, linked to anthropogenic activity, could lead to uneven sex ratios and higher population endangerment. We sampled 1108 individual bats in 18 different sites across an agricultural mosaic landscape in southern Costa Rica to investigate the relationships between anthropogenic impacts (deforestation and reductions in host species richness) and bat fly ectoparasitism of 35 species of Neotropical bats. Although female and male bat assemblages were similar across the deforestation gradient, bat fly assemblages tracked their hosts closely only on female bats. We found that in female hosts, parasite abundance per bat decreased with increasing bat species richness, while in male hosts, parasite abundance increased. We hypothesize the differences in the parasite-disturbance relationship are due to differences in roosting behavior between the sexes. We report a sex-specific parasite-disturbance relationship and argue that sex differences in anthropogenic impacts on wildlife parasitism could impact long-term population health and survival.

  12. The cervical cancer prevention programme in Costa Rica

    PubMed Central

    Rojas, Ileana Quirós

    2015-01-01

    Cervical and uterine cancer continues to be an important issue for women around the world, although neoplasia has the greatest demonstrated potential for prevention. Costa Rica has achieved important advances in the reduction of the incidence and mortality of these cancers since the last century. This is the result of a series of policies, programmes, and plans, not only at the level of the health care system, but also in other areas. Increased access for women to care in health centres, fundamentally at the primary level, has been vital, as has ensuring the quality of cytology readings and access to diagnosis and treatment for precursor lesions for in situ and invasive cancers. Despite all of these achievements, there are still challenges to be overcome, which are widespread in many countries in Latin America and the Caribbean. It is important to learn from the experiences of other countries in order to improve women’s health not only as a health objective, but also as an ethical imperative to promote the exercise of women’s rights to life and health. PMID:26557876

  13. Phytoplankton production and grazing balances in the Costa Rica Dome

    PubMed Central

    Landry, Michael R.; Selph, Karen E.; Décima, Moira; Gutiérrez-Rodríguez, Andrés; Stukel, Michael R.; Taylor, Andrew G.; Pasulka, Alexis L.

    2016-01-01

    We investigated phytoplankton production rates and grazing fates in the Costa Rica Dome (CRD) during summer 2010 based on dilution depth profiles analyzed by flow cytometry and pigments and mesozooplankton grazing assessed by gut fluorescence. Three community production estimates, from 14C uptake (1025 ± 113 mg C m−2 day−1) and from dilution experiments analyzed for total Chla (990 ± 106 mg C m−2 day−1) and flow cytometry populations (862 ± 71 mg C m−2 day−1), exceeded regional ship-based values by 2–3-fold. Picophytoplankton accounted for 56% of community biomass and 39% of production. Production profiles extended deeper for Prochlorococcus (PRO) and picoeukaryotes than for Synechococcus (SYN) and larger eukaryotes, but 93% of total production occurred above 40 m. Microzooplankton consumed all PRO and SYN growth and two-third of total production. Positive net growth of larger eukaryotes in the upper 40 m was balanced by independently measured consumption by mesozooplankton. Among larger eukaryotes, diatoms contributed ∼3% to production. On the basis of this analysis, the CRD region is characterized by high production and grazing turnover, comparable with or higher than estimates for the eastern equatorial Pacific. The region nonetheless displays characteristics atypical of high productivity, such as picophytoplankton dominance and suppressed diatom roles. PMID:27275036

  14. A Cross-Country Comparison of Virtual Discussion Board Use in United States and Costa Rican Education Settings

    ERIC Educational Resources Information Center

    Hodge, Kari; Saxon, Terrill F.; Trumble, Jason

    2013-01-01

    The purpose of the current study was to compare the use of virtual discussion boards in various educational settings in the United States and Costa Rica. Participants included professors of education, in-service and pre-service teachers in the United States and Costa Rica where a survey was used that included demographic, knowledge, attitude, and…

  15. Description of a new species and subspecies of Idalus Walker from Costa Rica, Honduras and Guatemala (Lepidoptera, Erebidae, Arctiinae, Arctiini)

    PubMed Central

    Espinoza, Bernardo A.; Janzen, Daniel H.; Winnie Hallwachs;  J. Bolling Sullivan

    2013-01-01

    Abstract A new species and subspecies of Idalus Walker are described from Costa Rica, Honduras and Guatemala. Images of males and females and their genitalia are provided. Locality information and distribution maps for Costa Rica and for Guatemala are included. The biology and phylogeny of Idalus are discussed. PMID:23730178

  16. Constructions of Difference and Deficit, a Case Study: Nicaraguan Families and Children on the Margins in Costa Rica

    ERIC Educational Resources Information Center

    Purcell-Gates, Victoria

    2014-01-01

    This analysis examines the nexus of marginalization and education, particularly the literacy potential and achievement of young children from socially and politically marginalized communities. Drawing on data from a study of literacy practice among Nicaraguan immigrants in Costa Rica and the schooling of the Nicaraguan children in Costa Rican…

  17. A Cross-Country Comparison of Virtual Discussion Board Use in United States and Costa Rican Education Settings

    ERIC Educational Resources Information Center

    Hodge, Kari; Saxon, Terrill F.; Trumble, Jason

    2013-01-01

    The purpose of the current study was to compare the use of virtual discussion boards in various educational settings in the United States and Costa Rica. Participants included professors of education, in-service and pre-service teachers in the United States and Costa Rica where a survey was used that included demographic, knowledge, attitude, and…

  18. DiaTreat: a new method of communication for better diagnosis and treatment of dental problems.

    PubMed

    Reddy, K Srinivas; Reddy, R Sunil Kumar; Sudheer, A; Reddy, R Vamshidhar; Rao, N Venugopal; Reddy, P Lakshmipathy

    2013-01-01

    The aim of this article is to present a simple method of communication between two oral health professionals so that the problem can be conveyed easily and treatment options obtained equally easily and quickly, using current electronic communication technologies. Treatment of dental problems involves a thorough understanding of the underlying dental and medical conditions. The arena of dentistry being ever changing, with new specialties arising each year, it has become virtually impossible for an average dentist to keep track of all the treatment modalities available for various problems at a given time. It is the duty of a dentist, however, to treat his patients to the best of his ability. Professional ethics bind the other health professionals to render their opinion to the dentist so that the patient will ultimately get the best possible treatment. Method of communication is the only problem remaining in the path to achieving a total oral health care. DiaTreat is a unique method of clinical charting by which a dentist can incorporate all the ailments affecting his patient, and by withholding the patients name and address, can communicate with any of his colleagues for their opinion on the best treatment option for his patient. It is a new and innovative method of communication between a dentist and specialist. Even though it has some shortcomings of its own, on a wider range, the advantages far outweigh the drawbacks of the system. CLINICAL AND ACADEMIC SIGNIFICANCE: This can also be used by educational institutes for easy communication during interdisciplinary exchanges. Improvements need to be made yet to incorporate all the ailments known in dental discipline and make communication a comprehensive one.

  19. A drug-induced accelerated senescence (DIAS) is a possibility to study aging in time lapse.

    PubMed

    Alili, Lirija; Diekmann, Johanna; Giesen, Melanie; Holtkötter, Olaf; Brenneisen, Peter

    2014-06-01

    Currently, the oxidative stress (or free radical) theory of aging is the most popular explanation of how aging occurs at the molecular level. Accordingly, a stress-induced senescence-like phenotype of human dermal fibroblasts can be induced in vitro by the exposure of human diploid fibroblasts to subcytotoxic concentrations of hydrogen peroxide. However, several biomarkers of replicative senescence e.g. cell cycle arrest and enlarged morphology are abrogated 14 days after treatment, indicating that reactive oxygen species (ROS) rather acts as a trigger for short-term senescence (1-3 days) than being responsible for the maintenance of the senescence-like phenotype. Further, DNA-damaging factors are discussed resulting in a permanent senescent cell type. To induce long-term premature senescence and to understand the molecular alterations occurring during the aging process, we analyzed mitomycin C (MMC) as an alkylating DNA-damaging agent and ROS producer. Human dermal fibroblasts (HDF), used as model for skin aging, were exposed to non-cytotoxic concentrations of MMC and analyzed for potential markers of cellular aging, for example enlarged morphology, activity of senescence-associated-ß-galactosidase, cell cycle arrest, increased ROS production and MMP1-activity, which are well-documented for HDF in replicative senescence. Our data show that mitomycin C treatment results in a drug-induced accelerated senescence (DIAS) with long-term expression of senescence markers, demonstrating that a combination of different susceptibility factors, here ROS and DNA alkylation, are necessary to induce a permanent senescent cell type.

  20. First report of acariasis by Caparinia tripilis in African hedgehogs, (Atelerix albiventris), in Costa Rica.

    PubMed

    Moreira, Andrés; Troyo, Adriana; Calderón-Arguedas, Olger

    2013-01-01

    The African hedgehog is one of the newly imported exotic pets which have been observed with increasing regularity in veterinary clinics in Costa Rica. Despite their popularity, information about their diseases is scarce. Within skin diseases of hedgehogs, mange caused by Caparinia spp. is a common diagnosis in other countries. Two adult African hedgehogs, one male and one female, were brought to a private clinic in Heredia, Costa Rica, with chronic pruritic dermatitis, scabs, nearly complete loss of spines, lethargy, dehydration, and weight loss. During physical exam, deposits of dry seborrhea were taken and processed for diagnosis. Microscopic examination revealed psoroptid mites identified as Caparinia tripilis. This is the first report of the presence of Caparinia tripilis in Costa Rica and, to the authors' knowledge, the rest of Central America.

  1. Two new species and a new combination in Protium (Burseraceae) from Costa Rica

    PubMed Central

    Santamaría-Aguilar, Daniel; Lagomarsino, Laura P.

    2017-01-01

    Abstract Two new species of Protium (Burseraceae) are described and illustrated: Protium aguilarii sp. nov., from the Pacific slope of the Osa Peninsula, Puntarenas Province, Costa Rica; and Protium hammelii sp. nov., from wet forests on the Caribbean slopes of Nicaragua and Costa Rica. In addition, Protium brenesii comb. nov., is proposed as a new combination based on Trichilia brenesii, a name that was based on a specimen collected with flowers in the mountains near San Ramón, Alajuela Province, Costa Rica. It is compared with Protium costaricense, a similar species with which it has been confused for more than 90 years. Finally, illustrations and specimen citations are provided for all the aforementioned taxa, and some others with which they have been confused. PMID:28228688

  2. Babies and belonging: reproduction, citizenship, and undocumented nicaraguan labor migrant women in Costa Rica.

    PubMed

    Goldade, Kate

    2011-01-01

    This article presents findings from an ethnographic study of 43 Nicaraguan labor migrant women in Costa Rica, among whom two thirds were undocumented. Drawing from more than a year of field research, this research explores how undocumented migrant women parlayed reproductive capacities in a context of a modernizing democratic host nation-state increasingly limited in its capacity to fulfill longstanding national ideals of "health for all." Pregnancy and postpartum periods presented unique opportunities for achieving gains related to citizenship. As the third most common migrant destination context in the Western hemisphere, Costa Rica is grappling with its dual role as a nation of emigration and immigration and is attempting to maintain its "exceptional" national identity in the face of rapid globalization. Due to the jus soli citizenship model, the health care system has become a site for struggle over inclusion in the Costa Rican nation-state.

  3. Space geodetic studies of crustal deformation in subduction zones: The Central Andes and Costa Rica

    NASA Astrophysics Data System (ADS)

    Norabuena, Edmundo O.

    Subduction zones are regions that account for most of the total energy released by large earthquakes around the world. Two of these regions, the Costa Rica Margin and the southern Peru Margin, historically prone to devastating earthquakes with severe social and economic impact, are the focus of my dissertation. I use GPS derived velocity fields estimated from time series of coordinates of campaign stations deployed between 1994 and 2001 over the Costa Rica and Peru subduction zones to infer fault geometry and slip distribution on the plate boundary, and study the corresponding seismogenic zones. Regions of locking are associated with asperities that may break at the end of the corresponding earthquake cycle; their area extent may signify amount of energy to be released. I also show that fore-arc motion in Costa Rica, as well as postseismic relaxation, are factors that contribute to or alter the observed velocity fields and must be taken into account.

  4. Plastic paradise: transforming bodies and selves in Costa Rica's cosmetic surgery tourism industry.

    PubMed

    Ackerman, Sara L

    2010-10-01

    Long popular as a nature tourism destination, Costa Rica has recently emerged as a haven for middle class North Americans seeking inexpensive, state-of-the-art cosmetic surgery. This paper examines "cosmetic surgery tourism" in Costa Rica as a form of medicalized leisure, situated in elite private spaces and yet inextricably linked to a beleaguered national medical program. Through historical context and ethnographic analysis of activities at medical hotels and clinics, I describe how the recovery industry operates on the embodied subjectivities of visiting patients and their local caretakers. Recovery sociality and healing landscapes facilitate patients' transition through a period of post-surgical liminality and provide nostalgic transport to an imagined medical arcadia, while clinicians are attracted by a neoliberal promise of prosperity and autonomy. Ultimately, Costa Rica's transformation into a paradise of medical consumption and self-optimization is contingent on a mythology that obscures growing uncertainties and inequities in the nation's broader medical landscape.

  5. Two new species and a new combination in Protium (Burseraceae) from Costa Rica.

    PubMed

    Santamaría-Aguilar, Daniel; Lagomarsino, Laura P

    2017-01-01

    Two new species of Protium (Burseraceae) are described and illustrated: Protium aguilariisp. nov., from the Pacific slope of the Osa Peninsula, Puntarenas Province, Costa Rica; and Protium hammeliisp. nov., from wet forests on the Caribbean slopes of Nicaragua and Costa Rica. In addition, Protium brenesiicomb. nov., is proposed as a new combination based on Trichilia brenesii, a name that was based on a specimen collected with flowers in the mountains near San Ramón, Alajuela Province, Costa Rica. It is compared with Protium costaricense, a similar species with which it has been confused for more than 90 years. Finally, illustrations and specimen citations are provided for all the aforementioned taxa, and some others with which they have been confused.

  6. New serovars of Leptospira isolated from patients in Costa Rica: implications for public health.

    PubMed

    Valverde, Ma de los A; Goris, M G A; González, V; Anchia, M E; Díaz, P; Ahmed, A; Hartskeerl, R A

    2013-09-01

    Leptospira strains JICH 05 and INCIENSA 04 were isolated from hospitalized leptospirosis patients in the province of Puntarenas, Costa Rica. The isolates produced agglutination titres notably against members of serogroups Pyrogenes and Tarassovi, respectively, but appeared serologically unique in the cross agglutinin absorption test (CAAT). Therefore, JICH 05 and INCIENSA 04 were considered to represent two new serovars, designated Corredores and Costa Rica of the serogroups Pyrogenes and Tarassovi, respectively. Multilocus sequence genotyping revealed that both strain INCIENSA 04 and strain JICH 05 belong to Leptospira santarosai. These two new serovars are in addition to various other recently identified highly virulent serovars, including the new L. santarosai, serovar Arenal. Considering the fact that isolation and typing of leptospires from patients has only recently been introduced in Costa Rica, these findings suggest that various known and unknown virulent serovars of Leptospira are circulating in this country and probably beyond, thus posing a severe threat to public and probably veterinary health in the region.

  7. Synthesis of economic criteria in the design of electric utility industrial conservation programs in Costa Rica

    SciTech Connect

    Fisher, S.C.

    1995-12-31

    This paper lays out a set of economic criteria to guide the development of electricity conservation programs for industrial customers of the Costa Rican utilities. It puts the problem of utility and other public policy formulation in the industrial conservation field into the context of ongoing economic and trade liberalization in Costa Rica, as well as the financial and political pressures with which the country`s utilities must contend. The need to bolster utility financial performance and the perennial political difficulty of adjusting power rates for inflation and devaluation, not to mention maintaining efficient real levels, puts a premium on controlling the costs of utility conservation programs and increasing the degree of cost recovery over time. Industrial conservation programs in Costa Rica must adopt a certain degree of activation to help overcome serious market failures and imperfections while at the same time avoiding significant distortion of the price signals guiding the ongoing industrial rationalization process and the reactivation of growth.

  8. Modeling a tsunami from the Nicoya, Costa Rica, seismic gap and its potential impact in Puntarenas

    NASA Astrophysics Data System (ADS)

    Chacón-Barrantes, Silvia E.; Protti, Marino

    2011-04-01

    Although subduction zones around the world are known to be the source of earthquakes and/or tsunamis, not all segments of these plate boundaries generate destructive earthquakes and catastrophic tsunamis. Costa Rica, in Central America, has subduction zones on both the Pacific and the Caribbean coasts and, even though large earthquakes (Mw = 7.4-7.8) occur in these convergent margins, they do not produce destructive tsunamis. The reason for this is that the seismogenic zones of the segments of the subduction zones that produce large earthquakes in Costa Rica are located beneath land (Nicoya peninsula, Osa peninsula and south of Limón) and not off shore as in most subduction zones around the world. To illustrate this particularity of Costa Rican subduction zones, we show in this work the case for the largest rupture area in Costa Rica (under the Nicoya peninsula), capable of producing Mw ˜ 7.8 earthquakes, but the tsunamis it triggers are small and present little potential for damage even to the largest port city in Costa Rica. The Nicoya seismic gap, in NW Costa Rica, has passed its ˜50-year interseismic period and therefore a large earthquake will have to occur there in the near future. The last large earthquake, in 1950 generated a tsunami which slightly affected the southwest coast of the Nicoya Peninsula. We present here a simulation to study the possible consequences that a tsunami generated by the next Nicoya earthquake could have for the city of Puntarenas. Puntarenas has a population of approximately eleven thousand people and is located on a 7.5 km long sand bar with a maximum height of 2 m above the mean sea level. This condition makes Puntarenas vulnerable to tsunamis.

  9. US fossil fuel technologies for developing countries: Costa Rica country packet

    SciTech Connect

    Not Available

    1988-07-21

    Costa Rica presents long-term opportunities for US participation in the power generation sector. A growing industrial base, high economic growth, and an increasing living standard will continue to require more reliable electric generation. Although the country has depended upon hydropower to meet much of its energy needs, coal could become a more reliable form of energy in the near term, based on estimated indigenous resources and proximity to food quality imports. Thus, trade opportunities exist for the United States, in the electric power sector, for the US advanced fossil fuel technologies and related services. This report describes the Costa Rican energy situation; examines the financial, economic, and trade issues; and discusses project opportunities in Costa Rica. Costa Rica appears to have a positive climate for trade and investment activities, stimulated by the Caribbean Basin Initiative. Although the economy has recently slowed, the economic outlook appears healthy. Application for membership in the General Agreement on Tariffs and Trade is pending. Due to an unexpectedly large growth in electricity demand, the Costa Rican utility Instituto Costarricense de Electricidad is evaluating the need for construction of a coal-fired power plant in the size range of 60 to 125 MW, with an in-service data of the mid-1990s. A decision is expected by the end of 1988 concerning the required size, source of coal, and timing of this coal-fired plant. Based on conditions in Costa Rica, US advanced fossil-fuel technologies were chosen for continued study in conjunction with the identified potential project opportunities. These technologies are the atmospheric fluidized bed combustor and coal-water mixtures. They could play a major role in meeting the utility expansion and/or industrial conversion opportunities summarized in Table I.1. The value of such projects could approximate US $160 million.

  10. Structural and Biochemical Basis for the Inhibitory Effect of Liprin-α3 on Mouse Diaphanous 1 (mDia1) Function*

    PubMed Central

    Brenig, Julian; de Boor, Susanne; Knyphausen, Philipp; Kuhlmann, Nora; Wroblowski, Sarah; Baldus, Linda; Scislowski, Lukas; Artz, Oliver; Trauschies, Philip; Baumann, Ulrich; Neundorf, Ines; Lammers, Michael

    2015-01-01

    Diaphanous-related formins are eukaryotic actin nucleation factors regulated by an autoinhibitory interaction between the N-terminal RhoGTPase-binding domain (mDiaN) and the C-terminal Diaphanous-autoregulatory domain (DAD). Although the activation of formins by Rho proteins is well characterized, its inactivation is only marginally understood. Recently, liprin-α3 was shown to interact with mDia1. Overexpression of liprin-α3 resulted in a reduction of the cellular actin filament content. The molecular mechanisms of how liprin-α3 exerts this effect and counteracts mDia1 activation by RhoA are unknown. Here, we functionally and structurally define a minimal liprin-α3 core region, sufficient to recapitulate the liprin-α3 determined mDia1-respective cellular functions. We show that liprin-α3 alters the interaction kinetics and thermodynamics of mDiaN with RhoA·GTP and DAD. RhoA displaces liprin-α3 allosterically, whereas DAD competes with liprin-α3 for a highly overlapping binding site on mDiaN. Liprin-α3 regulates actin polymerization by lowering the regulatory potency of RhoA and DAD on mDiaN. We present a model of a mechanistically unexplored and new aspect of mDiaN regulation by liprin-α3. PMID:25911102

  11. The RhoA effector mDia is induced during T cell activation and regulates actin polymerization and cell migration in T lymphocytes.

    PubMed

    Vicente-Manzanares, Miguel; Rey, Mercedes; Pérez-Martínez, Manuel; Yáñez-Mó, María; Sancho, David; Cabrero, José Román; Barreiro, Olga; de la Fuente, Hortensia; Itoh, Kazuyuki; Sánchez-Madrid, Francisco

    2003-07-15

    Regulation of actin polymerization is critical for many different functions of T lymphocytes, including cell migration. Here we show that the RhoA effector mDia is induced in vitro in activated PBL and is highly expressed in vivo in diseased tissue-infiltrating activated lymphocytes. mDia localizes at the leading edge of polarized T lymphoblasts in an area immediately posterior to the leading lamella, in which its effector protein profilin is also concentrated. Overexpression of an activated mutant of mDia results in an inhibition of both spontaneous and chemokine-directed T cell motility. mDia does not regulate the shape of the cell, which involves another RhoA effector, p160 Rho-coiled coil kinase, and is not involved in integrin-mediated cell adhesion. However, mDia activation blocked CD3- and PMA-mediated cell spreading. mDia activation increased polymerized actin levels, which resulted in the blockade of chemokine-induced actin polymerization by depletion of monomeric actin. Moreover, mDia was shown to regulate the function of the small GTPase Rac1 through the control of actin availability. Together, our data demonstrate that RhoA is involved in the control of the filamentous actin/monomeric actin balance through mDia, and that this balance is critical for T cell responses.

  12. Four new species of Symmerista Hübner, 1816 (Notodontidae, Nystaleinae) from Costa Rica

    PubMed Central

    Chacón, Isidro A.; Janzen, Daniel H.; Hallwachs, Winnie

    2014-01-01

    Abstract The genus Symmerista Hübner (Notodontidae, Nystaleinae) is reviewed for Costa Rica, based on 49 wild-caught specimens. Four species are newly described: Symmerista luisdiegogomezi Chacón, Symmerista inbioi Chacón, Symmerista minaei Chacón and Symmerista aura Chacón. All are from the cloud forests of the Talamanca moutain range, southern Costa Rica. Photographs of the adults, male and female genitalia, and barcodes are also provided. The species Symmerista tlotzin Schaus (1892) is removed from Symmerista and assigned to the genus Elymiotis Walker as a new combination. PMID:25061379

  13. Four new species of Symmerista Hübner, 1816 (Notodontidae, Nystaleinae) from Costa Rica.

    PubMed

    Chacón, Isidro A; Janzen, Daniel H; Hallwachs, Winnie

    2014-01-01

    The genus Symmerista Hübner (Notodontidae, Nystaleinae) is reviewed for Costa Rica, based on 49 wild-caught specimens. Four species are newly described: Symmerista luisdiegogomezi Chacón, Symmerista inbioi Chacón, Symmerista minaei Chacón and Symmerista aura Chacón. All are from the cloud forests of the Talamanca moutain range, southern Costa Rica. Photographs of the adults, male and female genitalia, and barcodes are also provided. The species Symmerista tlotzin Schaus (1892) is removed from Symmerista and assigned to the genus Elymiotis Walker as a new combination.

  14. [Costa Rica: a geographical approach to the study of its population (1522-1984)].

    PubMed

    Carvajal Alvarado, G

    1990-01-01

    The author provides a geographical interpretation of population dynamics in Costa Rica from 1522 to 1984. Sections are included on Spanish colonialism as a demographic catastrophe, 1500-1821; the country's stable demographic behavior after obtaining its independence in 1821; the population as a product of cross-breeding; the unequal spatial distribution of the country's population; model demographic growth, 1900-1984; low mortality and high fertility as factors driving population growth; the age structure of the population; regional migration in Costa Rica and areas of migratory attraction; the growth of the urban population and the extent of assimilation of diverse groups; and the problem of poverty.

  15. Using Social Networks to Educate Seismology to Non-Science Audiences in Costa Rica

    NASA Astrophysics Data System (ADS)

    Lücke, O. H.; Linkimer, L.

    2013-12-01

    Costa Rica has a very high rate of seismicity with 63 damaging earthquakes in its history as a nation and 12 felt earthquakes per month on average. In Costa Rica, earthquakes are part of everyday life; hence the inhabitants are highly aware of seismic activity and geological processes. However, formal educational programs and mainstream media have not yet addressed the appropriate way of educating the public on these topics, thus myths and misconceptions are common. With the increasing influence of social networks on information diffusion, they have become a new channel to address this issue in Costa Rica. The National Seismological Network of Costa Rica (RSN) is a joint effort between the University of Costa Rica and the Costa Rican Institute of Electricity. Since 1973, the RSN studies the seismicity and volcanic activity in the country. Starting on January 2011 the RSN has an active Facebook Page, in which felt earthquakes are reported and information on Seismology, geological processes, scientific talks, and RSN activities are routinely posted. Additionally, RSN gets almost instantaneous feedback from RSN followers including people from all rural and urban areas of Costa Rica. In this study, we analyze the demographics, geographic distribution, reach of specific Facebook posts per topic, and the episodic growth of RSN followers related to specific seismic events. We observe that 70 % of the RSN users are between ages from 18 to 34. We consistently observe that certain regions of the country have more Facebook activity, although those regions are not the most populated nor have a high connectivity index. We interpret this pattern as the result of a higher awareness to geological hazards in those specific areas. We notice that educational posts are as well 'liked' as most earthquake reports. For exceptional seismic events, we observe sudden increments in the number of RSN followers in the order of tens of thousands. For example, the May 2013 Sixaola earthquake (Mw

  16. The Diaphanous-related formin dDia1 is required for highly directional phototaxis and formation of properly sized fruiting bodies in Dictyostelium.

    PubMed

    Winterhoff, Moritz; Junemann, Alexander; Nordholz, Benjamin; Linkner, Jörn; Schleicher, Michael; Faix, Jan

    2014-01-01

    Diaphanous-related formins (DRFs) act as downstream effectors of Rho family GTPases and drive the formation and elongation of linear actin filaments in various cellular processes. Here we analyzed the DRF dDia1 from Dictyostelium cells. The biochemical characterization of recombinant dDia1-FH1FH2 by bulk polymerization assays and single filament TIRF microscopy revealed that dDia1 is a rather weak nucleator. Addition of any of the three Dictyostelium profilin isoforms, however, markedly accelerated formin-mediated actin filament barbed end elongation in TIRF assays. Interestingly, filament elongation was significantly faster in presence of DdPFN I (profilin I) when compared to the other two isoforms, suggesting selectivity of dDia1 for DdPFN I. Additionally, we frequently observed dissociation of the formin from growing barbed ends. These findings are consistent with dilution-induced depolymerization assays in presence of dDia1-FH1FH2 showing that dDia1 is a weak capper in comparison with heterodimeric capping protein. To study the physiological role of this formin, we created cell lines lacking dDia1 or overexpressing GFP-tagged dDia1. Of note, constitutively active dDia1 accumulated homogenously in the entire pseudopod suggesting that it controls microfilament architecture to regulate cell migration. Comparison of wild type and dDia1-null cells in random cell migration and chemotaxis toward a cAMP gradient revealed no major differences. By contrast, phototaxis of dDia1-deficient cells during the multicellular stage was markedly impaired. While wild type slugs moved with high directionality toward the light source, the trails of dDia1-null slugs displayed a characteristic V-shaped profile and deviated in angles between 50° and 60° from the path of the incident light. Possibly in conjunction with this defect, dDia1-null cells also formed substantially smaller fruiting bodies. These findings demonstrate dDia1 to be critically involved in collective cell migration

  17. [Consumption of fruits in an adult population from Costa Rica].

    PubMed

    Guzmán Padilla, Sonia; Roselló Araya, Marlene

    2002-03-01

    The consumption of fruits and it relation with the health and socioeconomic condition of an adult Costa Rican population is described. The study included a cross sectional and descriptive analysis in men and women 18 years old or older. Ten-house blocks were selected by affinity in a community or neighborhood in Cartago. Data were collected in a survey using home direct structured interviews carried out in the afternoons or during the weekend in February, 2000. Eighty percent of the 161 people interviewed were women. Results showed that the higher consumption of fruits was described in women who were older that 60 years old and, who proceed from a medium-high economic stratum or have a high schooling condition (2.3 +/- 1.0, 2.50 +/- 1.3 y 2.0 +/- 1.3 portions, respectively). No statistical significant difference was found in any of the variables evaluated. Data also showed that, in contrast with what it was expected, people that considered their health condition as bad, suffered chronic diseases, practiced physical exercise, took vitamin supplement or smoke, showed a higher consumption of fruits that those who do not have those conditions. The difference, however, showed to be no significant and the consumption of fruit showed to be not adequate in both groups. In conclusion, the amount and frequency of fruit consumption were inadequate in the population studied. The necessity of developing nutritional education strategies to promote a gradual increment in the consumption of fruits to approach the recommendation of the National Alimentary Guidelines is recommended.

  18. Basic limnology of fifty-one lakes in Costa Rica.

    PubMed

    Haberyan, Kurt A; Horn, Sally P; Umaña, Gerardo

    2003-03-01

    We visited 51 lakes in Costa Rica as part of a broad-based survey to document their physical and chemical characteristics and how these relate to the mode of formation and geographical distribution of the lakes. The four oxbow lakes were low in elevation and tended to be turbid, high in conductivity and CO2, but low in dissolved O2; one of these, L. Gandoca, had a hypolimnion essentially composed of sea water. These were similar to the four wetland lakes, but the latter instead had low conductivities and pH, and turbidity was often due to tannins rather than suspended sediments. The thirteen artificial lakes formed a very heterogenous group, whose features varied depending on local factors. The thirteen lakes dammed by landslides, lava flows, or lahars occurred in areas with steep slopes, and were more likely to be stratified than most other types of lakes. The eight lakes that occupy volcanic craters tended to be deep, stratified, clear, and cool; two of these, L. Hule and L. Río Cuarto, appeared to be oligomictic (tending toward meromictic). The nine glacial lakes, all located above 3440 m elevation near Cerro Chirripó, were clear, cold, dilute, and are probably polymictic. Cluster analysis resulted in three significant groups of lakes. Cluster 1 included four calcium-rich lakes (average 48 mg l-1), Cluster 2 included fourteen lakes with more Si than Ca+2 and higher Cl- than the other clusters, and Cluster 3 included the remaining thirty-three lakes that were generally less concentrated. Each cluster included lakes of various origins located in different geographical regions; these data indicate that, apart from the high-altitude glacial lakes and lakes in the Miravalles area, similarity in lake chemistry is independent of lake distribution.

  19. Organochlorine chemicals and neurodegeneration among elderly subjects in Costa Rica

    PubMed Central

    Mora, A.M.; Barr, D.B.; Juncos, J.; Roman, N.; Wesseling, C.

    2016-01-01

    Background We previously screened 400 elderly Costa Ricans for neurodegenerative disease. Those reporting occupational pesticide exposure (18%) had an increased Parkinson’s disease (PD) risk (OR 2.57, 95% CI 0.91–7.26), and worse cognition (Mini-Mental States Exam (MMSE) 24.5 versus 25.9 points, p=0.01). We subsequently measured long-lasting organochlorine pesticides (β-HCH, DDE, DDT, and dieldrin) in a sub-sample (n=89). Dieldrin and β-HCH have been linked to PD, and DDE to Alzheimer’s disease. Methods We ran regression models for MMSE and tremor-at-rest to assess associations with pesticides in 89 subjects. Results The percent of β-HCH, DDE, DDT (parent compound for DDE), and dieldrin above their limit of detection (LOD) were 100%, 93%, 75%, and 57%, respectively. Tremor-at-rest was found in 21 subjects, and the mean MMSE was 25. Those who reported occupational pesticide exposure (n=36) had more detectable dieldrin samples (p=0.005), and higher mean levels of dieldrin (p=0.01), than those not reporting exposure. Other pesticides did not differ between those with and without self-reported occupational exposure. There was a positive but non-significant trend of higher risk for tremor-at-rest with higher dieldrin (p=0.10 for linear trend). Neither DDE nor DDT showed a relationship with MMSE. However, after excluding two outliers with the lowest MMSE scores, higher DDT levels showed some modest association with lower MMSE (p=0.09 for linear trend). Conclusions Our data are limited by small sample size. However, dieldrin was high in our population, has been previously linked to PD, and could be partly responsible for the excess PD risk seen in our population. PMID:25173053

  20. Hematological survey of common neotropical bat species from Costa Rica.

    PubMed

    Schinnerl, Martin; Aydinonat, Denise; Schwarzenberger, Franz; Voigt, Christian C

    2011-09-01

    Although bats are one of the largest groups within the class Mammalia and may carry several zoonotic diseases, basic information about their hematology is limited. In this study, hematocrit (Hct), total white blood cell counts (TWBC; leukocytes), and differential white blood cell counts (DWBC) of free-ranging Neotropical bats were quantified. Blood samples from 255 bats representing 26 species from the families of Emballonuridae (3 species; 33 individuals), Molossidae (2 species; 26 individuals), Mormoopidae (1 species; 1 individual), Phyllostomidae (18 species; 180 individuals), and Vespertilionidae (2 species; 15 individuals) were collected in a Caribbean lowland rainforest of Costa Rica. Hct was measured after centrifugation of microhematocrit capillaries, TWBCs were performed using the Unopette system and a hemocytometer, and DWBCs were performed on eosin methylene blue stained blood films. Hct of bats ranged between 51.8 +/- 0.7% for Phyllostomus discolor (n = 27) and 65.8 +/- 2.2% for Molossus sinaloae (n = 6). Bat species of the same taxonomic family had comparable TWBCs; these were lower for insectivorous emballonurid, molossid, and vespertilionid bat species than for mostly phytophagous phyllostomid bat species. However, Ectophylla alba (Phyllostomidae) exhibited exceptionally low TWBCs (836 +/- 166 /microl; n = 10); this was less than half of the TWBCs of all other bat species, which ranged from 1,714 +/- 297/microl for Molossus bondae (n = 20) to 7,339 +/- 1,503/microl for Trachops cirrhosus (n = 6). Species with higher TWBCs tended to have lower Hct values. Overall, blood cell morphology was similar to other mammalian species. A large number of polychromatophilic erythrocytes and differences in lymphocyte morphology were noted. This study provides important hematological values for Neotropical bat species and significantly expands the knowledge on basal physiological measurements of Chiroptera.

  1. Forearc sedimentation in Terraba Trough, Costa Rica, Central America

    SciTech Connect

    Yuan, P.B.; Lowe, D.R.

    1987-05-01

    Sedimentary rocks of Terraba Trough, Costa Rica, were deposited in a forearc basin developed at an ocean-ocean convergent boundary. The basin developed in the middle to late Eocene when the Farallon plate began its subduction beneath the Caribbean plate. Shallow-water carbonates of the Brito Formation were deposited on shoals of basement blocks. These were surrounded by deeper marine areas in which volcaniclastics and carbonate debris accumulated. The Brito Formation consists of algal-foraminiferal packstone to grainstone, rudstone, and rare wackestone formed in fore-slope, carbonate buildup, and open platform environments in a warm, tropical sea. The Eocene Brito Formation is overlain by rocks of the upper Oligocene Rio Claro Member of the Terraba Formation. It is composed of rhodolite and bioclastic grainstone deposited in shallow water. A combination of little subsidence, mild volcanism, and possible erosion at about 30 Ma during a global drop of sea level may be responsible for the absence of lower Oligocene rocks in the study area. After the deposition of the Rio Claro Member, the area subsided rapidly to become a trough possibly deeper than 2000 m. Sedimentation took place in deep water from sediment gravity flows. In the early to early middle Miocene, coarser sediments and thicker sand units containing coal fragments became more abundant, suggesting that the basin was gradually filled. This study indicates that the timing and degree of subsidence of the fore-arc basin and the vertical variation in lithology are closely related to the variation in convergence rate between lithospheric plates in this part of Central America and the eastern Pacific.

  2. Fog deposition at a windward Costa Rican cloud forest site

    NASA Astrophysics Data System (ADS)

    Frumau, K. F. A.; Bruijnzeel, L. A.; Tobon-Marin, C.

    2010-07-01

    The hydrological importance of tropical montane cloud forests is recognized increasingly, mostly with respect to the additional water inputs provided by the capture of fog by the forest canopy compared to a non-forested situation (e.g. pasture) in the same environmental setting. The deposition of fog (interception) consists of two components, viz. advectional impaction against roughness elements in the landscape, and vertical settlement both by turbulent diffusion and by gravitational settling. Turbulent diffusion being a function of the aerodynamic roughness of the surface it is typically enhanced over forest compared to pasture. In windward montane areas fog often consists of stratus clouds being forced uphill with the cloud being "stripped" by roughness elements in the landscape. However, due to rain-generating processes these clouds rarely have fog-sized droplets only and larger drops are present as well. Under sufficiently strong wind speeds (e.g. in the trade-wind belt), drizzle-sized droplets tend to follow the terrain and behave like fog. Consequently, there is no unbiased manner in which to separate between fog and drizzle using conventional fog and rain gauges only. Similarly, hydrologically effective precipitation (inclined rainfall) is difficult to determine in mountainous areas, which complicates the determination of fog deposition using wet-canopy water budget approaches. The deposition of fog to a windward Costa Rican montane cloud forest was studied during a full hydrological year (between 1 July 2003 and 1 July 2004). Fog deposition was estimated from the wet canopy water budget as the difference between hydrologically effective precipitation and the sum of throughfall, stemflow, and interception loss. The results show that fog interception constituted a much smaller contribution at this site compared to wind-driven drizzle.

  3. Accretionary processes along the Middle America Trench off Costa Rica

    SciTech Connect

    Shipley, T.H.; Stoffa, P.L. ); McIntosh, K.; Silver, E.A. )

    1990-06-01

    The geometry of large-scale structures within modern accretionary prisms is known entirely from seismic reflection studies using single or grids of two-dimensional profiles. Off Costa Rica the authors collected a three-dimensional reflection data set covering a 9 km wide {times} 22 km long {times} 6 km thick volume of the accretionary prism just arcward of the Middle America Trench. The three-dimensional processing and ability to examine the prism as a volume has provided the means to map structures from a few hundred meters to kilometers in size with confidence. Reflections from within the prism define the gross structural features and tectonic processes active along this particular portion of the Middle America Trench. So far in the analysis, these data illustrate the relationships between the basement, the prism shape, and overlying slope sedimentary deposits. For instance, the subducted basement relief (of several hundred meters amplitude) does seem to affect the larger scale through-going faults within the prism. Offscraping of the uppermost 45 m of sediments occurs within 4 km of the trench creating a small pile of sediments at the base of the trench. How this offscraped sediment is incorporated into the prism is still being investigated. Underplating of parts of the 400 m thick subducted section begin: at a very shallow structural level, 4 to 10 km arcward of the trench. Amplitude anomalies associated with some of the larger arcward dipping structures in the prism and surface mud volcanoes suggest that efficient fluid migration paths may extend from the top of the downgoing slab at the shelf edge out into the lower and middle slope region, a distance of 50 to 100 km.

  4. Measuring Gases Using Drones at Turrialba Volcano, Costa Rica

    NASA Astrophysics Data System (ADS)

    Stix, J.; Alan, A., Jr.; Corrales, E.; D'Arcy, F.; de Moor, M. J.; Diaz, J. A.

    2016-12-01

    We are currently developing a series of drones and associated instrumentation to study Turrialba volcano in Costa Rica. This volcano has shown increasing activity during the last 20 years, and the volcano is currently in a state of heightened unrest as exemplified by recent explosive activity in May-August 2016. The eruptive activity has made the summit area inaccessible to normal gas monitoring activities, prompting development of new techniques to measure gas compositions. We have been using two drones, a DJI Spreading Wings S1000 octocopter and a Turbo Ace Matrix-i quadcopter, to airlift a series of instruments to measure volcanic gases in the plume of the volcano. These instruments comprise optical and electrochemical sensors to measure CO2, SO2, and H2S concentrations which are considered the most significant species to help forecast explosive eruptions and determine the relative proportions of magmatic and hydrothermal components in the volcanic gas. Additionally, cameras and sensors to measure air temperature, relative humidity, atmospheric pressure, and GPS location are included in the package to provide meteorological and geo-referenced information to complement the concentration data and provide a better picture of the volcano from a remote location. The integrated payloads weigh 1-2 kg, which can typically be flown by the drones in 10-20 minutes at altitudes of 2000-4000 meters. Preliminary tests at Turrialba in May 2016 have been very encouraging, and we are in the process of refining both the drones and the instrumentation packages for future flights. Our broader goals are to map gases in detail with the drones in order to make flux measurements of each species, and to apply this approach at other volcanoes.

  5. Studies of fluid flow indicators, Pacific margin of Costa Rica

    SciTech Connect

    Silver, E.; McAdoo, B. ); Langseth, M. ); Orange, D. )

    1996-01-01

    Seismic reflection profiles off Costa Rica image a decrease in thickness of the underthrust sedimentary section from the Middle America Trench, implying a significant reduction of porosity in the outer 3-5 km from the trench and a source of vent water through the wedge. We encountered no evidence of discrete fluid venting over the outer 3-5 km of this margin from dives using the ALVIN submersible or from heat flow measurements (based on absence of chemosynthetic vent communities and heat flow anomalies in this zone). Vent communities occur farther upslope, associated with a series of out-of-sequence thrusts, with two mud diapirs, and a mid-slope canyon. We infer that fracture permeability dominates in the out-of-sequence thrusts, upflow of fluid-rich muds in the diapir, and focusing of fluid flow in the canyon. Over 100 heat flow observations on the wedge and incoming COCOS plate showed a broad area of anomalously low heat flow (13 mW/m[sup 2]) seaward of the frontal thrust, whereas the expected heat flow for ocean crust of early Miocene age is seven times greater. The very low regional heat flow may reflect refrigeration by vigorous sea water flow through the upper crust pillow basalts. Heat flow increases to about 30 mW/m[sup 2] throughout the lower slope to mid-slope, implying a combination of widespread fluid venting, reheating of the cooled crust and frictional heating at the base of the wedge. The lack of discrete vents over the outer 3-5 km of the margin indicates diffuse flow and likely temporal episodicity, as this region has been aseismic since 1950.

  6. Studies of fluid flow indicators, Pacific margin of Costa Rica

    SciTech Connect

    Silver, E.; McAdoo, B.; Langseth, M.; Orange, D.

    1996-12-31

    Seismic reflection profiles off Costa Rica image a decrease in thickness of the underthrust sedimentary section from the Middle America Trench, implying a significant reduction of porosity in the outer 3-5 km from the trench and a source of vent water through the wedge. We encountered no evidence of discrete fluid venting over the outer 3-5 km of this margin from dives using the ALVIN submersible or from heat flow measurements (based on absence of chemosynthetic vent communities and heat flow anomalies in this zone). Vent communities occur farther upslope, associated with a series of out-of-sequence thrusts, with two mud diapirs, and a mid-slope canyon. We infer that fracture permeability dominates in the out-of-sequence thrusts, upflow of fluid-rich muds in the diapir, and focusing of fluid flow in the canyon. Over 100 heat flow observations on the wedge and incoming COCOS plate showed a broad area of anomalously low heat flow (13 mW/m{sup 2}) seaward of the frontal thrust, whereas the expected heat flow for ocean crust of early Miocene age is seven times greater. The very low regional heat flow may reflect refrigeration by vigorous sea water flow through the upper crust pillow basalts. Heat flow increases to about 30 mW/m{sup 2} throughout the lower slope to mid-slope, implying a combination of widespread fluid venting, reheating of the cooled crust and frictional heating at the base of the wedge. The lack of discrete vents over the outer 3-5 km of the margin indicates diffuse flow and likely temporal episodicity, as this region has been aseismic since 1950.

  7. Review of the Blastobasinae of Costa Rica (Lepidoptera: Gelechioidea: Blastobasidae).

    PubMed

    Adamski, David

    2013-02-25

    The Blastobasinae (Lepidoptera: Gelechioidea: Blastobasidae) of Costa Rica are reviewed. Five new genera, Barbaloba, Hallicis, Koleps, Pheos, and Pseudokoleps, and 101 new species are described. They include: Barbaloba jubae, B. meleagrisellae, Hallicis bisetosellus, H. calvicula, Koleps angulatus, Pheos aculeatus, Pseudokoleps akainae, Blastobasis abollae, B. achaea, B. aedes, B. babae, B. balucis, B. beo, B. caetrae, B. chanes, B. custodis, B. dapis, B. deae, B. deliciolarum, B. dicionis, B. echus, B. erae, B. fax, B. furtivus, B. iuanae, B. lex, B. litis, B. lygdi, B. manto, B. neniae, B. nivis, B. orithyia, B. paludis, B. phaedra, B. rotae, B. rotullae, B. tapetae, B. thyone, B. usurae, B. vesta, B. xiphiae, Hypatopa actes, H. acus, H. agnae, H. arxcis, H. bilobata, H. caedis, H. caepae, H. cladis, H. cotis, H. cotytto, H. crux, H. cyane, H. dicax, H. dolo, H. dux, H. edax, H. eos, H. erato, H. fio, H. gena, H. hecate, H. hera, H. hora, H. io, H. ira, H. leda, H. limae, H. lucina, H. joniella, H. juno, H. manus, H. mora, H. musa, H. nex, H. nox, H. phoebe, H. pica, H. plebis, H. rabio, H. rea, H. rego, H. rudis, H. sais, H. scobis, H. semela, H. solea, H. styga, H. texla, H. texo, H. umbra, H. verax, H. vitis, H. vox, Pigritia dido, P. faux, P. gruis, P. haha, P. sedis, P. stips, and P. ululae. Diagnoses, descriptions, and type data are provided for each species. Photographs of imagos, illustrations of wing venation for selected species, male and female genitalia, and distribution maps are furnished. Keys to all genera in Blastobasinae and keys to all species within each genus are provided to assist with identifications. In addition, scanning electron micrographs of the inner surface of the dilated first antennal flagellomere and associated sex scales for all Blastobasis are provided. Blastobasis coffeaella (Busck, 1925), B. graminea Adamski, 1999, Hypatopa tapadulcea Adamski, 1999, and Pigritia marjoriella Adamski, 1998 are redescribed.

  8. Accumulation of atmospheric sulfur in some Costa Rican soils

    USGS Publications Warehouse

    Bern, Carleton R.; Townsend, Alan R.

    2013-01-01

    Sulfur is one of the macronutrient elements whose sources to terrestrial ecosystems should shift from dominance by rock-weathering to atmospheric deposition as soils and underlying substrate undergo progressive weathering and leaching. However, the nature and timing of this transition is not well known. We investigated sources of sulfur to tropical rain forests growing on basalt-derived soils in the Osa Peninsula region of Costa Rica. Sulfur sources were examined using stable isotope ratios (δ34S) and compared to chemical indices of soil development. The most weathered soils, and the forests they supported, are dominated by atmospheric sulfur, while a less weathered soil type contains both rock-derived and atmospheric sulfur. Patterns of increasing δ34S with increasing soil sulfur concentration across the landscape suggest atmospheric sulfur is accumulating, and little rock-derived sulfur has been retained. Soil sulfur, minus adsorbed sulfate, is correlated with carbon and nitrogen, implying that sulfur accumulation occurs as plants and microbes incorporate sulfur into organic matter. Only the lower depth increments of the more weathered soils contained significant adsorbed sulfate. The evidence suggests a pattern of soil development in which sulfur-bearing minerals in rock, such as sulfides, weather early relative to other minerals, and the released sulfate is leached away. Sulfur added via atmospheric deposition is retained as organic matter accumulates in the soil profile. Adsorbed sulfate accumulates later, driven by changes in soil chemistry and mineralogy. These aspects of sulfur behavior during pedogenesis in this environment may hasten the transition to dominance by atmospheric sources.

  9. Transcriptional Switch of the dia1 and impA Promoter during the Growth/Differentiation Transition

    PubMed Central

    Hirose, Shigenori; Mayanagi, Taira; Pears, Catherine; Amagai, Aiko; Loomis, William F.; Maeda, Yasuo

    2005-01-01

    When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition. PMID:16087752

  10. T cell responses in mammalian diaphanous-related formin mDia1 knock-out mice.

    PubMed

    Eisenmann, Kathryn M; West, Richard A; Hildebrand, Dagmar; Kitchen, Susan M; Peng, Jun; Sigler, Robert; Zhang, Jinyi; Siminovitch, Katherine A; Alberts, Arthur S

    2007-08-24

    Activated T cells rapidly assemble filamentous (F-) actin networks in response to ligation of the T cell receptor or upon interaction with adhesive stimuli in order to facilitate cell migration and the formation of the immune synapse. Branched filament assembly is crucial for this process and is dependent upon activation of the Arp2/3 complex by the actin nucleation-promoting factor Wiskott-Aldrich Syndrome protein (WASp). Genetic disruption of the WAS gene has been linked to hematopoietic malignancies and various cytopenias. Although the contributions of WASp and Arp2/3 to T cell responses are fairly well characterized, the role of the mammalian Diaphanous (mDia)-related formins, which both nucleate and processively elongate non-branched F-actin, has not been demonstrated. Here, we report the effects on T cell development and function following the knock out of the murine Drf1 gene encoding the canonical formin p140mDia1. Drf1(-/-) mice develop lymphopenia characterized by diminished T cell populations in lymphoid tissues. Consistent with a role for p140mDia1 in the regulation of the actin cytoskeleton, isolated Drf1(-/-) splenic T cells adhered poorly to extracellular matrix proteins and migration in response to chemotactic stimuli was completely abrogated. Both integrin and chemokine receptor expression was unaffected by Drf1(-/-) targeting. In response to proliferative stimuli, both thymic and splenic Drf1(-/-) T cells failed to proliferate; ERK1/2 activation was also diminished in activated Drf1(-/-) T cells. These data suggest a central role for p140mDia1 in vivo in dynamic cytoskeletal remodeling events driving normal T cell responses.

  11. Development of an 8-ft-dia ribbon parachute for recovery of a test device at transonic speeds

    SciTech Connect

    Pepper, W.B.

    1984-01-01

    A lightweight hybrid Kevlar-29/nylon 8-ft-dia ribbon parachute has been designed and developed for recovery of a cluster of three Zuni rockets with a spin-up canister weighing 266 lb at deployment. The parachute is reefed for two seconds by a 9-ft-long reefing line to limit the peak loads. Successful recoveries have been achieved from 700-1300 ft/sec deployment velocities.

  12. Distinct roles for the actin nucleators Arp2/3 and hDia1 during NK-mediated cytotoxicity

    PubMed Central

    Butler, Boyd; Cooper, John A.

    2010-01-01

    Background Several actin nucleators, including Arp2/3 and various formins, control numerous cytoskeletal-based functions in vivo. Results We investigated the relative roles of these nucleators. As a model system, we used natural killer (NK) lymphocytes, which display a wide range of cytoskeletal-based functions that culminate in the lysis of target cells. NK cells lacking either Arp2/3 or the formin hDia1 were ineffective in target cell lysis, but for distinct reasons. Loss of Arp2/3 function led to defects in cells adhesion and actin assembly at the junction with the target cell (the lytic synapse). In contrast, loss of hDia1 did not disrupt actin assembly at the lytic synapse. Instead, loss of hDia1 led to perturbations in the microtubule cytoskeleton, including the targeting of microtubules to the lytic synapse. Conclusions These studies reveal novel distinctions and relationships among the functions of Arp2/3, formins and microtubules in cells. Notably, a formin mediates the capture of microtubules at the cell periphery. PMID:19913427

  13. Geochemical Atlas of the San Jose and Golfito quadrangles, Costa Rica. Atlas Geoquimico de los cuadrangulos de San Jose y Golfito, Costa Rica

    SciTech Connect

    Not Available

    1987-07-01

    The Geochemical Atlas of the San Jose and Golfito 1:200,000-scale quadrangles, Costa Rica, was produced to help stimulate the growth of the Costa Rican mining industry and, thus, to benefit the economy of the country. As a result of the geochemical data presented in the Atlas, future exploration for metallic minerals in Costa Rica can be focused on specific areas that have the highest potential for mineralization. Stream-sediment samples were collected from drainage basins within the two quadrangles. These samples were analyzed for 50 elements and the results were displayed as computer-generated color maps. Each map shows the variation in abundance of a single element within the quadrangle. Basic statistics, geological and cultural data are included as insets in each map to assist in interpretation. In the Golfito quadrangle, the geochemical data do not clearly indicate undiscovered gold mineralization. The areas known to contain placer (alluvial) gold are heavily affected by mining activity. Statistical treatment of the geochemical data is necessary before it will be possible to determine the gold potential of this quadrangle. In San Jose quadrangle, gold and the pathfinder elements, arsenic and antimony, are indicators of the gold mineralization characteristic of the Costa Rican gold district located in the Tilaran-Montes del Aguacate Range. This work shows that high concentrations of these elements occur in samples collected downstream from active gold mines. More importantly, the high concentrations of gold, arsenic, and antimony in sediment samples from an area southeast of the known gold district suggest a previously unknown extension of the district. This postulated extension underlain by Tertiary volcanic rocks which host the gold deposits within the gold district. The geochemical data, displayed herein, also indicate that drainage basins north of Ciudad Quesada on the flanks of Volcan Platanar have high gold potential.

  14. Sediment transport and deposition, Walnut and Pacheco Creeks, Contra Costa County, California, August 1965-April 1970

    USGS Publications Warehouse

    Porterfield, George

    1972-01-01

    Average annual sediment discharge in Pacheco Creek basin, Contra Costa County, Calif., was larger during August 1965-April 1970 than the historical annual sediment discharge (1909-62) by a factor of about 1.3. This increas in sediment discharge is attributed primarily to an increased frequency of peak streamflows and to a larger average annual streamflow during the 1965-70 period.

  15. Peace Education: Perspectives from Costa Rica and Japan. Peace Education Miniprints No. 62.

    ERIC Educational Resources Information Center

    Brenes, Abelardo; Ito, Takehiko

    This publication explores the views of two present members of the International Peace Research Association: Abelardo Brenes and Takehiko Ito. Brenes and Ito answer 13 questions related to peace education issues in their individual interviews. Abelardo Brenes is a professor at the University of Costa Rica and a consultant to the University for…

  16. Do birds select habitat or food resources? Nearctic-neotropic migrants in northeastern Costa Rica

    Treesearch

    Jared D. Wolfe; Matthew D. Johnson; C. John Ralph; R. Mark Brigham

    2014-01-01

    Nearctic-neotropic migrant birds need to replenish energy reserves during stopover periods to successfully complete their semiannual movements. In this study we used linear models to examine the habitat use of 11 migrant species in northeastern Costa Rica to better understand the influence of food and structural resources on the presence of birds during stopover...

  17. Breeding seasons, molt patterns, and gender and age criteria for selected northeastern Costa Rican resident landbirds

    Treesearch

    Jared D. Wolfe; Peter Pyle; C. John. Ralph

    2009-01-01

    Detailed accounts of molt and breeding cycles remain elusive for the majority of resident tropical bird species. We used data derived from a museum review and 12 years of banding data to infer breeding seasonality, molt patterns, and age and gender criteria for 27 common landbird species in northeastern Costa Rica. Prealternate molts appear to be rare, only occurring...

  18. A Preliminary Study of Riparian Songbirds in Costa Rica, with Emphasis on Wintering Louisiana Waterthrushes

    Treesearch

    Terry L. Master; Robert S. Mulvihill; Robert C. Leberman; Julio Sanchez; Ernesto Carmen

    2005-01-01

    We made preliminary observations on the winter distribution, ecology and behavior of Louisiana Waterthrushes (Seiurus motacilla) in Costa Rica during January 1999 and 2000. We visited 24 headwater streams in three of the four principal mountain ranges in the country (Cordilleras Tilarán, Central, and the Talamanca) and confirmed the...

  19. Influenza-associated Hospitalizations and Deaths, Costa Rica, 2009–2012

    PubMed Central

    Saborío, Guiselle Guzman; Clara, Alexey; Garcia, Antonio; Quesada, Fabio; Palekar, Rakhee; Minaya, Percy; Cervantes, Marvin; Lopez, Mariel; Lara, Jenny; Jara, Jorge; Blanco, Natalia; Bresee, Joseph; Widdowson, Marc-Alain; Azziz-Baumgartner, Eduardo

    2014-01-01

    Data needed to guide influenza vaccine policies are lacking in tropical countries. We multiplied the number of severe acute respiratory infections by the proportion testing positive for influenza. There were ≈6,699 influenza hospitalizations and 803 deaths in Costa Rica during 2009–2012, supporting continuation of a national influenza vaccine program. PMID:24750897

  20. Computer Assisted English Language Learning in Costa Rican Elementary Schools: An Experimental Study

    ERIC Educational Resources Information Center

    Alvarez-Marinelli, Horacio; Blanco, Marta; Lara-Alecio, Rafael; Irby, Beverly J.; Tong, Fuhui; Stanley, Katherine; Fan, Yinan

    2016-01-01

    This study presents first-year findings of a 25-week longitudinal project derived from a two-year longitudinal randomized trial study at the elementary school level in Costa Rica on effective computer-assisted language learning (CALL) approaches in an English as a foreign language (EFL) setting. A pre-test-post-test experimental group design was…

  1. Environmental Education in Costa Rica: Building a Framework for Sustainable Development?

    ERIC Educational Resources Information Center

    Blum, Nicole

    2008-01-01

    Environmental education is commonly claimed to be at the centre of efforts to achieve sustainable development. Since the 1980s, Costa Rica has been one of the acknowledged leaders in efforts to promote environmental learning, and national policy includes a three-fold national development strategy which simultaneously promotes education,…

  2. Differential DNA methylation and lymphocyte proportions in a Costa Rican high longevity region.

    PubMed

    McEwen, Lisa M; Morin, Alexander M; Edgar, Rachel D; MacIsaac, Julia L; Jones, Meaghan J; Dow, William H; Rosero-Bixby, Luis; Kobor, Michael S; Rehkopf, David H

    2017-01-01

    The Nicoya Peninsula in Costa Rica has one of the highest old-age life expectancies in the world, but the underlying biological mechanisms of this longevity are not well understood. As DNA methylation is hypothesized to be a component of biological aging, we focused on this malleable epigenetic mark to determine its association with current residence in Nicoya versus elsewhere in Costa Rica. Examining a population's unique DNA methylation pattern allows us to differentiate hallmarks of longevity from individual stochastic variation. These differences may be characteristic of a combination of social, biological, and environmental contexts. In a cross-sectional subsample of the Costa Rican Longevity and Healthy Aging Study, we compared whole blood DNA methylation profiles of residents from Nicoya (n = 48) and non-Nicoya (other Costa Rican regions, n = 47) using the Infinium HumanMethylation450 microarray. We observed a number of differences that may be markers of delayed aging, such as bioinformatically derived differential CD8+ T cell proportions. Additionally, both site- and region-specific analyses revealed DNA methylation patterns unique to Nicoyans. We also observed lower overall variability in DNA methylation in the Nicoyan population, another hallmark of younger biological age. Nicoyans represent an interesting group of individuals who may possess unique immune cell proportions as well as distinct differences in their epigenome, at the level of DNA methylation.

  3. Partial power, partial knowledge: accounting for the dis-integration of a Costa Rican cooperative

    Treesearch

    Susannah R. McCandless; Marla R. Emery

    2008-01-01

    Drawing on the writings of Foucault, we argue that the multiple-service cooperative at the core of a Costa Rican highland municipality failed due to an incomplete transformation from sovereign to governmental regimes at the regional scale. The cooperative challenged sovereign power, held by the local patron and private biological reserves, with a governance model based...

  4. Newly discovered natural hosts of tomato chlorosis virus in Costa Rica

    USDA-ARS?s Scientific Manuscript database

    Tomato chlorosis virus (ToCV) is an emerging whitefly-transmitted crinivirus. ToCV was detected in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica in 2007, causing symptoms of severe yellowing and foliar chlorosis. To identify alternative hosts that may serve as viru...

  5. Mites (Arachnida: Acari) inhabiting coffee domatia: a short review and recent findings from Costa Rica.

    USDA-ARS?s Scientific Manuscript database

    Six previously unreported domatia-inhabiting mites are reported from Coffea arabica accessions planted in Costa Rica. One of these is a new species of Asca found to be carrying fungal spores on its cuticle. A review of the literature on mites in coffee domatia is presented....

  6. Evaluating bee (Hymenoptera: Apoidea) diversity using malaise traps in coffee landscapes of Costa Rica

    USDA-ARS?s Scientific Manuscript database

    Even though Arabica coffee (Coffea arabica Linnaeus, Rubiaceae) can self-pollinate, bees are important pollinators, without which there is lower fruit quality and yield. We studied bee diversity in coffee agroecosystems in Costa Rica during two coffee flowering seasons (2005 and 2006). Malaise traps...

  7. BIOGENIC VOLATILE ORGANIC COMPOUND EMISSIONS FROM A LOWLAND TROPICAL WET FOREST IN COSTA RICA

    EPA Science Inventory

    Twenty common plant species were screened for emissions of biogenic volatile organic compounds (BVOCS) at a lowland tropical wet forest site in Costa Rica. Ten of the species. examined emitted substantial quantities of isoprene. These species accounted for 35-50% of the total bas...

  8. Lecto- and Paralectotype Designations and Redescription of Arachnocoris alboannulatus Costa Lima, 1927 (Hemiptera: Heteroptera: Nabidae)

    Treesearch

    Thaynara S. Martins; Felipe F. F. Moreira; Javier E. Mercado; Jorge A. Santiago-Blay

    2016-01-01

    The lecto- and a paralectotype of Arachnocoris alboannulatus Costa Lima, 1927 are designated to enhance nomenclatural stability. A redescription based on the type material from Rio de Janeiro deposited in the Entomological Collection of the Oswaldo Cruz Institute, Brazil, is presented. Specimens are illustrated and measured in detail for the first time.

  9. Educational Leadership for Social Justice in Costa Rica, Mexico, and Spain

    ERIC Educational Resources Information Center

    Silva, Patricia; Slater, Charles L.; Lopez Gorosave, Gema; Cerdas, Victoria; Torres, Nancy; Antunez, Serafin; Briceno, Fernando

    2017-01-01

    Purpose: The purpose of this paper is to examine the role of school leaders to provide social justice in three contexts: Costa Rica, Mexico, and Spain. Design/methodology/approach: A qualitative study was conducted under the interpretative tradition characterized by a search for an understanding of the social world from the point of view of a…

  10. An overview of a landbird monitoring program at Tortuguero, on the Caribbean coast of Costa Rica

    Treesearch

    C. John Ralph; Margaret J. Widdowson; Robert I. Frey; Pablo A. Herrera; Brian P. O' Donnell

    2005-01-01

    Since 1994, the Tortuguero Integrated Bird Monitoring Program has been monitoring birds in a coastal lowland rain forest of northeast Costa Rica. The Program has combined the use of area searches, constanteffort mist netting, and migration counts into a longterm landbird monitoring and training program following the recommendations of the Partners In Flight &ndash...

  11. Learning through Participatory Resource Management Programs: Case Studies from Costa Rica

    ERIC Educational Resources Information Center

    Sims, Laura; Sinclair, A. John

    2008-01-01

    Based on an ongoing qualitative case study in Costa Rica, this article presents the participatory work that the Instituto Costarricense de Electricidad (ICE) is doing with farmers to protect watersheds from erosion and contamination. Specifically, it includes a description of ICE's Watershed Management Agricultural Programme and how farmers…

  12. Wood anatomy of Pleodendron costaricense (Canellaceae) from Southern Pacific, Costa Rica

    Treesearch

    Roger Moya Roque; Manuel Morales Salazar; Michael C. Wiemann; Luis Poveda Alvarez

    2007-01-01

    Pleodendron costaricense N. Zamora, Hammel & R. Aguilar (Canellaceae) is an endemic species from the southern Pacific region of Costa Rica. It is rare and is considered to be a living fossil. The wood of P. costaricense has high density (0.92 Kg/cm3, air dry) with little distinction between heartwood and sapwood. The growth rings are marked...

  13. Pleistocene plant fossils in and near La Selva Biological Station, Costa Rica

    Treesearch

    Sally P. Horn; Robert L. Sanford; David Dilcher; Terry A. Lott; Paul R. Renne; Michael C. Wiemann; Duane Cozadd; Orlando Vargas

    2003-01-01

    Radiocarbon dating and 40 Ar/39Ar analysis of overlying tephra indicate that plant fossil assemblages exposed by stream erosion and well construction in and near La Selva Biological Station in eastern lowland Costa Rica are Pleistocene in age. We identified plant taxa based on wood, leaves, fruits, seeds, pollen, and spores examined from three sites at ca 30 m...

  14. An Analysis of Retention and Attrition at MiraCosta College.

    ERIC Educational Resources Information Center

    Baker, Ronald

    A study was conducted at MiraCosta College (MCC), in Del Mar, California, to investigate various aspects of retention and attrition and to make recommendations for possible program enhancements. The study sought to determine when students drop out of classes, which students drop out of school completely, and the drop out rate for various…

  15. Diary of an Edu-Tourist in Costa Rica: An Autoethnographical Account of Learning Spanish

    ERIC Educational Resources Information Center

    Lotherington, Heather

    2007-01-01

    This article presents an autoethnographical account of my foray into Spanish immersion education in Costa Rica as a professor of multilingual education at a university in Canada. This language-learning journey was inspired by curiosity about the growing trend for Internet marketing of second-language learning as a form of tourism, which I label…

  16. An Analysis of the Public Feeder High Schools in the MiraCosta Community College District.

    ERIC Educational Resources Information Center

    Baker, Ronald

    A study was conducted to analyze the enrollment patterns of high school seniors from the eight public feeder high schools in the MiraCosta Community College (MCC) District. Using the California Community Colleges Student Data System and information obtained from the County Department of Education and each feeder high school, the study examined the…

  17. Science Achievement of Costa Rican Sixth Grade Students and Its Relationship with Selected Variables.

    ERIC Educational Resources Information Center

    Esquivel-Alfaro, Juan Manuel; Diaz-Solis, Sofia Maria

    This study had three purposes. First, to develop and validate a criterion-referenced test to measure science knowledge of students who finished the second cycle of the Basic General Education (6th grade). Second, to assess the performance of the entire Costa Rican population of sixth graders and, third, to analyze the results according to some…

  18. The Power To Change: The Experience of the Costa Atlantica Project in Colombia (1977-1989).

    ERIC Educational Resources Information Center

    Chetley, Andrew

    In 1977, the Bernard van Leer Foundation began supporting a project in Colombia that had the objective of improving the quality of early childhood care and education in a small village. The Costa Atlantica project offered an approach to development that was based on community organization, social management, participation, cooperation, popular…

  19. Hunger in the Midst of Affluence: Task Force Combats Hunger in Contra Costa County.

    ERIC Educational Resources Information Center

    Fujii, Mary Lavender

    1994-01-01

    Research conducted by the Hunger Task Force in Contra Costa County (California) revealed a significant increase in the number of families, especially with young children, who live in poverty and who are going hungry. A food stamp outreach program, a countywide school breakfast program, and food distribution programs have been initiated. (LP)

  20. First Report of Tomato Chlorosis Virus in Tomato in Costa Rica

    USDA-ARS?s Scientific Manuscript database

    In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. The symptoms resembled those of the genus Crinivirus (family Closteroviridae) and large populations of whiteflies were observed in the fields and...

  1. A new species of Cyllopsis (Lepidoptera: Nymphalidae: Satyrinae) from Costa Rica.

    PubMed

    Chacón, Isidro; Nishida, Kenji

    2002-06-01

    Cyllopsis emilia Chacón and Nishida, a new satyrine species, is described from a single male specimen from Cerro de la Muerte, San José, Costa Rica. This new species can be distinguished from other species of Cyllopsis by its white coloration.

  2. First North American record of the Palearctic Microplax albofasciata (Costa) (Hemiptera: Lygaeoidea: Oxycarenidae)

    USDA-ARS?s Scientific Manuscript database

    Microplax albofasciata (Costa), a Palearctic (mainly Mediterranean) species of the small family Oxycarenidae, is reported from California as the first record for the New World. Adults of this little-known lygaeoid bug were found in 2012 and 2013 at the Hastings Natural History Reservation in norther...

  3. Learning through Participatory Resource Management Programs: Case Studies from Costa Rica

    ERIC Educational Resources Information Center

    Sims, Laura; Sinclair, A. John

    2008-01-01

    Based on an ongoing qualitative case study in Costa Rica, this article presents the participatory work that the Instituto Costarricense de Electricidad (ICE) is doing with farmers to protect watersheds from erosion and contamination. Specifically, it includes a description of ICE's Watershed Management Agricultural Programme and how farmers…

  4. Diet of some spring migrant landbirds on the Caribbean coast of Costa Rica

    Treesearch

    Jared D. Wolfe

    2009-01-01

    Spring dietary patterns of migrants in tropical latitudes are largely unknown. Here I present diet data derived from an analysis of fecal samples for six migrant landbird species during spring migration along the Caribbean coast of Costa Rica. High levels of insectivory were detected for all six species captured. The nature of the data presented is discussed in light...

  5. A new species of Erythrodiplax breeding in bromeliads in Costa Rica (Odonata: Libellulidae).

    PubMed

    Haber, William A; Wagner, David L; De La Rosa, Carlos

    2015-04-16

    We describe a new species, Erythrodiplax laselva (Libellulidae), that breeds in bromeliads and Cochliostema (Commelinaceae) in the eastern lowlands of Costa Rica. The closest known relative is thought to be E. castanea, widespread in Central and South America, and not E. bromeliicola, which is known to breed in bromeliads in Cuba and Jamaica. The male, female, genitalia, and larva are described and illustrated.

  6. Management commitments and primary care: another lesson from Costa Rica for the world?

    PubMed

    Soors, Werner; De Paepe, Pierre; Unger, Jean-Pierre

    2014-01-01

    Maintained dedication to primary care has fostered a public health delivery system with exceptional outcomes in Costa Rica. For more than a decade, management commitments have been part of Costa Rican health reform. We assessed the effect of the Costa Rican management commitments on access and quality of care and on compliance with their intended objectives. We constructed seven hypotheses on opinions of primary care providers. Through a mixed qualitative and quantitative approach, we tested these hypotheses and interpreted the research findings. Management commitments consume an excessive proportion of consultation time, inflate recordkeeping, reduce comprehensiveness in primary care consultations, and induce a disproportionate consumption of hospital emergency services. Their formulation relies on norms in need of optimization, their control on unreliable sources. They also affect professionalism. In Costa Rica, management commitments negatively affect access and quality of care and pose a threat to the public service delivery system. The failures of this pay-for-performance-like initiative in an otherwise well-performing health system cast doubts on the appropriateness of pay-for-performance for health systems strengthening in less advanced environments.

  7. Dying with AIDS in Costa Rica. Access to care and treatment.

    PubMed

    Stern, R

    1997-01-01

    Costa Rica, with a population of 3 million people, has approximately 1200 cumulative diagnosed cases of AIDS. 70% of AIDS cases in the country have been among gay men. About 500 people with AIDS (PWA) are still alive and it is estimated that just as many people may be asymptomatic carriers of HIV. At the cost of $800-1000 per month per person, approximately 700,000 people, mostly in the US and Europe, are being treated with combination drug therapy capable of managing AIDS as a fairly curable chronic illness. However, most people in Costa Rica, where the per capita annual income is $2500, cannot afford to pay for such therapy. Arguing that the drugs are too expensive, the government has not approved any of the retroviral medications for general use in its socialized medical system which otherwise guarantees appropriate medical treatment to its citizens. The pharmaceutical companies which distribute the medications in Costa Rica, Roche and Bristol Meyers, refuse to provide patients with either free or significantly discounted drugs. The author discusses social discrimination against gay people in Costa Rica and describes attempts made to negotiate drug supplies for PWA with the government and pharmaceutical companies.

  8. Situation Reports--Ceylon, Costa Rica, Ghana, Haiti, Morocco, Sudan, Tunisia, and U.S.A.

    ERIC Educational Resources Information Center

    International Planned Parenthood Federation, London (England).

    Data relating to population and family planning in eight countries are presented in these situation reports. Countries included are Ceylon, Costa Rica, Ghana, Haiti, Morocco, Sudan, Tunisia, and the United States of America. Information is provided under two topics, general background and family planning situation, where appropriate and if it is…

  9. Insurance and other socioeconomic determinants of elderly longevity in a Costa Rican panel.

    PubMed

    Rosero-Bixby, Luis; Dow, William H; Laclé, Adriana

    2005-11-01

    Official figures show that life expectancy in Costa Rica is longer than in the United States (US), in spite of the fact that per capita health expenditure is only one-tenth that of the US. To check whether this is for real and to explore some of its determinants, 900 Costa Ricans aged 60+ were followed from 1984 to 2001. Follow-up household visits were made, deaths were tracked in the national death registry, and survival status in the voting registry was double-checked. In addition, the survivors were contacted in 2002. Two-thirds of the panel had died by December 2001. Kaplan-Meier curves, life tables and Cox regression were used to analyse the panel's survival. Mortality in the panel was slightly higher than the Costa Rican average and similar to that in the US, confirming the exceptional longevity of Costa Ricans. Survival was substantially lower among unmarried men and individuals with limited autonomy at the beginning of the study. The effect of socioeconomic status is weak. Insurance effects seem to be confounded by selection biases.

  10. The Power To Change: The Experience of the Costa Atlantica Project in Colombia (1977-1989).

    ERIC Educational Resources Information Center

    Chetley, Andrew

    In 1977, the Bernard van Leer Foundation began supporting a project in Colombia that had the objective of improving the quality of early childhood care and education in a small village. The Costa Atlantica project offered an approach to development that was based on community organization, social management, participation, cooperation, popular…

  11. Music Education for Social Change in the Secondary Public Schools of Costa Rica

    ERIC Educational Resources Information Center

    Rosabal-Coto, Guillermo

    2010-01-01

    This article focuses on a recently implemented general music curriculum in secondary public schools, whose main goal is to address social issues in Costa Rica. The author describes and discusses its context, rationale, theoretical tenets, and proposed practices with the purpose of advancing theory-practice reflection on music education practices…

  12. First report of Tomato chlorosis virus infecting sweet pepper in Costa Rica

    USDA-ARS?s Scientific Manuscript database

    In September 2008, a survey of whiteflies and whitefly-borne viruses was performed in greenhouses in the province of Cartago, Costa Rica. During this survey, sweet pepper (Capsicum annuum cv. Nataly) plants showing interveinal chlorosis, enations, necrosis, and mild upward leaf curling were observed...

  13. A Historical Analysis of the Educational Modalities of Inequalities Management in Costa Rica, Cuba and Guatemala

    ERIC Educational Resources Information Center

    Mulot, Eric

    2004-01-01

    This article provides a historical and comparative study of the role that management of inequalities has played in the formation and evolution of educational institutions in three countries: Costa Rica, Cuba and Guatemala. This particular focus shows that this function has played a determining role, even if its organization has varied deeply in…

  14. Learning Disabilities in Costa Rica: Challenges for an "Army of Teachers."

    ERIC Educational Resources Information Center

    Stough, Laura M.; Aguirre-Roy, Ana Ruth

    1997-01-01

    Describes the history and evolution of special education services in Costa Rica, along with critical issues that impede the expansion of educational services to students with learning disabilities. These include shortages of trained personnel, geographic isolation of a large sector of the population, and severe economic limitations. (Author/CR)

  15. An Information Guide to Rehabilitation and Special Education in Costa Rica.

    ERIC Educational Resources Information Center

    de Mezerville, Gaston; Monge, Gerardo

    The report on rehabilitation and special education in Costa Rica covers the history of special services, with emphasis on medical, educational, and vocational efforts. Future priorities for each field are noted. A second section discusses the institutions that are the main national organizational forces in rehabiliation and special education, as…

  16. ISOLATION OF TOXOPLASMA GONDII FROM THE KEEL-BILLED TOUCAN (RAMPHASTOS SULFURATUS) FROM COSTA RICA

    USDA-ARS?s Scientific Manuscript database

    Pectoral muscles from a captive keel-billed toucan (Ramphastos sulfuratus) from the Costa Rican were fed to a Toxoplasma gondii-free cat and the cat shed oocysts. Laboratory mice fed these oocysts developed antibodies to T. gondii in their sera and T. gondii tissue cysts in their brains. The DNA ext...

  17. First report of Orange Rust of Sugarcane Caused by Puccinia kuehnii in Costa Rica and Nicaragua

    USDA-ARS?s Scientific Manuscript database

    Symptoms of orange rust of sugarcane were observed in Costa Rica at Coopeagri Sugar Mill located in Pérez Zeledón, San José, during July 2007 on (a complex hybrid of Saccharum L. species) cultivar, SP 71-5574, and at Providencia Sugar Mill near Muelle and at Cutris Sugar Mill near Los Chiles, in Aug...

  18. A food plant specialist in Sparganothini? A new genus and species from Costa Rica (Lepidoptera: Tortricidae)

    USDA-ARS?s Scientific Manuscript database

    Sparganocosma docsturnerorum Brown, new genus and new species, is described and illustrated from Area de Conservación (ACG) in northwestern Costa Rica. The new genus shares a long, crescent- or ribbon-shaped signum in the corpus bursae of the female genitalia with Aesiocopa Zeller, 1877, Amorbia Cle...

  19. Intelligent Behavior, Art Costa, and the Role of the Library Media Specialist.

    ERIC Educational Resources Information Center

    Shein, Dina

    1999-01-01

    Discusses Art Costa's 14 Intelligent Behavior Characteristics and gives examples of picture books that apply to each characteristic, including persistence, decreasing impulsivity, listening, cooperative thinking, flexibility, metacognition, accuracy and precision, sense of humor, questioning, using past knowledge, risk taking, using all senses,…

  20. Children's National Identity in Multicultural Classrooms in Costa Rica and the United States

    ERIC Educational Resources Information Center

    Solano-Campos, Ana

    2015-01-01

    The development of healthy national identifications in children and youth has important implications for the construction of democratic citizenries in culturally and linguistically diverse societies. In this comparative qualitative case study of two multicultural public schools-one in the United States and one in Costa Rica--I examined children's…

  1. Teaching Special Education in Costa Rica: Using a Learning Strategy in an Inclusive Classroom.

    ERIC Educational Resources Information Center

    Stough, Laura M.

    2002-01-01

    In the past decade, special education in Costa Rica has seen profound changes from creating primarily segregated services to developing innovative service models that promote inclusion. This article describes those changes and takes a look at current challenges in this small country, including teacher shortages and adequate funding. (Contains…

  2. A Historical Analysis of the Educational Modalities of Inequalities Management in Costa Rica, Cuba and Guatemala

    ERIC Educational Resources Information Center

    Mulot, Eric

    2004-01-01

    This article provides a historical and comparative study of the role that management of inequalities has played in the formation and evolution of educational institutions in three countries: Costa Rica, Cuba and Guatemala. This particular focus shows that this function has played a determining role, even if its organization has varied deeply in…

  3. Detection of antibodies against Sarcocystis neurona, neospora spp., and Toxoplasma gondii in horses from Costa Rica

    USDA-ARS?s Scientific Manuscript database

    Serum samples from 315 horses from Costa Rica, Central America were examined for the presence of antibodies against Sarcocystis neurona, Neospora spp., and Toxoplasma gondii using the SnSAG2 ELISA, the NhSAG1 ELISA, and the modified agglutination test, respectively. Anti-S. neurona antibodies were f...

  4. Register and Forms of Address in Costa Rica: Sociolinguistic Realities and Pedagogical Implications

    ERIC Educational Resources Information Center

    Schmidt-Rinehart, Barbara C.; LeLoup, Jean W.

    2017-01-01

    This article reports the findings of sociolinguistic research investigating the use of second-person singular pronouns in Costa Rica. The study was carried out onsite and involved 132 interviewees from all seven provinces of the country. These subjects reacted to scenarios in which they had to choose their preferred pronoun of use…

  5. Music Education for Social Change in the Secondary Public Schools of Costa Rica

    ERIC Educational Resources Information Center

    Rosabal-Coto, Guillermo

    2010-01-01

    This article focuses on a recently implemented general music curriculum in secondary public schools, whose main goal is to address social issues in Costa Rica. The author describes and discusses its context, rationale, theoretical tenets, and proposed practices with the purpose of advancing theory-practice reflection on music education practices…

  6. Afro-Mestizo Speech from Costa Chica, Guerrero: From Cuaji to Cuijla.

    ERIC Educational Resources Information Center

    Althoff, Daniel

    1994-01-01

    Traces the history of Africans in Mexico and the Costa Chica and compares elements of the regional speech as described in a 1958 study with data collected on-site in 1991-1992. Findings indicate that the successful introduction of public education coupled with the ubiquity of the mass media have reduced or eliminated the more distinctively…

  7. An Analysis of Retention and Attrition at MiraCosta College.

    ERIC Educational Resources Information Center

    Baker, Ronald

    A study was conducted at MiraCosta College (MCC), in Del Mar, California, to investigate various aspects of retention and attrition and to make recommendations for possible program enhancements. The study sought to determine when students drop out of classes, which students drop out of school completely, and the drop out rate for various…

  8. Hunger in the Midst of Affluence: Task Force Combats Hunger in Contra Costa County.

    ERIC Educational Resources Information Center

    Fujii, Mary Lavender

    1994-01-01

    Research conducted by the Hunger Task Force in Contra Costa County (California) revealed a significant increase in the number of families, especially with young children, who live in poverty and who are going hungry. A food stamp outreach program, a countywide school breakfast program, and food distribution programs have been initiated. (LP)

  9. Situation Report--Bahamas, Bermuda, Bolivia, China, Costa Rica, Guadeloupe, Haiti, Hong Kong, Liberia, Mexico, Panama.

    ERIC Educational Resources Information Center

    International Planned Parenthood Federation, London (England).

    Data relating to population and family planning in 11 foreign countries are presented in these situation reports. Countries included are Bahamas, Bermuda, Boliva, China, Costa Rica, Guadeloupe, Haiti, Hong Kong, Liberia, Mexico, and Panama. Information is provided under two topics, general background and family planning situation, where…

  10. Perceptions of Older Adults: Differences by Age and Sex among Children in a Costa Rican Community.

    ERIC Educational Resources Information Center

    Mitchell, Jim; Mathews, Holly F.

    1987-01-01

    Identified two subdimensions of an index designed to measure children's perceptions of older adults in responses from 120 Afro-Caribbean children living in a rural Costa Rican community. Findings showed older females were perceived as more authoritative and older males as more affective. Used ethnographic techniques with survey results to…

  11. Children's National Identity in Multicultural Classrooms in Costa Rica and the United States

    ERIC Educational Resources Information Center

    Solano-Campos, Ana

    2015-01-01

    The development of healthy national identifications in children and youth has important implications for the construction of democratic citizenries in culturally and linguistically diverse societies. In this comparative qualitative case study of two multicultural public schools-one in the United States and one in Costa Rica--I examined children's…

  12. Evaluation of the Third Year of Operation of the Contra Costa College Mobile Counseling Center.

    ERIC Educational Resources Information Center

    Edwards, Howard

    During 1971, the third year of operation of Contra Costa College's (California) mobile counseling unit, the priorities established for that program were (a) to make the mobile counseling unit and program as widely known in the community as possible, and (b) to concentrate on the services to the client. The counseling unit and program were…

  13. Evaluation of the Second Year of Operation of the Contra Costa Mobile Counseling Center.

    ERIC Educational Resources Information Center

    Gordon, Anthony T.

    Second year operations of this mobile center have validated many of the assumptions on which it was founded (see ED 031 243), including a reduction in the communications gap between Contra Costa College and the community at large. While attempts to compare this year's results with last year's can be considered premature, some findings may be of…

  14. West Contra Costa Unified School District Assessment and Improvement Plan: Facilities Management.

    ERIC Educational Resources Information Center

    2001

    This report analyzes the conditions of school facilities in Contra Costa Unified School District, California. The district had been prohibited from participating in the state's school facilities funding program because of a very heavy debt burden and near-bankruptcy of the district. The report begins by summarizing findings in the areas of…

  15. Evaluation of the First Year of Operation of the Contra Costa College Mobile Counseling Center.

    ERIC Educational Resources Information Center

    Gordon, Anthony T.

    Contra Costa College tried several ways to reach potential students who were unaware that they were eligible or even that the college had anything to offer them. Articulation with high schools, contacts with other agencies, and the mass media were of little help. The idea of a central, off-campus counseling center was abandoned in favor of the…

  16. An Emerging Institution: The University for Peace in Costa Rica. Discussion Paper Series, No. 73.

    ERIC Educational Resources Information Center

    Laughlin, Margaret A.

    A new United Nations college, the University for Peace in Costa Rica, is discussed. After providing a brief historical sketch on peace efforts since the Ancient Greeks, the objectives of the United Nations University are identified. The University for Peace is a new international university that is part of the United Nations University network, a…

  17. Computer Assisted English Language Learning in Costa Rican Elementary Schools: An Experimental Study

    ERIC Educational Resources Information Center

    Alvarez-Marinelli, Horacio; Blanco, Marta; Lara-Alecio, Rafael; Irby, Beverly J.; Tong, Fuhui; Stanley, Katherine; Fan, Yinan

    2016-01-01

    This study presents first-year findings of a 25-week longitudinal project derived from a two-year longitudinal randomized trial study at the elementary school level in Costa Rica on effective computer-assisted language learning (CALL) approaches in an English as a foreign language (EFL) setting. A pre-test-post-test experimental group design was…

  18. BIOGENIC VOLATILE ORGANIC COMPOUND EMISSIONS FROM A LOWLAND TROPICAL WET FOREST IN COSTA RICA

    EPA Science Inventory

    Twenty common plant species were screened for emissions of biogenic volatile organic compounds (BVOCS) at a lowland tropical wet forest site in Costa Rica. Ten of the species. examined emitted substantial quantities of isoprene. These species accounted for 35-50% of the total bas...

  19. Two new species of the Hagnagora anicata complex (Geometridae, Larentiinae) from Costa Rica.

    PubMed

    Sullivan, J Bolling

    2011-01-01

    Examination of the lectotype (here designated) reveals that Hagnagora anicata (Felder & Rogenhofer) does not occur in Costa Rica. Instead two new species are described, Hagnagora eliannesp. n. and Hagnagora unniasp. n., and their distribution is discussed. The previous treatment of Hagnagora anicata as a single widespread species ranging from Jamaica and Mexico to Bolivia needs to be critically evaluated.

  20. Longitudinal Relation of Community-Level Income Inequality and Mortality in Costa Rica

    PubMed Central

    Modrek, Sepideh; Ahern, Jennifer

    2011-01-01

    The controversy regarding the direct relationship between income distribution and health remains unresolved. Empirical evidence has often failed to advance our understanding because in the countries studied there was limited ability to distinguish hypotheses. This study examines the relation between inequality and mortality in the context of Costa Rica. Costa Rica’s unique social and political structure makes confounding through resource and political channels less likely, thus any effects would work predominantly through direct psychosocial channels. Using mortality data extracted from the Vital Statistics Registry, we evaluate the longitudinal relations between income inequality and cause-specific mortality in Costa Rica from 1989–2005. For those aged 15–60, results indicate that there is a significant adverse relation between increases in lagged inequality and mortality from liver disease, and marginal adverse relations with mortality from diabetes and suicide. For those aged 60 and over, there is a limited evidence of a relation between inequality and health. These results suggest increases in inequality may impact health behavior of the working aged population in Costa Rica. PMID:21873102

  1. STR data for 11 autosomal STR markers from Costa Rica, Central America.

    PubMed

    Sanóu, I; Núñez, G; Rodríguez, A; Silva, S; García, O; Uriarte, J; Espinoza, M

    2005-10-29

    Allele frequencies for 11 STR autosomal loci (F13A01, F13B, FESFPS, LPL, CSF1PO, TH01, TPOX, VWA, D16S539, D7S820 and D13S317) were obtained from a sample of 200 unrelated individuals from Costa Rica, Central America.

  2. Afro-Mestizo Speech from Costa Chica, Guerrero: From Cuaji to Cuijla.

    ERIC Educational Resources Information Center

    Althoff, Daniel

    1994-01-01

    Traces the history of Africans in Mexico and the Costa Chica and compares elements of the regional speech as described in a 1958 study with data collected on-site in 1991-1992. Findings indicate that the successful introduction of public education coupled with the ubiquity of the mass media have reduced or eliminated the more distinctively…

  3. Active Subduction on Both Coasts of Costa Rica Does not Represent an Important Tsunami Hazard

    NASA Astrophysics Data System (ADS)

    Protti, M.; Gonzalez, V.

    2007-05-01

    Costa Rica, on the southern terminus of the Middle American Trench is being affected by active subduction on both, along the Pacific coast as well as on its Caribbean coast. Three main subduction segments can be recognized along the Pacific coast: 1) under northwestern Costa Rica, off Papagayo Gulf and Nicoya peninsula, the Cocos plate is subducting under the Caribbean plate; 2) under southern Costa Rica (Osa and Burica peninsulas) the Cocos plate subducts under the Panama Block and 3) in the central Pacific coast (between Nicoya and Osa peninsulas) the Cocos plate subducts under a shear zone that marks the transition between the Caribbean and the Cocos plate. Along the Caribbean coast, south of Puerto Limon, the Caribbean plate subducts under the Panama block. Large subduction earthquakes occur under the Nicoya peninsula, Osa peninsula and south of Limon. Most of the rupture area of these large events lies below land so the deformation of the ocean floor is minimal and therefore the tsunamis they generate are small. No large subduction earthquakes occur under the central Pacific coast of Costa Rica due to the subduction of small sea mounts that act as small asperities without potential to accumulate large amounts of slip. For this reason the region between Nicoya and Osa peninsulas is not an important tsunamigenic zone.

  4. Environmental Education in Costa Rica: Building a Framework for Sustainable Development?

    ERIC Educational Resources Information Center

    Blum, Nicole

    2008-01-01

    Environmental education is commonly claimed to be at the centre of efforts to achieve sustainable development. Since the 1980s, Costa Rica has been one of the acknowledged leaders in efforts to promote environmental learning, and national policy includes a three-fold national development strategy which simultaneously promotes education,…

  5. A Further Review of the California State University's Contra Costa Center. Commission Report 89-9.

    ERIC Educational Resources Information Center

    California State Postsecondary Education Commission, Sacramento.

    A follow-up report on the California State University's Contra Costa Center, a proposed permanent off-campus center, is presented. The California Postsecondary Education Commission approved the original proposal in 1987, contingent on finding solutions to concerns about transportation access and services to disadvantaged students. The university…

  6. The Role of Water in Arc Magmatism in Nicaragua and Costa Rica.

    NASA Astrophysics Data System (ADS)

    Sadofsky, S. J.; Hoernle, K.; van den Bogaard, P.

    2004-12-01

    The Central American Volcanic Arc provides an excellent opportunity to study the effect of varying subduction parameters on arc magma geochemistry. Here we examine melt inclusions trapped in olivine phenocrysts in young mafic tephras from the active arc segments in Nicaragua and Costa Rica. These segments of the subduction zone provide starkly contrasting situations with differing oceanic crustal input (East Pacific Rise vs. oceanic crust overprinted by the Galapagos hot spot) and slab dip ( ˜70° vs. ˜30° ) in Nicaragua and Costa Rica respectively. We collected major-, trace-, and volatile-element concentration data from olivine-hosted (Fo68-87) melt inclusions from volcanoes Cerro Negro, Nejapa, Masaya, and Mombacho along the volcanic front in central Nicaragua and Irazu and Arenal in Costa Rica. In Nicaragua H2O shows a general increase with decreasing Fo of the host olivine, reflecting incompatible behavior during differentiation from 1-3 wt. % in samples from Fo>85 to ˜ 5% in some of the slightly more evolved, yet still relatively undegassed, samples. This is best illustrated by samples from Mombacho and Cerro Negro. Comparison of the major element data with experimental melting studies indicates that the Nicaraguan melts with higher FeO and lower SiO2 (at similar MgO contents) could have formed at greater depths and temperatures in the presence of less water than the Costa Rican melts with higher SiO2 and lower FeO. The most primitive samples from Irazu (host olivine Fo84-89) are extremely rich in H2O (3-5 wt. %). H2O enrichment correlates with enrichment of some LILE, LREE (i.e., Ba, La, K), relative to HFSE for most samples from the Nicaraguan volcanoes. S/Nb and Cl/Nb also show some correlation with H2O/Nb in Nicaraguan samples, with some exceptions possibly related to volatile loss is the less primitive samples. These correlations are generally not present in the Costa Rican samples, thus suggesting that despite apparent larger initial water contents

  7. Seismogenic zone structure along the Middle America subduction zone, Costa Rica

    NASA Astrophysics Data System (ADS)

    Deshon, Heather Rene

    Most large (MW > 7.0) underthrusting earthquakes nucleate along a shallow region of unstable frictional stability on or near the subducting plate interface termed the seismogenic zone. The studies presented here investigate along-strike spatial and temporal variability in microseismicity and seismic velocity and provide spatial constraints on the updip and downdip limits of microseismicity within the Middle America subduction offshore western Costa Rica. All chapters utilize data recorded by the Costa Rica Seismogenic Zone Experiment (CRSEIZE), a collaborative seismic and geodetic study undertaken from September 1999--June 2001 to better understand subduction zone behavior near the Osa and Nicoya Peninsulas, Costa Rica. Chapter 1 serves as a broad introduction to the thesis while Chapter 2 provides an overview of Costa Rica seismicity, the CRSEIZE experiment setup, data processing, and data quality. Chapter 3 discusses simultaneous inversion for 1D P- and S-wave velocity models, station corrections, and hypocenter parameters for both the Nicoya and Osa experiments and presents a refined location for the continental Moho in northern Costa Rica. Chapter 4 presents absolute and relative relocations of ˜300 aftershocks of the 1999 Quepos, Costa Rica, underthrusting earthquake and analyzes seismogenic zone structure offshore central Costa Rica during a period of increased seismicity rate. Subduction of highly disrupted seafloor north of the Osa Peninsula has established a set of conditions that presently limit the seismogenic zone to be between 10--35 km below sea level, 30--95 km from the trench axis. Chapter 5 presents high resolution earthquake locations and P-wave and P-wave/S-wave 3D velocity models for the locked Nicoya Peninsula segment of the Middle America subduction zone calculated using an iterative, damped least squares local tomography method. In the southern Nicoya Peninsula, microseismicity along the plate interface extends from 12--26 km depth, 73

  8. The costa of trichomonads: A complex macromolecular cytoskeleton structure made of uncommon proteins.

    PubMed

    de Andrade Rosa, Ivone; Caruso, Marjolly Brigido; de Oliveira Santos, Eidy; Gonzaga, Luiz; Zingali, Russolina Benedeta; de Vasconcelos, Ana Tereza R; de Souza, Wanderley; Benchimol, Marlene

    2017-06-01

    The costa is a prominent striated fibre that is found in protozoa of the Trichomonadidae family that present an undulating membrane. It is composed primarily of proteins that have not yet been explored. In this study, we used cell fractionation to obtain a highly enriched costa fraction whose structure and composition was further analysed by electron microscopy and mass spectrometry. Electron microscopy of negatively stained samples revealed that the costa, which is a periodic structure with alternating electron-dense and electron-lucent bands, displays three distinct regions, named the head, neck and body. Fourier transform analysis showed that the electron-lucent bands present sub-bands with a regular pattern. An analysis of the costa fraction via one- and two-dimensional electrophoresis and liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS) allowed the identification of 54 hypothetical proteins. Fourteen of those proteins were considered to be major components of the fraction. The costa of T. foetus is a complex and organised cytoskeleton structure made of a large number of proteins which is assembled into filamentous structures. Some of these proteins exhibit uncharacterised domains and no function related according to gene ontology, suggesting that the costa structure may be formed by a new class of proteins that differ from those previously described in other organisms. Seven of these proteins contain prefoldin domains displaying coiled-coil regions. This propriety is shared with proteins of the striated fibres of other protozoan as well as in intermediate filaments. Our observations suggest the presence of a new class of the cytoskeleton filaments in T. foetus. We believe that our data could auxiliate in determining the specific locations of these proteins in the distinct regions that compose the costa, as well as to define the functional roles of each component. Therefore, our study will help in the better understanding of the

  9. Handling and aflatoxin contamination of white maize in Costa Rica.

    PubMed

    Mora, M; Lacey, J

    1997-01-01

    Projects funded by International Development Research Centre (IDRC) of Canada and the European Commission have enabled the examination of more than 3000 samples of maize collected from all regions of Costa Rica at different stages, from the growing crop through storage to final sale, and at different water contents. Contamination with Aspergillus flavus was frequent and about 80% of samples contained more than 20 ng aflatoxins g(-1) grain. Average contamination with aflatoxins in the Brunca Region was > 274 ng g(-1) while that in other regions was < 70 ng g(-1). Except in Brunca region, where it averaged 376 ng g(-1), contamination of grain from commercial sources was slightly less than of that from farms (< or = 15 ng g(-1)). It appeared that samples kept on the cob after harvest contained almost no aflatoxin while shelled samples were frequently highly contaminated. Experiments were therefore done in Brunca and Huetar Atlantic Regions, utilising 34 experimental maize crops to study in detail the development of A. flavus and aflatoxin from before harvest, through postharvest treatment before drying and through storage for six months. A. flavus was isolated more frequently from maize shelled immediately after harvest than from that kept on the cob until it could be dried, and from more samples from the Brunca Region than from the Huetar Atlantic Region. Samples harvested with > or = 18% water content often contains > 70% of grains infected with A. flavus but sometimes there were few grains infected. As found in the initial survey, more aflatoxin contamination developed in shelled maize than in that handled on the cob during the period from harvesting to drying, especially if the delay was more than 5 days, and more in Brunca than in Huetar. Shelled grain contained 400-800 ng aflatoxin g(-1) in Brunca but < 100 ng g(-1) in Huetar while grain kept on the cob contained < 30 ng g(-1), even with > 18% water content. Incidence of Fusarium spp. exceeded 50% except where A

  10. The modeling of daily precipitation in Costa Rica

    NASA Astrophysics Data System (ADS)

    Harrison, John Michael

    The understanding of precipitation and its underlying processes is important to many human activities. Agricultural planning, hydroelectric resource management, and industrial infrastructure development all rely heavily on being able to make reasonable predictions concerning rainfall. The lack of sufficient rainfall can have devastating social and economic consequences for developing nations that are reliant on subsistence agriculture and hydroelectric power. This study examines the means by which daily precipitation in Costa Rica can be modeled, and how the El Nino-Southern Oscillation (ENSO) affects the precipitation generating mechanisms. A selection of three meteorological stations are used to test how daily rainfall can be characterized by the occurrence and intensity of the individual rainfall events. The occurrence is modeled using a two-state first-order Markov model, which provides insight into the relative length of wet and dry spells. The intensity model uses L-moments to determine the optimum statistical distribution. These statistical parameters are used to understand the inter-annual and inter-seasonal variations in the precipitation-generating mechanisms as they are modified by the ENSO phenomenon. The parameters are also combined to create monthly rainfall simulations based on the state of the ENSO, as well as test whether accurate forecasts can be created up to one year in advance. It is found that the ENSO plays an important role in the daily rainfall process, by altering the behavior of the Inter-Tropical Convergence Zone (ITCZ), the Northeast Trade Winds, and the advance of cold air masses from North America during the winter. The eastern Caribbean slope of the country receives proportionally more rainfall during El Nino events, while the western Pacific slope receives less rainfall during the same period. Cold front (norte) intrusion is minimized by the El Nino, resulting in less winter rainfall during El Nino years. Simulations based on the

  11. Small-molecule agonists of mammalian Diaphanous-related (mDia) formins reveal an effective glioblastoma anti-invasion strategy.

    PubMed

    Arden, Jessica D; Lavik, Kari I; Rubinic, Kaitlin A; Chiaia, Nicolas; Khuder, Sadik A; Howard, Marthe J; Nestor-Kalinoski, Andrea L; Alberts, Arthur S; Eisenmann, Kathryn M

    2015-11-01

    The extensive invasive capacity of glioblastoma (GBM) makes it resistant to surgery, radiotherapy, and chemotherapy and thus makes it lethal. In vivo, GBM invasion is mediated by Rho GTPases through unidentified downstream effectors. Mammalian Diaphanous (mDia) family formins are Rho-directed effectors that regulate the F-actin cytoskeleton to support tumor cell motility. Historically, anti-invasion strategies focused upon mDia inhibition, whereas activation remained unexplored. The recent development of small molecules directly inhibiting or activating mDia-driven F-actin assembly that supports motility allows for exploration of their role in GBM. We used the formin inhibitor SMIFH2 and mDia agonists IMM-01/-02 and mDia2-DAD peptides, which disrupt autoinhibition, to examine the roles of mDia inactivation versus activation in GBM cell migration and invasion in vitro and in an ex vivo brain slice invasion model. Inhibiting mDia suppressed directional migration and spheroid invasion while preserving intrinsic random migration. mDia agonism abrogated both random intrinsic and directional migration and halted U87 spheroid invasion in ex vivo brain slices. Thus mDia agonism is a superior GBM anti-invasion strategy. We conclude that formin agonism impedes the most dangerous GBM component-tumor spread into surrounding healthy tissue. Formin activation impairs novel aspects of transformed cells and informs the development of anti-GBM invasion strategies. © 2015 Arden et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  12. [Attitude of primary care professionals to gender violence. A comparative study between Catalonia and Costa Rica].

    PubMed

    Rojas Loría, Kattia; Gutiérrez Rosado, Teresa; Alvarado, Ricardo; Fernández Sánchez, Anna

    2015-10-01

    Describe the relationship between the attitude towards violence against women (VAW) of professionals of the health of primary care with variables such professional satisfaction, workload, orientation of professional practice, knowledge, training and use of network in Catalonia and Costa Rica. Cross-exploratory and comparative study. Primary care in Barcelona and nearby counties and the Greater Metropolitan Area (GAM) of Costa Rica. 235 primary health professionals of Medicine, Nursing, Psychology and Social Work. Questionnaire with eight sections about attitudes, professional satisfaction, and orientation of professional practice, workload, knowledge, training and use of network. Three types of analysis were carried out: a descriptive one by country; a bivariate analysis; and a multivariable linear regression model. Primary Health Professionals attitudes towards VAW health were similar in both contexts (Catalonia: 3.90 IC 95% 3.84-3.96; Costa Rica: 4.03 IC 95% 3.94-4.13). The variables associated with attitudes towards VAW were: Use of network resources (B=0.20, 95% CI -0.14-0.25, P=<.001), Training (B=0.10, 95% CI 0.04 to 0.17, P=<0.001), and country, Costa Rica (B=0.16, 95% CI 0.06 to 0.25, P=<0.001). There was no interaction between the country and the other variables, suggesting that the association between the variables and the attitude is similar in both countries. The results suggest that increased use of network resources and training are related to a positive attitude towards VWA in primary health professionals, both in Catalonia and Costa Rica. Copyright © 2014 Elsevier España, S.L.U. All rights reserved.

  13. Enhancing Outreach using Social Networks at the National Seismological Network of Costa Rica

    NASA Astrophysics Data System (ADS)

    Linkimer, L.; Lücke, O. H.

    2014-12-01

    Costa Rica has a very high seismicity rate and geological processes are part of everyday life. Traditionally, information about these processes has been provided by conventional mass media (television and radio). However, due to the new trends in information flow a new approach towards Science Education is necessary for transmitting knowledge from scientific research for the general public in Costa Rica. Since 1973, the National Seismological Network of Costa Rica (RSN: UCR-ICE) studies the seismicity and volcanic activity in the country. In this study, we describe the different channels to report earthquake information that the RSN is currently using: email, social networks, and a website, as well as the development of a smartphone application. Since the RSN started actively participating in Social Networks, an increase in awareness in the general public has been noticed particularly regarding felt earthquakes. Based on this trend, we have focused on enhancing public outreach through Social Media. We analyze the demographics and geographic distribution of the RSN Facebook Page, the growth of followers, and the significance of their feedback for reporting intensity data. We observe that certain regions of the country have more Facebook activity, although those regions are not the most populated nor have a high Internet connectivity index. We interpret this pattern as the result of a higher awareness to geological hazards in those specific areas. We noticed that the growth of RSN users on Facebook has a strong correlation with the seismic events as opposed to Twitter that displays a steady growth with no clear correlations with specific seismic events. We see the Social Networks as opportunities to engage non-science audiences and encourage the population to participate in reporting seismic observations, thus providing intensity data. With the increasing access to Internet from mobile phones in Costa Rica, we see this approach to science education as an opportunity

  14. The Tobosi Fault: Source of the 2011-2012 Tobosi Earthquake Swarm in Central Costa Rica.

    NASA Astrophysics Data System (ADS)

    Araya, M. C.; Linkimer, L.; Montero Pohly, W. K.; Rojas, W.

    2014-12-01

    The Central Costa Rica Deformed Belt (CCRDB) is a ~100 km broad zone of deformation that marks the boundary between the Caribbean Plate and the Panama Microplate. From December 2011 to February 2012 an earthquake swarm took place on a portion of the CCRDB, near the town of Tobosi, in the Cartago province. In this study, we use data recorded by the National Seismological Network of Costa Rica (RSN: UCR-ICE) to relocate 22 of these earthquakes and calculate focal mechanisms. Additionally, we analyze the Tectonic Geomorphology of the region. Our results show a transtension structure near the town of Tobosi, which comprises at least three faults, named: the Tobosi, Tablon, and Alumbre faults. This structure is located only 5 km south of the Aguacaliente fault, which caused the deadliest earthquake in Costa Rican history on May 4, 1910 (Ms 6.4). The earthquake locations analyzed are aligned with the Tobosi Fault. The events varied in moment magnitude between 2.4 and 3.9 Mw and depths of 1 and 8 km. The largest events were felt mainly in the town of Tobosi and as far as San Jose, the capital city of Costa Rica. We found that the Tobosi fault is an active left-lateral strike-slip fault with a normal component and is the source of the Tobosi earthquake swarm. The study of active faults in Central Costa Rica is significant as it may greatly improve seismic hazards assessment for this region where most of the population and the main economic activities are concentrated.

  15. Impact of Deforestation on Cloud Properties and Rainfall Over the Costa Rica-Nicaraguan region

    NASA Astrophysics Data System (ADS)

    Ray, D. K.; Nair, U. S.; Welch, R. M.; Lawton, R. O.

    2002-12-01

    The Nicaraguan-Costa Rican region in Central America exhibits the typical pattern of complex deforestation now seen throughout the tropics. The region is a mixture of lowland, mostly converted to agriculture, and mountainous regions, where pristine forests still persist. At present the northern fertile plains of Costa Rica are mostly utilized for agriculture. However in the adjacent regions of southern Nicaragua lowland forests are relatively intact. The extensive agricultural areas of northern Costa Rica is a region of discontinuity in the proposed Mesoamerican Biological Corridor which would connect the montane forests in Costa Rica to the lowland forests in Nicaragua. The present study is part of a larger study which investigates the effects of continuing lowland deforestation and associated regional climate change in Central America on the stability of the entire proposed Mesoamerican Biological Corridor. The present work focuses on the effects of land use on the formation of cloudiness, cloud properties and rainfall in the forested regions of southern Nicaragua and the deforested regions of northern Costa Rica. Land surface and cloud properties are retrieved using the Moderate Resolution Imaging Spectroradiometer (MODIS) and the Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER) satellite data and products. The land surface properties retrieved are land surface temperature, albedo, Normalized Difference Vegetation Index (NDVI), Available Soil Moisture fraction and surface energy fluxes. The cloud properties retrieved are cloud optical thickness and effective radii. In addition, the frequency of cumulus cloudiness on hourly basis are derived from the Geostationary Operational Environmental Satellite (GOES) and rainfall is studied using Tropical Rainfall Measuring Mission (TRMM) satellite products. The correlations between the surface properties, cloud properties, cumulus cloudiness and rainfall as a function of ecosystem and topography is

  16. Educational Gradients in Psychotropic Medication Use Among Older Adults in Costa Rica and the United States†

    PubMed Central

    Domino, Marisa E.; Dow, William H.; Coto-Yglesias, Fernando

    2014-01-01

    Objective The relationship among education, psychiatric diagnoses and psychotropic medication use has been explored in the United States, but little is known about patterns in poorer countries, despite their high documented burden of mental illness. Educational gradients in diagnosis and psychotropic use were estimated in the United States and Costa Rica – a middle-income country with universal health insurance. Methods Analyses were conducted using data on older adults (ages 60+) in nationally representative surveys from each country: the 2005 U.S. Medical Expenditures Panel Survey (n=4788) and the 2005 Costa Rican Longevity and Healthy Aging Study (n=2827). Logistic regressions examined the effect of lower educational attainment, income and urban residence on diagnosis and on psychotropic medication use with and without an associated mental illness diagnosis. Results Rates of self-reported diagnoses were lower in the U.S. (12% U.S.; n=598) than in, Costa Rica (20%; n=526), but may reflect differences in survey wording. Measures of self-reported and screened depression decreased with education in both countries. Psychotropic medication use among those with diagnoses increased with education in Costa Rica only. Conclusions We find similar patterns of educational gradients in diagnosis and screening between the U.S. and Costa Rica, but different patterns of medication use by education. Differences in stigma and access to care may play an important role in explaining differences between the countries, though we did not find evidence that insurance affected educational gradients in the U.S. These analyses increase the evidence on the role of education in the use of the health care system. PMID:24932755

  17. Effectiveness of protected areas for representing species and populations of terrestrial mammals in Costa Rica.

    PubMed

    González-Maya, José F; Víquez-R, Luis R; Belant, Jerrold L; Ceballos, Gerardo

    2015-01-01

    Costa Rica has one of the greatest percentages (26%) of protected land in the world. The National Protected Areas System (NPAS) of Costa Rica was established in 1976 and currently includes >190 protected areas within seven different protection categories. The effectiveness of the NPAS to represent species, populations, and areas with high species richness has not been properly evaluated. Such evaluations are fundamental to understand what is necessary to strengthen the NPAS and better protect biodiversity. We present a novel assessment of NPAS effectiveness in protecting mammal species. We compiled the geographical ranges of all terrestrial Costa Rican mammals then determined species lists for all protected areas and the estimated proportion of each species' geographic range protected. We also classified mammal species according to their conservation status using the IUCN Red List of Threatened Species. We found almost complete representation of mammal species (98.5%) in protected areas, but low relative coverage (28.3% on average) of their geographic ranges in Costa Rica and 25% of the species were classified as underprotected according to a priori representation targets. Interestingly, many species-rich areas are not protected, and at least 43% of cells covering the entire country are not included in protected areas. Though protected areas in Costa Rica represent species richness well, strategic planning for future protected areas to improve species complementarity and range protection is necessary. Our results can help to define sites where new protected areas can have a greater impact on mammal conservation, both in terms of species richness and range protection.

  18. Educational gradients in psychotropic medication use among older adults in Costa Rica and the United States.

    PubMed

    Domino, Marisa Elena; Dow, William H; Coto-Yglesias, Fernando

    2014-10-01

    The relationship of education, psychiatric diagnoses, and use of psychotropic medication has been explored in the United States, but little is known about this relationship in poorer countries, despite the high burden of mental illness in these countries. This study estimated educational gradients in diagnosis and psychotropic drug use in the United States and Costa Rica, a middle-income country with universal health insurance. Analyses were conducted by using data of older adults (≥60) from the 2005 U.S. Medical Expenditure Panel Survey (N=4,788) and the 2005 Costa Rican Longevity and Healthy Aging Study (N=2,827). Logistic regressions examined the effect of education level (low, medium, or high) and urban residence on the rates of self-reported mental health diagnoses, screening diagnosis, and psychotropic medication use with and without an associated psychiatric diagnosis. Rates of self-reported diagnoses were lower in the United States (12%) than in Costa Rica (20%), possibly reflecting differences in survey wording. In both countries, the odds of having depression were significantly lower among persons with high education. In Costa Rica, use of psychotropic medication among persons with self-reported diagnoses increased by education level. The educational gradients in medication use were different in the United States and Costa Rica, and stigma and access to care in these countries may play an important role in these differences, although type of insurance did not affect educational gradients in the United States. These analyses increase the evidence of the role of education in use of the health care system.

  19. Effectiveness of Protected Areas for Representing Species and Populations of Terrestrial Mammals in Costa Rica

    PubMed Central

    González-Maya, José F.; Víquez-R, Luis R.; Belant, Jerrold L.; Ceballos, Gerardo

    2015-01-01

    Costa Rica has one of the greatest percentages (26%) of protected land in the world. The National Protected Areas System (NPAS) of Costa Rica was established in 1976 and currently includes >190 protected areas within seven different protection categories. The effectiveness of the NPAS to represent species, populations, and areas with high species richness has not been properly evaluated. Such evaluations are fundamental to understand what is necessary to strengthen the NPAS and better protect biodiversity. We present a novel assessment of NPAS effectiveness in protecting mammal species. We compiled the geographical ranges of all terrestrial Costa Rican mammals then determined species lists for all protected areas and the estimated proportion of each species’ geographic range protected. We also classified mammal species according to their conservation status using the IUCN Red List of Threatened Species. We found almost complete representation of mammal species (98.5%) in protected areas, but low relative coverage (28.3% on average) of their geographic ranges in Costa Rica and 25% of the species were classified as underprotected according to a priori representation targets. Interestingly, many species-rich areas are not protected, and at least 43% of cells covering the entire country are not included in protected areas. Though protected areas in Costa Rica represent species richness well, strategic planning for future protected areas to improve species complementarity and range protection is necessary. Our results can help to define sites where new protected areas can have a greater impact on mammal conservation, both in terms of species richness and range protection. PMID:25970293

  20. Determination of differential stress in the D-DIA using cubic BN anvils and 2-D monochromatic diffraction

    NASA Astrophysics Data System (ADS)

    Uchida, T.; Wang, Y.; Rivers, M. L.; Durham, W. B.; Mei, S.

    2003-04-01

    We have adopted X-ray transparent cubic boron nitride (cBN) anvils in a modified deformation DIA (D-DIA) to conduct monochromatic diffraction using a 2-D CCD detector (SMART1500). This setup allows us to obtain real-time diffraction data with complete Debye rings that are essential for accurate determination of lattice strains in the deformed sample. Experiments have been conducted on MgO to 6.3 GPa and 1273 K in the D-DIA. Samples were deformed continuously up to 30 percent axial shortening, with various strain rates between 0.001 and 0.00001 per second, under fixed confining pressure. Pressure, temperature, sample length, and monochromatic diffraction patterns were recorded repeatedly during the constant-strain rate deformation process. A monochromatic beam with a wavelength of 0.248 Angstrom (50 keV) was used for diffraction. We have developed a software package to analyze the 2-D diffraction data. After spatial and flat-field corrections, each 2-D diffraction pattern is converted into a multiple of 1-D patterns, according to a given azimuth angle range (typically binned at 1 degree intervals). The 1-D patterns are then fitted to yield information on the azimuth dependence for each lattice spacing. Lattice strain is then computed based on the well-known theory (A.K. Singh, J. Appl. Phys., 73, 4278, 1993) to convert to differential stress. This approach allows us to examine lattice strain as a function of pressure, temperature, and total plastic strain systematically. With the known pressure and temperature dependence of the elastic constants for MgO, differential stress can be evaluated throughout deformation. Details of the methodology and analysis will be presented and sources of experimental uncertainties will be discussed.

  1. The Role of mDia1 in the Aberrant Innate Immune Signaling in del(5q) Myelodysplastic Syndromes

    DTIC Science & Technology

    2016-10-01

    Mac1 double positive cells . o Percentage of completion: 70% • Major goal 6: Determine whether mDia1 directly interacts with AP1 or SP1 to...knockout mice and littermate controls. These cells were treated with DAMPs prepared through repetitive freeze thaw cycles of wild-type bone marrow cells ...Similar to LPS, treatment with DAMPs induced over-production of TNF-α and IL- 6 in the bone marrow- and spleen-derived myeloid cells from each group of

  2. Differentials by socioeconomic status and institutional characteristics in preventive service utilization by older persons in Costa Rica.

    PubMed

    Brenes-Camacho, Gilbert; Rosero-Bixby, Luis

    2009-08-01

    Objective.The goals of this article are to assess the level of preventive service utilization by older persons in Costa Rica and to determine whether there are differentials in utilization across socioeconomic status (SES) and institutional characteristics. Method. Using data from the Costa Rican Study on Longevity and Healthy Aging (CRELES) project, a study of healthy aging in Costa Rica, the authors use self-reported information on preventive service utilization. The SES differentials are studied using logistic regressions. Results. Preventive services linked to cardiovascular disease prevention are frequently utilized; preventive services linked to cancer screening, vaccination, and sense impairments are not so widely used. Higher SES people are more likely to utilize most preventive services. Utilization rates among uninsured seniors are lower than among their insured peers. Home visits by community health workers are positively associated with higher utilization rates. Discussion. The SES disparities in preventive service utilization exist in Costa Rica, and institutional characteristics are positively associated with increasing utilization.

  3. Hyperparasitoid wasps (Hymenoptera: Trigonalidae) reared from dry forest and rain forest caterpillars of Area de Conservacion, Guanacaste, Costa Rica

    USDA-ARS?s Scientific Manuscript database

    Five species of Trigonalidae, hyperparasites of Ichneumonidae (Hymenoptera) and Tachinidae (Diptera) that parasitize caterpillars (Lepidoptera), have been reared during the ongoing caterpillar inventory of Area de Conservación Guanacaste (ACG), Guanacaste Province, northwestern Costa Rica: Lycogaste...

  4. Morphotectonic segmentation along the Nicoya Peninsula seismic gap, Costa Rica

    NASA Astrophysics Data System (ADS)

    Marshall, J.; Morrish, S.; Butcher, A.; Ritzinger, B.; Wellington, K.; Lafromboise, E.; Protti, M.; Gardner, T.; Spotila, J.

    2010-12-01

    The Nicoya Peninsula, Costa Rica forms a prominent morphologic high along the outer forearc of the erosive southern Middle America convergent margin. This emergent coastal landmass overlies the seismogenic zone and occupies a seismic gap that last ruptured in 1950 with a M7.7 megathrust earthquake. The edges of both the Nicoya seismic gap and the peninsula’s abrupt shorelines correspond with the aftershock limits of the more recent 1992 M7.2 Nicaragua tsunami earthquake to the north, and the 1990 M7.0 Cobano seamount rupture to the south. The coincidence of emergent topography and recent earthquake rupture zones suggests persistence of the Nicoya segment through multiple seismic cycles. Along the Nicoya Peninsula's seaward-facing coastline, net Quaternary uplift is recorded by emergent strandlines, marine terraces, and incised valley-fill alluvium. Ongoing field mapping, surveying, and isotopic dating reveal uplift variations along the Nicoya segment that coincide with three contrasting domains of subducting seafloor offshore (EPR, CNS-1, CNS-2). Uplift rates vary between 0.1-0.2 m/k.y. inboard of older EPR crust along the northern Nicoya coast; 0.2-0.3 m/k.y. inboard of younger CNS-1 crust along the southern Nicoya coast; and 1.0-2.0 m/k.y. inboard of CNS-2 seamounts impacting the peninsula’s southern tip. These results are consistent with geophysical observations that indicate finer scale segmentation of the Nicoya seismogenic zone related to along-strike changes in the characteristics of the subducting plate. Variable upper-plate uplift along the Nicoya segment may reflect differences in subducting-plate roughness, thermal structure, fluid flow, and seismogenic-zone locking (up-dip/down-dip limits). Based on the rapid convergence rate (9 cm/yr) and the frequency of historic seismicity, the recurrence interval for large Nicoya earthquakes is estimated at ~50 years. The most recent event, in 1950, generated >1m of coseismic uplift along the central Nicoya

  5. Tracking performance of the polarity-type costas loop at low SNR for UQPSK signal. [Unbalanced Quadri-PSK

    NASA Technical Reports Server (NTRS)

    Park, Y. H.

    1981-01-01

    Carrier tracking performance of the polarity type costas loop is analyzed for unbalanced quadriphase-shift-keyed (UQPSK) signals at low SNR. Squaring losses for various SNR, IF bandwidth, and data rate ratios are presented. The RMS phase jitter for a particular loop is computed for various I and Q channel power and data rate ratios. Experimental results using a breadboard costas loop are also included.

  6. A Historical Study of the Effectiveness of U.S. Security Assistance to Panama, Costa Rica and Nicaragua

    DTIC Science & Technology

    1986-09-01

    LC) 4 ,SL~c, - - - 4,,.’..O, t . A HISTORI AL STUDY OF THE EFFECTIVENESS"" OF U.S. SEC ’PlTY ASSISTANCF TO.’\\ ’ PANA"A, COSTA RICA AND NICARAGUA...Costa Rica ..... .................. ... 18 Nicaragua ...... ... ................... .1 Early History ... .. ................... ... 24 Panama...and the declining world economy combined to lower most Central Americans’ quality of life throughout history to present times. This situation

  7. Customized Consensus Spectral Library Building for Untargeted Quantitative Metabolomics Analysis with Data Independent Acquisition Mass Spectrometry and MetaboDIA Workflow.

    PubMed

    Chen, Gengbo; Walmsley, Scott; Cheung, Gemmy C M; Chen, Liyan; Cheng, Ching-Yu; Beuerman, Roger W; Wong, Tien Yin; Zhou, Lei; Choi, Hyungwon

    2017-05-02

    Data independent acquisition-mass spectrometry (DIA-MS) coupled with liquid chromatography is a promising approach for rapid, automatic sampling of MS/MS data in untargeted metabolomics. However, wide isolation windows in DIA-MS generate MS/MS spectra containing a mixed population of fragment ions together with their precursor ions. This precursor-fragment ion map in a comprehensive MS/MS spectral library is crucial for relative quantification of fragment ions uniquely representative of each precursor ion. However, existing reference libraries are not sufficient for this purpose since the fragmentation patterns of small molecules can vary in different instrument setups. Here we developed a bioinformatics workflow called MetaboDIA to build customized MS/MS spectral libraries using a user's own data dependent acquisition (DDA) data and to perform MS/MS-based quantification with DIA data, thus complementing conventional MS1-based quantification. MetaboDIA also allows users to build a spectral library directly from DIA data in studies of a large sample size. Using a marine algae data set, we show that quantification of fragment ions extracted with a customized MS/MS library can provide as reliable quantitative data as the direct quantification of precursor ions based on MS1 data. To test its applicability in complex samples, we applied MetaboDIA to a clinical serum metabolomics data set, where we built a DDA-based spectral library containing consensus spectra for 1829 compounds. We performed fragment ion quantification using DIA data using this library, yielding sensitive differential expression analysis.

  8. Loss of RhoB Expression Enhances the Myelodysplastic Phenotype of Mammalian Diaphanous-Related Formin mDia1 Knockout Mice

    PubMed Central

    DeWard, Aaron D.; Leali, Kellie; West, Richard A.; Prendergast, George C.; Alberts, Arthur S.

    2009-01-01

    Myelodysplastic syndrome (MDS) is characterized by ineffective hematopoiesis and hyperplastic bone marrow. Complete loss or interstitial deletions of the long arm of chromosome 5 occur frequently in MDS. One candidate tumor suppressor on 5q is the mammalian Diaphanous (mDia)-related formin mDia1, encoded by DIAPH1 (5q31.3). mDia-family formins act as effectors for Rho-family small GTP-binding proteins including RhoB, which has also been shown to possess tumor suppressor activity. Mice lacking the Drf1 gene that encodes mDia1 develop age-dependent myelodysplastic features. We crossed mDia1 and RhoB knockout mice to test whether the additional loss of RhoB expression would compound the myelodysplastic phenotype. Drf1−/−RhoB−/− mice are fertile and develop normally. Relative to age-matched Drf1−/−RhoB+/− mice, the age of myelodysplasia onset was earlier in Drf1−/−RhoB−/− animals—including abnormally shaped erythrocytes, splenomegaly, and extramedullary hematopoiesis. In addition, we observed a statistically significant increase in the number of activated monocytes/macrophages in both the spleen and bone marrow of Drf1−/−RhoB−/− mice relative to Drf1−/−RhoB+/− mice. These data suggest a role for RhoB-regulated mDia1 in the regulation of hematopoietic progenitor cells. PMID:19768111

  9. Aberrant overexpression of CD14 on granulocytes sensitizes the innate immune response in mDia1 heterozygous del(5q) MDS.

    PubMed

    Keerthivasan, Ganesan; Mei, Yang; Zhao, Baobing; Zhang, Ling; Harris, Chad E; Gao, Juehua; Basiorka, Ashley A; Schipma, Matthew J; McElherne, James; Yang, Jing; Verma, Amit K; Pellagatti, Andrea; Boultwood, Jacqueline; List, Alan F; Williams, David A; Ji, Peng

    2014-07-31

    The myelodysplastic syndromes (MDSs) include a spectrum of stem cell malignancies characterized by an increased risk of developing acute myeloid leukemia. Heterozygous loss of chromosome 5q (del[5q]) is the most common cytogenetic abnormality in MDS. DIAPH1 is localized to 5q31 and encodes one of the formin proteins, mDia1, which is involved in linear actin polymerization. Mice with mDia1 deficiency develop hematologic features with age mimicking human myeloid neoplasm, but its role in the pathogenesis of MDS is unclear. Here we report that mDia1 heterozygous and knockout mice develop MDS phenotypes with age. In these mice, CD14 was aberrantly overexpressed on granulocytes in a cell-autonomous manner, leading to a hypersensitive innate immune response to lipopolysaccharide (LPS) stimuli through CD14/Toll-like receptor 4 signaling. Chronic stimulation with LPS accelerated the development of MDS in mDia1 heterozygous and knockout mice that can be rescued by lenalidomide. Similar findings of CD14 overexpression were observed on the bone marrow granulocytes of del(5q) MDS patients. Mechanistically, mDia1 deficiency led to a downregulation of membrane-associated genes and a specific upregulation of CD14 messenger RNA in granulocytes, but not in other lineages. These results underscore the significance of mDia1 heterozygosity in deregulated innate immune responses in del(5q) MDS.

  10. Loss of RhoB expression enhances the myelodysplastic phenotype of mammalian diaphanous-related Formin mDia1 knockout mice.

    PubMed

    DeWard, Aaron D; Leali, Kellie; West, Richard A; Prendergast, George C; Alberts, Arthur S

    2009-09-21

    Myelodysplastic syndrome (MDS) is characterized by ineffective hematopoiesis and hyperplastic bone marrow. Complete loss or interstitial deletions of the long arm of chromosome 5 occur frequently in MDS. One candidate tumor suppressor on 5q is the mammalian Diaphanous (mDia)-related formin mDia1, encoded by DIAPH1 (5q31.3). mDia-family formins act as effectors for Rho-family small GTP-binding proteins including RhoB, which has also been shown to possess tumor suppressor activity. Mice lacking the Drf1 gene that encodes mDia1 develop age-dependent myelodysplastic features. We crossed mDia1 and RhoB knockout mice to test whether the additional loss of RhoB expression would compound the myelodysplastic phenotype. Drf1(-/-)RhoB(-/-) mice are fertile and develop normally. Relative to age-matched Drf1(-/-)RhoB(+/-) mice, the age of myelodysplasia onset was earlier in Drf1(-/-)RhoB(-/-) animals--including abnormally shaped erythrocytes, splenomegaly, and extramedullary hematopoiesis. In addition, we observed a statistically significant increase in the number of activated monocytes/macrophages in both the spleen and bone marrow of Drf1(-/-)RhoB(-/-) mice relative to Drf1(-/-)RhoB(+/-) mice. These data suggest a role for RhoB-regulated mDia1 in the regulation of hematopoietic progenitor cells.

  11. Ambient Tremor, But No Triggered Tremor at the Northern Costa Rica Subduction Zone

    NASA Astrophysics Data System (ADS)

    Swiecki, Z.; Schwartz, S. Y.

    2010-12-01

    Non-volcanic tremor (NVT) has been found to be triggered during the passage of surface waves from various teleseismic events in locations around the world including Cascadia, Southwest Japan, Taiwan, and California. In this study we examine the northern Costa Rica subduction zone for evidence of triggered tremor. The Nicoya Peninsula segment of the northern Costa Rica margin experiences both slow-slip and tremor and is thus a prime candidate for triggered tremor observations. Eleven teleseismic events with magnitudes (Mw) greater than 8 occurring between 2006 and 2010 were examined using data from both broadband and short period sensors deployed on the Nicoya Peninsula, Costa Rica. Waveforms from several large regional events were also considered. The largest teleseismic and regional events (27 February 2010 Chile, Mw 8.8 and 28 May 2009 Honduras, Mw 7.3) induced peak ground velocities (PGV) at the NIcoya stations of ~2 and 6 mm/s, respectively; larger than PGVs in other locations that have triggered tremor. Many of the earthquakes examined occurred during small episodes of background ambient tremor. In spite of this, no triggered tremor was observed during the passage of seismic waves from any event. This is significant because other studies have demonstrated that NVT is not triggered everywhere by all events above some threshold magnitude, indicating that unique conditions are required for its occurrence. The lack of triggered tremor at the Costa Rica margin can help to better quantify the requisite conditions and triggering mechanisms. An inherent difference between the Costa Rica margin and the other subduction zones where triggered tremor exists is its erosional rather than accretionary nature. Its relatively low sediment supply likely results in a drier, lower pore fluid pressure, stronger and less compliant thrust interface that is less receptive to triggering tremor from external stresses generated by teleseismic or strong local earthquakes. Another

  12. PM10 Concentration Estimates over Costa Rica using Chemical Transport Modeling Techniques

    NASA Astrophysics Data System (ADS)

    Briceno-Castillo, J. S.; Vidaurre, G.; Herrera, J.; Mora, R.; Rivera-fernandez, E. R.; Duran-Quesada, A. M.

    2016-12-01

    Aerosol pollution has become a major issue in Costa Rica because of the urban development that induces an increase in vehicle and industrial emissions. The Metropolitan area in Costa Rica is a valley ( 1,967 km2 area) with a population of 2.6 million. This area concentrates 60% of the country's total industry and 57% of its vehicle emissions. In addition, this area is impacted by biogenic emissions coming from national forests surround it and windblown dust from the Sahara Desert transported by the Trade winds. PM10 and other criteria pollutants have been measured in the past 12 years. However, those monitor stations are single points of observation and do not represent the spatial and temporal resolution that the Costa Rican national government requires for long term policy decisions and health effects assessments. This investigation uses the Weather Research and Forecasting model coupled with Chemistry version 3.7 (WRF-Chem) to forecast PM10 concentration over Costa Rica in 2013. The temporal scales take into consideration the dry, rainy, and transition seasons of the country. The spatial domain was constructed with a master domain (27 km resolution) and multiple nested-domains (9, 3, and 1 km respectively) that include the total area of Costa Rica. The meteorology data bases for this model are from the European Centre for Medium-Range Weather Forecasts (ECMWF) Interim Reanalysis (Era-Interim; Dee et al. 2011). In addition, the chemical transport model uses emissions inventories from the PREP-CHEM-SRC tool, because of the lack of an appropriate national emission inventory for this investigation. The total average of PM10 observed at the metropolitan area of Costa Rica was 26±9 μgm-3 in 2013. According to the World Health Organization, this result exceeds the PM10 standard established in the air quality guidelines (WHO 2005). The final goal of this investigation is to evaluate the chemical transport simulations with ground-level measurements from more than 10

  13. Exploring the Notion That Subduction Erosion Has Removed or Submerged Costa Rica's Early Tertiary Arc Massifs

    NASA Astrophysics Data System (ADS)

    Scholl, D. W.

    2007-05-01

    Arc igneous rocks of Paleocene, Eocene, and Oligocene age are widely exposed in the southern, coastal region of Panama (Lissinna et al., EGU abstract, 2006). These rocks intrude or overlie mafic basement rock of the Caribbean Large Igneous Province (CLIP) of Late Cretaceous age that extends to the east to underlie the Caribbean Basin and form the Caribbean plate. Immediately west of Panama, in coastal Costa Rica, exposures of CLIP basement are not intruded or overlain by arc magmatic rocks of early Tertiary age. EXPLANATIONS: Potentially, the early Tertiary subduction zone that dipped beneath the Pacific margin of Panama did not extend to the west, thus no arc magmatism occurred where Costa Rica presently exists. Alternatively, the subduction zone bordering the Pacific edge of the CLIP extended below Costa Rica but former exposures of early Tertiary arc magmatic rocks piled there have been erosionally removed or buried beneath Miocene and younger arc massifs of interior mountain belts. EXPLORING A SUBDUCTION EROSION EXPLANATION Onshore and offshore evidence documents that subduction erosion thins and truncates the submerged rock framework of the Middle and South America forearc. The eroded (removed) material is transported toward and into the mantle within the subduction channel separating the upper plate of the forearc and lower plate of the subducting oceanic crust. The long-term (greater than 10 Myr) rate of truncation (i. e., migration of the trench toward a fixed, onshore reference) averages 2 to 3 km/Myr. Because of the subduction of the aseismic Cocos Ridge beneath Costa Rica, during at least the past 4 to 5 Myr the rate of truncation at this margin has been much higher. It is proposed that during the past 50 Myr subduction erosion has truncated the Costa Rica forearc by at least 100 km and either obliterated or deeply submerged arc massifs of early Tertiary age. Their exposed presence to the east in neighboring Panama reflects the circumstance that since

  14. [Rural endemic diseases, health and development: Emmanuel Dias and the construction of a network of allies against Chagas disease].

    PubMed

    Kropf, Simone Petraglia

    2016-11-01

    The scope of this article is to analyze the trajectory of Emmanuel Dias (1908-1962), a researcher at the Oswaldo Cruz Institute (OCI) and director of the Center for Studies and Prophylaxis of Chagas Disease (OCI outpost established in 1943 in the city of Bambuí, Minas Gerais), as a key actor in the acknowledgement of Chagas disease as a public health problem in Brazil and the Americas. It seeks to show that the conquest of this acknowledgement, the cornerstone of which was the staging of the first campaign to combat the disease in Brazil in 1950, was made possible by the intense political mobilization of Dias together with the various social groups, such as physicians, politicians and residents of rural areas, public health officials, governments and international organizations. This mobilization occurred during the 1940s and 1950s in a historical context marked by intense debate about the relationship between health and development and helped to construct a network of alliances that was critical for the recognition of Chagas disease as a chronic cardiopathy, which threatened the productivity of rural workers and represented a medical and social problem that merited public health actions and programs geared to get it under control.

  15. Memo-RhoA-mDia1 signaling controls microtubules, the actin network, and adhesion site formation in migrating cells.

    PubMed

    Zaoui, Kossay; Honoré, Stéphane; Isnardon, Daniel; Braguer, Diane; Badache, Ali

    2008-11-03

    Actin assembly at the cell front drives membrane protrusion and initiates the cell migration cycle. Microtubules (MTs) extend within forward protrusions to sustain cell polarity and promote adhesion site turnover. Memo is an effector of the ErbB2 receptor tyrosine kinase involved in breast carcinoma cell migration. However, its mechanism of action remained unknown. We report in this study that Memo controls ErbB2-regulated MT dynamics by altering the transition frequency between MT growth and shortening phases. Moreover, although Memo-depleted cells can assemble the Rac1-dependent actin meshwork and form lamellipodia, they show defective localization of lamellipodial markers such as alpha-actinin-1 and a reduced number of short-lived adhesion sites underlying the advancing edge of migrating cells. Finally, we demonstrate that Memo is required for the localization of the RhoA guanosine triphosphatase and its effector mDia1 to the plasma membrane and that Memo-RhoA-mDia1 signaling coordinates the organization of the lamellipodial actin network, adhesion site formation, and MT outgrowth within the cell leading edge to sustain cell motility.

  16. Systematic observations of Volcán Turrialba, Costa Rica, with small unmanned aircraft and aerostats (UAVs): the Costa Rican Airborne Research and Technology Applications (CARTA) missions

    NASA Astrophysics Data System (ADS)

    Pieri, D. C.; Diaz, J. A.; Bland, G.; Fladeland, M. M.; Abtahi, A.; Alan, A., Jr.; Alegria, O.; Azofeifa, S.; Berthold, R.; Corrales, E.; Fuerstenau, S.; Gerardi, J.; Herlth, D.; Hickman, G.; Hunter, G.; Linick, J.; Madrigal, Y.; Makel, D.; Miles, T.; Realmuto, V. J.; Storms, B.; Vogel, A.; Kolyer, R.; Weber, K.

    2014-12-01

    For several years, the University of Costa Rica, NASA Centers (e.g., JPL, ARC, GSFC/WFF, GRC) & NASA contractors-partners have made regular in situ measurements of aerosols & gases at Turrialba Volcano in Costa Rica, with aerostats (e.g., tethered balloons & kites), & free-flying fixed wing UAVs (e.g., Dragon Eye, Vector Wing 100, DELTA 150), at altitudes up to 12.5Kft ASL within 5km of the summit. Onboard instruments included gas detectors (e.g., SO2, CO2), visible & thermal IR cameras, air samplers, temperature pressure & humidity sensors, particle counters, & a nephelometer. Deployments are timed to support bimonthly overflights of the Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER) onboard the NASA Terra satellite (26 deployments to date). In situ observations of dilute plume SO2 concentrations (~1-20ppmv), plume dimensions, and associated temperature, pressure, & humidity profiles, validate detailed radiative transfer-based SO2 retrievals, as well as archive-wide ASTER band-ratio SO2 algorithms. Our recent UAV-based CO2 observations confirm high concentrations (e.g., ~3000ppmv max at summit jet), with 1000-1500ppmv flank values, and essentially global background CO2 levels (400ppmv) over distal surroundings. Transient Turrialba He detections (up to 20ppmv) were obtained with a small (~10kg) airborne mass spectrometer on a light aircraft—a UAV version (~3kg) will deploy there soon on the UCR DELTA 500. Thus, these platforms, though small (most payloads <500gm), can perform valuable systematic measurements of potential eruption hazards, as well as of volcano processes. Because they are economical, flexible, and effective, such platforms promise unprecedented capabilities for researchers and responders throughout Central and South America, undertaking volcanic data acquisitions uniquely suited to such small aircraft in close proximity to known hazards, or that were previously only available using full-sized manned aircraft. This work was

  17. [Incidence and altitudinal distribution of 13 virus cultures in Solanum tuberosum (Solanaceae) from Costa Rica].

    PubMed

    Vásquez, Viviana; Montero-Astúa, Mauricio; Rivera, Carmen

    2006-12-01

    A survey was conducted in 30 fields located at three different altitudes in Cartago, Costa Rica's main potato producing area. Twenty plants were sampled per farm, for a total of 600 samples with 200 samples per altitude. ELISA was used with commercial reagents to independently test for PVX, PVY, PVM, PVA, PVS, PLRV, PMTV, PAMV, PVV, PVT, APLV, APMoV and TRSV. The presence of the following viruses was determined: PVX (77 %), PAMV (62 %), PLRV (42 %), TRSV (42 %), PVT (39 %), PVV (37 %), PMTV (31%), PVY (30 %), PVS (19 %), PVM (13 %), PVA (8 %), and APMoV (8%). APLV was not detected in any sample. This is the first report in Costa Rica of the presence of the viruses PMTV, PAMV, PVV, PVT and APMoV. A high viral incidence in the tuber seed production area as well as a high rate of mixed infections is reported.

  18. Costa Rican environmental service payments: The use of a financial instrument in participatory forest management.

    PubMed

    Miranda, Miriam; Dieperink, Carel; Glasbergen, Pieter

    2006-10-01

    The core element of the Costa Rican forestry policy is a financial instrument called the environmental service payment. This instrument rewards forest owners for the environmental services (the mitigation of greenhouse gases, the protection of watersheds and scenic beauty, and the development of biodiversity) their forests provide. In this article, the experiences with this new instrument are analyzed by focusing on the way interests are represented and access is granted, the openness of information exchange, whether social learning occurred, and whether decision-making authority is shared. The analysis is based on a survey conducted in the Huetar Norte Region and on in-depth interviews with the major stakeholders. The Costa Rican case indicates that financial instruments can be used to share responsibilities and that stakeholders can successfully cooperate on forest issues. It also shows that such a participatory approach is only promising if certain cultural, economic, organizational, and political conditions are met.

  19. Accelerations from the September 5, 2012 (Mw=7.6) Nicoya, Costa Rica Earthquake

    NASA Astrophysics Data System (ADS)

    Simila, G. W.; Quintero, R.; Burgoa, B.; Mohammadebrahim, E.; Segura, J.

    2013-05-01

    Since 1984, the Seismic Network of the Volcanological and Seismological Observatory of Costa Rica, Universidad Nacional (OVSICORI-UNA) has been recording and registering the seismicity in Costa Rica. Before September 2012, the earthquakes registered by this seismic network in northwestern Costa Rica were moderate to small, except the Cóbano earthquake of March 25, 1990, 13:23, Mw 7.3, lat. 9.648, long. 84.913, depth 20 km; a subduction quake at the entrance of the Gulf of Nicoya and generated peak intensities in the range of MM = VIII near the epicentral area and VI-VII in the Central Valley of Costa Rica. Six years before the installation of the seismic network, OVSICORI-UNA registered two subduction earthquakes in northwestern Costa Rica, specifically on August 23, 1978, at 00:38:32 and 00:50:29 with magnitudes Mw 7.0 (HRVD), Ms 7.0 (ISC) and depths of 58 and 69 km, respectively (EHB Bulletin). On September 5, 2012, at 14:42:02.8 UTC, the seismic network OVSICORI-UNA registered another large subduction earthquake in Nicoya peninsula, northwestern Costa Rica, located 29 km south of Samara, with a depth of 21 km and magnitude Mw 7.6, lat. 9.6392, long. 85.6167. This earthquake was caused by the subduction of the Cocos plate under the Caribbean plate in northwestern Costa Rica. This earthquake was felt throughout the country and also in much of Nicaragua. The instrumental intensity map for the Nicoya earthquake indicates that the earthquake was felt with an intensity of VII-VIII in the Puntarenas and Nicoya Peninsulas, in an area between Liberia, Cañas, Puntarenas, Cabo Blanco, Carrillo, Garza, Sardinal, and Tamarindo in Guanacaste; Nicoya city being the place where the maximum reported intensity of VIII is most notable. An intensity of VIII indicates that damage estimates are moderate to severe, and intensity VII indicates that damage estimates are moderate. According to the National Emergency Commission of Costa Rica, 371 affected communities were reported; most

  20. The therapeutic exception: abortion, sterilization and medical necessity in Costa Rica.

    PubMed

    Carranza, María

    2007-08-01

    Based on the case of Rosa, a nine-year-old girl who was denied a therapeutic abortion, this article analyzes the role played by the social in medical practice. For that purpose, it compares the different application of two similar pieces of legislation in Costa Rica, where both the practice of abortion and sterilization are restricted to the protection of health and life by the Penal Code. As a concept subject to interpretation, a broad conception of medical necessity could enable an ample use of the therapeutic exception and a liberal use of both surgeries. The practice of therapeutic sterilization has been generalized in Costa Rica and has become the legitimate way to distribute contraceptive sterilization. In contrast, therapeutic abortion is very rarely practiced. The analysis carried out proposes that it is the difference in social acceptance of abortion and sterilization that explains the different use that doctors, as gatekeepers of social morality, make of medical necessity.