Sample records for costa dias joao

  1. Inversion of Seismic Cross-hole Data from Dom Joao Field, Reconcavo Basin, Brazil

    NASA Astrophysics Data System (ADS)

    Bassrei, A.; Oliveira, N. P. D.


    Seismic Tomography was incorporated in Reservoir Geophysics with the intention of providing high-resolution images of regions in the Earth's subsurface that are characterized as potential reservoirs. In this work, seismic traveltime tomography in the transmission mode was applied to real data from the Dom Joao Field, Reconcavo Basin, State of Bahia, Brazil. This basin represents a landmark of oil exploration in Brazil and has been intensively studied since the 1950s. Today, the Reconcavo Basin is still the principal oil producer in the State of Bahia, but there is a demand for new technologies, especially for mature fields, to improve hydrocarbon recovery. Acoustic ray tracing for the computation of traveltimes was used for forward modeling, and the conjugate gradient algorithm with regularization through derivative matrices was used as an inverse procedure. The tomographic inversion is an ill-posed problem because the existence, uniqueness and stability conditions are not completely satisfied. Mathematical techniques are commonly used with the intention of providing better conditioning for the numerical solution of such problems. The input data in the system are the traveltimes between the sources and the receivers and the distances propagated by each ray connecting such sources and receivers. Both inputs are provided through acoustic forward modeling. The linear system is regularized by derivative matrices derived to minimize the instability. This regularization procedure has a crucially important parameter called regularization parameter lambda. For the selection of lambda we used the L-module, which is based on the well-known L-curve. The estimated tomograms were consistent with previous geological knowledge of the area and the P-wave velocity range was consistent. The results showed that traveltime tomography is feasible for the characterization of reservoirs with a high rate of vertical change, similar to the Dom Joao Field.

  2. Costa Rica.



    This discussion of Costa Rica focuses on: geography, people and history, government, political conditions, the economy, defense, foreign relations, and relations between the US and Costa Rica. In 1985 the population totaled 2.6 million with an annual growth rate of 2.6%. The infant mortality rate is 15.2/1000; life expectancy is 67.5 years for men and 71.9 years for women. Costa Rica, the 2nd smallest Central American country, is located in a narrow strip between Panama and Nicaragua. Costa Ricans are overwhelmingly of European descent. Although preominantly Spanish, there also are many Costa Ricans of German, Dutch, and Swiss origin. The indigenous Indian population numbers about 20,000, 20% fewer than inhabited Costa Rica when the Spanish first settled in 1522. Blacks, descendants of 19th century Jamaican immigrant workers, constitute a significant English-speaking minority of 30,000. Costa Rica is a democratic republic with a strong systems of checks and balances. The president and 57 legislative assembly deputies are elected for 4-year terms. Costa Rica's political system has contrasted with that of its neighbors. The nation has steadily developed and maintained democratic institutions and an orderly, constitutional process of government succession. Costa Rica faces severe challenges to its economic stability, although traditionally it is one of the strongest nations in the region. Increases in government spending in the late 1970s and higher world prices for coffee and other important Costa Rican exports stimulated the economy, creating inflationary pressure. The government is pursuing a course of disciplined management. The country is an outsponken and active member of the international community. The cordial relationship between Costa Rica and the US is based on mutual respect for democratic traditions, common goals, and a relationship free from serious political disagreement.

  3. Spatial distribution of hypocentres and crustal model in Joao Camara, Northeastern Brazil

    NASA Astrophysics Data System (ADS)

    Fernandes, C.; Berrocal, J.; Takeya, M.; Bezerra, F. H.; Sislva, J.; Barros, P.


    An important seismic cycle that begun in August 1986 occurred in João Câmara, Northeastern region of Brazil, which lasted for several years producing more than 60.000 small to medium magnitude earthquakes. The more important event of this cycle (mb 5.1 and intensity VII MM) occurred on November 30, 1986. The epicentral area is on the border of the Late Cretaceous sedimentary Potiguar basin that overlays the Precambrian shield. Large Late Precambrian SW-NE transcurrent ductile shear zones divide the shield in this region. These shear zone have been reactivated in the Cretaceous and again in the Cenozoic as brittle structures. Data for this study were collected from a local nine-station network installed by Cardiff and UFRN universities, obtained during June to September 1987. Using a simultaneous inversion method, hypocentres of some earthquakes of that sequence and a local structural model, were obtained with the VELEST program. Those hypocenters were also relocated with the HYPODD program for comparing the results obtained with both methods. An elongated SW-NE feature around represents the seismogenic source 40 km long. Stable solutions for the simultaneous inversion were obtained after about 400 iterations for the northern portion and 53 for the southern portion. The mean structural model beneath the seismographic network show tree layers with increasing VP from around 5.8 km/s to around 6.2 km/s, at the bottom of the third layer in 6.5 km of depth, showing also a probable low velocity layer between 3 and 5.5 km of depth. The hypocentres present depths between 0.9 and 9.0 km. The spatial distribution of those hypocentres and the composite focal mechanism solutions suggest a correlation with a dextral transcurrent fault, passing close to the east of Joao Camara, with a small normal component segmented in at least three no- coplanar portions with a dominant strike of around 41°. The dip angle, oriented to the NW, changes from 76° in the northern portion to 66

  4. Costa Rica.



    The Republic of Costa Rica is one of the most stable and strongest countries in Central America. It is bordered by Nicaragua and Panama to the north and south and the Caribbean Sea and the Pacific ocean to the east and west and has a total land size slightly smaller than West Virginia. Costa Ricans enjoy a high life expectancy and literacy rate. As well, schools have an attendance rate of nearly 100%. The predominant ethnic group is white, and the predominant spoken language is Spanish. The work force is divided up as follows: 32% agriculture, 25% industry and commerce, 38% services and government, and 5% finance and banking. The country's climate is tropical and subtropical, and the geography of Costa Rica is composed of rugged terrain, mountains, large forest areas, some lowlands and 3 volcanic mountain ranges. The great majority of Costa Ricans are of European descent with only small numbers of the indigenous Indian population surviving today. The government of Costa Rica is democratic, holding periodic elections. The electoral process is monitored by the Supreme Electoral Tribunal. Other bodies of government include the Supreme Court of Justice and the Legislative Assembly. The National Liberation Party has been in power since 1948 and represents socialist ideals. Many factors such as: an influx of enlightened leaders and officials, flexible class lines, economic prosperity and the absence of military force have allowed Costa Rica to progress and maintain a stable economy and government amidst an unstable region. Costa Rica's relations with other countries and international organizations are excellent.

  5. On markets and morals--(re-)establishing independent decision making in healthcare: a reply to Joao Calinas-Correia.


    Sahm, Stephan


    Medical practitioners owe much of the significant progress made in the diagnosis and treatment of disease to industrial research. Hence, co-operation between providers of medical services, most notably medical practitioners, and the pharmaceutical industry is in the best interest of patients. Yet, empirical evidence shows how well-directed influence exerted by the pharmaceutical industry impacts physicians' decision-making. Profit-motivated inducement by the pharmaceutical industry may expose patients to considerable risks. Against what many think to be based on overwhelming evidence, Joao Calinas-Correia takes the view that the criticism levelled at the pharmaceutical industry as well as the call for transparency in the relationships between physicians and the industry are exaggerated. In his polemic he praises "Big Pharma" as a success and espouses the view that the undesired consequences of its activities are allegedly inherent in the underlying market environment shaped by politics. Moreover, he believes that the proposals made to control and eliminate such undesired effects will lead to mediocrity. Astonishingly, his polemic reaches out to contest the appropriateness of setting rules at all-even if being set by a democratic process. Calinas-Correia's assertions are based on the wrong premises. They fail to recognize that today individual civil rights and liberties often enough do not have to be defended against encroachments by governmental authorities. Rather, it is incumbent on the state to create rules designed to defend the individual against infringements by overly powerful non-governmental institutions, in our case the medical-industrial complex. Given the power exercised by physicians and the special nature of their role in public health, clear-cut rules have to be enacted and implemented with respect to their relationship to Big Pharma.

  6. Costa Rica.



    The focus in this discussion of Costa Rica is on the following: the history of the country's demographic situation; the government's overall approach to population problems; statistical systems and development planning; institutional arrangements for the integration of population within development planning; the government's view of the importance of population policy in achieving development objectives; population size, growth, and natural increase; morbidity and mortality; fertility; international migration; and spatial distribution. The government of Costa Rica does not advocate direct intervention to modify the rate of population growth, largely because of its rapid decline in fertility and its moderate rate of natural increase. 5 censuses have been conducted since 1892, and the most recent census was conducted in 1973. The registration for births and deaths is complete. A National Fertility Survey was conducted in 1976 in cooperation with the World Fertility Survey. An important government priority in recent years has been the development of an institutional framework for the further integration of population factors within development plans. A National Commission on Population Policy was established in 1978. Population policy is viewed as instrumental in realizing the government's political objectives and overall development goals. The National Commission on Population Policy approved the terms of reference for a comprehensive population policy in 1979. The government considers its rate of population growth to be unsatisfactory because it remains moderately high. The crude death rate was estimated to be slightly more than 4/1000 in 1977. The government considers levels and trends of mortality to be acceptable. The crude birthrate declined to about 22.0 in 1975. The government considers levels and trends of fertility to be unsatisfactory because they are too high. The government now considers levels and trends of emigration to be significant and unsatisfactory

  7. Costa Rica.



    Costa Rica is a country of 51,032 sq. km with 3 million inhabitants, of whom 93% are literate. Independence was gained on September 15, 1821. The terrain consists of eastern and western coastal plains separated by a rugged, central massif, with a climate ranging from tropical to subtropical. Spanish and a Jamaican dialect of English are spoken by European, black, and indigenous ethnic groups who are overwhelmingly of Roman Catholic faith. Life expectancy is approximately 70 years. The gross domestic product is $5.6 billion, growing at a rate of 1%. Per capita income is $1810. Hydroelectric power is a natural resource of the country. Food processing, textiles, construction materials, and fertilizer, as well as banana, coffee, beef, sugarcane, and grain agriculture are areas of economic production. Manufactured goods, machinery, transportation equipment, chemicals, fuel, food, and fertilizer are imported, and bananas, coffee, beef, sugarcane, and grain are exported. In-depth information is also given on the people and history, government and principal officials, political conditions, the economy, defense, foreign relations, relations with the US, and names of principal US officials in the country.

  8. Lessons from Costa Rica

    ERIC Educational Resources Information Center

    Borthwick, Arlene; Lobo, Irina


    Costa Rica has one of the highest concentrations of computers in the Americas and is regarded as a Central American pioneer in technology development. The authors of this article describe their trip to Costa Rica, which included visits to several schools as well as to the Foundation Omar Dengo (FOD) and the Ministry of Public Education (MEP),…

  9. Spotlight: Costa Rica.



    3.5 million people lived in Costa Rica as of mid-1997. There were 24 births and 4 deaths per 1000 population, respectively, contributing to the annual natural increase rate of 2.0%. Each woman in Costa Rica bears an average of 2.8 children during her reproductive lifespan and men and women were expected to live for 73 and 78 years, respectively. Costa Rica's low infant mortality rate and high literacy and life expectancy rates set it apart from the rest of Central America. Costa Rica is also the only country in the region which maintains no standing army. About 96% of the population is White or Mestizo, 3% is Black, and 1% is indigenous Indian. More than half of the country lives in San Jose and its metropolitan area, 6% of the country's total land area. Unemployment has run near 5% over the past 2 years, but much of the labor force is underemployed. Costa Rica's economy depends upon tourism and agricultural exports such as coffee, beef, and bananas. A large Intel factory opened in 1997. The government and Costa Rican environmentalists are planning a joint campaign to reconvert 80% of Costa Rica's pasture back to forest and tree crops. About 20% of the government's budget is spent upon education and the 93% literacy rate is the highest in the region. Government health services provide low-cost contraceptives to more than 75% of users and 75% of women use some form of family planning.

  10. Educacion Fisica in Costa Rica.

    ERIC Educational Resources Information Center

    Cleland, Donna


    The goal of Costa Rica's Department of Physical Education and Sports is the "utilization of sport, physical education, and recreation as instruments of socialization and contribution to the improved health of Costa Ricans." (JN)

  11. Costa Rica. Spotlight.


    Haub, C; Adams, J


    Costa Rica's demographic and economic characteristics are highlighted. Costa Rica's demographic situation is unique in certain respects. Between the late 1950s and the late 1970s, the total fertility rate declined from about 7 to 4 and then stabilized instead of continuing to decline to 2 as expected. This is especially surprising since the level of contraceptive use is similar to that of most European countries. Approximately 2/3 of all couples practice contraception. It is possible that the rate will slowly decline to the expected level, but a delayed decline will ultimately produce a much larger population than initially expected. The demographic situation in Costa Rica is being carefully monitored for insights which might be useful in predicting future fertility patterns in other developing countries. The government of Costa Rica recognizes that family planning is a necessary component of maternal and child health care; however, most family planning services are provided by private organizations. In 1982, population size was 2.6 million, the crude birth rate was 30.7, the crude death rate was 3.9, infant mortality was 19.3, and the rate of natural increase was 2.7%. The population is predominantly Spanish, and the indigenous population totals only 20,000. 48% of the population is urban. Costa Rica has a relatively stable deomocratic government. It relationshiops with other countries are generally peaceful, but tensions between Nicaragua and Costa Rica are increasing. The country's economic situation deteriorated in recent years due primarily to a decline in the price of coffee, the country's principle export commodity. The trade deficit increased markedly, unemployment increased, and income fell sharply. The economic slowdown is now showing signs of a reversal. In 1983 exports, consisting primarily of coffee, bananas, beef, sugar, cane and cacao, totalled US$871 million, and imports, consisting mainly of manufactured goods and equipment, chemicals, fuel, food

  12. Staggered Costas signals

    NASA Astrophysics Data System (ADS)

    Freedman, Avraham; Levanon, Nadav


    A radar signal, based on coherent processing of a train of staggered Costas (1984) bursts is based on a minimum number of collocation of their individual ambiguity function sidelobe peaks. The resulting ambiguity function combines qualities of both 'thumbtack' and 'bed of nails' signals. Comparison with linear-FM, V-FM, and complementary phase coded signals is given, as well as comparison with hybrid signals consisting of both phase and frequency coding.

  13. Area Assessment. Costa Rica

    DTIC Science & Technology


    de la Muerte Oscar Aguilar R. Estereo S Sari Jo;; c Nicolasa Rojas i\\ . S e n d a s A Volcnri Irazu F.stereo Continent K. Estereo...Cart ago , Carlos La.fuente R. Runibc Volcnn I7:n2u >U;lt Vision de CT. ]•;. S i 3 t U n ■ Cerro c’c la Muerte Cad EtTiis...Quesada rL. Ultraso;: VolcSn Irazu -h Min de Cultura "■> Kaciona’:. Lii;i5n U de Costa Rica R. U n i V e I’s ’^ - San

  14. San Jose, Costa Rica

    NASA Technical Reports Server (NTRS)


    San Jose, capital city of Costa Rica, fills the valley between two steep mountain ranges. In this image made from data collected by the Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER) instrument on NASA's Terra satellite, visible, shortwave, and near-infrared wavelengths of light that the sensor observed have been combined to produce a false-color version of the scene in which vegetation is red, urban areas are silvery gray, water is dark blue, and clouds are white. The image was captured on February 8, 2007. San Jose is in the center of the image. The Rio Torres winds through downtown San Jose. Cartago, the much smaller colonial capital, sits in the lower right corner, while the city of Alajuela appears across the river, northwest of San Jose. The cities' manmade surfaces contrast sharply with the lushly vegetated landscape surrounding the city. Greenhouses are common in the region, and their glass roofs may be the brilliant white spots around the outer edges the cities. The long, straight runway of the Tobias Bolanos International Airport is visible as a dark line southeast of Alajuela. The landscape around the two cities shown here is rugged. Steep mountain peaks cast dark shadows across their leeward slopes. Patches of dark red vegetation on the mountains north of San Jose may be rainforest. Coffee plantations also cover the slopes of the mountains around the city. February is the dry season in Costa Rica. During the rainy season, from about April to November, clouds usually block the satellite's view of this tropical location. NASA image created by Jesse Allen, using data provided courtesy of Asaf Ullah and Tim Gubbels, SERVIR project.

  15. AmeriFlux US-Dia Diablo

    SciTech Connect

    Wharton, Sonia


    This is the AmeriFlux version of the carbon flux data for the site US-Dia Diablo. Site Description - The site is on land owned by Lawrence Livermore National Laboratory (Site 300) and has no grazing or management history since the 1950's except for summer-time burning of selected acres for fire management (not included in the tower footprint).

  16. Area Handbook for Costa Rica.

    ERIC Educational Resources Information Center

    Blutstein, Howard I.; And Others

    This handbook is an attempt to provide an integrated exposition and analysis of the dominant social, political, and economic aspects of the Costa Rican society. It is designed to give readers an understanding of the dynamics of the component elements of the society and an insight into the ideas and goals of its people. Chapters contain material…

  17. [Costa acro-kerato-elastoidosis].


    Boudghène-Stambouli, O; Merad-Boudia, A; Benkalfat, M R; Khedim, A


    We report 2 cases of acrokeratoelastoidosis of Costa observed in two sisters born of unaffected first cousins. The lesions were lenticular papules, either white or of normal skin colour, which were isolated or arranged in groups of plaques crossed by the natural furrows and located on the thenar eminences, the lateral edges of the hands and fingers and the back of the interphalangeal joints. On the feet, the lesions, located on the lateral edges, the plantar arch and the heel, were much more keratotic and appeared to be translucent. Hyperhidrosis was noted in only one of the two patients. Histological examination showed, beneath an acanthotic and hyperkeratotic epidermis, a reduced elastic network with shorter and thinner fibres in the middle dermis. These are two typical but rough cases of acrokeratoelastoidosis of Costa. The mode of transmission of this disease (autosomal recessive?) seems to be unusual compared with the data found in the literature (dominant, or sporadic cases).

  18. The peats of Costa Rica

    SciTech Connect

    Thayer, G.R.


    Peat has been identified in Cost Rica, and an economic analysis of energy applications for peat has been done. About 1000 km{sup 2} of Cost Rica has the potential of being covered by peat. The Talamanca Mountains and the northeastern plains contain most of the Costa Rican peat. Specific bogs have been identified by the Medio Queso River in north-central Costa Rica and near El Cairo, Moin, and the Limon airport in northeastern Costa Rica. The Medio Queso bog, which is supplying peat for use as a carrier for nitrogen-fixing bacteria, and the El Cairo bog, which has been identified as a source of horticultural peat for nearby ornamental plant farms, are of special interest. The economics of three energy applications of peat were examined -- as a fuel in large boilers, as a fuel in small boilers, and as an oil substitute in a cement plant. A facility using coal would have the same total costs as one using peat if coal prices were $45 and $30 per metric ton (used for large boilers and a cement plant, respectively). A facility using Bunker C or diesel would have the same total cost as one using peat if oil prices were $0.11, $0.08, and $0.06 per liter (used for large boilers, small boilers, and a cement plant, respectively). In all three cases, the costs for peat were comparable or less than the costs for coal and oil at 1987 prices. 6 refs., 8 figs.

  19. Mercury Contamination in Costa Rica

    NASA Astrophysics Data System (ADS)

    Varekamp, J. C.; Haynes, A.; Balcom, P. H.


    Recent measurements of Hg in air in the central valley of Costa Rica produced some remarkably high values (up to 700 ng Hg/m3;Castillo et al., 2011), raising concerns for public health. We made a broad assessment of Hg as an environmental contaminant in Costa Rica, and sampled and analyzed lake and wetland sediment and soils to derive atmospheric Hg deposition rates. We also measured Hg(0) in air in three locations, and sampled local fish that were analyzed for Hg. We set up a sampling program of Hg in hair of Costa Ricans, sampling hair from a broad crossection of the population, in combination with dietary and personal information. The lake sediments had Hg concentrations between 34 and 316 ppb Hg, with several lakes at common natural background concentrations (20-100 ppb Hg). Some lakes showed a Hg contamination component with concentrations well above simple background values. These sediments also were very rich in organic matter, and the high Hg concentrations may be a result of Hg focusing from the watersheds into the lake depositional environments. Deduced atmospheric deposition rates of Hg range from 0.16-0.25 ng Hg/cm2 per year, which is at the low end of the global range of measured wet atmospheric deposition rates. The observed Hg concentrations in sediment and soils thus can be characterized as natural background to mildly contaminated, but nothing that would indicate Hg inventories as expected from the reported high Hg air burdens. Some of our Hg(0) in air measurements were done at the same locations as those done earlier and yielded values between 0.6-4.2 ng Hg/m3; these values are similar to the low range measurements of Castillo et al. (their night time values), but we found no evidence in 2011 for their high daytime values. The range of a few ng Hg/m3 in air is compatible with global Hg dispersion modeling. Fish tissue of Trout and Tilapia gave a range of 68-112 ppb Hg (wet weight base), well below the 300 ppb Hg EPA alert level. Overall, these

  20. Counseling in Costa Rica: A Comparative Study

    ERIC Educational Resources Information Center

    Collier, Crystal


    With one of the world's most comprehensive universal healthcare systems, medical tourism in Costa Rica has increased significantly over the past few decades. American tourists save up to 80% of comparative costs for procedures, from heart surgery to root canal treatment. Although many Costa Rican healthcare professionals receive training in North…

  1. The peats of Costa Rica

    SciTech Connect

    Obando A, L.; Malavassi R, L.; Ramirez E, O. ); Cohen, A. . Dept. of Geological Sciences); Raymond, R. Jr.; Thayer, G.R. )


    The objectives of this investigation were: (1) to locate potential peat deposits in Costa Rica; (2) to estimate as closely as possible by representative sampling the amount of peat present in each deposit, and (3) to make a preliminary evaluation of the quality of the peat in each deposit. With information from soil maps and a 3-week survey of Costa Rica, it is estimated that a potential area of about 1000 km{sup 2} is covered by peat. Most of the peat area (about 830 km{sup 2}) is in northeastern Costa Rica in the Tortuguero area. An aerial survey identified the potential peat areas by the exclusive presence of the Yolillo palm. The next largest potential area of peat (about 175 km{sup 2}) is in the cloud-covered areas of the Talamanca Mountains. Some reconnaissance has been done in the Talamanca Mountains, and samples of the peat indicate that it is very similar to the sphagnum peat moss found in Canada and the northern US. Smaller bogs have been discovered at Medio Queso, El Cairo, Moin, and the Limon airport. Two bogs of immediate interest are Medio Queso and El Cairo. The Medio Queso bog has been extensively sampled and contains about 182,000 metric tons (dry) of highly decomposed peat, which is being used as a carrier for nitrogen-fixing bacteria. The El Cairo bog is sparsely sampled and contains about 1,300,000 metric tons of slightly decomposed dry peat. Plans are to use this peat in horticultural applications on nearby farms. 10 refs., 11 figs., 7 tabs.

  2. European Upper Atmosphere Server DIAS - Final Conference/ Abstract

    DTIC Science & Technology


    offers real-time ionograms produced simultaneously from the most European operating ionospheric stations with autoscaling results • DIAS provides the... ionograms and electron density forecasting. 3. Summary of the users’ meeting (19 May 2006) This meeting was mainly addressed to the DIAS

  3. Pesticide poisonings in Costa Rica.


    Wesseling, C; Castillo, L; Elinder, C G


    A descriptive epidemiologic study, conducted in Costa Rica, investigated the incidence of pesticide poisonings with special attention to agricultural workers and occupational exposure. Information from three national registers (occupational accident and disease reports, hospitalizations, and deaths) were used. During 1986, 1800 occupational accidents caused by pesticides were reported; between 1980 and 1986 altogether 3330 persons were hospitalized and 429 died. Cholinesterase inhibitors caused 71% of the reported occupational accidents, 63% of the hospitalizations, and 36% of the deaths. Paraquat caused 21% of the occupational accidents, 24% of the hospitalizations, and 60% of the deaths. Hospitalizations and deaths were 13 and 11 times, respectively, more frequent among agricultural workers than among the rest of the population. High-risk groups for occupational poisonings included agricultural workers aged 15-29 years, female workers, and banana plantation workers. The yearly incidence of symptomatic occupational pesticide poisonings among agricultural workers was estimated at 4.5%.

  4. Costa Rica saves infants' lives.


    Rosero-Bixby, L


    Even though Costa Rica is underdeveloped economically, life expectancy has been increasing over the past decade and the illiteracy rate was only 7% in 1984. Infant mortality rates have plummeted since 1972 when the 1st national health plan and social security were instituted (pre-1972: 2.3% annual reduction in infant mortality; 1972-1980: 13% decline annually). Decreased risk in the 1st postnatal month of life was responsible for 34% of the decrease from 1972-1980. Control of disease, especially diarrhea and acute respiratory infection, accounted for most of the decline (51%). Immunizations accounted for 8%, prevention of infectious diseases for 10%, control of malnutrition for 5%, and control of death due to premature birth for 14% of the decrease in mortality. Infant death due to pregnancy and delivery complications and congenital defects did not decrease during this period. Socioeconomic conditions normally influence survival rates strongly, but socioeconomic change in Costa Rica during 1970-1980 accounted for only 1/3 of the reduction in infant mortality. These improvements included an increase in the number of educated women, economic growth and decline in fertility (a decrease from 7.6 to 3.4 births between 1960-1980). The majority of the reduction stemmed from utilization of family planning techniques and the reduction of health risk factors. By 1980, the health program initiated in the 1970's provided primary care to 60% of the population, immunized 95% of the children against poliomyelitis, diptheria, pertussis, tetanus, and measles, and by 1984, provided almost all households with a sewage system. Analyses of the impact of socioeconomic development, fertility regulation, hospital care, outpatient services, and primary health care on infant mortality showed that, before 1970, those areas with better economies had a lower mortality rate, and after 1970, the economy and mortality rate had become independent variables. Furthermore, the introduction of health

  5. The McGill-Costa Rica Project

    PubMed Central

    Davis, M. William L.; Haggerty, Jeannie; Filion-Laporte, Liliane


    In 1987, health authorities in Costa Rica started a training program in family and community medicine and requested assistance from the Department of Family Medicine at McGill University. The authors outline the health care system in Costa Rica and the background of the project. The design, implementation, and progress of the project to date are discussed. The problems associated with this kind of project and its future are also discussed. Imagesp1152-a PMID:21221332

  6. 76 FR 70425 - Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Office of the Secretary Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board... discussions of classified information relating to DIA's intelligence operations including its support to... Advisory Board to discuss DIA operations and capabilities in support of current intelligence...

  7. 77 FR 2277 - Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... of the Secretary Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed... discussions of classified information relating to DIA's intelligence operations including its support to... Advisory Board to discuss DIA operations and capabilities in support of current intelligence...

  8. (Power sector efficiency analysis in Costa Rica). [Power Sector Efficiency Analysis in Costa Rica

    SciTech Connect

    Waddle, D.B.


    I traveled to San Jose, Costa Rica, to review the state of the electric power utility with a team of specialists, including a transmission and distribution specialist, a hydroelectric engineering specialist, and a thermal power plant specialist. The purpose of the mission was to determine the costs and benefits of efficiency improvements to supply side technologies employed by the Instituto Costarricense de Electricidad, the national power company in Costa Rica, and the potential contribution of these efficiency measures to the future electric power needs of Costa Rica.

  9. Dia de los Muertos: A Joyful Mexican Celebration

    ERIC Educational Resources Information Center

    Markello, Carrie; Bean, Kathy


    This brief article describes the history, traditions, and food of the Mexican holiday known as Dia de los Muertos, or the Day of the Day, and explores classroom and studio activities that teachers can do with their students. Teachers are urged to encourage students to explore the topic of the Day of the Dead, comparing it to other traditions and…

  10. Dia de los Muertos: An Illustrated Essay and Bibliography.

    ERIC Educational Resources Information Center

    California Univ., Santa Barbara. University Library.

    Among Mexico's most original traditions is the holiday dedicated to honoring the dead, Dia de los Muertos, November 2. This tradition combines aspects that define the national spirit. At the same time that it is a solemn festivity to remember the dead, it becomes a fiesta in its own right. Death, more than a thing to be feared, becomes the motif…

  11. Educational and Demographic Profile: Contra Costa County.

    ERIC Educational Resources Information Center

    California Postsecondary Education Commission, 2004


    This profile uniquely presents a variety of educational and socioeconomic information for Contra Costa County, nearby counties, and the state. The profile highlights the relationship between various factors that affect the economic well-being of individuals and communities. This presentation of information provides a framework for enhanced…

  12. Neurobrucellosis in Stranded Dolphins, Costa Rica

    PubMed Central

    Hernández-Mora, Gabriela; González-Barrientos, Rocío; Morales, Juan-Alberto; Chaves-Olarte, Esteban; Guzmán-Verri, Caterina; Baquero-Calvo, Elías; De-Miguel, María-Jesús; Marín, Clara-María; Blasco, José-María


    Ten striped dolphins, Stenella coeruleoalba, stranded along the Costa Rican Pacific coast, had meningoencephalitis and antibodies against Brucella spp. Brucella ceti was isolated from cerebrospinal fluid of 6 dolphins and 1 fetus. S. coeruleoalba constitutes a highly susceptible host and a potential reservoir for B. ceti transmission. PMID:18760012

  13. Violent Reform: Costa Rica, Central America's Exception.

    ERIC Educational Resources Information Center

    Singer, Shelly


    Examines factors contributing to Costa Rica's peaceful status in a region of violent political conflict. Describes the country's political and educational systems, stating that its democratic government allows the country to withstand many problems typical of the region and that its high level of education allows it to maintain the highest per…

  14. Education in Costa Rica: An Overview.

    ERIC Educational Resources Information Center

    Wahab, Zaher

    Costa Rican education, although fairly successful compared to other Third World or Latin American countries, has serious problems needing action, including (1) large discrepancies between educational ideals and the realities of urban privilege, with regard to access and quality, and (2) a rote, narrow, superficial, impractical education. Other…

  15. Let Book Joy Begin @ Your Library[R]!: Ten Years of El Dia de los Ninos/El Dia de los Libros

    ERIC Educational Resources Information Center

    Roy, Loriene


    Ten years ago, in 1996, poet and children's book author, Pat Mora began celebrating "book joy" by founding a children's book and reading day, El Dia de los Ninos/El Dia de los Libros or Children's Day/Book Day. Dia is modeled on National Children's Day Celebrations in Mexico held since 1925 when it was launched in conjunction with a…

  16. The European Server for Ionospheric Specification and Forecasting: Final Results from DIAS Project

    DTIC Science & Technology

    2006-06-01 operates since May 2005 and the basic products that are delivered are real-time and historical ionograms from all DIAS, an information collector is installed at each station which uploads the ionograms and associated data to the central DIAS server...generate the maps of the ionospheric parameters and other information products. The DIAS products make use of the latest available ionogram data

  17. Costa Rica turns to the world for help.



    Costa Rica's current financial crisis threatens to jeopardize recent gains in health indicators, especially among the low-income population. The increasing costs of developing health services and of providing social security coverage for marginal social groups can no longer be fully met by the Costa Rican government, which has steadily allocated a high percentage of the national budget to health. Given this situation, Costa Rica has appealed for international cooperation to help meet the most urgent health needs in the country. In 1985, Costa Rica's population stood at slightly under 2.6 million, with 36% aged 16 years and older. The country remains primarily rural; only 46% of the population is centered in urban areas. Costa Rica has been described as a country that maintains a strong tradition of peace and democracy. Given its political stability, Costa Rica has been the recipient of large waves of immigrants from other Central American countries in states of social political turmoil.

  18. Recent volcano monitoring in Costa Rica

    USGS Publications Warehouse

    Thorpe, R.; Brown, G.; Rymer, H.; Barritt, S.; Randal, M.


    The Costa Rican volacno Rincon de la Vieja is loosely but mysteriously translated as the "Old Lady's Corner." It consists of six volcanic centers that form a remote elongated ridge standing some 1300m above the surrounding terraine. Geologically speaking, the Guanacaste province of northern Costa Rica consists of a series of composite volcanic cones built on a shield of ignimbrites (welded and unwelded ash flows) of Pliocene-Pleistocene age (up to 2 million years old), that themselves lie on basement crust of Cretaceious-Tertiary age (up to 90 million years old). the active volcanoes are aligned on a northwest-southeast axis parallel to the Middle American oceanic trench in the Pacific Ocean that is the site of subduction of hte Cocos oceanic plate underneath Central America.  

  19. [Determinants of fertility in Costa Rica].


    Rosero, L


    An attempt to systematize variables or factors traditionally associated with fertility, this study is not intended as a theoretical framework. 2 periods in Costa Rican fertility are recognized: one before 1960 and one after 1960. Within these periods 4 stages, each with different "key" determinants, are recognized. Until 1960, high fertility rates prevailed, with more than 6 children as total. Fluctuations were due to voluntary factors such as nuptiality and breastfeeding, and involuntary factors such as demand for less children during economic recession. Between 1960 and 1975 fertility declined. It is believed that the "key" factors in this fertility decline were on the contraceptive "offert" side rather than on the children demand side. The participation of peasants and low socioeconomic groups in the fertility decline and governmental health and family planning services are also recognized as important factors. Since the mid 70's a new stage of relative stability has been reached with an apparent convergence towards a total fertility of 3 children. How close this level is reached in the near future will depend on the control of unwanted fertility. The possibility of a 2nd fertility decline in Costa Rica depends mainly on factors which determine why couples have a 3rd child. Consequently, investigation of these factors is suggested to anticipate the future course of Costa Rican fertility. Basic fertility data are given in tables and an appendix.

  20. Development Impact Assessment (DIA) Case Study. South Africa

    SciTech Connect

    Cox, Sadie; Nawaz, Kathleen; Sandor, Debra


    This case study reviews South Africa’s experience in considering the impacts of climate change action on development goals, focusing on the South African energy sector and development impact assessments (DIAs) that have and could be used to influence energy policy or inform the selection of energy activities. It includes a review of assessments—conducted by government ministries, technical partners, and academic institutes and non-governmental organizations (NGOs)—that consider employment, health, and water implications of possible energy sector actions, as well as multi-criteria impact assessments.

  1. Direct Immersion Annealing (DIA) of Block Copolymer Thin Film

    NASA Astrophysics Data System (ADS)

    Modi, Arvind; Karim, Alamgir


    Solvent Vapor Annealing (SVA) methodologies of block copolymer (BCP) films have demonstrated excellent potential for control of nanostructures and morphologies. However, SVA designs require sophisticated instrumentation, and fine control of system parameters in batch processing mode which is relatively complex and limits its feasibility. We developed a faster and robust solvent immersion strategy for microphase separation and nanostructure control of as-cast BCP thin films with minimal sophistication. Our Direct Immersion Annealing (DIA) method requires immersion in a mixture of non-solvent and good solvent (for BCP) for annealing. A non-solvent component prevents dissolution of the film resting on substrate while a good solvent percolates through the film, plasticizes it, and shifts glass-transition below room temperature leading to microphase separation and ordering. Our study of PS-PMMA system demonstrates that a robust control over thin film ordering and transient swelling could be achieved through a fine control of solubility parameter of solvent mixture and temperature with no dead-time. Further, we exhibit the utility of DIA for alignment of BCP domains on topographically patterned substrates. University of Akron Research Foundation (UARF).

  2. 77 FR 62222 - Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting AGENCY: DIA, Department of Defense (DoD... DIA's intelligence operations including its support to current operations. DATES: The meeting will be... capabilities in support of current intelligence operations. Agenda October 29, 2012: [[Page 62223

  3. The DiaCog: A Prototype Tool for Visualizing Online Dialog Games' Interactions

    ERIC Educational Resources Information Center

    Yengin, Ilker; Lazarevic, Bojan


    This paper proposes and explains the design of a prototype learning tool named the DiaCog. The DiaCog visualizes dialog interactions within an online dialog game by using dynamically created cognitive maps. As a purposefully designed tool for enhancing learning effectiveness the DiaCog might be applicable to dialogs at discussion boards within a…

  4. Costa Rica's SINEM: A Perspective from Postcolonial Institutional Ethnography

    ERIC Educational Resources Information Center

    Rosabal-Coto, Guillermo


    In this article I suggest that SINEM--the Costa Rican version of Venezuela's El Sistema--articulates a development discourse which legitimates neoliberal policies that govern the twenty-first-century international market, in which Costa Rica figures only as a subaltern. I contend that such articulation contributes to perpetuating notions and…

  5. GPS Monitoring of Subduction Zone Deformation in Costa Rica

    NASA Technical Reports Server (NTRS)

    Lundgren, Paul


    The subduction of the Cocos plate beneath Costa Rica is among the highest convergence rates in the world. The high subduction rate and nearness of the Nicoya Peninsula, Costa Rica to the Middle America Trench (MAT) provide a unique opportunity to map variations in interseismic strain of the crust above the seismogenic zone in response to variations in seismic coupling.

  6. Sustainability and Peace in Costa Rica: The Case of University of Costa Rica

    ERIC Educational Resources Information Center

    Segreda, Alejandrina Mata


    This article describes initiatives at the University of Costa Rica, which, in combination with national programs, have strengthened the country's commitment to sustainable development over the past 15 years. It discusses the University's role in defining a national perspective on sustainability starting in 1987, as well as the evolution of the…

  7. Deformation of Olivine at Mantle Pressure using D-DIA

    SciTech Connect



    Knowledge of the rheological properties of mantle materials is critical in modeling the dynamics of the Earth. The high-temperature flow law of olivine defined at mantle conditions is especially important since the pressure dependence of rheology may affect our estimation of the strength of olivine in the Earth's interior. In this study, steady-state high-temperature (up to 1473 K) deformation experiments of polycrystalline olivine (average grain size ? 10 ?m) at pressure up to 9.6 GPa, were conducted using a Deformation-DIA (D-DIA) high-pressure apparatus and synchrotron X-ray radiation. The oxygen fugacity (fo2) during the runs was in-between the iron-wustite and the Ni/NiO buffers' fo2. The water content of the polycrystalline samples was generally about 150 to 200 wt. ppm but was as low as 35 wt ppm. Typically, 30 % strain was generated during the uniaxial compression. Sample lengths during the deformation process as well as the differential stresses were monitored in situ by X-ray radiography and diffraction, respectively. The strain rate was derived with an accuracy of 10?6 s?1. Differential stress was measured at constant strain rate (?10?5 s?1) using a multi-element solid-state detector combined with a conical slit. Recovered specimens were investigated by optical and transmission electron microscopy (TEM). TEM shows that dislocation glide was the dominant deformation mechanism throughout the experiment. Evidence of dislocation climb and cross-slip as active mechanisms are also reported. Deformation data show little or no dependence of the dislocation creep flow with pressure, yielding to an activation volume V* of 0 {+-} 5 cm3/mol. These new data are consistent with the high-temperature rheological laws at lower pressures, as reported previously.

  8. [The health system of Costa Rica].


    Sáenz, María del Rocío; Acosta, Mónica; Muiser, Jorine; Bermúdez, Juan Luis


    This paper describes the Costa Rican health system which provides health, water and sanitation services. The health component of the system includes a public and a private sector. The public sector is dominated by the Caja Costarricense de Seguro Social (CCSS), an autonomous institution in charge of financing, purchasing and delivering most of the personal health services in Costa Rica. CCSS is financed with contributions of the affiliates, employers and the state, and manages three regimes: maternity and illness insurance, disability, old age and death insurance, and a non-contributive regime. CCSS provides services in its own facilities but also contracts with private providers. The private sector includes a broad set of services offering ambulatory and hospital care. These services are financed mostly out-of-pocket, but also with private insurance premiums. The Ministry of Health is the steward of the system, in charge of strategic planning, sanitary regulation, and research and technology development. Among the recent policy innovations we can mention the establishment of the basic teams for comprehensive health care (EBAIS), the de-concentration of hospitals and public clinics, the introduction of management agreements and the creation of the Health Boards.

  9. Radiological dosimetry measurements in Costa Rica

    NASA Astrophysics Data System (ADS)

    León, M.; Santos, F.


    The main cause of human exposure to artificial radiation corresponds to medical applications, so it is essential to reduce the dose to patients, workers and consequently the entire population [1]. Although there is no dose limit for patients, is necessary to reduce it to a minimum possible while still getting all the necessary diagnostic information, taking economic and social factors into account [2]. Based on this proposal, agencies such as the International Atomic Energy Agency has been dedicated to providing guidelines levels, whose function is to serve as standards for the optimization of the medical exposure [3]. This research was created as a preliminary survey with the claim of eventually determine the guidance levels in Costa Rica for three different studies of general radiology: Lumbar Spine-AP, Chest - PA and Thoracic Spine - AP (for screens with speeds of 400 and 800), and cranio-caudal study in mammography, applied to Costa Rica's adult population, perform properly in the institutions of Caja Costarricense del Seguro Social (CCSS).

  10. [Fresh water macroinvertebrates of Costa Rica I].


    Springer, Monika; Ramirez, Alonso; Hanson, Paul


    This is the first in a series of three volumes on the freshwater macroinvertebrates of Costa Rica. The present volume includes an introductory chapter summarizing the major types of freshwater environments, the biology of freshwater macroinvertebrates (habitats, food, respiration, osmoregulation, etc.), ecological and economic importance, conservation and a synopis of the major groups, followed by a simplified key. The next two chapters discuss collecting methods and biomonitoring. These are followed by chapters on mayflies (Ephemeroptera: 10 families), dragonflies (Odonata: 13 families), stoneflies (Plecoptera: 1 family) and caddisflies (Trichoptera: 15 families). Both in this volume and in those to follow, the chapters treating individual taxa include a summary of the natural history, importance, taxonomy, collecting methods, morphology and an illustrated key to the families; each family is discussed separately and an illustrated key to genera is provided; each chapter ends with a bibliography and a table listing all the genera with information on number of species, distribution, habitat and tolerance to water pollution. While the emphasis is on families and genera known from Costa Rica, additional taxa occurring elsewhere in Central America are mentioned. The present volume also includes numerous color plates of aquatic macroinvertebrates.

  11. Economics of health planning--Costa Rica as an example.


    Neuhauser, D


    Costa Rica has been unusually successful in providing high levels of health for its people given its economic resources. It is proposed that there are two reasons for its success. Having no military, Costa Rica has had resources to invest in health care. Having a relatively equal income and education distribution and a democratic government, it has been able to provide health care widely rather than just to the elites. This paper examines production functions for health and possible directions for appropriate management of health as Costa Rica confronts the chronic disease pattern of the developed world.

  12. Catalog of crater lakes from Costa Rica

    NASA Astrophysics Data System (ADS)

    Ramirez, C. J.; Mora-Amador, R.; González, G.


    Costa Rica has a diversity of volcanic crater lakes that can be classified into two groups: hot and cold lakes. The country contains at least 5% of the world's hot lakes. Costa Rica has 2 hot hyperacidic lakes, both of them on active volcanoes, the Rincón de la Vieja (38.0°C, pH = 0 - 1) and the Poás Laguna Caliente (36.1°C - 56°C, pH = 0.55 - 0.74), nowadays the Poás hot lake is the most active crater lake in the world, with more than 200 eruptions only on 2010. One of the most studied cold crater lakes is Irazú (13°C, pH = 3.5), that used to contain bubbling and clear areas of upwelling involving CO2 liberation and subaqueous fumaroles with temperatures up to 50°C, but since 2005 the lake presents an important descend until April 2010 when it disappeared. On February 9, 2003, Irazú's lake underwent a drastic change of color, from clear green to mustard with reddish loops, similar to the color of the waters of Lake Nyos after the gas burst of August 1986. Other studied cold lakes include Botos, Chato, and Tenorio, all at the summit of Quaternary volcanoes as well as Barva and Danta, located in recent pyroclastic cones. Some cold lakes are located in Holocene maar-type explosion craters, among them are Congo, Bosque Alegre, Hule, and Río Cuarto. These last two have undergone repeated rapid reddish color changes over the last 10 years, in association with fish kills and the liberation of apparently sulfurous scents. On March 2010, University of Costa Rica was the host of the 7th Workshop on Volcanic Lakes, part of the Commission of Volcanic Lakes of the IAVCEI, 51 participants from 14 countries attended the workshop; they presented 27 talks and 17 posters, also they visited and sample 4 of the lakes mentioned above (Botos, Irazú, Río Cuarto and Hule). Level of Study: 1: few or no data, 2: regular, 3: acceptable

  13. Ten new species of Daidalotarsonemus (Prostigmata: Tarsonemidae) from Costa Rica

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ten new tarsonemid species of the genus Daidalotarsonemus found on native plants in Costa Rica are described herein: Daidalotarsonemus alas sp. n. Ochoa, Rezende & Lofego; Daidalotarsonemus azofeifai sp. n. Ochoa, Rezende & Lofego; Daidalotarsonemus bauchani sp. n. Rezende, Ochoa & Lofego; Daidalota...

  14. Costa Rica: achievements of a heterodox health policy.


    Unger, Jean-Pierre; De Paepe, Pierre; Buitrón, René; Soors, Werner


    Costa Rica is a middle-income country with a strong governmental emphasis on human development. For more than half a century, its health policies have applied the principles of equity and solidarity to strengthen access to care through public services and universal social health insurance. Costa Rica's population measures of health service coverage, health service use, and health status are excellent, and in the Americas, life expectancy in Costa Rica is second only to that in Canada. Many of these outcomes can be linked to the performance of the public health care system. However, the current emphasis of international aid organizations on privatization of health services threatens the accomplishments and universality of the Costa Rican health care system.

  15. Ecotourism and Interpretation in Costa Rica: Parallels and Peregrinations.

    ERIC Educational Resources Information Center

    Williams, Wayne E.


    Discusses the ecotourism industry in Costa Rica and some of the problems faced by its national park system, including megaparks, rapid increase in tourism, and interpretive services. Suggests alternatives for the problems. (MKR)

  16. Rickettsia felis in Ctenocephalides felis from Guatemala and Costa Rica

    PubMed Central

    Troyo, Adriana; Álvarez, Danilo; Taylor, Lizeth; Abdalla, Gabriela; Calderón-Arguedas, Ólger; Zambrano, Maria L.; Dasch, Gregory A.; Lindblade, Kim; Hun, Laya; Eremeeva, Marina E.; Estévez, Alejandra


    Rickettsia felis is an emerging human pathogen associated primarily with the cat flea Ctenocephalides felis. In this study, we investigated the presence of Rickettsia felis in C. felis from Guatemala and Costa Rica. Ctenocephalides felis were collected directly from dogs and cats, and analyzed by polymerase chain reaction for Rickettsia-specific fragments of 17-kDa protein, OmpA, and citrate synthase genes. Rickettsia DNA was detected in 64% (55 of 86) and 58% (47 of 81) of flea pools in Guatemala and Costa Rica, respectively. Sequencing of gltA fragments identified R. felis genotype URRWXCal2 in samples from both countries, and genotype Rf2125 in Costa Rica. This is the first report of R. felis in Guatemala and of genotype Rf2125 in Costa Rica. The extensive presence of this pathogen in countries of Central America stresses the need for increased awareness and diagnosis. PMID:22665618

  17. [Perception about biotechnology in university students in Costa Rica].


    Valdez, Marta; Rodríguez, Iris; Sittenfeld, Ana


    A survey was carried out to determine the perception and knowledge about biotechnology and genetically modified organisms (GMOs) in a sample (n=750) of university students from three public universities in Costa Rica: Universidad de Costa Rica, Universidad Nacional and Instituto Tecnológico de Costa Rica. The study revealed that 88% of the students showed a satisfactory level of knowledge about modem biotechnology and 79% of them reported a favorable opinion and good acceptance of this technology. Students would accept some risks associated to biotechnology if it represents an improvement to the competitiveness of Costa Rica. Some differences were detected in the opinions from students of the three universities that can be associated to the area of study. Students from social disciplines showed a higher percentage of negative acceptances to biotechnology and GMOs when their opinions were compared with those of students from life sciences and technologies.

  18. Costa Rica: Achievements of a Heterodox Health Policy

    PubMed Central

    Unger, Jean-Pierre; De Paepe, Pierre; Buitrón, René; Soors, Werner


    Costa Rica is a middle-income country with a strong governmental emphasis on human development. For more than half a century, its health policies have applied the principles of equity and solidarity to strengthen access to care through public services and universal social health insurance. Costa Rica’s population measures of health service coverage, health service use, and health status are excellent, and in the Americas, life expectancy in Costa Rica is second only to that in Canada. Many of these outcomes can be linked to the performance of the public health care system. However, the current emphasis of international aid organizations on privatization of health services threatens the accomplishments and universality of the Costa Rican health care system. PMID:17901439

  19. Da Costa's syndrome or neurocirculatory asthenia.

    PubMed Central

    Paul, O


    The syndrome variously called Da Costa's syndrome, effort syndrome, neurocirculatory asthenia, etc has been studied for more than 100 years by many distinguished physicians. Originally identified in men in wartime, it has been widely recognised as a common chronic condition in both sexes in civilian life. Although the symptoms may seem to appear after infections and various physical and psychological stresses, neurocirculatory asthenia is most often encountered as a familial disorder that is unrelated to these factors, although they may aggravate an existing tendency. Respiratory complaints (including breathlessness, with and without effort, and smothering sensations) are almost universal, and palpitation, chest discomfort, dizziness and faintness, and fatigue are common. The physical examination is normal. The aetiology is obscure but patients usually have a normal life span. Reassurance and measures to improve physical fitness are helpful. PMID:3314950

  20. [The bathymetry of Coco's Island, Costa Rica].


    Lizano, O G


    The bathymetry of Coco's Island (UNESCO Natural and Cultural World Patrimony), located approximately 500 km from the Pacific coast of Costa Rica, is not well known. It has a high marine biodiversity and also represents a meeting site for many species traveling throughout the Pacific Ocean. The insular shelf is irregular in extension and also in bathymetric features. The northeast limit is defined by the 109.8-128.1 m contours (60-70 fathoms) while the 183 m contour (100 fathoms) practically defines the rest of the island, from which the depth gradient is steep. The maximum extension is to the northeast with a longitude of 13 km. In this context the present limits of the marine park (5 km), are insufficient to protect the whole insular shelf. Current regulation should be modified to prevent fishing activities less than 15 km from the Island.

  1. A report from rural Costa Rica.


    Fishel, J


    This report provides findings from interviews conducted among single mothers and other community members from Monteverde, Costa Rica in 1995. Costa Rica has experienced recent, rapid fertility decline. The population still includes 33% who are under 15 years old and capable of adding to population increases. The sample of single mothers includes women who were never married, or those who were divorced, widowed, or separated. This group of mothers contends with primary headship and decision making in family affairs and with social stigma from being single mothers. Many employers discriminate against single mothers in hiring. Single mothers were concerned about making enough money to pay for basic items, such as rent, food, and child care. Some worried about the lack of a father's love and discipline. All sample respondents stated that it was important to plan the number and timing of childbearing. The single mothers were familiar with several modern and traditional methods of contraception. Few pregnancies were planned. Most were mistrustful of the effectiveness and safety of modern contraceptives. The negative attitudes were attributed to religious influences, misinformation, or lack of information. High school sex education provides information about biological reproduction, sexually transmitted diseases, and methods of contraception. One instructor said that she recommends rhythm as the safest and best method. The only other source of information about family planning is the clinic. Little information is directed to unmarried girls and or male responsibility. The community organization that sponsored the survey is working to empower women and decrease social discrimination against single mothers. The author recommends improved information dissemination on sexuality, reproductive health, and contraception and improved access of unmarried teens to contraceptives.

  2. Seroepidemiology of chlamydia in Costa Rica.

    PubMed Central

    Vetter, K M; Barnes, R C; Oberle, M W; Rosero-Bixby, L; Schachter, J


    A population-based study of the sero-epidemiology of chlamydia was performed among a nationally representative sample of 760 Costa Rican women aged 25 to 59 years. Interviews and sera collection were completed between September 1984 and February 1985. The overall seroprevalence of chlamydial antibodies among these women was 56.1%. Women 25 to 39 years of age had a seroprevalence of 51.1%, while women 40 to 59 years of age had a seroprevalence of 64.2%. Women who reported no prior sexual activity had a seroprevalence rate of 48.6%, compared with a seroprevalence rate of 80.7% among women who reported three or more lifetime sexual partners. The geometric mean titre (GMT) of seropositive women ranged from 34.4 among the women who reported no prior sexual activity to 155.0 among the women with three or more lifetime sexual partners. Sero-positivity was more consistently associated with sexual activity than with age. Women with serological evidence of past Herpes simplex virus type 2 (HSV-2) or syphilis infection were more likely to be seropositive than were women without evidence of exposure to these sexually transmitted diseases, even when controlled for age and the number of lifetime sexual partners. The seropositivity among never sexually active women indicates the probable presence of Chlamydia pneumoniae infections, while the high seroprevalence of chlamydial antibodies among the sexually active women suggests that sexually transmitted Chlamydia trachomatis infections represent a public health problem not previously quantified in Costa Rica. Further seroepidemiological and/or culture studies are warranted to determine the incidence and prevalence of sexually transmitted chlamydial infection among men and younger women. PMID:2370061

  3. Costa Rica: Background and U.S. Relations

    DTIC Science & Technology


    trade agreements with China and Singapore, while strengthening the country’s social welfare programs. Throughout much of the electoral campaign...Ministerio Del Ambiente y Energia, “ Sistema Nacional de Áreas Protegidas,” available at planificacionasp.php. 31 “Costa Rica...and reflected the polarization of the issue among the Costa Rican electorate . Trade unions, students, a variety of social movements, and the PAC

  4. Development drop test results of the 15-ft-dia ribbon parachute and 73-ft-dia cross parachute for the US Army Natick Laboratory UHLCADS system

    SciTech Connect

    Pepper, W.B.


    During 1984 a series of 12 drop tests was conducted at the US Army Yuma Proving Ground near Yuma, Arizona to develop a new system to recover a 2200-lb resupply container from high altitude. The parachute system consists of a 15-ft-dia ribbon parachute reefed for 10 s and a 73-ft-dia cross parachute with no reefing. The system has been successfully demonstrated by flight tests. The impact velocity is 30 fps.

  5. Novel immunoassay formats for integrated microfluidic circuits: diffusion immunoassays (DIA)

    NASA Astrophysics Data System (ADS)

    Weigl, Bernhard H.; Hatch, Anson; Kamholz, Andrew E.; Yager, Paul


    Novel designs of integrated fluidic microchips allow separations, chemical reactions, and calibration-free analytical measurements to be performed directly in very small quantities of complex samples such as whole blood and contaminated environmental samples. This technology lends itself to applications such as clinical diagnostics, including tumor marker screening, and environmental sensing in remote locations. Lab-on-a-Chip based systems offer many *advantages over traditional analytical devices: They consume extremely low volumes of both samples and reagents. Each chip is inexpensive and small. The sampling-to-result time is extremely short. They perform all analytical functions, including sampling, sample pretreatment, separation, dilution, and mixing steps, chemical reactions, and detection in an integrated microfluidic circuit. Lab-on-a-Chip systems enable the design of small, portable, rugged, low-cost, easy to use, yet extremely versatile and capable diagnostic instruments. In addition, fluids flowing in microchannels exhibit unique characteristics ('microfluidics'), which allow the design of analytical devices and assay formats that would not function on a macroscale. Existing Lab-on-a-chip technologies work very well for highly predictable and homogeneous samples common in genetic testing and drug discovery processes. One of the biggest challenges for current Labs-on-a-chip, however, is to perform analysis in the presence of the complexity and heterogeneity of actual samples such as whole blood or contaminated environmental samples. Micronics has developed a variety of Lab-on-a-Chip assays that can overcome those shortcomings. We will now present various types of novel Lab- on-a-Chip-based immunoassays, including the so-called Diffusion Immunoassays (DIA) that are based on the competitive laminar diffusion of analyte molecules and tracer molecules into a region of the chip containing antibodies that target the analyte molecules. Advantages of this

  6. The Exceptionally High Life Expectancy of Costa Rican Nonagenarians

    PubMed Central



    Robust data from a voter registry show that Costa Rican nonagenarians have an exceptionally high live expectancy. Mortality at age 90 in Costa Rica is at least 14% lower than an average of 13 high-income countries. This advantage increases with age by 1% per year. Males have an additional 12% advantage. Age-90 life expectancy for males is 4.4 years, one-half year more than any other country in the world. These estimates do not use problematic data on reported ages, but ages are computed from birth dates in the Costa Rican birth-registration ledgers. Census data confirm the exceptionally high survival of elderly Costa Ricans, especially males. Comparisons with the United States and Sweden show that the Costa Rican advantage comes mostly from reduced incidence of cardiovascular diseases, coupled with a low prevalence of obesity, as the only available explanatory risk factor. Costa Rican nonagenarians are survivors of cohorts that underwent extremely harsh health conditions when young, and their advantage might be just a heterogeneity in frailty effect that might disappear in more recent cohorts. The availability of reliable estimates for the oldest-old in low-income populations is extremely rare. These results may enlighten the debate over how harsh early-life health conditions affect older-age mortality. PMID:18939667

  7. Dust Rotation Effects on DIA Surface Waves in a Semi-bounded Lorentzian Plasma

    SciTech Connect

    Lee, Myoung-Jae


    The dispersion relation for a dust ion-acoustic (DIA) surface wave is kinetically derived for the semi-bounded Lorentzian plasma containing elongated and rotating charged dust particles. The DIA surface wave frequency is found to be decreased as the dust rotational frequency increases.

  8. In Search of the Ideal Reader for Nonfiction Children's Books about el Dia de Los Muertos

    ERIC Educational Resources Information Center

    Davila, Denise


    In mainstream American culture, death is not usually talked about openly. It is discussed privately among adults because death is often regarded as a final ending. Nevertheless, many elementary school teachers discuss el Dia de los Muertos with their students. The celebration of el Dia de los Muertos, in contrast to dominant ideology, commemorates…

  9. 78 FR 295 - Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Intelligence Agency (DIA) Advisory Board; Closed Meeting AGENCY: DIA, Department of Defense (DoD). ACTION... intelligence operations including its support to current operations. DATES: The meeting will be held on January... capabilities in support of current intelligence operations. Agenda January 22, 2013: Ms. Ellen M....

  10. 77 FR 38041 - Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... of the Secretary Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed... discussions of classified information relating to DIA's intelligence operations including its support to... intelligence operations. Agenda July 23, 2012 1 p.m.--Call to Order Mr. William Caniano, Designated...

  11. 77 FR 56192 - Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... of the Secretary Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed... discussions of classified information relating to DIA's intelligence operations including its support to... intelligence operations. Agenda September 26, 2012: ] 8:30 a.m Call to Order........ Ms. Ellen M....

  12. 77 FR 18797 - Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed Meeting

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... of the Secretary Federal Advisory Committee; Defense Intelligence Agency (DIA) Advisory Board; Closed... discussions of classified information relating to DIA's intelligence operations including its support to... intelligence operations. Agenda May 2, 2012 S 8:30 a.m Convene Advisory Board Meeting Mr. William...

  13. Specificity of Interactions between mDia Isoforms and Rho Proteins*

    PubMed Central

    Lammers, Michael; Meyer, Simon; Kühlmann, Dorothee; Wittinghofer, Alfred


    Formins are key regulators of actin nucleation and polymerization. They contain formin homology 1 (FH1) and 2 (FH2) domains as the catalytic machinery for the formation of linear actin cables. A subclass of formins constitutes the Diaphanous-related formins, members of which are regulated by the binding of a small GTP-binding protein of the Rho subfamily. Binding of these molecular switch proteins to the regulatory N-terminal mDiaN, including the GTPase-binding domain, leads to the release of auto-inhibition. From the three mDia isoforms, mDia1 is activated only by Rho (RhoA, -B, and -C), in contrast to mDia2 and -3, which is also activated by Rac and Cdc42. Little is known about the determinants of specificity. Here we report on the interactions of RhoA, Rac1, and Cdc42 with mDia1 and an mDia1 mutant (mDiaN-Thr-Ser-His (TSH)), which based on structural information should mimic mDia2 and -3. Specificity is analyzed by biochemical studies and a structural analysis of a complex between Cdc42·Gpp(NH)p and mDiaN-TSH. A triple NNN motif in mDia1 (amino acids 164-166), corresponding to the TSH motif in mDia2/3 (amino acids 183-185 and 190-192), and the epitope interacting with the Rho insert helix are essential for high affinity binding. The triple N motif of mDia1 allows tight interaction with Rho because of the presence of Phe-106, whereas the corresponding His-104 in Rac and Cdc42 forms a complementary interface with the TSH motif in mDia2/3. We also show that the F106H and H104F mutations drastically alter the affinities and thermodynamics of mDia interactions. PMID:18829452

  14. [Education, modernity, and fertility in Costa Rica].


    Stycos, J M


    In an effort to identify the causal mechanisms involved in the relationship between education and fertility in Costa Rica, all married women who were interviewed in the National Fertility Survey were reinterviewed in 1977-78. Questions on modernity and attitudes toward family size were designed to measure the extent of their influence on fertility. Questions on modernity were grouped into 4 measures of mass communications/information, sex roles, husband's power, and "instrumental activism." The intercorrelation of the 4 measures was enough to justify their use as separate subscales but high enough to permit their combined use as a single measure of modernity. The correlation between the combined total and education was strong and positive at .68, while the correlation between education and the number of live births controlled for age was -.35. Results of a multiple regression analysis indicate that high levels of general information and exposure to mass media are responsible for the positive correlation between education and fertility. A variety of scales were developed to measure the extent to which predispositions toward family size, numerical preference, and desire for additional children were responsible for the relationship between general information and fertility. Modernity and education showed strong negative relationships to predisposition toward family size, moderate negative relationships to size preference, and almost no relationship to the desire for more children.

  15. The Spherical Tokamak MEDUSA for Costa Rica

    NASA Astrophysics Data System (ADS)

    Ribeiro, Celso; Vargas, Ivan; Guadamuz, Saul; Mora, Jaime; Ansejo, Jose; Zamora, Esteban; Herrera, Julio; Chaves, Esteban; Romero, Carlos


    The former spherical tokamak (ST) MEDUSA (Madison EDUcation Small Aspect.ratio tokamak, R<0.14m, a<0.10m, BT<0.5T, Ip<40kA, 3ms pulse)[1] is in a process of donation to Costa Rica Institute of Technology. The main objective of MEDUSA is to train students in plasma physics /technical related issues which will help all tasks of the very low aspect ratio stellarator SCR-1(A≡R/>=3.6, under design[2]) and also the ongoing activities in low temperature plasmas. Courses in plasma physics at undergraduate and post-graduate joint programme levels are regularly conducted. The scientific programme is intend to clarify several issues in relevant physics for conventional and mainly STs, including transport, heating and current drive via Alfv'en wave, and natural divertor STs with ergodic magnetic limiter[3,4]. [1] G.D.Garstka, PhD thesis, University of Wisconsin at Madison, 1997 [2] L.Barillas et al., Proc. 19^th Int. Conf. Nucl. Eng., Japan, 2011 [3] C.Ribeiro et al., IEEJ Trans. Electrical and Electronic Eng., 2012(accepted) [4] C.Ribeiro et al., Proc. 39^th EPS Conf. Contr. Fusion and Plasma Phys., Sweden, 2012

  16. Personality Traits Change in Adulthood: Reply to Costa and McCrae (2006)

    ERIC Educational Resources Information Center

    Roberts, Brent W.; Walton, Kate E.; Viechtbauer, Wolfgang


    In a response to comments by P. T. Costa, Jr., and R. R. McCrae on the current authors' original article, the authors show that Costa and McCrae's writings on personality suggest a belief in immutability of personality traits. The authors agree with Costa and McCrae that new personality trait models that provide an accurate lower order structure…

  17. A Case Study in Distance Learning Systems: Costa Rica's Universidad Estatal a Distancia.

    ERIC Educational Resources Information Center

    Rumble, G. W. S. V.

    A case study of Costa Rica's Universidad Estatal a Distancia, an Open University school with a distance learning system, is presented. Areas of discussion include characteristics of the country, the educational system of Costa Rica, and the university. Specific topics include: the physical setting of Costa Rica; the population; the economy;…

  18. Diamagnetic chemical exchange saturation transfer (diaCEST) liposomes: physicochemical properties and imaging applications.


    Chan, Kannie W Y; Bulte, Jeff W M; McMahon, Michael T


    Chemical exchange saturation transfer (CEST) is a new type of magnetic resonance imaging (MRI) contrast based on labile spins which rapidly exchange with solvent, resulting in an amplification of signal which allows detection of solute protons at millimolar to micromolar concentrations. An additional feature of these agents is that natural organic and biodegradable compounds can provide strong CEST contrast, allowing the development of diamagnetic CEST (diaCEST) MRI contrast agents. The sensitivity of the CEST approach per unit of agent increases further when diaCEST contrast agents are loaded into liposomes to become diaCEST liposomes. In this review, we will discuss the unique and favorable features of diaCEST liposomes which are well suited for in vivo imaging. diaCEST liposomes are nanocarriers which feature high concentrations of encapsulated contrast material, controlled release of payload, and an adjustable coating for passive or active tumor targeting. These liposomes have water permeable bilayers and both the interior and exterior can be fine-tuned for many biomedical applications. Furthermore, a number of liposome formulations are used in the clinic including Doxil™, which is an approved product for treating patients with cancer for decades, rapid translation of these materials can be envisaged. diaCEST liposomes have shown promise in imaging of cancer, and monitoring of chemotherapy and cell transplants. The unique features of diaCEST liposomes are discussed to provide an overview of the applications currently envisioned for this new technology and to provide an overall insight of their potential.

  19. Arbitrary Amplitude DIA and DA Solitary Waves in Adiabatic Dusty Plasmas

    SciTech Connect

    Mamun, A. A.; Jahan, N.; Shukla, P. K.


    The dust-ion-acoustic (DIA) as well as the dust-acoustic (DA) solitary waves (SWs) in an adiabatic dusty plasma are investigated by the pseudo-potential approach which is valid for arbitrary amplitude SWs. The role of the adiabaticity of electrons and ions in modifying the basic features (polarity, speed, amplitude and width) of arbitrary amplitude DIA and DA SWs are explicitly examined. It is found that the effects of the adiabaticity of electrons and ions significantly modify the basic features (polarity, speed, amplitude and width) of the DIA and DA SWs. The implications of our results in space and laboratory dusty plasmas are briefly discussed.

  20. Primary Health Care That Works: The Costa Rican Experience.


    Pesec, Madeline; Ratcliffe, Hannah L; Karlage, Ami; Hirschhorn, Lisa R; Gawande, Atul; Bitton, Asaf


    Long considered a paragon among low- and middle-income countries in its provision of primary health care, Costa Rica reformed its primary health care system in 1994 using a model that, despite its success, has been generally understudied: basic integrated health care teams. This case study provides a detailed description of Costa Rica's innovative implementation of four critical service delivery reforms and explains how those reforms supported the provision of the four essential functions of primary health care: first-contact access, coordination, continuity, and comprehensiveness. As countries around the world pursue high-quality universal health coverage to attain the Sustainable Development Goals, Costa Rica's experiences provide valuable lessons about both the types of primary health care reforms needed and potential mechanisms through which these reforms can be successfully implemented.

  1. Anthoathecatae and Leptothecatae hydroids from Costa Rica (Cnidaria: Hydrozoa).


    Kelmo, Francisco; Vargas, Rita


    This paper is the first taxonomic account of the hydroid orders Anthoathecatae and Leptothecatae from the Caribbean and Pacific coast of Costa Rica. All specimens are currently stored at the reference collection of the Museo de Zoología, Escuela de Biología, Universidad de Costa Rica. Sixteen hydroid species are recorded: Eudendrium carneum, Pennaria disticha, Acryptolaria longitheca, Plumularia floridana, Halopteris polymorpha, Aglaophenia dubia, Aglaophenia latecarinata, Lytocarpia tridentata, Macrorhynchia phillipina, Macrorhynchia sp., Clytia gracilis, Cnidoscyphus marginatus, Thyroscyphus ramosus, Dynamena disticha, Sertularella diaphana, and Tridentata distans. An extensive synonymy has been given for each species. A simplified taxonomic key is included, and illustrations and descriptions are provided for each species.

  2. Costa Rica's Chain of laterally collapsed volcanoes.

    NASA Astrophysics Data System (ADS)

    Duarte, E.; Fernandez, E.


    From the NW extreme to the SW end of Costa Rica's volcanic backbone, a number of laterally collapsed volcanoes can be observed. Due to several factors, attention has been given to active volcanoes disregarding the importance of collapsed features in terms of assessing volcanic hazards for future generations around inhabited volcanoes. In several cases the typical horseshoe shape amphitheater-like depression can be easily observed. In other cases due to erosion, vegetation, topography, seismic activity or drastic weather such characteristics are not easily recognized. In the order mentioned above appear: Orosi-Cacao, Miravalles, Platanar, Congo, Von Frantzius, Cacho Negro and Turrialba volcanoes. Due to limited studies on these structures it is unknown if sector collapse occurred in one or several phases. Furthermore, in the few studied cases no evidence has been found to relate collapses to actual eruptive episodes. Detailed studies on the deposits and materials composing dome-like shapes will shed light on unsolved questions about petrological and chemical composition. Volume, form and distance traveled by deposits are part of the questions surrounding most of these collapsed volcanoes. Although most of these mentioned structures are extinct, at least Irazú volcano (active volcano) has faced partial lateral collapses recently. It did presented strombolian activity in the early 60s. Collapse scars show on the NW flank show important mass removal in historic and prehistoric times. Moreover, in 1994 a minor hydrothermal explosion provoked the weakening of a deeply altered wall that holds a crater lake (150m diameter, 2.6x106 ). A poster will depict images of the collapsed volcanoes named above with mayor descriptive characteristics. It will also focus on the importance of deeper studies to assess the collapse potential of Irazú volcano with related consequences. Finally, this initiative will invite researchers interested in such topic to join future studies in

  3. Ena/VASP regulates mDia2-initiated filopodial length, dynamics, and function

    PubMed Central

    Barzik, Melanie; McClain, Leslie M.; Gupton, Stephanie L.; Gertler, Frank B.


    Filopodia are long plasma membrane extensions involved in the formation of adhesive, contractile, and protrusive actin-based structures in spreading and migrating cells. Whether filopodia formed by different molecular mechanisms equally support these cellular functions is unresolved. We used Enabled/vasodilator-stimulated phosphoprotein (Ena/VASP)–deficient MVD7 fibroblasts, which are also devoid of endogenous mDia2, as a model system to investigate how these different actin regulatory proteins affect filopodia morphology and dynamics independently of one another. Filopodia initiated by either Ena/VASP or mDia2 contained similar molecular inventory but differed significantly in parameters such as number, length, F-actin organization, lifetime, and protrusive persistence. Moreover, in the absence of Ena/VASP, filopodia generated by mDia2 did not support initiation of integrin-dependent signaling cascades required for adhesion and subsequent lamellipodial extension, thereby causing a defect in early cell spreading. Coexpression of VASP with constitutively active mDia2M/A rescued these early adhesion defects. We conclude that Ena/VASP and mDia2 support the formation of filopodia with significantly distinct properties and that Ena/VASP regulates mDia2-initiated filopodial morphology, dynamics, and function. PMID:24989797

  4. Enucleation of cultured mouse fetal erythroblasts requires Rac GTPases and mDia2.


    Ji, Peng; Jayapal, Senthil Raja; Lodish, Harvey F


    Mammalian erythroid cells undergo enucleation, an asymmetric cell division involving extrusion of a pycnotic nucleus enveloped by the plasma membrane. The mechanisms that power and regulate the enucleation process have remained obscure. Here, we show that deregulation of Rac GTPase during a late stage of erythropoiesis completely blocks enucleation of cultured mouse fetal erythroblasts without affecting their proliferation or differentiation. Formation of the contractile actin ring (CAR) on the plasma membrane of enucleating erythroblasts was disrupted by inhibition of Rac GTPases. Furthermore, we demonstrate that mDia2, a downstream effector of Rho GTPases and a formin protein required for nucleation of unbranched actin filaments, is also required for enucleation of mouse fetal erythroblasts. We show that Rac1 and Rac2 bind to mDia2 in a GTP-dependent manner and that downregulation of mDia2, but not mDia1, by small interfering RNA (siRNA) during the late stages of erythropoiesis blocked both CAR formation and erythroblast enucleation. Additionally, overexpression of a constitutively active mutant of mDia2 rescued the enucleation defects induced by the inhibition of Rac GTPases. These results reveal important roles for Rac GTPases and their effector mDia2 in enucleation of mammalian erythroblasts.

  5. 77 FR 37997 - Importation of Dracaena Plants From Costa Rica

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... / Tuesday, June 26, 2012 / Rules and Regulations#0;#0; ] DEPARTMENT OF AGRICULTURE Animal and Plant Health Inspection Service 7 CFR Part 319 RIN 0579-AD54 Importation of Dracaena Plants From Costa Rica AGENCY: Animal and Plant Health Inspection Service, USDA. ACTION: Final rule. SUMMARY: We are amending the plants...

  6. Case Study: Transgenic Crop Controversy in Costa Rica

    ERIC Educational Resources Information Center

    Hague, Steve S.


    Costa Rica has rich ecological resources and has been a steady political force in turbulent Central America. Most recently, it has become a battleground between pro- and anti-genetically modified organism (GMO) political forces. This case study examines the roles of U.S.-based cotton ("Gossypium hirsutum" L.) seed companies, anti-GMO…

  7. Disability and Rehabilitation in Rural Costa Rica. Occasional Paper 3.

    ERIC Educational Resources Information Center

    de Mezerville, Gaston

    To assist the Costa Rican Social Security Systems in designing a Rural Community Comprehensive Health Model, a study identified functional limitations among 1253 persons over age 7; assessed functional development of 293 children, ages 0-6; identified possible preventive factors of disability; and explored practices and resources in the districts…

  8. The genus Neotherina Dognin (Geometridae, Ennominae) in Costa Rica.


    Sullivan, J Bolling; Chacón, Isidro


    So far, two species of Neotherina Dognin have been recorded in Costa Rica. Neotherina imperilla (Dognin) occurs primarily at altitudes between 1100 and 1700 meters and Neotherina callas (Druce) which is widely distributed above 1100 meters. A third, new species, Neotherina xanthosa Sullivan and Chacón is described from altitudes above 2400 meters. Heterogeneity of the genus is discussed.

  9. First 5 Contra Costa Report on Parent Involvement. Final Report

    ERIC Educational Resources Information Center

    Duffy, Sarah; Induni, Marta; Moiduddin, Emily


    This report presents the results of the Parental Involvement in Pre-School Telephone Interview study completed by Mathematica Policy Research for the First 5 Contra Costa Children and Families Commission. Parent involvement in children's preschool programs and learning experiences is proven to be positively associated with cognitive, academic,…

  10. Empowering Women through Photovoice: Women of La Carpio, Costa Rica

    ERIC Educational Resources Information Center

    Morgan, Mary Y.; Vardell, Rosemarie; Lower, Joanna K.; Kinter-Duffy, Ibarra, Laura C.; Victoria L.; Cecil-Dyrkacz, Joy E.


    The purpose of the project was to allow participants to document, critique, and change their family and community conditions through photographs and stories of their everyday lives. This study used photovoice, a participatory action research methodology, with 7 women from La Carpio, Costa Rica. The women were given cameras and asked to photograph…

  11. Rewriting Citizenship? Civic Education in Costa Rica and Argentina

    ERIC Educational Resources Information Center

    Suarez, David F.


    To what degree are nations "rewriting" citizenship by expanding discussions of human rights, diversity and cultural pluralism in modern civic education, and what explains variation between countries? This study addresses these issues by analysing the intended content of civic education in Costa Rica and Argentina. Over time, civic…

  12. Environmental Education for Democracy and Social Justice in Costa Rica

    ERIC Educational Resources Information Center

    Locke, Steven


    This study focused on how democratic values and citizenship education are promoted through environmental education in Costa Rica. Data were collected through the examination of textbook and curriculum guides and interviews with classroom teachers. The qualitative study utilized Bowers' (2001) and Gruenewald's (2003) theories of eco-justice and…

  13. Contra Costa Community College District Vocational Education Report.

    ERIC Educational Resources Information Center

    Contra Costa Community Coll. District, Martinez, CA. Office of District Research.

    This report provides an overview of the legislative and administrative context of Vocational Education and profiles Vocational Education nationally, statewide, and at Contra Costa Community College District (CCCCD). Certain national trends, economic trends, and labor market trends have created implications for vocational and technical education in…

  14. Inventory of Vocational Programs in Alameda and Contra Costa Counties.

    ERIC Educational Resources Information Center

    Banaghan, William F., Comp.

    The document presents a directory of vocationally oriented educational programs which already exist in Alameda and Contra Costa Counties, California. It is hoped that the inventory will permit improved planning for future programs and greater utilization and coordination of present ones. Listings include: Directory of Educational Agencies, with…

  15. [Migration and employment in the metropolitan area of Costa Rica].


    Maguid, A


    The relationship between rural-urban migration and employment in Costa Rica is explored. "The main purpose of this paper is to examine the conditions in which immigrants are absorbed in the labour market." The data are from the Survey on Migration and Employment in Metropolitan Areas carried out by the Ministry of Planning and Political Economics in 1982. (summary in ENG)

  16. Interdisciplinary Team Teaching on Sustainable Development in Costa Rica.

    ERIC Educational Resources Information Center

    Lessor, Roberta; Reeves, Margaret; Andrade, Enrique


    Describes the development and implementation of an interdisciplinary field course in Costa Rica focused on sustainable development. The semester-long curriculum integrated sociology, political economy, and agricultural ecology. The curriculum was empirically based and involved faculty members and students working collaboratively on different…

  17. Area Handbook Series: Costa Rica, a Country Study.

    DTIC Science & Technology


    Costarricense de Electricidad -ICE) furnishes electricity either directly or ,4 through sale to private or government companies. Authority in each canton...34 San Jos6: 1979. Costa Rica. Servicio Nacional de Electricidad . Estadistica elkc- trica, 1972. n. pl.: n. d. * Estadistica elctrica, 1978. n. pl

  18. Science and Mathematics Education Research in Costa Rica.

    ERIC Educational Resources Information Center

    Berty, Rolando; Esquivel, Juan M.

    Increased emphasis on science and mathematics education research in Costa Rica since 1973 is reported. The majority of the studies carried out in the past 12 years have been diagnostic studies. General findings are listed, under the headings of certification, supervision, basic skills, teaching methods, attitudes, and curriculum. The diagnostic…

  19. Contra Costa Community College District Transfer Education Report.

    ERIC Educational Resources Information Center

    Contra Costa Community Coll. District, Martinez, CA.

    This research report from Contra Costa Community College District (CCCCD), California, summarizes relevant findings from assessments of the performance of students receiving transfer education, and CCCCD's progress in meeting its Partnership for Excellence (PFE) goals in this area. Findings reported include the following: (1) Student Goal…

  20. Contra Costa Community College District Institutional Effectiveness Report.

    ERIC Educational Resources Information Center

    Contra Costa Community Coll. District, Martinez, CA. Office of District Research.

    This document addresses the 2000 institutional effectiveness report for Contra Costa Community College District. The document discusses the following ten indicators which are directly aligned with Partnership for Excellence (PFE) 2005-2006 Goals: (1) Student Goal Attainment; (2) Course Success/ Persistence/ Retention Rates; (3) Certificate/ Degree…

  1. Costa Rica's Marine Protected Areas: status and perspectives.


    Alvarado, Juan José; Cortés, Jorge; Esquivel, María Fernanda; Salas, Eva


    With 51 100km2 of terrestrial area and 589 000km2 of national waters, Costa Rica is considered one of the countries with the greatest biodiversity. It has approximately 3.5% of the world marine species. In the last four decades, Costa Rica has done a considerable effort to create a representative system of Protected Areas (PA), mainly terrestrial. We present an assessment of the current situation of the Marine Protected Areas (MPA) in Costa Rica, through an historical analysis, and an evaluation of their distribution, coverage and management categories. Costa Rica has 166 protected areas covering 50% of the coastline; of these 20 are MPAs, classified as National Parks (90.6%), National Wildlife Refuges (6.6%), Wetlands (1.5%), Biological Reserves (1%), and one Absolute Natural Reserve (0.3%). According to IUCN criteria, 93.7% correspond to category II, 5% to IV and 1.3% to I. The marine protected surface is 5 296.5km2, corresponding to 17.5% of the territorial waters and 0.9% of the Exclusive Economic Zone. The median distance between MPAs is 22.4km in the Pacific and 32.9km along the Caribbean. The median size is close to 54km2. The main threats to MPAs are the lack of coordination between governmental agencies, limited economic resources, restricted patrolling and control, poor watershed management, and rampant coastal alteration.

  2. The Marine Education Programme and ESD Schools in Costa Rica

    ERIC Educational Resources Information Center

    Mata-Segreda, Alejandrina


    The purpose of this article is to share information about the Costa Rican Marine Education Programme in relation to the quality criteria for Education for Sustainable Development (ESD) Schools. We found that the application of these criteria is feasible, not only to the organisation and management of schools that are looking to become ESD Schools,…

  3. Situation of Drug Information Centers and Services in Costa Rica

    PubMed Central

    Hall, Victoria; Gomez, Carolina; Fernandez-Llimos, Fernando

    PAHO establishes guidelines that must be met by drug information centers (DIC) and the drug information services (DIS). Objective To describe the operations, activities, and resources of the DICs and the DISs affiliated with public institutions of Costa Rica, and their adjustment to the provisions set forth by the PAHO. Methods Descriptive study conducted in May 2003. The officers in charge of each of the seven public DICs or DISs in Costa Rica were interviewed, and inquiries were made regarding aspects of the structure and process of their centers. Results In Costa Rica there are seven public drug information units, that is, four DICs and three DISs. One of the DICs is located in this university, and the remaining six centers and services are in located in hospitals. Five of the centers do not have the primary sources required by the PAHO. Fifteen out of the 36 tertiary sources recommended are not available in any of the centers. 100% of the information units carry out four main activities: answering inquiries from the hospital community, answering inquiries from users outside the hospital, implementing education programs for patients and risk groups, and rotation programs for student training. Conclusions The activities developed by the DISs and the DICs in Costa Rica are similar to each other; they respond not only to the PAHO’s guidelines, but they also have similarities with the activities and operations of other DICs worldwide. Primary, secondary, and tertiary bibliographical support must be strengthened. PMID:25246999

  4. The genus Neotherina Dognin (Geometridae, Ennominae) in Costa Rica

    PubMed Central

    Sullivan, J. Bolling; Chacón, Isidro


    Abstract So far, two species of Neotherina Dognin have been recorded in Costa Rica. Neotherina imperilla (Dognin) occurs primarily at altitudes between 1100 and 1700 meters and Neotherina callas (Druce) which is widely distributed above 1100 meters. A third, new species, Neotherina xanthosa Sullivan and Chacón is described from altitudes above 2400 meters. Heterogeneity of the genus is discussed. PMID:22207793

  5. [Zooplankton of the Costa Rica Dome: taxonomy and biogeography].


    Vicencio Aguilar, M E; Fernández Alamo, M A


    A list of the species and taxa of some pelagic animals from a tropical upwelling region, based on collections made off the coast of Costa Rica is presented. The list includes a total of 224 species, 53 genera and 11 subspecific forms in Cnidaria, Annelida, Mollusca, Artropoda (Crustacea), Chaetognatha and Pisces.

  6. Citizenship, Wealth, and Whiteness in a Costa Rican High School

    ERIC Educational Resources Information Center

    Stocker, Karen


    This article addresses the democratic rhetoric taught in a Costa Rican High School and the ways in which that rhetoric clashed with school practices that revealed hierarchies based on race, ethnicity, class, and religion. This contradiction was rendered visible through student elections, the Independence Day celebration, and civic acts. Through…

  7. CREADS, a Teacher Training Course on ESD in Costa Rica

    ERIC Educational Resources Information Center

    Jimenez-Elizondo, Alicia


    After the Costa Rican government signed a commitment to implement the UN Decade of Education for Sustainable Development (DESD), the challenge was how to put the commitment into action. Fortunately, an opportunity presented itself with an initiative called Peace with Nature (Iniciativa Paz con la Naturaleza-IPN), under which a teacher training…

  8. Electronic Invoice in Costa Rica: Challenges for Its Implementation

    ERIC Educational Resources Information Center

    Ramírez-Jiménez, Juan José; De La O-Selva, Mario; Cortés-Morales, Roberto


    This paper discusses the current situation that Costa Rica faces around fiscal issues and high evasion rates. Using actors and multidimensional analysis, it proposes the electronic invoice as an e-government strategic solution that will close the gap around tax evasion and the government incomes. The success achieved by Brazil in this area…

  9. A diaCEST MRI approach for monitoring liposomal accumulation in tumors.


    Chan, Kannie W Y; Yu, Tao; Qiao, Yuan; Liu, Qiang; Yang, Ming; Patel, Himatkumar; Liu, Guanshu; Kinzler, Kenneth W; Vogelstein, Bert; Bulte, Jeff W M; van Zijl, Peter C M; Hanes, Justin; Zhou, Shibin; McMahon, Michael T


    Nanocarrier-based chemotherapy allows preferential delivery of therapeutics to tumors and has been found to improve the efficacy of cancer treatment. However, difficulties in tracking nanocarriers and evaluating their pharmacological fates in patients have limited judicious selection of patients to those who might most benefit from nanotherapeutics. To enable the monitoring of nanocarriers in vivo, we developed MRI-traceable diamagnetic Chemical Exchange Saturation Transfer (diaCEST) liposomes. The diaCEST liposomes were based on the clinical formulation of liposomal doxorubicin (i.e. DOXIL®) and were loaded with barbituric acid (BA), a small, organic, biocompatible diaCEST contrast agent. The optimized diaCEST liposomal formulation with a BA-to-lipid ratio of 25% exhibited 30% contrast enhancement at B1=4.7μT in vitro. The contrast was stable, with ~80% of the initial CEST signal sustained over 8h in vitro. We used the diaCEST liposomes to monitor the response to tumor necrosis factor-alpha (TNF-α), an agent in clinical trials that increases vascular permeability and uptake of nanocarriers into tumors. After systemic administration of diaCEST liposomes to mice bearing CT26 tumors, we found an average diaCEST contrast at the BA frequency (5ppm) of 0.4% at B1=4.7μT while if TNF-α was co-administered the contrast increased to 1.5%. This novel approach provides a non-radioactive, non-metallic, biocompatible, semi-quantitative, and clinically translatable approach to evaluate the tumor targeting of stealth liposomes in vivo, which may enable personalized nanomedicine.

  10. Activation of the S-Phase Checkpoint Inhibits Degradation of the F-Box Protein Dia2 ▿

    PubMed Central

    Kile, Andrew C.; Koepp, Deanna M.


    A stable genome is critical to cell viability and proliferation. During DNA replication, the S-phase checkpoint pathway responds to replication stress. In budding yeast, the chromatin-bound F-box protein Dia2 is required to maintain genomic stability and may help replication complexes overcome sites of damaged DNA and natural fragile regions. SCF (Skp1/Cul1/F-box protein) complexes are modular ubiquitin ligases. We show here that Dia2 is itself targeted for ubiquitin-mediated proteolysis and that activation of the S-phase checkpoint pathway inhibits Dia2 protein degradation. S-phase checkpoint mutants fail to stabilize Dia2 in response to replication stress. Deletion of DIA2 from these checkpoint mutants exacerbates their sensitivity to hydroxyurea, suggesting that stabilization of Dia2 contributes to the replication stress response. Unlike the case for other F-box proteins, deletion of the F-box domain in Dia2 does not stabilize the protein. Rather, an N-terminal domain that is also required for nuclear localization is necessary for degradation. When a strong nuclear localization signal (NLS) is added to dia2 mutants lacking this domain, the Dia2 protein is both stable and nuclear. Together, our results suggest that Dia2 protein turnover does not involve an autocatalytic mechanism and that Dia2 proteolysis is inhibited by activation of the replication stress response. PMID:19858292

  11. MetDIA: Targeted Metabolite Extraction of Multiplexed MS/MS Spectra Generated by Data-Independent Acquisition.


    Li, Hao; Cai, Yuping; Guo, Yuan; Chen, Fangfang; Zhu, Zheng-Jiang


    With recent advances in mass spectrometry, there is an increased interest in data-independent acquisition (DIA) techniques for metabolomics. With DIA technique, all metabolite ions are sequentially selected and isolated using a wide window to generate multiplexed MS/MS spectra. Therefore, DIA strategy enables a continuous and unbiased acquisition of all metabolites and increases the data dimensionality, but presents a challenge to data analysis due to the loss of the direct link between precursor ion and fragment ions. However, very few DIA data processing methods are developed for metabolomics application. Here, we developed a new DIA data analysis approach, namely, MetDIA, for targeted extraction of metabolites from multiplexed MS/MS spectra generated using DIA technique. MetDIA approach considers each metabolite in the spectral library as an analysis target. Ion chromatograms for each metabolite (both precursor ion and fragment ions) and MS(2) spectra are readily detected, extracted, and scored for metabolite identification, referred as metabolite-centric identification. A minimum metabolite-centric identification score responsible for 1% false positive rate of identification is determined as 0.8 using fully (13)C labeled biological extracts. Finally, the comparisons of our MetDIA method with data-dependent acquisition (DDA) method demonstrated that MetDIA could significantly detect more metabolites in biological samples, and is more accurate and sensitive for metabolite identifications. The MetDIA program and the metabolite spectral library is freely available on the Internet.

  12. Diaphanous formin mDia2 regulates CENP-A levels at centromeres

    PubMed Central

    Liu, Chenshu


    Centromeres of higher eukaryotes are epigenetically defined by centromere protein A (CENP-A), a centromere-specific histone H3 variant. The incorporation of new CENP-A into centromeres to maintain the epigenetic marker after genome replication in S phase occurs in G1 phase; however, how new CENP-A is loaded and stabilized remains poorly understood. Here, we identify the formin mDia2 as essential for stable replenishment of new CENP-A at centromeres. Quantitative imaging, pulse-chase analysis, and high-resolution ratiometric live-cell studies demonstrate that mDia2 and its nuclear localization are required to maintain CENP-A levels at centromeres. Depletion of mDia2 results in a prolonged centromere association of holiday junction recognition protein (HJURP), the chaperone required for CENP-A loading. A constitutively active form of mDia2 rescues the defect in new CENP-A loading caused by depletion of male germ cell Rac GTPase-activating protein (MgcRacGAP), a component of the small GTPase pathway essential for CENP-A maintenance. Thus, the formin mDia2 functions downstream of the MgcRacGAP-dependent pathway in regulating assembly of new CENP-A containing nucleosomes at centromeres. PMID:27185834

  13. Compressive and rarefactive DIA solitons beyond the KdV limit

    SciTech Connect

    Mamun, A. A.; Deeba, F.


    The modified Gardner equation (MGE), showing the existence of compressive and rarefactive dust-ion-acoustic (DIA) solitons in a nonplanar dusty plasma (containing inertial ions, Boltzmann electrons, and negatively charged stationary dust) beyond the KdV Korteweg-de Vries (KdV) limit, is derived and numerically solved. The basic features of the compressive and rarefactive cylindrical and spherical DIA solitons, which are found to exist beyond the KdV limit, i.e., exist for {mu} {approx} 2/3 (where {mu} = Z{sub n}n{sub d0}/n{sub i0}, z{sub d} is the number of electrons residing onto the dust grain surface, n{sub d0}(n{sub i0}) is the dust (ion) number density at equilibrium, and {mu} {approx} 2/3 means that {mu} is not equal to 2/3, but it is around 2/3) are identified. These solitons (which can be referred to as DIA Gardner solitons (DIA-GSs)) are completely different from the KdV solitons because {mu} = 2/3 corresponds to the vanishing of the nonlinear coefficient of the KdV equation, and {mu} {approx} 2/3 corresponds to extremely large amplitude KdV solitons for which the validity of the reductive perturbation method breaks down. It is also shown that the properties of the nonplanar (cylindrical and spherical) DIA-GSs are significantly different from those of the one dimensional planar ones.

  14. Rights of the Child in Costa Rica: Report Concerning the Application of the Convention on the Rights of the Child by the Republic of Costa Rica.

    ERIC Educational Resources Information Center

    Melo, Luz Angela

    This report to the United Nations Committee on the Rights of the Child contains observations of the World Organisation Against Torture (OMCT) concerning the application of the U.N. Convention on the Rights of the Child by the nation of Costa Rica. The report's introduction notes that in addition to ratifying the Convention, Costa Rica's…

  15. Data Integration and Analysis System (DIAS) Contributing to the Sustainable Development Goals (SDGs)

    NASA Astrophysics Data System (ADS)

    Koike, T.


    It has been said that scientists and experts usually use 80% of their research time for data management (DOE, 2002). Only 20% of research time is used for purely scientific activities. This ratio should be reversed by introducing computer science technology. To realize this goal, the Japanese government supported the development of a data system called "Data Integration and Analysis System (DIAS)," as one of the national key projects promoted by the Council for Science and Technology Policy (CSTP) from 2006 to 2010. A follow-up 5-year project is also ongoing. The essential aim for the DIAS was to create knowledge that would enable solutions to problems and generate socioeconomic benefits. DIAS mainly consists of four data components including data injection, management, integration, and interoperability. DIAS is now tackling a large increase in the diversity and volume of data from observing the Earth. Dictionaries have been developing an ontology system for technical and geographical terms, and a metadata design has been completed according to international standards. The volume of data stored has exponentially increased. Previously, almost all of the large-volume data came from satellites, but model outputs occupy the largest volume of our data storage nowadays. In collaboration with scientific and technological groups, DIAS can accelerate data archiving by including data loading, quality checking, metadata registration, and our system data-searching capability is being enriched. DIAS also enables us to perform integrated research and realize interdisciplinarity. Essentially, we are now working in the fields of climate, water resources, food, fisheries, and biodiversity by collaborating between different disciplines and trying to develop bases of contribution to Sustainable Development Goals (SDGs).

  16. Diversity and levels of endemism of the Bromeliaceae of Costa Rica - an updated checklist.


    Cáceres González, Daniel A; Schulte, Katharina; Schmidt, Marco; Zizka, Georg


    An updated inventory of the Bromeliaceae for Costa Rica is presented including citations of representative specimens for each species. The family comprises 18 genera and 198 species in Costa Rica, 32 species being endemic to the country. Additional 36 species are endemic to Costa Rica and Panama. Only 4 of the 8 bromeliad subfamilies occur in Costa Rica, with a strong predominance of Tillandsioideae (7 genera/150 spp.; 75.7% of all bromeliad species in Costa Rica). 124 species (62.6%) grow exclusively epiphytic, additional 59 spp. (29.8%) are facultative epiphytes. The most diverse genus is Werauhia, with 59 species (29.8% of the Costa Rican bromeliad flora), followed by Tillandsia with 40 species (20.2%) and Guzmania with 28 spp. (8.6%).

  17. Diversity and levels of endemism of the Bromeliaceae of Costa Rica – an updated checklist

    PubMed Central

    Cáceres González, Daniel A.; Schulte, Katharina; Schmidt, Marco; Zizka, Georg


    Abstract An updated inventory of the Bromeliaceae for Costa Rica is presented including citations of representative specimens for each species. The family comprises 18 genera and 198 species in Costa Rica, 32 species being endemic to the country. Additional 36 species are endemic to Costa Rica and Panama. Only 4 of the 8 bromeliad subfamilies occur in Costa Rica, with a strong predominance of Tillandsioideae (7 genera/150 spp.; 75.7% of all bromeliad species in Costa Rica). 124 species (62.6%) grow exclusively epiphytic, additional 59 spp. (29.8%) are facultative epiphytes. The most diverse genus is Werauhia, with 59 species (29.8% of the Costa Rican bromeliad flora), followed by Tillandsia with 40 species (20.2%) and Guzmania with 28 spp. (8.6%). PMID:24399894

  18. The Orbiniidae (Annelida: Polychaeta) of Pacific Costa Rica.


    Dean, Harlan K; Blake, James A


    Seven species of Orbiniidae are described from the Pacific coast of Costa Rica including two new species. Leodamas hamatus n. sp., a commonly occurring species on the coast of Pacific Costa Rica, is described from 11‒18 m in the Gulf of Nicoya and Bahia Culebra. This species is unusual in that the neuropodial uncini differ morphologically from anterior to posterior in the thorax. Scoloplos cryptospinigerus n. sp. is described from 18-22 m in the Gulf of Nicoya and has only a few short, toothed spines amidst numerous capillary setae in most of the thoracic neuropodia. This arrangement of thoracic neurosetae is unusual and has been seen only in one other described species of Scoloplos from Australia.

  19. [Abnormal haemoglobins in the newborn human population of Costa Rica].


    Abarca, Gabriela; Navarrete, Marta; Trejos, Rafael; de Céspedes, Carlos; Saborío, Manuel


    Hemoglobinopathies are hereditary autosomic recessive diseases. A total of 70 943 samples of whole blood collected by heel prick in filter paper (S&S 903) from throughout Costa Rica (October 2005-October 2006) were analyzed to detect variants of hemoglobin by the iso-electric focusing technique. Eight hundred ninety one cases presented some variant, for a frecuency of 1/79. Five cases are homozygous for hemoglobin S (sickle cell disease) and one shows the double heterozygous genotype SC. In this study the S and C variants of hemoglobin, although with some local differences, are widespread all over the country. Thus, the prevention of new cases is important through the testing of hemoglobin in the Costa Rican National Newborn Screening Program, together with a Interdisciplinary National Program of Education for the disease and carrier status (AS/AC) for patients, families and medicar personnel. This is the basis for proper genetic counseling, to improve treatment and to reduce morbi-mortality.

  20. Agricultural "killing fields": the poisoning of Costa Rican banana workers.


    Sass, R


    The poisoning of Costa Rican banana workers by multinational corporations' excessive use of pesticides is not a local issue; it is embedded in a dominant ideology expressed by the phenomenon of globalization. This ideology seeps into every aspect of our social institutions--economic, political, and legal. The practice of this ideological perspective is evident in the industrialization of global agriculture and the shift from "developmentalism"--liberal welfarism, industrialization, and urbanization--to a dominant, undemocratic, global financial elite with "economism" and a neoliberal political agenda overriding the nation-state polis. A specific effect is to transform the agricultural workers of developing countries, such as Costa Rican banana workers, into politically superfluous flesh-and-blood human beings.

  1. Diarrheagenic Escherichia coli in Children from Costa Rica

    PubMed Central

    Pérez, Cristian; Gómez-Duarte, Oscar G.; Arias, María L.


    More than 5,000 diarrheal cases per year receive medical care at the National Children's Hospital of Costa Rica, and nearly 5% of them require hospitalization. A total of 173 Escherichia coli strains isolated from children with diarrhea were characterized at the molecular, serologic, and phenotypic level. Multiplex and duplex polymerase chain reactions were used to detect the six categories of diarrheagenic E. coli. Thirty percent (n = 52) of the strains were positive, indicating a high prevalence among the pediatric population. Enteropathogenic E. coli and enteroinvasive E. coli pathotypes were the most prevalent (21% and 19%, respectively). Pathogenic strains were distributed among the four E. coli phylogenetic groups A, B1, B2, and D, with groups A and B1 the most commonly found. This study used molecular typing to evaluate the prevalence of diarrheagenic E. coli reported in Costa Rica and demonstrated the importance of these pathotypes in the pediatric population. PMID:20682870

  2. Climate change scenario for Costa Rican montane forests

    NASA Astrophysics Data System (ADS)

    Karmalkar, A. V.; Bradley, R. S.; Diaz, H. F.


    Tropical montane cloud forests are characterized by persistent immersion in clouds, an important source of moisture during the dry season. Future changes in temperature and precipitation could alter cloud cover at the vegetation level and seriously affect mountain ecosystems. A regional climate modeling study that focuses on changes in the distributions of temperature and precipitation in Costa Rica shows, in general, an increase in temperature and a decrease in precipitation under the A2 scenario. At high elevations, warming is amplified and future temperature distribution lies outside the range of present-day distribution. Compared to the Caribbean side, temperature changes are greater at high elevations on the Pacific side. Model results also show significant changes in precipitation amounts and variability and an increase in the altitude of cloud formation on the Pacific side that may have serious implications for mountain ecosystems in and around Costa Rica.

  3. New records of fishes at Isla del Coco, Costa Rica

    USGS Publications Warehouse

    Garrison, V.H.


    Isla del Coco lies at 5 degrees 32'N latitude, 87 degrees 04'W longitude and is the sole peak of the Cocos Ridge exposed above sea level. This isolated island formed approximately 2 million years ago. It rises 575 m above the surface of the sea and covers 46 km2 (Castillo et aI., 1988). Five hundred km to the NNE is Costa Rica; 630 km SSW are the Galapagos Islands; 650 km to the E is Isla Malpelo, Colombia; and approximately 8,000 km W lie the Line Islands. Costa Rica claimed Isla del Coco in 1832 and declared it a National Park in 1978. The area of the park was increased to include the adjacent waters 5 km offshore in 1984 and 25 km offshore in 1991.

  4. Contra Costa Community College District Enrollment Report, October 2000.

    ERIC Educational Resources Information Center

    Contra Costa Community Coll. District, Martinez, CA.

    This report analyzes enrollment figures for Contra Costa Community College District in 2000-2001. The data for 2002 is compared with the data from 1997-1998, 1998-1999, and 1999-2000. The following are some of the major findings of the report: (1) both resident and non-resident FTES totals have increased over 1995/1996 levels; (2) the growth…

  5. Population genetic data for 18 STR loci in Costa Rica.


    Rodríguez, A; Arrieta, G; Sanóu, I; Vargas, M C; García, O; Yurrebaso, I; Pérez, J A; Villalta, M; Espinoza, M


    Allele frequencies for 18 STR autosomal loci (D3S1358, VWA, FGA, D8S1179, D21S11, D18S51, D5S818, D13S317, D7S820, D16S539, TH01, TPOX, CSF1PO, Penta D, Penta E, D19S433, D2S1338 and SE33) were obtained from a sample of 191-500 unrelated individuals from Costa Rica, Central America.

  6. Costa Rica: Background and U.S. Relations

    DTIC Science & Technology


    legislative elections were held in February 2006, though the presidential election was so close that the Supreme Electoral Tribunal (TSE) did not...Ambiente y Energia, “ Sistema Nacional de Áreas Protegidas,” available at <>. 24 Thomas L. Friedman, “(No) Drill...polarization of the issue among the Costa Rican electorate . Trade unions, students, a variety of social movements, and the PAC opposed the ratification

  7. Costa Rica: Background and U.S. Relations

    DTIC Science & Technology


    legislative elections were held in February 2006, though the presidential election was so close that the Supreme Electoral Tribunal (TSE) did not...Del Ambiente y Energia, “ Sistema Nacional de Áreas Protegidas,” available at planificacionasp.php. 25 Thomas L. Friedman, “(No...among the Costa Rican electorate . Trade unions, students, a variety of social movements, and the PAC opposed the ratification of CAFTA-DR, while

  8. Costa Rica: Background and U.S. Relations

    DTIC Science & Technology


    and legislative elections were held in February 2006, though the presidential election was so close that the Supreme Electoral Tribunal (TSE) did not...Government seeks green credentials,” Oxford Analytica, October 21, 2008. 23 Ministerio Del Ambiente y Energia, “ Sistema Nacional de Áreas Protegidas...CAFTA-DR. The referendum was held in October 2007 and reflected the polarization of the issue among the Costa Rican electorate . Trade unions

  9. [Organochlorine pesticide residues in human adipose tissue in Costa Rica].


    Barquero, M; Constenla, M A


    Organochlorine pesticide residues were found in 82 samples of human adipose material from 82 surgical cases in 16 Costa Rica hospitals. Identification was made by gas-liquid chromatography. The highest pesticide concentration was that of DDT and its metabolites (33.16 micrograms/g). Residues of almost all commercial pesticides were also found. Concentrations of alpha-chlordane. Aldrin and Polychlorinated biphenyls were not significant.

  10. Canine Distemper Virus in Wild Felids of Costa Rica.


    Avendaño, Roberto; Barrueta, Flor; Soto-Fournier, Sofía; Chavarría, Max; Monge, Otto; Gutiérrez-Espeleta, Gustavo A; Chaves, Andrea


    Several highly infectious diseases can be transmitted through feces and cause elevated mortality among carnivore species. One such infectious agent, canine distemper virus (CDV; Paramyxoviridae: Morbillivirus), has been reported to affect wild carnivores, among them several felid species. We screened free-ranging and captive wild carnivores in Costa Rica for CDV. Between 2006 and 2012, we collected 306 fecal samples from 70 jaguars (Panther onca), 71 ocelots ( Leopardus pardalis ), five jaguarundis (Puma yaguaroundi), 105 pumas ( Puma concolor ), five margays ( Leopardus wiedii ), 23 coyotes ( Canis latrans ), and 27 undetermined Leopardus spp. We found CDV in six individuals: one captive jaguarundi (rescued in 2009), three free-ranging ocelots (samples collected in 2012), and two free-ranging pumas (samples collected in 2007). Phylogenetic analyses were performed using sequences of the phosphoprotein (P) gene. We provide evidence of CDV in wild carnivores in Costa Rica and sequence data from a Costa Rican CDV isolate, adding to the very few sequence data available for CDV isolates from wild Central American carnivores.

  11. Costa Rica regroups for sales kick-off.



    Cost Rica's contraceptive social marketing project is scheduled to be launched in March 1985. The project is run through a for-profit corporation, Asdecosta, which is owned by the Costa Rican International Planned Parenthood affiliate. Asdecosta was formed as a for-profit entity because Costa Rican law prohibits product sales by nonprofit groups. The US Agency for International Development (AID) will allocate US$1.2 million over a 5-year period, 1983-88. The project manager, Jorge Lopez, is an economist with considerable experience in marketing. The project has lined up a top national distributor, a packaging company, and an advertising agency for its 1st product, a condom manufactured in the US by Ansell. Asdecost's target market is projected to include 50,000-75,000 couples at its peak operating capacity. An estimated 65% of Costa Rican women have used a contraceptive method at some time. The condom, pill, and IUD are the most popular methods. Eventually, Asdecosta expects to expand its product line to include oral contraceptives. Another goal is to counter the high drop out rate among users of government and other family planning services.

  12. (Findings of the Costa Rica power sector efficiency study)

    SciTech Connect

    Waddle, D.B.


    To present findings of the Costa Rica Power Sector Efficiency Study to the Instituto Costarricense de Electridad, and to the Ministry of Energy, Natural Resources and Mining. To discuss the progress and plans for the Central American Rural Electrification Project with US Agency for International Development (USAID)/Regional Office Central American Program (ROCAP). I traveled to San Jose, Costa Rica to present the findings of the Costa Rica Power Sector Efficiency Study to our counterparts in the utility and the Ministry of Energy. Discussions were held with line level managers at Instituto Costarricensede Electricidad (ICE) and Ministry of Energy Mines and Natural Resources (MIRENEM), as well as a plan of action set for the final stage of the project. Discussions were held for a one day period with both the bilateral Agency for International Development (AID) and the regional AID mission regarding the need for a similar study in Guatemala and matters directly pertaining to the Central American Rural Electrification Study (CARES) project.

  13. A guide to the winged aphids (Homoptera) of Costa Rica.


    Voegtlin, David; Villalobos, William; Sánchez, Marco Vinicio; Saborio-R, Guido; Rivera, Carmen


    This guide is a compilation of limited morphological and biological information on the winged morphs of 60 species of aphids that have been collected in Costa Rica. It should not be viewed as a definitive taxonomic treatise on the aphids of Costa Rica, rather it is a tool that can be used to assist in research on the biology, host plant relationships, taxonomy, and virus transmission capabilities of aphids. Each species is covered in an identical manner. Morphological and biological information is provided in both Spanish and English as well as photographs of slide mounted specimens. Keys are provided to help the user in identifying the species. Most of the specimens examined were taken in traps associated with epidemiological studies. Limited field collecting has generated host records and these have been added to a list of the aphids of Central America that was compiled by Pamela Anderson and appended in the guide with her permission. The authors hope that this book will be useful to entomologists in Costa Rica and Central America.

  14. From Yoknapatawpha to Piratininga and Beyond: Antônio Dutra's "Dias De Faulkner"

    ERIC Educational Resources Information Center

    Valente, Luiz Fernando


    By reimagining William Faulkner's 1954 visit to Brazil, Antônio Dutra's "Dias de Faulkner" (2008) establishes a creative dialogue with Faulkner's "oeuvre" while also inquiring into the author's enigmatic personality. In the process Dutra's narrative invites us to reflect on the complex and contradictory relationship between the…

  15. Los Dias de Los Muertos. The Days of the Dead. 1991 Edition.

    ERIC Educational Resources Information Center

    Lane, Sarah; Turkovich, Marilyn

    The Dias de los Muertos is a celebration of Mexico that is a recognition of mortality, transience, and death, and a celebration of life, hope, and resurrection. This curriculum activity book begins with a general introduction to the festival followed by sections of explanations and activities intended to engage the learner in various aspects of…

  16. El Dia de los Muertos -- Libreto. (The Day of the Dead -- Notebook.)

    ERIC Educational Resources Information Center

    Espinoza, Delia; Lopez, Santiago, III

    On November 2, all Mexican Americans remember their dead as Mexico does on that same day. Called "El Dia de los Muertos" (Day of the Dead), the dead are remembered posthumously with flowers, candles, music, prayers, chants, and wreaths. The people go to cemeteries to clean tombs, lay fresh or artificial flowers on them, and pray for…

  17. Collaboration using open standards and open source software (examples of DIAS/CEOS Water Portal)

    NASA Astrophysics Data System (ADS)

    Miura, S.; Sekioka, S.; Kuroiwa, K.; Kudo, Y.


    The DIAS/CEOS Water Portal is a part of the DIAS (Data Integration and Analysis System, systems for data distribution for users including, but not limited to, scientists, decision makers and officers like river administrators. One of the functions of this portal is to enable one-stop search and access variable water related data archived multiple data centers located all over the world. This portal itself does not store data. Instead, according to requests made by users on the web page, it retrieves data from distributed data centers on-the-fly and lets them download and see rendered images/plots. Our system mainly relies on the open source software GI-cat ( and open standards such as OGC-CSW, Opensearch and OPeNDAP protocol to enable the above functions. Details on how it works will be introduced during the presentation. Although some data centers have unique meta data format and/or data search protocols, our portal's brokering function enables users to search across various data centers at one time. And this portal is also connected to other data brokering systems, including GEOSS DAB (Discovery and Access Broker). As a result, users can search over thousands of datasets, millions of files at one time. Users can access the DIAS/CEOS Water Portal system at

  18. Demography and development: the lessons of Costa Rica.


    Gallagher, C F


    Focus in this discussion is on demography and development in Costa Rica. In a 15-year period, during the 1960s and the 1st years of the 1970s, Costa Rica achieved the fastest and steepest fertility decline yet recorded in Latin America. The crude birthrate dropped from a high point in 1959 of 48.3/1000 to a low of 29.9/1000 in 1973. During the same period, the death rate declined from 9.2/1000 to 5.2/1000 by 1973. Because of this, the drop in the rate of natural increase, from 3.9% a year in 1959 to 2.47% in 1973, was not quite as pronounced in percentage terms. During those same years infant mortality dropped from 74/1000 to about 45/1000. The total fertility rate declined from 7.3 children in 1960 to 5.5 in 1968 and to just above 4 children in 1973. The major thrust of the decline originated primarily in popular perception of the imbalance between an unnecessarily high birthrate and changed socioeconomic conditions toward the end of the 1950s, of which improvements in health and general social care were among the most influential. It is not so much the economic performance of Costa Rica that distinguishes it from its neighbors as its social condition. What keeps Costa Rica from being a "banana republic" is its comparatively much higher level of social indicators: newspaper circulation per capita and the amount of newsprint consumption, the extraordinary number of bookstores in San Jose, the number of physicians and hospital beds per person, the number of teachers and students enrolled at all levels of education, and its extremely low mortality rate and very high longevity. The total fertility rate appears to have entered a period of stagnation or pause, with virtually no decline since 1974 and even a slight increase since 1976. In the 5-year period since 1973, the decline through 1978 amounted to only 5%. In the preceding 1968-73 period it wasmore than 26%. The number of births/1000 women in the 15-19 year old age group remains constant and is comparatively very

  19. Teacher Expectations and Students from Low Socioeconomic Background: A Perspective from Costa Rica

    ERIC Educational Resources Information Center

    Regalla, Michele


    This study explores teachers' academic expectations of students from low socioeconomic status (SES) in Costa Rica for the purpose of cross-cultural comparison. A group of 17 teachers from two different elementary schools located in a small town in Costa Rica were questioned about their expectations of low SES students enrolled in their classes.…

  20. Differences and Similarities between School Principals in Costa Rica and the United States

    ERIC Educational Resources Information Center

    Ballestero, Victor; Wright, Sam


    The need for effective school leadership is a global concern. This paper provides a comparison of the school principal in Costa Rica to the United States. Differences and similarities are described for principals in both nations. Major differences for principals in Costa Rica include administrative salaries, selection procedures, induction, no…

  1. The Impact of Post-Secondary Privatization: The Case of Costa Rica

    ERIC Educational Resources Information Center

    Espinosa, Lorelle L.; Santos, Jose L.


    Between 1985 and 2000, the Central American country of Costa Rica experienced rapid and unprecedented private university growth as part of an international movement towards post-secondary privatization. Costa Rica stands apart from other developing countries in that all 50 of the nation's private universities are proprietary, resulting in a…

  2. Quality Early Childhood Education in Costa Rica? Policy, Practice, Outcomes and Challenges

    ERIC Educational Resources Information Center

    San Francisco, Andrea Rolla; Arias, Melissa; Villers, Renata


    High-quality early childhood education has been shown to improve school outcomes in several developing and developed nations. The history of policy around pre-school education in Costa Rica is described as background to presenting cross-sectional data on the emergent literacy skills of low-income Costa Rican children in kindergarten, 1st and 2nd…

  3. Crack cocaine use among persons with tuberculosis--Contra Costa County, California, 1987-1990.



    From January 1, 1987, through June 30, 1990, 44 cases of tuberculosis (TB) occurred among residents of Contra Costa County, California, who were known to use crack cocaine. To investigate a possible association between crack cocaine use and TB, local health officials conducted a retrospective study of TB cases among residents of Contra Costa County.

  4. Costa Rica's Universidad Estatal a Distancia: A Case Study. DERG Papers, Number 4.

    ERIC Educational Resources Information Center

    Rumble, Greville

    Costa Rica's Universidad Estatal a Distancia (UNED), the education system in the country, and information on Costa Rica are considered. UNED is helping to equalize geographical inequalities of access to higher education. Overall, UNED's academic programs have been aimed at those who want to obtain professional qualifications. In the first semester…

  5. Educational Change and Structural Adjustment: A Case Study of Costa Rica. [Working Document.

    ERIC Educational Resources Information Center

    Carnoy, Martin; Torres, Carlos

    In the 1960s and 1970s, steady economic growth helped the Costa Rican government expand its education system rapidly. The 1979 oil shocks, the U.S. 1981-82 recession, and other factors ended this prosperity and exposed the fragility of Costa Rica's late 1970s debt-financed development. To restore economic growth, new economic policies were…

  6. Incidence, distribution and association of Spongospora subterranea and Potato mop-top virus in Costa Rica

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A survey was conducted in 39 potato (Solanum tuberosum L.) fields in Costa Rica to determine incidence and association of Spongospora subterranea f. sp. subterranea and Potato mop-top pomovirus (PMTV). The fields were located in Costa Rica’s two major potato production regions, and were further char...

  7. Special Education and Severe Disabilities in Costa Rica: Developing Inclusion in a Developing Country.

    ERIC Educational Resources Information Center

    Stough, Laura M.


    An overview of special education in Costa Rica is provided. Costa Rica has promulgated four educational service models that extend special education expertise: consulting teachers, educational assistance teams, itinerant teams, and resource centers. Their educational classification system describes the level of modifications required by students.…

  8. Costa Rica's 'White legend': how racial narratives undermine its health care system.


    Campo-Engelstein, Lisa; Meagher, Karen


    A dominant cultural narrative within Costa Rica describes Costa Ricans not only as different from their Central American neighbours, but it also exalts them as better: specifically, as more white, peaceful, egalitarian and democratic. This notion of Costa Rican exceptionalism played a key role in the creation of their health care system, which is based on the four core principles of equity, universality, solidarity and obligation. While the political justification and design of the current health care system does, in part, realize this ideal, we argue that the narrative of Costa Rican exceptionalism prevents the full actualization of these principles by marginalizing and excluding disadvantaged groups, especially indigenous and black citizens and the substantial Nicaraguan minority. We offer three suggestions to mitigate the self-undermining effects of the dominant national narrative: 1) encouragement and development of counternarratives; 2) support of an emerging field of Costa Rican bioethics; and 3) decoupling health and national successes.

  9. DiAs User Interface: A Patient-Centric Interface for Mobile Artificial Pancreas Systems

    PubMed Central

    Keith-Hynes, Patrick; Guerlain, Stephanie; Mize, Benton; Hughes-Karvetski, Colleen; Khan, Momin; McElwee-Malloy, Molly; Kovatchev, Boris P.


    Background Recent in-hospital studies of artificial pancreas (AP) systems have shown promising results in improving glycemic control in patients with type 1 diabetes mellitus. The next logical step in AP development is to conduct transitional outpatient clinical trials with a mobile system that is controlled by the patient. In this article, we present the user interface (UI) of the Diabetes Assistant (DiAs), an experimental smartphone-based mobile AP system, and describe the reactions of a round of focus groups to the UI. This work is an initial inquiry involving a relatively small number of potential users, many of whom had never seen an AP system before, and the results should be understood in that light. Methods We began by considering how the UI of an AP system could be designed to make use of the familiar touch-based graphical UI of a consumer smartphone. After developing a working prototype UI, we enlisted a human factors specialist to perform a heuristic expert analysis. Next we conducted a formative evaluation of the UI through a series of three focus groups with N = 13 potential end users as participants. The UI was modified based upon the results of these studies, and the resulting DiAs system was used in transitional outpatient AP studies of adults in the United States and Europe. Results The DiAs UI was modified based on focus group feedback from potential users. The DiAs was subsequently used in JDRF- and AP@Home-sponsored transitional outpatient AP studies in the United States and Europe by 40 subjects for 2400 h with no adverse events. Conclusions Adult patients with type 1 diabetes mellitus are able to control an AP system successfully using a patient-centric UI on a commercial smartphone in a transitional outpatient environment. PMID:24351168

  10. Simultaneous Quantification of Viral Antigen Expression Kinetics Using Data-Independent (DIA) Mass Spectrometry.


    Croft, Nathan P; de Verteuil, Danielle A; Smith, Stewart A; Wong, Yik Chun; Schittenhelm, Ralf B; Tscharke, David C; Purcell, Anthony W


    The generation of antigen-specific reagents is a significant bottleneck in the study of complex pathogens that express many hundreds to thousands of different proteins or to emerging or new strains of viruses that display potential pandemic qualities and therefore require rapid investigation. In these instances the development of antibodies for example can be prohibitively expensive to cover the full pathogen proteome, or the lead time may be unacceptably long in urgent cases where new highly pathogenic viral strains may emerge. Because genomic information on such pathogens can be rapidly acquired this opens up avenues using mass spectrometric approaches to study pathogen antigen expression, host responses and for screening the utility of therapeutics. In particular, data-independent acquisition (DIA) modalities on high-resolution mass spectrometers generate spectral information on all components of a complex sample providing depth of coverage hitherto only seen in genomic deep sequencing. The spectral information generated by DIA can be iteratively interrogated for potentially any protein of interest providing both evidence of protein expression and quantitation. Here we apply a solely DIA mass spectrometry based methodology to profile the viral antigen expression in cells infected with vaccinia virus up to 9 h post infection without the need for antigen specific antibodies or other reagents. We demonstrate deep coverage of the vaccinia virus proteome using a SWATH-MS acquisition approach, extracting quantitative kinetics of 100 virus proteins within a single experiment. The results highlight the complexity of vaccinia protein expression, complementing what is known at the transcriptomic level, and provide a valuable resource and technique for future studies of viral infection and replication kinetics. Furthermore, they highlight the utility of DIA and mass spectrometry in the dissection of host-pathogen interactions.

  11. Human Rabies: A Reemerging Disease in Costa Rica?

    PubMed Central

    Pérez-Herra, Victor; Quirós, Ligia; Morice, Ana; Jiménez, Edwin; Sáenz, Elizabeth; Salazar, Fernando; Fernández, Rodrigo; Orciari, Lillian; Yager, Pamela; Whitfield, Sylvia; Rupprecht, Charles E.


    Two human rabies cases caused by a bat-associated virus variant were identified in September 2001 in Costa Rica, after a 31-year absence of the disease in persons. Both patients lived in a rural area where cattle had a high risk for bat bites, but neither person had a definitive history of being bitten by a rabid animal. Characterization of the rabies viruses from the patients showed that the reservoir was the hematophagous Vampire Bat, Desmodus rotundus, and that a sick cat was the vector. PMID:12781014

  12. Drug abuse in Costa Rica: a review of several studies.


    Alfaro Murillo, E


    This article provides a review of drug use surveys conducted by Costa Rica's Institute on Alcoholism and Drug Dependence during the years 1983-1987. These studies dealt with a wide range of subjects--residents of marginal neighborhoods, juvenile male and adult female detainees, and high school students--as well as with the general population. Overall, the studies indicated that the most commonly used illicit drug was marijuana, that the bulk of the drug users (excluding alcohol and tobacco users) were young males, that relevant levels of cocaine use were starting to occur, and that the country's general drug abuse picture poses a problem in need of immediate attention.

  13. Hispines (Chrysomelidae, Cassidinae) of La Selva Biological Station, Costa Rica

    PubMed Central

    Staines, Charles L.


    Abstract Survey work from 1992–2001 identified 139 species of hispines at the lowland part of La Selva Biological Station, Costa Rica. The tribe Cephaloleiini was the most speciose with 58 species (41.7%) followed by the Chalepini with 55 (39.5%). The fauna is most closely related to that in South America but with some genera which are more speciose in the Nearctic Region. Plant associations are known for 88 (63.3%) of the species but many of these are merely collecting records, not host plant associations. The first plant associations are reported for Alurnus ornatus, Alurnus salvini, and Acentroptera nevermanni. PMID:22303103

  14. The DIAS/CEOS Water Portal, distributed system using brokering architecture

    NASA Astrophysics Data System (ADS)

    Miura, Satoko; Sekioka, Shinichi; Kuroiwa, Kaori; Kudo, Yoshiyuki


    The DIAS/CEOS Water Portal is a one of the DIAS (Data Integration and Analysis System, systems for data distribution for users including, but not limited to, scientists, decision makers and officers like river administrators. This portal has two main functions; one is to search and access data and the other is to register and share use cases which use datasets provided via this portal. This presentation focuses on the first function, to search and access data. The Portal system is distributed in the sense that, while the portal system is located in Tokyo, the data is located in archive centers which are globally distributed. For example, some in-situ data is archived at the National Center for Atmospheric Research (NCAR) Earth Observing Laboratory in Boulder, Colorado, USA. The NWP station time series and global gridded model output data is archived at the Max Planck Institute for Meteorology (MPIM) in cooperation with the World Data Center for Climate in Hamburg, Germany. Part of satellite data is archived at DIAS storage at the University of Tokyo, Japan. This portal itself does not store data. Instead, according to requests made by users on the web page, it retrieves data from distributed data centers on-the-fly and lets them download and see rendered images/plots. Although some data centers have unique meta data format and/or data search protocols, our portal's brokering function enables users to search across various data centers at one time, like one-stop shopping. And this portal is also connected to other data brokering systems, including GEOSS DAB (Discovery and Access Broker). As a result, users can search over thousands of datasets, millions of files at one time. Our system mainly relies on the open source software GI-cat (, Opensearch protocol and OPeNDAP protocol to enable the above functions. Details on how it works will be introduced during the

  15. Willow Flycatcher nonbreeding territory defense behavior in Costa Rica

    USGS Publications Warehouse

    Sogge, M.K.; Koronkiewicz, T.J.; van Riper, Charles; Durst, S.L.


    We studied the intraspecific territorial defense behavior of wintering Willow Flycatchers (Empidonax traillii) in Costa Rica using a randomized playback experiment that exposed male and female birds to recordings of Willow Flycatcher songs and calls, Lesser Ground Cuckoo (Morococcyx erythropygius) vocalizations, and random noise. Flycatchers of both sexes responded most strongly to simulated conspecific territory intrusion, and the agonistic behaviors that we observed were similar to those seen during natural intraspecific encounters in winter. Both males and females engaged in song and aggressive behaviors in defense of territories, and there was no significant difference between the sexes in scored agonistic responses. The similarity between the sexes in intraspecific territorial defense behaviors and aggressiveness may account for both sexes of flycatchers using the same habitats at our study sites in Costa Rica, and wintering females defending territories against males. The Willow Flycatcher, a sexually monomorphic species, differs in this way from a number of sexually dimorphic passerines, in which behaviorally dominant males occur in more optimal winter habitats. ?? The Cooper Ornithological Society 2007.

  16. [Mass screening for gastric cancer performed in Costa Rica].


    Sasagawa, Yumiko; Sasagawa, Tsuyoshi; Takasaki, Ken


    We performed mass screening for gastric cancer by means of X-ray in Costa Rica from 1996 through 1999. Screening was performed on 10,064 subjects and 69 gastric cancers were detected (screening group). During the same period 172 gastric cancer patients were referred to us (non-screening group). Results of screening in Japan (Japanese group) were quoted from the annual report of the Japanese Society of Gastroenterological Mass Survey. This study is a comparison of these 3 groups. The detection rate was 0.68% in the screening group, 0.11% in the Japanese group. The operability was 92.7%, 76.1%, 97.0%, the resectability 96.8%, 83.2%, 98.6%, the rate of early gastric cancer 64.5%, 30.3%, 65.9%, and the rate of curability A 79.0%, 38.5%. 82.6% in the screening group, non-screening group and Japanese group respectively. The results in the screening group were exactly equal to those in the Japanese group. These results show that the same results can be obtained in Costa Rica as in Japan, if screening is performed with the same diagnostic level and skill as in Japan.

  17. Forests of hope: Costa Rica. Restoring hope in the clouds.


    Bowen, L


    The rapid population growth in Central America has created pressure on the largest tract of cloud forest spanning the Talamanca Mountains in Costa Rica and Panama. Of immediate concern is restoring hope in the forest and improving the standard of living among local people. Such is the goal of the Amistad Conservation and Development (AMISCONDE) project in the communities of Cerro Punta, Panama, and San Rafael in Costa Rica. Through agriculture, forestry, animal husbandry, environmental education, and community development, AMISCONDE aims to restore the degraded lands in the reserve's buffer zone and improve the income of the people. All the local people, the farmers, women and children have benefited from the project. Some of the activities carried out to meet its objectives include helping the farmers improve the productivity and marketability of their products by teaching them new technologies and giving agricultural credits to farmers, women, and youth groups. In addition, AMISCONDE conducts training courses to address the economic, social and educational needs of women and communities. It is assured that the community and the group will be prepared to continue on their own after the official AMISCONDE office is gone.

  18. Labor force growth and the environment in Costa Rica.


    Abler, D G; Rodriguez, A G; Shortle, J S


    The introduction to this report of a study that examines the potential environmental impacts of labor force growth (LFG) in Costa Rica under LFG scenarios notes that LFG is an economically critical aspect of population growth that can affect the environment by expanding the economy's production possibilities frontier and/or by increasing consumption. The introduction also explains why Costa Rica is ideal for this study and identifies the study as unique because it constructs a computable general equilibrium (CGE) model using 10 environmental indicators and because it models uncertainty regarding the values of the economic parameters. The report continues by reviewing the literature linking population and environmental issues; detailing the CGE model; discussing the 10 environmental indicators (deforestation, erosion, pesticide use, overfishing, hazardous wastes, inorganic wastes, organic wastes, greenhouse gas emissions, air pollution, and water/sewer usage) used in the model; and explaining the method used to simulate the impacts of LFG. The major conclusions that emerged from the results of this study are that 1) the economy-wide impacts of LFG (and, thus, population growth) on the environment are important and vary significantly according to the amounts of physical and human capital present in the labor force and 2) the impacts of LFG vary substantially among environmental indicators.

  19. Effect of fragmentation on the Costa Rican dry forest avifauna.


    Barrantes, Gilbert; Ocampo, Diego; Ramírez-Fernández, José D; Fuchs, Eric J


    Deforestation and changes in land use have reduced the tropical dry forest to isolated forest patches in northwestern Costa Rica. We examined the effect of patch area and length of the dry season on nestedness of the entire avian community, forest fragment assemblages, and species occupancy across fragments for the entire native avifauna, and for a subset of forest dependent species. Species richness was independent of both fragment area and distance between fragments. Similarity in bird community composition between patches was related to habitat structure; fragments with similar forest structure have more similar avian assemblages. Size of forest patches influenced nestedness of the bird community and species occupancy, but not nestedness of assemblages across patches in northwestern Costa Rican avifauna. Forest dependent species (species that require large tracts of mature forest) and assemblages of these species were nested within patches ordered by a gradient of seasonality, and only occupancy of species was nested by area of patches. Thus, forest patches with a shorter dry season include more forest dependent species.

  20. Status and conservation of coral reefs in Costa Rica.


    Cortés, Jorge; Jiménez, Carlos E; Fonseca, Ana C; Alvarado, Juan José


    Costa Rica has coral communities and reefs on the Caribbean coast and on the Pacific along the coast and off-shore islands. The Southern section of the Caribbean coast has fringing and patch reefs, carbonate banks, and an incipient algal ridge. The Pacific coast has coral communities, reefs and isolated coral colonies. Coral reefs have been seriously impacted in the last 30 years, mainly by sediments (Caribbean coast and some Pacific reefs) and by El Niño warming events (both coasts). Monitoring is being carried out at three sites on each coast. Both coasts suffered significant reductions in live coral cover in the 1980's, but coral cover is now increasing in most sites. The government of Costa Rica is aware of the importance of coral reefs and marine environments in general, and in recent years decrees have been implemented (or are in the process of approval) to protect them, but limited resources endanger their proper management and conservation, including proper outreach to reef users and the general public.

  1. Costas loop lock detection in the advanced receiver

    NASA Technical Reports Server (NTRS)

    Mileant, A.; Hinedi, S.


    The advanced receiver currently being developed uses a Costas digital loop to demodulate the subcarrier. Previous analyses of lock detector algorithms for Costas loops have ignored the effects of the inherent correlation between the samples of the phase-error process. Accounting for this correlation is necessary to achieve the desired lock-detection probability for a given false-alarm rate. Both analysis and simulations are used to quantify the effects of phase correlation on lock detection for the square-law and the absolute-value type detectors. Results are obtained which depict the lock-detection probability as a function of loop signal-to-noise ratio for a given false-alarm rate. The mathematical model and computer simulation show that the square-law detector experiences less degradation due to phase jitter than the absolute-value detector and that the degradation in detector signal-to-noise ratio is more pronounced for square-wave than for sine-wave signals.

  2. Reconnaissance of selected PPCP compounds in Costa Rican surface waters.


    Spongberg, Alison L; Witter, Jason D; Acuña, Jenaro; Vargas, José; Murillo, Manuel; Umaña, Gerardo; Gómez, Eddy; Perez, Greivin


    Eighty-six water samples were collected in early 2009 from Costa Rican surface water and coastal locations for the analysis of 34 pharmaceutical and personal care product compounds (PPCPs). Sampling sites included areas receiving treated and untreated wastewaters, and urban and rural runoff. PPCPs were analyzed using a combination of solid phase extraction and liquid chromatography tandem mass spectrometry. The five most frequently detected compounds were doxycycline (77%), sulfadimethoxine (43%), salicylic acid (41%), triclosan (34%) and caffeine (29%). Caffeine had the maximum concentration of 1.1 mg L(-1), possibly due to coffee bean production facilities upstream. Other compounds found in high concentrations include: doxycycline (74 μg L(-1)), ibuprofen (37 μg L(-1)), gemfibrozil (17 μg L(-1)), acetominophen (13 μg L(-1)) and ketoprofen (10 μg L(-1)). The wastewater effluent collected from an oxidation pond had similar detection and concentrations of compounds compared to other studies reported in the literature. Waters receiving runoff from a nearby hospital showed higher concentrations than other areas for many PPCPs. Both caffeine and carbamazepine were found in low frequency compared to other studies, likely due to enhanced degradation and low usage, respectively. Overall concentrations of PPCPs in surface waters of Costa Rica are inline with currently reported occurrence data from around the world, with the exception of doxycycline.

  3. Smoking: attitudes of Costa Rican physicians and opportunities for intervention.

    PubMed Central

    Grossman, D. W.; Knox, J. J.; Nash, C.; Jiménez, J. G.


    The aim of this study was to obtain information, using a written questionnaire, on the knowledge, smoking behaviour, and attitudes of Costa Rican physicians about smoking as a health issue. A random sample of 650 physicians was chosen from a list of active physicians; 287 of them were covered by survey between August 1993 and October 1994, and 217 (76%) responded with data for the study. While 40% of the physicians who participated were ex-smokers, 19% were current smokers; 67% of these two groups combined reported smoking in the workplace. Only 49% believed that physicians could be a nonsmoking role model; the majority (87%) had asked patients about their smoking status. The only cessation technique consistently used (90%) was counselling about the dangers of smoking. Measures such as setting a date to quit smoking and nicotine replacement were rarely recommended (< or = 2%). Nearly all the physicians (99%) considered smoking to be a major health issue. These results showed a high prevalence of smoking among Costa Rican physicians, with little recognition of the need for them to set an example as a role model. While they were knowledgeable about the health risks of smoking, they did not recommend any of the proven techniques to help their patients to quit smoking. A clear consensus for more strict tobacco regulation exists, but to date little has been done to act on this. PMID:10327710

  4. Effect of fragmentation on the Costa Rican dry forest avifauna

    PubMed Central

    Barrantes, Gilbert; Ocampo, Diego; Ramírez-Fernández, José D.


    Deforestation and changes in land use have reduced the tropical dry forest to isolated forest patches in northwestern Costa Rica. We examined the effect of patch area and length of the dry season on nestedness of the entire avian community, forest fragment assemblages, and species occupancy across fragments for the entire native avifauna, and for a subset of forest dependent species. Species richness was independent of both fragment area and distance between fragments. Similarity in bird community composition between patches was related to habitat structure; fragments with similar forest structure have more similar avian assemblages. Size of forest patches influenced nestedness of the bird community and species occupancy, but not nestedness of assemblages across patches in northwestern Costa Rican avifauna. Forest dependent species (species that require large tracts of mature forest) and assemblages of these species were nested within patches ordered by a gradient of seasonality, and only occupancy of species was nested by area of patches. Thus, forest patches with a shorter dry season include more forest dependent species. PMID:27672498

  5. Box-Jenkins analysis for shark landings in Costa Rica.


    Bonilla, Roger; Chavarría, Juan B


    Sharks are highly vulnerable to intense and prolonged fishery extraction. This article analyzes the data on shark landings from the artisan fishing fleet on Costa Rica's Pacific coast between 1988 and 1997. The data come from an invoicing system administered by the Costa Rican Fisheries Institute (Instituto Costarricense de la Pesca y Acuacultura, INCOPESCA). Pacific coast shark fishing during the period under study represented approximately 20% of the total national fisheries volume. According to data from the invoicing system, the Northern Pacific region was the most productive, reporting 58% of the shark catch nationwide. Within this region, shark fishing in Papagayo Gulf represented 91% and 53% of the landings by fishery region and nationwide, respectively. The mid-sized and advanced (length of boat > 10 meters) artisan fishing fleets reported 96% of the shark catches in the zone. The study of shark fisheries in the Papagayo Gulf zone is crucial for an understanding of fishery dynamics for this resource at the national level. A monthly chronological series was constructed with the landings in the Papagayo Gulf zone, and a Univariate Box-Jenkins (UBJ) Model was estimated for first-order moving averages MA(1) with a seasonal component of the Yt = lamda(t-1) + gammaS12 + a(t) type.

  6. Neotropical Bats from Costa Rica harbour Diverse Coronaviruses.


    Moreira-Soto, A; Taylor-Castillo, L; Vargas-Vargas, N; Rodríguez-Herrera, B; Jiménez, C; Corrales-Aguilar, E


    Bats are hosts of diverse coronaviruses (CoVs) known to potentially cross the host-species barrier. For analysing coronavirus diversity in a bat species-rich country, a total of 421 anal swabs/faecal samples from Costa Rican bats were screened for CoV RNA-dependent RNA polymerase (RdRp) gene sequences by a pancoronavirus PCR. Six families, 24 genera and 41 species of bats were analysed. The detection rate for CoV was 1%. Individuals (n = 4) from four different species of frugivorous (Artibeus jamaicensis, Carollia perspicillata and Carollia castanea) and nectivorous (Glossophaga soricina) bats were positive for coronavirus-derived nucleic acids. Analysis of 440 nt. RdRp sequences allocated all Costa Rican bat CoVs to the α-CoV group. Several CoVs sequences clustered near previously described CoVs from the same species of bat, but were phylogenetically distant from the human CoV sequences identified to date, suggesting no recent spillover events. The Glossophaga soricina CoV sequence is sufficiently dissimilar (26% homology to the closest known bat CoVs) to represent a unique coronavirus not clustering near other CoVs found in the same bat species so far, implying an even higher CoV diversity than previously suspected.

  7. Mantle Xenoliths of Cerro Mercedes, Costa Rica, Central America

    NASA Astrophysics Data System (ADS)

    Lindsay, F. N.; Carr, M. J.; Herzberg, C. T.; Feigenson, M. D.


    Mantle peridotite occurs as xenoliths in lavas and bombs at Cerro Mercedes, a Plio-Quaternary potassic alkaline basalt volcano approximately 70 km behind the volcanic front of northern Costa Rica (Tournon and Alvarado, 1997). Mineral exploration led to the first discovery of abundant mantle xenoliths in Central America (Vargas and Alfaro, 1992). The compositions of 71 xenoliths recovered in January 2003 include dunite, harzburgite, lherzolite and olivine websterite. Twenty xenoliths have a diameter of at least 3 cm. The nodules are abundant in basalt outcrops and the rare bombs. In spite of substantial soil development in a rain forest environment, both xenoliths and host lava remain well preserved. Olivine, pyroxenes and spinel are common, plagioclase is present and garnet appears to be absent. There is no obvious shearing or deformation and several pyroxenes are as much as 1 cm in diameter. The mineralogy suggests a relatively shallow upper mantle source, within either the lithosphere or possibly the uppermost asthenosphere. Cerro Mercedes, at latitude 10° 58' N and longitude 82° 21' W, lies along the Rio San Juan, which is locally the border between Nicaragua and Costa Rica, Central America. This location approximately coincides with a boundary between dominantly depleted mantle to the northwest and OIB or Galapagos-like mantle to the southeast. We will use mineralogical data to better define the likely depths and oxidation states of representative nodules and isotopic data to define the type of mantle source.

  8. Workplace carcinogen and pesticide exposures in Costa Rica.


    Partanen, Timo; Chaves, Jorge; Wesseling, Catharina; Chaverri, Fabio; Monge, Patricia; Ruepert, Clemens; Aragón, Aurora; Kogevinas, Manolis; Hogstedt, Christer; Kauppinen, Timo


    The CAREX data system converts national workforce volumes and proportions of workers exposed to workplace carcinogens into numbers of exposed in 55 industrial categories. CAREX was adapted for Costa Rica for 27 carcinogens and seven groups of pesticides. Widespread workplace carcinogens in the 1.3 million workforce of Costa Rica are solar radiation (333,000 workers), diesel engine exhaust (278,000), environmental tobacco smoke (71,000), hexavalent chromium compounds (55,000), benzene (52,000), wood dust (32,000), silica dust (27,000), lead and inorganic lead compounds (19,000), and polycyclic aromatic compounds (17,000). The most ubiquitous pesticides were paraquat and diquat (175,000), mancozeb, maneb, and zineb (49,000), chlorothalonil (38,000), benomyl (19,000), and chlorophenoxy herbicides (11,000). Among women, formaldehyde, radon, and methylene chloride overrode pesticides, chromium, wood dust, and silica dust in numbers of exposed. High-risk sectors included agriculture, construction, personal and household services, land and water transport and allied services, pottery and similar industries, woodworks, mining, forestry and logging, fishing, manufacturing of electrical machinery, and bar and restaurant personnel.

  9. [Punta Cocles coral reef, Caribbean Coast of Costa Rica].


    Fernández, Cindy; Alvarado, Juan José


    This paper describes the Punta Cocles reef (Limón, Costa Rica). Data were obtained by sampling nine transects along the coast and observations done by skin diving between September and November of 2002. This reef consist of 10.5 hectares, where 13 species of corals, 39 of macroalgae, two of seagrasses, two of zoantids, one anemone, one corallimorpharian, and one sponge were identified. Life coral coverage (16%), was higher than in other years (5% for 1985, and 13.2% for 1995), and death coral coverage was very low (0.2%). Macroalgae have the highest coverage (59%), particularly brown algae with a patchy distribution of Sargassum and Padina. Laurencia brongniartii (Rhodophyta) is added to the list of marine flora of Costa Rica. The Punta Cocles reef works as a refuge for organisms, because there are no towns or river mouths nearby, and because of the coast formation. The refuge character is enhanced by the environmental conscience of the people that live close to the reef and help to protect the environment.

  10. Costa Rica publications in the Science Citation Index Expanded: a bibliometric analysis for 1981-2010.


    Monge-Nájera, Julián; Ho, Yuh-Shan


    Despite of its small size, the Central American country of Costa Rica is internationally recognized as one of the world leaders in conservation and as the Central American leader in science. There have been no recent studies on the country's scientific production. The objective of this study was to analyze the Costa Rican scientific output as represented in the Science Citation Index Expanded. All documents with "Costa Rica" in the address field from 1981 to 2010 were included (total 6 801 publications). Articles (79%) were more frequent than other types of publication and were mostly in English (83%). Revista de Biología Tropical published the most articles (17%), followed by Toxicon and Turrialba (2.5%). The New England Journal of Medicine had the highest impact factor (53.484) with nine articles. Of 5 343 articles with known institutional address, 63%were internationally collaborative articles (most with the USA) with h index 91 and citation per publication 18. A total of 81% of all articles were inter-institutionally collaborative articles, led by the Universidad de Costa Rica. This reflects research and education agreements among these countries. Universidad de Costa Rica ranked top one in inter-institutionally collaborative articles, the rank of the total inter-institutionally collaborative articles, and the rank of first author articles and corresponding author articles. Studied subjects and journals in our sample are in agreement with dominant science fields and journals in Costa Rica. Articles with the highest citation were published in New England Journal of Medicine. The largest citation of medical articles reflects the general interest and wider readership of this subject. All corresponding and first authors of the high impact articles were not from Costa Rica. In conclusion, the scientific output of Costa Rican authors is strong in the areas related to conservation but the impact is higher for biomedical articles, and Costa Rican authors need to

  11. Hydraulic Model Investigation: Walnut Creek Flood-Control Project Contra Costa County, California.

    DTIC Science & Technology


    TECHNICAL REPORT HL-87-14 WALNUT CREEK FLOOD-CONTROL PROJECT CONTRA COSTA COUNTY, CALIFORNIA Hydraulic Model Investigation by W. G. Davis O11C tLE...34’ : AA Ii iA e d S O a :::: SCALE IN MILES 5 0 5 10 Figure 1. Vicinity map 4~ 4.. %- . " . " %____ WALNUT CREEK FLOOD-CONTROL PROJECT CONTRA COSTA COUNTY...Pleasant Hi-1, nd Martinez, California, on its way to the Suisin Bay. All of th.e planned imcrovements are located in Contra Costa County, California

  12. Control of myofibroblast differentiation by microtubule dynamics through a regulated localization of mDia2.


    Sandbo, Nathan; Ngam, Caitlyn; Torr, Elizabeth; Kregel, Steve; Kach, Jacob; Dulin, Nickolai


    Myofibroblast differentiation plays a critical role in wound healing and in the pathogenesis of fibrosis. We have previously shown that myofibroblast differentiation is mediated by the activity of serum response factor (SRF), which is tightly controlled by the actin polymerization state. In this study, we investigated the role of the microtubule cytoskeleton in modulating myofibroblast phenotype. Treatment of human lung fibroblasts with the microtubule-destabilizing agent, colchicine, resulted in a formation of numerous stress fibers and expression of myofibroblast differentiation marker proteins. These effects of colchicine were independent of Smad signaling but were mediated by Rho signaling and SRF, as they were attenuated by the Rho kinase inhibitor, Y27632, or by the SRF inhibitor, CCG-1423. TGF-β-induced myofibroblast differentiation was not accompanied by gross changes in the microtubule polymerization state. However, microtubule stabilization by paclitaxel attenuated TGF-β-induced myofibroblast differentiation. Paclitaxel had no effect on TGF-β-induced Smad activation and Smad-dependent gene transcription but inhibited actin polymerization, nuclear accumulation of megakaryoblastic leukemia-1 protein, and SRF activation. The microtubule-associated formin, mDIA2, localized to actin stress fibers upon treatment with TGF-β, and paclitaxel prevented this localization. Treatment with the formin inhibitor, SMI formin homology 2 domain, inhibited stress fiber formation and myofibroblast differentiation induced by TGF-β, without affecting Smad-phosphorylation or microtubule polymerization. Together, these data suggest that (a) TGF-β promotes association of mDia2 with actin stress fibers, which further drives stress fiber formation and myofibroblast differentiation, and (b) microtubule polymerization state controls myofibroblast differentiation through the regulation of mDia2 localization.

  13. [Marine biodiversity of Costa Rica, the microcrustacea: Copepoda (Crustacea: Maxillopoda)].


    Morales-Ramírez, A


    This report is part of a series that summarizes the species and localities of Costa Rican marine taxa. A review of the literature on copepods, both pelagic and benthic for the Pacific and Caribbean coast of Costa Rica, includes eighty species. Sixty seven pelagic species have been found, distributed between sixteen calanoid, one cyclopoid, three harparticoid and four poecilostomatoid families. Moreover, thirteen benthonic species distributed into six families, all harparticoids, are reported. Among the pelagic families, Pontellidae has six species, while Paracalanidae and Eucalanidae had five each. Other families, like Calanidae, Pseudodiaptomidae and Acartiidae had four species and most families only one. Forty five species are reported only for the Pacific coast, thirteen for the Caribbean coast, only nine species occurred in both coasts; being a direct consequence of the more intensive research effort in the Pacific. Pelagic copepod biodiversity reflects different oceanographic conditions in both coasts. Typical estuarine species were found in the lower region of the Gulf of Nicoya, while a mixture of estuarine and oceanic species were found in Golfo Dulce. Diversity in the Caribbean, specially at the Cahuita coral reef is lower in comparison with the copepod diversity found in other regions in the Caribbean sea. This may be due to the high sediment resuspension rate characteristic of the Cahuita coral reef, which could affect the reproduction of many holozooplankters, specially copepods. Although sixty seven pelagic copepod species appears to be in low numbers, in terms of specific biodiversity it is as high when compared to numbers found in other tropical areas. Thirteen species are reported in the literature, all harparticoids. Five species, three sub-species and one genera were new to science. Balacopsylla is reported for the first time from a neotropical regions, while the genus Karllangia, represented by two coexisting species in the Caribbean coast

  14. Targeted proteomics coming of age - SRM, PRM and DIA performance evaluated from a core facility perspective.


    Kockmann, Tobias; Trachsel, Christian; Panse, Christian; Wahlander, Asa; Selevsek, Nathalie; Grossmann, Jonas; Wolski, Witold E; Schlapbach, Ralph


    Quantitative mass spectrometry is a rapidly evolving methodology applied in a large number of omics-type research projects. During the past years, new designs of mass spectrometers have been developed and launched as commercial systems while in parallel new data acquisition schemes and data analysis paradigms have been introduced. Core facilities provide access to such technologies, but also actively support the researchers in finding and applying the best-suited analytical approach. In order to implement a solid fundament for this decision making process, core facilities need to constantly compare and benchmark the various approaches. In this article we compare the quantitative accuracy and precision of current state of the art targeted proteomics approaches single reaction monitoring (SRM), parallel reaction monitoring (PRM) and data independent acquisition (DIA) across multiple liquid chromatography mass spectrometry (LC-MS) platforms, using a readily available commercial standard sample. All workflows are able to reproducibly generate accurate quantitative data. However, SRM and PRM workflows show higher accuracy and precision compared to DIA approaches, especially when analyzing low concentrated analytes.

  15. Heat exposure in sugarcane workers in Costa Rica during the non-harvest season

    PubMed Central

    Crowe, Jennifer; Moya-Bonilla, José Manuel; Román-Solano, Bryan; Robles-Ramírez, Andrés


    This observational pilot study was carried out at three sugarcane companies in Costa Rica. Its main objective was to determine the potential for heat stress conditions for workers in one sugarcane-growing region in Costa Rica during the maintenance (non-harvest) period. Wet bulb globe temperature (WBGT) variables were measured with a heat stress meter and threshold value limits and the Sweat Rate Indexes were calculated for each workplace. It was determined that workers in this study were in heat stress conditions. Costa Rica is likely to experience warmer temperatures and increased heat waves in the coming decades. It is therefore important to take action to decrease current and future heat-related risks for sugarcane workers in both harvest and non-harvest conditions and in all sugarcane growing regions in Costa Rica. It is also necessary to improve guidelines and occupational health standards for protecting worker health and productivity in the tropics. PMID:21139704

  16. A new species of Anastrepha (Diptera: Tephritidae) from Colombia, Costa Rica and Panama

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Anastrepha woodi, new species, is described and illustrated based on specimens from Colombia and Costa Rica. It is compared with A. loewi Stone, the most similar species, which is also redescribed....

  17. Costa Rica's payment for environmental services program: intention, implementation, and impact.


    Sánchez-Azofeifa, G Arturo; Pfaff, Alexander; Robalino, Juan Andres; Boomhower, Judson P


    We evaluated the intention, implementation, and impact of Costa Rica's program of payments for environmental services (PSA), which was established in the late 1990s. Payments are given to private landowners who own land in forest areas in recognition of the ecosystem services their land provides. To characterize the distribution of PSA in Costa Rica, we combined remote sensing with geographic information system databases and then used econometrics to explore the impacts of payments on deforestation. Payments were distributed broadly across ecological and socioeconomic gradients, but the 1997-2000 deforestation rate was not significantly lower in areas that received payments. Other successful Costa Rican conservation policies, including those prior to the PSA program, may explain the current reduction in deforestation rates. The PSA program is a major advance in the global institutionalization of ecosystem investments because few, if any, other countries have such a conservation history and because much can be learned from Costa Rica's experiences.

  18. Laryngeal malformations in the Richieri-Costa and Pereira form of acrofacial dysostosis.


    Tabith Júnior, A; Gonçalves, C G


    We report on laryngeal malformations in 5 subjects, 4 females and 1 male, with the autosomal-recessive Richieri-Costa and Pereira form of acrofacial dysostosis. Characteristics of the voice are described.

  19. The DIAS Outreach Seismology in Schools (Seismeolaí­ocht sa Scoil) Pilot Programme

    NASA Astrophysics Data System (ADS)

    Blake, T.; Jones, A. G.; Campbell, G.


    Ireland has technology to thank for the 'Celtic Tiger' Revolution, yet over the last half decade fewer and fewer Irish students are completing high school with a science focus. To counter this trend, and to ensure a supply of Irish geophysicists for the future, it is important to engage and fascinate young minds with the wonders of physics and of the Earth we live on. The Geophysics Section of the School of Cosmic Physics in the Dublin Institute for Advanced Studies (DIAS) has been running an Outreach programme for some years, but there was a more general public orientation to the programme. In an effort to bring DIAS's science directly to the schools, we have launched a pilot programme, coincidentally and fortuitously during the International Year of Planet Earth (IYPE), in Seismology in Schools (Seismeolaíocht sa Scoil) that introduces young students to the world of seismology and earthquake research. The launch of DIAS's Seismology in Schools programme has been aided considerably through IRIS's (The Incorporated Institutes for Research Seismology) contributions of their AMASEIS software, that is used to display the data output from the seismometer, and educational posters and demonstration software used to teach Earth Science to students, and through BGS's design and development of the educational seismometer, which is a Lehman pattern horizontal motion seismometer using a garden-gate offset suspension pendulum. Initially, we planned for a very tentative pilot with just two seismometers rotating around local schools, but the Directors of the Educational Centres across Ireland (ATECI, Association of Teachers/Education Centres in Ireland) have become key players in this pilot by purchasing a further 34 seismometers and promoting this initiative among their school. In addition, Geological Survey of Ireland (GSI) has purchased a further four seismometers as part of their contribution to IYPE. Currently 36 schools are participating in the enlarged pilot programme

  20. [Variation of thermohaline properties in the Nicoya Gulf, Costa Rica].


    Brenes, C L; Léon, S; Chaves, J


    The time-space behavior of thermohaline properties of the water masses in the Gulf of Nicoya, a tropical estuary in the Costa Rican Pacific coast, was studied by sampling monthly from April 1992 to April 1993. The saline field has a seasonal maximum during April, a month before the maximum temperature is observed. Minimun values were observed during October and November, in the rainy season. A defined surface saline front is located towards the east of Negritos Islands; it is produced by the interaction of freshwater from the Tarcoles River and the oceanic waters that enter through the occidental coast of the gulf. The vertical distribution of temperature and salinity indicates a gulf whose internal area is highly stratified in the rainy season, and much less stratified, or even well mixed in the dry season. The outer area of the Gulf is stratified throughout the year.

  1. Contra Costa County's one-year experience with gasohol

    SciTech Connect

    Gibbs, L.M.; Gilbert, B.J.


    Starting August 1, 1979, a one-year gasohol test was conducted by Contra Costa County. A total of 30 county pool cars were on test - 15 on gasohol and 15 similar cars on gasoline as a control group. Findings were as follows. There were no fuel-related maintenance problems in either the gasohol or gasoline groups of cars. Cool weather driveability for the gasohol cars was the same or better than gasoline cars. No vapor lock or other hot driveability problems were reported for either fuel. Fuel economy of the gasohol cars was about 5% poorer than that of the gasoline cars. Fuel system deposits with gasohol were increased and differed in character compared to gasoline. Also, the gasohol carburetors showed more inlet needle valve tip wear. However, to date, the observed deposits and wear with gasohol have not caused any apparent problems.

  2. Ecosystem-Level Carbon Stocks in Costa Rican Mangrove Forests

    NASA Astrophysics Data System (ADS)

    Cifuentes, M.


    Tropical mangroves provide a wide variety of ecosystem services, including atmospheric carbon sequestration. Because of their high rates of carbon accumulation, the large expected size of their total stocks (from 2 to 5 times greater than those of upland tropical forests), and the alarming rates at which they are being converted to other uses (releasing globally from 0.02 to 0.12 Pg C yr-1), mangroves are receiving increasing attention as additional tools to mitigate climate change. However, data on whole ecosystem-level carbon in tropical mangroves is limited. Here I present the first estimate of ecosystem level carbon stocks in mangrove forests of Central America. I established 28, 125 m-long, sampling transects along the 4 main rivers draining the Térraba-Sierpe National Wetland in the southern Pacific coast of Costa Rica. This area represents 39% of all remaining mangroves in the country (48300 ha). A circular nested plot was placed every 25 m along each transect. Carbon stocks of standing trees, regeneration, the herbaceous layer, litter, and downed wood were measured following internationally-developed methods compatible with IPCC "Good Practice Guidelines". In addition, total soil carbon stocks were determined down to 1 m depth. Together, these carbon estimates represent the ecosystem-carbon stocks of these forests. The average aboveground carbon stocks were 72.5 ± 3.2 MgC ha-1 (range: 9 - 241 MgC ha-1), consistent with results elsewhere in the world. Between 74 and 92% of the aboveground carbon is stored in trees ≥ 5cm dbh. I found a significant correlation between basal area of trees ≥ 5cm dbh and total aboveground carbon. Soil carbon stocks to 1 m depth ranged between 141 y 593 MgC ha-1. Ecosystem-level carbon stocks ranged from 391 MgC ha-1 to 438 MgC ha-1, with a slight increase from south to north locations. Soil carbon stocks represent an average 76% of total ecosystem carbon stocks, while trees represent only 20%. These Costa Rican mangroves

  3. Protected areas reduced poverty in Costa Rica and Thailand.


    Andam, Kwaw S; Ferraro, Paul J; Sims, Katharine R E; Healy, Andrew; Holland, Margaret B


    As global efforts to protect ecosystems expand, the socioeconomic impact of protected areas on neighboring human communities continues to be a source of intense debate. The debate persists because previous studies do not directly measure socioeconomic outcomes and do not use appropriate comparison groups to account for potential confounders. We illustrate an approach using comprehensive national datasets and quasi-experimental matching methods. We estimate impacts of protected area systems on poverty in Costa Rica and Thailand and find that although communities near protected areas are indeed substantially poorer than national averages, an analysis based on comparison with appropriate controls does not support the hypothesis that these differences can be attributed to protected areas. In contrast, the results indicate that the net impact of ecosystem protection was to alleviate poverty.

  4. Chytridiomycosis in wild frogs from southern Costa Rica

    USGS Publications Warehouse

    Lips, Karen R.; Green, D.E.; Papendick, R.


    In 1993, the amphibian fauna of Las Tablas, Costa Rica, began to decline, and by 1998 approximately 50% of the species formerly present could no longer be found. Three years later, at the Reserva Forestal Fortuna, in western Panama, a site approximately 75 km east southeast of Las Tablas, KRL encountered a mass die-off of amphibians and a subsequent decline in abundance and species richness. The epidemiological features of the anuran population declines and die-offs at both sites were similar, suggesting a similar cause. Herein we document the presence of the fungus, Batrachochytrium dendrobatidis, in dead and dying wild frogs collected at Las Tablas just prior to population declines of several anuran species.

  5. The chemical and hydrologic structure of Poas volcano, Costa Rica

    USGS Publications Warehouse

    Rowe, G.L.; Brantley, S.L.; Fernandez, J.F.; Borgia, A.


    Comparison of the chemical characteristics of spring and river water draining the flanks of Poas Volcano, Costa Rica indicates that acid chloride sulfate springs of the northwestern flank of the volcano are derived by leakage and mixing of acid brines formed in the summit hydrothermal system with dilute flank groundwater. Acid chloride sulfate waters of the Rio Agrio drainage basin on the northwestern flank are the only waters on Poas that are affected by leakage of acid brines from the summit hydrothermal system. Acid sulfate waters found on the northwestern flank are produced by the interaction of surface and shallow groundwater with dry and wet acid deposition of SO2 and H2SO4 aerosols, respectively. The acid deposition is caused by a plume of acid gases that is released by a shallow magma body located beneath the active crater of Poas. -from Authors

  6. Seismic reflection images of the accretionary wedge of Costa Rica

    SciTech Connect

    Shipley, T.H.; Stoffa, P.L. ); McIntosh, K.; Silver, E.A. )


    The large-scale structure of modern accretionary wedges is known almost entirely from seismic reflection investigations using single or grids of two-dimensional profiles. The authors will report on the first three-dimensional seismic reflection data volume collected of a wedge. This data set covers a 9-km-wide {times} 22-km-long {times} 6-km-thick volume of the accretionary wedge just arcward of the Middle America Trench off Costa Rica. The three-dimensional processing has improved the imaging ability of the multichannel data, and the data volume allows mapping of structures from a few hundred meters to kilometers in size. These data illustrate the relationships between the basement, the wedge shape, and overlying slope sedimentary deposits. Reflections from within the wedge define the gross structural features and tectonic processes active along this particular convergent margin. So far, the analysis shows that the subdued basement relief (horst and graben structures seldom have relief of more than a few hundred meters off Costa Rica) does affect the larger scale through going structural features within the wedge. The distribution of mud volcanoes and amplitude anomalies associated with the large-scale wedge structures suggests that efficient fluid migration paths may extend from the top of the downgoing slab at the shelf edge out into the lower and middle slope region at a distance of 50-100 km. Offscraping of the uppermost (about 45 m) sediment occurs within 4 km of the trench, creating a small pile of sediments near the trench lower slope. Underplating of parts of the 400-m-thick subducted sedimentary section begins at a very shallow structural level, 4-10 km arcward of the trench. Volumetrically, the most important accretionary process is underplating.

  7. A radio voice for women. Organizing for change: Costa Rica.


    Suarez Toro, M


    The Feminist Radio Endeavor (FIRE) was organized in Costa Rica in 1991 and broadcasts in English and Spanish for two hours every day on its own short-wave radio station, Radio for Peace International. In January 1995, FIRE discovered that the Costa Rican government planned to create a huge garbage land-fill proximate to a unique forest reserve which is the last primary forest reserve near the city of San Jose. The 100 acres of forest rests in a transitional zone between the Pacific and Atlantic coasts and hosts a wide variety of flora and fauna. On one side of the forest, a small village is situated whose inhabitants have protected the forest for decades. On the other side, the indigenous Quitirisi continue their centuries-old protection of the forest. In February, FIRE staff traveled by horseback and used walkie-talkie radios to air a live Radio Eco-tour of the forest and its neighboring village. People from over 100 countries listened to the broadcast. Within days, the staff was broadcasting live from outside the municipal building where delegates were discussing the growing protest over the dump site. The delegates emerged to announce that they would oppose the use of the road for dump trucks. FIRE then invited call-ins to their broadcast, and the lines were flooded with people expressing fears and frustration with the delegates for refusing to discuss the issues. Callers from the US stated that hearing the voices of the people affected brought the issue to life for them. To FIRE, this is the essential element of global communications.

  8. Health care in Costa Rica: boom and crisis.


    Mesa-Lago, C


    In 1960-1980 Costa Rica experienced a health boom, achieving significant improvements which moved that country into the number two position in Latin America for indicators such as population coverage, infant mortality, life expectancy and health services. In addition, there was a gradual process of integration of health services. But in the same period, the cost of health care as a percentage of GNP increased almost 5-fold and in 1980 was the fourth highest in the region. The economic crisis of the 1980s aggravated the financial difficulties; to cope with them, the government introduced an austere program to reduce costs and plans to transform the current model of health care into a more efficient one capable of maintaining Costa Rica's high health standards in the future. The paper is divided into five sections: summary of the historical development of health care, and description of its current organization and of its gradual process of integration; estimation of population coverage and its trends, evaluation of inequalities in coverage, and identification of the non-covered group; analysis of health-care financing and its sources, as well of the recent financial desequilibrium, its causes and measures to restore the equilibrium; description of health care benefits and their differences among groups and regions, analysis of the country's advances in health-care facilities and standards, and measurement of the impact of the health care system in income distribution; and description of the rising cost of health care and the current crisis, analysis of the causes of both phenomena, and review of the measures that have been and should be implemented to solve these problems.

  9. Sustaining life in frontier land. Country report 2: Costa Rica.


    Prescott-allen, R


    The Community Development Association of the fishing village of Barra del Colorado populated by Blacks embraced the Conservation Strategy for the Sustainable Development of the Plains Tortuguero covering 419,000 hectares of lowland rain forest and wetlands along the Caribbean cost of northern Costa Rica. In 1985 the government established the Barra del Colorado Wildlife Refuge. The International Union for the Conservation of Nature (IUCN) team visited families and identified community problems. This resulted in the establishment of a communal bank; a community fisherman's association to help obtain a boat and fishing gear; assistance to help villagers obtain title to their land; a feasibility study of a public transport link to the rest of the country; new chairs for the school; and weekly instead of monthly visits by a doctor. The Tortuguero Strategy endeavors to establish 147,000 hectares of conservation area including the Tortuguero National Park. 5000 people live in the buffer zone and 132,000 live in the neighboring western area. The strategy strives to reverse deforestation in the buffer zone by restoring forest cover to 80% of the area by 2000. The Strategy has funded the Union of Small Agricultural Producers of the Atlantic to train people in ecotourism, forestry management, and growing and selling medicinal plants. The IUCN evaluated the environmental impact of expanding banana plantations and recommended ameliorative steps which have not been implemented. The preparation of the Tortuguero Strategy started in 1990 in concert with the Natural Resources Ministry, IUCN, and the European Community. A 1992 draft document based on biophysical, socioeconomic, and legal studies is waiting for official approval. Community strategies have been launched in 2 communities, self-sustaining financing is delayed, and a draft law setting up the conservation area awaits Costa Rican legislative authorization. The strategy is for the long term, but the experience of Barra del

  10. Monitoring coral reefs, seagrasses and mangroves in Costa Rica (CARICOMP).


    Cortés, Jorge; Fonseca, Ana C; Nivia-Ruiz, Jaime; Nielsen-Muñoz, Vanessa; Samper-Villarreal, Jimena; Salas, Eva; Martínez, Solciré; Zamora-Trejos, Priscilla


    The coral reefs, seagrasses and mangroves from the Costa Rican Caribbean coast have been monitored since 1999 using the CARICOMP protocol. Live coral cover at Meager Shoal reef bank (7 to 10 m depth) at the Parque Nacional Cahuita (National Park), increased from 13.3% in 1999, to 28.2% in 2003, but decreased during the next 5 years to around 17.5%. Algal cover increased significantly since 2003 from 36.6% to 61.3% in 2008. The density of Diadema antillarum oscillated between 2 and 7ind/m2, while Echinometra viridis decreased significantly from 20 to 0.6ind/m2. Compared to other CARICOMP sites, live coral cover, fish diversity and density, and sea urchin density were low, and algal cover was intermediate. The seagrass site, also in the Parque Nacional Cahuita, is dominated by Thalassia testudinum and showed an intermediate productivity (2.7 +/- 1.15 g/m2/d) and biomass (822.8 +/- 391.84 g/m2) compared to other CARICOMP sites. Coral reefs and seagrasses at the Parque Nacional Cahuita continue to be impacted by high sediment loads from terrestrial origin. The mangrove forest at Gandoca, within the Refugio Nacional de Vida Silvestre Gandoca-Manzanillo (National Wildlife Refuge), surrounds a lagoon and it is dominated by the red mangrove, Rhizophora mangle. Productivity and flower production peak was in July. Biomass (14 kg/m2) and density (9.0 +/- 0.58 trees/100 m2) in Gandoca were relatively low compared to other CARICOMP sites, while productivity in July in Costa Rica (4 g/m2/d) was intermediate, similar to most CARICOMP sites. This mangrove is expanding and has low human impact thus far. Management actions should be taken to protect and preserve these important coastal ecosystems.

  11. The Phyllodonta latrata (Guenée) species group in Costa Rica (Geometridae, Ennominae).


    Sullivan, J Bolling


    Historically, the name Phyllodonta latrata (Guenée) has been applied to what is a complex of three undescribed species in Costa Rica. They are very similar in maculation, but can be differentiated by genitalic characters and barcodes. P. alajuela Sullivan, sp. n. occurs at lower altitudes in the northwestern part of Costa Rica whereas P. intermediata Sullivan, sp. n. and P. esperanza Sullivan, sp. n. are found at partially overlapping altitudes in the central mountain ranges.

  12. [The importance of genealogy applied to genetic research in Costa Rica].


    Meléndez Obando, Mauricio O


    The extensive development of genealogical studies based on archival documents has provided powerful support for genetic research in Costa Rica over the past quarter century. As a result, several questions of population history have been answered, such as those involving hereditary illnesses, suggesting additional avenues and questions as well. Similarly, the preservation of massive amounts of historical documentation highlights the major advantages that the Costa Rican population offers to genetic research.

  13. The Phyllodonta latrata (Guenée) species group in Costa Rica (Geometridae, Ennominae)

    PubMed Central

    Sullivan, J. Bolling


    Abstract Historically, the name Phyllodonta latrata (Guenée) has been applied to what is a complex of three undescribed species in Costa Rica. They are very similar in maculation, but can be differentiated by genitalic characters and barcodes. P. alajuela Sullivan, sp. n. occurs at lower altitudes in the northwestern part of Costa Rica whereas P. intermediata Sullivan, sp. n. and P. esperanza Sullivan, sp. n. are found at partially overlapping altitudes in the central mountain ranges. PMID:25061377

  14. Proposed Expansion of Acme Landfill Operations, Contra Costa, County, California. Volume 1.

    DTIC Science & Technology


    for example, plastic beverage bottles, cardboard, wood, yardwastes, textiles , rubber, and leather. In addition to traditional activities, a central...a 6000-foot-long dredged channel. The 200-acre parcel is crossed with a number of drainage ditches, constructed by the Contra Costa Mosquito ...incoming flow at the high tide. It is the only point of discharge for flood water and is maintained by the Contra Costa Mosquito Abatement District

  15. Undeserving mothers? Shifting rationalities in the maternal healthcare of undocumented Nicaraguan migrants in Costa Rica.


    Dos Santos, Sara Leon Spesny


    The case of Nicaraguan migrants in Costa Rica is emblematic of the issues that immigration generates in host countries. Undocumented Nicaraguan women seeking maternal care constitute a key challenge to the universal coverage of Costa Rica's health system. Can the long-standing commitment to universality, solidarity and equality expressed in the legislation be translated into practice? Discourses of health professionals in Costa Rica reveal a contradiction between merit and prejudice in prenatal and delivery care. Here, I present qualitative research based on semi-structured interviews with physicians and nurses at a Costa Rican National Hospital. The data show that migrant women, rejected from primary care, do find help in emergency services, but not without difficulties, as they must engage in individual negotiations centred on their bodies. The discourses of health providers reflect an ambivalence between the perceived undeservingness of undocumented migrant women and the medical realisation that two lives are at risk. While the foetus often evokes compassion, the mother commonly provokes repression, as specific and shifting rationalities reflect new moral regimes that are applied to this population. Women are perceived as being 'illegal', 'immoral' and 'irrational', and the baby, although legally Costa Rican due to jus solis policy, embodies 'the other'. Ultimately, otherness frames perceptions of deservingness of maternal care for undocumented migrant women in Costa Rica.

  16. Altitude and regional gradients in chronic kidney disease prevalence in Costa Rica: Data from the Costa Rican Longevity and Healthy Aging Study

    PubMed Central

    Harhay, Meera N.; Harhay, Michael O.; Coto-Yglesias, Fernando; Bixby, Luis Rosero


    Summary Objectives Recent studies in Central America indicate that mortality attributable to chronic kidney disease (CKD) is rising rapidly. We sought to determine the prevalence and regional variation of CKD and the relationship of biologic and socioeconomic factors to CKD risk in the older-adult population of Costa Rica. Methods We used data from the Costa Rican Longevity and Health Aging Study (CRELES). The cohort was comprised of 2657 adults born before 1946 in Costa Rica, chosen through a sampling algorithm to represent the national population of Costa Ricans >60 years of age. Participants answered questionnaire data and completed laboratory testing. The primary outcome of this study was CKD, defined as an estimated glomerular filtration rate (eGFR) <60 ml/min/1.73m2. Results The estimated prevalence of CKD for older Costa Ricans was 20% (95% CI 18.5 – 21.9%). In multivariable logistic regression, older age (adjusted odds ratio [aOR] 1.08 per year, 95%CI 1.07–1.10, p<0.001) was independently associated with CKD. For every 200 meters above sea level of residence, subjects’ odds of CKD increased 26% (aOR 1.26 95% CI 1.15–1.38, p<0.001). There was large regional variation in adjusted CKD prevalence, highest in Limon (40%, 95% CI 30%–50%) and Guanacaste (36%, 95% CI 26–46%) provinces. Regional and altitude effects remained robust after adjustment for socioeconomic status. Conclusions We observed large regional and altitude-related variations in CKD prevalence in Costa Rica, not explained by the distribution of traditional CKD risk factors. More studies are needed to explore the potential association of geographic and environmental exposures with the risk of CKD. PMID:26466575

  17. Beyond the D-DIA: new initiatives for deformation experiments at higher pressure and temperature

    NASA Astrophysics Data System (ADS)

    Wang, Y.; Jing, Z.; Yu, T.; Hilairet, N.; Nishiyama, N.


    Advances in experimental high-pressure, high-temperature deformation have relied to a large extent on technological developments. From the pioneer work of F.D. Adams [1] in generating differential stress at high pressure to deform rocks plastically to Griggs' famous deformation apparatus [2], each new invention has enabled numerous scientific publications and brought our understanding of rock deformation to a new level. For the past few years, two major workhorses in deformation experiments above 3 GPa are the rotational deformation apparatus (RDA) [3] and the deformation DIA (D-DIA) [4]. These developments brought us to almost 20 GPa under controlled differential stress and strain rates. Several new initiatives are being undertaken at GSECARS aiming at further enhancing experimental capabilities to higher pressures, temperatures and better in situ characterization of the deforming samples. We constructed a modified RDA with microtomography capability at high pressure which is used to image, in situ and in 3D, fabric evolution in multi-phase composites under large shear strains, to shed lights on the physics of complex earth materials during deformation. A large version of D-DIA (DDIA-30) has also been developed taking advantages of the rigidity of large guide blocks for much improved alignment. A 6-6 multianvil cell (MA6-6) [5] is used for deformation experiments with various truncated edge lengths, without having to change the large first-stage anvils. This configuration has the potential to reach pressure conditions corresponding to the lower mantle. We present recent results of these developments, and their potential applications for understanding dynamic processes from the upper mantle to the lower mantle. [1] Adams, F. D. and J. T. Nicolson (1900) Phil. Trans. Roy. Soc. London. A, 195: 363-401. [2] Griggs, D.T. (1967) Geophys. J. Roy. Astr. Soc., 14:19-31. [3] Yamazaki, D., and S. Karato (2001) Rev. Sci. Instrum., 72:4207-4211. [4] Wang, Y., I. Getting, W

  18. Involvement of the Rho–mDia1 pathway in the regulation of Golgi complex architecture and dynamics

    PubMed Central

    Zilberman, Yuliya; Alieva, Naila O.; Miserey-Lenkei, Stéphanie; Lichtenstein, Alexandra; Kam, Zvi; Sabanay, Helena; Bershadsky, Alexander


    In mammalian cells, the Golgi apparatus is a ribbon-like, compact structure composed of multiple membrane stacks connected by tubular bridges. Microtubules are known to be important to Golgi integrity, but the role of the actin cytoskeleton in the maintenance of Golgi architecture remains unclear. Here we show that an increase in Rho activity, either by treatment of cells with lysophosphatidic acid or by expression of constitutively active mutants, resulted in pronounced fragmentation of the Golgi complex into ministacks. Golgi dispersion required the involvement of mDia1 formin, a downstream target of Rho and a potent activator of actin polymerization; moreover, constitutively active mDia1, in and of itself, was sufficient for Golgi dispersion. The dispersion process was accompanied by formation of dynamic F-actin patches in the Golgi area. Experiments with cytoskeletal inhibitors (e.g., latrunculin B, blebbistatin, and Taxol) revealed that actin polymerization, myosin-II–driven contractility, and microtubule-based intracellular movement were all involved in the process of Golgi dispersion induced by Rho–mDia1 activation. Live imaging of Golgi recovery revealed that fusion of the small Golgi stacks into larger compartments was repressed in cells with active mDia1. Furthermore, the formation of Rab6-positive transport vesicles derived from the Golgi complex was enhanced upon activation of the Rho–mDia1 pathway. Transient localization of mDia1 to Rab6-positive vesicles was detected in cells expressing active RhoA. Thus, the Rho–mDia1 pathway is involved in regulation of the Golgi structure, affecting remodeling of Golgi membranes. PMID:21680709

  19. Diffusely infiltrated lymphoid areas of the bursa of Fabricius (DIA) and of the cloaca: an embryological study with morphological analogies.

    PubMed Central

    Dolfi, A; Lupetti, M; Bianchi, F; Michelucci, S


    The aim of the present experiment was to verify whether the origin of the DIA is ectodermal or endodermal. A rabbit serum against the epithelial cells of the final portion of the cloaca was prepared. The indirect immunofluorescence method was applied to strips obtained with a cryostat, carefully cut in such a way as to include a part of the cloaca, the burso-cloacal stalk, the DIA, and the bursal plicae. In this way, it was possible to demonstrate that the epithelium of the cloaca, of the burso-cloacal stalk, and of the DIA exhibited an intense fluorescence that could not be observed at the level of the epithelium of the bursal plicae. These findings would appear to indicate that the DIA, like the cloaca and the burso-cloacal stalk, is ectodermal in origin. Furthermore, histological study revealed that the DIA exhibits close structural analogies with the dorsal wall of the cloaca. In both areas, unorganized lymphoid infiltrations of the tunica propria can be seen, and the epithelium does not show any follicle-associated epithelial cells. The glands often assume the aspect of dilated crypts containing intestinal transit material. The epithelium of these glands reveals lymphoid infiltrations at various points, and it is not uncommon to detect accumulations of cells in their lumina. Several groups of eosinophilic granulocytes can also be observed in the tunica propria of these two areas, with a clear predominance at the level of the DIA. These similarities between the cloaca and the DIA might lead one to suppose the existence of a functional as well as a morphological correspondence. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 Fig. 8 Fig. 9 Fig. 10 Fig. 11 Fig. 12 PMID:3417544

  20. Distribution of DI*A and DI*B Allele Frequencies and Comparisons among Central Thai and Other Populations

    PubMed Central

    Nathalang, Oytip; Panichrum, Puangpaka; Intharanut, Kamphon; Thattanon, Phatchira; Nathalang, Siriporn


    Alloantibodies to the Diego (DI) blood group system, anti-Dia and anti-Dib are clinically significant in causing hemolytic transfusion reactions (HTRs) and hemolytic disease of the fetus and newborn (HDFN), especially in Asian populations with Mongolian ancestry. This study aimed to report the frequency of the DI*A and DI*B alleles in a Central Thai population and to compare them with those of other populations previously published. Altogether, 1,011 blood samples from unrelated healthy blood donors at the National Blood Centre, Thai Red Cross Society, Bangkok were included. Only 391 samples were tested with anti-Dia by conventional tube technique. All samples were genotyped for DI*A and DI*B alleles using an in-house polymerase chain reaction with sequence-specific primer (PCR-SSP) technique. The DI phenotyping and genotyping results were in 100% concordance. The DI*A and DI*B allele frequencies among 1,011 Central Thais were 0.0183 (37/2,022) and 0.9817 (1,985/2,022), respectively. Allele frequencies were compared between Central Thai and other populations. Our data shows that DI*A and DI*B allele frequencies are similar to Southeast Asian, Brazilian, Southern Brazilian and American Native populations; whereas, these frequencies significantly differ from those reported in East Asian, Italian, Alaska Native/Aleut, Hawaiian/Pacific Islander and Filipino populations (P<0.05), corresponding to the results of a matrix of geometric genetic distances. This study confirms that the prevalence of DI*A and DI*B alleles among Central Thais is similar to Southeast Asians and different to others populations of the world. A PCR-based identification of DI genotyping should overcome some of the serological limitations in transfusion medicine and provides a complementary tool for further population-genetic studies. PMID:27764238

  1. Electronic Dietary Intake Assessment (e-DIA): relative validity of a mobile phone application to measure intake of food groups.


    Rangan, Anna M; Tieleman, Laurissa; Louie, Jimmy C Y; Tang, Lie Ming; Hebden, Lana; Roy, Rajshri; Kay, Judy; Allman-Farinelli, Margaret


    Automation of dietary assessment can reduce limitations of established methodologies, by alleviating participant and researcher burden. Designed as a research tool, the electronic Dietary Intake Assessment (e-DIA) is a food record in mobile phone application format. The present study aimed to examine the relative validity of the e-DIA with the 24-h recall method to estimate intake of food groups. A sample of eighty university students aged 19-24 years recorded 5 d of e-DIA and 3 d of recall within this 5-d period. The three matching days of dietary data were used for analysis. Food intake data were disaggregated and apportioned to one of eight food groups. Median intakes of food groups were similar between the methods, and strong correlations were found (mean: 0·79, range: 0·69-0·88). Cross-classification by tertiles produced a high level of exact agreement (mean: 71 %, range: 65-75 %), and weighted κ values were moderate to good (range: 0·54-0·71). Although mean differences (e-DIA-recall) were small (range: -13 to 23 g), limits of agreement (LOA) were relatively large (e.g. for vegetables, mean difference: -4 g, LOA: -159 to 151 g). The Bland-Altman plots showed robust agreement, with minimum bias. This analysis supports the use of e-DIA as an alternative to the repeated 24-h recall method for ranking individuals' food group intake.

  2. Crustal structure along the active Costa Rican volcanic arc

    NASA Astrophysics Data System (ADS)

    Lizarralde, D.; Holbrook, W. S.; van Avendonk, H. J.; Mora Fernandez, M.; Alvarado, G. E.; Harder, S. H.


    We present results from an explosion-source seismic refraction transect along the entire active Costa Rican volcanic arc. The seismic data were acquired in 2005 as part of the TICO-CAVA experiment with the goals of delineating the basic crustal architecture of this relatively young volcanic arc, understanding magmatic emplacement processes, and estimating the bulk composition and growth rates of arc crust. The seismic transect extends ~280 km along the axis of the arc and consists of 16 shots (200 - 1200 kg) recorded by 710 seismometers. The active Costa Rican arc consists of two segments with distinct morphologies, the Guanacaste Cordillera (GC) in the north and Central Cordillera (CC) in the south. This segmentation is linked to the subducting Cocos ridge, which occurs beneath the CC and has a northern boundary roughly coincident with the arc segment boundary. Volcanoes of the GC rise from a plateau of ~500 m elevation to maximum heights of ~1500 m, while the CC volcanoes rise from ~1500 m to heights of 3500 m. The crustal structure beneath these segments is distinctly different. The entire arc is covered by a ~5-km-thick carapace with velocities of 4.5-5.8 km/s that probably represent volcaniclastics, flows and small plutons. Beneath the GC, a 1- to 2-km-thick “grainitic” layer (6.0-6.1 km/s) lies beneath the carapace. Velocities below this granitic layer suggest a somewhat more mafic composition, but they increase slowly with depth from 6.2-6.3 km/s between 6-15 km depth. Total crustal thickness beneath the GC is ~40 km, but analysis of crustal thickness is ongoing. The crust beneath Guanacaste thus has a velocity structure very similar to average continental crust, though with slightly slower velocities, perhaps due to high temperatures beneath the arc. As the arc has only been active in this location for <5 m.y., this suggests that either the earlier Neogene arc to the west substantially modified the oceanic-plateau crustal foundation here or that the

  3. SRTM Perspective View with Landsat Overlay: Costa Rica Coastal Plain

    NASA Technical Reports Server (NTRS)


    This perspective view shows the northern coastal plain of Costa Rica with the Cordillera Central, composed of a number of active and dormant volcanoes, rising in the background. This view looks toward the south over the Rio San Juan, which marks the boundary between Costa Rica and Nicaragua. The smaller river joining Rio San Juan in the center of the image is Rio Sarapiqui, which is navigable upstream as far inland as Puerto Viejo (Old Port) de Sarapiqui at the mountain's base. This river was an important transportation route for those few hardy settlers who first moved into this region, although as recently as 1953 a mere three thatched-roof houses were all that comprised the village of Puerto Viejo.

    This coastal plain is a sedimentary basin formed about 50 million years ago composed of river alluvium and lahar (mud and ash flow) deposits from the volcanoes of the Cordillera Central. It comprises the province of Heredia (the smallest of Costa Rica's seven) and demonstrates a wide range of climatic conditions, from warm and humid lowlands to cool and damp highlands, and including the mild but seasonally wet and dry Central Valley.

    This image was generated in support of the Central American Commission for Environment and Development through an agreement with NASA. The Commission involves eight nations working to develop the Mesoamerican Biological Corridor, an effort to study and preserve some of the most biologically diverse regions of the planet.

    This three-dimensional perspective view was generated using topographic data from the Shuttle Radar Topography Mission (SRTM) and an enhanced false-color Landsat 7 satellite image. Colors are from Landsat bands 5, 4, and 2 as red, green and blue, respectively. Topographic expression is exaggerated 2X.

    Landsat has been providing visible and infrared views of the Earth since 1972. SRTM elevation data matches the 30-meter resolution of most Landsat images and will substantially help in analyses of the large

  4. Rates of weathering rind formation on Costa Rican basalt

    NASA Astrophysics Data System (ADS)

    Sak, Peter B.; Fisher, Donald M.; Gardner, Thomas W.; Murphy, Katherine; Brantley, Susan L.


    Weathering rind thicknesses were measured on ˜ 200 basaltic clasts collected from three regionally extensive alluvial fill terraces (Qt 1, Qt 2, and Qt 3) preserved along the Pacific coast of Costa Rica. Mass balance calculations suggest that conversion of unweathered basaltic core minerals (plagioclase and augite) to authigenic minerals in the porous rind (kaolinite, allophane, gibbsite, Fe oxyhydroxides) is iso-volumetric and Ti and Zr are relatively immobile. The hierarchy of cation mobility (Ca ≈ Na > K ≈ Mg > Si > Al > Fe ≈ P) is similar to other tropical weathering profiles and is indicative of differential rates of mineral weathering (anorthite > albite ≈ hypersthene > orthoclase ≫ apatite). Alteration profiles across the cm-thick rinds document dissolution of plagioclase and augite and the growth of kaolinite, with subsequent dissolution of kaolinite and precipitation of gibbsite as weathering rinds age. The rate of weathering rind advance is evaluated using a diffusion-limited model which predicts a parabolic rate law for weathering rind thickness, r r, as a function of time, t( r r = κt), and an interface-limited model which predicts a linear rate law for weathering rind thickness as a function of time ( r r = k appt ). In these rate laws, κ is a diffusion parameter and k app is an apparent rate constant. The rate of advance is best fit by the interface model. Terrace exposures are confined to the lower reaches of streams draining the Pacific slope near the coast where the stream gradient is less than ˜3 m/km, and terrace deposition is influenced by eustatic sea level fluctuations. Geomorphological evidence is consistent with terrace deposition coincident with sea level maxima when the stream gradient would be lowest. Assigning the most weathered regionally extensive terrace Qt 1 (mean rind thickness 6.9 ± 0. 6cm) to oxygen isotope stage (OIS) 7 (ca. 240 ka), and assuming that at time = 0 rind thickness = 0, it is inferred that terrace Qt 2

  5. Mammals of the Braulio Carrillo- La Selva Complex, Costa Rica

    USGS Publications Warehouse

    Timm, Robert M.; Wilson, Don E.; Clauson, Barbara L.; LaVal, Richard K.; Vaughan, Christopher S.


    Costa Rica's La Selva-Braulio Carrillo complex encompasses a 60-km protected corridor of Caribbean rain and cloud forest extending from 30 m at the La Selva Biological Station to 2,906 m at the top of Volcán Barva. The 52,000-ha complex covers four life zones and two transitional zones, including tropical wet forest, tropical wet forest cool-transition, tropical premontane wet-transition rain forest, tropical premontane rain forest, lower montane rain forest, and montane rain forest. Located in the northeastern part of the country, the area is representative of Central American Caribbean slope forests that extend from Mexico to Panama. The extensive elevational gradient of the complex provides protected habitat for a variety of altitudinal migrants. With support from the National Geographic Society and Rice Foundation, the Organization for Tropical Studies organized a biological survey of the complex in early 1986. The mammal team worked at six sites along the elevational transect established by the expedition: 300 m, 700 m, 1,000 m, 1,500 m, 2,050 m, and 2,600 m. We supplemented our collecting records with unpublished records made available by colleagues, records in the published literature, and specimens in museum collections. In addition, observations recorded by a variety of observers at the La Selva Biological Station are summarized. The mammal fauna of the complex comprises 142 species including 79 bats, 23 rodents, 15 carnivores, 7 marsupials, 6 edentates, 4 artiodactyls, 3 primates, 2 rabbits, 2 shrews, and 1 perissodactyl. At least 10 additional species are likely to occur there. The only species of mammal likely to have been extirpated from the area is the giant anteater. Recognizing the importance of the area to wildlife and to mankind in general, the government of Costa Rica added 13,500 ha to the complex on 13 April 1986. This area, previously known as the “Zona Protectora,” provided the mid-elevational link between the lowlands of the La Selva

  6. Que Sucede? Manual Informativo Sobre Rehabilitacion y Educacion Especial en Costa Rica (What's Happening? Informative Manual on Rehabilitation and Special Education in Costa Rica).

    ERIC Educational Resources Information Center

    de Mezerville, Gaston; And Others

    The manual, in Spanish, provides descriptions of rehabilitation, medical, and special education services; centers and institutions which offer physical and mental rehabilitation services; and lists of professionals and advocacy organizations in Costa Rica. Part 1 includes an overview of rehabilitation and special education, a short history of…

  7. G-actin regulates rapid induction of actin nucleation by mDia1 to restore cellular actin polymers.


    Higashida, Chiharu; Suetsugu, Shiro; Tsuji, Takahiro; Monypenny, James; Narumiya, Shuh; Watanabe, Naoki


    mDia1 belongs to the formin family of proteins that share FH1 and FH2 domains. Although formins play a critical role in the formation of many actin-based cellular structures, the physiological regulation of formin-mediated actin assembly within the cell is still unknown. Here we show that cells possess an acute actin polymer restoration mechanism involving mDia1. By using single-molecule live-cell imaging, we found that several treatments including low-dose G-actin-sequestering drugs and unpolymerizable actin mutants activate mDia1 to initiate fast directional movement. The FH2 region, the core domain for actin nucleation, is sufficient to respond to latrunculin B (LatB) to increase its actin nucleation frequency. Simulation analysis revealed an unexpected paradoxical effect of LatB that leads to a several fold increase in free G-actin along with an increase in total G-actin. These results indicate that in cells, the actin nucleation frequency of mDia1 is enhanced not only by Rho, but also strongly through increased catalytic efficiency of the FH2 domain. Consistently, frequent actin nucleation by mDia1 was found around sites of vigorous actin disassembly. Another major actin nucleator, the Arp2/3 complex, was not affected by the G-actin increase induced by LatB. Taken together, we propose that transient accumulation of G-actin works as a cue to promote mDia1-catalyzed actin nucleation to execute rapid reassembly of actin filaments.

  8. Diversity of the free-living marine and freshwater Copepoda (Crustacea) in Costa Rica: a review.


    Morales-Ramírez, Álvaro; Suárez-Morales, Eduardo; Corrales-Ugalde, Marco; Garrote, Octavio Esquivel


    The studies on marine copepods of Costa Rica started in the 1990's and focused on the largest coastal-estuarine systems in the country, particularly along the Pacific coast. Diversity is widely variable among these systems: 40 species have been recorded in the Culebra Bay influenced by upwelling, northern Pacific coast, only 12 in the Gulf of Nicoya estuarine system, and 38 in Golfo Dulce, an anoxic basin in the southern Pacific coast of the country. Freshwater environments of Costa Rica are known to harbor a moderate diversity of continental copepods (25 species), which includes 6 calanoids, 17 cyclopoids and only two harpacticoids. Of the +100 freshwater species recorded in Central America, six are known only from Costa Rica, and one appears to be endemic to this country. The freshwater copepod fauna of Costa Rica is clearly the best known in Central America. Overall, six of the 10 orders of Copepoda are reported from Costa Rica. A previous summary by 2001 of the free-living copepod diversity in the country included 80 marine species (67 pelagic, 13 benthic). By 2009, the number of marine species increased to 209: 164 from the Pacific (49% of the copepod fauna from the Eastern Tropical Pacific) and 45 from the Caribbean coast (8% of species known from the Caribbean Basin). Both the Caribbean and Pacific species lists are growing. Additional collections of copepods at Cocos Island, an oceanic island 530 km away of the Pacific coast, have revealed many new records, including five new marine species from Costa Rica. Currently, the known diversity of marine copepods of Costa Rica is still in development and represents up to 52.6% of the total marine microcrustaceans recorded in the country. Future sampling and taxonomic efforts in the marine habitats should emphasize oceanic environments including deep waters but also littoral communities. Several Costa Rican records of freshwater copepods are likely to represent undescribed species. Also, the biogeographic relevance

  9. Diversity of the free-living marine and freshwater Copepoda (Crustacea) in Costa Rica: a review

    PubMed Central

    Morales-Ramírez, Álvaro; Suárez-Morales, Eduardo; Corrales-Ugalde, Marco; Garrote, Octavio Esquivel


    Abstract The studies on marine copepods of Costa Rica started in the 1990’s and focused on the largest coastal-estuarine systems in the country, particularly along the Pacific coast. Diversity is widely variable among these systems: 40 species have been recorded in the Culebra Bay influenced by upwelling, northern Pacific coast, only 12 in the Gulf of Nicoya estuarine system, and 38 in Golfo Dulce, an anoxic basin in the southern Pacific coast of the country. Freshwater environments of Costa Rica are known to harbor a moderate diversity of continental copepods (25 species), which includes 6 calanoids, 17 cyclopoids and only two harpacticoids. Of the +100 freshwater species recorded in Central America, six are known only from Costa Rica, and one appears to be endemic to this country. The freshwater copepod fauna of Costa Rica is clearly the best known in Central America. Overall, six of the 10 orders of Copepoda are reported from Costa Rica. A previous summary by 2001 of the free-living copepod diversity in the country included 80 marine species (67 pelagic, 13 benthic). By 2009, the number of marine species increased to 209: 164 from the Pacific (49% of the copepod fauna from the Eastern Tropical Pacific) and 45 from the Caribbean coast (8% of species known from the Caribbean Basin). Both the Caribbean and Pacific species lists are growing. Additional collections of copepods at Cocos Island, an oceanic island 530 km away of the Pacific coast, have revealed many new records, including five new marine species from Costa Rica. Currently, the known diversity of marine copepods of Costa Rica is still in development and represents up to 52.6% of the total marine microcrustaceans recorded in the country. Future sampling and taxonomic efforts in the marine habitats should emphasize oceanic environments including deep waters but also littoral communities. Several Costa Rican records of freshwater copepods are likely to represent undescribed species. Also, the

  10. [Trace metals in coastal sediments from Costa Rica].


    García-Céspedes, Jairo; Acuña-González, Jenaro; Vargas-Zamora, José A


    Marine sediment samples from four coastal ecosystems in Costa Rica were taken between the years 2000-2002 and their iron, lead, copper and zinc concentrations were determined by the atomic absorption technique with flame or graphite furnace. In the Pacific coast, Culebra Bay (Papagayo Gulf), Gulf of Nicoya, and Golfito Bay (Dulce Gulf), were selected as representative sites, and Moín Bay, at the Caribbean coast. Mean metal concentrations for all ecosystems followed the same pattern: Fe > Zn > Cu > Pb. No temporal pattern was found for any metal. Iron and copper mean concentrations were higher in Golfito Bay (5.8% and 87 microg/g, respectively) and lower in Moín Bay (3.4% and 52 microg/g, respectively). Zinc mean concentration was also higher in Golfito Bay (96 microg/g), but lower in Culebra Bay (66 microg/g). Lead mean concentration was higher in Moín Bay (6.4 microg/g) and lower in Culebra Bay (3.0 microg/g). Lead highest concentrations occurred in the Caribbean and in Golfito Bay, and for the rest of the elements the maximum values were found in Golfito Bay. On the basis of data obtained in this work, Culebra Bay was considered a relatively unpolluted location; Golfito Bay was more contaminated, and Moín Bay and the Gulf of Nicoya showed an intermediate condition.

  11. [The phytoplankton community of Punta Morales, Nicoya Gulf, Costa Rica ].


    Brugnoli Olivera, E; Morales Ramirez, A


    Three daily samplings of the phytoplankton community were made at two consecutive days in March, April, May, September, October, November and December 1997, at Punta Morales, Golfo de Nicoya, Costa Rica. Samples were collected during each tide at depths of 50% and 10% of light penetration using a Niskin bottle. A total of 43 taxa were identified. Centric diatoms, pennates and flagellates represented 90% of total phytoplankton abundance. In the phytoplankton fraction (cells > 30 microm), diatoms were the most abundant group, and Skeletonema costatum (32%) dominated. In nannophytoplankton (cells < 30 microm), Chaetoceros (23.7%) was the most abundant taxon, followed by flagellates (23%) and Cylindrotheca closterium (13.1%). These results agree with previous surveys and suggest that a typical net phytoplankton community persist through time in the Punta Morales zone. The number of nannophytoplankton fraction cells varied seasonally and suggests quantitative changes in species abundance, with possible modifications of cellular size or chain length in filamentous species. The codominance between S. costatum and Chaetoceros spp. during the rainy season suggested the ocurrence of an early ecological sucession, and nutrients could be the factor generating such population changes.

  12. [A biogeochemical model for the Gulf of Nicoya, Costa Rica].


    Tabash Blanco, Farid A


    In agreement with the Broecker and Penn two-boxes model, I generated a biogeochemical balance model for the Gulf of Nicoya (Guanacaste, Costa Rica) using two nutrient reservoirs: surface water and deep water. The mixing zone was located at a depth of 20 m. There is a balance between surface waters descending to the bottom and upwelling waters that carry nutrients and other chemical elements to the surface. The main source of nitrogen (nitrate), was the outlet of the Tempisque and Tárcoles rivers. The Gulf of Nicoya is a net source of Dissolved Inorganic Nitrogen (DIN) with an availability rate of 87 x 10(3) mol day(-1) in the dry season and 3044 x 10(3) mol day(-1)in the rainy season. Dissolved Inorganic Phosphate (DIP) was estimated in 27 mol day(-1) in the dry season and 207 mol day(-1) in the rainy season. The dynamics of these biolimited nutrients, in relation to runoff seasonal variations, fits the biological processes reported for the gulf, for example, for variations in primary productivity levels, and maturity and reproduction seasons for species with short and long life cycles.

  13. Light Diffusion in the Tropical Dry Forest of Costa Rica

    NASA Astrophysics Data System (ADS)

    Calvo-Rodriguez, S.; Sanchez-Azofeifa, G. A.


    Leaf Area Index (LAI) has been defined as the total leaf area (one-sided) in relation to the ground. LAI has an impact on tree growth and recruitment through the interception of light, which in turn affects primary productivity. Even though many instruments exist for estimating LAI from ground, they are often laborious and costly to run continuously. Measurements of LAI from the field using traditional sensors (e.g., LAI-2000) require multiple visits to the field under very specific sky conditions, making them unsuitable to operate in inaccessible areas and forests with dense vegetation, as well as areas where persistent sunny conditions are the norm like tropical dry forests. With this context, we proposed a methodology to characterize light diffusion based on NDVI and LAI measurements taken from the field in two successional stages in the tropical dry forest of Santa Rosa National Park in Costa Rica. We estimate a "K" coefficient to characterize light diffusion by the canopy, based on field NDVI measurements derived from optical phenology instruments and MODIS NDVI. From the coefficients determined, we estimated LAI values and compared them with ground measurements of LAI. In both successional stages ground measurements of LAI had no significant difference to the tower-derived LAI and the estimated LAI from MODIS NDVI.

  14. A clandestine burial in Costa Rica: prospection and excavation.


    Congram, Derek R


    This case report describes the search for a clandestine grave in Costa Rica for which the police sought the assistance of an archaeologist. An anonymous informant suggested that the victim had been kidnapped and murdered, placed in a shallow grave in the woods, then covered with lime and cement. A search of the area to detect conventional signs of burial (e.g., slumping, different plant growth) resulted in excavation of unrelated features of past disturbance. Different aspects of the grave including the deposition of cement powder over the body prevented its initial discovery. Improvisation of conventional archaeological excavation methods and use of police familiar with archaeological excavation resulted in the location of the grave and exhumation of the victim without loss of important contextual evidence that supported testimony on the cause of death. The taphonomic effects of high-lying ground water and lime in the tropical burial environment are briefly discussed. Recommendations such as the construction of a temporary sump to lower the ground water level in the grave during excavation are made to assist in similar investigations in the future.

  15. Ocular disease in American crocodiles (Crocodylus acutus) in Costa Rica.


    Rainwater, Thomas R; Millichamp, Nicholas J; Barrantes, Luz Denia Barrantes; Barr, Brady R; Montero, Juan R Bolaños; Platt, Steven G; Abel, Mike T; Cobb, George P; Anderson, Todd A


    Beginning in early 2006, an ocular disease of unknown etiology was routinely observed in American crocodiles (Crocodylus acutus) inhabiting the highly polluted Tarcoles River in west-central Costa Rica. We examined the nature and incidence of ocular disease in Tarcoles crocodiles and assessed the possible association between the disease and accumulation of chemical pollutants in diseased individuals. During 12-15 September and 12-13 December 2007, crocodiles were captured and examined for ocular disease and sampled to determine environmental contaminant accumulation. Three of 11 (27.3%) crocodiles captured (all males) exhibited unilateral ocular disease, primarily characterized by corneal opacity and scarring, anterior synechia, and phthisis bulbi. Multiple pollutants were detected in crocodile caudal scutes (organochlorine pesticides [OCPs] and metals), crocodile blood (OCPs), and sediments (OCPs and metals) from the Tarcoles, but no associations were found between contaminant accumulation and the incidence of eye disease. On the basis of the limited number of diseased animals examined and the potential exposure of crocodiles to pathogens and other pollutants not targeted in this study, we cannot rule out infection or chemical toxicosis as causes of the eye lesions. However, circumstantial evidence suggests that the observed ocular disease is likely the result of injury-induced trauma (and possibly secondary infection) inflicted during aggressive encounters (e.g., territorial combat) among large adult crocodiles living at relatively high densities.

  16. Health insurance and child mortality in Costa Rica.


    Dow, William H; Schmeer, Kammi K


    This study uses a natural experiment approach to evaluate the effect of health insurance on infant and child mortality. In the 1970s Costa Rica adopted national health insurance, which expanded children's insurance coverage from 42 percent in 1973 to 73 percent by 1984. Aggregate infant and child mortality rates dropped rapidly during this period, but this trend had begun prior to the insurance expansion, and may be related to other changes during this period. We use county-level vital statistics and census data to isolate the causal insurance effect on mortality using county fixed effects models. We find that insurance increases are strongly related to mortality decreases at the county level before controlling for other time-varying factors. However, after controlling for changes in other correlated maternal, household, and community characteristics, fixed effects models indicate that the insurance expansion could have explained only a small portion of the mortality change. These results question the proposition that health insurance can lead to large improvements in infant and child mortality, and that expanding insurance to the poor can substantially narrow socioeconomic differentials in mortality.

  17. Meiofauna associated with a Pacific coral reef in Costa Rica

    NASA Astrophysics Data System (ADS)

    Guzmán, Héctor M.; Obando, Vilma L.; Cortés, Jorge


    The meiofauna of two coral reef habitats at Isla del Naño, Costa Rica was studied over a one year period. The dominant groups were: Foraminifera (21.2%), Copepoda (19.7%), Nematoda (19.1%), Gastropoda (16.5%), Polychaeta (7.2%) and Bivalvia (6.6%). The highest diversity was found in coarse, heterogeneous sands with the highest percentage of carbonates. The meiofauna showed a high degree of horizontal aggregation, which is a characteristic pattern for macro- and meiofauna in sediments of variable composition. No vertical variation in distribution was evident, probably due to the deep location of the Redox Potential Discontinuity layer. The total densities of organisms found in this study (99 to 575 ind/10 cm2) are low compared with densities in similar non-reefal sands (7 to 6116), and from fine sediments (80 to 17 000), but are comparable to densities found in other reef areas (39 to 609.5 ind/10 cm2). This is the first report on meiofauna from the eastern Pacific, and the first time that foraminiferans are the dominant group.

  18. The cervical cancer prevention programme in Costa Rica

    PubMed Central

    Rojas, Ileana Quirós


    Cervical and uterine cancer continues to be an important issue for women around the world, although neoplasia has the greatest demonstrated potential for prevention. Costa Rica has achieved important advances in the reduction of the incidence and mortality of these cancers since the last century. This is the result of a series of policies, programmes, and plans, not only at the level of the health care system, but also in other areas. Increased access for women to care in health centres, fundamentally at the primary level, has been vital, as has ensuring the quality of cytology readings and access to diagnosis and treatment for precursor lesions for in situ and invasive cancers. Despite all of these achievements, there are still challenges to be overcome, which are widespread in many countries in Latin America and the Caribbean. It is important to learn from the experiences of other countries in order to improve women’s health not only as a health objective, but also as an ethical imperative to promote the exercise of women’s rights to life and health. PMID:26557876

  19. Phytoplankton production and grazing balances in the Costa Rica Dome.


    Landry, Michael R; Selph, Karen E; Décima, Moira; Gutiérrez-Rodríguez, Andrés; Stukel, Michael R; Taylor, Andrew G; Pasulka, Alexis L


    We investigated phytoplankton production rates and grazing fates in the Costa Rica Dome (CRD) during summer 2010 based on dilution depth profiles analyzed by flow cytometry and pigments and mesozooplankton grazing assessed by gut fluorescence. Three community production estimates, from (14)C uptake (1025 ± 113 mg C m(-2) day(-1)) and from dilution experiments analyzed for total Chla (990 ± 106 mg C m(-2) day(-1)) and flow cytometry populations (862 ± 71 mg C m(-2) day(-1)), exceeded regional ship-based values by 2-3-fold. Picophytoplankton accounted for 56% of community biomass and 39% of production. Production profiles extended deeper for Prochlorococcus (PRO) and picoeukaryotes than for Synechococcus (SYN) and larger eukaryotes, but 93% of total production occurred above 40 m. Microzooplankton consumed all PRO and SYN growth and two-third of total production. Positive net growth of larger eukaryotes in the upper 40 m was balanced by independently measured consumption by mesozooplankton. Among larger eukaryotes, diatoms contributed ∼3% to production. On the basis of this analysis, the CRD region is characterized by high production and grazing turnover, comparable with or higher than estimates for the eastern equatorial Pacific. The region nonetheless displays characteristics atypical of high productivity, such as picophytoplankton dominance and suppressed diatom roles.

  20. Urban structure and dengue fever in Puntarenas, Costa Rica

    PubMed Central

    Troyo, Adriana; Fuller, Douglas O.; Calderón-Arguedas, Olger; Solano, Mayra E.; Beier, John C.


    Dengue is currently the most important arboviral disease globally and is usually associated with built environments in tropical areas. Remotely sensed information can facilitate the study of urban mosquito-borne diseases by providing multiple temporal and spatial resolutions appropriate to investigate urban structure and ecological characteristics associated with infectious disease. In this study, coarse, medium and fine resolution satellite imagery (Moderate Resolution Imaging Spectrometer, Advanced Spaceborne Thermal Emission and Reflection Radiometer and QuickBird respectively) and ground-based data were analyzed for the Greater Puntarenas area, Costa Rica for the years 2002–04. The results showed that the mean normalized difference vegetation index (NDVI) was generally higher in the localities with lower incidence of dengue fever during 2002, although the correlation was statistically significant only in the dry season (r=−0.40; p=0.03). Dengue incidence was inversely correlated to built area and directly correlated with tree cover (r=0.75, p=0.01). Overall, the significant correlations between dengue incidence and urban structural variables (tree cover and building density) suggest that properties of urban structure may be associated with dengue incidence in tropical urban settings. PMID:20161131

  1. Phytoplankton production and grazing balances in the Costa Rica Dome

    PubMed Central

    Landry, Michael R.; Selph, Karen E.; Décima, Moira; Gutiérrez-Rodríguez, Andrés; Stukel, Michael R.; Taylor, Andrew G.; Pasulka, Alexis L.


    We investigated phytoplankton production rates and grazing fates in the Costa Rica Dome (CRD) during summer 2010 based on dilution depth profiles analyzed by flow cytometry and pigments and mesozooplankton grazing assessed by gut fluorescence. Three community production estimates, from 14C uptake (1025 ± 113 mg C m−2 day−1) and from dilution experiments analyzed for total Chla (990 ± 106 mg C m−2 day−1) and flow cytometry populations (862 ± 71 mg C m−2 day−1), exceeded regional ship-based values by 2–3-fold. Picophytoplankton accounted for 56% of community biomass and 39% of production. Production profiles extended deeper for Prochlorococcus (PRO) and picoeukaryotes than for Synechococcus (SYN) and larger eukaryotes, but 93% of total production occurred above 40 m. Microzooplankton consumed all PRO and SYN growth and two-third of total production. Positive net growth of larger eukaryotes in the upper 40 m was balanced by independently measured consumption by mesozooplankton. Among larger eukaryotes, diatoms contributed ∼3% to production. On the basis of this analysis, the CRD region is characterized by high production and grazing turnover, comparable with or higher than estimates for the eastern equatorial Pacific. The region nonetheless displays characteristics atypical of high productivity, such as picophytoplankton dominance and suppressed diatom roles. PMID:27275036

  2. Conversion or conservation? Understanding wetland change in northwest Costa Rica.


    Daniels, Amy E; Cumming, Graeme S


    Wetlands are more threatened than any other ecosystem type, with losses exceeding 50% of their original extent worldwide. Despite the small portion of the Earth's surface that they comprise, wetlands contribute significantly to global ecosystem services. In this study, we tested the hypothesis that the location and rate of change in wetland amount in the Tempisque Basin of northwest Costa Rica is predictable from landscape setting. Our results demonstrate that a strong potential exists for developing predictive models of wetland conversion based on an understanding of wetland location and surrounding trends of land use. We found that topography was the single most important predictor of wetland conversion in this area, entraining other conversion processes, and that spatial patterns of wetland loss could consistently be predicted from landscape-level variables. Areas with highest probabilities of conversion were found in the most accessible, non-protected regions of the landscape. While Palo Verde National Park made a substantial contribution to wetland conservation, our results highlight the dependence of lower-lying protected areas on upland processes, adding a little-addressed dimension of complexity to the dialogue about protected area management. Conservation strategies aimed at reducing wetland loss in tropical habitats will benefit from careful analysis of the dominant land use system(s) at a relatively broad scale, and the subsequent development of management and policy responses that take into account dynamic opportunities and constraints in the landscape.

  3. The cervical cancer prevention programme in Costa Rica.


    Rojas, Ileana Quirós


    Cervical and uterine cancer continues to be an important issue for women around the world, although neoplasia has the greatest demonstrated potential for prevention. Costa Rica has achieved important advances in the reduction of the incidence and mortality of these cancers since the last century. This is the result of a series of policies, programmes, and plans, not only at the level of the health care system, but also in other areas. Increased access for women to care in health centres, fundamentally at the primary level, has been vital, as has ensuring the quality of cytology readings and access to diagnosis and treatment for precursor lesions for in situ and invasive cancers. Despite all of these achievements, there are still challenges to be overcome, which are widespread in many countries in Latin America and the Caribbean. It is important to learn from the experiences of other countries in order to improve women's health not only as a health objective, but also as an ethical imperative to promote the exercise of women's rights to life and health.

  4. The fertility plateau in Costa Rica: a review of causes and remedies.


    Holl, K D; Daily, G C; Ehrlich, P R


    Costa Rica achieved a substantial reduction in its overall fertility rate in a very short period of time. The halving of the fertility rate which occurred in less than ten years in Costa Rica transpired over the course of 100 years in France and 170 in Sweden. The level of contraceptive use in Costa Rica is twice that in other Central American nations. The authors summarize the recent demographic history of Costa Rica and review factors influencing its remarkable fertility decline. They then discuss possible explanations for the ensuing fertility plateau and conclude by suggesting strategies for affecting a further decrease in fertility rates. With regard to the reasons for the fertility plateau, cultural factors, socioeconomic factors, declining government commitment and family planning services, education, and the Church are considered. To reduce the level of fertility even further, the authors recommend that the government adopt a clear population policy which could serve as a basis for other changes such as increased support of family planning programs, improvements in the educational system, increased women's status and employment opportunities, and extensive education in schools and through the mass media on the socioeconomic and environmental effects of overpopulation. It is important to increase Costa Ricans' understanding of the negative impacts of continued population growth and the role of individual family planning decisions in that growth.

  5. Hydro and geothermal electricity as an alternative for industrial petroleum consumption in Costa Rica

    SciTech Connect

    Mendis, M.; Park, W.; Sabadell, A.; Talib, A.


    This report assesses the potential for substitution of electricity for petroleum in the industrial/agro-industrial sector of Costa Rica. The study includes a preliminary estimate of the process energy needs in this sector, a survey of the principal petroleum consuming industries in Costa Rica, an assessment of the electrical technologies appropriate for substitution, and an analysis of the cost trade offs of alternative fuels and technologies. The report summarizes the total substitution potential both by technical feasibility and by cost effectiveness under varying fuel price scenarios and identifies major institutional constraints to the introduction of electric based technologies. Recommendations to the Government of Costa Rica are presented. The key to the success of a Costa Rican program for substitution of electricity for petroleum in industry rests in energy pricing policy. The report shows that if Costa Rica Bunker C prices are increased to compare equitably with Caribbean Bunker C prices, and increase at 3 percent per annum relative to a special industrial electricity rate structure, the entire substitution program, including both industrial and national electric investment, would be cost effective. The definition of these pricing structures and their potential impacts need to be assessed in depth.

  6. The Galapagos-OIB signature of the central Costa Rican volcanic front: arc-hotspot interaction

    NASA Astrophysics Data System (ADS)

    Gazel, E.; Carr, M. J.; Hoernle, K.; Feigenson, M. D.; Hauff, F.; Szymanski, D.; van den Bogaard, P.


    Although most Central American magmas have a typical arc geochemical signature, magmas in southern Central America have isotopic and trace element compositions with an OIB affinity, similar to the Galapagos hotspot lavas. Our new data for Costa Rica suggest that this signature, unusual for a convergent margin, has a relatively recent origin (Late Miocene-Pliocene ca. 6 Ma). We also show that there was a transition from typical arc magmas (analogous to the modern Nicaraguan volcanic front) to OIB-like magmas. The geographic distribution of the Galapagos signature in recent lavas from southern Central America is present landward from the subduction of the Galapagos hotspot tracks (the Seamount Province and the Cocos/Coiba Ridges) at the Middle American Trench. The higher Pb isotopic ratios, relatively low Nd isotopic ratios and enriched geochemical signature of central Costa Rican magmas can be explained by arc-hotspot interaction. The isotopic ratios of central Costa Rican lavas require the subducting Seamount Province (Northern Galapagos Domain) component, whereas the isotopic ratios of the adakites and alkaline basalts from southern Costa Rica and Panama are in the geochemical range of the subducting Cocos/Coiba Ridges (Central Galapagos Domain). Geological, geochemical, and isotopic evidence collectively indicate that the relatively recent Galapagos-OIB signature in southern Central America represents a geochemical signal from subducting Galapagos hotspot tracks, which started to collide with the margin ~8 Ma ago. The Galapagos hotspot contribution decreases systematically along the volcanic front from central Costa Rica to NW Nicaragua.

  7. Challenges for implementing water quality monitoring and analysis on a small Costa Rican catchment

    NASA Astrophysics Data System (ADS)

    Golcher, Christian; Cernesson, Flavie; Tournoud, Marie-George; Bonin, Muriel; Suarez, Andrea


    The Costa Rican water regulatory framework (WRF) (2007), expresses the national concern about the degradation of surface water quality observed in the country since several years. Given the urgency of preserving and restoring the surface water bodies, and facing the need of defining a monitoring tool to classify surface water pollution, the Costa-Rican WRF relies on two water quality indexes: the so-called "Dutch Index" (D.I) and the Biological Monitoring Working Party adapted to Costa Rica (BMWP'CR), allowing an "easy" physicochemical and biological appraisal of the water quality and the ecological integrity of water bodies. Herein, we intend to evaluate whether the compound of water quality indexes imposed by Costa Rican legislation, is suitable to assess rivers local and global anthropogenic pressure and environmental conditions. We monitor water quality for 7 points of Liberia River (northern pacific region - Costa Rica) from March 2013 to July 2015. Anthropogenic pressures are characterized by catchment land use and riparian conditions. Environmental conditions are built from rainfall daily series. Our results show (i) the difficulties to monitor new sites following the recent implementation of the WRF; (ii) the statistical characteristics of each index; and (iii) a modelling tentative of relationships between water quality indexes and explanatory factors (land-use, riparian characteristics and climate conditions).

  8. Constructions of Difference and Deficit, a Case Study: Nicaraguan Families and Children on the Margins in Costa Rica

    ERIC Educational Resources Information Center

    Purcell-Gates, Victoria


    This analysis examines the nexus of marginalization and education, particularly the literacy potential and achievement of young children from socially and politically marginalized communities. Drawing on data from a study of literacy practice among Nicaraguan immigrants in Costa Rica and the schooling of the Nicaraguan children in Costa Rican…

  9. A Cross-Country Comparison of Virtual Discussion Board Use in United States and Costa Rican Education Settings

    ERIC Educational Resources Information Center

    Hodge, Kari; Saxon, Terrill F.; Trumble, Jason


    The purpose of the current study was to compare the use of virtual discussion boards in various educational settings in the United States and Costa Rica. Participants included professors of education, in-service and pre-service teachers in the United States and Costa Rica where a survey was used that included demographic, knowledge, attitude, and…

  10. DIA2: Web-based Cyberinfrastructure for Visual Analysis of Funding Portfolios.


    Madhavan, Krishna; Elmqvist, Niklas; Vorvoreanu, Mihaela; Chen, Xin; Wong, Yuetling; Xian, Hanjun; Dong, Zhihua; Johri, Aditya


    We present a design study of the Deep Insights Anywhere, Anytime (DIA2) platform, a web-based visual analytics system that allows program managers and academic staff at the U.S. National Science Foundation to search, view, and analyze their research funding portfolio. The goal of this system is to facilitate users' understanding of both past and currently active research awards in order to make more informed decisions of their future funding. This user group is characterized by high domain expertise yet not necessarily high literacy in visualization and visual analytics-they are essentially casual experts-and thus require careful visual and information design, including adhering to user experience standards, providing a self-instructive interface, and progressively refining visualizations to minimize complexity. We discuss the challenges of designing a system for casual experts and highlight how we addressed this issue by modeling the organizational structure and workflows of the NSF within our system. We discuss each stage of the design process, starting with formative interviews, prototypes, and finally live deployments and evaluation with stakeholders.

  11. Space geodetic studies of crustal deformation in subduction zones: The Central Andes and Costa Rica

    NASA Astrophysics Data System (ADS)

    Norabuena, Edmundo O.

    Subduction zones are regions that account for most of the total energy released by large earthquakes around the world. Two of these regions, the Costa Rica Margin and the southern Peru Margin, historically prone to devastating earthquakes with severe social and economic impact, are the focus of my dissertation. I use GPS derived velocity fields estimated from time series of coordinates of campaign stations deployed between 1994 and 2001 over the Costa Rica and Peru subduction zones to infer fault geometry and slip distribution on the plate boundary, and study the corresponding seismogenic zones. Regions of locking are associated with asperities that may break at the end of the corresponding earthquake cycle; their area extent may signify amount of energy to be released. I also show that fore-arc motion in Costa Rica, as well as postseismic relaxation, are factors that contribute to or alter the observed velocity fields and must be taken into account.

  12. Plastic paradise: transforming bodies and selves in Costa Rica's cosmetic surgery tourism industry.


    Ackerman, Sara L


    Long popular as a nature tourism destination, Costa Rica has recently emerged as a haven for middle class North Americans seeking inexpensive, state-of-the-art cosmetic surgery. This paper examines "cosmetic surgery tourism" in Costa Rica as a form of medicalized leisure, situated in elite private spaces and yet inextricably linked to a beleaguered national medical program. Through historical context and ethnographic analysis of activities at medical hotels and clinics, I describe how the recovery industry operates on the embodied subjectivities of visiting patients and their local caretakers. Recovery sociality and healing landscapes facilitate patients' transition through a period of post-surgical liminality and provide nostalgic transport to an imagined medical arcadia, while clinicians are attracted by a neoliberal promise of prosperity and autonomy. Ultimately, Costa Rica's transformation into a paradise of medical consumption and self-optimization is contingent on a mythology that obscures growing uncertainties and inequities in the nation's broader medical landscape.

  13. First report of acariasis by Caparinia tripilis in African hedgehogs, (Atelerix albiventris), in Costa Rica.


    Moreira, Andrés; Troyo, Adriana; Calderón-Arguedas, Olger


    The African hedgehog is one of the newly imported exotic pets which have been observed with increasing regularity in veterinary clinics in Costa Rica. Despite their popularity, information about their diseases is scarce. Within skin diseases of hedgehogs, mange caused by Caparinia spp. is a common diagnosis in other countries. Two adult African hedgehogs, one male and one female, were brought to a private clinic in Heredia, Costa Rica, with chronic pruritic dermatitis, scabs, nearly complete loss of spines, lethargy, dehydration, and weight loss. During physical exam, deposits of dry seborrhea were taken and processed for diagnosis. Microscopic examination revealed psoroptid mites identified as Caparinia tripilis. This is the first report of the presence of Caparinia tripilis in Costa Rica and, to the authors' knowledge, the rest of Central America.

  14. Babies and belonging: reproduction, citizenship, and undocumented nicaraguan labor migrant women in Costa Rica.


    Goldade, Kate


    This article presents findings from an ethnographic study of 43 Nicaraguan labor migrant women in Costa Rica, among whom two thirds were undocumented. Drawing from more than a year of field research, this research explores how undocumented migrant women parlayed reproductive capacities in a context of a modernizing democratic host nation-state increasingly limited in its capacity to fulfill longstanding national ideals of "health for all." Pregnancy and postpartum periods presented unique opportunities for achieving gains related to citizenship. As the third most common migrant destination context in the Western hemisphere, Costa Rica is grappling with its dual role as a nation of emigration and immigration and is attempting to maintain its "exceptional" national identity in the face of rapid globalization. Due to the jus soli citizenship model, the health care system has become a site for struggle over inclusion in the Costa Rican nation-state.

  15. Two new species and a new combination in Protium (Burseraceae) from Costa Rica

    PubMed Central

    Santamaría-Aguilar, Daniel; Lagomarsino, Laura P.


    Abstract Two new species of Protium (Burseraceae) are described and illustrated: Protium aguilarii sp. nov., from the Pacific slope of the Osa Peninsula, Puntarenas Province, Costa Rica; and Protium hammelii sp. nov., from wet forests on the Caribbean slopes of Nicaragua and Costa Rica. In addition, Protium brenesii comb. nov., is proposed as a new combination based on Trichilia brenesii, a name that was based on a specimen collected with flowers in the mountains near San Ramón, Alajuela Province, Costa Rica. It is compared with Protium costaricense, a similar species with which it has been confused for more than 90 years. Finally, illustrations and specimen citations are provided for all the aforementioned taxa, and some others with which they have been confused. PMID:28228688


    EPA Science Inventory

    Previously we reported that a single dose of ATR herbicide stimulated HPA axis activation in the male rat while its primary metabolite, DACT, did so to a lesser extent. In this study, we evaluated the effects of ATR, DACT, and an intermediate metabolite, DIA, on adrenocorticotrop...


    EPA Science Inventory

    Atrazine (ATR) is one of the most widely used herbicides in the United States, with current total annual use of approximately 76 million pounds of active ingredient. Previous work in our laboratory has shown that ATR and its metabolite deisopropyl-atrazine (DIA) induce a dose-dep...

  18. Modeling a tsunami from the Nicoya, Costa Rica, seismic gap and its potential impact in Puntarenas

    NASA Astrophysics Data System (ADS)

    Chacón-Barrantes, Silvia E.; Protti, Marino


    Although subduction zones around the world are known to be the source of earthquakes and/or tsunamis, not all segments of these plate boundaries generate destructive earthquakes and catastrophic tsunamis. Costa Rica, in Central America, has subduction zones on both the Pacific and the Caribbean coasts and, even though large earthquakes (Mw = 7.4-7.8) occur in these convergent margins, they do not produce destructive tsunamis. The reason for this is that the seismogenic zones of the segments of the subduction zones that produce large earthquakes in Costa Rica are located beneath land (Nicoya peninsula, Osa peninsula and south of Limón) and not off shore as in most subduction zones around the world. To illustrate this particularity of Costa Rican subduction zones, we show in this work the case for the largest rupture area in Costa Rica (under the Nicoya peninsula), capable of producing Mw ˜ 7.8 earthquakes, but the tsunamis it triggers are small and present little potential for damage even to the largest port city in Costa Rica. The Nicoya seismic gap, in NW Costa Rica, has passed its ˜50-year interseismic period and therefore a large earthquake will have to occur there in the near future. The last large earthquake, in 1950 generated a tsunami which slightly affected the southwest coast of the Nicoya Peninsula. We present here a simulation to study the possible consequences that a tsunami generated by the next Nicoya earthquake could have for the city of Puntarenas. Puntarenas has a population of approximately eleven thousand people and is located on a 7.5 km long sand bar with a maximum height of 2 m above the mean sea level. This condition makes Puntarenas vulnerable to tsunamis.

  19. Small-molecule agonists of mammalian Diaphanous–related (mDia) formins reveal an effective glioblastoma anti-invasion strategy

    PubMed Central

    Arden, Jessica D.; Lavik, Kari I.; Rubinic, Kaitlin A.; Chiaia, Nicolas; Khuder, Sadik A.; Howard, Marthe J.; Nestor-Kalinoski, Andrea L.; Alberts, Arthur S.; Eisenmann, Kathryn M.


    The extensive invasive capacity of glioblastoma (GBM) makes it resistant to surgery, radiotherapy, and chemotherapy and thus makes it lethal. In vivo, GBM invasion is mediated by Rho GTPases through unidentified downstream effectors. Mammalian Diaphanous (mDia) family formins are Rho-directed effectors that regulate the F-actin cytoskeleton to support tumor cell motility. Historically, anti-invasion strategies focused upon mDia inhibition, whereas activation remained unexplored. The recent development of small molecules directly inhibiting or activating mDia-driven F-actin assembly that supports motility allows for exploration of their role in GBM. We used the formin inhibitor SMIFH2 and mDia agonists IMM-01/-02 and mDia2-DAD peptides, which disrupt autoinhibition, to examine the roles of mDia inactivation versus activation in GBM cell migration and invasion in vitro and in an ex vivo brain slice invasion model. Inhibiting mDia suppressed directional migration and spheroid invasion while preserving intrinsic random migration. mDia agonism abrogated both random intrinsic and directional migration and halted U87 spheroid invasion in ex vivo brain slices. Thus mDia agonism is a superior GBM anti-invasion strategy. We conclude that formin agonism impedes the most dangerous GBM component—tumor spread into surrounding healthy tissue. Formin activation impairs novel aspects of transformed cells and informs the development of anti-GBM invasion strategies. PMID:26354425

  20. Using Social Networks to Educate Seismology to Non-Science Audiences in Costa Rica

    NASA Astrophysics Data System (ADS)

    Lücke, O. H.; Linkimer, L.


    Costa Rica has a very high rate of seismicity with 63 damaging earthquakes in its history as a nation and 12 felt earthquakes per month on average. In Costa Rica, earthquakes are part of everyday life; hence the inhabitants are highly aware of seismic activity and geological processes. However, formal educational programs and mainstream media have not yet addressed the appropriate way of educating the public on these topics, thus myths and misconceptions are common. With the increasing influence of social networks on information diffusion, they have become a new channel to address this issue in Costa Rica. The National Seismological Network of Costa Rica (RSN) is a joint effort between the University of Costa Rica and the Costa Rican Institute of Electricity. Since 1973, the RSN studies the seismicity and volcanic activity in the country. Starting on January 2011 the RSN has an active Facebook Page, in which felt earthquakes are reported and information on Seismology, geological processes, scientific talks, and RSN activities are routinely posted. Additionally, RSN gets almost instantaneous feedback from RSN followers including people from all rural and urban areas of Costa Rica. In this study, we analyze the demographics, geographic distribution, reach of specific Facebook posts per topic, and the episodic growth of RSN followers related to specific seismic events. We observe that 70 % of the RSN users are between ages from 18 to 34. We consistently observe that certain regions of the country have more Facebook activity, although those regions are not the most populated nor have a high connectivity index. We interpret this pattern as the result of a higher awareness to geological hazards in those specific areas. We notice that educational posts are as well 'liked' as most earthquake reports. For exceptional seismic events, we observe sudden increments in the number of RSN followers in the order of tens of thousands. For example, the May 2013 Sixaola earthquake (Mw

  1. [Costa Rica: a geographical approach to the study of its population (1522-1984)].


    Carvajal Alvarado, G


    The author provides a geographical interpretation of population dynamics in Costa Rica from 1522 to 1984. Sections are included on Spanish colonialism as a demographic catastrophe, 1500-1821; the country's stable demographic behavior after obtaining its independence in 1821; the population as a product of cross-breeding; the unequal spatial distribution of the country's population; model demographic growth, 1900-1984; low mortality and high fertility as factors driving population growth; the age structure of the population; regional migration in Costa Rica and areas of migratory attraction; the growth of the urban population and the extent of assimilation of diverse groups; and the problem of poverty.

  2. Four new species of Symmerista Hübner, 1816 (Notodontidae, Nystaleinae) from Costa Rica

    PubMed Central

    Chacón, Isidro A.; Janzen, Daniel H.; Hallwachs, Winnie


    Abstract The genus Symmerista Hübner (Notodontidae, Nystaleinae) is reviewed for Costa Rica, based on 49 wild-caught specimens. Four species are newly described: Symmerista luisdiegogomezi Chacón, Symmerista inbioi Chacón, Symmerista minaei Chacón and Symmerista aura Chacón. All are from the cloud forests of the Talamanca moutain range, southern Costa Rica. Photographs of the adults, male and female genitalia, and barcodes are also provided. The species Symmerista tlotzin Schaus (1892) is removed from Symmerista and assigned to the genus Elymiotis Walker as a new combination. PMID:25061379

  3. Fog deposition at a windward Costa Rican cloud forest site

    NASA Astrophysics Data System (ADS)

    Frumau, K. F. A.; Bruijnzeel, L. A.; Tobon-Marin, C.


    The hydrological importance of tropical montane cloud forests is recognized increasingly, mostly with respect to the additional water inputs provided by the capture of fog by the forest canopy compared to a non-forested situation (e.g. pasture) in the same environmental setting. The deposition of fog (interception) consists of two components, viz. advectional impaction against roughness elements in the landscape, and vertical settlement both by turbulent diffusion and by gravitational settling. Turbulent diffusion being a function of the aerodynamic roughness of the surface it is typically enhanced over forest compared to pasture. In windward montane areas fog often consists of stratus clouds being forced uphill with the cloud being "stripped" by roughness elements in the landscape. However, due to rain-generating processes these clouds rarely have fog-sized droplets only and larger drops are present as well. Under sufficiently strong wind speeds (e.g. in the trade-wind belt), drizzle-sized droplets tend to follow the terrain and behave like fog. Consequently, there is no unbiased manner in which to separate between fog and drizzle using conventional fog and rain gauges only. Similarly, hydrologically effective precipitation (inclined rainfall) is difficult to determine in mountainous areas, which complicates the determination of fog deposition using wet-canopy water budget approaches. The deposition of fog to a windward Costa Rican montane cloud forest was studied during a full hydrological year (between 1 July 2003 and 1 July 2004). Fog deposition was estimated from the wet canopy water budget as the difference between hydrologically effective precipitation and the sum of throughfall, stemflow, and interception loss. The results show that fog interception constituted a much smaller contribution at this site compared to wind-driven drizzle.

  4. Accretionary processes along the Middle America Trench off Costa Rica

    SciTech Connect

    Shipley, T.H.; Stoffa, P.L. ); McIntosh, K.; Silver, E.A. )


    The geometry of large-scale structures within modern accretionary prisms is known entirely from seismic reflection studies using single or grids of two-dimensional profiles. Off Costa Rica the authors collected a three-dimensional reflection data set covering a 9 km wide {times} 22 km long {times} 6 km thick volume of the accretionary prism just arcward of the Middle America Trench. The three-dimensional processing and ability to examine the prism as a volume has provided the means to map structures from a few hundred meters to kilometers in size with confidence. Reflections from within the prism define the gross structural features and tectonic processes active along this particular portion of the Middle America Trench. So far in the analysis, these data illustrate the relationships between the basement, the prism shape, and overlying slope sedimentary deposits. For instance, the subducted basement relief (of several hundred meters amplitude) does seem to affect the larger scale through-going faults within the prism. Offscraping of the uppermost 45 m of sediments occurs within 4 km of the trench creating a small pile of sediments at the base of the trench. How this offscraped sediment is incorporated into the prism is still being investigated. Underplating of parts of the 400 m thick subducted section begin: at a very shallow structural level, 4 to 10 km arcward of the trench. Amplitude anomalies associated with some of the larger arcward dipping structures in the prism and surface mud volcanoes suggest that efficient fluid migration paths may extend from the top of the downgoing slab at the shelf edge out into the lower and middle slope region, a distance of 50 to 100 km.

  5. Organochlorine chemicals and neurodegeneration among elderly subjects in Costa Rica

    PubMed Central

    Mora, A.M.; Barr, D.B.; Juncos, J.; Roman, N.; Wesseling, C.


    Background We previously screened 400 elderly Costa Ricans for neurodegenerative disease. Those reporting occupational pesticide exposure (18%) had an increased Parkinson’s disease (PD) risk (OR 2.57, 95% CI 0.91–7.26), and worse cognition (Mini-Mental States Exam (MMSE) 24.5 versus 25.9 points, p=0.01). We subsequently measured long-lasting organochlorine pesticides (β-HCH, DDE, DDT, and dieldrin) in a sub-sample (n=89). Dieldrin and β-HCH have been linked to PD, and DDE to Alzheimer’s disease. Methods We ran regression models for MMSE and tremor-at-rest to assess associations with pesticides in 89 subjects. Results The percent of β-HCH, DDE, DDT (parent compound for DDE), and dieldrin above their limit of detection (LOD) were 100%, 93%, 75%, and 57%, respectively. Tremor-at-rest was found in 21 subjects, and the mean MMSE was 25. Those who reported occupational pesticide exposure (n=36) had more detectable dieldrin samples (p=0.005), and higher mean levels of dieldrin (p=0.01), than those not reporting exposure. Other pesticides did not differ between those with and without self-reported occupational exposure. There was a positive but non-significant trend of higher risk for tremor-at-rest with higher dieldrin (p=0.10 for linear trend). Neither DDE nor DDT showed a relationship with MMSE. However, after excluding two outliers with the lowest MMSE scores, higher DDT levels showed some modest association with lower MMSE (p=0.09 for linear trend). Conclusions Our data are limited by small sample size. However, dieldrin was high in our population, has been previously linked to PD, and could be partly responsible for the excess PD risk seen in our population. PMID:25173053

  6. Forearc sedimentation in Terraba Trough, Costa Rica, Central America

    SciTech Connect

    Yuan, P.B.; Lowe, D.R.


    Sedimentary rocks of Terraba Trough, Costa Rica, were deposited in a forearc basin developed at an ocean-ocean convergent boundary. The basin developed in the middle to late Eocene when the Farallon plate began its subduction beneath the Caribbean plate. Shallow-water carbonates of the Brito Formation were deposited on shoals of basement blocks. These were surrounded by deeper marine areas in which volcaniclastics and carbonate debris accumulated. The Brito Formation consists of algal-foraminiferal packstone to grainstone, rudstone, and rare wackestone formed in fore-slope, carbonate buildup, and open platform environments in a warm, tropical sea. The Eocene Brito Formation is overlain by rocks of the upper Oligocene Rio Claro Member of the Terraba Formation. It is composed of rhodolite and bioclastic grainstone deposited in shallow water. A combination of little subsidence, mild volcanism, and possible erosion at about 30 Ma during a global drop of sea level may be responsible for the absence of lower Oligocene rocks in the study area. After the deposition of the Rio Claro Member, the area subsided rapidly to become a trough possibly deeper than 2000 m. Sedimentation took place in deep water from sediment gravity flows. In the early to early middle Miocene, coarser sediments and thicker sand units containing coal fragments became more abundant, suggesting that the basin was gradually filled. This study indicates that the timing and degree of subsidence of the fore-arc basin and the vertical variation in lithology are closely related to the variation in convergence rate between lithospheric plates in this part of Central America and the eastern Pacific.

  7. Basic limnology of fifty-one lakes in Costa Rica.


    Haberyan, Kurt A; Horn, Sally P; Umaña, Gerardo


    We visited 51 lakes in Costa Rica as part of a broad-based survey to document their physical and chemical characteristics and how these relate to the mode of formation and geographical distribution of the lakes. The four oxbow lakes were low in elevation and tended to be turbid, high in conductivity and CO2, but low in dissolved O2; one of these, L. Gandoca, had a hypolimnion essentially composed of sea water. These were similar to the four wetland lakes, but the latter instead had low conductivities and pH, and turbidity was often due to tannins rather than suspended sediments. The thirteen artificial lakes formed a very heterogenous group, whose features varied depending on local factors. The thirteen lakes dammed by landslides, lava flows, or lahars occurred in areas with steep slopes, and were more likely to be stratified than most other types of lakes. The eight lakes that occupy volcanic craters tended to be deep, stratified, clear, and cool; two of these, L. Hule and L. Río Cuarto, appeared to be oligomictic (tending toward meromictic). The nine glacial lakes, all located above 3440 m elevation near Cerro Chirripó, were clear, cold, dilute, and are probably polymictic. Cluster analysis resulted in three significant groups of lakes. Cluster 1 included four calcium-rich lakes (average 48 mg l-1), Cluster 2 included fourteen lakes with more Si than Ca+2 and higher Cl- than the other clusters, and Cluster 3 included the remaining thirty-three lakes that were generally less concentrated. Each cluster included lakes of various origins located in different geographical regions; these data indicate that, apart from the high-altitude glacial lakes and lakes in the Miravalles area, similarity in lake chemistry is independent of lake distribution.

  8. Accumulation of atmospheric sulfur in some Costa Rican soils

    USGS Publications Warehouse

    Bern, Carleton R.; Townsend, Alan R.


    Sulfur is one of the macronutrient elements whose sources to terrestrial ecosystems should shift from dominance by rock-weathering to atmospheric deposition as soils and underlying substrate undergo progressive weathering and leaching. However, the nature and timing of this transition is not well known. We investigated sources of sulfur to tropical rain forests growing on basalt-derived soils in the Osa Peninsula region of Costa Rica. Sulfur sources were examined using stable isotope ratios (δ34S) and compared to chemical indices of soil development. The most weathered soils, and the forests they supported, are dominated by atmospheric sulfur, while a less weathered soil type contains both rock-derived and atmospheric sulfur. Patterns of increasing δ34S with increasing soil sulfur concentration across the landscape suggest atmospheric sulfur is accumulating, and little rock-derived sulfur has been retained. Soil sulfur, minus adsorbed sulfate, is correlated with carbon and nitrogen, implying that sulfur accumulation occurs as plants and microbes incorporate sulfur into organic matter. Only the lower depth increments of the more weathered soils contained significant adsorbed sulfate. The evidence suggests a pattern of soil development in which sulfur-bearing minerals in rock, such as sulfides, weather early relative to other minerals, and the released sulfate is leached away. Sulfur added via atmospheric deposition is retained as organic matter accumulates in the soil profile. Adsorbed sulfate accumulates later, driven by changes in soil chemistry and mineralogy. These aspects of sulfur behavior during pedogenesis in this environment may hasten the transition to dominance by atmospheric sources.

  9. Structural and Biochemical Basis for the Inhibitory Effect of Liprin-α3 on Mouse Diaphanous 1 (mDia1) Function*

    PubMed Central

    Brenig, Julian; de Boor, Susanne; Knyphausen, Philipp; Kuhlmann, Nora; Wroblowski, Sarah; Baldus, Linda; Scislowski, Lukas; Artz, Oliver; Trauschies, Philip; Baumann, Ulrich; Neundorf, Ines; Lammers, Michael


    Diaphanous-related formins are eukaryotic actin nucleation factors regulated by an autoinhibitory interaction between the N-terminal RhoGTPase-binding domain (mDiaN) and the C-terminal Diaphanous-autoregulatory domain (DAD). Although the activation of formins by Rho proteins is well characterized, its inactivation is only marginally understood. Recently, liprin-α3 was shown to interact with mDia1. Overexpression of liprin-α3 resulted in a reduction of the cellular actin filament content. The molecular mechanisms of how liprin-α3 exerts this effect and counteracts mDia1 activation by RhoA are unknown. Here, we functionally and structurally define a minimal liprin-α3 core region, sufficient to recapitulate the liprin-α3 determined mDia1-respective cellular functions. We show that liprin-α3 alters the interaction kinetics and thermodynamics of mDiaN with RhoA·GTP and DAD. RhoA displaces liprin-α3 allosterically, whereas DAD competes with liprin-α3 for a highly overlapping binding site on mDiaN. Liprin-α3 regulates actin polymerization by lowering the regulatory potency of RhoA and DAD on mDiaN. We present a model of a mechanistically unexplored and new aspect of mDiaN regulation by liprin-α3. PMID:25911102

  10. The RhoA effector mDia is induced during T cell activation and regulates actin polymerization and cell migration in T lymphocytes.


    Vicente-Manzanares, Miguel; Rey, Mercedes; Pérez-Martínez, Manuel; Yáñez-Mó, María; Sancho, David; Cabrero, José Román; Barreiro, Olga; de la Fuente, Hortensia; Itoh, Kazuyuki; Sánchez-Madrid, Francisco


    Regulation of actin polymerization is critical for many different functions of T lymphocytes, including cell migration. Here we show that the RhoA effector mDia is induced in vitro in activated PBL and is highly expressed in vivo in diseased tissue-infiltrating activated lymphocytes. mDia localizes at the leading edge of polarized T lymphoblasts in an area immediately posterior to the leading lamella, in which its effector protein profilin is also concentrated. Overexpression of an activated mutant of mDia results in an inhibition of both spontaneous and chemokine-directed T cell motility. mDia does not regulate the shape of the cell, which involves another RhoA effector, p160 Rho-coiled coil kinase, and is not involved in integrin-mediated cell adhesion. However, mDia activation blocked CD3- and PMA-mediated cell spreading. mDia activation increased polymerized actin levels, which resulted in the blockade of chemokine-induced actin polymerization by depletion of monomeric actin. Moreover, mDia was shown to regulate the function of the small GTPase Rac1 through the control of actin availability. Together, our data demonstrate that RhoA is involved in the control of the filamentous actin/monomeric actin balance through mDia, and that this balance is critical for T cell responses.

  11. Active Subduction on Both Coasts of Costa Rica Does not Represent an Important Tsunami Hazard

    NASA Astrophysics Data System (ADS)

    Protti, M.; Gonzalez, V.


    Costa Rica, on the southern terminus of the Middle American Trench is being affected by active subduction on both, along the Pacific coast as well as on its Caribbean coast. Three main subduction segments can be recognized along the Pacific coast: 1) under northwestern Costa Rica, off Papagayo Gulf and Nicoya peninsula, the Cocos plate is subducting under the Caribbean plate; 2) under southern Costa Rica (Osa and Burica peninsulas) the Cocos plate subducts under the Panama Block and 3) in the central Pacific coast (between Nicoya and Osa peninsulas) the Cocos plate subducts under a shear zone that marks the transition between the Caribbean and the Cocos plate. Along the Caribbean coast, south of Puerto Limon, the Caribbean plate subducts under the Panama block. Large subduction earthquakes occur under the Nicoya peninsula, Osa peninsula and south of Limon. Most of the rupture area of these large events lies below land so the deformation of the ocean floor is minimal and therefore the tsunamis they generate are small. No large subduction earthquakes occur under the central Pacific coast of Costa Rica due to the subduction of small sea mounts that act as small asperities without potential to accumulate large amounts of slip. For this reason the region between Nicoya and Osa peninsulas is not an important tsunamigenic zone.


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pectoral muscles from a captive keel-billed toucan (Ramphastos sulfuratus) from the Costa Rican were fed to a Toxoplasma gondii-free cat and the cat shed oocysts. Laboratory mice fed these oocysts developed antibodies to T. gondii in their sera and T. gondii tissue cysts in their brains. The DNA ext...

  13. Two new species of the Hagnagora anicata complex (Geometridae, Larentiinae) from Costa Rica.


    Sullivan, J Bolling


    Examination of the lectotype (here designated) reveals that Hagnagora anicata (Felder & Rogenhofer) does not occur in Costa Rica. Instead two new species are described, Hagnagora eliannesp. n. and Hagnagora unniasp. n., and their distribution is discussed. The previous treatment of Hagnagora anicata as a single widespread species ranging from Jamaica and Mexico to Bolivia needs to be critically evaluated.

  14. Situation Report--Bahamas, Bermuda, Bolivia, China, Costa Rica, Guadeloupe, Haiti, Hong Kong, Liberia, Mexico, Panama.

    ERIC Educational Resources Information Center

    International Planned Parenthood Federation, London (England).

    Data relating to population and family planning in 11 foreign countries are presented in these situation reports. Countries included are Bahamas, Bermuda, Boliva, China, Costa Rica, Guadeloupe, Haiti, Hong Kong, Liberia, Mexico, and Panama. Information is provided under two topics, general background and family planning situation, where…

  15. An Emerging Institution: The University for Peace in Costa Rica. Discussion Paper Series, No. 73.

    ERIC Educational Resources Information Center

    Laughlin, Margaret A.

    A new United Nations college, the University for Peace in Costa Rica, is discussed. After providing a brief historical sketch on peace efforts since the Ancient Greeks, the objectives of the United Nations University are identified. The University for Peace is a new international university that is part of the United Nations University network, a…

  16. Intelligent Behavior, Art Costa, and the Role of the Library Media Specialist.

    ERIC Educational Resources Information Center

    Shein, Dina


    Discusses Art Costa's 14 Intelligent Behavior Characteristics and gives examples of picture books that apply to each characteristic, including persistence, decreasing impulsivity, listening, cooperative thinking, flexibility, metacognition, accuracy and precision, sense of humor, questioning, using past knowledge, risk taking, using all senses,…

  17. Children's National Identity in Multicultural Classrooms in Costa Rica and the United States

    ERIC Educational Resources Information Center

    Solano-Campos, Ana


    The development of healthy national identifications in children and youth has important implications for the construction of democratic citizenries in culturally and linguistically diverse societies. In this comparative qualitative case study of two multicultural public schools-one in the United States and one in Costa Rica--I examined children's…

  18. Evaluation of the Third Year of Operation of the Contra Costa College Mobile Counseling Center.

    ERIC Educational Resources Information Center

    Edwards, Howard

    During 1971, the third year of operation of Contra Costa College's (California) mobile counseling unit, the priorities established for that program were (a) to make the mobile counseling unit and program as widely known in the community as possible, and (b) to concentrate on the services to the client. The counseling unit and program were…

  19. Evaluation of the Second Year of Operation of the Contra Costa Mobile Counseling Center.

    ERIC Educational Resources Information Center

    Gordon, Anthony T.

    Second year operations of this mobile center have validated many of the assumptions on which it was founded (see ED 031 243), including a reduction in the communications gap between Contra Costa College and the community at large. While attempts to compare this year's results with last year's can be considered premature, some findings may be of…

  20. West Contra Costa Unified School District Assessment and Improvement Plan: Facilities Management.

    ERIC Educational Resources Information Center


    This report analyzes the conditions of school facilities in Contra Costa Unified School District, California. The district had been prohibited from participating in the state's school facilities funding program because of a very heavy debt burden and near-bankruptcy of the district. The report begins by summarizing findings in the areas of…

  1. Evaluation of the First Year of Operation of the Contra Costa College Mobile Counseling Center.

    ERIC Educational Resources Information Center

    Gordon, Anthony T.

    Contra Costa College tried several ways to reach potential students who were unaware that they were eligible or even that the college had anything to offer them. Articulation with high schools, contacts with other agencies, and the mass media were of little help. The idea of a central, off-campus counseling center was abandoned in favor of the…

  2. A Further Review of the California State University's Contra Costa Center. Commission Report 89-9.

    ERIC Educational Resources Information Center

    California State Postsecondary Education Commission, Sacramento.

    A follow-up report on the California State University's Contra Costa Center, a proposed permanent off-campus center, is presented. The California Postsecondary Education Commission approved the original proposal in 1987, contingent on finding solutions to concerns about transportation access and services to disadvantaged students. The university…

  3. 75 FR 13301 - Los Vaqueros Reservoir Expansion, Contra Costa and Alameda Counties, CA

    Federal Register 2010, 2011, 2012, 2013, 2014


    .... This expansion option would be operated for environmental water management and San Francisco Bay Area water supply reliability. A 60 TAF expansion option would expand the reservoir to 160 TAF. This second... Environmental Policy Act Federal lead agency, and the Contra Costa Water District, as the...

  4. Environmental Education in Costa Rica: Building a Framework for Sustainable Development?

    ERIC Educational Resources Information Center

    Blum, Nicole


    Environmental education is commonly claimed to be at the centre of efforts to achieve sustainable development. Since the 1980s, Costa Rica has been one of the acknowledged leaders in efforts to promote environmental learning, and national policy includes a three-fold national development strategy which simultaneously promotes education,…

  5. A new species of Erythrodiplax breeding in bromeliads in Costa Rica (Odonata: Libellulidae).


    Haber, William A; Wagner, David L; De La Rosa, Carlos


    We describe a new species, Erythrodiplax laselva (Libellulidae), that breeds in bromeliads and Cochliostema (Commelinaceae) in the eastern lowlands of Costa Rica. The closest known relative is thought to be E. castanea, widespread in Central and South America, and not E. bromeliicola, which is known to breed in bromeliads in Cuba and Jamaica. The male, female, genitalia, and larva are described and illustrated.

  6. Management commitments and primary care: another lesson from Costa Rica for the world?


    Soors, Werner; De Paepe, Pierre; Unger, Jean-Pierre


    Maintained dedication to primary care has fostered a public health delivery system with exceptional outcomes in Costa Rica. For more than a decade, management commitments have been part of Costa Rican health reform. We assessed the effect of the Costa Rican management commitments on access and quality of care and on compliance with their intended objectives. We constructed seven hypotheses on opinions of primary care providers. Through a mixed qualitative and quantitative approach, we tested these hypotheses and interpreted the research findings. Management commitments consume an excessive proportion of consultation time, inflate recordkeeping, reduce comprehensiveness in primary care consultations, and induce a disproportionate consumption of hospital emergency services. Their formulation relies on norms in need of optimization, their control on unreliable sources. They also affect professionalism. In Costa Rica, management commitments negatively affect access and quality of care and pose a threat to the public service delivery system. The failures of this pay-for-performance-like initiative in an otherwise well-performing health system cast doubts on the appropriateness of pay-for-performance for health systems strengthening in less advanced environments.

  7. Dying with AIDS in Costa Rica. Access to care and treatment.


    Stern, R


    Costa Rica, with a population of 3 million people, has approximately 1200 cumulative diagnosed cases of AIDS. 70% of AIDS cases in the country have been among gay men. About 500 people with AIDS (PWA) are still alive and it is estimated that just as many people may be asymptomatic carriers of HIV. At the cost of $800-1000 per month per person, approximately 700,000 people, mostly in the US and Europe, are being treated with combination drug therapy capable of managing AIDS as a fairly curable chronic illness. However, most people in Costa Rica, where the per capita annual income is $2500, cannot afford to pay for such therapy. Arguing that the drugs are too expensive, the government has not approved any of the retroviral medications for general use in its socialized medical system which otherwise guarantees appropriate medical treatment to its citizens. The pharmaceutical companies which distribute the medications in Costa Rica, Roche and Bristol Meyers, refuse to provide patients with either free or significantly discounted drugs. The author discusses social discrimination against gay people in Costa Rica and describes attempts made to negotiate drug supplies for PWA with the government and pharmaceutical companies.

  8. Situation Reports--Ceylon, Costa Rica, Ghana, Haiti, Morocco, Sudan, Tunisia, and U.S.A.

    ERIC Educational Resources Information Center

    International Planned Parenthood Federation, London (England).

    Data relating to population and family planning in eight countries are presented in these situation reports. Countries included are Ceylon, Costa Rica, Ghana, Haiti, Morocco, Sudan, Tunisia, and the United States of America. Information is provided under two topics, general background and family planning situation, where appropriate and if it is…

  9. Insurance and other socioeconomic determinants of elderly longevity in a Costa Rican panel.


    Rosero-Bixby, Luis; Dow, William H; Laclé, Adriana


    Official figures show that life expectancy in Costa Rica is longer than in the United States (US), in spite of the fact that per capita health expenditure is only one-tenth that of the US. To check whether this is for real and to explore some of its determinants, 900 Costa Ricans aged 60+ were followed from 1984 to 2001. Follow-up household visits were made, deaths were tracked in the national death registry, and survival status in the voting registry was double-checked. In addition, the survivors were contacted in 2002. Two-thirds of the panel had died by December 2001. Kaplan-Meier curves, life tables and Cox regression were used to analyse the panel's survival. Mortality in the panel was slightly higher than the Costa Rican average and similar to that in the US, confirming the exceptional longevity of Costa Ricans. Survival was substantially lower among unmarried men and individuals with limited autonomy at the beginning of the study. The effect of socioeconomic status is weak. Insurance effects seem to be confounded by selection biases.

  10. Learning through Participatory Resource Management Programs: Case Studies from Costa Rica

    ERIC Educational Resources Information Center

    Sims, Laura; Sinclair, A. John


    Based on an ongoing qualitative case study in Costa Rica, this article presents the participatory work that the Instituto Costarricense de Electricidad (ICE) is doing with farmers to protect watersheds from erosion and contamination. Specifically, it includes a description of ICE's Watershed Management Agricultural Programme and how farmers…

  11. Longitudinal Relation of Community-Level Income Inequality and Mortality in Costa Rica

    PubMed Central

    Modrek, Sepideh; Ahern, Jennifer


    The controversy regarding the direct relationship between income distribution and health remains unresolved. Empirical evidence has often failed to advance our understanding because in the countries studied there was limited ability to distinguish hypotheses. This study examines the relation between inequality and mortality in the context of Costa Rica. Costa Rica’s unique social and political structure makes confounding through resource and political channels less likely, thus any effects would work predominantly through direct psychosocial channels. Using mortality data extracted from the Vital Statistics Registry, we evaluate the longitudinal relations between income inequality and cause-specific mortality in Costa Rica from 1989–2005. For those aged 15–60, results indicate that there is a significant adverse relation between increases in lagged inequality and mortality from liver disease, and marginal adverse relations with mortality from diabetes and suicide. For those aged 60 and over, there is a limited evidence of a relation between inequality and health. These results suggest increases in inequality may impact health behavior of the working aged population in Costa Rica. PMID:21873102

  12. Science Achievement of Costa Rican Sixth Grade Students and Its Relationship with Selected Variables.

    ERIC Educational Resources Information Center

    Esquivel-Alfaro, Juan Manuel; Diaz-Solis, Sofia Maria

    This study had three purposes. First, to develop and validate a criterion-referenced test to measure science knowledge of students who finished the second cycle of the Basic General Education (6th grade). Second, to assess the performance of the entire Costa Rican population of sixth graders and, third, to analyze the results according to some…

  13. First North American record of the Palearctic Microplax albofasciata (Costa) (Hemiptera: Lygaeoidea: Oxycarenidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Microplax albofasciata (Costa), a Palearctic (mainly Mediterranean) species of the small family Oxycarenidae, is reported from California as the first record for the New World. Adults of this little-known lygaeoid bug were found in 2012 and 2013 at the Hastings Natural History Reservation in norther...

  14. The Power To Change: The Experience of the Costa Atlantica Project in Colombia (1977-1989).

    ERIC Educational Resources Information Center

    Chetley, Andrew

    In 1977, the Bernard van Leer Foundation began supporting a project in Colombia that had the objective of improving the quality of early childhood care and education in a small village. The Costa Atlantica project offered an approach to development that was based on community organization, social management, participation, cooperation, popular…

  15. First Report of Tomato Chlorosis Virus in Tomato in Costa Rica

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. The symptoms resembled those of the genus Crinivirus (family Closteroviridae) and large populations of whiteflies were observed in the fields and...

  16. Afro-Mestizo Speech from Costa Chica, Guerrero: From Cuaji to Cuijla.

    ERIC Educational Resources Information Center

    Althoff, Daniel


    Traces the history of Africans in Mexico and the Costa Chica and compares elements of the regional speech as described in a 1958 study with data collected on-site in 1991-1992. Findings indicate that the successful introduction of public education coupled with the ubiquity of the mass media have reduced or eliminated the more distinctively…

  17. An Analysis of Retention and Attrition at MiraCosta College.

    ERIC Educational Resources Information Center

    Baker, Ronald

    A study was conducted at MiraCosta College (MCC), in Del Mar, California, to investigate various aspects of retention and attrition and to make recommendations for possible program enhancements. The study sought to determine when students drop out of classes, which students drop out of school completely, and the drop out rate for various…

  18. Hunger in the Midst of Affluence: Task Force Combats Hunger in Contra Costa County.

    ERIC Educational Resources Information Center

    Fujii, Mary Lavender


    Research conducted by the Hunger Task Force in Contra Costa County (California) revealed a significant increase in the number of families, especially with young children, who live in poverty and who are going hungry. A food stamp outreach program, a countywide school breakfast program, and food distribution programs have been initiated. (LP)

  19. First report of Tomato chlorosis virus infecting sweet pepper in Costa Rica

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In September 2008, a survey of whiteflies and whitefly-borne viruses was performed in greenhouses in the province of Cartago, Costa Rica. During this survey, sweet pepper (Capsicum annuum cv. Nataly) plants showing interveinal chlorosis, enations, necrosis, and mild upward leaf curling were observed...

  20. A Historical Analysis of the Educational Modalities of Inequalities Management in Costa Rica, Cuba and Guatemala

    ERIC Educational Resources Information Center

    Mulot, Eric


    This article provides a historical and comparative study of the role that management of inequalities has played in the formation and evolution of educational institutions in three countries: Costa Rica, Cuba and Guatemala. This particular focus shows that this function has played a determining role, even if its organization has varied deeply in…

  1. Learning Disabilities in Costa Rica: Challenges for an "Army of Teachers."

    ERIC Educational Resources Information Center

    Stough, Laura M.; Aguirre-Roy, Ana Ruth


    Describes the history and evolution of special education services in Costa Rica, along with critical issues that impede the expansion of educational services to students with learning disabilities. These include shortages of trained personnel, geographic isolation of a large sector of the population, and severe economic limitations. (Author/CR)

  2. An Information Guide to Rehabilitation and Special Education in Costa Rica.

    ERIC Educational Resources Information Center

    de Mezerville, Gaston; Monge, Gerardo

    The report on rehabilitation and special education in Costa Rica covers the history of special services, with emphasis on medical, educational, and vocational efforts. Future priorities for each field are noted. A second section discusses the institutions that are the main national organizational forces in rehabiliation and special education, as…

  3. A food plant specialist in Sparganothini? A new genus and species from Costa Rica (Lepidoptera: Tortricidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sparganocosma docsturnerorum Brown, new genus and new species, is described and illustrated from Area de Conservación (ACG) in northwestern Costa Rica. The new genus shares a long, crescent- or ribbon-shaped signum in the corpus bursae of the female genitalia with Aesiocopa Zeller, 1877, Amorbia Cle...

  4. First report of Orange Rust of Sugarcane Caused by Puccinia kuehnii in Costa Rica and Nicaragua

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Symptoms of orange rust of sugarcane were observed in Costa Rica at Coopeagri Sugar Mill located in Pérez Zeledón, San José, during July 2007 on (a complex hybrid of Saccharum L. species) cultivar, SP 71-5574, and at Providencia Sugar Mill near Muelle and at Cutris Sugar Mill near Los Chiles, in Aug...

  5. 75 FR 3179 - Defense Federal Acquisition Regulation Supplement; Trade Agreements-Costa Rica and Peru (DFARS...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Regulation Supplement; Trade Agreements--Costa Rica and Peru (DFARS Case 2008-D046) AGENCY: Defense... States-Peru Trade Promotion Agreement. The trade agreements waive the applicability of the Buy American... United States-Peru Trade Promotion Agreement. The trade agreements waive the applicability of the...

  6. Music Education for Social Change in the Secondary Public Schools of Costa Rica

    ERIC Educational Resources Information Center

    Rosabal-Coto, Guillermo


    This article focuses on a recently implemented general music curriculum in secondary public schools, whose main goal is to address social issues in Costa Rica. The author describes and discusses its context, rationale, theoretical tenets, and proposed practices with the purpose of advancing theory-practice reflection on music education practices…

  7. Sediment transport and deposition, Walnut and Pacheco Creeks, Contra Costa County, California, August 1965-April 1970

    USGS Publications Warehouse

    Porterfield, George


    Average annual sediment discharge in Pacheco Creek basin, Contra Costa County, Calif., was larger during August 1965-April 1970 than the historical annual sediment discharge (1909-62) by a factor of about 1.3. This increas in sediment discharge is attributed primarily to an increased frequency of peak streamflows and to a larger average annual streamflow during the 1965-70 period.

  8. Computer Assisted English Language Learning in Costa Rican Elementary Schools: An Experimental Study

    ERIC Educational Resources Information Center

    Alvarez-Marinelli, Horacio; Blanco, Marta; Lara-Alecio, Rafael; Irby, Beverly J.; Tong, Fuhui; Stanley, Katherine; Fan, Yinan


    This study presents first-year findings of a 25-week longitudinal project derived from a two-year longitudinal randomized trial study at the elementary school level in Costa Rica on effective computer-assisted language learning (CALL) approaches in an English as a foreign language (EFL) setting. A pre-test-post-test experimental group design was…

  9. Diary of an Edu-Tourist in Costa Rica: An Autoethnographical Account of Learning Spanish

    ERIC Educational Resources Information Center

    Lotherington, Heather


    This article presents an autoethnographical account of my foray into Spanish immersion education in Costa Rica as a professor of multilingual education at a university in Canada. This language-learning journey was inspired by curiosity about the growing trend for Internet marketing of second-language learning as a form of tourism, which I label…

  10. Mites (Arachnida: Acari) inhabiting coffee domatia: a short review and recent findings from Costa Rica.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Six previously unreported domatia-inhabiting mites are reported from Coffea arabica accessions planted in Costa Rica. One of these is a new species of Asca found to be carrying fungal spores on its cuticle. A review of the literature on mites in coffee domatia is presented....

  11. Evaluating bee (Hymenoptera: Apoidea) diversity using malaise traps in coffee landscapes of Costa Rica

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Even though Arabica coffee (Coffea arabica Linnaeus, Rubiaceae) can self-pollinate, bees are important pollinators, without which there is lower fruit quality and yield. We studied bee diversity in coffee agroecosystems in Costa Rica during two coffee flowering seasons (2005 and 2006). Malaise traps...


    EPA Science Inventory

    Twenty common plant species were screened for emissions of biogenic volatile organic compounds (BVOCS) at a lowland tropical wet forest site in Costa Rica. Ten of the species. examined emitted substantial quantities of isoprene. These species accounted for 35-50% of the total bas...

  13. Influenza-associated Hospitalizations and Deaths, Costa Rica, 2009–2012

    PubMed Central

    Saborío, Guiselle Guzman; Clara, Alexey; Garcia, Antonio; Quesada, Fabio; Palekar, Rakhee; Minaya, Percy; Cervantes, Marvin; Lopez, Mariel; Lara, Jenny; Jara, Jorge; Blanco, Natalia; Bresee, Joseph; Widdowson, Marc-Alain; Azziz-Baumgartner, Eduardo


    Data needed to guide influenza vaccine policies are lacking in tropical countries. We multiplied the number of severe acute respiratory infections by the proportion testing positive for influenza. There were ≈6,699 influenza hospitalizations and 803 deaths in Costa Rica during 2009–2012, supporting continuation of a national influenza vaccine program. PMID:24750897

  14. Handling and aflatoxin contamination of white maize in Costa Rica.


    Mora, M; Lacey, J


    Projects funded by International Development Research Centre (IDRC) of Canada and the European Commission have enabled the examination of more than 3000 samples of maize collected from all regions of Costa Rica at different stages, from the growing crop through storage to final sale, and at different water contents. Contamination with Aspergillus flavus was frequent and about 80% of samples contained more than 20 ng aflatoxins g(-1) grain. Average contamination with aflatoxins in the Brunca Region was > 274 ng g(-1) while that in other regions was < 70 ng g(-1). Except in Brunca region, where it averaged 376 ng g(-1), contamination of grain from commercial sources was slightly less than of that from farms (< or = 15 ng g(-1)). It appeared that samples kept on the cob after harvest contained almost no aflatoxin while shelled samples were frequently highly contaminated. Experiments were therefore done in Brunca and Huetar Atlantic Regions, utilising 34 experimental maize crops to study in detail the development of A. flavus and aflatoxin from before harvest, through postharvest treatment before drying and through storage for six months. A. flavus was isolated more frequently from maize shelled immediately after harvest than from that kept on the cob until it could be dried, and from more samples from the Brunca Region than from the Huetar Atlantic Region. Samples harvested with > or = 18% water content often contains > 70% of grains infected with A. flavus but sometimes there were few grains infected. As found in the initial survey, more aflatoxin contamination developed in shelled maize than in that handled on the cob during the period from harvesting to drying, especially if the delay was more than 5 days, and more in Brunca than in Huetar. Shelled grain contained 400-800 ng aflatoxin g(-1) in Brunca but < 100 ng g(-1) in Huetar while grain kept on the cob contained < 30 ng g(-1), even with > 18% water content. Incidence of Fusarium spp. exceeded 50% except where A

  15. The modeling of daily precipitation in Costa Rica

    NASA Astrophysics Data System (ADS)

    Harrison, John Michael

    The understanding of precipitation and its underlying processes is important to many human activities. Agricultural planning, hydroelectric resource management, and industrial infrastructure development all rely heavily on being able to make reasonable predictions concerning rainfall. The lack of sufficient rainfall can have devastating social and economic consequences for developing nations that are reliant on subsistence agriculture and hydroelectric power. This study examines the means by which daily precipitation in Costa Rica can be modeled, and how the El Nino-Southern Oscillation (ENSO) affects the precipitation generating mechanisms. A selection of three meteorological stations are used to test how daily rainfall can be characterized by the occurrence and intensity of the individual rainfall events. The occurrence is modeled using a two-state first-order Markov model, which provides insight into the relative length of wet and dry spells. The intensity model uses L-moments to determine the optimum statistical distribution. These statistical parameters are used to understand the inter-annual and inter-seasonal variations in the precipitation-generating mechanisms as they are modified by the ENSO phenomenon. The parameters are also combined to create monthly rainfall simulations based on the state of the ENSO, as well as test whether accurate forecasts can be created up to one year in advance. It is found that the ENSO plays an important role in the daily rainfall process, by altering the behavior of the Inter-Tropical Convergence Zone (ITCZ), the Northeast Trade Winds, and the advance of cold air masses from North America during the winter. The eastern Caribbean slope of the country receives proportionally more rainfall during El Nino events, while the western Pacific slope receives less rainfall during the same period. Cold front (norte) intrusion is minimized by the El Nino, resulting in less winter rainfall during El Nino years. Simulations based on the

  16. Seismogenic zone structure along the Middle America subduction zone, Costa Rica

    NASA Astrophysics Data System (ADS)

    Deshon, Heather Rene

    Most large (MW > 7.0) underthrusting earthquakes nucleate along a shallow region of unstable frictional stability on or near the subducting plate interface termed the seismogenic zone. The studies presented here investigate along-strike spatial and temporal variability in microseismicity and seismic velocity and provide spatial constraints on the updip and downdip limits of microseismicity within the Middle America subduction offshore western Costa Rica. All chapters utilize data recorded by the Costa Rica Seismogenic Zone Experiment (CRSEIZE), a collaborative seismic and geodetic study undertaken from September 1999--June 2001 to better understand subduction zone behavior near the Osa and Nicoya Peninsulas, Costa Rica. Chapter 1 serves as a broad introduction to the thesis while Chapter 2 provides an overview of Costa Rica seismicity, the CRSEIZE experiment setup, data processing, and data quality. Chapter 3 discusses simultaneous inversion for 1D P- and S-wave velocity models, station corrections, and hypocenter parameters for both the Nicoya and Osa experiments and presents a refined location for the continental Moho in northern Costa Rica. Chapter 4 presents absolute and relative relocations of ˜300 aftershocks of the 1999 Quepos, Costa Rica, underthrusting earthquake and analyzes seismogenic zone structure offshore central Costa Rica during a period of increased seismicity rate. Subduction of highly disrupted seafloor north of the Osa Peninsula has established a set of conditions that presently limit the seismogenic zone to be between 10--35 km below sea level, 30--95 km from the trench axis. Chapter 5 presents high resolution earthquake locations and P-wave and P-wave/S-wave 3D velocity models for the locked Nicoya Peninsula segment of the Middle America subduction zone calculated using an iterative, damped least squares local tomography method. In the southern Nicoya Peninsula, microseismicity along the plate interface extends from 12--26 km depth, 73

  17. The Role of Water in Arc Magmatism in Nicaragua and Costa Rica.

    NASA Astrophysics Data System (ADS)

    Sadofsky, S. J.; Hoernle, K.; van den Bogaard, P.


    The Central American Volcanic Arc provides an excellent opportunity to study the effect of varying subduction parameters on arc magma geochemistry. Here we examine melt inclusions trapped in olivine phenocrysts in young mafic tephras from the active arc segments in Nicaragua and Costa Rica. These segments of the subduction zone provide starkly contrasting situations with differing oceanic crustal input (East Pacific Rise vs. oceanic crust overprinted by the Galapagos hot spot) and slab dip ( ˜70° vs. ˜30° ) in Nicaragua and Costa Rica respectively. We collected major-, trace-, and volatile-element concentration data from olivine-hosted (Fo68-87) melt inclusions from volcanoes Cerro Negro, Nejapa, Masaya, and Mombacho along the volcanic front in central Nicaragua and Irazu and Arenal in Costa Rica. In Nicaragua H2O shows a general increase with decreasing Fo of the host olivine, reflecting incompatible behavior during differentiation from 1-3 wt. % in samples from Fo>85 to ˜ 5% in some of the slightly more evolved, yet still relatively undegassed, samples. This is best illustrated by samples from Mombacho and Cerro Negro. Comparison of the major element data with experimental melting studies indicates that the Nicaraguan melts with higher FeO and lower SiO2 (at similar MgO contents) could have formed at greater depths and temperatures in the presence of less water than the Costa Rican melts with higher SiO2 and lower FeO. The most primitive samples from Irazu (host olivine Fo84-89) are extremely rich in H2O (3-5 wt. %). H2O enrichment correlates with enrichment of some LILE, LREE (i.e., Ba, La, K), relative to HFSE for most samples from the Nicaraguan volcanoes. S/Nb and Cl/Nb also show some correlation with H2O/Nb in Nicaraguan samples, with some exceptions possibly related to volatile loss is the less primitive samples. These correlations are generally not present in the Costa Rican samples, thus suggesting that despite apparent larger initial water contents

  18. The Diaphanous-related formin dDia1 is required for highly directional phototaxis and formation of properly sized fruiting bodies in Dictyostelium.


    Winterhoff, Moritz; Junemann, Alexander; Nordholz, Benjamin; Linkner, Jörn; Schleicher, Michael; Faix, Jan


    Diaphanous-related formins (DRFs) act as downstream effectors of Rho family GTPases and drive the formation and elongation of linear actin filaments in various cellular processes. Here we analyzed the DRF dDia1 from Dictyostelium cells. The biochemical characterization of recombinant dDia1-FH1FH2 by bulk polymerization assays and single filament TIRF microscopy revealed that dDia1 is a rather weak nucleator. Addition of any of the three Dictyostelium profilin isoforms, however, markedly accelerated formin-mediated actin filament barbed end elongation in TIRF assays. Interestingly, filament elongation was significantly faster in presence of DdPFN I (profilin I) when compared to the other two isoforms, suggesting selectivity of dDia1 for DdPFN I. Additionally, we frequently observed dissociation of the formin from growing barbed ends. These findings are consistent with dilution-induced depolymerization assays in presence of dDia1-FH1FH2 showing that dDia1 is a weak capper in comparison with heterodimeric capping protein. To study the physiological role of this formin, we created cell lines lacking dDia1 or overexpressing GFP-tagged dDia1. Of note, constitutively active dDia1 accumulated homogenously in the entire pseudopod suggesting that it controls microfilament architecture to regulate cell migration. Comparison of wild type and dDia1-null cells in random cell migration and chemotaxis toward a cAMP gradient revealed no major differences. By contrast, phototaxis of dDia1-deficient cells during the multicellular stage was markedly impaired. While wild type slugs moved with high directionality toward the light source, the trails of dDia1-null slugs displayed a characteristic V-shaped profile and deviated in angles between 50° and 60° from the path of the incident light. Possibly in conjunction with this defect, dDia1-null cells also formed substantially smaller fruiting bodies. These findings demonstrate dDia1 to be critically involved in collective cell migration

  19. Transcriptional Switch of the dia1 and impA Promoter during the Growth/Differentiation Transition

    PubMed Central

    Hirose, Shigenori; Mayanagi, Taira; Pears, Catherine; Amagai, Aiko; Loomis, William F.; Maeda, Yasuo


    When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition. PMID:16087752

  20. Development of an 8-ft-dia ribbon parachute for recovery of a test device at transonic speeds

    SciTech Connect

    Pepper, W.B.


    A lightweight hybrid Kevlar-29/nylon 8-ft-dia ribbon parachute has been designed and developed for recovery of a cluster of three Zuni rockets with a spin-up canister weighing 266 lb at deployment. The parachute is reefed for two seconds by a 9-ft-long reefing line to limit the peak loads. Successful recoveries have been achieved from 700-1300 ft/sec deployment velocities.

  1. Distinct roles for the actin nucleators Arp2/3 and hDia1 during NK-mediated cytotoxicity

    PubMed Central

    Butler, Boyd; Cooper, John A.


    Background Several actin nucleators, including Arp2/3 and various formins, control numerous cytoskeletal-based functions in vivo. Results We investigated the relative roles of these nucleators. As a model system, we used natural killer (NK) lymphocytes, which display a wide range of cytoskeletal-based functions that culminate in the lysis of target cells. NK cells lacking either Arp2/3 or the formin hDia1 were ineffective in target cell lysis, but for distinct reasons. Loss of Arp2/3 function led to defects in cells adhesion and actin assembly at the junction with the target cell (the lytic synapse). In contrast, loss of hDia1 did not disrupt actin assembly at the lytic synapse. Instead, loss of hDia1 led to perturbations in the microtubule cytoskeleton, including the targeting of microtubules to the lytic synapse. Conclusions These studies reveal novel distinctions and relationships among the functions of Arp2/3, formins and microtubules in cells. Notably, a formin mediates the capture of microtubules at the cell periphery. PMID:19913427

  2. Educational Gradients in Psychotropic Medication Use Among Older Adults in Costa Rica and the United States†

    PubMed Central

    Domino, Marisa E.; Dow, William H.; Coto-Yglesias, Fernando


    Objective The relationship among education, psychiatric diagnoses and psychotropic medication use has been explored in the United States, but little is known about patterns in poorer countries, despite their high documented burden of mental illness. Educational gradients in diagnosis and psychotropic use were estimated in the United States and Costa Rica – a middle-income country with universal health insurance. Methods Analyses were conducted using data on older adults (ages 60+) in nationally representative surveys from each country: the 2005 U.S. Medical Expenditures Panel Survey (n=4788) and the 2005 Costa Rican Longevity and Healthy Aging Study (n=2827). Logistic regressions examined the effect of lower educational attainment, income and urban residence on diagnosis and on psychotropic medication use with and without an associated mental illness diagnosis. Results Rates of self-reported diagnoses were lower in the U.S. (12% U.S.; n=598) than in, Costa Rica (20%; n=526), but may reflect differences in survey wording. Measures of self-reported and screened depression decreased with education in both countries. Psychotropic medication use among those with diagnoses increased with education in Costa Rica only. Conclusions We find similar patterns of educational gradients in diagnosis and screening between the U.S. and Costa Rica, but different patterns of medication use by education. Differences in stigma and access to care may play an important role in explaining differences between the countries, though we did not find evidence that insurance affected educational gradients in the U.S. These analyses increase the evidence on the role of education in the use of the health care system. PMID:24932755

  3. The Tobosi Fault: Source of the 2011-2012 Tobosi Earthquake Swarm in Central Costa Rica.

    NASA Astrophysics Data System (ADS)

    Araya, M. C.; Linkimer, L.; Montero Pohly, W. K.; Rojas, W.


    The Central Costa Rica Deformed Belt (CCRDB) is a ~100 km broad zone of deformation that marks the boundary between the Caribbean Plate and the Panama Microplate. From December 2011 to February 2012 an earthquake swarm took place on a portion of the CCRDB, near the town of Tobosi, in the Cartago province. In this study, we use data recorded by the National Seismological Network of Costa Rica (RSN: UCR-ICE) to relocate 22 of these earthquakes and calculate focal mechanisms. Additionally, we analyze the Tectonic Geomorphology of the region. Our results show a transtension structure near the town of Tobosi, which comprises at least three faults, named: the Tobosi, Tablon, and Alumbre faults. This structure is located only 5 km south of the Aguacaliente fault, which caused the deadliest earthquake in Costa Rican history on May 4, 1910 (Ms 6.4). The earthquake locations analyzed are aligned with the Tobosi Fault. The events varied in moment magnitude between 2.4 and 3.9 Mw and depths of 1 and 8 km. The largest events were felt mainly in the town of Tobosi and as far as San Jose, the capital city of Costa Rica. We found that the Tobosi fault is an active left-lateral strike-slip fault with a normal component and is the source of the Tobosi earthquake swarm. The study of active faults in Central Costa Rica is significant as it may greatly improve seismic hazards assessment for this region where most of the population and the main economic activities are concentrated.

  4. Effectiveness of Protected Areas for Representing Species and Populations of Terrestrial Mammals in Costa Rica

    PubMed Central

    González-Maya, José F.; Víquez-R, Luis R.; Belant, Jerrold L.; Ceballos, Gerardo


    Costa Rica has one of the greatest percentages (26%) of protected land in the world. The National Protected Areas System (NPAS) of Costa Rica was established in 1976 and currently includes >190 protected areas within seven different protection categories. The effectiveness of the NPAS to represent species, populations, and areas with high species richness has not been properly evaluated. Such evaluations are fundamental to understand what is necessary to strengthen the NPAS and better protect biodiversity. We present a novel assessment of NPAS effectiveness in protecting mammal species. We compiled the geographical ranges of all terrestrial Costa Rican mammals then determined species lists for all protected areas and the estimated proportion of each species’ geographic range protected. We also classified mammal species according to their conservation status using the IUCN Red List of Threatened Species. We found almost complete representation of mammal species (98.5%) in protected areas, but low relative coverage (28.3% on average) of their geographic ranges in Costa Rica and 25% of the species were classified as underprotected according to a priori representation targets. Interestingly, many species-rich areas are not protected, and at least 43% of cells covering the entire country are not included in protected areas. Though protected areas in Costa Rica represent species richness well, strategic planning for future protected areas to improve species complementarity and range protection is necessary. Our results can help to define sites where new protected areas can have a greater impact on mammal conservation, both in terms of species richness and range protection. PMID:25970293

  5. Enhancing Outreach using Social Networks at the National Seismological Network of Costa Rica

    NASA Astrophysics Data System (ADS)

    Linkimer, L.; Lücke, O. H.


    Costa Rica has a very high seismicity rate and geological processes are part of everyday life. Traditionally, information about these processes has been provided by conventional mass media (television and radio). However, due to the new trends in information flow a new approach towards Science Education is necessary for transmitting knowledge from scientific research for the general public in Costa Rica. Since 1973, the National Seismological Network of Costa Rica (RSN: UCR-ICE) studies the seismicity and volcanic activity in the country. In this study, we describe the different channels to report earthquake information that the RSN is currently using: email, social networks, and a website, as well as the development of a smartphone application. Since the RSN started actively participating in Social Networks, an increase in awareness in the general public has been noticed particularly regarding felt earthquakes. Based on this trend, we have focused on enhancing public outreach through Social Media. We analyze the demographics and geographic distribution of the RSN Facebook Page, the growth of followers, and the significance of their feedback for reporting intensity data. We observe that certain regions of the country have more Facebook activity, although those regions are not the most populated nor have a high Internet connectivity index. We interpret this pattern as the result of a higher awareness to geological hazards in those specific areas. We noticed that the growth of RSN users on Facebook has a strong correlation with the seismic events as opposed to Twitter that displays a steady growth with no clear correlations with specific seismic events. We see the Social Networks as opportunities to engage non-science audiences and encourage the population to participate in reporting seismic observations, thus providing intensity data. With the increasing access to Internet from mobile phones in Costa Rica, we see this approach to science education as an opportunity

  6. Impact of Deforestation on Cloud Properties and Rainfall Over the Costa Rica-Nicaraguan region

    NASA Astrophysics Data System (ADS)

    Ray, D. K.; Nair, U. S.; Welch, R. M.; Lawton, R. O.


    The Nicaraguan-Costa Rican region in Central America exhibits the typical pattern of complex deforestation now seen throughout the tropics. The region is a mixture of lowland, mostly converted to agriculture, and mountainous regions, where pristine forests still persist. At present the northern fertile plains of Costa Rica are mostly utilized for agriculture. However in the adjacent regions of southern Nicaragua lowland forests are relatively intact. The extensive agricultural areas of northern Costa Rica is a region of discontinuity in the proposed Mesoamerican Biological Corridor which would connect the montane forests in Costa Rica to the lowland forests in Nicaragua. The present study is part of a larger study which investigates the effects of continuing lowland deforestation and associated regional climate change in Central America on the stability of the entire proposed Mesoamerican Biological Corridor. The present work focuses on the effects of land use on the formation of cloudiness, cloud properties and rainfall in the forested regions of southern Nicaragua and the deforested regions of northern Costa Rica. Land surface and cloud properties are retrieved using the Moderate Resolution Imaging Spectroradiometer (MODIS) and the Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER) satellite data and products. The land surface properties retrieved are land surface temperature, albedo, Normalized Difference Vegetation Index (NDVI), Available Soil Moisture fraction and surface energy fluxes. The cloud properties retrieved are cloud optical thickness and effective radii. In addition, the frequency of cumulus cloudiness on hourly basis are derived from the Geostationary Operational Environmental Satellite (GOES) and rainfall is studied using Tropical Rainfall Measuring Mission (TRMM) satellite products. The correlations between the surface properties, cloud properties, cumulus cloudiness and rainfall as a function of ecosystem and topography is

  7. Differentials by socioeconomic status and institutional characteristics in preventive service utilization by older persons in Costa Rica.


    Brenes-Camacho, Gilbert; Rosero-Bixby, Luis


    Objective.The goals of this article are to assess the level of preventive service utilization by older persons in Costa Rica and to determine whether there are differentials in utilization across socioeconomic status (SES) and institutional characteristics. Method. Using data from the Costa Rican Study on Longevity and Healthy Aging (CRELES) project, a study of healthy aging in Costa Rica, the authors use self-reported information on preventive service utilization. The SES differentials are studied using logistic regressions. Results. Preventive services linked to cardiovascular disease prevention are frequently utilized; preventive services linked to cancer screening, vaccination, and sense impairments are not so widely used. Higher SES people are more likely to utilize most preventive services. Utilization rates among uninsured seniors are lower than among their insured peers. Home visits by community health workers are positively associated with higher utilization rates. Discussion. The SES disparities in preventive service utilization exist in Costa Rica, and institutional characteristics are positively associated with increasing utilization.

  8. Hyperparasitoid wasps (Hymenoptera: Trigonalidae) reared from dry forest and rain forest caterpillars of Area de Conservacion, Guanacaste, Costa Rica

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Five species of Trigonalidae, hyperparasites of Ichneumonidae (Hymenoptera) and Tachinidae (Diptera) that parasitize caterpillars (Lepidoptera), have been reared during the ongoing caterpillar inventory of Area de Conservación Guanacaste (ACG), Guanacaste Province, northwestern Costa Rica: Lycogaste...

  9. Morphotectonic segmentation along the Nicoya Peninsula seismic gap, Costa Rica

    NASA Astrophysics Data System (ADS)

    Marshall, J.; Morrish, S.; Butcher, A.; Ritzinger, B.; Wellington, K.; Lafromboise, E.; Protti, M.; Gardner, T.; Spotila, J.


    The Nicoya Peninsula, Costa Rica forms a prominent morphologic high along the outer forearc of the erosive southern Middle America convergent margin. This emergent coastal landmass overlies the seismogenic zone and occupies a seismic gap that last ruptured in 1950 with a M7.7 megathrust earthquake. The edges of both the Nicoya seismic gap and the peninsula’s abrupt shorelines correspond with the aftershock limits of the more recent 1992 M7.2 Nicaragua tsunami earthquake to the north, and the 1990 M7.0 Cobano seamount rupture to the south. The coincidence of emergent topography and recent earthquake rupture zones suggests persistence of the Nicoya segment through multiple seismic cycles. Along the Nicoya Peninsula's seaward-facing coastline, net Quaternary uplift is recorded by emergent strandlines, marine terraces, and incised valley-fill alluvium. Ongoing field mapping, surveying, and isotopic dating reveal uplift variations along the Nicoya segment that coincide with three contrasting domains of subducting seafloor offshore (EPR, CNS-1, CNS-2). Uplift rates vary between 0.1-0.2 m/k.y. inboard of older EPR crust along the northern Nicoya coast; 0.2-0.3 m/k.y. inboard of younger CNS-1 crust along the southern Nicoya coast; and 1.0-2.0 m/k.y. inboard of CNS-2 seamounts impacting the peninsula’s southern tip. These results are consistent with geophysical observations that indicate finer scale segmentation of the Nicoya seismogenic zone related to along-strike changes in the characteristics of the subducting plate. Variable upper-plate uplift along the Nicoya segment may reflect differences in subducting-plate roughness, thermal structure, fluid flow, and seismogenic-zone locking (up-dip/down-dip limits). Based on the rapid convergence rate (9 cm/yr) and the frequency of historic seismicity, the recurrence interval for large Nicoya earthquakes is estimated at ~50 years. The most recent event, in 1950, generated >1m of coseismic uplift along the central Nicoya

  10. Tracking performance of the polarity-type costas loop at low SNR for UQPSK signal. [Unbalanced Quadri-PSK

    NASA Technical Reports Server (NTRS)

    Park, Y. H.


    Carrier tracking performance of the polarity type costas loop is analyzed for unbalanced quadriphase-shift-keyed (UQPSK) signals at low SNR. Squaring losses for various SNR, IF bandwidth, and data rate ratios are presented. The RMS phase jitter for a particular loop is computed for various I and Q channel power and data rate ratios. Experimental results using a breadboard costas loop are also included.

  11. Ambient Tremor, But No Triggered Tremor at the Northern Costa Rica Subduction Zone

    NASA Astrophysics Data System (ADS)

    Swiecki, Z.; Schwartz, S. Y.


    Non-volcanic tremor (NVT) has been found to be triggered during the passage of surface waves from various teleseismic events in locations around the world including Cascadia, Southwest Japan, Taiwan, and California. In this study we examine the northern Costa Rica subduction zone for evidence of triggered tremor. The Nicoya Peninsula segment of the northern Costa Rica margin experiences both slow-slip and tremor and is thus a prime candidate for triggered tremor observations. Eleven teleseismic events with magnitudes (Mw) greater than 8 occurring between 2006 and 2010 were examined using data from both broadband and short period sensors deployed on the Nicoya Peninsula, Costa Rica. Waveforms from several large regional events were also considered. The largest teleseismic and regional events (27 February 2010 Chile, Mw 8.8 and 28 May 2009 Honduras, Mw 7.3) induced peak ground velocities (PGV) at the NIcoya stations of ~2 and 6 mm/s, respectively; larger than PGVs in other locations that have triggered tremor. Many of the earthquakes examined occurred during small episodes of background ambient tremor. In spite of this, no triggered tremor was observed during the passage of seismic waves from any event. This is significant because other studies have demonstrated that NVT is not triggered everywhere by all events above some threshold magnitude, indicating that unique conditions are required for its occurrence. The lack of triggered tremor at the Costa Rica margin can help to better quantify the requisite conditions and triggering mechanisms. An inherent difference between the Costa Rica margin and the other subduction zones where triggered tremor exists is its erosional rather than accretionary nature. Its relatively low sediment supply likely results in a drier, lower pore fluid pressure, stronger and less compliant thrust interface that is less receptive to triggering tremor from external stresses generated by teleseismic or strong local earthquakes. Another

  12. Exploring the Notion That Subduction Erosion Has Removed or Submerged Costa Rica's Early Tertiary Arc Massifs

    NASA Astrophysics Data System (ADS)

    Scholl, D. W.


    Arc igneous rocks of Paleocene, Eocene, and Oligocene age are widely exposed in the southern, coastal region of Panama (Lissinna et al., EGU abstract, 2006). These rocks intrude or overlie mafic basement rock of the Caribbean Large Igneous Province (CLIP) of Late Cretaceous age that extends to the east to underlie the Caribbean Basin and form the Caribbean plate. Immediately west of Panama, in coastal Costa Rica, exposures of CLIP basement are not intruded or overlain by arc magmatic rocks of early Tertiary age. EXPLANATIONS: Potentially, the early Tertiary subduction zone that dipped beneath the Pacific margin of Panama did not extend to the west, thus no arc magmatism occurred where Costa Rica presently exists. Alternatively, the subduction zone bordering the Pacific edge of the CLIP extended below Costa Rica but former exposures of early Tertiary arc magmatic rocks piled there have been erosionally removed or buried beneath Miocene and younger arc massifs of interior mountain belts. EXPLORING A SUBDUCTION EROSION EXPLANATION Onshore and offshore evidence documents that subduction erosion thins and truncates the submerged rock framework of the Middle and South America forearc. The eroded (removed) material is transported toward and into the mantle within the subduction channel separating the upper plate of the forearc and lower plate of the subducting oceanic crust. The long-term (greater than 10 Myr) rate of truncation (i. e., migration of the trench toward a fixed, onshore reference) averages 2 to 3 km/Myr. Because of the subduction of the aseismic Cocos Ridge beneath Costa Rica, during at least the past 4 to 5 Myr the rate of truncation at this margin has been much higher. It is proposed that during the past 50 Myr subduction erosion has truncated the Costa Rica forearc by at least 100 km and either obliterated or deeply submerged arc massifs of early Tertiary age. Their exposed presence to the east in neighboring Panama reflects the circumstance that since

  13. Systematic observations of Volcán Turrialba, Costa Rica, with small unmanned aircraft and aerostats (UAVs): the Costa Rican Airborne Research and Technology Applications (CARTA) missions

    NASA Astrophysics Data System (ADS)

    Pieri, D. C.; Diaz, J. A.; Bland, G.; Fladeland, M. M.; Abtahi, A.; Alan, A., Jr.; Alegria, O.; Azofeifa, S.; Berthold, R.; Corrales, E.; Fuerstenau, S.; Gerardi, J.; Herlth, D.; Hickman, G.; Hunter, G.; Linick, J.; Madrigal, Y.; Makel, D.; Miles, T.; Realmuto, V. J.; Storms, B.; Vogel, A.; Kolyer, R.; Weber, K.


    For several years, the University of Costa Rica, NASA Centers (e.g., JPL, ARC, GSFC/WFF, GRC) & NASA contractors-partners have made regular in situ measurements of aerosols & gases at Turrialba Volcano in Costa Rica, with aerostats (e.g., tethered balloons & kites), & free-flying fixed wing UAVs (e.g., Dragon Eye, Vector Wing 100, DELTA 150), at altitudes up to 12.5Kft ASL within 5km of the summit. Onboard instruments included gas detectors (e.g., SO2, CO2), visible & thermal IR cameras, air samplers, temperature pressure & humidity sensors, particle counters, & a nephelometer. Deployments are timed to support bimonthly overflights of the Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER) onboard the NASA Terra satellite (26 deployments to date). In situ observations of dilute plume SO2 concentrations (~1-20ppmv), plume dimensions, and associated temperature, pressure, & humidity profiles, validate detailed radiative transfer-based SO2 retrievals, as well as archive-wide ASTER band-ratio SO2 algorithms. Our recent UAV-based CO2 observations confirm high concentrations (e.g., ~3000ppmv max at summit jet), with 1000-1500ppmv flank values, and essentially global background CO2 levels (400ppmv) over distal surroundings. Transient Turrialba He detections (up to 20ppmv) were obtained with a small (~10kg) airborne mass spectrometer on a light aircraft—a UAV version (~3kg) will deploy there soon on the UCR DELTA 500. Thus, these platforms, though small (most payloads <500gm), can perform valuable systematic measurements of potential eruption hazards, as well as of volcano processes. Because they are economical, flexible, and effective, such platforms promise unprecedented capabilities for researchers and responders throughout Central and South America, undertaking volcanic data acquisitions uniquely suited to such small aircraft in close proximity to known hazards, or that were previously only available using full-sized manned aircraft. This work was

  14. Determination of differential stress in the D-DIA using cubic BN anvils and 2-D monochromatic diffraction

    NASA Astrophysics Data System (ADS)

    Uchida, T.; Wang, Y.; Rivers, M. L.; Durham, W. B.; Mei, S.


    We have adopted X-ray transparent cubic boron nitride (cBN) anvils in a modified deformation DIA (D-DIA) to conduct monochromatic diffraction using a 2-D CCD detector (SMART1500). This setup allows us to obtain real-time diffraction data with complete Debye rings that are essential for accurate determination of lattice strains in the deformed sample. Experiments have been conducted on MgO to 6.3 GPa and 1273 K in the D-DIA. Samples were deformed continuously up to 30 percent axial shortening, with various strain rates between 0.001 and 0.00001 per second, under fixed confining pressure. Pressure, temperature, sample length, and monochromatic diffraction patterns were recorded repeatedly during the constant-strain rate deformation process. A monochromatic beam with a wavelength of 0.248 Angstrom (50 keV) was used for diffraction. We have developed a software package to analyze the 2-D diffraction data. After spatial and flat-field corrections, each 2-D diffraction pattern is converted into a multiple of 1-D patterns, according to a given azimuth angle range (typically binned at 1 degree intervals). The 1-D patterns are then fitted to yield information on the azimuth dependence for each lattice spacing. Lattice strain is then computed based on the well-known theory (A.K. Singh, J. Appl. Phys., 73, 4278, 1993) to convert to differential stress. This approach allows us to examine lattice strain as a function of pressure, temperature, and total plastic strain systematically. With the known pressure and temperature dependence of the elastic constants for MgO, differential stress can be evaluated throughout deformation. Details of the methodology and analysis will be presented and sources of experimental uncertainties will be discussed.

  15. Accelerations from the September 5, 2012 (Mw=7.6) Nicoya, Costa Rica Earthquake

    NASA Astrophysics Data System (ADS)

    Simila, G. W.; Quintero, R.; Burgoa, B.; Mohammadebrahim, E.; Segura, J.


    Since 1984, the Seismic Network of the Volcanological and Seismological Observatory of Costa Rica, Universidad Nacional (OVSICORI-UNA) has been recording and registering the seismicity in Costa Rica. Before September 2012, the earthquakes registered by this seismic network in northwestern Costa Rica were moderate to small, except the Cóbano earthquake of March 25, 1990, 13:23, Mw 7.3, lat. 9.648, long. 84.913, depth 20 km; a subduction quake at the entrance of the Gulf of Nicoya and generated peak intensities in the range of MM = VIII near the epicentral area and VI-VII in the Central Valley of Costa Rica. Six years before the installation of the seismic network, OVSICORI-UNA registered two subduction earthquakes in northwestern Costa Rica, specifically on August 23, 1978, at 00:38:32 and 00:50:29 with magnitudes Mw 7.0 (HRVD), Ms 7.0 (ISC) and depths of 58 and 69 km, respectively (EHB Bulletin). On September 5, 2012, at 14:42:02.8 UTC, the seismic network OVSICORI-UNA registered another large subduction earthquake in Nicoya peninsula, northwestern Costa Rica, located 29 km south of Samara, with a depth of 21 km and magnitude Mw 7.6, lat. 9.6392, long. 85.6167. This earthquake was caused by the subduction of the Cocos plate under the Caribbean plate in northwestern Costa Rica. This earthquake was felt throughout the country and also in much of Nicaragua. The instrumental intensity map for the Nicoya earthquake indicates that the earthquake was felt with an intensity of VII-VIII in the Puntarenas and Nicoya Peninsulas, in an area between Liberia, Cañas, Puntarenas, Cabo Blanco, Carrillo, Garza, Sardinal, and Tamarindo in Guanacaste; Nicoya city being the place where the maximum reported intensity of VIII is most notable. An intensity of VIII indicates that damage estimates are moderate to severe, and intensity VII indicates that damage estimates are moderate. According to the National Emergency Commission of Costa Rica, 371 affected communities were reported; most

  16. Digital database of microfossil localities in Alameda and Contra Costa Counties, California

    USGS Publications Warehouse

    McDougall, Kristin; Block, Debra


    The eastern San Francisco Bay region (Contra Costa and Alameda Counties, California) is a geologically complex area divided by faults into a suite of tectonic blocks. Each block contains a unique stratigraphic sequence of Tertiary sediments that in most blocks unconformably overlie Mesozoic sediments. Age and environmental interpretations based on analysis of microfossil assemblages are key factors in interpreting geologic history, structure, and correlation of each block. Much of this data, however, is distributed in unpublished internal reports and memos, and is generally unavailable to the geologic community. In this report the U.S. Geological Survey microfossil data from the Tertiary sediments of Alameda and Contra Costa counties are analyzed and presented in a digital database, which provides a user-friendly summary of the micropaleontologic data, locality information, and biostratigraphic and ecologic interpretations.

  17. [Incidence and altitudinal distribution of 13 virus cultures in Solanum tuberosum (Solanaceae) from Costa Rica].


    Vásquez, Viviana; Montero-Astúa, Mauricio; Rivera, Carmen


    A survey was conducted in 30 fields located at three different altitudes in Cartago, Costa Rica's main potato producing area. Twenty plants were sampled per farm, for a total of 600 samples with 200 samples per altitude. ELISA was used with commercial reagents to independently test for PVX, PVY, PVM, PVA, PVS, PLRV, PMTV, PAMV, PVV, PVT, APLV, APMoV and TRSV. The presence of the following viruses was determined: PVX (77 %), PAMV (62 %), PLRV (42 %), TRSV (42 %), PVT (39 %), PVV (37 %), PMTV (31%), PVY (30 %), PVS (19 %), PVM (13 %), PVA (8 %), and APMoV (8%). APLV was not detected in any sample. This is the first report in Costa Rica of the presence of the viruses PMTV, PAMV, PVV, PVT and APMoV. A high viral incidence in the tuber seed production area as well as a high rate of mixed infections is reported.

  18. [Diversity and microstructure of quitons (Mollusca: Polyplacophora) from the Caribbean of Costa Rica].


    García-Ríos, Cedar I; Alvarez-Ruiz, Migdalia


    Diversity and microstructure of quitons (Mollusca: Polyplacophora) from the Caribbean of Costa Rica. The polyplacophorans of the coral reef on the Caribbean coast of Costa Rica have been insufficiently studied. The examination of coral rubble accumulated in the shallow sublitoral waters on four collection stations in Provincia Limón revealed a higher diversity of chitons than was documented. From the country eight species were previously known: Ischnochiton erythronotus (C.B. Adams 1845); Ischnoplax pectinata (Sowerby 1840); Stenoplax boogii (Haddon 1886); S. purpurascens (C.B. Adams 1845); Acanthopleura granulata (Gmelin 1791); Chiton marmoratus Gmelin 1791; C. tuberculatus Linnaeus 1758 and Acanthochitona rhodea (Pilsbry 1893). This study added five more species that are reported here for the first time: Callistochiton portobelensis Ferreira 1976; Ischnochiton kaasi Ferreira 1987; I. pseudovirgatus Kaas 1972; Acanthochitona balesae Abbott 1954 and Cryptoconchus floridanus (Dall 1889).

  19. Breeding habit of the toad Bufo coccifer in Costa Rica, with a description of the tadpole

    USGS Publications Warehouse

    McDiarmid, R.W.; Foster, M.S.


    The breeding habits of Bufo coccifer were studied in northwestern Costa Rica between 1971 and 1974. This species breeds during the rainy season, at least from May through August. Males chorus from areas of shallow water. Their calls resemble those of Mexican representatives of the species in pulse rate and duration, but are closer to those of other Costa Rican and Panamanian populations in dominant frequency. Thus, our data do not clearly support recognition of Bufo cycladen as a distinct species for the Mexican populations. Amplexus is axillary, and two strings of eggs are extruded simultaneously during oviposition. Tadpoles, described for the first time in this paper, are secretive and do not aggregate. Development to metamorphosis requires about 5 weeks.

  20. Tracking performance of unbalanced QPSK demodulators. I - Biphase Costas loop with passive arm filters

    NASA Technical Reports Server (NTRS)

    Simon, M. K.; Alem, W. K.


    Unbalanced quadriphase-shift-keying (QPSK) is an attractive means for transmitting two digital data streams which in general have different average powers, data rates, and data formats. Previous analyses of the tracking performance of Costas loop demodulators of unbalanced QPSK have accounted only for the filtering effect produced by the loop's two arm filters on the equivalent additive noise perturbing the loop. When the bandwidth of these filters is selected on the basis of the order of the data rate, as is typical of optimum Costas loop design, the filtering degradations of the data modulations themselves and the cross-modulation noise produced by their multiplication in the loop often cannot be neglected. The purpose of this paper is to incorporate these additional filtering effects into the analysis. Many of the results obtained herein are in the form of closed-form expressions which can easily be evaluated numerically for design and performance prediction purposes.

  1. Tracking performance of unbalanced QPSK demodulators. II - Biphase Costas loop with active arm filters

    NASA Technical Reports Server (NTRS)

    Simon, M. K.


    In a Costas loop study for biphase modulation conducted by Simon and Lindsey (1977), it was demonstrated that considerable improvement in tracking performance could be obtained by employing active arm filters of the integrate-and-dump type as opposed to passive arm filters. An investigation is conducted concerning the possibility to obtain a similar performance improvement for an unbalanced quadriphase-shift-keying (QPSK) modulation. It is found that the biphase Costas loop can be used as an efficient demodulator of QPSK in cases in which the ratio of data rates is of the same order of magnitude as the inverse of the power ratio. These cases involve approximately equal signal energies in the two channels.

  2. Empirical findings on socioeconomic determinants of fertility differentials in Costa Rica.


    Carvajal, M J; Geithman, D T


    "This paper seeks to (1) identify socioeconomic variables that are expected to generate fertility differentials; (2) hypothesize the direction and magnitude of the effect of each variable by reference to a demand-for-children model; and (3) test empirically the model using evidence from Costa Rica. The estimates are obtained from a ten-percent systematic random sample of all Costa Rican individual-family households. There are 15,924 families in the sample...." The authors specifically seek "to capture the effects of changing relative prices and available income and time constraints on parental preferences for children. Least-squares estimates show statistically significant relationships between household fertility and opportunity cost of time, parental education, occurrence of an extended family, medical care, household sanitation, economic sector of employment, and household stock of nonhuman capital."

  3. [Bacteriological load of the fishes Cynoscion squamipinnis and Lutjanus gutattus in the marketing chain, Costa Rica].


    Marín, Carolina; Fonseca, Cristian; Arias, Sidey; Villegas, Irene; García, Andrea; Ishihara, Hikaru


    Bacteriological load of the fishes Cynoscion squamipinnis and Lutjanus gutattus in the marketing chain, Costa Rica. To determine the bacteriological quality of fishery products in the different stages from commercialization, monthly samples were taken during March 2004 and February 2006 from a Costa Rica marketing chain. Microbiological analyses were made to determine total coliforms (CT), faecal coliforms (CF), Escherichia coli (EC), aerobic total count (RTA), Salmonella sp., Staphylococcus aureus, Vibrio cholerae and Vibrio parahaemolyticus. Three body zones were analyzed: skin, belly and muscle. There were differences in the amount of CT between parts: skin had the highest counts, 11% of samples were identified as E. coli. and 2.5% of total counts were higher than the legal limit. Only 1.3% of the samples were S. aureus-positive. Salmonella sp., V. cholerae and V. parahaemolyticus were absent.

  4. Costa Rican environmental service payments: The use of a financial instrument in participatory forest management.


    Miranda, Miriam; Dieperink, Carel; Glasbergen, Pieter


    The core element of the Costa Rican forestry policy is a financial instrument called the environmental service payment. This instrument rewards forest owners for the environmental services (the mitigation of greenhouse gases, the protection of watersheds and scenic beauty, and the development of biodiversity) their forests provide. In this article, the experiences with this new instrument are analyzed by focusing on the way interests are represented and access is granted, the openness of information exchange, whether social learning occurred, and whether decision-making authority is shared. The analysis is based on a survey conducted in the Huetar Norte Region and on in-depth interviews with the major stakeholders. The Costa Rican case indicates that financial instruments can be used to share responsibilities and that stakeholders can successfully cooperate on forest issues. It also shows that such a participatory approach is only promising if certain cultural, economic, organizational, and political conditions are met.

  5. Comments on article "Toxicity and carcinogenicity of chromium compounds in humans" by Costa and Klein.


    Post, Gloria B; Stern, Alan H


    The recent article by Costa and Klein (2006) contains several inaccuracies about the federal drinking water standard for chromium. The federal drinking water standard for chromium is 100 ppb, not 50 ppb as stated by Costa and Klein, and it is based on non-carcinogenic effects, not a one in one million cancer risk level. The question of whether or not hexavalent chromium is carcinogenic via the oral route is the focus of much current interest and has major implications for regulation of chromium in drinking water and soil. The chronic drinking water study of hexavalent chromium currently being conducted by the National Toxicology Program will provide further information that will be useful in addressing this question.

  6. [The privatization of public services. The case of health services in Costa Rica].


    Vargas-Fuentes, M


    This article analyzes the role of the State and public enterprises in the development of nations, from a particular standing point, and inquires into the privatization issue, reviewing both its concept and the possible mechanisms for its implementation. Also, emphasis is made on the selling of public enterprises as one of the several ways to privatize. Within this context, some measures for the reorganization of the Costa Rican National Health System are proposed. These measures uphold fundamental values of social justice. This article is based on a theoretical-conceptual framework from an innovative experience in health services management in Costa Rica, in which a self-managing cooperative society (a nonprofit enterprise) manages, by contract with national health care public institutions, an urban local health care system.

  7. Use of linkage disequilibrium approaches to map genes for bipolar disorder in the Costa Rican population

    SciTech Connect

    Escamilla, M.A.; Reus, V.I.; Smith, L.B.; Freimer, N.B.


    Linkage disequilibrium (LD) analysis provides a powerful means for screening the genome to map the location of disease genes, such as those for bipolar disorder (BP). As described in this paper, the population of the Central Valley of Costa Rica, which is descended from a small number of founders, should be suitable for LD mapping; this assertion is supported by reconstruction of extended haplotypes shared by distantly related individuals in this population suffering low-frequency hearing loss (LFHL1), which has previously been mapped by linkage analysis. A sampling strategy is described for applying LD methods to map genes for BP, and clinical and demographic characteristics of an initially collected sample are discussed. This sample will provide a complement to a previously collected set of Costa Rican BP families which is under investigation using standard linkage analysis. 42 refs., 4 figs., 2 tabs.

  8. [Isolation of enteropathogenic Vibrio in bivalves and mud from the Nicoya Gulf, Costa Rica].


    García Cortés, V; Antillón, F


    The presence of enteropathogenic Vibrio was evaluated in 36 sediment samples and 41 bivalve samples obtained from 3 collecting sites in the Golfo de Nicoya, Costa Rica. Isolation methods for halophilic and non halophilic Vibrio were used. The biochemical profiles of the strains obtained revealed the presence of the following isolates: 224 Vibrio parahaemolyticus, 3 V. furnissii, 1 V. damsela and 3 V. fluvialis. V. cholerae was not isolated, due principally to the use of TCBS agar.

  9. Metals and organochlorine pesticides in caudal scutes of crocodiles from Belize and Costa Rica.


    Rainwater, Thomas R; Wu, Ted H; Finger, Adam G; Cañas, Jaclyn E; Yu, Lu; Reynolds, Kevin D; Coimbatore, Gopal; Barr, Brady; Platt, Steven G; Cobb, George P; Anderson, Todd A; McMurry, Scott T


    Despite high animal diversity in the Neotropics and the largely unregulated use and disposal of pesticides and industrial chemicals in Central America, few data exist regarding accumulation of environmental contaminants in Central American wildlife. In this study we examined accumulation of metals and organochlorine (OC) pesticides in caudal scutes of crocodiles from Belize and Costa Rica. Scutes from Morelet's crocodiles (Crocodylus moreletii) from two sites in northern Belize were analyzed for metals, and scutes from American crocodiles (C. acutus) from one site in Costa Rica were analyzed for metals and OC pesticides. All scutes (n=25; one scute from each of 25 individuals) contained multiple contaminants. Mercury was the predominant metal detected, occurring in all scutes examined from both species. Other metals detected include cadmium, copper, lead, and zinc. American crocodile scutes from Costa Rica contained multiple OC pesticides, including endrin, methoxychlor, p,p'-DDE, and p,p'-DDT, all of which occurred in 100% of scutes analyzed (n=6). Mean metal and OC concentrations varied in relation to those previously reported in crocodilian scutes from other localities in North, Central, and South America. OC concentrations in American crocodile scutes were generally higher than those previously reported for other Costa Rican wildlife. Currently, caudal scutes may serve as general, non-lethal indicators of contaminant accumulation in crocodilians and their areas of occurrence. However, a better understanding of the relationships between pollutant concentrations in scutes, internal tissues, and environmental matrices at sample collection sites are needed to improve the utility of scutes in future ecotoxicological investigations.

  10. [Antibodies against Toxoplasma gondii in swine in Costa Rica: epidemiologic importance].


    Torres, A L; Chinchilla, M; Reyes, L


    On a three hundred swine sera sample collected from a Municipal Slaughter house and a Research Laboratory at the Ministerio de Agricultura y Ganadería a 26% of positivity against T. gondii was found using the carbon immunoassay. A relationship between the age and swine race are made. The epidemiological significance of this findings are discussed focused mainly on the role of swine meat as a source of human infection in Costa Rica.

  11. Rare solitary neoplasm of the costa in an adult: a case report.


    Shen, Cheng; Liang, Yasha; Xu, Huan; Che, Guowei


    Regional solitary plasmacytoma of the costa is a rare disease and is characterized by only one or two isolated bone lesions. We report the case of a solitary plasmacytoma of the bone of the right chest wall in an adult. The patient underwent complete enbloc resection of the chest wall including ribs, muscle and parietal pleura. The patient is asymptomatic without any recurrence after two months of follow-up.

  12. Chemical quality of ground water in San Joaquin and part of Contra Costa Counties, California

    USGS Publications Warehouse

    Sorenson, Stephen K.


    Chemical water-quality conditions were investigated in San Joaquin and part of Contra Costa Counties by canvassing available wells and sampling water from 324 representative wells. Chemical water types varied, with 73 percent of the wells sampled containing either calcium-magnesium bicarbonate, or calcium-sodium bicarbonate type water. Substantial areas contain ground water exceeding water-quality standards for boron, manganese, and nitrate. Trace elements, with the exception of boron and manganese, were present in negligible amounts. (USGS)

  13. A new genus and species of Coenosiini from Costa Rica (Diptera, Muscidae, Coenosiinae)

    PubMed Central

    Couri, Márcia Souto; de Carvalho, Claudio José Barros


    Abstract Palpilongus gen. n. is herein described for one species – Palpilongus bifurcus sp. n., from Costa Rica, based on male and females. The striking morphological characters of the species – palpus very long, about as long as prementum; upper calypter truncate and very short and setae of male sternite 5 bifurcated, confirm that this new species is also a new genus in the tribe Coenosiini. Male and female terminalia were dissected and illustrated. PMID:23950688

  14. Tayloring energy levels with curvature ? An illustration of Da Costa formalism

    NASA Astrophysics Data System (ADS)

    Fumeron, Sébastien; Berche, Bertrand; Moraes, Fernando; Santos, Fernando


    Nanotubes are generally not perfectly straight cylinders and the local curvature can influence transport properties. As shown by da Costa [1], charged particles moving on a curved surface experience an effective potential which modifies their dynamics. In this paper, we solve a one-electron Schrödinger equation in a distorted nanotube with open boundary conditions. We find that the deformations may open bandgaps suggesting their use in the design of nanotube- based electronic devices.

  15. The salt content of products from popular fast-food chains in Costa Rica.


    Heredia-Blonval, Katrina; Blanco-Metzler, Adriana; Montero-Campos, Marielos; Dunford, Elizabeth K


    Salt is a major determinant of population blood pressure levels. Salt intake in Costa Rica is above levels required for good health. With an increasing number of Costa Ricans visiting fast food restaurants, it is likely that fast-food is contributing to daily salt intake. Salt content data from seven popular fast food chains in Costa Rica were collected in January 2013. Products were classified into 10 categories. Mean salt content was compared between chains and categories. Statistical analysis was performed using Welch ANOVA and Tukey-Kramer HSD tests. Significant differences were found between companies; Subway products had lowest mean salt content (0.97 g/100 g; p < 0.05) while Popeye's and KFC had the highest (1.57 g/100 g; p < 0.05). Significant variations in mean salt content were observed between categories. Salads had a mean salt content of 0.45 g/100 g while sauces had 2.16 g/100 g (p < 0.05). Wide variation in salt content was also seen within food categories. Salt content in sandwiches ranged from 0.5 to 2.1 g/100 g. The high levels and wide variation in salt content of fast food products in Costa Rica suggest that salt reduction is likely to be technically feasible in many cases. With an increasing number of consumers purchasing fast foods, even small improvements in salt levels could produce important health gains.

  16. Cost analysis of an integrated vaccine-preventable disease surveillance system in Costa Rica✩

    PubMed Central

    Toscano, C.M.; Vijayaraghavan, M.; Salazar-Bolaños, H.M.; Bolaños-Acuña, H.M.; Ruiz-González, A.I.; Barrantes-Solis, T.; Fernández-Vargas, I.; Panero, M.S.; de Oliveira, L.H.; Hyde, T.B.


    Introduction Following World Health Organization recommendations set forth in the Global Framework for Immunization Monitoring and Surveillance, Costa Rica in 2009 became the first country to implement integrated vaccine-preventable disease (iVPD) surveillance, with support from the U.S. Centers for Disease Control and Prevention (CDC) and the Pan American Health Organization (PAHO). As surveillance for diseases prevented by new vaccines is integrated into existing surveillance systems, these systems could cost more than routine surveillance for VPDs targeted by the Expanded Program on Immunization. Objectives We estimate the costs associated with establishing and subsequently operating the iVPD surveillance system at a pilot site in Costa Rica. Methods We retrospectively collected data on costs incurred by the institutions supporting iVPD surveillance during the preparatory (January 2007 through August 2009) and implementation (September 2009 through August 2010) phases of the iVPD surveillance project in Costa Rica. These data were used to estimate costs for personnel, meetings, infrastructure, office equipment and supplies, transportation, and laboratory facilities. Costs incurred by each of the collaborating institutions were also estimated. Results During the preparatory phase, the estimated total cost was 128,000 U.S. dollars (US$), including 64% for personnel costs. The preparatory phase was supported by CDC and PAHO. The estimated cost for 1 year of implementation was US$ 420,000, including 58% for personnel costs, 28% for laboratory costs, and 14% for meeting, infrastructure, office, and transportation costs combined. The national reference laboratory and the PAHO Costa Rica office incurred 64% of total costs, and other local institutions supporting iVPD surveillance incurred the remaining 36%. Conclusions Countries planning to implement iVPD surveillance will require adequate investments in human resources, laboratories, data management, reporting, and

  17. False lock performance in polarity-type Costas receivers in the presence of periodic data patterns

    NASA Technical Reports Server (NTRS)

    Wang, James June-Ming; Lai, Dennis Teng-Tsun; Heng, Veronica Siang-Gek; Godfrey, Robert D.


    The authors address the false-lock performance of receivers which use polarity-type Costas loops for the carrier recovery of unbalanced quadrature phase-shift keyed (QPSK), asynchronous QPSK or binary PSK (BPSK) signals in the presence of periodic data patterns. The potential false-lock frequencies are first identified. Expressions for both true-lock and false-lock components are also derived, thereby allowing numerical evaluation of various key parameters for cases of practical interest.

  18. International trade, and land use intensification and spatial reorganization explain Costa Rica’s forest transition

    NASA Astrophysics Data System (ADS)

    Jadin, I.; Meyfroidt, P.; Lambin, E. F.


    While tropical deforestation remains widespread, some countries experienced a forest transition—a shift from net deforestation to net reforestation. Costa Rica had one of the highest deforestation rates in the 1980s and is now considered as a model of environmental sustainability, despite being a major producer of bananas and pineapples. We tested three land use processes that are thought to facilitate forest transitions. First, forest transitions may be accompanied by land use displacement through international trade of land-based products, which may undermine the global-scale environmental benefits of national forest protection. Second, reforestation is often associated with land use intensification in agriculture and forestry, allowing for land sparing. Third, this intensification may partly result from a geographical redistribution of land use at the sub-national scale to better match land use with land suitability. These hypotheses were verified for Costa Rica’s forest transition. We also tested whether forest increased mainly in regions with a low ecological value and agriculture expanded in regions with a high ecological value. Intensification and land use redistribution accounted for 76% of land spared during the forest transition, with 32% of this spared area corresponding to net reforestation. Decreasing meat exports led to a contraction of pastures, freeing an area equivalent to 80% of the reforested area. The forest transition in Costa Rica was environmentally beneficial at the global scale, with the reforested area over 1989-2013 corresponding to 130% of the land use displaced abroad through imports of agricultural products. However, expansion of export-oriented cropland caused deforestation in the most ecologically valuable regions of Costa Rica. Moreover, wood extraction from forest plantations increased to produce the pallets needed to export fruits. This highlights the importance of a multi-scale analysis when evaluating causes and impacts of

  19. Bacteria of the genus Rickettsia in ticks (Acari: Ixodidae) collected from birds in Costa Rica.


    Ogrzewalska, Maria; Literák, Ivan; Capek, Miroslav; Sychra, Oldřich; Calderón, Víctor Álvarez; Rodríguez, Bernardo Calvo; Prudencio, Carlos; Martins, Thiago F; Labruna, Marcelo B


    The aim of this study was to document the presence of Rickettsia spp. in ticks parasitizing wild birds in Costa Rica. Birds were trapped at seven locations in Costa Rica during 2004, 2009, and 2010; then visually examined for the presence of ticks. Ticks were identified, and part of them was tested individually for the presence of Rickettsia spp. by polymerase chain reaction (PCR) using primers targeting fragments of the rickettsial genes gltA and ompA. PCR products were DNA-sequenced and analyzed in BLAST to determine similarities with previously reported rickettsial agents. A total of 1878 birds were examined, from which 163 birds (9%) were infested with 388 ticks of the genera Amblyomma and Ixodes. The following Amblyomma (in decreasing order of abundance) were found in immature stages (larvae and nymphs): Amblyomma longirostre, Amblyomma calcaratum, Amblyomma coelebs, Amblyomma sabanerae, Amblyomma varium, Amblyomma maculatum, and Amblyomma ovale. Ixodes ticks were represented by Ixodes minor and two unclassified species, designated here as Ixodes sp. genotype I, and Ixodes sp. genotype II. Twelve of 24 tested A. longirostre ticks were found to be infected with 'Candidatus Rickettsia amblyommii', and 2 of 4 A. sabanerae were found to be infected with Rickettsia bellii. Eight of 10 larval Ixodes minor were infected with an endosymbiont (a novel Rickettsia sp. agent) genetically related to the Ixodes scapularis endosymbiont. No rickettsial DNA was found in A. calcaratum, A. coelebs, A. maculatum, A. ovale, A. varium, Ixodes sp. I, and Ixodes sp. II. We report the occurrence of I. minor in Costa Rica for the first time and a number of new bird host-tick associations. Moreover, 'Candidatus R. amblyommii' and R. bellii were found in A. longirostre and A. sabanerae, respectively, in Costa Rica for the first time.

  20. A Costas loop with tangent error signal for use in Navstar GPS avionics

    NASA Technical Reports Server (NTRS)

    Painter, J. H.; Mcclung, D. A.; Reininger, R. C.


    This paper describes an augmented Costas loop for use in low-cost avionics for the Navstar Global Positioning System. A standard loop has been augmented with supplementing feed-back to give a tracking error voltage proportional to the tangent of the phase error, rather than to the sine. The augmented loop yields increased performance in the presence of input phase acceleration and jerk, as caused by maneuvers of the GPS user vehicle. Many Monte Carlo simulation results are given.

  1. Arcobacter butzleri: first isolation report from chicken carcasses in costa rica

    PubMed Central

    Arias, Maria Laura; Cid, Adriana; Fernandéz, Heriberto


    Arcobacter butzleri isolation from chicken carcasses in Costa Rica is reported for the first time. The isolated strains (P and R) were presumptively identified by their phenotypic characteristics. Definitive identification was made using a multiplex PCR assay for the simultaneous detection and identification of Arcobacter butzleri, Arcobacter cryaerophilus and Arcobacter skirrowii. These first isolations indicate the necessity of further investigation about the prevalence, distribution, ecology and interactions with human beings of this and other Arcobacter species. PMID:24031682

  2. Scarlet Macaw, Ara macao, (Psittaciformes: Psittacidae) diet in Central Pacific Costa Rica.


    Vaughan, Christopher; Nemeth, Nicole; Marineros, Leonel


    From 1993 to 1997, we observed Scarlet Macaw (Ara macao) feeding behavior in Central Pacific Costa Rica. Feeding data acquired in this study were not collected systematically, but opportunistically whenever macaws were observed feeding. To supplement feeding observations, we conducted interviews with local residents. Scarlet Macaws fed on seeds, fruits, leaves, flowers and/or bark of 43 plant species. Various plant parts eaten by macaws from several tree species contain secondary compounds toxic to humans, and additional species included in their diet are nonnative, introduced for agricultural purposes. Important macaw feeding tree species are Ceiba pentandra, Schizolobium parahybum, and Hura crepitans; these species are also crucial to this macaw population because of nest cavities they provide. The results of this study contribute to the conservation of Scarlet Macaws in Central Pacific Costa Rica through promoting protection of individual trees, and through local elementary school reforestation programs focusing on tree species that macaws use for feeding and/or nesting. Scarlet Macaw conservation is extremely important, as numerous population pressures have caused significant declines in macaw numbers in Costa Rica.

  3. Long-Term Association of Economic Inequality and Mortality in Adult Costa Ricans

    PubMed Central

    Modrek, Sepideh; Dow, William H.; Rosero-Bixby, Luis


    Despite the large number of studies, mostly in developed economies, there is limited consensus on the health effects of inequality. Recently a related literature has examined the relationship between relative deprivation and health as a mechanism to explain the economic inequality and health relationship. This study evaluates the relationship between mortality and economic inequality, as measured by area-level Gini coefficients, as well as the relationship between mortality and relative deprivation, in the context of a middle-income country, Costa Rica. We followed a nationally representative prospective cohort of approximately 16,000 individuals aged 30 and over who were randomly selected from the 1984 census. These individuals were then linked to the Costa Rican National Death Registry until Dec. 31, 2007. Hazard models were used to estimate the relative risk of mortality for all-cause and cardiovascular disease mortality for two indicators: canton-level income inequality and relative deprivation based on asset ownership. Results indicate that there was an unexpectedly negative association between canton income inequality and mortality, but the relationship is not robust to the inclusion of canton fixed-effects. In contrast, we find a positive association between relative deprivation and mortality, which is robust to the inclusion of canton fixed-effects. Taken together, these results suggest that deprivation relative to those higher in a hierarchy is more detrimental to health than the overall dispersion of the hierarchy itself, within the Costa Rican context. PMID:22240449

  4. An interview with Lucio G. Costa and Michael Aschner, section editors for toxicology.


    Costa, Lucio G; Aschner, Michael


    Lucio G. Costa is currently Professor of Environmental and Occupational Health Sciences at the School of Public Health at the University of Washington. Dr. Costa is a renowned neurotoxicologist whose research interests are focused on understanding the role of neurotoxic substances in neurodevelopmental disorders and other neurological, neuropsychiatric and neurodegenerative diseases. Dr Costa's research laboratory makes use of a variety of in vivo and in vitro cell culture systems, transgenic animal models and imaging techniques to study the cellular, biochemical and molecular mechanisms of neurotoxicity.Michael Aschner is the Gray E. B. Stahlman Professor of Pediatrics and Pharmacology at Vanderbilt University School of Medicine as well as a Senior Investigator at the Kennedy Center for Research on Human Development. Dr Aschner's research group has a particular interest in the neurobiology and physiology of astrocytes and the signaling mechanisms associated with central nervous system injury. Dr Aschner's laboratory studies metal uptake and distribution in the brain, investigating the mechanisms of transport of methylmercury and manganese across the capillaries of the blood-brain barrier. His research utilizes various experimental models (C. elegans, tissue cultures and rodents) to understand the acute toxicity of manganese deposition in the brains of human neonates.In this interview we find out a little more about the key issues in the field of toxicology research.

  5. Export-led growth as a determinant of social development in Costa Rica.


    Lundahl, M


    Costa Rica has put considerable effort into the development of education, health care, housing and social security. In order to be sustainable, this process requires that the output of such sectors as agriculture and manufacturing expands over time. The article examines the growth of the Costa Rican economy in a long run perspective, with an emphasis on foreign trade policy. The fate of the Costa Rican economy has been highly dependent on the exports of primary products, mainly coffee and bananas, for more than a century. This, however, has created a very vulnerable economy. As a result, during the 1960s, a new development strategy emerged: production of manufactures for the Central American Common Market (CACM). At the end of the 1970s, the prices of traditional export fell and the CACM more or less collapsed. The Central American economies were thrown into an acute crisis, aggravated by faculty domestic economic policies, which also jeopardized social development. This necessitated a stabilization effort on the one hand, and the development of a new trade strategy--promotion of non-traditional exports--on the other. It would appear that both efforts have been successful, although not without difficulties.

  6. Characterization of the Mid Summer Drought in the Central Valley of Costa Rica, Central America

    NASA Astrophysics Data System (ADS)

    Alfaro, E.


    The IAS region is characterized by climate features of unique nature, one of them is the Mid-Summer Drought (MSD) or "veranillo", an atmospheric feature rarely observed in other tropical regions. On the Pacific slope of Central America, the precipitation annual cycle is characterized by two rainfall maxima in June and September-October, an extended dry season from November to May, and a secondary precipitation minima during July-August (MSD). Three daily gauge stations records, e.g. La Argentina, Fabio Baudrit and Juan Santamaria, located in the Central Valley of Costa Rica were studied to characterize the MSD from 1937 to 2010. Among the aspects considered are the MSD duration, intensity, timing and seasonal predictability. The modulation of these aspects by climate variability sources as Equatorial Eastern Pacific and Tropical North Atlantic was lately explored, including their interannual and decadal variability. The MSD signal strongly impact social and economic life in the region like energy and the agriculture sector. Additionally, the Central Valley of Costa Rica hosts most of the Costa Rican population with the higher level of exposure and vulnerability to hydro-meteorological hazards.

  7. John Chalmers DaCosta (1863-1933): restoration of the old operating table.


    Peters, Madalyn G; Berger, Adam C; Schwartz, Gordon F; Yeo, Charles J; Cowan, Scott W


    John Chalmers DaCosta was an influential chairman and the first Samuel D. Gross Professor of Surgery at Jefferson Medical College in Philadelphia. He was well known throughout the field as a skilled surgeon, passionate speaker, and exceptional writer. In addition to countless accomplishments during his career, DaCosta was deeply dedicated to the preservation and commemoration of surgical history. This ideology was exemplified when he set out on a mission to recover the old wooden operating table used by many of his iconic mentors including Samuel D. Gross, Joseph Pancoast, and William W. Keen. This table was originally used for surgical demonstrations and anatomy lessons in a lecture room of the Ely Building and later in the great amphitheater of the Jefferson Sansom Street Hospital. It was found forgotten in the basement of the College Building and was promptly refurbished, donned with dedicatory plaques, and returned to its honored position in the medical college. Dr. DaCosta also contributed a detailed article recalling the history of the table and the notable leaders in surgery who taught and practiced on its surface. The old table currently stands proudly in the entranceway of the Department of Surgery where it will remain as a cherished symbol of the early beginnings of surgical practice and education.

  8. Determinants of health in seasonal migrants: coffee harvesters in Los Santos, Costa Rica.


    Loría Bolaños, Rocío; Partanen, Timo; Berrocal, Milena; Alvárez, Benjamín; Córdoba, Leonel


    In the agroexport zone of Los Santos Zone in Costa Rica, coffee is harvested by migrant labor. Most migrants are from Panama and Nicaragua. We describe migrants' housing- and service-related health determinants, with analyses of ethnicity, nationality and geography. We used interviews, observation-based assessments, and the Geographic Information System to assess a population of 8,783 seasonal migrants and 1,099 temporary dwellings at a total of 520 farms during 2004-2005. We identified determinants of poor health including widespread deficiencies in the quality of grower-provided dwellings, geographical isolation, crowding, lack of radio and television, and deficient toilets and cooking facilities. The indigenous and non-Costa Ricans shared the poorest conditions. Reluctance to use mainstream public health services was widespread, especially among foreign and indigenous migrants and the geographically isolated. Post-study, researchers organized workshops for audiences including workers, coffee producers, public officials and service providers. Topics have included migration, preventive health and hygiene, and child labor. This work was successful in convincing Costa Rican social security authorities to implement reforms that improve access to and quality of health care for the migrants. Special projects on ergonomics, psychosocial health hazards, and water quality, as well as a literacy program, are ongoing.

  9. [Claudio Costa Casaretto M.D. (1914-1999) in Revista Medica de Chile].


    Goic, A


    The work of Dr. Claudio Costa Casaretto covers a broad field in the history of Medicine in Chile. He contributed with the historical aspects in the Centennial issue of Revista Médica de Chile in July, 1972. He published 85 papers in this journal in a lapse of 20 years. In his works, he investigated about medical personalities with the highest relevance for Chilean medicine such as Dr. William Blest, graduated in Edinburgh and director of the first Medicine Course in Chile in 1833, the French obstetrician Dr. Lorenzo Sazie, first Dean of the Faculty of Medicine of the University of Chile in 1843 and Dr. Eloisa Díaz, first physician graduated in Chile and South America in 1887. He published the translation from Latin of Juan Ignacio Molina's verses "Elegies to smallpox", Chilean writer and erudite of the XVIII century. He also undertook the origins of Universidad de San Felipe (1737), Universidad de Chile (1842) and Pontificia Universidad Católica de Chile (1889) and the main educational events occurred in the Faculty of Medicine of the University of Chile, during the past century. He also published about the public health situation and sanitary care during the XIX century, about the conflict between private and public teaching and other political events of the past century. The work of Dr. Costa as a whole, is a real history textbook of Chilean Medicine. Dr. Costa and Dr. Enrique Laval are the most important Chilean medical historians of the XX century.

  10. Tobacco industry success in Costa Rica: The importance of FCTC Article 5.3

    PubMed Central

    Crosbie, Eric; Sebrié, Ernesto M; Glantz, Stanton A


    Objective To analyze how the tobacco industry influenced tobacco control policymaking in Costa Rica. Materials and Methods Review of tobacco industry documents, tobacco control legislation, newspaper articles, and interviewing of key informants. Results During the mid-to-late 1980s, Health Ministry issued several advanced (for their time) smoking restriction decrees causing British American Tobacco (BAT) and Philip Morris International (PMI) to strengthen their political presence there, resulting in passage of a weak 1995 law, which, as of August 2011, remained in effect. Since 1995 the industry has used Costa Rica as a pilot site for Latin American programs and has dominated policymaking by influencing the Health Ministry, including direct private negotiations with the tobacco industry which violate Article 5.3’s implementing guidelines of the World Health Organization Framework Convention on Tobacco Control (WHO FCTC). Conclusions The Costa Rica experience demonstrates the importance of vigorous implementation of FCTC Article 5.3 which insulates public health policymaking from industry interference. PMID:22286826

  11. Identification of endangered or threatened Costa Rican tree species by wood anatomy and fluorescence activity.


    Moya, Róger; Wiemann, Michael C; Olivares, Carlos


    A total of 45 native Costa Rican tree species are threatened or in danger of extinction, but the Convention on International Trade Endangered Species (CITES) includes only eight of these in its Appendices. However, the identification of other species based on their wood anatomy is limited. The present study objective was to describe and to compare wood anatomy and fluorescence activity in some endangered or threatened species of Costa Rica. A total of 45 (22 endangered and 23 threatened with extinction) wood samples of these species, from the xylaria of the Instituto Tecnológico de Costa Rica and the Forest Products Laboratory in Madison, Wisconsin, were examined. Surface fluorescence was positive in eight species, water extract fluorescence was positive in six species and ethanol extract fluorescence was positive in 24 species. Almost all species were diffuse porous except for occasional (Cedrela odorata, C. fissilis, Cordia gerascanthus) or regular (C. salvadorensis and C. tonduzii) semi-ring porosity. A dendritic vessel arrangement was found in Sideroxylon capari, and pores were solitary in Guaiacum sanctum and Vantanea barbourii. Vessel element length was shortest in Guaiacum sanctum and longest in Humiriastrum guianensis, Minquartia guianensis and Vantanea barbourii. Finally, anatomical information and fluorescence activity were utilized to construct an identification key of species, in which fluorescence is a feature used in identification.

  12. Conservation genetics of American crocodile, Crocodylus acutus, populations in Pacific Costa Rica

    USGS Publications Warehouse

    Mauger, Laurie A.; Velez, Elizabeth; Cherkiss, Michael S.; Brien, Matthew L.; Mazzotti, Frank J.; Spotila, James R.


    Maintaining genetic diversity is crucial for the survival and management of threatened and endangered species. In this study, we analyzed genetic diversity and population genetic structure at neutral loci in American crocodiles, Crocodylus acutus, from several areas (Parque Nacional Marino Las Baulas, Parque Nacional Santa Rosa, Parque Nacional Palo Verde, Rio Tarcoles, and Osa Conservation Area) in Pacific Costa Rica. We genotyped 184 individuals at nine microsatellite loci to describe the genetic diversity and conservation genetics between and among populations. No population was at Hardy-Weinberg Equilibrium (HWE) over all loci tested and a small to moderate amount of inbreeding was present. Populations along the Pacific coast had an average heterozygosity of 0.572 across all loci. All populations were significantly differentiated from each other with both FST and RST measures of population differentiation with a greater degree of molecular variance (81%) found within populations. Our results suggest C. acutus populations in Pacific Costa Rica were not panmictic with moderate levels of genetic diversity. An effective management plan that maintains the connectivity between clusters is critical to the success of C. acutus in Pacific Costa Rica.

  13. Validity of the Addiction Severity Index (adapted version) in a Costa Rican population group.


    Sandí Esquivel, L E; Avila Corrales, K


    Until recently, no adapted and validated instrument was available for assessing the alcohol and drug problems of individuals in Costa Rica. This article reports the results of a study performed by Costa Rica's Institute on Alcoholism and Drug Dependence in order to test an adapted version of one such instrument, the Addiction Severity Index (ASI), in a Costa Rican setting. The instrument was used to interview 100 male subjects 18 to 64 years old (51 with diagnosed alcohol or drug problems and 49 controls). In general, the subjects with previously diagnosed alcohol or drug problems were assigned substantially higher scores. More specifically, statistical analysis indicated highly significant correlations (p less than 0.001) between the type of subject (test subject or control) and the likelihood that noteworthy problems would be found in the areas of alcohol use, family/social relations, work/finances, and psychological status. Overall, the study demonstrated that the instrument was capable of distinguishing between the affected and unaffected populations, and also of gauging the severity of the problems involved and the patients' treatment needs.

  14. Sub-Nyquist sampling and detection in Costas coded pulse compression radars

    NASA Astrophysics Data System (ADS)

    Hanif, Adnan; Mansoor, Atif Bin; Imran, Ali Shariq


    Modern pulse compression radar involves digital signal processing of high bandwidth pulses modulated with different coding schemes. One of the limiting factors in the radar's design to achieve desired target range and resolution is the need of high rate analog-to-digital (A/D) conversion fulfilling the Nyquist sampling criteria. The high sampling rates necessitate huge storage capacity, more power consumption, and extra processing requirement. We introduce a new approach to sample wideband radar waveform modulated with Costas sequence at a sub-Nyquist rate based upon the concept of compressive sensing (CS). Sub-Nyquist measurements of Costas sequence waveform are performed in an analog-to-information (A/I) converter based upon random demodulation replacing traditional A/D converter. The novel work presents an 8-order Costas coded waveform with sub-Nyquist sampling and its reconstruction. The reconstructed waveform is compared with the conventionally sampled signal and depicts high-quality signal recovery from sub-Nyquist sampled signal. Furthermore, performance of CS-based detections after reconstruction are evaluated in terms of receiver operating characteristic (ROC) curves and compared with conventional Nyquist-rate matched filtering scheme.

  15. A new species of Reithrodontomys, subgenus Aporodon (Cricetidae: Neotominae), from the highlands of Costa Rica, with comments on Costa Rican and Panamanian Reithrodontomys

    USGS Publications Warehouse

    Gardner, Alfred L.; Carleton, Michael D.


    A new species of the rodent genus Reithrodontomys (Cricetidae: Neotominae) is described from Cerro Asuncion in the western Cordillera de Talamanca, Costa Rica. The long tail, elongate rostrum, bulbous braincase, and complex molars of the new species associate it with members of the subgenus Aporodon, tenuirostris species group. In its diminutive size and aspects of cranial shape, the new species (Reithrodontomys musseri, sp. nov.) most closely resembles R. microdon, a form known from highlands in Guatemala and Chiapas, Mexico. In the course of differentially diagnosing the new species, we necessarily reviewed the Costa Rican and Panamanian subspecies of R. mexicanus based on morphological comparisons, study of paratypes and vouchers used in recent molecular studies, and morphometric analyses. We recognize Reithrodontomys cherrii (Allen, 1891) and R. garichensis finders and Pearson, 1940, as valid species, and allocate R. mexicanus potrerograndei Goodwin, 1945, as a subjective synonym of R. brevirostris Goodwin, 1943. Critical review of museum specimens collected subsequent to Hooper's (1952) revision is needed and would do much to improve understanding of Reithrodontomys taxonomy and distribution in Middle America.

  16. [Rural endemic diseases, health and development: Emmanuel Dias and the construction of a network of allies against Chagas disease].


    Kropf, Simone Petraglia


    The scope of this article is to analyze the trajectory of Emmanuel Dias (1908-1962), a researcher at the Oswaldo Cruz Institute (OCI) and director of the Center for Studies and Prophylaxis of Chagas Disease (OCI outpost established in 1943 in the city of Bambuí, Minas Gerais), as a key actor in the acknowledgement of Chagas disease as a public health problem in Brazil and the Americas. It seeks to show that the conquest of this acknowledgement, the cornerstone of which was the staging of the first campaign to combat the disease in Brazil in 1950, was made possible by the intense political mobilization of Dias together with the various social groups, such as physicians, politicians and residents of rural areas, public health officials, governments and international organizations. This mobilization occurred during the 1940s and 1950s in a historical context marked by intense debate about the relationship between health and development and helped to construct a network of alliances that was critical for the recognition of Chagas disease as a chronic cardiopathy, which threatened the productivity of rural workers and represented a medical and social problem that merited public health actions and programs geared to get it under control.

  17. Memo-RhoA-mDia1 signaling controls microtubules, the actin network, and adhesion site formation in migrating cells.


    Zaoui, Kossay; Honoré, Stéphane; Isnardon, Daniel; Braguer, Diane; Badache, Ali


    Actin assembly at the cell front drives membrane protrusion and initiates the cell migration cycle. Microtubules (MTs) extend within forward protrusions to sustain cell polarity and promote adhesion site turnover. Memo is an effector of the ErbB2 receptor tyrosine kinase involved in breast carcinoma cell migration. However, its mechanism of action remained unknown. We report in this study that Memo controls ErbB2-regulated MT dynamics by altering the transition frequency between MT growth and shortening phases. Moreover, although Memo-depleted cells can assemble the Rac1-dependent actin meshwork and form lamellipodia, they show defective localization of lamellipodial markers such as alpha-actinin-1 and a reduced number of short-lived adhesion sites underlying the advancing edge of migrating cells. Finally, we demonstrate that Memo is required for the localization of the RhoA guanosine triphosphatase and its effector mDia1 to the plasma membrane and that Memo-RhoA-mDia1 signaling coordinates the organization of the lamellipodial actin network, adhesion site formation, and MT outgrowth within the cell leading edge to sustain cell motility.

  18. Aberrant overexpression of CD14 on granulocytes sensitizes the innate immune response in mDia1 heterozygous del(5q) MDS.


    Keerthivasan, Ganesan; Mei, Yang; Zhao, Baobing; Zhang, Ling; Harris, Chad E; Gao, Juehua; Basiorka, Ashley A; Schipma, Matthew J; McElherne, James; Yang, Jing; Verma, Amit K; Pellagatti, Andrea; Boultwood, Jacqueline; List, Alan F; Williams, David A; Ji, Peng


    The myelodysplastic syndromes (MDSs) include a spectrum of stem cell malignancies characterized by an increased risk of developing acute myeloid leukemia. Heterozygous loss of chromosome 5q (del[5q]) is the most common cytogenetic abnormality in MDS. DIAPH1 is localized to 5q31 and encodes one of the formin proteins, mDia1, which is involved in linear actin polymerization. Mice with mDia1 deficiency develop hematologic features with age mimicking human myeloid neoplasm, but its role in the pathogenesis of MDS is unclear. Here we report that mDia1 heterozygous and knockout mice develop MDS phenotypes with age. In these mice, CD14 was aberrantly overexpressed on granulocytes in a cell-autonomous manner, leading to a hypersensitive innate immune response to lipopolysaccharide (LPS) stimuli through CD14/Toll-like receptor 4 signaling. Chronic stimulation with LPS accelerated the development of MDS in mDia1 heterozygous and knockout mice that can be rescued by lenalidomide. Similar findings of CD14 overexpression were observed on the bone marrow granulocytes of del(5q) MDS patients. Mechanistically, mDia1 deficiency led to a downregulation of membrane-associated genes and a specific upregulation of CD14 messenger RNA in granulocytes, but not in other lineages. These results underscore the significance of mDia1 heterozygosity in deregulated innate immune responses in del(5q) MDS.

  19. Exploring why Costa Rica outperforms the United States in life expectancy: A tale of two inequality gradients

    PubMed Central

    Rosero-Bixby, Luis; Dow, William H.


    Mortality in the United States is 18% higher than in Costa Rica among adult men and 10% higher among middle-aged women, despite the several times higher income and health expenditures of the United States. This comparison simultaneously shows the potential for substantially lowering mortality in other middle-income countries and highlights the United States’ poor health performance. The United States’ underperformance is strongly linked to its much steeper socioeconomic (SES) gradients in health. Although the highest SES quartile in the United States has better mortality than the highest quartile in Costa Rica, US mortality in its lowest quartile is markedly worse than in Costa Rica’s lowest quartile, providing powerful evidence that the US health inequality patterns are not inevitable. High SES-mortality gradients in the United States are apparent in all broad cause-of-death groups, but Costa Rica’s overall mortality advantage can be explained largely by two causes of death: lung cancer and heart disease. Lung cancer mortality in the United States is four times higher among men and six times higher among women compared with Costa Rica. Mortality by heart disease is 54% and 12% higher in the United States than in Costa Rica for men and women, respectively. SES gradients for heart disease and diabetes mortality are also much steeper in the United States. These patterns may be partly explained by much steeper SES gradients in the United States compared with Costa Rica for behavioral and medical risk factors such as smoking, obesity, lack of health insurance, and uncontrolled dysglycemia and hypertension. PMID:26729886

  20. Exploring why Costa Rica outperforms the United States in life expectancy: A tale of two inequality gradients.


    Rosero-Bixby, Luis; Dow, William H


    Mortality in the United States is 18% higher than in Costa Rica among adult men and 10% higher among middle-aged women, despite the several times higher income and health expenditures of the United States. This comparison simultaneously shows the potential for substantially lowering mortality in other middle-income countries and highlights the United States' poor health performance. The United States' underperformance is strongly linked to its much steeper socioeconomic (SES) gradients in health. Although the highest SES quartile in the United States has better mortality than the highest quartile in Costa Rica, US mortality in its lowest quartile is markedly worse than in Costa Rica's lowest quartile, providing powerful evidence that the US health inequality patterns are not inevitable. High SES-mortality gradients in the United States are apparent in all broad cause-of-death groups, but Costa Rica's overall mortality advantage can be explained largely by two causes of death: lung cancer and heart disease. Lung cancer mortality in the United States is four times higher among men and six times higher among women compared with Costa Rica. Mortality by heart disease is 54% and 12% higher in the United States than in Costa Rica for men and women, respectively. SES gradients for heart disease and diabetes mortality are also much steeper in the United States. These patterns may be partly explained by much steeper SES gradients in the United States compared with Costa Rica for behavioral and medical risk factors such as smoking, obesity, lack of health insurance, and uncontrolled dysglycemia and hypertension.

  1. Clinical relevance of Helicobacter pylori babA2 and babA2/B in Costa Rica and Japan

    PubMed Central

    Con, Sergio A; Takeuchi, Hiroaki; Nishioka, Mitsuaki; Morimoto, Norihito; Sugiura, Tetsuro; Yasuda, Nobufumi; Con-Wong, Reinaldo


    AIM: To evaluate the prevalence of Helicobacter pylori (H. pylori) babA2, babB and a recombinant gene between babA2 and babB (babA2/B), and their role in the development of atrophic gastritis in Costa Rican and Japanese clinical isolates. METHODS: A total of 95 continuous H. pylori-positive Costa Rican (41 males and 54 females; mean age, 50.65 years; SD, ± 13.04 years) and 95 continuous H. pylori-positive Japanese (50 males and 45 females; mean age, 63.43; SD, ± 13.21 years) patients underwent upper endoscopy from October 2005 to July 2006. They were enrolled for the polymerase chain reaction (PCR)-based genotyping of the H. pylori babA2, babB and babA2/B genes. Statistical analysis was performed using the χ2 test and the Fisher’s exact probability test and multivariate analysis was performed by logistic regression adjusting for gender and age. P < 0.05 was regarded as statistically significant. RESULTS: The PCR-based genotyping of 95 Costa Rican and 95 Japanese isolates showed a higher prevalence of babA2 in Japan (96.8%) than in Costa Rica (73.7%), while that of babA2/B was higher in Costa Rica (11.6%) than in Japan (1.1%). In Costa Rican isolates only, babA2 was significantly associated with atrophic gastritis (P = 0.01). CONCLUSION: These results suggest that the status of babA2 and babA2/B shows geographic differences, and that babA2 has clinical relevance in Costa Rica. PMID:20101774

  2. Integrating multi-view transmission system into MPEG-21 stereoscopic and multi-view DIA (digital item adaptation)

    NASA Astrophysics Data System (ADS)

    Lee, Seungwon; Park, Ilkwon; Kim, Manbae; Byun, Hyeran


    As digital broadcasting technologies have been rapidly progressed, users' expectations for realistic and interactive broadcasting services also have been increased. As one of such services, 3D multi-view broadcasting has received much attention recently. In general, all the view sequences acquired at the server are transmitted to the client. Then, the user can select a part of views or all the views according to display capabilities. However, this kind of system requires high processing power of the server as well as the client, thus posing a difficulty in practical applications. To overcome this problem, a relatively simple method is to transmit only two view-sequences requested by the client in order to deliver a stereoscopic video. In this system, effective communication between the server and the client is one of important aspects. In this paper, we propose an efficient multi-view system that transmits two view-sequences and their depth maps according to user's request. The view selection process is integrated into MPEG-21 DIA (Digital Item Adaptation) so that our system is compatible to MPEG-21 multimedia framework. DIA is generally composed of resource adaptation and descriptor adaptation. It is one of merits that SVA (stereoscopic video adaptation) descriptors defined in DIA standard are used to deliver users' preferences and device capabilities. Furthermore, multi-view descriptions related to multi-view camera and system are newly introduced. The syntax of the descriptions and their elements is represented in XML (eXtensible Markup Language) schema. If the client requests an adapted descriptor (e.g., view numbers) to the server, then the server sends its associated view sequences. Finally, we present a method which can reduce user's visual discomfort that might occur while viewing stereoscopic video. This phenomenon happens when view changes as well as when a stereoscopic image produces excessive disparity caused by a large baseline between two cameras. To

  3. New records of benthic marine algae and Cyanobacteria for Costa Rica, and a comparison with other Central American countries

    NASA Astrophysics Data System (ADS)

    Bernecker, Andrea; Wehrtmann, Ingo S.


    We present the results of an intensive sampling program carried out from 2000 to 2007 along both coasts of Costa Rica, Central America. The presence of 44 species of benthic marine algae is reported for the first time for Costa Rica. Most of the new records are Rhodophyta (27 spp.), followed by Chlorophyta (15 spp.), and Heterokontophyta, Phaeophycea (2 spp.). Overall, the currently known marine flora of Costa Rica is comprised of 446 benthic marine algae and 24 Cyanobacteria. This species number is an under estimation, and will increase when species of benthic marine algae from taxonomic groups where only limited information is available (e.g., microfilamentous benthic marine algae, Cyanobacteria) are included. The Caribbean coast harbors considerably more benthic marine algae (318 spp.) than the Pacific coast (190 spp.); such a trend has been observed in all neighboring countries. Compared to other Central American countries, Costa Rica has the highest number of reported benthic marine algae; however, Panama may have a similarly high diversity after unpublished results from a Rhodophyta survey (Wysor, unpublished) are included. Sixty-two species have been found along both the Pacific and Caribbean coasts of Costa Rica; we discuss this result in relation to the emergence of the Central American Isthmus.

  4. [Environmental Guarantees in the Constitution: a new ecological-political model for Costa Rica and the rest of the world].


    Quesada A, Gabriel


    In the last thirty years significant changes to protect the environment have been introduced in the judicial, administrative and social systems. Costa Rica is a well known international model in the field of sustainable development, and here I present a proposal for adding environmental gaurantees to the Costa Rican Constitution. One of the most important changes in the Costa Rican judicial system has been the introduction of an environmental amendment in the Constitution (Article 50). However, it is still fundamental to introduce a Title of Environmental Guarantees in the Constitution of Costa Rica, with these components: first, the State, the public and the private sector have the duty of defending the right to a safe environment; second, public domain over environmental issues, and third, the use of the environment should be regulated by scientific and technical knowledge. If current efforts succeed, Costa Rica will be the first country in the world to include Environmental Guarantees in its Constitution. This would be an example to other nations.

  5. The formin DIAPH1 (mDia1) regulates megakaryocyte proplatelet formation by remodeling the actin and microtubule cytoskeletons.


    Pan, Jiajia; Lordier, Larissa; Meyran, Deborah; Rameau, Philippe; Lecluse, Yann; Kitchen-Goosen, Susan; Badirou, Idinath; Mokrani, Hayat; Narumiya, Shuh; Alberts, Arthur S; Vainchenker, William; Chang, Yunhua


    Megakaryocytes are highly specialized precursor cells that produce platelets via cytoplasmic extensions called proplatelets. Proplatelet formation (PPF) requires profound changes in microtubule and actin organization. In this work, we demonstrated that DIAPH1 (mDia1), a mammalian homolog of Drosophila diaphanous that works as an effector of the small GTPase Rho, negatively regulates PPF by controlling the dynamics of the actin and microtubule cytoskeletons. Moreover, we showed that inhibition of both DIAPH1 and the Rho-associated protein kinase (Rock)/myosin pathway increased PPF via coordination of both cytoskeletons. We provide evidence that 2 major effectors of the Rho GTPase pathway (DIAPH1 and Rock/myosin II) are involved not only in Rho-mediated stress fibers assembly, but also in the regulation of microtubule stability and dynamics during PPF.

  6. Radiation Detection Field Test at the Federal Express (FedEx) Air Cargo Facility at Denver International Airport (DIA)

    SciTech Connect

    Weirup, D; Waters, A; Hall, H; Dougan, A; Trombino, D; Mattesich, G; Hull, E; Bahowick, S; Loshak, A; Gruidl, J


    Lawrence Livermore National Laboratory (LLNL) recently conducted a field-test of radiation detection and identification equipment at the air cargo facility of Federal Express (FedEx) located at Denver International Airport (DIA) over a period of two weeks. Comprehensive background measurements were performed and were analyzed, and a trial strategy for detection and identification of parcels displaying radioactivity was implemented to aid in future development of a comprehensive protection plan. The purpose of this project was threefold: {sm_bullet} Quantify background radiation environments at an air cargo facility. {sm_bullet} Quantify and identify ''nuisance'' alarms. {sm_bullet} Evaluate the performance of various isotope identifiers deployed in an operational environment (in this case, the operational environment included the biggest blizzard in over 90 years!).

  7. Costa Rica’s implementation of the Framework Convention on Tobacco Control: Overcoming decades of industry dominance

    PubMed Central

    Crosbie, Eric; Sosa, Patricia; Glantz, Stanton A


    Objective To analyze the passage of Costa Rica’s 2012 tobacco control law. Materials and methods Review of legislation, newspaper articles, and key informant interviews. Results Tobacco control advocates, in close collaboration with international health groups, recruited national, regional and international experts to testify in the Legislative Assembly, implemented grassroots advocacy campaigns, and generated media coverage to enact strong legislation in March 2012 consistent with the World Health Organization Framework Convention on Tobacco Control, despite tobacco industry lobbying efforts that for decades blocked effective tobacco control legislation. Conclusion Costa Rica’s experience illustrates how with resources, good strategic planning, aggressive tactics and perseverance tobacco control advocates can overcome tobacco industry opposition in the Legislative Assembly and Executive Branch. This determined approach has positioned Costa Rica to become a regional leader in tobacco control. PMID:26879509

  8. Cryptic species within cryptic moths: new species of Dunama Schaus (Notodontidae, Nystaleinae) in Costa Rica.


    Chacón, Isidro A; Janzen, Daniel H; Hallwachs, Winnie; J Bolling Sullivan; Hajibabaei, Mehrdad


    Based on almost 1,700 recently reared and wild-collected specimens, the genus Dunama Schaus (Notodontidae, Nystaelinae) in Costa Rica is reviewed. Eight species are recorded of which seven are newly described: Dunama jessiehillae Chacón, Dunama jessiebarronae Chacón, Dunama janewaldronae Chacón, Dunama jessiebancroftae Chacón, Dunama janecoxae Chacón, Dunama biosise Chacón, Dunama indereci Chacón. Dunama angulinea Schaus is redescribed and associated with its correct genitalia. Dunama tuna (Schaus), previously listed as ocurring in Costa Rica, is restricted to Colombia. Most species are described through their distinctive CO1 barcodes, genitalia and life histories. Dunama adults and caterpillars, their foodplants, and their parasites in Area de Conservación Guanacaste (ACG) in northwestern Costa Rica are described where known. Many life history stages are illustrated.

  9. CompCytogen of two of the smallest Amazonian fishes: Fluviphylax simplex Costa, 1996 and Fluviphylax zonatus Costa, 1996 (Cyprinodontiformes, Poeciliidae)

    PubMed Central

    Souza, E.R.; Ribeiro, L.B.; Feldberg, E.; Hrbek, I.P. Farias T.; Gross, M.C.


    Abstract The genus Fluviphylax Whitley, 1965is comprized of five valid species (Fluviphylax pygmaeus Myers et Carvalho, 1955, Fluviphylax zonatus, Fluviphylax simplex, Fluviphylax obscurus Costa, 1996,and Fluviphylax palikur Costa et Le Bail, 1999), which are endemic to the Amazon region. These fishes are the smallest known South American vertebrates and among the smallest know vertebrates on Earth. All species but the type Fluviphylax pygmaeus have been described in late 1990’s, and much remains unknown about the biology, taxonomy and systematics of this group of fishes. The aims of the present study were to establish the diploid and haploid number of Fluviphylax zonatus and Fluviphylax simplex, and to find species-specific markers for the discrimination of taxa. The diploid number for both species was 48 chromosomes, with no sex chromosome heteromorphism. Fluviphylax zonatus exhibited the karyotypic formula 4m+8sm+22st+14a and FN=82, and Fluviphylax simplex exhibited 4m+16sm+18st+10a and FN=86. The determination of the total mean length of the chromosomes and their grouping into five size classes demonstrated different chromosome composition of the two species. This difference was further supported by the distribution of constitutive heterochromatin. The meiotic analysis revealed 24 bivalents in both species, but Fluviphylax zonatus exhibited chromosomes with late pairing of the telomeric portions in the pachytene. These data reveal that cytogenetic characterization is useful and important for the discrimination of these species. Our study further indicates that this method could be employed in the analysis of other species of small fishes that are difficult to distinguish using traditional morphological traits or are morphologically cryptic. PMID:24260645

  10. The annual cycle and biological effects of the Costa Rica Dome

    NASA Astrophysics Data System (ADS)

    Fiedler, Paul C.


    The Costa Rica Dome is similar to other tropical thermocline domes in several respects: it is part of an east-west thermocline ridge associated with the equatorial circulation, surface currents flow cyclonically around it, and its seasonal evolution is affected by large-scale wind patterns. The Costa Rica Dome is unique because it is also forced by a coastal wind jet. Monthly climatological fields of thermocline depth and physical forcing variables (wind stress curl and surface current divergence) were analyzed to examine the structure and seasonal evolution of the dome. The annual cycle of the dome can be explained by wind forcing in four stages: (1) coastal shoaling of the thermocline off the Gulf of Papagayo during February-April, forced by Ekman pumping on the equatorward side of the Papagayo wind jet; (2) separation from the coast during May-June when the intertropical convergence zone (ITCZ) moves north to the countercurrent thermocline ridge, the wind jet stops, and the North Equatorial Countercurrent extends toward the coast on the equatorward flank of the ridge; (3) countercurrent thermocline ridging during July-November, when the dome expands to the west as the countercurrent thermocline ridge shoals beneath a band of cyclonic wind stress curl on the poleward side of the ITCZ; and (4) deepening during December-January when the ITCZ moves south and strong trade winds blow over the dome. Coastal eddies may be involved in the coastal shoaling observed during February-March. A seasonally predictable, strong, and shallow thermocline makes the Costa Rica Dome a distinct biological habitat where phytoplankton and zooplankton biomass are higher than in surrounding tropical waters. The physical structure and biological productivity of the dome affect the distribution and feeding of whales and dolphins, probably through forage availability.

  11. Breast Cancer Characteristics and Survival in a Hispanic Population of Costa Rica

    PubMed Central

    Srur-Rivero, Nadia; Cartin-Brenes, Mayra


    BACKGROUND Breast cancer characteristics may vary according to the patient’s ethnic group. The goal of this cohort study was to evaluate the characteristics of a group of Costa Rican breast cancer patients and their relationship with survival. METHODS Age, stage, tumor grade, immunohistochemistry, lymphovascular invasion, recurrence, and survival data on 199 Hispanic patients with breast cancer diagnosis, treated between January 2009 and May 2010, were collected from a single institution in San Jose, Costa Rica. The data were statistically analyzed for significance. RESULTS Median age at diagnosis was 53 years. With a median follow-up of 46.5 months, there was an 88% overall survival rate. Thirty-seven percent of the patients (p < 0.001) were at stages III and IV during diagnosis. The hormone receptor human epidermal receptor negative phenotype (HR−HER2−) (p < 0.001) was present in 17% of the cases. In a multivariate analysis, local (risk ratio, RR: 7.2; confidence interval, CI 95%: 3.8–7.6; p = 0.06) and distant recurrence (RR: 14.9; CI 95%: 7.7–28.9; p = 0.01) showed the strongest association with the probability of death from the disease. Patients with HR−HER2− phenotype tumors reported more local recurrences (p = 0.04), a higher tumor grade (p < 0.01), and lower overall survival than patients with other breast cancer phenotypes (p = 0.01). CONCLUSIONS Although this study analyzes a modest number of cases, it is an initial insight into factors that may contribute to differences in breast cancer outcomes among Hispanic women in Costa Rica. The higher proportion of triple negative tumors, advanced stage, and younger median age at diagnosis could contribute to the inferior prognostic described among Hispanic women. There may be a different distribution of tumor subtypes compared to non-Hispanic white women. Further studies are necessary to confirm such findings. PMID:25125980

  12. In vitro antimalarial activity of extracts of some plants from a biological reserve in Costa Rica.


    Chinchilla, Misael; Valerio, Idalia; Sánchez, Ronald; Mora, Víctor; Bagnarello, Vanessa; Martínez, Laura; Gonzalez, Antonieta; Vanegas, Juan Carlos; Apestegui, Alvaro


    Treatment with the usual antimalarial drugs, have induced parasite resistance, reinforcing the need to finding natural antimalarial components that would be found on plants from the forest. Therefore, we decided to look for these components in Costa Rican plants from a protected forest area. Fresh and dry extracts of roots, bark, leaves, flowers and fruits of 25 plants from a biological reserve in Costa Rica, Reserva Biol6gica Alberto Manuel Brenes (REBAMB), were studied in vitro for the presence of substances with antimalarial activity. By studying the inhibition of P berghei schizogony, we assessed the antimalarial activity of several plant extracts: Aphelandra aurantiaca, A. tridentata (Acanthaceae); Xanthosoma undipes (Araceae); Iriartea deltoidea (Arecaceae); Neurolaena lobata (Asteraceae); Senna papillosa, Pterocarpus hayessi, Lonchocarpus pentaphyllus (Fabaceae); Nectandra membranacea, Persea povedae, Cinamomum chavarrianum (Lauraceae); Hampea appendiculata (Malvaceae); Ruagea glabra, Guarea glabra (Meliaceae); Psidium guajava (Myrtaceae); Bocconia frutescens (Papaveraceae); Piper friedrichsthalii (Piperaceae); Clematis dioica (Ranunculaceae); Prunus annularis (Rosaceae); Siparuna thecaphora (Siparunaceae); Solanum arboreum, Witheringia solanacea (Solanaceae); Ticodendrum incognitum (Ticodendraceae); Heliocarpus appendiculatus (Tiliaceae) and Myriocarpa longipes (Urticaceae). We used different parts of the plants as well as fresh and dried extracts for testing IC50. The solid content of the extracts ranged from 1-71.9 microg/mL. The fresh extracts showed stronger activity than the dry ones. Since the plants showing the strongest antimalarial activity are very common in Central America, and some similar genera of these plants have shown positives results in South America, we considered important to present these findings for discussion. On the other hand, this is the first systematic study of this kind ever realized in a circumscribed and protected area of

  13. Ancestry informative markers clarify the regional admixture variation in the Costa Rican population.


    Cámpos-Sanchez, Rebeca; Raventós, Henriette; Barrantes, Ramiro


    The genetic structure of Costa Rica's population is complex, both by region and by individual, due to the admixture process that started during the 15th century and historical events thereafter. Previous studies have been done mostly on Amerindian populations and the Central Valley inhabitants using various microsatellites and mitochondrial DNA markers. Here, we study for the first time a random sample from all regions of the country with ancestry informative markers (AIMs) to address the individual and regional admixture proportions. A sample of 160 male individuals was screened for 78 AIMs customized in a GoldenGate platform from Illumina. We observed that this small set of AIMs has the same power of hundreds of microsatellites and thousands of single-nucleotide polymorphisms to evaluate admixture, with the benefit of reducing genotyping costs. This type of investigation is necessary to explore new genetic markers useful for forensic and genetic investigation. Our data showed a mean admixture proportion of 49.2% European (EUR), 37.8% Native American (NAM), and 12.9% African (AFR), with a disproportionate admixture composition by region. In addition, when Chinese (CHB) was included as a fourth component, the proportions changed to 45.6% EUR, 33.5% NAM, 11.7% AFR, and 9.2% CHB. The admixture trend is consistent among all regions (EUR > NAM > AFR), and individual admixture estimates vary broadly in each region. Though we did not find stratification in Costa Rica's population, gene admixture should be evaluated in future genetic studies of Costa Rica, especially for the Caribbean region, as it contains the largest proportion of African ancestry (30.9%).

  14. Estrogenic effects of herbal medicines from Costa Rica used for the management of menopausal symptoms

    PubMed Central

    Doyle, Brian J.; Frasor, Jonna; Bellows, Lauren E.; Locklear, Tracie D.; Perez, Alice; Gomez- Laurito, Jorge; Mahady, Gail. B.


    Objective Outcomes from the Women's Health Initiative have demonstrated adverse effects associated with hormone therapy (HT), and have prioritized the need to develop new alternative treatments for the management of menopause and osteoporosis. To this end, we have been investigating natural herbal medicines used by Costa Rican women to manage menopausal symptoms. Design Seventeen plant species were collected and extracted in Costa Rica. To establish possible mechanisms of action, and determine their potential future use for menopause or osteoporosis, the estrogenic activities of the herbal extracts were investigated in an estrogen reporter gene ERβ-CALUX® assay in U2-OS cells, and in reporter and endogenous gene assays in MCF-7 cells. Results Six of the plant extracts bound to the estrogen receptors. Four of the six extracts stimulated reporter gene expression in the ERβ-CALUX® assay. All six extracts modulated expression of endogenous genes in MCF-7 cells, with four extracts acting as estrogen agonists and two extracts, Pimenta dioica and Smilax domingensis, acting as partial agonist/antagonists by enhancing E2-stimulated pS2 mRNA expression, but reducing E2-stimulated PR and PTGES mRNA expression. Both P. dioica and S. domingensis induced a 2ERE-luciferase reporter gene in transient transfected MCF-7 cells, which was inhibited by the ER antagonist ICI 182780. Conclusions This work presents a plausible mechanism of action for many of the herbal medicines used by Costa Rican women to treat menopausal symptoms. However, it further suggests that studies of safety and efficacy are needed before these herbs should be used as alternative therapies to HT. PMID:19424091

  15. Results from the Astronomy Diagnostic Test: 3 Years at MiraCosta College

    NASA Astrophysics Data System (ADS)

    Sirbaugh French, Rica


    The Astronomy Diagnostic Test 2.0 (ADT) was administered to 26 sections of ASTR 101 at MiraCosta College (MCC) from fall 2004 through summer 2007. MiraCosta is a two-year community college located in Oceanside, CA, USA (roughly 40 miles north of San Diego) with an enrollment of approximately 11,000 students. ASTR 101 is MiraCosta's introductory astronomy survey course for non-science majors and has no math prerequisite. Class sizes ranged from 10 to 38 students. Comparison with the ADT National Project results indicates similar pre- and post-course averages: 31.8% (MCC) vs. 32.4% (National) for pre-course tests and 49.3% (MCC) vs. 47.3% (National) for post-course tests. The sample sizes are 709 and 530 students for the pre- and post-tests, respectively. The normalized gain for the entire data set is 0.256 and the effect size (ES) is 1.04, meaning that approximately 85% of the post-test scores are above the average of the pre-test scores. Previous studies have shown the ADT to be a reliable indicator of pre-course misconceptions while post-course scores are useful for comparing modes of instruction and assessing student learning on a limited number of concepts. Additional analyses of the MCC data probe for trends with variables such as gender, class size, and implementation of materials designed for a more "learner-centered” approach (such as Lecture Tutorials, Ranking Tasks, and Think-Pair-Share questions), as well as gains for a particular subset of concepts.

  16. Effect of hydrothermal circulation on slab dehydration for the subduction zone of Costa Rica and Nicaragua

    NASA Astrophysics Data System (ADS)

    Rosas, Juan Carlos; Currie, Claire A.; Harris, Robert N.; He, Jiangheng


    Dehydration of subducting oceanic plates is associated with mantle wedge melting, arc volcanism, intraslab earthquakes through dehydration embrittlement, and the flux of water into the mantle. In this study, we present two-dimensional thermal models of the Costa Rica-Nicaragua subduction zone to investigate dehydration reactions within the subducting Cocos plate. Seismic and geochemical observations indicate that the mantle wedge below Nicaragua is more hydrated than that below Costa Rica. These trends have been hypothesized to be due to a variation in either the thermal state or the hydration state of the subducting slab. Despite only small variations in plate age along strike, heat flow measurements near the deformation front reveal significantly lower heat flow offshore Nicaragua than offshore Costa Rica. These measurements are interpreted to reflect an along-strike change in the efficiency of hydrothermal circulation in the oceanic crust. We parameterize thermal models in terms of efficient and inefficient hydrothermal circulation and explore their impact on slab temperature in the context of dehydration models. Relative to models without fluid flow, efficient hydrothermal circulation reduces slab temperature by as much at 60 °C to depths of ∼75 km and increases the predicted depth of eclogitization by ∼15 km. Inefficient hydrothermal circulation has a commensurately smaller influence on slab temperatures and the depth of eclogitization. For both regions, the change in eclogitization depth better fits the observed intraslab crustal seismicity, but there is not a strong contrast in the slab thermal structure or location of the main dehydration reactions. Consistent with other studies, these results suggest that observed along-strike differences in mantle wedge hydration may be better explained by a northwestward increase in the hydration state of the Cocos plate before it is subducted.

  17. [Medusae (Cnidaria: Hydrozoa) from a coastal upwelling zone, Culebra Bay, Pacific, Costa Rica].


    Rodríguez-Sáenz, Karina; Vargas-Zamora, José A; Segura-Puertas, Lourdes


    The hydromedusae have an important role in marine trophic webs due to their predatory feeding habits. This is the first study of this group of gelatinous marine zooplankton in a coastal upwelling area of Central America. The composition and abundance variability of hydromedusae were studied during six months in 1999 at four stations in Culebra Bay, Gulf of Papagayo, Pacific coast of Costa Rica (10 degrees 37' N-85 degrees 40' W). A total of 53 species were identified, of which 26 are new records for Costa Rica, 21 are new records for Central America, and eight are new records for the Eastern Tropical Pacific. The more abundant species (more than 30% of the total abundance) were Liriope tetraphylla, Solmundella bitentaculata and Aglaura hemistoma. Six species occurred throughout the sampling period, 10 were present only during the dry season (December-April), and 17 were so during the rainy season (May-November). Significant differences of medusan abundances were found between seasons (dry vs. rainy). Maximum abundance (2.1 +/- 4.3ind./m3) was recorded when upwelled deeper water influenced the Bay, as indicated by local higher oxygen concentrations and lower water temperatures. The relatively high species richness of medusae found in Culebra Bay is probably related to factors like the pristine condition of the Bay, the arrival of oceanic species transported by the Equatorial Counter Current (ECC), the eastward shoaling of the Costa Rica Dome, and local currents. Illustrations of the 15 more important species are included to facilitate their identification and foster future work in the region.

  18. The Gulf of Nicoya Estuary, Costa Rica: Past, present, and future cooperative research

    NASA Astrophysics Data System (ADS)

    Vargas, J. A.


    The Gulf of Nicoya is a tectonic estuary on the Pacific coast of Costa Rica (10°N 85°W), extending about 100 km from the Tempisque river to the 500 m isobath. A dry season (December April) and a rainy season (May November) exert a significant impact on its water characteristics. The estuary is the most important fishing ground of Costa Rica, and the main Pacific ports are located within it. Coastal zone development has increased in recent years. In 1979 a research programme to study the Gulf was established at the University of Costa Rica, and foreign scientists were invited to work jointly with local experts to achieve the goals of the evaluation. More than 80 papers have been published to date, making the Gulf one of the best known tropical estuaries. The study of soft-bottom communities is an important component of this research programme. Past benthic research focused on the description of the structure of communities, while future efforts will find an unexplored field in the study of energy flow and community interactions. More than 200 species of fish, and 400 of benthic invertebrates have been identified. Future cooperative research is most welcome in larval ecology, interactions between size groups, and physiological tolerances. Considerable experience has been accumulated in the experimental manipulation of soft-bottom communities of high latitudes. This branch of ecology, however, remains little explored in the tropics. Future cooperative efforts in the Gulf of Nicoya will be established on solid ground, formed by a data base that has been improved since 1979, the existence of a marine research centre and a group of active, local scientists who have experience in working together with foreign expertise.

  19. Isolation and molecular characterization of Xylella fastidiosa from coffee plants in Costa Rica.


    Montero-Astúa, Mauricio; Chacón-Díaz, Carlos; Aguilar, Estela; Rodríguez, Carlos Mario; Garita, Laura; Villalobos, William; Moreira, Lisela; Hartung, John S; Rivera, Carmen


    Coffee plants exhibiting a range of symptoms including mild to severe curling of leaf margins, chlorosis and deformation of leaves, stunting of plants, shortening of internodes, and dieback of branches have been reported since 1995 in several regions of Costa Rica's Central Valley. The symptoms are referred to by coffee producers in Costa Rica as "crespera" disease and have been associated with the presence of the bacterium Xylella fastidiosa. Coffee plants determined to be infected by the bacterium by enzyme linked immunosorbent assay (ELISA), were used for both transmission electron microscopy (TEM) and for isolation of the bacterium in PW broth or agar. Petioles examined by TEM contained rod-shaped bacteria inside the xylem vessels. The bacteria measured 0.3 to 0.5 microm in width and 1.5 to 3.0 microm in length, and had rippled cell walls 10 to 40 nm in thickness, typical of X. fastidiosa. Small, circular, dome-shaped colonies were observed 7 to 26 days after plating of plant extracts on PW agar. The colonies were comprised of Gram-negative rods of variable length and a characteristic slight longitudinal bending. TEM of the isolated bacteria showed characteristic rippled cell walls, similar to those observed in plant tissue. ELISA and PCR with specific primer pairs 272-l-int/272-2-int and RST31/RST33 confirmed the identity of the isolated bacteria as X. fastidiosa. RFLP analysis of the amplification products revealed diversity within X. fastidiosa strains from Costa Rica and suggest closer genetic proximity to strains from the United States of America than to other coffee or citrus strains from Brazil.

  20. Southern Costa Rica: an Island-arc Segment That Behaves Like a Doubly Vergent Orogen

    NASA Astrophysics Data System (ADS)

    Brandes, C.; Winsemann, J.


    Southern Central America is a Mesosoic/Cenozoic island-arc that evolved from the subduction of the Farallón Plate below the Caribbean Plate. The southern Costa Rican land-bridge comprises deformed fore-arc and back-arc basins in the west and east, respectively, separated by the up to 3.8 km high Talamanca Range. The structure of the southern Central American island-arc is similar to doubly vergent and asymmetric orogens. The deformed fore-arc basin in the west and the Limon fold-and-thrust belt in the east can be interpreted as pro-wedge and retro-wedge, respectively. The Talamanca Range represents the uplifted block in between. The pro-wedge is wider and has a lower slope angle than the retro-wedge. The uplift of the Talamanca Range is probably related to a system of conjugate shear zones. Precipitation is unevenly distributed, with orographic effects concentrating precipitation in SW Costa Rica, which has caused pro-wedge denudation, leading to exhumation of granitic rocks at in the interior of the mountain range. The large-scale structure of the Central American island-arc in southern Costa Rica can be described using models of continental collision zones. Previous studies attributed the deformation and uplift pattern to the subduction/collision of the Cocos Ridge. Another reasonable driving mechanism for the evolution of such an orogen in an oceanic island-arc setting is the basal traction due to long-term subduction of the Cocos Plate at a very low angle.

  1. [Isolation of Vibrio cholerae no-01 in the Gulf of Nicoya, Costa Rica].


    Antillón, F; Rodríguez, E


    In a bacteriological study on samples of bivalves, mud and surface waters from the Gulf of Nicoya, Costa Rica, 18 strains of non-01 Vibrio cholerae and 50 of V. mimicus were isolated. The samples were enriched in alkaline peptone water, and streaked on MacConkey and inositol-brilliant green bile agars. Biochemical and serological tests were used for their identification. Both species were isolated from all sampling sites (Lepanto, Jicaral and Puntarenas) with either of the two agar media, even though these were not specific for vibrios.

  2. An epidemiologic study of unreported cutaneous malignant melanoma among residents of Alameda and Contra Costa Counties

    SciTech Connect

    West, D.W.; Whittemore, A.S. Stanford Univ., CA ); Zippin, C.; Lum, D. ); Holly, E. )


    Because of a reported excess of cutaneous malignant melanoma cases at the Lawrence Livermore National Laboratory during the 1970's this study was funded to: determine if the number of cases in Alameda and Contra Costa Counties may have been underreported during 1973--1985 (this is the comparison group used to report an excess of melanoma at the LLNL), and determine if melanoma cases at the LLNL had different melanomas from the comparison population in terms of tumor thickness and therefore aggressiveness of tumors. The results of these two objectives are reported in the form of two papers, each dealing with one of the objectives.

  3. Chemical analyses for selected wells in San Joaquin County and part of Contra Costa County, California

    USGS Publications Warehouse

    Keeter, Gail L.


    The study area of this report includes the eastern valley area of Contra Costa County and all of San Joaquin County, an area of approximately 1,600 square miles in the northern part of the San Joaquin Valley, Calif. Between December 1977 and December 1978, 1,489 wells were selectively canvassed. During May and June in 1978 and 1979, water samples were collected for chemical analysis from 321 of these wells. Field determinations of alkalinity, conductance, pH, and temperature were made, and individual constituents were analyzed. This report is the fourth in a series of baseline data reports on wells in the Sacramento and San Joaquin Valleys. (USGS)

  4. A new fish, Peristedion nesium (Scorpaeniformes: Peristediidae) from Isla del Coco, Costa Rica.


    Bussing, William A


    Several expeditions in recent years to Isla del Coco have increased the total number of species of fishes known from the island. Several of these species have been described as new endemics (Bussing 1983, 1990, 1991a, 1991b, 1997). During the 1972 R/V Searcher Expedition to Costa Rica several trawl collections were made around Isla del Coco. At five localities in depths between 110 and 180m, 86 specimens of a new species of Peristedion were taken and are described herein. A key to the four species of Eastern Pacific Peristedion is included.

  5. [Distribution, surface and protected area of palm-swamps in Costa Rica and Nicaragua].


    Serrano-Sandí, Juan; Bonilla-Murillo, Fabian; Sasa, Mahmood


    In Central America, palm swamps are known collectively as yolillales. These wetlands are usually dominated by the raffia palm Raphia taedigera, but also by the royal palm Manicaria saccifera and -in lower extensions- by the American oil palm Elaeis oleifera. The yolillales tend to be poor in woody species and are characteristic of regions with high rainfall and extensive hydroperiods, so they remain flooded most of the year. The dominance of large raffia palm leaves in the canopy, allow these environments to be distinguishable in aerial photographs, which consequently has helped to map them along most of their distribution. However, while maps depicting yolillales are available, the extent of their surface area, perimeter and connectivity remains poorly understood. This is particularly true for yolillales in Costa Rica and Nicaragua, countries that share a good proportion of palm dominated swaps in the Rio San Juan Basin. In addition, it is not known the actual area of these environments that is under any category of protection according to the conservation systems of both countries. As a first step to catalog yolillal wetlands in Costa Rica and Nicaragua, this paper evaluates cartographic maps to delineate yolillales in the region. A subsample of yolillales mapped in this study were visited and we geo-referenced them and evaluate the extent and condition of the swamp. A total of 110 883.2ha are classified as yolillales in Nicaragua, equivalent to 22% of wetland surface area recorded for that country (excluding the Cocibolca and Xolothn Lakes). In Costa Rica, 53 931.3ha are covered by these palm dominated swamps, which represent 16.24% of the total surface area covered by wetlands. About 47% of the area covered by yolillales in Nicaragua is under some category of protection, the largest extensions protected by Cerro Silva, Laguna Tale Sulumas and Indio Maiz Nature Reserves. In Costa Rica, 55.5% of the area covered by yolillal is located within protected areas

  6. A new species of Metagovea Rosas Costa, 1950 from Napo Province, Ecuador (Opiliones, Cyphophthalmi, Neogoveidae)

    PubMed Central

    Giupponi, Alessandro P. L.; Kury, Adriano Brilhante


    Abstract As a result of an expedition to Ecuador in 2014, a new species of mite harvestman was discovered. This new species belonging to the genus Metagovea Rosas Costa, 1950 – Metagovea ligiae sp. n. – is described, based on male and female specimens from Napo Province, Ecuador. This is the fourth species described for the genus and the second from Ecuador. A simple terminology is proposed for the microtrichiae of the spermatopositor and genital characters in the family are discussed. The genus Brasiliogovea Martens, 1969 is consistently misspelled in the literature as Brasilogovea. The description of Metagovea ligiae offered opportunity to discuss some aspects of systematics of the family. PMID:25685003

  7. The decline in infant mortality in Costa Rica, 1950-1973: modernization or technological diffusion?


    Klijzing Fkh; Taylor, H W


    Spatial patterns of infant mortality in Costa Rica are examined for the period 1950-1973, with special attention paid to contagious diffusion effects. In more general terms, the study is considered as an example of the spatial structures that arise during the process of demographic transition and modernization. The data are from official sources. The authors conclude that the census year 1950 probably marks the transition from a stage where technological diffusion had the primary effect on mortality to a stage where socioeconomic modernization played the major role.

  8. Spatial patterns of age-sex structures in Costa Rica: a study in demographic modernization.


    Taylor, H W; Fesenmaier, D R


    The relationship between economic development and demographic factors in Costa Rica is examined. "Specifically, the paper illustrates the evolution of spatial patterns in age-sex structures over three points in time for a single case study area." The authors suggest that there is order in the evolving patterns and that this order may be explained by the economic modernization process. Data are from the 1950, 1963, and 1973 censuses. Although some spatial order is indicated, the patterns are confused primarily by an increase in fertility that apparently occurred between 1950 and 1963.

  9. Analysis of power sector efficiency improvements for an integrated utility planning process in Costa Rica

    SciTech Connect

    Waddle, D.B.; MacDonald, J.M.


    In an effort to analyze and document the potential for power sector efficiency improvements from generation to end-use, the Agency for International Development and the Government of Costa Rica are jointly conducting an integrated power sector efficiency analysis. Potential for energy and cost savings in power plants, transmission and distribution, and demand-side management programs are being evaluated. The product of this study will be an integrated investment plan for the Instituto Costarricense de Electricidad, incorporating both supply and demand side investment options. This paper presents the methodology employed in the study, as well as preliminary estimates of the results of the study. 14 refs., 4 figs., 5 tabs.

  10. Integrated power sector efficiency analysis: A case study of Costa Rica

    SciTech Connect

    Waddle, D.B.; MacDonald, J.M.


    In an effort to analyze and document the potential for power sector efficiency improvements from generation to end-use, the Agency for International Development and the Government of Costa Rica are jointly conducting an integrated power sector efficiency analysis. Potential for energy and cost savings in power plants, transmission and distribution, and demand-side management programs are being evaluated. The product of this study will be an integrated investment plan for the Instituto Costarricense de Electricidad, incorporating both supply and demand side investment options. This paper presents the methodology employed in the study, as well as preliminary estimates of the results of the study. 14 refs., 2 figs., 5 tabs.

  11. Helium and Carbon Relationships in Geothermal Fluids From the Central American arc in Costa Rica

    NASA Astrophysics Data System (ADS)

    Shaw, A. M.; Hilton, D. R.; Fischer, T. P.; Zimmer, M. M.; Alvarado, G.


    A fundamental aim of arc-related studies is to quantify the flux of elements from the various subduction zone reservoirs: a) the mantle wedge, b) the overlying arc crust through which the magmas erupt and c) both the oceanic basement and sedimentary veneer of the subducting slab. In the case of estimating the CO2 mass balance at convergent margins, one approach has been to couple CO2 and He measurements (isotopes and relative abundances) which allows both identification and quantitative assessment of the various contributors to the magmatic output. The Central American arc presents a unique opportunity to consider the He-C approach given prior studies which show dramatic variations in the angle of subduction, the amount and type of sediments subducted and the crustal thickness. The Costa Rica subduction zone is particularly intriguing due to the pronounced steepening of the down-going slab to the north and the occurrence of carbonate rich sediments on the down-going plate. Here, we report 3He/4He ratios, He, Ne, and CO2 abundances as well as δ 13C values for volatiles from the volcanic output along the Costa Rican segment utilising fumaroles, geothermal wells, water springs and bubbling hot springs. The results from our study show the following: 1) 3He/4He ratios of the southern volcanoes (Turrialba, Irazu and Poas) are slightly higher (6.9-8.1 RA) than those of Miravalles and Rincon de la Vieja in the north (5.1-6.8 RA), 2) water spring samples show poor preservation of magmatic gases (low 3He/4He; very high CO2/3He) relative to other sampling media, 3) CO2/3He ratios range from 9.9-27 x 109 in the south to 13-78 x 109 in the north, and 4) δ 13C values trend from isotopically heavier values in the north ( ~ -1.0 ‰ at Rincon de la Vieja) to lighter more MORB-like values in the south ( ~ -6.1 ‰ at Poas volcano). The He-CO2 relationships are consistent with a large input of marine carbonate/limestone carbon to magma sources in Costa Rica. The average ratio of

  12. Characterization of volatiles in Costa Rican guava [Psidium friedrichsthalianum (Berg) Niedenzu] fruit.


    Pino, Jorge A; Marbot, Rolando; Vázquez, Carlos


    Volatile compounds were isolated from Costa Rican guava fruit by simultaneous steam distillation-solvent extraction according to the Likens-Nickerson method. Compounds were identified by capillary GC-MS and sensorially characterized by sniffing-GC. One hundred and seventy-three components were identified in the aroma concentrate, from which (E)-beta-caryophyllene, alpha-terpineol, alpha-pinene, alpha-selinene, beta-selinene, delta-cadinene, 4,11-selinadiene, and alpha-copaene were found to be the major constituents. The amounts of aliphatic esters and terpenic compounds were thought to contribute to the unique flavor of this fruit.

  13. Naegleria fowleri-associated encephalitis in a cow from Costa Rica.


    Morales, Juan A; Chaves, Aida J; Visvesvara, G S; Dubey, J P


    Species of Naegleria, Acanthamoeba, and Balamuthia are soil amoebae that can cause encephalitis in animals and humans. Of these, Naegleria fowleri is the cause of often fatal primary meningoencephalitis in humans. N. fowleri-associated encephalitis was diagnosed in a cow that was suspected to have rabies. Only formalin-fixed brain was available for diagnosis. There was severe meningoencephalitis involving all parts of the brain and numerous amoebic trophozoites were present in lesions. The amoebae reacted with N. fowleri-specific polyclonal antibodies in an indirect immunofluorescent antibody test. This is the first report of amoebic encephalitis in any host from Costa Rica.

  14. A new species of Rhopalosiphum (Hemiptera, Aphididae) on Chusquea tomentosa (Poaceae, Bambusoideae) from Costa Rica.


    Hidalgo, Nicolás Pérez; Martínez-Torres, David; Collantes-Alegre, Jorge Mariano; Muller, William Villalobos; Nafría, Juan M Nieto


    The new species Rhopalosiphum chusqueae Pérez Hidalgo & Villalobos Muller, is described from apterous viviparous females caught on Chusquea tomentosa in Cerro de la Muerte (Costa Rica). The identity of the species is supported both by the morphological features and by a molecular phylogenetic analysis based on a fragment of the mitochondrial DNA containing the 5' region of the cytochrome c oxidase 1 (COI) and on the nuclear gene coding for the Elongation factor-1 alpha (EF1α). The taxonomic position of the new species is discussed. An identification key to the Aphidinae species living on plants of Bambusoideae (Poaceae) is presented.

  15. [Phytogeography of dry ecosystems in the ignimbrite meseta of Guanacaste, Costa Rica].


    Vargas Ulate, G


    The dry ecosystems in the ignimbrite meseta of Guanacaste, northwest Costa Rica is mapped. Plant community distribution is intimately related to the type of relief, soils and humidity. In the upper parts of the meseta, characterised by soils which are stony, sandy, and acidic, herbacious vegetation such as savanna and edaphic steppe is dominant. By contrast, woodland is found on the deep and organically rich soils of the valley floors. Within the herbaceous formations dwarf varieties of Byrsonima crassifolia (nance), Curatella americana (raspa guacal) and Quercus oleoides (encino) are found because of the acid and infertile soils.

  16. Annual Proxy Records from Tropical Cloud Forest Trees in the Monteverde Cloud Forest, Costa Rica

    NASA Astrophysics Data System (ADS)

    Anchukaitis, K. J.; Evans, M. N.; Wheelwright, N. T.; Schrag, D. P.


    The extinction of the Golden Toad (Bufo periglenes) from Costa Rica's Monteverde Cloud Forest prompted research into the causes of ecological change in the montane forests of Costa Rica. Subsequent analysis of meteorological data has suggested that warmer global surface and tropical Pacific sea surface temperatures contribute to an observed decrease in cloud cover at Monteverde. However, while recent studies may have concluded that climate change is already having an effect on cloud forest environments in Costa Rica, without the context provided by long-term climate records, it is difficult to confidently conclude that the observed ecological changes are the result of anthropogenic climate forcing, land clearance in the lowland rainforest, or natural variability in tropical climate. To address this, we develop high-resolution proxy paleoclimate records from trees without annual rings in the Monteverde Cloud Forest in Costa Rica. Calibration of an age model in these trees is a fundamental prerequisite for proxy paleoclimate reconstructions. Our approach exploits the isotopic seasonality in the δ18O of water sources (fog versus rainfall) used by trees over the course of a single year. Ocotea tenera individuals of known age and measured annual growth increments were sampled in long-term monitored plantation sites in order to test this proposed age model. High-resolution (200μm increments) stable isotope measurements on cellulose reveal distinct, coherent δ18O cycles of 6 to 10‰. The calculated growth rates derived from the isotope timeseries match those observed from basal growth increment measurements. Spatial fidelity in the age model and climate signal is examined by using multiple cores from multiple trees and multiple sites. These data support our hypothesis that annual isotope cycles in these trees can be used to provide chronological control in the absence of rings. The ability of trees to record interannual climate variability in local hydrometeorology

  17. Description of Pratylenchus gutierrezi n. sp. (Nematoda: Pratylenchidae) from Coffee in Costa Rica

    PubMed Central

    Golden, A. Morgan; López Ch., Róger; Vílchez R., Hernán


    A lesion nematode, Pratylenchus gutierrezi n. sp., collected from the roots of coffee in the Central Plateau of Costa Rica, is described and illustrated. Its relationships to Pratylenchus flakkensis, P. similis, and P. gibbicaudatus, the only other species of the genus having two head annules, males, or spermatheca with sperm, and an annulated tail terminus, is discussed. Other distinctive characters are its posterior vulva (mean of 80%); its prominently rounded stylet knobs, low head, and subcylindrical tail. SEM observations provide additional details of females and males, especially face views, which show for the first time sexual dimorphism. PMID:19282999

  18. Factors associated with hypertension prevalence, unawareness and treatment among Costa Rican elderly

    PubMed Central

    Méndez-Chacón, Ericka; Santamaría-Ulloa, Carolina; Rosero-Bixby, Luis


    Background Reliable information on the prevalence of hypertension is crucial in the development of health policies for prevention, control, and early diagnosis of this condition. This study describes the prevalence of hypertension among Costa Rican elderly, and identifies co-factors associated with its prevalence, unawareness and treatment. Methods The prevalence of hypertension is estimated for the Costa Rican elderly. Measurement error is assessed, and factors associated with high blood pressure are explored. Data for this study came from a nationally representative sample of about 2,800 individuals from CRELES (Costa Rica: Longevity and Healthy Aging Study). Two blood pressure measures were collected using digital monitors. Self reports of previous diagnosis, and medications taken were also recorded as part of the study. Results No evidence of information bias was found among interviewers, or over time. Hypertension prevalence in elderly Costa Ricans was found to be 65% (Males = 60%, Females = 69%). Twenty-five percent of the studied population did not report previous diagnoses of hypertension, but according to our measurement they had high blood pressure. The proportion of unaware men is higher than the proportion of unaware women (32% vs. 20%). The main factors associated with hypertension are: age, being overweight or obese, and family history of hypertension. For men, current smokers are 3 times more likely to be unaware of their condition than non smokers. Both men and women are less likely to be unaware of their condition if they have a family history of hypertension. Those women who are obese, diabetic, have suffered heart disease or stroke, or have been home visited by community health workers are less likely to be unaware of their hypertension. The odds of being treated are higher in educated individuals, those with a family history of hypertension, elderly with diabetes or those who have had heart disease. Conclusion Sex differences in terms of

  19. A new species of Metagovea Rosas Costa, 1950 from Napo Province, Ecuador (Opiliones, Cyphophthalmi, Neogoveidae).


    Giupponi, Alessandro P L; Kury, Adriano Brilhante


    As a result of an expedition to Ecuador in 2014, a new species of mite harvestman was discovered. This new species belonging to the genus Metagovea Rosas Costa, 1950 - Metagovealigiae sp. n. - is described, based on male and female specimens from Napo Province, Ecuador. This is the fourth species described for the genus and the second from Ecuador. A simple terminology is proposed for the microtrichiae of the spermatopositor and genital characters in the family are discussed. The genus Brasiliogovea Martens, 1969 is consistently misspelled in the literature as Brasilogovea. The description of Metagovealigiae offered opportunity to discuss some aspects of systematics of the family.

  20. A new species of Rhopalosiphum (Hemiptera, Aphididae) on Chusquea tomentosa (Poaceae, Bambusoideae) from Costa Rica

    PubMed Central

    Hidalgo, Nicolás Pérez; Martínez-Torres, David; Collantes-Alegre, Jorge Mariano; Muller, William Villalobos; Nafría, Juan M. Nieto


    Abstract The new species Rhopalosiphum chusqueae Pérez Hidalgo & Villalobos Muller, is described from apterous viviparous females caught on Chusquea tomentosa in Cerro de la Muerte (Costa Rica). The identity of the species is supported both by the morphological features and by a molecular phylogenetic analysis based on a fragment of the mitochondrial DNA containing the 5’ region of the cytochrome c oxidase 1 (COI) and on the nuclear gene coding for the Elongation factor-1 alpha (EF1α). The taxonomic position of the new species is discussed. An identification key to the Aphidinae species living on plants of Bambusoideae (Poaceae) is presented. PMID:22328859

  1. [Dipteran parasitoidism on larvae of Caligo atreus (Lepidoptera: Nymphalidae) in Cartago, Costa Rica].


    Calvo, Renin


    Parasitoids on larvae of Caligo atreus were studied at the Estación de Biologia Tropical in Rio Macho, Cartago, Costa Rica. (1 600 masl), from March through July 2000. Fifth instar larvae of C. atreus were placed on Heliconia tortuosa Griggs var. Red Twist (Heliconiaceae) host plants at a mean temperature of 16.7 degrees C. The parasitoids obtained belong to an unidentified species of the genus Winthemia (Diptera: Tachinidae). Most flies emerge some 40 days after the eggs were laid (maximum 68 days). They make an orifice on the upper ventral part of the lepidopteran pupa. Winthemia is used commercially as biological control of cotton and banana.

  2. On the false lock behavior of polarity-type Costas loops with Manchester coded input. [for Space Shuttle Orbiter communication

    NASA Technical Reports Server (NTRS)

    Simon, M. K.


    A modification of a Costas loop is described, and the false lock behavior of this system is studied. The modified Costas loop hard limits the output of the in-phase channel, replaces the analog multiplier with a chopper-type device, and is equipped with single-pole arm filters in the loop. The false lock behavior associated with the use of Manchester coded data is investigated; the results can be applied to the assessment of the false lock margin on the Ku-band uplink to the Space Shuttle Orbiter through the TURSS.

  3. Pampered sons, (wo)manly men, or do-nothing machos? Costa Rican men coming of age under neoliberalism.


    Mannon, Susan E; Kemp, Eagan


    This article explores how young men in Costa Rica negotiate ideas of manhood under neoliberalism. We draw on interview data involving 23 men, ages 15–35, residing in one Costa Rican city. Comparing men across three different class locations, we find diverse "markers of manhood." Our data suggest an emerging globally dominant masculine ideal among an elite class of men, a declining locally dominant masculine ideal among working-class men, and a cynical, possibly counter-cultural masculine ideal among poor men. We conclude that masculinities are not only fluid, but tied to changing economic circumstances and class structures.

  4. First record of Porocephalus cf. clavatus (Pentastomida: Porocephalida) as a parasite on Bothrops asper (Squamata: Viperidae) in Costa Rica.


    Alvarado, G; Sánchez-Monge, A


    Pentastomids are parasites that infect respiratory cavities of vertebrates, they are pretty common but poorly known in wildlife veterinary. A Bothrops asper snake (Garman, 1884) was captured in the Caribbean region of Costa Rica and had its lung infested with pentastomids, identified as ca Porocephalus clavatus (Wyman, 1845). This represents the first record of Porocephalus (Humboldt, 1812) on B. asper as well as P. cf. clavatus in Costa Rica. Further studies are needed to clarify their taxonomic position, images and scanning electron microscopy photographs (SEM) of the specimens are given.

  5. Coxiella burnetii Phagocytosis Is Regulated by GTPases of the Rho Family and the RhoA Effectors mDia1 and ROCK

    PubMed Central

    Distel, Jesús S.; Aguilera, Milton O.; Colombo, María I.; Berón, Walter


    The GTPases belonging to the Rho family control the actin cytoskeleton rearrangements needed for particle internalization during phagocytosis. ROCK and mDia1 are downstream effectors of RhoA, a GTPase involved in that process. Coxiella burnetii, the etiologic agent of Q fever, is internalized by the host´s cells in an actin-dependent manner. Nevertheless, the molecular mechanism involved in this process has been poorly characterized. This work analyzes the role of different GTPases of the Rho family and some downstream effectors in the internalization of C. burnetii by phagocytic and non-phagocytic cells. The internalization of C. burnetii into HeLa and RAW cells was significantly inhibited when the cells were treated with Clostridium difficile Toxin B which irreversibly inactivates members of the Rho family. In addition, the internalization was reduced in HeLa cells that overexpressed the dominant negative mutants of RhoA, Rac1 or Cdc42 or that were knocked down for the Rho GTPases. The pharmacological inhibition or the knocking down of ROCK diminished bacterium internalization. Moreover, C. burnetii was less efficiently internalized in HeLa cells overexpressing mDia1-N1, a dominant negative mutant of mDia1, while the overexpression of the constitutively active mutant mDia1-ΔN3 increased bacteria uptake. Interestingly, when HeLa and RAW cells were infected, RhoA, Rac1 and mDia1 were recruited to membrane cell fractions. Our results suggest that the GTPases of the Rho family play an important role in C. burnetii phagocytosis in both HeLa and RAW cells. Additionally, we present evidence that ROCK and mDia1, which are downstream effectors of RhoA, are involved in that process. PMID:26674774

  6. Checklist and identification key of Anomalini (Coleoptera, Scarabaeidae, Rutelinae) of Costa Rica

    PubMed Central

    Filippini, Valentina; Micó, Estefanía; Galante, Eduardo


    Abstract A checklist and identification key for the species of the tribe Anomalini in Costa Rica are presented. The Anomalini species are important economically, as they have larvae that are or can become agricultural pests, as well as ecologically, having potential as bioindicators. In spite of their importance and richness, identification tools for the group in the Neotropics remain scarce. The Costa Rican fauna comprises six genera (Anomala, Anomalorhina, Callistethus, Epectinaspis, Moroniella, and Strigoderma) and a total of 120 species. Anomala contusa Filippini, Micó, Galante, 2015 is proposed as a synonym of Anomala inbio (Ramírez-Ponce, Bitar, Curoe 2014); Anomala limon nom. n. is proposed as a new name for Anomala inbio Filippini, Galante, Micó, 2015, a homonym of Anomala inbio (Ramírez-Ponce, Bitar, Curoe, 2014); Anomala cinaedias nom. n. is proposed as a new name for Anomala chloropyga Ohaus, 1897, a homonym of Anomala chloropyga Burmeister, 1844; and Anomala chrysomelina is moved to the genus Callistethus. PMID:27833420

  7. Active deformation near the Nicoya Peninsula, northwestern Costa Rica, between 1996 and 2010: Interseismic megathrust coupling

    NASA Astrophysics Data System (ADS)

    Feng, Lujia; Newman, Andrew V.; Protti, Marino; GonzáLez, VíCtor; Jiang, Yan; Dixon, Timothy H.


    We use campaign and continuous GPS measurements at 49 sites between 1996 and 2010 to describe the long-term active deformation in and near the Nicoya Peninsula, northwestern Costa Rica. The observed deformation reveals partial partitioning of the Cocos-Caribbean oblique convergence into trench-parallel forearc sliver motion and less oblique thrusting on the subduction interface. The northern Costa Rican forearc translates northwestward as a whole ridge block at 11 ± 1 mm/yr relative to the stable Caribbean. The transition from the forearc to the stable Caribbean occurs in a narrow deforming zone of ˜16 km wide. Subduction thrust earthquakes take 2/3 of the trench-parallel component of the plate convergence; however, surface deformation caused by interseismic megathrust coupling is primarily trench-normal. Two fully coupled patches, one located offshore Nicoya centered at ˜15 km depth and the other located inland centered at ˜24 km depth, are identified in Nicoya with the potential to generate an Mw 7.8 1950-type earthquake. Another fully coupled patch SE of Nicoya coincides with the rupture region of the 1990 Nicoya Gulf earthquake. Interface microearthquakes, non-volcanic tremor, low-frequency earthquakes, and transient slow-slip events generally occur in the intermediately to weakly coupled regions.

  8. PCB concentrations in sediments from the Gulf of Nicoya estuary, Pacific coast of Costa Rica.


    Spongberg, Alison L


    Thirty-one sediment samples collected from 1996-2003 from the Gulf of Nicoya estuary on the northwestern coast of Costa Rica, have been obtained for PCB analyses. This is part of the first study to evaluate the PCB contamination in coastal Costa Rica. Overall, the concentrations are low, especially when compared to sediments from more temperate climates and/or sediments from more heavily industrialized areas. Values average less than 3 ng/g dw sediment, however, a few samples contained up to 7 ng/g dw sediment. Sediments with the highest concentrations were located in the Punta Morales area, where muds were sampled from among mangrove roots. The Puntarenas samples had surprisingly low PCB concentrations, likely due to their sandy lithology. The congener distribution within the majority of the samples showed signs of either recent sources or lack of degradation. However, a few sites, specifically some of the inter-gulf islands and more remote samples had congener distributions indicative of airborne contaminants and/or degradation. Considering the presence of airborne PCBs in the Gulf of Papagayo to the north, the lack of airborne PCBs and more varied congener distribution in the Gulf of Nicoya estuary was surprising.

  9. Molecular characterization and genetic diversity of Jatropha curcas L. in Costa Rica.


    Vásquez-Mayorga, Marcela; Fuchs, Eric J; Hernández, Eduardo J; Herrera, Franklin; Hernández, Jesús; Moreira, Ileana; Arnáez, Elizabeth; Barboza, Natalia M


    We estimated the genetic diversity of 50 Jatropha curcas samples from the Costa Rican germplasm bank using 18 EST-SSR, one G-SSR and nrDNA-ITS markers. We also evaluated the phylogenetic relationships among samples using nuclear ribosomal ITS markers. Non-toxicity was evaluated using G-SSRs and SCARs markers. A Neighbor-Joining (NJ) tree and a Maximum Likelihood (ML) tree were constructed using SSR markers and ITS sequences, respectively. Heterozygosity was moderate (He = 0.346), but considerable compared to worldwide values for J. curcas. The PIC (PIC = 0.274) and inbreeding coefficient (f =  - 0.102) were both low. Clustering was not related to the geographical origin of accessions. International accessions clustered independently of collection sites, suggesting a lack of genetic structure, probably due to the wide distribution of this crop and ample gene flow. Molecular markers identified only one non-toxic accession (JCCR-24) from Mexico. This work is part of a countrywide effort to characterize the genetic diversity of the Jatropha curcas germplasm bank in Costa Rica.

  10. Novel genotype of Ehrlichia canis detected in samples of human blood bank donors in Costa Rica.


    Bouza-Mora, Laura; Dolz, Gaby; Solórzano-Morales, Antony; Romero-Zuñiga, Juan José; Salazar-Sánchez, Lizbeth; Labruna, Marcelo B; Aguiar, Daniel M


    This study focuses on the detection and identification of DNA and antibodies to Ehrlichia spp. in samples of blood bank donors in Costa Rica using molecular and serological techniques. Presence of Ehrlichia canis was determined in 10 (3.6%) out of 280 blood samples using polymerase chain reaction (PCR) targeting the ehrlichial dsb conserved gene. Analysis of the ehrlichial trp36 polymorphic gene in these 10 samples revealed substantial polymorphism among the E. canis genotypes, including divergent tandem repeat sequences. Nucleotide sequences of dsb and trp36 amplicons revealed a novel genotype of E. canis in blood bank donors from Costa Rica. Indirect immunofluorescence assay (IFA) detected antibodies in 35 (35%) of 100 serum samples evaluated. Thirty samples showed low endpoint titers (64-256) to E. canis, whereas five sera yielded high endpoint titers (1024-8192); these five samples were also E. canis-PCR positive. These findings represent the first report of the presence of E. canis in humans in Central America.

  11. Environmental hazards associated with pesticide import into Costa Rica, 1977-2009.


    de la Cruz, Elba; Bravo-Durán, Viria; Ramírez, Fernando; Castillo, Luisa E


    Raw pesticide import data from 1977 to 2009 obtained from the Ministry of Agriculture in Costa Rica were processed and analyzed. The quantity of specific active ingredients (a.i.), and chemical groups were calculated by year and presented in ten-year periods. Three sets of environmental hazard indicators were constructed: one for general pesticides exposure to monitor tendencies in time, including total quantities imported divided by significant denominators, such as hectares of protected and wetland areas. The second indicator calculates pesticide use on the Pacific or Caribbean slope. The third one is an assessment of environmental hazards intended to estimate fate and toxicity to aquatic biota. A review of Costa Rican aquatic ecosystems' contamination with pesticides is presented. The annual average import as well as the quantity of pesticides capable of reaching water bodies increased during the analyzed period. The same was observed for harmful a.i., 98% of the pesticides imported were classified as acutely toxic for fish and crustaceans and 73% for amphibians. Approximately 8.4 kg of a.i. were imported per hectare of protected areas and 24.3 kg of a.i. per hectare of wetlands. The contamination of aquatic systems over time by specific pesticides matches quite well the list of imported ones. We recommend using data of pesticide imports as a source of information to evaluate environmental risk exposure and promote changes to reduce impacts on aquatic systems.

  12. Land cover dynamics following a deforestation ban in northern Costa Rica

    NASA Astrophysics Data System (ADS)

    Fagan, M. E.; DeFries, R. S.; Sesnie, S. E.; Arroyo, J. P.; Walker, W.; Soto, C.; Chazdon, R. L.; Sanchun, A.


    Forest protection policies potentially reduce deforestation and re-direct agricultural expansion to already-cleared areas. Using satellite imagery, we assessed whether deforestation for conversion to pasture and cropland decreased in the lowlands of northern Costa Rica following the 1996 ban on forest clearing, despite a tripling of area under pineapple cultivation in the last decade. We observed that following the ban, mature forest loss decreased from 2.2% to 1.2% per year, and the proportion of pineapple and other export-oriented cropland derived from mature forest declined from 16.4% to 1.9%. The post-ban expansion of pineapples and other crops largely replaced pasture, exotic and native tree plantations, and secondary forests. Overall, there was a small net gain in forest cover due to a shifting mosaic of regrowth and clearing in pastures, but cropland expansion decreased reforestation rates. We conclude that forest protection efforts in northern Costa Rica have likely slowed mature forest loss and succeeded in re-directing expansion of cropland to areas outside mature forest. Our results suggest that deforestation bans may protect mature forests better than older forest regrowth and may restrict clearing for large-scale crops more effectively than clearing for pasture.

  13. Molecular Detection and Genotyping of Chlamydia psittaci in Captive Psittacines from Costa Rica

    PubMed Central

    Sheleby-Elías, Jessica; Solórzano-Morales, Ántony; Romero-Zuñiga, Juan José


    Oropharyngeal and cloacal swabs from 117 captive psittacine birds presented at veterinary clinics (88) and from shelters/rescue centers of wildlife (29) were collected to determine the prevalence of C. psittaci in captive birds in Costa Rica. Samples were collected during 2009 from a total of 19 different species of parrots, with Ara macao (33), Amazona autumnalis (24), Amazona ochrocephala (21), and Ara ararauna (8) being the most representative species sampled. C. psittaci was detected in four (3.4%) birds using molecular detection (PCR). The positive samples belonged to birds presented at veterinary clinics; three of them were Ara macao and one Amazona ochrocephala. Three birds were adults; all positive birds showed no symptoms of illness and lived in homes with other birds, two in San José and two in Heredia. Sequencing was used to confirm the PCR positive results, showing that two samples of C. psittaci belonged to genotype A, representing the first report of the presence of this genotype in Costa Rica. The detection of this bacterium in captive psittacine birds shows that there is a potential risk for people living or having contact with them and that there is a possibility of infecting other birds. PMID:24163776

  14. [Basal state of the nutritional information declared in labels of foods products marketed in Costa Rica].


    Blanco-Metzler, A; Roselló-Araya, M; Núñez-Rivas, H P


    The nutritional labeling regulations for prepackaged foods based on the Codex Alimentarius legislation enacted in 2002 in Costa Rica. In the same year, a research was conducted in order to describe the baseline of nutritional labeling. The declared information on the labels of all prepackaged foods was collected, except for alcoholic beverages. Six variables were analyzed using SPSS. 2,910 labels of foods were reviewed and classified in 19 food categories. 58.4% (n = 1698) included nutritional information, proportion that varied by country of origin and food category. Of the labels that included nutritional information, 68.1% had nutritional panel, 1.2% nutrient claims and 27.4%, both. 95% of the nutritional components declared on the labels included energy and macronutrients data. At least 100 different nutritional and health claims were identified. Most frequently used claims were content (74.7%), followed by addition (16.9%). The components most frequently mentioned were vitamins and minerals, vitamins (alone), carbohydrates, total fat, cholesterol and energy. Food groups who reported these descriptors were: cereals and by products, baby foods, milks, beverages, foods for special dietary uses and substitutes. One to five descriptors were used in a label. In a decade the proportion of prepackaged foods with nutritional labeling tripled in the metropolitan area of Costa Rica. It is concluded that the tendency of nutrition information declaration is up, sustained and represents an accessible tool for health promotion, if the information provided is reliable and secure.

  15. Registration of fatal occupational injuries in Costa Rica, 2005-2006.


    Mora, Ana Maria; Mora-Mora, Maria Gabriela; Partanen, Timo; Wesseling, Catharina


    Data on fatal occupational injuries (FOIs) for Latin America are controversial. Costa Rican national rates are inconsistent with estimates extrapolated from other countries. We reviewed the files for all possible FOIs in Costa Rica for 2005-2006 at the National Insurance Institute and at the Center of Forensic Sciences by formality/informality of work, sex, age, economic activity, occupation, and cause of death. The national mortality rate was estimated at 9.5/100,000 person-years (342 deaths). The informal/formal rate ratio was 1.06. Men's rates were over 10 times higher than women's and increased with age. The highest rates were found for transport, storage, and communication (32.1/100,000 person-years), and, by occupation, for messengers and delivery men (91.4). Leading causes of death were traffic injuries and gunshots. Recalculated rates are probably underestimates. Data limitations include the absence of systematic identification and registration among informal sector workers and other groups such as children and farm workers.

  16. A recent phase of accretion along the southern Costa Rican subduction zone

    NASA Astrophysics Data System (ADS)

    Bangs, Nathan L.; McIntosh, Kirk D.; Silver, Eli A.; Kluesner, Jared W.; Ranero, César R.


    In 2011 we acquired a 3D seismic reflection volume across the Costa Rica margin NW of the Osa Peninsula to investigate the complex structure and the development of the seismogenic zone within the Costa Rican subduction zone in the vicinity of recent International Ocean Drilling Program (IODP) drilling. In contrast to previous interpretations, these newly acquired seismic images show that the margin wedge is composed of a layered fabric that is consistent with clastic sediments, similar to materials recovered from IODP drilling, that have been thrust and thickened into thrust-bounded folded sequences. These structures are consistent with a balanced sequence that has been frontally accreted in the context of an accretionary model. We interpret these sequences as sediment originally deposited on the subducting crust in a trench basin created by the southward migration of the Cocos-Nazca-Caribbean triple junction, and accreted during recent margin subduction that also accelerated with passage of the triple junction. The margin is composed of relatively rapidly accreted sediment that was added to the margin during a phase of accretion within the last ∼5 Ma that was probably preceded throughout the Neogene by periods of non-accretion or erosion.

  17. Higher survival drives the success of nitrogen-fixing trees through succession in Costa Rican rainforests.


    Menge, Duncan N L; Chazdon, Robin L


    Trees capable of symbiotic nitrogen (N) fixation ('N fixers') are abundant in many tropical forests. In temperate forests, it is well known that N fixers specialize in early-successional niches, but in tropical forests, successional trends of N-fixing species are poorly understood. We used a long-term census study (1997-2013) of regenerating lowland wet tropical forests in Costa Rica to document successional patterns of N fixers vs non-fixers, and used an individual-based model to determine the demographic drivers of these trends. N fixers increased in relative basal area during succession. In the youngest forests, N fixers grew 2.5 times faster, recruited at a similar rate and were 15 times less likely to die as non-fixers. As succession proceeded, the growth and survival disparities decreased, whereas N fixer recruitment decreased relative to non-fixers. According to our individual-based model, high survival was the dominant driver of the increase in basal area of N fixers. Our data suggest that N fixers are successful throughout secondary succession in tropical rainforests of north-east Costa Rica, and that attempts to understand this success should focus on tree survival.

  18. Natural radiation doses for cosmic and terrestrial components in Costa Rica.


    Mora, Patricia; Picado, Esteban; Minato, Susumu


    A study of external natural radiation, cosmic and terrestrial components, was carried out with in situ measurements using NaI scintillation counters while driving along the roads in Costa Rica for the period July 2003-July 2005. The geographical distribution of the terrestrial air-absorbed dose rates and the total effective dose rates (including cosmic) are represented on contour maps. Information on the population density of the country permitted the calculation of the per capita doses. The average effective dose for the total cosmic component was 46.88+/-18.06 nSvh(-1) and the average air-absorbed dose for the terrestrial component was 29.52+/-14.46 nGyh(-1). The average total effective dose rate (cosmic plus terrestrial components) was 0.60+/-0.18 mSv per year. The effective dose rate per capita was found to be 83.97 nSvh(-1) which gives an annual dose of 0.74 mSv. Assuming the world average for the internal radiation component, the natural radiation dose for Costa Rica will be 2.29 mSv annually.

  19. Molecular characterization and genetic diversity of Jatropha curcas L. in Costa Rica

    PubMed Central

    Vásquez-Mayorga, Marcela; Fuchs, Eric J.; Hernández, Eduardo J.; Herrera, Franklin; Hernández, Jesús; Moreira, Ileana; Arnáez, Elizabeth


    We estimated the genetic diversity of 50 Jatropha curcas samples from the Costa Rican germplasm bank using 18 EST-SSR, one G-SSR and nrDNA-ITS markers. We also evaluated the phylogenetic relationships among samples using nuclear ribosomal ITS markers. Non-toxicity was evaluated using G-SSRs and SCARs markers. A Neighbor-Joining (NJ) tree and a Maximum Likelihood (ML) tree were constructed using SSR markers and ITS sequences, respectively. Heterozygosity was moderate (He = 0.346), but considerable compared to worldwide values for J. curcas. The PIC (PIC = 0.274) and inbreeding coefficient (f =  − 0.102) were both low. Clustering was not related to the geographical origin of accessions. International accessions clustered independently of collection sites, suggesting a lack of genetic structure, probably due to the wide distribution of this crop and ample gene flow. Molecular markers identified only one non-toxic accession (JCCR-24) from Mexico. This work is part of a countrywide effort to characterize the genetic diversity of the Jatropha curcas germplasm bank in Costa Rica. PMID:28289556

  20. Call for a change in research funding priorities: the example of mental health in Costa Rica.


    Contreras, Javier; Raventós, Henriette; Rodríguez, Gloriana; Leandro, Mauricio


    The World Health Organization (WHO) Mental Health Action Plan 2013-2020 urges its Member States to strengthen leadership in mental health, ensure mental and social health interventions in community-based settings, promote mental health and strengthen information systems, and increase evidence and research for mental health. Although Costa Rica has strongly invested in public health and successfully reduced the burden of nutritional and infectious diseases, its transitional epidemiological pattern, population growth, and immigration from unstable neighboring countries has shifted the burden to chronic disorders. Although policies for chronic disorders have been in place for several decades, mental disorders have not been included. Recently, as the Ministry of Health of Costa Rica developed a Mental Health Policy for 2013-2020, it became evident that the country needs epidemiological data to prioritize evidence-based intervention areas. This article stresses the importance of conducting local epidemiological studies on mental health, and calls for changes in research funding priorities by public and private national and international funding agencies in order to follow the WHO Mental Health Action Plan.

  1. Gender, migration and urban development in Costa Rica: the case of Guanacaste.


    Chant, S


    Factors fueling urbanization in Guanacaste province, Costa Rica are explored and how the pattern of urban growth reflects gender divisions of labor is considered. Urbanization in Latin America has been due largely to the expansion of economic activities in urban centers, but in Guanacaste, rural employment persists among the poor. Towns in this peripheral province have witnessed no major expansion in urban-based employment opportunities. On the basis of an in-depth survey of urban dwellers in the province's 3 leading towns (Liberia, Canas, and Santa Cruz), an attempt is made to explain Guanacaste's urbanization. The 1st section discusses the migration, urbanization, and economic development in Costa Rica, as well as Guanacaste. The 2nd section provides the findings of the survey of 350 low-income, urban households in Guanacaste, focusing on the households' reported reasons for moving. Section 3 examines household survival strategies in the areas surveyed, paying close attention to gender and age selectivity of short-term out-migration to external labor markets. Section 4 interprets the apparent connection between gender-differentiated labor migration and the dominance of reproductive factors in household decisions to move to urban centers. Section 5 considers the implications of the migration patterns on women, while section 6 discusses the wider implications of the study. The study reveals that in Guanacaste, urbanization is more strongly linked to the reproductive (e.g., housing and welfare) needs of household survival than to productive (employment and income) needs.

  2. The impact of hospital management reforms on absenteeism in Costa Rica.


    García-Prado, Ariadna; Chawla, Mukesh


    The reduction of high levels of absenteeism among health care workers was one the objectives of the reforms undertaken to improve public hospital performance during the 1990s in Costa Rica. This paper attempts to assess the impact of changes in reimbursement methods and organizational reform on absence rates among health care personnel in Costa Rican public hospitals for the period 1995-2001. Our results show the reforms to have had a negative impact on absenteeism, which increased throughout the considered period. Results further indicate that the policy of not substituting absentee workers, which was introduced through the reforms, did not work as expected in a permissive environment in which peer pressure mechanisms were lacking. In addition, the explicit incentives for workers included in the reforms were retained and used at facility level. There is a pressing need in the future for control and disciplinary mechanisms for health care personnel and for the introduction of absence rates as an explicit goal to be monitored and evaluated.

  3. [Inshore cetaceans from the North and South Pacific coast of Costa Rica].


    Martínez-Fernández, Damián; Montero-Cordero, Andrea; May-Collado, Laura


    Twenty nine cetacean species occur in Costa Rican waters but extensive research has been conducted only for three species. The latter shows there is a lack of general and local information about these mammals, even when the country, has shown a remarkable growth in whale watching activities. The increasing use of marine resources in coastal areas has also developed the need to determine the occurrence of cetaceans in areas showing high tourist presence, in order to propose sound conservation measures. In this study, environmental variables were determined and subsequently related to the presence of the species recorded, out of 166 sightings, between 2005 and 2006. The species with highest proportion of sightings were Stenella attenuata (68%), followed by Megaptera novaeangliae (13%) and Tursiops truncatus (10%). The presence of spotted dolphins is related to changes in salinity and water transparency, while that of the humpback whale was related to wave height (Beaufort scale) and water temperature. The presence of seven species of cetaceans was confirmed in two coastal areas of the Pacific coast of Costa Rica, from which three are present throughout the year. Environmental variables were found related to the presence of at least two species.

  4. First Report of Anthelmintic Resistance in Gastrointestinal Nematodes of Sheep from Costa Rica

    PubMed Central

    Maroto, R.; Jiménez, A. E.; Romero, J. J.; Alvarez, V.; De Oliveira, J. B.; Hernández, J.


    As the prevalence and severity of anthelmintic resistance continue to rise, nematode infections in sheep correspondingly reduce the profitability of the sheep industry. In Costa Rica, sheep production systems are increasing in both number and importance. A field trial study was carried out to detect the level of anthelmintic resistance to albendazole and ivermectin in gastrointestinal nematodes (GIN) of sheep from seven farms in Costa Rica. Resistance was determined using the fecal egg count reduction test (FECRT). Three treatment groups were assessed on each farm: control, albendazole, and ivermectin. Haemonchus spp. (71%), Strongyloides sp. (57%), and Trichostrongylus spp. (43%) presented resistance levels to albendazole, whereas Strongyloides sp. (43%), Haemonchus spp. (29%), and Trichostrongylus spp. (29%) were resistant to ivermectin. Haemonchus spp., Strongyloides sp., and Trichostrongylus spp. were the most resistant GIN to both products. This study suggests that frequency of treatment, exclusive chemical control, and visual estimation of animal weight to calculate dosage may contribute to the high levels of anthelmintic resistance that were observed on the farms analyzed herein. PMID:21772962

  5. Gastrointestinal parasites and ectoparasites of Bradypus variegatus and Choloepus hoffmanni sloths in captivity from Costa Rica.


    Sibaja-Morales, Karen D; de Oliveira, Jaqueline B; Jiménez Rocha, Ana E; Hernández Gamboa, Jorge; Prendas Gamboa, Jorge; Arroyo Murillo, Francisco; Sandí, Janet; Nuñez, Yessenia; Baldi, Mario


    Sloths may serve as host to a wide range of parasites. However, there is little information available on the types of parasites that affect Costa Rica's sloth population. During a 1-yr period, 65 specimens of Costa Rican sloth species (Choloepus hoffmanni; n = 56) and Bradypus variegates; n = 9) from a local zoo were sampled. Fecal samples were evaluated using two different diagnostic techniques, Sheather's flotation and sedimentation. Concurrently, these sloths were examined for ectoparasites. Gastrointestinal parasites were found in 14 sloths (21.5%), from which 13 animals were C. hoffmanni and one was B. variegatus. Gastrointestinal parasites were recognized as Coccidia 71.4% (10/14), Cestoda 21.4% (3/14), and Spiruroidea 7.1% (1/14). Coccidia and cestodes were seen in C. hoffmanni, and spirurids were identified in B. variegatus. Among 27 sloths examined, only six had dermal problems (five C. hoffmanni and two B. variegatus). Ectoparasites recovered were Sarcoptes scabiei (Acari, Sarcoptidae) mites and Amblyomma varium (Acari, Ixodidae) ticks. This is the first time that cestode strobilae and nematode eggs are reported in sloth feces and that Monezia benedeni and L. leptocephalus were found in captive sloths.

  6. Baird's tapir density in high elevation forests of the Talamanca region of Costa Rica.


    González-Maya, José F; Schipper, Jan; Polidoro, Beth; Hoepker, Annelie; Zárrate-Charry, Diego; Belant, Jerrold L


    Baird's tapir (Tapirus bairdii) is currently endangered throughout its neotropical range with an expected population decline >50% in the next 30 years. We present the first density estimation of Baird's tapir for the Talamanca mountains of Costa Rica, and one of the first for the country. Ten stations with paired cameras were established in Valle del Silencio within Parque Internacional La Amistad (PILA). Seventy-seven tapir pictures of 15 individuals comprising 25 capture-recapture events were analyzed using mark-recapture techniques. The 100% minimum convex polygon of the sampled area was 5.7 km(2) and the effective sampled area using half mean maximum distances moved by tapirs was 7.16 km(2) . We estimated a tapir density of 2.93 individuals/km(2) which represents the highest density reported for this species. Intermountain valleys can represent unique and important habitats for large mammal species. However, the extent of isolation of this population, potentially constrained by steep slopes of the cordillera, remains unknown. Further genetic and movement studies are required to understand meta-population dynamics and connectivity between lowland and highland areas for Baird's tapir conservation in Costa Rica.

  7. Ectoparasites of dogs in home environments on the Caribbean slope of Costa Rica.


    Troyo, Adriana; Calderón-Arguedas, Olger; Alvarado, Gilbert; Vargas-Castro, Luis E; Avendaño, Adrián


    Reports on ectoparasites on dogs in Central America are scarce. The aim of this study was to identify flea, louse and tick species infesting dogs in home environments on the Caribbean slope of Costa Rica, and determine their frequency and coexistence. Ectoparasites were collected from dogs in 83 rural homes at five study sites. Specimens were identified and separated according to species. Fleas were the most common ectoparasite (G = 22,217, DF = 8, p = 0.004). Ctenocephalides felis and Pulex simulans were found in 83% and 55% of the homes with ectoparasites, respectively. Trichodectes canis (13%), Heterodoxus spiniger (10%), Rhipicephalus sanguineus (18%), Rhipicephalus (Boophilus) microplus (5%) and Amblyomma ovale (8%) were also present. More than one species was collected in most cases (66%), and the most common combination was C. felis and P. simulans (59% of homes with fleas). The high frequency of P. simulans emphasizes the need for adequate identification. This was the first study involving different ectoparasites of dogs in Costa Rica, as well as the first report of T. canis in this country. The relative frequency and coexistence of these ectoparasites in the home environment may have implications for animal and human health.

  8. Sensitivity of Costa Rica's native cladoceran Daphnia ambigua and Simocephalus serrulatus to the organophosphate pesticide ethoprophos.


    Arias-Andrés, María; Torres, Freylan Mena; Vargas, Seiling; Solano, Karla


    The study of pesticide toxicity in aquatic environments is assessed with ecotoxicological tests and most research has been performed using species from temperate regions. In the present study, series of acute (48 hrs) toxicity tests to compare the sensibility of two indigenous cladocera of Costa Rica and two reference species were used in temperate regions to the organophosphate pesticide, Ethoprophos. Additionally, reproduction tests using S. serrulatus with sub lethal concentrations of ethoprophos and a control were assayed to check its sensitivity over a longer period exposure. The sensitivity of Costa Rica's native species Daphnia ambigua (EC50 48 hr: 12.9 +/- 3.0 microg(l(-1)) and Simocephalus serrulatus (10.6 +/- 2.1 microg l(-1)) to ethoprophos were higher (p < 0.05) when compared to the exotic species Daphnia magna (289.8 +/- 77.4 microg l(-1)), and were comparable to that of the more widely distributed species, Ceriodaphnia dubia (18.2 +/- 5.2 microg l(-1)). No effect on S. serrulatus reproduction was observed at concentrations between 1 and 4 microg l(-1). This study provides information that can be considered in the selection of species for ecosystem studies of pesticide toxicity in neotropical regions.

  9. The Nicoya region of Costa Rica: a high longevity island for elderly males

    PubMed Central

    Dow, William H.; Rehkopf, David H.


    Reliable data show that the Nicoyan region of Costa Rica is a hot spot of high longevity. A survival follow-up of 16,300 elderly Costa Ricans estimated a Nicoya death rate ratio (DRR) for males 1990–2011 of 0.80 (0.69–0.93 CI). For a 60-year-old Nicoyan male, the probability of becoming centenarian is seven times that of a Japanese male, and his life expectancy is 2.2 years greater. This Nicoya advantage does not occur in females, is independent of socio-economic conditions, disappears in out-migrants and comes from lower cardiovascular (CV) mortality (DRR = 0.65). Nicoyans have lower levels of biomarkers of CV risk; they are also leaner, taller and suffer fewer disabilities. Two markers of ageing and stress—telomere length and dehydroepiandrosterone sulphate—are also more favourable. The Nicoya diet is prosaic and abundant in traditional foods like rice, beans and animal protein, with low glycemic index and high fibre content. PMID:25426140

  10. Late Cretaceous-Cenozoic Basin framework and petroleum potential of Panama and Costa Rica

    SciTech Connect

    Mann, P. ); Kolarsky, R. )


    Despite its location between major petroleum provinces in northwestern South America and northern Central America, there is a widespread negative perception of the petroleum potential of Panama and Costa Rica in southern Central America. Several factors may contribute to this perception: (1) the on and offshore geology of many areas has only be studied in a reconnaissance fashion; (2) sandstone reservoirs and source rocks are likely to be of poor quality because Upper Cretaceous-Cenozoic sandstones are eroded from island arc or oceanic basement rocks and because oil-prone source rocks are likely to be scarce in near-arc basins; and (3) structural traps are likely to be small and fragmented because of complex late Cenozoic thrust and strike-slip tectonics. On the other hand, onshore oil and gas seeps, shows and small production in wildcat wells, and source rocks with TOC values up to 26% suggest the possibility of future discoveries. In this talk, we present the results of a regional study using 3100 km of offshore seismic lines kindly provided by industry. Age and stratigraphic control of offshore lines is constrained by limited well data and detailed field studies of basin outcrops in coastal areas. We describe the major structures, stratigraphy, and tectonic history of the following areas: Gulf of Panama and Gulf of Chiriqui of Panama and the Pacific and Caribbean margins of Costa Rica.

  11. Estimating the greenhouse gas benefits of forestry projects: A Costa Rican Case Study

    SciTech Connect

    Busch, Christopher; Sathaye, Jayant; Sanchez Azofeifa, G. Arturo


    If the Clean Development Mechanism proposed under the Kyoto Protocol is to serve as an effective means for combating global climate change, it will depend upon reliable estimates of greenhouse gas benefits. This paper sketches the theoretical basis for estimating the greenhouse gas benefits of forestry projects and suggests lessons learned based on a case study of Costa Rica's Protected Areas Project, which is a 500,000 hectare effort to reduce deforestation and enhance reforestation. The Protected Areas Project in many senses advances the state of the art for Clean Development Mechanism-type forestry projects, as does the third-party verification work of SGS International Certification Services on the project. Nonetheless, sensitivity analysis shows that carbon benefit estimates for the project vary widely based on the imputed deforestation rate in the baseline scenario, e.g. the deforestation rate expected if the project were not implemented. This, along with a newly available national dataset that confirms other research showing a slower rate of deforestation in Costa Rica, suggests that the use of the 1979--1992 forest cover data originally as the basis for estimating carbon savings should be reconsidered. When the newly available data is substituted, carbon savings amount to 8.9 Mt (million tones) of carbon, down from the original estimate of 15.7 Mt. The primary general conclusion is that project developers should give more attention to the forecasting land use and land cover change scenarios underlying estimates of greenhouse gas benefits.

  12. Seismic cycle and plate margin deformation in Costa Rica: GPS observations from 1994 to 1997

    NASA Astrophysics Data System (ADS)

    Lundgren, P.; Protti, M.; Donnellan, A.; Heflin, M.; Hernandez, E.; Jefferson, D.


    Global Positioning System (GPS) observations in Costa Rica from 1994 to 1997 reveal a complex pattern of motion consistent with the superposition of seismic cycle and secular plate margin deformation. In the south, velocity vectors are consistent with motion of the Panama Block plus postseismic deformation following the 1991 Limon earthquake and interseismic strain due to partial locking of the Middle America Trench (MAT) thrust. In the northwest, sites west of the volcanic arc are moving to the NW as a forearc sliver. Superimposed on this sliver motion are vertical and horizontal interseismic deformations from the adjacent Nicoya segment of the MAT. We apply two different inverse methods to understand the source of the seismic strain in NW Costa Rica. We compare fault-locking models derived using a singular value decomposition inversion with that of a simulated annealing global optimization approach. Both methods yield similar models for partial locking of the thrust interface beneath the Nicoya Peninsula. Our results define an area of nearly fully locked fault beneath the outer coast of the southern portion of the peninsula, with somewhat lower coupling beneath the northern half and with low coupling elsewhere. These initial results show the promise for detailed imaging of the locked portion of a thrust interface responsible for future large subduction zone earthquakes.

  13. The Moín High, East Costa Rica: Seamount, laccolith or contractional structure?

    NASA Astrophysics Data System (ADS)

    Brandes, Christian; Astorga, Allan; Winsemann, Jutta


    The back-arc area of the southern Central American arc-trench system in East Costa Rica is characterized by a complex basin system. An extensional back-arc area (the North Limón Basin) and a compressional retro-arc foreland basin (the South Limón Basin) are closely related. Both basins are separated by an approximately 50 km long and 30 km wide mound-shaped structure referred to as Moín High, which evolved in Eocene times. The Moín High has previously been interpreted as a basement structure or paleo-high. The modern geothermal gradient is 3 °C/100 m. There is no evidence for thermal anomaly or higher heat flow in that area. A mean heat flow of 56-60 mW/m 2 implies that an origin as a volcanic seamount or magmatic intrusion is unlikely. 3D static models show that the Moín High trends NNE-SSW and has an antiformal shape in cross-section and an elliptic outline in map view. The trend of the Moín High coincides with the orientation of folds in West Costa Rica that formed in response to an Eocene deformation phase. The seismic lines show that Miocene reflectors onlap against the structure. Based on this data set it is likely that the Moín High is an anticline formed due to contraction.

  14. Evaluation model for developing, implementing, and assessing conservation education programs: Examples from Belize and Costa Rica

    NASA Astrophysics Data System (ADS)

    Jacobson, Susan K.


    Evaluation of conservation education programs can: (1) provide accountability in demonstrating a program's worth, (2) offer an opportunity for receiving feedback and improving programs, (3) further our understanding of the process of program development, and (4) promote conservation education by substantiating claims about its benefits. The Planning-Process-Product systems evaluation model provides feedback needed for making decisions about the development, implementation, and outcome of a program. Planning evaluation was useful in assessing the needs, goals, opportunities, and constraints of a number of programs in Costa Rica and Belize, such as a forestry education project and a zoo outreach program. It provided a basis for making planning decisions incorporating specific objectives, such as the reforestation of a region or a change in knowledge and attitudes in program participants. Process evaluation provided a Costa Rican sustainable development program with feedback during its implementation and enabled it to modify and improve its newsletter for local farmers and its ecology classes for school children. Product evaluation assessed project accomplishments, such as the 700,000 raised by the Children's Rainforest group and the 20 miles of riparian land under conservation management as part of the Belize Community Baboon Sanctuary project. Outcomes are compared with the programs original monetary or land management objectives to determine the success of the programs and to provide feedback for improvement.

  15. Microevolution in lower Central America: genetic characterization of the Chibcha-speaking groups of Costa Rica and Panama, and a consensus taxonomy based on genetic and linguistic affinity.

    PubMed Central

    Barrantes, R; Smouse, P E; Mohrenweiser, H W; Gershowitz, H; Azofeifa, J; Arias, T D; Neel, J V


    There is evidence that Amerindians have continuously occupied the lower Central American Isthmus for as long as 10,000 years. There remains some doubt about the relationships of these original colonizers to the resident peoples of this zone at the time of European contact (approximately A.D. 1500). We present new genetic data for up to 48 genetic loci for 570 members of six Chibcha-speaking tribes of lower Central America--the Boruca, Bribri, Cabecar, and Guatuso of Costa Rica and the Kuna and Teribe of Panama--and delineate the genetic affinities among the various groups (these six tribes and the Guaymi and Bokota) of lower Central America. We convert standard genetic distance metrics into a form that is linear with the effective time since divergence, and we compare the genetic distances with linguistic distances for the same groups (r = .74, P less than .001). Geographic affinity accounts for some of the genetic divergence among groups (r = .49, P less than .084) and for some of the linguistic divergence (r = .53, P less than .037), but the correspondence between geographic position and taxonomic affinity is not high. We combine all of the genetic and linguistic data to construct a synthetic overview taxonomy of the lower Central American Chibcha. Both the genetic and linguistic data exhibit hierarchical organization of tribal groups, showing a general east-to-west pattern of grouping, with greater affinities between close neighbors. The presence of private genetic variants of some antiquity within the region and their absence outside the zone, coupled with the essential absence of the DI*A polymorphism of mongoloid origin that is widespread outside the zone, argue for a relatively isolated development of the Central American Chibcha. Our results do not support the old view of lower Central America as a frontier between more advanced cultures to the north and south. Any such explanation would require recent waves of migration from outside the region, migration

  16. Building positive nature awareness in pupils using the "Rainforest of the Austrians" in Costa Rica.

    NASA Astrophysics Data System (ADS)

    Aubrecht, Margit; Hölzl, Irmgard; Huber, Werner; Weissenhofer, Anton


    20 years ago, Michael Schnitzler founded the NGO "Rainforest of the Austrians" to help save one of the most diverse rainforests in Central America, the Esquinas rainforest on the Pacific coast of SW Costa Rica, from being destroyed through logging. In this abstract we present an interdisciplinary upper Austrian school project aiming at building positive awareness in pupils towards rainforest conservation by fund-raising to help purchase endangered forest areas. The acquired rainforest was donated to the Costa Rican government and became part of the National Park "Piedras Blancas". In the following, we present a chronology of events and actions of the school project. We started our rainforest project by face-to-face encounters, letting involved persons speak directly to the pupils. Dr. Huber, coordinator of the tropical rainforest station La Gamba in Costa Rica (, together with Dr. Weissenhofer, presented an introductory slide show about the "Rainforest of the Austrians". With rainforest images and sounds in their mind the pupils wrote "trips of a lifetime" stories, thus creating idyllic images of rainforest habitats. Following up on that, we visited the exhibition "Heliconia and Hummingbirds" at the Biology Center in Linz. Reports about the slide show and the exhibition followed. Tropical sites were compared by producing climate graphs of La Gamba, Costa Rica, and Manaus in Brazil. The global distribution and the decrease of rainforests were also analyzed. In biology lessons the symbiosis between plants and animals of the rainforest were worked out by searching the Internet. Flyers with profiles of rainforest animals were produced. We also discussed the ecotourism project "RICANCIE" in Ecuador using fact sheets. "RICANCIE" is a Spanish acronym standing for "Indigenous Community Network of the Upper Napo for Intercultural Exchange and Ecotourism". It was founded in 1993 aiming to improve the quality of life for some 200 indigenous Kichwa families

  17. Frequency, types and determinants of degenerative complications of type 2 diabetes in Morocco: "EpiDiaM" cohort inclusion data.


    Selihi, Z; Berraho, M; Rhazi, K El; Achhab, Y El; Lyoussi, B; Nejjari, C


    Degenerative complications as a result of diabetes impose a heavy disease burden and increase mortality. This study presents epidemiological and clinical profiles of diabetic patients in the EpiDiaM cohort study, which include 1196 diabetic cases recruited from the basic health care network in the city of Fez. The mean age of the participants was 57.5 (SD 10.4) years with 47.1% aged between 50 and 60 years. The majority (77.7%) were women. The mean duration of diabetes was 8 (SD 6.6) years. Hypertension was found in 49.3% of the cohort, 77.9% were overweight or obese and 63.8% had one or more complications. Among those with complications, retinopathy was the most common (69.4%), followed by heart conditions (50.8%), neuropathy (45.6%) and renal disease (4.8 %). The high prevalence of complications emphasizes the need to address the avoidable risk factors and prevent complications.

  18. Reduced PM2.5 in Trujillo, Peru, on El Dia Sin Autos ("The Day Without Cars").


    Cassidy, Brandon E; Aguilar-Villalobos, Manuel; Ryan, P Barry; Naeher, Luke P


    Street-level and rooftop (three-story building) concentrations of particulate matter < or = 2.5 microm in diameter (PM2.5) were measured in downtown Trujillo, Peru, in July and August 2003 to determine the PM2.5 concentration reduction on days with normal traffic conditions (32 days) versus a day when motor vehicles were temporarily banned from the downtown district (8:00 a.m. to 6:00 p.m., July 15) known as El Dia Sin Autos ("The Day Without Cars"). The mean 8:00 a.m. to 6:00 p.m. street-level PM2.5 concentration during the motor vehicle ban (21.4 microg/m3; one day) was 49% lower than when vehicles were not impeded (42.2 +/- 7.8 microg/m3--mean +/- 1 standard deviation; 20 days). The rooftop monitoring station indicated a 20% decrease in PM2.5 concentrations (24.8 +/- 2.6 microg/m3 vs. 19.9 +/- 6.0 microg/m3) when motor vehicles were not present within historic downtown Trujillo. Temperature, relative humidity, and wind speed during the motor vehicle ban and during normal traffic were not significantly different (p > .05).

  19. Influence of Voluntary Coffee Certifications on Cooperatives' Advisory Services and Agricultural Practices of Smallholder Farmers in Costa Rica

    ERIC Educational Resources Information Center

    Snider, Anna; Kraus, Eva; Sibelet, Nicole; Bosselmann, Aske Skovmand; Faure, Guy


    Purpose: This article explores how voluntary certifications influence the way cooperatives provide advisory services to their members and the influence of these services on agricultural practices. Design/Methodology/Approach: Case studies were conducted in four representative Costa Rican cooperatives interviewing twenty interviewed cooperative…

  20. New species of Potamocoris Hungerford (Heteroptera, Potamocoridae) from Costa Rica and a key to the species .


    Herrera, Federico; Springer, Monika


    A new potamocorid species, Potamocoris sitesi NEW SPECIES, with its two wing morphs (coleopteroid and macropterous) are described from Costa Rica.  Descriptions are supported with photographs and illustrations. Parameres become progressively narrower, ending in a sharp needle-like point. This is the third species of Potamocoris known from Central America. A key to the species of the genus is provided.

  1. Differences in the association of cardiovascular risk factors with education: a comparison of Costa Rica (CRELES) and the USA (NHANES)

    PubMed Central

    Dow, William H; Rosero-Bixby, Luis


    Background Despite different levels of economic development, Costa Rica and the USA have similar mortalities among adults. However, in the USA there are substantial differences in mortality by educational attainment, and in Costa Rica there are only minor differences. This contrast motivates an examination of behavioural and biological correlates underlying this difference. Methods The authors used data on adults aged 60 and above from the Costa Rican Longevity and Healthy Ageing Study (CRELES) (n=2827) and from the US National Health and Nutrition Examination Survey (NHANES) (n=5607) to analyse the cross-sectional association between educational level and the following risk factors for cardiovascular disease (CVD): ever smoked, current smoker, sedentary, high saturated fat, high carbohydrates, high calorie diet, obesity, severe obesity, large waist circumference, HDL cholesterol, LDL cholesterol, triglycerides, hemoglobin A1c, fasting glucose, C-reactive protein, systolic blood pressure and BMI. Results There were significantly fewer hazardous levels of risk biomarkers at higher levels of education for more than half (10 out of 17) of the risk factors in the USA, but for less than a third of the outcomes in Costa Rica (five out of 17). Conclusions These results are consistent with the context-specific nature of educational differences in risk factors for CVD and with a non-uniform nature of association of CVD risk factors with education within countries. Our results also demonstrate that social equity in mortality is achieved without uniform equity in all risk factors. PMID:19822554

  2. Thirty-Seven Years of the Contra Costa Community College District Governing Board's Minutes in Historical Context. An Abstract.

    ERIC Educational Resources Information Center

    Drexel, Karl O., Ed.; And Others

    This compilation of highly condensed abstracts of the minutes of governing board meetings chronicles the 37-year history of the Contra Costa Community College District (CCCCD) from 1949 to 1986. First, introductory material describes the context and the character of the opening years of the district, and lists the previous and current members of…

  3. Map showing locations of damaging landslides in Contra Costa County, California, resulting from 1997-98 El Nino rainstorms

    USGS Publications Warehouse

    Graymer, Russell W.; Godt, Jonathan W.


    Heavy rainfall associated with a strong El Nino caused over $150 million in landslide damage in the 10-county San Francisco Bay region during the winter and spring of 1998. A team of USGS scientists collected information on landslide locations and damage costs. About $27 million in damages were assessed in Contra Costa County.

  4. Understanding Social Justice Leadership: An International Exploration of the Perspectives of Two School Leaders in Costa Rica and England

    ERIC Educational Resources Information Center

    Slater, Charles; Potter, Ian; Torres, Nancy; Briceno, Fernando


    This article is an examination of two social justice leaders, one in Costa Rica and one in England. It is part of the International Study of Leadership Development Network, a multi-nation study of social justice and educational leadership. A brief discussion of the philosophy of social justice and an examination of the macro and micro context in…

  5. Barriers to and Suggestions for a Healthful, Active Lifestyle as Perceived by Rural and Urban Costa Rican Adolescents

    ERIC Educational Resources Information Center

    Monge-Rojas, Rafael; Garita-Arce, Carlos; Sanchez-Lopez, Marta; Colon-Ramos, Uriyoan


    Objective: To assess the perceptions of rural and urban Costa Rican adolescents regarding which barriers and motivators affect their adoption of an active lifestyle. Design: Data were collected in focus group discussions. Participants: 108 male and female adolescents aged 12 to 18 from the 7th to 11th grades. Setting: Two urban and 1 rural high…

  6. Characterization of a Collective Action between Farmers' Organizations and Institutions in an Innovative Process to Face Liberalization in Costa Rica

    ERIC Educational Resources Information Center

    Faure, Guy


    In Northern Costa Rica, agricultural production conditions change very rapidly due to public policies that encourage the exportation of new crops according to the liberalization process imposed by the international context. For many years, farmers' organizations at the local, regional and national levels have taken initiatives to respond to this…

  7. Biology and trapping of stable flies (Diptera: Muscidae) developing in pineapple residues (Ananas comosus) in Costa Rica

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pineapple production in Costa Rica increased nearly 300-fold during the last 30 yr, and >40,000 hectares of land are currently dedicated to this crop. At the end of the pineapple cropping cycle, plants are chopped and residues incorporated into the soil in preparation for replanting. Associated with...

  8. First report of Bemisia tabaci biotype Q in Costa Rica and detection of viruliferous whiteflies in greenhouses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Whiteflies are a complex that comprises multiple species and biotypes or races which are capable of affecting crops by phloem feeding, virus transmission and promotion of fungal colonization. The distribution of these pests is worldwide. In Costa Rica, a country located in the tropics, the most prob...

  9. The Costa Rica GLOBE (Global Learning and Observations to Benefit the Environment) Project as a Learning Science Environment

    ERIC Educational Resources Information Center

    Castro Rojas, María Dolores; Zuñiga, Ana Lourdes Acuña; Ugalde, Emmanuel Fonseca


    GLOBE is a global educational program for elementary and high school levels, and its main purpose in Costa Rica is to develop scientific thinking and interest for science in high school students through hydrology research projects that allow them to relate science with environmental issues in their communities. Youth between 12 and 17 years old…

  10. 75 FR 13421 - Federal Acquisition Regulation; FAR Case 2008-036, Trade Agreements-Costa Rica, Oman, and Peru

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Peru AGENCIES: Department of Defense (DoD), General Services Administration (GSA), ] and National... States-Oman Free Trade Agreement, and the United States-Peru Trade Promotion Agreement. DATES: Effective... rule added Costa Rica, Oman, and Peru to the definition of ``Free Trade Agreement country''. The...

  11. First report of new phytoplasma diseases associated with soybean, sweet pepper, and passion fruit in Costa Rica

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A new soybean disease outbreak occurred in 2002 in a soybean (Glycine max) plantation in Alajuela Province, Costa Rica. Symptoms in the affected plants included general stunting, little leaf, formation of excessive buds, and aborted seed pods. Another two diseases occurred in sweet pepper (Capsicum ...

  12. "Candidatus phytoplasma costaricanum" a new phytoplasma associated with a newly emerging disease in soybean in Costa Rica

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A new phytoplasma associated with a newly emerging disease, soybean stunt (SoyST), in soybean (Glycine max) was found in 2002 in a soybean plantation in Alajuela Province, Costa Rica. The same or very closely related phytoplasma also infected sweet pepper (Capsicum annuum) with purple vein syndrome ...

  13. Breast Self-Examination: Attitude and Knowledge of Female College Students from USA, Thailand, Costa Rica, and Puerto Rico.

    ERIC Educational Resources Information Center

    Kay, Noy S.; Torabi, Mohammad R.; Ding, Kele; Fernandez, Xinia; Encarnacion, Haydee


    Examined attitudes and knowledge among U.S., Thai, Costa Rican, and Puerto Rican female college students regarding breast self-examination (BSE). Students completed surveys before and after watching an instructional video on BSE. BSE practice was low in all four countries. Students considered BSE a necessary part of individual healthy behaviors.…

  14. Piagetian Study of Science Teaching: An Adaptation of SCIIS to Schools in San Ramon, Alajuela, Costa Rica.

    ERIC Educational Resources Information Center

    Rodriguez, Maria del Carmen Hernandez; And Others


    Describes an interdisciplinary project from the University of Costa Rica conducted to contribute to the improvement of science teaching in primary schools by adopting the Science Curriculum Improvement Study. Changes included the use of woods, rocks, shells, and rain water in science class and integration of science with other subjects. Student…

  15. Comment on: Cyclic extrusion of a lava dome based on a stick-slip mechanism, by Costa et al. (2012)

    NASA Astrophysics Data System (ADS)

    Alexandrov, D. V.; Bashkirtseva, I. A.; Ryashko, L. B.


    Costa et al. (2012) obtained a simple set of nonlinear equations that describe the cyclic extrusions of a lava dome based on a stick-slip model. Here we correct some sign errors in the published derivation of these equations and show that it has exact analytical solutions.

  16. El Dia de los Muertos: A Reference Module for Elementary and Middle School Students. Curriculum Projects. Fulbright-Hays Summer Seminars Abroad Program, 2002 (Mexico).

    ERIC Educational Resources Information Center

    Marchick, Gloria Becker

    The story of the conquest of Mexico, Mezo-America, and South America is widely known, and most of the known traditions are referred to as historical events and in the past tense. "El Dia de los Muertos," however, is a perfect example of the blending of two cultures or transculturation. To ignore what California's large Hispanic…


    EPA Science Inventory

    Atrazine (ATR) is one of the most widely used herbicides in the United States, with current total annual use of approximately 76 million pounds of active ingredient. Previous work in our laboratory has shown that ATR and its metabolite deisopropyl-atrazine (DIA) induce a dose-dep...

  18. Upper-Plate Seismicity Remotely Triggered by the 2012 Mw-7.6 Nicoya Earthquake, Costa Rica

    NASA Astrophysics Data System (ADS)

    Linkimer, L.; Arroyo, I. G.; Montero Pohly, W. K.; Lücke, O. H.


    Remotely triggered seismicity that takes place at distances greater than 1-2 fault lengths appears to be a frequent phenomenon after large earthquakes, including examples in Costa Rica after the large (Mw > 7.0) inter-plate earthquakes in 1941, 1950, 1983, 1990, and 1991. On September 5, 2012, an inter-plate 7.6-Mw earthquake struck the Nicoya Peninsula, triggering upper-plate seismicity in the interior of Costa Rica. In this study, we analyze the largest earthquakes and earthquake swarms that took place during the first nine months after the Nicoya earthquake. These swarms occurred at distances of 150 to 450 km from the Nicoya source region in different tectonic settings: the Calero Island near the Costa Rica-Nicaragua border in the backarc Caribbean region, the Sixaola region near the Costa Rica-Panama border in the backarc Caribbean region, the Cartago area in the central part of Costa Rica near the active volcanic arc, and the San Vito area in the Costa Rica-Panama border region, at the southern flank of the Talamanca Cordillera in an inactive portion of the magmatic arc. The Calero swarm with 70 2.0-to-4.2 Mw earthquakes took place from September 22 to October 9, 2012. The earthquake pattern suggests a smaller-scale fault as a possible source, which is located along the inland projection of the Hess Escarpment. The Cartago swarm with 284 1.8-to-4.1 Mw earthquakes occurred from September 5 to October 31, 2012. The focal mechanism solutions suggest that strike-slip faulting predominates in this region, consistent with neotectonic observations. The San Vito earthquake swarm with 30 2.3-to-4.5 Mw earthquakes occurred between October 14, 2012 and January 28, 2013. These earthquakes occurred in the vicinity of north-south striking faults, which are located along the inland projection of the Panama Fracture Zone. The largest earthquake (5.6 Mw) occurred on the Sixaola region on 27 of May, 2013. The focal mechanism solution suggests a thrust fault that correlates with

  19. Upper-Plate Earthquake Swarms Remotely Triggered by the 2012 Mw-7.6 Nicoya Earthquake, Costa Rica

    NASA Astrophysics Data System (ADS)

    Linkimer, L.; Arroyo, I. G.; Montero Pohly, W. K.; Rojas, W.


    Remotely triggered seismicity that takes place at distances greater than 1-2 fault lengths appears to be a frequent phenomenon after large earthquakes, including damaging upper-plate 5.0-to-6.0 magnitude earthquakes in Costa Rica after the large (Mw > 7.0) inter-plate earthquakes in 1983, 1990, and 1991. On September 5, 2012, an inter-plate 7.6-Mw earthquake struck the Nicoya Peninsula, triggering upper-plate seismicity in the interior of Costa Rica. In this study, we analyze the largest earthquake swarms that took place during the first five months after the Nicoya earthquake. These swarms occurred at distances of 200 to 300 km from the Nicoya source region in three different tectonic settings: the Calero Island near the Costa Rica-Nicaragua border in the backarc Caribbean region, the Cartago area in the central part of Costa Rica near the active volcanic arc, and the San Vito area in the Costa Rica-Panama border region, at the southern flank of the Talamanca Cordillera, an inactive portion of the magmatic arc. The Calero swarm with 64 2.0-to-4.2 Mw earthquakes took place from September 22 to October 9, 2012. The earthquake pattern suggests a smaller-scale fault as a possible source even though this swarm is located along the inland projection of the Hess Escarpment. The Cartago swarm with 284 2.0-to-3.7 Mw earthquakes occurred from September 5 to October 5, 2012. The location and left-lateral solution of the largest event focal mechanism suggest that the Aguacaliente fault, which caused the deadliest earthquake in Costa Rican history on May 4, 1910 (Ms 6.4), is the source of some of this triggered seismicity. The San Vito earthquake swarm with 30 2.0-to-4.5 Mw earthquakes occurred between December 9, 2012 and January 28, 2013. These earthquakes occurred in the vicinity of the San Vito and Agua Buena faults, which are located along the inland projection of the Panama Fracture Zone. Documenting remotely triggered earthquakes may provide us with insight into the

  20. Genetic diversity in Oryza glumaepatula wild rice populations in Costa Rica and possible gene flow from O. sativa

    PubMed Central

    Meneses Martínez, Allan; Calvo, Amanda; Muñoz, Melania


    Wild crop relatives are an important source of genetic diversity for crop improvement. Diversity estimates are generally lacking for many wild crop relatives. The objective of the present study was to analyze how genetic diversity is distributed within and among populations of the wild rice species Oryza glumaepatula in Costa Rica. We also evaluated the likelihood of gene flow between wild and commercial rice species because the latter is commonly sympatric with wild rice populations. Introgression may change wild species by incorporating alleles from domesticated species, increasing the risk of losing original variation. Specimens from all known O. glumaepatula populations in Costa Rica were analyzed with 444 AFLP markers to characterize genetic diversity and structure. We also compared genetic diversity estimates between O. glumaepatula specimens and O. sativa commercial rice. Our results showed that O. glumaepatula populations in Costa Rica have moderately high levels of genetic diversity, comparable to those found in South American populations. Despite the restricted distribution of this species in Costa Rica, populations are fairly large, reducing the effects of drift on genetic diversity. We found a dismissible but significant structure (θ = 0.02 ± 0.001) among populations. A Bayesian structure analysis suggested that some individuals share a significant proportion of their genomes with O. sativa. These results suggest that gene flow from cultivated O. sativa populations may have occurred in the recent past. These results expose an important biohazard: recurrent hybridization may reduce the genetic diversity of this wild rice species. Introgression may transfer commercial traits into O. glumaepatula, which in turn could alter genetic diversity and increase the likelihood of local extinction. These results have important implications for in situ conservation strategies of the only wild populations of O. glumaepatula in Costa Rica. PMID:27077002

  1. Taxonomy of the freshwater crabs of Costa Rica, with a revision of the genus Ptychophallus Smalley, 1964 (Crustacea: Decapoda: Pseudothelphusidae).


    Magalhães, Célio; Wehrtmann, Ingo S; Lara, Luis Rólier; Mantelatto, Fernando L


    The taxonomy and geographic distribution of the freshwater crabs of the family Pseudothelphusidae Ortmann, 1893, of Costa Rica, Central America, particularly of the genus Ptychophallus Smalley, 1964, are revised. Historical materials deposited in major collections of several institutions were examined, as well as valuable collections in the Zoological Museum of the University of Costa Rica that include abundant specimens obtained recently (2007-2010) in the southern region of the country. The pseudothelphusids of Costa Rica consists of 15 currently valid species belonging to Achlidon Smalley, 1964 (two species), Allacanthos Smalley, 1964 (two species), Potamocarcinus H. Milne Edwards, 1853 (three species), and Ptychophallus (eight species). Two species seem to be restricted to the Atlantic drainage, while seven are known only from the Pacific drainage; six species occur in both drainages. Ptychophallus comprises 13 valid species; four new synonymies are proposed: P. osaensis Rodríguez, 2001, P. campylus Pretzmann, 1968, P. tumimanus ingae            Pretzmann, 1978, and P. barbillaensis Rodríguez & Hedström, 2001, as junior synonyms of P. paraxantusi (Bott, 1968), P. tristani (Rathbum 1896), P. tumimanus (Rathbun, 1898), and P. uncinatus Campos & Lemaitre, 1999, respectively. Two species, P. colombianus (Rathbun, 1896) and P. exilipes (Rathbun, 1898), are considered species inquerendae. Lectotype designations are made for P. montanus and P. colombianus. Three species of Ptychophallus are known exclusively from Costa Rica, five exclusively from Panama, and five species occur in both countries; one species appears to be exclusive of the Atlantic drainage, whereas five are known only from the Pacific drainage and seven occur in both drainages. The gonopod morphology of all species is redescribed and illustrated, and maps of their geographic distribution are furnished. A key to the species of Pseudothelphusidae from Costa Rica and to all species of

  2. Lower tier toxicity risk assessment of agriculture pesticides detected on the Río Madre de Dios watershed, Costa Rica.


    Arias-Andrés, M; Rämö, R; Mena Torres, F; Ugalde, R; Grandas, L; Ruepert, C; Castillo, L E; Van den Brink, P J; Gunnarsson, J S


    Costa Rica is a tropical country with one of the highest biodiversity on Earth. It also has an intensive agriculture, and pesticide runoff from banana and pineapple plantations may cause a high toxicity risk to non-target species in rivers downstream the plantations. We performed a first tier risk assessment of the maximum measured concentrations of 32 pesticides detected over 4 years in the River Madre de Dios (RMD) and its coastal lagoon on the Caribbean coast of Costa Rica. Species sensitivity distributions (SSDs) were plotted in order to derive HC5 values for each pesticide, i.e., hazard concentrations for 5 % of the species, often used as environmental criteria values in other countries. We also carried out toxicity tests for selected pesticides with native Costa Rican species in order to calculate risk coefficients according to national guidelines in Costa Rica. The concentrations of herbicides diuron and ametryn and insecticides carbofuran, diazinon, and ethoprophos exceeded either the HC5 value or the lower limit of its 90 % confidence interval suggesting toxic risks above accepted levels. Risk coefficients of diuron and carbofuran derived using local guidelines indicate toxicity risks as well. The assessed fungicides did not present acute toxic risks according to our analysis. Overall, these results show a possible toxicity of detected pesticides to aquatic organisms and provide a comparison of Costa Rican national guidelines with more refined methods for risk assessment based on SSDs. Further higher tier risk assessments of pesticides in this watershed are also necessary in order to consider pesticide water concentrations over time, toxicity from pesticide mixtures, and eventual effects on ecosystem functions.

  3. Apparent Stress Variation in Response to Seamount Subduction at Nicoya Peninsula, Costa Rica

    NASA Astrophysics Data System (ADS)

    Stankova-Pursley, J.; Bilek, S. L.; Phillips, W. S.; Newman, A. V.


    Seamounts are high relief features seen on many oceanic plates, including the Cocos plate offshore Costa Rica. As these features enter the subduction zone at Middle America Trench, they may perturb interface coupling by changing physical properties of the plate interface. Here we explore the role of seamounts on rupture process of microseismicity along Nicoya Peninsula, Costa Rica. This peninsula lies close to a region where down-going Cocos plate structure varies along-strike of the trench. The Cocos plate has low relief along the north and central parts of Nicoya Peninsula, where the subducting plate was created at East Pacific Rise (EPR). Seamounts dot the plate subducting at the southern tip of the peninsula, where the plate was created at Cocos-Nazca Spreading center (CNS). Given these structural differences, we are able to evaluate possible along-strike variations in earthquake source properties. We use 357 earthquakes from the Costa Rica Seismogenic Zone (CR-SEIZE) project to estimate the effects of seamount subduction on apparent stress (σa). We compute σa, which is a measure of stress drop combined with seismic efficiency, using waveform coda because of its proven stability relative to measurements using direct arrivals. We allow variable source scaling, finding that non-constant scaling provides good fit for our data, suggesting that seismic moment is not proportional to the cube root of corner frequency at ML 0.8 to 4.2. σa values for well constrained data indicate along strike variations between the northern and southern tips of the peninsula. Except in the region of a previously subducted seamount in the Gulf of Nicoya where the mean σa is 1.03 MPa, the southern and central portions of the peninsula have mean σa values 0.79 and 0.89 MPa respectively, while the mean σa value in the northern region is 1.66 MPa. The larger mean σa values in the northern region and in the Gulf of Nicoya implies that the interface is more strongly coupled where there

  4. Three-Dimensional Thermal Model of the Costa Rica-Nicaragua Subduction Zone

    NASA Astrophysics Data System (ADS)

    Rosas, Juan Carlos; Currie, Claire A.; He, Jiangheng


    The thermal structure of a subduction zone controls many key processes, including subducting plate metamorphism and dehydration, the megathrust earthquake seismogenic zone and volcanic arc magmatism. Here, we present the first three-dimensional (3D), steady-state kinematic-dynamic thermal model for the Costa Rica-Nicaragua subduction zone. The model consists of the subducting Cocos plate, the overriding Caribbean Plate, and a viscous mantle wedge in which flow is driven by interactions with the downgoing slab. The Cocos plate geometry includes along-strike variations in slab dip, which induce along-strike flow in the mantle wedge. Along-strike flow occurs primarily below Costa Rica, with a maximum magnitude of 4 cm/year (~40 % of the convergence rate) for a mantle with a dislocation creep rheology; an isoviscous mantle has lower velocities. Along-margin flow causes temperatures variations of up to 80 °C in the subducting slab and mantle wedge at the volcanic arc and backarc. The 3D effects do not strongly alter the shallow (<35 km) thermal structure of the subduction zone. The models predict that the megathrust seismogenic zone width decreases from ~100 km below Costa Rica to just a few kilometers below Nicaragua; the narrow width in the north is due to hydrothermal cooling of the oceanic plate. These results are in good agreement with previous 2D models and with the rupture area of recent earthquakes. In the models, along-strike mantle flow is induced only by variations in slab dip, with flow directed toward the south where the dip angle is smallest. In contrast, geochemical and seismic observations suggest a northward flow of 6-19 cm/year. We do not observe this in our models, suggesting that northward flow may be driven by additional factors, such as slab rollback or proximity to a slab edge (slab window). Such high velocities may significantly affect the thermal structure, especially at the southern end of the subduction zone. In this area, 3D models that

  5. Co-designing communication and hazard preparedness strategies at Turrialba volcano, Costa Rica

    NASA Astrophysics Data System (ADS)

    van Manen, Saskia; Avard, Geoffroy; Martinez, Maria


    Globally volcanic activity results in huge human, social, environmental and economic losses. Disaster risk reduction (DRR) is the concept and systematic practice of reducing disaster risks and associated losses through a wide range of strategies, including efforts to increase knowledge through education and outreach. However, recent studies have shown a substantial gap between risk reduction actions taken at national and local levels, with national policies showing little change at the community level. Yet it is at local levels are where DRR efforts can have the biggest impact. This research focuses on communicating hazard preparedness strategies at Turrialba volcano, Costa Rica. Located in the Central Cordillera just 35 km northeast of Costa Rica's capital city San Jose this 3,340 m high active stratovolcano looms over Costa Rica's Central Valley, the social and economic hub of the country. Following progressive increases in degassing and seismic activity Turrialba resumed activity in 1996 after more than 100 years of quiescence. Since 2007 it has continuously emitted gas and since 2010 intermittent phreatic explosions accompanied by ash emissions have occurred. Despite high levels of hazard salience individuals and communities are not or under-prepared to deal with a volcanic eruption. In light of Turrialba's continued activity engaging local communities with disaster risk management is key. At the local levels culture (collective behaviours, interactions, cognitive constructs, and affective understanding) is an important factor in shaping peoples' views, understanding and response to natural phenomena. As such an increasing number of academic studies and intergovernmental organisations advocate for the incorporation of cultural context into disaster risk reduction strategies, which firstly requires documenting people's perception. Therefore approaching community disaster preparedness from a user-centred perspective, through an iterative and collaborative

  6. Parkinson's and Alzheimer's diseases in Costa Rica: a feasibility study toward a national screening program

    PubMed Central

    Wesseling, Catharina; Román, Norbel; Quirós, Indiana; Páez, Laura; García, Vilma; María Mora, Ana; Juncos, Jorge L.; Steenland, Kyle N.


    Background The integration of mental and neurologic services in healthcare is a global priority. The universal Social Security of Costa Rica aspires to develop national screening of neurodegenerative disorders among the elderly, as part of the non-communicable disease agenda. Objective This study assessed the feasibility of routine screening for Parkinson's disease (PD) and Alzheimer's disease (AD) within the public healthcare system of Costa Rica. Design The population (aged ≥65) in the catchment areas of two primary healthcare clinics was targeted for motor and cognitive screening during routine annual health check-ups. The screening followed a tiered three-step approach, with increasing specificity. Step 1 involved a two-symptom questionnaire (tremor-at-rest; balance) and a spiral drawing test for motor assessment, as well as a three-word recall and animal category fluency test for cognitive assessment. Step 2 (for those failing Step 1) was a 10-item version of the Unified Parkinson Disease Rating Scale and the Mini-Mental State Examination. Step 3 (for those failing Step 2) was a comprehensive neurologic exam with definitive diagnosis of PD, AD, mild cognitive impairment (MCI), other disorders, or subjects who were healthy. Screening parameters and disease prevalence were calculated. Results Of the 401 screened subjects (80% of target population), 370 (92%), 163 (45%), and 81 (56%) failed in Step 1, Step 2, and Step 3, respectively. Thirty-three, 20, and 35 patients were diagnosed with PD, AD, and MCI, respectively (7 were PD with MCI/AD); 90% were new cases. Step 1 sensitivities of motor and cognitive assessments regarding Step 2 were both 93%, and Step 2 sensitivities regarding definitive diagnosis 100 and 96%, respectively. Specificities for Step 1 motor and cognitive tests were low (23% and 29%, respectively) and for Step 2 tests acceptable (76%, 94%). Based on international data, PD prevalence was 3.7 times higher than expected; AD prevalence was as

  7. Tropical agricultural residues and their potential uses in fish feeds: the Costa Rican situation.


    Ulloa, J B; van Weerd, J H; Huisman, E A; Verreth, J A J


    In Costa Rica as many other tropical countries, the disposal problem of agricultural wastes is widely recognized but efforts to find solutions are not equal for different sectors. This study describes the situation of major agricultural residues in Costa Rica, identifying the activities with higher amounts produced and, the potential use of these residues in fish feeds. In Costa Rica, during the 1993-1994 production season, major agricultural sectors (crop and livestock) generated a total amount of 3.15-3.25 million MT of residues (classified in by-products: used residues and wastes: not used residues). Some residues are treated to turn them into valuable items or to diminish their polluting effects (e.g., the so-called by-products). About 1.56-1.63 million MT of by-products were used for different purposes (e.g. fertilization, animal feeding, fuel, substrates in greenhouses). However, the remainder (1.59-1.62 million MT) was discharged into environment causing pollution. About 1.07-1.2 million MT wastes came from major crop systems (banana, coffee, sugarcane and oil palm) whereas the remainder came from animal production systems (porcine and poultry production, slaughtering). These data are further compared to residues estimates for the 2001-2002 production season coming from the biggest crops activities. Unfortunately, most of the studied wastes contain high levels of moisture and low levels of protein, and also contain variable amounts of antinutritional factors (e.g., polyphenols, tannins, caffeine), high fibre levels and some toxic substances and pesticides. All these reasons may limit the use of these agricultural wastes for animal feeding, especially in fish feeds. The potential use of the major vegetable and animal residues in fish feeds is discussed based on their nutritional composition, on their amount available over the year and on their pollution risks. Other constraints to use these wastes in fish feeds are the extra costs of drying and, in most cases

  8. Incidence and predictors of hypoglycaemia in type 2 diabetes – an analysis of the prospective DiaRegis registry

    PubMed Central


    Background Hypoglycaemia is a serious adverse effect of antidiabetic drug therapy. We aimed to determine incidence rates of hypoglycaemia in type-2 diabetic patients and identify predictors of hypoglycaemia when treatment is intensified. Methods DiaRegis is a prospective German registry that follows 3810 patients with type-2 diabetes referred for treatment intensification because of insufficient glycaemic control on one or two oral antidiabetic drugs. Results Out of a total of 3347 patients with data available for the present analysis 473 (14.1%) presented any severity hypoglycaemia over a follow-up of 12 months. 0.4% were hospitalized (mean of 1.3±0.6 episodes), 0.1% needed medical assistance (1.0±0.0), 0.8% needed any help (1.1±0.5) and 10.1% no help (3.4±3.7), and 8.0% had no specific symptoms (3.6±3.5). Patients with incident hypoglycaemia had longer diabetes duration, higher HbA1c and a more frequent smoking history; more had co-morbid disease conditions such as coronary artery disease, peripheral arterial disease, amputation, heart failure, peripheral neuropathy, diabetic retinopathy and clinically relevant depression at baseline. Multivariable adjusted positive predictors of incident hypoglycaemia over the follow-up were prior anamnestic hypoglycaemia, retinopathy, depression, insulin use and blood glucose self-measurement, but not sulfonylurea use as previously reported for anamnestic or recalled hypogylcaemia. On the contrary, glitazones, DPP-4 inhibitors and GLP-1 analogues were associated with a reduced risk of hypoglycaemia. Conclusions Hypoglycaemia is a frequent adverse effect in ambulatory patients when antidiabetic treatment is intensified. Particular attention is warranted in patients with prior episodes of hypoglycaemia, microvascular disease such as retinopathy and in patients receiving insulin. On the other hand glitazones, DPP-4 inhibitors and GLP-1 analogues are associated with a reduced risk. PMID:23075070

  9. First isolation and molecular characterization of Ehrlichia canis in Costa Rica, Central America.


    Romero, L E; Meneses, A I; Salazar, L; Jiménez, M; Romero, J J; Aguiar, D M; Labruna, M B; Dolz, G


    The present study investigated Ehrlichia species in blood samples from dogs suspected of clinical ehrlichiosis, using molecular and isolation techniques in cell culture. From a total of 310 canine blood samples analyzed by 16S rRNA nested PCR, 148 (47.7%) were positive for Ehrlichia canis. DNA from Ehrlichia chaffeensis or Ehrlichia ewingii was not detected in any sample using species-specific primers in separated reactions. Leukocytes from five PCR-positive dogs were inoculated into DH82 cells; successful isolation of E. canis was obtained in four samples. Partial sequence of the dsb gene of eight canine blood samples (including the five samples for in vitro isolation) was obtained by PCR and their analyses through BLAST showed 100% of identity with the corresponding sequence of E. canis in GenBank. This study represents the first molecular diagnosis, isolation, and molecular characterization of E. canis in dogs from Costa Rica.

  10. Poor alkaloid sequestration by arrow poison frogs of the genus Phyllobates from Costa Rica.


    Mebs, Dietrich; Alvarez, Joseph Vargas; Pogoda, Werner; Toennes, Stefan W; Köhler, Gunther


    Frogs of the genus Phyllobates from Colombia are known to contain the highly toxic alkaloid batrachotoxin, but species from Central America exhibit only very low levels or are entirely free of this toxin. In the present study alcohol extracts from 101 specimens of Phyllobates lugubris and Phyllobates vittatus and 21 of three sympatric species (Dendrobates pumilio, Dendrobates auratus, Dendrobates granuliferus) from Costa Rica were analyzed by gas chromatography-mass spectrometry. Whereas the extracts of the Dendrobates species exhibited typical profiles of toxic alkaloids, those of the two Phyllobates species contained low levels of few alkaloids only, batrachotoxin was not detected. Although the feeding pattern of the Dendrobates and Phyllobates species are similar as revealed by examination of their stomach content (mainly ants and mites), the Phyllobates species are poorly sequestering alkaloids from their food source in contrast to the Dendrobates frogs.

  11. Costa de Cocos 11-kW wind-diesel hybrid system

    SciTech Connect

    Corbus, D; Bergey, M


    Costa de Cocos is a small resort located in the state of Quintana Roo, Mexico. Using the existing diesel generator, the resort`s power system was retrofitted to a wind-hybrid diesel system. The reason for this retrofit was to supply 24-hour power, to reduce diesel fuel by using wind energy, and to reduce diesel air and noise emissions in order to promote ecotourism. The wind system was installed in October 1996 with cost-shared funding from the U.S. Department of Energy/U.S. Agency for International Development renewable energy program in Mexico. The National Renewable Energy Laboratory (NREL) supplied technical assistance to the project. Discussed in this paper are the system design, installation, and initial performance.

  12. 40Gbit/s coherent optical receiver using a Costas loop.


    Park, Hyun-chul; Lu, Mingzhi; Bloch, Eli; Reed, Thomas; Griffith, Zach; Johansson, Leif; Coldren, Larry; Rodwell, Mark


    A highly integrated 40 Gbit/s coherent optical receiver is reported using a Costas loop as a homodyne optical phase locked loop (OPLL). A photonic IC, an electrical IC, and a hybrid loop filter are characterized, and the feedback loop system is fully analyzed to build a stable homodyne OPLL. All components are integrated on a single substrate within the compact size of 10 × 10mm(2), and a 1.1 GHz loop bandwidth and a 120 psloop delay are achieved. The binary phase-shift keying receiver exhibits error-free (BER<10(-12)) up to 35 Gbit/s and BER<10(-7) for 40 Gbit/s with no latency, and consumes less than 3 W power.

  13. New Species and Records of Costa Rican Featherwing Beetles (Coleoptera:Ptiliidae).


    Darby, Michael


    This paper describes a new genus and species of Acrotrichinae, Seminis factiosum gen. n., sp. n.; two new species of Nossidium: Nossidium schuelkei, n. sp. and Nossidium issyae, sp. n.; and  a new species of Ptenidium (Peruvium), Ptenidium gruenbergae  sp. n. from Costa Rica. Three further species: Ptenidium nitidum (Heer),  Petrotrichis rotundata Darby, and Bambara invisibilis Nietner are recorded as being present. With the exception of N. issyae all the insects were collected using a vehicle roof-mounted net on a single 40  kilometre drive from the east and west coasts of the Osa Peninsula by M. Schülke and B. Grünberg in 2012.

  14. The 'foremost ornithological mystery of Costa Rica': Amazilia alfaroana Underwood, 1896.


    Kirwan, Guy M; Collar, Nigel J


    The hummingbird Amazilia alfaroana is known from a single specimen, collected on the Volcán de Miravalles, in north-west Costa Rica, in September 1895. Since the early 20th century, the taxon has been almost always been treated as a subspecies of Indigo-capped Hummingbird A. cyanifrons, which is otherwise endemic to Colombia, although it has also been tentatively suggested that the holotype might represent a hybrid between two unnamed species of trochilids. Our detailed analysis of the specimen reveals species-level differences between A. alfaroana and A. cyanifrons, and no evidence of characters that might suggest a hybrid between two species known to occur in the relevant region. Until molecular techniques have been brought to bear, we believe that A. alfaroana is best treated as a possibly now extinct species.

  15. Intestinal parasites among Indochinese refugees and Mexican immigrants resettled in Contra Costa County, California.


    Arfaa, F


    Stool examinations of 186 Indochinese refugees and 90 immigrants from Mexico resettled in Contra Costa, County, California, have shown that 60 percent of refugees and 39 percent of immigrants are infected with one or more species of pathogenic protozoa and helminths. The mean prevalences of infections among refugees and immigrants, respectively, were: hookworms, 25 and 2 percent; whipworm, 22 and 12 percent; Ascaris, 20 and 12 percent; Giardia lamblia, 11 and 11 percent; Strongyloides, 9 and 1 percent; and Entamoeba histolytica, 2 and 4 percent. clonorchis sinensis was found in 13 percent of refugees and dwarf tapeworm in 9 percent of immigrants. Rates of infection varied with age and sex. Treatment of these parasitic infections is important and justified because: the prevalence is high; some species are highly pathogenic and directly transmittable; most species have long life spans; and safe broad-spectrum drugs are now available.

  16. A new genus and species of Leptocheliidae (Crustacea: Peracarida: Tanaidacea) from Isla del Coco (Costa Rica).


    Esquete, Patricia; Sibaja-Cordero, Jeffrey A; Troncoso, Jesús S


    Samples from the scarcely-studied sedimentary seabed from the Isla del Coco (Costa Rica) yielded a single species of Tanaidacea, belonging to a new genus of Leptocheliidae, Cocotanais. The new genus shows affinities with Pseudonototanais and Heterotanais in bearing a conspicuous forcipate cheliped in the males, which in Cocotanais has a modified merus and carpal flange. Other distinct characters of the males are a triangular cephalothorax, a three-articled antennular peduncle and swollen bases of pereopods 4-6. Females have a four-articled antennule, a maxilliped endite with three distal flat spines and two inner coupling hooks, and a maxilliped basis with two long setae. The species was found in sheltered bays, both free-living in the sediment and also as a commensal of anemones (Infraorder Boloceroidaria), thus representing the first reported case of such an association. 

  17. An ecological risk assessment of pesticides and fish kills in the Sixaola watershed, Costa Rica.


    Polidoro, Beth A; Morra, Matthew J


    Along the southeastern coast of Costa Rica, a variety of pesticides are intensively applied to produce export-quality plantains and bananas. In this region, and in other agricultural areas, fish kills are often documented by local residents and/or in the national news. This study examines principal exposure pathways, measured environmental concentrations, and selected toxicity thresholds of the three most prevalent pesticides (chlorpyrifos, terbufos, and difenoconazole) to construct a deterministic risk assessment for fish mortality. Comparisons of observed pesticide concentrations, along with estimated biological effects and observations during actual fish kills, highlight gaps in knowledge in correlating pesticide environmental concentration and toxicity in tropical environments. Observations of fish kill events and measured pesticide concentrations in the field, along with other water quality indicators, suggest that a number of environmental conditions can interact to cause fish mortality and that current species toxicity datasets may not be applicable for estimating toxicological or other synergistic effects, especially in tropical environments.

  18. Do Birds Select Habitat or Food Resources? Nearctic-Neotropic Migrants in Northeastern Costa Rica

    PubMed Central

    Wolfe, Jared D.; Johnson, Matthew D.; Ralph, C. John


    Nearctic-neotropic migrant birds need to replenish energy reserves during stopover periods to successfully complete their semiannual movements. In this study we used linear models to examine the habitat use of 11 migrant species in northeastern Costa Rica to better understand the influence of food and structural resources on the presence of birds during stopover periods. Our models indicated that frugivorous migrants primarily used food abundance, while insectivorous migrants chiefly used vegetation structure as cues for habitat use during stopover. In addition to habitat use models, we documented fruiting plant phenology and found a general relationship between migrant arrival and the timing of ripe fruit availability. Our results suggest that insectivorous migrants probably rely on structural features when using habitat because it may be inherently difficult to assess cryptic-arthropod availability during a short period of time in a novel habitat, such as stopover periods. PMID:24489701

  19. Isolation and Molecular Characterization of Acanthamoeba Strains from Dental Units in Costa Rica.


    Retana-Moreira, Lissette; Abrahams-Sandí, Elizabeth; Castro-Artavia, Esteban; Fernández-Sánchez, Ana; Castro-Castillo, Alfredo; Reyes-Batlle, María; Lorenzo-Morales, Jacob


    Free-living amoebae are protozoa widely distributed in nature, which can be found in a variety of environments. Four genera are recognized as causal agents of infections in humans and animals: Acanthamoeba, Naegleria, Balamuthia, and Sappinia. In this study, the presence of Acanthamoeba in dental units was determined and the isolates obtained were molecularly characterized; osmotolerance and thermotolerance assays were also performed to evaluate multiplication under these conditions, frequently associated with pathogenicity. The morphological analysis and partial sequencing of the 18S rDNA gene revealed the presence of Acanthamoeba genotype T4 in 14% of the units sampled. Osmotolerance and thermotolerance tests were positive for more than 80% of the isolates. Up to date, this is the first study that reports the detection, identification, and genotyping of Acanthamoeba isolated from dental units in Costa Rica and even in Latin-America. Further assays to determine the potential pathogenicity of these Acanthamoeba isolates are underway.

  20. [Public health programs have greatly reduced infant mortality in Costa Rica].



    The spectacular decline of infant mortality in Costa Rica from 68/1000 live births in 1970 to 20/1000 in 1980 was largely due to the implementation of public health programs in the 1970s. The abrupt decline was even more notable because deaths of infants constituted the major health problem of the country during the 1960s, accounting for 40% of all registered deaths. Socioeconomic development and reduced fertility contributed to the reduction, but 3/4 of the improvement can be attributed to extension of primary health care to previously unserved rural populations and to better secondary health care, according to a study by the Costa Rican demographer Luis Rosero Bixby. The programs targeted at less privileged groups substantially reduced class and geographic differentials in infant mortality. Infant mortality began to decline at an accelerating rate in 1972, coinciding with the first national health plan and the law of universal social security in 1971, the transfer of public hospitals to the social security system and promulgation of a general health law in 1973, and application of the rural health program in 1973 and community health program in 1976. By 1980, home services reached 60% of the population and immunization programs were in place for measles and diphtheria, pertussis, and tetanus. There was a doubling of outpatient services and a tripling of hours contracted by doctors between 1970-80. Also in 1980, 78% of the Costa Rican population was fully covered by health insurance. After 1972, infant mortality declined from all causes except complications of pregnancy and congenital anomalies. The decline was most rapid for deaths due to prematurity, illnesses avoidable by vaccination, and illnesses such as septicemia and meningitis in which prompt diagnosis and treatment can be lifesaving. Although impressive gains were made in neonatal mortality, the main share of the decline between 1970-80 was in postneonatal mortality. Reductions in deaths due to diarrheal

  1. An empirical evaluation of devolving administrative control to Costa Rican hospital and clinic directors.


    Lee, Theodore; McKee, Douglas


    In the early 2000s, Costa Rica implemented comprehensive reforms of its health care system, including devolving administrative power from the central government to some providers that remain part of the national system. In this article, we evaluate how this aspect of the reform affected clinic efficiency and population health by analyzing administrative data on regional providers and mortality rates in local areas. We compare changes in outcomes across time between areas that signed performance contracts with the central government and received limited budgetary control to those that continued to be managed directly by the central government. We believe the reform created opportunities for providers to become more efficient and effective. Our results suggest that the reform significantly decreased costs without adversely affecting quality of care or population health.

  2. Clinica Tibas: an experimental response to health system challenges in Costa Rica.


    Pezza, P E; Barquero Bolaños, J F


    Several experiments in health services delivery featuring contractual arrangements between government and the private sector have been initiated in Costa Rica. This report describes a public-private partnership serving a community of 50,000. A 'cooperative' of providers stands to gain financially if it succeeds in providing clinic services in an efficacious and efficient manner. This experimental approach retains elements of the existing public system for health promotion and disease prevention while introducing innovations for increased organizational efficiency and client satisfaction. The clinic provides easier access to better care, including ambulatory surgery, pharmacy service, and home visits, and at a lower cost to government than that budgeted under pre-existing arrangements. Inappropriate usage of area hospitals has been reduced; and a commitment to community participation and organized programming permit greater responsiveness to community needs. Those served by the clinic report satisfaction. Personnel also report satisfaction and enthusiasm for their work. Issues concerning extension of this model are considered.

  3. Surveillance and epidemiology of occupational pesticide poisonings on banana plantations in Costa Rica.


    Vergara, A E; Fuortes, L


    A review of one year's workers' compensation records from the Costa Rican National Insurance Institute was performed in a banana plantation region to determine rates of and risk factors for agrichemical poisonings. Review of 9,060 medical records revealed that the most commonly reported agrichemical-related injuries (n=800) were chemical burns (28%) and acute intoxications (21%). Other agrichemical-related injuries included eye injuries, chemical dermatoses, and chronic fungal infections. The incidences and types of injuries differed between male and female workers and workers of different age groups. Older female workers were more likely to report chemical dermatoses. Young male workers were more likely to experience acute intoxication. These differences seem to be attributable to divisions of labor by gender and age among plantation workers.

  4. [The mangrove and others vegetation associations in de Gandoca lagoon, Limón, Costa Rica].


    Coll, M; Fonseca, A C; Cortés, J


    Six plant associations were identified at Gandoca Lagoon by photointerpretation and field verification: a) mangroves, b) palm trees swamp, and palm trees with Acrostichum aureum and A. danaefolium, c) mixed palm trees, d) very humid tropical rain forest, and e) tropical beach vegetation. The mangroves cover 12.5 ha surrounding the lagoon and extend 2 km up the Gandoca River. Rhizophora mangle (red mangrove) was the dominant species, with Avicennia germinans (black mangrove), Laguncularia racemosa (white mangrove) and Conocarpus erectus (buttonwood) also present. Moving inland the mangroves grade into a tropical rain forest. Gandoca, the largest and best preserved mangrove of Caribbean Costa Rica, tripled its area from 1976 to 2000. Possible causes include sedimentation and the Limón earthquake, which may have subside the lagoon area.

  5. Secondary mineral growth in fractures in the Miravalles geothermal system, Costa Rica

    SciTech Connect

    Rochelle, C.A. . Dept. of Earth Sciences); Milodowski, A.E.; Savage, D. . Fluid Processes Research Group); Corella, M. )


    A mineralogical, fluid-chemical, and theoretical study of hydrothermal alteration in veins from drillcore from the Miravalles geothermal field, Costa Rica has revealed a complex history of mineral-fluid reaction which may be used to characterize changes in temperature and fluid composition with time. Mineralogical and mineral-chemical data are consistent with hydrothermal alteration in the temperature range 200{sup 0}-270{sup 0}C, with deeper portions of the system having undergone temperatures in excess of 300{sup 0}C. Thermodynamic calculations suggest that the observed alteration assemblage is not equilibrium with current well fluids, unless estimates of reservoir pH are incorrect. Fe-Al zoning of prehnite and epidote in veins is consistent with rapid, isothermal fluctuations in fluid composition at current reservoir temperatures, and may be due to changes in volatile content of the fluid due to tectonic activity.

  6. [Determination of trace elements in ancient Cheshi human costa by ICP-AES].


    Jin, Hai-yan; Zhang, Quan-chao; Zhu, Hong


    In recent years, the study on palaeodiet is an important research in the international archaeological field. Trace elements in human bones can supply a lot of valuable information to reconstruct ancient diet. In this study, The trace elements in Bronze age Cheshi human costa from Chubeixi cemetery in shanshan, Xinjiang were determined by ICP-AES. The sample was dissolved by HNO3 and HCl. Under the optimum conditions, eight elements can be determined simultaneously. The recoveries of the method are in the range of 87.4%-106.6%, and RSDs are in the range of 0.5%-3.3%. The method is simple, rapid, precise and convenient to operate. The results would be helpful for research in archaeology. This analysis established Xinjiang' s consult system of trace elements analysis for ancient human bones. The effects of various concentrations of acid solution on analysis results, the interference of coexistent elements, standard addition recovery, and precision of the method were investigated.

  7. Do birds select habitat or food resources? Nearctic-neotropic migrants in northeastern Costa Rica.


    Wolfe, Jared D; Johnson, Matthew D; Ralph, C John


    Nearctic-neotropic migrant birds need to replenish energy reserves during stopover periods to successfully complete their semiannual movements. In this study we used linear models to examine the habitat use of 11 migrant species in northeastern Costa Rica to better understand the influence of food and structural resources on the presence of birds during stopover periods. Our models indicated that frugivorous migrants primarily used food abundance, while insectivorous migrants chiefly used vegetation structure as cues for habitat use during stopover. In addition to habitat use models, we documented fruiting plant phenology and found a general relationship between migrant arrival and the timing of ripe fruit availability. Our results suggest that insectivorous migrants probably rely on structural features when using habitat because it may be inherently difficult to assess cryptic-arthropod availability during a short period of time in a novel habitat, such as stopover periods.

  8. Costa de Cocos 11-kW wind-diesel hybrid system

    SciTech Connect

    Corbus, D.; Bergey, M.


    Costa de Cocos is a small resort located in the state of Quintana Roo, Mexico. Using the existing diesel generator, the resort`s power system was retrofitted to a wind-hybrid diesel system. The reason for this retrofit was to supply 24-hour power, to reduce diesel fuel by using wind energy, and to reduce diesel air and noise emissions in order to promote ecotourism. The wind system was installed in October 1996 with cost-shared funding from the U.S. Department of Energy/U.S. Agency for International Development renewable energy program in Mexico. The National Renewable Energy Laboratory (NREL) supplied technical assistance to the project. Discussed in this paper are the system design, installation, and initial performance.

  9. [Preliminary plant inventory of the palm-swamps in the Caribbean of Costa Rica and Nicaragua].


    Rueda, Ricardo; Jarquín, Orlando; Munguía, Blanca; Reyes, Aquiles; Coronado, Indiana


    In the Caribbean slope of Isthmian Central America, plant associations dominated by the palms Raphia taedigera and Manicaria saccifera develop in poorly drained or waterlogged soils. These associations are known locally as yolillales or palm-swamps, although there are differences in the forest structure and plant diversity associated with both palm species. In this paper, we report the results of a preliminary inventory of tree species found in eight palm-swamps at five locations in southeastern Nicaragua and northeastern Costa Rica. Our data reveal low tree diversity in these swamps with only 60 species accounted in them. This figure is equivalent to close to 8% of the plant species known for this region. In general, R. taedigera dominates flooded areas with extensive hydroperiods and lower floristic diversity, while M. saccifera is often found in flooded forests with more structure and diversity.

  10. Crepidotus crocophyllus found in Costa Rica and Mexico and revision of related species in subsection Fulvifibrillosi.


    Bandala, Victor M; Montoya, Leticia; Mata, Milagro


    The study of Crepidotus specimens collected in Costa Rica and Mexico revealed that C. crocophyllus occurs in the tropical and subtropical forests of both countries. Type specimens of seven species related to C. crocophyllus in subsection Fulvifibrillosi s. Hesler and Smith were re-examined. Based on the morphological features, specimens supporting C. appalachianensis, C. aureifolius, C. distortus, C. subaureifolius and C. subnidulans are interpreted to be C. crocophyllus, thus all herein are proposed as its synonyms. Furthermore A. nephrodes is confirmed as a synonym of Crepidotus crocophyllus while Agaricus malachius, long considered contaxic with the former, is proposed as synonym of Crepidotus applanatus. The known records of C. crocophyllus indicate a wide but fragmented range of extension of the taxon throughout the Americas. Description, illustrations of microscopic features and discussions are provided.

  11. Survey of Wild Mammal Hosts of Cutaneous Leishmaniasis Parasites in Panamá and Costa Rica

    PubMed Central

    González, Kadir; Calzada, José E.; Saldaña, Azael; Rigg, Chystrie A.; Alvarado, Gilbert; Rodríguez-Herrera, Bernal; Kitron, Uriel D.; Adler, Gregory H.; Gottdenker, Nicole L.; Chaves, Luis Fernando; Baldi, Mario


    The eco-epidemiology of American cutaneous leishmaniasis (ACL) is driven by animal reservoir species that are a source of infection for sand flies that serve as vectors infecting humans with Leishmania spp parasites. The emergence and re-emergence of this disease across Latin America calls for further studies to identify reservoir species associated with enzootic transmission. Here, we present results from a survey of 52 individuals from 13 wild mammal species at endemic sites in Costa Rica and Panama where ACL mammal hosts have not been previously studied. For Leishmania spp. diagnostics we employed a novel PCR technique using blood samples collected on filter paper. We only found Leishmania spp parasites in one host, the two-toed sloth, Choloepus hoffmanni. Our findings add further support to the role of two-toed sloths as an important ACL reservoir in Central America. PMID:25859156

  12. Interstitial water chemistry of sediments of the Costa Rica Accretionary Complex off the Nicoya Peninsula

    NASA Astrophysics Data System (ADS)

    Zuleger, E.; Gieskes, J. M.; You, C.-F.

    Interstitial water analyses from numerous piston, gravity, and Alvin push cores show that fluid flow at the Costa Rica Accretionary Prism is spatially limited and can only be detected by visually directed cores in zones of biogenic activity. Most of the sites cored show evidence for normal diagenetic processes in rapidly deposited, organic carbon-rich sediments, with little evidence for fluid advection. However, in visually directed Alvin push cores, obtained from black sulfidic sediments characterized by the presence of Calyptogena clams or tubeworms, evidence for fluids advected upward from greater depth horizons is shown. These zones are associated with a large mudvolcano on the prism and with the zoes of Out Of Sequence Thrusts. As changes from sea water concentrations are still relatively small, substantial mixing with sea water must have occurred during this upward fluid movement.

  13. Landscape-Scale Canopy Complexity in and Near Braulio Carillo National Park, Costa Rica

    NASA Technical Reports Server (NTRS)

    Knox, Robert G.; Blair, J. B.; Weishampel, J. F.; Clark, D. B.; Hofton, M. A.; Dubayah, R.


    Using medium-large footprint lidar sampling of approximately 500 square km of Costa Rica, we assessed the vertical and horizontal complexity of a forest-dominated tropical landscape. As expected, vertical extents of structure and canopy heights estimated from lidar waveforms were smaller in high elevation forests than in forests at lower elevations. In areas of the park and long-protected areas of La Selva Biological Station, forests typically had more consistent ratios of median height to total height than areas with other types of recent land use. Areas outside the park exhibited both stronger and weaker spatial correlations in canopy properties than most areas within the park. We also simulated the effects of these differences on data products gridded from lidar transects, like those produced by the Vegetation Canopy Lidar (VCL) Mission.

  14. [Fulminant Wilson's disease in Costa Rica. Clinico-pathological study of 7 cases].


    Herra, S A; Hevia, F J; Vargas, M; Schosinsky, K


    In the last eighteen years, from 1972 to 1989, around 150 cases of Wilson's disease have been diagnosed in Costa Rica (6/100.000 inhabitants). In the San Juan de Dios Hospital, 120 cases have been studied during this period, seven of whom died with a picture of acute hepatic insufficiency, hemolytic anemia, encephalopathy, intestinal bleeding and renal insufficiency. In four of the cases, postmortem histopathologic studies were done with high resolution microscopy, which revealed extensive submassive necrosis of the liver, with severe cholestatic, lytic and acidophilic necrosis with nodular, irregular regeneration and specially microvacuolar steatosis, different from that observed in other forms of fulminant hepatitis. With the clinical, laboratory and histopathologic findings, we concluded that fulminant Wilson's disease is a well-defined pathological clinical entity of fatal evolution with no response to therapy, including early treatment with penicillamine and steroids.

  15. [Juvenile fish in a tidal pool, Térraba-Sierpe Forest Reserve, Puntarenas, Costa Rica].


    Chicas, F A


    Juvenile fish were sampled with a 10 m long net in a tide pool (17,000 m2) on the West margin of Boca Guarumal, Térraba-Sierpe Forest Reserve, Puntarenas, Costa Rica, from October 1992 through January 1994. Water temperature and surface salinity were recorded in each visit. The specimens were fixed in 5% formaldehyde and preserved in 70% ethanol. Abundance and size data were pooled based on precipitation, a main ecological influence in the Reserve. A total of 13,494 individuals from 18 species were captured. Eucinostomus currani, Gobionellus sagittula, Diapterus peruvianus, Agonostomus monticola and Atherinella sp. represented more than 97% of the captures. Although many species presented the tendency of concentrating during the dry season, significant differences in temporal abundance were found. The fish entered the estuary when their body length was between 20 and 60 mm.

  16. Survey of wild mammal hosts of cutaneous leishmaniasis parasites in panamá and costa rica.


    González, Kadir; Calzada, José E; Saldaña, Azael; Rigg, Chystrie A; Alvarado, Gilbert; Rodríguez-Herrera, Bernal; Kitron, Uriel D; Adler, Gregory H; Gottdenker, Nicole L; Chaves, Luis Fernando; Baldi, Mario


    The eco-epidemiology of American cutaneous leishmaniasis (ACL) is driven by animal reservoir species that are a source of infection for sand flies that serve as vectors infecting humans with Leishmania spp parasites. The emergence and re-emergence of this disease across Latin America calls for further studies to identify reservoir species associated with enzootic transmission. Here, we present results from a survey of 52 individuals from 13 wild mammal species at endemic sites in Costa Rica and Panama where ACL mammal hosts have not been previously studied. For Leishmania spp. diagnostics we employed a novel PCR technique using blood samples collected on filter paper. We only found Leishmania spp parasites in one host, the two-toed sloth, Choloepus hoffmanni. Our findings add further support to the role of two-toed sloths as an important ACL reservoir in Central America.

  17. An approach to investigating linkage for bipolar disorder using large Costa Rican pedigrees

    SciTech Connect

    Freimer, N.B.; Reus, V.I.; Vinogradov, S.


    Despite the evidence that major gene effects exist for bipolar disorder (BP), efforts to map BP loci have so far been unsuccessful. A strategy for mapping BP loci is described, focused on investigation of large pedigrees from a genetically homogenous population, that of Costa Rica. This approach is based on the use of a conservative definition of the BP phenotype in preparation for whole genome screening with polymorphic markers. Linkage simulation analyses are utilized to indicate the probability of detecting evidence suggestive of linkage, using these pedigrees. These analyses are performed under a series of single locus models, ranging form recessive to nearly dominant, utilizing both lod score and affected pedigree member analyses. Additional calculations demonstrate that with any of the models employed, most of the information for linkage derives from affected rather than unaffected individuals. 26 refs., 2 figs., 5 tabs.

  18. Accounting for quality in the measurement of hospital performance: evidence from Costa Rica.


    Arocena, Pablo; García-Prado, Ariadna


    This paper provides insights into how Costa Rican public hospitals responded to the pressure for increased efficiency and quality introduced by the reforms carried out over the period 1997-2001. To that purpose we compute a generalized output distance function by means of non-parametric mathematical programming to construct a productivity index, which accounts for productivity changes while controlling for quality of care. Our results show an improvement in hospital performance mainly driven by quality increases. The adoption of management contracts seems to have contributed to such enhancement, more notably for small hospitals. Further, productivity growth is primarily due to technical and scale efficiency change rather than technological change. A number of policy implications are drawn from these results.

  19. Use of a national reporting system for occupational injuries in Costa Rica.


    Buchanan, Susan; Krantz, Anne; Klempner, Sophia; Alvarado, Rebeca; Wesseling, Catharina; Fernández, Eduardo; Forst, Linda


    Occupational injury surveillance in developing countries may be hindered by the lack of health data infrastructure as well the large numbers of informal-sector workers. The goal of this study was to elucidate the scope of occupational injury in the Monteverde district of Costa Rica using data collected through the national workers social security system. A list of occupational injuries occurring in the district reported to the National Insurance Institute (INS) central office between 1998 and 2002 was taken to the regional INS office, and the original injury reports for the cases were pulled. Specific data on the injuries were collected. There were 184 injuries reported during the five year period. Occupations with the highest number of injuries included production, building and grounds maintenance, and agricultural/forestry/fishing. Descriptive data showed that prevention efforts in this rural region should target food manufacturing, hotels, and construction.

  20. The blood parasites of anurans from Costa Rica with reflections on the taxonomy of their trypanosomes.


    Desser, S S


    During May 1997, specimens of 7 species of anurans, that included 5 Phrynohyas venulosa Laurenti, 5 Rana forreri Boulenger, 7 Rana vaillanti Brucchi, 6 Eleutherodactylus fitzingeri Schimdt, 4 Smilisca baudinii Duméril and Bibron, 1 Leptodactylus melanonotus, and 3 Bufo marinus Linneaus, from the Guanacaste Conservation Area, Costa Rica were examined for blood parasites. Their hematozoan fauna included intraerythrocytic and intraleukocytic icosahedral viruses, a rickettsia (Aegyptianella sp.), 2 species of Hepatozoon, Lankesterella minima, 2 unknown species of apicomplexans, 9 morphologically distinct types of trypanosomes, and 2 species of microfilariae. Rana vaillanti, the most aquatic species of frog, harbored the most species of parasites. Recent evidence indicates that morphological changes in the highly pleomorphic trypanosomes of anurans from different geographical regions have not kept pace with biochemical (isozyme) and molecular (DNA sequence) changes. Describing new species based solely on bloodstream trypomastigotes is discouraged. Additional criteria described herein should be applied when naming new species of anuran trypanosomes.