21 CFR 866.3145 - Coxsackievirus serological reagents.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Coxsackievirus serological reagents. 866.3145 Section 866.3145 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3145...

Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

PubMed

Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

2015-07-01

Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Placental Massive Perivillous Fibrinoid Deposition Associated with Coxsackievirus A16-Report of a Case, and Review of the Literature.

PubMed

Heller, Debra S; Tellier, Raymond; Pabbaraju, Kanti; Wong, Sallene; Faye-Petersen, Ona M; Muehlenbachs, Atis; Goldsmith, Cynthia; Denison, Amy; Zaki, Sherif R

Massive placental perivillous fibrinoid deposition in the placenta is thought to be an immune-related condition associated with poor perinatal outcomes, including growth restriction and intrauterine fetal demise, with a high risk of recurrence. Rare cases have been associated with Coxsackievirus infection. We present such a case and review the literature.

Molecular phylogeny of Coxsackievirus A16 in Shenzhen, China, from 2005 to 2009.

PubMed

Zong, Wenping; He, Yaqing; Yu, Shouyi; Yang, Hong; Xian, Huixia; Liao, Yuxue; Hu, Guifang

2011-04-01

Phylogenetic analysis of a Coxsackievirus A16 (CA16) sequence from Shenzhen, China, and other Chinese and international CA16 sequences revealed a pattern of endemic cocirculation of strains of clusters B2a and B2b within subtype B2 viruses. Amino acid evolution and nucleotide variation in the VP1 region were slight for 5 years.

Regulatory T cells protect mice against coxsackievirus-induced myocarditis through the transforming growth factor beta-coxsackie-adenovirus receptor pathway.

PubMed

Shi, Yu; Fukuoka, Masahiro; Li, Guohua; Liu, Youan; Chen, Manyin; Konviser, Michael; Chen, Xin; Opavsky, Mary Anne; Liu, Peter P

2010-06-22

Coxsackievirus B3 infection is an excellent model of human myocarditis and dilated cardiomyopathy. Cardiac injury is caused either by a direct cytopathic effect of the virus or through immune-mediated mechanisms. Regulatory T cells (Tregs) play an important role in the negative modulation of host immune responses and set the threshold of autoimmune activation. This study was designed to test the protective effects of Tregs and to determine the underlying mechanisms. Carboxyfluorescein diacetate succinimidyl ester-labeled Tregs or naïve CD4(+) T cells were injected intravenously once every 2 weeks 3 times into mice. The mice were then challenged with intraperitoneal coxsackievirus B3 immediately after the last cell transfer. Transfer of Tregs showed higher survival rates than transfer of CD4(+) T cells (P=0.0136) but not compared with the PBS injection group (P=0.0589). Interestingly, Tregs also significantly decreased virus titers and inflammatory scores in the heart. Transforming growth factor-beta and phosphorylated AKT were upregulated in Tregs-transferred mice and coxsackie-adenovirus receptor expression was decreased in the heart compared with control groups. Transforming growth factor-beta decreased coxsackie-adenovirus receptor expression and inhibited coxsackievirus B3 infection in HL-1 cells and neonatal cardiac myocytes. Splenocytes collected from Treg-, CD4(+) T-cell-, and PBS-treated mice proliferated equally when stimulated with heat-inactivated virus, whereas in the Treg group, the proliferation rate was reduced significantly when stimulated with noninfected heart tissue homogenate. Adoptive transfer of Tregs protected mice from coxsackievirus B3-induced myocarditis through the transforming growth factor beta-coxsackie-adenovirus receptor pathway and thus suppresses the immune response to cardiac tissue, maintaining the antiviral immune response.

Echoviruses are a major cause of aseptic meningitis in infants and young children in Kuwait.

PubMed

Dalwai, Ajmal; Ahmad, Suhail; Al-Nakib, Widad

2010-09-16

The etiologic agents of aseptic meningitis (AM) often include human enteroviruses. The role of enteroviruses causing AM in young children was investigated during a 3-year period in Kuwait. Enteroviral RNA was detected in cerebrospinal fluid (CSF) by reverse transcription-PCR and specific genotypes of enteroviruses were identified by direct DNA sequencing of VP4-VP2 region. Enteroviral RNA was detected in 92 of 387 (24%) suspected AM cases and the results were confirmed by hybridization of amplicons with an internal, enterovirus-specific probe. The CSF samples from 75 of 281 (27%) children < 2 years old but only from 3 of 38 (8%) 4-12 year-old children were positive for enteroviral RNA (p = 0.011). Majority of infections in children < 2 years old (49 of 75, 65%) were due to three echoviruses; echovirus type 9 (E9), E11 and E30. Only three other enteroviruses, namely coxsackievirus type B4, coxsackievirus type B5 and enterovirus 71 were detected among AM cases in Kuwait. Our data show that three types of echoviruses (E9, E11 and E30) are associated with the majority of AM cases in Kuwait. To the best of our knowledge, this is the first report to characterize different enterovirus genotypes associated with AM in the Arabian Gulf region.

Coxsackievirus A6: a new emerging pathogen causing hand, foot and mouth disease outbreaks worldwide.

PubMed

Bian, Lianlian; Wang, Yiping; Yao, Xin; Mao, Qunying; Xu, Miao; Liang, Zhenglun

2015-01-01

Enterovirus 71 (EV71) and coxsackievirus A16 (CA16) are the predominant pathogens causing outbreaks of hand, foot and mouth disease (HFMD) worldwide. Other human enterovirus A (HEV-A) serotypes tend to cause only sporadic HFMD cases. However, since a HFMD caused by coxsackievirus A6 broke out in Finland in 2008, CA6 has been identified as the responsible pathogen for a series of HFMD outbreaks in Europe, North America and Asia. Because of the severity of the clinical manifestations and the underestimated public health burden, the epidemic of CA6-associated HFMD presents a new challenge to the control of HFMD. This article reviewed the epidemic characteristics, molecular epidemiology, clinical features and laboratory diagnosis of CA6 infection. The genetic evolution of CA6 strains associated with HFMD was also analyzed. It indicated that the development of a multivalent vaccine combining EV71, CA16 and CA6 is an urgent necessity to control HFMD.

Serological detection and analysis of anti-VP1 responses against various enteroviruses (EV) (EV-A, EV-B and EV-C) in Chinese individuals.

PubMed

Gao, Caixia; Ding, Yingying; Zhou, Peng; Feng, Jiaojiao; Qian, Baohua; Lin, Ziyu; Wang, Lili; Wang, Jinhong; Zhao, Chunyan; Li, Xiangyu; Cao, Mingmei; Peng, Heng; Rui, Bing; Pan, Wei

2016-02-26

The overall serological prevalence of EV infections based on ELISA remains unknown. In the present study, the antibody responses against VP1 of the EV-A species (enterovirus 71 (EV71), Coxsackievirus A16 (CA16), Coxsackievirus A5 (CA5) and Coxsackievirus A6 (CA6)), of the EV-B species (Coxsackievirus B3 (CB3)), and of the EV-C species (Poliovirus 1 (PV1)) were detected and analyzed by a NEIBM (novel evolved immunoglobulin-binding molecule)-based ELISA in Shanghai blood donors. The serological prevalence of anti-CB3 VP1 antibodies was demonstrated to show the highest level, with anti-PV1 VP1 antibodies at the second highest level, and anti-CA5, CA6, CA16 and EV71 VP1 antibodies at a comparatively low level. All reactions were significantly correlated at different levels, which were approximately proportional to their sequence similarities. Antibody responses against EV71 VP1 showed obvious differences with responses against other EV-A viruses. Obvious differences in antibody responses between August 2013 and May 2014 were revealed. These findings are the first to describe the detailed information of the serological prevalence of human antibody responses against the VP1 of EV-A, B and C viruses, and could be helpful for understanding of the ubiquity of EV infections and for identifying an effective approach for seroepidemiological surveillance based on ELISA.

Quinoxaline derivatives as new inhibitors of coxsackievirus B5.

PubMed

Carta, Antonio; Sanna, Giuseppina; Briguglio, Irene; Madeddu, Silvia; Vitale, Gabriella; Piras, Sandra; Corona, Paola; Peana, Alessandra Tiziana; Laurini, Erik; Fermeglia, Maurizio; Pricl, Sabrina; Serra, Alessandra; Carta, Elisa; Loddo, Roberta; Giliberti, Gabriele

2018-02-10

Enteroviruses are among the most common and important human pathogens for which there are no specific antiviral agents approved by the US Food and Drug Administration so far. Particularly, coxsackievirus infections have a worldwide distribution and can cause many important diseases. We here report the synthesis of new 14 quinoxaline derivatives and the evaluation of their cytotoxicity and antiviral activity against representatives of ssRNA, dsRNA and dsDNA viruses. Promisingly, three compounds showed a very potent and selective antiviral activity against coxsackievirus B5, with EC 50 in the sub-micromolar range (0.3-0.06 μM). A combination of experimental techniques (i.e. virucidal activity, time of drug addition and adsorption assays) and in silico modeling studies were further performed, aiming to understand the mode of action of the most active, selective and not cytotoxic compound, the ethyl 4-[(2,3-dimethoxyquinoxalin-6-yl)methylthio]benzoate (6). Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Coxsackievirus B3 vaccines: use as an expression vector for prevention of myocarditis.

PubMed

Henke, Andreas; Jarasch, Nadine; Wutzler, Peter

2008-12-01

Coxsackievirus B3 (CVB3), a member of the Picornaviridae family, is considered to be one of the most important infectious agents to cause virus-induced myocarditis. Despite improvements in studying virus pathology, structure and molecular biology, as well as the diagnosis of this disease, there is still no virus-specific drug or vaccine in clinical use. During the last 20 years many investigations have been performed to develop classic and modern immunization techniques against CVB3-induced heart disease. One promising approach among others includes the insertion of coding sequences of cytokines into the viral genome. The application of an IFN-gamma-expressing recombinant coxsackievirus vector is especially efficient against CVB3-induced myocarditis. Beside direct IFN-gamma-mediated antiviral effects, the local and simultaneous expression of IFN-gamma by the virus itself activates the immune system in a strong and long-lasting manner, which protects animals completely against subsequent lethal infections independently of the age of the immunized individual and the route of vaccine administration.

Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

PubMed

Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

2017-06-01

A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

Is a multivalent hand, foot, and mouth disease vaccine feasible?

PubMed Central

Klein, Michel; Chong, Pele

2015-01-01

Enterovirus A infections are the primary cause of hand, foot and mouth disease (HFMD) in infants and young children. Although enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) are the predominant causes of HFMD epidemics worldwide, EV-A71 has emerged as a major neurovirulent virus responsible for severe neurological complications and fatal outcomes. HFMD is a serious health threat and economic burden across the Asia-Pacific region. Inactivated EV-A71 vaccines have elicited protection against EV-A71 but not against CV-A16 infections in large efficacy trials. The current development of a bivalent inactivated EV-A71/CV-A16 vaccine is the next step toward that of multivalent HFMD vaccines. These vaccines should ultimately include other prevalent pathogenic coxsackieviruses A (CV-A6 and CV-A10), coxsackieviruses B (B3 and B5) and echovirus 30 that often co-circulate during HFMD epidemics and can cause severe HFMD, aseptic meningitis and acute viral myocarditis. The prospect and challenges for the development of such multivalent vaccines are discussed. PMID:26009802

Antiviral Effects of Small Interfering RNA Simultaneously Inducing RNA Interference and Type 1 Interferon in Coxsackievirus Myocarditis

PubMed Central

Ahn, Jeonghyun; Ko, Ara; Jun, Eun Jung; Won, Minah; Kim, Yoo Kyum; Ju, Eun-Seon

2012-01-01

Antiviral therapeutics are currently unavailable for treatment of coxsackievirus B3, which can cause life-threatening myocarditis. A modified small interfering RNA (siRNA) containing 5′-triphosphate, 3p-siRNA, was shown to induce RNA interference and interferon activation. We aimed to develop a potent antiviral treatment using CVB3-specific 3p-siRNA and to understand its underlying mechanisms. Virus-specific 3p-siRNA was superior to both conventional virus-specific siRNA with an empty hydroxyl group at the 5′ end (OH-siRNA) and nonspecific 3p-siRNA in decreasing viral replication and subsequent cytotoxicity. A single administration of 3p-siRNA dramatically attenuated virus-associated pathological symptoms in mice with no signs of toxicity, and their body weights eventually reached the normal range. Myocardial inflammation and fibrosis were rare, and virus production was greatly reduced. A nonspecific 3p-siRNA showed relatively less protective effect under identical conditions, and a virus-specific OH-siRNA showed no protective effects. We confirmed that virus-specific 3p-siRNA simultaneously activated target-specific gene silencing and type I interferon signaling. We provide a clear proof of concept that coxsackievirus B3-specific 3p-siRNA has 2 distinct modes of action, which significantly enhance antiviral activities with minimal organ damage. This is the first direct demonstration of improved antiviral effects with an immunostimulatory virus-specific siRNA in coxsackievirus myocarditis, and this method could be applied to many virus-related diseases. PMID:22508300

Development and evaluation of a rapid recombinase polymerase amplification assay for detection of coxsackievirus A6.

PubMed

Wang, Kaifeng; Wu, Yue; Yin, Dan; Tang, Shixing; Hu, Guifang; He, Yaqing

2017-01-01

Coxsackievirus A6 (CV-A6) is an important pathogen causing hand, foot and mouth disease (HFMD). The aim of this study was to develop and evaluate a rapid real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for detection of CV-A6. The sensitivity of this assay was 202 copies/reaction, with 100 % specificity. Furthermore, this assay yielded consistent results comparable with a commercial qRT-PCR diagnostic kit. This assay is therefore potentially useful for surveillance of CV-A6 infections and outbreak control.

The Association of Recombination Events in the Founding and Emergence of Subgenogroup Evolutionary Lineages of Human Enterovirus 71

PubMed Central

McWilliam Leitch, E. C.; Cabrerizo, M.; Cardosa, J.; Harvala, H.; Ivanova, O. E.; Koike, S.; Kroes, A. C. M.; Lukashev, A.; Perera, D.; Roivainen, M.; Susi, P.; Trallero, G.; Evans, D. J.

2012-01-01

Enterovirus 71 (EV71) is responsible for frequent large-scale outbreaks of hand, foot, and mouth disease worldwide and represent a major etiological agent of severe, sometimes fatal neurological disease. EV71 variants have been classified into three genogroups (GgA, GgB, and GgC), and the latter two are further subdivided into subgenogroups B1 to B5 and C1 to C5. To investigate the dual roles of recombination and evolution in the epidemiology and transmission of EV71 worldwide, we performed a large-scale genetic analysis of isolates (n = 308) collected from 19 countries worldwide over a 40-year period. A series of recombination events occurred over this period, which have been identified through incongruities in sequence grouping between the VP1 and 3Dpol regions. Eleven 3Dpol clades were identified, each specific to EV71 and associated with specific subgenogroups but interspersed phylogenetically with clades of coxsackievirus A16 and other EV species A serotypes. The likelihood of recombination increased with VP1 sequence divergence; mean half-lives for EV71 recombinant forms (RFs) of 6 and 9 years for GgB and GgC overlapped with those observed for the EV-B serotypes, echovirus 9 (E9), E30, and E11, respectively (1.3 to 9.8 years). Furthermore, within genogroups, sporadic recombination events occurred, such as the linkage of two B4 variants to RF-W instead of RF-A and of two C4 variants to RF-H. Intriguingly, recombination events occurred as a founding event of most subgenogroups immediately preceding their lineage expansion and global emergence. The possibility that recombination contributed to their subsequent spread through improved fitness requires further biological and immunological characterization. PMID:22205739

Evaluation of a rapid detection for Coxsackievirus B3 using one-step reverse transcription loop-mediated isothermal amplification (RT-LAMP).

PubMed

Monazah, A; Zeinoddini, M; Saeeidinia, A R

2017-08-01

Coxsackievirus B3 (CVB3) is a member of the genus Enterovirus within the family Picornaviridae and is an important pathogen of viral myocarditis, which accounts for more than 50% viral myocarditis cases. VP1 is major capsid protein that this region has a low homology in both amino acid and nucleotide sequences among Enteroviruses. Therefore we have chosen this region for designed a set of RT-LAMP primers for CVB3 detection. For this the total RNA was extracted from 24-h post infected-HeLa cells with complete cytopathic effect (CPE), and applied to a one-step reverse transcription loop-mediated isothermal amplification reaction (RT-LAMP) using CVB3-specific primers. The optimization of RT-LAMP reaction was carried out with three variables factors including MgSO 4 concentration, temperature and time of incubation. Amplification was analyzed by using 2% agarose gel electrophoresis and ethidium bromide and SYBR Green staining. Our results were shown the ladder-like pattern of the VP1 gene amplification. The LAMP reaction mix was optimized and the best result observed at 4mM MgSO 4 and 60°C for 90min incubation. RT-LAMP had high sensitivity and specificity for detection of CVB3 infection. This method can be used as a rapid and easy diagnostic test for detection of CVB3 in clinical laboratories. Copyright © 2017 Elsevier B.V. All rights reserved.

Antiviral activity of Lactobacillus reuteri Protectis against Coxsackievirus A and Enterovirus 71 infection in human skeletal muscle and colon cell lines.

PubMed

Ang, Lei Yin Emily; Too, Horng Khit Issac; Tan, Eng Lee; Chow, Tak-Kwong Vincent; Shek, Lynette Pei-Chi; Tham, Elizabeth Huiwen; Alonso, Sylvie

2016-06-24

Recurrence of hand, foot and mouth disease (HFMD) pandemics continues to threaten public health. Despite increasing awareness and efforts, effective vaccine and drug treatment have yet to be available. Probiotics have gained recognition in the field of healthcare worldwide, and have been extensively prescribed to babies and young children to relieve gastrointestinal (GI) disturbances and diseases, associated or not with microbial infections. Since the faecal-oral axis represents the major route of HFMD transmission, transient persistence of probiotic bacteria in the GI tract may confer some protection against HFMD and limit transmission among children. In this work, the antiviral activity of two commercially available probiotics, namely Lactobacillus reuteri Protectis (L. reuteri Protectis) and Lactobacillus casei Shirota (L. casei Shirota), was assayed against Coxsackieviruses and Enterovirus 71 (EV71), the main agents responsible for HFMD. In vitro infection set-ups using human skeletal muscle and colon cell lines were designed to assess the antiviral effect of the probiotic bacteria during entry and post-entry steps of the infection cycle. Our findings indicate that L. reuteri Protectis displays a significant dose-dependent antiviral activity against Coxsackievirus type A (CA) strain 6 (CA6), CA16 and EV71, but not against Coxsackievirus type B strain 2. Our data support that the antiviral effect is likely achieved through direct physical interaction between bacteria and virus particles, which impairs virus entry into its mammalian host cell. In contrast, no significant antiviral effect was observed with L. casei Shirota. Should the antiviral activity of L. reuteri Protectis observed in vitro be translated in vivo, such probiotics-based therapeutic approach may have the potential to address the urgent need for a safe and effective means to protect against HFMD and limit its transmission among children.

Hand, foot and mouth disease (HFMD): emerging epidemiology and the need for a vaccine strategy.

PubMed

Aswathyraj, S; Arunkumar, G; Alidjinou, E K; Hober, D

2016-10-01

Hand, foot, and mouth disease (HFMD) is a contagious viral disease and mainly affects infants and young children. The main manifestations are fever, vesicular rashes on hand, feet and buttocks and ulcers in the oral mucosa. Usually, HFMD is self-limiting, but a small proportion of children may experience severe complications such as meningitis, encephalitis, acute flaccid paralysis and neurorespiratory syndrome. Historically, outbreaks of HFMD were mainly caused by two enteroviruses: the coxsackievirus A16 (CV-A16) and the enterovirus 71 (EV-A71). In the recent years, coxsackievirus A6 and coxsackievirus A10 have been widely associated with both sporadic cases and outbreaks of HFMD worldwide, particularly in India, South East Asia and Europe with an increased frequency of neurological complications as well as mortality. Currently, there is no pharmacological intervention or vaccine available for HFMD. A formalin-inactivated EV-A71 vaccine has completed clinical trial in several Asian countries. However, this vaccine cannot protect against other major emerging etiologies of HFMD such as CV-A16, CV-A6 and CV-A10. Therefore, the development of a globally representative multivalent HFMD vaccine could be the best strategy.

Susceptibility of Skeletal Muscle to Coxsackie A2 Virus Infection: Effects of Botulinum Toxin and Denervation

NASA Astrophysics Data System (ADS)

Andrew, Clifford G.; Drachman, Daniel B.; Pestronk, Alan; Narayan, Opendra

1984-02-01

Coxsackie A viruses can infect denervated but not innervated mature skeletal muscles. The role of synaptic transmission in preventing susceptibility to Coxsackievirus infection was studied by surgically denervating leg muscles of mice or injecting the muscles with botulinum toxin to block quantal release of acetylcholine. Control muscles were injected with heat-inactivated toxin. Subsequent injection of Coxsackie A2 virus resulted in extensive virus replication and tissue destruction in the denervated and botulinum toxin-treated muscles, while the control muscles showed only minimal changes. This suggests that the susceptibility of skeletal muscle to Coxsackievirus infection is regulated by synaptic transmission.

Detection and typing of enteroviruses from CSF specimens from patients diagnosed with meningitis/encephalitis.

PubMed

Tavakoli, Norma P; Wang, Heng; Nattanmai, Seela; Dupuis, Michelle; Fusco, Heather; Hull, Rene

2008-10-01

Human enteroviruses are the most common cause of viral meningitis. Rapid enterovirus detection and identification is important in order to ruleout other causes of disease, initiate appropriate patient management and to aid in epidemiological investigations. A 2-year study (2005-2006) of patients with symptoms of meningitis/encephalitis was performed in New York State (NYS) to determine the underlying enteroviral etiology. Reverse-transcription, followed by a sequential PCR strategy targeting the 5'-nontranslated and VP1 regions, were used to first detect and then type, these RNA viruses. From a total of 1374 specimens tested, enterovirus was detected in 67 specimens (4.9%); of these, 59 could subsequently be typed. Coxsackievirus B5 was found in 14 cases in 2005, but none in 2006. Overall, 14 enterovirus serotypes were detected. The most prevalent enteroviruses in this cohort were Coxsackievirus B5, and echoviruses 18, and 6 collectively accounting for 46%. 2005 was a period of high activity for Coxsackievirus B5 in NYS. A large majority of the enterovirus-positive patients suffered from headache and fever. In most cases, the cerebrospinal fluid profile was reported and generally showed elevated protein levels (>45mg/dl) and a higher than normal white blood cell count (>5mm(3)).

The Crystal Structure of Coxsackievirus A21 and Its Interaction with ICAM-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiao, Chuan; Bator-Kelly, Carol M.; Rieder, Elizabeth

2010-11-30

CVA21 and polioviruses both belong to the Enterovirus genus in the family of Picornaviridae, whereas rhinoviruses form a distinct picornavirus genus. Nevertheless, CVA21 and the major group of human rhinoviruses recognize intercellular adhesion molecule-1 (ICAM-1) as their cellular receptor, whereas polioviruses use poliovirus receptor. The crystal structure of CVA21 has been determined to 3.2 {angstrom} resolution. Its structure has greater similarity to poliovirus structures than to other known picornavirus structures. Cryo-electron microscopy (cryo-EM) was used to determine an 8.0 {angstrom} resolution structure of CVA21 complexed with an ICAM-1 variant, ICAM-1{sup Kilifi}. The cryo-EM map was fitted with the crystal structuresmore » of ICAM-1 and CVA21. Significant differences in the structure of CVA21 with respect to the poliovirus structures account for the inability of ICAM-1 to bind polioviruses. The interface between CVA21 and ICAM-1 has shape and electrostatic complementarity with many residues being conserved among those CVAs that bind ICAM-1.« less

[Serotype distribution of enteroviruses isolated from paediatric cases prediagnosed as aseptic meningitis between 2001-2004 period].

PubMed

Ozkaya, Etem; Uysal, Gülnar; Atak, Tunca; Alkan, Mehmet

2005-01-01

Enteroviruses have major clinical and public health importance and are one of the leading causes of aseptic meningitis. There are many diseases with similar clinical symptoms and cerebrospinal fluid (CSF) findings of aseptic meningitis, thus virus isolation and identification is crucial for definitive diagnosis. Virological diagnosis is nonetheless important to distinguish between induced meningitis and other treatable causes of disease with a similar clinical picture. A total of 249 samples obtained from 246 cases (age range: 0-15 years), prediagnosed as aseptic meningitis, were sent to Virology Laboratory of Refik Saydam Hygiene Center. The patients were followed at Department of Pediatric Infectious Diseases in the Social Security Hospital, Ankara, Turkey, between 2001 and 2004. Stool (n: 180), CSF (n: 54) and throat swab (n: 15) samples have been inoculated to RD (rhabdomyosarcoma), Hep-2 (human epithelioma) and L20B (transgenic mice) cell lines, and followed up for the presence of cytopathic effects. A total of 95 enterovirus strains were isolated from 85 (34.6%) cases, and serotyped by using RIVM (National Institute of Public and the Environment, Nederlands) antisera with microneutralization method. As a result, the most frequently isolated types were found as echovirus type 30 (n: 24) and coxsackievirus type B (n: 19), which were most frequently isolated between July to October. This is the first report from Turkey for aseptic meningitis cases due to echovirus type 25 (n:3), 18 (n:2), 14 (n:1), 13 (n:4), 11 (n:6), 9 (n:1), 6 (n:9), 5 (n:1), 4 (n:1) and coxsackievirus type A9 (n:1).

The Impact of Juvenile Coxsackievirus Infection on Cardiac Progenitor Cells and Postnatal Heart Development

PubMed Central

Sin, Jon; Puccini, Jenna M.; Huang, Chengqun; Konstandin, Mathias H.; Gilbert, Paul E.; Sussman, Mark A.; Gottlieb, Roberta A.; Feuer, Ralph

2014-01-01

Coxsackievirus B (CVB) is an enterovirus that most commonly causes a self-limited febrile illness in infants, but cases of severe infection can manifest in acute myocarditis. Chronic consequences of mild CVB infection are unknown, though there is an epidemiologic association between early subclinical infections and late heart failure, raising the possibility of subtle damage leading to late-onset dysfunction, or chronic ongoing injury due to inflammatory reactions during latent infection. Here we describe a mouse model of juvenile infection with a subclinical dose of coxsackievirus B3 (CVB3) which showed no evident symptoms, either immediately following infection or in adult mice. However following physiological or pharmacologically-induced cardiac stress, juvenile-infected adult mice underwent cardiac hypertrophy and dilation indicative of progression to heart failure. Evaluation of the vasculature in the hearts of adult mice subjected to cardiac stress showed a compensatory increase in CD31+ blood vessel formation, although this effect was suppressed in juvenile-infected mice. Moreover, CVB3 efficiently infected juvenile c-kit+ cells, and cardiac progenitor cell numbers were reduced in the hearts of juvenile-infected adult mice. These results suggest that the exhausted cardiac progenitor cell pool following juvenile CVB3 infection may impair the heart's ability to increase capillary density to adapt to increased load. PMID:25079373

Novel [(biphenyloxy)propyl]isoxazole derivatives for inhibition of human rhinovirus 2 and coxsackievirus B3 replication.

PubMed

Makarov, Vadim A; Riabova, Olga B; Granik, Vladimir G; Wutzler, Peter; Schmidtke, Michaela

2005-04-01

During this study, novel biphenyl derivatives were synthesized and tested for antiviral activity. A new method based on the Suzuki coupling reaction has been established for the synthesis of these polysubstituted chain systems. In parallel with cytotoxicity, the antiviral activity of biphenyl derivatives has been determined in cytopathic effect (CPE)-inhibitory assays with the pleconaril-resistant coxsackievirus B3 (CVB3) strain Nancy, human rhinovirus 2 (HRV-2) and 14 (HRV-14) and in plaque reduction assays with the pleconaril-sensitive human isolate CVB3 97-927 in HeLa cells. Based on the results from these investigations the selectivity index (SI) was determined as the ratio of the 50% cytotoxic concentration to the 50% inhibitory concentration. The new method based on the Suzuki coupling reaction includes the condensation of 2,6-dimethyl-4-bromophenol with pentyne chloride by means of potassium carbonate and potassium iodide in N-methylpyrrolidone-2 and yields 5-bromo-1,3-dimethyl-2-(4-pentynyloxy)benzene. Its condensation with methylacetaldoxime results in 3-methylisoxazole derivatives. The following reaction with different benzeneboronic acids by means of tetrakis(triphenylphosphine)-palladium(0) finally yields the corresponding derivatives. Several of the novel synthesized derivatives demonstrated a good antiviral activity on CVB3 (SI > 2 to > 37.5) and a strong anti-HRV-2 activity (SI > 50 to > 200). In contrast, none of the compounds inhibited the HRV-14-induced CPE. These results indicate that [(biphenyloxy)propyl]isoxazole derivatives are potential inhibitors of HRV-2 and CVB3 replication, and make them promising agents for the specific treatment of these virus infections.

Picornavirus proteins share antigenic determinants with heat shock proteins 60/65.

PubMed

Härkönen, T; Puolakkainen, M; Sarvas, M; Airaksinen, U; Hovi, T; Roivainen, M

2000-11-01

Immunological cross-reactions between enteroviruses and islet cell autoantigens have been suggested to play a role in the etiopathogenesis of insulin dependent diabetes mellitus (IDDM). In the nonobese diabetic mouse, an autoimmune model of IDDM, one of the reactive beta cell autoantigens is the heat shock protein 60 (HSP60). These studies were prompted by sequence homology discovered between the immunogenic region in HSP60 and two regions in enterovirus capsid proteins, one in the VP1 protein and the other in the VP0, the precursor of VP2 and VP4 proteins. Possible immunological cross-reactions between enterovirus proteins and heat shock proteins were studied by EIA and immunoblotting by using purified virus preparations, viral expression proteins VP1 and VP0, and recombinant HSP60/65 proteins, and corresponding polyclonal antisera. The HSP60/65 family of proteins is highly conserved and there is a striking degree of homology between bacterial and human heat shock proteins. Rabbit antibodies to HSP65 of Mycobacterium bovis that reacted with human HSP60 were also found to recognise capsid protein VP1 of coxsackievirus A9, VP1, and/or VP2 of coxsackievirus B4. Both viruses were also recognised by antisera raised against HSP60 of Chlamydia pneumoniae. In addition to the capsid proteins derived from native virions, antisera to both bacterial HSP proteins recognised expression protein VP1 of coxsackievirus A9. The cross-reactivity was also demonstrated the other way around; antisera to purified virus particles reacted with the HSP 60/65 proteins to some extent. These results suggest that apart from the well-documented sequence homology between the 2C protein of coxsackieviruses and the beta-cell autoantigen glutamic acid decarboxylase, there are other motifs in picornavirus proteins homologous to islet cell autoantigens, which might induce cross-reacting immune responses during picornavirus infections.

Pathogenesis of coxsackievirus B2 in mice: characterization of clinical isolates of the coxsackievirus B2 from patients with myocarditis and aseptic meningitis in Korea.

PubMed

Hong, Jiyoung; Kang, Bunghak; Yeo, Sanggu; Jee, Youngmee; Park, Jae-Hak

2017-12-31

Group B coxsackieviruses (CVBs) are a group of common human pathogens producing various clinical symptoms. Although the virology of CVB is well known, there is limited information on viral pathogenesis and the relationship between clinical symptoms and viral phenotype, particularly for CVB type 2 (CVB2). In 2004 in Korea, two CVB2 strains were isolated: CB2/04/279 from stool of an acute myocarditis patient with heart failure and CB2/04/243 from an aseptic meningitis patient. In this study, a high degree of homology was observed between the CB2/04/279 and CB2/04/243 full genome sequences. The two Korean CVB2 isolates had 93.1% homology compared to 82.1%-82.5% nucleotide sequence identity with the cardiovirulence-associated reference CVB strain Ohio-1 (CVB/O). CVB2-induced pathogenesis was analyzed, focusing on virus-induced pathology of various tissues in 4-week-old BALB/c inbred male mice. Myocarditis developed and extensive pancreatic inflammation was observed in all mice infected with CB2/04/279 or CVB/O, but not in animals infected with CB2/04/243. This is the first report of the full-genomic sequence and pathogenesis of the CVB2 strain isolated from an acute myocarditis patient in Korea.

A study based on whole-genome sequencing yields a rare variant at 8q24 associated with prostate cancer

PubMed Central

Gudmundsson, Julius; Sulem, Patrick; Gudbjartsson, Daniel F.; Masson, Gisli; Agnarsson, Bjarni A.; Benediktsdottir, Kristrun R.; Sigurdsson, Asgeir; Magnusson, Olafur Th.; Gudjonsson, Sigurjon A.; Magnusdottir, Droplaug N.; Johannsdottir, Hrefna; Helgadottir, Hafdis Th.; Stacey, Simon N.; Jonasdottir, Adalbjorg; Olafsdottir, Stefania B.; Thorleifsson, Gudmar; Jonasson, Jon G.; Tryggvadottir, Laufey; Navarrete, Sebastian; Fuertes, Fernando; Helfand, Brian T.; Hu, Qiaoyan; Csiki, Irma E.; Mates, Ioan N.; Jinga, Viorel; Aben, Katja K. H.; van Oort, Inge M.; Vermeulen, Sita H.; Donovan, Jenny L.; Hamdy, Freddy C.; Ng, Chi-Fai; Chiu, Peter K.F.; Lau, Kin-Mang; Ng, Maggie C.Y.; Gulcher, Jeffrey R.; Kong, Augustine; Catalona, William J.; Mayordomo, Jose I.; Einarsson, Gudmundur V.; Barkardottir, Rosa B.; Jonsson, Eirikur; Mates, Dana; Neal, David E.; Kiemeney, Lambertus A.; Thorsteinsdottir, Unnur; Rafnar, Thorunn; Stefansson, Kari

2013-01-01

Western countries, prostate cancer is the most prevalent cancer of men, and one of the leading causes of cancer-related death in men. Several genome-wide association studies have yielded numerous common variants conferring risk of prostate cancer. In the present study we analyzed 32.5 million variants discovered by whole-genome sequencing 1,795 Icelanders. One variant was found to be associated with prostate cancer in European populations: rs188140481[A] (OR = 2.90, Pcomb = 6.2×10−34) located on 8q24, with an average risk allele control frequency of 0.54%. This variant is only very weakly correlated (r2 ≤ 0.06) with previously reported risk variants on 8q24, and remains significant after adjustment for all of them. Carriers of rs188140481[A] were diagnosed with prostate cancer 1.26 years younger than non-carriers (P = 0.0059). We also report results for the previously described HOXB13 mutation (rs138213197[T]), confirming it as prostate cancer risk variant in populations from all over Europe. PMID:23104005

Co-infection with coxsackievirus A5 and norovirus GII.4 could have been the trigger of the first episode of severe acute encephalopathy in a six-year-old child with the intermittent form of maple syrup urine disease (MSUD).

PubMed

Boros, Ákos; Pankovics, Péter; Kőmíves, Sándor; Liptai, Zoltán; Dobner, Sarolta; Ujhelyi, Enikő; Várallyay, György; Zsidegh, Petra; Bolba, Nóra; Reuter, Gábor

2017-06-01

In this case study, a co-infection with coxsackievirus A5 (family Picornaviridae) and norovirus GII.4 (family Caliciviridae) was detected by RT-PCR in a faecal sample from a six-year-old girl with symptoms of severe acute encephalopathy subsequently diagnosed as the intermittent form of maple syrup urine disease (MSUD). The two co-infecting viruses, which had been detected previously, appeared to have triggered the underlying metabolic disorder. Here, we describe the genotyping of the viruses, as well as the chronological course, laboratory test results, and clinical presentation of this case, which included recurrent vomiting without diarrhoea, metabolic acidosis, unconsciousness, seizure and circulatory collapse, but with a positive final outcome.

Mersalyl: a Diuretic with Antiviral Properties

PubMed Central

Kramer, M. J.; Cleeland, R.; Grunberg, E.

1975-01-01

Mersalyl (Salyrgan), an organic mercurial diuretic, was tested against human and animal viruses with in vivo model infections in mice and tissue culture systems. Mersalyl was active against coxsackieviruses A21 and B1 in mice if administered intraperitoneally immediately after infection. No effect was observed if intraperitoneal treatment was delayed 1 or 2 h postinfection, or if treatment was administered either subcutaneously or per os. Topical treatment with a 5% aqueous solution of mersalyl produced a statistically significant effect against herpes simplex dermatitis in mice but the substance was inactive against systemic infections in mice with herpes simplex as well as Columbia SK, influenza, Semliki Forest, and Sendai viruses. Contact inactivation of coxsackieviruses A21 and B1 and herpes simplex virus was observed, but mersalyl was inactive in tissue culture against coxackieviruses A21 and B1, herpes simplex, influenza, rhinovirus, Semliki Forest, Sendai, and vaccinia viruses. PMID:810082

Structure Elucidation of Coxsackievirus A16 in Complex with GPP3 Informs a Systematic Review of Highly Potent Capsid Binders to Enteroviruses.

PubMed

De Colibus, Luigi; Wang, Xiangxi; Tijsma, Aloys; Neyts, Johan; Spyrou, John A B; Ren, Jingshan; Grimes, Jonathan M; Puerstinger, Gerhard; Leyssen, Pieter; Fry, Elizabeth E; Rao, Zihe; Stuart, David I

2015-10-01

The replication of enterovirus 71 (EV71) and coxsackievirus A16 (CVA16), which are the major cause of hand, foot and mouth disease (HFMD) in children, can be inhibited by the capsid binder GPP3. Here, we present the crystal structure of CVA16 in complex with GPP3, which clarifies the role of the key residues involved in interactions with the inhibitor. Based on this model, in silico docking was performed to investigate the interactions with the two next-generation capsid binders NLD and ALD, which we show to be potent inhibitors of a panel of enteroviruses with potentially interesting pharmacological properties. A meta-analysis was performed using the available structural information to obtain a deeper insight into those structural features required for capsid binders to interact effectively and also those that confer broad-spectrum anti-enterovirus activity.

Efficacy of a Trivalent Hand, Foot, and Mouth Disease Vaccine against Enterovirus 71 and Coxsackieviruses A16 and A6 in Mice.

PubMed

Caine, Elizabeth A; Fuchs, Jeremy; Das, Subash C; Partidos, Charalambos D; Osorio, Jorge E

2015-11-17

Hand, foot, and mouth disease (HFMD) has recently emerged as a major public health concern across the Asian-Pacific region. Enterovirus 71 (EV71) and Coxsackievirus A16 (CVA16) are the primary causative agents of HFMD, but other members of the Enterovirus A species, including Coxsackievirus A6 (CVA6), can cause disease. The lack of small animal models for these viruses have hampered the development of a licensed HFMD vaccine or antivirals. We have previously reported on the development of a mouse model for EV71 and demonstrated the protective efficacy of an inactivated EV71 vaccine candidate. Here, mouse-adapted strains of CVA16 and CVA6 were produced by sequential passage of the viruses through mice deficient in interferon (IFN) α/β (A129) and α/β and γ (AG129) receptors. Adapted viruses were capable of infecting 3 week-old A129 (CVA6) and 12 week-old AG129 (CVA16) mice. Accordingly, these models were used in active and passive immunization studies to test the efficacy of a trivalent vaccine candidate containing inactivated EV71, CVA16, and CVA6. Full protection from lethal challenge against EV71 and CVA16 was observed in trivalent vaccinated groups. In contrast, monovalent vaccinated groups with non-homologous challenges failed to cross protect. Protection from CVA6 challenge was accomplished through a passive transfer study involving serum raised against the trivalent vaccine. These animal models will be useful for future studies on HFMD related pathogenesis and the efficacy of vaccine candidates.

Pathogenesis of coxsackievirus A9 in mice: role of the viral arginine-glycine-aspartic acid motif.

PubMed

Harvala, Heli; Kalimo, Hannu; Stanway, Glyn; Hyypiä, Timo

2003-09-01

Coxsackievirus A9 (CAV9) contains an arginine-glycine-aspartic acid (RGD) motif which participates in cell entry. Mutants with alterations in the RGD-containing region were utilized to explore the importance of the tripeptide in the pathogenesis of CAV9 in mice. Using in situ hybridization, the parental CAV9 strain was observed to infect skeletal muscle (intercostal, platysma, lingual and thigh muscles) of newborn mice, whereas the RGD-less mutants were detectable only in platysma and lingual muscles. In addition, newborn mice infected with the mutants survived longer than CAV9-infected mice. In adult mice, the parental strain of CAV9, but not the mutants, achieved moderately high titres in the pancreas. These results suggest that the RGD motif has a significant role in the pathogenesis of CAV9 in mice but also that RGD-independent entry routes can be utilized in the infection of murine tissue.

New carbocyclic N(6)-substituted adenine and pyrimidine nucleoside analogues with a bicyclo[2.2.1]heptane fragment as sugar moiety; synthesis, antiviral, anticancer activity and X-ray crystallography.

PubMed

Tănase, Constantin I; Drăghici, Constantin; Cojocaru, Ana; Galochkina, Anastasia V; Orshanskaya, Jana R; Zarubaev, Vladimir V; Shova, Sergiu; Enache, Cristian; Maganu, Maria

2015-10-01

New nucleoside analogues with an optically active bicyclo[2.2.1]heptane skeleton as sugar moiety and 6-substituted adenine were synthesized by alkylation of 6-chloropurine intermediate. Thymine and uracil analogs were synthesized by building the pyrimidine ring on amine 1. X-ray crystallography confirmed an exo-coupling of the thymine to the ring and an L configuration of the nucleoside analogue. The library of compounds was tested for their inhibitory activity against influenza virus A∖California/07/09 (H1N1)pdm09 and coxsackievirus B4 in cell culture. Compounds 13a and 13d are the most promising for their antiviral activity against influenza, and compound 3c against coxsackievirus B4. Compounds 3b and 3g were tested for anticancer activity. Copyright © 2015 Elsevier Ltd. All rights reserved.

Co-Circulation and Genomic Recombination of Coxsackievirus A16 and Enterovirus 71 during a Large Outbreak of Hand, Foot, and Mouth Disease in Central China

PubMed Central

Liu, Weiyong; Wu, Shimin; Xiong, Ying; Li, Tongya; Wen, Zhou; Yan, Mingzhe; Qin, Kai; Liu, Yingle; Wu, Jianguo

2014-01-01

A total of 1844 patients with hand, foot, and mouth disease (HFMD), most of them were children of age 1–3-year-old, in Central China were hospitalized from 2011 to 2012. Among them, 422 were infected with coxsackievirus A16 (CVA16), 334 were infected with enterovirus 71 (EV71), 38 were co-infected with EV71 and CVA16, and 35 were infected with other enteroviruses. Molecular epidemiology analysis revealed that EV71 and CVA16 were detected year-round, but EV71 circulated mainly in July and CVA16 circulated predominantly in November, and incidence of HFMD was reduced in January and February and increased in March. Clinical data showed that hyperglycemia and neurologic complications were significantly higher in EV71-infected patients, while upper respiratory tract infection and C-reactive protein were significantly higher in CVA16-associated patients. 124 EV71 and 80 CVA16 strains were isolated, among them 56 and 68 EV71 strains were C4a and C4b, while 25 and 55 CVA16 strains were B1a and B1b, respectively. Similarity plots and bootscan analyses based on entire genomic sequences revealed that the three C4a sub-genotype EV71 strains were recombinant with C4b sub-genotype EV71 in 2B–2C region, and the three CVA16 strains were recombinant with EV71 in 2A–2B region. Thus, CVA16 and EV71 were the major causative agents in a large HFMD outbreak in Central China. HFMD incidence was high for children among household contact and was detected year-round, but outbreak was seasonal dependent. CVA16 B1b and EV71 C4b reemerged and caused a large epidemic in China after a quiet period of many years. Moreover, EV71 and CVA16 were co-circulated during the outbreak, which may have contributed to the genomic recombination between the pathogens. It should gain more attention as there may be an upward trend in co-circulation of the two pathogens globally and the new role recombination plays in the emergence of new enterovirus variants. PMID:24776922

Coxsackievirus Infections (For Parents)

MedlinePlus

... The virus spreads easily in group settings like schools, childcare centers, and summer camps. People are most contagious the first week they're sick. In cooler climates, outbreaks most often happen in the summer and ...

Variants on 8q24 and prostate cancer risk in Chinese population: a meta-analysis.

PubMed

Ren, Xiao-Qiang; Zhang, Jian-Guo; Xin, Shi-Yong; Cheng, Tao; Li, Liang; Ren, Wei-Hua

2015-01-01

Previous studies have identified 8q24 as an important region to prostate cancer (PCa) susceptibility. The aim of this study was to investigate the role of six genetic variants on 8q24 (rs1447295, A; rs6983267, G; rs6983561, C; rs7837688, T; rs10090154, T and rs16901979, A) on PCa risk in Chinese population. Online electronic databases were searched to retrieve related articles concerning the association between 8q24 variants and PCa risk in men of Chinese population published between 2000 and 2014. Odds ratio (ORs) with its 95% correspondence interval (CI) were employed to assess the strength of association. Total eleven case-control studies were screened out, including 2624 PCa patients and 2438 healthy controls. Our results showed that three risk alleles of rs1447295 A (OR=1.35, 95% CI=1.19-1.53, P<0.00001), rs6983561 C (C vs. A: OR=1.41, 95% CI=1.21-1.63, P<0.00001) and rs10090154 T (T vs. C: OR=1.48, 95% CI=1.22-1.80, P<0.00001) on8q24 were significantly associated with PCa risk in Chinese population. Furthermore, genotypes of rs1447295, AA+AC; rs6983561, CC+AC and CC; rs10090154, TT+TC; and rs16901979, AA were associated with PCa as well (P<0.01). No association was found between rs6983267, rs7837688 and PCa risk. In conclusions, variants including rs1447295, rs6983561, rs10090154 and rs16901979 on 8q24 might be associated with PCa risk in Chinese population, indicating these four variations may contribute risk to this disease. This meta-analysis was the first study to assess the role of 8q24 variants on PCa risk in Chinese population.

Basic reproduction number of coxsackievirus type A6 and A16 and enterovirus 71: estimates from outbreaks of hand, foot and mouth disease in Singapore, a tropical city-state.

PubMed

Lim, C T K; Jiang, L; Ma, S; James, L; Ang, L W

2016-04-01

Coxsackievirus A6 (CV-A6), coxsackievirus A16 (CV-A16) and enterovirus 71 (EV-A71) were the major enteroviruses causing nationwide hand, foot and mouth disease (HFMD) epidemics in Singapore in the last decade. We estimated the basic reproduction number (R 0) of these enteroviruses to obtain a better understanding of their transmission dynamics. We merged records of cases from HFMD outbreaks reported between 2007 and 2012 with laboratory results from virological surveillance. R 0 was estimated based on the cumulative number of reported cases in the initial growth phase of each outbreak associated with the particular enterovirus type. A total of 33 HFMD outbreaks were selected based on the inclusion criteria specified for our study, of which five were associated with CV-A6, 13 with CV-A16, and 15 with EV-A71. The median R 0 was estimated to be 5·04 [interquartile range (IQR) 3·57-5·16] for CV-A6, 2·42 (IQR 1·85-3·36) for CV-A16, and 3·50 (IQR 2·36-4·53) for EV-A71. R 0 was not significantly associated with number of infected children (P = 0·86), number of exposed children (P = 0·94), and duration of the outbreak (P = 0·05). These enterovirus-specific R 0 estimates will be helpful in providing insights into the potential growth of future HFMD epidemics and outbreaks for timely implementation of disease control measures, together with disease dynamics such as severity of the cases.

Sewage workers: risk of acquiring enteric virus infections including hepatitis A.

PubMed

Divizia, Maurizio; Cencioni, Barbara; Palombi, Leonardo; Panà, Augusto

2008-07-01

To determine if sewage workers have an increased risk of acquiring viral infections, 66 workers at a small wastewater plant in north-eastern Italy and 72 control subjects recruited from blood donors were enrolled in a seroprevalence study to determine whether sewage workers are at increased risk of acquiring viral infections. In order to evaluate various risk factors, a questionnaire was filled out by each worker whereas seropositivity to Hepatitis A virus, Coxsackievirus B2 - B3 - B4 - B5, and Echovirus types 1 and 9 was determined in the laboratory. Anti-HAV antibodies were present in 37.8% of sewage workers and 36.1% of subjects in the control group. The difference was not statistically significant in the two groups, whereas a significant association was observed regarding age (P < 0.3). No association was observed with the occupational age, or with number and duration of contacts per day. The lack of evident occupational risk for hepatitis A among sewage workers may be explained by the adult age of the workers (mean age 41.3 years, range 22-58 years), and thus the antibody titre against different enteroviruses was determined. No statistically significant differences were evident with the raw values, but considering the 90 degrees percentile as a dichotomic value for the antibody levels a strong and significant association was present with Coxsackievirus B3 (O.R. 22.85, C.I. 95% 2.93-178.08) and Coxsackievirus B2 (O.R. 14.25, C.I. 95% 1.78-113.87). Analysis of the data confirms a limited risk of acquiring infection and/or disease but also the evident possibility of silent exposure to the viruses. The shift in HAV epidemiology and increased morbidity and mortality in adult age suggest that active immunization against hepatitis A should be considered.

Establishment of a panel of in-house polyclonal antibodies for the diagnosis of enterovirus infections.

PubMed

Kotani, Osamu; Iwata-Yoshikawa, Naoko; Suzuki, Tadaki; Sato, Yuko; Nakajima, Noriko; Koike, Satoshi; Iwasaki, Takuya; Sata, Tetsutaro; Yamashita, Teruo; Minagawa, Hiroko; Taguchi, Fumihiro; Hasegawa, Hideki; Shimizu, Hiroyuki; Nagata, Noriyo

2015-04-01

The aim of this study was to establish a reliable method of virus detection for the diagnosis of critical enterovirus infections such as acute infective encephalitis, encephalomyelitis and myocarditis. Because histopathological and immunohistochemical analyses of paraffin-embedded tissues play an important role in recognizing infectious agents in tissue samples, six in-house polyclonal antibodies raised against three representative enteroviruses using an indirect immunofluorescence assay and immunohistochemistry were examined. This panel of polyclonal antibodies recognized three serotypes of enterovirus. Two of the polyclonal antibodies were raised against denatured virus particles from enterovirus A71, one was raised against the recombinant VP1 protein of coxsackievirus B3, and the other for poliovirus type 1 were raised against denatured virus particles, the recombinant VP1 protein and peptide 2C. Western blot analysis revealed that each of these antibodies recognized the corresponding viral antigen and none cross-reacted with non-enteroviruses within the family Picornaviridae. However, all cross-reacted to some extent with the antigens derived from other serotypes of enterovirus. Indirect immunofluorescence assay and immunohistochemistry revealed that the virus capsid and non-structural proteins were localized in the cytoplasm of affected culture cells, and skeletal muscles and neurons in neonatal mice experimentally-infected with human enterovirus. The antibodies also recognized antigens derived from recent clinical isolates of enterovirus A71, coxsackievirus B3 and poliovirus. In addition, immunohistochemistry revealed that representative antibodies tested showed the same recognition pattern according to each serotype. Thus, the panel of in-house anti-enterovirus polyclonal antibodies described herein will be an important tool for the screening and pathological diagnosis for enterovirus infections, and may be useful for the classification of different enterovirus serotypes, including coxsackieviruses A and B, echoviruses, enterovirus A71 and poliovirus. © 2014 Japanese Society of Neuropathology.

Emerging Coxsackievirus A6 Causing Hand, Foot and Mouth Disease, Vietnam

PubMed Central

Anh, Nguyen To; Nhu, Le Nguyen Truc; Van, Hoang Minh Tu; Hong, Nguyen Thi Thu; Thanh, Tran Tan; Hang, Vu Thi Ty; Ny, Nguyen Thi Han; Nguyet, Lam Anh; Phuong, Tran Thi Lan; Nhan, Le Nguyen Thanh; Hung, Nguyen Thanh; Khanh, Truong Huu; Tuan, Ha Manh; Viet, Ho Lu; Nam, Nguyen Tran; Viet, Do Chau; Qui, Phan Tu; Wills, Bridget; Sabanathan, Sarawathy; Chau, Nguyen Van Vinh; Thwaites, Louise; Rogier van Doorn, H.; Thwaites, Guy; Rabaa, Maia A.

2018-01-01

Hand, foot and mouth disease (HFMD) is a major public health issue in Asia and has global pandemic potential. Coxsackievirus A6 (CV-A6) was detected in 514/2,230 (23%) of HFMD patients admitted to 3 major hospitals in southern Vietnam during 2011–2015. Of these patients, 93 (18%) had severe HFMD. Phylogenetic analysis of 98 genome sequences revealed they belonged to cluster A and had been circulating in Vietnam for 2 years before emergence. CV-A6 movement among localities within Vietnam occurred frequently, whereas viral movement across international borders appeared rare. Skyline plots identified fluctuations in the relative genetic diversity of CV-A6 corresponding to large CV-A6–associated HFMD outbreaks worldwide. These data show that CV-A6 is an emerging pathogen and emphasize the necessity of active surveillance and understanding the mechanisms that shape the pathogen evolution and emergence, which is essential for development and implementation of intervention strategies. PMID:29553326

Nucleic acid sequences encoding D1 and D1/D2 domains of human coxsackievirus and adenovirus receptor (CAR)

DOEpatents

Freimuth, Paul I.

2010-04-06

The invention provides recombinant human CAR (coxsackievirus and adenovirus receptor) polypeptides which bind adenovirus. Specifically, polypeptides corresponding to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2 are provided. In another aspect, the invention provides nucleic acid sequences encoding these domains and expression vectors for producing the domains and bacterial cells containing such vectors. The invention also includes an isolated fusion protein comprised of the D1 polypeptide fused to a polypeptide which facilitates folding of D1 when expressed in bacteria. The functional D1 domain finds application in a therapeutic method for treating a patient infected with a CAR D1-binding virus, and also in a method for identifying an antiviral compound which interferes with viral attachment. The invention also provides a method for specifically targeting a cell for infection by a virus which binds to D1.

Large outbreak of herpangina in children caused by enterovirus in summer of 2015 in Hangzhou, China.

PubMed

Li, Wei; Gao, Hui-Hui; Zhang, Qiong; Liu, Yu-Jie; Tao, Ran; Cheng, Yu-Ping; Shu, Qiang; Shang, Shi-Qiang

2016-10-18

Herpangina, usually caused by coxsackie virus A, is prevalent in children spreading through the fecal-oral transmission and the respiratory droplets dissemination. Also, it is mostly asymptomatic and self-limiting. In our study, we found that large outbreak of herpangina in children occurred in the summer of 2015 in Hangzhou, China. From May 1th to August 31th, a total of 10 210 children were diagnosed with herpangina in Children's Hospital of Zhejiang University School of Medicine. 2 310 throat swabs were collected and tested for enterovirus detection by real-time RT-PCR, while 1 651 cases were positive with the rate of 71.5%. Based on VP1 gene or 5'UTR region sequences, Coxsackievirus A2, A4, A6, A10, B2, B4 and echovirus 30 were detected in these cases. More importantly, Coxsackievirus A2 may be the major subtype of enterovirus resulting in children with herpangina in hangzhou, China.

Permeability of oral tissues to blood-borne coxsackievirus B-1.

PubMed

Madonia, J V; Bahn, A N

1967-03-01

The ability of coxsackievirus B-1 to pass the barriers of the circulatory system into whole saliva has been shown previously. In this investigation, the major salivary glands and the oral mucosa were studied, and their role as participants in the excretion of coxsackievirus B-1 during viremia was evaluated. The effect of the salivary-gland stimulant pilocarpine nitrate on both the salivary flow rate and the recovery of virus during viremia was determined. A comparison was made between the amount of virus recovered from whole saliva during viremia in animals deficient in one or both of the major salivary-gland pairs and animals with a complete complement of salivary glands. The salivary glands in other animals were cannulated, and pure glandular secretions were collected during viremia and assayed for the presence of virus The amount of virus passing from the capillaries of the oral mucosa to the surface was also determined to evaluate this route as a possible site for the excretion of virus into saliva during viremia. The major salivary glands did not excrete appreciable quantities of virus during viremia. The submaxillary-gland secretions did not contain virus, and the parotid-gland secretions showed virus only at extremely high blood virus levels. Either removal of the major salivary glands or decreased salivary flow rates increased the concentration of virus in whole saliva. This observation suggested that the production of saliva by the major salivary glands tends to dilute the virus in the oral cavity. A 0.88-cm(2) sample of the oral mucosa excreted significantly large amounts of virus during viremia and suggested that the passage of virus through the oral mucosa was the major route for the excretion of virus into saliva during viremia.

Yeast-produced recombinant virus-like particles of coxsackievirus A6 elicited protective antibodies in mice.

PubMed

Zhou, Yu; Shen, Chaoyun; Zhang, Chao; Zhang, Wei; Wang, Lili; Lan, Ke; Liu, Qingwei; Huang, Zhong

2016-08-01

Coxsackievirus A6 (CA6) has recently emerged as the predominant pathogen of hand, foot and mouth disease (HFMD), causing significant morbidity in children and adults. The increasing prevalence of CA6 infection and its associated disease burden underscore the need for effective CA6 vaccines. However, CA6 grows poorly in cultured cells, making it difficult to develop inactivated whole-virus or live attenuated vaccines. Here we report the development of a recombinant virus-like particle (VLP) based CA6 vaccine. CA6 VLPs were produced in Pichia pastoris yeast transformed with a vector encoding both P1 and 3CD proteins of CA6. Immunization with CA6 VLPs elicited CA6-specific serum antibodies in mice. Passive transfer of anti-VLP antisera protected recipient mice against lethal CA6 challenge. Collectively, these results demonstrate that CA6 VLPs represent a viable CA6 vaccine candidate which warrants further preclinical and clinical development. Copyright © 2016 Elsevier B.V. All rights reserved.

Coxsackievirus A16 infection triggers apoptosis in RD cells by inducing ER stress.

PubMed

Zhu, Guoguo; Zheng, Yingcheng; Zhang, Lianglu; Shi, Yingying; Li, Wenhua; Liu, Zhongchun; Peng, Biwen; Yin, Jun; Liu, Wanhong; He, Xiaohua

2013-11-29

Coxsackievirus A16 (CA16) infection, which is responsible for hand, foot and mouth disease (HFMD), has become a common health problem in Asia due to the prevalence of the virus. Thus, it is important to understand the pathogenesis of CA16 infection. Viruses that induce endoplasmic reticulum (ER) stress are confronted with the unfolded protein response (UPR), which may lead to apoptotic cell death and influence viral replication. In this study, we found that CA16 infection could induce apoptosis and ER stress in RD cells. Interestingly, apoptosis via the activation of caspase-3, -8 and -9 in the extrinsic or intrinsic apoptotic pathways in RD cells was inhibited by 4-phenyl butyric acid (4PBA), a chemical chaperone that reduces ER stress. These results suggest that CA16 infection leads to ER stress, which in turn results in prolonged ER stress-induced apoptosis. This study provides a new basis for understanding CA16 infection and host responses. Copyright © 2013 Elsevier Inc. All rights reserved.

ViriChip: a solid phase assay for detection and identification of viruses by atomic force microscopy

NASA Astrophysics Data System (ADS)

Nettikadan, Saju R.; Johnson, James C.; Vengasandra, Srikanth G.; Muys, James; Henderson, Eric

2004-03-01

Bionanotechnology can be viewed as the integration of tools and concepts in nanotechnology with the attributes of biomolecules. We report here on an atomic force microscopy-immunosensor assay (AFMIA) that couples AFM with solid phase affinity capture of biological entities for the rapid detection and identification of group B coxsackievirus particles. Virus identification is based on type-specific immunocapture and the morphological properties of the captured viruses as obtained by the AFM. Representatives of the six group B coxsackieviruses have been specifically captured from 1 µl volumes of clarified cell lysates, body fluids and environmental samples. Concentration and kinetic profiles for capture indicate that detection is possible at 103 TCID50 µl-1 and the dynamic range of the assay spans three logs. The results demonstrate that the melding of a nanotechnological tool (AFM) with biotechnology (solid phase immunocapture of virus particles) can create a clinically relevant platform, useful for the detection and identification of enterovirus particles in a variety of samples.

Pathogenic Anti-Müllerian Hormone Variants in Polycystic Ovary Syndrome.

PubMed

Gorsic, Lidija K; Kosova, Gulum; Werstein, Brian; Sisk, Ryan; Legro, Richard S; Hayes, M Geoffrey; Teixeira, Jose M; Dunaif, Andrea; Urbanek, Margrit

2017-08-01

Polycystic ovary syndrome (PCOS), a common endocrine condition, is the leading cause of anovulatory infertility. Given that common disease-susceptibility variants account for only a small percentage of the estimated PCOS heritability, we tested the hypothesis that rare variants contribute to this deficit in heritability. Unbiased whole-genome sequencing (WGS) of 80 patients with PCOS and 24 reproductively normal control subjects identified potentially deleterious variants in AMH, the gene encoding anti-Müllerian hormone (AMH). Targeted sequencing of AMH of 643 patients with PCOS and 153 control patients was used to replicate WGS findings. Dual luciferase reporter assays measured the impact of the variants on downstream AMH signaling. We found 24 rare (minor allele frequency < 0.01) AMH variants in patients with PCOS and control subjects; 18 variants were specific to women with PCOS. Seventeen of 18 (94%) PCOS-specific variants had significantly reduced AMH signaling, whereas none of 6 variants observed in control subjects showed significant defects in signaling. Thus, we identified rare AMH coding variants that reduced AMH-mediated signaling in a subset of patients with PCOS. To our knowledge, this study is the first to identify rare genetic variants associated with a common PCOS phenotype. Our findings suggest decreased AMH signaling as a mechanism for the pathogenesis of PCOS. AMH decreases androgen biosynthesis by inhibiting CYP17 activity; a potential mechanism of action for AMH variants in PCOS, therefore, is to increase androgen biosynthesis due to decreased AMH-mediated inhibition of CYP17 activity. Copyright © 2017 Endocrine Society

Development of potent inhibitors of the coxsackievirus 3C protease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Eui Seung; Lee, Won Gil; Yun, Soo-Hyeon

Coxsackievirus B3 (CVB3) 3C protease (3CP) plays essential roles in the viral replication cycle, and therefore, provides an attractive therapeutic target for treatment of human diseases caused by CVB3 infection. CVB3 3CP and human rhinovirus (HRV) 3CP have a high degree of amino acid sequence similarity. Comparative modeling of these two 3CPs revealed one prominent distinction; an Asn residue delineating the S2' pocket in HRV 3CP is replaced by a Tyr residue in CVB3 3CP. AG7088, a potent inhibitor of HRV 3CP, was modified by substitution of the ethyl group at the P2' position with various hydrophobic aromatic rings thatmore » are predicted to interact preferentially with the Tyr residue in the S2' pocket of CVB3 3CP. The resulting derivatives showed dramatically increased inhibitory activities against CVB3 3CP. In addition, one of the derivatives effectively inhibited the CVB3 proliferation in vitro.« less

Detection and identification of enteroviruses from various drinking water sources in Taiwan

NASA Astrophysics Data System (ADS)

Hsu, Bing-Mu; Chen, Chien-Hsien; Wan, Min-Tao; Chang, Po-Jen; Fan, Cheng-Wei

2009-02-01

SummaryTwenty-three water samples, including seventeen from surface water reservoirs, three from the raw water of groundwater treatment plants, and three from small water systems, were collected in Taiwan and investigated for the presence of, as well as the species of enteroviruses. RT-PCR was used for the detection of enteroviruses. Results revealed that 23.5% of raw water samples from reservoirs were positive for enteroviruses. In addition, one of the three groundwater samples and two of the three small system water samples were positive for enteroviruses. Water samples that were positive for enteroviruses subsequently were evaluated by real-time PCR. The results indicated that enterovirus concentration in groundwater was lower than that in samples obtained from surface water sources. Enteroviruses were identified by nucleic acid sequencing in the 5'-untranslated regions. Three clusters of enteroviruses were identified as coxsackievirus A2, coxsackievirus A6, and enterovirus 71. The presence of enteroviruses indicates the possibility of waterborne transmission of enteroviruses in Taiwan, if water is not adequately treated.

Cough-variant asthma: a diagnostic dilemma in the occupational setting.

PubMed

Lipińska-Ojrzanowska, A; Wiszniewska, M; Walusiak-Skorupa, J

2015-03-01

Cough-variant asthma (Corrao's syndrome) is defined as the presence of chronic non-productive cough in patients with bronchial hyperresponsiveness (BHR) and response to bronchodilator therapy. This variant of asthma may present a diagnostic problem in occupational medicine. To describe additional evaluation of cough-variant asthma in a cyanoacrylate-exposed worker in whom standard diagnostic testing was negative. A female beautician was evaluated for suspected occupational allergic rhinitis and asthma. A specific inhalation challenge test (SICT) was performed with cyanoacrylate glues used for applying artificial eyelashes and nails. Spirometry and peak expiratory flow (PEF) measurements were recorded hourly for 24h; methacholine challenge testing was performed and nasal lavage (NL) samples were analysed for eosinophilia. After SICT, the patient developed sneezing, nasal airflow obstruction and cough. Declines in forced expiratory volume in 1 s and PEF were not observed. Eosinophil proportions in NL fluid increased markedly at 4 and 24h after SICT. A significant increase in BHR also occurred 24h after SICT. Clinical symptoms, post-challenge BHR and increased NL eosinophil counts confirmed a positive response to SICT and validated the diagnosis of cough-variant occupational asthma. SICT may be useful in cases where history and clinical data suggest cough-variant asthma and spirometric indices are negative. © The Author 2014. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Lower metabolic rate in individuals heterozygous for either a frameshift or a functional missense MC4R variant.

PubMed

Krakoff, Jonathan; Ma, Lijun; Kobes, Sayuko; Knowler, William C; Hanson, Robert L; Bogardus, Clifton; Baier, Leslie J

2008-12-01

Humans with functional variants in the melanocortin 4 receptor (MC4R) are obese, hyperphagic, and hyperinsulinemic but have been reported to have no difference in energy expenditure. We investigated the association of two MC4R variants, Arg165Gln (R165Q) and A insertion at nucleotide 100 (NT100), with adiposity in 3,074 full-heritage Pima Indians, a subset of whom had metabolic measures including 24-h energy expenditure (n = 252) and resting metabolic rate (RMR) (n = 364). Among the 3,074 subjects, 43 were heterozygous for R165Q and 14 for NT100 (frequency = 0.007 and 0.002). Mean (+/- SD) BMI was higher among subjects with R165Q (39.3 +/- 8.6 kg/m(2)) or NT100 (41.2 +/- 7.8) than subjects without either variant (37.1 +/- 8.4) (P = 0.04 and 0.02, adjusted for age, sex, and birth year and accounting for family membership). The 24-h energy expenditure (four with NT100; three with R165Q) or RMR (six with NT100; two with R165Q) was lower in heterozygous subjects but only met statistical significance when heterozygous subjects were combined and compared with subjects without either variant: least-squares means, 2,163 kcal/24 h (95% CI 2,035-2,291) vs. 2,307 kcal/24 h (2,285-2,328), P = 0.03 for 24-h energy expenditure, and 1,617 kcal/24 h (1,499-1,734) vs. 1,754 kcal/24 h (1,736-1,772), P = 0.02 for RMR; adjusted for age, sex, fat-free mass, and fat mass). For RMR, this difference persisted, even after accounting for family membership. Pima Indians heterozygous for R165Q or NT100 in MC4R have higher BMIs and lower energy expenditure (by approximately 140 kcal/day), indicating that lower energy expenditure was a component of the increased adiposity.

Pleurodynia among football players at a high school. An outbreak associated with coxsackievirus B1.

PubMed

Ikeda, R M; Kondracki, S F; Drabkin, P D; Birkhead, G S; Morse, D L

1993-11-10

Enteroviral outbreaks involving athletic teams have been described, although the mode of transmission has been unclear. In September 1991, an outbreak of pleurodynia among high school football players provided an opportunity to identify possible modes of transmission. Retrospective cohort outbreak investigation. Public high school in upstate New York. Illness was reported by 17 (20%) of the football players. Behaviors involving contact with common water containers were associated with illness, including eating ice cubes from the team ice chest (relative risk [RR], 9.2; 95% confidence interval [CI], 1.3 to 65.5) and drinking water from the team cooler (RR, 6.3; 95% CI, 1.5 to 25.7). Coxsackievirus B1 was isolated in four (50%) of the eight stool specimens collected. Contamination of common water containers by an infected player may have contributed to or initiated the outbreak. In addition to discouraging direct oral contact with common drinking containers, use of individual water containers and ice packs for injuries was recommended.

Amiloride inhibits the initiation of Coxsackievirus and poliovirus RNA replication by inhibiting VPg uridylylation.

PubMed

Ogram, Sushma A; Boone, Christopher D; McKenna, Robert; Flanegan, James B

2014-09-01

The mechanism of amiloride inhibition of Coxsackievirus B3 (CVB3) and poliovirus type 1 (PV1) RNA replication was investigated using membrane-associated RNA replication complexes. Amiloride was shown to inhibit viral RNA replication and VPgpUpU synthesis. However, the drug had no effect on polymerase elongation activity during either (-) strand or (+) strand synthesis. These findings indicated that amiloride inhibited the initiation of RNA synthesis by inhibiting VPg uridylylation. In addition, in silico binding studies showed that amiloride docks in the VPg binding site on the back of the viral RNA polymerase, 3D(pol). Since VPg binding at this site on PV1 3D(pol) was previously shown to be required for VPg uridylylation, our results suggest that amiloride inhibits VPg binding to 3D(pol). In summary, our findings are consistent with a model in which amiloride inhibits VPgpUpU synthesis and viral RNA replication by competing with VPg for binding to 3D(pol). Copyright © 2014 Elsevier Inc. All rights reserved.

DEVELOPMENT OF BIOMARKER OF EXPOSURE TO VIRAL PATHOGENS

EPA Science Inventory

Interferon gamma (IFN-γ) was selected as a biomarker for a viral exposure study. Twelve-week-old BALB/c mice were intraperitoneally injected with 0.2ml of 104 PFU/ml of coxsackievirus B3 or B4 diluted in phosphate-buffered saline (PBS). Control mice were injected with PBS on...

Interferon Gamma as a Biomarker of Exposure to Enteric Viruses

EPA Science Inventory

Interferon gamma (IFN-γ) was selected as a biomarker for viral exposure. Twelve-week-old BALB/c mice were intraperitoneally injected with Coxsackievirus B3 or B4 diluted in phosphate-buffered saline (PBS). Control mice were injected with PBS only. Four months after viral infectio...

Exposure to enteroviruses and hepatitis A virus among divers in environmental waters in France, first biological and serological survey of a controlled cohort.

PubMed Central

Garin, D.; Fuchs, F.; Crance, J. M.; Rouby, Y.; Chapalain, J. C.; Lamarque, D.; Gounot, A. M.; Aymard, M.

1994-01-01

An epidemiological study of hepatitis A and enteroviruses was conducted in a military diving training school, by evaluating the viral contamination of water using an ultrafiltration concentration technique, and assessing seroconversion and the presence of virus in stool specimens obtained from 109 divers and 48 controls. Three of 29 water specimens were positive for enterovirus by cell culture and 9 by molecular hybridization. There was little or no risk of virus infection during the training course (49 h exposure) because there was no significant difference between divers and controls for both viral isolation and seroconversion. However, a higher percentage of coxsackievirus B4 and B5 seropositive divers suggests that these were more exposed during previous water training. No hepatitis A virus (HAV) detection and no seroconversion to HAV was observed. The rate of HAV seropositive subjects was 17% in this 24.5-year-old population. PMID:7995363

AN INTEGRATED CELL CULTURE/RT-PCR METHOD FOR DETECTING ENTEROVIRUS IN WATER

EPA Science Inventory

Echovirus and coxsackievirus can cause mild to severe disease following consumption of contaminated drinking water. However, comprehensive occurrence studies of enteroviruses in drinking water matrices are limited, in part because of the lack of available methods that are rapid, ...

Prostate cancer risk regions at 8q24 and 17q24 are differentially associated with somatic TMPRSS2:ERG fusion status

PubMed Central

Luedeke, Manuel; Rinckleb, Antje E.; FitzGerald, Liesel M.; Geybels, Milan S.; Schleutker, Johanna; Eeles, Rosalind A.; Teixeira, Manuel R.; Cannon-Albright, Lisa; Ostrander, Elaine A.; Weikert, Steffen; Herkommer, Kathleen; Wahlfors, Tiina; Visakorpi, Tapio; Leinonen, Katri A.; Tammela, Teuvo L.J.; Cooper, Colin S.; Kote-Jarai, Zsofia; Edwards, Sandra; Goh, Chee L.; McCarthy, Frank; Parker, Chris; Flohr, Penny; Paulo, Paula; Jerónimo, Carmen; Henrique, Rui; Krause, Hans; Wach, Sven; Lieb, Verena; Rau, Tilman T.; Vogel, Walther; Kuefer, Rainer; Hofer, Matthias D.; Perner, Sven; Rubin, Mark A.; Agarwal, Archana M.; Easton, Doug F.; Al Olama, Ali Amin; Benlloch, Sara; Hoegel, Josef; Stanford, Janet L.

2016-01-01

Abstract Molecular and epidemiological differences have been described between TMPRSS2:ERG fusion-positive and fusion-negative prostate cancer (PrCa). Assuming two molecularly distinct subtypes, we have examined 27 common PrCa risk variants, previously identified in genome-wide association studies, for subtype specific associations in a total of 1221 TMPRSS2:ERG phenotyped PrCa cases. In meta-analyses of a discovery set of 552 cases with TMPRSS2:ERG data and 7650 unaffected men from five centers we have found support for the hypothesis that several common risk variants are associated with one particular subtype rather than with PrCa in general. Risk variants were analyzed in case-case comparisons (296 TMPRSS2:ERG fusion-positive versus 256 fusion-negative cases) and an independent set of 669 cases with TMPRSS2:ERG data was established to replicate the top five candidates. Significant differences (P < 0.00185) between the two subtypes were observed for rs16901979 (8q24) and rs1859962 (17q24), which were enriched in TMPRSS2:ERG fusion-negative (OR = 0.53, P = 0.0007) and TMPRSS2:ERG fusion-positive PrCa (OR = 1.30, P = 0.0016), respectively. Expression quantitative trait locus analysis was performed to investigate mechanistic links between risk variants, fusion status and target gene mRNA levels. For rs1859962 at 17q24, genotype dependent expression was observed for the candidate target gene SOX9 in TMPRSS2:ERG fusion-positive PrCa, which was not evident in TMPRSS2:ERG negative tumors. The present study established evidence for the first two common PrCa risk variants differentially associated with TMPRSS2:ERG fusion status. TMPRSS2:ERG phenotyping of larger studies is required to determine comprehensive sets of variants with subtype-specific roles in PrCa. PMID:27798103

Detection and genotyping of enteroviruses in cerebrospinal fluid in patients in Victoria, Australia, 2007-2013.

PubMed

Papadakis, Georgina; Chibo, Doris; Druce, Julian; Catton, Michael; Birch, Chris

2014-09-01

Genotyping by VP1 fragment polymerase chain reaction (PCR) and nucleic acid sequencing to detect enterovirus (EV) genotypes was performed directly on 729 EV PCR positive cerebrospinal fluid (CSF) samples collected between 2007 and 2012 from Victorian hospital inpatients. The overall genotype identification rate from CSF-positive material was 43%. The four most common genotypes identified were Echovirus 6 (24%), Echovirus 30 (17%), Echovirus 25 (10%), and Coxsackievirus A9 (10%), together comprising 61% of all EVs typed. The seasonal distribution of all EVs identified followed the recognized pattern of mainly summer epidemics. Three of the four predominant genotypes were present in each of the 6 years in which the study was conducted, with 20 other EV genotypes also detected, often in only a single year. Genotyping of EVs directly in CSF is faster, simpler and more sensitive than traditional virus neutralization assays performed on EV positive samples. © 2014 Wiley Periodicals, Inc.

Molecular Background of Colorectal Tumors From Patients with Lynch Syndrome Associated With Germline Variants in PMS2.

PubMed

Ten Broeke, S W; van Bavel, T C; Jansen, A M L; Gómez-García, E; Hes, F J; van Hest, L P; Letteboer, T G W; Olderode-Berends, M J W; Ruano, D; Spruijt, L; Suerink, M; Tops, C M; van Eijk, R; Morreau, H; van Wezel, T; Nielsen, M

2018-05-11

Germline variants in the mismatch repair genes MLH1, MSH2 (EPCAM), MSH6, or PMS2 cause Lynch syndrome. Patients with these variants have an increased risk of developing colorectal cancers (CRCs) that differ from sporadic CRCs in genetic and histologic features. It has been a challenge to study CRCs associated with PMS2 variants (PMS2-associated CRCs) because these develop less frequently and in patients of older ages than colorectal tumors with variants in the other mismatch repair genes. We analyzed 20 CRCs associated with germline variants in PMS2, 22 sporadic CRCs, 18 CRCs with germline variants in MSH2, and 24 CRCs from patients with germline variants in MLH1. Tumor tissue blocks were collected from Dutch pathology departments in 2017. After extraction of tumor DNA, we used a platform designed to detect approximately 3000 somatic hotspot variants in 55 genes (including KRAS, APC, CTNNB1, and TP53). Somatic variant frequencies were compared using the Fisher's exact test. None of the PMS2-associated CRCs contained any somatic variants in the catenin beta 1 gene (CTNNB1), which encodes β-catenin, whereas 14/24 MLH1-associated CRCs (58%) contained variants in CTNNB1. Half of PMS2-associated CRCs contained KRAS variants, but only 20% of these were in hotspots that encoded G12D or G13D. These hotspot variants occurred more frequently in CRCs associated with variants in MLH1 (37.5%, P=.44) and MSH2 (and 71.4%, P=.035) than with variants in PMS2. In a genetic analysis of 84 colorectal tumors, we found tumors from patients with PMS2-associated Lynch syndrome to be distinct from colorectal tumors associated with defects in other mismatch repair genes. This might account for differences in development and less frequent occurrence. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.

Coxsackievirus and adenovirus receptor (CAR) mediates trafficking of acid sensing ion channel 3 (ASIC3) via PSD-95.

PubMed

Excoffon, Katherine J D A; Kolawole, Abimbola O; Kusama, Nobuyoshi; Gansemer, Nicholas D; Sharma, Priyanka; Hruska-Hageman, Alesia M; Petroff, Elena; Benson, Christopher J

2012-08-17

We have previously shown that the Coxsackievirus and adenovirus receptor (CAR) can interact with post-synaptic density 95 (PSD-95) and localize PSD-95 to cell-cell junctions. We have also shown that activity of the acid sensing ion channel (ASIC3), a H(+)-gated cation channel that plays a role in mechanosensation and pain signaling, is negatively modulated by PSD-95 through a PDZ-based interaction. We asked whether CAR and ASIC3 simultaneously interact with PSD-95, and if so, whether co-expression of these proteins alters their cellular distribution and localization. Results indicate that CAR and ASIC3 co-immunoprecipitate only when co-expressed with PSD-95. CAR also brings both PSD-95 and ASIC3 to the junctions of heterologous cells. Moreover, CAR rescues PSD-95-mediated inhibition of ASIC3 currents. These data suggest that, in addition to activity as a viral receptor and adhesion molecule, CAR can play a role in trafficking proteins, including ion channels, in a PDZ-based scaffolding complex. Copyright © 2012 Elsevier Inc. All rights reserved.

Ambulatory Pediatric Surveillance of Hand, Foot and Mouth Disease as Signal of an Outbreak of Coxsackievirus A6 Infections, France, 2014–2015

PubMed Central

le Sage, François Vié; Pereira, Bruno; Cohen, Robert; Levy, Corinne; Archimbaud, Christine; Peigue-Lafeuille, Hélène; Bailly, Jean-Luc; Henquell, Cécile

2016-01-01

The clinical impact of enteroviruses associated with hand, foot and mouth disease (HFMD) is unknown outside Asia, and the prevalence of enterovirus A71 (EV-A71) in particular might be underestimated. To investigate the prevalence of enterovirus serotypes and the clinical presentations associated with HFMD in France, we conducted prospective ambulatory clinic–based surveillance of children during April 2014–March 2015. Throat or buccal swabs were collected from children with HFMD and tested for the enterovirus genome. Physical examinations were recorded on a standardized form. An enterovirus infection was detected in 523 (79.3%) of 659 children tested. Two epidemic waves occurred, dominated by coxsackievirus (CV) A6, which was detected in 53.9% of enterovirus-infected children. CV-A6 was more frequently related to atypical HFMD manifestations (eruptions extended to limbs and face). Early awareness and documentation of HFMD outbreaks can be achieved by syndromic surveillance of HFMD by ambulatory pediatricians and rapid enterovirus testing and genotyping. PMID:27767012

Epidemiological and genetic analysis concerning the non-enterovirus 71 and non-coxsackievirus A16 causative agents related to hand, foot and mouth disease in Anyang city, Henan Province, China, from 2011 to 2015.

PubMed

Li, Yang; Bao, Honghong; Zhang, Xiangping; Zhai, Mingqiang; Bao, Xiaobing; Wang, Demin; Zhang, Shuanhu

2017-10-01

Enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) are major pathogens of hand, foot, and mouth disease (HFMD) and have been associated with consecutive outbreaks of HFMD in China over the past years. Although several other human enteroviruses (HEVs) have also acted as causative agents of HFMD, published information on their roles in the prevalence of HFMD is limited. This study was conducted to reveal the characteristics of the pathogenic spectrum and molecular epidemiology of the non-EV-71 and -CV-A16 HEVs in Anyang City, which is located in north-central China and has a population of five million. From 2011 to 2015, 2270 samples were collected from HFMD patients (3.89 ± 1.06 years of age), and 1863 HEV-positive samples, including 524 samples with 23 non-EV-71 and non-CV-A16 serotypes, were identified. Based on the nucleotide sequence of the VP1 gene, 6 common non-EV-71 and non-CV-A16 HEVs, including coxsackievirus A2, A6, A10, A14, B2, and B5, were studied to determine their phylogenies and selective pressures. Phylogenetic analyses revealed a high level of genetic divergence and a pattern of lineage replacement over time in Mainland China. Selective pressure analyses showed that purifying selection was predominant in the evolution of the VP1 gene, whereas positive selection acted on individual codons. Overall, non-EV-71 and non-CV-A16 HEVs were important constituents of the pathogenic spectrum of HFMD in Anyang City during 2011-2015. Some of these HEVs with complex and active phylogenies represent a potential threat to public health, suggesting that long-term monitoring of these pathogens should be implemented to prevent HFMD outbreaks. © 2017 Wiley Periodicals, Inc.

Amiloride Derivatives Inhibit Coxsackievirus B3 RNA Replication▿

PubMed Central

Harrison, David N.; Gazina, Elena V.; Purcell, Damian F.; Anderson, David A.; Petrou, Steven

2008-01-01

Amiloride derivatives are known blockers of the cellular Na+/H+ exchanger and the epithelial Na+ channel. More recent studies demonstrate that they also inhibit ion channels formed by a number of viral proteins. We previously reported that 5-(N-ethyl-N-isopropyl)amiloride (EIPA) modestly inhibits intracellular replication and, to a larger extent, release of human rhinovirus 2 (HRV2) (E. V. Gazina, D. N. Harrison, M. Jefferies, H. Tan, D. Williams, D. A. Anderson and S. Petrou, Antiviral Res. 67:98-106, 2005). Here, we demonstrate that amiloride and EIPA strongly inhibit coxsackievirus B3 (CVB3) RNA replication and do not inhibit CVB3 release, in contrast to our previous findings on HRV2. Passaging of plasmid-derived CVB3 in the presence of amiloride generated mutant viruses with amino acid substitutions in position 299 or 372 of the CVB3 polymerase. Introduction of either of these mutations into the CVB3 plasmid produced resistance to amiloride and EIPA, suggesting that they act as inhibitors of CVB3 polymerase, a novel mechanism of antiviral activity for these compounds. PMID:18032495

Inactivated coxsackievirus A10 experimental vaccines protect mice against lethal viral challenge.

PubMed

Shen, Chaoyun; Liu, Qingwei; Zhou, Yu; Ku, Zhiqiang; Wang, Lili; Lan, Ke; Ye, Xiaohua; Huang, Zhong

2016-09-22

Coxsackievirus A10 (CVA10) has become one of the major causative agents of hand, foot and mouth disease (HFMD). It is now recognized that CVA10 should be targeted for vaccine development. We report here that β-propiolactone inactivated whole-virus based CVA10 vaccines can elicit protective immunity in mice. We prepared two inactivated CVA10 experimental vaccines derived from the prototype strain CVA10/Kowalik and from a clinical isolate CVA10/S0148b, respectively. Immunization with the experimental vaccines elicited CVA10-specific serum antibodies in mice. The antisera from vaccinated mice could potently neutralize in vitro infection with either homologous or heterologous CVA10 strains. Importantly, passive transfer of the anti-CVA10 sera protected recipient mice against CVA10/Kowalik or CVA10/S0148b infections. Moreover, active immunization with the inactivated vaccines also conferred protection against homologous and heterologous infections in mice. Collectively, our results demonstrate the proof-of-concept for inactivated whole-virus based CVA10 vaccines. Copyright © 2016 Elsevier Ltd. All rights reserved.

Type 2 diabetes susceptibility genes on chromosome 1q21-24.

PubMed

Hasstedt, S J; Chu, W S; Das, S K; Wang, H; Elbein, S C

2008-03-01

Type 2 diabetes (T2D) has been linked to chromosome 1q21-24 in multiple samples, including a Utah family sample. Variants in 13 of the numerous candidate genes in the 1q region were tested for association with T2D in a Utah case-control sample. The most promising, 19 variants in 6 candidates, were genotyped on the Utah family sample. Herein, we tested the 19 variants individually and in pairs for an effect on T2D risk in family members using a logistic regression model that accounted for gender, age, and BMI and attributed residual genetic effects to a polygenic component. Seven variants increased risk significantly through 5 pairs of interactions. The significant variant pairs were apolipoprotein A-II (APOA2) rs6413453 interacting with calsequestrin 1 (CASQ1) rs617698, dual specificity phosphatase 12 (DUSP12) rs1503814, and retinoid X receptor gamma (RXRG) rs10918169, a poly-T insertion-deletion polymorphism in liver pyruvate kinase (PKLR) interacting with APOA2 rs12143180, and DUSP12 rs1027702 interacting with RXRG rs10918169. Genotypes of these 5 variant pairs accounted for 25.8% of the genetic variance in T2D in these pedigrees.

Paenibacillus polymyxa PKB1 produces variants of polymyxin B-type antibiotics.

PubMed

Shaheen, Mohamed; Li, Jingru; Ross, Avena C; Vederas, John C; Jensen, Susan E

2011-12-23

Polymyxins are cationic lipopeptide antibiotics active against many species of Gram-negative bacteria. We sequenced the gene cluster for polymyxin biosynthesis from Paenibacillus polymyxa PKB1. The 40.8 kb gene cluster comprises three nonribosomal peptide synthetase-encoding genes and two ABC transporter-like genes. Disruption of a peptide synthetase gene abolished all antibiotic production, whereas deletion of one or both transporter genes only reduced antibiotic production. Computational analysis of the peptide synthetase modules suggested that the enzyme system produces variant forms of polymyxin B (1 and 2), with D-2,4-diaminobutyrate instead of L-2,4-diaminobutyrate in amino acid position 3. Two antibacterial metabolites were resolved by HPLC and identified by high-resolution mass spectrometry and MS/MS sequencing as the expected variants 3 and 4 of polymyxin B(1) (1) and B(2) (2). Stereochemical analysis confirmed the presence of both D-2,4-diaminobutyrate and L-2,4-diaminobutyrate residues. Copyright © 2011 Elsevier Ltd. All rights reserved.

Temperature effects for high pressure processing of Picornaviruses

USDA-ARS?s Scientific Manuscript database

Investigation of the effects of pre-pressurization temperature on the high pressure inactivation for single strains of aichivirus (AiV), coxsackievirus A9 (CAV9) and B5 (CBV5) viruses, as well as human parechovirus -1 (HPeV), was performed. For CAV9, an average 1.99 log10 greater inactivation was ...

Loss of Virus-Specific Memory T. cells in Coxsackievirus B3 and B4 Infected Mice

EPA Science Inventory

There are two major types of enteroviruses: polioviruses and non-polio enteroviruses. While vaccines have effectively eliminated poliovirus infections, no vaccine is currently available for the non-polio enteroviruses. Generation of long-term pathogen specific memory cells is cri...

Common non-synonymous polymorphisms in the BRCA1 Associated RING Domain (BARD1) gene are associated with breast cancer susceptibility: a case-control analysis.

PubMed

Huo, Xiang; Hu, Zhibin; Zhai, Xiangjun; Wang, Yan; Wang, Shui; Wang, Xuechen; Qin, Jianwei; Chen, Wenseng; Jin, Guangfu; Liu, Jiyong; Gao, Jun; Wei, Qingyi; Wang, Xinru; Shen, Hongbing

2007-05-01

The BRCA1 Associated RING Domain (BARD1) gene has been identified as a high penetrance gene for breast cancer, whose germline and somatic mutations were reported in both non-BRCA1/2 hereditary site-specific and sporadic breast cancer cases. BARD1 plays a crucial role in tumor repression, along with its heterodimeric partner BRCA1. In the current study, we tested the hypothesis that common non-synonymous polymorphisms in BARD1 are associated with breast cancer susceptibility in a case-control study of 507 patients with incident breast cancer and 539 frequency-matched cancer-free controls in Chinese women. We genotyped all three common (minor allele frequency (MAF)>0.10) non-synonymous polymorphisms (Pro24Ser, Arg378Ser, and Val507Met) in BARD1. We found that the BARD1 Pro24Ser variant genotypes (24Pro/Ser and 24Ser/Ser) and Arg378Ser variant homozygote 378Ser/Ser were associated with a significantly decreased breast cancer risk, compared with their wild-type homozygotes, respectively. Furthermore, a significant locus-locus interaction was evident between Pro24Ser and Arg378Ser (P(int )= 0.032). Among the 378Ser variant allele carriers, the 24Pro/Pro wild-type homozygote was associated with a significantly increased breast cancer risk (adjusted OR=1.81, 95% CI=1.11-2.95), but the subjects having 24Pro/Ser or Ser/Ser variant genotypes had a significantly decreased risk (adjusted OR=0.74, 95% CI=0.56-0.99). In stratified analysis, this locus-locus interaction was more evident among subjects without family cancer history, those with positive estrogen receptor (ER) and individuals with negative progesterone receptor (PR). These findings indicate that the potentially functional polymorphisms Pro24Ser and Arg378Ser in BARD1 may jointly contribute to the susceptibility of breast cancer.

Validation of copy number variants associated with prostate cancer risk and prognosis.

PubMed

Blackburn, August; Wilson, Desiree; Gelfond, Jonathan; Yao, Li; Hernandez, Javier; Thompson, Ian M; Leach, Robin J; Lehman, Donna M

2014-01-01

Two recent studies have reported novel heritable copy number variants on chromosomes 2p, 15q, and 12q to be associated with prostate cancer (PCa) risk in non-Hispanic Caucasians. The goal of this study was to determine whether these findings could be independently confirmed in the Caucasian population from the South Texas area. The study subjects consisted of participants of the San Antonio Biomarkers of Risk for PCa cohort and additional cases ascertained in the same metropolitan area. We genotyped all 7 of the reported copy number variants using real-time quantitative polymerase chain reaction in 1,536 (317 cases and 1,219 controls) non-Hispanic Caucasian men, and additionally, we genotyped 632 (191 cases and 441 controls) Hispanic Caucasian men for one of these variants, a deletion on 2p24.3. Association of the deletion on 2p24.3 with overall PCa risk did not meet our significance criteria but was consistent with previous reports (odds ratio, 1.40; 95% confidence interval 0.99-2.00; P = 0.06). Among Hispanic Caucasians, this deletion is much less prevalent (minor allele frequencies of 0.059 and 0.024 in non-Hispanic and Hispanic Caucasians, respectively) and did not show evidence of association with risk for PCa. Interestingly, among non-Hispanic Caucasians, carrying a homozygous deletion of 2p24.3 was significantly associated with high-grade PCa as defined by Gleason score sum ≥8 (odds ratio, 27.99; 95% confidence interval 1.99-392.6; P = 0.007 [the Fisher exact test]). The remaining 6 copy number variable regions either were not polymorphic in our cohort of non-Hispanic Caucasians or showed no evidence of association. Our findings are consistent with the reported observation that a heritable deletion on 2p24.3 is associated with PCa risk in non-Hispanic Caucasians. Additionally, our observations indicate that the 2p24.3 variant is associated with risk for high-grade PCa in a recessive manner. We were unable to replicate any association with PCa for the variants on chromosomes 15q and 12q, which may be explained by regional population differences in low frequency variants and disease heterogeneity. Published by Elsevier Inc.

VIRAL ANTIBODIES IN AGRICULTURAL POPULATIONS EXPOSED TO AEROSOLS FROM WASTEWATER IRRIGATION DURING A VIRAL DISEASE OUTBREAK

EPA Science Inventory

The presence of antibodies to eight enteroviruses (ecovirus types 4, 7, and 9, coxsackievirus types A9, B1, B3, B4 and hepatitis A virus (HAY)) and Varicella-zoster virus was determined during a two-year period, 1980/1981 in paired blood samples of 777 persons in selected agricul...

Understanding the Mechanism of the Broad-Spectrum Antiviral Activity of Favipiravir (T-705): Key Role of the F1 Motif of the Viral Polymerase.

PubMed

Abdelnabi, Rana; Morais, Ana Theresa Silveira de; Leyssen, Pieter; Imbert, Isabelle; Beaucourt, Stéphanie; Blanc, Hervé; Froeyen, Mathy; Vignuzzi, Marco; Canard, Bruno; Neyts, Johan; Delang, Leen

2017-06-15

Favipiravir (T-705) is a broad-spectrum antiviral agent that has been approved in Japan for the treatment of influenza virus infections. T-705 also inhibits the replication of various RNA viruses, including chikungunya virus (CHIKV). We demonstrated earlier that the K291R mutation in the F1 motif of the RNA-dependent RNA polymerase (RdRp) of CHIKV is responsible for low-level resistance to T-705. Interestingly, this lysine is highly conserved in the RdRp of positive-sense single-stranded RNA (+ssRNA) viruses. To obtain insights into the unique broad-spectrum antiviral activity of T-705, we explored the role of this lysine using another +ssRNA virus, namely, coxsackievirus B3 (CVB3). Introduction of the corresponding K-to-R substitution in the CVB3 RdRp (K159R) resulted in a nonviable virus. Replication competence of the K159R variant was restored by spontaneous acquisition of an A239G substitution in the RdRp. A mutagenesis analysis at position K159 identified the K159M variant as the only other viable variant which had also acquired the A239G substitution. The K159 substitutions markedly decreased the processivity of the purified viral RdRp, which was restored by the introduction of the A239G mutation. The K159R A239G and K159M A239G variants proved, surprisingly, more susceptible than the wild-type virus to T-705 and exhibited lower fidelity in polymerase assays. Furthermore, the K159R A239G variant was found to be highly attenuated in mice. We thus demonstrate that the conserved lysine in the F1 motif of the RdRp of +ssRNA viruses is involved in the broad-spectrum antiviral activity of T-705 and that it is a key amino acid for the proper functioning of the enzyme. IMPORTANCE In this study, we report the key role of a highly conserved lysine residue of the viral polymerase in the broad-spectrum antiviral activity of favipiravir (T-705) against positive-sense single-stranded RNA viruses. Substitutions of this conserved lysine have a major negative impact on the functionality of the RdRp. Furthermore, we show that this lysine is involved in the fidelity of the RdRp and that the RdRp fidelity influences the sensitivity of the virus for the antiviral efficacy of T-705. Consequently, these results provide insights into the mechanism of the antiviral activity of T-705 and may lay the basis for the design of novel chemical scaffolds that may be endowed with a more potent broad-spectrum antiviral activity than that of T-705. Copyright © 2017 American Society for Microbiology.

Immunomodulation by adoptive regulatory T-cell transfer improves Coxsackievirus B3-induced myocarditis.

PubMed

Pappritz, Kathleen; Savvatis, Konstantinos; Miteva, Kapka; Kerim, Bahtiyar; Dong, Fengquan; Fechner, Henry; Müller, Irene; Brandt, Christine; Lopez, Begoña; González, Arantxa; Ravassa, Susana; Klingel, Karin; Diez, Javier; Reinke, Petra; Volk, Hans-Dieter; Van Linthout, Sophie; Tschöpe, Carsten

2018-06-04

Regulatory T (T reg ) cells offer new therapeutic options for controlling undesired systemic and local immune responses. The aim of the current study was to determine the impact of therapeutic T reg administration on systemic and cardiac inflammation and remodeling in coxsackievirus B3 (CVB3) -induced myocarditis. Therefore, syngeneic T reg cells were applied intravenously in CVB3-infected mice 3 d after infection. Compared with CVB3 + PBS mice, CVB3 + T reg mice exhibited lower left ventricular (LV) chemokine expression, accompanied by reduced cardiac presence of proinflammatory Ly6C high CCR2 high Cx3Cr1 low monocytes and higher retention of proinflammatory Ly6C mid CCR2 high Cx3Cr1 low monocytes in the spleen. In addition, splenic myelopoiesis was reduced in CVB3 + T reg compared with CVB3 + PBS mice. Coculture of T reg cells with splenocytes isolated from mice 3 d post-CVB3 infection further demonstrated the ability of T reg cells to modulate monocyte differentiation in favor of the anti-inflammatory Ly6C low CCR2 low Cx3Cr1 high subset. T reg -mediated immunomodulation was paralleled by lower collagen 1 protein expression and decreased levels of soluble and insoluble collagen in LV of CVB3 + T reg compared with CVB3 + PBS mice. In agreement with these findings, LV systolic and diastolic function was improved in CVB3 + T reg mice compared with CVB3 + PBS mice. In summary, adoptive T reg transfer in the inflammatory phase of viral-induced myocarditis protects the heart against inflammatory damage and fibrosis via modulation of monocyte subsets.-Pappritz, K., Savvatis, K., Miteva, K., Kerim, B., Dong, F., Fechner, H., Müller, I., Brandt, C., Lopez, B., González, A., Ravassa, S., Klingel, K., Diez, J., Reinke, P., Volk, H.-D., Van Linthout, S., Tschöpe, C. Immunomodulation by adoptive regulatory T-cell transfer improves Coxsackievirus B3-induced myocarditis.

Functional and clinical relevance of novel and known PCSK1 variants for childhood obesity and glucose metabolism.

PubMed

Löffler, Dennis; Behrendt, Susanne; Creemers, John W M; Klammt, Jürgen; Aust, Gabriela; Stanik, Juraj; Kiess, Wieland; Kovacs, Peter; Körner, Antje

2017-03-01

Variants in Proprotein Convertase Subtilisin/Kexin Type 1 ( PCSK1 ) may be causative for obesity as suggested by monogenic cases and association studies. Here we assessed the functional relevance in experimental studies and the clinical relevance through detailed metabolic phenotyping of newly identified and known PCSK1 variants in children. In 52 obese children selected for elevated proinsulin levels and/or impaired glucose tolerance, we found eight known variants and two novel heterozygous variants (c.1095 + 1G > A and p.S24C) by sequencing the PCSK1 gene. Patients with the new variants presented with extreme obesity, impaired glucose tolerance, and PCOS. Functionally, c.1095 + 1G > A caused skipping of exon8 translation and a complete loss of enzymatic activity. The protein was retained within the endoplasmic reticulum (ER) causing ER stress. The p.S24C variant had no functional effect on protein size, cell trafficking, or enzymatic activity. The known variants rs6230, rs35753085, and rs725522 in the 5' end did not affect PCSK1 promoter activity. In clinical association studies in 1673 lean and obese children, we confirmed associations of rs6232 and rs6234 with BMI-SDS and of rs725522 with glucose stimulated insulin secretion and Matsuda index. We did not find the new variants in any other subjects. We identified and functionally characterized two rare novel PCSK1 variants of which c.1095 + 1G > A caused complete loss of protein function. In addition to confirming rs6232 and rs6234 in PCSK1 as polygenic risk variants for childhood obesity, we describe an association of rs725522 with insulin metabolism. Our results support the contribution of PCSK1 variants to obesity predisposition in children.

Use of a series of chemostat cultures to isolate 'improved' variants of the Quorn mycoprotein fungus, Fusarium graminearum A3/5.

PubMed

Wiebe, M G; Robson, G D; Oliver, S G; Trinci, A P

1994-11-01

Variants (designated A23-S and A24-S) of the Quorn myco-protein fungus, Fusarium graminearum A3/5 were isolated from a series of glucose-limited cultures grown at a dilution rate of 0.18 h-1 for a combined total of 109 d. These variants had unchanged mycelial morphologies but, when grown in mixed culture with the parental strain (A3/5) in glucose-limited chemostat culture at 0.18 h-1, A23-S and A24-S had selection coefficients of 0.013 and 0.017 h-1, respectively, and supplanted A3/5. When a monoculture of A23-S was grown in a glucose-limited culture at a dilution rate of 0.18 h-1, the appearance of highly branched (so-called colonial) mutants was delayed compared with their appearance in chemostat cultures of the parental strain. Furthermore, when a monoculture of A24-S was grown in glucose-limited culture at 0.18 h-1, the appearance of colonial mutants was delayed even further. Thus, it is possible to isolate advantageous (relative to A3/5) variants of F. graminearum A3/5 which have unchanged mycelial morphologies, but in which the appearance of colonial mutants is delayed.

Phenotypic heterogeneity of ZMPSTE24 deficiency.

PubMed

Cassini, Thomas A; Robertson, Amy K; Bican, Anna G; Cogan, Joy D; Hannig, Vickie L; Newman, John H; Hamid, Rizwan; Phillips, John A

2018-05-01

A 4-year-old girl was referred to the Undiagnosed Diseases Network with a history of short stature, thin and translucent skin, macrocephaly, small hands, and camptodactyly. She had been diagnosed with possible Hallerman-Streiff syndrome. Her evaluation showed that she was mosaic for uniparental isodisomy of chromosome 1, which harbored a pathogenic c.1077dupT variant in ZMPSTE24 which predicts p.(Leu362fsX18). ZMPSTE24 is a zinc metalloproteinase that is involved in processing farnesylated proteins and pathogenic ZMPSTE24 variants cause accumulation of abnormal farnesylated forms of prelamin A. This, in turn, causes a spectrum of disease severity which is based on enzyme activity. The current patient has an intermediate form, which is a genocopy of severe Progeria. © 2018 Wiley Periodicals, Inc.

Acute localized exanthem due to Coxsackievirus A4.

PubMed

Drago, Francesco; Ciccarese, Giulia; Gariazzo, Lodovica; Cioni, Margherita; Parodi, Aurora

2017-09-01

Enteroviruses are the leading cause of exanthems in children, especially during summer and autumn. Enterovirus infections may occur in epidemics or small outbreaks. A 30-year-old woman presented with a three-day history of an erythematous maculopapular skin rash with petechiae localized exclusively under the nipple of the right breast. The skin eruption was associated with an erythematous-petechial enanthem. The patient complained of low-grade fever, headache, asthenia, sore throat and arthromyalgias. IgM (1:128) and IgG (1:640) antibodies against Coxsackievirus A4 were detected by the virus neutralization test. Reverse transcriptase real time polymerase chain reaction (PCR) assay detected enterovirus RNA in the patient's plasma and faeces. Diagnosis of an acute localized exanthem due to Coxsachievirus A4 was performed. Skin lesions improved in seven days and completely cleared in two weeks without any systemic or topical treatment. Physicians should be aware of the possibility that enteroviruses may determine localized skin eruptions in addition to hand-foot-mouth disease and atypical exanthems. Viral infections should be considered in the differential diagnosis of localized dermatitis especially when the skin eruption is associated with enanthems and with systemic symptoms.

Medical Surveillance Monthly Report. Volume 19, Number 8

DTIC Science & Technology

2012-08-01

than bacteria, fungi, or parasites. Non-polio enteroviruses (members of the subgenera coxsackieviruses, echoviruses, and enteroviruses ) are the...many viral meningitis cases are unknown.2 Enteroviruses are spread through both fecal-oral and respiratory transmission. % e transmission of these...viruses is seasonal; a majority of cases are diagnosed during the summer months.3,4 Enteroviruses are common human viruses; infections with

Specific Retrograde Transduction of Spinal Motor Neurons Using Lentiviral Vectors Targeted to Presynaptic NMJ Receptors

PubMed Central

Eleftheriadou, I; Trabalza, A; Ellison, SM; Gharun, K; Mazarakis, ND

2014-01-01

To understand how receptors are involved in neuronal trafficking and to be able to utilize them for specific targeting via the peripheral route would be of great benefit. Here, we describe the generation of novel lentiviral vectors with tropism to motor neurons that were made by coexpressing onto the lentiviral surface a fusogenic glycoprotein (mutated sindbis G) and an antibody against a cell-surface receptor (Thy1.1, p75NTR, or coxsackievirus and adenovirus receptor) on the presynaptic terminal of the neuromuscular junction. These vectors exhibit binding specificity and efficient transduction of receptor positive cell lines and primary motor neurons in vitro. Targeting of each of these receptors conferred to these vectors the capability of being transported retrogradely from the axonal tip, leading to transduction of motor neurons in vitro in compartmented microfluidic cultures. In vivo delivery of coxsackievirus and adenovirus receptor-targeted vectors in leg muscles of mice resulted in predicted patterns of motor neuron labeling in lumbar spinal cord. This opens up the clinical potential of these vectors for minimally invasive administration of central nervous system-targeted therapeutics in motor neuron diseases. PMID:24670531

INACTIVATION OF HEPATITIS A VIRUS AND MODEL VIRUSES IN WATER BY FREE CHLORINE AND MONOCHLORAMINE

EPA Science Inventory

The kinetics and extent of inactivation of hepatitis A virus (HAV) as well as three other viruses, coxsackievirus B5 (CB5) and coliphages MS2 and X174, by 0.5 mg/l free chlorine, pH 6-10, and 10 mg/1 monochloramine, pH8, in 0.01 M phosphate buffer were determined. These results i...

Loci associated with skin pigmentation identified in African populations

PubMed Central

Crawford, Nicholas G.; Kelly, Derek E.; Hansen, Matthew E. B.; Beltrame, Marcia H.; Fan, Shaohua; Bowman, Shanna L.; Jewett, Ethan; Ranciaro, Alessia; Thompson, Simon; Lo, Yancy; Pfeifer, Susanne P.; Jensen, Jeffrey D.; Campbell, Michael C.; Beggs, William; Hormozdiari, Farhad; Mpoloka, Sununguko Wata; Mokone, Gaonyadiwe George; Nyambo, Thomas; Meskel, Dawit Wolde; Belay, Gurja; Haut, Jake; Rothschild, Harriet; Zon, Leonard; Zhou, Yi; Kovacs, Michael A.; Xu, Mai; Zhang, Tongwu; Bishop, Kevin; Sinclair, Jason; Rivas, Cecilia; Elliot, Eugene; Choi, Jiyeon; Li, Shengchao A.; Hicks, Belynda; Burgess, Shawn; Abnet, Christian; Watkins-Chow, Dawn E.; Oceana, Elena; Song, Yun S.; Eskin, Eleazar; Brown, Kevin M.; Marks, Michael S.; Loftus, Stacie K.; Pavan, William J.; Yeager, Meredith; Chanock, Stephen; Tishkoff, Sarah

2017-01-01

Despite the wide range of skin pigmentation in humans, little is known about its genetic basis in global populations. Examining ethnically diverse African genomes, we identify variants in or near SLC24A5, MFSD12, DDB1, TMEM138, OCA2 and HERC2 that are significantly associated with skin pigmentation. Genetic evidence indicates that the light pigmentation variant at SLC24A5 was introduced into East Africa by gene flow from non-Africans. At all other loci, variants associated with dark pigmentation in Africans are identical by descent in southern Asian and Australo-Melanesian populations. Functional analyses indicate that MFSD12 encodes a lysosomal protein that affects melanogenesis in zebrafish and mice, and that mutations in melanocyte-specific regulatory regions near DDB1/TMEM138 correlate with expression of UV response genes under selection in Eurasians. PMID:29025994

Rabies virus quasispecies: Implications for pathogenesis

PubMed Central

Morimoto, Kinjiro; Hooper, D. Craig; Carbaugh, Heather; Fu, Zhen Fang; Koprowski, Hilary; Dietzschold, Bernhard

1998-01-01

Passage of the mouse-adapted rabies virus strain CVS-24 (where CVS is challenge virus standard) in BHK cells results in the rapid selection of a dominant variant designated CVS-B2c that differs genotypically and phenotypically from the dominant variant CVS-N2c present in mouse-brain- or neuroblastoma-cell-passaged CVS-24. The glycoprotein of CVS-B2c has 10 amino acid substitutions compared with that of CVS-N2c. Because CVS-B2c can be reproducibly selected in BHK cells, it is likely to be a conserved minor subpopulation of CVS-24. CVS-N2c is more neurotropic in vitro and in vivo than CVS-B2c, which replicates more readily in nonneuronal cells in vitro and in vivo. These characteristics appear to be relevant to the pathogenicity of the two variants. CVS-N2c is more pathogenic for adult mice than CVS-B2c. In contrast, CVS-B2c is more pathogenic for neonatal mice. These differences in pathogenicity are reflected in the selection pattern when mixtures of CVS-N2c and CVS-B2c were used to infect neonatal and adult mice. Although CVS-N2c was highly selected in adult mice, no selection for either variant was seen in neonates, suggesting that certain aspects of development, such as maturation of the nervous and immune systems, may contribute to the selection process. We speculate that the existence of different variants within a rabies virus strain may facilitate the virus in overcoming barriers to its spread, both within the host and between species. PMID:9501231

Rabies virus quasispecies: implications for pathogenesis.

PubMed

Morimoto, K; Hooper, D C; Carbaugh, H; Fu, Z F; Koprowski, H; Dietzschold, B

1998-03-17

Passage of the mouse-adapted rabies virus strain CVS-24 (where CVS is challenge virus standard) in BHK cells results in the rapid selection of a dominant variant designated CVS-B2c that differs genotypically and phenotypically from the dominant variant CVS-N2c present in mouse-brain- or neuroblastoma-cell-passaged CVS-24. The glycoprotein of CVS-B2c has 10 amino acid substitutions compared with that of CVS-N2c. Because CVS-B2c can be reproducibly selected in BHK cells, it is likely to be a conserved minor subpopulation of CVS-24. CVS-N2c is more neurotropic in vitro and in vivo than CVS-B2c, which replicates more readily in nonneuronal cells in vitro and in vivo. These characteristics appear to be relevant to the pathogenicity of the two variants. CVS-N2c is more pathogenic for adult mice than CVS-B2c. In contrast, CVS-B2c is more pathogenic for neonatal mice. These differences in pathogenicity are reflected in the selection pattern when mixtures of CVS-N2c and CVS-B2c were used to infect neonatal and adult mice. Although CVS-N2c was highly selected in adult mice, no selection for either variant was seen in neonates, suggesting that certain aspects of development, such as maturation of the nervous and immune systems, may contribute to the selection process. We speculate that the existence of different variants within a rabies virus strain may facilitate the virus in overcoming barriers to its spread, both within the host and between species.

Antiviral potential of medicinal plants against HIV, HSV, influenza, hepatitis, and coxsackievirus: A systematic review.

PubMed

Akram, Muhammad; Tahir, Imtiaz Mahmood; Shah, Syed Muhammad Ali; Mahmood, Zahed; Altaf, Awais; Ahmad, Khalil; Munir, Naveed; Daniyal, Muhammad; Nasir, Suhaila; Mehboob, Huma

2018-05-01

Viral infections are being managed therapeutically through available antiviral regimens with unsatisfactory clinical outcomes. The refractory viral infections resistant to available antiviral drugs are alarming threats and a serious health concern. For viral hepatitis, the interferon and vaccine therapies solely are not ultimate solutions due to recurrence of hepatitis C virus. Owing to the growing incidences of viral infections and especially of resistant viral strains, the available therapeutic modalities need to be improved, complemented with the discovery of novel antiviral agents to combat refractory viral infections. It is widely accepted that medicinal plant heritage is nature gifted, precious, and fueled with the valuable resources for treatment of metabolic and infectious disorders. The aims of this review are to assemble the facts and to conclude the therapeutic potential of medicinal plants in the eradication and management of various viral diseases such as influenza, human immunodeficiency virus (HIV), herpes simplex virus (HSV), hepatitis, and coxsackievirus infections, which have been proven in diverse clinical studies. The articles, published in the English language since 1982 to 2017, were included from Web of Science, Cochrane Library, AMED, CISCOM, EMBASE, MEDLINE, Scopus, and PubMed by using relevant keywords including plants possessing antiviral activity, the antiviral effects of plants, and plants used in viral disorders. The scientific literature mainly focusing on plant extracts and herbal products with therapeutic efficacies against experimental models of influenza, HIV, HSV, hepatitis, and coxsackievirus were included in the study. Pure compounds possessing antiviral activity were excluded, and plants possessing activity against viruses other than viruses in inclusion criteria were excluded. Hundreds of plant extracts with antiviral effect were recognized. However, the data from only 36 families investigated through in vitro and in vivo studies met the inclusion criteria of this review. The inferences from scientific literature review, focusing on potential therapeutic consequences of medicinal plants on experimental models of HIV, HSV, influenza, hepatitis, and coxsackievirus have ascertained the curative antiviral potential of plants. Fifty-four medicinal plants belonging to 36 different families having antiviral potential were documented. Out of 54 plants, 27 individually belong to particular plant families. On the basis of the work of several independent research groups, the therapeutic potential of medicinal plants against listed common viral diseases in the region has been proclaimed. In this context, the herbal formulations as alternative medicine may contribute to the eradication of complicated viral infection significantly. The current review consolidates the data of the various medicinal plants, those are Sambucus nigra, Caesalpinia pulcherrima, and Hypericum connatum, holding promising specific antiviral activities scientifically proven through studies on experimental animal models. Consequently, the original research addressing the development of novel nutraceuticals based on listed medicinal plants is highly recommended for the management of viral disorders. Copyright © 2018 John Wiley & Sons, Ltd.

Association of the g.19074G>A genetic variant in the osteoprotegerin gene with bone mineral density in Chinese postmenopausal women.

PubMed

Zhang, Y D; Zhang, Z; Zhou, N F; Jia, W T; Cheng, X G; Wei, X J

2014-08-28

Primary osteoporosis is a common health problem in postmenopausal women. This study aimed to detect the association of the g.19074G>A genetic variant in the osteoprotegerin gene (OPG) with bone mineral density (BMD) and primary osteoporosis. The created restriction site-polymerase chain reaction method was used to investigate the g.19074G>A genetic variant. The BMD of the femoral neck hip, lumbar spine (L2-4), and total hip were assessed by dual-energy X-ray absorptiometry (DEXA) in 856 unrelated Chinese postmenopausal women. We found significant differences in the BMDs of the femoral neck hip, lumbar spine (L2-4), and total hip among different genotypes; individuals with the GG genotype had significantly higher BMDs than those with the GA and AA genotypes (P < 0.05). Our results indicated that the A allele was an increased risk factor for primary osteoporosis and the g.19074G>A genetic variant of the OPG gene was associated with BMD and primary osteoporosis in Chinese postmenopausal women.

Genomic analysis of coxsackieviruses A1, A19, A22, enteroviruses 113 and 104: viruses representing two clades with distinct tropism within enterovirus C

PubMed Central

Haq, Saddef; Sameroff, Stephen; Howie, Stephen R. C.; Lipkin, W. Ian

2013-01-01

Coxsackieviruses (CV) A1, CV-A19 and CV-A22 have historically comprised a distinct phylogenetic clade within Enterovirus (EV) C. Several novel serotypes that are genetically similar to these three viruses have been recently discovered and characterized. Here, we report the coding sequence analysis of two genotypes of a previously uncharacterized serotype EV-C113 from Bangladesh and demonstrate that it is most similar to CV-A22 and EV-C116 within the capsid region. We sequenced novel genotypes of CV-A1, CV-A19 and CV-A22 from Bangladesh and observed a high rate of recombination within this group. We also report genomic analysis of the rarely reported EV-C104 circulating in the Gambia in 2009. All available EV-C104 sequences displayed a high degree of similarity within the structural genes but formed two clusters within the non-structural genes. One cluster included the recently reported EV-C117, suggesting an ancestral recombination between these two serotypes. Phylogenetic analysis of all available complete genome sequences indicated the existence of two subgroups within this distinct Enterovirus C clade: one has been exclusively recovered from gastrointestinal samples, while the other cluster has been implicated in respiratory disease. PMID:23761409

Virus-like particle-based vaccine against coxsackievirus A6 protects mice against lethal infections.

PubMed

Shen, Chaoyun; Ku, Zhiqiang; Zhou, Yu; Li, Dapeng; Wang, Lili; Lan, Ke; Liu, Qingwei; Huang, Zhong

2016-07-25

Coxsackievirus A6 (CA6) is emerging as one of the major causative agents of hand, foot, and mouth disease (HFMD) worldwide. However, no vaccine is currently available for preventing CA6 infection. Here, we report the development of a virus-like particle (VLP)-based recombinant vaccine for CA6. We produced CA6 VLPs in insect cells by infecting the cells with a baculovirus coexpressing the genes encoding CA6 P1 and 3CD. Biochemical analyses showed that the produced VLPs consisted of VP0, VP1, and VP3 capsid subunit proteins generated by the cleavage of P1 by 3CD. Mice immunized with these VLPs produced CA6-specific serum antibodies. Passive transfer of antisera from CA6 VLP-immunized mice protected recipient mice from lethal infections caused by homologous and heterologous CA6 strains. Moreover, active immunization of mice with CA6 VLPs efficiently conferred protection against both homologous and heterologous CA6 infections. These results suggested that CA6 VLP-based recombinant vaccine is a promising candidate vaccine for preventing CA6 infection and can be incorporated into a multivalent HFMD vaccine formulation to achieve broad-spectrum and effective prevention of this disease. Copyright © 2016 Elsevier Ltd. All rights reserved.

Two variants of fat embolism syndrome evolving in a young patient with multiple fractures

PubMed Central

Bajuri, Mohd Yazid; Johan, Rudy Reza; Shukur, Hassan

2013-01-01

Fat embolism syndrome (FES) is a continuum of fat emboli. Variants of FES: acute fulminant form and classic FES are postulated to represent two different pathomechanisms. Acute fulminant FES occurs during the first 24 h. It is attributed to massive mechanical blockage pulmonary vasculature by the fat emboli. The classic FES typically has a latency period of 24–36 h manifestation of respiratory failure and other signs of fat embolism. Progression of asymptomatic fat embolism with FES frequently represents inadequate treatment of hypovolaemic shock. We present a rare case of two variants of FES evolving in a patient with multiple fractures to emphasis the importance of adequate and appropriate treatment of shock in preventing the development of FES. Since supportive therapy which is a ventilatory support remains as the treatment of FES, it is appropriate to treat FES in the intensive care unit setting. PMID:23576653

Two variants of fat embolism syndrome evolving in a young patient with multiple fractures.

PubMed

Bajuri, Mohd Yazid; Johan, Rudy Reza; Shukur, Hassan

2013-04-09

Fat embolism syndrome (FES) is a continuum of fat emboli. Variants of FES: acute fulminant form and classic FES are postulated to represent two different pathomechanisms. Acute fulminant FES occurs during the first 24 h. It is attributed to massive mechanical blockage pulmonary vasculature by the fat emboli. The classic FES typically has a latency period of 24-36 h manifestation of respiratory failure and other signs of fat embolism. Progression of asymptomatic fat embolism with FES frequently represents inadequate treatment of hypovolaemic shock. We present a rare case of two variants of FES evolving in a patient with multiple fractures to emphasis the importance of adequate and appropriate treatment of shock in preventing the development of FES. Since supportive therapy which is a ventilatory support remains as the treatment of FES, it is appropriate to treat FES in the intensive care unit setting.

Recent Progress in Understanding Coxsackievirus Replication, Dissemination, and Pathogenesis

PubMed Central

Sin, Jon; Mangale, Vrushali; Thienphrapa, Wdee; Gottlieb, Roberta A.; Feuer, Ralph

2015-01-01

Coxsackieviruses (CVs) are relatively common viruses associated with a number of serious human diseases, including myocarditis and meningo-encephalitis. These viruses are considered cytolytic yet can persist for extended periods of time within certain host tissues requiring evasion from the host immune response and a greatly reduced rate of replication. A member of Picornaviridae family, CVs have been historically considered non-enveloped viruses – although recent evidence suggest that CV and other picornaviruses hijack host membranes and acquire an envelope. Acquisition of an envelope might provide distinct benefits to CV virions, such as resistance to neutralizing antibodies and efficient nonlytic viral spread. CV exhibits a unique tropism for progenitor cells in the host which may help to explain the susceptibility of the young host to infection and the establishment of chronic disease in adults. CVs have also been shown to exploit autophagy to maximize viral replication and assist in unconventional release from target cells. In this article, we review recent progress in clarifying virus replication and dissemination within the host cell, identifying determinants of tropism, and defining strategies utilized by the virus to evade the host immune response. Also, we will highlight unanswered questions and provide future perspectives regarding the potential mechanisms of CV pathogenesis. PMID:26142496

Disoxaril mutants of Coxsackievirus B1: phenotypic characteristics and analysis of the target VP1 gene.

PubMed

Nikolova, Ivanka; Galabov, Angel S; Petkova, Rumena; Chakarov, Stoyan; Atanasov, Boris

2011-01-01

Disoxaril inhibits enterovirus replication by binding to the hydrophobic pocket within the VP1 coat protein, thus stabilizing the virion and blocking its uncoating. Disoxaril-resistant (RES) mutants of the Coxsackievirus B1 (CVB1/RES) were derived from the wild disoxaril-sensitive (SOF) strain (CVB1/SOF) using a selection approach. A disoxaril-dependent (DEP) mutant (CVB1/DEP) was obtained following nine consecutive passages of the disoxaril-resistant mutant in the presence of disoxaril. Phenotypic characteristics of the disoxaril mutants were investigated. A timing-of-addition study of the CVB1/DEP replication demonstrated that in the absence of disoxaril the virus particle assembly stopped. VP1 RNA sequences of disoxaril mutants were compared with the existing Gen Bank CVB1 reference structure. The amino acid sequence of a large VP1 196-258 peptide (disoxaril-binding region) of CVB1/RES was significantly different from that of the CVB1/SOF. Crucially important changes in CVB1/RES were two point mutations, M213H and F237L, both in the ligand-binding pocket. The sequence analysis of the CVB1/DEP showed some reversion to CVB1/SOF. The amino acid sequences of the three VP1 proteins are presented.

The Coxsackievirus and Adenovirus Receptor: a new adhesion protein in cochlear development.

PubMed

Excoffon, Katherine J D A; Avenarius, Matthew R; Hansen, Marlan R; Kimberling, William J; Najmabadi, Hossein; Smith, Richard J H; Zabner, Joseph

2006-05-01

The Coxsackievirus and Adenovirus Receptor (CAR) is an essential regulator of cell growth and adhesion during development. The gene for CAR, CXADR, is located within the genomic locus for Usher syndrome type 1E (USH1E). Based on this and a physical interaction with harmonin, the protein responsible for USH1C, we hypothesized that CAR may be involved in cochlear development and that mutations in CXADR may be responsible for USH1E. The expression of CAR in the cochlea was determined by PCR and immunofluorescence microscopy. We found that CAR expression is highly regulated during development. In neonatal mice, CAR is localized to the junctions of most cochlear cell types but is restricted to the supporting and strial cells in adult cochlea. A screen of two populations consisting of non-syndromic deaf and Usher 1 patients for mutations in CXADR revealed one haploid mutation (P356S). Cell surface expression, viral receptor activity, and localization of the mutant form of CAR were indistinguishable from wild-type CAR. Although we were unable to confirm a role for CAR in autosomal recessive, non-syndromic deafness, or Usher syndrome type 1, based on its regulation, localization, and molecular interactions, CAR remains an attractive candidate for genetic deafness.

Rare RNF213 variants in the C-terminal region encompassing the RING-finger domain are associated with moyamoya angiopathy in Caucasians.

PubMed

Guey, Stéphanie; Kraemer, Markus; Hervé, Dominique; Ludwig, Thomas; Kossorotoff, Manoëlle; Bergametti, Françoise; Schwitalla, Jan Claudius; Choi, Simone; Broseus, Lucile; Callebaut, Isabelle; Genin, Emmanuelle; Tournier-Lasserve, Elisabeth

2017-08-01

Moyamoya angiopathy (MMA) is a cerebral angiopathy affecting the terminal part of internal carotid arteries. Its prevalence is 10 times higher in Japan and Korea than in Europe. In East Asian countries, moyamoya is strongly associated to the R4810K variant in the RNF213 gene that encodes for a protein containing a RING-finger and two AAA+ domains. This variant has never been detected in Caucasian MMA patients, but several rare RNF213 variants have been reported in Caucasian cases. Using a collapsing test based on exome data from 68 European MMA probands and 573 ethnically matched controls, we showed a significant association between rare missense RNF213 variants and MMA in European patients (odds ratio (OR)=2.24, 95% confidence interval (CI)=(1.19-4.11), P=0.01). Variants specific to cases had higher pathogenicity predictive scores (median of 24.2 in cases versus 9.4 in controls, P=0.029) and preferentially clustered in a C-terminal hotspot encompassing the RING-finger domain of RNF213 (P<10 -3 ). This association was even stronger when restricting the analysis to childhood-onset and familial cases (OR=4.54, 95% CI=(1.80-11.34), P=1.1 × 10 -3 ). All clinically affected relatives who were genotyped were carriers. However, the need for additional factors to develop MMA is strongly suggested by the fact that only 25% of mutation carrier relatives were clinically affected.

HABP2 p.G534E variant in patients with family history of thyroid and breast cancer

PubMed Central

Pinheiro, Maisa; Drigo, Sandra Aparecida; Tonhosolo, Renata; Andrade, Sonia C.S.; Marchi, Fabio Albuquerque; Jurisica, Igor; Kowalski, Luiz Paulo; Achatz, Maria Isabel; Rogatto, Silvia Regina

2017-01-01

Familial Papillary Thyroid Carcinoma (PTC) has been described as a hereditary predisposition cancer syndrome associated with mutations in candidate genes including HABP2. Two of 20 probands from families with history of PTC and breast carcinoma (BC) were evaluated by whole exome sequencing (WES) revealing HABP2 p.G534E. Sanger sequencing was used to confirm the involvement of this variant in three families (F1: 7 relatives; F2: 3 and F3: 3). The proband and his sister (with no malignant tumor so far) from F1 were homozygous for the variant whereas one relative with PTC from F2 was negative for the variant. Although the proband of the F3 with PTC was HABP2 wild type, three relatives presented the variant. Five of 170 healthy Brazilian individuals with no family history of BC or PTC and three of 50 sporadic PTC presented the p.G534E. These findings suggested no association of this variant with our familial PTC cases. Genes potentially associated with deregulation of the extracellular matrix organization pathway (CTSB, TNXB, COL4A3, COL16A1, COL24A1, COL5A2, NID1, LOXL2, MMP11, TRIM24 and MUSK) and DNA repair function (NBN and MSH2) were detected by WES, suggesting that other cancer-associated genes have pathogenic effects in the risk of familial PTC development. PMID:28402931

Negligible impact of rare autoimmune-locus coding-region variants on missing heritability.

PubMed

Hunt, Karen A; Mistry, Vanisha; Bockett, Nicholas A; Ahmad, Tariq; Ban, Maria; Barker, Jonathan N; Barrett, Jeffrey C; Blackburn, Hannah; Brand, Oliver; Burren, Oliver; Capon, Francesca; Compston, Alastair; Gough, Stephen C L; Jostins, Luke; Kong, Yong; Lee, James C; Lek, Monkol; MacArthur, Daniel G; Mansfield, John C; Mathew, Christopher G; Mein, Charles A; Mirza, Muddassar; Nutland, Sarah; Onengut-Gumuscu, Suna; Papouli, Efterpi; Parkes, Miles; Rich, Stephen S; Sawcer, Steven; Satsangi, Jack; Simmonds, Matthew J; Trembath, Richard C; Walker, Neil M; Wozniak, Eva; Todd, John A; Simpson, Michael A; Plagnol, Vincent; van Heel, David A

2013-06-13

Genome-wide association studies (GWAS) have identified common variants of modest-effect size at hundreds of loci for common autoimmune diseases; however, a substantial fraction of heritability remains unexplained, to which rare variants may contribute. To discover rare variants and test them for association with a phenotype, most studies re-sequence a small initial sample size and then genotype the discovered variants in a larger sample set. This approach fails to analyse a large fraction of the rare variants present in the entire sample set. Here we perform simultaneous amplicon-sequencing-based variant discovery and genotyping for coding exons of 25 GWAS risk genes in 41,911 UK residents of white European origin, comprising 24,892 subjects with six autoimmune disease phenotypes and 17,019 controls, and show that rare coding-region variants at known loci have a negligible role in common autoimmune disease susceptibility. These results do not support the rare-variant synthetic genome-wide-association hypothesis (in which unobserved rare causal variants lead to association detected at common tag variants). Many known autoimmune disease risk loci contain multiple, independently associated, common and low-frequency variants, and so genes at these loci are a priori stronger candidates for harbouring rare coding-region variants than other genes. Our data indicate that the missing heritability for common autoimmune diseases may not be attributable to the rare coding-region variant portion of the allelic spectrum, but perhaps, as others have proposed, may be a result of many common-variant loci of weak effect.

Fine-Mapping of Common Genetic Variants Associated with Colorectal Tumor Risk Identified Potential Functional Variants

PubMed Central

Gala, Manish; Abecasis, Goncalo; Bezieau, Stephane; Brenner, Hermann; Butterbach, Katja; Caan, Bette J.; Carlson, Christopher S.; Casey, Graham; Chang-Claude, Jenny; Conti, David V.; Curtis, Keith R.; Duggan, David; Gallinger, Steven; Haile, Robert W.; Harrison, Tabitha A.; Hayes, Richard B.; Hoffmeister, Michael; Hopper, John L.; Hudson, Thomas J.; Jenkins, Mark A.; Küry, Sébastien; Le Marchand, Loic; Leal, Suzanne M.; Newcomb, Polly A.; Nickerson, Deborah A.; Potter, John D.; Schoen, Robert E.; Schumacher, Fredrick R.; Seminara, Daniela; Slattery, Martha L.; Hsu, Li; Chan, Andrew T.; White, Emily; Berndt, Sonja I.; Peters, Ulrike

2016-01-01

Genome-wide association studies (GWAS) have identified many common single nucleotide polymorphisms (SNPs) associated with colorectal cancer risk. These SNPs may tag correlated variants with biological importance. Fine-mapping around GWAS loci can facilitate detection of functional candidates and additional independent risk variants. We analyzed 11,900 cases and 14,311 controls in the Genetics and Epidemiology of Colorectal Cancer Consortium and the Colon Cancer Family Registry. To fine-map genomic regions containing all known common risk variants, we imputed high-density genetic data from the 1000 Genomes Project. We tested single-variant associations with colorectal tumor risk for all variants spanning genomic regions 250-kb upstream or downstream of 31 GWAS-identified SNPs (index SNPs). We queried the University of California, Santa Cruz Genome Browser to examine evidence for biological function. Index SNPs did not show the strongest association signals with colorectal tumor risk in their respective genomic regions. Bioinformatics analysis of SNPs showing smaller P-values in each region revealed 21 functional candidates in 12 loci (5q31.1, 8q24, 11q13.4, 11q23, 12p13.32, 12q24.21, 14q22.2, 15q13, 18q21, 19q13.1, 20p12.3, and 20q13.33). We did not observe evidence of additional independent association signals in GWAS-identified regions. Our results support the utility of integrating data from comprehensive fine-mapping with expanding publicly available genomic databases to help clarify GWAS associations and identify functional candidates that warrant more onerous laboratory follow-up. Such efforts may aid the eventual discovery of disease-causing variant(s). PMID:27379672

Evaluation of NFKB1A variants in patients with knee osteoarthritis.

PubMed

Hulin-Curtis, S L; Sharif, M; Bidwell, J L; Perry, M J

2013-08-01

A key feature of osteoarthritis (OA) is articular cartilage loss mediated by numerous catabolic factors including pro-inflammatory cytokines. Cytokine expression is modulated by the nuclear factor κB (NF-κB) family of transcription factors that are in turn, regulated by the inhibitor of NF-κB IκBα encoded by NFKB1A. We examined eight, previously reported common germline polymorphisms to determine whether NFKB1A variants are associated with knee OA. Eight common single-nucleotide polymorphisms (SNPs) across the NFKB1A gene were genotyped in 189 cases with knee OA and 197 healthy controls. Allele, genotype and haplotype frequencies were compared between case and control groups and stratified according to gender due to the increased prevalence of female OA. Serum concentrations of four biochemical markers elevated in OA were compared with genotype for each knee OA case. None of the SNPs showed an association with knee OA; however, stratification of the data for gender showed an increased frequency of the rs8904 variant allele in the female knee OA case group (P = 0.02). Six common haplotypes were identified (H1-H6). H6 was marginally more prevalent in the knee OA group (P = 0.05). The rs8904 variant was associated with increased levels of hyaluronan (HA), a marker of synovial inflammation at 12 and 24 months compared to baseline levels. The nearby rs696 variant demonstrated increased levels of C-reactive protein (CRP) at 12 months and HA at 12 and 24 months. A reduction in CRP levels at 12 months was observed for the rs2233419 variant. These findings provide evidence for the association of NFKB1A variants and knee OA. © 2012 John Wiley & Sons Ltd.

Coxsackievirus B4 Can Infect Human Peripheral Blood-Derived Macrophages

PubMed Central

Alidjinou, Enagnon Kazali; Sané, Famara; Trauet, Jacques; Copin, Marie-Christine; Hober, Didier

2015-01-01

Beyond acute infections, group B coxsackieviruses (CVB) are also reported to play a role in the development of chronic diseases, like type 1 diabetes. The viral pathogenesis mainly relies on the interplay between the viruses and innate immune response in genetically-susceptible individuals. We investigated the interaction between CVB4 and macrophages considered as major players in immune response. Monocyte-derived macrophages (MDM) generated with either M-CSF or GM-CSF were inoculated with CVB4, and infection, inflammation, viral replication and persistence were assessed. M-CSF-induced MDM, but not GM-CSF-induced MDM, can be infected by CVB4. In addition, enhancing serum was not needed to infect MDM in contrast with parental monocytes. The expression of viral receptor (CAR) mRNA was similar in both M-CSF and GM-CSF MDM. CVB4 induced high levels of pro-inflammatory cytokines (IL-6 and TNFα) in both MDM populations. CVB4 effectively replicated and persisted in M-CSF MDM, but IFNα was produced in the early phase of infection only. Our results demonstrate that CVB4 can replicate and persist in MDM. Further investigations are required to determine whether the interaction between the virus and MDM plays a role in the pathogenesis of CVB-induced chronic diseases. PMID:26610550

Coxsackievirus B4 Can Infect Human Peripheral Blood-Derived Macrophages.

PubMed

Alidjinou, Enagnon Kazali; Sané, Famara; Trauet, Jacques; Copin, Marie-Christine; Hober, Didier

2015-11-24

Beyond acute infections, group B coxsackieviruses (CVB) are also reported to play a role in the development of chronic diseases, like type 1 diabetes. The viral pathogenesis mainly relies on the interplay between the viruses and innate immune response in genetically-susceptible individuals. We investigated the interaction between CVB4 and macrophages considered as major players in immune response. Monocyte-derived macrophages (MDM) generated with either M-CSF or GM-CSF were inoculated with CVB4, and infection, inflammation, viral replication and persistence were assessed. M-CSF-induced MDM, but not GM-CSF-induced MDM, can be infected by CVB4. In addition, enhancing serum was not needed to infect MDM in contrast with parental monocytes. The expression of viral receptor (CAR) mRNA was similar in both M-CSF and GM-CSF MDM. CVB4 induced high levels of pro-inflammatory cytokines (IL-6 and TNFα) in both MDM populations. CVB4 effectively replicated and persisted in M-CSF MDM, but IFNα was produced in the early phase of infection only. Our results demonstrate that CVB4 can replicate and persist in MDM. Further investigations are required to determine whether the interaction between the virus and MDM plays a role in the pathogenesis of CVB-induced chronic diseases.

A variant of PSMD6 is associated with the therapeutic efficacy of oral antidiabetic drugs in Chinese type 2 diabetes patients.

PubMed

Chen, Miao; Hu, Cheng; Zhang, Rong; Jiang, Feng; Wang, Jie; Peng, Danfeng; Tang, Shanshan; Sun, Xue; Yan, Jing; Wang, Shiyun; Wang, Tao; Bao, Yuqian; Jia, Weiping

2015-05-29

The PSMD6 variant rs831571 has been identified as a susceptibility locus for type 2 diabetes mellitus (T2DM). This study aimed to investigate the association of this variant with therapeutic effects of oral antidiabetic drugs in Chinese T2DM patients. 209 newly diagnosed T2DM patients were randomly assigned to treatment with repaglinide or rosiglitazone for 48 weeks, and the therapeutic effects were compared. In the rosiglitazone cohort, rs831571 showed significant associations with fasting plasma glucose (FPG), 2-h glucose and decrement of glycated haemoglobin (HbA1c) levels after 24 weeks of treatment (P = 0.0368, 0.0468 and 0.0247, respectively). The C allele was significantly associated with a better attainment of FPG at 24 and 32 weeks (P = 0.0172 and 0.0257, respectively). Survival analyses showed CC homozygotes were more likely to attain a standard FPG level (P = 0.0654). In the repaglinide cohort, rs831571 was significantly associated with decreased HbA1c levels after 24 weeks of treatment, the homeostatic model assessment of insulin resistance and fasting insulin level after 48 weeks of treatment with repaglinide (P = 0.0096, 0235 and 0.0212, respectively). In conclusion, we observed that the PSMD6 variant rs831571 might be associated with the therapeutic effects of rosiglitazone and repaglinide in Chinese T2DM patients. However, these findings need to be confirmed in the future.

A variant of PSMD6 is associated with the therapeutic efficacy of oral antidiabetic drugs in Chinese type 2 diabetes patients

PubMed Central

Chen, Miao; Hu, Cheng; Zhang, Rong; Jiang, Feng; Wang, Jie; Peng, Danfeng; Tang, Shanshan; Sun, Xue; Yan, Jing; Wang, Shiyun; Wang, Tao; Bao, Yuqian; Jia, Weiping

2015-01-01

The PSMD6 variant rs831571 has been identified as a susceptibility locus for type 2 diabetes mellitus (T2DM). This study aimed to investigate the association of this variant with therapeutic effects of oral antidiabetic drugs in Chinese T2DM patients. 209 newly diagnosed T2DM patients were randomly assigned to treatment with repaglinide or rosiglitazone for 48 weeks, and the therapeutic effects were compared. In the rosiglitazone cohort, rs831571 showed significant associations with fasting plasma glucose (FPG), 2-h glucose and decrement of glycated haemoglobin (HbA1c) levels after 24 weeks of treatment (P = 0.0368, 0.0468 and 0.0247, respectively). The C allele was significantly associated with a better attainment of FPG at 24 and 32 weeks (P = 0.0172 and 0.0257, respectively). Survival analyses showed CC homozygotes were more likely to attain a standard FPG level (P = 0.0654). In the repaglinide cohort, rs831571 was significantly associated with decreased HbA1c levels after 24 weeks of treatment, the homeostatic model assessment of insulin resistance and fasting insulin level after 48 weeks of treatment with repaglinide (P = 0.0096, 0235 and 0.0212, respectively). In conclusion, we observed that the PSMD6 variant rs831571 might be associated with the therapeutic effects of rosiglitazone and repaglinide in Chinese T2DM patients. However, these findings need to be confirmed in the future. PMID:26024304

Genetic association study of exfoliation syndrome identifies a protective rare variant at LOXL1 and five new susceptibility loci.

PubMed

Aung, Tin; Ozaki, Mineo; Lee, Mei Chin; Schlötzer-Schrehardt, Ursula; Thorleifsson, Gudmar; Mizoguchi, Takanori; Igo, Robert P; Haripriya, Aravind; Williams, Susan E; Astakhov, Yury S; Orr, Andrew C; Burdon, Kathryn P; Nakano, Satoko; Mori, Kazuhiko; Abu-Amero, Khaled; Hauser, Michael; Li, Zheng; Prakadeeswari, Gopalakrishnan; Bailey, Jessica N Cooke; Cherecheanu, Alina Popa; Kang, Jae H; Nelson, Sarah; Hayashi, Ken; Manabe, Shin-Ichi; Kazama, Shigeyasu; Zarnowski, Tomasz; Inoue, Kenji; Irkec, Murat; Coca-Prados, Miguel; Sugiyama, Kazuhisa; Järvelä, Irma; Schlottmann, Patricio; Lerner, S Fabian; Lamari, Hasnaa; Nilgün, Yildirim; Bikbov, Mukharram; Park, Ki Ho; Cha, Soon Cheol; Yamashiro, Kenji; Zenteno, Juan C; Jonas, Jost B; Kumar, Rajesh S; Perera, Shamira A; Chan, Anita S Y; Kobakhidze, Nino; George, Ronnie; Vijaya, Lingam; Do, Tan; Edward, Deepak P; de Juan Marcos, Lourdes; Pakravan, Mohammad; Moghimi, Sasan; Ideta, Ryuichi; Bach-Holm, Daniella; Kappelgaard, Per; Wirostko, Barbara; Thomas, Samuel; Gaston, Daniel; Bedard, Karen; Greer, Wenda L; Yang, Zhenglin; Chen, Xueyi; Huang, Lulin; Sang, Jinghong; Jia, Hongyan; Jia, Liyun; Qiao, Chunyan; Zhang, Hui; Liu, Xuyang; Zhao, Bowen; Wang, Ya-Xing; Xu, Liang; Leruez, Stéphanie; Reynier, Pascal; Chichua, George; Tabagari, Sergo; Uebe, Steffen; Zenkel, Matthias; Berner, Daniel; Mossböck, Georg; Weisschuh, Nicole; Hoja, Ursula; Welge-Luessen, Ulrich-Christoph; Mardin, Christian; Founti, Panayiota; Chatzikyriakidou, Anthi; Pappas, Theofanis; Anastasopoulos, Eleftherios; Lambropoulos, Alexandros; Ghosh, Arkasubhra; Shetty, Rohit; Porporato, Natalia; Saravanan, Vijayan; Venkatesh, Rengaraj; Shivkumar, Chandrashekaran; Kalpana, Narendran; Sarangapani, Sripriya; Kanavi, Mozhgan R; Beni, Afsaneh Naderi; Yazdani, Shahin; Lashay, Alireza; Naderifar, Homa; Khatibi, Nassim; Fea, Antonio; Lavia, Carlo; Dallorto, Laura; Rolle, Teresa; Frezzotti, Paolo; Paoli, Daniela; Salvi, Erika; Manunta, Paolo; Mori, Yosai; Miyata, Kazunori; Higashide, Tomomi; Chihara, Etsuo; Ishiko, Satoshi; Yoshida, Akitoshi; Yanagi, Masahide; Kiuchi, Yoshiaki; Ohashi, Tsutomu; Sakurai, Toshiya; Sugimoto, Takako; Chuman, Hideki; Aihara, Makoto; Inatani, Masaru; Miyake, Masahiro; Gotoh, Norimoto; Matsuda, Fumihiko; Yoshimura, Nagahisa; Ikeda, Yoko; Ueno, Morio; Sotozono, Chie; Jeoung, Jin Wook; Sagong, Min; Park, Kyu Hyung; Ahn, Jeeyun; Cruz-Aguilar, Marisa; Ezzouhairi, Sidi M; Rafei, Abderrahman; Chong, Yaan Fun; Ng, Xiao Yu; Goh, Shuang Ru; Chen, Yueming; Yong, Victor H K; Khan, Muhammad Imran; Olawoye, Olusola O; Ashaye, Adeyinka O; Ugbede, Idakwo; Onakoya, Adeola; Kizor-Akaraiwe, Nkiru; Teekhasaenee, Chaiwat; Suwan, Yanin; Supakontanasan, Wasu; Okeke, Suhanya; Uche, Nkechi J; Asimadu, Ifeoma; Ayub, Humaira; Akhtar, Farah; Kosior-Jarecka, Ewa; Lukasik, Urszula; Lischinsky, Ignacio; Castro, Vania; Grossmann, Rodolfo Perez; Sunaric Megevand, Gordana; Roy, Sylvain; Dervan, Edward; Silke, Eoin; Rao, Aparna; Sahay, Priti; Fornero, Pablo; Cuello, Osvaldo; Sivori, Delia; Zompa, Tamara; Mills, Richard A; Souzeau, Emmanuelle; Mitchell, Paul; Wang, Jie Jin; Hewitt, Alex W; Coote, Michael; Crowston, Jonathan G; Astakhov, Sergei Y; Akopov, Eugeny L; Emelyanov, Anton; Vysochinskaya, Vera; Kazakbaeva, Gyulli; Fayzrakhmanov, Rinat; Al-Obeidan, Saleh A; Owaidhah, Ohoud; Aljasim, Leyla Ali; Chowbay, Balram; Foo, Jia Nee; Soh, Raphael Q; Sim, Kar Seng; Xie, Zhicheng; Cheong, Augustine W O; Mok, Shi Qi; Soo, Hui Meng; Chen, Xiao Yin; Peh, Su Qin; Heng, Khai Koon; Husain, Rahat; Ho, Su-Ling; Hillmer, Axel M; Cheng, Ching-Yu; Escudero-Domínguez, Francisco A; González-Sarmiento, Rogelio; Martinon-Torres, Frederico; Salas, Antonio; Pathanapitoon, Kessara; Hansapinyo, Linda; Wanichwecharugruang, Boonsong; Kitnarong, Naris; Sakuntabhai, Anavaj; Nguyn, Hip X; Nguyn, Giang T T; Nguyn, Trình V; Zenz, Werner; Binder, Alexander; Klobassa, Daniela S; Hibberd, Martin L; Davila, Sonia; Herms, Stefan; Nöthen, Markus M; Moebus, Susanne; Rautenbach, Robyn M; Ziskind, Ari; Carmichael, Trevor R; Ramsay, Michele; Álvarez, Lydia; García, Montserrat; González-Iglesias, Héctor; Rodríguez-Calvo, Pedro P; Fernández-Vega Cueto, Luis; Oguz, Çilingir; Tamcelik, Nevbahar; Atalay, Eray; Batu, Bilge; Aktas, Dilek; Kasım, Burcu; Wilson, M Roy; Coleman, Anne L; Liu, Yutao; Challa, Pratap; Herndon, Leon; Kuchtey, Rachel W; Kuchtey, John; Curtin, Karen; Chaya, Craig J; Crandall, Alan; Zangwill, Linda M; Wong, Tien Yin; Nakano, Masakazu; Kinoshita, Shigeru; den Hollander, Anneke I; Vesti, Eija; Fingert, John H; Lee, Richard K; Sit, Arthur J; Shingleton, Bradford J; Wang, Ningli; Cusi, Daniele; Qamar, Raheel; Kraft, Peter; Pericak-Vance, Margaret A; Raychaudhuri, Soumya; Heegaard, Steffen; Kivelä, Tero; Reis, André; Kruse, Friedrich E; Weinreb, Robert N; Pasquale, Louis R; Haines, Jonathan L; Thorsteinsdottir, Unnur; Jonasson, Fridbert; Allingham, R Rand; Milea, Dan; Ritch, Robert; Kubota, Toshiaki; Tashiro, Kei; Vithana, Eranga N; Micheal, Shazia; Topouzis, Fotis; Craig, Jamie E; Dubina, Michael; Sundaresan, Periasamy; Stefansson, Kari; Wiggs, Janey L; Pasutto, Francesca; Khor, Chiea Chuen

2017-07-01

Exfoliation syndrome (XFS) is the most common known risk factor for secondary glaucoma and a major cause of blindness worldwide. Variants in two genes, LOXL1 and CACNA1A, have previously been associated with XFS. To further elucidate the genetic basis of XFS, we collected a global sample of XFS cases to refine the association at LOXL1, which previously showed inconsistent results across populations, and to identify new variants associated with XFS. We identified a rare protective allele at LOXL1 (p.Phe407, odds ratio (OR) = 25, P = 2.9 × 10 -14 ) through deep resequencing of XFS cases and controls from nine countries. A genome-wide association study (GWAS) of XFS cases and controls from 24 countries followed by replication in 18 countries identified seven genome-wide significant loci (P < 5 × 10 -8 ). We identified association signals at 13q12 (POMP), 11q23.3 (TMEM136), 6p21 (AGPAT1), 3p24 (RBMS3) and 5q23 (near SEMA6A). These findings provide biological insights into the pathology of XFS and highlight a potential role for naturally occurring rare LOXL1 variants in disease biology.

Spatial distributions of Pseudomonas fluorescens colony variants in mixed-culture biofilms.

PubMed

Workentine, Matthew L; Wang, Siyuan; Ceri, Howard; Turner, Raymond J

2013-07-28

The emergence of colony morphology variants in structured environments is being recognized as important to both niche specialization and stress tolerance. Pseudomonas fluorescens demonstrates diversity in both its natural environment, the rhizosphere, and in laboratory grown biofilms. Sub-populations of these variants within a biofilm have been suggested as important contributors to antimicrobial stress tolerance given their altered susceptibility to various agents. As such it is of interest to determine how these variants might be distributed in the biofilm environment. Here we present an analysis of the spatial distribution of Pseudomonas fluorescens colony morphology variants in mixed-culture biofilms with the wildtype phenotype. These findings reveal that two variant colony morphotypes demonstrate a significant growth advantage over the wildtype morphotype in the biofilm environment. The two variant morphotypes out-grew the wildtype across the entire biofilm and this occurred within 24 h and was maintained through to 96 h. This competitive advantage was not observed in homogeneous broth culture. The significant advantage that the variants demonstrate in biofilm colonization over the wildtype denotes the importance of this phenotype in structured environments.

Characterization of the colorectal cancer-associated enhancer MYC-335 at 8q24: the role of rs67491583.

PubMed

Tuupanen, Sari; Yan, Jian; Turunen, Mikko; Gylfe, Alexandra E; Kaasinen, Eevi; Li, Li; Eng, Charis; Culver, Daniel A; Kalady, Matthew F; Pennison, Michael J; Pasche, Boris; Manne, Upender; de la Chapelle, Albert; Hampel, Heather; Henderson, Brian E; Marchand, Loic Le; Hautaniemi, Sampsa; Askhtorab, Hassan; Smoot, Duane; Sandler, Robert S; Keku, Temitope; Kupfer, Sonia S; Ellis, Nathan A; Haiman, Christopher A; Taipale, Jussi; Aaltonen, Lauri A

2012-01-01

Recent genome-wide association studies have identified multiple regions at 8q24 that confer susceptibility to many cancers. In our previous work, we showed that the colorectal cancer (CRC) risk variant rs6983267 at 8q24 resides within a TCF4 binding site at the MYC-335 enhancer, with the risk allele G having a stronger binding capacity and Wnt responsiveness. Here, we searched for other potential functional variants within MYC-335. Genetic variation within MYC-335 was determined in samples from individuals of European, African, and Asian descent, with emphasis on variants in putative transcription factor binding sites. A 2-bp GA deletion rs67491583 was found to affect a growth factor independent (GFI) binding site and was present only in individuals with African ancestry. Chromatin immunoprecipitation performed in heterozygous cells showed that the GA deletion had an ability to reduce binding of the transcriptional repressors GFI1 and GFI1b. Screening of 1,027 African American colorectal cancer cases and 1,773 healthy controls did not reveal evidence for association (odds ratio: 1.17, 95% confidence interval: 0.97-1.41, P = 0.095). In this study, rs67491583 was identified as another functional variant in the CRC-associated enhancer MYC-335, but further studies are needed to establish the role of rs67491583 in the colorectal cancer predisposition of African Americans. Copyright © 2012 Elsevier Inc. All rights reserved.

Variations in cerebrospinal fluid viral loads among enterovirus genotypes in patients hospitalized with laboratory-confirmed meningitis due to enterovirus.

PubMed

Volle, Romain; Bailly, Jean-Luc; Mirand, Audrey; Pereira, Bruno; Marque-Juillet, Stéphanie; Chambon, Martine; Regagnon, Christel; Brebion, Amélie; Henquell, Cécile; Peigue-Lafeuille, Hélène; Archimbaud, Christine

2014-08-15

Acute enterovirus (EV) meningitis is a major cause of hospitalization among adults and children. It is caused by multiple EV genotypes assigned to 4 species (EV-A, EV-B, EV-C, and EV-D). We determined viral loads in the cerebrospinal fluid (CSF) of 156 patients of all ages with EV meningitis during a 5-year observational prospective study. The virus strains were genotyped, and their time origin was determined with Bayesian phylogenetic methods. The CSF viral loads ranged between 3.4 and 7.5 log10 copies/mL (median, 4.9 log10 copies/mL). They were higher in neonates than in infants and children (P = .02) but were comparable in adults. Viral loads were associated with EV genotypes (P < .001). The EV strains were identified in 152 of 156 patients and assigned to 23 genotypes within the EV-A and EV-B species. The most frequent genotypes, echoviruses 6 and 30, were associated with different viral loads (P < .001). The highest viral loads were in meningitis cases caused by coxsackievirus A9, B4, and B5 genotypes. Most patients infected by a same genotype were infected by a major virus variant of recent emergence. The variations in CSF viral loads in patients at the onset of EV meningitis are related to genotypic differences in the virus strains involved. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Two Variants in SLC24A5 Are Associated with “Tiger-Eye” Iris Pigmentation in Puerto Rican Paso Fino Horses

PubMed Central

Mack, Maura; Kowalski, Elizabeth; Grahn, Robert; Bras, Dineli; Penedo, Maria Cecilia T.; Bellone, Rebecca

2017-01-01

A unique eye color, called tiger-eye, segregates in the Puerto Rican Paso Fino (PRPF) horse breed and is characterized by a bright yellow, amber, or orange iris. Pedigree analysis identified a simple autosomal recessive mode of inheritance for this trait. A genome-wide association study (GWAS) with 24 individuals identified a locus on ECA 1 reaching genome-wide significance (Pcorrected = 1.32 × 10−5). This ECA1 locus harbors the candidate gene, Solute Carrier Family 24 (Sodium/Potassium/Calcium Exchanger), Member 5 (SLC24A5), with known roles in pigmentation in humans, mice, and zebrafish. Humans with compound heterozygous mutations in SLC24A5 have oculocutaneous albinism (OCA) type 6 (OCA6), which is characterized by dilute skin, hair, and eye pigmentation, as well as ocular anomalies. Twenty tiger-eye horses were homozygous for a nonsynonymous mutation in exon 2 (p.Phe91Tyr) of SLC24A5 (called here Tiger-eye 1), which is predicted to be deleterious to protein function. Additionally, eight of the remaining 12 tiger-eye horses heterozygous for the p.Phe91Tyr variant were also heterozygous for a 628 bp deletion encompassing all of exon 7 of SLC24A5 (c.875-340_1081+82del), which we will call here the Tiger-eye 2 allele. None of the 122 brown-eyed horses were homozygous for either tiger-eye-associated allele or were compound heterozygotes. Further, neither variant was detected in 196 horses from four related breeds not known to have the tiger-eye phenotype. Here, we propose that two mutations in SLC24A5 affect iris pigmentation in tiger-eye PRPF horses. Further, unlike OCA6 in humans, the Tiger-eye 1 mutation in its homozygous state or as a compound heterozygote (Tiger-eye 1/Tiger-eye 2) does not appear to cause ocular anomalies or a change in coat color in the PRPF horse. PMID:28655738

Analysis of immune-related loci identifies 48 new susceptibility variants for multiple sclerosis

PubMed Central

Beecham, Ashley H; Patsopoulos, Nikolaos A; Xifara, Dionysia K; Davis, Mary F; Kemppinen, Anu; Cotsapas, Chris; Shahi, Tejas S; Spencer, Chris; Booth, David; Goris, An; Oturai, Annette; Saarela, Janna; Fontaine, Bertrand; Hemmer, Bernhard; Martin, Claes; Zipp, Frauke; D’alfonso, Sandra; Martinelli-Boneschi, Filippo; Taylor, Bruce; Harbo, Hanne F; Kockum, Ingrid; Hillert, Jan; Olsson, Tomas; Ban, Maria; Oksenberg, Jorge R; Hintzen, Rogier; Barcellos, Lisa F; Agliardi, Cristina; Alfredsson, Lars; Alizadeh, Mehdi; Anderson, Carl; Andrews, Robert; Søndergaard, Helle Bach; Baker, Amie; Band, Gavin; Baranzini, Sergio E; Barizzone, Nadia; Barrett, Jeffrey; Bellenguez, Céline; Bergamaschi, Laura; Bernardinelli, Luisa; Berthele, Achim; Biberacher, Viola; Binder, Thomas M C; Blackburn, Hannah; Bomfim, Izaura L; Brambilla, Paola; Broadley, Simon; Brochet, Bruno; Brundin, Lou; Buck, Dorothea; Butzkueven, Helmut; Caillier, Stacy J; Camu, William; Carpentier, Wassila; Cavalla, Paola; Celius, Elisabeth G; Coman, Irène; Comi, Giancarlo; Corrado, Lucia; Cosemans, Leentje; Cournu-Rebeix, Isabelle; Cree, Bruce A C; Cusi, Daniele; Damotte, Vincent; Defer, Gilles; Delgado, Silvia R; Deloukas, Panos; di Sapio, Alessia; Dilthey, Alexander T; Donnelly, Peter; Dubois, Bénédicte; Duddy, Martin; Edkins, Sarah; Elovaara, Irina; Esposito, Federica; Evangelou, Nikos; Fiddes, Barnaby; Field, Judith; Franke, Andre; Freeman, Colin; Frohlich, Irene Y; Galimberti, Daniela; Gieger, Christian; Gourraud, Pierre-Antoine; Graetz, Christiane; Graham, Andrew; Grummel, Verena; Guaschino, Clara; Hadjixenofontos, Athena; Hakonarson, Hakon; Halfpenny, Christopher; Hall, Gillian; Hall, Per; Hamsten, Anders; Harley, James; Harrower, Timothy; Hawkins, Clive; Hellenthal, Garrett; Hillier, Charles; Hobart, Jeremy; Hoshi, Muni; Hunt, Sarah E; Jagodic, Maja; Jelčić, Ilijas; Jochim, Angela; Kendall, Brian; Kermode, Allan; Kilpatrick, Trevor; Koivisto, Keijo; Konidari, Ioanna; Korn, Thomas; Kronsbein, Helena; Langford, Cordelia; Larsson, Malin; Lathrop, Mark; Lebrun-Frenay, Christine; Lechner-Scott, Jeannette; Lee, Michelle H; Leone, Maurizio A; Leppä, Virpi; Liberatore, Giuseppe; Lie, Benedicte A; Lill, Christina M; Lindén, Magdalena; Link, Jenny; Luessi, Felix; Lycke, Jan; Macciardi, Fabio; Männistö, Satu; Manrique, Clara P; Martin, Roland; Martinelli, Vittorio; Mason, Deborah; Mazibrada, Gordon; McCabe, Cristin; Mero, Inger-Lise; Mescheriakova, Julia; Moutsianas, Loukas; Myhr, Kjell-Morten; Nagels, Guy; Nicholas, Richard; Nilsson, Petra; Piehl, Fredrik; Pirinen, Matti; Price, Siân E; Quach, Hong; Reunanen, Mauri; Robberecht, Wim; Robertson, Neil P; Rodegher, Mariaemma; Rog, David; Salvetti, Marco; Schnetz-Boutaud, Nathalie C; Sellebjerg, Finn; Selter, Rebecca C; Schaefer, Catherine; Shaunak, Sandip; Shen, Ling; Shields, Simon; Siffrin, Volker; Slee, Mark; Sorensen, Per Soelberg; Sorosina, Melissa; Sospedra, Mireia; Spurkland, Anne; Strange, Amy; Sundqvist, Emilie; Thijs, Vincent; Thorpe, John; Ticca, Anna; Tienari, Pentti; van Duijn, Cornelia; Visser, Elizabeth M; Vucic, Steve; Westerlind, Helga; Wiley, James S; Wilkins, Alastair; Wilson, James F; Winkelmann, Juliane; Zajicek, John; Zindler, Eva; Haines, Jonathan L; Pericak-Vance, Margaret A; Ivinson, Adrian J; Stewart, Graeme; Hafler, David; Hauser, Stephen L; Compston, Alastair; McVean, Gil; De Jager, Philip; Sawcer, Stephen; McCauley, Jacob L

2013-01-01

Using the ImmunoChip custom genotyping array, we analysed 14,498 multiple sclerosis subjects and 24,091 healthy controls for 161,311 autosomal variants and identified 135 potentially associated regions (p-value < 1.0 × 10-4). In a replication phase, we combined these data with previous genome-wide association study (GWAS) data from an independent 14,802 multiple sclerosis subjects and 26,703 healthy controls. In these 80,094 individuals of European ancestry we identified 48 new susceptibility variants (p-value < 5.0 × 10-8); three found after conditioning on previously identified variants. Thus, there are now 110 established multiple sclerosis risk variants in 103 discrete loci outside of the Major Histocompatibility Complex. With high resolution Bayesian fine-mapping, we identified five regions where one variant accounted for more than 50% of the posterior probability of association. This study enhances the catalogue of multiple sclerosis risk variants and illustrates the value of fine-mapping in the resolution of GWAS signals. PMID:24076602

[Typing and identification of non-polio enterovirus from acute flaccid paralysis cases in Ningxia, 1997-2011].

PubMed

Ma, Jiang-tao; Chen, Hui; Yuan, Fang; Ma, Xue-min; Guan, Guang-yu; Zhan, Jun

2012-11-01

To identify the serotype of 73 non-polio enterovirus (NPEV) strains from acute flaccid paralysis (AFP) cases in Ningxia province, during 1997 - 2011. Partial sequencing of the VP1 region was amplified by RT-PCR with degenerate primers and sequenced while sequences were compared with the database of GenBank by the BLAST algorithm. Evolution was analyzed by constructing phylogenetic tree using Mega 5.1. In this study, a total of 73 NPEVs were analyzed, including 4 strains un-typed, 69 strains typed by RT-PCR. A total of 27 serotypes were identified, including 8 serotypes of human enterovirus (HEV)-A, 19 serotypes of HEV-B. The HEV-B group (46/69, 66.7%) constituted the largest proportion of isolates, followed by HEV-A (23/69, 33.3%), but no strains were found that belonged to HEV-C or HEV-D group. In the 69 strains, enterovirus 71 was the most frequently seen isolates, followed by coxsackie-virus A4, 16, 9 and echovirus 24, 6. HEV-B was the most predominant (46/69, 66.7%) serotype of NPEV in Ningxia during the AFP surveillance, in 1997 - 2011.

Vitamin D receptor variants in 192 patients with schizophrenia and other psychiatric diseases.

PubMed

Yan, Jin; Feng, Jinong; Craddock, Nick; Jones, Ian R; Cook, Edwin H; Goldman, David; Heston, Leonard L; Chen, Jiesheng; Burkhart, Patricia; Li, Wenyan; Shibayama, Akane; Sommer, Steve S

Intriguing parallels have been noted previously between the biology of Vitamin D and the epidemiology of schizophrenia. We have scanned the Vitamin D receptor (VDR) gene by DOVAM-S (Detection of Virtually All Mutations-SSCP), a robotically enhanced multiplexed scanning method. In total, 100 patients with schizophrenia (86 Caucasians and 14 African-Americans) were scanned. In addition, pilot experiments were performed in patients with bipolar disorder (BPD) (24), autism (24), attention deficit hyperactivity disorder (ADHD) (24), and alcoholism (20). A total of 762 kb of the VDR genomic sequence was scanned. R208N and V339I were each found in one African-American patient, while absent in 35 African-American controls without schizophrenia (2/14 versus 0/35, P=0.08). Within the power of the study (> or =1.6-fold relative risk), the common M1T variant is not associated with schizophrenia. In the 92 scanned patients with other psychiatric diseases, R173S was found in a single patient with bipolar disorder. In conclusion, we describe three novel structural variants of the Vitamin D receptor. Further study is required to clarify their role, if any, in psychiatric disease.

Y2 receptor gene variants reduce the risk of hypertension in obese children and adolescents.

PubMed

Santoro, Nicola; Del Giudice, Emanuele Miraglia; Grandone, Anna; Marzuillo, Pierluigi; Cozzolino, Domenico; Di Salvo, Giovanni; Pacileo, Giuseppe; Calabrò, Raffaele; Perrone, Laura

2008-08-01

To verify whether peptide YY (PYY) and its Y2 receptor (Y2R) gene variants can be associated with obesity or hypertension or both in a cohort of obese children and adolescents. Two hundred and twenty-nine obese children (105 girls, mean z-score BMI 5.1 +/- 2.4; mean age 10.5 +/- 2.9 years) and 250 age and sex-matched lean controls (130 women, mean z-score BMI 0.5 +/- 1.1; mean age 10.3 +/- 2.8) were enrolled in the study. Height, weight, BMI, waist circumference and 24-h systolic and diastolic blood pressure were measured. Night-time, day-time and 24-h systolic and diastolic blood pressures were evaluated by 24 h ambulatory blood pressure measurement, and appropriate standard deviation scores according to sex, age and height were calculated. Molecular screening of the PYY and Y2R genes was performed. No new mutations were found. We observed three previously described polymorphisms: G767C on PYY and T585C and T936C on Y2R. An association study was carried out in obese patients. No associations were found between the PYY genotypes and the studied phenotypes. The Y2R gene variants, T585C and T936C, which are in almost complete linkage disequilibrium, were found to be associated with night-time, day-time and 24-h systolic and diastolic blood pressures. In particular, subject homozygotes for the T allele showed lower systolic and diastolic blood pressure values compared with the other genotypes. Moreover, obese children homozygous for the T585 allele showed a lower risk of developing hypertension than patients carrying the CC and CT genotypes (chi 6.9; df = 1, P = 0.03; odds ratio = 0.5, 95% confidence interval: 0.27-0.88). Our results suggest that Y2R gene variants are involved in blood pressure regulation in obese children and adolescents.

Medical Surveillance Monthly Report (MSMR). Volume 19, Number 8. August 2012

DTIC Science & Technology

2012-08-01

much more common causes than bacteria, fungi, or parasites. Non-polio enteroviruses (members of the subgenera coxsackieviruses, echoviruses, and... enteroviruses ) are the most common causes of viral meningitis; however, vari- cella-zoster virus (VZV), herpes simplex virus (HSV), mumps virus...assessment, the etiologies of many viral meningitis cases are unknown.2 Enteroviruses are spread through both fecal-oral and respiratory transmission. % e

Genetic Variants in Transcription Factors Are Associated With the Pharmacokinetics and Pharmacodynamics of Metformin

PubMed Central

Goswami, S; Yee, SW; Stocker, S; Mosley, JD; Kubo, M; Castro, R; Mefford, JA; Wen, C; Liang, X; Witte, J; Brett, C; Maeda, S; Simpson, MD; Hedderson, MM; Davis, RL; Roden, DM; Giacomini, KM; Savic, RM

2014-01-01

One-third of type 2 diabetes patients do not respond to metformin. Genetic variants in metformin transporters have been extensively studied as a likely contributor to this high failure rate. Here, we investigate, for the first time, the effect of genetic variants in transcription factors on metformin pharmacokinetics (PK) and response. Overall, 546 patients and healthy volunteers contributed their genome-wide, pharmacokinetic (235 subjects), and HbA1c data (440 patients) for this analysis. Five variants in specificity protein 1 (SP1), a transcription factor that modulates the expression of metformin transporters, were associated with changes in treatment HbA1c (P < 0.01) and metformin secretory clearance (P < 0.05). Population pharmacokinetic modeling further confirmed a 24% reduction in apparent clearance in homozygous carriers of one such variant, rs784888. Genetic variants in other transcription factors, peroxisome proliferator–activated receptor-α and hepatocyte nuclear factor 4-α, were significantly associated with HbA1c change only. Overall, our study highlights the importance of genetic variants in transcription factors as modulators of metformin PK and response. PMID:24853734

Targeted delivery of anti-coxsackievirus siRNAs using ligand-conjugated packaging RNAs.

PubMed

Zhang, Huifang M; Su, Yue; Guo, Songchuan; Yuan, Ji; Lim, Travis; Liu, Jing; Guo, Peixuan; Yang, Decheng

2009-09-01

Coxsackievirus B3 (CVB3) is a common pathogen of myocarditis. We previously synthesized a siRNA targeting the CVB3 protease 2A (siRNA/2A) gene and achieved reduction of CVB3 replication by 92% in vitro. However, like other drugs under development, CVB3 siRNA faces a major challenge of targeted delivery. In this study, we investigated a novel approach to deliver CVB3 siRNAs to a specific cell population (e.g. HeLa cells containing folate receptor) using receptor ligand (folate)-linked packaging RNA (pRNA) from bacterial phage phi29. pRNA monomers can spontaneously form dimers and multimers under optimal conditions by base-pairing between their stem loops. By covalently linking a fluorescence-tag to folate, we delivered the conjugate specifically to HeLa cells without the need of transfection. We further demonstrated that pRNA covalently conjugated to siRNA/2A achieved an equivalent antiviral effect to that of the siRNA/2A alone. Finally, the drug targeted delivery was further evaluated by using pRNA monomers or dimers, which carried both the siRNA/2A and folate ligand and demonstrated that both of them strongly inhibited CVB3 replication. These data indicate that pRNA as a siRNA carrier can specifically deliver the drug to target cells via its ligand and specific receptor interaction and inhibit virus replication effectively.

Clinical and Etiological Characteristics of Atypical Hand-Foot-and-Mouth Disease in Children from Chongqing, China: A Retrospective Study.

PubMed

Yan, Xiang; Zhang, Zhen-Zhen; Yang, Zhen-Hua; Zhu, Chao-Min; Hu, Yun-Ge; Liu, Quan-Bo

2015-01-01

Hand-foot-and-mouth disease (HFMD) is a disease that had similar manifestations to chickenpox, impetigo, and measles, which is easy to misdiagnose and subsequently causes delayed therapy and subsequent epidemic. To date, no study has been conducted to report the clinical and epidemiological characteristics of atypical HFMD. 64 children with atypical HFMD out of 887 HFMD children were recruited, stool was collected, and viral VP1 was detected. The atypical HFMD accounted for 7.2% of total HFMD in the same period (64/887) and there were two peaks in its prevalence in nonepidemic seasons. Ten children (15.6%) had manifestations of neurologic involvement, of whom 4 (6.3%) were diagnosed with severe HFMD and 1 with critically severe HFMD, but all recovered smoothly. Onychomadesis and desquamation were found in 14 patients (21.9%) and 15 patients (23.4%), respectively. The most common pathogen was coxsackievirus A6 (CV-A6) which accounted for 67.2%, followed by nontypable enterovirus (26.6%), enterovirus 71 (EV-A71) (4.7%), and coxsackievirus A16 (A16) (1.5%). Atypical HFMD has seasonal prevalence. The manifestations of neurologic involvement in atypical HFMD are mild and usually have a good prognosis. CV-A6 is a major pathogen causing atypical HFMD, but not a major pathogen in Chongqing, China.

Effects of mutations on active site conformation and dynamics of RNA-dependent RNA polymerase from Coxsackievirus B3.

PubMed

Shen, Hujun; Deng, Mingsen; Zhang, Yachao

2017-10-01

Recent crystal structures of RNA-dependent RNA polymerase (3D pol ) from Coxsackievirus B3 (CVB3) revealed that a tyrosine mutation at Phe364 (F364Y) resulted in structures with open active site whereas a hydrophobic mutation at Phe364 (F364A) led to conformations with closed active site. Besides, the crystal structures showed that the F364W mutation had no preference between the open and closed active sites, similar to wild-type. In this paper, we present a molecular dynamics (MD) study on CVB3 3D pol in order to address some important questions raised by experiments. First, MD simulations of F364Y and F364A were carried out to explore how these mutations at Phe364 influence active site dynamics and conformations. Second, MD simulations of wild-type and mutants were performed to discover the connection between active site dynamics and polymerase function. MD simulations reveal that the effect of mutations on active site dynamics is associated with the interaction between the structural motifs A and D in CVB3 3D pol . Interestingly, we discover that the active site state is influenced by the formation of a hydrogen bond between backbone atoms of Ala231 (in motif A) and Ala358 (in motif D), which has never been revealed before. Copyright © 2017 Elsevier Inc. All rights reserved.

Purification, crystallization and preliminary X-ray diffraction analysis of a soluble variant of the monoglyceride lipase Yju3p from the yeast Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rengachari, Srinivasan; Aschauer, Philipp; Sturm, Christian

A soluble variant of the monoglyceride lipase Yju3p was successfully expressed, purified and crystallized. Diffraction data were collected to 2.4 Å resolution. The protein Yju3p is the orthologue of monoglyceride lipases in the yeast Saccharomyces cerevisiae. A soluble variant of this lipase termed s-Yju3p (38.3 kDa) was generated and purified to homogeneity by affinity and size-exclusion chromatography. s-Yju3p was crystallized in a vapour-diffusion setup at 293 K and a complete data set was collected to 2.4 Å resolution. The crystal form was orthorhombic (space group P2{sub 1}2{sub 1}2{sub 1}), with unit-cell parameters a = 77.2, b = 108.6, c =more » 167.7 Å. The asymmetric unit contained four molecules with a solvent content of 46.4%.« less

Complete Sequence Analysis and Antiviral Screening of Medicinal Plants for Human Coxsackievirus A16 Isolated in Korea

PubMed Central

Song, Jae-Hyoung; Park, Kwisung; Shim, Aeri; Kwon, Bo-Eun; Ahn, Jae-Hee; Choi, Young Jin; Kim, Jae Kyung; Yeo, Sang-Gu; Yoon, Kyungah; Ko, Hyun-Jeong

2015-01-01

Objectives Coxsackievirus A group 16 strain (CVA16) is one of the predominant causative agents of hand, foot, and mouth disease (HFMD). Methods Using a specimen from a male patient with HFMD, we isolated and performed sequencing of the Korean CVA16 strain and compared it with a G10 reference strain. Also, we were investigated the effects of medicinal plant extract on the cytopathic effects (CPE) by CPE reduction assay against Korean CVA16. Results Phylogenetic analysis showed that the Korean CVA16 isolate belonged to cluster B-1 and was closely related to the strain PM-15765-00 isolated in Malaysia in 2000. The Korean CVA16 isolate showed 73.2% nucleotide identity to the G10 prototype strain and 98.7% nucleotide identity to PM-15765-00. Next, we assessed whether the Korean CVA16 isolate could be used for in vitro screening of antiviral agents to treat HFMD infection. Vero cells infected with the Korean CVA16 isolate showed a cytopathic effect 2 days after the infection, and the treatment of cells with Cornus officinalis, Acer triflorum, Pulsatilla koreana, and Clematis heracleifolia var. davidiana Hemsl extracts exhibited strong antiviral activity against CVA16. Conclusion Collectively, our work provides potential candidates for the development of vaccine and novel drugs to treat the CVA16 strain isolated from a Korean patient. PMID:25737832

Complete sequence analysis and antiviral screening of medicinal plants for human coxsackievirus a16 isolated in Korea.

PubMed

Song, Jae-Hyoung; Park, Kwisung; Shim, Aeri; Kwon, Bo-Eun; Ahn, Jae-Hee; Choi, Young Jin; Kim, Jae Kyung; Yeo, Sang-Gu; Yoon, Kyungah; Ko, Hyun-Jeong

2015-02-01

Coxsackievirus A group 16 strain (CVA16) is one of the predominant causative agents of hand, foot, and mouth disease (HFMD). Using a specimen from a male patient with HFMD, we isolated and performed sequencing of the Korean CVA16 strain and compared it with a G10 reference strain. Also, we were investigated the effects of medicinal plant extract on the cytopathic effects (CPE) by CPE reduction assay against Korean CVA16. Phylogenetic analysis showed that the Korean CVA16 isolate belonged to cluster B-1 and was closely related to the strain PM-15765-00 isolated in Malaysia in 2000. The Korean CVA16 isolate showed 73.2% nucleotide identity to the G10 prototype strain and 98.7% nucleotide identity to PM-15765-00. Next, we assessed whether the Korean CVA16 isolate could be used for in vitro screening of antiviral agents to treat HFMD infection. Vero cells infected with the Korean CVA16 isolate showed a cytopathic effect 2 days after the infection, and the treatment of cells with Cornus officinalis, Acer triflorum, Pulsatilla koreana, and Clematis heracleifolia var. davidiana Hemsl extracts exhibited strong antiviral activity against CVA16. Collectively, our work provides potential candidates for the development of vaccine and novel drugs to treat the CVA16 strain isolated from a Korean patient.

Prophylactic Methods in Prevention of Disease Among Army Personnel

DTIC Science & Technology

1977-12-01

E. Coli 1 . Enterotoxin in Infant Dependents. 20. Abstract (Contd) PCoxsackie A 21 and Polio ; and 74.7% by agents that were not determined.) Of the...virus specimens was conducted using Tryptose Phosphate Broth (TPB) as a control. The recovery of Vaccinia, ECHO 9, Coxsackievirus, Polio , Adenovirus...Mycoplasma, Coxsackie A21 and Polio ; and 74.7% by agents that were not determined. Of the Adenovirus isolates (1,073), 87.7% (941) were Adenovirus type 21, 8

Elimination of representative contaminant candidate list viruses, coxsackievirus, echovirus, hepatitis A virus, and norovirus, from water by coagulation processes.

PubMed

Shirasaki, N; Matsushita, T; Matsui, Y; Murai, K; Aochi, A

2017-03-15

We examined the removal of representative contaminant candidate list (CCL) viruses (coxsackievirus [CV] B5, echovirus type [EV] 11, and hepatitis A virus [HAV] IB), recombinant norovirus virus-like particles (rNV-VLPs), and murine norovirus (MNV) type 1 by coagulation. Water samples were subjected to coagulation with polyaluminum chloride (PACl, basicity 1.5) followed by either settling or settling and filtration. Together with our previously published results, the removal ratio order, as evaluated by a plaque-forming-unit method or an enzyme-linked immunosorbent assay after settling, was HAV>EV=rNV-VLPs≥CV=poliovirus type 1=MNV>adenovirus type 40 (range, 0.1-2.7-log 10 ). Infectious HAV was likely inactivated by the PACl and therefore was removed to a greater extent than the other viruses. A nonsulfated high-basicity PACl (basicity 2.1), removed the CCL viruses more efficiently than did two other sulfated PACls (basicity 1.5 or 2.1), alum, or ferric chloride. We also examined the removal ratio of two bacteriophages. The removal ratios for MS2 tended to be larger than those of the CCL viruses, whereas those for φX174 were comparable with or smaller than those of the CCL viruses. Therefore, φX174 may be a useful conservative surrogate for CCL viruses during coagulation. Copyright © 2016 Elsevier B.V. All rights reserved.

Molecular typing of enteroviruses associated with viral meningitis in Cyprus, 2000-2002.

PubMed

Richter, Jan; Koptides, Dana; Tryfonos, Christina; Christodoulou, Christina

2006-08-01

Human enteroviruses are responsible for a wide spectrum of clinical diseases affecting many different organ systems. Although infection is usually asymptomatic, infections of the central nervous system manifested as meningitis or encephalitis can pose a serious public health problem, especially during outbreaks. In this study, samples from 218 patients diagnosed with enteroviral meningitis between January 2000 and December 2002 were analysed in order to assess the epidemiology of human enteroviruses as a cause of viral meningitis in Cyprus. A new typing strategy, based on partial sequencing of the 5' non-coding region (5'NCR), prediction of type, and selection of type-specific primers for sensitive VP1 PCR amplification, was developed. As clustering in the 5'NCR was concordant with clustering in the VP1 region, quick and reliable typing by VP1 sequencing was achieved without virus isolation in cell culture. The most frequent enterovirus serotypes identified were Human echovirus 30 (55.5%), Human echovirus 13 (15.1%), Human echovirus 6 (13.8%) and Human echovirus 9 (8.3%). Human coxsackieviruses B2, B1 and B5, Human echovirus 4, Human enterovirus 71 and Human coxsackievirus A6 represented rather rare serotypes. This is the first molecular epidemiological study of enterovirus meningitis in Cyprus. Serotype distribution corresponded basically with observations in other European countries, suggesting the spread of enteroviruses by tourism.

Protection Against Type 1 Diabetes Upon Coxsackievirus B4 Infection and iNKT-Cell Stimulation

PubMed Central

Ghazarian, Liana; Diana, Julien; Beaudoin, Lucie; Larsson, Pär G.; Puri, Raj K.; van Rooijen, Nico; Flodström-Tullberg, Malin; Lehuen, Agnès

2013-01-01

Invariant natural killer T (iNKT) cells belong to the innate immune system and exercise a dual role as potent regulators of autoimmunity and participate in responses against different pathogens. They have been shown to prevent type 1 diabetes development and to promote antiviral responses. Many studies in the implication of environmental factors on the etiology of type 1 diabetes have suggested a link between enteroviral infections and the development of this disease. This study of the pancreatropic enterovirus Coxsackievirus B4 (CVB4) shows that although infection accelerated type 1 diabetes development in a subset of proinsulin 2–deficient NOD mice, the activation of iNKT cells by a specific agonist, α-galactosylceramide, at the time of infection inhibited the disease. Diabetes development was associated with the infiltration of pancreatic islets by inflammatory macrophages, producing high levels of interleukin (IL)-1β, IL-6, and tumor necrosis factor-α and activation of anti-islet T cells. On the contrary, macrophages infiltrating the islets after CVB4 infection and iNKT-cell stimulation expressed a number of suppressive enzymes, among which indoleamine 2,3-dioxygenase was sufficient to inhibit anti-islet T-cell response and to prevent diabetes. This study highlights the critical interaction between virus and the immune system in the acceleration or prevention of type 1 diabetes. PMID:23894189

Detection, quantitation and identification of enteroviruses from surface waters and sponge tissue from the Florida Keys using real-time RT-PCR

USGS Publications Warehouse

Donaldson, K.A.; Griffin, Dale W.; Paul, J.H.

2002-01-01

A method was developed for the quantitative detection of pathogenic human enteroviruses from surface waters in the Florida Keys using Taqman (R) one-step Reverse transcription (RT)-PCR with the Model 7700 ABI Prism (R) Sequence Detection System. Viruses were directly extracted from unconcentrated grab samples of seawater, from seawater concentrated by vortex flow filtration using a 100kD filter and from sponge tissue. Total RNA was extracted from the samples, purified and concentrated using spin-column chromatography. A 192-196 base pair portion of the 5??? untranscribed region was amplified from these extracts. Enterovirus concentrations were estimated using real-time RT-PCR technology. Nine of 15 sample sites or 60% were positive for the presence of pathogenic human enteroviruses. Considering only near-shore sites, 69% were positive with viral concentrations ranging from 9.3viruses/ml to 83viruses/g of sponge tissue (uncorrected for extraction efficiency). Certain amplicons were selected for cloning and sequencing for identification. Three strains of waterborne enteroviruses were identified as Coxsackievirus A9, Coxsackievirus A16, and Poliovirus Sabin type 1. Time and cost efficiency of this one-step real-time RT-PCR methodology makes this an ideal technique to detect, quantitate and identify pathogenic enteroviruses in recreational waters. Copyright ?? 2002 Elsevier Science Ltd.

Detection of non-polio enteroviruses in Hungary 2000-2008 and molecular epidemiology of enterovirus 71, coxsackievirus A16, and echovirus 30.

PubMed

Kapusinszky, Beatrix; Szomor, Katalin N; Farkas, Agnes; Takács, Mária; Berencsi, György

2010-04-01

Human enteroviruses are associated with various clinical syndromes from minor febrile illness to severe, potentially fatal conditions like aseptic meningitis, paralysis, myocarditis, and neonatal enteroviral sepsis. Between June 2000 and August 2008 echovirus (E) type 2, 4, 6, 7, 9, 11, 13, 25, 30, coxsackievirus (CV) -A16, -A19, -B5, and enterovirus 71 (EV71) were reported in Hungary. In this study, 29 previously enterovirus positive samples from 28 patients diagnosed with hand, foot and mouth disease, meningitis and encephalitis, were molecularly typed. The genetic relationships of identified serotypes CV-A16, EV71, and E30 were assessed by direct sequencing of genomic region encoding the capsid protein VP1. The sequences were compared to each other and sequences from other geographical regions possessed in Genbank. The phylogenetic analysis of CV-A16 revealed that the viruses were mostly of Far-Eastern or Asia-Pacific origin. Typing of EV71 showed that one virus from 2000 belonged to genotype C1 and five viruses observed in 2004 and 2005 were identified as genotype C4. The 11 echovirus 30 strains showed homology with those of neighbor European countries. The molecular examination of E30 revealed that three separate lineages circulated in 2000, 2001, and 2004-2006 in Hungary.

Enterovirus inhibitory activity of C-8-tert-butyl substituted 4-aryl-6,7,8,9-tetrahydrobenzo[4,5]thieno[3,2-e][1,2,4]triazolo[4,3-a]pyrimidin-5(4H)-ones.

PubMed

Kumar Biswas, Bishyajit; Malpani, Yashwardhan R; Ha, Neul; Kwon, Do-Hyun; Soo Shin, Jin; Kim, Hae-Soo; Kim, Chonsaeng; Bong Han, Soo; Lee, Chong-Kyo; Jung, Young-Sik

2017-08-01

Members of a series of 4-aryl-6,7,8,9-tetrahydrobenzo[4,5]thieno[3,2-e][1,2,4]triazolo[4,3-a]pyrimidin-5(4H)-ones (1, Fig. 2) were prepared and tested against representative enteroviruses including Human Coxsackievirus B1 (Cox B1), Human Coxsackievirus B3 (Cox B3), human Poliovirus 3 (PV3), human Rhinovirus 14 (HRV14), human Rhinovirus 21 (HRV 21) and human Rhinovirus 71 (HRV 71). The C-8-tert-butyl group on the tetrahydrobenzene ring in these substances was found to be crucial for their enterovirus activity. One member of this group, 1e, showed single digit micromolar activities (1.6-8.85μM) against a spectrum of viruses screened, and the highest selectivity index (SI) values for Cox B1 (>11.2), for Cox B3 (>11.5), and for PV3 (>51.2), respectively. In contrast, 1p, was the most active analog against the selected HRVs (1.8-2.6μM), and showed the highest selectivity indices among the group of compounds tested. The SI values for 1p were 11.5 for HRV14, 8.4 for HRV21, and 12.1 for HRV71, respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.

PNPLA3 genetic variants determine hepatic steatosis in non-obese chronic hepatitis C patients.

PubMed

Huang, Chung-Feng; Chen, Jyh-Jou; Yeh, Ming-Lun; Huang, Ching-I; Hsieh, Ming-Yen; Yang, Hua-Ling; Dai, Chia-Yen; Huang, Jee-Fu; Lin, Zu-Yau; Chen, Shinn-Cherng; Chuang, Wan-Long; Chen, Yao-Li; Yu, Ming-Lung

2015-07-03

The influence of patatin-like phospholipase domain-containing 3 (PNPLA3) genetic variants in the development of liver steatosis in Asian chronic hepatitis C patients remains elusive. A total of 1018 biopsy-proven chronic hepatitis C patients were enrolled for evaluation. The proportions of PNPLA3 rs738409 GG genotype carriage were 7.8% (44/563), 15.8% (58/367) and 19.3% (17/88) in patients with no (liver fat content < 5%), mild (5-33%) and moderate/severe (> 66%) hepatic steatosis, respectively (trend P < 0.001). Stepwise logistic regression analysis revealed that the strongest factor independently associated with steatosis was the carriage of the PNPLA3 rs738409 GG genotype (odds ratio [OR]/95% confidence intervals [CI]:2.34/1.557-3.515, P < 0.001). Among the patients with BMI < 24 kg/m(2), carriage of the rs738409 GG genotype was the only factor associated with hepatic steatosis (OR/CI:3.44/1.824-6.500, P < 0.001). PNPLA3 genetic variants had minimal effects on hepatic steatosis among overweight or obese patients. Compared to patients with BMI < 24 kg/m(2)/non-GG genotype, those with BMI >24 kg/m(2)/GG genotype were more likely to have hepatic steatosis (OR/CI:3.87/2.292-6.524, P < 0.001). In conclusions, both PNPLA3 genetic variants and BMI played important roles in hepatic steatosis among Asian chronic hepatitis C patients. However, the genetic effect was mainly restricted to non-obese patients.

A clinically driven variant prioritization framework outperforms purely computational approaches for the diagnostic analysis of singleton WES data.

PubMed

Stark, Zornitza; Dashnow, Harriet; Lunke, Sebastian; Tan, Tiong Y; Yeung, Alison; Sadedin, Simon; Thorne, Natalie; Macciocca, Ivan; Gaff, Clara; Oshlack, Alicia; White, Susan M; James, Paul A

2017-11-01

Rapid identification of clinically significant variants is key to the successful application of next generation sequencing technologies in clinical practice. The Melbourne Genomics Health Alliance (MGHA) variant prioritization framework employs a gene prioritization index based on clinician-generated a priori gene lists, and a variant prioritization index (VPI) based on rarity, conservation and protein effect. We used data from 80 patients who underwent singleton whole exome sequencing (WES) to test the ability of the framework to rank causative variants highly, and compared it against the performance of other gene and variant prioritization tools. Causative variants were identified in 59 of the patients. Using the MGHA prioritization framework the average rank of the causative variant was 2.24, with 76% ranked as the top priority variant, and 90% ranked within the top five. Using clinician-generated gene lists resulted in ranking causative variants an average of 8.2 positions higher than prioritization based on variant properties alone. This clinically driven prioritization approach significantly outperformed purely computational tools, placing a greater proportion of causative variants top or in the top 5 (permutation P-value=0.001). Clinicians included 40 of the 49 WES diagnoses in their a priori list of differential diagnoses (81%). The lists generated by PhenoTips and Phenomizer contained 14 (29%) and 18 (37%) of these diagnoses respectively. These results highlight the benefits of clinically led variant prioritization in increasing the efficiency of singleton WES data analysis and have important implications for developing models for the funding and delivery of genomic services.

Comparison of locus-specific databases for BRCA1 and BRCA2 variants reveals disparity in variant classification within and among databases.

PubMed

Vail, Paris J; Morris, Brian; van Kan, Aric; Burdett, Brianna C; Moyes, Kelsey; Theisen, Aaron; Kerr, Iain D; Wenstrup, Richard J; Eggington, Julie M

2015-10-01

Genetic variants of uncertain clinical significance (VUSs) are a common outcome of clinical genetic testing. Locus-specific variant databases (LSDBs) have been established for numerous disease-associated genes as a research tool for the interpretation of genetic sequence variants to facilitate variant interpretation via aggregated data. If LSDBs are to be used for clinical practice, consistent and transparent criteria regarding the deposition and interpretation of variants are vital, as variant classifications are often used to make important and irreversible clinical decisions. In this study, we performed a retrospective analysis of 2017 consecutive BRCA1 and BRCA2 genetic variants identified from 24,650 consecutive patient samples referred to our laboratory to establish an unbiased dataset representative of the types of variants seen in the US patient population, submitted by clinicians and researchers for BRCA1 and BRCA2 testing. We compared the clinical classifications of these variants among five publicly accessible BRCA1 and BRCA2 variant databases: BIC, ClinVar, HGMD (paid version), LOVD, and the UMD databases. Our results show substantial disparity of variant classifications among publicly accessible databases. Furthermore, it appears that discrepant classifications are not the result of a single outlier but widespread disagreement among databases. This study also shows that databases sometimes favor a clinical classification when current best practice guidelines (ACMG/AMP/CAP) would suggest an uncertain classification. Although LSDBs have been well established for research applications, our results suggest several challenges preclude their wider use in clinical practice.

De novo 14q24.2q24.3 microdeletion including IFT43 is associated with intellectual disability, skeletal anomalies, cardiac anomalies, and myopia.

PubMed

Stokman, Marijn F; Oud, Machteld M; van Binsbergen, Ellen; Slaats, Gisela G; Nicolaou, Nayia; Renkema, Kirsten Y; Nijman, Isaac J; Roepman, Ronald; Giles, Rachel H; Arts, Heleen H; Knoers, Nine V A M; van Haelst, Mieke M

2016-06-01

We report an 11-year-old girl with mild intellectual disability, skeletal anomalies, congenital heart defect, myopia, and facial dysmorphisms including an extra incisor, cup-shaped ears, and a preauricular skin tag. Array comparative genomic hybridization analysis identified a de novo 4.5-Mb microdeletion on chromosome 14q24.2q24.3. The deleted region and phenotype partially overlap with previously reported patients. Here, we provide an overview of the literature on 14q24 microdeletions and further delineate the associated phenotype. We performed exome sequencing to examine other causes for the phenotype and queried genes present in the 14q24.2q24.3 microdeletion that are associated with recessive disease for variants in the non-deleted allele. The deleted region contains 65 protein-coding genes, including the ciliary gene IFT43. Although Sanger and exome sequencing did not identify variants in the second IFT43 allele or in other IFT complex A-protein-encoding genes, immunocytochemistry showed increased accumulation of IFT-B proteins at the ciliary tip in patient-derived fibroblasts compared to control cells, demonstrating defective retrograde ciliary transport. This could suggest a ciliary defect in the pathogenesis of this disorder. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Strong association of common variants in the CDKN2A/CDKN2B region with type 2 diabetes in French Europids.

PubMed

Duesing, K; Fatemifar, G; Charpentier, G; Marre, M; Tichet, J; Hercberg, S; Balkau, B; Froguel, P; Gibson, F

2008-05-01

Genome-wide association studies (GWASs) recently identified common variants in the CDKN2A/CDKN2B region on chromosome 9p as being strongly associated with type 2 diabetes. Since these association signals were not picked up by the French-Canadian GWAS, we sought to replicate these findings in the French Europid population and to further characterise the susceptibility variants at this novel locus. We genotyped 20 single nucleotide polymorphisms (SNPs) spanning the CDKN2A/CDKN2B locus in our type 2 diabetes case-control cohort. The association between CDKN2A/CDKN2B SNPs and quantitative metabolic traits was also examined in the normoglycaemic participants comprising the control cohort. We report replication of the strong association of rs10811661 with type 2 diabetes found in the GWASs (P= 3.8 X 10(-7); OR 1.43 [95% CI 1.24-1.64]). The other CDKN2A/CDKN2B susceptibility variant, rs564398, did not attain statistical significance (p = 0.053; OR 1.11 [95% CI 1.00-1.24]) in the present study. We also obtained several additional nominal association signals (p < 0.05) at the CDKN2A/CDKN2B locus; however, only the rs3218018 result (p = 0.002) survived Bonferroni correction for multiple testing (adjusted p = 0.04). Our comprehensive association study of common variation spanning the CDKN2A/CDKN2B locus confirms the strong association between the distal susceptibility variant rs10811661 and type 2 diabetes in the French population. Further genetic and functional studies are required to identify the aetiological variants at this locus and determine the cellular and physiological mechanisms by which they act to modulate type 2 diabetes susceptibility.

Recurrent Coding Sequence Variation Explains Only A Small Fraction of the Genetic Architecture of Colorectal Cancer

PubMed Central

Timofeeva, Maria N.; Kinnersley, Ben; Farrington, Susan M.; Whiffin, Nicola; Palles, Claire; Svinti, Victoria; Lloyd, Amy; Gorman, Maggie; Ooi, Li-Yin; Hosking, Fay; Barclay, Ella; Zgaga, Lina; Dobbins, Sara; Martin, Lynn; Theodoratou, Evropi; Broderick, Peter; Tenesa, Albert; Smillie, Claire; Grimes, Graeme; Hayward, Caroline; Campbell, Archie; Porteous, David; Deary, Ian J.; Harris, Sarah E.; Northwood, Emma L.; Barrett, Jennifer H.; Smith, Gillian; Wolf, Roland; Forman, David; Morreau, Hans; Ruano, Dina; Tops, Carli; Wijnen, Juul; Schrumpf, Melanie; Boot, Arnoud; Vasen, Hans F A; Hes, Frederik J.; van Wezel, Tom; Franke, Andre; Lieb, Wolgang; Schafmayer, Clemens; Hampe, Jochen; Buch, Stephan; Propping, Peter; Hemminki, Kari; Försti, Asta; Westers, Helga; Hofstra, Robert; Pinheiro, Manuela; Pinto, Carla; Teixeira, Manuel; Ruiz-Ponte, Clara; Fernández-Rozadilla, Ceres; Carracedo, Angel; Castells, Antoni; Castellví-Bel, Sergi; Campbell, Harry; Bishop, D. Timothy; Tomlinson, Ian P M; Dunlop, Malcolm G.; Houlston, Richard S.

2015-01-01

Whilst common genetic variation in many non-coding genomic regulatory regions are known to impart risk of colorectal cancer (CRC), much of the heritability of CRC remains unexplained. To examine the role of recurrent coding sequence variation in CRC aetiology, we genotyped 12,638 CRCs cases and 29,045 controls from six European populations. Single-variant analysis identified a coding variant (rs3184504) in SH2B3 (12q24) associated with CRC risk (OR = 1.08, P = 3.9 × 10−7), and novel damaging coding variants in 3 genes previously tagged by GWAS efforts; rs16888728 (8q24) in UTP23 (OR = 1.15, P = 1.4 × 10−7); rs6580742 and rs12303082 (12q13) in FAM186A (OR = 1.11, P = 1.2 × 10−7 and OR = 1.09, P = 7.4 × 10−8); rs1129406 (12q13) in ATF1 (OR = 1.11, P = 8.3 × 10−9), all reaching exome-wide significance levels. Gene based tests identified associations between CRC and PCDHGA genes (P < 2.90 × 10−6). We found an excess of rare, damaging variants in base-excision (P = 2.4 × 10−4) and DNA mismatch repair genes (P = 6.1 × 10−4) consistent with a recessive mode of inheritance. This study comprehensively explores the contribution of coding sequence variation to CRC risk, identifying associations with coding variation in 4 genes and PCDHG gene cluster and several candidate recessive alleles. However, these findings suggest that recurrent, low-frequency coding variants account for a minority of the unexplained heritability of CRC. PMID:26553438

Associations between a common variant near the MC4R gene and serum triglyceride levels in an obese pediatric cohort.

PubMed

Fernandes, Ariana Ester; de Melo, Maria Edna; Fujiwara, Clarissa Tamie Hiwatashi; Pioltine, Marina Brosso; Matioli, Sergio Russo; Santos, Aritânia; Cercato, Cintia; Halpern, Alfredo; Mancini, Marcio C

2015-08-01

Polymorphisms near the MC4R gene may be related to an increased risk for obesity, but studies of variations in this gene and its relation to cardiometabolic profiles and food intake are scarce and controversial. The aim of this study is to evaluate the influence of the variants rs12970134 and rs17782313 near the MC4R gene in food intake, binge eating (BE) behavior, anthropometric parameters, body composition, metabolic profile, and cardiometabolic risk factors in obese children and adolescents. This is a cross-sectional study that included obese children and adolescents. We evaluated anthropometric, metabolic parameters and cardiometabolic risk factors, including hypertension, impaired fasting glucose, hypertriglyceridemia, and low HDL-cholesterol. BE was assessed through the BE scale, and a 24-h recall was used to evaluate total caloric intake and percentage of macronutrients and types of dietary fat. The MC4R variants rs12970134 and rs17782313 were genotyped using TaqMan assay. To assess the magnitude of risk, a logistic regression adjusted for Z-BMI, age, and gender was performed, adopting the significance level of 0.05. The study included 518 subjects (52.1 % girls, 12.7 ± 2.7 years old, Z-BMI = 3.24 ± 0.57). Carriers of the variant rs17782313 exhibit increased triglyceride levels (108 ± 48 vs. 119 ± 54, p = 0.034) and an increased risk of hypertriglyceridemia (OR 1.985, 95 % CI 1.288-3.057, p = 0.002). There was no association of the SNP rs12970134 with clinical, metabolic, or nutritional parameters. The variant rs12970134 and rs17782313 did not influence food intake or the presence of BE. The variant rs17782313 is associated with an increased risk of hypertriglyceridemia in obese children and adolescents.

Identification of Susceptibility Loci and Genes for Colorectal Cancer Risk

PubMed Central

Zeng, Chenjie; Matsuda, Koichi; Jia, Wei-Hua; Chang, Jiang; Kweon, Sun-Seog; Xiang, Yong-Bing; Shin, Aesun; Jee, Sun Ha; Kim, Dong-Hyun; Zhang, Ben; Cai, Qiuyin; Guo, Xingyi; Long, Jirong; Wang, Nan; Courtney, Regina; Pan, Zhi-Zhong; Wu, Chen; Takahashi, Atsushi; Shin, Min-Ho; Matsuo, Keitaro; Matsuda, Fumihiko; Gao, Yu-Tang; Oh, Jae Hwan; Kim, Soriul; Jung, Keum Ji; Ahn, Yoon-Ok; Ren, Zefang; Li, Hong-Lan; Wu, Jie; Shi, Jiajun; Wen, Wanqing; Yang, Gong; Li, Bingshan; Ji, Bu-Tian; Brenner, Hermann; Schoen, Robert E.; Küry, Sébastien; Gruber, Stephen B.; Schumacher, Fredrick R.; Stenzel, Stephanie L.; Casey, Graham; Hopper, John L.; Jenkins, Mark A.; Kim, Hyeong-Rok; Jeong, Jin-Young; Park, Ji Won; Tajima, Kazuo; Cho, Sang-Hee; Kubo, Michiaki; Shu, Xiao-Ou; Lin, Dongxin; Zeng, Yi-Xin; Zheng, Wei

2016-01-01

Background & Aims Known Genetic factors explain only a small fraction of genetic variation in colorectal cancer (CRC). We conducted a genome-wide association study (GWAS) to identify risk loci for CRC. Methods This discovery stage included 8027 cases and 22577 controls of East-Asian ancestry. Promising variants were evaluated in studies including as many as 11044 cases and 12047 controls. Tumor-adjacent normal tissues from 188 patients were analyzed to evaluate correlations of risk variants with expression levels of nearby genes. Potential functionality of risk variants were evaluated using public genomic and epigenomic databases. Results We identified 4 loci associated with CRC risk; P values for the most significant variant in each locus ranged from 3.92×10−8 to 1.24×10−12: 6p21.1 (rs4711689), 8q23.3 (rs2450115, rs6469656), 10q24.3 (rs4919687), and 12p13.3 (rs11064437). We also identified 2 risk variants at loci previously associated with CRC: 10q25.2 (rs10506868) and 20q13.3 (rs6061231). These risk variants, conferring an approximate 10%–18% increase in risk per allele, are located either inside or near protein-coding genes that include TFEB (lysosome biogenesis and autophagy), EIF3H (initiation of translation), CYP17A1 (steroidogenesis), SPSB2 (proteasome degradation), and RPS21 (ribosome biogenesis). Gene expression analyses showed a significant association (P <.05) for rs4711689 with TFEB, rs6469656 with EIF3H, rs11064437 with SPSB2, and rs6061231 with RPS21. Conclusions We identified susceptibility loci and genes associated with CRC risk, linking CRC predisposition to steroid hormone, protein synthesis and degradation, and autophagy pathways and providing added insight into the mechanism of CRC pathogenesis. PMID:26965516

GENETIC ARCHITECTURE OF AMBULATORY BLOOD PRESSURE IN THE GENERAL POPULATION – INSIGHTS FROM CARDIOVASCULAR GENE-CENTRIC ARRAY

PubMed Central

Tomaszewski, Maciej; Debiec, Radoslaw; Braund, Peter S; Nelson, Christopher P; Hardwick, Robert; Christofidou, Paraskevi; Denniff, Matthew; Codd, Veryan; Rafelt, Suzanne; van der Harst, Pim; Waterworth, Dawn; Song, Kijoung; Vollenweider, Peter; Waeber, Gerard; Zukowska-Szczechowska, Ewa; Burton, Paul R; Mooser, Vincent; Charchar, Fadi J; Thompson, John R; Tobin, Martin D; Samani, Nilesh J

2010-01-01

Genetic determinants of blood pressure are poorly defined. We undertook a large-scale gene-centric analysis to identify loci and pathways associated with ambulatory systolic and diastolic blood pressure. We measured 24-hour ambulatory BP in 2020 individuals from 520 white European nuclear families (the GRAPHIC Study) and genotyped their DNA using the Illumina HumanCVD BeadChip array which contains approximately 50000 single nucleotide polymorphisms in >2000 cardiovascular candidate loci. We found a strong association between rs13306560 polymorphism in the promoter region of MTHFR and CLCN6 and mean 24-hour diastolic blood pressure - each minor allele copy of rs13306560 was associated with 2.6 mmHg lower mean 24-hour diastolic blood pressure (P=1.2×10−8). rs13306560 was also associated with clinic diastolic blood pressure in a combined analysis of 8129 subjects from the GRAPHIC Study, the CoLaus Study and the Silesian Cardiovascular Study (P=5.4×10−6). Additional analysis of associations between variants in Gene Ontology-defined pathways and mean 24-hour blood pressure in the GRAPHIC Study showed that cell survival control signalling cascades could play a role in blood pressure regulation. There was also a significant over-representation of rare variants (minor allele frequency <0.05) amongst polymorphisms showing at least nominal association with mean 24-hour blood pressure indicating that a considerable proportion of its heritability may be explained by uncommon alleles. Through a large scale gene-centric analysis of ambulatory blood pressure, we identified an association of a novel variant at the MTHFR/CLNC6 locus with diastolic blood pressure and provided new insights into the genetic architecture of blood pressure. PMID:21060006

The UK10K project identifies rare variants in health and disease.

PubMed

Walter, Klaudia; Min, Josine L; Huang, Jie; Crooks, Lucy; Memari, Yasin; McCarthy, Shane; Perry, John R B; Xu, ChangJiang; Futema, Marta; Lawson, Daniel; Iotchkova, Valentina; Schiffels, Stephan; Hendricks, Audrey E; Danecek, Petr; Li, Rui; Floyd, James; Wain, Louise V; Barroso, Inês; Humphries, Steve E; Hurles, Matthew E; Zeggini, Eleftheria; Barrett, Jeffrey C; Plagnol, Vincent; Richards, J Brent; Greenwood, Celia M T; Timpson, Nicholas J; Durbin, Richard; Soranzo, Nicole

2015-10-01

The contribution of rare and low-frequency variants to human traits is largely unexplored. Here we describe insights from sequencing whole genomes (low read depth, 7×) or exomes (high read depth, 80×) of nearly 10,000 individuals from population-based and disease collections. In extensively phenotyped cohorts we characterize over 24 million novel sequence variants, generate a highly accurate imputation reference panel and identify novel alleles associated with levels of triglycerides (APOB), adiponectin (ADIPOQ) and low-density lipoprotein cholesterol (LDLR and RGAG1) from single-marker and rare variant aggregation tests. We describe population structure and functional annotation of rare and low-frequency variants, use the data to estimate the benefits of sequencing for association studies, and summarize lessons from disease-specific collections. Finally, we make available an extensive resource, including individual-level genetic and phenotypic data and web-based tools to facilitate the exploration of association results.

From days to hours: reporting clinically actionable variants from whole genome sequencing.

PubMed

Middha, Sumit; Baheti, Saurabh; Hart, Steven N; Kocher, Jean-Pierre A

2014-01-01

As the cost of whole genome sequencing (WGS) decreases, clinical laboratories will be looking at broadly adopting this technology to screen for variants of clinical significance. To fully leverage this technology in a clinical setting, results need to be reported quickly, as the turnaround rate could potentially impact patient care. The latest sequencers can sequence a whole human genome in about 24 hours. However, depending on the computing infrastructure available, the processing of data can take several days, with the majority of computing time devoted to aligning reads to genomics regions that are to date not clinically interpretable. In an attempt to accelerate the reporting of clinically actionable variants, we have investigated the utility of a multi-step alignment algorithm focused on aligning reads and calling variants in genomic regions of clinical relevance prior to processing the remaining reads on the whole genome. This iterative workflow significantly accelerates the reporting of clinically actionable variants with no loss of accuracy when compared to genotypes obtained with the OMNI SNP platform or to variants detected with a standard workflow that combines Novoalign and GATK.

Survival of Microbial Pathogens in the Marine Environment

DTIC Science & Technology

1979-05-01

individaal virusesLLd [aried widely In their stability with Coxsackie B-5 being the most stable, HO virus 6 being intermediate, and poliovirus 1 the...Department of Microbiology University of Maryland College Park, Maryland 2074P 1 May 1979 Reproduction in whole or in part is permitted for any...study: poliovirus type 1, coxsackievirus B-5, and Echoviru’ 6. Synthetic seawater was adjusted to 10, 20, and 34 parts per thousand and the temperatures

Pathogenic copy number variants in patients with congenital hypopituitarism associated with complex phenotypes.

PubMed

Correa, Fernanda A; Jorge, Alexander Al; Nakaguma, Marilena; Canton, Ana Pm; Costa, Silvia S; Funari, Mariana F; Lerario, Antonio M; Franca, Marcela M; Carvalho, Luciani R; Krepischi, Ana Cv; Arnhold, Ivo Jp; Rosenberg, Carla; Mendonca, Berenice B

2018-03-01

The aetiology of congenital hypopituitarism (CH) is unknown in most patients. Rare copy number variants (CNVs) have been implicated as the cause of genetic syndromes with previously unknown aetiology. Our aim was to study the presence of CNVs and their pathogenicity in patients with idiopathic CH associated with complex phenotypes. We selected 39 patients with syndromic CH for array-based comparative genomic hybridization (aCGH). Patients with pathogenic CNVs were also evaluated by whole exome sequencing. Twenty rare CNVs were detected in 19 patients. Among the identified rare CNVs, six were classified as benign, eleven as variants of uncertain clinical significance (VUS) and four as pathogenic. The three patients with pathogenic CNVs had combined pituitary hormone deficiencies, and the associated complex phenotypes were intellectual disabilities: trichorhinophalangeal type I syndrome (TRPS1) and developmental delay/intellectual disability with cardiac malformation, respectively. Patient one has a de novo 1.6-Mb deletion located at chromosome 3q13.31q13.32, which overlaps with the region of the 3q13.31 deletion syndrome. Patient two has a 10.5-Mb de novo deletion at 8q23.1q24.11, encompassing the TRPS1 gene; his phenotype is compatible with TRPS1. Patient three carries a chromosome translocation t(2p24.3;4q35.1) resulting in two terminal alterations: a 2p25.3p24.3 duplication of 14.7 Mb and a 4-Mb deletion at 4q35.1q35.2. Copy number variants explained the phenotype in 8% of patients with hypopituitarism and additional complex phenotypes. This suggests that chromosomal alterations are an important contributor to syndromic hypopituitarism. © 2017 John Wiley & Sons Ltd.

Genome-wide significant association between a sequence variant at 15q15.2 and lung cancer risk

PubMed Central

Rafnar, Thorunn; Sulem, Patrick; Besenbacher, Soren; Gudbjartsson, Daniel F.; Zanon, Carlo; Gudmundsson, Julius; Stacey, Simon N.; Kostic, Jelena P.; Thorgeirsson, Thorgeir E.; Thorleifsson, Gudmar; Bjarnason, Hjordis; Skuladottir, Halla; Gudbjartsson, Tomas; Isaksson, Helgi J.; Isla, Dolores; Murillo, Laura; García-Prats, Maria D.; Panadero, Angeles; Aben, Katja K.H.; Vermeulen, Sita H.; van der Heijden, Henricus F.M.; Feser, William; Miller, York E.; Bunn, Paul A.; Kong, Augustine; Wolf, Holly J.; Franklin, Wilbur A.; Mayordomo, Jose I; Kiemeney, Lambertus A.; Jonsson, Steinn; Thorsteinsdottir, Unnur; Stefansson, Kari

2010-01-01

Genome-wide association studies (GWAS) have identified three genomic regions, at 15q24-25.1, 5p15.33 and 6p21.33, which associate with risk of lung cancer. Large meta-analyses of GWA data have failed to find additional associations of genome-wide significance. In this study, we sought to confirm 7 variants with suggestive association to lung cancer (P<10−5) in a recently published meta-analysis. In a GWA dataset of 1,447 lung cancer cases and 36,256 controls in Iceland, three correlated variants on 15q15.2 (rs504417, rs11853991 and rs748404) showed a significant association with lung cancer whereas rs4254535 on 2p14, rs1530057 on 3p24.1, rs6438347 on 3q13.31 and rs1926203 on 10q23.31 did not. The most significant variant, rs748404, was genotyped in additional 1,299 lung cancer cases and 4,102 controls from the Netherlands, Spain and the USA and the results combined with published GWAS data. In this analysis, the T allele of rs748404 reached genome-wide significance (OR=1.15, P=1.1×10−9). Another variant at the same locus, rs12050604, showed association with lung cancer (OR=1.09, 3.6×10−6) and remained significant after adjustment for rs748404 and vice versa. rs748404 is located 140 kb centromeric of the TP53BP1 gene that has been implicated in lung cancer risk. Two fully correlated, non-synonymous coding variants in TP53BP1, rs2602141 (Q1136K) and rs560191 (E353D), showed association with lung cancer in our sample set; however, this association did not remain significant after adjustment for rs748404. Our data show that one or more lung cancer risk variants of genome-wide significance and distinct from the coding variants in TP53BP1 are located at 15q15.2. PMID:21303977

Identification of a nucleotide in 5′ untranslated region contributing to virus replication and virulence of Coxsackievirus A16

PubMed Central

Li, Zhaolong; Liu, Xin; Wang, Shaohua; Li, Jingliang; Hou, Min; Liu, Guanchen; Zhang, Wenyan; Yu, Xiao-Fang

2016-01-01

Coxsackievirus A16 (CA16) and enterovirus 71 (EV71) are two main causative pathogens of hand, foot and mouth disease (HFMD). Unlike EV71, virulence determinants of CA16, particularly within 5′ untranslated region (5′UTR), have not been investigated until now. Here, a series of nucleotides present in 5′UTR of lethal but not in non-lethal CA16 strains were screened by aligning nucleotide sequences of lethal circulating Changchun CA16 and the prototype G10 as well as non-lethal SHZH05 strains. A representative infectious clone based on a lethal Changchun024 sequence and infectious mutants with various nucleotide alterations in 5′UTR were constructed and further investigated by assessing virus replication in vitro and virulence in neonatal mice. Compared to the lethal infectious clone, the M2 mutant with a change from cytosine to uracil at nucleotide 104 showed weaker virulence and lower replication capacity. The predicted secondary structure of the 5′UTR of CA16 RNA showed that M2 mutant located between the cloverleaf and stem-loop II, affected interactions between the 5′UTR and the heterogeneous nuclear ribonucleoprotein K (hnRNP K) and A1 (hnRNP A1) that are important for translational activity. Thus, our research determined a virulence-associated site in the 5′UTR of CA16, providing a crucial molecular target for antiviral drug development. PMID:26861413

A novel inactivated enterovirus 71 vaccine can elicit cross-protective immunity against coxsackievirus A16 in mice.

PubMed

Yang, Lisheng; Liu, Yajing; Li, Shuxuan; Zhao, Huan; Lin, Qiaona; Yu, Hai; Huang, Xiumin; Zheng, Qingbing; Cheng, Tong; Xia, Ningshao

2016-11-21

Hand, foot, and mouth disease (HFMD) is a highly contagious disease that mainly affects infants and children. Enterovirus 71 (EV71) and coxsackievirus A16 (CA16) are the major pathogens of HFMD. Two EV71 vaccines were recently licensed in China and the administration of the EV71 vaccines is believed to significantly reduce the number of HFMD-related severe or fatal cases. However, a monovalent EV71 vaccine cannot cross-protect against CA16 infection, this may result in that it cannot effectively control the overall HFMD epidemic. In this study, a chimeric EV71, whose VP1/210-225 epitope was replaced by that of CA16, was constructed using a reverse genetics technique to produce a candidate EV71/CA16 bivalent vaccine strain. The chimeric EV71 was infectious and showed similar growth characteristics as its parental strain. The replacement of the VP1/210-225 epitope did not significantly affect the antigenicity and immunogenicity of EV71. More importantly, the chimeric EV71 could induce protective immunity against both EV71 and CA16, and protect neonatal mice against either EV71 or CA16 lethal infections, the chimeric EV71 constructed in this study was shown to be a feasible and promising candidate bivalent vaccine against both EV71 and CA16. The construction of a chimeric enterovirus also provides an alternative platform for broad-spectrum HFMD vaccines development. Copyright © 2016 Elsevier Ltd. All rights reserved.

Phylogeography of Coxsackievirus A16 Reveals Global Transmission Pathways and Recent Emergence and Spread of a Recombinant Genogroup.

PubMed

Hassel, Chervin; Mirand, Audrey; Farkas, Agnes; Diedrich, Sabine; Huemer, Hartwig P; Peigue-Lafeuille, Hélène; Archimbaud, Christine; Henquell, Cécile; Bailly, Jean-Luc

2017-09-15

Coxsackievirus A16 (CV-A16; Picornaviridae ) is an enterovirus (EV) type associated with hand, foot, and mouth disease (HFMD) in children. To investigate the spatial spread of CV-A16, we used viral sequence data sampled during a prospective sentinel surveillance of HFMD in France (2010 to 2014) and phylogenetic reconstruction. A data set of 168 VP1 sequences was assembled with 416 publicly available sequences of various geographic origins. The CV-A16 sequences reported were assigned to two clades, genogroup B and a previously uncharacterized clade D. The time origins of clades B and D were assessed in 1978 (1973 to 1981) and 2004 (2001 to 2007), respectively. The shape of the global CV-A16 phylogeny indicated worldwide cocirculation of genetically distinct virus lineages over time and across geographic regions. Phylogenetic tree topologies and Bayes factor analysis indicated virus migration. Virus transportation events in clade B within Europe and Asia and between countries of the two geographic regions were assessed. The sustained transmission of clade D viruses over 4 years was analyzed at the township level in France and traced back to Peru in South America. Comparative genomics provided evidence of recombination between CV-A16 clades B and D and suggested an intertype recombinant origin for clade D. Time-resolved phylogenies and HFMD surveillance data indicated that CV-A16 persistence is sustained by continuing virus migration at different geographic scales, from community transmission to virus transportation between distant countries. The results showed a significant impact of virus movements on the epidemiological dynamics of HFMD that could have implications for disease prevention. IMPORTANCE Coxsackievirus A16 is one of the most prevalent enterovirus types in hand, foot, and mouth disease outbreaks reported in Southeast Asia. This study is based on epidemiological and viral data on HFMD caused by CV-A16 in a European country. The phylogeographic data complemented the syndromic surveillance with virus migration patterns between geographic regions in France. The results show how viral evolutionary dynamics and global virus spread interact to shape the worldwide pattern of an EV disease. CV-A16 transmission is driven by movements of infected individuals at different geographic levels: within a country (local dynamics), between neighboring countries (regional dynamics), and between distant countries (transcontinental dynamics). The results are consistent with our earlier data on EV-A71 and confirm the epidemiological interconnection of Asia and Europe with regard to EV infections. Copyright © 2017 American Society for Microbiology.

Intersubtype Differences in the Effect of a Rare p24 Gag Mutation on HIV-1 Replicative Fitness

PubMed Central

Chopera, Denis R.; Cotton, Laura A.; Zawaira, Alexander; Mann, Jaclyn K.; Ngandu, Nobubelo K.; Ntale, Roman; Carlson, Jonathan M.; Mlisana, Koleka; Woodman, Zenda; de Assis Rosa, Debra; Martin, Eric; Miura, Toshiyuki; Pereyra, Florencia; Walker, Bruce D.; Gray, Clive M.; Martin, Darren P.; Ndung'u, Thumbi; Brockman, Mark A.; Karim, Salim Abdool

2012-01-01

Certain immune-driven mutations in HIV-1, such as those arising in p24Gag, decrease viral replicative capacity. However, the intersubtype differences in the replicative consequences of such mutations have not been explored. In HIV-1 subtype B, the p24Gag M250I mutation is a rare variant (0.6%) that is enriched among elite controllers (7.2%) (P = 0.0005) and appears to be a rare escape variant selected by HLA-B58 supertype alleles (P < 0.01). In contrast, in subtype C, it is a relatively common minor polymorphic variant (10 to 15%) whose appearance is not associated with a particular HLA allele. Using site-directed mutant viruses, we demonstrate that M250I reduces in vitro viral replicative capacity in both subtype B and subtype C sequences. However, whereas in subtype C downstream compensatory mutations at p24Gag codons 252 and 260 reduce the adverse effects of M250I, fitness costs in subtype B appear difficult to restore. Indeed, patient-derived subtype B sequences harboring M250I exhibited in vitro replicative defects, while those from subtype C did not. The structural implications of M250I were predicted by protein modeling to be greater in subtype B versus C, providing a potential explanation for its lower frequency and enhanced replicative defects in subtype B. In addition to accounting for genetic differences between HIV-1 subtypes, the design of cytotoxic-T-lymphocyte-based vaccines may need to account for differential effects of host-driven viral evolution on viral fitness. PMID:23015721

Fine-scale mapping of the 4q24 locus identifies two independent loci associated with breast cancer risk.

PubMed

Guo, Xingyi; Long, Jirong; Zeng, Chenjie; Michailidou, Kyriaki; Ghoussaini, Maya; Bolla, Manjeet K; Wang, Qin; Milne, Roger L; Shu, Xiao-Ou; Cai, Qiuyin; Beesley, Jonathan; Kar, Siddhartha P; Andrulis, Irene L; Anton-Culver, Hoda; Arndt, Volker; Beckmann, Matthias W; Beeghly-Fadiel, Alicia; Benitez, Javier; Blot, William; Bogdanova, Natalia; Bojesen, Stig E; Brauch, Hiltrud; Brenner, Hermann; Brinton, Louise; Broeks, Annegien; Brüning, Thomas; Burwinkel, Barbara; Cai, Hui; Canisius, Sander; Chang-Claude, Jenny; Choi, Ji-Yeob; Couch, Fergus J; Cox, Angela; Cross, Simon S; Czene, Kamila; Darabi, Hatef; Devilee, Peter; Droit, Arnaud; Dörk, Thilo; Fasching, Peter A; Fletcher, Olivia; Flyger, Henrik; Fostira, Florentia; Gaborieau, Valerie; García-Closas, Montserrat; Giles, Graham G; Grip, Mervi; Guénel, Pascal; Haiman, Christopher A; Hamann, Ute; Hartman, Mikael; Hollestelle, Antoinette; Hopper, John L; Hsiung, Chia-Ni; Ito, Hidemi; Jakubowska, Anna; Johnson, Nichola; Kabisch, Maria; Kang, Daehee; Khan, Sofia; Knight, Julia A; Kosma, Veli-Matti; Lambrechts, Diether; Le Marchand, Loic; Li, Jingmei; Lindblom, Annika; Lophatananon, Artitaya; Lubinski, Jan; Mannermaa, Arto; Manoukian, Siranoush; Margolin, Sara; Marme, Frederik; Matsuo, Keitaro; McLean, Catriona A; Meindl, Alfons; Muir, Kenneth; Neuhausen, Susan L; Nevanlinna, Heli; Nord, Silje; Olson, Janet E; Orr, Nick; Peterlongo, Paolo; Putti, Thomas Choudary; Rudolph, Anja; Sangrajrang, Suleeporn; Sawyer, Elinor J; Schmidt, Marjanka K; Schmutzler, Rita K; Shen, Chen-Yang; Shi, Jiajun; Shrubsole, Martha J; Southey, Melissa C; Swerdlow, Anthony; Teo, Soo Hwang; Thienpont, Bernard; Toland, Amanda Ewart; Tollenaar, Robert A E M; Tomlinson, Ian P M; Truong, Thérèse; Tseng, Chiu-Chen; van den Ouweland, Ans; Wen, Wanqing; Winqvist, Robert; Wu, Anna; Yip, Cheng Har; Zamora, M Pilar; Zheng, Ying; Hall, Per; Pharoah, Paul D P; Simard, Jacques; Chenevix-Trench, Georgia; Dunning, Alison M; Easton, Douglas F; Zheng, Wei

2015-11-01

A recent association study identified a common variant (rs9790517) at 4q24 to be associated with breast cancer risk. Independent association signals and potential functional variants in this locus have not been explored. We conducted a fine-mapping analysis in 55,540 breast cancer cases and 51,168 controls from the Breast Cancer Association Consortium. Conditional analyses identified two independent association signals among women of European ancestry, represented by rs9790517 [conditional P = 2.51 × 10(-4); OR, 1.04; 95% confidence interval (CI), 1.02-1.07] and rs77928427 (P = 1.86 × 10(-4); OR, 1.04; 95% CI, 1.02-1.07). Functional annotation using data from the Encyclopedia of DNA Elements (ENCODE) project revealed two putative functional variants, rs62331150 and rs73838678 in linkage disequilibrium (LD) with rs9790517 (r(2) ≥ 0.90) residing in the active promoter or enhancer, respectively, of the nearest gene, TET2. Both variants are located in DNase I hypersensitivity and transcription factor-binding sites. Using data from both The Cancer Genome Atlas (TCGA) and Molecular Taxonomy of Breast Cancer International Consortium (METABRIC), we showed that rs62331150 was associated with level of expression of TET2 in breast normal and tumor tissue. Our study identified two independent association signals at 4q24 in relation to breast cancer risk and suggested that observed association in this locus may be mediated through the regulation of TET2. Fine-mapping study with large sample size warranted for identification of independent loci for breast cancer risk. ©2015 American Association for Cancer Research.

Fine-scale mapping of the 4q24 locus identifies two independent loci associated with breast cancer risk

PubMed Central

Guo, Xingyi; Long, Jirong; Zeng, Chenjie; Michailidou, Kyriaki; Ghoussaini, Maya; Bolla, Manjeet K.; Wang, Qin; Milne, Roger L.; Shu, Xiao-Ou; Cai, Qiuyin; Beesley, Jonathan; Kar, Siddhartha P.; Andrulis, Irene L.; Anton-Culver, Hoda; Arndt, Volker; Beckmann, Matthias W.; Beeghly-Fadiel, Alicia; Benitez, Javier; Blot, William; Bogdanova, Natalia; Bojesen, Stig E.; Brauch, Hiltrud; Brenner, Hermann; Brinton, Louise; Broeks, Annegien; Brüning, Thomas; Burwinkel, Barbara; Cai, Hui; Canisius, Sander; Chang-Claude, Jenny; Choi, Ji-Yeob; Couch, Fergus J.; Cox, Angela; Cross, Simon S.; Czene, Kamila; Darabi, Hatef; Devilee, Peter; Droit, Arnaud; Dörk, Thilo; Fasching, Peter A.; Fletcher, Olivia; Flyger, Henrik; Fostira, Florentia; Gaborieau, Valerie; García-Closas, Montserrat; Giles, Graham G.; Grip, Mervi; Guénel, Pascal; Haiman, Christopher A.; Hamann, Ute; Hartman, Mikael; Hollestelle, Antoinette; Hopper, John L.; Hsiung, Chia-Ni; Ito, Hidemi; Jakubowska, Anna; Johnson, Nichola; Kabisch, Maria; Kang, Daehee; Khan, Sofia; Knight, Julia A.; Kosma, Veli-Matti; Lambrechts, Diether; Marchand, Loic Le; Li, Jingmei; Lindblom, Annika; Lophatananon, Artitaya; Lubinski, Jan; Mannermaa, Arto; Manoukian, Siranoush; Margolin, Sara; Marme, Frederik; Matsuo, Keitaro; McLean, Catriona A.; Meindl, Alfons; Muir, Kenneth; Neuhausen, Susan L.; Nevanlinna, Heli; Nord, Silje; Olson, Janet E.; Orr, Nick; Peterlongo, Paolo; Putti, Thomas Choudary; Rudolph, Anja; Sangrajrang, Suleeporn; Sawyer, Elinor J.; Schmidt, Marjanka K.; Schmutzler, Rita K.; Shen, Chen-Yang; Shi, Jiajun; Shrubsole, Martha J; Southey, Melissa C.; Swerdlow, Anthony; Teo, Soo Hwang; Thienpont, Bernard; Toland, Amanda Ewart; Tollenaar, Robert A.E.M.; Tomlinson, Ian P.M.; Truong, Thérèse; Tseng, Chiu-chen; van den Ouweland, Ans; Wen, Wanqing; Winqvist, Robert; Wu, Anna; Yip, Cheng Har; Zamora, M. Pilar; Zheng, Ying; Hall, Per; Pharoah, Paul D.P.; Simard, Jacques; Chenevix-Trench, Georgia; Dunning, Alison M.; Easton, Douglas F.; Zheng, Wei

2015-01-01

Background A recent association study identified a common variant (rs9790517) at 4q24 to be associated with breast cancer risk. Independent association signals and potential functional variants in this locus have not been explored. Methods We conducted a fine-mapping analysis in 55,540 breast cancer cases and 51,168 controls from the Breast Cancer Association Consortium. Results Conditional analyses identified two independent association signals among women of European ancestry, represented by rs9790517 (conditional p = 2.51 × 10−4; OR = 1.04; 95% CI 1.02–1.07) and rs77928427 (p = 1.86 × 10−4; OR = 1.04; 95% CI 1.02–1.07). Functional annotation using data from the Encyclopedia of DNA Elements (ENCODE) project revealed two putative functional variants, rs62331150 and rs73838678 in linkage disequilibrium (LD) with rs9790517 (r2 ≥ 0.90) residing in the active promoter or enhancer, respectively, of the nearest gene, TET2. Both variants are located in DNase I hypersensitivity and transcription factor binding sites. Using data from both The Cancer Genome Atlas (TCGA) and Molecular Taxonomy of Breast Cancer International Consortium (METABRIC), we showed that rs62331150 was associated with level of expression of TET2 in breast normal and tumor tissue. Conclusion Our study identified two independent association signals at 4q24 in relation to breast cancer risk and suggested that observed association in this locus may be mediated through the regulation of TET2. Impact Fine-mapping study with large sample size warranted for identification of independent loci for breast cancer risk. PMID:26354892

Significance of common variants on human chromosome 8q24 in relation to the risk of prostate cancer in native Japanese men

PubMed Central

Liu, Miao; Kurosaki, Takayuki; Suzuki, Motofumi; Enomoto, Yutaka; Nishimatsu, Hiroaki; Arai, Tomio; Sawabe, Motoji; Hosoi, Takayuki; Homma, Yukio; Kitamura, Tadaichi

2009-01-01

Background Common variants on human chromosome 8q24, rs1447295 (C/A) and rs6983267 (T/G), have been recently linked to the prevalence of prostate cancer in European and American populations. Here, we evaluated whether the single-nucleotide polymorphisms rs1447295 and rs6983267 were associated with the risk of sporadic prostate cancer as well as latent prostate cancer in a native Japanese population. Results We analyzed genomic DNA samples from 391 sporadic prostate cancer patients, 323 controls who had died from causes unrelated to cancer and 112 Japanese men who were diagnosed as having latent prostate cancer based on autopsy results. The polymorphisms were determined by allelic discrimination using a fluorescent-based TaqMan assay. The A allele of rs1447295 was significantly associated with the risk of sporadic prostate cancer (p = 0.04; age-adjusted OR, 1.34), while the G allele of rs6983267 showed a trend towards being a high-risk allele (p = 0.06; age-adjusted OR, 1.27). No significant difference between these two polymorphisms and the risk of latent prostate cancer was observed in the present Japanese population. Conclusion Known variants on human chromosome 8q24 may be risk factors for sporadic prostate cancer in native Japanese men. PMID:19602258

Defining the role of common variation in the genomic and biological architecture of adult human height.

PubMed

Wood, Andrew R; Esko, Tonu; Yang, Jian; Vedantam, Sailaja; Pers, Tune H; Gustafsson, Stefan; Chu, Audrey Y; Estrada, Karol; Luan, Jian'an; Kutalik, Zoltán; Amin, Najaf; Buchkovich, Martin L; Croteau-Chonka, Damien C; Day, Felix R; Duan, Yanan; Fall, Tove; Fehrmann, Rudolf; Ferreira, Teresa; Jackson, Anne U; Karjalainen, Juha; Lo, Ken Sin; Locke, Adam E; Mägi, Reedik; Mihailov, Evelin; Porcu, Eleonora; Randall, Joshua C; Scherag, André; Vinkhuyzen, Anna A E; Westra, Harm-Jan; Winkler, Thomas W; Workalemahu, Tsegaselassie; Zhao, Jing Hua; Absher, Devin; Albrecht, Eva; Anderson, Denise; Baron, Jeffrey; Beekman, Marian; Demirkan, Ayse; Ehret, Georg B; Feenstra, Bjarke; Feitosa, Mary F; Fischer, Krista; Fraser, Ross M; Goel, Anuj; Gong, Jian; Justice, Anne E; Kanoni, Stavroula; Kleber, Marcus E; Kristiansson, Kati; Lim, Unhee; Lotay, Vaneet; Lui, Julian C; Mangino, Massimo; Mateo Leach, Irene; Medina-Gomez, Carolina; Nalls, Michael A; Nyholt, Dale R; Palmer, Cameron D; Pasko, Dorota; Pechlivanis, Sonali; Prokopenko, Inga; Ried, Janina S; Ripke, Stephan; Shungin, Dmitry; Stancáková, Alena; Strawbridge, Rona J; Sung, Yun Ju; Tanaka, Toshiko; Teumer, Alexander; Trompet, Stella; van der Laan, Sander W; van Setten, Jessica; Van Vliet-Ostaptchouk, Jana V; Wang, Zhaoming; Yengo, Loïc; Zhang, Weihua; Afzal, Uzma; Arnlöv, Johan; Arscott, Gillian M; Bandinelli, Stefania; Barrett, Amy; Bellis, Claire; Bennett, Amanda J; Berne, Christian; Blüher, Matthias; Bolton, Jennifer L; Böttcher, Yvonne; Boyd, Heather A; Bruinenberg, Marcel; Buckley, Brendan M; Buyske, Steven; Caspersen, Ida H; Chines, Peter S; Clarke, Robert; Claudi-Boehm, Simone; Cooper, Matthew; Daw, E Warwick; De Jong, Pim A; Deelen, Joris; Delgado, Graciela; Denny, Josh C; Dhonukshe-Rutten, Rosalie; Dimitriou, Maria; Doney, Alex S F; Dörr, Marcus; Eklund, Niina; Eury, Elodie; Folkersen, Lasse; Garcia, Melissa E; Geller, Frank; Giedraitis, Vilmantas; Go, Alan S; Grallert, Harald; Grammer, Tanja B; Gräßler, Jürgen; Grönberg, Henrik; de Groot, Lisette C P G M; Groves, Christopher J; Haessler, Jeffrey; Hall, Per; Haller, Toomas; Hallmans, Goran; Hannemann, Anke; Hartman, Catharina A; Hassinen, Maija; Hayward, Caroline; Heard-Costa, Nancy L; Helmer, Quinta; Hemani, Gibran; Henders, Anjali K; Hillege, Hans L; Hlatky, Mark A; Hoffmann, Wolfgang; Hoffmann, Per; Holmen, Oddgeir; Houwing-Duistermaat, Jeanine J; Illig, Thomas; Isaacs, Aaron; James, Alan L; Jeff, Janina; Johansen, Berit; Johansson, Åsa; Jolley, Jennifer; Juliusdottir, Thorhildur; Junttila, Juhani; Kho, Abel N; Kinnunen, Leena; Klopp, Norman; Kocher, Thomas; Kratzer, Wolfgang; Lichtner, Peter; Lind, Lars; Lindström, Jaana; Lobbens, Stéphane; Lorentzon, Mattias; Lu, Yingchang; Lyssenko, Valeriya; Magnusson, Patrik K E; Mahajan, Anubha; Maillard, Marc; McArdle, Wendy L; McKenzie, Colin A; McLachlan, Stela; McLaren, Paul J; Menni, Cristina; Merger, Sigrun; Milani, Lili; Moayyeri, Alireza; Monda, Keri L; Morken, Mario A; Müller, Gabriele; Müller-Nurasyid, Martina; Musk, Arthur W; Narisu, Narisu; Nauck, Matthias; Nolte, Ilja M; Nöthen, Markus M; Oozageer, Laticia; Pilz, Stefan; Rayner, Nigel W; Renstrom, Frida; Robertson, Neil R; Rose, Lynda M; Roussel, Ronan; Sanna, Serena; Scharnagl, Hubert; Scholtens, Salome; Schumacher, Fredrick R; Schunkert, Heribert; Scott, Robert A; Sehmi, Joban; Seufferlein, Thomas; Shi, Jianxin; Silventoinen, Karri; Smit, Johannes H; Smith, Albert Vernon; Smolonska, Joanna; Stanton, Alice V; Stirrups, Kathleen; Stott, David J; Stringham, Heather M; Sundström, Johan; Swertz, Morris A; Syvänen, Ann-Christine; Tayo, Bamidele O; Thorleifsson, Gudmar; Tyrer, Jonathan P; van Dijk, Suzanne; van Schoor, Natasja M; van der Velde, Nathalie; van Heemst, Diana; van Oort, Floor V A; Vermeulen, Sita H; Verweij, Niek; Vonk, Judith M; Waite, Lindsay L; Waldenberger, Melanie; Wennauer, Roman; Wilkens, Lynne R; Willenborg, Christina; Wilsgaard, Tom; Wojczynski, Mary K; Wong, Andrew; Wright, Alan F; Zhang, Qunyuan; Arveiler, Dominique; Bakker, Stephan J L; Beilby, John; Bergman, Richard N; Bergmann, Sven; Biffar, Reiner; Blangero, John; Boomsma, Dorret I; Bornstein, Stefan R; Bovet, Pascal; Brambilla, Paolo; Brown, Morris J; Campbell, Harry; Caulfield, Mark J; Chakravarti, Aravinda; Collins, Rory; Collins, Francis S; Crawford, Dana C; Cupples, L Adrienne; Danesh, John; de Faire, Ulf; den Ruijter, Hester M; Erbel, Raimund; Erdmann, Jeanette; Eriksson, Johan G; Farrall, Martin; Ferrannini, Ele; Ferrières, Jean; Ford, Ian; Forouhi, Nita G; Forrester, Terrence; Gansevoort, Ron T; Gejman, Pablo V; Gieger, Christian; Golay, Alain; Gottesman, Omri; Gudnason, Vilmundur; Gyllensten, Ulf; Haas, David W; Hall, Alistair S; Harris, Tamara B; Hattersley, Andrew T; Heath, Andrew C; Hengstenberg, Christian; Hicks, Andrew A; Hindorff, Lucia A; Hingorani, Aroon D; Hofman, Albert; Hovingh, G Kees; Humphries, Steve E; Hunt, Steven C; Hypponen, Elina; Jacobs, Kevin B; Jarvelin, Marjo-Riitta; Jousilahti, Pekka; Jula, Antti M; Kaprio, Jaakko; Kastelein, John J P; Kayser, Manfred; Kee, Frank; Keinanen-Kiukaanniemi, Sirkka M; Kiemeney, Lambertus A; Kooner, Jaspal S; Kooperberg, Charles; Koskinen, Seppo; Kovacs, Peter; Kraja, Aldi T; Kumari, Meena; Kuusisto, Johanna; Lakka, Timo A; Langenberg, Claudia; Le Marchand, Loic; Lehtimäki, Terho; Lupoli, Sara; Madden, Pamela A F; Männistö, Satu; Manunta, Paolo; Marette, André; Matise, Tara C; McKnight, Barbara; Meitinger, Thomas; Moll, Frans L; Montgomery, Grant W; Morris, Andrew D; Morris, Andrew P; Murray, Jeffrey C; Nelis, Mari; Ohlsson, Claes; Oldehinkel, Albertine J; Ong, Ken K; Ouwehand, Willem H; Pasterkamp, Gerard; Peters, Annette; Pramstaller, Peter P; Price, Jackie F; Qi, Lu; Raitakari, Olli T; Rankinen, Tuomo; Rao, D C; Rice, Treva K; Ritchie, Marylyn; Rudan, Igor; Salomaa, Veikko; Samani, Nilesh J; Saramies, Jouko; Sarzynski, Mark A; Schwarz, Peter E H; Sebert, Sylvain; Sever, Peter; Shuldiner, Alan R; Sinisalo, Juha; Steinthorsdottir, Valgerdur; Stolk, Ronald P; Tardif, Jean-Claude; Tönjes, Anke; Tremblay, Angelo; Tremoli, Elena; Virtamo, Jarmo; Vohl, Marie-Claude; Amouyel, Philippe; Asselbergs, Folkert W; Assimes, Themistocles L; Bochud, Murielle; Boehm, Bernhard O; Boerwinkle, Eric; Bottinger, Erwin P; Bouchard, Claude; Cauchi, Stéphane; Chambers, John C; Chanock, Stephen J; Cooper, Richard S; de Bakker, Paul I W; Dedoussis, George; Ferrucci, Luigi; Franks, Paul W; Froguel, Philippe; Groop, Leif C; Haiman, Christopher A; Hamsten, Anders; Hayes, M Geoffrey; Hui, Jennie; Hunter, David J; Hveem, Kristian; Jukema, J Wouter; Kaplan, Robert C; Kivimaki, Mika; Kuh, Diana; Laakso, Markku; Liu, Yongmei; Martin, Nicholas G; März, Winfried; Melbye, Mads; Moebus, Susanne; Munroe, Patricia B; Njølstad, Inger; Oostra, Ben A; Palmer, Colin N A; Pedersen, Nancy L; Perola, Markus; Pérusse, Louis; Peters, Ulrike; Powell, Joseph E; Power, Chris; Quertermous, Thomas; Rauramaa, Rainer; Reinmaa, Eva; Ridker, Paul M; Rivadeneira, Fernando; Rotter, Jerome I; Saaristo, Timo E; Saleheen, Danish; Schlessinger, David; Slagboom, P Eline; Snieder, Harold; Spector, Tim D; Strauch, Konstantin; Stumvoll, Michael; Tuomilehto, Jaakko; Uusitupa, Matti; van der Harst, Pim; Völzke, Henry; Walker, Mark; Wareham, Nicholas J; Watkins, Hugh; Wichmann, H-Erich; Wilson, James F; Zanen, Pieter; Deloukas, Panos; Heid, Iris M; Lindgren, Cecilia M; Mohlke, Karen L; Speliotes, Elizabeth K; Thorsteinsdottir, Unnur; Barroso, Inês; Fox, Caroline S; North, Kari E; Strachan, David P; Beckmann, Jacques S; Berndt, Sonja I; Boehnke, Michael; Borecki, Ingrid B; McCarthy, Mark I; Metspalu, Andres; Stefansson, Kari; Uitterlinden, André G; van Duijn, Cornelia M; Franke, Lude; Willer, Cristen J; Price, Alkes L; Lettre, Guillaume; Loos, Ruth J F; Weedon, Michael N; Ingelsson, Erik; O'Connell, Jeffrey R; Abecasis, Goncalo R; Chasman, Daniel I; Goddard, Michael E; Visscher, Peter M; Hirschhorn, Joel N; Frayling, Timothy M

2014-11-01

Using genome-wide data from 253,288 individuals, we identified 697 variants at genome-wide significance that together explained one-fifth of the heritability for adult height. By testing different numbers of variants in independent studies, we show that the most strongly associated ∼2,000, ∼3,700 and ∼9,500 SNPs explained ∼21%, ∼24% and ∼29% of phenotypic variance. Furthermore, all common variants together captured 60% of heritability. The 697 variants clustered in 423 loci were enriched for genes, pathways and tissue types known to be involved in growth and together implicated genes and pathways not highlighted in earlier efforts, such as signaling by fibroblast growth factors, WNT/β-catenin and chondroitin sulfate-related genes. We identified several genes and pathways not previously connected with human skeletal growth, including mTOR, osteoglycin and binding of hyaluronic acid. Our results indicate a genetic architecture for human height that is characterized by a very large but finite number (thousands) of causal variants.

Defining the role of common variation in the genomic and biological architecture of adult human height

PubMed Central

Chu, Audrey Y; Estrada, Karol; Luan, Jian’an; Kutalik, Zoltán; Amin, Najaf; Buchkovich, Martin L; Croteau-Chonka, Damien C; Day, Felix R; Duan, Yanan; Fall, Tove; Fehrmann, Rudolf; Ferreira, Teresa; Jackson, Anne U; Karjalainen, Juha; Lo, Ken Sin; Locke, Adam E; Mägi, Reedik; Mihailov, Evelin; Porcu, Eleonora; Randall, Joshua C; Scherag, André; Vinkhuyzen, Anna AE; Westra, Harm-Jan; Winkler, Thomas W; Workalemahu, Tsegaselassie; Zhao, Jing Hua; Absher, Devin; Albrecht, Eva; Anderson, Denise; Baron, Jeffrey; Beekman, Marian; Demirkan, Ayse; Ehret, Georg B; Feenstra, Bjarke; Feitosa, Mary F; Fischer, Krista; Fraser, Ross M; Goel, Anuj; Gong, Jian; Justice, Anne E; Kanoni, Stavroula; Kleber, Marcus E; Kristiansson, Kati; Lim, Unhee; Lotay, Vaneet; Lui, Julian C; Mangino, Massimo; Leach, Irene Mateo; Medina-Gomez, Carolina; Nalls, Michael A; Nyholt, Dale R; Palmer, Cameron D; Pasko, Dorota; Pechlivanis, Sonali; Prokopenko, Inga; Ried, Janina S; Ripke, Stephan; Shungin, Dmitry; Stancáková, Alena; Strawbridge, Rona J; Sung, Yun Ju; Tanaka, Toshiko; Teumer, Alexander; Trompet, Stella; van der Laan, Sander W; van Setten, Jessica; Van Vliet-Ostaptchouk, Jana V; Wang, Zhaoming; Yengo, Loïc; Zhang, Weihua; Afzal, Uzma; Ärnlöv, Johan; Arscott, Gillian M; Bandinelli, Stefania; Barrett, Amy; Bellis, Claire; Bennett, Amanda J; Berne, Christian; Blüher, Matthias; Bolton, Jennifer L; Böttcher, Yvonne; Boyd, Heather A; Bruinenberg, Marcel; Buckley, Brendan M; Buyske, Steven; Caspersen, Ida H; Chines, Peter S; Clarke, Robert; Claudi-Boehm, Simone; Cooper, Matthew; Daw, E Warwick; De Jong, Pim A; Deelen, Joris; Delgado, Graciela; Denny, Josh C; Dhonukshe-Rutten, Rosalie; Dimitriou, Maria; Doney, Alex SF; Dörr, Marcus; Eklund, Niina; Eury, Elodie; Folkersen, Lasse; Garcia, Melissa E; Geller, Frank; Giedraitis, Vilmantas; Go, Alan S; Grallert, Harald; Grammer, Tanja B; Gräßler, Jürgen; Grönberg, Henrik; de Groot, Lisette C.P.G.M.; Groves, Christopher J; Haessler, Jeffrey; Hall, Per; Haller, Toomas; Hallmans, Goran; Hannemann, Anke; Hartman, Catharina A; Hassinen, Maija; Hayward, Caroline; Heard-Costa, Nancy L; Helmer, Quinta; Hemani, Gibran; Henders, Anjali K; Hillege, Hans L; Hlatky, Mark A; Hoffmann, Wolfgang; Hoffmann, Per; Holmen, Oddgeir; Houwing-Duistermaat, Jeanine J; Illig, Thomas; Isaacs, Aaron; James, Alan L; Jeff, Janina; Johansen, Berit; Johansson, Åsa; Jolley, Jennifer; Juliusdottir, Thorhildur; Junttila, Juhani; Kho, Abel N; Kinnunen, Leena; Klopp, Norman; Kocher, Thomas; Kratzer, Wolfgang; Lichtner, Peter; Lind, Lars; Lindström, Jaana; Lobbens, Stéphane; Lorentzon, Mattias; Lu, Yingchang; Lyssenko, Valeriya; Magnusson, Patrik KE; Mahajan, Anubha; Maillard, Marc; McArdle, Wendy L; McKenzie, Colin A; McLachlan, Stela; McLaren, Paul J; Menni, Cristina; Merger, Sigrun; Milani, Lili; Moayyeri, Alireza; Monda, Keri L; Morken, Mario A; Müller, Gabriele; Müller-Nurasyid, Martina; Musk, Arthur W; Narisu, Narisu; Nauck, Matthias; Nolte, Ilja M; Nöthen, Markus M; Oozageer, Laticia; Pilz, Stefan; Rayner, Nigel W; Renstrom, Frida; Robertson, Neil R; Rose, Lynda M; Roussel, Ronan; Sanna, Serena; Scharnagl, Hubert; Scholtens, Salome; Schumacher, Fredrick R; Schunkert, Heribert; Scott, Robert A; Sehmi, Joban; Seufferlein, Thomas; Shi, Jianxin; Silventoinen, Karri; Smit, Johannes H; Smith, Albert Vernon; Smolonska, Joanna; Stanton, Alice V; Stirrups, Kathleen; Stott, David J; Stringham, Heather M; Sundström, Johan; Swertz, Morris A; Syvänen, Ann-Christine; Tayo, Bamidele O; Thorleifsson, Gudmar; Tyrer, Jonathan P; van Dijk, Suzanne; van Schoor, Natasja M; van der Velde, Nathalie; van Heemst, Diana; van Oort, Floor VA; Vermeulen, Sita H; Verweij, Niek; Vonk, Judith M; Waite, Lindsay L; Waldenberger, Melanie; Wennauer, Roman; Wilkens, Lynne R; Willenborg, Christina; Wilsgaard, Tom; Wojczynski, Mary K; Wong, Andrew; Wright, Alan F; Zhang, Qunyuan; Arveiler, Dominique; Bakker, Stephan JL; Beilby, John; Bergman, Richard N; Bergmann, Sven; Biffar, Reiner; Blangero, John; Boomsma, Dorret I; Bornstein, Stefan R; Bovet, Pascal; Brambilla, Paolo; Brown, Morris J; Campbell, Harry; Caulfield, Mark J; Chakravarti, Aravinda; Collins, Rory; Collins, Francis S; Crawford, Dana C; Cupples, L Adrienne; Danesh, John; de Faire, Ulf; den Ruijter, Hester M; Erbel, Raimund; Erdmann, Jeanette; Eriksson, Johan G; Farrall, Martin; Ferrannini, Ele; Ferrières, Jean; Ford, Ian; Forouhi, Nita G; Forrester, Terrence; Gansevoort, Ron T; Gejman, Pablo V; Gieger, Christian; Golay, Alain; Gottesman, Omri; Gudnason, Vilmundur; Gyllensten, Ulf; Haas, David W; Hall, Alistair S; Harris, Tamara B; Hattersley, Andrew T; Heath, Andrew C; Hengstenberg, Christian; Hicks, Andrew A; Hindorff, Lucia A; Hingorani, Aroon D; Hofman, Albert; Hovingh, G Kees; Humphries, Steve E; Hunt, Steven C; Hypponen, Elina; Jacobs, Kevin B; Jarvelin, Marjo-Riitta; Jousilahti, Pekka; Jula, Antti M; Kaprio, Jaakko; Kastelein, John JP; Kayser, Manfred; Kee, Frank; Keinanen-Kiukaanniemi, Sirkka M; Kiemeney, Lambertus A; Kooner, Jaspal S; Kooperberg, Charles; Koskinen, Seppo; Kovacs, Peter; Kraja, Aldi T; Kumari, Meena; Kuusisto, Johanna; Lakka, Timo A; Langenberg, Claudia; Le Marchand, Loic; Lehtimäki, Terho; Lupoli, Sara; Madden, Pamela AF; Männistö, Satu; Manunta, Paolo; Marette, André; Matise, Tara C; McKnight, Barbara; Meitinger, Thomas; Moll, Frans L; Montgomery, Grant W; Morris, Andrew D; Morris, Andrew P; Murray, Jeffrey C; Nelis, Mari; Ohlsson, Claes; Oldehinkel, Albertine J; Ong, Ken K; Ouwehand, Willem H; Pasterkamp, Gerard; Peters, Annette; Pramstaller, Peter P; Price, Jackie F; Qi, Lu; Raitakari, Olli T; Rankinen, Tuomo; Rao, DC; Rice, Treva K; Ritchie, Marylyn; Rudan, Igor; Salomaa, Veikko; Samani, Nilesh J; Saramies, Jouko; Sarzynski, Mark A; Schwarz, Peter EH; Sebert, Sylvain; Sever, Peter; Shuldiner, Alan R; Sinisalo, Juha; Steinthorsdottir, Valgerdur; Stolk, Ronald P; Tardif, Jean-Claude; Tönjes, Anke; Tremblay, Angelo; Tremoli, Elena; Virtamo, Jarmo; Vohl, Marie-Claude; Amouyel, Philippe; Asselbergs, Folkert W; Assimes, Themistocles L; Bochud, Murielle; Boehm, Bernhard O; Boerwinkle, Eric; Bottinger, Erwin P; Bouchard, Claude; Cauchi, Stéphane; Chambers, John C; Chanock, Stephen J; Cooper, Richard S; de Bakker, Paul IW; Dedoussis, George; Ferrucci, Luigi; Franks, Paul W; Froguel, Philippe; Groop, Leif C; Haiman, Christopher A; Hamsten, Anders; Hayes, M Geoffrey; Hui, Jennie; Hunter, David J.; Hveem, Kristian; Jukema, J Wouter; Kaplan, Robert C; Kivimaki, Mika; Kuh, Diana; Laakso, Markku; Liu, Yongmei; Martin, Nicholas G; März, Winfried; Melbye, Mads; Moebus, Susanne; Munroe, Patricia B; Njølstad, Inger; Oostra, Ben A; Palmer, Colin NA; Pedersen, Nancy L; Perola, Markus; Pérusse, Louis; Peters, Ulrike; Powell, Joseph E; Power, Chris; Quertermous, Thomas; Rauramaa, Rainer; Reinmaa, Eva; Ridker, Paul M; Rivadeneira, Fernando; Rotter, Jerome I; Saaristo, Timo E; Saleheen, Danish; Schlessinger, David; Slagboom, P Eline; Snieder, Harold; Spector, Tim D; Strauch, Konstantin; Stumvoll, Michael; Tuomilehto, Jaakko; Uusitupa, Matti; van der Harst, Pim; Völzke, Henry; Walker, Mark; Wareham, Nicholas J; Watkins, Hugh; Wichmann, H-Erich; Wilson, James F; Zanen, Pieter; Deloukas, Panos; Heid, Iris M; Lindgren, Cecilia M; Mohlke, Karen L; Speliotes, Elizabeth K; Thorsteinsdottir, Unnur; Barroso, Inês; Fox, Caroline S; North, Kari E; Strachan, David P; Beckmann, Jacques S.; Berndt, Sonja I; Boehnke, Michael; Borecki, Ingrid B; McCarthy, Mark I; Metspalu, Andres; Stefansson, Kari; Uitterlinden, André G; van Duijn, Cornelia M; Franke, Lude; Willer, Cristen J; Price, Alkes L.; Lettre, Guillaume; Loos, Ruth JF; Weedon, Michael N; Ingelsson, Erik; O’Connell, Jeffrey R; Abecasis, Goncalo R; Chasman, Daniel I; Goddard, Michael E

2014-01-01

Using genome-wide data from 253,288 individuals, we identified 697 variants at genome-wide significance that together explain one-fifth of heritability for adult height. By testing different numbers of variants in independent studies, we show that the most strongly associated ~2,000, ~3,700 and ~9,500 SNPs explained ~21%, ~24% and ~29% of phenotypic variance. Furthermore, all common variants together captured the majority (60%) of heritability. The 697 variants clustered in 423 loci enriched for genes, pathways, and tissue-types known to be involved in growth and together implicated genes and pathways not highlighted in earlier efforts, such as signaling by fibroblast growth factors, WNT/beta-catenin, and chondroitin sulfate-related genes. We identified several genes and pathways not previously connected with human skeletal growth, including mTOR, osteoglycin and binding of hyaluronic acid. Our results indicate a genetic architecture for human height that is characterized by a very large but finite number (thousands) of causal variants. PMID:25282103

A novel hemoglobin variant found on the α1 chain: Hb KSVGH (HBA1: p.Lys57_Gly58insSerHisGlySerAlaGlnValLys).

PubMed

Wang, Mei-Chun; Tsai, Kuo-Wang; Chu, Chih-Hsun; Yu, Ming-Sun; Lam, Hing-Chung

2015-01-01

Glycosylated hemoglobin (Hb A1C) is a crucial indicator for the long-term control and the diagnosis of diabetes. However, the presence of hemoglobin (Hb) variants may affect the measured value of Hb A1C and result in an abnormal graph trend and inconsistency between the clinical blood sugar test and Hb A1C values. In this study, laboratory data of 41,267 patients with diabetes were collected. The Hb A1C levels and the graph results were examined. We identified 74 cases containing abnormal Hb A1C graph trends. The conducted blood cell counts and capillary Hb electrophoresis were used to analyze Hb variants. We also determined gene variation for the Hb variants by a sequence approach. Fifteen different types of Hb variants were identified in this study. Among these, we found a novel variant in which the α1 subunit of Hb showed an insertion of 24 nucleotides (nts) between the 56th and 57th residues. We named this novel variant Hb Kaohsiung Veterans General Hospital (Hb KSVGH) (HBA1: p.Lys57_Gly58insSerHisGlySerAlaGlnValLys).

Detection and genetic characterization of norovirus in oysters from China and Japan.

PubMed

Phan, Tung Gia; Khamrin, Pattara; Akiyama, Miho; Yagyu, Fumihiro; Okitsu, Shoko; Maneekarn, Niwat; Nishio, Osamu; Ushijima, Hiroshi

2007-01-01

A total of 225 oysters from China and Japan were collected during October 2005 to September 2006 and were then tested for the presence of norovirus by RT-nested PCR. The detection rate of norovirus was different between China and Japan, accounting for 14.6% (19 of 130) and 25.3% (24 of 95), respectively. In China, norovirus in oyster was detected continuously from July to February with the highest prevalence in August, October and November (each of 21%, 4 of 19). On the other hand, norovirus in Japan was found year-round with highest prevalence in March and October (each of 20.8%, 5 of 24). Norovirus strains detected were subjected to further characterization by sequence analysis. It was found that the norovirus strains belonged to only two distinct genotypes, the GII/3 (known as the Mexico virus cluster) and the GII/4 (known as the Lordsdale virus cluster). In China, the norovirus GII/4 was the most predominant, accounting for 78.9% (15 of 19). In contrast, it was interesting that both the norovirus GII/4 and the norovirus GII/3 were co-predominant with a prevalence of 50% (12 of 24) in Japan. Another interesting feature of the study was that the norovirus GII/4 strains in oysters from both countries were grouped into two distinct variant clusters known as the Farmington Hills variant and the Hunter variant. More than 102 copies of norovirus were detected in 41 of 43 oysters. This study provided additional evidence of the presence of norovirus in oysters and is also the first report to demonstrate the existence of norovirus variants in oysters.

Mucosal Immunization with High-Mobility Group Box 1 in Chitosan Enhances DNA Vaccine-Induced Protection against Coxsackievirus B3-Induced Myocarditis

PubMed Central

Wang, Maowei; Yue, Yan; Dong, Chunsheng; Li, Xiaoyun; Xu, Wei

2013-01-01

Coxsackievirus B3 (CVB3), a small single-stranded RNA virus, belongs to the Picornaviridae family. Its infection is the most common cause of myocarditis, with no vaccine available. Gastrointestinal mucosa is the major entry port for CVB3; therefore, the induction of local immunity in mucosal tissues may help control initial viral infections and alleviate subsequent myocardial injury. Here we evaluated the ability of high-mobility group box 1 (HMGB1) encapsulated in chitosan particles to enhance the mucosal immune responses induced by the CVB3-specific mucosal DNA vaccine chitosan-pVP1. Mice were intranasally coimmunized with 4 doses of chitosan-pHMGB1 and chitosan-pVP1 plasmids, at 2-week intervals, and were challenged with CVB3 4 weeks after the last immunization. Compared with chitosan-pVP1 immunization alone, coimmunization with chitosan-pHMGB1 significantly (P < 0.05) enhanced CVB3-specific fecal secretory IgA levels and promoted mucosal T cell immune responses. In accordance, reduced severity of myocarditis was observed in coimmunized mice, as evidenced by significantly (P < 0.05) reduced viral loads, decreased myocardial injury, and increased survival rates. Flow cytometric analysis indicated that HMGB1 enhanced dendritic cell (DC) recruitment to mesenteric lymph nodes and promoted DC maturation, which might partly account for its mucosal adjuvant effect. This strategy may represent a promising approach to candidate vaccines against CVB3-induced myocarditis. PMID:24027262

Effects of 22 Novel CYP2D6 Variants Found in the Chinese Population on the Bufuralol and Dextromethorphan Metabolisms In Vitro.

PubMed

Cai, Jie; Dai, Da-Peng; Geng, Pei-Wu; Wang, Shuang-Hu; Wang, Hao; Zhan, Yun-Yun; Huang, Xiang-Xin; Hu, Guo-Xin; Cai, Jian-Ping

2016-03-01

Cytochrome P450 2D6 (CYP2D6) is a highly polymorphic enzyme that metabolizes a large number of therapeutic drugs. To date, more than 100 CYP2D6 allelic variants have been reported. Among these variants, we recently identified 22 novel variants in the Chinese population. The aim of this study was to functionally characterize the enzymatic activity of these variants in vitro. A baculovirus-mediated expression system was used to express wild-type CYP2D6.1 and other variants (CYP2D6.2, CYP2D6.10 and 22 novel CYP2D6 variants) at high levels. Then, the insect microsomes containing expressed CYP2D6 proteins were incubated with bufuralol or dextromethorphan at 37°C for 20 or 25 min., respectively. After termination, the metabolites were extracted and used for the detection with high-performance liquid chromatography. Among the 24 CYP2D6 variants tested, two variants (CYP2D6.92 and CYP2D6.96) were found to be catalytically inactive. The remaining 22 variants exhibited significantly decreased intrinsic clearance values for bufuralol 1'-hydroxylation and 20 variants showed significantly lower intrinsic clearance values for dextromethorphan O-demethylation than those of the wild-type CYP2D6.1. Our in vitro results suggest that most of the variants exhibit significantly reduced catalytic activities compared with the wild-type, and these data provide valuable information for personalized medicine in Chinese and other Asian populations. © 2015 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society).

Absence of a primary role for TTN missense variants in arrhythmogenic cardiomyopathy: From a clinical and pathological perspective.

PubMed

Chen, Kai; Song, Jiangping; Wang, Zhen; Rao, Man; Chen, Liang; Hu, Shengshou

2018-05-01

Arrhythmogenic cardiomyopathy (ACM) is an inheritable heart disease characterized by fibro-fatty replacement of the myocardium. TTN missense variants were previously reported as a pathogenic factor for ACM. TTN missense variants are commonly identified in ACM, but have limited effect on the phenotype of ACM. We sequenced 15 ACM-related genes in 35 patients who had a heart transplantation and quantified myocardium, and fibrous and adipose tissue in blocks of the explanted heart. Clinical and pathological characteristics were compared between patients with TTN variants and others. Pedigree analysis was performed in 3 families with TTN variants. TTN variants were detected in 11 patients (all missense, 9 heterozygous and 2 oligogenic form). The TTN truncating variant was absent in the cohort. Patients with TTN variants had late onset age of the disease (31 ±13 years vs 17 ±3 years, P = 0.049) and age of heart transplantation (41 ±14 years vs 24 ±9 years, P = 0.027), larger left ventricle end-diastolic diameter (62 ±10 mm vs 45 ±10 mm, P = 0.019), smaller right ventricular outflow tract (34 ±14 mm vs 50 ±15 mm, P = 0.046), more myocardium (40.8% ±29.4% vs 13.8% ±11.0%, P = 0.017), and less adipose tissue (43.0% ±30.9% vs 66.9% ±18.5%, P = 0.036) in right ventricle than those with desmosomal variants. There was few difference between patients with TTN variants and those without variants. Pedigrees showed none of the family members with TTN missense variants had a disease phenotype, indicating a very low penetrance. TTN missense variants was commonly identified in ACM patients in this cohort, but hardly played a primary role in ACM as causative variants. © 2018 Wiley Periodicals, Inc.

Novel cancer gene variants and gene fusions of triple-negative breast cancers (TNBCs) reveal their molecular diversity conserved in the patient-derived xenograft (PDX) model.

PubMed

Jung, Jaeyun; Jang, Kiwon; Ju, Jung Min; Lee, Eunji; Lee, Jong Won; Kim, Hee Jung; Kim, Jisun; Lee, Sae Byul; Ko, Beom Seok; Son, Byung Ho; Lee, Hee Jin; Gong, Gyungyup; Ahn, Sei Yeon; Choi, Jung Kyoon; Singh, Shree Ram; Chang, Suhwan

2018-08-01

Despite the improved 5-year survival rate of breast cancer, triple-negative breast cancer (TNBC) remains a challenge due to lack of effective targeted therapy and higher recurrence and metastasis than other subtypes. To identify novel druggable targets and to understand its unique biology, we tried to implement 24 patient-derived xenografts (PDXs) of TNBC. The overall success rate of PDX implantation was 45%, much higher than estrogen receptor (ER)-positive cases. Immunohistochemical analysis revealed conserved ER/PR/Her2 negativity (with two exceptions) between the original and PDX tumors. Genomic analysis of 10 primary tumor-PDX pairs with Ion AmpliSeq CCP revealed high degree of variant conservation (85.0%-96.9%) between primary and PDXs. Further analysis showed 44 rare variants with a predicted high impact in 36 genes including Trp53, Pten, Notch1, and Col1a1. Among them, we confirmed frequent Notch1 variant. Furthermore, RNA-seq analysis of 24 PDXs revealed 594 gene fusions, of which 163 were in-frame, including AZGP1-GJC3 and NF1-AARSD1. Finally, western blot analysis of oncogenic signaling proteins supporting molecular diversity of TNBC PDXs. Overall, our report provides a molecular basis for the usefulness of the TNBC PDX model in preclinical study. Published by Elsevier B.V.

Effects of common hemoglobin variants on HbA1c measurements in China: results for α- and β-globin variants measured by six methods.

PubMed

Xu, Anping; Chen, Weidong; Xia, Yong; Zhou, Yu; Ji, Ling

2018-04-07

HbA1c is a widely used biomarker for diabetes mellitus management. Here, we evaluated the accuracy of six methods for determining HbA1c values in Chinese patients with common α- and β-globin chains variants in China. Blood samples from normal subjects and individuals exhibiting hemoglobin variants were analyzed for HbA1c, using Sebia Capillarys 2 Flex Piercing (C2FP), Bio-Rad Variant II Turbo 2.0, Tosoh HLC-723 G8 (ver. 5.24), Arkray ADAMS A1c HA-8180V fast mode, Cobas c501 and Trinity Ultra2 systems. DNA sequencing revealed five common β-globin chain variants and three common α-globin chain variants. The most common variant was Hb E, followed by Hb New York, Hb J-Bangkok, Hb G-Coushatta, Hb Q-Thailand, Hb G-Honolulu, Hb Ube-2 and Hb G-Taipei. Variant II Turbo 2.0, Ultra2 and Cobas c501 showed good agreement with C2FP for most samples with variants. HLC-723 G8 yielded no HbA1c values for Hb J-Bangkok, Hb Q-Thailand and Hb G-Honolulu. Samples with Hb E, Hb G-Coushatta, Hb G-Taipei and Hb Ube-2 produced significant negative biases for HLC-723 G8. HA-8180V showed statistically significant differences for Hb E, Hb G-Coushatta, Hb G-Taipei, Hb Q-Thailand and Hb G-Honolulu. HA-8180V yielded no HbA1c values for Hb J-Bangkok. All methods showed good agreement for samples with Hb New York. Some common hemoglobin variants can interfere with HbA1c determination by the most popular methods in China.

Gamma-aminobutyric acid A receptor, α-2 (GABRA2) variants as individual markers for alcoholism: a meta-analysis.

PubMed

Zintzaras, Elias

2012-08-01

The available evidence from the genetic association studies (GAS) published to date on the association between variants in the GABRA2 gene and alcoholism has produced inconclusive results. To interpret these results, a meticulous meta-analysis of all available studies was carried out. The PubMed database and the HuGE Navigator were searched for published GAS-related variants in the GABRA2 gene with susceptibility to alcoholism. Then, the GAS were synthesized to decrease the uncertainty of estimated genetic risk effects. The risk effects were estimated on the basis of the odds ratio (OR) of the allele contrast and the generalized odds ratio (OR(G)), a model-free approach. Cumulative and recursive cumulative meta-analyses (CMA) were also carried out to investigate the trend and stability of effect sizes as evidence accumulates. Fourteen variants investigated in eight studies were analyzed. Significant associations were derived for four variants either for the allele contrast or for the OR(G). In particular, the variants rs279858 and rs279845 showed marginal significance for OR(G): OR(G)=1.27 (1.01-1.60) and OR(G)=1.49 (1.02-2.19), respectively. Also, the variants rs567926 and rs279844 showed significance for the allele contrast: OR=1.24 (1.06-1.46) and OR=1.23 (1.08-1.43), respectively; the ORG produced similar results. The variant rs279858 produced a large heterogeneity between studies. CMA showed a trend of an association only for the variant rs567926. Recursive CMA indicated that more evidence is needed to conclude on the status of significance of all variants. There is evidence that variants in the GABRA2 gene are associated with alcoholism. However, the present findings should be interpreted with caution.

Effects of carboxypeptidase B treatment and elevated temperature on recombinant monoclonal antibody charge variants in cation-exchange chromatography analysis.

PubMed

Kim, Do Gyun; Kim, Hyoung Jin; Kim, Hong-Jin

2016-10-01

Charge variants (acidic and basic) of recombinant monoclonal antibodies (Mabs) have received much attention due to their potential biological effects. C-terminal lysine variants are common in Mabs and their proportion is affected by the manufacturing process. In the present study, changes of trastuzumab charge variants brought about by carboxypeptidase B treatment and subsequent storage at 8 or 37 °C for up to 24 h were monitored by cation-exchange chromatography analysis to investigate the effects of C-terminal lysine cleavage and its subsequent reaction at 8 or 37 °C. C-terminal lysine cleavage at 8 °C reduced the fraction of basic species and had little effect on the fraction of acidic species. Analysis of individual peaks demonstrated that C-terminal lysine cleavage induced both increases and decreases in individual acidic variants, with the result that there was little overall change in the overall proportion of acidic species. It appeared that most of the basic variant Mab molecules but only a fraction of the acidic variant molecules had C-terminal lysines. Increasing the temperature to 37 °C appeared to increase the fraction of acidic species and decrease main species significantly, without a similar change in basic species. These results indicate that length of exposure to elevated temperature is a critical consideration in charge variant analysis.

A Large Cohort of Hemoglobin Variants in Thailand: Molecular Epidemiological Study and Diagnostic Consideration

PubMed Central

Srivorakun, Hataichanok; Singha, Kritsada; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan

2014-01-01

Background Hemoglobin (Hb) variants are structurally inherited changes of globin chains. Accurate diagnoses of these variants are important for planning of appropriate management and genetic counseling. Since no epidemiological study has been conducted before, we have investigated frequencies, molecular and hematological features of Hb variants found in a large cohort of Thai subjects. Materials and Methods Study was conducted on 26,013 unrelated subjects, inhabiting in all geographical parts of Thailand over a period of 11 years from January 2002-December 2012. Hb analysis was done on high performance liquid chromatography (HPLC) or capillary electrophoresis (CE). Mutations causing Hb variants were identified using PCR and related techniques. Results Among 26,013 subjects investigated, 636 (2.4%) were found to carry Hb variants. Of these 636 subjects, 142 (22.4%) carried α-chain variants with 13 different mutations. The remaining included 451 (70.9%) cases with 16 β-chain variants, 37 (5.8%) cases with Hb Lepore (δβ-hybrid Hb) and 6 (0.9%) cases with a single δ-chain variant. The most common α-globin chain variant was the Hb Q-Thailand (α74GAC-CAC, Asp-His) which was found in 101 cases (15.8%). For β-globin chain variants, Hb Hope (β136GGT-GAT, Gly-Asp) and Hb Tak (β146+AC, Ter-Thr) are the two most common ones, found in 121 (19.0%) and 90 (14.2%) cases, respectively. Seven Hb variants have never been found in Thai population. Hb analysis profiles on HPLC or CE of these variants were illustrated to guide presumptive diagnostics. Conclusions Hb variants are common and heterogeneous in Thai population. With varieties of thalassemias and hemoglobinopathies in the population, interactions between them leading to complex syndromes are common and render their diagnoses difficult in routine practices. Knowledge of the spectrum, molecular basis, genotype-phenotype correlation and diagnostic features should prove useful for prevention and control of the diseases in the region. PMID:25244406

Comprehensive splicing functional analysis of DNA variants of the BRCA2 gene by hybrid minigenes

PubMed Central

2012-01-01

Introduction The underlying pathogenic mechanism of a large fraction of DNA variants of disease-causing genes is the disruption of the splicing process. We aimed to investigate the effect on splicing of the BRCA2 variants c.8488-1G > A (exon 20) and c.9026_9030del (exon 23), as well as 41 BRCA2 variants reported in the Breast Cancer Information Core (BIC) mutation database. Methods DNA variants were analyzed with the splicing prediction programs NNSPLICE and Human Splicing Finder. Functional analyses of candidate variants were performed by lymphocyte RT-PCR and/or hybrid minigene assays. Forty-one BIC variants of exons 19, 20, 23 and 24 were bioinformatically selected and generated by PCR-mutagenesis of the wild type minigenes. Results Lymphocyte RT-PCR of c.8488-1G > A showed intron 19 retention and a 12-nucleotide deletion in exon 20, whereas c.9026_9030del did not show any splicing anomaly. Minigene analysis of c.8488-1G > A displayed the aforementioned aberrant isoforms but also exon 20 skipping. We further evaluated the splicing outcomes of 41 variants of four BRCA2 exons by minigene analysis. Eighteen variants presented splicing aberrations. Most variants (78.9%) disrupted the natural splice sites, whereas four altered putative enhancers/silencers and had a weak effect. Fluorescent RT-PCR of minigenes accurately detected 14 RNA isoforms generated by cryptic site usage, exon skipping and intron retention events. Fourteen variants showed total splicing disruptions and were predicted to truncate or eliminate essential domains of BRCA2. Conclusions A relevant proportion of BRCA2 variants are correlated with splicing disruptions, indicating that RNA analysis is a valuable tool to assess the pathogenicity of a particular DNA change. The minigene system is a straightforward and robust approach to detect variants with an impact on splicing and contributes to a better knowledge of this gene expression step. PMID:22632462

Novel Common Genetic Susceptibility Loci for Colorectal Cancer.

PubMed

Schmit, Stephanie L; Edlund, Christopher K; Schumacher, Fredrick R; Gong, Jian; Harrison, Tabitha A; Huyghe, Jeroen R; Qu, Chenxu; Melas, Marilena; Van Den Berg, David J; Wang, Hansong; Tring, Stephanie; Plummer, Sarah J; Albanes, Demetrius; Alonso, M Henar; Amos, Christopher I; Anton, Kristen; Aragaki, Aaron K; Arndt, Volker; Barry, Elizabeth L; Berndt, Sonja I; Bezieau, Stéphane; Bien, Stephanie; Bloomer, Amanda; Boehm, Juergen; Boutron-Ruault, Marie-Christine; Brenner, Hermann; Brezina, Stefanie; Buchanan, Daniel D; Butterbach, Katja; Caan, Bette J; Campbell, Peter T; Carlson, Christopher S; Castelao, Jose E; Chan, Andrew T; Chang-Claude, Jenny; Chanock, Stephen J; Cheng, Iona; Cheng, Ya-Wen; Chin, Lee Soo; Church, James M; Church, Timothy; Coetzee, Gerhard A; Cotterchio, Michelle; Cruz Correa, Marcia; Curtis, Keith R; Duggan, David; Easton, Douglas F; English, Dallas; Feskens, Edith J M; Fischer, Rocky; FitzGerald, Liesel M; Fortini, Barbara K; Fritsche, Lars G; Fuchs, Charles S; Gago-Dominguez, Manuela; Gala, Manish; Gallinger, Steven J; Gauderman, W James; Giles, Graham G; Giovannucci, Edward L; Gogarten, Stephanie M; Gonzalez-Villalpando, Clicerio; Gonzalez-Villalpando, Elena M; Grady, William M; Greenson, Joel K; Gsur, Andrea; Gunter, Marc; Haiman, Christopher A; Hampe, Jochen; Harlid, Sophia; Harju, John F; Hayes, Richard B; Hofer, Philipp; Hoffmeister, Michael; Hopper, John L; Huang, Shu-Chen; Huerta, Jose Maria; Hudson, Thomas J; Hunter, David J; Idos, Gregory E; Iwasaki, Motoki; Jackson, Rebecca D; Jacobs, Eric J; Jee, Sun Ha; Jenkins, Mark A; Jia, Wei-Hua; Jiao, Shuo; Joshi, Amit D; Kolonel, Laurence N; Kono, Suminori; Kooperberg, Charles; Krogh, Vittorio; Kuehn, Tilman; Küry, Sébastien; LaCroix, Andrea; Laurie, Cecelia A; Lejbkowicz, Flavio; Lemire, Mathieu; Lenz, Heinz-Josef; Levine, David; Li, Christopher I; Li, Li; Lieb, Wolfgang; Lin, Yi; Lindor, Noralane M; Liu, Yun-Ru; Loupakis, Fotios; Lu, Yingchang; Luh, Frank; Ma, Jing; Mancao, Christoph; Manion, Frank J; Markowitz, Sanford D; Martin, Vicente; Matsuda, Koichi; Matsuo, Keitaro; McDonnell, Kevin J; McNeil, Caroline E; Milne, Roger; Molina, Antonio J; Mukherjee, Bhramar; Murphy, Neil; Newcomb, Polly A; Offit, Kenneth; Omichessan, Hanane; Palli, Domenico; Cotoré, Jesus P Paredes; Pérez-Mayoral, Julyann; Pharoah, Paul D; Potter, John D; Qu, Conghui; Raskin, Leon; Rennert, Gad; Rennert, Hedy S; Riggs, Bridget M; Schafmayer, Clemens; Schoen, Robert E; Sellers, Thomas A; Seminara, Daniela; Severi, Gianluca; Shi, Wei; Shibata, David; Shu, Xiao-Ou; Siegel, Erin M; Slattery, Martha L; Southey, Melissa; Stadler, Zsofia K; Stern, Mariana C; Stintzing, Sebastian; Taverna, Darin; Thibodeau, Stephen N; Thomas, Duncan C; Trichopoulou, Antonia; Tsugane, Shoichiro; Ulrich, Cornelia M; van Duijnhoven, Franzel J B; van Guelpan, Bethany; Vijai, Joseph; Virtamo, Jarmo; Weinstein, Stephanie J; White, Emily; Win, Aung Ko; Wolk, Alicja; Woods, Michael; Wu, Anna H; Wu, Kana; Xiang, Yong-Bing; Yen, Yun; Zanke, Brent W; Zeng, Yi-Xin; Zhang, Ben; Zubair, Niha; Kweon, Sun-Seog; Figueiredo, Jane C; Zheng, Wei; Marchand, Loic Le; Lindblom, Annika; Moreno, Victor; Peters, Ulrike; Casey, Graham; Hsu, Li; Conti, David V; Gruber, Stephen B

2018-06-16

Previous genome-wide association studies (GWAS) have identified 42 loci (P < 5 × 10-8) associated with risk of colorectal cancer (CRC). Expanded consortium efforts facilitating the discovery of additional susceptibility loci may capture unexplained familial risk. We conducted a GWAS in European descent CRC cases and control subjects using a discovery-replication design, followed by examination of novel findings in a multiethnic sample (cumulative n = 163 315). In the discovery stage (36 948 case subjects/30 864 control subjects), we identified genetic variants with a minor allele frequency of 1% or greater associated with risk of CRC using logistic regression followed by a fixed-effects inverse variance weighted meta-analysis. All novel independent variants reaching genome-wide statistical significance (two-sided P < 5 × 10-8) were tested for replication in separate European ancestry samples (12 952 case subjects/48 383 control subjects). Next, we examined the generalizability of discovered variants in East Asians, African Americans, and Hispanics (12 085 case subjects/22 083 control subjects). Finally, we examined the contributions of novel risk variants to familial relative risk and examined the prediction capabilities of a polygenic risk score. All statistical tests were two-sided. The discovery GWAS identified 11 variants associated with CRC at P < 5 × 10-8, of which nine (at 4q22.2/5p15.33/5p13.1/6p21.31/6p12.1/10q11.23/12q24.21/16q24.1/20q13.13) independently replicated at a P value of less than .05. Multiethnic follow-up supported the generalizability of discovery findings. These results demonstrated a 14.7% increase in familial relative risk explained by common risk alleles from 10.3% (95% confidence interval [CI] = 7.9% to 13.7%; known variants) to 11.9% (95% CI = 9.2% to 15.5%; known and novel variants). A polygenic risk score identified 4.3% of the population at an odds ratio for developing CRC of at least 2.0. This study provides insight into the architecture of common genetic variation contributing to CRC etiology and improves risk prediction for individualized screening.

Three new pancreatic cancer susceptibility signals identified on chromosomes 1q32.1, 5p15.33 and 8q24.21

PubMed Central

Zhang, Mingfeng; Wang, Zhaoming; Obazee, Ofure; Jia, Jinping; Childs, Erica J.; Hoskins, Jason; Figlioli, Gisella; Mocci, Evelina; Collins, Irene; Chung, Charles C.; Hautman, Christopher; Arslan, Alan A.; Beane-Freeman, Laura; Bracci, Paige M.; Buring, Julie; Duell, Eric J.; Gallinger, Steven; Giles, Graham G.; Goodman, Gary E.; Goodman, Phyllis J.; Kamineni, Aruna; Kolonel, Laurence N.; Kulke, Matthew H.; Malats, Núria; Olson, Sara H.; Sesso, Howard D.; Visvanathan, Kala; White, Emily; Zheng, Wei; Abnet, Christian C.; Albanes, Demetrius; Andreotti, Gabriella; Brais, Lauren; Bueno-de-Mesquita, H. Bas; Basso, Daniela; Berndt, Sonja I.; Boutron-Ruault, Marie-Christine; Bijlsma, Maarten F.; Brenner, Hermann; Burdette, Laurie; Campa, Daniele; Caporaso, Neil E.; Capurso, Gabriele; Cavestro, Giulia Martina; Cotterchio, Michelle; Costello, Eithne; Elena, Joanne; Boggi, Ugo; Gaziano, J. Michael; Gazouli, Maria; Giovannucci, Edward L.; Goggins, Michael; Gross, Myron; Haiman, Christopher A.; Hassan, Manal; Helzlsouer, Kathy J.; Hu, Nan; Hunter, David J.; Iskierka-Jazdzewska, Elzbieta; Jenab, Mazda; Kaaks, Rudolf; Key, Timothy J.; Khaw, Kay-Tee; Klein, Eric A.; Kogevinas, Manolis; Krogh, Vittorio; Kupcinskas, Juozas; Kurtz, Robert C.; Landi, Maria T.; Landi, Stefano; Marchand, Le Loic; Mambrini, Andrea; Mannisto, Satu; Milne, Roger L.; Neale, Rachel E.; Oberg, Ann L.; Panico, Salvatore; Patel, Alpa V.; Peeters, Petra H. M.; Peters, Ulrike; Pezzilli, Raffaele; Porta, Miquel; Purdue, Mark; Quiros, J. Ramón; Riboli, Elio; Rothman, Nathaniel; Scarpa, Aldo; Scelo, Ghislaine; Shu, Xiao-Ou; Silverman, Debra T.; Soucek, Pavel; Strobel, Oliver; Sund, Malin; Małecka-Panas, Ewa; Taylor, Philip R.; Tavano, Francesca; Travis, Ruth C.; Thornquist, Mark; Tjønneland, Anne; Tobias, Geoffrey S.; Trichopoulos, Dimitrios; Vashist, Yogesh; Vodicka, Pavel; Wactawski-Wende, Jean; Wentzensen, Nicolas; Yu, Herbert; Yu, Kai; Zeleniuch-Jacquotte, Anne; Kooperberg, Charles; Risch, Harvey A.; Jacobs, Eric J.; Li, Donghui; Fuchs, Charles; Hoover, Robert; Hartge, Patricia; Chanock, Stephen J.; Petersen, Gloria M.; Stolzenberg-Solomon, Rachael S.; Wolpin, Brian M.; Kraft, Peter; Klein, Alison P.; Canzian, Federico; Amundadottir, Laufey T.

2016-01-01

Genome-wide association studies (GWAS) have identified common pancreatic cancer susceptibility variants at 13 chromosomal loci in individuals of European descent. To identify new susceptibility variants, we performed imputation based on 1000 Genomes (1000G) Project data and association analysis using 5,107 case and 8,845 control subjects from 27 cohort and case-control studies that participated in the PanScan I-III GWAS. This analysis, in combination with a two-staged replication in an additional 6,076 case and 7,555 control subjects from the PANcreatic Disease ReseArch (PANDoRA) and Pancreatic Cancer Case-Control (PanC4) Consortia uncovered 3 new pancreatic cancer risk signals marked by single nucleotide polymorphisms (SNPs) rs2816938 at chromosome 1q32.1 (per allele odds ratio (OR) = 1.20, P = 4.88×10−15), rs10094872 at 8q24.21 (OR = 1.15, P = 3.22×10−9) and rs35226131 at 5p15.33 (OR = 0.71, P = 1.70×10−8). These SNPs represent independent risk variants at previously identified pancreatic cancer risk loci on chr1q32.1 (NR5A2), chr8q24.21 (MYC) and chr5p15.33 (CLPTM1L-TERT) as per analyses conditioned on previously reported susceptibility variants. We assessed expression of candidate genes at the three risk loci in histologically normal (n = 10) and tumor (n = 8) derived pancreatic tissue samples and observed a marked reduction of NR5A2 expression (chr1q32.1) in the tumors (fold change -7.6, P = 5.7×10−8). This finding was validated in a second set of paired (n = 20) histologically normal and tumor derived pancreatic tissue samples (average fold change for three NR5A2 isoforms -31.3 to -95.7, P = 7.5×10−4-2.0×10−3). Our study has identified new susceptibility variants independently conferring pancreatic cancer risk that merit functional follow-up to identify target genes and explain the underlying biology. PMID:27579533

Selection of an HLA-C*03:04-Restricted HIV-1 p24 Gag Sequence Variant Is Associated with Viral Escape from KIR2DL3+ Natural Killer Cells: Data from an Observational Cohort in South Africa.

PubMed

Hölzemer, Angelique; Thobakgale, Christina F; Jimenez Cruz, Camilo A; Garcia-Beltran, Wilfredo F; Carlson, Jonathan M; van Teijlingen, Nienke H; Mann, Jaclyn K; Jaggernath, Manjeetha; Kang, Seung-gu; Körner, Christian; Chung, Amy W; Schafer, Jamie L; Evans, David T; Alter, Galit; Walker, Bruce D; Goulder, Philip J; Carrington, Mary; Hartmann, Pia; Pertel, Thomas; Zhou, Ruhong; Ndung'u, Thumbi; Altfeld, Marcus

2015-11-01

Viruses can evade immune surveillance, but the underlying mechanisms are insufficiently understood. Here, we sought to understand the mechanisms by which natural killer (NK) cells recognize HIV-1-infected cells and how this virus can evade NK-cell-mediated immune pressure. Two sequence mutations in p24 Gag associated with the presence of specific KIR/HLA combined genotypes were identified in HIV-1 clade C viruses from a large cohort of infected, untreated individuals in South Africa (n = 392), suggesting viral escape from KIR+ NK cells through sequence variations within HLA class I-presented epitopes. One sequence polymorphism at position 303 of p24 Gag (TGag303V), selected for in infected individuals with both KIR2DL3 and HLA-C*03:04, enabled significantly better binding of the inhibitory KIR2DL3 receptor to HLA-C*03:04-expressing cells presenting this variant epitope compared to the wild-type epitope (wild-type mean 18.01 ± 10.45 standard deviation [SD] and variant mean 44.67 ± 14.42 SD, p = 0.002). Furthermore, activation of primary KIR2DL3+ NK cells from healthy donors in response to HLA-C*03:04+ target cells presenting the variant epitope was significantly reduced in comparison to cells presenting the wild-type sequence (wild-type mean 0.78 ± 0.07 standard error of the mean [SEM] and variant mean 0.63 ± 0.07 SEM, p = 0.012). Structural modeling and surface plasmon resonance of KIR/peptide/HLA interactions in the context of the different viral sequence variants studied supported these results. Future studies will be needed to assess processing and antigen presentation of the investigated HIV-1 epitope in natural infection, and the consequences for viral control. These data provide novel insights into how viruses can evade NK cell immunity through the selection of mutations in HLA-presented epitopes that enhance binding to inhibitory NK cell receptors. Better understanding of the mechanisms by which HIV-1 evades NK-cell-mediated immune pressure and the functional validation of a structural modeling approach will facilitate the development of novel targeted immune interventions to harness the antiviral activities of NK cells.

MANPRINT Evaluation of the High Mobility Multipurpose Wheeled Vehicle-Heavy Variant (HMMWV-HV)

DTIC Science & Technology

1990-02-01

gap between brake and gas pedal . Knee hits throttle control. Metal below seat hits back of calf muscle. Visibility Is the driver’s visibility adequate...24, No - 0, NA - 0] Gas pedal : 79. Parked? [Yes - 24, No - 0, NA - 0] 80. Primary and Secondary roads? [Yes - 24, No - 0, NA - 0] 81. Cross-country...Yes - 24, No - 0, NA - 0] 89 Brake pedal : 82. Parked? [Yes - 24, No - 0, NA - 0] 83. Primary and Secondary roads? [Yes - 24, No - 0, NA - 0] 84

Clinical validity of new genetic biomarkers of irinotecan neutropenia: an independent replication study.

PubMed

Crona, D J; Ramirez, J; Qiao, W; de Graan, A-J; Ratain, M J; van Schaik, R H N; Mathijssen, R H J; Rosner, G L; Innocenti, F

2016-02-01

The overall goal of this study was to provide evidence for the clinical validity of nine genetic variants in five genes previously associated with irinotecan neutropenia and pharmacokinetics. Variants associated with absolute neutrophil count (ANC) nadir and/or irinotecan pharmacokinetics in a discovery cohort of cancer patients were genotyped in an independent replication cohort of 108 cancer patients. Patients received single-agent irinotecan every 3 weeks. For ANC nadir, we replicated UGT1A1*28, UGT1A1*93 and SLCO1B1*1b in univariate analyses. For irinotecan area under the concentration-time curve (AUC0-24), we replicated ABCC2 -24C>T; however, ABCC2 -24C>T only predicted a small fraction of the variance. For SN-38 AUC0-24 and the glucuronidation ratio, we replicated UGT1A1*28 and UGT1A1*93. In addition to UGT1A1*28, this study independently validated UGT1A1*93 and SLCO1B1*1b as new predictors of irinotecan neutropenia. Further demonstration of their clinical utility will optimize irinotecan therapy in cancer patients.

The structure and mobility of the intervariant boundaries in 18R martensite in a Cu-Zn-Al alloy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, J.X.; Zheng, Y.F.; Zhao, L.C.

1999-05-28

Detailed crystallographic analysis was carried out on the martensitic transformation and the various variant combinations in 18R martensite in a Cu-Zn-Al alloy. The self-accommodation of martensitic shear strain is quite perfect within a variant group, but not effective or even does not exist for variant combinations which belong to different groups. Twenty-three unique variant combinations between 24 martensite variants can be divided into four groups, i.e. reflection twin, 180 rotation twin, 120 rotation twin and 90 rotation twin. TEM and HREM observations show that the A C boundary is straight, well-defined and perfectly coherent, the A B boundary is irrational,more » coherent and gradually curved, and the A D boundary is stepped. The A C and A B boundaries have obvious mobility, and the mobility is not effective for A D boundary. The interplate group boundaries are curved, blurred and immobile. The morphology, structure and mobility of interplate boundary are all related to the degree of self-accommodation and the misorientation of twin boundary.« less

Common genetic variants associated with thyroid function may be risk alleles for Hashimoto's disease and Graves' disease.

PubMed

Campbell, Purdey; Brix, Thomas H; Wilson, Scott G; Ward, Lynley C; Hui, Jennie; Beilby, John P; Hegedüs, Laszlo; Walsh, John P

2015-02-14

Recent studies have identified common genetic variants associated with TSH, free T4 and thyroid peroxidase antibodies, but it is unclear whether these differ between patients with Hashimoto's disease and Graves' disease. To examine whether 11 common genetic variants differ between Graves' disease and Hashimoto's disease. We genotyped 11 common variants in a discovery cohort of 203 Australian patients with autoimmune thyroid disease (AITD). Two variants with significant or suggestive associations were analysed in a replication cohort of 384 Danish patients. For rs753760 (PDE10A), the minor allele frequency in Graves' disease and Hashimoto's disease was 0·38 vs. 0·23, respectively, (P = 6·42 × 10 -4 ) in the discovery cohort, 0·29 vs. 0·24 (P = 0·147) in the replication cohort and 0·32 vs. 0·24 in combined analysis (P = 0·0021; all analyses adjusted for sex). In healthy controls from Busselton, the frequency was 0·29, significantly different from Hashimoto's disease but not Graves' disease. For rs4889009 (MAF gene region), the frequency of the minor G-allele in Graves' disease and Hashimoto's disease was 0·48 vs. 0·36 (P = 0·0156) in the discovery cohort, 0·48 vs. 0·34 (P = 1·83 × 10 -4 ) in the replication cohort and 0·48 vs. 0·35 in the combined analysis (P = 7·53 × 10 -6 ); in controls, the frequency was 0·38, significantly different from Graves' disease but not Hashimoto's disease. After further adjustment for smoking, associations with rs4889009 remained significant, whereas those with rs753760 were not. Common variants in PDE10A and MAF gene regions may influence whether patients with AITD develop Graves' disease or Hashimoto's disease. © 2015 John Wiley & Sons Ltd.

Bioavailability of Lumefantrine Is Significantly Enhanced with a Novel Formulation Approach, an Outcome from a Randomized, Open-Label Pharmacokinetic Study in Healthy Volunteers.

PubMed

Jain, Jay Prakash; Leong, F Joel; Chen, Lan; Kalluri, Sampath; Koradia, Vishal; Stein, Daniel S; Wolf, Marie-Christine; Sunkara, Gangadhar; Kota, Jagannath

2017-09-01

The artemether-lumefantrine combination requires food intake for the optimal absorption of lumefantrine. In an attempt to enhance the bioavailability of lumefantrine, new solid dispersion formulations (SDF) were developed, and the pharmacokinetics of two SDF variants were assessed in a randomized, open-label, sequential two-part study in healthy volunteers. In part 1, the relative bioavailability of the two SDF variants was compared with that of the conventional formulation after administration of a single dose of 480 mg under fasted conditions in three parallel cohorts. In part 2, the pharmacokinetics of lumefantrine from both SDF variants were evaluated after a single dose of 480 mg under fed conditions and a single dose of 960 mg under fasted conditions. The bioavailability of lumefantrine from SDF variant 1 and variant 2 increased up to ∼48-fold and ∼24-fold, respectively, relative to that of the conventional formulation. Both variants demonstrated a positive food effect and a less than proportional increase in exposure between the 480-mg and 960-mg doses. Most adverse events (AEs) were mild to moderate in severity and not suspected to be related to the study drug. All five drug-related AEs occurred in subjects taking SDF variant 2. No clinically significant treatment-emergent changes in vital signs, electrocardiograms, or laboratory blood assessments were noted. The solid dispersion formulation enhances the lumefantrine bioavailability to a significant extent, and SDF variant 1 is superior to SDF variant 2. Copyright © 2017 Jain et al.

Fine-scale mapping of 8q24 locus identifies multiple independent risk variants for breast cancer

PubMed Central

Zheng, Wei; Michailidou, Kyriaki; Ghoussaini, Maya; Bolla, Manjeet K.; Wang, Qin; Dennis, Joe; Lush, Michael; Milne, Roger L.; Shu, Xiao-Ou; Beesley, Jonathan; Kar, Siddhartha; Andrulis, Irene L.; Anton-Culver, Hoda; Arndt, Volker; Beckmann, Matthias W.; Zhao, Zhiguo; Guo, Xingyi; Benitez, Javier; Beeghly-Fadiel, Alicia; Blot, William; Bogdanova, Natalia V.; Bojesen, Stig E.; Brauch, Hiltrud; Brenner, Hermann; Brinton, Louise; Broeks, Annegien; Brüning, Thomas; Burwinkel, Barbara; Cai, Hui; Canisius, Sander; Chang-Claude, Jenny; Choi, Ji-Yeob; Couch, Fergus J.; Cox, Angela; Cross, Simon S.; Czene, Kamila; Darabi, Hatef; Devilee, Peter; Droit, Arnaud; Dork, Thilo; Fasching, Peter A.; Fletcher, Olivia; Flyger, Henrik; Fostira, Florentia; Gaborieau, Valerie; García-Closas, Montserrat; Giles, Graham G.; Guenel, Pascal; Haiman, Christopher A.; Hamann, Ute; Hartman, Mikael; Miao, Hui; Hollestelle, Antoinette; Hopper, John L.; Hsiung, Chia-Ni; Ito, Hidemi; Jakubowska, Anna; Johnson, Nichola; Torres, Diana; Kabisch, Maria; Kang, Daehee; Khan, Sofia; Knight, Julia A.; Kosma, Veli-Matti; Lambrechts, Diether; Li, Jingmei; Lindblom, Annika; Lophatananon, Artitaya; Lubinski, Jan; Mannermaa, Arto; Manoukian, Siranoush; Le Marchand, Loic; Margolin, Sara; Marme, Frederik; Matsuo, Keitaro; McLean, Catriona; Meindl, Alfons; Muir, Kenneth; Neuhausen, Susan L.; Nevanlinna, Heli; Nord, Silje; Børresen-Dale, Anne-Lise; Olson, Janet E.; Orr, Nick; van den Ouweland, Ans M.W.; Peterlongo, Paolo; Putti, Thomas Choudary; Rudolph, Anja; Sangrajrang, Suleeporn; Sawyer, Elinor J.; Schmidt, Marjanka K.; Schmutzler, Rita K.; Shen, Chen-Yang; Hou, Ming-Feng; Shrubsole, Matha J; Southey, Melissa C.; Swerdlow, Anthony; Teo, Soo Hwang; Thienpont, Bernard; Toland, Amanda E.; Tollenaar, Robert A.E.M.; Tomlinson, Ian; Truong, Therese; Tseng, Chiu-chen; Wen, Wanqing; Winqvist, Robert; Wu, Anna H.; Yip, Cheng Har; Zamora, Pilar M.; Zheng, Ying; Floris, Giuseppe; Cheng, Ching-Yu; Hooning, Maartje J.; Martens, John W.M.; Seynaeve, Caroline; Kristensen, Vessela N.; Hall, Per; Pharoah, Paul D.P.; Simard, Jacques; Chenevix-Trench, Georgia; Dunning, Alison M.; Antoniou, Antonis C.; Easton, Douglas F.; Cai, Qiuyin; Long, Jirong

2016-01-01

Previous genome-wide association studies among women of European ancestry identified two independent breast cancer susceptibility loci represented by single nucleotide polymorphisms (SNPs) rs13281615 and rs11780156 at 8q24. We conducted a fine-mapping study across 2.06 Mb (chr8:127,561,724 −129,624,067, hg19) in 55,540 breast cancer cases and 51,168 controls within the Breast Cancer Association Consortium. We found three additional independent association signals in women of European ancestry, represented by rs35961416 (OR = 0.95, 95% CI = 0.93-0.97, conditional P = 5.8 × 10−6), rs7815245 (OR = 0.94, 95% CI = 0.91-0.96, conditional P = 1.1 × 10−6), and rs2033101 (OR = 1.05, 95% CI = 1.02-1.07, conditional P = 1.1 × 10−4). Integrative analysis using functional genomic data from the Roadmap Epigenomics, the Encyclopedia of DNA Elements project, the Cancer Genome Atlas, and other public resources implied that SNPs rs7815245 in Signal 3, and rs1121948 in Signal 5 (in linkage disequilibrium with rs11780156, r2 = 0.77), were putatively functional variants for two of the five independent association signals. Our results highlight multiple 8q24 variants associated with breast cancer susceptibility in women of European ancestry. PMID:27087578

Fine-scale mapping of 8q24 locus identifies multiple independent risk variants for breast cancer.

PubMed

Shi, Jiajun; Zhang, Yanfeng; Zheng, Wei; Michailidou, Kyriaki; Ghoussaini, Maya; Bolla, Manjeet K; Wang, Qin; Dennis, Joe; Lush, Michael; Milne, Roger L; Shu, Xiao-Ou; Beesley, Jonathan; Kar, Siddhartha; Andrulis, Irene L; Anton-Culver, Hoda; Arndt, Volker; Beckmann, Matthias W; Zhao, Zhiguo; Guo, Xingyi; Benitez, Javier; Beeghly-Fadiel, Alicia; Blot, William; Bogdanova, Natalia V; Bojesen, Stig E; Brauch, Hiltrud; Brenner, Hermann; Brinton, Louise; Broeks, Annegien; Brüning, Thomas; Burwinkel, Barbara; Cai, Hui; Canisius, Sander; Chang-Claude, Jenny; Choi, Ji-Yeob; Couch, Fergus J; Cox, Angela; Cross, Simon S; Czene, Kamila; Darabi, Hatef; Devilee, Peter; Droit, Arnaud; Dork, Thilo; Fasching, Peter A; Fletcher, Olivia; Flyger, Henrik; Fostira, Florentia; Gaborieau, Valerie; García-Closas, Montserrat; Giles, Graham G; Guenel, Pascal; Haiman, Christopher A; Hamann, Ute; Hartman, Mikael; Miao, Hui; Hollestelle, Antoinette; Hopper, John L; Hsiung, Chia-Ni; Ito, Hidemi; Jakubowska, Anna; Johnson, Nichola; Torres, Diana; Kabisch, Maria; Kang, Daehee; Khan, Sofia; Knight, Julia A; Kosma, Veli-Matti; Lambrechts, Diether; Li, Jingmei; Lindblom, Annika; Lophatananon, Artitaya; Lubinski, Jan; Mannermaa, Arto; Manoukian, Siranoush; Le Marchand, Loic; Margolin, Sara; Marme, Frederik; Matsuo, Keitaro; McLean, Catriona; Meindl, Alfons; Muir, Kenneth; Neuhausen, Susan L; Nevanlinna, Heli; Nord, Silje; Børresen-Dale, Anne-Lise; Olson, Janet E; Orr, Nick; van den Ouweland, Ans M W; Peterlongo, Paolo; Putti, Thomas Choudary; Rudolph, Anja; Sangrajrang, Suleeporn; Sawyer, Elinor J; Schmidt, Marjanka K; Schmutzler, Rita K; Shen, Chen-Yang; Hou, Ming-Feng; Shrubsole, Matha J; Southey, Melissa C; Swerdlow, Anthony; Teo, Soo Hwang; Thienpont, Bernard; Toland, Amanda E; Tollenaar, Robert A E M; Tomlinson, Ian; Truong, Therese; Tseng, Chiu-Chen; Wen, Wanqing; Winqvist, Robert; Wu, Anna H; Yip, Cheng Har; Zamora, Pilar M; Zheng, Ying; Floris, Giuseppe; Cheng, Ching-Yu; Hooning, Maartje J; Martens, John W M; Seynaeve, Caroline; Kristensen, Vessela N; Hall, Per; Pharoah, Paul D P; Simard, Jacques; Chenevix-Trench, Georgia; Dunning, Alison M; Antoniou, Antonis C; Easton, Douglas F; Cai, Qiuyin; Long, Jirong

2016-09-15

Previous genome-wide association studies among women of European ancestry identified two independent breast cancer susceptibility loci represented by single nucleotide polymorphisms (SNPs) rs13281615 and rs11780156 at 8q24. A fine-mapping study across 2.06 Mb (chr8:127,561,724-129,624,067, hg19) in 55,540 breast cancer cases and 51,168 controls within the Breast Cancer Association Consortium was conducted. Three additional independent association signals in women of European ancestry, represented by rs35961416 (OR = 0.95, 95% CI = 0.93-0.97, conditional p = 5.8 × 10(-6) ), rs7815245 (OR = 0.94, 95% CI = 0.91-0.96, conditional p = 1.1 × 10(-6) ) and rs2033101 (OR = 1.05, 95% CI = 1.02-1.07, conditional p = 1.1 × 10(-4) ) were found. Integrative analysis using functional genomic data from the Roadmap Epigenomics, the Encyclopedia of DNA Elements project, the Cancer Genome Atlas and other public resources implied that SNPs rs7815245 in Signal 3, and rs1121948 in Signal 5 (in linkage disequilibrium with rs11780156, r(2)  = 0.77), were putatively functional variants for two of the five independent association signals. The results highlighted multiple 8q24 variants associated with breast cancer susceptibility in women of European ancestry. © 2016 UICC.

Association of Cardiometabolic Genes with Arsenic Metabolism Biomarkers in American Indian Communities: The Strong Heart Family Study (SHFS)

PubMed Central

Balakrishnan, Poojitha; Vaidya, Dhananjay; Franceschini, Nora; Voruganti, V. Saroja; Gribble, Matthew O.; Haack, Karin; Laston, Sandra; Umans, Jason G.; Francesconi, Kevin A.; Goessler, Walter; North, Kari E.; Lee, Elisa; Yracheta, Joseph; Best, Lyle G.; MacCluer, Jean W.; Kent, Jack; Cole, Shelley A.; Navas-Acien, Ana

2016-01-01

Background: Metabolism of inorganic arsenic (iAs) is subject to inter-individual variability, which is explained partly by genetic determinants. Objectives: We investigated the association of genetic variants with arsenic species and principal components of arsenic species in the Strong Heart Family Study (SHFS). Methods: We examined variants previously associated with cardiometabolic traits (~ 200,000 from Illumina Cardio MetaboChip) or arsenic metabolism and toxicity (670) among 2,428 American Indian participants in the SHFS. Urine arsenic species were measured by high performance liquid chromatography–inductively coupled plasma mass spectrometry (HPLC-ICP-MS), and percent arsenic species [iAs, monomethylarsonate (MMA), and dimethylarsinate (DMA), divided by their sum × 100] were logit transformed. We created two orthogonal principal components that summarized iAs, MMA, and DMA and were also phenotypes for genetic analyses. Linear regression was performed for each phenotype, dependent on allele dosage of the variant. Models accounted for familial relatedness and were adjusted for age, sex, total arsenic levels, and population stratification. Single nucleotide polymorphism (SNP) associations were stratified by study site and were meta-analyzed. Bonferroni correction was used to account for multiple testing. Results: Variants at 10q24 were statistically significant for all percent arsenic species and principal components of arsenic species. The index SNP for iAs%, MMA%, and DMA% (rs12768205) and for the principal components (rs3740394, rs3740393) were located near AS3MT, whose gene product catalyzes methylation of iAs to MMA and DMA. Among the candidate arsenic variant associations, functional SNPs in AS3MT and 10q24 were most significant (p < 9.33 × 10–5). Conclusions: This hypothesis-driven association study supports the role of common variants in arsenic metabolism, particularly AS3MT and 10q24. Citation: Balakrishnan P, Vaidya D, Franceschini N, Voruganti VS, Gribble MO, Haack K, Laston S, Umans JG, Francesconi KA, Goessler W, North KE, Lee E, Yracheta J, Best LG, MacCluer JW, Kent J Jr., Cole SA, Navas-Acien A. 2017. Association of cardiometabolic genes with arsenic metabolism biomarkers in American Indian communities: the Strong Heart Family Study (SHFS). Environ Health Perspect 125:15–22; http://dx.doi.org/10.1289/EHP251 PMID:27352405

Association of Cardiometabolic Genes with Arsenic Metabolism Biomarkers in American Indian Communities: The Strong Heart Family Study (SHFS).

PubMed

Balakrishnan, Poojitha; Vaidya, Dhananjay; Franceschini, Nora; Voruganti, V Saroja; Gribble, Matthew O; Haack, Karin; Laston, Sandra; Umans, Jason G; Francesconi, Kevin A; Goessler, Walter; North, Kari E; Lee, Elisa; Yracheta, Joseph; Best, Lyle G; MacCluer, Jean W; Kent, Jack; Cole, Shelley A; Navas-Acien, Ana

2017-01-01

Metabolism of inorganic arsenic (iAs) is subject to inter-individual variability, which is explained partly by genetic determinants. We investigated the association of genetic variants with arsenic species and principal components of arsenic species in the Strong Heart Family Study (SHFS). We examined variants previously associated with cardiometabolic traits (~ 200,000 from Illumina Cardio MetaboChip) or arsenic metabolism and toxicity (670) among 2,428 American Indian participants in the SHFS. Urine arsenic species were measured by high performance liquid chromatography-inductively coupled plasma mass spectrometry (HPLC-ICP-MS), and percent arsenic species [iAs, monomethylarsonate (MMA), and dimethylarsinate (DMA), divided by their sum × 100] were logit transformed. We created two orthogonal principal components that summarized iAs, MMA, and DMA and were also phenotypes for genetic analyses. Linear regression was performed for each phenotype, dependent on allele dosage of the variant. Models accounted for familial relatedness and were adjusted for age, sex, total arsenic levels, and population stratification. Single nucleotide polymorphism (SNP) associations were stratified by study site and were meta-analyzed. Bonferroni correction was used to account for multiple testing. Variants at 10q24 were statistically significant for all percent arsenic species and principal components of arsenic species. The index SNP for iAs%, MMA%, and DMA% (rs12768205) and for the principal components (rs3740394, rs3740393) were located near AS3MT, whose gene product catalyzes methylation of iAs to MMA and DMA. Among the candidate arsenic variant associations, functional SNPs in AS3MT and 10q24 were most significant (p < 9.33 × 10-5). This hypothesis-driven association study supports the role of common variants in arsenic metabolism, particularly AS3MT and 10q24. Citation: Balakrishnan P, Vaidya D, Franceschini N, Voruganti VS, Gribble MO, Haack K, Laston S, Umans JG, Francesconi KA, Goessler W, North KE, Lee E, Yracheta J, Best LG, MacCluer JW, Kent J Jr., Cole SA, Navas-Acien A. 2017. Association of cardiometabolic genes with arsenic metabolism biomarkers in American Indian communities: the Strong Heart Family Study (SHFS). Environ Health Perspect 125:15-22; http://dx.doi.org/10.1289/EHP251.

Deciphering Variability of PKD1 and PKD2 in an Italian Cohort of 643 Patients with Autosomal Dominant Polycystic Kidney Disease (ADPKD)

PubMed Central

Carrera, Paola; Calzavara, Silvia; Magistroni, Riccardo; den Dunnen, Johan T.; Rigo, Francesca; Stenirri, Stefania; Testa, Francesca; Messa, Piergiorgio; Cerutti, Roberta; Scolari, Francesco; Izzi, Claudia; Edefonti, Alberto; Negrisolo, Susanna; Benetti, Elisa; Alibrandi, Maria Teresa Sciarrone; Manunta, Paolo; Boletta, Alessandra; Ferrari, Maurizio

2016-01-01

Autosomal Dominant Polycystic Kidney Disease (ADPKD) is the most common hereditary kidney disease. We analysed PKD1 and PKD2, in a large cohort of 440 unrelated Italian patients with ADPKD and 203 relatives by direct sequencing and MLPA. Molecular and detailed phenotypic data have been collected and submitted to the PKD1/PKD2 LOVD database. This is the first large retrospective study in Italian patients, describing 701 variants, 249 (35.5%) already associated with ADPKD and 452 (64.5%) novel. According to the criteria adopted, the overall detection rate was 80% (352/440). Novel variants with uncertain significance were found in 14% of patients. Among patients with pathogenic variants, in 301 (85.5%) the disease is associated with PKD1, 196 (55.7%) truncating, 81 (23%) non truncating, 24 (6.8%) IF indels, and in 51 (14.5%) with PKD2. Our results outline the high allelic heterogeneity of variants, complicated by the presence of variants of uncertain significance as well as of multiple variants in the same subject. Classification of novel variants may be particularly cumbersome having an important impact on the genetic counselling. Our study confirms the importance to improve the assessment of variant pathogenicity for ADPKD; to this point databasing of both clinical and molecular data is crucial. PMID:27499327

Prediction of dynamic and aerodynamic characteristics of the centrifugal fan with forward curved blades

NASA Astrophysics Data System (ADS)

Polanský, Jiří; Kalmár, László; Gášpár, Roman

2013-12-01

The main aim of this paper is determine the centrifugal fan with forward curved blades aerodynamic characteristics based on numerical modeling. Three variants of geometry were investigated. The first, basic "A" variant contains 12 blades. The geometry of second "B" variant contains 12 blades and 12 semi-blades with optimal length [1]. The third, control variant "C" contains 24 blades without semi-blades. Numerical calculations were performed by CFD Ansys. Another aim of this paper is to compare results of the numerical simulation with results of approximate numerical procedure. Applied approximate numerical procedure [2] is designated to determine characteristics of the turbulent flow in the bladed space of a centrifugal-flow fan impeller. This numerical method is an extension of the hydro-dynamical cascade theory for incompressible and inviscid fluid flow. Paper also partially compares results from the numerical simulation and results from the experimental investigation. Acoustic phenomena observed during experiment, during numerical simulation manifested as deterioration of the calculation stability, residuals oscillation and thus also as a flow field oscillation. Pressure pulsations are evaluated by using frequency analysis for each variant and working condition.

Genetic analysis of LRRK2 functional domains in Brazilian patients with Parkinson's disease.

PubMed

Abdalla-Carvalho, C B; Santos-Rebouças, C B; Guimarães, B C; Campos, M; Pereira, J S; de Rosso, A L Zuma; Nicaretta, D H; Marinho e Silva, M; dos Santos, Mendonça J; Pimentel, M M G

2010-12-01

Mutations in the leucine-rich repeat kinase 2 gene (LRRK2) have been associated with Parkinson's disease (PD), and the majority of the pathogenic variants are located in the ROC and MAPKKK domains. Exons 29-31 and 38-44 (ROC and MAPKKK domains) were sequenced in 204 patients with PD, mostly Brazilian. We identified four polymorphisms, a novel silent variant p.R1398R and four substitutions: p.T1410M, p.G2019S, p.Y2189C and the novel variant p.C2139S. The most prevalent mutation was the p.G2019S (2.4%). We consider that the p.T1410M and the p.Y2189C variants are probably polymorphisms and that the p.C2139S mutation is potentially pathogenic. © 2010 The Author(s). European Journal of Neurology © 2010 EFNS.

Identification of low-frequency TRAF3IP2 coding variants in psoriatic arthritis patients and functional characterization

PubMed Central

2012-01-01

Introduction In recent genome-wide association studies for psoriatic arthritis (PsA) and psoriasis vulgaris, common coding variants in the TRAF3IP2 gene were identified to contribute to susceptibility to both disease entities. The risk allele of p.Asp10Asn (rs33980500) proved to be most significantly associated and to encode a mutant protein with an almost completely disrupted binding property to TRAF6, supporting its impact as a main disease-causing variant and modulator of IL-17 signaling. Methods To identify further variants, exons 2-4 encoding both known TNF-receptor-associated factor (TRAF) binding domains were sequenced in 871 PsA patients. Seven missense variants and one three-base-pair insertion were identified in 0.06% to 1.02% of alleles. Five of these variants were also present in 931 control individuals at comparable frequency. Constructs containing full-length wild-type or mutant TRAF3IP2 were generated and used to analyze functionally all variants for TRAF6-binding in a mammalian two-hybrid assay. Results None of the newly found alleles, though, encoded proteins with different binding properties to TRAF6, or to the cytoplasmic tail of the IL-17-receptor α-chain, suggesting that they do not contribute to susceptibility. Conclusions Thus, the TRAF3IP2-variant p.Asp10Asn is the only susceptibility allele with functional impact on TRAF6 binding, at least in the German population. PMID:22513239

Hexon-modified recombinant E1-deleted adenoviral vectors as bivalent vaccine carriers for Coxsackievirus A16 and Enterovirus 71.

PubMed

Zhang, Chao; Yang, Yong; Chi, Yudan; Yin, Jieyun; Yan, Lijun; Ku, Zhiqiang; Liu, Qingwei; Huang, Zhong; Zhou, Dongming

2015-09-22

Hand, foot and mouth disease (HFMD) is a major public health concern in Asia; more efficient vaccines against HFMD are urgently required. Adenoviral (Ad) capsids have been used widely for the presentation of foreign antigens to induce specific immune responses in the host. Here, we describe a novel bivalent vaccine for HFMD based on the hexon-modified, E1-deleted chimpanzee adenovirus serotype 68 (AdC68). The novel vaccine candidate was generated by incorporating the neutralising epitope of Coxsackievirus A16 (CA16), PEP71, into hypervariable region 1 (HVR1), and a shortened neutralising epitope of Enterovirus 71 (EV71), sSP70, into HVR2 of the AdC68 hexon. In order to enhance the immunogenicity of EV71, VP1 of EV71 was cloned into the E1-region of the AdC68 vectors. The results demonstrated that these two epitopes were well presented on the virion surface and had high affinity towards specific antibodies, and VP1 of EV71 was also significantly expressed. In pre-clinical mouse models, the hexon-modified AdC68 elicited neutralising antibodies against both CA16 and EV71, which conferred protection to suckling mice against a lethal challenge of CA16 and EV71. In summary, this study demonstrates that the hexon-modified AdC68 may represent a promising bivalent vaccine carrier against EV71 and CA16 and an epitope-display platform for other pathogens. Copyright © 2015 Elsevier Ltd. All rights reserved.

Satellite tobacco mosaic virus sequence variants with only five Nucleotide differences can interfere with each other in a cross protection-like phenomenon in plants

USGS Publications Warehouse

Kurath, Gael; Dodds, J. Allan

1994-01-01

The type strain of satellite tobacco mosaic virus (STMV) contains two major variants, designated type 5 (T5) and type 6 (T6), which can be easily distinguished by RNase protection analyses. Clones containing cDNA of representative T5 and T6 STMV genomes have only five single-base differences in the entire 1059-nucleotide genome, and RNA transcribed from each clone is highly infectious when inoculated onto tobacco plants. The different RNase protection assay patterns can be used as genetic markers to identify individual STMV variants and to follow the interactions of variants and their progeny during coinfections in plants. The study described here investigated the effects of coinoculation and various delayed inoculations of T5 and T6 variants on the composition of the progeny STMV populations in systemically infected tobacco tissues. When T5 and T6 STMV RNAs were coinoculated or inoculated with 1-hr delays, the progeny from individual plants most often contained a mixture of T5 and T6 genomes. However, when there was a 24-hr delay between inoculations, the balance of T5 and T6 components in the progeny populations shifted toward predominance of the first variant inoculated. With delays of 3 or 7 days only the first variant was evident in the progeny populations, indicating that established replication of one STMV variant interferes with replication of another in a manner similar to the cross protection phenomenon.

External quality assessment for enterovirus 71 and coxsackievirus A16 detection by reverse transcription-PCR using armored RNA as a virus surrogate.

PubMed

Song, Liqiong; Sun, Shipeng; Li, Bo; Pan, Yang; Li, Wenli; Zhang, Kuo; Li, Jinming

2011-10-01

Three armored RNAs (virus-like particles [VLPs]) containing target sequences from enterovirus 71 (EV71) and coxsackievirus A16 (CA16) and a pan-enterovirus (pan-EV) sequence were constructed and used in an external quality assessment (EQA) to determine the performance of laboratories in the detection of EV71 and CA16. The EQA panel, which consisted of 20 samples, including 14 positive samples with different concentrations of EV and either EV71 or CA16 armored RNAs, 2 samples with all 3 armored RNAs, and 4 negative-control samples (NaN(3)-preserved minimal essential medium [MEM] without VLPs), was distributed to 54 laboratories that perform molecular diagnosis of hand, foot, and mouth disease (HFMD) virus infections. A total of 41 data sets from 41 participants were returned; 5 (12.2%) were generated using conventional in-house reverse transcription-PCR (RT-PCR) assays, and 36 (87.8%) were generated using commercial real-time RT-PCR assays. Performance assessments of laboratories differed; 12 (29.3%) showed a need for improvement. Surprisingly, 4 laboratories were unable to detect EV71 RNA in any samples, even those containing the highest concentration of 10(7) IU/ml. Furthermore, the detection sensitivity for EV71 among all laboratories (82.1%) was substantially lower than that for EV (97.4%) or CA16 (95.1%). Overall, the results of the present study indicate that EQA should be performed periodically to help laboratories monitor their ability to detect HFMD viruses and to improve the comparability of results from different laboratories.

Detection of human enterovirus 71 and coxsackievirus A16 in children with hand, foot and mouth disease in China.

PubMed

Chen, Ling; Mou, Xiaozhou; Zhang, Qiong; Li, Yifei; Lin, Jian; Liu, Fanlong; Yuan, Li; Tang, Yiming; Xiang, Charlie

2012-04-01

The aims of the present study were to investigate the genetic characteristics of enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) strains in China and to evaluate the relationship between the genotypes of CVA16 and EV71 and their geographical distribution. A total of 399 stool specimens were collected from children with symptoms of hand, foot and mouth disease (HFMD) in Zhejiang Province. The presence of enteroviruses was determined using reverse transcription-semi-nested PCR targeted to the VP1 gene of all human enteroviruses and DNA sequencing. EV71 and CVA16, the major etiological agents of HFMD, were detected in 38.4% (38/99) and 35.4% (35/99) of HEV-A species-positive cases, respectively. Based on the phylogenetic analysis of the VP1 gene, EV71 strains identified in this study belong to subgenotype C4, and CVA16 strains herein were classified into clusters B2a and B2b within the genotype B2. Taking into consideration other published data, we conclude that the genetic characteristics of enteroviruses in China reflect the pattern of the endemic circulation of the subgenotype C4 to EV71 and clusters B2a and B2b within genotype B2 to CVA16, which have been continuously circulating in China since 1997. This observation indicates that the genetic characteristics of enteroviruses in China seem to depend on their special geographical and climatical features allowing them to be sustained with little external effect.

Detection of human enterovirus 71 and coxsackievirus A16 in children with hand, foot and mouth disease in China

PubMed Central

CHEN, LING; MOU, XIAOZHOU; ZHANG, QIONG; LI, YIFEI; LIN, JIAN; LIU, FANLONG; YUAN, LI; TANG, YIMING; XIANG, CHARLIE

2012-01-01

The aims of the present study were to investigate the genetic characteristics of enterovirus 71 (EV71) and coxsackievirus A16 (CVA16) strains in China and to evaluate the relationship between the genotypes of CVA16 and EV71 and their geographical distribution. A total of 399 stool specimens were collected from children with symptoms of hand, foot and mouth disease (HFMD) in Zhejiang Province. The presence of enteroviruses was determined using reverse transcription-semi-nested PCR targeted to the VP1 gene of all human enteroviruses and DNA sequencing. EV71 and CVA16, the major etiological agents of HFMD, were detected in 38.4% (38/99) and 35.4% (35/99) of HEV-A species-positive cases, respectively. Based on the phylogenetic analysis of the VP1 gene, EV71 strains identified in this study belong to subgenotype C4, and CVA16 strains herein were classified into clusters B2a and B2b within the genotype B2. Taking into consideration other published data, we conclude that the genetic characteristics of enteroviruses in China reflect the pattern of the endemic circulation of the subgenotype C4 to EV71 and clusters B2a and B2b within genotype B2 to CVA16, which have been continuously circulating in China since 1997. This observation indicates that the genetic characteristics of enteroviruses in China seem to depend on their special geographical and climatical features allowing them to be sustained with little external effect. PMID:22218731

Adenovirus type 4 respiratory infections with a concurrent outbreak of coxsackievirus A21 among United States Army Basic Trainees, a retrospective viral etiology study using next-generation sequencing.

PubMed

Hang, Jun; Vento, Todd J; Norby, Erica A; Jarman, Richard G; Keiser, Paul B; Kuschner, Robert A; Binn, Leonard N

2017-08-01

Human adenoviruses (HAdV), in particular types 4 and 7, frequently cause acute respiratory disease (ARD) during basic military training. HAdV4 and HAdV7 vaccines reduced the ARD risk in U.S. military. It is important to identify other respiratory pathogens and assess their potential impact on military readiness. In 2002, during a period when the HAdV vaccines were not available, throat swabs were taken from trainees (n = 184) with respiratory infections at Fort Jackson, South Carolina. Viral etiology was investigated initially with viral culture and neutralization assay and recently in this study by sequencing the viral isolates. Viral culture and neutralization assays identified 90 HAdV4 isolates and 27 additional cultures that showed viral cytopathic effects (CPE), including some with picornavirus-like CPE. Next-generation sequencing confirmed these results and determined viral genotypes, including 77 HAdV4, 4 HAdV3, 1 HAdV2, 17 coxsackievirus A21 (CAV21), and 1 enterovirus D68. Two samples were positive for both HAdV4 and CAV21. The identified genotypes are phylogenetically close to but distinct from those found during other years or in other military/non-military sites. HAdV4 is the predominant respiratory pathogen in unvaccinated military trainee. HAdV4 has temporal and demographic variability. CAV21 is a significant respiratory pathogen and needs to be evaluated for its current significance in military basic trainees. © 2017 Wiley Periodicals, Inc.

External Quality Assessment for Enterovirus 71 and Coxsackievirus A16 Detection by Reverse Transcription-PCR Using Armored RNA as a Virus Surrogate▿†

PubMed Central

Song, Liqiong; Sun, Shipeng; Li, Bo; Pan, Yang; Li, Wenli; Zhang, Kuo; Li, Jinming

2011-01-01

Three armored RNAs (virus-like particles [VLPs]) containing target sequences from enterovirus 71 (EV71) and coxsackievirus A16 (CA16) and a pan-enterovirus (pan-EV) sequence were constructed and used in an external quality assessment (EQA) to determine the performance of laboratories in the detection of EV71 and CA16. The EQA panel, which consisted of 20 samples, including 14 positive samples with different concentrations of EV and either EV71 or CA16 armored RNAs, 2 samples with all 3 armored RNAs, and 4 negative-control samples (NaN3-preserved minimal essential medium [MEM] without VLPs), was distributed to 54 laboratories that perform molecular diagnosis of hand, foot, and mouth disease (HFMD) virus infections. A total of 41 data sets from 41 participants were returned; 5 (12.2%) were generated using conventional in-house reverse transcription-PCR (RT-PCR) assays, and 36 (87.8%) were generated using commercial real-time RT-PCR assays. Performance assessments of laboratories differed; 12 (29.3%) showed a need for improvement. Surprisingly, 4 laboratories were unable to detect EV71 RNA in any samples, even those containing the highest concentration of 107 IU/ml. Furthermore, the detection sensitivity for EV71 among all laboratories (82.1%) was substantially lower than that for EV (97.4%) or CA16 (95.1%). Overall, the results of the present study indicate that EQA should be performed periodically to help laboratories monitor their ability to detect HFMD viruses and to improve the comparability of results from different laboratories. PMID:21865426

Common variants at 12q15 and 12q24 are associated with infant head circumference.

PubMed

Taal, H Rob; Pourcain, Beate St; Thiering, Elisabeth; Das, Shikta; Mook-Kanamori, Dennis O; Warrington, Nicole M; Kaakinen, Marika; Kreiner-Møller, Eskil; Bradfield, Jonathan P; Freathy, Rachel M; Geller, Frank; Guxens, Mònica; Cousminer, Diana L; Kerkhof, Marjan; Timpson, Nicholas J; Ikram, M Arfan; Beilin, Lawrence J; Bønnelykke, Klaus; Buxton, Jessica L; Charoen, Pimphen; Chawes, Bo Lund Krogsgaard; Eriksson, Johan; Evans, David M; Hofman, Albert; Kemp, John P; Kim, Cecilia E; Klopp, Norman; Lahti, Jari; Lye, Stephen J; McMahon, George; Mentch, Frank D; Müller, Martina; O'Reilly, Paul F; Prokopenko, Inga; Rivadeneira, Fernando; Steegers, Eric A P; Sunyer, Jordi; Tiesler, Carla; Yaghootkar, Hanieh; Breteler, Monique M B; Debette, Stephanie; Fornage, Myriam; Gudnason, Vilmundur; Launer, Lenore J; van der Lugt, Aad; Mosley, Thomas H; Seshadri, Sudha; Smith, Albert V; Vernooij, Meike W; Blakemore, Alexandra If; Chiavacci, Rosetta M; Feenstra, Bjarke; Fernandez-Benet, Julio; Grant, Struan F A; Hartikainen, Anna-Liisa; van der Heijden, Albert J; Iñiguez, Carmen; Lathrop, Mark; McArdle, Wendy L; Mølgaard, Anne; Newnham, John P; Palmer, Lyle J; Palotie, Aarno; Pouta, Annneli; Ring, Susan M; Sovio, Ulla; Standl, Marie; Uitterlinden, Andre G; Wichmann, H-Erich; Vissing, Nadja Hawwa; DeCarli, Charles; van Duijn, Cornelia M; McCarthy, Mark I; Koppelman, Gerard H; Estivill, Xavier; Hattersley, Andrew T; Melbye, Mads; Bisgaard, Hans; Pennell, Craig E; Widen, Elisabeth; Hakonarson, Hakon; Smith, George Davey; Heinrich, Joachim; Jarvelin, Marjo-Riitta; Jaddoe, Vincent W V

2012-04-15

To identify genetic variants associated with head circumference in infancy, we performed a meta-analysis of seven genome-wide association studies (GWAS) (N = 10,768 individuals of European ancestry enrolled in pregnancy and/or birth cohorts) and followed up three lead signals in six replication studies (combined N = 19,089). rs7980687 on chromosome 12q24 (P = 8.1 × 10(-9)) and rs1042725 on chromosome 12q15 (P = 2.8 × 10(-10)) were robustly associated with head circumference in infancy. Although these loci have previously been associated with adult height, their effects on infant head circumference were largely independent of height (P = 3.8 × 10(-7) for rs7980687 and P = 1.3 × 10(-7) for rs1042725 after adjustment for infant height). A third signal, rs11655470 on chromosome 17q21, showed suggestive evidence of association with head circumference (P = 3.9 × 10(-6)). SNPs correlated to the 17q21 signal have shown genome-wide association with adult intracranial volume, Parkinson's disease and other neurodegenerative diseases, indicating that a common genetic variant in this region might link early brain growth with neurological disease in later life.

A comprehensive examination of breast cancer risk loci in African American women

PubMed Central

Feng, Ye; Stram, Daniel O.; Rhie, Suhn Kyong; Millikan, Robert C.; Ambrosone, Christine B.; John, Esther M.; Bernstein, Leslie; Zheng, Wei; Olshan, Andrew F.; Hu, Jennifer J.; Ziegler, Regina G.; Nyante, Sarah; Bandera, Elisa V.; Ingles, Sue A.; Press, Michael F.; Deming, Sandra L.; Rodriguez-Gil, Jorge L.; Palmer, Julie R.; Olopade, Olufunmilayo I.; Huo, Dezheng; Adebamowo, Clement A.; Ogundiran, Temidayo; Chen, Gary K.; Stram, Alex; Park, Karen; Rand, Kristin A.; Chanock, Stephen J.; Le Marchand, Loic; Kolonel, Laurence N.; Conti, David V.; Easton, Douglas; Henderson, Brian E.; Haiman, Christopher A.

2014-01-01

Genome-wide association studies have identified 73 breast cancer risk variants mainly in European populations. Given considerable differences in linkage disequilibrium structure between populations of European and African ancestry, the known risk variants may not be informative for risk in African ancestry populations. In a previous fine-mapping investigation of 19 breast cancer loci, we were able to identify SNPs in four regions that better captured risk associations in African American women. In this study of breast cancer in African American women (3016 cases, 2745 controls), we tested an additional 54 novel breast cancer risk variants. Thirty-eight variants (70%) were found to have an association with breast cancer in the same direction as previously reported, with eight (15%) replicating at P < 0.05. Through fine-mapping, in three regions (1q32, 3p24, 10q25), we identified variants that better captured associations with overall breast cancer or estrogen receptor positive disease. We also observed suggestive associations with variants (at P < 5 × 10−6) in three separate regions (6q25, 14q13, 22q12) that may represent novel risk variants. Directional consistency of association observed for ∼65–70% of currently known genetic variants for breast cancer in women of African ancestry implies a shared functional common variant at most loci. To validate and enhance the spectrum of alleles that define associations at the known breast cancer risk loci, as well as genome-wide, will require even larger collaborative efforts in women of African ancestry. PMID:24852375

The coxsackievirus-adenovirus receptor reveals complex homophilic and heterophilic interactions on neural cells.

PubMed

Patzke, Christopher; Max, Klaas E A; Behlke, Joachim; Schreiber, Jadwiga; Schmidt, Hannes; Dorner, Armin A; Kröger, Stephan; Henning, Mechthild; Otto, Albrecht; Heinemann, Udo; Rathjen, Fritz G

2010-02-24

The coxsackievirus-adenovirus receptor (CAR) is a member of the Ig superfamily strongly expressed in the developing nervous system. Our histological investigations during development reveal an initial uniform distribution of CAR on all neural cells with a concentration on membranes that face the margins of the nervous system (e.g., the basal laminae and the ventricular side). At more advanced stages, CAR becomes downregulated and restricted to specific regions including areas rich in axonal and dendritic surfaces. To study the function of CAR on neural cells, we used the fiber knob of the adenovirus, extracellular CAR domains, blocking antibodies to CAR, as well as CAR-deficient neural cells. Blocking antibodies were found to inhibit neurite extension in retina organ and retinal explant cultures, whereas the application of the recombinant fiber knob of the adenovirus subtype Ad2 or extracellular CAR domains promoted neurite extension and adhesion to extracellular matrices. We observed a promiscuous interaction of CAR with extracellular matrix glycoproteins, which was deduced from analytical ultracentrifugation experiments, affinity chromatography, and adhesion assays. The membrane proximal Ig domain of CAR, termed D2, was found to bind to a fibronectin fragment, including the heparin-binding domain 2, which promotes neurite extension of wild type, but not of CAR-deficient neural cells. In contrast to heterophilic interactions, homophilic association of CAR involves both Ig domains, as was revealed by ultracentrifugation, chemical cross-linking, and adhesion studies. The results of these functional and binding studies are correlated to a U-shaped homodimer of the complete extracellular domains of CAR detected by x-ray crystallography.

Frequency of a FAS ligand gene variant associated with inherited feline autoimmune lymphoproliferative syndrome in British shorthair cats in New Zealand.

PubMed

Aberdein, D; Munday, J S; Dittmer, K E; Heathcott, R W; Lyons, L A

2017-11-01

AIMS To determine the frequency of the FAS-ligand gene (FASLG) variant associated with feline autoimmune lymphoproliferative syndrome (FALPS) and the proportion of carriers of the variant in three British shorthair (BSH) breeding catteries in New Zealand. METHODS Buccal swabs were collected from all cats in two BSH breeding catteries from the South Island and one from the North Island of New Zealand. DNA was extracted and was tested for the presence of the FASLG variant using PCR. Cats with the FASLG variant were identified and the frequency of the FASLG variant allele calculated. Pedigree analysis was performed and inbreeding coefficients were calculated for cats with the FASLG variant. RESULTS Of 32 BSH cats successfully tested for the presence of the FASLG variant, one kitten (3%) was homozygous (FALPS-affected), and seven (22%) cats were heterozygous (carriers) for the FASLG variant allele, and 24 (75%) cats were homozygous for the wild type allele. The overall frequency of the FASLG variant allele in these 32 cats was 0.14. Cats carrying the FASLG variant were from all three breeding catteries sampled, including two catteries that had not previously reported cases of FALPS. Pedigree analysis revealed common ancestry of FALPS-affected and carrier cats within six generations, as well as frequent inbreeding, with inbreeding coefficients >0.12 for five cats with the FASLG variant. CONCLUSIONS AND CLINICAL RELEVANCE There was a high frequency of the FASLG variant allele (0.14) in this small sample of BSH cats, with 22% of healthy cats identified as carriers of the FASLG variant. For an inherited disease, lethal at a young age, in a small population in which inbreeding is common, these results are significant. To prevent future cases of disease and stop further spread of the FASLG variant allele within the BSH population in New Zealand, it is recommended that all BSH and BSH-cross cats be tested for the presence of the FASLG variant before mating. Cats identified as carriers of the variant allele should be desexed and not used for breeding. Results support the need for further investigations of the true frequency of the FASLG variant allele and occurrence of FALPS in the wider population of BSH cats in New Zealand.

The Evolution of Vp1 Gene in Enterovirus C Species Sub-Group That Contains Types CVA-21, CVA-24, EV-C95, EV-C96 and EV-C99

PubMed Central

Smura, Teemu; Blomqvist, Soile; Vuorinen, Tytti; Ivanova, Olga; Samoilovich, Elena; Al-Hello, Haider; Savolainen-Kopra, Carita; Hovi, Tapani; Roivainen, Merja

2014-01-01

Genus Enterovirus (Family Picornaviridae,) consists of twelve species divided into genetically diverse types by their capsid protein VP1 coding sequences. Each enterovirus type can further be divided into intra-typic sub-clusters (genotypes). The aim of this study was to elucidate what leads to the emergence of novel enterovirus clades (types and genotypes). An evolutionary analysis was conducted for a sub-group of Enterovirus C species that contains types Coxsackievirus A21 (CVA-21), CVA-24, Enterovirus C95 (EV-C95), EV-C96 and EV-C99. VP1 gene datasets were collected and analysed to infer the phylogeny, rate of evolution, nucleotide and amino acid substitution patterns and signs of selection. In VP1 coding gene, high intra-typic sequence diversities and robust grouping into distinct genotypes within each type were detected. Within each type the majority of nucleotide substitutions were synonymous and the non-synonymous substitutions tended to cluster in distinct highly polymorphic sites. Signs of positive selection were detected in some of these highly polymorphic sites, while strong negative selection was indicated in most of the codons. Despite robust clustering to intra-typic genotypes, only few genotype-specific ‘signature’ amino acids were detected. In contrast, when different enterovirus types were compared, there was a clear tendency towards fixation of type-specific ‘signature’ amino acids. The results suggest that permanent fixation of type-specific amino acids is a hallmark associated with evolution of different enterovirus types, whereas neutral evolution and/or (frequency-dependent) positive selection in few highly polymorphic amino acid sites are the dominant forms of evolution when strains within an enterovirus type are compared. PMID:24695547

The evolution of Vp1 gene in enterovirus C species sub-group that contains types CVA-21, CVA-24, EV-C95, EV-C96 and EV-C99.

PubMed

Smura, Teemu; Blomqvist, Soile; Vuorinen, Tytti; Ivanova, Olga; Samoilovich, Elena; Al-Hello, Haider; Savolainen-Kopra, Carita; Hovi, Tapani; Roivainen, Merja

2014-01-01

Genus Enterovirus (Family Picornaviridae,) consists of twelve species divided into genetically diverse types by their capsid protein VP1 coding sequences. Each enterovirus type can further be divided into intra-typic sub-clusters (genotypes). The aim of this study was to elucidate what leads to the emergence of novel enterovirus clades (types and genotypes). An evolutionary analysis was conducted for a sub-group of Enterovirus C species that contains types Coxsackievirus A21 (CVA-21), CVA-24, Enterovirus C95 (EV-C95), EV-C96 and EV-C99. VP1 gene datasets were collected and analysed to infer the phylogeny, rate of evolution, nucleotide and amino acid substitution patterns and signs of selection. In VP1 coding gene, high intra-typic sequence diversities and robust grouping into distinct genotypes within each type were detected. Within each type the majority of nucleotide substitutions were synonymous and the non-synonymous substitutions tended to cluster in distinct highly polymorphic sites. Signs of positive selection were detected in some of these highly polymorphic sites, while strong negative selection was indicated in most of the codons. Despite robust clustering to intra-typic genotypes, only few genotype-specific 'signature' amino acids were detected. In contrast, when different enterovirus types were compared, there was a clear tendency towards fixation of type-specific 'signature' amino acids. The results suggest that permanent fixation of type-specific amino acids is a hallmark associated with evolution of different enterovirus types, whereas neutral evolution and/or (frequency-dependent) positive selection in few highly polymorphic amino acid sites are the dominant forms of evolution when strains within an enterovirus type are compared.

Inhibition of coxsackievirus B3 replication by small interfering RNAs requires perfect sequence match in the central region of the viral positive strand.

PubMed

Yuan, Ji; Cheung, Paul K M; Zhang, Huifang M; Chau, David; Yang, Decheng

2005-02-01

Coxsackievirus B3 (CVB3) is the most common causal agent of viral myocarditis, but existing drug therapies are of limited value. Application of small interfering RNA (siRNA) in knockdown of gene expression is an emerging technology in antiviral gene therapy. To investigate whether RNA interference (RNAi) can protect against CVB3 infection, we evaluated the effects of RNAi on viral replication in HeLa cells and murine cardiomyocytes by using five CVB3-specific siRNAs targeting distinct regions of the viral genome. The most effective one is siRNA-4, targeting the viral protease 2A, achieving a 92% inhibition of CVB3 replication. The specific RNAi effects could last at least 48 h, and cell viability assay revealed that 90% of siRNA-4-pretreated cells were still alive and lacked detectable viral protein expression 48 h postinfection. Moreover, administration of siRNAs after viral infection could also effectively inhibit viral replication, indicating its therapeutic potential. Further evaluation by combination found that no enhanced inhibitory effects were observed when siRNA-4 was cotransfected with each of the other four candidates. In mutational analysis of the mechanisms of siRNA action, we found that siRNA functions by targeting the positive strand of virus and requires a perfect sequence match in the central region of the target, but mismatches were more tolerated near the 3' end than the 5' end of the antisense strand. These findings reveal an effective target for CVB3 silencing and provide a new possibility for antiviral intervention.

Detection and characterization of viruses causing hand, foot and mouth disease from children in Seri Kembangan, Malaysia.

PubMed

Ling, Beh Poay; Jalilian, Farid Azizi; Harmal, Nabil Saad; Yubbu, Putri; Sekawi, Zamberi

2014-12-01

Hand, foot and mouth disease (HFMD) is a common viral infection among infants and children. The major causative agents of HFMD are enterovirus 71 (EV71) and coxsackievirus A16 (CVA16). Recently, coxsackievirus A6 (CVA6) infections were reported in neighboring countries. Infected infants and children may present with fever, mouth/throat ulcers, rashes and vesicles on hands and feet. Moreover, EV71 infections might cause fatal neurological complications. Since 1997, EV71 caused fatalities in Sarawak and Peninsula Malaysia. The purpose of this study was to identify and classify the viruses which detected from the patients who presenting clinical signs and symptoms of HFMD in Seri Kembangan, Malaysia. From December 2012 until July 2013, a total of 28 specimens were collected from patients with clinical case definitions of HFMD. The HFMD viruses were detected by using semi-nested reverse transcription polymerase chain reaction (snRT-PCR). The positive snRT-PCR products were sequenced and phylogenetic analyses of the viruses were performed. 12 of 28 specimens (42.9%) were positive in snRT-PCR, seven are CVA6 (58.3%), two CVA16 (16.7%) and three EV71 (25%). Based on phylogenetic analysis studies, EV71 strains were identified as sub-genotype B5; CVA16 strains classified into sub-genotype B2b and B2c; CVA6 strains closely related to strains in Taiwan and Japan. In this study, HFMD in Seri Kembangan were caused by different types of Enterovirus, which were EV71, CVA6 and CVA16.

Characterization of severe hand, foot, and mouth disease in Shenzhen, China, 2009-2013.

PubMed

Huang, Yun; Zhou, Yuanping; Lu, Hong; Yang, Hong; Feng, Qianjin; Dai, Yingchun; Chen, Long; Yu, Shouyi; Yao, Xiangjie; Zhang, Hailong; Jiang, Ming; Wang, Yujie; Han, Ning; Hu, Guifang; He, Yaqing

2015-09-01

Hand, foot, and mouth disease (HFMD) is caused by human enteroviruses, especially by enterovirus 71 (EV71) and coxsackievirus A16 (CA16). Patients infected with different enteroviruses show varied clinical symptoms. The aim of this study was to determine whether the etiological spectrum of mild and severe HFMD changed, and the association between pathogens and clinical features. From 2009 to 2013, a total of 2,299 stool or rectal specimens were collected with corresponding patient data. A dynamic view of the etiological spectrum of mild and severe HFMD in Shenzhen city of China was provided. EV71 accounted for the majority proportion of severe HFMD cases and fatalities during 2009-2013. CA16 and EV71 were gradually replaced by coxsackievirus A6 (CA6) as the most common serotype for mild HFMD since 2010. Myoclonic jerk and vomiting were the most frequent severe symptoms. Nervous system complications, including aseptic encephalitis and aseptic meningitis were observed mainly in patients infected by EV71. Among EV71, CA16, CA6, and CA10 infection, fever and pharyngalgia were more likely to develop, vesicles on the hand, foot, elbow, knee and buttock were less likely to develop in patients infected with CA10. Vesicles on the mouth more frequently occurred in the patients with CA6, but less in the patient with EV71. Associations between diverse enterovirus serotypes and various clinical features were discovered in the present study, which may offer further insight into early detection, diagnosis and treatment of HFMD. © 2015 Wiley Periodicals, Inc.

A new transcriptional role for matrix metalloproteinase-12 in antiviral immunity.

PubMed

Marchant, David J; Bellac, Caroline L; Moraes, Theo J; Wadsworth, Samuel J; Dufour, Antoine; Butler, Georgina S; Bilawchuk, Leanne M; Hendry, Reid G; Robertson, A Gordon; Cheung, Caroline T; Ng, Julie; Ang, Lisa; Luo, Zongshu; Heilbron, Karl; Norris, Michael J; Duan, Wenming; Bucyk, Taylor; Karpov, Andrei; Devel, Laurent; Georgiadis, Dimitris; Hegele, Richard G; Luo, Honglin; Granville, David J; Dive, Vincent; McManus, Bruce M; Overall, Christopher M

2014-05-01

Interferon-α (IFN-α) is essential for antiviral immunity, but in the absence of matrix metalloproteinase-12 (MMP-12) or IκBα (encoded by NFKBIA) we show that IFN-α is retained in the cytosol of virus-infected cells and is not secreted. Our findings suggest that activated IκBα mediates the export of IFN-α from virus-infected cells and that the inability of cells in Mmp12(-/-) but not wild-type mice to express IκBα and thus export IFN-α makes coxsackievirus type B3 infection lethal and renders respiratory syncytial virus more pathogenic. We show here that after macrophage secretion, MMP-12 is transported into virus-infected cells. In HeLa cells MMP-12 is also translocated to the nucleus, where it binds to the NFKBIA promoter, driving transcription. We also identified dual-regulated substrates that are repressed both by MMP-12 binding to the substrate's gene exons and by MMP-12-mediated cleavage of the substrate protein itself. Whereas intracellular MMP-12 mediates NFKBIA transcription, leading to IFN-α secretion and host protection, extracellular MMP-12 cleaves off the IFN-α receptor 2 binding site of systemic IFN-α, preventing an unchecked immune response. Consistent with an unexpected role for MMP-12 in clearing systemic IFN-α, treatment of coxsackievirus type B3-infected wild-type mice with a membrane-impermeable MMP-12 inhibitor elevates systemic IFN-α levels and reduces viral replication in pancreas while sparing intracellular MMP-12. These findings suggest that inhibiting extracellular MMP-12 could be a new avenue for the development of antiviral treatments.

Prevalence of melanocortin receptor 4 (MC4R) V103I gene variant and its association with obesity among the Kampar Health Clinic cohort, Perak, Malaysia.

PubMed

Chua, H N; Fan, S H; Say, Y H

2012-04-01

This study investigated the prevalence of the Melanocortin receptor 4 (MC4R) V1031 gene variant and its association with obesity among a cohort of 254 patients (101 males; 118 obese) attending the Kampar Health Clinic. Genotyping revealed the mutated I allele frequency of 0.02, no homozygous mutated (II), and similar distribution of V and I alleles across BMI groups, genders and ethnic groups. No significant difference was found for the means of anthropometric measurements between alleles. Prevalence of this gene variant among the Malaysian cohort was similar with previous populations (2-4% of mutated allele carrier), but was not associated with obesity.

Systemic lupus erythematosus in a patient with Noonan syndrome-like disorder with loose anagen hair 1: More than a chance association.

PubMed

Uehara, Tomoko; Hosogaya, Naoki; Matsuo, Nobutake; Kosaki, Kenjiro

2018-05-07

Systemic lupus erythematosus (SLE) has been reported among patients with RASopathy. Five patients have been reported: three with SHOC2 variants, one with a PTPN11 variant, and one with a KRAS variant. SHOC2 variant might represent a relatively common predisposing factor for SLE among the RASopathy genes. However, the clinical details were only reported for two patients, while information on the remaining patient appeared only in a tabular format with minimal clinical description. Here, we report a patient with a SHOC2 variant and SLE. The proband was a 28-year-old male patient with intellectual disabilities, a short stature, dysmorphic facial features, and thin hair. He developed hypertrophic cardiomyopathy and afebrile generalized seizures at the ages of 7 and 18 years, respectively. At the age of 24 years, he presented with a 3-day history of intermittent fever accompanied by right chest pain and a malar butterfly rash. He fulfilled both the American College of Rheumatology (ACR) criteria and the Systemic Lupus International Collaborating Clinics (SLICC) criteria for SLE and was successfully treated with prednisolone. Medical exome sequencing identified a de novo SHOC2 variant (c.4A > G, p.S2G). The present report of a second patient who fulfills both the ACR criteria and the SLICC criteria of SLE. We suggest that the association between SHOC2 variant and SLE represents more than a chance association. In the event of fever of unknown origin in patients with constitutional SHOC2 pathogenic variant, SLE should be suspected. © 2018 Wiley Periodicals, Inc.

Common variants in genes encoding adiponectin (ADIPOQ) and its receptors (ADIPOR1/2), adiponectin concentrations, and diabetes incidence in the Diabetes Prevention Program

PubMed Central

Mather, K. J.; Christophi, C. A.; Jablonski, K. A.; Knowler, W. C.; Goldberg, R. B.; Kahn, S. E.; Spector, T.; Dastani, Z.; Waterworth, D.; Richards, J. B.; Funahashi, T.; Pi-Sunyer, F. X.; Pollin, T. I.; Florez, J. C.; Franks, P. W.

2012-01-01

Aims Baseline adiponectin concentrations predict incident Type 2 diabetes mellitus in the Diabetes Prevention Program. We tested the hypothesis that common variants in the genes encoding adiponectin (ADIPOQ) and its receptors (ADIPOR1, ADIPOR2) would associate with circulating adiponectin concentrations and/or with diabetes incidence in the Diabetes Prevention Program population. Methods Seventy-seven tagging single-nucleotide polymorphisms (SNPs) in ADIPOQ (24), ADIPOR1 (22) and ADIPOR2 (31) were genotyped. Associations of SNPs with baseline adiponectin concentrations were evaluated using linear modelling. Associations of SNPs with diabetes incidence were evaluated using Cox proportional hazards modelling. Results Thirteen of 24 ADIPOQ SNPs were significantly associated with baseline adiponectin concentrations. Multivariable analysis including these 13 SNPs revealed strong independent contributions from rs17366568, rs1648707, rs17373414 and rs1403696 with adiponectin concentrations. However, no ADIPOQ SNPs were directly associated with diabetes incidence. Two ADIPOR1 SNPs (rs1342387 and rs12733285) were associated with ~18% increased diabetes incidence for carriers of the minor allele without differences across treatment groups, and without any relationship with adiponectin concentrations. Conclusions ADIPOQ SNPs are significantly associated with adiponectin concentrations in the Diabetes Prevention Program cohort. This observation extends prior observations from unselected populations of European descent into a broader multi-ethnic population, and confirms the relevance of these variants in an obese/dysglycaemic population. Despite the robust relationship between adiponectin concentrations and diabetes risk in this cohort, variants in ADIPOQ that relate to adiponectin concentrations do not relate to diabetes risk in this population. ADIPOR1 variants exerted significant effects on diabetes risk distinct from any effect of adiponectin concentrations. [Clinical Trials Registry Nos; NCT 00004992 (Diabetes Prevention Program) and NCT 00038727 (Diabetes Prevention Program Outcomes Study)] PMID:22443353

Association of the distal region of the ectonucleotide pyrophosphatase/phosphodiesterase 1 gene with type 2 diabetes in an African-American population enriched for nephropathy.

PubMed

Keene, Keith L; Mychaleckyj, Josyf C; Smith, Shelly G; Leak, Tennille S; Perlegas, Peter S; Langefeld, Carl D; Freedman, Barry I; Rich, Stephen S; Bowden, Donald W; Sale, Michèle M

2008-04-01

Variants in the ectonucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1) gene have shown positive associations with diabetes and related phenotypes, including insulin resistance, metabolic syndrome, and type 1 diabetic nephropathy. Additionally, evidence for linkage for type 2 diabetes in African Americans was observed at 6q24-27, with the proximal edge of the peak encompassing the ENPP1 gene. Our objective was to comprehensively evaluate variants in ENPP1 for association with type 2 diabetic end-stage renal disease (ESRD). Forty-nine single nucleotide polymorphisms (SNPs) located in the coding and flanking regions of ENPP1 were genotyped in 577 African-American individuals with type 2 diabetic ESRD and 596 African-American control subjects. Haplotypic association and genotypic association for the dominant, additive, and recessive models were tested by calculating a chi(2) statistic and corresponding P value. Nine SNPs showed nominal evidence for association (P < 0.05) with type 2 diabetic ESRD in one or more genotypic model. The most significant associations were observed with rs7754586 (P = 0.003 dominant model, P = 0.0005 additive, and P = 0.007 recessive), located in the 3' untranslated region, and an intron 24 SNP (rs1974201: P = 0.004 dominant, P = 0.0005 additive, and P = 0.005 recessive). However, the extensively studied K121Q variant (rs1044498) did not reveal evidence for association with type 2 diabetic ESRD in this African-American population. This study was the first to comprehensively evaluate variants of the ENPP1 gene for association in an African-American population with type 2 diabetes and ESRD and suggests that variants in the distal region of the ENPP1 gene may contribute to diabetes or diabetic nephropathy susceptibility in African Americans.

Investigation of established genetic risk variants for glioma in prediagnostic samples from a population-based nested case-control study.

PubMed

Wibom, Carl; Späth, Florentin; Dahlin, Anna M; Langseth, Hilde; Hovig, Eivind; Rajaraman, Preetha; Johannesen, Tom Børge; Andersson, Ulrika; Melin, Beatrice

2015-05-01

Although glioma etiology is poorly understood in general, growing evidence indicates a genetic component. Four large genome-wide association studies (GWAS) have linked common genetic variants with an increased glioma risk. However, to date, these studies are based largely on a case-control design, where cases have been recruited at the time of or after diagnosis. They may therefore suffer from a degree of survival bias, introduced when rapidly fatal cases are not included. To confirm glioma risk variants in a prospective setting, we have analyzed 11 previously identified risk variants in a set of prediagnostic serum samples with 598 cases and 595 matched controls. Serum samples were acquired from The Janus Serum Bank, a Norwegian population-based biobank reserved for cancer research. We confirmed the association with glioma risk for variants within five genomic regions: 8q24.21 (CCDC26), 9p21.3 (CDKN2B-AS1), 11q23.3 (PHLDB1), 17p13.1 (TP53), and 20q13.33 (RTEL1). However, previously identified risk variants within the 7p11.2 (EGFR) region were not confirmed by this study. Our results indicate that the risk variants that were confirmed by this study are truly associated with glioma risk and may, consequently, affect gliomagenesis. Though the lack of positive confirmation of EGFR risk variants may be attributable to relatively limited statistical power, it nevertheless raises the question whether they truly are risk variants or markers for glioma prognosis. Our findings indicate the need for further studies to clarify the role of glioma risk loci with respect to prolonged survival versus etiology. ©2015 American Association for Cancer Research.

Sequence variant on 8q24 confers susceptibility to urinary bladder cancer

PubMed Central

Kiemeney, Lambertus A.; Thorlacius, Steinunn; Sulem, Patrick; Geller, Frank; Aben, Katja K.H.; Stacey, Simon N.; Gudmundsson, Julius; Jakobsdottir, Margret; Bergthorsson, Jon T.; Sigurdsson, Asgeir; Blondal, Thorarinn; Witjes, J. Alfred; Vermeulen, Sita H.; Hulsbergen-van de Kaa, Christina A.; Swinkels, Dorine W.; Ploeg, Martine; Cornel, Erik B.; Vergunst, Henk; Thorgeirsson, Thorgeir E.; Gudbjartsson, Daniel; Gudjonsson, Sigurjon A.; Thorleifsson, Gudmar; Kristinsson, Kari T.; Mouy, Magali; Snorradottir, Steinunn; Placidi, Donatella; Campagna, Marcello; Arici, Cecilia; Koppova, Kvetoslava; Gurzau, Eugene; Rudnai, Peter; Kellen, Eliane; Polidoro, Silvia; Guarrera, Simonetta; Sacerdote, Carlotta; Sanchez, Manuel; Saez, Berta; Valdivia, Gabriel; Ryk, Charlotta; de Verdier, Petra; Lindblom, Annika; Golka, Klaus; Bishop, D. Timothy; Knowles, Margaret A.; Nikulasson, Sigfus; Petursdottir, Vigdis; Jonsson, Eirikur; Geirsson, Gudmundur; Kristjansson, Baldvin; Mayordomo, Jose I.; Steineck, Gunnar; Porru, Stefano; Buntinx, Frank; Zeegers, Maurice P.; Fletcher, Tony; Kumar, Rajiv; Matullo, Giuseppe; Vineis, Paolo; Kiltie, Anne E.; Gulcher, Jeffrey R.; Thorsteinsdottir, Unnur; Kong, Augustine; Rafnar, Thorunn; Stefansson, Kari

2015-01-01

We conducted a genome wide SNP association study on 1,803 Urinary Bladder Cancer (UBC) cases and 34,336 controls from Iceland and the Netherlands and follow up studies in seven additional case control groups (2,165 cases and 3,800 controls). The strongest association was observed with allele T of rs9642880 on chromosome 8q24, 30kb upstream of the c-Myc gene (allele specific OR=1.22; P=9.34×10−12). Approximately 20% of individuals of European ancestry are homozygous for rs9642880 (T) and their estimated risk of developing UBC is 1.49 times that of non-carriers with population attributable risk (PAR) of 17%. No association was observed between UBC and the four 8q24 variants previously associated with prostate, colorectal and breast cancers, nor did rs9642880 associate with any of these three cancers. A weaker signal, but nonetheless of genome wide significance, was captured by rs710521 (A) located near the TP63 gene on chromosome 3q28 (allele specific OR=1.19; P=1. 15× 10−7). PMID:18794855

Small interfering RNA against the 2C genomic region of coxsackievirus B3 exerts potential antiviral effects in permissive HeLa cells.

PubMed

Luan, Ying; Dai, Hai-Li; Yang, Dan; Zhu, Lin; Gao, Tie-Lei; Shao, Hong-Jiang; Peng, Xue; Jin, Zhan-Feng

2012-01-01

Coxsackievirus B3 (CVB3) is the most important causal agent of viral heart muscle disease, but no specific antiviral drug is currently available. Small interfering RNA (siRNA) has been used as an antiviral therapeutic strategy via posttranscriptional gene silencing. In this study, eleven siRNAs were designed to target seven distinct regions of the CVB3 genome including VP1, VP2, VP3, 2A, 2C, 3C, and 3D. All of the siRNAs were individually transfected into HeLa cells, which were subsequently infected with CVB3. The impacts of RNA interference (RNAi) on viral replication were evaluated using five measures: cytopathic effect (CPE), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, 50% tissue culture infectious dose (TCID(50)), real-time RT-PCR, and Western blot. Five of the eleven siRNAs were highly efficient at inhibiting viral replication. This was especially true for siRNA-5, which targeted the ATPase 2C. However, antiviral activity varied significantly among siRNA-9, -10, and -11 even though that they all targeted the 3D region. Our results revealed several effective targets for CVB3 silencing, and provided evidence that sequences except CRE within the 2C region may also be potential targets for CVB3-specific siRNAs design. These data supported a potential role of RNA interference in future antiviral intervention therapies. Copyright © 2011 Elsevier B.V. All rights reserved.

PUF60 variants cause a syndrome of ID, short stature, microcephaly, coloboma, craniofacial, cardiac, renal and spinal features

PubMed Central

Low, Karen J; Ansari, Morad; Abou Jamra, Rami; Clarke, Angus; El Chehadeh, Salima; FitzPatrick, David R; Greenslade, Mark; Henderson, Alex; Hurst, Jane; Keller, Kory; Kuentz, Paul; Prescott, Trine; Roessler, Franziska; Selmer, Kaja K; Schneider, Michael C; Stewart, Fiona; Tatton-Brown, Katrina; Thevenon, Julien; Vigeland, Magnus D; Vogt, Julie; Willems, Marjolaine; Zonana, Jonathan; Study, D D D; Smithson, Sarah F

2017-01-01

PUF60 encodes a nucleic acid-binding protein, a component of multimeric complexes regulating RNA splicing and transcription. In 2013, patients with microdeletions of chromosome 8q24.3 including PUF60 were found to have developmental delay, microcephaly, craniofacial, renal and cardiac defects. Very similar phenotypes have been described in six patients with variants in PUF60, suggesting that it underlies the syndrome. We report 12 additional patients with PUF60 variants who were ascertained using exome sequencing: six through the Deciphering Developmental Disorders Study and six through similar projects. Detailed phenotypic analysis of all patients was undertaken. All 12 patients had de novo heterozygous PUF60 variants on exome analysis, each confirmed by Sanger sequencing: four frameshift variants resulting in premature stop codons, three missense variants that clustered within the RNA recognition motif of PUF60 and five essential splice-site (ESS) variant. Analysis of cDNA from a fibroblast cell line derived from one of the patients with an ESS variants revealed aberrant splicing. The consistent feature was developmental delay and most patients had short stature. The phenotypic variability was striking; however, we observed similarities including spinal segmentation anomalies, congenital heart disease, ocular colobomata, hand anomalies and (in two patients) unilateral renal agenesis/horseshoe kidney. Characteristic facial features included micrognathia, a thin upper lip and long philtrum, narrow almond-shaped palpebral fissures, synophrys, flared eyebrows and facial hypertrichosis. Heterozygote loss-of-function variants in PUF60 cause a phenotype comprising growth/developmental delay and craniofacial, cardiac, renal, ocular and spinal anomalies, adding to disorders of human development resulting from aberrant RNA processing/spliceosomal function. PMID:28327570

The type of variants at the COL3A1 gene associates with the phenotype and severity of vascular Ehlers–Danlos syndrome

PubMed Central

Frank, Michael; Albuisson, Juliette; Ranque, Brigitte; Golmard, Lisa; Mazzella, Jean-Michael; Bal-Theoleyre, Laurence; Fauret, Anne-Laure; Mirault, Tristan; Denarié, Nicolas; Mousseaux, Elie; Boutouyrie, Pierre; Fiessinger, Jean-Noël; Emmerich, Joseph; Messas, Emmanuel; Jeunemaitre, Xavier

2015-01-01

Vascular Ehlers–Danlos syndrome (vEDS) is a rare and severe autosomal dominant disorder caused by variants at the COL3A1 gene. Clinical characteristics and course of disease of 215 molecularly proven patients (146 index cases and 69 relatives) were analysed. We found 126 distincts variants that were divided into five groups: (1) Glycine substitutions (n=71), (2) splice-site and in-frame insertions–deletions (n=36), (3) variants leading to haplo-insufficiency (n=7), (4) non-glycine missense variants within the triple helix (n=4 variants), and (5) non-glycine missense variants or in-frame insertions–deletions, in the N- or C-terminal part of the protein (n=8). Overall, our cohort confirmed the severity of the disease with a median age at first complication of 29 years (IQR 22–39), the most frequent being arterial (48%) and digestive (24%) ruptures. Groups 2 and 1 were significantly more severe than groups 3–5, with extreme median ages at first major complication of 23–47 years. Patients of groups 3–5 had a less typical phenotype and remarkably absence of digestive events. The distribution of glycine-replacing amino acids was strongly biased towards more destabilizing residues of the collagen assembly. Thus the natural course of vEDS and the clinical phenotype of patients are influenced by the type of COL3A1 variant. This study also confirms that patients with variants located in the C- and N-termini or leading to haplo-insufficiency have milder course of the disease and less prevalent diagnostic criteria. These findings may help refine diagnostic strategy, genetic counselling and clinical care. PMID:25758994

Whole-genome sequencing and genetic variant analysis of a Quarter Horse mare.

PubMed

Doan, Ryan; Cohen, Noah D; Sawyer, Jason; Ghaffari, Noushin; Johnson, Charlie D; Dindot, Scott V

2012-02-17

The catalog of genetic variants in the horse genome originates from a few select animals, the majority originating from the Thoroughbred mare used for the equine genome sequencing project. The purpose of this study was to identify genetic variants, including single nucleotide polymorphisms (SNPs), insertion/deletion polymorphisms (INDELs), and copy number variants (CNVs) in the genome of an individual Quarter Horse mare sequenced by next-generation sequencing. Using massively parallel paired-end sequencing, we generated 59.6 Gb of DNA sequence from a Quarter Horse mare resulting in an average of 24.7X sequence coverage. Reads were mapped to approximately 97% of the reference Thoroughbred genome. Unmapped reads were de novo assembled resulting in 19.1 Mb of new genomic sequence in the horse. Using a stringent filtering method, we identified 3.1 million SNPs, 193 thousand INDELs, and 282 CNVs. Genetic variants were annotated to determine their impact on gene structure and function. Additionally, we genotyped this Quarter Horse for mutations of known diseases and for variants associated with particular traits. Functional clustering analysis of genetic variants revealed that most of the genetic variation in the horse's genome was enriched in sensory perception, signal transduction, and immunity and defense pathways. This is the first sequencing of a horse genome by next-generation sequencing and the first genomic sequence of an individual Quarter Horse mare. We have increased the catalog of genetic variants for use in equine genomics by the addition of novel SNPs, INDELs, and CNVs. The genetic variants described here will be a useful resource for future studies of genetic variation regulating performance traits and diseases in equids.

A Neonatal Murine Model of Coxsackievirus A6 Infection for Evaluation of Antiviral and Vaccine Efficacy

PubMed Central

Zhang, Zhenjie; Dong, Zhaopeng; Wei, Qingjuan; Carr, Michael J.; Li, Juan; Ding, Shujun; Tong, Yigang

2017-01-01

ABSTRACT Hand, foot, and mouth disease (HFMD) is a global health concern. Family Picornaviridae members, particularly enterovirus A71 (EVA71) and coxsackievirus A16 (CVA16), are the primary etiological agents of HFMD; however, a third enterovirus A species, CVA6, has been recently associated with epidemic outbreaks. Study of the pathogenesis of CVA6 infection and development of antivirals and vaccines are hindered by a lack of appropriate animal models. We have developed and characterized a murine model of CVA6 infection that was employed to evaluate the antiviral activities of different drugs and the protective efficacies of CVA6-inactivated vaccines. Neonatal mice were susceptible to CVA6 infection via intramuscular inoculation, and the susceptibility of mice to CVA6 infection was age and dose dependent. Five-day-old mice infected with 105.5 50% tissue culture infective doses of the CVA6 WF057R strain consistently exhibited clinical signs, including reduced mobility, lower weight gain, and quadriplegia with significant pathology in the brain, hind limb skeletal muscles, and lungs of the infected mice in the moribund state. Immunohistochemical analysis and quantitative reverse transcription-PCR (qRT-PCR) analyses showed high viral loads (11 log10/mg) in skeletal muscle, and elevated levels of interleukin-6 (IL-6; >2,000 pg/ml) were associated with severe viral pneumonia and encephalitis. Ribavirin and gamma interferon administered prophylactically diminished CVA6-associated pathology in vivo, and treatment with IL-6 accelerated the death of neonatal mice. Both specific anti-CVA6 serum and maternal antibody play important roles in controlling CVA6 infection and viral replication. Collectively, these findings indicate that this neonatal murine model will be invaluable in future studies to develop CVA6-specific antivirals and vaccines. IMPORTANCE Although coxsackievirus A6 (CVA6) infections are commonly mild and self-limiting, a small proportion of children may have serious complications, such as encephalitis, acute flaccid paralysis, and neurorespiratory syndrome, leading to fatalities. We have established a mouse model of CVA6 infection by inoculation of neonatal mice with a CVA6 clinical isolate that produced consistent pathological outcomes. Here, using this model of CVA6 infection, we found that high levels of IL-6 were associated with severe viral pneumonia and encephalitis, as in an evaluation of antiviral efficacy in vivo, IL-6 had no protective effect and instead accelerated death in neonatal mice. We demonstrated that, as antiviral drugs, both gamma interferon and ribavirin played important protective roles in the early stages of infection, with increased survival in treated neonatal mice challenged with CVA6. Moreover, active and passive immunization with the inactivated vaccines and anti-CVA6 serum also protected mice against homologous challenge infections. PMID:28250116

The BRCA2 c.68-7T > A variant is not pathogenic: A model for clinical calibration of spliceogenicity.

PubMed

Colombo, Mara; Lòpez-Perolio, Irene; Meeks, Huong D; Caleca, Laura; Parsons, Michael T; Li, Hongyan; De Vecchi, Giovanna; Tudini, Emma; Foglia, Claudia; Mondini, Patrizia; Manoukian, Siranoush; Behar, Raquel; Garcia, Encarna B Gómez; Meindl, Alfons; Montagna, Marco; Niederacher, Dieter; Schmidt, Ane Y; Varesco, Liliana; Wappenschmidt, Barbara; Bolla, Manjeet K; Dennis, Joe; Michailidou, Kyriaki; Wang, Qin; Aittomäki, Kristiina; Andrulis, Irene L; Anton-Culver, Hoda; Arndt, Volker; Beckmann, Matthias W; Beeghly-Fadel, Alicia; Benitez, Javier; Boeckx, Bram; Bogdanova, Natalia V; Bojesen, Stig E; Bonanni, Bernardo; Brauch, Hiltrud; Brenner, Hermann; Burwinkel, Barbara; Chang-Claude, Jenny; Conroy, Don M; Couch, Fergus J; Cox, Angela; Cross, Simon S; Czene, Kamila; Devilee, Peter; Dörk, Thilo; Eriksson, Mikael; Fasching, Peter A; Figueroa, Jonine; Fletcher, Olivia; Flyger, Henrik; Gabrielson, Marike; García-Closas, Montserrat; Giles, Graham G; González-Neira, Anna; Guénel, Pascal; Haiman, Christopher A; Hall, Per; Hamann, Ute; Hartman, Mikael; Hauke, Jan; Hollestelle, Antoinette; Hopper, John L; Jakubowska, Anna; Jung, Audrey; Kosma, Veli-Matti; Lambrechts, Diether; Le Marchand, Loid; Lindblom, Annika; Lubinski, Jan; Mannermaa, Arto; Margolin, Sara; Miao, Hui; Milne, Roger L; Neuhausen, Susan L; Nevanlinna, Heli; Olson, Janet E; Peterlongo, Paolo; Peto, Julian; Pylkäs, Katri; Sawyer, Elinor J; Schmidt, Marjanka K; Schmutzler, Rita K; Schneeweiss, Andreas; Schoemaker, Minouk J; See, Mee Hoong; Southey, Melissa C; Swerdlow, Anthony; Teo, Soo H; Toland, Amanda E; Tomlinson, Ian; Truong, Thérèse; van Asperen, Christi J; van den Ouweland, Ans M W; van der Kolk, Lizet E; Winqvist, Robert; Yannoukakos, Drakoulis; Zheng, Wei; Dunning, Alison M; Easton, Douglas F; Henderson, Alex; Hogervorst, Frans B L; Izatt, Louise; Offitt, Kenneth; Side, Lucy E; van Rensburg, Elizabeth J; Embrace, Study; Hebon, Study; McGuffog, Lesley; Antoniou, Antonis C; Chenevix-Trench, Georgia; Spurdle, Amanda B; Goldgar, David E; Hoya, Miguel de la; Radice, Paolo

2018-05-01

Although the spliceogenic nature of the BRCA2 c.68-7T > A variant has been demonstrated, its association with cancer risk remains controversial. In this study, we accurately quantified by real-time PCR and digital PCR (dPCR), the BRCA2 isoforms retaining or missing exon 3. In addition, the combined odds ratio for causality of the variant was estimated using genetic and clinical data, and its associated cancer risk was estimated by case-control analysis in 83,636 individuals. Co-occurrence in trans with pathogenic BRCA2 variants was assessed in 5,382 families. Exon 3 exclusion rate was 4.5-fold higher in variant carriers (13%) than controls (3%), indicating an exclusion rate for the c.68-7T > A allele of approximately 20%. The posterior probability of pathogenicity was 7.44 × 10 -115 . There was neither evidence for increased risk of breast cancer (OR 1.03; 95% CI 0.86-1.24) nor for a deleterious effect of the variant when co-occurring with pathogenic variants. Our data provide for the first time robust evidence of the nonpathogenicity of the BRCA2 c.68-7T > A. Genetic and quantitative transcript analyses together inform the threshold for the ratio between functional and altered BRCA2 isoforms compatible with normal cell function. These findings might be exploited to assess the relevance for cancer risk of other BRCA2 spliceogenic variants. © 2018 The Authors. Human Mutation published by Wiley Periodicals, Inc.

Differential Effect of Initiating Moderate Red Wine Consumption on 24-h Blood Pressure by Alcohol Dehydrogenase Genotypes: Randomized Trial in Type 2 Diabetes.

PubMed

Gepner, Yftach; Henkin, Yaakov; Schwarzfuchs, Dan; Golan, Rachel; Durst, Ronen; Shelef, Ilan; Harman-Boehm, Ilana; Spitzen, Shosana; Witkow, Shula; Novack, Lena; Friger, Michael; Tangi-Rosental, Osnat; Sefarty, Dana; Bril, Nitzan; Rein, Michal; Cohen, Noa; Chassidim, Yoash; Sarusi, Benny; Wolak, Talia; Stampfer, Meir J; Rudich, Assaf; Shai, Iris

2016-04-01

Observational studies report inconsistent associations between moderate alcohol intake and blood pressure (BP). In a sub-study of a larger randomized controlled trial, we assessed the effect of initiating moderate red wine consumption on 24-h BP recordings and the effect of a common genetic variant of alcohol dehydrogenases (ADH) among patients with type 2 diabetes. Fifty-four type 2 diabetes, alcohol abstainers were randomized to consume 150 ml/dinner dry red wine or mineral water. Both groups were guided to adhere to a Mediterranean diet, without caloric restriction. We measured 24-h ambulatory BP monitoring (ABPM) at baseline and after 6 months. Participants (age = 57 years; 85% men; mean 24-h BP = 129/77 mm Hg) had 92% 6-month retention. After 6 months of intervention, the average 24-h BP did not differ between the wine and water groups. A transient decrease in BP was observed in the red wine group at midnight (3-4 hours after wine intake: systolic BP: red wine = -10.6mm Hg vs. mineral water = +2.3 mm Hg; P = 0.031) and the following morning at 7-9 am (red wine: -6.2mm Hg vs. mineral water: +5.6mm Hg; P = 0.014). In a second post hoc sub-analysis among the red wine consumers, individuals who were homozygous for the gene encoding ADH1B*2 variant (Arg48His; rs1229984, TT, fast ethanol metabolizers), exhibited a reduction in mean 24-h systolic BP (-8.0mm Hg vs. +3.7 mm Hg; P = 0.002) and pulse pressure (-3.8 mm Hg vs. +1.2 mm Hg; P = 0.032) compared to heterozygotes and those homozygous for the ADH1B*1 variant (CC, slow metabolizers). Initiating moderate red wine consumption at dinner among type 2 diabetes patients does not have a discernable effect on mean 24-h BP. Yet, a modest temporal BP reduction could be documented, and a more pronounced BP-lowering effect is suggested among fast ethanol metabolizers. ClinicalTrials.gov Identifier: NCT00784433. © American Journal of Hypertension, Ltd 2015. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Differential Effect of Initiating Moderate Red Wine Consumption on 24-h Blood Pressure by Alcohol Dehydrogenase Genotypes: Randomized Trial in Type 2 Diabetes

PubMed Central

Gepner, Yftach; Henkin, Yaakov; Schwarzfuchs, Dan; Golan, Rachel; Durst, Ronen; Shelef, Ilan; Harman-Boehm, Ilana; Spitzen, Shosana; Witkow, Shula; Novack, Lena; Friger, Michael; Tangi-Rosental, Osnat; Sefarty, Dana; Bril, Nitzan; Rein, Michal; Cohen, Noa; Chassidim, Yoash; Sarusi, Benny; Wolak, Talia; Stampfer, Meir J.; Rudich, Assaf

2016-01-01

AIMS Observational studies report inconsistent associations between moderate alcohol intake and blood pressure (BP). In a sub-study of a larger randomized controlled trial, we assessed the effect of initiating moderate red wine consumption on 24-h BP recordings and the effect of a common genetic variant of alcohol dehydrogenases (ADH) among patients with type 2 diabetes. METHODS Fifty-four type 2 diabetes, alcohol abstainers were randomized to consume 150ml/dinner dry red wine or mineral water. Both groups were guided to adhere to a Mediterranean diet, without caloric restriction. We measured 24-h ambulatory BP monitoring (ABPM) at baseline and after 6 months. RESULTS Participants (age = 57 years; 85% men; mean 24-h BP = 129/77mm Hg) had 92% 6-month retention. After 6 months of intervention, the average 24-h BP did not differ between the wine and water groups. A transient decrease in BP was observed in the red wine group at midnight (3–4 hours after wine intake: systolic BP: red wine = −10.6mm Hg vs. mineral water = +2.3mm Hg; P = 0.031) and the following morning at 7–9 am (red wine: −6.2mm Hg vs. mineral water: +5.6mm Hg; P = 0.014). In a second post hoc sub-analysis among the red wine consumers, individuals who were homozygous for the gene encoding ADH1B*2 variant (Arg48His; rs1229984, TT, fast ethanol metabolizers), exhibited a reduction in mean 24-h systolic BP (−8.0mm Hg vs. +3.7mm Hg; P = 0.002) and pulse pressure (−3.8mm Hg vs. +1.2mm Hg; P = 0.032) compared to heterozygotes and those homozygous for the ADH1B*1 variant (CC, slow metabolizers). CONCLUSIONS Initiating moderate red wine consumption at dinner among type 2 diabetes patients does not have a discernable effect on mean 24-h BP. Yet, a modest temporal BP reduction could be documented, and a more pronounced BP-lowering effect is suggested among fast ethanol metabolizers. CLINICAL TRIALS REGISTRATION ClinicalTrials.gov Identifier: NCT00784433. PMID:26232779

SSX2-4 expression in early-stage non-small cell lung cancer.

PubMed

Greve, K B V; Pøhl, M; Olsen, K E; Nielsen, O; Ditzel, H J; Gjerstorff, M F

2014-05-01

The expression of cancer/testis antigens SSX2, SSX3, and SSX4 in non-small cell lung cancers (NSCLC) was examined, since they are considered promising targets for cancer immunotherapy due to their immunogenicity and testis-restricted normal tissue expression. We characterized three SSX antibodies and performed immunohistochemical staining of 25 different normal tissues and 143 NSCLCs. The antibodies differed in binding to two distinctive splice variants of SSX2 that exhibited different subcellular staining patterns, suggesting that the two splice variants display different functions. SSX2-4 expression was only detected in 5 of 143 early-stage NSCLCs, which is rare compared to other cancer/testis antigens (e.g. MAGE-A and GAGE). However, further studies are needed to determine whether SSX can be used as a prognostic or predictive biomarker in NSCLC. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Multiplex families with epilepsy

PubMed Central

Afawi, Zaid; Oliver, Karen L.; Kivity, Sara; Mazarib, Aziz; Blatt, Ilan; Neufeld, Miriam Y.; Helbig, Katherine L.; Goldberg-Stern, Hadassa; Misk, Adel J.; Straussberg, Rachel; Walid, Simri; Mahajnah, Muhammad; Lerman-Sagie, Tally; Ben-Zeev, Bruria; Kahana, Esther; Masalha, Rafik; Kramer, Uri; Ekstein, Dana; Shorer, Zamir; Wallace, Robyn H.; Mangelsdorf, Marie; MacPherson, James N.; Carvill, Gemma L.; Mefford, Heather C.; Jackson, Graeme D.; Scheffer, Ingrid E.; Bahlo, Melanie; Gecz, Jozef; Heron, Sarah E.; Corbett, Mark; Mulley, John C.; Dibbens, Leanne M.; Korczyn, Amos D.

2016-01-01

Objective: To analyze the clinical syndromes and inheritance patterns of multiplex families with epilepsy toward the ultimate aim of uncovering the underlying molecular genetic basis. Methods: Following the referral of families with 2 or more relatives with epilepsy, individuals were classified into epilepsy syndromes. Families were classified into syndromes where at least 2 family members had a specific diagnosis. Pedigrees were analyzed and molecular genetic studies were performed as appropriate. Results: A total of 211 families were ascertained over an 11-year period in Israel. A total of 169 were classified into broad familial epilepsy syndrome groups: 61 generalized, 22 focal, 24 febrile seizure syndromes, 33 special syndromes, and 29 mixed. A total of 42 families remained unclassified. Pathogenic variants were identified in 49/211 families (23%). The majority were found in established epilepsy genes (e.g., SCN1A, KCNQ2, CSTB), but in 11 families, this cohort contributed to the initial discovery (e.g., KCNT1, PCDH19, TBC1D24). We expand the phenotypic spectrum of established epilepsy genes by reporting a familial LAMC3 homozygous variant, where the predominant phenotype was epilepsy with myoclonic-atonic seizures, and a pathogenic SCN1A variant in a family where in 5 siblings the phenotype was broadly consistent with Dravet syndrome, a disorder that usually occurs sporadically. Conclusion: A total of 80% of families were successfully classified, with pathogenic variants identified in 23%. The successful characterization of familial electroclinical and inheritance patterns has highlighted the value of studying multiplex families and their contribution towards uncovering the genetic basis of the epilepsies. PMID:26802095

Molecular variants of HPV type 16 E6 among Mexican women with LSIL and invasive cancer.

PubMed

del Refugio González-Losa, María; Laviada Mier y Teran, Miguel A; Puerto-Solís, Marylín; García-Carrancá, Alejandro

2004-02-01

Cervical cancer is the second most common cancer in women worldwide. Infection with human papillomavirus (HPV) 16 is an important risk factor associated with cervical cancer, more than 50% of cervical cancer tissues have DNA of HPV 16. Intratypic variants have been reported, although they differ in prevalence, biological and biochemical properties, their implication in the aetiology of cervical cancer is still uncertain. To identify HPV type 16 E6 variants among Mexican women with diagnosis of low-grade squamous intraepithelial lesion (LSIL) or invasive cancer (IC). Forty HPV16-positive samples were included, 15 were from women with LSIL, 25 from women with IC; 610 pb from the E6 gene were amplified by PCR and the variant status subsequently determined by hybridization with 27 biotinilated probes. Statistical analysis was performed with chi2, odds ratio (OR). In the LSIL group we only found ten (66%) EP and five (33%) EP350G variants. In the IC group, four variants were found; 11 (44%) AA, seven (28%) EP, six (24%) EP350G, one (4%) Af2. Comparison of the frequency of variants differed from EP in both groups of patients (P=0.01) with an odds ratio (OR) of 5.14 (CI 95% [1.07-26.56]). This study demonstrates an association between HPV type 16 variants different from prototype (EP) and invasive cervical cancer.

Synthesis and Antiviral Activity of 5-Substituted Cytidine Analogues: Identification of a Potent Inhibitor of Viral RNA-Dependent RNA Polymerases

PubMed Central

Harki, Daniel A.; Graci, Jason D.; Galarraga, Jessica E.; Chain, William J.; Cameron, Craig E.; Peterson, Blake R.

2007-01-01

As part of our studies of lethal viral mutagens, a series of 5-substituted cytidine analogues were synthesized and evaluated for antiviral activity. Among the compounds examined, 5-nitrocytidine was effective against poliovirus (PV) and coxsackievirus B3 (CVB3) and exhibited greater activity than the clinically employed drug ribavirin. Instead of promoting viral mutagenesis, 5-nitrocytidine triphosphate inhibited PV RNA-dependent RNA polymerase (Kd = 1.1 ± 0.1 μM), and this inhibition is sufficient to explain the observed antiviral activity. PMID:17034123

A comprehensive examination of breast cancer risk loci in African American women.

PubMed

Feng, Ye; Stram, Daniel O; Rhie, Suhn Kyong; Millikan, Robert C; Ambrosone, Christine B; John, Esther M; Bernstein, Leslie; Zheng, Wei; Olshan, Andrew F; Hu, Jennifer J; Ziegler, Regina G; Nyante, Sarah; Bandera, Elisa V; Ingles, Sue A; Press, Michael F; Deming, Sandra L; Rodriguez-Gil, Jorge L; Palmer, Julie R; Olopade, Olufunmilayo I; Huo, Dezheng; Adebamowo, Clement A; Ogundiran, Temidayo; Chen, Gary K; Stram, Alex; Park, Karen; Rand, Kristin A; Chanock, Stephen J; Le Marchand, Loic; Kolonel, Laurence N; Conti, David V; Easton, Douglas; Henderson, Brian E; Haiman, Christopher A

2014-10-15

Genome-wide association studies have identified 73 breast cancer risk variants mainly in European populations. Given considerable differences in linkage disequilibrium structure between populations of European and African ancestry, the known risk variants may not be informative for risk in African ancestry populations. In a previous fine-mapping investigation of 19 breast cancer loci, we were able to identify SNPs in four regions that better captured risk associations in African American women. In this study of breast cancer in African American women (3016 cases, 2745 controls), we tested an additional 54 novel breast cancer risk variants. Thirty-eight variants (70%) were found to have an association with breast cancer in the same direction as previously reported, with eight (15%) replicating at P < 0.05. Through fine-mapping, in three regions (1q32, 3p24, 10q25), we identified variants that better captured associations with overall breast cancer or estrogen receptor positive disease. We also observed suggestive associations with variants (at P < 5 × 10(-6)) in three separate regions (6q25, 14q13, 22q12) that may represent novel risk variants. Directional consistency of association observed for ∼65-70% of currently known genetic variants for breast cancer in women of African ancestry implies a shared functional common variant at most loci. To validate and enhance the spectrum of alleles that define associations at the known breast cancer risk loci, as well as genome-wide, will require even larger collaborative efforts in women of African ancestry. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Decoding the Effect of Isobaric Substitutions on Identifying Missing Proteins and Variant Peptides in Human Proteome.

PubMed

Choong, Wai-Kok; Lih, Tung-Shing Mamie; Chen, Yu-Ju; Sung, Ting-Yi

2017-12-01

To confirm the existence of missing proteins, we need to identify at least two unique peptides with length of 9-40 amino acids of a missing protein in bottom-up mass-spectrometry-based proteomic experiments. However, an identified unique peptide of the missing protein, even identified with high level of confidence, could possibly coincide with a peptide of a commonly observed protein due to isobaric substitutions, mass modifications, alternative splice isoforms, or single amino acid variants (SAAVs). Besides unique peptides of missing proteins, identified variant peptides (SAAV-containing peptides) could also alternatively map to peptides of other proteins due to the aforementioned issues. Therefore, we conducted a thorough comparative analysis on data sets in PeptideAtlas Tiered Human Integrated Search Proteome (THISP, 2017-03 release), including neXtProt (2017-01 release), to systematically investigate the possibility of unique peptides in missing proteins (PE2-4), unique peptides in dubious proteins, and variant peptides affected by isobaric substitutions, causing doubtful identification results. In this study, we considered 11 isobaric substitutions. From our analysis, we found <5% of the unique peptides of missing proteins and >6% of variant peptides became shared with peptides of PE1 proteins after isobaric substitutions.

A targeted genotyping approach enhances identification of variants in taste receptor and appetite/reward genes of potential functional importance for obesity-related porcine traits.

PubMed

Cirera, S; Clop, A; Jacobsen, M J; Guerin, M; Lesnik, P; Jørgensen, C B; Fredholm, M; Karlskov-Mortensen, P

2018-04-01

Taste receptors (TASRs) and appetite and reward (AR) mechanisms influence eating behaviour, which in turn affects food intake and risk of obesity. In a previous study, we used next generation sequencing to identify potentially functional mutations in TASR and AR genes and found indications for genetic associations between identified variants and growth and fat deposition in a subgroup of animals (n = 38) from the UNIK resource pig population. This population was created for studying obesity and obesity-related diseases. In the present study we validated results from our previous study by investigating genetic associations between 24 selected single nucleotide variants in TASR and AR gene variants and 35 phenotypes describing obesity and metabolism in the entire UNIK population (n = 564). Fifteen variants showed significant association with specific obesity-related phenotypes after Bonferroni correction. Six of the 15 genes, namely SIM1, FOS, TAS2R4, TAS2R9, MCHR2 and LEPR, showed good correlation between known biological function and associated phenotype. We verified a genetic association between potentially functional variants in TASR/AR genes and growth/obesity and conclude that the combination of identification of potentially functional variants by next generation sequencing followed by targeted genotyping and association studies is a powerful and cost-effective approach for increasing the power of genetic association studies. © 2018 Stichting International Foundation for Animal Genetics.

Concentration of Enteroviruses, Adenoviruses, and Noroviruses from Drinking Water by Use of Glass Wool Filters▿

PubMed Central

Lambertini, Elisabetta; Spencer, Susan K.; Bertz, Phillip D.; Loge, Frank J.; Kieke, Burney A.; Borchardt, Mark A.

2008-01-01

Available filtration methods to concentrate waterborne viruses are either too costly for studies requiring large numbers of samples, limited to small sample volumes, or not very portable for routine field applications. Sodocalcic glass wool filtration is a cost-effective and easy-to-use method to retain viruses, but its efficiency and reliability are not adequately understood. This study evaluated glass wool filter performance to concentrate the four viruses on the U.S. Environmental Protection Agency contaminant candidate list, i.e., coxsackievirus, echovirus, norovirus, and adenovirus, as well as poliovirus. Total virus numbers recovered were measured by quantitative reverse transcription-PCR (qRT-PCR); infectious polioviruses were quantified by integrated cell culture (ICC)-qRT-PCR. Recovery efficiencies averaged 70% for poliovirus, 14% for coxsackievirus B5, 19% for echovirus 18, 21% for adenovirus 41, and 29% for norovirus. Virus strain and water matrix affected recovery, with significant interaction between the two variables. Optimal recovery was obtained at pH 6.5. No evidence was found that water volume, filtration rate, and number of viruses seeded influenced recovery. The method was successful in detecting indigenous viruses in municipal wells in Wisconsin. Long-term continuous filtration retained viruses sufficiently for their detection for up to 16 days after seeding for qRT-PCR and up to 30 days for ICC-qRT-PCR. Glass wool filtration is suitable for large-volume samples (1,000 liters) collected at high filtration rates (4 liters min−1), and its low cost makes it advantageous for studies requiring large numbers of samples. PMID:18359827

Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease.

PubMed

Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong

2017-10-01

Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification of Susceptibility Loci and Genes for Colorectal Cancer Risk.

PubMed

Zeng, Chenjie; Matsuda, Koichi; Jia, Wei-Hua; Chang, Jiang; Kweon, Sun-Seog; Xiang, Yong-Bing; Shin, Aesun; Jee, Sun Ha; Kim, Dong-Hyun; Zhang, Ben; Cai, Qiuyin; Guo, Xingyi; Long, Jirong; Wang, Nan; Courtney, Regina; Pan, Zhi-Zhong; Wu, Chen; Takahashi, Atsushi; Shin, Min-Ho; Matsuo, Keitaro; Matsuda, Fumihiko; Gao, Yu-Tang; Oh, Jae Hwan; Kim, Soriul; Jung, Keum Ji; Ahn, Yoon-Ok; Ren, Zefang; Li, Hong-Lan; Wu, Jie; Shi, Jiajun; Wen, Wanqing; Yang, Gong; Li, Bingshan; Ji, Bu-Tian; Brenner, Hermann; Schoen, Robert E; Küry, Sébastien; Gruber, Stephen B; Schumacher, Fredrick R; Stenzel, Stephanie L; Casey, Graham; Hopper, John L; Jenkins, Mark A; Kim, Hyeong-Rok; Jeong, Jin-Young; Park, Ji Won; Tajima, Kazuo; Cho, Sang-Hee; Kubo, Michiaki; Shu, Xiao-Ou; Lin, Dongxin; Zeng, Yi-Xin; Zheng, Wei

2016-06-01

Known genetic factors explain only a small fraction of genetic variation in colorectal cancer (CRC). We conducted a genome-wide association study to identify risk loci for CRC. This discovery stage included 8027 cases and 22,577 controls of East-Asian ancestry. Promising variants were evaluated in studies including as many as 11,044 cases and 12,047 controls. Tumor-adjacent normal tissues from 188 patients were analyzed to evaluate correlations of risk variants with expression levels of nearby genes. Potential functionality of risk variants were evaluated using public genomic and epigenomic databases. We identified 4 loci associated with CRC risk; P values for the most significant variant in each locus ranged from 3.92 × 10(-8) to 1.24 × 10(-12): 6p21.1 (rs4711689), 8q23.3 (rs2450115, rs6469656), 10q24.3 (rs4919687), and 12p13.3 (rs11064437). We also identified 2 risk variants at loci previously associated with CRC: 10q25.2 (rs10506868) and 20q13.3 (rs6061231). These risk variants, conferring an approximate 10%-18% increase in risk per allele, are located either inside or near protein-coding genes that include transcription factor EB (lysosome biogenesis and autophagy), eukaryotic translation initiation factor 3, subunit H (initiation of translation), cytochrome P450, family 17, subfamily A, polypeptide 1 (steroidogenesis), splA/ryanodine receptor domain and SOCS box containing 2 (proteasome degradation), and ribosomal protein S2 (ribosome biogenesis). Gene expression analyses showed a significant association (P < .05) for rs4711689 with transcription factor EB, rs6469656 with eukaryotic translation initiation factor 3, subunit H, rs11064437 with splA/ryanodine receptor domain and SOCS box containing 2, and rs6061231 with ribosomal protein S2. We identified susceptibility loci and genes associated with CRC risk, linking CRC predisposition to steroid hormone, protein synthesis and degradation, and autophagy pathways and providing added insight into the mechanism of CRC pathogenesis. Copyright © 2016 AGA Institute. Published by Elsevier Inc. All rights reserved.

Rare variants in FBN1 and FBN2 are associated with severe adolescent idiopathic scoliosis

PubMed Central

Buchan, Jillian G.; Alvarado, David M.; Haller, Gabe E.; Cruchaga, Carlos; Harms, Matthew B.; Zhang, Tianxiao; Willing, Marcia C.; Grange, Dorothy K.; Braverman, Alan C.; Miller, Nancy H.; Morcuende, Jose A.; Tang, Nelson Leung-Sang; Lam, Tsz-Ping; Ng, Bobby Kin-Wah; Cheng, Jack Chun-Yiu; Dobbs, Matthew B.; Gurnett, Christina A.

2014-01-01

Adolescent idiopathic scoliosis (AIS) causes spinal deformity in 3% of children. Despite a strong genetic basis, few genes have been associated with AIS and the pathogenesis remains poorly understood. In a genome-wide rare variant burden analysis using exome sequence data, we identified fibrillin-1 (FBN1) as the most significantly associated gene with AIS. Based on these results, FBN1 and a related gene, fibrillin-2 (FBN2), were sequenced in a total of 852 AIS cases and 669 controls. In individuals of European ancestry, rare variants in FBN1 and FBN2 were enriched in severely affected AIS cases (7.6%) compared with in-house controls (2.4%) (OR = 3.5, P = 5.46 × 10−4) and Exome Sequencing Project controls (2.3%) (OR = 3.5, P = 1.48 × 10−6). Scoliosis severity in AIS cases was associated with FBN1 and FBN2 rare variants (P = 0.0012) and replicated in an independent Han Chinese cohort (P = 0.0376), suggesting that rare variants may be useful as predictors of curve progression. Clinical evaluations revealed that the majority of AIS cases with rare FBN1 variants do not meet diagnostic criteria for Marfan syndrome, though variants are associated with tall stature (P = 0.0035) and upregulation of the transforming growth factor beta pathway. Overall, these results expand our definition of fibrillin-related disorders to include AIS and open up new strategies for diagnosing and treating severe AIS. PMID:24833718

Expression, purification, crystallization and preliminary X-ray analysis of the Met244Ala variant of catalase–peroxidase (KatG) from the haloarchaeon Haloarcula marismortui

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ten-i, Tomomi; Kumasaka, Takashi; Higuchi, Wataru

2007-11-01

The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. The covalent modification of the side chains of Trp95, Tyr218 and Met244 within the active site of Haloarcula marismortui catalase–peroxidase (KatG) appears to be common to all KatGs and has been demonstrated to be particularly significant formore » its bifunctionality [Smulevich et al. (2006 ▶), J. Inorg. Biochem.100, 568–585; Jakopitsch, Kolarich et al. (2003 ▶), FEBS Lett.552, 135–140; Jakopitsch, Auer et al. (2003 ▶), J. Biol. Chem.278, 20185–20191; Jakopitsch et al. (2004 ▶), J. Biol. Chem.279, 46082–46095; Regelsberger et al. (2001 ▶), Biochem. Soc. Trans.29, 99–105; Ghiladi, Knudsen et al. (2005 ▶), J. Biol. Chem.280, 22651–22663; Ghiladi, Medzihradzky et al. (2005 ▶), Biochemistry, 44, 15093–15105]. The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant showed a complete loss of catalase activity, whereas the peroxidase activity of this mutant was highly enhanced owing to an increase in its affinity for the peroxidatic substrate. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. A crystal frozen using lithium sulfate as the cryoprotectant diffracted to beyond 2.0 Å resolution. Preliminary X-ray analysis suggests the presence of a dimer in the asymmetric unit.« less

Analysis of Hepatitis C Virus Genotype 1b Resistance Variants in Japanese Patients Treated with Paritaprevir-Ritonavir and Ombitasvir.

PubMed

Krishnan, Preethi; Schnell, Gretja; Tripathi, Rakesh; Beyer, Jill; Reisch, Thomas; Zhang, Xinyan; Setze, Carolyn; Rodrigues, Lino; Burroughs, Margaret; Redman, Rebecca; Chayama, Kazuaki; Kumada, Hiromitsu; Collins, Christine; Pilot-Matias, Tami

2016-02-01

Treatment of HCV genotype 1b (GT1b)-infected Japanese patients with paritaprevir (NS3/4A inhibitor boosted with ritonavir) and ombitasvir (NS5A inhibitor) in studies M12-536 and GIFT-I demonstrated high sustained virologic response (SVR) rates. The virologic failure rate was 3% (13/436) across the two studies. Analyses were conducted to evaluate the impact of baseline resistance-associated variants (RAVs) on treatment outcome and the emergence and persistence of RAVs in patients experiencing virologic failure. Baseline paritaprevir resistance-conferring variants in NS3 were infrequent, while Y93H in NS5A was the most prevalent ombitasvir resistance-conferring variant at baseline. A comparison of baseline prevalence of polymorphisms in Japanese and western patients showed that Q80L and S122G in NS3 and L28M, R30Q, and Y93H in NS5A were significantly more prevalent in Japanese patients. In the GIFT-I study, the prevalence of Y93H in NS5A varied between 13% and 21% depending on the deep-sequencing detection threshold. Among patients with Y93H comprising <1%, 1 to 40%, or >40% of their preexisting viral population, the 24-week SVR (SVR24) rates were >99% (276/277), 93% (38/41), and 76% (25/33), respectively, indicating that the prevalence of Y93H within a patient's viral population is a good predictor of treatment response. The predominant RAVs at the time of virologic failure were D168A/V in NS3 and Y93H alone or in combination with other variants in NS5A. While levels of NS3 RAVs declined over time, NS5A RAVs persisted through posttreatment week 48. Results from these analyses are informative in understanding the resistance profile of an ombitasvir- plus paritaprevir/ritonavir-based regimen in Japanese GT1b-infected patients. Copyright © 2016 Krishnan et al.

The cholinesterase variants found in some African tribes living in Rhodesia.

PubMed

Whittaker, M; Lowe, R F

1976-01-01

Blood samples from 1,614 Africans living in Rhodesia have been phenotyped for the cholinesterase variants at the E1 and E2 loci. 24% of the African population were non-Rhodesian by birth. 1,227 Rhodesians aligned themselves to 20 tribes, 191 Malawians to 8 tribes. 162 Mozambique Africans to 9 tribes and 34 Zambians to 8 tribes. A high frequency of 0.036 for the Ef1 gene, which varies from tribe to tribe, has been found in Rhodesian and Malawian Africans. Similar high frequencies for this gene are recorded for Zambian (0.045) and Mozambique Africans (0.034). The frequencies of the Es1 gene in these groups are 0.013 (Rhodesian), 0.009 (Malawian), and 0.016 (Mozambique African). The small Zambian sample showed evidence for neither the Es1 nor the C5+ electrophoretic variant. The absence of the Ea1 gene in the 1,613 Africans provides additional evidence of the rarity of this gene in negroid populations. The frequency of the C5+ variant in Rhodesian, Malawian and Mozambique Africans, although varying from tribe to tribe within the range of 0-8%, averages 3% in each group. These represent low frequencies for this variant when compared to other populations. No rare or 'private' electrophoretic variant has been found.

The Epidemiology of Hand, Foot and Mouth Disease in Asia: A Systematic Review and Analysis.

PubMed

Koh, Wee Ming; Bogich, Tiffany; Siegel, Karen; Jin, Jing; Chong, Elizabeth Y; Tan, Chong Yew; Chen, Mark Ic; Horby, Peter; Cook, Alex R

2016-10-01

Hand, foot and mouth disease (HFMD) is a widespread pediatric disease caused primarily by human enterovirus 71 (EV-A71) and Coxsackievirus A16 (CV-A16). This study reports a systematic review of the epidemiology of HFMD in Asia. PubMed, Web of Science and Google Scholar were searched up to December 2014. Two reviewers independently assessed studies for epidemiologic and serologic information about prevalence and incidence of HFMD against predetermined inclusion/exclusion criteria. Two reviewers extracted answers for 8 specific research questions on HFMD epidemiology. The results are checked by 3 others. HFMD is found to be seasonal in temperate Asia with a summer peak and in subtropical Asia with spring and fall peaks, but not in tropical Asia; evidence of a climatic role was identified for temperate Japan. Risk factors for HFMD include hygiene, age, gender and social contacts, but most studies were underpowered to adjust rigorously for confounding variables. Both community-level and school-level transmission have been implicated, but their relative importance for HFMD is inconclusive. Epidemiologic indices are poorly understood: No supporting quantitative evidence was found for the incubation period of EV-A71; the symptomatic rate of EV-A71/Coxsackievirus A16 infection was from 10% to 71% in 4 studies; while the basic reproduction number was between 1.1 and 5.5 in 3 studies. The uncertainty in these estimates inhibits their use for further analysis. Diversity of study designs complicates attempts to identify features of HFMD epidemiology. Knowledge on HFMD remains insufficient to guide interventions such as the incorporation of an EV-A71 vaccine in pediatric vaccination schedules. Research is urgently needed to fill these gaps.

Nuclear lamina genetic variants, including a truncated LAP2, in twins and siblings with nonalcoholic fatty liver disease.

PubMed

Brady, Graham F; Kwan, Raymond; Ulintz, Peter J; Nguyen, Phirum; Bassirian, Shirin; Basrur, Venkatesha; Nesvizhskii, Alexey I; Loomba, Rohit; Omary, M Bishr

2018-05-01

Nonalcoholic fatty liver disease (NAFLD) is becoming the major chronic liver disease in many countries. Its pathogenesis is multifactorial, but twin and familial studies indicate significant heritability, which is not fully explained by currently known genetic susceptibility loci. Notably, mutations in genes encoding nuclear lamina proteins, including lamins, cause lipodystrophy syndromes that include NAFLD. We hypothesized that variants in lamina-associated proteins predispose to NAFLD and used a candidate gene-sequencing approach to test for variants in 10 nuclear lamina-related genes in a cohort of 37 twin and sibling pairs: 21 individuals with and 53 without NAFLD. Twelve heterozygous sequence variants were identified in four lamina-related genes (ZMPSTE24, TMPO, SREBF1, SREBF2). The majority of NAFLD patients (>90%) had at least one variant compared to <40% of controls (P < 0.0001). When only insertions/deletions and changes in conserved residues were considered, the difference between the groups was similarly striking (>80% versus <25%; P < 0.0001). Presence of a lamina variant segregated with NAFLD independently of the PNPLA3 I148M polymorphism. Several variants were found in TMPO, which encodes the lamina-associated polypeptide-2 (LAP2) that has not been associated with liver disease. One of these, a frameshift insertion that generates truncated LAP2, abrogated lamin-LAP2 binding, caused LAP2 mislocalization, altered endogenous lamin distribution, increased lipid droplet accumulation after oleic acid treatment in transfected cells, and led to cytoplasmic association with the ubiquitin-binding protein p62/SQSTM1. Several variants in nuclear lamina-related genes were identified in a cohort of twins and siblings with NAFLD; one such variant, which results in a truncated LAP2 protein and a dramatic phenotype in cell culture, represents an association of TMPO/LAP2 variants with NAFLD and underscores the potential importance of the nuclear lamina in NAFLD. (Hepatology 2018;67:1710-1725). © 2017 by the American Association for the Study of Liver Diseases.

The Epidemiology of Hand, Foot and Mouth Disease in Asia

PubMed Central

Koh, Wee Ming; Bogich, Tiffany; Siegel, Karen; Jin, Jing; Chong, Elizabeth Y.; Tan, Chong Yew; Chen, Mark IC; Horby, Peter

2016-01-01

Context: Hand, foot and mouth disease (HFMD) is a widespread pediatric disease caused primarily by human enterovirus 71 (EV-A71) and Coxsackievirus A16 (CV-A16). Objective: This study reports a systematic review of the epidemiology of HFMD in Asia. Data Sources: PubMed, Web of Science and Google Scholar were searched up to December 2014. Study Selection: Two reviewers independently assessed studies for epidemiologic and serologic information about prevalence and incidence of HFMD against predetermined inclusion/exclusion criteria. Data Extraction: Two reviewers extracted answers for 8 specific research questions on HFMD epidemiology. The results are checked by 3 others. Results: HFMD is found to be seasonal in temperate Asia with a summer peak and in subtropical Asia with spring and fall peaks, but not in tropical Asia; evidence of a climatic role was identified for temperate Japan. Risk factors for HFMD include hygiene, age, gender and social contacts, but most studies were underpowered to adjust rigorously for confounding variables. Both community-level and school-level transmission have been implicated, but their relative importance for HFMD is inconclusive. Epidemiologic indices are poorly understood: No supporting quantitative evidence was found for the incubation period of EV-A71; the symptomatic rate of EV-A71/Coxsackievirus A16 infection was from 10% to 71% in 4 studies; while the basic reproduction number was between 1.1 and 5.5 in 3 studies. The uncertainty in these estimates inhibits their use for further analysis. Limitations: Diversity of study designs complicates attempts to identify features of HFMD epidemiology. Conclusions: Knowledge on HFMD remains insufficient to guide interventions such as the incorporation of an EV-A71 vaccine in pediatric vaccination schedules. Research is urgently needed to fill these gaps. PMID:27273688

Assessing the impact of copy number variants on miRNA genes in autism by Monte Carlo simulation.

PubMed

Marrale, Maurizio; Albanese, Nadia Ninfa; Calì, Francesco; Romano, Valentino

2014-01-01

Autism Spectrum Disorders (ASDs) are childhood neurodevelopmental disorders with complex genetic origins. Previous studies have investigated the role of de novo Copy Number Variants (CNVs) and microRNAs as important but distinct etiological factors in ASD. We developed a novel computational procedure to assess the potential pathogenic role of microRNA genes overlapping de novo CNVs in ASD patients. Here we show that for chromosomes # 1, 2 and 22 the actual number of miRNA loci affected by de novo CNVs in patients was found significantly higher than that estimated by Monte Carlo simulation of random CNV events. Out of 24 miRNA genes over-represented in CNVs from these three chromosomes only hsa-mir-4436b-1 and hsa-mir-4436b-2 have not been detected in CNVs from non-autistic subjects as reported in the Database of Genomic Variants. Altogether the results reported in this study represent a first step towards a full understanding of how a dysregulated expression of the 24 miRNAs genes affect neurodevelopment in autism. We also propose that the procedure used in this study can be effectively applied to CNVs/miRNA genes association data in other genomic disorders beyond autism.

Chemical disinfection of non-porous inanimate surfaces experimentally contaminated with four human pathogenic viruses.

PubMed

Sattar, S A; Springthorpe, V S; Karim, Y; Loro, P

1989-06-01

The chemical disinfection of virus-contaminated non-porous inanimate surfaces was investigated using coxsackievirus B3, adenovirus type 5, parainfluenza virus type 3 and coronavirus 229E as representatives of important nosocomial viral pathogens. A 10 microliter amount of the test virus, suspended in either faeces or mucin, was placed onto each stainless steel disk (about 1 cm in diameter) and the inoculum allowed to dry for 1 h under ambient conditions. Sixteen disinfectant formulations were selected for this study based on the findings of an earlier investigation with a human rotavirus. After 1 min exposure to 20 microliters of the disinfectant, the virus from the disks was immediately eluted into tryptose phosphate broth and plaque assayed. Using an efficacy criterion of a 3 log10 or greater reduction in virus infectivity titre and irrespective of the virus suspending medium, only the following five disinfectants proved to be effective against all the four viruses tested: (1) 2% glutaraldehyde normally used as an instrument soak, (2) a strongly alkaline mixture of 0.5% sodium o-benzyl-p-chlorophenate and 0.6% sodium lauryl sulphate, generally used as a domestic disinfectant cleaner for hard surfaces, (3) a 0.04% solution of a quaternary ammonium compound containing 7% hydrochloric acid, which is the basis of many toilet bowl cleaners, (4) chloramine T at a minimum free chlorine level of 3000 p.p.m. and (5) sodium hypochlorite at a minimum free chlorine concentration of 5000 p.p.m. Of those chemicals suitable for use as topical antiseptics, 70% ethanol alone or products containing at least 70% ethanol were ineffective only against coxsackievirus B3. These results emphasize the care needed in selecting chemical disinfectants for routine use in infection control.

Characterization of genome sequences and clinical features of coxsackievirus A6 strains collected in Hyogo, Japan in 1999-2013.

PubMed

Ogi, Miki; Yano, Yoshihiko; Chikahira, Masatsugu; Takai, Denshi; Oshibe, Tomohiro; Arashiro, Takeshi; Hanaoka, Nozomu; Fujimoto, Tsuguto; Hayashi, Yoshitake

2017-08-01

Coxsackievirus A6 (CV-A6) is an enterovirus, which is known to cause herpangina. However, since 2009 it has frequently been isolated from children with hand, foot, and mouth disease (HFMD). In Japan, CV-A6 has been linked to HFMD outbreaks in 2011 and 2013. In this study, the full-length genome sequencing of CV-A6 strains were analyzed to identify the association with clinical manifestations. Five thousand six hundred and twelve children with suspected enterovirus infection (0-17 years old) between 1999 and 2013 in Hyogo Prefecture, Japan, were enrolled. Enterovirus infection was confirmed with reverse transcriptase-PCR in 753 children (791 samples), 127 of whom (133 samples) were positive for CV-A6 based on the direct sequencing of the VP4 region. The complete genomes of CV-A6 from 22 positive patients with different clinical manifestations were investigated. A phylogenetic analysis divided these 22 strains into two clusters based on the VP1 region; cluster I contained strains collected in 1999-2009 and mostly related to herpangina, and cluster II contained strains collected in 2011-2013 and related to HFMD outbreak. Based on the full-length polyprotein analysis, the amino acid differences between the strains in cluster I and II were 97.7 ± 0.28%. Amino acid differences were detected in 17 positions within the polyprotein. Strains collected in 1999-2009 and those in 2011-2013 were separately clustered by phylogenetic analysis based on 5'UTR and 3Dpol region, as well as VP1 region. In conclusion, HFMD outbreaks by CV-A6 were recently frequent in Japan and the accumulation of genomic change might be associated with the clinical course. © 2017 Wiley Periodicals, Inc.

TaqMan based real time PCR assay targeting EML4-ALK fusion transcripts in NSCLC.

PubMed

Robesova, Blanka; Bajerova, Monika; Liskova, Kvetoslava; Skrickova, Jana; Tomiskova, Marcela; Pospisilova, Sarka; Mayer, Jiri; Dvorakova, Dana

2014-07-01

Lung cancer with the ALK rearrangement constitutes only a small fraction of patients with non-small cell lung cancer (NSCLC). However, in the era of molecular-targeted therapy, efficient patient selection is crucial for successful treatment. In this context, an effective method for EML4-ALK detection is necessary. We developed a new highly sensitive variant specific TaqMan based real time PCR assay applicable to RNA from formalin-fixed paraffin-embedded tissue (FFPE). This assay was used to analyze the EML4-ALK gene in 96 non-selected NSCLC specimens and compared with two other methods (end-point PCR and break-apart FISH). EML4-ALK was detected in 33/96 (34%) specimens using variant specific real time PCR, whereas in only 23/96 (24%) using end-point PCR. All real time PCR positive samples were confirmed with direct sequencing. A total of 46 specimens were subsequently analyzed by all three detection methods. Using variant specific real time PCR we identified EML4-ALK transcript in 17/46 (37%) specimens, using end-point PCR in 13/46 (28%) specimens and positive ALK rearrangement by FISH was detected in 8/46 (17.4%) specimens. Moreover, using variant specific real time PCR, 5 specimens showed more than one EML4-ALK variant simultaneously (in 2 cases the variants 1+3a+3b, in 2 specimens the variants 1+3a and in 1 specimen the variant 1+3b). In one case of 96 EML4-ALK fusion gene and EGFR mutation were detected. All simultaneous genetic variants were confirmed using end-point PCR and direct sequencing. Our variant specific real time PCR assay is highly sensitive, fast, financially acceptable, applicable to FFPE and seems to be a valuable tool for the rapid prescreening of NSCLC patients in clinical practice, so, that most patients able to benefit from targeted therapy could be identified. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

De Novo Mutations in SLC25A24 Cause a Disorder Characterized by Early Aging, Bone Dysplasia, Characteristic Face, and Early Demise.

PubMed

Writzl, Karin; Maver, Ales; Kovačič, Lidija; Martinez-Valero, Paula; Contreras, Laura; Satrustegui, Jorgina; Castori, Marco; Faivre, Laurence; Lapunzina, Pablo; van Kuilenburg, André B P; Radović, Slobodanka; Thauvin-Robinet, Christel; Peterlin, Borut; Del Arco, Araceli; Hennekam, Raoul C

2017-11-02

A series of simplex cases have been reported under various diagnoses sharing early aging, especially evident in congenitally decreased subcutaneous fat tissue and sparse hair, bone dysplasia of the skull and fingers, a distinctive facial gestalt, and prenatal and postnatal growth retardation. For historical reasons, we suggest naming the entity Fontaine syndrome. Exome sequencing of four unrelated affected individuals showed that all carried the de novo missense variant c.649C>T (p.Arg217Cys) or c.650G>A (p.Arg217His) in SLC25A24, a solute carrier 25 family member coding for calcium-binding mitochondrial carrier protein (SCaMC-1, also known as SLC25A24). SLC25A24 allows an electro-neutral and reversible exchange of ATP-Mg and phosphate between the cytosol and mitochondria, which is required for maintaining optimal adenine nucleotide levels in the mitochondrial matrix. Molecular dynamic simulation studies predict that p.Arg217Cys and p.Arg217His narrow the substrate cavity of the protein and disrupt transporter dynamics. SLC25A24-mutant fibroblasts and cells expressing p.Arg217Cys or p.Arg217His variants showed altered mitochondrial morphology, a decreased proliferation rate, increased mitochondrial membrane potential, and decreased ATP-linked mitochondrial oxygen consumption. The results suggest that the SLC25A24 mutations lead to impaired mitochondrial ATP synthesis and cause hyperpolarization and increased proton leak in association with an impaired energy metabolism. Our findings identify SLC25A24 mutations affecting codon 217 as the underlying genetic cause of human progeroid Fontaine syndrome. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Rare, low frequency, and common coding variants in CHRNA5 and their contribution to nicotine dependence in European and African Americans

PubMed Central

Olfson, Emily; Saccone, Nancy L.; Johnson, Eric O.; Chen, Li-Shiun; Culverhouse, Robert; Doheny, Kimberly; Foltz, Steven M.; Fox, Louis; Gogarten, Stephanie M.; Hartz, Sarah; Hetrick, Kurt; Laurie, Cathy C.; Marosy, Beth; Amin, Najaf; Arnett, Donna; Barr, R. Graham; Bartz, Traci M.; Bertelsen, Sarah; Borecki, Ingrid B.; Brown, Michael R.; Chasman, Daniel I.; van Duijn, Cornelia M.; Feitosa, Mary F.; Fox, Ervin R.; Franceschini, Nora; Franco, Oscar H.; Grove, Megan L.; Guo, Xiuqing; Hofman, Albert; Kardia, Sharon L.R.; Morrison, Alanna C.; Musani, Solomon K.; Psaty, Bruce M.; Rao, D.C.; Reiner, Alex P.; Rice, Kenneth; Ridker, Paul M.; Rose, Lynda M.; Schick, Ursula M.; Schwander, Karen; Uitterlinden, Andre G.; Vojinovic, Dina; Wang, Jen-Chyong; Ware, Erin B.; Wilson, Gregory; Yao, Jie; Zhao, Wei; Breslau, Naomi; Hatsukami, Dorothy; Stitzel, Jerry A.; Rice, John; Goate, Alison; Bierut, Laura J.

2015-01-01

The common nonsynonymous variant rs16969968 in the α5 nicotinic receptor subunit gene (CHRNA5) is the strongest genetic risk factor for nicotine dependence in European Americans and contributes to risk in African Americans. To comprehensively examine whether other CHRNA5 coding variation influences nicotine dependence risk, we performed targeted sequencing on 1582 nicotine dependent cases (Fagerström Test for Nicotine Dependence score≥4) and 1238 non-dependent controls, with independent replication of common and low frequency variants using 12 studies with exome chip data. Nicotine dependence was examined using logistic regression with individual common variants (MAF≥0.05), aggregate low frequency variants (0.05>MAF≥0.005), and aggregate rare variants (MAF<0.005). Meta-analysis of primary results was performed with replication studies containing 12 174 heavy and 11 290 light smokers. Next-generation sequencing with 180X coverage identified 24 nonsynonymous variants and 2 frameshift deletions in CHRNA5, including 9 novel variants in the 2820 subjects. Meta-analysis confirmed the risk effect of the only common variant (rs16969968, European ancestry: OR=1.3, p=3.5×10−11; African ancestry: OR=1.3, p=0.01) and demonstrated that 3 low frequency variants contributed an independent risk (aggregate term, European ancestry: OR=1.3, p=0.005; African ancestry: OR=1.4, p=0.0006). The remaining 22 rare coding variants were associated with increased risk of nicotine dependence in the European American primary sample (OR=12.9, p=0.01) and in the same risk direction in African Americans (OR=1.5, p=0.37). Our results indicate that common, low frequency and rare CHRNA5 coding variants are independently associated with nicotine dependence risk. These newly identified variants likely influence risk for smoking-related diseases such as lung cancer. PMID:26239294

Rare, low frequency and common coding variants in CHRNA5 and their contribution to nicotine dependence in European and African Americans.

PubMed

Olfson, E; Saccone, N L; Johnson, E O; Chen, L-S; Culverhouse, R; Doheny, K; Foltz, S M; Fox, L; Gogarten, S M; Hartz, S; Hetrick, K; Laurie, C C; Marosy, B; Amin, N; Arnett, D; Barr, R G; Bartz, T M; Bertelsen, S; Borecki, I B; Brown, M R; Chasman, D I; van Duijn, C M; Feitosa, M F; Fox, E R; Franceschini, N; Franco, O H; Grove, M L; Guo, X; Hofman, A; Kardia, S L R; Morrison, A C; Musani, S K; Psaty, B M; Rao, D C; Reiner, A P; Rice, K; Ridker, P M; Rose, L M; Schick, U M; Schwander, K; Uitterlinden, A G; Vojinovic, D; Wang, J-C; Ware, E B; Wilson, G; Yao, J; Zhao, W; Breslau, N; Hatsukami, D; Stitzel, J A; Rice, J; Goate, A; Bierut, L J

2016-05-01

The common nonsynonymous variant rs16969968 in the α5 nicotinic receptor subunit gene (CHRNA5) is the strongest genetic risk factor for nicotine dependence in European Americans and contributes to risk in African Americans. To comprehensively examine whether other CHRNA5 coding variation influences nicotine dependence risk, we performed targeted sequencing on 1582 nicotine-dependent cases (Fagerström Test for Nicotine Dependence score⩾4) and 1238 non-dependent controls, with independent replication of common and low frequency variants using 12 studies with exome chip data. Nicotine dependence was examined using logistic regression with individual common variants (minor allele frequency (MAF)⩾0.05), aggregate low frequency variants (0.05>MAF⩾0.005) and aggregate rare variants (MAF<0.005). Meta-analysis of primary results was performed with replication studies containing 12 174 heavy and 11 290 light smokers. Next-generation sequencing with 180 × coverage identified 24 nonsynonymous variants and 2 frameshift deletions in CHRNA5, including 9 novel variants in the 2820 subjects. Meta-analysis confirmed the risk effect of the only common variant (rs16969968, European ancestry: odds ratio (OR)=1.3, P=3.5 × 10(-11); African ancestry: OR=1.3, P=0.01) and demonstrated that three low frequency variants contributed an independent risk (aggregate term, European ancestry: OR=1.3, P=0.005; African ancestry: OR=1.4, P=0.0006). The remaining 22 rare coding variants were associated with increased risk of nicotine dependence in the European American primary sample (OR=12.9, P=0.01) and in the same risk direction in African Americans (OR=1.5, P=0.37). Our results indicate that common, low frequency and rare CHRNA5 coding variants are independently associated with nicotine dependence risk. These newly identified variants likely influence the risk for smoking-related diseases such as lung cancer.

The Coxsackievirus and Adenovirus Receptor (CAR) Undergoes Ectodomain Shedding and Regulated Intramembrane Proteolysis (RIP)

PubMed Central

Houri, Nadia; Huang, Kuo-Cheng; Nalbantoglu, Josephine

2013-01-01

The Coxsackievirus and Adenovirus Receptor (CAR) is a cell adhesion molecule originally characterized as a virus receptor but subsequently shown to be involved in physiological processes such as neuronal and heart development, epithelial tight junction integrity, and tumour suppression. Proteolysis of cell adhesion molecules and a wide variety of other cell surface proteins serves as a mechanism for protein turnover and, in some cases, cell signaling. Metalloproteases such as A Disintegrin and Metalloprotease (ADAM) family members cleave cell surface receptors to release their substrates’ ectodomains, while the presenilin/ɣ-secretase complex mediates regulated intramembrane proteolysis (RIP), releasing intracellular domain fragments from the plasma membrane. In the case of some substrates such as Notch and amyloid precursor protein (APP), the released intracellular domains enter the nucleus to modulate gene expression. We report that CAR ectodomain is constitutively shed from glioma cells and developing neurons, and is also shed when cells are treated with the phorbol ester phorbol 12-myristate 13-acetate (PMA) and the calcium ionophore ionomycin. We identified ADAM10 as a sheddase of CAR using assays involving shRNA knockdown and rescue, overexpression of wild-type ADAM10 and inhibition of ADAM10 activity by addition of its prodomain. In vitro peptide cleavage, mass spectrometry and mutagenesis revealed the amino acids M224 to L227 of CAR as the site of ADAM10-mediated ectodomain cleavage. CAR also undergoes RIP by the presenilin/γ-secretase complex, and the intracellular domain of CAR enters the nucleus. Ectodomain shedding is a prerequisite for RIP of CAR. Thus, CAR belongs to the increasing list of cell surface molecules that undergo ectodomain shedding and that are substrates for ɣ-secretase-mediated RIP. PMID:24015300

Differential Effects of the Putative GBF1 Inhibitors Golgicide A and AG1478 on Enterovirus Replication▿

PubMed Central

van der Linden, Lonneke; van der Schaar, Hilde M.; Lanke, Kjerstin H. W.; Neyts, Johan; van Kuppeveld, Frank J. M.

2010-01-01

The genus Enterovirus, belonging to the family Picornaviridae, includes well-known pathogens, such as poliovirus, coxsackievirus, and rhinovirus. Brefeldin A (BFA) impedes replication of several enteroviruses through inhibition of Golgi-specific BFA resistance factor 1 (GBF1), a regulator of secretory pathway integrity and transport. GBF1 mediates the GTP exchange of Arf1, which in activated form recruits coatomer protein complex I (COP-I) to Golgi vesicles, a process important in transport between the endoplasmic reticulum and Golgi vesicles. Recently, the drugs AG1478 and Golgicide A (GCA) were put forward as new inhibitors of GBF1. In this study, we investigated the effects of these putative GBF1 inhibitors on secretory pathway function and enterovirus replication. We show that both drugs induced fragmentation of the Golgi vesicles and caused dissociation of Arf1 and COP-I from Golgi membranes, yet they differed in their effect on GBF1 localization. The effects of AG1478, but not those of GCA, could be countered by overexpression of Arf1, indicating a difference in their molecular mechanism of action. Consistent with this idea, we observed that GCA drastically reduced replication of coxsackievirus B3 (CVB3) and other human enterovirus species, whereas AG1478 had no effect at all on enterovirus replication. Time-of-addition studies and analysis of RNA replication using a subgenomic replicon both showed that GCA suppresses RNA replication of CVB3, which could be countered by overexpression of GBF1. These results indicate that, in contrast to AG1478, GCA inhibits CVB3 RNA replication by targeting GBF1. AG1478 and GCA may be valuable tools to further dissect enterovirus replication. PMID:20504936

Binding of Glutathione to Enterovirus Capsids Is Essential for Virion Morphogenesis

PubMed Central

Thibaut, Hendrik Jan; Thys, Bert; Canela, María-Dolores; Aguado, Leire; Wimmer, Eckard; Paul, Aniko; Pérez-Pérez, María-Jesús; van Kuppeveld, Frank J. M.; Neyts, Johan

2014-01-01

Enteroviruses (family of the Picornaviridae) cover a large group of medically important human pathogens for which no antiviral treatment is approved. Although these viruses have been extensively studied, some aspects of the viral life cycle, in particular morphogenesis, are yet poorly understood. We report the discovery of TP219 as a novel inhibitor of the replication of several enteroviruses, including coxsackievirus and poliovirus. We show that TP219 binds directly glutathione (GSH), thereby rapidly depleting intracellular GSH levels and that this interferes with virus morphogenesis without affecting viral RNA replication. The inhibitory effect on assembly was shown not to depend on an altered reducing environment. Using TP219, we show that GSH is an essential stabilizing cofactor during the transition of protomeric particles into pentameric particles. Sequential passaging of coxsackievirus B3 in the presence of low GSH-levels selected for GSH-independent mutants that harbored a surface-exposed methionine in VP1 at the interface between two protomers. In line with this observation, enteroviruses that already contained this surface-exposed methionine, such as EV71, did not rely on GSH for virus morphogenesis. Biochemical and microscopical analysis provided strong evidence for a direct interaction between GSH and wildtype VP1 and a role for this interaction in localizing assembly intermediates to replication sites. Consistently, the interaction between GSH and mutant VP1 was abolished resulting in a relocalization of the assembly intermediates to replication sites independent from GSH. This study thus reveals GSH as a novel stabilizing host factor essential for the production of infectious enterovirus progeny and provides new insights into the poorly understood process of morphogenesis. PMID:24722756

Common variants at 12q15 and 12q24 are associated with infant head circumference

PubMed Central

Warrington, Nicole M; Kaakinen, Marika; Kreiner-Møller, Eskil; Bradfield, Jonathan P; Freathy, Rachel M; Geller, Frank; Guxens, Mònica; Cousminer, Diana L; Kerkhof, Marjan; Timpson, Nicholas J; Ikram, M Arfan; Beilin, Lawrence J; Bønnelykke, Klaus; Buxton, Jessica L; Charoen, Pimphen; Chawes, Bo Lund Krogsgaard; Eriksson, Johan; Evans, David M; Hofman, Albert; Kemp, John P; Kim, Cecilia E; Klopp, Norman; Lahti, Jari; Lye, Stephen J; McMahon, George; Mentch, Frank D; Müller, Martina; O’Reilly, Paul F; Prokopenko, Inga; Rivadeneira, Fernando; Steegers, Eric A P; Sunyer, Jordi; Tiesler, Carla; Yaghootkar, Hanieh; Breteler, Monique M B; Debette, Stephanie; Fornage, Myriam; Gudnason, Vilmundur; Launer, Lenore J; van der Lugt, Aad; Mosley, Thomas H; Seshadri, Sudha; Smith, Albert V; Vernooij, Meike W; Blakemore, Alexandra IF; Chiavacci, Rosetta M; Feenstra, Bjarke; Fernandez-Benet, Julio; Grant, Struan F A; Hartikainen, Anna-Liisa; van der Heijden, Albert J; Iñiguez, Carmen; Lathrop, Mark; McArdle, Wendy L; Mølgaard, Anne; Newnham, John P; Palmer, Lyle J; Palotie, Aarno; Pouta, Annneli; Ring, Susan M; Sovio, Ulla; Standl, Marie; Uitterlinden, Andre G; Wichmann, H-Erich; Vissing, Nadja Hawwa; DeCarli, Charles; van Duijn, Cornelia M; McCarthy, Mark I; Koppelman, Gerard H.; Estivill, Xavier; Hattersley, Andrew T; Melbye, Mads; Bisgaard, Hans; Pennell, Craig E; Widen, Elisabeth; Hakonarson, Hakon; Smith, George Davey; Heinrich, Joachim; Jarvelin, Marjo-Riitta; Jaddoe, Vincent W V

2013-01-01

To identify genetic variants associated with head circumference in infancy, we performed a meta-analysis of seven genome-wide association (GWA) studies (N=10,768 from European ancestry enrolled in pregnancy/birth cohorts) and followed up three lead signals in six replication studies (combined N=19,089). Rs7980687 on chromosome 12q24 (P=8.1×10−9), and rs1042725 on chromosome 12q15 (P=2.8×10−10) were robustly associated with head circumference in infancy. Although these loci have previously been associated with adult height1, their effects on infant head circumference were largely independent of height (P=3.8×10−7 for rs7980687, P=1.3×10−7 for rs1042725 after adjustment for infant height). A third signal, rs11655470 on chromosome 17q21, showed suggestive evidence of association with head circumference (P=3.9×10−6). SNPs correlated to the 17q21 signal show genome-wide association with adult intra cranial volume2, Parkinson’s disease and other neurodegenerative diseases3-5, indicating that a common genetic variant in this region might link early brain growth with neurological disease in later life. PMID:22504419

Variant adrenal venous anatomy in 546 laparoscopic adrenalectomies.

PubMed

Scholten, Anouk; Cisco, Robin M; Vriens, Menno R; Shen, Wen T; Duh, Quan-Yang

2013-04-01

Knowing the types and frequency of adrenal vein variants would help surgeons identify and control the adrenal vein during laparoscopic adrenalectomy. To establish the surgical anatomy of the main vein and its variants for laparoscopic adrenalectomy and to analyze the relationship between variant adrenal venous anatomy and tumor size, pathologic diagnosis, and operative outcomes. In a retrospective review of patients at a tertiary referral hospital, 506 patients underwent 546 consecutive laparoscopic adrenalectomies between April 22, 1993, and October 21, 2011. Patients with variant adrenal venous anatomy were compared with patients with normal adrenal venous anatomy regarding preoperative variables (patient and tumor characteristics [size and location] and clinical diagnosis), intraoperative variables (details on the main adrenal venous drainage, any variant venous anatomy, duration of operation, rate of conversion to hand-assisted or open procedure, and estimated blood loss), and postoperative variables (transfusion requirement, reoperation for bleeding, duration of hospital stay, and histologic diagnosis). Laparoscopic adrenalectomy. Prevalence of variant adrenal venous anatomy and its relationship to tumor characteristics, pathologic diagnosis, and operative outcomes. Variant venous anatomy was encountered in 70 of 546 adrenalectomies (13%). Variants included no main adrenal vein identifiable (n = 18), 1 main adrenal vein with additional small veins (n = 11), 2 adrenal veins (n = 20), more than 2 adrenal veins (n = 14), and variants of the adrenal vein drainage to the inferior vena cava and hepatic vein or of the inferior phrenic vein (n = 7). Variants occurred more often on the right side than on the left side (42 of 250 glands [17%] vs. 28 of 296 glands [9%], respectively; P = .02). Patients with variant anatomy compared with those with normal anatomy had larger tumors (mean, 5.1 vs 3.3 cm, respectively; P < .001), more pheochromocytomas (24 of 70 [35%] vs. 100 of 476 [21%], respectively; P = .02), and more estimated blood loss (mean, 134 vs. 67 mL, respectively; P = .01). For patients with variant anatomy vs those with normal anatomy, the rates of transfusion requirement (2 of 70 [3%] vs. 10 of 476 [2%], respectively; P = .69) and reoperation for bleeding (1 of 70 [1%] vs. 3 of 476 [1%]; P = .46) were similar between groups. Understanding variant adrenal venous anatomy is important to avoid bleeding during laparoscopic adrenalectomy, particularly in patients with large tumors or pheochromocytomas. Surgeons should anticipate a higher probability of adrenal vein variants when operating on pheochromocytomas and larger adrenal tumors.

Characterizing Enterovirus 71 and Coxsackievirus A16 virus-like particles production in insect cells.

PubMed

Somasundaram, Balaji; Chang, Cindy; Fan, Yuan Y; Lim, Pei-Yin; Cardosa, Jane; Lua, Linda

2016-02-15

Enterovirus 71 (EV71) and Coxsackievirus A16 (CVA16) are two viruses commonly responsible for hand, foot and mouth disease (HFMD) in children. The lack of prophylactic or therapeutic measures against HFMD is a major public health concern. Insect cell-based EV71 and CVA16 virus-like particles (VLPs) are promising vaccine candidates against HFMD and are currently under development. In this paper, the influence of insect cell line, incubation temperature, and serial passaging effect and stability of budded virus (BV) stocks on EV71 and CVA16 VLP production was investigated. Enhanced EV71 and CVA16 VLP production was observed in Sf9 cells compared to High Five™ cells. Lowering the incubation temperature from the standard 27°C to 21°C increased the production of both VLPs in Sf9 cells. Serial passaging of CVA16 BV stocks in cell culture had a detrimental effect on the productivity of the structural proteins and the effect was observed with only 5 passages of BV stocks. A 2.7× higher production yield was achieved with EV71 compared to CVA16. High-resolution asymmetric flow field-flow fractionation couple with multi-angle light scattering (AF4-MALS) was used for the first time to characterize EV71 and CVA16 VLPs, displaying an average root mean square radius of 15±1nm and 15.3±5.8 nm respectively. This study highlights the need for different approaches in the design of production process to develop a bivalent EV71 and CVA16 vaccine. Copyright © 2015 Elsevier Inc. All rights reserved.

Crystal Structure of Swine Vesicular Disease Virus and Implications for Host Adaptation

PubMed Central

Fry, Elizabeth E.; Knowles, Nick J.; Newman, John W. I.; Wilsden, Ginette; Rao, Zihe; King, Andrew M. Q.; Stuart, David I.

2003-01-01

Swine vesicular disease virus (SVDV) is an Enterovirus of the family Picornaviridae that causes symptoms indistinguishable from those of foot-and-mouth disease virus. Phylogenetic studies suggest that it is a recently evolved genetic sublineage of the important human pathogen coxsackievirus B5 (CBV5), and in agreement with this, it has been shown to utilize the coxsackie and adenovirus receptor (CAR) for cell entry. The 3.0-Å crystal structure of strain UK/27/72 SVDV (highly virulent) reveals the expected similarity in core structure to those of other picornaviruses, showing most similarity to the closest available structure to CBV5, that of coxsackievirus B3 (CBV3). Features that help to cement together and rigidify the protein subunits are extended in this virus, perhaps explaining its extreme tolerance of environmental factors. Using the large number of capsid sequences available for both SVDV and CBV5, we have mapped the amino acid substitutions that may have occurred during the supposed adaptation of SVDV to a new host onto the structure of SVDV and a model of the SVDV/CAR complex generated by reference to the cryo-electron microscopy-visualized complex of CBV3 and CAR. The changes fall into three clusters as follows: one lines the fivefold pore, a second maps to the CAR-binding site and partially overlaps the site for decay accelerating factor (DAF) to bind to echovirus 7 (ECHO7), and the third lies close to the fivefold axis, where the low-density lipoprotein receptor binds to the minor group of rhinoviruses. Later changes in SVDV (post-1971) map to the first two clusters and may, by optimizing recognition of a pig CAR and/or DAF homologue, have improved the adaptation of the virus to pigs. PMID:12692248

Virological investigation of hand, foot, and mouth disease in a tertiary care center in South India.

PubMed

Vijayaraghavan, Pavithra M; Chandy, Sara; Selvaraj, Kavitha; Pulimood, Susanne; Abraham, Asha M

2012-07-01

Hand, foot, and mouth disease (HFMD) remains a common problem in India, yet its etiology is largely unknown as diagnosis is based on clinical characteristics. There are very few laboratory-based molecular studies on HFMD outbreaks. The aim of this study was to characterize HFMD-related isolates by molecular techniques. Between 2005 and 2008, during two documented HFMD outbreaks, 30 suspected HFMD cases presented at the Outpatient Unit of the Department of Dermatology, Christian Medical College (CMC), Vellore. Seventy-eight clinical specimens (swabs from throat, mouth, rectum, anus, buttocks, tongue, forearm, sole, and foot) were received from these patients at the Department of Clinical Virology, CMC, for routine diagnosis of hand, foot, and mouth disease. Samples from these patients were cultured in Vero and rhabdomyosarcoma (RD) cell lines. Isolates producing enterovirus-like cytopathogenic effect (CPE) in cell culture were identified by a nested reverse transcription-based polymerase chain reaction (RT-PCR) and sequenced. The nucleotide sequences were analyzed using the BioEdit sequence program. Homology searches were performed using the Basic Local Alignment Search Tool (BLAST) algorithm. The statistical analysis was performed using Epi Info version 6.04b and Microsoft Excel 2002 (Microsoft Office XP). Of the 30 suspected HFMD cases, only 17 (57%) were laboratory confirmed and Coxsackievirus A16 (CVA16) was identified as the etiological agent in all these cases. Coxsackievirus A16 (CVA16) was identified as the virus that caused the HFMD outbreaks in Vellore between 2005 and 2008. Early confirmation of HFMD helps to initiate control measures to interrupt virus transmission. In the laboratory, classical diagnostic methods, culture and serological tests are being replaced by molecular techniques. Routine surveillance systems will help understand the epidemiology of HFMD in India.

Mutational analysis of Kex2 recognition sites and a disulfide bond in tannase from Aspergillus oryzae.

PubMed

Koseki, Takuya; Otsuka, Motohiro; Mizuno, Toshiyuki; Shiono, Yoshihito

2017-01-22

Aspergillus oryzae tannase (AoTanA), which contains two Kex2 recognition sites at positions Arg311 and Arg316, consists of two subunits that are generated by the cleavage of tannase gene product by the Kex2 protease. Based on the crystal structure of feruloyl esterase from Aspergillus oryzae (AoFaeB), which has been classified as a member of the fungal tannase family, the catalytic triad residues of AoTanA are predicted to be Ser195, Asp455, and His501, with the serine and histidine residues brought together by a disulfide bond of the neighboring cysteines, Cys194 and Cys502. In this study, we investigated the functional role of the Kex2 recognition sites and disulfide bond between the neighboring cysteines in AoTanA. We constructed a double variant (R311A/R316A), a seven amino-acid deletion variant of region Lys310-Arg316 (ΔKR), and two single variants (C194A and C502A). While the R311A/R316A variant exhibited the two bands similar to wild type by SDS-PAGE after treatment with endoglycosidase H, the ΔKR variant exhibited only one band. R311A/R316A variation had no effect on tannase activity and stability. Meanwhile, the ΔKR variant exhibited higher activity compared to the wild-type. The activities of the C194A and C502A variants decreased considerably (<0.24% of the wild-type) toward methyl gallate. Copyright © 2016 Elsevier Inc. All rights reserved.

Genome-wide association study and meta-analysis in Northern European populations replicate multiple colorectal cancer risk loci.

PubMed

Tanskanen, Tomas; van den Berg, Linda; Välimäki, Niko; Aavikko, Mervi; Ness-Jensen, Eivind; Hveem, Kristian; Wettergren, Yvonne; Bexe Lindskog, Elinor; Tõnisson, Neeme; Metspalu, Andres; Silander, Kaisa; Orlando, Giulia; Law, Philip J; Tuupanen, Sari; Gylfe, Alexandra E; Hänninen, Ulrika A; Cajuso, Tatiana; Kondelin, Johanna; Sarin, Antti-Pekka; Pukkala, Eero; Jousilahti, Pekka; Salomaa, Veikko; Ripatti, Samuli; Palotie, Aarno; Järvinen, Heikki; Renkonen-Sinisalo, Laura; Lepistö, Anna; Böhm, Jan; Mecklin, Jukka-Pekka; Al-Tassan, Nada A; Palles, Claire; Martin, Lynn; Barclay, Ella; Tenesa, Albert; Farrington, Susan M; Timofeeva, Maria N; Meyer, Brian F; Wakil, Salma M; Campbell, Harry; Smith, Christopher G; Idziaszczyk, Shelley; Maughan, Tim S; Kaplan, Richard; Kerr, Rachel; Kerr, David; Buchanan, Daniel D; Win, Aung K; Hopper, John; Jenkins, Mark A; Newcomb, Polly A; Gallinger, Steve; Conti, David; Schumacher, Fredrick R; Casey, Graham; Cheadle, Jeremy P; Dunlop, Malcolm G; Tomlinson, Ian P; Houlston, Richard S; Palin, Kimmo; Aaltonen, Lauri A

2018-02-01

Genome-wide association studies have been successful in elucidating the genetic basis of colorectal cancer (CRC), but there remains unexplained variability in genetic risk. To identify new risk variants and to confirm reported associations, we conducted a genome-wide association study in 1,701 CRC cases and 14,082 cancer-free controls from the Finnish population. A total of 9,068,015 genetic variants were imputed and tested, and 30 promising variants were studied in additional 11,647 cases and 12,356 controls of European ancestry. The previously reported association between the single-nucleotide polymorphism (SNP) rs992157 (2q35) and CRC was independently replicated (p = 2.08 × 10 -4 ; OR, 1.14; 95% CI, 1.06-1.23), and it was genome-wide significant in combined analysis (p = 1.50 × 10 -9 ; OR, 1.12; 95% CI, 1.08-1.16). Variants at 2q35, 6p21.2, 8q23.3, 8q24.21, 10q22.3, 10q24.2, 11q13.4, 11q23.1, 14q22.2, 15q13.3, 18q21.1, 20p12.3 and 20q13.33 were associated with CRC in the Finnish population (false discovery rate < 0.1), but new risk loci were not found. These results replicate the effects of multiple loci on the risk of CRC and identify shared risk alleles between the Finnish population isolate and outbred populations. © 2017 UICC.

Characterizing Genetic Risk at Known Prostate Cancer Susceptibility Loci in African Americans

PubMed Central

Haiman, Christopher A.; Chen, Gary K.; Blot, William J.; Strom, Sara S.; Berndt, Sonja I.; Kittles, Rick A.; Rybicki, Benjamin A.; Isaacs, William B.; Ingles, Sue A.; Stanford, Janet L.; Diver, W. Ryan; Witte, John S.; Chanock, Stephen J.; Kolb, Suzanne; Signorello, Lisa B.; Yamamura, Yuko; Neslund-Dudas, Christine; Thun, Michael J.; Murphy, Adam; Casey, Graham; Sheng, Xin; Wan, Peggy; Pooler, Loreall C.; Monroe, Kristine R.; Waters, Kevin M.; Le Marchand, Loic; Kolonel, Laurence N.; Stram, Daniel O.; Henderson, Brian E.

2011-01-01

GWAS of prostate cancer have been remarkably successful in revealing common genetic variants and novel biological pathways that are linked with its etiology. A more complete understanding of inherited susceptibility to prostate cancer in the general population will come from continuing such discovery efforts and from testing known risk alleles in diverse racial and ethnic groups. In this large study of prostate cancer in African American men (3,425 prostate cancer cases and 3,290 controls), we tested 49 risk variants located in 28 genomic regions identified through GWAS in men of European and Asian descent, and we replicated associations (at p≤0.05) with roughly half of these markers. Through fine-mapping, we identified nearby markers in many regions that better define associations in African Americans. At 8q24, we found 9 variants (p≤6×10−4) that best capture risk of prostate cancer in African Americans, many of which are more common in men of African than European descent. The markers found to be associated with risk at each locus improved risk modeling in African Americans (per allele OR = 1.17) over the alleles reported in the original GWAS (OR = 1.08). In summary, in this detailed analysis of the prostate cancer risk loci reported from GWAS, we have validated and improved upon markers of risk in some regions that better define the association with prostate cancer in African Americans. Our findings with variants at 8q24 also reinforce the importance of this region as a major risk locus for prostate cancer in men of African ancestry. PMID:21637779

A Clinical and Molecular Survey of 62 Cystic Fibrosis Patients from Umbria (Central Italy) Disclosing a High Frequency (2.4%) of the 2184insA Allele: Implications for Screening.

PubMed

Prontera, Paolo; Isidori, Ilenia; Mencarini, Valeria; Pennoni, Guido; Mencarelli, Amedea; Stangoni, Gabriela; Di Cara, Giuseppe; Verrotti, Alberto

2016-01-01

Genetic testing strategies and counseling in cystic fibrosis (CF) can be problematic due to its extreme allelic heterogeneity and the difficult clinical interpretation of rare variants. Since in a previous survey of Italian CF patients, Umbria (a small region with about 900,000 inhabitants) was excluded due to the low number of chromosomes tested (<50), we have performed a comprehensive retrospective clinical and molecular survey of 62 CF patients coming from this region. We have summarized all the genotypic and phenotypic data in a table, and we interviewed the older patients in order to obtain a comprehensive overview of their conditions. We found that the c.2052_2053insA (2184insA) variant, a class I mutation with high frequency in Eastern Europe but very rare in Italy, is the fourth most frequent allele in Umbria. The 2184insA variant was not included in the first-level regional screening, and we therefore suggest the implementation of this variant in the future. © 2016 S. Karger AG, Basel.

Heat shock protein 70 promotes coxsackievirus B3 translation initiation and elongation via Akt-mTORC1 pathway depending on activation of p70S6K and Cdc2.

PubMed

Wang, Fengping; Qiu, Ye; Zhang, Huifang M; Hanson, Paul; Ye, Xin; Zhao, Guangze; Xie, Ronald; Tong, Lei; Yang, Decheng

2017-07-01

We previously demonstrated that coxsackievirus B3 (CVB3) infection upregulated heat shock protein 70 (Hsp70) and promoted CVB3 multiplication. Here, we report the underlying mechanism by which Hsp70 enhances viral RNA translation. By using an Hsp70-overexpressing cell line infected with CVB3, we found that Hsp70 enhanced CVB3 VP1 translation at two stages. First, Hsp70 induced upregulation of VP1 translation at the initiation stage via upregulation of internal ribosome entry site trans-acting factor lupus autoantigen protein and activation of eIF4E binding protein 1, a cap-dependent translation suppressor. Second, we found that Hsp70 increased CVB3 VP1 translation by enhancing translation elongation. This was mediated by the Akt-mammalian target of rapamycin complex 1 signal cascade, which led to the activation of eukaryotic elongation factor 2 via p70S6K- and cell division cycle protein 2 homolog (Cdc2)-mediated phosphorylation and inactivation of eukaryotic elongation factor 2 kinase. We also determined the position of Cdc2 in this signal pathway, indicating that Cdc2 is regulated by mammalian target of rapamycin complex 1. This signal transduction pathway was validated using a number of specific pharmacological inhibitors, short interfering RNAs (siRNAs) and a dominant negative Akt plasmid. Because Hsp70 is a central component of the cellular network of molecular chaperones enhancing viral replication, these data may provide new strategies to limit this viral infection. © 2017 John Wiley & Sons Ltd.

Expression of Coxsackievirus and Adenovirus Receptor Separates Hematopoietic and Cardiac Progenitor Cells in Fetal Liver Kinase 1-Expressing Mesoderm

PubMed Central

Tashiro, Katsuhisa; Hirata, Nobue; Okada, Atsumasa; Yamaguchi, Tomoko; Takayama, Kazuo; Mizuguchi, Hiroyuki

2015-01-01

In developing embryos or in vitro differentiation cultures using pluripotent stem cells (PSCs), such as embryonic stem cells and induced pluripotent stem cells, fetal liver kinase 1 (Flk1)-expressing mesodermal cells are thought to be a heterogeneous population that includes hematopoietic progenitors, endothelial progenitors, and cardiac progenitors. However, information on cell surface markers for separating these progenitors in Flk1+ cells is currently limited. In the present study, we show that distinct types of progenitor cells in Flk1+ cells could be separated according to the expression of coxsackievirus and adenovirus receptor (CAR, also known as CXADR), a tight junction component molecule. We found that mouse and human PSC- and mouse embryo-derived Flk1+ cells could be subdivided into Flk1+CAR+ cells and Flk1+CAR− cells. The progenitor cells with cardiac potential were almost entirely restricted to Flk1+CAR+ cells, and Flk1+CAR− cells efficiently differentiated into hematopoietic cells. Endothelial differentiation potential was observed in both populations. Furthermore, from the expression of CAR, Flk1, and platelet-derived growth factor receptor-α (PDGFRα), Flk1+ cells could be separated into three populations (Flk1+PDGFRα−CAR− cells, Flk1+PDGFRα−CAR+ cells, and Flk1+PDGFRα+CAR+ cells). Flk1+PDGFRα+ cells and Flk1+PDGFRα− cells have been reported as cardiac and hematopoietic progenitor cells, respectively. We identified a novel population (Flk1+PDGFRα−CAR+ cells) with the potential to differentiate into not only hematopoietic cells and endothelial cells but also cardiomyocytes. Our findings indicate that CAR would be a novel and prominent marker for separating PSC- and embryo-derived Flk1+ mesodermal cells with distinct differentiation potentials. PMID:25762001

Clinical features and phylogenetic analysis of Coxsackievirus A9 in Northern Taiwan in 2011

PubMed Central

2013-01-01

Background Coxsackievirus A9 (CA9) was one of the most prevalent serotype of enteroviral infections in Taiwan in 2011. After several patient series were reported in the 1960s and 1970s, few studies have focused on the clinical manifestations of CA9 infections. Our study explores and deepens the current understanding of CA9. Methods We analyzed the clinical presentations of 100 culture-proven CA9-infected patients in 2011 by reviewing their medical records and depicted the CA9 phylogenetic tree. Results Of the 100 patients with culture-proven CA9 infections, the mean (SD) age was 4.6 (3.4) years and the male to female ratio was 1.9. For clinical manifestations, 96 patients (96%) had fever and the mean (SD) duration of fever was 5.9 (3.4) days. Sixty one patients (61%) developed a skin rash, and the predominant pattern was a generalized non-itchy maculopapular rash without vesicular changes. While most patients showed injected throat, oral ulcers were found in only 19 cases (19%), among whom, 6 were diagnosed as herpangina. Complicated cases included: aseptic meningitis (n=8), bronchopneumonia (n=6), acute cerebellitis (n=1), and polio-like syndrome (n=1). Phylogenetic analysis for current CA9 strains is closest to the CA9 isolate 27-YN-2008 from the border area of mainland China and Myanmar. Conclusions The most common feature of CA9 during the 2011 epidemic in Taiwan is generalized febrile exanthema rather than herpangina or hand, foot, and mouth disease. Given that prolonged fever and some complications are possible, caution should be advised in assessing patients as well as in predicting the clinical course. PMID:23347781

Inhibition of Drp1 attenuates mitochondrial damage and myocardial injury in Coxsackievirus B3 induced myocarditis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Lin; Zhang, Ming; Yan, Rui

Viral myocarditis (VMC) is closely related to apoptosis, oxidative stress, innate immunity, and energy metabolism, which are all linked to mitochondrial dysfunction. A close nexus between mitochondrial dynamics and cardiovascular disease with mitochondrial dysfunction has been deeply researched, but there is still no relevant report in viral myocarditis. In this study, we aimed to explore the role of Dynamin-related protein 1 (Drp1)-linked mitochondrial fission in VMC. Mice were inoculated with the Coxsackievirus B3 (CVB3) and treated with mdivi1 (a Drp1 inhibitor). Protein expression of Drp1 was increased in mitochondria while decreased in cytoplasm and accompanied by excessive mitochondrial fission inmore » VMC mice. In addition, midivi1 treatment attenuate inflammatory cells infiltration in myocardium of the mice, serum Cardiac troponin I (CTnI) and Creatine kinase-MB (CK-MB) level. Mdivi1 also could improved the survival rate of mice and mitochondrial dysfunction reflected as the up-regulated mitochondrial marker enzymatic activities of succinate dehydrogenase (SDH), cytochrome c oxidase (COX) and mitochondrial membrane potential (MMP). At the same time, mdivi1 rescued the body weight loss, myocardial injury and apoptosis of cardiomyocyte. Furthermore, decease in LVEDs and increase in EF and FS were detected by echocardiogram, which indicated the improved myocardial function. Thus, Drp1-linked excessive mitochondrial fission contributed to VMC and midivi1 may be a potential therapeutic approach. - Highlights: • The expression of Drp1 is significantly increased in mitochondria while decreased in cytoplasm in VMC mice. • Drp1-linked excessive mitochondrial fission is involved in VMC. • Midivi1 treatment mitigate the mitochondrial damage, inflammation, apoptosis in VMC mice. • The disturbance of mitochondrial dynamics may be a new therapeutic target for VMC.« less

Rare Variation in TET2 Is Associated with Clinically Relevant Prostate Carcinoma in African-Americans

PubMed Central

Koboldt, Daniel C.; Kanchi, Krishna L.; Gui, Bin; Larson, David E.; Fulton, Robert S.; Isaacs, William B.; Kraja, Aldi; Borecki, Ingrid B.; Jia, Li; Wilson, Richard K.; Mardis, Elaine R.; Kibel, Adam S.

2016-01-01

Background Common variants have been associated with prostate cancer risk. Unfortunately, few are reproducibly linked to aggressive disease, the phenotype of greatest clinical relevance. One possible explanation is that rare genetic variants underlie a significant proportion of the risk for aggressive disease. Method To identify such variants, we performed a two staged approach using whole exome sequencing followed by targeted sequencing of 800 genes in 652 aggressive prostate cancer patients and 752 disease-free controls in both African and European Americans. In each population, we tested rare variants for association using two gene-based aggregation tests. We established a study-wide significance threshold of 3.125 × 10−5 to correct for multiple testing. Results TET2 in African-Americans was associated with aggressive disease with 24.4% of cases harboring a rare deleterious variant compared to 9.6% of controls (FET p = 1.84×10−5, OR=3.0; SKAT-O p= 2.74×10−5). We report 8 additional genes with suggestive evidence of association, including the DNA repair genes PARP2 and MSH6. Finally, we observed an excess of rare truncation variants in 5 genes including the DNA repair genes MSH6, BRCA1 and BRCA2. This adds to the growing body of evidence that DNA repair pathway defects may influence susceptibility to aggressive prostate cancer. Conclusion Our findings suggest that rare variants influence risk of clinically relevant prostate cancer and, if validated, could serve to identify men for screening, prophylaxis and treatment. Impact This study provides evidence that rare variants in TET2 may help identify African-American men at increased risk for clinically relevant prostate cancer. PMID:27486019

Toll-Like Receptor 3 Is Critical for Coxsackievirus B4-Induced Type 1 Diabetes in Female NOD Mice

PubMed Central

Thuma, Jean R.; Courreges, Maria C.; Benencia, Fabian; James, Calvin B.L.; Malgor, Ramiro; Kantake, Noriko; Mudd, William; Denlinger, Nathan; Nolan, Bret; Wen, Li; Schwartz, Frank L.

2015-01-01

Group B coxsackieviruses (CVBs) are involved in triggering some cases of type 1 diabetes mellitus (T1DM). However, the molecular mechanism(s) responsible for this remain elusive. Toll-like receptor 3 (TLR3), a receptor that recognizes viral double-stranded RNA, is hypothesized to play a role in virus-induced T1DM, although this hypothesis is yet to be substantiated. The objective of this study was to directly investigate the role of TLR3 in CVB-triggered T1DM in nonobese diabetic (NOD) mice, a mouse model of human T1DM that is widely used to study both spontaneous autoimmune and viral-induced T1DM. As such, we infected female wild-type (TLR3+/+) and TLR3 knockout (TLR3−/−) NOD mice with CVB4 and compared the incidence of diabetes in CVB4-infected mice with that of uninfected counterparts. We also evaluated the islets of uninfected and CVB4-infected wild-type and TLR3 knockout NOD mice by immunohistochemistry and insulitis scoring. TLR3 knockout mice were markedly protected from CVB4-induced diabetes compared with CVB4-infected wild-type mice. CVB4-induced T-lymphocyte-mediated insulitis was also significantly less severe in TLR3 knockout mice compared with wild-type mice. No differences in insulitis were observed between uninfected animals, either wild-type or TLR3 knockout mice. These data demonstrate for the first time that TLR3 is 1) critical for CVB4-induced T1DM, and 2) modulates CVB4-induced insulitis in genetically prone NOD mice. PMID:25422874

Comparative polymorphism of BAT-26 between healthy individuals and cancer patients and its cancer risk implication for local Chinese.

PubMed

Zheng, Yanying; Liu, Li; Sun, Yi; Chen, Jie; Wang, Jianrong; Zhu, Changle; Lai, Rensheng; Xie, Ling

2016-07-30

BAT-26 is one of the representative markers for microsatellite instability evaluation and presents different polymorphisms in different ethnic populations. The current knowledge of its comparative polymorphism between healthy individuals and cancer patients in the Chinese population is insufficient. This study aims to analyze germline polymorphic variations of BAT-26 between healthy individuals and cancer patients in Chinese from Jiangsu province and the associated cancer risk implications. The various BAT-26 alleles and their percentages in cervical cells from 500 healthy women were assessed by direct sequencing. Twenty of these samples were also analyzed by fragment analysis. BAT-26 of blood DNA from 24 healthy individuals and 247 cancer patients was analyzed by fragment analysis. Compared with the sequencing results, 122.6-122.9 bp, 123.4-123.8 bp and 124.1-124.8 bp corresponded to the A25, A26 and A27 alleles, respectively. The 524 healthy individuals showed 4.58%, 92.18% and 3.24% of A25, A26 and A27, respectively. The variant alleles A18, A24, A28, A29 and A32 were only found in cancer patients, accounting for 0.81%, 0.40%, 0.40%, 0.40% and 0.40%, respectively; the A25, A26 and A27 alleles in cancer patients accounted for 6.48%, 77.33% and 13.77%. Healthy individuals had a stable BAT-26 profile within the quasimonomorphic variation range (QMVR), but cancer patients harbored variant alleles outside QMVR and showed a trend from quasimonomorph to polymonomorph, suggesting that variant alleles of BAT-26 in germline cells may be regarded as a potential marker of higher cancer risk in the Chinese population from Jiangsu province.

Engineering a switch-on peptide to ricin A chain for increasing its specificity towards HIV-infected cells.

PubMed

Au, Ka-Yee; Wang, Rui-Rui; Wong, Yuen-Ting; Wong, Kam-Bo; Zheng, Yong-Tang; Shaw, Pang-Chui

2014-03-01

Ricin is a type II ribosome-inactivating protein (RIP) that potently inactivates eukaryotic ribosomes by removing a specific adenine residue at the conserved α-sarcin/ricin loop of 28S ribosomal RNA (rRNA). Here, we try to increase the specificity of the enzymatically active ricin A chain (RTA) towards human immunodeficiency virus type 1 (HIV-1) by adding a loop with HIV protease recognition site to RTA. HIV-specific RTA variants were constructed by inserting a peptide with HIV-protease recognition site either internally or at the C-terminal region of wild type RTA. Cleavability of variants by viral protease was tested in vitro and in HIV-infected cells. The production of viral p24 antigen and syncytium in the presence of C-terminal variants was measured to examine the anti-HIV activities of the variants. C-terminal RTA variants were specifically cleaved by HIV-1 protease both in vitro and in HIV-infected cells. Upon proteolysis, the processed variants showed enhanced antiviral effect with low cytotoxicity towards uninfected cells. RTA variants with HIV protease recognition sequence engineered at the C-terminus were cleaved and the products mediated specific inhibitory effect towards HIV replication. Current cocktail treatment of HIV infection fails to eradicate the virus from patients. Here we illustrate the feasibility of targeting an RIP towards HIV-infected cells by incorporation of HIV protease cleavage sequence. This approach may be generalized to other RIPs and is promising in drug design for combating HIV. Copyright © 2013 Elsevier B.V. All rights reserved.

Interaction of phase variation, host and pressure/gas composition: pneumococcal gene expression of PsaA, SpxB, Ply and LytA in simulated middle ear environments.

PubMed

Li-Korotky, Ha-Sheng; Lo, Chia-Yee; Zeng, Fan-Rui; Lo, David; Banks, Juliane M

2009-10-01

Streptococcus pneumoniae, a leading cause of otitis media (OM), undergoes spontaneous intra-strain variations in colony morphology. Transparent (T) variants are more efficient in colonizing the nasopharynx while opaque (O) variants exhibit greater virulence during systemic infections. This study was intended to delineate the underlying molecular mechanisms by which the predominant S. pneumoniae variant efficiently infects the middle ear (ME) mucosa. Human ME epithelial cells were preconditioned for 24h under one of the three gas/pressure conditions designed to simulate those for (1) normal ME (NME), (2) ME with Eustachian tube obstruction (ETO) and (3) ME with tympanostomy tube placement (TT), and then were incubated with ∼ 10(7)CFU/ml of either T or O variants of S. pneumoniae (6A) for 3h. Relative expression levels of genes encoding virulence factors, PsaA (surface adhesion), SpxB (pyruvate oxidase), Ply (pneumolysin), and LytA (autolysin) were assessed separately in epithelium-attached and supernatant bacteria 3h post infection using real-time PCR. Basal levels of the virulence molecules in inocula were comparable between two variants. However, relative expression levels of the gene transcripts were significantly induced in epithelium-attached T variants 3h after infection. Comparing with NME and TT conditions, ETO environment produced the largest effect on the differential expression of the virulence genes in the infected ME epithelial cells between T (induced) and O (suppressed) phenotypic pneumococci. T variant is a predominant phenotype responsible for the pathogenesis of pneumococcal OM.

Variants and pitfalls on radioiodine scans in pediatric patients with differentiated thyroid carcinoma.

PubMed

Mostafa, Mohamed; Vali, Reza; Chan, Jeffrey; Omarkhail, Yusuaf; Shammas, Amer

2016-10-01

Potentially false-positive findings on radioiodine scans in children with differentiated thyroid carcinoma can mimic functioning thyroid tissue and functioning thyroid carcinomatous tissue. Such false-positive findings comprise variants and pitfalls that can vary slightly in children as compared with adults. To determine the patterns and frequency of these potential false-positive findings on radioiodine scans in children with differentiated thyroid carcinoma. We reviewed a total of 223 radioiodine scans from 53 pediatric patients (mean age 13.3 years, 37 girls) with differentiated thyroid carcinoma. Focal or regional activity that likely did not represent functioning thyroid tissue or functioning thyroid carcinomatous tissue were categorized as variants or pitfalls. The final diagnosis was confirmed by reviewing the concurrent and follow-up clinical data, correlative ultrasonography, CT scanning, serum thyroglobulin and antithyroglobulin antibody levels. We calculated the frequency of these variants and pitfalls from diagnostic and post-therapy radioiodine scans. The most common variant on the radioiodine scans was the thymic activity (24/223, 10.8%) followed by the cardiac activity (8/223, 3.6%). Salivary contamination and star artifact, caused by prominent thyroid remnant, were the most important observed pitfalls. Variants and pitfalls that mimic functioning thyroid tissue or functioning thyroid carcinomatous tissue on radioiodine scan in children with differentiated thyroid carcinoma are not infrequent, but they decrease in frequency on successive radioiodine scans. Potential false-positive findings can be minimized with proper knowledge of the common variants and pitfalls in children and correlation with clinical, laboratory and imaging data.

Variant vicilins from a resistant Vigna unguiculata lineage (IT81D-1053) accumulate inside Callosobruchus maculatus larval midgut epithelium.

PubMed

Oliveira, Gabriel B; Kunz, Daniele; Peres, Tanara V; Leal, Rodrigo B; Uchôa, Adriana F; Samuels, Richard I; Macedo, Maria Lígia R; Carlini, Célia R; Ribeiro, Alberto F; Grangeiro, Thalles B; Terra, Walter R; Xavier-Filho, José; Silva, Carlos P

2014-02-01

It has been demonstrated that variant vicilins are the main resistance factor of cowpea seeds (Vigna unguiculata) against attack by the cowpea beetle Callosobruchus maculatus. There is evidence that the toxic properties of these storage proteins may be related to their interaction with glycoproteins and other microvillar membrane constituents along the digestive tract of the larvae. New findings have shown that following interaction with the microvilli, the vicilins are absorbed across the intestinal epithelium and thus reach the internal environment of the larvae. In the present paper we studied the insecticidal activity of the variant vicilins purified from a resistant cowpea variety (IT81D-1053). Bioassays showed that the seeds of this genotype affected larval growth, causing developmental retardation and 100% mortality. By feeding C. maculatus larvae on susceptible and IT81D-1053 derived vicilins (FITC labelled or unlabelled), followed by fluorescence and immunogold cytolocalization, we were able to demonstrate that both susceptible and variant forms are internalized in the midgut cells and migrate inside vesicular structures from the apex to the basal portion of the enterocytes. However, when larvae were fed with the labelled vicilins for 24h and then returned to a control diet, the concentration of the variant form remained relatively high, suggesting that variant vicilins are not removed from the cells at the same rate as the non-variant vicilins. We suggest that the toxic effects of variant vicilins on midgut cells involve the binding of these proteins to the cell surface followed by internalization and interference with the normal physiology of the enterocytes, thereby affecting larval development in vivo. Copyright © 2013 Elsevier Inc. All rights reserved.

Chymotrypsinogen C Genetic Variants, Including c.180TT, Are Strongly Associated With Chronic Pancreatitis in Pediatric Patients.

PubMed

Grabarczyk, Alicja Monika; Oracz, Grzegorz; Wertheim-Tysarowska, Katarzyna; Kujko, Aleksandra Anna; Wejnarska, Karolina; Kolodziejczyk, Elwira; Bal, Jerzy; Koziel, Dorota; Kowalik, Artur; Gluszek, Stanislaw; Rygiel, Agnieszka Magdalena

2017-12-01

Genetic studies in adults/adolescent patients with chronic pancreatitis (CP) identified chymotrypsinogen C (CTRC) genetic variants but their association with CP risk has been difficult to replicate. To evaluate the risk of CP associated with CTRC variants in CP pediatric patients-control study. The distribution of CTRC variants in CP pediatric cohort (n = 136, median age at CP onset 8 years) with no history of alcohol/smoking abuse was compared with controls (n = 401, median age 45). We showed that p.Arg254Trp (4.6%) and p.Lys247_Arg254del (5.3%) heterozygous mutations are frequent and significantly associated with CP risk in pediatric patients (odds ratio [OR] = 19.1; 95% CI 2.8-160; P = 0.001 and OR = 5.5; 95% CI 1.6-19.4; P = 0.001, respectively). For the first time, we demonstrated that the c.180TT genotype of common p.Gly60Gly variant is strong, an independent CP risk factor (OR = 23; 95% CI 7.7-70; P < 0.001) with effect size comparable to p.Arg254Trp mutation. The other novel observation is that common c.493+51C>A variant, both CA and AA genotype, is significantly underrepresented in CP compared with controls (15% vs 35%; OR = 0.33; 95% CI 0.19-0.59; P < 0.001 and 2.8% vs 11%; OR = 0.24; 95% CI 0.06-0.85; P = 0.027, respectively). Our study provides evidence that CTRC variants, including c.180TT (p.Gly60Gly) are strong CP risk factors. The c.493+51C>A variant may play a protective role against CP development.

Whole genome sequence analyses of brain imaging measures in the Framingham Study.

PubMed

Sarnowski, Chloé; Satizabal, Claudia L; DeCarli, Charles; Pitsillides, Achilleas N; Cupples, L Adrienne; Vasan, Ramachandran S; Wilson, James G; Bis, Joshua C; Fornage, Myriam; Beiser, Alexa S; DeStefano, Anita L; Dupuis, Josée; Seshadri, Sudha

2018-01-16

We sought to identify rare variants influencing brain imaging phenotypes in the Framingham Heart Study by performing whole genome sequence association analyses within the Trans-Omics for Precision Medicine Program. We performed association analyses of cerebral and hippocampal volumes and white matter hyperintensity (WMH) in up to 2,180 individuals by testing the association of rank-normalized residuals from mixed-effect linear regression models adjusted for sex, age, and total intracranial volume with individual variants while accounting for familial relatedness. We conducted gene-based tests for rare variants using (1) a sliding-window approach, (2) a selection of functional exonic variants, or (3) all variants. We detected new loci in 1p21 for cerebral volume (minor allele frequency [MAF] 0.005, p = 10 -8 ) and in 16q23 for hippocampal volume (MAF 0.05, p = 2.7 × 10 -8 ). Previously identified associations in 12q24 for hippocampal volume (rs7294919, p = 4.4 × 10 -4 ) and in 17q25 for WMH (rs7214628, p = 2.0 × 10 -3 ) were confirmed. Gene-based tests detected associations ( p ≤ 2.3 × 10 -6 ) in new loci for cerebral (5q13, 8p12, 9q31, 13q12-q13, 15q24, 17q12, 19q13) and hippocampal volumes (2p12) and WMH (3q13, 4p15) including Alzheimer disease- ( UNC5D ) and Parkinson disease-associated genes ( GBA ). Pathway analyses evidenced enrichment of associated genes in immunity, inflammation, and Alzheimer disease and Parkinson disease pathways. Whole genome sequence-wide search reveals intriguing new loci associated with brain measures. Replication of novel loci is needed to confirm these findings. Copyright © 2017 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology.

The compatibility of inactivated-Enterovirus 71 vaccination with Coxsackievirus A16 and Poliovirus immunizations in humans and animals

PubMed Central

Mao, Qunying; Wang, Yiping; Shao, Jie; Ying, Zhifang; Gao, Fan; Yao, Xin; Li, Changgui; Ye, Qiang; Xu, Miao; Li, Rongcheng; Zhu, Fengcai; Liang, Zhenglun

2015-01-01

Enterovirus 71 (EV71) is the key pathogen for Hand, Foot, and Mouth Disease (HFMD) and can result in severe neurological complications and death among young children. Three inactivated-EV71 vaccines have gone through phase III clinical trials and have demonstrated good safety and efficacy. These vaccines will benefit young children under the threat of severe HFMD. However, the potential immunization-related compatibility for different enterovirus vaccines remains unclear, making it hard to include the EV71 vaccine in Expanded Program on Immunization (EPI). Here, we measured the neutralizing antibodies (NTAbs) against EV71, Coxsackievirus A16 (CA16) and Poliovirus from infants enrolled in those EV71 vaccine clinical trials. The results indicated that the levels of NTAb GMTs for EV71 increased significantly in all 3 vaccine groups (high, middle and low dosages, respectively) post-vaccination. Seroconversion ratios and Geometric mean fold increase were significantly higher in the vaccine groups (≥7/9 and 8.9～228.1) than in the placebo group (≤1/10 and 0.8～1.7, P < 0.05). But no similar NTAb response trends were found in CA16 and 3 types of Poliovirus. The decrease of 3 types of Poliovirus NTAb GMTs and an increase of CA16 GMTs post-EV71-vaccination were found in vaccine and placebo groups. Further animal study on CA16 and poliovirus vaccine co-immunization or pre-immunization with EV71 vaccine in mice indicated that there was no NTAb cross-activity between EV71 and CA16/Poliovirus. Our research showed that inactivated-EV71 vaccine has good specific-neutralizing capacity and can be included in EPI. PMID:25715318

Epithelial-Mesenchymal Transition (EMT) Gene Variants and Epithelial Ovarian Cancer (EOC) Risk.

PubMed

Amankwah, Ernest K; Lin, Hui-Yi; Tyrer, Jonathan P; Lawrenson, Kate; Dennis, Joe; Chornokur, Ganna; Aben, Katja K H; Anton-Culver, Hoda; Antonenkova, Natalia; Bruinsma, Fiona; Bandera, Elisa V; Bean, Yukie T; Beckmann, Matthias W; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A; Brooks-Wilson, Angela; Bunker, Clareann H; Butzow, Ralf; Campbell, Ian G; Carty, Karen; Chen, Zhihua; Chen, Y Ann; Chang-Claude, Jenny; Cook, Linda S; Cramer, Daniel W; Cunningham, Julie M; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; du Bois, Andreas; Despierre, Evelyn; Dicks, Ed; Doherty, Jennifer A; Dörk, Thilo; Dürst, Matthias; Easton, Douglas F; Eccles, Diana M; Edwards, Robert P; Ekici, Arif B; Fasching, Peter A; Fridley, Brooke L; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G; Glasspool, Rosalind; Goodman, Marc T; Gronwald, Jacek; Harrington, Patricia; Harter, Philipp; Hasmad, Hanis N; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A T; Hillemanns, Peter; Hogdall, Claus K; Hogdall, Estrid; Hosono, Satoyo; Iversen, Edwin S; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y; Jim, Heather; Kellar, Melissa; Kiemeney, Lambertus A; Krakstad, Camilla; Kjaer, Susanne K; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D; Lee, Alice W; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A; Liang, Dong; Lim, Boon Kiong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F A G; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R; McNeish, Ian; Menon, Usha; Milne, Roger L; Modugno, Francesmary; Moysich, Kirsten B; Ness, Roberta B; Nevanlinna, Heli; Eilber, Ursula; Odunsi, Kunle; Olson, Sara H; Orlow, Irene; Orsulic, Sandra; Weber, Rachel Palmieri; Paul, James; Pearce, Celeste L; Pejovic, Tanja; Pelttari, Liisa M; Permuth-Wey, Jennifer; Pike, Malcolm C; Poole, Elizabeth M; Risch, Harvey A; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H; Rudolph, Anja; Runnebaum, Ingo B; Rzepecka, Iwona K; Salvesen, Helga B; Schernhammer, Eva; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C; Spiewankiewicz, Beata; Sucheston-Campbell, Lara; Teo, Soo-Hwang; Terry, Kathryn L; Thompson, Pamela J; Thomsen, Lotte; Tangen, Ingvild L; Tworoger, Shelley S; van Altena, Anne M; Vierkant, Robert A; Vergote, Ignace; Walsh, Christine S; Wang-Gohrke, Shan; Wentzensen, Nicolas; Whittemore, Alice S; Wicklund, Kristine G; Wilkens, Lynne R; Wu, Anna H; Wu, Xifeng; Woo, Yin-Ling; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Kelemen, Linda E; Berchuck, Andrew; Schildkraut, Joellen M; Ramus, Susan J; Goode, Ellen L; Monteiro, Alvaro N A; Gayther, Simon A; Narod, Steven A; Pharoah, Paul D P; Sellers, Thomas A; Phelan, Catherine M

2015-12-01

Epithelial-mesenchymal transition (EMT) is a process whereby epithelial cells assume mesenchymal characteristics to facilitate cancer metastasis. However, EMT also contributes to the initiation and development of primary tumors. Prior studies that explored the hypothesis that EMT gene variants contribute to epithelial ovarian carcinoma (EOC) risk have been based on small sample sizes and none have sought replication in an independent population. We screened 15,816 single-nucleotide polymorphisms (SNPs) in 296 genes in a discovery phase using data from a genome-wide association study of EOC among women of European ancestry (1,947 cases and 2,009 controls) and identified 793 variants in 278 EMT-related genes that were nominally (P < 0.05) associated with invasive EOC. These SNPs were then genotyped in a larger study of 14,525 invasive-cancer patients and 23,447 controls. A P-value <0.05 and a false discovery rate (FDR) <0.2 were considered statistically significant. In the larger dataset, GPC6/GPC5 rs17702471 was associated with the endometrioid subtype among Caucasians (odds ratio (OR) = 1.16, 95% CI = 1.07-1.25, P = 0.0003, FDR = 0.19), whereas F8 rs7053448 (OR = 1.69, 95% CI = 1.27-2.24, P = 0.0003, FDR = 0.12), F8 rs7058826 (OR = 1.69, 95% CI = 1.27-2.24, P = 0.0003, FDR = 0.12), and CAPN13 rs1983383 (OR = 0.79, 95% CI = 0.69-0.90, P = 0.0005, FDR = 0.12) were associated with combined invasive EOC among Asians. In silico functional analyses revealed that GPC6/GPC5 rs17702471 coincided with DNA regulatory elements. These results suggest that EMT gene variants do not appear to play a significant role in the susceptibility to EOC. © 2015 WILEY PERIODICALS, INC.

Epithelial-Mesenchymal Transition (EMT) gene variants and Epithelial Ovarian Cancer (EOC) risk

PubMed Central

Amankwah, Ernest K.; Lin, Hui-Yi; Tyrer, Jonathan P.; Lawrenson, Kate; Dennis, Joe; Chornokur, Ganna; Aben, Katja KH.; Anton-Culver, Hoda; Antonenkova, Natalia; Bruinsma, Fiona; Bandera, Elisa V.; Bean, Yukie T.; Beckmann, Matthias W.; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A.; Brooks-Wilson, Angela; Bunker, Clareann H.; Butzow, Ralf; Campbell, Ian G.; Carty, Karen; Chen, Zhihua; Chen, Y. Ann; Chang-Claude, Jenny; Cook, Linda S.; Cramer, Daniel W.; Cunningham, Julie M.; Cybulski, Cezary; Dansonka-Mieszkowska, Agnieszka; du Bois, Andreas; Despierre, Evelyn; Dicks, Ed; Doherty, Jennifer A.; Dörk, Thilo; Dürst, Matthias; Easton, Douglas F.; Eccles, Diana M.; Edwards, Robert P.; Ekici, Arif B.; Fasching, Peter A.; Fridley, Brooke L.; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G.; Glasspool, Rosalind; Goodman, Marc T.; Gronwald, Jacek; Harrington, Patricia; Harter, Philipp; Hasmad, Hanis N.; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A.T.; Hillemanns, Peter; Hogdall, Claus K.; Hogdall, Estrid; Hosono, Satoyo; Iversen, Edwin S.; Jakubowska, Anna; Jensen, Allan; Ji, Bu-Tian; Karlan, Beth Y.; Jim, Heather; Kellar, Melissa; Kiemeney, Lambertus A.; Krakstad, Camilla; Kjaer, Susanne K.; Kupryjanczyk, Jolanta; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D.; Lee, Alice W.; Lele, Shashi; Leminen, Arto; Lester, Jenny; Levine, Douglas A.; Liang, Dong; Lim, Boon Kiong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F.A.G.; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R.; McNeish, Ian; Menon, Usha; Milne, Roger L.; Modugno, Francesmary; Moysich, Kirsten B.; Ness, Roberta B.; Nevanlinna, Heli; Eilber, Ursula; Odunsi, Kunle; Olson, Sara H.; Orlow, Irene; Orsulic, Sandra; Weber, Rachel Palmieri; Paul, James; Pearce, Celeste L.; Pejovic, Tanja; Pelttari, Liisa M.; Permuth-Wey, Jennifer; Pike, Malcolm C.; Poole, Elizabeth M.; Risch, Harvey A.; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H.; Rudolph, Anja; Runnebaum, Ingo B.; Rzepecka, Iwona K.; Salvesen, Helga B.; Schernhammer, Eva; Schwaab, Ira; Shu, Xiao-Ou; Shvetsov, Yurii B.; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C.; Spiewankiewicz, Beata; Sucheston-Campbell, Lara; Teo, Soo-Hwang; Terry, Kathryn L.; Thompson, Pamela J.; Thomsen, Lotte; Tangen, Ingvild L.; Tworoger, Shelley S.; van Altena, Anne M.; Vierkant, Robert A.; Vergote, Ignace; Walsh, Christine S.; Wang-Gohrke, Shan; Wentzensen, Nicolas; Whittemore, Alice S.; Wicklund, Kristine G.; Wilkens, Lynne R.; Wu, Anna H.; Wu, Xifeng; Woo, Yin-Ling; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Kelemen, Linda E.; Berchuck, Andrew; Schildkraut, Joellen M.; Ramus, Susan J.; Goode, Ellen L.; Monteiro, Alvaro N.A.; Gayther, Simon A.; Narod, Steven A.; Pharoah, Paul D. P.; Sellers, Thomas A.; Phelan, Catherine M.

2016-01-01

Introduction Epithelial-mesenchymal transition (EMT) is a process whereby epithelial cells assume mesenchymal characteristics to facilitate cancer metastasis. However, EMT also contributes to the initiation and development of primary tumors. Prior studies that explored the hypothesis that EMT gene variants contribute to EOC risk have been based on small sample sizes and none have sought replication in an independent population. Methods We screened 1254 SNPs in 296 genes in a discovery phase using data from a genome-wide association study of EOC among women of European ancestry (1,947 cases and 2,009 controls) and identified 793 variants in 278 EMT-related genes that were nominally (p<0.05) associated with invasive EOC. These SNPs were then genotyped in a larger study of 14,525 invasive-cancer patients and 23,447 controls. A p-value <0.05 and a false discovery rate (FDR) <0.2 was considered statistically significant. Results In the larger dataset, GPC6/GPC5 rs17702471 was associated with the endometrioid subtype among Caucasians (OR=1.16, 95%CI=1.07–1.25, p=0.0003, FDR=0.19), while F8 rs7053448 (OR=1.69, 95%CI=1.27–2.24, p=0.0003, FDR=0.12), F8 rs7058826 (OR=1.69, 95%CI=1.27–2.24, p=0.0003, FDR=0.12), and CAPN13 rs1983383 (OR=0.79, 95%CI=0.69–0.90, p=0.0005, FDR=0.12) were associated with combined invasive EOC among Asians. In silico functional analyses revealed that GPC6/GPC5 rs17702471 coincided with DNA regulatory elements. Conclusion These results suggest that EMT gene variants do not appear to play a significant role in the susceptibility to EOC. PMID:26399219

[Investigation of a Patient with Pre-vaccine-derived Poliovirus in Shandong Province, China].

PubMed

Lin, Xiaojuan; Liu, Yao; Wang, Suting; Zhang Xiao; Song, Lizhi; Tao, Zexin; Ji, Feng; Xiong, Ping; Xu, Aiqiang

2015-09-01

To analyze the genetic characteristics of a polio-I highly variant vaccine recombinant virus in Shandong Province (China) in 2011 and to identify isolates from healthy contacts, two stool specimens from one patient with acute flaccid paralysis (AFP) and 40 stool specimens from his contacts were collected for virus isolation. The complete genome of poliovirus and VP1 coding region of the non-polio enterovirus were sequenced. Homologous comparison and phylogenetic analyses based on VP1 sequences were undertaken among coxsackievirus (CV) B1, CV-B3 isolates, and those in GenBank. One poliovirus (P1/11186), CV-A4 and CV-A8 were isolated from the AFP patient; one CV-A2, Echovirus 3 (E-3), E-12 and E-14, ten CV-B1, and five CV-B3 strains were isolated from his contacts. These results led us to believe that there may be a human enterovirus epidemic in this area, and that surveillance must be enhanced. P1/11186 was a type-1 vaccine-related poliovirus; it combined with type-2 and type-3 polioviruses in 2A and 3A regions, respectively. There were 25 nucleotide mutations with 9 amino-acid alterations in the entire genome. There were 8 nucleotide mutations with 5 amino-acid alterations in the VP1 region compared with the corresponding Sabin strains. Homology analyses suggested that the ten CV-B1 isolates had 97.0%-100% nucleotide and 98.9%-100% amino-acid identities with each other, as well as 92.6%-100% nucleotide and 99.2%-100% amino-acid identities among the five CV-B3 isolates. Phylogenetic analyses on the complete sequences of VP1 among CV-B1 and CV-B3 isolates showed that Shandong strains, together with strains from other provinces in China, had a close relationship and belonged to the same group.

Saturated evanescent-wave absorption of few-layer graphene-covered side-polished single-mode fiber for all-optical switching

NASA Astrophysics Data System (ADS)

Peng, Kaung-Jay; Wu, Chun-Lung; Lin, Yung-Hsiang; Wang, Hwai-Yung; Cheng, Chih-Hsien; Chi, Yu-Chieh; Lin, Gong-Ru

2018-01-01

Using the evanescent-wave saturation effect of hydrogen-free low-temperature synthesized few-layer graphene covered on the cladding region of a side-polished single-mode fiber, a blue pump/infrared probe-based all-optical switch is demonstrated with specific wavelength-dependent probe modulation efficiency. Under the illumination of a blue laser diode at 405 nm, the few-layer graphene exhibits cross-gain modulation at different wavelengths covering the C- and L-bands. At a probe power of 0.5 mW, the L-band switching throughput power variant of 16 μW results in a probe modulation depth of 3.2%. Blue shifting the probe wavelength from 1580 to 1520 nm further enlarges the switching throughput power variant to 24 mW and enhances the probe modulation depth to 5%. Enlarging the probe power from 0.5 to 1 mW further enlarges the switching throughput power variant from 25 to 58 μW to promote its probe modulation depth of up to 5.8% at 1520 nm. In contrast, the probe modulation depth degrades from 5.1% to 1.2% as the pumping power reduces from 85 to 24 mW, which is attributed to the saturable absorption of the few-layer graphene-based evanescent-wave absorber. The modulation depth at wavelength of 1550 nm under a probe power of 1 mW increases from 1.2% to 5.1%, as more carriers can be excited when increasing the blue laser power from 24 to 85 mW, whereas it decreases from 5.1% to 3.3% by increasing the input probe power from 1 to 2 mW to show an easier saturated condition at longer wavelength.

Common variants at the CHEK2 gene locus and risk of epithelial ovarian cancer

PubMed Central

Lawrenson, Kate; Iversen, Edwin S.; Tyrer, Jonathan; Weber, Rachel Palmieri; Concannon, Patrick; Hazelett, Dennis J.; Li, Qiyuan; Marks, Jeffrey R.; Berchuck, Andrew; Lee, Janet M.; Aben, Katja K.H.; Anton-Culver, Hoda; Antonenkova, Natalia; Bandera, Elisa V.; Bean, Yukie; Beckmann, Matthias W.; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A.; Brooks-Wilson, Angela; Bruinsma, Fiona; Butzow, Ralf; Campbell, Ian G.; Carty, Karen; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Chen, Ann; Chen, Zhihua; Cook, Linda S.; Cramer, Daniel W.; Cunningham, Julie M.; Cybulski, Cezary; Plisiecka-Halasa, Joanna; Dennis, Joe; Dicks, Ed; Doherty, Jennifer A.; Dörk, Thilo; du Bois, Andreas; Eccles, Diana; Easton, Douglas T.; Edwards, Robert P.; Eilber, Ursula; Ekici, Arif B.; Fasching, Peter A.; Fridley, Brooke L.; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G.; Glasspool, Rosalind; Goode, Ellen L.; Goodman, Marc T.; Gronwald, Jacek; Harter, Philipp; Hasmad, Hanis Nazihah; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A.T.; Hillemanns, Peter; Hogdall, Estrid; Hogdall, Claus; Hosono, Satoyo; Jakubowska, Anna; Paul, James; Jensen, Allan; Karlan, Beth Y.; Kjaer, Susanne Kruger; Kelemen, Linda E.; Kellar, Melissa; Kelley, Joseph L.; Kiemeney, Lambertus A.; Krakstad, Camilla; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D.; Lee, Alice W.; Cannioto, Rikki; Leminen, Arto; Lester, Jenny; Levine, Douglas A.; Liang, Dong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F.A.G.; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R.; Nevanlinna, Heli; McNeish, Iain; Menon, Usha; Modugno, Francesmary; Moysich, Kirsten B.; Narod, Steven A.; Nedergaard, Lotte; Ness, Roberta B.; Noor Azmi, Mat Adenan; Odunsi, Kunle; Olson, Sara H.; Orlow, Irene; Orsulic, Sandra; Pearce, Celeste L.; Pejovic, Tanja; Pelttari, Liisa M.; Permuth-Wey, Jennifer; Phelan, Catherine M.; Pike, Malcolm C.; Poole, Elizabeth M.; Ramus, Susan J.; Risch, Harvey A.; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H.; Rudolph, Anja; Runnebaum, Ingo B.; Rzepecka, Iwona K.; Salvesen, Helga B.; Budzilowska, Agnieszka; Sellers, Thomas A.; Shu, Xiao-Ou; Shvetsov, Yurii B.; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C.; Sucheston, Lara; Tangen, Ingvild L.; Teo, Soo-Hwang; Terry, Kathryn L.; Thompson, Pamela J.; Timorek, Agnieszka; Tworoger, Shelley S.; Nieuwenhuysen, Els Van; Vergote, Ignace; Vierkant, Robert A.; Wang-Gohrke, Shan; Walsh, Christine; Wentzensen, Nicolas; Whittemore, Alice S.; Wicklund, Kristine G.; Wilkens, Lynne R.; Woo, Yin-Ling; Wu, Xifeng; Wu, Anna H.; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Coetzee, Gerhard A.; Freedman, Matthew L.; Monteiro, Alvaro N.A.; Moes-Sosnowska, Joanna; Kupryjanczyk, Jolanta; Pharoah, Paul D.; Gayther, Simon A.; Schildkraut, Joellen M.

2015-01-01

Genome-wide association studies have identified 20 genomic regions associated with risk of epithelial ovarian cancer (EOC), but many additional risk variants may exist. Here, we evaluated associations between common genetic variants [single nucleotide polymorphisms (SNPs) and indels] in DNA repair genes and EOC risk. We genotyped 2896 common variants at 143 gene loci in DNA samples from 15 397 patients with invasive EOC and controls. We found evidence of associations with EOC risk for variants at FANCA, EXO1, E2F4, E2F2, CREB5 and CHEK2 genes (P ≤ 0.001). The strongest risk association was for CHEK2 SNP rs17507066 with serous EOC (P = 4.74 x 10–7). Additional genotyping and imputation of genotypes from the 1000 genomes project identified a slightly more significant association for CHEK2 SNP rs6005807 (r 2 with rs17507066 = 0.84, odds ratio (OR) 1.17, 95% CI 1.11–1.24, P = 1.1×10−7). We identified 293 variants in the region with likelihood ratios of less than 1:100 for representing the causal variant. Functional annotation identified 25 candidate SNPs that alter transcription factor binding sites within regulatory elements active in EOC precursor tissues. In The Cancer Genome Atlas dataset, CHEK2 gene expression was significantly higher in primary EOCs compared to normal fallopian tube tissues (P = 3.72×10−8). We also identified an association between genotypes of the candidate causal SNP rs12166475 (r 2 = 0.99 with rs6005807) and CHEK2 expression (P = 2.70×10-8). These data suggest that common variants at 22q12.1 are associated with risk of serous EOC and CHEK2 as a plausible target susceptibility gene. PMID:26424751

Genome-wide association analysis identifies variants associated with nonalcoholic fatty liver disease that have distinct effects on metabolic traits.

PubMed

Speliotes, Elizabeth K; Yerges-Armstrong, Laura M; Wu, Jun; Hernaez, Ruben; Kim, Lauren J; Palmer, Cameron D; Gudnason, Vilmundur; Eiriksdottir, Gudny; Garcia, Melissa E; Launer, Lenore J; Nalls, Michael A; Clark, Jeanne M; Mitchell, Braxton D; Shuldiner, Alan R; Butler, Johannah L; Tomas, Marta; Hoffmann, Udo; Hwang, Shih-Jen; Massaro, Joseph M; O'Donnell, Christopher J; Sahani, Dushyant V; Salomaa, Veikko; Schadt, Eric E; Schwartz, Stephen M; Siscovick, David S; Voight, Benjamin F; Carr, J Jeffrey; Feitosa, Mary F; Harris, Tamara B; Fox, Caroline S; Smith, Albert V; Kao, W H Linda; Hirschhorn, Joel N; Borecki, Ingrid B

2011-03-01

Nonalcoholic fatty liver disease (NAFLD) clusters in families, but the only known common genetic variants influencing risk are near PNPLA3. We sought to identify additional genetic variants influencing NAFLD using genome-wide association (GWA) analysis of computed tomography (CT) measured hepatic steatosis, a non-invasive measure of NAFLD, in large population based samples. Using variance components methods, we show that CT hepatic steatosis is heritable (∼26%-27%) in family-based Amish, Family Heart, and Framingham Heart Studies (n = 880 to 3,070). By carrying out a fixed-effects meta-analysis of genome-wide association (GWA) results between CT hepatic steatosis and ∼2.4 million imputed or genotyped SNPs in 7,176 individuals from the Old Order Amish, Age, Gene/Environment Susceptibility-Reykjavik study (AGES), Family Heart, and Framingham Heart Studies, we identify variants associated at genome-wide significant levels (p<5×10(-8)) in or near PNPLA3, NCAN, and PPP1R3B. We genotype these and 42 other top CT hepatic steatosis-associated SNPs in 592 subjects with biopsy-proven NAFLD from the NASH Clinical Research Network (NASH CRN). In comparisons with 1,405 healthy controls from the Myocardial Genetics Consortium (MIGen), we observe significant associations with histologic NAFLD at variants in or near NCAN, GCKR, LYPLAL1, and PNPLA3, but not PPP1R3B. Variants at these five loci exhibit distinct patterns of association with serum lipids, as well as glycemic and anthropometric traits. We identify common genetic variants influencing CT-assessed steatosis and risk of NAFLD. Hepatic steatosis associated variants are not uniformly associated with NASH/fibrosis or result in abnormalities in serum lipids or glycemic and anthropometric traits, suggesting genetic heterogeneity in the pathways influencing these traits.

Genetic study of intracranial aneurysms.

PubMed

Yan, Junxia; Hitomi, Toshiaki; Takenaka, Katsunobu; Kato, Masayasu; Kobayashi, Hatasu; Okuda, Hiroko; Harada, Kouji H; Koizumi, Akio

2015-03-01

Rupture of intracranial aneurysms (IAs) causes subarachnoid hemorrhage, leading to immediate death or severe disability. Identification of the genetic factors involved is critical for disease prevention and treatment. We aimed to identify the susceptibility genes for IAs. Exome sequencing was performed in 12 families with histories of multiple cases of IA (number of cases per family ≥3), with a total of 42 cases. Various filtering strategies were used to select the candidate variants. Replicate association studies of several candidate variants were performed in probands of 24 additional IA families and 426 sporadic IA cases. Functional analysis for the mutations was conducted. After sequencing and filtering, 78 variants were selected for the following reasons: allele frequencies of variants in 42 patients was significantly (P<0.05) larger than expected; variants were completely shared by all patients with IA within ≥1 family; variants predicted damage to the structure or function of the protein by PolyPhen-2 (Polymorphism Phenotyping V2) and SIFT (Sorting Intolerance From Tolerant). We selected 10 variants from 9 genes (GPR63, ADAMST15, MLL2, IL10RA, PAFAH2, THBD, IL11RA, FILIP1L, and ZNF222) to form 78 candidate variants by considering commonness in families, known disease genes, or ontology association with angiogenesis. Replicate association studies revealed that only p.E133Q in ADAMTS15 was aggregated in the familial IA cases (odds ratio, 5.96; 95% confidence interval, 2.40-14.82; P=0.0001; significant after the Bonferroni correction [P=0.05/78=0.0006]). Silencing ADAMTS15 and overexpression of ADAMTS15 p.E133Q accelerated endothelial cell migration, suggesting that ADAMTS15 may have antiangiogenic activity. ADAMTS15 is a candidate gene for IAs. © 2015 American Heart Association, Inc.

Mutational analysis and genotype-phenotype relation in familial hypercholesterolemia: The SAFEHEART registry.

PubMed

Bourbon, Mafalda; Alves, Ana Catarina; Alonso, Rodrigo; Mata, Nelva; Aguiar, Pedro; Padró, Teresa; Mata, Pedro

2017-07-01

Familial hypercholesterolemia (FH) is an autosomal dominant disease of cholesterol metabolism that confers an increased risk of premature atherosclerotic cardiovascular disease (ASCVD). Therefore, early identification and treatment of these patients can improve prognosis and reduce the burden of cardiovascular mortality. The aim of this work was to perform the mutational analysis of the SAFEHEART (Spanish Familial Hypercholesterolaemia Cohort Study) registry. The study recruited 2938 individuals with genetic diagnosis of FH belonging to 775 families. Statistical analysis was performed using SPSS v23. A total of 194 variants have been detected in this study, 24 of them were never described before. About 88% of the patients have a pathogenic or likely pathogenic variant. Patients with null variants have a more severe phenotype than patients with defective variants, presenting with significantly higher levels of atherogenic particles (total cholesterol, LDL-cholesterol and apolipoprotein B). This study shows the molecular characteristics of the FH patients included in the SAFEHEART registry and the relationship with the phenotypic expression. The majority of the genetic variants are considered to be pathogenic or likely pathogenic, which confers a high level of confidence to the entry and follow-up data analysis performed with this registry concerning FH patients' prognosis, treatment and survival. Copyright © 2017 Elsevier B.V. All rights reserved.

Genetics Home Reference: SOX2 anophthalmia syndrome

MedlinePlus

... and sequence variants in the SOX2 and CHX10 genes in patients with anophthalmia/microphthalmia. Mol Vis. 2008 Mar 24;14:583-92. ... are genome editing and CRISPR-Cas9? What is precision medicine? What ...

Biallelic mutations in CYP24A1 or SLC34A1 as a cause of infantile idiopathic hypercalcemia (IIH) with vitamin D hypersensitivity: molecular study of 11 historical IIH cases.

PubMed

Pronicka, Ewa; Ciara, Elżbieta; Halat, Paulina; Janiec, Agnieszka; Wójcik, Marek; Rowińska, Elżbieta; Rokicki, Dariusz; Płudowski, Paweł; Wojciechowska, Ewa; Wierzbicka, Aldona; Książyk, Janusz B; Jacoszek, Agnieszka; Konrad, Martin; Schlingmann, Karl P; Litwin, Mieczysław

2017-08-01

Idiopathic infantile hypercalcemia (IIH) is a mineral metabolism disorder characterized by severe hypercalcemia, failure to thrive, vomiting, dehydration, and nephrocalcinosis. The periodical increase in incidence of IIH, which occurred in the twentieth century in the United Kingdom, Poland, and West Germany, turned out to be a side effect of rickets over-prophylaxis. It was recently discovered that the condition is linked to two genes, CYP24A1 and SLC34A1. The aim of the study was to search for pathogenic variants of the genes in adult persons who were shortlisted in infancy as IIH caused by "hypersensitivity to vit. D". All persons were found to carry mutations in CYP24A1 or SLC34A1, nine and two persons respectively. The changes were biallelic, with one exception. Incidence of IIH in Polish population estimated on the basis of allele frequency of recurrent p.R396W CYP24A1 variant, is 1:32,465 births. It indicates that at least a thousand homozygotes and compound heterozygotes with risk of IIH live in the country. Differences in mechanism of developing hypercalcemia indicate that its prevention may vary in both IIH defects. Theoretically, vit. D restriction is a first indication for CYP24A1 defect (which disturbs 1,25(OH) 2 D degradation) and phosphate supplementation for SLC34A1 defect (which impairs renal phosphate transport). In conclusion, we suggest that molecular testing for CYP24A1 and SLC34A1 mutations should be performed in each case of idiopathic hypercalcemia/hypercalciuria, both in children and adults, to determine the proper way for acute treatment and complications prevention.

Genome-wide association study of caffeine metabolites provides new insights to caffeine metabolism and dietary caffeine-consumption behavior.

PubMed

Cornelis, Marilyn C; Kacprowski, Tim; Menni, Cristina; Gustafsson, Stefan; Pivin, Edward; Adamski, Jerzy; Artati, Anna; Eap, Chin B; Ehret, Georg; Friedrich, Nele; Ganna, Andrea; Guessous, Idris; Homuth, Georg; Lind, Lars; Magnusson, Patrik K; Mangino, Massimo; Pedersen, Nancy L; Pietzner, Maik; Suhre, Karsten; Völzke, Henry; Bochud, Murielle; Spector, Tim D; Grabe, Hans J; Ingelsson, Erik

2016-12-15

Caffeine is the most widely consumed psychoactive substance in the world and presents with wide interindividual variation in metabolism. This variation may modify potential adverse or beneficial effects of caffeine on health. We conducted a genome-wide association study (GWAS) of plasma caffeine, paraxanthine, theophylline, theobromine and paraxanthine/caffeine ratio among up to 9,876 individuals of European ancestry from six population-based studies. A single SNP at 6p23 (near CD83) and several SNPs at 7p21 (near AHR), 15q24 (near CYP1A2) and 19q13.2 (near CYP2A6) met GW-significance (P < 5 × 10-8) and were associated with one or more metabolites. Variants at 7p21 and 15q24 associated with higher plasma caffeine and lower plasma paraxanthine/caffeine (slow caffeine metabolism) were previously associated with lower coffee and caffeine consumption behavior in GWAS. Variants at 19q13.2 associated with higher plasma paraxanthine/caffeine (slow paraxanthine metabolism) were also associated with lower coffee consumption in the UK Biobank (n = 94 343, P < 1.0 × 10-6). Variants at 2p24 (in GCKR), 4q22 (in ABCG2) and 7q11.23 (near POR) that were previously associated with coffee consumption in GWAS were nominally associated with plasma caffeine or its metabolites. Taken together, we have identified genetic factors contributing to variation in caffeine metabolism and confirm an important modulating role of systemic caffeine levels in dietary caffeine consumption behavior. Moreover, candidate genes identified encode proteins with important clinical functions that extend beyond caffeine metabolism. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Imputation of orofacial clefting data identifies novel risk loci and sheds light on the genetic background of cleft lip ± cleft palate and cleft palate only

PubMed Central

Böhmer, Anne C.; Bowes, John; Nikolić, Miloš; Ishorst, Nina; Wyatt, Niki; Hammond, Nigel L.; Gölz, Lina; Thieme, Frederic; Barth, Sandra; Schuenke, Hannah; Klamt, Johanna; Spielmann, Malte; Aldhorae, Khalid; Rojas-Martinez, Augusto; Nöthen, Markus M.; Rada-Iglesias, Alvaro; Dixon, Michael J.; Knapp, Michael; Mangold, Elisabeth

2017-01-01

Abstract Nonsyndromic cleft lip with or without cleft palate (nsCL/P) is among the most common human birth defects with multifactorial etiology. Here, we present results from a genome-wide imputation study of nsCL/P in which, after adding replication cohort data, four novel risk loci for nsCL/P are identified (at chromosomal regions 2p21, 14q22, 15q24 and 19p13). On a systematic level, we show that the association signals within this high-density dataset are enriched in functionally-relevant genomic regions that are active in both human neural crest cells (hNCC) and mouse embryonic craniofacial tissue. This enrichment is also detectable in hNCC regions primed for later activity. Using GCTA analyses, we suggest that 30% of the estimated variance in risk for nsCL/P in the European population can be attributed to common variants, with 25.5% contributed to by the 24 risk loci known to date. For each of these, we identify credible SNPs using a Bayesian refinement approach, with two loci harbouring only one probable causal variant. Finally, we demonstrate that there is no polygenic component of nsCL/P detectable that is shared with nonsyndromic cleft palate only (nsCPO). Our data suggest that, while common variants are strongly contributing to risk for nsCL/P, they do not seem to be involved in nsCPO which might be more often caused by rare deleterious variants. Our study generates novel insights into both nsCL/P and nsCPO etiology and provides a systematic framework for research into craniofacial development and malformation. PMID:28087736

Reevaluation of RINT1 as a breast cancer predisposition gene.

PubMed

Li, Na; Thompson, Ella R; Rowley, Simone M; McInerny, Simone; Devereux, Lisa; Goode, David; Investigators, LifePool; Wong-Brown, Michelle W; Scott, Rodney J; Trainer, Alison H; Gorringe, Kylie L; James, Paul A; Campbell, Ian G

2016-09-01

Rad50 interactor 1 (RINT1) has recently been reported as an intermediate-penetrance (odds ratio 3.24) breast cancer susceptibility gene, as well as a risk factor for Lynch syndrome. The coding regions and exon-intron boundaries of RINT1 were sequenced in 2024 familial breast cancer cases previously tested negative for BRCA1, BRCA2, and PALB2 mutations and 1886 population-matched cancer-free controls using HaloPlex Targeted Enrichment Assays. Only one RINT1 protein-truncating variant was detected in a control. No excess was observed in the total number of rare variants (truncating and missense) (28, 1.38 %, vs. 27, 1.43 %. P > 0.999) or in the number of variants predicted to be pathogenic by various in silico tools (Condel, Polyphen2, SIFT, and CADD) in the cases compared to the controls. In addition, there was no difference in the incidence of classic Lynch syndrome cancers in RINT1 rare variant-carrying families compared to RINT1 wild-type families. This study had 90 % power to detect an odds ratio of at least 2.06, and the results do not provide any support for RINT1 being a moderate-penetrance breast cancer susceptibility gene, although larger studies will be required to exclude more modest effects. This study emphasizes the need for caution before designating a cancer predisposition role for any gene based on very rare truncating variants and in silico-predicted missense variants.

Endoplasmic Reticulum Stress Aggravates Viral Myocarditis by Raising Inflammation Through the IRE1-Associated NF-κB Pathway.

PubMed

Zha, Xi; Yue, Yan; Dong, Ning; Xiong, Sidong

2015-08-01

Viral myocarditis, which is mostly caused by coxsackievirus infection, is characterized by myocardial inflammation. Abnormal endoplasmic reticulum (ER) stress participates in many heart diseases, but its role in viral myocarditis remains unsolved. We investigated the influence of ER stress in coxsackievirus B3 (CVB3)-induced viral myocarditis by dynamically detecting its activation in CVB3-infected hearts, analyzing its association with myocarditis severity, and exploring its impact on disease development by modulating the strength of ER stress with the chemical activator tunicamycin (Tm) or the inhibitor tauroursodeoxycholic acid (TUDCA). The underlying signal pathway of ER stress in CVB3-induced myocarditis was also deciphered. We found that myocardial expression of Grp78 and Grp94, 2 ER stress markers, was significantly increased after CVB3 infection and positively correlated with myocarditis severity. Consistently, Tm-augmented ER stress obviously aggravated myocarditis, as shown by more severe myocardial inflammation, reduced cardiac function, and a lower survival rate, whereas TUDCA decreased ER stress and obviously alleviated myocarditis. This pathologic effect of ER stress could be attributed to increased levels of proinflammatory cytokine (interleukin [IL]-6, IL-12, tumor necrosis factor-alpha, and monocyte chemoattractant protein-1) production through the IRE1-associated nuclear factor-κB (NF-kB) pathway. ER stress accentuated CVB3-induced myocardial inflammation through the IRE1-associated NF-κB pathway. This study may help us understand the role of ER stress in viral myocarditis and promote the development of corresponding therapeutic strategies based on manipulating ER stress. Copyright © 2015 Canadian Cardiovascular Society. Published by Elsevier Inc. All rights reserved.

Coxsackievirus B3 induces the formation of autophagosomes in cardiac fibroblasts both in vitro and in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhai, Xia, E-mail: zhai_xia_cool@126.com; Qin, Ying, E-mail: qinyinggaofeng@163.com; Chen, Yang, E-mail: cy_hmu@126.com

Coxsackievirus group B (CVB) is one of the common pathogens that cause myocarditis and cardiomyopathy. Evidence has shown that CVB replication in cardiomyocytes is responsible for the damage and loss of cardiac muscle and the dysfunction of the heart. However, it remains largely undefined how CVB would directly impact cardiac fibroblasts, the most abundant cells in human heart. In this study, cardiac fibroblasts were isolated from Balb/c mice and infected with CVB type 3 (CVB3). Increased double-membraned, autophagosome-like vesicles in the CVB3-infected cardiac fibroblasts were observed with electron microscope. Punctate distribution of LC3 and increased level of LC3-II were alsomore » detected in the infected cardiac fibroblasts. Furthermore, we observed that the expression of pro-inflammatory cytokines, IL-6 and TNF-α, was increased in the CVB3-infected cardiac fibroblasts, while suppressed autophagy by 3-MA and Atg7-siRNA inhibited cytokine expression. Consistent with the in vitro findings, increased formation of autophagosomes was observed in the cardiac fibroblasts of Balb/c mice infected with CVB3. In conclusion, our data demonstrated that cardiac fibroblasts respond to CVB3 infection with the formation of autophagosomes and the release of the pro-inflammatory cytokines. These results suggest that the autophagic response of cardiac fibroblasts may play a role in the pathogenesis of myocarditis caused by CVB3 infection. - Highlights: • CVB3 replication induced autophagosome assembly in primary cardiac fibroblasts. • Both IL-6 and TNF-α in cardiac fibroblasts infected by CVB3 were increased. • IL-6 and TNF-α were reduced in cardiac fibroblasts when autophagy was inhibited. • Autophagosome assembly in cardiac fibroblasts of CVB-infected mice was increased.« less

The counsellees' view of an unclassified variant in BRCA1/2: recall, interpretation, and impact on life.

PubMed

Vos, Joël; Otten, Wilma; van Asperen, Christi; Jansen, Anna; Menko, Fred; Tibben, Aad

2008-08-01

Unclassified variants (UVs, variants of uncertain clinical significance) are found in 13% of all BRCA1/2 mutation analyses. Little is known about the counsellees' recall and interpretation of a UV, and its psychosocial/medical impact. Retrospective semi-structured interviews with open questions and five-point Likert scales were carried out in 24 counsellees who received a UV result 3 years before (sd=1.9). Sixty-seven percent (16/24) recalled the UV result as a non-informative DNA result; 29% recalled a pathogenic result. However, 79% of all counsellees interpreted the UV result as a genetic predisposition for cancer. Variations in recall and interpretation were unexplained by demographics, cancer history of themselves and relatives, and communication aspects of UV disclosure. Sixty-seven percent perceived genetic counselling as completed, whereas 71% expected to receive new DNA information. Although most counsellees reported that UV disclosure had changed their lives in general little, one in three counsellees reported large changes in specific life domains, especially in surveillance behavior and medical decisions. Ten out of 19 participants who interpreted the UV as pathogenic had undergone preventive surgery against none of the 5 counsellees who interpreted the UV as non-informative. Counsellors and researchers need to address discrepancies between the counsellees' factual recall and their subjective interpretation of non-informative BRCA1/2-test results.

A Neonatal Murine Model of Coxsackievirus A6 Infection for Evaluation of Antiviral and Vaccine Efficacy.

PubMed

Zhang, Zhenjie; Dong, Zhaopeng; Wei, Qingjuan; Carr, Michael J; Li, Juan; Ding, Shujun; Tong, Yigang; Li, Dong; Shi, Weifeng

2017-05-01

Hand, foot, and mouth disease (HFMD) is a global health concern. Family Picornaviridae members, particularly enterovirus A71 (EVA71) and coxsackievirus A16 (CVA16), are the primary etiological agents of HFMD; however, a third enterovirus A species, CVA6, has been recently associated with epidemic outbreaks. Study of the pathogenesis of CVA6 infection and development of antivirals and vaccines are hindered by a lack of appropriate animal models. We have developed and characterized a murine model of CVA6 infection that was employed to evaluate the antiviral activities of different drugs and the protective efficacies of CVA6-inactivated vaccines. Neonatal mice were susceptible to CVA6 infection via intramuscular inoculation, and the susceptibility of mice to CVA6 infection was age and dose dependent. Five-day-old mice infected with 10 5.5 50% tissue culture infective doses of the CVA6 WF057R strain consistently exhibited clinical signs, including reduced mobility, lower weight gain, and quadriplegia with significant pathology in the brain, hind limb skeletal muscles, and lungs of the infected mice in the moribund state. Immunohistochemical analysis and quantitative reverse transcription-PCR (qRT-PCR) analyses showed high viral loads (11 log 10 /mg) in skeletal muscle, and elevated levels of interleukin-6 (IL-6; >2,000 pg/ml) were associated with severe viral pneumonia and encephalitis. Ribavirin and gamma interferon administered prophylactically diminished CVA6-associated pathology in vivo , and treatment with IL-6 accelerated the death of neonatal mice. Both specific anti-CVA6 serum and maternal antibody play important roles in controlling CVA6 infection and viral replication. Collectively, these findings indicate that this neonatal murine model will be invaluable in future studies to develop CVA6-specific antivirals and vaccines. IMPORTANCE Although coxsackievirus A6 (CVA6) infections are commonly mild and self-limiting, a small proportion of children may have serious complications, such as encephalitis, acute flaccid paralysis, and neurorespiratory syndrome, leading to fatalities. We have established a mouse model of CVA6 infection by inoculation of neonatal mice with a CVA6 clinical isolate that produced consistent pathological outcomes. Here, using this model of CVA6 infection, we found that high levels of IL-6 were associated with severe viral pneumonia and encephalitis, as in an evaluation of antiviral efficacy in vivo , IL-6 had no protective effect and instead accelerated death in neonatal mice. We demonstrated that, as antiviral drugs, both gamma interferon and ribavirin played important protective roles in the early stages of infection, with increased survival in treated neonatal mice challenged with CVA6. Moreover, active and passive immunization with the inactivated vaccines and anti-CVA6 serum also protected mice against homologous challenge infections. Copyright © 2017 American Society for Microbiology.

Novel factor VIII variants with a modified furin cleavage site improve the efficacy of gene therapy for hemophilia A.

PubMed

Nguyen, G N; George, L A; Siner, J I; Davidson, R J; Zander, C B; Zheng, X L; Arruda, V R; Camire, R M; Sabatino, D E

2017-01-01

Essentials Factor (F) VIII is an inefficiently expressed protein. Furin deletion FVIII variants were purified and characterized using in vitro and in vivo assays. These minimally modified novel FVIII variants have enhanced function. These variants provide a strategy for increasing FVIII expression in hemophilia A gene therapy. Background The major challenge for developing gene-based therapies for hemophilia A is that human factor VIII (hFVIII) has intrinsic properties that result in inefficient biosynthesis. During intracellular processing, hFVIII is predominantly cleaved at a paired basic amino acid cleaving enzyme (PACE) or furin cleavage site to yield a heterodimer that is the major form of secreted protein. Previous studies with B-domain-deleted (BDD) canine FVIII and hFVIII-R1645H, both differing from hFVIII by a single amino acid at this site, suggested that these proteins are secreted mainly in a single polypeptide chain (SC) form and exhibit enhanced function. Objective We hypothesized that deletion(s) of the furin site modulates FVIII biology and may enhance its function. Methods A series of recombinant hFVIII-furin deletion variants were introduced into hFVIII-BDD [Δ1645, 1645-46(Δ2), 1645-47(Δ3), 1645-48(Δ4), or Δ1648] and characterized. Results In vitro, recombinant purified Δ3 and Δ4 were primarily SC and, interestingly, had 2-fold higher procoagulant activity compared with FVIII-BDD. In vivo, the variants also have improved hemostatic function. After adeno-associated viral (AAV) vector delivery, the expression of these variants is 2-4-fold higher than hFVIII-BDD. Protein challenges of each variant in mice tolerant to hFVIII-BDD showed no anti-FVIII immune response. Conclusions These data suggest that the furin deletion hFVIII variants are superior to hFVIII-BDD without increased immunogenicity. In the setting of gene-based therapeutics, these novel variants provide a unique strategy to increase FVIII expression, thus lowering the vector dose, a critical factor for hemophilia A gene therapy. © 2016 The Authors. Journal of Thrombosis and Haemostasis published by Wiley Periodicals, Inc. on behalf of International Society on Thrombosis and Haemostasis.

CRISPR EnAbled trackable genome engineering for isopropanol production in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liang, Liya; Liu, Rongming; Garst, Andrew D.

Isopropanol is an important target molecule for sustainable production of fuels and chemicals. Increases in DNA synthesis and synthetic biology capabilities have resulted in the development of a range of new strategies for the more rapid design, construction, and testing of production strains. Here, we report on the use of such capabilities to construct and test 903 different variants of the isopropanol production pathway in Escherichia coli. We first constructed variants to explore the effect of codon optimization, copy number, and translation initiation rates on isopropanol production. The best strain (PA06) produced isopropanol at titers of 17.5 g/L, with amore » yield of 0.62 (mol/mol), and maximum productivity of 0.40 g/L/h. We next integrated the isopropanol synthetic pathway into the genome and then used the CRISPR EnAbled Trackable genome Engineering (CREATE) strategy to generate an additional 640 individual RBS library variants for further evaluation. After testing each of these variants, we constructed a combinatorial library containing 256 total variants from four different RBS levels for each gene. The best producing variant, PA14, produced isopropanol at titers of 7.1 g/L at 24 h, with a yield of 0.75 (mol/mol), and maximum productivity of 0.62 g/L/h (which was 0.22 g/L/h above the parent strain PA07). As a result, we demonstrate the ability to rapidly construct and test close to ~1000 designer strains and identify superior performers.« less

CRISPR EnAbled trackable genome engineering for isopropanol production in Escherichia coli

DOE PAGES

Liang, Liya; Liu, Rongming; Garst, Andrew D.; ...

2017-02-16

Isopropanol is an important target molecule for sustainable production of fuels and chemicals. Increases in DNA synthesis and synthetic biology capabilities have resulted in the development of a range of new strategies for the more rapid design, construction, and testing of production strains. Here, we report on the use of such capabilities to construct and test 903 different variants of the isopropanol production pathway in Escherichia coli. We first constructed variants to explore the effect of codon optimization, copy number, and translation initiation rates on isopropanol production. The best strain (PA06) produced isopropanol at titers of 17.5 g/L, with amore » yield of 0.62 (mol/mol), and maximum productivity of 0.40 g/L/h. We next integrated the isopropanol synthetic pathway into the genome and then used the CRISPR EnAbled Trackable genome Engineering (CREATE) strategy to generate an additional 640 individual RBS library variants for further evaluation. After testing each of these variants, we constructed a combinatorial library containing 256 total variants from four different RBS levels for each gene. The best producing variant, PA14, produced isopropanol at titers of 7.1 g/L at 24 h, with a yield of 0.75 (mol/mol), and maximum productivity of 0.62 g/L/h (which was 0.22 g/L/h above the parent strain PA07). As a result, we demonstrate the ability to rapidly construct and test close to ~1000 designer strains and identify superior performers.« less

Effects of ubiquilin 1 on the unfolded protein response.

PubMed

Lu, Alice; Hiltunen, Mikko; Romano, Donna M; Soininen, Hilkka; Hyman, Bradley T; Bertram, Lars; Tanzi, Rudolph E

2009-05-01

Previous studies have implicated the unfolded protein response (UPR) in the pathogenesis of Alzheimer's disease (AD). We previously reported that DNA variants in the ubiquilin 1 (UBQLN1) gene increase the risk for AD. Since UBQLN1 has been shown to play a role in the UPR, we assessed the effects of overexpression and downregulation of UBQLN1 splice variants during tunicamycin-induced ER stress. In addition to previously described transcript variants, TV1 and TV2, we identified two novel transcript variants of UBQLN1 in brain: TV3 (lacking exons 2-4) and TV4 (lacking exon 4). Overexpression of TV1-3, but not TV4 significantly decreased the mRNA induction of UPR-inducible genes, C/EBP homologous protein (CHOP), BiP/GRP78, and protein disulfide isomerase (PDI) during the UPR. Stable overexpression of TV1-3, but not TV4, also significantly decreased the induction of CHOP protein and increased cell viability during the UPR. In contrast, downregulation of UBQLN1 did not affect CHOP mRNA induction, but instead increased PDI mRNA levels. These findings suggest that overexpression UBQLN1 transcript variants TV1-3, but not TV4, exert a protective effect during the UPR by attenuating CHOP induction and potentially increasing cell viability.

Characterization of a spliced variant of human IRF-3 promoter and its regulation by the transcription factor Sp1.

PubMed

Ren, Wei; Zhu, Liang-Hua; Xu, Hua-Guo; Jin, Rui; Zhou, Guo-Ping

2012-06-01

Interferon regulatory factor 3 (IRF-3), an essential transcriptional regulator of the interferon genes, plays an important role in host defense against viral and microbial infection as well as in cell growth regulation. Promoter plays a crucial role in gene transcription. We have reported the characterization of the wide type of human IRF-3 promoter, but the characterization of the spliced variant of human IRF-3 Int2V1 promoter has not been systematically analyzed. To observe the spliced variant of human IRF-3 promoter, we have cloned the human IRF-3 gene promoter region containing 300 nucleotides upstream the transcription start site (TSS). Transient transfection of 5' deleted promoter-reporter constructs and luciferase assay illustrated the region -159/-100 relative to the TSS is sufficient for full promoter activity. This region contains GATA1 and specific protein-1 (Sp1) transcription factor binding sites. Interestingly, mutation of this Sp1 site reduced the promoter activity by 50%. However, overexpression of Sp1 increased the transcription activity by 2.4-fold. These results indicated that the spliced variant of human IRF-3 gene core promoter was located within the region -159/-100 relative to the TSS. Sp1 transcription factor upregulates the spliced variant of human IRF-3 gene promoter.

Lack of association between dopamine D2 receptor gene Cys311 variant and schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Toshihisa; Fukushima, Noboru; Takahashi, Makoto

Itokawa et al. reported identifying one missense nucleotide mutation from C to G resulting in a substitution of serine with cysteine at codon 311 in the third intracellular loop of the dopamine D2 receptor in schizophrenics. Arinami et al. reported finding a positive association between the Cys311 variant and schizophrenia. In response to the report by Arinami et al. we examined 106 unrelated Japanese schizophrenics and 106 normal controls to determine if there is any association of the Cys311 variant with schizophrenia. However, we found no statistically significant differences in allelic frequencies of Cys311 between schizophrenia and normal controls. Themore » present results as well as those of all previous studies except for that of Arinami et al. indicated that an association between the dopamine D2 receptor gene and schizophrenia is unlikely to exist. 24 refs., 1 fig., 1 tab.« less

SCRIB and PUF60 Are Primary Drivers of the Multisystemic Phenotypes of the 8q24.3 Copy-Number Variant

PubMed Central

Dauber, Andrew; Golzio, Christelle; Guenot, Cécile; Jodelka, Francine M.; Kibaek, Maria; Kjaergaard, Susanne; Leheup, Bruno; Martinet, Danielle; Nowaczyk, Malgorzata J.M.; Rosenfeld, Jill A.; Zeesman, Susan; Zunich, Janice; Beckmann, Jacques S.; Hirschhorn, Joel N.; Hastings, Michelle L.; Jacquemont, Sebastien; Katsanis, Nicholas

2013-01-01

Copy-number variants (CNVs) represent a significant interpretative challenge, given that each CNV typically affects the dosage of multiple genes. Here we report on five individuals with coloboma, microcephaly, developmental delay, short stature, and craniofacial, cardiac, and renal defects who harbor overlapping microdeletions on 8q24.3. Fine mapping localized a commonly deleted 78 kb region that contains three genes: SCRIB, NRBP2, and PUF60. In vivo dissection of the CNV showed discrete contributions of the planar cell polarity effector SCRIB and the splicing factor PUF60 to the syndromic phenotype, and the combinatorial suppression of both genes exacerbated some, but not all, phenotypic components. Consistent with these findings, we identified an individual with microcephaly, short stature, intellectual disability, and heart defects with a de novo c.505C>T variant leading to a p.His169Tyr change in PUF60. Functional testing of this allele in vivo and in vitro showed that the mutation perturbs the relative dosage of two PUF60 isoforms and, subsequently, the splicing efficiency of downstream PUF60 targets. These data inform the functions of two genes not associated previously with human genetic disease and demonstrate how CNVs can exhibit complex genetic architecture, with the phenotype being the amalgam of both discrete dosage dysfunction of single transcripts and also of binary genetic interactions. PMID:24140112

Association between alcohol and cardiovascular disease: Mendelian randomisation analysis based on individual participant data

PubMed Central

Holmes, Michael V; Dale, Caroline E; Zuccolo, Luisa; Silverwood, Richard J; Guo, Yiran; Ye, Zheng; Prieto-Merino, David; Dehghan, Abbas; Trompet, Stella; Wong, Andrew; Cavadino, Alana; Drogan, Dagmar; Padmanabhan, Sandosh; Yesupriya, Ajay; Leusink, Maarten; Sundstrom, Johan; Hubacek, Jaroslav A; Pikhart, Hynek; Swerdlow, Daniel I; Panayiotou, Andrie G; Borinskaya, Svetlana A; Finan, Chris; Shah, Sonia; Kuchenbaecker, Karoline B; Shah, Tina; Engmann, Jorgen; Folkersen, Lasse; Eriksson, Per; Ricceri, Fulvio; Melander, Olle; Sacerdote, Carlotta; Gamble, Dale M; Rayaprolu, Sruti; Ross, Owen A; McLachlan, Stela; Vikhireva, Olga; Sluijs, Ivonne; Scott, Robert A; Adamkova, Vera; Flicker, Leon; van Bockxmeer, Frank M; Power, Christine; Marques-Vidal, Pedro; Meade, Tom; Marmot, Michael G; Ferro, Jose M; Paulos-Pinheiro, Sofia; Humphries, Steve E; Talmud, Philippa J; Leach, Irene Mateo; Verweij, Niek; Linneberg, Allan; Skaaby, Tea; Doevendans, Pieter A; Cramer, Maarten J; van der Harst, Pim; Klungel, Olaf H; Dowling, Nicole F; Dominiczak, Anna F; Kumari, Meena; Nicolaides, Andrew N; Weikert, Cornelia; Boeing, Heiner; Ebrahim, Shah; Gaunt, Tom R; Price, Jackie F; Lannfelt, Lars; Peasey, Anne; Kubinova, Ruzena; Pajak, Andrzej; Malyutina, Sofia; Voevoda, Mikhail I; Tamosiunas, Abdonas; Maitland-van der Zee, Anke H; Norman, Paul E; Hankey, Graeme J; Bergmann, Manuela M; Hofman, Albert; Franco, Oscar H; Cooper, Jackie; Palmen, Jutta; Spiering, Wilko; de Jong, Pim A; Kuh, Diana; Hardy, Rebecca; Uitterlinden, Andre G; Ikram, M Arfan; Ford, Ian; Hyppönen, Elina; Almeida, Osvaldo P; Wareham, Nicholas J; Khaw, Kay-Tee; Hamsten, Anders; Husemoen, Lise Lotte N; Tjønneland, Anne; Tolstrup, Janne S; Rimm, Eric; Beulens, Joline W J; Verschuren, W M Monique; Onland-Moret, N Charlotte; Hofker, Marten H; Wannamethee, S Goya; Whincup, Peter H; Morris, Richard; Vicente, Astrid M; Watkins, Hugh; Farrall, Martin; Jukema, J Wouter; Meschia, James; Cupples, L Adrienne; Sharp, Stephen J; Fornage, Myriam; Kooperberg, Charles; LaCroix, Andrea Z; Dai, James Y; Lanktree, Matthew B; Siscovick, David S; Jorgenson, Eric; Spring, Bonnie; Coresh, Josef; Buxbaum, Sarah G; Schreiner, Pamela J; Ellison, R Curtis; Tsai, Michael Y; Patel, Sanjay R; Redline, Susan; Johnson, Andrew D; Hoogeveen, Ron C; Hakonarson, Hakon; Rotter, Jerome I; Boerwinkle, Eric; de Bakker, Paul I W; Kivimaki, Mika; Asselbergs, Folkert W; Sattar, Naveed; Lawlor, Debbie A; Whittaker, John; Davey Smith, George; Mukamal, Kenneth; Psaty, Bruce M; Wilson, James G; Lange, Leslie A; Hamidovic, Ajna; Hingorani, Aroon D; Nordestgaard, Børge G; Bobak, Martin; Leon, David A; Langenberg, Claudia; Palmer, Tom M; Reiner, Alex P; Keating, Brendan J; Dudbridge, Frank

2014-01-01

Objective To use the rs1229984 variant in the alcohol dehydrogenase 1B gene (ADH1B) as an instrument to investigate the causal role of alcohol in cardiovascular disease. Design Mendelian randomisation meta-analysis of 56 epidemiological studies. Participants 261 991 individuals of European descent, including 20 259 coronary heart disease cases and 10 164 stroke events. Data were available on ADH1B rs1229984 variant, alcohol phenotypes, and cardiovascular biomarkers. Main outcome measures Odds ratio for coronary heart disease and stroke associated with the ADH1B variant in all individuals and by categories of alcohol consumption. Results Carriers of the A-allele of ADH1B rs1229984 consumed 17.2% fewer units of alcohol per week (95% confidence interval 15.6% to 18.9%), had a lower prevalence of binge drinking (odds ratio 0.78 (95% CI 0.73 to 0.84)), and had higher abstention (odds ratio 1.27 (1.21 to 1.34)) than non-carriers. Rs1229984 A-allele carriers had lower systolic blood pressure (−0.88 (−1.19 to −0.56) mm Hg), interleukin-6 levels (−5.2% (−7.8 to −2.4%)), waist circumference (−0.3 (−0.6 to −0.1) cm), and body mass index (−0.17 (−0.24 to −0.10) kg/m2). Rs1229984 A-allele carriers had lower odds of coronary heart disease (odds ratio 0.90 (0.84 to 0.96)). The protective association of the ADH1B rs1229984 A-allele variant remained the same across all categories of alcohol consumption (P=0.83 for heterogeneity). Although no association of rs1229984 was identified with the combined subtypes of stroke, carriers of the A-allele had lower odds of ischaemic stroke (odds ratio 0.83 (0.72 to 0.95)). Conclusions Individuals with a genetic variant associated with non-drinking and lower alcohol consumption had a more favourable cardiovascular profile and a reduced risk of coronary heart disease than those without the genetic variant. This suggests that reduction of alcohol consumption, even for light to moderate drinkers, is beneficial for cardiovascular health. PMID:25011450

Hyaluronan Tumor Cell Interactions in Prostate Cancer Growth and Survival

DTIC Science & Technology

2006-12-01

prognostic value of CD44 standard and variant v3 and v6 isoforms in prostate cancer. Eur Urol, 2001. 39(2): p. 138-44. 32. De Marzo , A.M., et al., CD44...subcutaneous injection model [ 24 ]and in orthotopic or intrafemoral bone injection models (see progress report below). Importantly, the addition of...expression from these cells, completely reverses growth inhibition[ 24 ]. CD44 and Rhamm – Two Hyaladherins with Overlapping Function: The two most

A clinical and molecular characterisation of CRB1-associated maculopathy.

PubMed

Khan, Kamron N; Robson, Anthony; Mahroo, Omar A R; Arno, Gavin; Inglehearn, Chris F; Armengol, Monica; Waseem, Naushin; Holder, Graham E; Carss, Keren J; Raymond, Lucy F; Webster, Andrew R; Moore, Anthony T; McKibbin, Martin; van Genderen, Maria M; Poulter, James A; Michaelides, Michel

2018-05-01

To date, over 150 disease-associated variants in CRB1 have been described, resulting in a range of retinal disease phenotypes including Leber congenital amaurosis and retinitis pigmentosa. Despite this, no genotype-phenotype correlations are currently recognised. We performed a retrospective review of electronic patient records to identify patients with macular dystrophy due to bi-allelic variants in CRB1. In total, seven unrelated individuals were identified. The median age at presentation was 21 years, with a median acuity of 0.55 decimalised Snellen units (IQR = 0.43). The follow-up period ranged from 0 to 19 years (median = 2.0 years), with a median final decimalised Snellen acuity of 0.65 (IQR = 0.70). Fundoscopy revealed only a subtly altered foveal reflex, which evolved into a bull's-eye pattern of outer retinal atrophy. Optical coherence tomography identified structural changes-intraretinal cysts in the early stages of disease, and later outer retinal atrophy. Genetic testing revealed that one rare allele (c.498_506del, p.(Ile167_Gly169del)) was present in all patients, with one patient being homozygous for the variant and six being heterozygous. In trans with this, one variant recurred twice (p.(Cys896Ter)), while the four remaining alleles were each observed once (p.(Pro1381Thr), p.(Ser478ProfsTer24), p.(Cys195Phe) and p.(Arg764Cys)). These findings show that the rare CRB1 variant, c.498_506del, is strongly associated with localised retinal dysfunction. The clinical findings are much milder than those observed with bi-allelic, loss-of-function variants in CRB1, suggesting this in-frame deletion acts as a hypomorphic allele. This is the most prevalent disease-causing CRB1 variant identified in the non-Asian population to date.

Large-scale gene-centric analysis identifies novel variants for coronary artery disease.

PubMed

2011-09-01

Coronary artery disease (CAD) has a significant genetic contribution that is incompletely characterized. To complement genome-wide association (GWA) studies, we conducted a large and systematic candidate gene study of CAD susceptibility, including analysis of many uncommon and functional variants. We examined 49,094 genetic variants in ∼2,100 genes of cardiovascular relevance, using a customised gene array in 15,596 CAD cases and 34,992 controls (11,202 cases and 30,733 controls of European descent; 4,394 cases and 4,259 controls of South Asian origin). We attempted to replicate putative novel associations in an additional 17,121 CAD cases and 40,473 controls. Potential mechanisms through which the novel variants could affect CAD risk were explored through association tests with vascular risk factors and gene expression. We confirmed associations of several previously known CAD susceptibility loci (eg, 9p21.3:p<10(-33); LPA:p<10(-19); 1p13.3:p<10(-17)) as well as three recently discovered loci (COL4A1/COL4A2, ZC3HC1, CYP17A1:p<5×10(-7)). However, we found essentially null results for most previously suggested CAD candidate genes. In our replication study of 24 promising common variants, we identified novel associations of variants in or near LIPA, IL5, TRIB1, and ABCG5/ABCG8, with per-allele odds ratios for CAD risk with each of the novel variants ranging from 1.06-1.09. Associations with variants at LIPA, TRIB1, and ABCG5/ABCG8 were supported by gene expression data or effects on lipid levels. Apart from the previously reported variants in LPA, none of the other ∼4,500 low frequency and functional variants showed a strong effect. Associations in South Asians did not differ appreciably from those in Europeans, except for 9p21.3 (per-allele odds ratio: 1.14 versus 1.27 respectively; P for heterogeneity = 0.003). This large-scale gene-centric analysis has identified several novel genes for CAD that relate to diverse biochemical and cellular functions and clarified the literature with regard to many previously suggested genes.

Molecular Characteristics of Hb New York [β113(G15)Val→Glu, HBB: c.341T>A] in Thailand.

PubMed

Chaibunruang, Attawut; Singha, Kritsada; Srivorakun, Hataichanok; Fucharoen, Goonnapa; Fucharoen, Supan

2018-01-01

Hb New York or Hb Kaohsiung [β113(G15)Val→Glu (GTG>GAG), HBB: c.341T>A] has been considered a rare β hemoglobin (Hb) variant found originally in an Iranian woman and later in diverse populations but its genetic origin has not been elucidated. Here we report molecular and hematological descriptions of this variant found in the Thai population. Among 5643 subjects referred for hemoglobinopathy investigation during January 2015 to September 2017, 183 (3.2%) were found to carry several Hb variants, including β chain variants (n = 135, 2.4%), α chain variants (n = 33, 0.6%), Hb Lepore-Hollandia (NG_000007.3: g.63290_70702del) and Hb Lepore-Boston-Washington (NG_000007.3: g.63632_71046del) (δβ hybrid Hb) (n = 12, 0.2%) and δ chain variants (n = 3, 0.05%). Of patients with β chain variants, six with normal high performance liquid chromatography (HPLC) patterns, had an abnormal Hb in zone 11 of capillary electrophoresis (CE), the amounts of which ranged from 29.6-45.4% with normal levels of Hb A 2 and Hb F. DNA analysis identified a heterozygous Hb New York mutation in all cases. Further screening of α-thalassemia (α-thal) identified coinheritance of α + - and α 0 -thal in two of them who had reduced levels of Hb New York. Haplotype analysis suggested that the Thai Hb New York was likely associated with a single β-globin haplotype [+ - - - - + +], indicating that it was of the same origin. Hematological findings and simple DNA assay based on allele-specific polymerase chain reaction (PCR) for rapid detection of Hb New York are presented.

Preliminary spectrum of genetic variants in familial hypercholesterolemia in Argentina.

PubMed

Bañares, Virginia G; Corral, Pablo; Medeiros, Ana Margarida; Araujo, María Beatriz; Lozada, Alfredo; Bustamante, Juan; Cerretini, Roxana; López, Graciela; Bourbon, Mafalda; Schreier, Laura E

Familial hypercholesterolemia (FH) is a genetic disorder characterized by elevated low-density lipoprotein cholesterol and early cardiovascular disease. As cardiovascular disease is a leading cause of mortality in Argentina, early identification of patients with FH is of great public health importance. The aim of our study was to identify families with FH and to approximate to the characterization of the genetic spectrum mutations of FH in Argentina. Thirty-three not related index cases were selected with clinical diagnosis of FH. Genetic analysis was performed by sequencing, multiplex ligation-dependent probe amplification, and bioinformatics tools. Twenty genetic variants were identified among 24 cases (73%), 95% on the low-density lipoprotein receptor gene. The only variant on APOB was the R3527Q. Four were novel variants: c.-135C>A, c.170A>C p.(Asp57Ala), c.684G>C p.(Glu228Asp), and c.1895A>T p.(Asn632Ile); the bioinformatics' analysis revealed clear destabilizing effects for 2 of them. The exon 14 presented the highest number of variants (32%). Four variants were observed in more than 1 case and the c.2043C>A p.(Cys681*) was carried by 18% of index cases. Two true homozygotes, 3 compound heterozygotes, and 1 double heterozygote were identified. This study characterizes for the first time in Argentina genetic variants associated with FH and suggest that the allelic heterogeneity of the FH in the country could have 1 relative common low-density lipoprotein receptor mutation. This knowledge is important for the genotype-phenotype correlation and for optimizing both cholesterol-lowering therapies and mutational analysis protocols. In addition, these data contribute to the understanding of the molecular basis of FH in Argentina. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

The fibrous form of intracellular inclusion bodies in recombinant variant fibrinogen-producing cells is specific to the hepatic fibrinogen storage disease-inducible variant fibrinogen.

PubMed

Arai, Shinpei; Ogiwara, Naoko; Mukai, Saki; Takezawa, Yuka; Sugano, Mitsutoshi; Honda, Takayuki; Okumura, Nobuo

2017-06-01

Fibrinogen storage disease (FSD) is a rare disorder that is characterized by the accumulation of fibrinogen in hepatocytes and induces liver injury. Six mutations in the γC domain (γG284R, γT314P, γD316N, the deletion of γG346-Q350, γG366S, and γR375W) have been identified for FSD. Our group previously established γ375W fibrinogen-producing Chinese hamster ovary (CHO) cells and observed aberrant large granular and fibrous forms of intracellular inclusion bodies. The aim of this study was to investigate whether fibrous intracellular inclusion bodies are specific to FSD-inducible variant fibrinogen. Thirteen expression vectors encoding the variant γ-chain were stably or transiently transfected into CHO cells expressing normal fibrinogen Aα- and Bβ-chains or HuH-7 cells, which were then immunofluorescently stained. Six CHO and HuH-7 cell lines that transiently produced FSD-inducible variant fibrinogen presented the fibrous (3.2-22.7 and 2.1-24.5%, respectively) and large granular (5.4-25.5 and 7.7-23.9%) forms of intracellular inclusion bodies. Seven CHO and HuH-7 cell lines that transiently produced FSD-non-inducible variant fibrinogen only exhibit the large granular form. These results demonstrate that transiently transfected variant fibrinogen-producing CHO cells and inclusion bodies of the fibrous form may be useful in non-invasive screening for FSD risk factors for FSD before its onset.

Molecular and geographic analyses of vampire bat-transmitted cattle rabies in central Brazil

PubMed Central

Kobayashi, Yuki; Sato, Go; Mochizuki, Nobuyuki; Hirano, Shinji; Itou, Takuya; Carvalho, Adolorata AB; Albas, Avelino; Santos, Hamilton P; Ito, Fumio H; Sakai, Takeo

2008-01-01

Background Vampire bats are important rabies virus vectors, causing critical problems in both the livestock industry and public health sector in Latin America. In order to assess the epidemiological characteristics of vampire bat-transmitted rabies, the authors conducted phylogenetic and geographical analyses using sequence data of a large number of cattle rabies isolates collected from a wide geographical area in Brazil. Methods Partial nucleoprotein genes of rabies viruses isolated from 666 cattle and 18 vampire bats between 1987 and 2006 were sequenced and used for phylogenetic analysis. The genetic variants were plotted on topographical maps of Brazil. Results In this study, 593 samples consisting of 24 genetic variants were analyzed. Regional localization of variants was observed, with the distribution of several variants found to be delimited by mountain ranges which served as geographic boundaries. The geographical distributions of vampire-bat and cattle isolates that were classified as the identical phylogenetic group were found to overlap with high certainty. Most of the samples analyzed in this study were isolated from adjacent areas linked by rivers. Conclusion This study revealed the existence of several dozen regional variants associated with vampire bats in Brazil, with the distribution patterns of these variants found to be affected by mountain ranges and rivers. These results suggest that epidemiological characteristics of vampire bat-related rabies appear to be associated with the topographical and geographical characteristics of areas where cattle are maintained, and the factors affecting vampire bat ecology. PMID:18983685

Preferential Targeting of Conserved Gag Regions after Vaccination with a Heterologous DNA Prime-Modified Vaccinia Virus Ankara Boost HIV-1 Vaccine Regimen.

PubMed

Bauer, Asli; Podola, Lilli; Mann, Philipp; Missanga, Marco; Haule, Antelmo; Sudi, Lwitiho; Nilsson, Charlotta; Kaluwa, Bahati; Lueer, Cornelia; Mwakatima, Maria; Munseri, Patricia J; Maboko, Leonard; Robb, Merlin L; Tovanabutra, Sodsai; Kijak, Gustavo; Marovich, Mary; McCormack, Sheena; Joseph, Sarah; Lyamuya, Eligius; Wahren, Britta; Sandström, Eric; Biberfeld, Gunnel; Hoelscher, Michael; Bakari, Muhammad; Kroidl, Arne; Geldmacher, Christof

2017-09-15

Prime-boost vaccination strategies against HIV-1 often include multiple variants for a given immunogen for better coverage of the extensive viral diversity. To study the immunologic effects of this approach, we characterized breadth, phenotype, function, and specificity of Gag-specific T cells induced by a DNA-prime modified vaccinia virus Ankara (MVA)-boost vaccination strategy, which uses mismatched Gag immunogens in the TamoVac 01 phase IIa trial. Healthy Tanzanian volunteers received three injections of the DNA-SMI vaccine encoding a subtype B and AB-recombinant Gag p37 and two vaccinations with MVA-CMDR encoding subtype A Gag p55 Gag-specific T-cell responses were studied in 42 vaccinees using fresh peripheral blood mononuclear cells. After the first MVA-CMDR boost, vaccine-induced gamma interferon-positive (IFN-γ + ) Gag-specific T-cell responses were dominated by CD4 + T cells ( P < 0.001 compared to CD8 + T cells) that coexpressed interleukin-2 (IL-2) (66.4%) and/or tumor necrosis factor alpha (TNF-α) (63.7%). A median of 3 antigenic regions were targeted with a higher-magnitude median response to Gag p24 regions, more conserved between prime and boost, compared to those of regions within Gag p15 (not primed) and Gag p17 (less conserved; P < 0.0001 for both). Four regions within Gag p24 each were targeted by 45% to 74% of vaccinees upon restimulation with DNA-SMI-Gag matched peptides. The response rate to individual antigenic regions correlated with the sequence homology between the MVA- and DNA Gag-encoded immunogens ( P = 0.04, r 2 = 0.47). In summary, after the first MVA-CMDR boost, the sequence-mismatched DNA-prime MVA-boost vaccine strategy induced a Gag-specific T-cell response that was dominated by polyfunctional CD4 + T cells and that targeted multiple antigenic regions within the conserved Gag p24 protein. IMPORTANCE Genetic diversity is a major challenge for the design of vaccines against variable viruses. While including multiple variants for a given immunogen in prime-boost vaccination strategies is one approach that aims to improve coverage for global virus variants, the immunologic consequences of this strategy have been poorly defined so far. It is unclear whether inclusion of multiple variants in prime-boost vaccination strategies improves recognition of variant viruses by T cells and by which mechanisms this would be achieved, either by improved cross-recognition of multiple variants for a given antigenic region or through preferential targeting of antigenic regions more conserved between prime and boost. Engineering vaccines to induce adaptive immune responses that preferentially target conserved antigenic regions of viral vulnerability might facilitate better immune control after preventive and therapeutic vaccination for HIV and for other variable viruses. Copyright © 2017 American Society for Microbiology.

NOD2/CARD15 mutations and the risk of reoperation in patients with Crohns disease.

PubMed

Martínek, L; Kupka, T; Simova, J; Klvaňa, P; Bojková, M; Uvírová, M; Dítě, P; Dvorackova, J; Hoch, J; Zonca, P

2015-06-01

Three NOD2/CARD15 gene variants (3020insC, R702W, G908R) have been identified as genetic risk factors for Crohns disease patients. However the diagnostic and therapeutic relevance for clinical practice remains limited. The aim of this study was to evaluate the association between these variants, the risk of reoperation and disease phenotype. In 76 Crohns disease patients (41 female, 35 male) with a minimum 5 year follow-up, three polymorphisms of the NOD2/CARD15 gene (R702W, G908R, 3020insC) were tested. Detailed clinical and medical history including surgical procedures and reoperations were obtained by reviewing the medical charts and completed prospectively. Association between the need for reoperation, disease phenotypes and gene variants were analyzed. 24 patients (32%) showed at least one NOD2/CARD15 mutation. 25 patients (33%) required reoperation, 51 (67%) represented the control group. The expected trend that patients with NOD2/CARD15 variants have a higher frequency of reoperations was not confirmed to a level of statistical significance (p=0.2688). Two of the four patients (50%) with the 3020insC variant required further surgery. We did not confirm any association between NOD2/CARD15 mutations and age at diagnosis (p=0.4356), behavior (p=0.6610), or localization (p=0.4747) according to the Montreal classification. NOD2/CARD15 polymorphisms did not significantly affect the reoperation rate. Homozygosity for the 3020insC variant in the NOD2/CARD15 gene is associated with a high risk of reoperation. NOD2/CARD15 gene variants are not significantly associated with specific disease phenotypes.

MMP3 and TIMP2 gene variants as predisposing factors for Achilles tendon pathologies: Attempted replication study in a British case-control cohort.

PubMed

El Khoury, Louis; Ribbans, William J; Raleigh, Stuart M

2016-09-01

Variants within the MMP3 (rs679620) and TIMP2 (rs4789932) genes have been associated with the risk of Achilles tendon pathology (ATP) in populations from South Africa and Australia. This study aimed to determine whether these variants were associated with the risk of ATP in British Caucasians. We recruited 118 cases with ATP, including a subset of 25 individuals with Achilles tendon rupture (RUP) and 131 controls. DNA samples were isolated from saliva and genotyped using qPCR. For the TIMP2 rs4789932 variant we found a significant (p = 0.038) difference in the genotype distribution frequency between males with ATP (CC, 39.4%; CT, 43.7%; TT, 16.9%) compared to male controls (CC, 20.7%; CT, 59.8%; TT, 19.5%). We also observed a difference in the TIMP2 rs4789932 genotype distribution between males with rupture compared to male controls (p = 0.038). The MMP3 rs679620 GG genotype was found to be overrepresented in the Achilles tendon rupture (RUP) group (AA, 24.0%; AG, 32.0%; GG, 44.0%) compared to controls (AA, 26.7%; AG, 54.2%; GG, 19.1%). In conclusion, the CT genotype of the TIMP2 rs4789932 variant was associated with lower risk of ATP in males. Furthermore, while we revealed differences for both variants in genotype distribution between the RUP and control groups, the sample size of the RUP group was small and confirmation would be required in additional cohorts. Finally, although both the TIMP2 rs4789932 and MMP3 rs679620 variants tentatively associated with ATP, there were differences in the direction of association compared to earlier work.

The Australian experience following plain packaging: the impact on tobacco branding.

PubMed

Greenland, Steven J

2016-12-01

Brands are critical to tobacco marketing. Industry stakeholders predicted that plain packaging, by removing key tangible branding dimensions, would restrict new products and brand differentiation. However, manufacturers respond innovatively to limit regulatory impact. This study investigates brand strategy following plain packaging's introduction to Australia. Brand portfolios were determined using 2006-15 tobacco ingredient reports. These detail the brand and variant names sold and are provided annually as part of a voluntary agreement between the Australian Government and leading manufacturers. Post-plain packaging brand ranges were verified using retail price lists and a supermarket retail audit using a method used previously to verify a period of pre-plain packaging data. The verification process identified some data inaccuracies from one manufacturer which resulted in the issuing of corrected data. After plain packaging the leading manufacturers continued with extensive brand ranges differentiated by price. All launched new products. While total brand numbers fell from 29 to 24, the mean number of variants for the leading 12 brands grew from 8.9 to 9.7. Substantial variant name modifications occurred with 50 new or modified names in 2012-13. Among leading brands, the incidence of variant colour names increased from 49.5 to 79.3%. New brands and variants were not inhibited by the introduction of plain packaging in Australia. After plain packaging, leading brand variant numbers expanded by 9 to 116 and colour variant names increased by 73.6% and became the norm-lighter colours (blue, gold and silver) dominated, perpetuating notions of less harmful cigarettes. [Correction added on 09 September 2016, after first online publication: The figures in the last sentence of the Abstract are now corrected from 'expanded by 116' to 'expanded by 9 to 116'.]. © 2016 Society for the Study of Addiction.

A novel ANO3 variant identified in a 53-year-old woman presenting with hyperkinetic dysarthria, blepharospasm, hyperkinesias, and complex motor tics.

PubMed

Blackburn, Patrick R; Zimmermann, Michael T; Gass, Jennifer M; Harris, Kimberly G; Cousin, Margot A; Boczek, Nicole J; Ross, Owen A; Klee, Eric W; Brazis, Paul W; Van Gerpen, Jay A; Atwal, Paldeep S

2016-12-05

Cervical dystonias have a variable presentation and underlying etiology, but collectively represent the most common form of focal dystonia. There are a number of known genetic forms of dystonia (DYT1-27); however the heterogeneity of disease presentation does not always make it easy to categorize the disease by phenotype-genotype comparison. In this report, we describe a 53-year-old female who presented initially with hand tremor following a total hip arthroplasty. The patient developed a mixed hyperkinetic disorder consisting of chorea, dystonia affecting the upper extremities, dysarthria, and blepharospasm. Whole exome sequencing of the patient revealed a novel heterozygous missense variant (Chr11(GRCh38): g.26525644C > G; NM_031418.2(ANO3): c.702C > G; NP_113606.2. p.C234W) in exon 7 in the ANO3 gene. ANO3 encodes anoctamin-3, a Ca +2 -dependent phospholipid scramblase expressed in striatal-neurons, that has been implicated in autosomal dominant craniocervical dystonia (Dystonia-24, DYT24, MIM# 615034). To date, only a handful of cases of DYT-24 have been described in the literature. The complex clinical presentation of the patient described includes hyperkinesias, complex motor movements, and vocal tics, which have not been reported in other patients with DYT24. This report highlights the utility of using clinical whole exome sequencing in patients with complex neurological phenotypes that would not normally fit a classical presentation of a defined genetic disease.

Enterovirus infections in hospitals of Ile de France region over 2013.

PubMed

Molet, Lucie; Saloum, Kenda; Marque-Juillet, Stéphanie; Garbarg-Chenon, Antoine; Henquell, Cécile; Schuffenecker, Isabelle; Peigue-Lafeuille, Hélène; Rozenberg, Flore; Mirand, Audrey

2016-01-01

The monitoring and genotyping of Enterovirus (EV) infections can help to associate particular or severe clinical manifestations with specific EV types and to identify the aetiology of infectious outbreaks. To describe the epidemiological features of EV infections diagnosed during the year 2013 in the Greater Paris area (Ile de France). During 2013, 2497 samples taken from 470 patients in 33 hospitals of Ile-de France were tested for EV genome by RT-PCR. EV genotyping was performed by the National Reference Centre (NRC) laboratories. EV infections were retrospectively reviewed by retrieving clinical and genotyping data from the NRC database. Of the 2497 samples, 490 (19.6%) was positive for EV genome detection. These EV infections represented 88.7% and 24.1%, respectively, of all reported regional and national infections. Twenty-seven different genotypes were identified. Echovirus 30 (E-30) accounted for 54.1% of all characterized strains and caused a large outbreak. Four severe neonatal infections were reported, of which two were caused by EV-A71. Respiratory infections involving EV-D68 were observed in two adults. One fatal case of Coxsackievirus A2-associated myocarditis was reported. Monitoring EV infections in combination with EV genotyping via the French EV network characterized the epidemiology of EV infections in the Ile de France region in 2013 and documented severe EV infections associated with EV-A71 or CV-A2. Copyright © 2015 Elsevier B.V. All rights reserved.

A survey of single nucleotide polymorphisms identified from whole-genome sequencing and their functional effect in the porcine genome.

PubMed

Keel, B N; Nonneman, D J; Rohrer, G A

2017-08-01

Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a more significant effect on phenotypic variation than do other types of genetic variants. Hence, a comprehensive list of these functional variants would be of considerable interest in swine genomic studies, particularly those targeting fertility and production traits. Whole-genome sequence was obtained from 72 of the founders of an intensely phenotyped experimental swine herd at the U.S. Meat Animal Research Center (USMARC). These animals included all 24 of the founding boars (12 Duroc and 12 Landrace) and 48 Yorkshire-Landrace composite sows. Sequence reads were mapped to the Sscrofa10.2 genome build, resulting in a mean of 6.1 fold (×) coverage per genome. A total of 22 342 915 high confidence SNPs were identified from the sequenced genomes. These included 21 million previously reported SNPs and 79% of the 62 163 SNPs on the PorcineSNP60 BeadChip assay. Variation was detected in the coding sequence or untranslated regions (UTRs) of 87.8% of the genes in the porcine genome: loss-of-function variants were predicted in 504 genes, 10 202 genes contained nonsynonymous variants, 10 773 had variation in UTRs and 13 010 genes contained synonymous variants. Approximately 139 000 SNPs were classified as loss-of-function, nonsynonymous or regulatory, which suggests that over 99% of the variation detected in our pigs could potentially be ignored, allowing us to focus on a much smaller number of functional SNPs during future analyses. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

Association of the S267F variant on NTCP gene and treatment response to pegylated interferon in patients with chronic hepatitis B: a multicentre study.

PubMed

Thanapirom, Kessarin; Suksawatamnuay, Sirinporn; Sukeepaisarnjaroen, Wattana; Treeprasertsuk, Sombat; Tanwandee, Tawesak; Charatcharoenwitthaya, Phunchai; Thongsawat, Satawat; Leerapun, Apinya; Piratvisuth, Teerha; Boonsirichan, Rattana; Bunchorntavakul, Chalermrat; Pattanasirigool, Chaowalit; Pornthisarn, Bubpha; Tuntipanichteerakul, Supoj; Sripariwuth, Ekawee; Jeamsripong, Woramon; Sanpajit, Theeranun; Poovorawan, Yong; Komolmit, Piyawat

2018-01-01

Sodium taurocholate co-transporting polypeptide (NTCP) is a cell receptor for HBV. The S267F variant on the NTCP gene is inversely associated with the chronicity of HBV infection, progression to cirrhosis and hepatocellular carcinoma in East Asian populations. The aim of this study was to determine whether the S267F variant was associated with response to pegylated interferon (PEG-IFN) in patients with chronic HBV infection. A total of 257 patients with chronic HBV, treated with PEG-IFN for 48 weeks, were identified from 13 tertiary hospitals included in the hepatitis B database of the Thai Association for the Study of the Liver (THASL). Of these, 202 patients were infected with HBV genotype C (84.9%); 146 patients were hepatitis B e antigen (HBeAg)-positive (56.8%). Genotypic frequencies of the S267F polymorphism were 85.2%, 14.8% and 0% for the GG, GA and AA genotypes, respectively. S267F GA was associated with sustained alanine aminotransferase (ALT) normalization (OR = 3.25, 95% CI 1.23, 8.61; P=0.02) in HBeAg-positive patients. Patients with S267F variant tended to have more virological response, sustained response with hepatitis B surface antigen (HBsAg) loss at 24 weeks following PEG-IFN treatment. There was no association between the S267F variant and improved patient outcomes in HBeAg-negative patients. The S267F variant on the NTCP gene is independently associated with sustained normalization of ALT following treatment with PEG-IFN in patients with HBV infection who are HBeAg-positive. The findings of this study provide additional support for the clinical significance of the S267F variant of NTCP beyond HBV entry.

Genetic Analyses in Small-for-Gestational-Age Newborns.

PubMed

Stalman, Susanne E; Solanky, Nita; Ishida, Miho; Alemán-Charlet, Cristina; Abu-Amero, Sayeda; Alders, Marielle; Alvizi, Lucas; Baird, William; Demetriou, Charalambos; Henneman, Peter; James, Chela; Knegt, Lia C; Leon, Lydia J; Mannens, Marcel M A M; Mul, Adi N; Nibbering, Nicole A; Peskett, Emma; Rezwan, Faisal I; Ris-Stalpers, Carrie; van der Post, Joris A M; Kamp, Gerdine A; Plötz, Frans B; Wit, Jan M; Stanier, Philip; Moore, Gudrun E; Hennekam, Raoul C

2018-03-01

Small for gestational age (SGA) can be the result of fetal growth restriction, which is associated with perinatal morbidity and mortality. Mechanisms that control prenatal growth are poorly understood. The aim of the current study was to gain more insight into prenatal growth failure and determine an effective diagnostic approach in SGA newborns. We hypothesized that one or more copy number variations (CNVs) and disturbed methylation and sequence variants may be present in genes associated with fetal growth. A prospective cohort study of subjects with a low birth weight for gestational age. The study was conducted at an academic pediatric research institute. A total of 21 SGA newborns with a mean birth weight below the first centile and a control cohort of 24 appropriate-for-gestational-age newborns were studied. Array comparative genomic hybridization, genome-wide methylation studies, and exome sequencing were performed. The numbers of CNVs, methylation disturbances, and sequence variants. The genetic analyses demonstrated three CNVs, one systematically disturbed methylation pattern, and one sequence variant explaining SGA. Additional methylation disturbances and sequence variants were present in 20 patients. In 19 patients, multiple abnormalities were found. Our results confirm the influence of a large number of mechanisms explaining dysregulation of fetal growth. We concluded that CNVs, methylation disturbances, and sequence variants all contribute to prenatal growth failure. These genetic workups can be an effective diagnostic approach in SGA newborns.

Estimating the basic reproduction rate of HFMD using the time series SIR model in Guangdong, China

PubMed Central

Du, Zhicheng; Zhang, Wangjian; Zhang, Dingmei; Yu, Shicheng

2017-01-01

Hand, foot, and mouth disease (HFMD) has caused a substantial burden of disease in China, especially in Guangdong Province. Based on notifiable cases, we use the time series Susceptible-Infected-Recovered model to estimate the basic reproduction rate (R0) and the herd immunity threshold, understanding the transmission and persistence of HFMD more completely for efficient intervention in this province. The standardized difference between the reported and fitted time series of HFMD was 0.009 (<0.2). The median basic reproduction rate of total, enterovirus 71, and coxsackievirus 16 cases in Guangdong were 4.621 (IQR: 3.907–5.823), 3.023 (IQR: 2.289–4.292) and 7.767 (IQR: 6.903–10.353), respectively. The heatmap of R0 showed semiannual peaks of activity, including a major peak in spring and early summer (about the 12th week) followed by a smaller peak in autumn (about the 36th week). The county-level model showed that Longchuan (R0 = 33), Gaozhou (R0 = 24), Huazhou (R0 = 23) and Qingxin (R0 = 19) counties have higher basic reproduction rate than other counties in the province. The epidemic of HFMD in Guangdong Province is still grim, and strategies like the World Health Organization’s expanded program on immunization need to be implemented. An elimination of HFMD in Guangdong might need a Herd Immunity Threshold of 78%. PMID:28692654

Neighborhood × Serotonin Transporter Linked Polymorphic Region (5-HTTLPR) interactions for substance use from ages 10 to 24 years using a harmonized data set of African American children.

PubMed

Windle, Michael; Kogan, Steven M; Lee, Sunbok; Chen, Yi-Fu; Lei, Karlo Mankit; Brody, Gene H; Beach, Steven R H; Yu, Tianyi

2016-05-01

This study investigated the influences of neighborhood factors (residential stability and neighborhood disadvantage) and variants of the serotonin transporter linked polymorphic region (5-HTTLPR) genotype on the development of substance use among African American children aged 10-24 years. To accomplish this, a harmonized data set of five longitudinal studies was created via pooling overlapping age cohorts to establish a database with 2,689 children and 12,474 data points to span ages 10-24 years. A description of steps used in the development of the harmonized data set is provided, including how issues such as the measurement equivalence of constructs were addressed. A sequence of multilevel models was specified to evaluate Gene × Environment effects on growth of substance use across time. Findings indicated that residential instability was associated with higher levels and a steeper gradient of growth in substance use across time. The inclusion of the 5-HTTLPR genotype provided greater precision to the relationships in that higher residential instability, in conjunction with the risk variant of 5-HTTLPR (i.e., the short allele), was associated with the highest level and steepest gradient of growth in substance use across ages 10-24 years. The findings demonstrated how the creation of a harmonized data set increased statistical power to test Gene × Environment interactions for an under studied sample.

X-Linked and Autosomal Recessive Alport Syndrome: Pathogenic Variant Features and Further Genotype-Phenotype Correlations

PubMed Central

Savige, Judith; Storey, Helen; Il Cheong, Hae; Gyung Kang, Hee; Park, Eujin; Hilbert, Pascale; Persikov, Anton; Torres-Fernandez, Carmen; Ars, Elisabet; Torra, Roser; Hertz, Jens Michael; Thomassen, Mads; Shagam, Lev; Wang, Dongmao; Wang, Yanyan; Flinter, Frances; Nagel, Mato

2016-01-01

Alport syndrome results from mutations in the COL4A5 (X-linked) or COL4A3/COL4A4 (recessive) genes. This study examined 754 previously- unpublished variants in these genes from individuals referred for genetic testing in 12 accredited diagnostic laboratories worldwide, in addition to all published COL4A5, COL4A3 and COL4A4 variants in the LOVD databases. It also determined genotype-phenotype correlations for variants where clinical data were available. Individuals were referred for genetic testing where Alport syndrome was suspected clinically or on biopsy (renal failure, hearing loss, retinopathy, lamellated glomerular basement membrane), variant pathogenicity was assessed using currently-accepted criteria, and variants were examined for gene location, and age at renal failure onset. Results were compared using Fisher’s exact test (DNA Stata). Altogether 754 new DNA variants were identified, an increase of 25%, predominantly in people of European background. Of the 1168 COL4A5 variants, 504 (43%) were missense mutations, 273 (23%) splicing variants, 73 (6%) nonsense mutations, 169 (14%) short deletions and 76 (7%) complex or large deletions. Only 135 of the 432 Gly residues in the collagenous sequence were substituted (31%), which means that fewer than 10% of all possible variants have been identified. Both missense and nonsense mutations in COL4A5 were not randomly distributed but more common at the 70 CpG sequences (p<10−41 and p<0.001 respectively). Gly>Ala substitutions were underrepresented in all three genes (p< 0.0001) probably because of an association with a milder phenotype. The average age at end-stage renal failure was the same for all mutations in COL4A5 (24.4 ±7.8 years), COL4A3 (23.3 ± 9.3) and COL4A4 (25.4 ± 10.3) (COL4A5 and COL4A3, p = 0.45; COL4A5 and COL4A4, p = 0.55; COL4A3 and COL4A4, p = 0.41). For COL4A5, renal failure occurred sooner with non-missense than missense variants (p<0.01). For the COL4A3 and COL4A4 genes, age at renal failure occurred sooner with two non-missense variants (p = 0.08, and p = 0.01 respectively). Thus DNA variant characteristics that predict age at renal failure appeared to be the same for all three Alport genes. Founder mutations (with the pathogenic variant in at least 5 apparently- unrelated individuals) were not necessarily associated with a milder phenotype. This study illustrates the benefits when routine diagnostic laboratories share and analyse their data. PMID:27627812

X-Linked and Autosomal Recessive Alport Syndrome: Pathogenic Variant Features and Further Genotype-Phenotype Correlations.

PubMed

Savige, Judith; Storey, Helen; Il Cheong, Hae; Gyung Kang, Hee; Park, Eujin; Hilbert, Pascale; Persikov, Anton; Torres-Fernandez, Carmen; Ars, Elisabet; Torra, Roser; Hertz, Jens Michael; Thomassen, Mads; Shagam, Lev; Wang, Dongmao; Wang, Yanyan; Flinter, Frances; Nagel, Mato

2016-01-01

Alport syndrome results from mutations in the COL4A5 (X-linked) or COL4A3/COL4A4 (recessive) genes. This study examined 754 previously- unpublished variants in these genes from individuals referred for genetic testing in 12 accredited diagnostic laboratories worldwide, in addition to all published COL4A5, COL4A3 and COL4A4 variants in the LOVD databases. It also determined genotype-phenotype correlations for variants where clinical data were available. Individuals were referred for genetic testing where Alport syndrome was suspected clinically or on biopsy (renal failure, hearing loss, retinopathy, lamellated glomerular basement membrane), variant pathogenicity was assessed using currently-accepted criteria, and variants were examined for gene location, and age at renal failure onset. Results were compared using Fisher's exact test (DNA Stata). Altogether 754 new DNA variants were identified, an increase of 25%, predominantly in people of European background. Of the 1168 COL4A5 variants, 504 (43%) were missense mutations, 273 (23%) splicing variants, 73 (6%) nonsense mutations, 169 (14%) short deletions and 76 (7%) complex or large deletions. Only 135 of the 432 Gly residues in the collagenous sequence were substituted (31%), which means that fewer than 10% of all possible variants have been identified. Both missense and nonsense mutations in COL4A5 were not randomly distributed but more common at the 70 CpG sequences (p<10-41 and p<0.001 respectively). Gly>Ala substitutions were underrepresented in all three genes (p< 0.0001) probably because of an association with a milder phenotype. The average age at end-stage renal failure was the same for all mutations in COL4A5 (24.4 ±7.8 years), COL4A3 (23.3 ± 9.3) and COL4A4 (25.4 ± 10.3) (COL4A5 and COL4A3, p = 0.45; COL4A5 and COL4A4, p = 0.55; COL4A3 and COL4A4, p = 0.41). For COL4A5, renal failure occurred sooner with non-missense than missense variants (p<0.01). For the COL4A3 and COL4A4 genes, age at renal failure occurred sooner with two non-missense variants (p = 0.08, and p = 0.01 respectively). Thus DNA variant characteristics that predict age at renal failure appeared to be the same for all three Alport genes. Founder mutations (with the pathogenic variant in at least 5 apparently- unrelated individuals) were not necessarily associated with a milder phenotype. This study illustrates the benefits when routine diagnostic laboratories share and analyse their data.

Progesterone potentiates the growth inhibitory effects of calcitriol in endometrial cancer via suppression of CYP24A1.

PubMed

Bokhari, Amber A; Lee, Laura R; Raboteau, Dewayne; Turbov, Jane; Rodriguez, Isabel V; Pike, John Wesley; Hamilton, Chad A; Maxwell, George Larry; Rodriguez, Gustavo C; Syed, Viqar

2016-11-22

Here, we evaluated the expression of CYP24A1, a protein that inactivates vitamin D in tissues. CYP24A1 expression was increased in advanced-stage endometrial tumors compared to normal tissues. Similarly, endometrial cancer cells expressed higher levels of CYP24A1 than immortalized endometrial epithelial cells. RT-PCR and Western blotting were used to examine CYP24A1 mRNA and protein levels in endometrial cancer cells after 8, 24, 72, and 120 h of exposure to progesterone, progestin derivatives and calcitriol, either alone or in combination. Progestins inhibited calcitriol-induced expression of CYP24A1 and splice variant CYP24SV mRNA and protein in cancer cells. Furthermore, actinomycin D, but not cycloheximide, blocked calcitriol-induced CYP24A1 splicing. siRNA-induced knockdown of CYP24A1 expression sensitized endometrial cancer cells to calcitriol-induced growth inhibition. These data suggest that CYP24A1 overexpression reduces the antitumor effects of calcitriol in cancer cells and that progestins may be beneficial for maintaining calcitriol's anti-endometrial cancer activity.

PNPLA3 I148M (rs738409) genetic variant and age at onset of at-risk alcohol consumption are independent risk factors for alcoholic cirrhosis.

PubMed

Burza, Maria Antonella; Molinaro, Antonio; Attilia, Maria Luisa; Rotondo, Claudia; Attilia, Fabio; Ceccanti, Mauro; Ferri, Flaminia; Maldarelli, Federica; Maffongelli, Angela; De Santis, Adriano; Attili, Adolfo Francesco; Romeo, Stefano; Ginanni Corradini, Stefano

2014-04-01

Environmental and genetic factors contribute to alcoholic cirrhosis onset. In particular, age at exposure to liver stressors has been shown to be important in progression to fibrosis in hepatitis C individuals. However, no definite data on the role of age at onset of at-risk alcohol consumption are available. Moreover, patatin-like phospholipase domain-containing protein 3 (PNPLA3) I148M (rs738409) variant has been associated with alcoholic cirrhosis, but only in cross-sectional studies. The aim of this study was to investigate the role of age at onset of at-risk alcohol consumption and PNPLA3 I148M variant on alcoholic cirrhosis incidence. A total of 384 at-risk alcohol drinkers were retrospectively examined. The association among age at onset of at-risk alcohol consumption, PNPLA3 I148M variant and cirrhosis incidence was tested. A higher incidence of alcoholic cirrhosis was observed in individuals with an older (≥24 years) compared with a younger (<24) age at onset of at-risk alcohol consumption (P-value < 0.001). Moreover, PNPLA3 148M allele carriers showed an increased incidence of cirrhosis (P-value < 0.001). Both age at onset of at-risk alcohol consumption and PNPLA3 148M allele were independent risk factors for developing cirrhosis (H.R. (95% C.I.): 2.76 (2.18-3.50), P-value < 0.001; 1.53(1.07-2.19), P-value = 0.021 respectively). The 148M allele was associated with a two-fold increased risk of cirrhosis in individuals with a younger compared with an older age at onset of at-risk alcohol consumption (H.R. (95% C.I.): 3.03(1.53-6.00) vs. 1.61(1.09-2.38). Age at onset of at-risk alcohol consumption and PNPLA3 I148M genetic variant are independently associated with alcoholic cirrhosis incidence. © 2013 The Authors. Liver International published by John Wiley & Sons Ltd.

Do Genetic Susceptibility Variants Associate with Disease Severity in Early Active Rheumatoid Arthritis?

PubMed

Scott, Ian C; Rijsdijk, Frühling; Walker, Jemma; Quist, Jelmar; Spain, Sarah L; Tan, Rachael; Steer, Sophia; Okada, Yukinori; Raychaudhuri, Soumya; Cope, Andrew P; Lewis, Cathryn M

2015-07-01

Genetic variants affect both the development and severity of rheumatoid arthritis (RA). Recent studies have expanded the number of RA susceptibility variants. We tested the hypothesis that these associated with disease severity in a clinical trial cohort of patients with early, active RA. We evaluated 524 patients with RA enrolled in the Combination Anti-Rheumatic Drugs in Early RA (CARDERA) trials. We tested validated susceptibility variants - 69 single-nucleotide polymorphisms (SNP), 15 HLA-DRB1 alleles, and amino acid polymorphisms in 6 HLA molecule positions - for their associations with progression in Larsen scoring, 28-joint Disease Activity Scores, and Health Assessment Questionnaire (HAQ) scores over 2 years using linear mixed-effects and latent growth curve models. HLA variants were associated with joint destruction. The *04:01 SNP (rs660895, p = 0.0003), *04:01 allele (p = 0.0002), and HLA-DRβ1 amino acids histidine at position 13 (p = 0.0005) and valine at position 11 (p = 0.0012) significantly associated with radiological progression. This association was only significant in anticitrullinated protein antibody (ACPA)-positive patients, suggesting that while their effects were not mediated by ACPA, they only predicted joint damage in ACPA-positive RA. Non-HLA variants did not associate with radiograph damage (assessed individually and cumulatively as a weighted genetic risk score). Two SNP - rs11889341 (STAT4, p = 0.0001) and rs653178 (SH2B3-PTPN11, p = 0.0004) - associated with HAQ scores over 6-24 months. HLA susceptibility variants play an important role in determining radiological progression in early, active ACPA-positive RA. Genome-wide and HLA-wide analyses across large populations are required to better characterize the genetic architecture of radiological progression in RA.

Genetic variants associated with the white blood cell count in 13,923 subjects in the eMERGE Network

PubMed Central

McDavid, Andrew; Weston, Noah; Nelson, Sarah C.; Zheng, Xiuwen; Hart, Eugene; de Andrade, Mariza; Kullo, Iftikhar J.; McCarty, Catherine A.; Doheny, Kimberly F.; Pugh, Elizabeth; Kho, Abel; Hayes, M. Geoffrey; Pretel, Stephanie; Saip, Alexander; Ritchie, Marylyn D.; Crawford, Dana C.; Crane, Paul K.; Newton, Katherine; Li, Rongling; Mirel, Daniel B.; Crenshaw, Andrew; Larson, Eric B.; Carlson, Chris S.; Jarvik, Gail P.

2013-01-01

White blood cell count (WBC) is unique among identified inflammatory predictors of chronic disease in that it is routinely measured in asymptomatic patients in the course of routine patient care. We led a genome-wide association analysis to identify variants associated with WBC levels in 13,923 subjects in the electronic Medical Records and Genomics (eMERGE) Network. We identified two regions of interest that were each unique to subjects of genetically determined ancestry to the African continent (AA) or to the European continent (EA). WBC varies among different ancestry groups. Despite being ancestry specific, these regions were identifiable in the combined analysis. In AA subjects, the region surrounding the Duffy antigen/chemokine receptor gene (DARC) on 1q21 exhibited significant association (p value = 6.71e–55). These results validate the previously reported association between WBC and of the regulatory variant rs2814778 in the promoter region, which causes the Duffy negative phenotype (Fy−/−). A second missense variant (rs12075) is responsible for the two principal antigens, Fya and Fyb of the Duffy blood group system. The two variants, consisting of four alleles, act in concert to produce five antigens and subsequent phenotypes. We were able to identify the marginal and novel interaction effects of these two variants on WBC. In the EA subjects, we identified significantly associated SNPs tagging three separate genes in the 17q21 region: (1) GSDMA, (2) MED24, and (3) PSMD3. Variants in this region have been reported to be associated with WBC, neutrophil count, and inflammatory diseases including asthma and Crohn’s disease. PMID:22037903

Genetic variants in GCKR and PNPLA3 confer susceptibility to nonalcoholic fatty liver disease in obese individuals.

PubMed

Lin, Yu-Cheng; Chang, Pi-Feng; Chang, Mei-Hwei; Ni, Yen-Hsuan

2014-04-01

A genome-wide association study identified variants in or near patatin-like phospholipase domain-containing-3 (PNPLA3), neurocan (NCAN), lysophospholipase-like 1 (LYPLAL1), glucokinase regulatory protein (GCKR), and protein phosphatase 1 regulatory subunit 3b (PPP1R3B) that were strongly associated with nonalcoholic fatty liver disease (NAFLD) in adults of European ancestry. We examined these genetic variants in obese children and tested whether their effects on NAFLD are significant in the Taiwanese Han Chinese population. We genotyped PNPLA3 rs738409, NCAN rs2228603, LYPLAL1 rs12137855, GCKR rs780094, and PPP1R3B rs4240624 in 797 obese children aged 7-18 y. NAFLD was identified by liver ultrasonography. We analyzed the effect of these genetic variants on NAFLD. NAFLD was identified in 24% of the recruited obese children. We found significant associations with NAFLD at variants in PNPLA3 and GCKR but not in NCAN, LYPLAL1, and PPP1R3B. Multiple logistic regression analysis showed that, after control for the effects of age- and sex-adjusted body mass index, waist-to-hip ratio, sex, and PNPLA3 rs738409 polymorphism, the variant GCKR rs780094 TT genotype independently increased the OR of NAFLD by 1.997 (95% CI: 1.196, 3.335; P = 0.008) compared with the CC genotype. Subjects with the variant GCKR rs780094 TT genotype had a higher mean serum alanine aminotransferase concentration than did those with the CC genotype (30.8 ± 34.7 compared with 22.2 ± 18.6 IU/L; P = 0.01). By studying the genetic variants of obese Taiwanese children, we confirmed that the genetic variants in GCKR rs780094 and PNPLA3 rs738409, but not in NCAN rs2228603, LYPLAL1 rs12137855, and PPP1R3B rs4240624, are associated with an increased risk of NAFLD. GCKR and PNPLA3 variants are the common genetic factors that may confer susceptibility to NAFLD in obese individuals across multiple ethnic groups.

ADRA2B Deletion Variant Influences Time-Dependent Effects of Pre-Learning Stress on Long-Term Memory

PubMed Central

Zoladz, Phillip R.; Dailey, Alison M.; Nagle, Hannah E.; Fiely, Miranda K.; Mosley, Brianne E.; Brown, Callie M.; Duffy, Tessa J.; Scharf, Amanda R.; Earley, McKenna B.; Rorabaugh, Boyd R.

2017-01-01

Extensive work over the past few decades has shown that certain genetic variations interact with life events to confer increased susceptibility for the development of psychological disorders. The deletion variant of the ADRA2B gene, which has been associated with enhanced emotional memory and heightened amygdala responses to emotional stimuli, might confer increased susceptibility for the development of post-traumatic stress disorder (PTSD) or related phenotypes by increasing the likelihood of traumatic memory formation. Thus, we examined whether this genetic variant would predict stress effects on learning and memory in a non-clinical sample. Two hundred and thirty-five individuals were exposed to the socially evaluated cold pressor test or a control condition immediately or 30 min prior to learning a list of words that varied in emotional valence and arousal level. Participants’ memory for the words was tested immediately (recall) and 24 h after learning (recall and recognition), and saliva samples were collected to genotype participants for the ADRA2B deletion variant. Results showed that stress administered immediately before learning selectively enhanced long-term recall in deletion carriers. Stress administered 30 min before learning impaired recognition memory in male deletion carriers, while enhancing recognition memory in female deletion carriers. These findings provide additional evidence to support the idea that ADRA2B deletion variant carriers retain a sensitized stress response system, which results in amplified effects of stress on learning and memory. The accumulating evidence regarding this genetic variant implicates it as a susceptibility factor for traumatic memory formation and PTSD-related phenotypes. PMID:28254464

Genotyping of Canine parvovirus in western Mexico.

PubMed

Pedroza-Roldán, César; Páez-Magallan, Varinia; Charles-Niño, Claudia; Elizondo-Quiroga, Darwin; De Cervantes-Mireles, Raúl Leonel; López-Amezcua, Mario Alberto

2015-01-01

Canine parvovirus (CPV) is one of the most common infectious agents related to high morbidity rates in dogs. In addition, the virus is associated with severe gastroenteritis, diarrhea, and vomiting, resulting in high death rates, especially in puppies and nonvaccinated dogs. To date, there are 3 variants of the virus (CPV-2a, CPV-2b, and CPV-2c) circulating worldwide. In Mexico, reports describing the viral variants circulating in dog populations are lacking. In response to this deficiency, a total of 41 fecal samples of suspected dogs were collected from October 2013 through April 2014 in the Veterinary Hospital of the University of Guadalajara in western Mexico. From these, 24 samples resulted positive by polymerase chain reaction, and the viral variant was determined by restriction fragment length polymorphism. Five positive diagnosed samples were selected for partial sequencing of the vp2 gene and codon analysis. The results demonstrated that the current dominant viral variant in Mexico is CPV-2c. The current study describes the genotyping of CPV strains, providing valuable evidence of the dominant frequency of this virus in a dog population from western Mexico. © 2014 The Author(s).

European external quality control study on the competence of laboratories to recognize rare sequence variants resulting in unusual genotyping results.

PubMed

Márki-Zay, János; Klein, Christoph L; Gancberg, David; Schimmel, Heinz G; Dux, László

2009-04-01

Depending on the method used, rare sequence variants adjacent to the single nucleotide polymorphism (SNP) of interest may cause unusual or erroneous genotyping results. Because such rare variants are known for many genes commonly tested in diagnostic laboratories, we organized a proficiency study to assess their influence on the accuracy of reported laboratory results. Four external quality control materials were processed and sent to 283 laboratories through 3 EQA organizers for analysis of the prothrombin 20210G>A mutation. Two of these quality control materials contained sequence variants introduced by site-directed mutagenesis. One hundred eighty-nine laboratories participated in the study. When samples gave a usual result with the method applied, the error rate was 5.1%. Detailed analysis showed that more than 70% of the failures were reported from only 9 laboratories. Allele-specific amplification-based PCR had a much higher error rate than other methods (18.3% vs 2.9%). The variants 20209C>T and [20175T>G; 20179_20180delAC] resulted in unusual genotyping results in 67 and 85 laboratories, respectively. Eighty-three (54.6%) of these unusual results were not recognized, 32 (21.1%) were attributed to technical issues, and only 37 (24.3%) were recognized as another sequence variant. Our findings revealed that some of the participating laboratories were not able to recognize and correctly interpret unusual genotyping results caused by rare SNPs. Our study indicates that the majority of the failures could be avoided by improved training and careful selection and validation of the methods applied.

Role of Multiple Hosts in the Cross-Species Transmission and Emergence of a Pandemic Parvovirus

PubMed Central

Allison, Andrew B.; Harbison, Carole E.; Pagan, Israel; Stucker, Karla M.; Kaelber, Jason T.; Brown, Justin D.; Ruder, Mark G.; Keel, M. Kevin; Dubovi, Edward J.; Holmes, Edward C.

2012-01-01

Understanding the mechanisms of cross-species virus transmission is critical to anticipating emerging infectious diseases. Canine parvovirus type 2 (CPV-2) emerged as a variant of a feline parvovirus when it acquired mutations that allowed binding to the canine transferrin receptor type 1 (TfR). However, CPV-2 was soon replaced by a variant virus (CPV-2a) that differed in antigenicity and receptor binding. Here we show that the emergence of CPV involved an additional host range variant virus that has circulated undetected in raccoons for at least 24 years, with transfers to and from dogs. Raccoon virus capsids showed little binding to the canine TfR, showed little infection of canine cells, and had altered antigenic structures. Remarkably, in capsid protein (VP2) phylogenies, most raccoon viruses fell as evolutionary intermediates between the CPV-2 and CPV-2a strains, suggesting that passage through raccoons assisted in the evolution of CPV-2a. This highlights the potential role of alternative hosts in viral emergence. PMID:22072763

Role of multiple hosts in the cross-species transmission and emergence of a pandemic parvovirus.

PubMed

Allison, Andrew B; Harbison, Carole E; Pagan, Israel; Stucker, Karla M; Kaelber, Jason T; Brown, Justin D; Ruder, Mark G; Keel, M Kevin; Dubovi, Edward J; Holmes, Edward C; Parrish, Colin R

2012-01-01

Understanding the mechanisms of cross-species virus transmission is critical to anticipating emerging infectious diseases. Canine parvovirus type 2 (CPV-2) emerged as a variant of a feline parvovirus when it acquired mutations that allowed binding to the canine transferrin receptor type 1 (TfR). However, CPV-2 was soon replaced by a variant virus (CPV-2a) that differed in antigenicity and receptor binding. Here we show that the emergence of CPV involved an additional host range variant virus that has circulated undetected in raccoons for at least 24 years, with transfers to and from dogs. Raccoon virus capsids showed little binding to the canine TfR, showed little infection of canine cells, and had altered antigenic structures. Remarkably, in capsid protein (VP2) phylogenies, most raccoon viruses fell as evolutionary intermediates between the CPV-2 and CPV-2a strains, suggesting that passage through raccoons assisted in the evolution of CPV-2a. This highlights the potential role of alternative hosts in viral emergence.

Genetic variants in pigmentation genes, pigmentary phenotypes, and risk of skin cancer in Caucasians

PubMed Central

Nan, Hongmei; Kraft, Peter; Hunter, David J.; Han, Jiali

2009-01-01

Human pigmentation is a polygenic quantitative trait with high heritability. Although a large number of single nucleotide polymorphisms (SNPs) have been identified in pigmentation genes, very few SNPs have been examined in relation to human pigmentary phenotypes and skin cancer risk. We evaluated the associations between fifteen SNPs in eight candidate pigmentation genes (TYR, TYRP1, OCA2, SLC24A5, SLC45A2, POMC, ASIP, and ATRN) and both pigmentary phenotypes (hair color, skin color, and tanning ability) and skin cancer risk in a nested case-control study of Caucasians within the Nurses’ Health Study (NHS) among 218 melanoma cases, 285 squamous cell carcinoma (SCC) cases, 300 basal cell carcinoma (BCC) cases, and 870 common controls. We found that the TYR Arg402Gln variant was significantly associated with skin color (p-value =7.7×10−4) and tanning ability (p-value =7.3×10−4); the SLC45A2 Phe374Leu variant was significantly associated with hair color (black to blonde) (p-value =2.4×10−7), skin color (p-value =1.1×10−7), and tanning ability (p-value =2.5×10−4). These associations remained significant after controlling for MC1R variants. No significant associations were found between these polymorphisms and the risk of skin cancer. We observed that the TYRP1 rs1408799 and SLC45A2 -1721 C>G were associated with melanoma risk (OR, 0.77; 95% CI, 0.60–0.98 and OR, 0.75; 95% CI, 0.60–0.95, respectively). The TYR Ser192Tyr was associated with SCC risk (OR, 1.23; 95% CI, 1.00–1.50). The TYR haplotype carrying only the Arg402Gln variant allele was significantly associated with SCC risk (OR, 1.35; 95% CI, 1.04–1.74). The OCA2 Arg419Gln and ASIP g.8818 A>G were associated with BCC risk (OR, 1.50; 95% CI, 1.06–2.13 and OR, 0.73; 95% CI, 0.53–1.00, respectively). The haplotype near ASIP (rs4911414[T] and rs1015362[G]) was significantly associated with fair skin color (OR, 2.28; 95% CI, 1.46–3.57) as well as the risks of melanoma (OR, 1.68; 95% CI, 1.18–2.39) and SCC (OR, 1.54; 95% CI, 1.08–2.19). These associations remained similar after adjusting for pigmentary phenotypes and MC1R variants. The statistical power of this study was modest and additional studies are warranted to confirm the associations observed in the present study. This study provides evidence for the contribution of pigmentation genetic variants, in addition to the MC1R variants, to variation in human pigmentary phenotypes and possibly the development of skin cancer. PMID:19384953

Multiple Loci With Different Cancer Specificities Within the 8q24 Gene Desert

PubMed Central

Song, Honglin; Koessler, Thibaud; Al Olama, Ali Amin; Kote-Jarai, Zsofia; Driver, Kristy E.; Pooley, Karen A.; Ramus, Susan J.; Kjaer, Susanne Krüger; Hogdall, Estrid; DiCioccio, Richard A.; Whittemore, Alice S.; Gayther, Simon A.; Giles, Graham G.; Guy, Michelle; Edwards, Stephen M.; Morrison, Jonathan; Donovan, Jenny L.; Hamdy, Freddie C.; Dearnaley, David P.; Ardern-Jones, Audrey T.; Hall, Amanda L.; O'Brien, Lynne T.; Gehr-Swain, Beatrice N.; Wilkinson, Rosemary A.; Brown, Paul M.; Hopper, John L.; Neal, David E.; Pharoah, Paul D. P.; Ponder, Bruce A. J.; Eeles, Rosalind A.; Easton, Douglas F.; Dunning, Alison M.

2008-01-01

Recent studies based on genome-wide association, linkage, and admixture scan analysis have reported associations of various genetic variants in 8q24 with susceptibility to breast, prostate, and colorectal cancer. This locus lies within a 1.18-Mb region that contains no known genes but is bounded at its centromeric end by FAM84B and at its telomeric end by c-MYC, two candidate cancer susceptibility genes. To investigate the associations of specific loci within 8q24 with specific cancers, we genotyped the nine previously reported cancer-associated single-nucleotide polymorphisms across the region in four case–control sets of prostate (1854 case subjects and 1894 control subjects), breast (2270 case subjects and 2280 control subjects), colorectal (2299 case subjects and 2284 control subjects), and ovarian (1975 case subjects and 3411 control subjects) cancer. Five different haplotype blocks within this gene desert were specifically associated with risks of different cancers. One block was solely associated with risk of breast cancer, three others were associated solely with the risk of prostate cancer, and a fifth was associated with the risk of prostate, colorectal, and ovarian cancer, but not breast cancer. We conclude that there are at least five separate functional variants in this region. PMID:18577746

Analysis of protein-altering variants in telomerase genes and their association with MUC5B common variant status in patients with idiopathic pulmonary fibrosis: a candidate gene sequencing study.

PubMed

Dressen, Amy; Abbas, Alexander R; Cabanski, Christopher; Reeder, Janina; Ramalingam, Thirumalai R; Neighbors, Margaret; Bhangale, Tushar R; Brauer, Matthew J; Hunkapiller, Julie; Reeder, Jens; Mukhyala, Kiran; Cuenco, Karen; Tom, Jennifer; Cowgill, Amy; Vogel, Jan; Forrest, William F; Collard, Harold R; Wolters, Paul J; Kropski, Jonathan A; Lancaster, Lisa H; Blackwell, Timothy S; Arron, Joseph R; Yaspan, Brian L

2018-06-08

Idiopathic pulmonary fibrosis (IPF) risk has a strong genetic component. Studies have implicated variations at several loci, including TERT, surfactant genes, and a single nucleotide polymorphism at chr11p15 (rs35705950) in the intergenic region between TOLLIP and MUC5B. Patients with IPF who have risk alleles at rs35705950 have longer survival from the time of IPF diagnosis than do patients homozygous for the non-risk allele, whereas patients with shorter telomeres have shorter survival times. We aimed to assess whether rare protein-altering variants in genes regulating telomere length are enriched in patients with IPF homozygous for the non-risk alleles at rs35705950. Between Nov 1, 2014, and Nov 1, 2016, we assessed blood samples from patients aged 40 years or older and of European ancestry with sporadic IPF from three international phase 3 clinical trials (INSPIRE, CAPACITY, ASCEND), one phase 2 study (RIFF), and US-based observational studies (Vanderbilt Clinical Interstitial Lung Disease Registry and the UCSF Interstitial Lung Disease Clinic registry cohorts) at the Broad Institute (Cambridge, MA, USA) and Human Longevity (San Diego, CA, USA). We also assessed blood samples from non-IPF controls in several clinical trials. We did whole-genome sequencing to assess telomere length and identify rare protein-altering variants, stratified by rs35705950 genotype. We also assessed rare functional variation in TERT exons and compared telomere length and disease progression across genotypes. We assessed samples from 1510 patients with IPF and 1874 non-IPF controls. 30 (3%) of 1046 patients with an rs35705950 risk allele had a rare protein-altering variant in TERT compared with 34 (7%) of 464 non-risk allele carriers (odds ratio 0·40 [95% CI 0·24-0·66], p=0·00039). Subsequent analyses identified enrichment of rare protein-altering variants in PARN and RTEL1, and rare variation in TERC in patients with IPF compared with controls. We expanded our study population to provide a more accurate estimation of rare variant frequency in these four loci, and to calculate telomere length. The proportion of patients with at least one rare variant in TERT, PARN, TERC, or RTEL1 was higher in patients with IPF than in controls (149 [9%] of 1739 patients vs 205 [2%] of 8645 controls, p=2·44 × 10 -8 ). Patients with IPF who had a variant in any of the four identified telomerase component genes had telomeres that were 3·69-16·10% shorter than patients without a variant in any of the four genes and had an earlier mean age of disease onset than patients without one or more variants (65·1 years [SD 7·8] vs 67·1 years [7·9], p=0·004). In the placebo arms of clinical trials, shorter telomeres were significantly associated with faster disease progression (1·7% predicted forced vital capacity per kb per year, p=0·002). Pirfenidone had treatment benefit regardless of telomere length (p=4·24 × 10 -8 for telomere length lower than the median, p=0·0044 for telomere length greater than the median). Rare protein-altering variants in TERT, PARN, TERC, and RTEL1 are enriched in patients with IPF compared with controls, and, in the case of TERT, particularly in individuals without a risk allele at the rs35705950 locus. This suggests that multiple genetic factors contribute to sporadic IPF, which might implicate distinct mechanisms of pathogenesis and disease progression. Genentech, National Institutes of Health, Francis Family Foundation, Pulmonary Fibrosis Foundation, Nina Ireland Program for Lung Health, US Department of Veterans Affairs. Copyright © 2018 Elsevier Ltd. All rights reserved.

Pathogenic Role of the Damage-Associated Molecular Patterns S100A8 and S100A9 in Coxsackievirus B3-Induced Myocarditis.

PubMed

Müller, Irene; Vogl, Thomas; Pappritz, Kathleen; Miteva, Kapka; Savvatis, Konstantinos; Rohde, David; Most, Patrick; Lassner, Dirk; Pieske, Burkert; Kühl, Uwe; Van Linthout, Sophie; Tschöpe, Carsten

2017-11-01

The alarmins S100A8 and S100A9 are damage-associated molecular patterns, which play a pivotal role in cardiovascular diseases, inflammation, and viral infections. We aimed to investigate their role in Coxsackievirus B3 (CVB3)-induced myocarditis. S100A8 and S100A9 mRNA expression was 13.0-fold ( P =0.012) and 5.1-fold ( P =0.038) higher in endomyocardial biopsies from patients with CVB3-positive myocarditis compared with controls, respectively. Elimination of CVB3 led to a downregulation of these alarmins. CVB3-infected mice developed an impaired left ventricular function and displayed an increased left ventricular S100A8 and S100A9 protein expression versus controls. In contrast, CVB3-infected S100A9 knockout mice, which are also a complete knockout for S100A8 on protein level, showed an improved left ventricular function, which was associated with a reduced cardiac inflammatory and oxidative response, and lower CVB3 copy number compared with wild-type CVB3 mice. Exogenous application of S100A8 to S100A9 knockout CVB3 mice induced a severe myocarditis similar to wild-type CVB3 mice. In CVB3-infected HL-1 cells, S100A8 and S100A9 enhanced oxidative stress and CVB3 copy number compared with unstimulated infected cells. In CVB3-infected RAW macrophages, both alarmins increased MIP-2 (macrophage inflammatory protein-2) chemokine expression, which was reduced in CVB3 S100A8 knockdown versus scrambled siRNA CVB3 cells. S100A8 and S100A9 aggravate CVB3-induced myocarditis and might serve as therapeutic targets in inflammatory cardiomyopathies. © 2017 American Heart Association, Inc.

NKX2-3 and IRGM variants are associated with disease susceptibility to IBD in Eastern European patients

PubMed Central

Meggyesi, Nora; Kiss, Lajos S; Koszarska, Magdalena; Bortlik, Martin; Duricova, Dana; Lakatos, Laszlo; Molnar, Tamas; Leniček, Martin; Vítek, Libor; Altorjay, Istvan; Papp, Maria; Tulassay, Zsolt; Miheller, Pal; Papp, Janos; Tordai, Attila; Andrikovics, Hajnalka; Lukas, Milan; Lakatos, Peter Laszlo

2010-01-01

AIM: To investigate variants of immunity-related GTPase family M (IRGM) and NKX2-3 genes and genotype-phenotype in Eastern European patients with inflammatory bowel disease (IBD). METHODS: We analyzed 1707 Hungarian and Czech subjects with Crohn’s disease (CD) (n = 810, age: 37.1 ± 12.6 years, duration: 10.7 ± 8.4 years) and ulcerative colitis (UC) (n = 428, age: 43.7 ± 15.0 years, duration: 12.6 ± 9.9 years), as well as 469 healthy controls. IRGM rs13361189, NKX2-3 rs10883365 and ECM1 rs13294 polymorphisms were tested by LightCycler allele discrimination. Detailed clinical phenotypes were determined by reviewing the medical charts. RESULTS: NKX2-3 rs10883365 variant allele was associated with increased risk for CD (P = 0.009, OR = 1.24, 95% CI = 1.06-1.48) and UC (P = 0.001, OR = 1.36, 95% CI = 1.13-1.63), whereas variant IRGM allele increased risk for CD (P = 0.029, OR = 1.36, 95% CI = 1.03-1.79). In contrast, ECM1 rs13294 was not associated with either CD or UC. In CD, the variant IRGM allele was associated with a colon-only location (P = 0.02, OR = 1.62, 95% CI = 1.07-2.44), whereas in UC, the ECM1 variant was associated with cutaneous manifestations (P = 0.002, OR = 3.36, 95% CI = 1.48-7.63). Variant alleles did not predict resistance to steroids or azathioprine, efficacy of infliximab, or need for surgery. CONCLUSION: NKX2-3 and IRGM are susceptibility loci for IBD in Eastern European patients. Further studies are needed to confirm the reported phenotype-genotype associations. PMID:21049557

Identification of new susceptibility loci for type 2 diabetes and shared etiological pathways with coronary heart disease

PubMed Central

Zhao, Wei; Rasheed, Asif; Tikkanen, Emmi; Lee, Jung-Jin; Butterworth, Adam S; Howson, Joanna MM; Assimes, Themistocles L; Chowdhury, Rajiv; Orho-Melander, Marju; Damrauer, Scott; Small, Aeron; Asma, Senay; Imamura, Minako; Yamauch, Toshimasa; Chambers, John C; Chen, Peng; Sapkota, Bishwa R; Shah, Nabi; Jabeen, Sehrish; Surendran, Praveen; Lu, Yingchang; Zhang, Weihua; Imran, Atif; Abbas, Shahid; Majeed, Faisal; Trindade, Kevin; Qamar, Nadeem; Mallick, Nadeem Hayyat; Yaqoob, Zia; Saghir, Tahir; Rizvi, Syed Nadeem Hasan; Memon, Anis; Rasheed, Syed Zahed; Memon, Fazal-ur-Rehman; Mehmood, Khalid; Ahmed, Naveeduddin; Qureshi, Irshad Hussain; Tanveer-us-Salam; Iqbal, Wasim; Malik, Uzma; Mehra, Narinder; Kuo, Jane Z; Sheu, Wayne H-H; Guo, Xiuqing; Hsiung, Chao A; Juang, Jyh-Ming J; Taylor, Kent D; Hung, Yi-Jen; Lee, Wen-Jane; Quertermous, Thomas; Lee, I-Te; Hsu, Chih-Cheng; Bottinger, Erwin P.; Ralhan, Sarju; Teo, Yik Ying; Wang, Tzung-Dau; Alam, Dewan S; Di Angelantonio, Emanuele; Epstein, Steve; Nielsen, Sune F; Nordestgaard, Børge G; Tybjaerg-Hansen, Anne; Young, Robin; Benn, Marianne; Frikke-Schmidt, Ruth; Kamstrup, Pia R; Biobank, Michigan; Jukema, J Wouter; Sattar, Naveed; Smit, Roelof; Chung, Ren-Hua; Liang, Kae-Woei; Anand, Sonia; Sanghera, Dharambir K; Ripatti, Samuli; Loos, Ruth J.F.; Kooner, Jaspal S; Tai, E Shyong; Rotter, Jerome I; Chen, Yii-Der Ida; Frossard, Philippe; Maeda, Shiro; Kadowaki, Takashi; Reilly, Muredach; Pare, Guillaume; Melander, Olle; Salomaa, Veikko; Rader, Daniel J; Danesh, John; Voight, Benjamin F; Saleheen, Danish

2018-01-01

To evaluate the shared genetic etiology of type-2 diabetes (T2D) and coronary heart disease (CHD), we conducted a multi-ethnic study of genetic variation genome-wide for both diseases in up to 265,678 subjects for T2D and 260,365 subjects for CHD. We identify 16 previously unreported loci for T2D and one for CHD, including a novel T2D association at a missense variant in HLA-DRB5 (OR=1.29). We show that genetically mediated increase in T2D risk also confers higher CHD risk. Joint analysis of T2D loci demonstrated that 24% are associated with CHD, highlighting eight variants - two of which are coding - where T2D and CHD associations appear to co-localize, and a novel joint T2D/CHD association which also replicated for T2D. Variants associated with both outcomes implicate several novel pathways including cellular proliferation and cardiovascular development. PMID:28869590

Common variants at the CHEK2 gene locus and risk of epithelial ovarian cancer.

PubMed

Lawrenson, Kate; Iversen, Edwin S; Tyrer, Jonathan; Weber, Rachel Palmieri; Concannon, Patrick; Hazelett, Dennis J; Li, Qiyuan; Marks, Jeffrey R; Berchuck, Andrew; Lee, Janet M; Aben, Katja K H; Anton-Culver, Hoda; Antonenkova, Natalia; Bandera, Elisa V; Bean, Yukie; Beckmann, Matthias W; Bisogna, Maria; Bjorge, Line; Bogdanova, Natalia; Brinton, Louise A; Brooks-Wilson, Angela; Bruinsma, Fiona; Butzow, Ralf; Campbell, Ian G; Carty, Karen; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Chen, Ann; Chen, Zhihua; Cook, Linda S; Cramer, Daniel W; Cunningham, Julie M; Cybulski, Cezary; Plisiecka-Halasa, Joanna; Dennis, Joe; Dicks, Ed; Doherty, Jennifer A; Dörk, Thilo; du Bois, Andreas; Eccles, Diana; Easton, Douglas T; Edwards, Robert P; Eilber, Ursula; Ekici, Arif B; Fasching, Peter A; Fridley, Brooke L; Gao, Yu-Tang; Gentry-Maharaj, Aleksandra; Giles, Graham G; Glasspool, Rosalind; Goode, Ellen L; Goodman, Marc T; Gronwald, Jacek; Harter, Philipp; Hasmad, Hanis Nazihah; Hein, Alexander; Heitz, Florian; Hildebrandt, Michelle A T; Hillemanns, Peter; Hogdall, Estrid; Hogdall, Claus; Hosono, Satoyo; Jakubowska, Anna; Paul, James; Jensen, Allan; Karlan, Beth Y; Kjaer, Susanne Kruger; Kelemen, Linda E; Kellar, Melissa; Kelley, Joseph L; Kiemeney, Lambertus A; Krakstad, Camilla; Lambrechts, Diether; Lambrechts, Sandrina; Le, Nhu D; Lee, Alice W; Cannioto, Rikki; Leminen, Arto; Lester, Jenny; Levine, Douglas A; Liang, Dong; Lissowska, Jolanta; Lu, Karen; Lubinski, Jan; Lundvall, Lene; Massuger, Leon F A G; Matsuo, Keitaro; McGuire, Valerie; McLaughlin, John R; Nevanlinna, Heli; McNeish, Iain; Menon, Usha; Modugno, Francesmary; Moysich, Kirsten B; Narod, Steven A; Nedergaard, Lotte; Ness, Roberta B; Noor Azmi, Mat Adenan; Odunsi, Kunle; Olson, Sara H; Orlow, Irene; Orsulic, Sandra; Pearce, Celeste L; Pejovic, Tanja; Pelttari, Liisa M; Permuth-Wey, Jennifer; Phelan, Catherine M; Pike, Malcolm C; Poole, Elizabeth M; Ramus, Susan J; Risch, Harvey A; Rosen, Barry; Rossing, Mary Anne; Rothstein, Joseph H; Rudolph, Anja; Runnebaum, Ingo B; Rzepecka, Iwona K; Salvesen, Helga B; Budzilowska, Agnieszka; Sellers, Thomas A; Shu, Xiao-Ou; Shvetsov, Yurii B; Siddiqui, Nadeem; Sieh, Weiva; Song, Honglin; Southey, Melissa C; Sucheston, Lara; Tangen, Ingvild L; Teo, Soo-Hwang; Terry, Kathryn L; Thompson, Pamela J; Timorek, Agnieszka; Tworoger, Shelley S; Van Nieuwenhuysen, Els; Vergote, Ignace; Vierkant, Robert A; Wang-Gohrke, Shan; Walsh, Christine; Wentzensen, Nicolas; Whittemore, Alice S; Wicklund, Kristine G; Wilkens, Lynne R; Woo, Yin-Ling; Wu, Xifeng; Wu, Anna H; Yang, Hannah; Zheng, Wei; Ziogas, Argyrios; Coetzee, Gerhard A; Freedman, Matthew L; Monteiro, Alvaro N A; Moes-Sosnowska, Joanna; Kupryjanczyk, Jolanta; Pharoah, Paul D; Gayther, Simon A; Schildkraut, Joellen M

2015-11-01

Genome-wide association studies have identified 20 genomic regions associated with risk of epithelial ovarian cancer (EOC), but many additional risk variants may exist. Here, we evaluated associations between common genetic variants [single nucleotide polymorphisms (SNPs) and indels] in DNA repair genes and EOC risk. We genotyped 2896 common variants at 143 gene loci in DNA samples from 15 397 patients with invasive EOC and controls. We found evidence of associations with EOC risk for variants at FANCA, EXO1, E2F4, E2F2, CREB5 and CHEK2 genes (P ≤ 0.001). The strongest risk association was for CHEK2 SNP rs17507066 with serous EOC (P = 4.74 x 10(-7)). Additional genotyping and imputation of genotypes from the 1000 genomes project identified a slightly more significant association for CHEK2 SNP rs6005807 (r (2) with rs17507066 = 0.84, odds ratio (OR) 1.17, 95% CI 1.11-1.24, P = 1.1×10(-7)). We identified 293 variants in the region with likelihood ratios of less than 1:100 for representing the causal variant. Functional annotation identified 25 candidate SNPs that alter transcription factor binding sites within regulatory elements active in EOC precursor tissues. In The Cancer Genome Atlas dataset, CHEK2 gene expression was significantly higher in primary EOCs compared to normal fallopian tube tissues (P = 3.72×10(-8)). We also identified an association between genotypes of the candidate causal SNP rs12166475 (r (2) = 0.99 with rs6005807) and CHEK2 expression (P = 2.70×10(-8)). These data suggest that common variants at 22q12.1 are associated with risk of serous EOC and CHEK2 as a plausible target susceptibility gene. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Genome-Wide Association Analysis Identifies Variants Associated with Nonalcoholic Fatty Liver Disease That Have Distinct Effects on Metabolic Traits

PubMed Central

Palmer, Cameron D.; Gudnason, Vilmundur; Eiriksdottir, Gudny; Garcia, Melissa E.; Launer, Lenore J.; Nalls, Michael A.; Clark, Jeanne M.; Mitchell, Braxton D.; Shuldiner, Alan R.; Butler, Johannah L.; Tomas, Marta; Hoffmann, Udo; Hwang, Shih-Jen; Massaro, Joseph M.; O'Donnell, Christopher J.; Sahani, Dushyant V.; Salomaa, Veikko; Schadt, Eric E.; Schwartz, Stephen M.; Siscovick, David S.; Voight, Benjamin F.; Carr, J. Jeffrey; Feitosa, Mary F.; Harris, Tamara B.; Fox, Caroline S.

2011-01-01

Nonalcoholic fatty liver disease (NAFLD) clusters in families, but the only known common genetic variants influencing risk are near PNPLA3. We sought to identify additional genetic variants influencing NAFLD using genome-wide association (GWA) analysis of computed tomography (CT) measured hepatic steatosis, a non-invasive measure of NAFLD, in large population based samples. Using variance components methods, we show that CT hepatic steatosis is heritable (∼26%–27%) in family-based Amish, Family Heart, and Framingham Heart Studies (n = 880 to 3,070). By carrying out a fixed-effects meta-analysis of genome-wide association (GWA) results between CT hepatic steatosis and ∼2.4 million imputed or genotyped SNPs in 7,176 individuals from the Old Order Amish, Age, Gene/Environment Susceptibility-Reykjavik study (AGES), Family Heart, and Framingham Heart Studies, we identify variants associated at genome-wide significant levels (p<5×10−8) in or near PNPLA3, NCAN, and PPP1R3B. We genotype these and 42 other top CT hepatic steatosis-associated SNPs in 592 subjects with biopsy-proven NAFLD from the NASH Clinical Research Network (NASH CRN). In comparisons with 1,405 healthy controls from the Myocardial Genetics Consortium (MIGen), we observe significant associations with histologic NAFLD at variants in or near NCAN, GCKR, LYPLAL1, and PNPLA3, but not PPP1R3B. Variants at these five loci exhibit distinct patterns of association with serum lipids, as well as glycemic and anthropometric traits. We identify common genetic variants influencing CT–assessed steatosis and risk of NAFLD. Hepatic steatosis associated variants are not uniformly associated with NASH/fibrosis or result in abnormalities in serum lipids or glycemic and anthropometric traits, suggesting genetic heterogeneity in the pathways influencing these traits. PMID:21423719

Phenotypic and Genetic Analysis of Clock, a New Circadian Rhythm Mutant in Drosophila Melanogaster

PubMed Central

Dushay, M. S.; Konopka, R. J.; Orr, D.; Greenacre, M. L.; Kyriacou, C. P.; Rosbash, M.; Hall, J. C.

1990-01-01

Clock is a semidominant X-linked mutation that results in shortening the period of Drosophila melanogaster's free-running locomotor activity rhythm from ca. 24.0 to ca. 22.5 hr. This mutation similarly shortened the phase response curve, determined by resetting activity rhythms with light pulses. Eclosion peaks for Clk cultures were separated by only 22.5 hr instead of the normal 24 hr. Clk was mapped close to, but separable from, another rhythm mutation--period(01)--by recombination. The estimated distance between these two mutations was short enough to suggest that Clk could be a per allele. If this is the case, the new mutant is unique in that it, unlike other per variants, is associated with essentially normal 1-min courtship song rhythms when Clk is expressed in males. Also, the new rhythm variant could not, in contrast to a short-period per mutation, have its effects on free-running activity rhythms uncovered by deletions. This result, and the lack of coverage of Clk's effects by duplications, suggest that it is not a simple hypomorphic or amorphic mutation. PMID:2116357

Quantification and Formalization of Security

DTIC Science & Technology

2010-02-01

Quantification of Information Flow . . . . . . . . . . . . . . . . . . 30 2.4 Language Semantics . . . . . . . . . . . . . . . . . . . . . . . . . . 46...system behavior observed by users holding low clearances. This policy, or a variant of it, is enforced by many pro- gramming language -based mechanisms...illustrates with a particular programming language (while-programs plus probabilistic choice). The model is extended in §2.5 to programs in which

A neonatal mouse model for the evaluation of antibodies and vaccines against coxsackievirus A6.

PubMed

Yang, Lisheng; Mao, Qunying; Li, Shuxuan; Gao, Fan; Zhao, Huan; Liu, Yajing; Wan, Junkai; Ye, Xiangzhong; Xia, Ningshao; Cheng, Tong; Liang, Zhenglun

2016-10-01

Coxsackievirus A6 (CA6) can induce atypical hand, foot, and mouth disease, which is characterized by severe rash, onychomadesis and a higher rate of infection in adults. Increasing epidemiological data indicated that outbreaks of CA6-associated hand, foot, and mouth disease have markedly increased worldwide in recent years. However, the current body of knowledge on the infection, pathogenic mechanism, and immunogenicity of CA6 is still very limited. In this study, we established the first neonatal mouse model for the evaluation of antibodies and vaccines against CA6. The CA6 strain CA6/141 could infect a one-day-old BALB/c mouse through intraperitoneal and intracerebral routes. The infected mice developed clinical symptoms, such as inactivity, wasting, hind-limb paralysis and even death. Pathological examination indicated that CA6 showed special tropism to skeletal muscles and skin, but not to nervous system or cardiac muscles. Infections with CA6 could induce vesicles in the dermis without a rash in mice, and the CA6 antigen was mainly localized in hair follicles. The strong tropism of CA6 to the skin may be related to its severe clinical features in infants. This mouse model was further applied to evaluate the efficacy of a therapeutic antibody and an experimental vaccine against CA6. A potential mAb 1D5 could fully protect mice from a lethal CA6 infection and also showed good therapeutic effects in the CA6-infected mice. In addition, an inactivated CA6 vaccine was evaluated through maternal immunization and showed 100% protection of neonatal mice from lethal CA6 challenge. Collectively, these results indicate that this infection model will be a useful tool in future studies on vaccines and antiviral reagents against CA6. Copyright © 2016 Elsevier B.V. All rights reserved.

Fibroblast growth factor regulates insulin-like growth factor-binding protein production by vascular smooth muscle cells.

PubMed

Ververis, J; Ku, L; Delafontaine, P

1994-02-01

Insulin-like growth factor I is an important mitogen for vascular smooth muscle cells, and its effects are regulated by several binding proteins. Western ligand blotting of conditioned medium from rat aortic smooth muscle cells detected a 24 kDa binding protein and a 28 kDa glycosylated variant of this protein, consistent with insulin-like growth factor binding protein-4 by size. Low amounts of a glycosylated 38 to 42 kDa doublet (consistent with binding protein-3) and a 31 kDa non-glycosylated protein also were present. Basic fibroblast growth factor markedly increased secretion of the 24 kDa binding protein and its 28 kDa glycosylated variant. This effect was dose- and time-dependent and was inhibited by co-incubation with cycloheximide. Crosslinking of [125I]-insulin-like growth factor I to cell monolayers revealed no surface-associated binding proteins, either basally or after agonist treatment. Induction of binding protein production by fibroblast growth factor at sites of vascular injury may be important in vascular proliferative responses in vivo.

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

PubMed

Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

2016-08-01

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Impact of posterior communicating artery on basilar artery steno-occlusive disease.

PubMed

Hong, J M; Choi, J Y; Lee, J H; Yong, S W; Bang, O Y; Joo, I S; Huh, K

2009-12-01

Acute brainstem infarction with basilar artery (BA) occlusive disease is the most fatal type of all ischaemic strokes. This report investigates the prognostic impact of the posterior communicating artery (PcoA) and whether its anatomy is a safeguard or not. Consecutive patients who had acute brainstem infarction with at least 50% stenosis of BA upon CT angiography (CTA) were studied. The configuration of PcoA was divided into two groups upon CTA: "textbook" group (invisible PcoA with good P1 and P2 segment) and "fetal-variant of PcoA" group (only visible PcoA with absent P1 segment). Baseline demographics, radiological findings and stroke mechanisms were analysed. A multiple regression analysis was performed to predict clinical outcome at 30 days (modified Rankin disability Scale (mRS

Occurrence of CYP1B1 Mutations in Juvenile Open-Angle Glaucoma With Advanced Visual Field Loss.

PubMed

Souzeau, Emmanuelle; Hayes, Melanie; Zhou, Tiger; Siggs, Owen M; Ridge, Bronwyn; Awadalla, Mona S; Smith, James E H; Ruddle, Jonathan B; Elder, James E; Mackey, David A; Hewitt, Alex W; Healey, Paul R; Goldberg, Ivan; Morgan, William H; Landers, John; Dubowsky, Andrew; Burdon, Kathryn P; Craig, Jamie E

2015-07-01

Juvenile open-angle glaucoma (JOAG) is a severe neurodegenerative eye disorder in which most of the genetic contribution remains unexplained. To assess the prevalence of pathogenic CYP1B1 sequence variants in an Australian cohort of patients with JOAG and severe visual field loss. For this cohort study, we recruited 160 patients with JOAG classified as advanced (n = 118) and nonadvanced (n = 42) through the Australian and New Zealand Registry of Advanced Glaucoma from January 1, 2007, through April 1, 2014. Eighty individuals with no evidence of glaucoma served as a control group. We defined JOAG as diagnosis before age 40 years and advanced JOAG as visual field loss in 2 of the 4 central fixation squares on a reliable visual field test result. We performed direct sequencing of the entire coding region of CYP1B1. Data analysis was performed in October 2014. Identification and characterization of CYP1B1 sequence variants. We identified 7 different pathogenic variants among 8 of 118 patients with advanced JOAG (6.8%) but none among the patients with nonadvanced JOAG. Three patients were homozygous or compound heterozygous for CYP1B1 pathogenic variants, which provided a likely basis for their disease. Five patients were heterozygous. The allele frequency among the patients with advanced JOAG (11 in 236 [4.7%]) was higher than among our controls (1 in 160 [0.6%]; P = .02; odds ratio, 7.8 [95% CI, 0.02-1.0]) or among the control population from the Exome Aggregation Consortium database (2946 of 122 960 [2.4%]; P = .02; odds ratio, 2.0 [95% CI, 0.3-0.9]). Individuals with CYP1B1 pathogenic variants, whether heterozygous or homozygous, had worse mean (SD) deviation on visual fields (-24.5 [5.1] [95% CI, -31.8 to -17.2] vs -15.6 [10.0] [95% CI, -17.1 to -13.6] dB; F1,126 = 5.90; P = .02; partial ηp2 = 0.05) and were younger at diagnosis (mean [SD] age, 23.1 [8.4] [95% CI, 17.2-29.1] vs 31.5 [8.0] [95% CI, 30.1-33.0] years; F1,122 = 7.18; P = .008; ηp2 = 0.06) than patients without CYP1B1 pathogenic variants. Patients with advanced JOAG based on visual field loss had enrichment of CYP1B1 pathogenic variants and a more severe phenotype compared with unaffected controls and patients with nonadvanced JOAG.

Large-Scale Gene-Centric Analysis Identifies Novel Variants for Coronary Artery Disease

PubMed Central

2011-01-01

Coronary artery disease (CAD) has a significant genetic contribution that is incompletely characterized. To complement genome-wide association (GWA) studies, we conducted a large and systematic candidate gene study of CAD susceptibility, including analysis of many uncommon and functional variants. We examined 49,094 genetic variants in ∼2,100 genes of cardiovascular relevance, using a customised gene array in 15,596 CAD cases and 34,992 controls (11,202 cases and 30,733 controls of European descent; 4,394 cases and 4,259 controls of South Asian origin). We attempted to replicate putative novel associations in an additional 17,121 CAD cases and 40,473 controls. Potential mechanisms through which the novel variants could affect CAD risk were explored through association tests with vascular risk factors and gene expression. We confirmed associations of several previously known CAD susceptibility loci (eg, 9p21.3:p<10−33; LPA:p<10−19; 1p13.3:p<10−17) as well as three recently discovered loci (COL4A1/COL4A2, ZC3HC1, CYP17A1:p<5×10−7). However, we found essentially null results for most previously suggested CAD candidate genes. In our replication study of 24 promising common variants, we identified novel associations of variants in or near LIPA, IL5, TRIB1, and ABCG5/ABCG8, with per-allele odds ratios for CAD risk with each of the novel variants ranging from 1.06–1.09. Associations with variants at LIPA, TRIB1, and ABCG5/ABCG8 were supported by gene expression data or effects on lipid levels. Apart from the previously reported variants in LPA, none of the other ∼4,500 low frequency and functional variants showed a strong effect. Associations in South Asians did not differ appreciably from those in Europeans, except for 9p21.3 (per-allele odds ratio: 1.14 versus 1.27 respectively; P for heterogeneity = 0.003). This large-scale gene-centric analysis has identified several novel genes for CAD that relate to diverse biochemical and cellular functions and clarified the literature with regard to many previously suggested genes. PMID:21966275

Analysis of viral (zucchini yellow mosaic virus) genetic diversity during systemic movement through a Cucurbita pepo vine

PubMed Central

Holmes, E.C.; Stephenson, A.G.

2014-01-01

Determining the extent and structure of intra-host genetic diversity and the magnitude and impact of population bottlenecks is central to understanding the mechanisms of viral evolution. To determine the nature of viral evolution following systemic movement through a plant, we performed deep sequencing of 23 leaves that grew sequentially along a single Cucurbita pepo vine that was infected with zucchini yellow mosaic virus (ZYMV), and on a leaf that grew in on a side branch. Strikingly, of 112 genetic (i.e. sub-consensus) variants observed in the data set as a whole, only 22 were found in multiple leaves. Similarly, only three of the 13 variants present in the inoculating population were found in the subsequent leaves on the vine. Hence, it appears that systemic movement is characterized by sequential population bottlenecks, although not sufficient to reduce the population to a single virion as multiple variants were consistently transmitted between leaves. In addition, the number of variants within a leaf increases as a function of distance from the inoculated (source) leaf, suggesting that the circulating sap may serve as a continual source of virus. Notably, multiple mutational variants were observed in the cylindrical Inclusion (CI) protein (known to be involved in both cell-to-cell and systemic movement of the virus) that were present in multiple (19/24) leaf samples. These mutations resulted in a conformational change, suggesting that they might confer a selective advantage in systemic movement within the vine. Overall, these data reveal that bottlenecks occur during systemic movement, that variants circulate in the phloem sap throughout the infection process, and that important conformational changes in CI protein may arise during individual infections. PMID:25107623

Identification of SLC20A1 and SLC15A4 among other genes as potential risk factors for combined pituitary hormone deficiency.

PubMed

Simm, Franziska; Griesbeck, Anne; Choukair, Daniela; Weiß, Birgit; Paramasivam, Nagarajan; Klammt, Jürgen; Schlesner, Matthias; Wiemann, Stefan; Martinez, Cristina; Hoffmann, Georg F; Pfäffle, Roland W; Bettendorf, Markus; Rappold, Gudrun A

2017-10-26

PurposeCombined pituitary hormone deficiency (CPHD) is characterized by a malformed or underdeveloped pituitary gland resulting in an impaired pituitary hormone secretion. Several transcription factors have been described in its etiology, but defects in known genes account for only a small proportion of cases.MethodsTo identify novel genetic causes for congenital hypopituitarism, we performed exome-sequencing studies on 10 patients with CPHD and their unaffected parents. Two candidate genes were sequenced in further 200 patients. Genotype data of known hypopituitary genes are reviewed.ResultsWe discovered 51 likely damaging variants in 38 genes; 12 of the 51 variants represent de novo events (24%); 11 of the 38 genes (29%) were present in the E12.5/E14.5 pituitary transcriptome. Targeted sequencing of two candidate genes, SLC20A1 and SLC15A4, of the solute carrier membrane transport protein family in 200 additional patients demonstrated two further variants predicted as damaging. We also found combinations of de novo (SLC20A1/SLC15A4) and transmitted variants (GLI2/LHX3) in the same individuals, leading to the full-blown CPHD phenotype.ConclusionThese data expand the pituitary target genes repertoire for diagnostics and further functional studies. Exome sequencing has identified a combination of rare variants in different genes that might explain incomplete penetrance in CPHD.Genetics in Medicine advance online publication, 26 October 2017; doi:10.1038/gim.2017.165.

Dissecting Redox Biology Using Fluorescent Protein Sensors.

PubMed

Schwarzländer, Markus; Dick, Tobias P; Meyer, Andreas J; Morgan, Bruce

2016-05-01

Fluorescent protein sensors have revitalized the field of redox biology by revolutionizing the study of redox processes in living cells and organisms. Within one decade, a set of fundamental new insights has been gained, driven by the rapid technical development of in vivo redox sensing. Redox-sensitive yellow and green fluorescent protein variants (rxYFP and roGFPs) have been the central players. Although widely used as an established standard tool, important questions remain surrounding their meaningful use in vivo. We review the growing range of thiol redox sensor variants and their application in different cells, tissues, and organisms. We highlight five key findings where in vivo sensing has been instrumental in changing our understanding of redox biology, critically assess the interpretation of in vivo redox data, and discuss technical and biological limitations of current redox sensors and sensing approaches. We explore how novel sensor variants may further add to the current momentum toward a novel mechanistic and integrated understanding of redox biology in vivo. Antioxid. Redox Signal. 24, 680-712.

High local genetic diversity of canine parvovirus from Ecuador.

PubMed

Aldaz, Jaime; García-Díaz, Juan; Calleros, Lucía; Sosa, Katia; Iraola, Gregorio; Marandino, Ana; Hernández, Martín; Panzera, Yanina; Pérez, Ruben

2013-09-27

Canine parvovirus (CPV) comprises three antigenic variants (2a, 2b, and 2c) that are distributed globally with different frequencies and levels of genetic variability. CPVs from central Ecuador were herein analyzed to characterize the strains and to provide new insights into local viral diversity, evolution, and pathogenicity. Variant prevalence was analyzed by PCR and partial sequencing for 53 CPV-positive samples collected during 2011 and 2012. The full-length VP2 gene was sequenced in 24 selected strains and a maximum-likelihood phylogenetic tree was constructed using both Ecuadorian and worldwide strains. Ecuadorian CPVs have a remarkable genetic diversity that includes the circulation of all three variants and the existence of different evolutionary groups or lineages. CPV-2c was the most prevalent variant (54.7%), confirming the spread of this variant in America. Ecuadorian CPV-2c strains clustered in two lineages, which represent the first evidence of polyphyletic CPV-2c circulating in South America. CPV-2a strains constituted 41.5% of the samples and clustered in a single lineage. The two detected CPV-2b strains (3.8%) were clearly polyphyletic and appeared related to Ecuadorian CPV-2a or foreign CPV-2b strains. Besides the substitution at residue 426 that is used to identify the variants, two amino acid changes occurred in Ecuadorian strains: Val139Iso and Thr440Ser. Ser(440) occurred in a biologically relevant domain of VP2 and is here described for the first time in CPV. The associations of Ecuadorian CPV-2c and CPV-2a with clinical symptoms indicate that dull mentation, hemorrhagic gastroenteritis and hypothermia occurred more frequently in infection with CPV-2c than with CPV-2a. Copyright © 2013 Elsevier B.V. All rights reserved.

Emodin inhibits coxsackievirus B3 replication via multiple signalling cascades leading to suppression of translation.

PubMed

Zhang, Huifang M; Wang, Fengping; Qiu, Ye; Ye, Xin; Hanson, Paul; Shen, Hongxing; Yang, Decheng

2016-02-15

CVB3 (coxsackievirus 3) is a primary causal agent of viral myocarditis. Emodin is a natural compound isolated from certain plant roots. In the present study, we found that emodin inhibited CVB3 replication in vitro and in mice, and now we report an unrecognized mechanism by which emodin inhibits CVB3 replication through suppression of viral protein translation via multiple pathways. On one hand, emodin treatment inhibited Akt/mTOR (mammalian target of rapamycin) signalling and activated 4EBP1 (eukaryotic initiation factor 4R-binding protein 1), leading to suppression of translation initiation of ribosomal protein L32 encoded by a 5'-TOP (terminal oligopyrimidine) mRNA. On the other hand, emodin treatment differentially regulated multiple signal cascades, including Akt/mTORC1/p70(S6K) (p70 S6 kinase), ERK1/2 (extracellular-signal-regulated kinase 1/2)/p90(RSK) (p90 ribosomal S6 kinase) and Ca(2+)/calmodulin, leading to activation of eEF2K (eukaryotic elongation factor 2 kinase) and subsequent inactivation of eEF2 (eukaryotic elongation factor 2), resulting in inhibition of CVB3 VP1 (viral protein 1) synthesis. These data imply that eEF2K is a major factor mediating cross-talk of different arms of signalling cascades in this signal network. This notion was verified by either overexpressing eEF2K or treating the cells with siRNAs or eEF2K inhibitor A484954. We showed further that the emodin-induced decrease in p70(S6K) phosphorylation plays a dominant positive role in activation of eEF2K and in turn in conferring the antiviral effect of emodin. This finding was further solidified by expressing constitutively active and dominant-negative Akt. Collectively, our data reveal that emodin inhibits viral replication through impairing translational machinery and suppression of viral translation elongation. © 2016 Authors; published by Portland Press Limited.

Randomized, Placebo-Controlled, Single-Ascending-Dose Study of BMS-791325, a Hepatitis C Virus (HCV) NS5B Polymerase Inhibitor, in HCV Genotype 1 Infection

PubMed Central

Lemm, Julie; Eley, Timothy; Liu, Menping; Berglind, Anna; Sherman, Diane; Lawitz, Eric; Vutikullird, Apinya B.; Tebas, Pablo; Gao, Min; Pasquinelli, Claudio; Grasela, Dennis M.

2014-01-01

BMS-791325 is a nonnucleoside inhibitor of hepatitis C virus (HCV) NS5B polymerase with low-nanomolar potency against genotypes 1a (50% effective concentration [EC50], 3 nM) and 1b (EC50, 7 nM) in vitro. BMS-791325 safety, pharmacokinetics, and antiviral activity were evaluated in a double-blind, placebo-controlled, single-ascending-dose study in 24 patients (interferon naive and experienced) with chronic HCV genotype 1 infection, randomized (5:1) to receive a single dose of BMS-791325 (100, 300, 600, or 900 mg) or placebo. The prevalence and phenotype of HCV variants at baseline and specific posttreatment time points were assessed. Antiviral activity was observed in all cohorts, with a mean HCV RNA decline of ≈2.5 log10 copies/ml observed 24 h after a single 300-mg dose. Mean plasma half-life among cohorts was 7 to 9 h; individual 24-hour levels exceeded the protein-adjusted EC90 for genotype 1 at all doses. BMS-791325 was generally well tolerated, with no serious adverse events or discontinuations. Enrichment for resistance variants was not observed at 100 to 600 mg. At 900 mg, variants (P495L/S) associated with BMS-791325 resistance in vitro were transiently observed in one patient, concurrent with an observed HCV RNA decline of 3.4 log10 IU/ml, but were replaced with wild type by 48 h. Single doses of BMS-791325 were well tolerated; demonstrated rapid, substantial, and exposure-related antiviral activity; displayed dose-related increases in exposure; and showed viral kinetic and pharmacokinetic profiles supportive of once- or twice-daily dosing. These results support its further development in combination with other direct-acting antivirals for HCV genotype 1 infection. (This trial has been registered at ClinicalTrials.gov under registration no. NCT00664625.) PMID:24733462

MODY3, renal cysts, and Dandy-Walker variants with a microdeletion spanning the HNF1A gene.

PubMed

Matsukura, Hiro; Nagamori, Mariko; Miya, Kazushi; Yorifuji, Tohru

2017-09-01

Heterozygous hepatocyte nuclear factor-1-α gene (HNF1A) mutations are the most common cause of maturity-onset diabetes of the young (MODY), but they rarely involve extrahepatic manifestations. Renal cysts and diabetes syndrome can be caused by HNF1B mutations. No association between MODY3 and Dandy-Walker variants (DWV) has been reported. HNF1A mutations might be responsible for renal malformations. In a Japanese girl with glycosuria, developmental delay, mental retardation, renal cysts, and DWV, the HNF1B gene had no mutations. Array comparative genomic hybridization analysis identified a de-novo interstitial 12q24.22-q24.31 deletion of 5.6 Mb encompassing the HNF1A gene, which is compatible with a diagnosis of MODY3. The variety of phenotypes suggests a novel microdeletion syndrome spanning the HNF1A gene. Because HNF1B functions as an HNF1A/HNF1B heterodimer, haploinsufficient HNF1A interacts with a certain HNF1B haplotype. The resulting truncated heterodimer might engender renal cysts. More patients with well-defined deletion within 12q.24.31 must be evaluated to produce a detailed genotype-phenotype correlation and to elucidate this emerging microdeletion syndrome.
.

Carbapenem-Resistant Acinetobacter baumannii from Serbia: Revision of CarO Classification

PubMed Central

Novovic, Katarina; Mihajlovic, Sanja; Vasiljevic, Zorica; Filipic, Brankica; Begovic, Jelena; Jovcic, Branko

2015-01-01

Carbapenem-resistant A. baumannii present a significant therapeutic challenge for the treatment of nosocomial infections in many European countries. Although it is known that the gradient of A. baumannii prevalence increases from northern to southern Europe, this study provides the first data from Serbia. Twenty-eight carbapenem-resistant A. baumannii clinical isolates were collected at a Serbian pediatric hospital during a 2-year period. The majority of isolates (67.68%) belonged to the sequence type Group 1, European clonal complex II. All isolates harbored intrinsic OXA-51 and AmpC cephalosporinase. OXA-23 was detected in 16 isolates (57.14%), OXA-24 in 23 isolates (82.14%) and OXA-58 in 11 isolates (39.29%). Six of the isolates (21.43%) harbored all of the analyzed oxacillinases, except OXA-143 and OXA-235 that were not detected in this study. Production of oxacillinases was detected in different pulsotypes indicating the presence of horizontal gene transfer. NDM-1, VIM and IMP were not detected in analyzed clinical A. baumannii isolates. ISAba1 insertion sequence was present upstream of OXA-51 in one isolate, upstream of AmpC in 13 isolates and upstream of OXA-23 in 10 isolates. In silico analysis of carO sequences from analyzed A. baumannii isolates revealed the existence of two out of six highly polymorphic CarO variants. The phylogenetic analysis of CarO protein among Acinetobacter species revised the previous classification CarO variants into three groups based on strong bootstraps scores in the tree analysis. Group I comprises four variants (I-IV) while Groups II and III contain only one variant each. One half of the Serbian clinical isolates belong to Group I variant I, while the other half belongs to Group I variant III. PMID:25822626

Rabies surveillance in the United States during 2009.

PubMed

Blanton, Jesse D; Palmer, Dustyn; Rupprecht, Charles E

2010-09-15

During 2009, 49 states and Puerto Rico reported 6,690 rabid animals and 4 human rabies cases to the CDC, representing a 2.2% decrease from the 6,841 rabid animals and 2 human cases reported in 2008. Approximately 92% of reported rabid animals were wildlife. Relative contributions by the major animal groups were as follows: 2,327 (34.8%) raccoons, 1,625 (24.3%) bats, 1,603 (24.0%) skunks, 504 (75%) foxes, 300 (4.5%) cats, 81 (1.2%) dogs, and 74 (1.1%) cattle. Compared with 2008, numbers of rabid raccoons and bats that were reported decreased, whereas numbers of rabid skunks, foxes, cats, cattle, dogs, and horses that were reported increased. Fewer rabid raccoons, compared with 2008, were reported by 12 of the 20 eastern states where raccoon rabies is enzootic, and number of rabid raccoons decreased by 2.6% overall nationally. Despite a 10% decrease in the number of rabid bats that were reported and a decrease in the total number of bats submitted for testing, bats were the second most commonly submitted animal, behind cats, during 2009. The number of rabid skunks that were reported increased by 0.9% overall. The proportion of rabid skunks in which infection was attributed to the raccoon rabies virus variant decreased from 473% in 2008 to 40.9% in 2009, resulting in a 12.7% increase in the number of rabid skunks infected with a skunk rabies virus variant. The number of rabid foxes increased 11.0% overall from the previous year. Four cases of rabies involving humans were reported from Texas, Indiana, Virginia, and Michigan. The Texas case represented the first presumptive abortive human rabies case, with the patient recovering after the onset of symptoms without intensive care. The Indiana and Michigan cases were associated with bat rabies virus variants. The human rabies case in Virginia was associated with a canine rabies virus variant acquired during the patient's travel to India.

Clinical and Genetic Risk Factors for Acute Pancreatitis in Patients With Acute Lymphoblastic Leukemia

PubMed Central

Liu, Chengcheng; Yang, Wenjian; Devidas, Meenakshi; Cheng, Cheng; Pei, Deqing; Smith, Colton; Carroll, William L.; Raetz, Elizabeth A.; Bowman, W. Paul; Larsen, Eric C.; Maloney, Kelly W.; Martin, Paul L.; Mattano, Leonard A.; Winick, Naomi J.; Mardis, Elaine R.; Fulton, Robert S.; Bhojwani, Deepa; Howard, Scott C.; Jeha, Sima; Pui, Ching-Hon; Hunger, Stephen P.; Evans, William E.; Loh, Mignon L.

2016-01-01

Purpose Acute pancreatitis is one of the common causes of asparaginase intolerance. The mechanism is unknown, and genetic predisposition to asparaginase-induced pancreatitis has not been previously identified. Methods To determine clinical risk factors for asparaginase-induced pancreatitis, we studied a cohort of 5,185 children and young adults with acute lymphoblastic leukemia, including 117 (2.3%) who were diagnosed with at least one episode of acute pancreatitis during therapy. A genome-wide association study was performed in the cohort and in an independent case-control group of 213 patients to identify genetic risk factors. Results Risk factors associated with pancreatitis included genetically defined Native American ancestry (P < .001), older age (P < .001), and higher cumulative dose of asparaginase (P < .001). No common variants reached genome-wide significance in the genome-wide association study, but a rare nonsense variant rs199695765 in CPA2, encoding carboxypeptidase A2, was highly associated with pancreatitis (hazard ratio, 587; 95% CI, 66.8 to 5166; P = 9.0 × 10−9). A gene-level analysis showed an excess of additional CPA2 variants in patients who did versus those who did not develop pancreatitis (P = .001). Sixteen CPA2 single-nucleotide polymorphisms were associated (P < .05) with pancreatitis, and 13 of 24 patients who carried at least one of these variants developed pancreatitis. Biologic functions that were overrepresented by common variants modestly associated with pancreatitis included purine metabolism and cytoskeleton regulation. Conclusion Older age, higher exposure to asparaginase, and higher Native American ancestry were independent risk factors for pancreatitis in patients with acute lymphoblastic leukemia. Those who inherit a nonsense rare variant in the CPA2 gene had a markedly increased risk of asparaginase-induced pancreatitis. PMID:27114598

Targeted next-generation sequencing reveals MODY in up to 6.5% of antibody-negative diabetes cases listed in the Norwegian Childhood Diabetes Registry.

PubMed

Johansson, Bente B; Irgens, Henrik U; Molnes, Janne; Sztromwasser, Paweł; Aukrust, Ingvild; Juliusson, Petur B; Søvik, Oddmund; Levy, Shawn; Skrivarhaug, Torild; Joner, Geir; Molven, Anders; Johansson, Stefan; Njølstad, Pål R

2017-04-01

MODY can be wrongly diagnosed as type 1 diabetes in children. We aimed to find the prevalence of MODY in a nationwide population-based registry of childhood diabetes. Using next-generation sequencing, we screened the HNF1A, HNF4A, HNF1B, GCK and INS genes in all 469 children (12.1%) negative for both GAD and IA-2 autoantibodies and 469 antibody-positive matched controls selected from the Norwegian Childhood Diabetes Registry (3882 children). Variants were classified using clinical diagnostic criteria for pathogenicity ranging from class 1 (neutral) to class 5 (pathogenic). We identified 58 rare exonic and splice variants in cases and controls. Among antibody-negative patients, 6.5% had genetic variants of classes 3-5 (vs 2.4% in controls; p = 0.002). For the stricter classification (classes 4 and 5), the corresponding number was 4.1% (vs 0.2% in controls; p = 1.6 × 10 -5 ). HNF1A showed the strongest enrichment of class 3-5 variants, with 3.9% among antibody-negative patients (vs 0.4% in controls; p = 0.0002). Antibody-negative carriers of variants in class 3 had a similar phenotype to those carrying variants in classes 4 and 5. This is the first study screening for MODY in all antibody-negative children in a nationwide population-based registry. Our results suggest that the prevalence of MODY in antibody-negative childhood diabetes may reach 6.5%. One-third of these MODY cases had not been recognised by clinicians. Since a precise diagnosis is important for treatment and genetic counselling, molecular screening of all antibody-negative children should be considered in routine diagnostics.

Determination of SCN1A genetic variants in Mexican patients with refractory epilepsy and Dravet syndrome.

PubMed

Jiménez-Arredondo, R E; Brambila-Tapia, A J L; Mercado-Silva, F M; Magaña-Torres, M T; Figuera, L E

2017-05-18

Mutations in the SCN1A gene can result in syndromes associated with epilepsy, including the Dravet syndrome (DS). However, the prevalence of such mutations in these diseases varies widely between different studies, and has not been examined in Mexican patients with epilepsy. Therefore, the objective of this study was to determine the frequency of SCN1A mutations (in the exon 26) in a cohort of Mexican patients with DS and refractory epilepsy (RE). We recruited 24 Mexican patients (14 males and 10 females), of which 15 were diagnosed with RE and 9 were diagnosed with DS. The SCN1A gene was sequenced to uncover mutations in exon 26. We detected 2 novel genotypes in 2 DS patients. One was a synonymous variant, c.5418 G > A (E1806E), and the other was a missense variant, c. 5324 T > C (L1775P). The missense mutation was predicted to be damaging with a score of 100% by the PolyPhen-2 program. The frequency of pathogenic variants was 4.17% in all the patients and 11.1% in DS patients, which, together with other publications, emphasize that specific and more severe phenotypes are associated with SCN1A mutations.

An outbreak of coxsackievirus A6 hand, foot, and mouth disease associated with onychomadesis in Taiwan, 2010

PubMed Central

2011-01-01

Background In 2010, an outbreak of coxsackievirus A6 (CA6) hand, foot and mouth disease (HFMD) occurred in Taiwan and some patients presented with onychomadesis and desquamation following HFMD. Therefore, we performed an epidemiological and molecular investigation to elucidate the characteristics of this outbreak. Methods Patients who had HFMD with positive enterovirus isolation results were enrolled. We performed a telephone interview with enrolled patients or their caregivers to collect information concerning symptoms, treatments, the presence of desquamation, and the presence of nail abnormalities. The serotypes of the enterovirus isolates were determined using indirect immunofluorescence assays. The VP1 gene was sequenced and the phylogenetic tree for the current CA6 strains in 2010, 52 previous CA6 strains isolated in Taiwan from 1998 through 2009, along with 8 reference sequences from other countries was constructed using the neighbor-joining command in MEGA software. Results Of the 130 patients with laboratory-confirmed CA6 infection, some patients with CA6 infection also had eruptions around the perioral area (28, 22%), the trunk and/or the neck (39, 30%) and generalized skin eruptions (6, 5%) in addition to the typical presentation of skin eruptions on the hands, feet, and mouths. Sixty-six (51%) CA6 patients experienced desquamation of palms and soles after the infection episode and 48 (37%) CA6 patients developed onychomadesis, which only occurred in 7 (5%) of 145 cases with non-CA6 enterovirus infection (p < 0.001). The sequences of viral protein 1 of CA6 in 2010 differ from those found in Taiwan before 2010, but are similar to those found in patients in Finland in 2008. Conclusions HFMD patients with CA6 infection experienced symptoms targeting a broader spectrum of skin sites and more profound tissue destruction, i.e., desquamation and nail abnormalities. PMID:22168544

Epstein-Barr virus latent membrane protein-1 (LMP-1) 30-bp deletion and Xho I-loss is associated with type III nasopharyngeal carcinoma in Malaysia

PubMed Central

See, Hui Shien; Yap, Yoke Yeow; Yip, Wai Kien; Seow, Heng Fong

2008-01-01

Background Nasopharyngeal carcinoma (NPC) is a human epithelial tumour with high prevalence amongst Chinese in Southern China and South East Asia and is associated with the Epstein-Barr virus (EBV). The viral genome harbours an oncogene, namely, the latent membrane protein 1 (LMP1) gene and known variants such as the 30-bp deletion and loss of XhoI restriction site have been found. Less is known about the relationship between these variants and the population characteristics and histological type. Methods In this study, the EBV LMP1 gene variants from 42 NPC and 10 non-malignant archived formalin fixed, paraffin-embedded tissues, as well as plasma from another 35 patients with nasopharyngeal carcinoma were determined by using Polymerase Chain Reaction (PCR). Statistical analysis was performed by using SPSS programme. Results LMP1 30-bp deletion was detected in 19/34 (55.9%) of NPC tissues, 7/29 (24.1%) of plasma but absent in non-malignant tissues (8/8). Coexistence of variants with and without 30bp deletion was found only in 5/29 (17.2%) plasma samples but not in NPC tissues. The loss of XhoI restriction site in LMP1 gene was found in 34/39 (87.2%) of the NPC tissues and 11/30 (36.7%) of plasma samples. None of the non-malignant nasopharyngeal tissues (8/8) harbour XhoI-loss variants. LMP1 30-bp deletion was detected in 16/18 Chinese versus 3/15 Malays and 13/16 type III (undifferentiated carcinoma) versus 1/6 type I (keratinizing squamous cell carcinoma). XhoI-loss was found in 19/19 Chinese versus 14/19 Malays and 18/18 type III (undifferentiated) versus 2/5 type I (keratinizing squamous cell carcinoma). Statistical analysis showed that these variants were associated with ethnic race (30-bp deletion, p < 0.05; XhoI-loss, p = 0.046) and histological type of NPC (30-bp deletion, p = 0.011; XhoI-loss, p = 0.006). Nineteen out of 32 NPC tissues (19/32; 59.4%) and 6/24 (25%) of plasma samples showed the coexistence of both the 30-bp deletion and the loss of XhoI restriction site. A significant relationship was found with the Chinese race but not histological type. Conclusion The incidence rate of 56% for LMP1 30-bp deletion was lower compared to previously reported rates of 75–100% in NPC tissues. Coexistence of variants with and without 30-bp deletion was found only in 5/29 plasma samples. The incidence rate of XhoI restriction site loss in NPC was comparable to other studies from endemic regions such as Southern China. For the first time, the presence of LMP1 30-bp deletion or XhoI-loss was associated with the Chinese race and type III NPC. Both these variants were not found in non-malignant tissues. The influence of these variants on disease progression and outcome in Chinese and type III NPC requires further investigation. PMID:18275617

Release of β-casomorphin-7/5 during simulated gastrointestinal digestion of milk β-casein variants from Indian crossbred cattle (Karan Fries).

PubMed

Ul Haq, Mohammad Raies; Kapila, Rajeev; Kapila, Suman

2015-02-01

Crossbred Karan Fries (KF) cows, among the best yielders of milk in India are carriers of A1 and A2 alleles. These genetic variants have been established as the source of β-casomorphins (BCMs) bioactive peptides that are implicated with various physiological and health issues. Therefore, the present study was aimed to investigate the release of BCM-7/5 from β-casein variants of KF by simulated gastrointestinal digestion (SGID) performed with proteolytic enzymes, in vitro. β-Casein variants (A1A1, A1A2 and A2A2) were isolated from milk samples of genotyped Karan Fries animals and subjected to hydrolysis by SGID using proteolytic enzymes (pepsin, trypsin, chymotrypsin and pancreatin), in vitro. Detection of BCMs were carried out in two peptide fractions (A and B) of RP-HPLC collected at retention time (RT) 24 and 28min respectively corresponding to standard BCM-5 and BCM-7 by MS-MS and competitive ELISA. One of the RP-HPLC fractions (B) showed the presence of 14 amino acid peptide (VYPFPGPIHNSLPQ) having encrypted internal BCMs sequence while no such peptide or precursor was observed in fraction A by MS-MS analysis. Further hydrolysis of fraction B of A1A1 and A1A2 variants of β-casein with elastase and leucine aminopeptidase revealed the release of BCM-7 by competitive ELISA. The yield of BCM-7 (0.20±0.02mg/g β-casein) from A1A1 variant was observed to be almost 3.2 times more than A1A2 variant of β-casein. However, release of BCM-7/5 could not be detected from A2A2 variant of β-casein. The biological activity of released peptides on rat ileum by isolated organ bath from A1A1 (IC50=0.534-0.595μM) and A1A2 (IC50=0.410-0.420μM) hydrolysates further confirmed the presence of opioid peptide BCM-7. Copyright © 2014 Elsevier Ltd. All rights reserved.

Utility of Post-Mortem Genetic Testing in Cases of Sudden Arrhythmic Death Syndrome.

PubMed

Lahrouchi, Najim; Raju, Hariharan; Lodder, Elisabeth M; Papatheodorou, Efstathios; Ware, James S; Papadakis, Michael; Tadros, Rafik; Cole, Della; Skinner, Jonathan R; Crawford, Jackie; Love, Donald R; Pua, Chee J; Soh, Bee Y; Bhalshankar, Jaydutt D; Govind, Risha; Tfelt-Hansen, Jacob; Winkel, Bo G; van der Werf, Christian; Wijeyeratne, Yanushi D; Mellor, Greg; Till, Jan; Cohen, Marta C; Tome-Esteban, Maria; Sharma, Sanjay; Wilde, Arthur A M; Cook, Stuart A; Bezzina, Connie R; Sheppard, Mary N; Behr, Elijah R

2017-05-02

Sudden arrhythmic death syndrome (SADS) describes a sudden death with negative autopsy and toxicological analysis. Cardiac genetic disease is a likely etiology. This study investigated the clinical utility and combined yield of post-mortem genetic testing (molecular autopsy) in cases of SADS and comprehensive clinical evaluation of surviving relatives. We evaluated 302 expertly validated SADS cases with suitable DNA (median age: 24 years; 65% males) who underwent next-generation sequencing using an extended panel of 77 primary electrical disorder and cardiomyopathy genes. Pathogenic and likely pathogenic variants were classified using American College of Medical Genetics (ACMG) consensus guidelines. The yield of combined molecular autopsy and clinical evaluation in 82 surviving families was evaluated. A gene-level rare variant association analysis was conducted in SADS cases versus controls. A clinically actionable pathogenic or likely pathogenic variant was identified in 40 of 302 cases (13%). The main etiologies established were catecholaminergic polymorphic ventricular tachycardia and long QT syndrome (17 [6%] and 11 [4%], respectively). Gene-based rare variants association analysis showed enrichment of rare predicted deleterious variants in RYR2 (p = 5 × 10 -5 ). Combining molecular autopsy with clinical evaluation in surviving families increased diagnostic yield from 26% to 39%. Molecular autopsy for electrical disorder and cardiomyopathy genes, using ACMG guidelines for variant classification, identified a modest but realistic yield in SADS. Our data highlighted the predominant role of catecholaminergic polymorphic ventricular tachycardia and long QT syndrome, especially the RYR2 gene, as well as the minimal yield from other genes. Furthermore, we showed the enhanced utility of combined clinical and genetic evaluation. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Waardenburg syndrome: Novel mutations in a large Brazilian sample.

PubMed

Bocángel, Magnolia Astrid Pretell; Melo, Uirá Souto; Alves, Leandro Ucela; Pardono, Eliete; Lourenço, Naila Cristina Vilaça; Marcolino, Humberto Vicente Cezar; Otto, Paulo Alberto; Mingroni-Netto, Regina Célia

2018-06-01

This paper deals with the molecular investigation of Waardenburg syndrome (WS) in a sample of 49 clinically diagnosed probands (most from southeastern Brazil), 24 of them having the type 1 (WS1) variant (10 familial and 14 isolated cases) and 25 being affected by the type 2 (WS2) variant (five familial and 20 isolated cases). Sequential Sanger sequencing of all coding exons of PAX3, MITF, EDN3, EDNRB, SOX10 and SNAI2 genes, followed by CNV detection by MLPA of PAX3, MITF and SOX10 genes in selected cases revealed many novel pathogenic variants. Molecular screening, performed in all patients, revealed 19 causative variants (19/49 = 38.8%), six of them being large whole-exon deletions detected by MLPA, seven (four missense and three nonsense substitutions) resulting from single nucleotide substitutions (SNV), and six representing small indels. A pair of dizygotic affected female twins presented the c.430delC variant in SOX10, but the mutation, imputed to gonadal mosaicism, was not found in their unaffected parents. At least 10 novel causative mutations, described in this paper, were found in this Brazilian sample. Copy-number-variation detected by MLPA identified the causative mutation in 12.2% of our cases, corresponding to 31.6% of all causative mutations. In the majority of cases, the deletions were sporadic, since they were not present in the parents of isolated cases. Our results, as a whole, reinforce the fact that the screening of copy-number-variants by MLPA is a powerful tool to identify the molecular cause in WS patients. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Assessing interactions between the associations of common genetic susceptibility variants, reproductive history and body mass index with breast cancer risk in the breast cancer association consortium: a combined case-control study

PubMed Central

2010-01-01

Introduction Several common breast cancer genetic susceptibility variants have recently been identified. We aimed to determine how these variants combine with a subset of other known risk factors to influence breast cancer risk in white women of European ancestry using case-control studies participating in the Breast Cancer Association Consortium. Methods We evaluated two-way interactions between each of age at menarche, ever having had a live birth, number of live births, age at first birth and body mass index (BMI) and each of 12 single nucleotide polymorphisms (SNPs) (10q26-rs2981582 (FGFR2), 8q24-rs13281615, 11p15-rs3817198 (LSP1), 5q11-rs889312 (MAP3K1), 16q12-rs3803662 (TOX3), 2q35-rs13387042, 5p12-rs10941679 (MRPS30), 17q23-rs6504950 (COX11), 3p24-rs4973768 (SLC4A7), CASP8-rs17468277, TGFB1-rs1982073 and ESR1-rs3020314). Interactions were tested for by fitting logistic regression models including per-allele and linear trend main effects for SNPs and risk factors, respectively, and single-parameter interaction terms for linear departure from independent multiplicative effects. Results These analyses were applied to data for up to 26,349 invasive breast cancer cases and up to 32,208 controls from 21 case-control studies. No statistical evidence of interaction was observed beyond that expected by chance. Analyses were repeated using data from 11 population-based studies, and results were very similar. Conclusions The relative risks for breast cancer associated with the common susceptibility variants identified to date do not appear to vary across women with different reproductive histories or body mass index (BMI). The assumption of multiplicative combined effects for these established genetic and other risk factors in risk prediction models appears justified. PMID:21194473

Genome-wide association study identifies common and low-frequency variants at the AMH gene locus that strongly predict serum AMH levels in males.

PubMed

Perry, John R B; McMahon, George; Day, Felix R; Ring, Susan M; Nelson, Scott M; Lawlor, Debbie A

2016-01-15

Anti-Müllerian hormone (AMH) is an essential messenger of sexual differentiation in the foetus and is an emerging biomarker of postnatal reproductive function in females. Due to a paucity of adequately sized studies, the genetic determinants of circulating AMH levels are poorly characterized. In samples from 2815 adolescents aged 15 from the ALSPAC study, we performed the first genome-wide association study of serum AMH levels across a set of ∼9 m '1000 Genomes Reference Panel' imputed genetic variants. Genetic variants at the AMH protein-coding gene showed considerable allelic heterogeneity, with both common variants [rs4807216 (P(Male) = 2 × 10(-49), Beta: ∼0.9 SDs per allele), rs8112524 (P(Male) = 3 × 10(-8), Beta: ∼0.25)] and low-frequency variants [rs2385821 (P(Male) = 6 × 10(-31), Beta: ∼1.2, frequency 3.6%)] independently associated with apparently large effect sizes in males, but not females. For all three SNPs, we highlight mechanistic links to AMH gene function and demonstrate highly significant sex interactions (P(Het) 0.0003-6.3 × 10(-12)), culminating in contrasting estimates of trait variance explained (24.5% in males versus 0.8% in females). Using these SNPs as a genetic proxy for AMH levels, we found no evidence in additional datasets to support a biological role for AMH in complex traits and diseases in men. © The Author 2015. Published by Oxford University Press.

Somatic mutation dynamics in MDS patients treated with azacitidine indicate clonal selection in patients-responders

PubMed Central

Polgarova, Kamila; Vargova, Karina; Kulvait, Vojtech; Dusilkova, Nina; Minarik, Lubomir; Zemanova, Zuzana; Pesta, Michal; Jonasova, Anna; Stopka, Tomas

2017-01-01

Azacitidine (AZA) for higher risk MDS patients is a standard therapy with limited durability. To monitor mutation dynamics during AZA therapy we utilized massive parallel sequencing of 54 genes previously associated with MDS/AML pathogenesis. Serial sampling before and during AZA therapy of 38 patients (reaching median overall survival 24 months (Mo) with 60% clinical responses) identified 116 somatic pathogenic variants with allele frequency (VAF) exceeding 5%. High accuracy of data was achieved via duplicate libraries from myeloid cells and T-cell controls. We observed that nearly half of the variants were stable while other variants were highly dynamic. Patients with marked decrease of allelic burden upon AZA therapy achieved clinical responses. In contrast, early-progressing patients on AZA displayed minimal changes of the mutation pattern. We modeled the VAF dynamics on AZA and utilized a joint model for the overall survival and response duration. While the presence of certain variants associated with clinical outcomes, such as the mutations of CDKN2A were adverse predictors while KDM6A mutations yield lower risk of dying, the data also indicate that allelic burden volatility represents additional important prognostic variable. In addition, preceding 5q- syndrome represents strong positive predictor of longer overall survival and response duration in high risk MDS patients treated with AZA. In conclusion, variants dynamics detected via serial sampling represents another parameter to consider when evaluating AZA efficacy and predicting outcome. PMID:29340104

Apolipoprotein L1 and Chronic Kidney Disease Risk in Young Potential Living Kidney Donors.

PubMed

Locke, Jayme E; Sawinski, Deirdre; Reed, Rhiannon D; Shelton, Brittany; MacLennan, Paul A; Kumar, Vineeta; Mehta, Shikha; Mannon, Roslyn B; Gaston, Robert; Julian, Bruce A; Carr, John J; Terry, James G; Kilgore, Meredith; Massie, Allan B; Segev, Dorry L; Lewis, Cora E

2018-06-01

The aim of this study was to develop a novel chronic kidney disease (CKD) risk prediction tool for young potential living kidney donors. Living kidney donor selection practices have evolved from examining individual risk factors to a risk calculator incorporating multiple characteristics. Owing to limited long-term data and lack of genetic information, current risk tools lack precision among young potential living kidney donors, particularly African Americans (AAs). We identified a cohort of young adults (18-30 years) with no absolute contraindication to kidney donation from the longitudinal cohort study Coronary Artery Risk Development in Young Adults. Risk associations for CKD (estimated glomerular filtration rate <60 mL/min/1.73 m) were identified and assigned weighted points to calculate risk scores. A total of 3438 healthy adults were identified [mean age 24.8 years; 48.3% AA; median follow-up 24.9 years (interquartile range: 24.5-25.2)]. For 18-year olds, 25-year projected CKD risk varied by ethnicity and sex even without baseline clinical and genetic abnormalities; risk was 0.30% for European American (EA) women, 0.52% for EA men, 0.52% for AA women, 0.90% for AA men. Among 18-year-old AAs with apolipoprotein L1 gene (APOL1) renal-risk variants without baseline abnormalities, 25-year risk significantly increased: 1.46% for women and 2.53% for men; among those with 2 APOL1 renal-risk variants and baseline abnormalities, 25-year risk was higher: 2.53% to 6.23% for women and 4.35% to 10.58% for men. Young AAs were at highest risk for CKD, and APOL1 renal-risk variants drove some of this risk. Understanding the genetic profile of young AA potential living kidney donors in the context of baseline health characteristics may help to inform candidate selection and counseling.

HapFABIA: Identification of very short segments of identity by descent characterized by rare variants in large sequencing data

PubMed Central

Hochreiter, Sepp

2013-01-01

Identity by descent (IBD) can be reliably detected for long shared DNA segments, which are found in related individuals. However, many studies contain cohorts of unrelated individuals that share only short IBD segments. New sequencing technologies facilitate identification of short IBD segments through rare variants, which convey more information on IBD than common variants. Current IBD detection methods, however, are not designed to use rare variants for the detection of short IBD segments. Short IBD segments reveal genetic structures at high resolution. Therefore, they can help to improve imputation and phasing, to increase genotyping accuracy for low-coverage sequencing and to increase the power of association studies. Since short IBD segments are further assumed to be old, they can shed light on the evolutionary history of humans. We propose HapFABIA, a computational method that applies biclustering to identify very short IBD segments characterized by rare variants. HapFABIA is designed to detect short IBD segments in genotype data that were obtained from next-generation sequencing, but can also be applied to DNA microarray data. Especially in next-generation sequencing data, HapFABIA exploits rare variants for IBD detection. HapFABIA significantly outperformed competing algorithms at detecting short IBD segments on artificial and simulated data with rare variants. HapFABIA identified 160 588 different short IBD segments characterized by rare variants with a median length of 23 kb (mean 24 kb) in data for chromosome 1 of the 1000 Genomes Project. These short IBD segments contain 752 000 single nucleotide variants (SNVs), which account for 39% of the rare variants and 23.5% of all variants. The vast majority—152 000 IBD segments—are shared by Africans, while only 19 000 and 11 000 are shared by Europeans and Asians, respectively. IBD segments that match the Denisova or the Neandertal genome are found significantly more often in Asians and Europeans but also, in some cases exclusively, in Africans. The lengths of IBD segments and their sharing between continental populations indicate that many short IBD segments from chromosome 1 existed before humans migrated out of Africa. Thus, rare variants that tag these short IBD segments predate human migration from Africa. The software package HapFABIA is available from Bioconductor. All data sets, result files and programs for data simulation, preprocessing and evaluation are supplied at http://www.bioinf.jku.at/research/short-IBD. PMID:24174545

Assessing the Pathogenicity of Insertion and Deletion Variants with the Variant Effect Scoring Tool (VEST‐Indel)

PubMed Central

Douville, Christopher; Masica, David L.; Stenson, Peter D.; Cooper, David N.; Gygax, Derek M.; Kim, Rick; Ryan, Michael

2015-01-01

ABSTRACT Insertion/deletion variants (indels) alter protein sequence and length, yet are highly prevalent in healthy populations, presenting a challenge to bioinformatics classifiers. Commonly used features—DNA and protein sequence conservation, indel length, and occurrence in repeat regions—are useful for inference of protein damage. However, these features can cause false positives when predicting the impact of indels on disease. Existing methods for indel classification suffer from low specificities, severely limiting clinical utility. Here, we further develop our variant effect scoring tool (VEST) to include the classification of in‐frame and frameshift indels (VEST‐indel) as pathogenic or benign. We apply 24 features, including a new “PubMed” feature, to estimate a gene's importance in human disease. When compared with four existing indel classifiers, our method achieves a drastically reduced false‐positive rate, improving specificity by as much as 90%. This approach of estimating gene importance might be generally applicable to missense and other bioinformatics pathogenicity predictors, which often fail to achieve high specificity. Finally, we tested all possible meta‐predictors that can be obtained from combining the four different indel classifiers using Boolean conjunctions and disjunctions, and derived a meta‐predictor with improved performance over any individual method. PMID:26442818

Assessing the Pathogenicity of Insertion and Deletion Variants with the Variant Effect Scoring Tool (VEST-Indel).

PubMed

Douville, Christopher; Masica, David L; Stenson, Peter D; Cooper, David N; Gygax, Derek M; Kim, Rick; Ryan, Michael; Karchin, Rachel

2016-01-01

Insertion/deletion variants (indels) alter protein sequence and length, yet are highly prevalent in healthy populations, presenting a challenge to bioinformatics classifiers. Commonly used features--DNA and protein sequence conservation, indel length, and occurrence in repeat regions--are useful for inference of protein damage. However, these features can cause false positives when predicting the impact of indels on disease. Existing methods for indel classification suffer from low specificities, severely limiting clinical utility. Here, we further develop our variant effect scoring tool (VEST) to include the classification of in-frame and frameshift indels (VEST-indel) as pathogenic or benign. We apply 24 features, including a new "PubMed" feature, to estimate a gene's importance in human disease. When compared with four existing indel classifiers, our method achieves a drastically reduced false-positive rate, improving specificity by as much as 90%. This approach of estimating gene importance might be generally applicable to missense and other bioinformatics pathogenicity predictors, which often fail to achieve high specificity. Finally, we tested all possible meta-predictors that can be obtained from combining the four different indel classifiers using Boolean conjunctions and disjunctions, and derived a meta-predictor with improved performance over any individual method. © 2015 The Authors. **Human Mutation published by Wiley Periodicals, Inc.

Carvedilol has stronger anti-inflammation and anti-virus effects than metoprolol in murine model with coxsackievirus B3-induced viral myocarditis.

PubMed

Wang, Dan; Chen, Yiming; Jiang, Jianbin; Zhou, Aihua; Pan, Lulu; Chen, Qi; Qian, Yan; Chu, Maoping; Chen, Chao

2014-09-01

This study aims to compare the effects of carvedilol and metoprolol in alleviating viral myocarditis (VMC) induced by coxsackievirus B3 (CVB3) in mice. A total of 116 Balb/c mice were included in this study. Ninety-six mice were inoculated intraperitoneally with CVB3 to induce VMC. The CVB3 inoculated mice were evenly divided into myocarditis group (n=32), carvedilol group (n=32) and metoprolol group (n=32). Twenty mice (control group) were inoculated intraperitoneally with normal saline. Hematoxylin and eosin staining and histopathologic scoring were used to investigate the effects of carvedilol and metoprolol on myocardial histopathologic changes on days 3 and 5. In addition, serum cTn-I levels, cytokine levels and virus titers were determined using chemiluminescence immunoassay, enzyme-linked immunosorbent assay and plaque assay, respectively, on days 3 and 5. Finally, the levels of phosphorylated p38MAPK were studied using immunohistochemical staining and Western blotting on day 5. Carvedilol had a stronger effect than metoprolol in reducing the pathological scores of VMC induced by CVB3. Both carvedilol and metoprolol reduced the levels of cTn-I, but the effect of carvedilol was stronger. Carvedilol and metoprolol decreased the levels of myocardial pro-inflammatory cytokines and increased the expression of anti-inflammatory cytokine, with the effects of carvedilol being stronger than those of metoprolol. Carvedilol had a stronger effect in reducing myocardial virus concentration compared with metoprolol. Carvedilol was stronger than metoprolol in decreasing the levels of myocardial phosphorylated p38MAPK. In conclusion, carvedilol was more potent than metoprolol in ameliorating myocardial lesions in VMC, probably due to its stronger modulation of the balance between pro- and anti-inflammatory cytokines by inhibiting the activation of p38MAPK pathway through β1- and β2-adrenoreceptors. Copyright © 2014 Elsevier B.V. All rights reserved.

Altered Antibody Profiles against Common Infectious Agents in Chronic Disease

PubMed Central

Burbelo, Peter D.; Ching, Kathryn H.; Morse, Caryn G.; Alevizos, Ilias; Bayat, Ahmad; Cohen, Jeffrey I.; Ali, Mir A.; Kapoor, Amit; Browne, Sarah K.; Holland, Steven M.; Kovacs, Joseph A.; Iadarola, Michael J.

2013-01-01

Despite the important diagnostic value of evaluating antibody responses to individual human pathogens, antibody profiles against multiple infectious agents have not been used to explore health and disease mainly for technical reasons.  We hypothesized that the interplay between infection and chronic disease might be revealed by profiling antibodies against multiple agents. Here, the levels of antibodies against a panel of 13 common infectious agents were evaluated with the quantitative Luciferase Immunoprecipitation Systems (LIPS) in patients from three disease cohorts including those with pathogenic anti-interferon-γ autoantibodies (IFN-γ AAB), HIV and Sjögren’s syndrome (SjS) to determine if their antibody profiles differed from control subjects.  The IFN-γ AAB patients compared to controls demonstrated statistically higher levels of antibodies against VZV (p=0.0003), EBV (p=0.002), CMV (p=0.003), and C. albicans (p=0.03), but lower antibody levels against poliovirus (p=0.04). Comparison of HIV patients with blood donor controls revealed that the patients had higher levels of antibodies against CMV (p=0.0008), HSV-2 (p=0.0008), EBV (p=0.001), and C. albicans (p=0.01), but showed decreased levels of antibodies against coxsackievirus B4 (p=0.0008), poliovirus (p=0.0005),   and HHV-6B (p=0.002). Lastly, SjS patients had higher levels of anti-EBV antibodies (p=0.03), but lower antibody levels against several enteroviruses including a newly identified picornavirus, HCoSV-A (p=0.004), coxsackievirus B4 (p=0.04), and poliovirus (p=0.02). For the IFN-γ AAB and HIV cohorts, principal component analysis revealed unique antibody clusters that showed the potential to discriminate patients from controls.  The results suggest that antibody profiles against these and likely other common infectious agents may yield insight into the interplay between exposure to infectious agents, dysbiosis, adaptive immunity and disease activity. PMID:24312567

Mesenchymal Stromal Cells Modulate Monocytes Trafficking in Coxsackievirus B3‐Induced Myocarditis

PubMed Central

Miteva, Kapka; Pappritz, Kathleen; El‐Shafeey, Muhammad; Dong, Fengquan; Ringe, Jochen; Tschöpe, Carsten

2017-01-01

Abstract Mesenchymal stromal cell (MSC) application in Coxsackievirus B3 (CVB3)‐induced myocarditis reduces myocardial inflammation and fibrosis, exerts prominent extra‐cardiac immunomodulation, and improves heart function. Although the abovementioned findings demonstrate the benefit of MSC application, the mechanism of the MSC immunomodulatory effects leading to a final cardioprotective outcome in viral myocarditis remains poorly understood. Monocytes are known to be a trigger of myocardial tissue inflammation. The present study aims at investigating the direct effect of MSC on the mobilization and trafficking of monocytes to the heart in CVB3‐induced myocarditis. One day post CVB3 infection, C57BL/6 mice were intravenously injected with 1 x 106 MSC and sacrificed 6 days later for molecular biology and flow cytometry analysis. MSC application reduced the severity of myocarditis, and heart and blood pro‐inflammatory Ly6Chigh and Ly6Cmiddle monocytes, while those were retained in the spleen. Anti‐inflammatory Ly6Clow monocytes increased in the blood, heart, and spleen of MSC‐treated CVB3 mice. CVB3 infection induced splenic myelopoiesis, while MSC application slightly diminished the spleen myelopoietic activity in CVB3 mice. Left ventricular (LV) mRNA expression of the chemokines monocyte chemotactic protein‐1 (MCP)−1, MCP‐3, CCL5, the adhesion molecules intercellular adhesion molecule‐1, vascular cell adhesion molecule‐1, the pro‐inflammatory cytokines interleukin‐6, interleukin‐12, tumor necrosis factor‐α, the pro‐fibrotic transforming growth factorβ1, and circulating MCP‐1 and MCP‐3 levels decreased in CVB3 MSC mice, while LV stromal cell‐derived factor‐1α RNA expression and systemic levels of fractalkine were increased in CVB3 MSC mice. MSC application in CVB3‐induced myocarditis modulates monocytes trafficking to the heart and could be a promising strategy for the resolution of cardiac inflammation and prevention of the disease progression. Stem Cells Translational Medicine 2017;6:1249–1261 PMID:28186704

Design, Synthesis, and Crystal Structures of 6-Alkylidene-2 -Substituted Penicillanic Acid Sulfones as Potent Inhibitors of Acinetobacter baumannii OXA-24 Carbapenemase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bou, G.; Santillana, E; Sheri, A

Class D {beta}-lactamases represent a growing and diverse class of penicillin-inactivating enzymes that are usually resistant to commercial {beta}-lactamase inhibitors. As many such enzymes are found in multi-drug resistant (MDR) Acinetobacter baumannii and Pseudomonas aeruginosa, novel {beta}-lactamase inhibitors are urgently needed. Five unique 6-alkylidene-2{prime}-substituted penicillanic acid sulfones (1-5) were synthesized and tested against OXA-24, a clinically important {beta}-lactamase that inactivates carbapenems and is found in A. baumannii. Based upon the roles Tyr112 and Met223 play in the OXA-24 {beta}-lactamase, we also engineered two variants (Tyr112Ala and Tyr112Ala,Met223Ala) to test the hypothesis that the hydrophobic tunnel formed by these residues influencesmore » inhibitor recognition. IC{sub 50} values against OXA-24 and two OXA-24 {beta}-lactamase variants ranged from 10 {+-} 1 (4 vs WT) to 338 {+-} 20 nM (5 vs Tyr112Ala, Met223Ala). Compound 4 possessed the lowest K{sub i} (500 {+-} 80 nM vs WT), and 1 possessed the highest inactivation efficiency (k{sub inact}/K{sub i} = 0.21 {+-} 0.02 {micro}M{sup -1}s{sup -1}). Electrospray ionization mass spectrometry revealed a single covalent adduct, suggesting the formation of an acyl-enzyme intermediate. X-ray structures of OXA-24 complexed to four inhibitors (2.0-2.6 {angstrom}) reveal the formation of stable bicyclic aromatic intermediates with their carbonyl oxygen in the oxyanion hole. These data provide the first structural evidence that 6-alkylidene-2{prime}-substituted penicillin sulfones are effective mechanism-based inactivators of class D {beta}-lactamases. Their unique chemistry makes them developmental candidates. Mechanisms for class D hydrolysis and inhibition are discussed, and a pathway for the evolution of the BlaR1 sensor of Staphylococcus aureus to the class D {beta}-lactamases is proposed.« less

Herpes Simplex Virus Type 2 Glycoprotein G Is Targeted by the Sulfated Oligo- and Polysaccharide Inhibitors of Virus Attachment to Cells▿

PubMed Central

Adamiak, Beata; Ekblad, Maria; Bergström, Tomas; Ferro, Vito; Trybala, Edward

2007-01-01

Variants of herpes simplex virus type 2 (HSV-2) generated by virus passage in GMK-AH1 cells in the presence of the sulfated oligosaccharide PI-88 were analyzed. Many of these variants were substantially resistant to PI-88 in their initial infection of cells and/or their cell-to-cell spread. The major alteration detected in all variants resistant to PI-88 in the initial infection of cells was a frameshift mutation(s) in the glycoprotein G (gG) gene that resulted in the lack of protein expression. Molecular transfer of the altered gG gene into the wild-type background confirmed that the gG-deficient recombinants were resistant to PI-88. In addition to PI-88, all gG-deficient variants of HSV-2 were resistant to the sulfated polysaccharide heparin. The gG-deficient virions were capable of attaching to cells, and this activity was relatively resistant to PI-88. In addition to having a drug-resistant phenotype, the gG-deficient variants were inefficiently released from infected cells. Purified gG bound to heparin and showed the cell-binding activity which was inhibited by PI-88. Many PI-88 variants produced syncytia in cultured cells and contained alterations in gB, including the syncytium-inducing L792P amino acid substitution. Although this phenotype can enhance the lateral spread of HSV in cells, it conferred no virus resistance to PI-88. Some PI-88 variants also contained occasional alterations in gC, gD, gE, gK, and UL24. In conclusion, we found that glycoprotein gG, a mucin-like component of the HSV-2 envelope, was targeted by sulfated oligo- and polysaccharides. This is a novel finding that suggests the involvement of HSV-2 gG in interactions with sulfated polysaccharides, including cell surface glycosaminoglycans. PMID:17928351

In1-ghrelin splicing variant is overexpressed in pituitary adenomas and increases their aggressive features.

PubMed

Ibáñez-Costa, Alejandro; Gahete, Manuel D; Rivero-Cortés, Esther; Rincón-Fernández, David; Nelson, Richard; Beltrán, Manuel; de la Riva, Andrés; Japón, Miguel A; Venegas-Moreno, Eva; Gálvez, Ma Ángeles; García-Arnés, Juan A; Soto-Moreno, Alfonso; Morgan, Jennifer; Tsomaia, Natia; Culler, Michael D; Dieguez, Carlos; Castaño, Justo P; Luque, Raúl M

2015-03-04

Pituitary adenomas comprise a heterogeneous subset of pathologies causing serious comorbidities, which would benefit from identification of novel, common molecular/cellular biomarkers and therapeutic targets. The ghrelin system has been linked to development of certain endocrine-related cancers. Systematic analysis of the presence and functional implications of some components of the ghrelin system, including native ghrelin, receptors and the recently discovered splicing variant In1-ghrelin, in human normal pituitaries (n = 11) and pituitary adenomas (n = 169) revealed that expression pattern of ghrelin system suffers a clear alteration in pituitary adenomasas compared with normal pituitary, where In1-ghrelin is markedly overexpressed. Interestingly, in cultured pituitary adenoma cells In1-ghrelin treatment (acylated peptides at 100 nM; 24-72 h) increased GH and ACTH secretion, Ca(2+) and ERK1/2 signaling and cell viability, whereas In1-ghrelin silencing (using a specific siRNA; 100 nM) reduced cell viability. These results indicate that an alteration of the ghrelin system, specially its In1-ghrelin variant, could contribute to pathogenesis of different pituitary adenomas types, and suggest that this variant and its related ghrelin system could provide new tools to identify novel, more general diagnostic, prognostic and potential therapeutic targets in pituitary tumors.

In1-ghrelin splicing variant is overexpressed in pituitary adenomas and increases their aggressive features

PubMed Central

Ibáñez-Costa, Alejandro; Gahete, Manuel D.; Rivero-Cortés, Esther; Rincón-Fernández, David; Nelson, Richard; Beltrán, Manuel; de la Riva, Andrés; Japón, Miguel A.; Venegas-Moreno, Eva; Gálvez, Ma Ángeles; García-Arnés, Juan A.; Soto-Moreno, Alfonso; Morgan, Jennifer; Tsomaia, Natia; Culler, Michael D.; Dieguez, Carlos; Castaño, Justo P.; Luque, Raúl M.

2015-01-01

Pituitary adenomas comprise a heterogeneous subset of pathologies causing serious comorbidities, which would benefit from identification of novel, common molecular/cellular biomarkers and therapeutic targets. The ghrelin system has been linked to development of certain endocrine-related cancers. Systematic analysis of the presence and functional implications of some components of the ghrelin system, including native ghrelin, receptors and the recently discovered splicing variant In1-ghrelin, in human normal pituitaries (n = 11) and pituitary adenomas (n = 169) revealed that expression pattern of ghrelin system suffers a clear alteration in pituitary adenomasas comparedwith normal pituitary, where In1-ghrelin is markedly overexpressed. Interestingly, in cultured pituitary adenoma cells In1-ghrelin treatment (acylated peptides at 100 nM; 24–72 h) increased GH and ACTH secretion, Ca2+ and ERK1/2 signaling and cell viability, whereas In1-ghrelin silencing (using a specific siRNA; 100 nM) reduced cell viability. These results indicate that an alteration of the ghrelin system, specially its In1-ghrelin variant, could contribute to pathogenesis of different pituitary adenomas types, and suggest that this variant and its related ghrelin system could provide new tools to identify novel, more general diagnostic, prognostic and potential therapeutic targets in pituitary tumors. PMID:25737012

Salivary anti-coxsackievirus-B4 neutralizing activity and pattern of immune parameters in patients with type 1 diabetes: a pilot study.

PubMed

Nekoua, Magloire Pandoua; Yessoufou, Akadiri; Alidjinou, Enagnon Kazali; Badia-Boungou, Francis; Moutairou, Kabirou; Sane, Famara; Hober, Didier

2018-05-17

Enteroviruses, especially coxsackieviruses B (CV-B), have been associated with the pathogenesis of type 1 diabetes (T1D). An anti-CV-B4 neutralizing activity in saliva of T1D patients was previously reported. Our aim was to study the association between the saliva anti-CV-B4 neutralizing activity and immune parameters in T1D patients in comparison with non-diabetic individuals. Saliva and blood samples were collected from 15 T1D patients and 8 controls. The anti-CV-B4 and anti-poliovirus type 1 (PV-1) activities of saliva and serum samples were determined by a plaque neutralization assay. Quantification of serum cytokines was performed by ELISA and the frequencies of lymphocyte subsets were evaluated using flow cytometry. The levels of salivary anti-CV-B4 neutralizing activity were higher in T1D patients than in controls (p = 0.02), whereas the serum levels of anti-CV-B4 neutralizing activity and the saliva and serum levels of anti-PV-1 neutralizing activity were not different. The proportions of effector CD4 + T cells and CD19 + B cells, but not those of CD4 + T cells, CD8 + T cells and Foxp3 + regulatory T cells, were higher in T1D patients than in controls (p = 0.02 and p = 0.01 respectively). Moreover, serum IFN-γ levels were lower in T1D patients compared to controls (p = 0.03) while IL-4 and IL-10 were not different. There was an association between saliva anti-CV-B4 activity, down-regulation of IFN-γ and B cell expansion in peripheral blood of T1D patients. The association between saliva anti-CV-B4 activity and disturbance of immune system in T1D patients deserves further investigation.

The Arg72 variant of the p53 functional polymorphism (rs1042522) is associated with coronary artery disease in young South Africans of Indian ancestry.

PubMed

Khan, Sajidah; Phulukdaree, Alisa; Ramkaran, Prithiksha; Moodley, Devapregasan; Chuturgoon, Anil A

2016-11-30

Tumor protein p53 (p53), classically referred to as a tumor suppressor gene, is involved in cell cycle regulation and may be related to atherosclerosis by affecting smooth muscle cell proliferation, a feature of atherogenesis. A polymorphism at codon 72 (rs1042522) results in functional variability and hence plays a role in the pathophysiology of coronary artery disease (CAD). This polymorphism has been well established for its role in cancer and has only recently been investigated in CAD. Limited data is available on South Africans (SA) of Indian ancestry. We examined associations of this polymorphism and clinical markers in a cohort of young SA Indian CAD patients. A total of 284 subjects were recruited into this study which included 100 CAD patients (diagnosed on angiography, mean age 37.5, range 24-45years), 100 age- and sex-matched Indian controls and 84 age- and sex-matched Black controls. Polymorphic variants were assessed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Data for clinical markers were obtained from pathology reports. Genotype distribution differed significantly between CAD patients and Indian controls (Pro/Pro, Pro/Arg, Arg/Arg: 24%, 48%, 28% vs. 30%, 61%, 9% respectively, p=0.0025). There was a significant genotype distribution between Indian and Black controls (Pro/Pro, Pro/Arg, Arg/Arg: 30%, 61%, 9% vs. 45.2% 40.5%, 14.3% respectively, p=0.0212). A significantly higher frequency of the p53 Arg72 allele was found in CAD patients compared to controls (52% vs. 39.5% respectively, p=0.0159). The variant allele was slightly higher in Indian controls (39.5%) compared to Black controls (34.5%), but this did not reach statistical significance (p=0.3324). The levels of total cholesterol, LDL, HDL, triglycerides, fasting glucose, fasting insulin and %HbA1c were not significantly influenced by the p53 genotypic variants. Although the p53 codon 72 SNP is not associated with clinical markers of disease in CAD, the higher frequency of the variant allele in SA Indians may be a contributing factor for this population having an increased risk of developing premature CAD. Copyright © 2016. Published by Elsevier B.V.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Ze; Shuldiner, A.R.; Zenilman, M.E.

There are two insulin receptor (IR) isoforms (designated type A and type B), derived from alternative splicing of exon 11 of the IR gene. Recently, we reported that an increase in the exon 11- (i.e. lacking exon 11) (type A) IR messenger RNA (mRNA) variant in muscle is associated with hyperinsulinemia, an early risk factor for noninsulin-dependent diabetes mellitus (NIDDM), in the spontaneously obese, diabetic rhesus monkey. To explore further the role of IR mRNA splicing in insulin resistance of NIDDM, we studied liver, another target organ that is resistant to insulin action in NIDDM. The relative amounts of themore » two IR mRNA-splicing variants in liver were quantitated by RT-PCR in normal, prediabetic, and diabetic (NIDDM) monkeys. The percentage of the exon 11- mRNA variant in liver (n = 24) was significantly correlated with fasting plasma glucose (r = 0.55, P < 0.01) and intravenous glucose disappearance rate (r = -0.45, P < 0.05). The exon 11- mRNA variant was increased significantly from 29.8 {+-} 1.6% in monkeys with normal fasting glucose to 39.2 {+-} 2.9% in monkeys with elevated fasting glucose (P < 0.01). These studies provide the first direct evidence in vivo that the relative expression of the two IR mRNA-splicing variants is altered in liver and suggest that increased expression of the exon 11- IR isoform may contribute to hepatic insulin resistance and NIDDM or may compensate for some yet unidentified defect. 33 refs., 3 figs., 1 tab.« less

Positive association between KCNJ5 rs2604204 (A/C) polymorphism and plasma aldosterone levels, but also plasma renin and angiotensin I and II levels, in newly diagnosed hypertensive Chinese: a case-control study.

PubMed

Wang, H; Weng, C; Chen, H

2017-07-01

Variants in G protein-coupled inward rectifier K + channels 4 (GIRK4 also known as KCNJ5) gene are associated with primary aldosteronism, which is the most common cause of secondary hypertension. The KCNJ5 rs2604204 variant was shown to be common (minor allele frequency=32.5%) in Chinese patients with essential hypertension (EH). The relationship between KCNJ5 variant and plasma aldosterone (ALD) levels in EH patients has not been reported. We collected 229 patients with newly diagnosed EH without any antihypertensive agents. According to the median standing plasma ALD, high-ALD and control groups were divided. Clinical data and blood samples were collected. KCNJ5 rs2604204 genotype was determined by PCR. The results showed that the levels of triglyceride, uric acid, insulin, insulin resistance (IR) index, renin, angiotensin I (Ang I), angiotensin II (Ang II), cortisol, 24 h mean systolic blood pressure (SBP) and daytime mean SBP were significantly increased in the high-ALD group than those in the control group, as well as 24 h s.d. of SBP and diastolic BP (DBP), and 24 h coefficient of variance of SBP and DBP. Notably, the distribution frequency of AC and CC genotypes, and the C allele of KCNJ5 were also significantly higher in the high-ALD group. Logistic regression analysis showed that the C allele of KCNJ5 rs2604204 was one risk factor for increased plasma ALD in Chinese EH patients (P=0.008, odds ratio=2.2 (95% confidence interval 1.2-4.1)). Our findings indicated that the variation of plasma ALD might be associated with increased IR and BP variability. Moreover, KCNJ5 rs2604204 polymorphism was related to increased plasma ALD level, but also plasma renin, Ang I and II levels in newly diagnosed, never-treated EH patients.

The IRF5-TNPO3 association with systemic lupus erythematosus has two components that other autoimmune disorders variably share.

PubMed

Kottyan, Leah C; Zoller, Erin E; Bene, Jessica; Lu, Xiaoming; Kelly, Jennifer A; Rupert, Andrew M; Lessard, Christopher J; Vaughn, Samuel E; Marion, Miranda; Weirauch, Matthew T; Namjou, Bahram; Adler, Adam; Rasmussen, Astrid; Glenn, Stuart; Montgomery, Courtney G; Hirschfield, Gideon M; Xie, Gang; Coltescu, Catalina; Amos, Chris; Li, He; Ice, John A; Nath, Swapan K; Mariette, Xavier; Bowman, Simon; Rischmueller, Maureen; Lester, Sue; Brun, Johan G; Gøransson, Lasse G; Harboe, Erna; Omdal, Roald; Cunninghame-Graham, Deborah S; Vyse, Tim; Miceli-Richard, Corinne; Brennan, Michael T; Lessard, James A; Wahren-Herlenius, Marie; Kvarnström, Marika; Illei, Gabor G; Witte, Torsten; Jonsson, Roland; Eriksson, Per; Nordmark, Gunnel; Ng, Wan-Fai; Anaya, Juan-Manuel; Rhodus, Nelson L; Segal, Barbara M; Merrill, Joan T; James, Judith A; Guthridge, Joel M; Scofield, R Hal; Alarcon-Riquelme, Marta; Bae, Sang-Cheol; Boackle, Susan A; Criswell, Lindsey A; Gilkeson, Gary; Kamen, Diane L; Jacob, Chaim O; Kimberly, Robert; Brown, Elizabeth; Edberg, Jeffrey; Alarcón, Graciela S; Reveille, John D; Vilá, Luis M; Petri, Michelle; Ramsey-Goldman, Rosalind; Freedman, Barry I; Niewold, Timothy; Stevens, Anne M; Tsao, Betty P; Ying, Jun; Mayes, Maureen D; Gorlova, Olga Y; Wakeland, Ward; Radstake, Timothy; Martin, Ezequiel; Martin, Javier; Siminovitch, Katherine; Moser Sivils, Kathy L; Gaffney, Patrick M; Langefeld, Carl D; Harley, John B; Kaufman, Kenneth M

2015-01-15

Exploiting genotyping, DNA sequencing, imputation and trans-ancestral mapping, we used Bayesian and frequentist approaches to model the IRF5-TNPO3 locus association, now implicated in two immunotherapies and seven autoimmune diseases. Specifically, in systemic lupus erythematosus (SLE), we resolved separate associations in the IRF5 promoter (all ancestries) and with an extended European haplotype. We captured 3230 IRF5-TNPO3 high-quality, common variants across 5 ethnicities in 8395 SLE cases and 7367 controls. The genetic effect from the IRF5 promoter can be explained by any one of four variants in 5.7 kb (P-valuemeta = 6 × 10(-49); OR = 1.38-1.97). The second genetic effect spanned an 85.5-kb, 24-variant haplotype that included the genes IRF5 and TNPO3 (P-valuesEU = 10(-27)-10(-32), OR = 1.7-1.81). Many variants at the IRF5 locus with previously assigned biological function are not members of either final credible set of potential causal variants identified herein. In addition to the known biologically functional variants, we demonstrated that the risk allele of rs4728142, a variant in the promoter among the lowest frequentist probability and highest Bayesian posterior probability, was correlated with IRF5 expression and differentially binds the transcription factor ZBTB3. Our analytical strategy provides a novel framework for future studies aimed at dissecting etiological genetic effects. Finally, both SLE elements of the statistical model appear to operate in Sjögren's syndrome and systemic sclerosis whereas only the IRF5-TNPO3 gene-spanning haplotype is associated with primary biliary cirrhosis, demonstrating the nuance of similarity and difference in autoimmune disease risk mechanisms at IRF5-TNPO3. Published by Oxford University Press 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Pathogenic Variants in Complement Genes and Risk of Atypical Hemolytic Uremic Syndrome Relapse after Eculizumab Discontinuation.

PubMed

Fakhouri, Fadi; Fila, Marc; Provôt, François; Delmas, Yahsou; Barbet, Christelle; Châtelet, Valérie; Rafat, Cédric; Cailliez, Mathilde; Hogan, Julien; Servais, Aude; Karras, Alexandre; Makdassi, Raifah; Louillet, Feriell; Coindre, Jean-Philippe; Rondeau, Eric; Loirat, Chantal; Frémeaux-Bacchi, Véronique

2017-01-06

The complement inhibitor eculizumab has dramatically improved the outcome of atypical hemolytic uremic syndrome. However, the optimal duration of eculizumab treatment in atypical hemolytic uremic syndrome remains debated. We report on the French atypical hemolytic uremic syndrome working group's first 2-year experience with eculizumab discontinuation in patients with atypical hemolytic uremic syndrome. Using the French atypical hemolytic uremic syndrome registry database, we retrospectively identified all dialysis-free patients with atypical hemolytic uremic syndrome who discontinued eculizumab between 2010 and 2014 and reviewed their relevant clinical and biologic data. The decision to discontinue eculizumab was made by the clinician in charge of the patient. All patients were closely monitored by regular urine dipsticks and blood tests. Eculizumab was rapidly (24-48 hours) restarted in case of relapse. Among 108 patients treated with eculizumab, 38 patients (nine children and 29 adults) discontinued eculizumab (median treatment duration of 17.5 months). Twenty-one patients (55%) carried novel or rare complement genes variants. Renal recovery under eculizumab was equally good in patients with and those without complement gene variants detected. After a median follow-up of 22 months, 12 patients (31%) experienced atypical hemolytic uremic syndrome relapse. Eight of 11 patients (72%) with complement factor H variants, four of eight patients (50%) with membrane cofactor protein variants, and zero of 16 patients with no rare variant detected relapsed. In relapsing patients, early reintroduction (≤48 hours) of eculizumab led to rapid (<7 days) hematologic remission and a return of serum creatinine to baseline level in a median time of 26 days. At last follow-up, renal function remained unchanged in nonrelapsing and relapsing patients compared with baseline values before eculizumab discontinuation. Pathogenic variants in complement genes were associated with higher risk of atypical hemolytic uremic syndrome relapse after eculizumab discontinuation. Prospective studies are needed to identify biomarkers predictive of relapse and determine the best strategy of retreatment in relapsing patients. Copyright © 2016 by the American Society of Nephrology.

Low density lipoprotein receptor related protein-1 and 6 gene variants and ischemic stroke risk

PubMed Central

Harriott, Andrea M.; Heckman, Michael G.; Rayaprolu, Sruti; Soto-Ortolaza, Alexandra I.; Diehl, Nancy N.; Kanekiyo, Takahisa; Liu, Chia-Chen; Bu, Guojun; Malik, Rainer; Cole, John W.; Meschia, James F.; Ross, Owen A.

2015-01-01

Background Low density lipoprotein receptor related proteins-1 and 6 have been implicated in cerebral ischemia. In addition, genetic variation in LRP1 and LRP6 has been linked with various factors that are related to risk of ischemic stroke. The aim of this study was to examine the association of LRP1 and LRP6 gene variants with risk of ischemic stroke as part of the Ischemic Stroke Genetics Study (ISGS). Methods We included a Caucasian series (434 stroke patients, 319 controls) and an African American series (161 stroke patients, 116 controls). Fourteen LRP6 variants and 3 LRP1 variants were genotyped and assessed for association with ischemic stroke. Results In the Caucasian series, significant associations with ischemic stroke were observed for LRP6 rs2075241 (OR:0.42, P=0.023), rs2302685 (OR:0.44, P=0.049), rs7975614 (OR: 0.07, P=0.017), rs10492120 (OR: 0.62, P=0.036), and rs10743980 (OR: 0.66, P=0.037). Risk of ischemic stroke was significantly lower for carriers of any of these five protective LRP6 variants (24.0% of subjects) compared to non-carriers (OR:0.57, P=0.003). The protective association for LRP6 rs2075241 was observed at a similar magnitude across ischemic stroke subtypes, while the effects of rs23022685, rs10492120, and rs10743980 were most apparent for cardioembolic and large vessel stroke. In the African American series, LRP1 rs11172113 was associated with an increased risk of stroke (OR:1.89, P=0.006). Conclusions The results of our preliminary study provide evidence that LRP6 and LRP1 variants may be associated with risk of ischemic stroke. Validation in larger studies is warranted. PMID:26031789

Cloning, characterisation, and comparative quantitative expression analyses of receptor for advanced glycation end products (RAGE) transcript forms.

PubMed

Sterenczak, Katharina A; Willenbrock, Saskia; Barann, Matthias; Klemke, Markus; Soller, Jan T; Eberle, Nina; Nolte, Ingo; Bullerdiek, Jörn; Murua Escobar, Hugo

2009-04-01

RAGE is a member of the immunoglobulin superfamily of cell surface molecules playing key roles in pathophysiological processes, e.g. immune/inflammatory disorders, Alzheimer's disease, diabetic arteriosclerosis and tumourigenesis. In humans 19 naturally occurring RAGE splicing variants resulting in either N-terminally or C-terminally truncated proteins were identified and are lately discussed as mechanisms for receptor regulation. Accordingly, deregulation of sRAGE levels has been associated with several diseases e.g. Alzheimer's disease, Type 1 diabetes, and rheumatoid arthritis. Administration of recombinant sRAGE to animal models of cancer blocked tumour growth successfully. In spite of its obvious relationship to cancer and metastasis data focusing sRAGE deregulation and tumours is rare. In this study we screened a set of tumours, healthy tissues and various cancer cell lines for RAGE splicing variants and analysed their structure. Additionally, we analysed the ratio of the mainly found transcript variants using quantitative Real-Time PCR. In total we characterised 24 previously not described canine and 4 human RAGE splicing variants, analysed their structure, classified their characteristics, and derived their respective protein forms. Interestingly, the healthy and the neoplastic tissue samples showed in majority RAGE transcripts coding for the complete receptor and transcripts showing insertions of intron 1.

FTO genetic variants, dietary intake and body mass index: insights from 177,330 individuals.

PubMed

Qi, Qibin; Kilpeläinen, Tuomas O; Downer, Mary K; Tanaka, Toshiko; Smith, Caren E; Sluijs, Ivonne; Sonestedt, Emily; Chu, Audrey Y; Renström, Frida; Lin, Xiaochen; Ängquist, Lars H; Huang, Jinyan; Liu, Zhonghua; Li, Yanping; Asif Ali, Muhammad; Xu, Min; Ahluwalia, Tarunveer Singh; Boer, Jolanda M A; Chen, Peng; Daimon, Makoto; Eriksson, Johan; Perola, Markus; Friedlander, Yechiel; Gao, Yu-Tang; Heppe, Denise H M; Holloway, John W; Houston, Denise K; Kanoni, Stavroula; Kim, Yu-Mi; Laaksonen, Maarit A; Jääskeläinen, Tiina; Lee, Nanette R; Lehtimäki, Terho; Lemaitre, Rozenn N; Lu, Wei; Luben, Robert N; Manichaikul, Ani; Männistö, Satu; Marques-Vidal, Pedro; Monda, Keri L; Ngwa, Julius S; Perusse, Louis; van Rooij, Frank J A; Xiang, Yong-Bing; Wen, Wanqing; Wojczynski, Mary K; Zhu, Jingwen; Borecki, Ingrid B; Bouchard, Claude; Cai, Qiuyin; Cooper, Cyrus; Dedoussis, George V; Deloukas, Panos; Ferrucci, Luigi; Forouhi, Nita G; Hansen, Torben; Christiansen, Lene; Hofman, Albert; Johansson, Ingegerd; Jørgensen, Torben; Karasawa, Shigeru; Khaw, Kay-Tee; Kim, Mi-Kyung; Kristiansson, Kati; Li, Huaixing; Lin, Xu; Liu, Yongmei; Lohman, Kurt K; Long, Jirong; Mikkilä, Vera; Mozaffarian, Dariush; North, Kari; Pedersen, Oluf; Raitakari, Olli; Rissanen, Harri; Tuomilehto, Jaakko; van der Schouw, Yvonne T; Uitterlinden, André G; Zillikens, M Carola; Franco, Oscar H; Shyong Tai, E; Ou Shu, Xiao; Siscovick, David S; Toft, Ulla; Verschuren, W M Monique; Vollenweider, Peter; Wareham, Nicholas J; Witteman, Jacqueline C M; Zheng, Wei; Ridker, Paul M; Kang, Jae H; Liang, Liming; Jensen, Majken K; Curhan, Gary C; Pasquale, Louis R; Hunter, David J; Mohlke, Karen L; Uusitupa, Matti; Cupples, L Adrienne; Rankinen, Tuomo; Orho-Melander, Marju; Wang, Tao; Chasman, Daniel I; Franks, Paul W; Sørensen, Thorkild I A; Hu, Frank B; Loos, Ruth J F; Nettleton, Jennifer A; Qi, Lu

2014-12-20

FTO is the strongest known genetic susceptibility locus for obesity. Experimental studies in animals suggest the potential roles of FTO in regulating food intake. The interactive relation among FTO variants, dietary intake and body mass index (BMI) is complex and results from previous often small-scale studies in humans are highly inconsistent. We performed large-scale analyses based on data from 177,330 adults (154 439 Whites, 5776 African Americans and 17 115 Asians) from 40 studies to examine: (i) the association between the FTO-rs9939609 variant (or a proxy single-nucleotide polymorphism) and total energy and macronutrient intake and (ii) the interaction between the FTO variant and dietary intake on BMI. The minor allele (A-allele) of the FTO-rs9939609 variant was associated with higher BMI in Whites (effect per allele = 0.34 [0.31, 0.37] kg/m(2), P = 1.9 × 10(-105)), and all participants (0.30 [0.30, 0.35] kg/m(2), P = 3.6 × 10(-107)). The BMI-increasing allele of the FTO variant showed a significant association with higher dietary protein intake (effect per allele = 0.08 [0.06, 0.10] %, P = 2.4 × 10(-16)), and relative weak associations with lower total energy intake (-6.4 [-10.1, -2.6] kcal/day, P = 0.001) and lower dietary carbohydrate intake (-0.07 [-0.11, -0.02] %, P = 0.004). The associations with protein (P = 7.5 × 10(-9)) and total energy (P = 0.002) were attenuated but remained significant after adjustment for BMI. We did not find significant interactions between the FTO variant and dietary intake of total energy, protein, carbohydrate or fat on BMI. Our findings suggest a positive association between the BMI-increasing allele of FTO variant and higher dietary protein intake and offer insight into potential link between FTO, dietary protein intake and adiposity. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Effect of Fertilization on Soil Fertility and Nutrient Use Efficiency at Potatoes

NASA Astrophysics Data System (ADS)

Neshev, Nesho; Manolov, Ivan

2016-04-01

The effect of fertilization on soil fertility, yields and nutrient use efficiency of potatoes grown under field experimental conditions was studied. The trail was conducted on shallow brown forest soil (Cambisols-coarse) during the vegetation periods of 2013 to 2015. The variants of the experiment were: control, N140; P80; K100; N140P80; N140K100; P80K100; N140P80K100; N140P80K100Mg33. The applied fertilization slightly decreased soil's pH after the harvest of potatoes compared to the soil pH their planting. Decreasing of pH was more severe at variant N (from 5,80 to 4,19 in 2014). The mineral nitrogen content in the soil after the harvest of potatoes was lower for the variants P, K and PK. The positive effect of fertilization on soil fertility after the end of the trails was more pronounced at variants NPK and NPKMg. The content of available nitrogen, phosphorus and potassium forms for these variants was the highest for each year. The highest content of mineral nitrogen was observed in 2013 (252,5 and 351,1 mg/1000g, respectively for variants NPK and NPKMg). It was due to extremely dry weather conditions during the vegetation in this year. Soil content of mineral N for the next two years was lower. The same tendency was observed for phosphorus and potassium was observed. In 2013 the P2O5 and K2O content in soil was the highest for the variants with full mineral fertilization - NPK (64,4 and 97,6 mg 100g-1 respectively for P2O5 and K2O) and NPKMg (65,2 and 88,0 mg 100g-1 respectively for P2O5 and K2O). The highest yields were recorded at variants NPK and NPKMg - 24,21 and 22,01 t ha-1, average for the studied period. The yield of variant NPK was 25 % higher than the yield from variant NP and 68 % higher than control. The partial factor productivity (PFPN, PFPP and PFPK) of the applied fertilizers was the highest at variant NPK. The PFPN (80,10 kg kg-1) for the yields of variant N was 57 % lower than the PFPN at variant NPK (180,36 kg kg-1). The PFPP and PFPK at variants P and K was approximately 57 and 47 % lower compared with variant NPK. Agronomic efficiency (AE) of applied nutrient was the highest for the combined NPK fertilization. The application only of N, P, K and PK combination without N was agronomically not effective practice. The combined NPK and NPKMg variants ensure the highest yields. The indicators of nutrient use efficiency (PFP and AE) were also the highest at these variants. Key words: Soil fertility, nutrient use efficiency, potatoes, yields,

A frameshift mutation in MOCOS is associated with familial renal syndrome (xanthinuria) in Tyrolean Grey cattle.

PubMed

Murgiano, Leonardo; Jagannathan, Vidhya; Piffer, Christian; Diez-Prieto, Inmaculada; Bolcato, Marilena; Gentile, Arcangelo; Drögemüller, Cord

2016-12-05

Renal syndromes are occasionally reported in domestic animals. Two identical twin Tyrolean Grey calves exhibited weight loss, skeletal abnormalities and delayed development associated with kidney abnormalities and formation of uroliths. These signs resembled inherited renal tubular dysplasia found in Japanese Black cattle which is associated with mutations in the claudin 16 gene. Despite demonstrating striking phenotypic similarities, no obvious presence of pathogenic variants of this candidate gene were found. Therefore further analysis was required to decipher the genetic etiology of the condition. The family history of the cases suggested the possibility of an autosomal recessive inheritance. Homozygosity mapping combined with sequencing of the whole genome of one case detected two associated non-synonymous private coding variants: A homozygous missense variant in the uncharacterized KIAA2026 gene (g.39038055C > G; c.926C > G), located in a 15 Mb sized region of homozygosity on BTA 8; and a homozygous 1 bp deletion in the molybdenum cofactor sulfurase (MOCOS) gene (g.21222030delC; c.1881delG and c.1782delG), located in an 11 Mb region of homozygosity on BTA 24. Pathogenic variants in MOCOS have previously been associated with inherited metabolic syndromes and xanthinuria in different species including Japanese Black cattle. Genotyping of two additional clinically suspicious cases confirmed the association with the MOCOS variant, as both animals had a homozygous mutant genotype and did not show the variant KIAA2026 allele. The identified genomic deletion is predicted to be highly disruptive, creating a frameshift and premature termination of translation, resulting in severely truncated MOCOS proteins that lack two functionally essential domains. The variant MOCOS allele was absent from cattle of other breeds and approximately 4% carriers were detected among more than 1200 genotyped Tyrolean Grey cattle. Biochemical urolith analysis of one case revealed the presence of approximately 95% xanthine. The identified MOCOS loss of function variant is highly likely to cause the renal syndrome in the affected animals. The results suggest that the phenotypic features of the renal syndrome were related to an early onset form of xanthinuria, which is highly likely to lead to the progressive defects. The identification of the candidate causative mutation thus enables selection against this pathogenic variant in Tyrolean Grey cattle.

Relationship between the melanocortin-1 receptor (MC1R) variant R306ter and physiological responses to mechanical or thermal stimuli in Labrador Retriever dogs.

PubMed

Perez, Tania E; Mealey, Katrina L; Burke, Neal S; Grubb, Tamara L; Court, Michael H; Greene, Stephen A

2017-03-01

Variants in the MC1R gene have been associated with red hair color and sensitivity to pain in humans. The study objective was to determine if a relationship exists between MC1R genotype and physiological thermal or mechanical nociceptive thresholds in Labrador Retriever dogs. Prospective experimental study. Thirty-four Labrador Retriever dogs were included in the study following public requests for volunteers. Owner consent was obtained and owners verified that their dog was apparently not experiencing pain and had not been treated for pain during the previous 14 days. The study was approved by the Institutional Animal Care and Use Committee. Nociceptive thresholds were determined from a mean of three thermal and five mechanical replications using commercially available algometers. Each dog was genotyped for the previously described MC1R variant (R306ter). Data were analyzed using one-way anova with post hoc comparisons using Tukey's test (p < 0.05). Thirteen dogs were homozygous wild-type (WT/WT), nine were heterozygous (WT/R306ter), and eight were homozygous variant (R306ter/R306ter) genotype. Four dogs could not be genotyped. A significant difference (p = 0.04) in mechanical nociceptive thresholds was identified between dogs with the WT/WT genotype (12.1±2.1 N) and those with the WT/R306ter genotype (9.2±2.4 N). A difference in mechanical, but not thermal, nociceptive threshold was observed between wild-type and heterozygous MC1R variants. Differences in nociceptive thresholds between homozygous R306ter variants and other genotypes for MC1R were not observed. Compared with the wild-type MC1R genotype, nociceptive sensitivity to mechanical force in dogs with a single variant R306ter allele may be greater. However, in contrast to the reported association between homozygous MC1R variants (associated with red hair color) and nociception in humans, we found no evidence of a similar relationship in dogs with the homozygous variant genotype. Copyright © 2017 Association of Veterinary Anaesthetists and American College of Veterinary Anesthesia and Analgesia. Published by Elsevier Ltd. All rights reserved.

The IRF5–TNPO3 association with systemic lupus erythematosus has two components that other autoimmune disorders variably share

PubMed Central

Kottyan, Leah C.; Zoller, Erin E.; Bene, Jessica; Lu, Xiaoming; Kelly, Jennifer A.; Rupert, Andrew M.; Lessard, Christopher J.; Vaughn, Samuel E.; Marion, Miranda; Weirauch, Matthew T.; Namjou, Bahram; Adler, Adam; Rasmussen, Astrid; Glenn, Stuart; Montgomery, Courtney G.; Hirschfield, Gideon M.; Xie, Gang; Coltescu, Catalina; Amos, Chris; Li, He; Ice, John A.; Nath, Swapan K.; Mariette, Xavier; Bowman, Simon; Rischmueller, Maureen; Lester, Sue; Brun, Johan G.; Gøransson, Lasse G.; Harboe, Erna; Omdal, Roald; Cunninghame-Graham, Deborah S.; Vyse, Tim; Miceli-Richard, Corinne; Brennan, Michael T.; Lessard, James A.; Wahren-Herlenius, Marie; Kvarnström, Marika; Illei, Gabor G.; Witte, Torsten; Jonsson, Roland; Eriksson, Per; Nordmark, Gunnel; Ng, Wan-Fai; Anaya, Juan-Manuel; Rhodus, Nelson L.; Segal, Barbara M.; Merrill, Joan T.; James, Judith A.; Guthridge, Joel M.; Hal Scofield, R.; Alarcon-Riquelme, Marta; Bae, Sang-Cheol; Boackle, Susan A.; Criswell, Lindsey A.; Gilkeson, Gary; Kamen, Diane L.; Jacob, Chaim O.; Kimberly, Robert; Brown, Elizabeth; Edberg, Jeffrey; Alarcón, Graciela S.; Reveille, John D.; Vilá, Luis M.; Petri, Michelle; Ramsey-Goldman, Rosalind; Freedman, Barry I.; Niewold, Timothy; Stevens, Anne M.; Tsao, Betty P.; Ying, Jun; Mayes, Maureen D.; Gorlova, Olga Y.; Wakeland, Ward; Radstake, Timothy; Martin, Ezequiel; Martin, Javier; Siminovitch, Katherine; Moser Sivils, Kathy L.; Gaffney, Patrick M.; Langefeld, Carl D.; Harley, John B.; Kaufman, Kenneth M.

2015-01-01

Exploiting genotyping, DNA sequencing, imputation and trans-ancestral mapping, we used Bayesian and frequentist approaches to model the IRF5–TNPO3 locus association, now implicated in two immunotherapies and seven autoimmune diseases. Specifically, in systemic lupus erythematosus (SLE), we resolved separate associations in the IRF5 promoter (all ancestries) and with an extended European haplotype. We captured 3230 IRF5–TNPO3 high-quality, common variants across 5 ethnicities in 8395 SLE cases and 7367 controls. The genetic effect from the IRF5 promoter can be explained by any one of four variants in 5.7 kb (P-valuemeta = 6 × 10−49; OR = 1.38–1.97). The second genetic effect spanned an 85.5-kb, 24-variant haplotype that included the genes IRF5 and TNPO3 (P-valuesEU = 10−27–10−32, OR = 1.7–1.81). Many variants at the IRF5 locus with previously assigned biological function are not members of either final credible set of potential causal variants identified herein. In addition to the known biologically functional variants, we demonstrated that the risk allele of rs4728142, a variant in the promoter among the lowest frequentist probability and highest Bayesian posterior probability, was correlated with IRF5 expression and differentially binds the transcription factor ZBTB3. Our analytical strategy provides a novel framework for future studies aimed at dissecting etiological genetic effects. Finally, both SLE elements of the statistical model appear to operate in Sjögren's syndrome and systemic sclerosis whereas only the IRF5–TNPO3 gene-spanning haplotype is associated with primary biliary cirrhosis, demonstrating the nuance of similarity and difference in autoimmune disease risk mechanisms at IRF5–TNPO3. PMID:25205108

Molecular outcomes, clinical consequences, and genetic diagnosis of Oculocutaneous Albinism in Pakistani population.

PubMed

Shahzad, Mohsin; Yousaf, Sairah; Waryah, Yar M; Gul, Hadia; Kausar, Tasleem; Tariq, Nabeela; Mahmood, Umair; Ali, Muhammad; Khan, Muzammil A; Waryah, Ali M; Shaikh, Rehan S; Riazuddin, Saima; Ahmed, Zubair M

2017-03-07

Nonsyndromic oculocutaneous Albinism (nsOCA) is clinically characterized by the loss of pigmentation in the skin, hair, and iris. OCA is amongst the most common causes of vision impairment in children. To date, pathogenic variants in six genes have been identified in individuals with nsOCA. Here, we determined the identities, frequencies, and clinical consequences of OCA alleles in 94 previously unreported Pakistani families. Combination of Sanger and Exome sequencing revealed 38 alleles, including 22 novel variants, segregating with nsOCA phenotype in 80 families. Variants of TYR and OCA2 genes were the most common cause of nsOCA, occurring in 43 and 30 families, respectively. Twenty-two novel variants include nine missense, four splice site, two non-sense, one insertion and six gross deletions. In vitro studies revealed retention of OCA proteins harboring novel missense alleles in the endoplasmic reticulum (ER) of transfected cells. Exon-trapping assays with constructs containing splice site alleles revealed errors in splicing. As eight alleles account for approximately 56% (95% CI: 46.52-65.24%) of nsOCA cases, primarily enrolled from Punjab province of Pakistan, hierarchical strategies for variant detection would be feasible and cost-efficient genetic tests for OCA in families with similar origin. Thus, we developed Tetra-primer ARMS assays for rapid, reliable, reproducible and economical screening of most of these common alleles.

Pathogenetics of alveolar capillary dysplasia with misalignment of pulmonary veins.

PubMed

Szafranski, Przemyslaw; Gambin, Tomasz; Dharmadhikari, Avinash V; Akdemir, Kadir Caner; Jhangiani, Shalini N; Schuette, Jennifer; Godiwala, Nihal; Yatsenko, Svetlana A; Sebastian, Jessica; Madan-Khetarpal, Suneeta; Surti, Urvashi; Abellar, Rosanna G; Bateman, David A; Wilson, Ashley L; Markham, Melinda H; Slamon, Jill; Santos-Simarro, Fernando; Palomares, María; Nevado, Julián; Lapunzina, Pablo; Chung, Brian Hon-Yin; Wong, Wai-Lap; Chu, Yoyo Wing Yiu; Mok, Gary Tsz Kin; Kerem, Eitan; Reiter, Joel; Ambalavanan, Namasivayam; Anderson, Scott A; Kelly, David R; Shieh, Joseph; Rosenthal, Taryn C; Scheible, Kristin; Steiner, Laurie; Iqbal, M Anwar; McKinnon, Margaret L; Hamilton, Sara Jane; Schlade-Bartusiak, Kamilla; English, Dawn; Hendson, Glenda; Roeder, Elizabeth R; DeNapoli, Thomas S; Littlejohn, Rebecca Okashah; Wolff, Daynna J; Wagner, Carol L; Yeung, Alison; Francis, David; Fiorino, Elizabeth K; Edelman, Morris; Fox, Joyce; Hayes, Denise A; Janssens, Sandra; De Baere, Elfride; Menten, Björn; Loccufier, Anne; Vanwalleghem, Lieve; Moerman, Philippe; Sznajer, Yves; Lay, Amy S; Kussmann, Jennifer L; Chawla, Jasneek; Payton, Diane J; Phillips, Gael E; Brosens, Erwin; Tibboel, Dick; de Klein, Annelies; Maystadt, Isabelle; Fisher, Richard; Sebire, Neil; Male, Alison; Chopra, Maya; Pinner, Jason; Malcolm, Girvan; Peters, Gregory; Arbuckle, Susan; Lees, Melissa; Mead, Zoe; Quarrell, Oliver; Sayers, Richard; Owens, Martina; Shaw-Smith, Charles; Lioy, Janet; McKay, Eileen; de Leeuw, Nicole; Feenstra, Ilse; Spruijt, Liesbeth; Elmslie, Frances; Thiruchelvam, Timothy; Bacino, Carlos A; Langston, Claire; Lupski, James R; Sen, Partha; Popek, Edwina; Stankiewicz, Paweł

2016-05-01

Alveolar capillary dysplasia with misalignment of pulmonary veins (ACDMPV) is a lethal lung developmental disorder caused by heterozygous point mutations or genomic deletion copy-number variants (CNVs) of FOXF1 or its upstream enhancer involving fetal lung-expressed long noncoding RNA genes LINC01081 and LINC01082. Using custom-designed array comparative genomic hybridization, Sanger sequencing, whole exome sequencing (WES), and bioinformatic analyses, we studied 22 new unrelated families (20 postnatal and two prenatal) with clinically diagnosed ACDMPV. We describe novel deletion CNVs at the FOXF1 locus in 13 unrelated ACDMPV patients. Together with the previously reported cases, all 31 genomic deletions in 16q24.1, pathogenic for ACDMPV, for which parental origin was determined, arose de novo with 30 of them occurring on the maternally inherited chromosome 16, strongly implicating genomic imprinting of the FOXF1 locus in human lungs. Surprisingly, we have also identified four ACDMPV families with the pathogenic variants in the FOXF1 locus that arose on paternal chromosome 16. Interestingly, a combination of the severe cardiac defects, including hypoplastic left heart, and single umbilical artery were observed only in children with deletion CNVs involving FOXF1 and its upstream enhancer. Our data demonstrate that genomic imprinting at 16q24.1 plays an important role in variable ACDMPV manifestation likely through long-range regulation of FOXF1 expression, and may be also responsible for key phenotypic features of maternal uniparental disomy 16. Moreover, in one family, WES revealed a de novo missense variant in ESRP1, potentially implicating FGF signaling in the etiology of ACDMPV.

Pathogenetics of Alveolar Capillary Dysplasia with Misalignment of Pulmonary Veins

PubMed Central

Szafranski, Przemyslaw; Gambin, Tomasz; Dharmadhikari, Avinash V.; Akdemir, Kadir Caner; Jhangiani, Shalini N.; Schuette, Jennifer; Godiwala, Nihal; Yatsenko, Svetlana A.; Sebastian, Jessica; Madan-Khetarpal, Suneeta; Surti, Urvashi; Abellar, Rosanna G.; Bateman, David A.; Wilson, Ashley L.; Markham, Melinda H.; Slamon, Jill; Santos-Simarro, Fernando; Palomares, María; Nevado, Julián; Lapunzina, Pablo; Hon-Yin, Brian Chung; Wai-Lap, Wong; Chu, Yoyo Wing Yiu; Mok, Gary Tsz Kin; Eitan, Kerem; Reiter, Joel; Ambalavanan, Namasivayam; Anderson, Scott A.; Kelly, David R.; Shieh, Joseph; Rosenthal, Taryn C.; Scheible, Kristin; Steiner, Laurie; Iqbal, M. Anwar; McKinnon, Margaret; Hamilton, Sara Jane; Schlade-Bartusiak, Kamilla; English, Dawn; Hendson, Glenda; Roeder, Elizabeth R.; DeNapoli, Thomas S.; Littlejohn, Rebecca Okashah; Wolff, Daynna J.; Wagner, Carol L.; Yeung, Alison; Francis, David; Fiorino, Elizabeth K.; Edelman, Morris; Fox, Joyce; Hayes, Denise A.; Janssens, Sandra; De Baere, Elfride; Menten, Bjorn; Loccufier, Anne; Van Walleghem, Lieve; Moerman, Philippe; Sznajer, Yves; Lay, Amy S.; Kussmann, Jennifer L.; Chawla, Jasneek; Payton, Diane J.; Phillips, Gael E.; Brosens, Erwin; Tibboel, Dick; de Klein, Annelies; Maystadt, Isabelle; Fisher, Richard; Sebire, Neil; Male, Alison; Chopra, Maya; Pinner, Jason; Malcolm, Girvan; Peters, Gregory; Arbuckle, Susan; Lees, Melissa; Mead, Zoe; Quarrell, Oliver; Sayers, Richard; Owens, Martina; Shaw-Smith, Charles; Lioy, Janet; McKay, Eileen; de Leeuw, Nicole; Feenstra, Ilse; Spruijt, Liesbeth; Elmslie, Frances; Thiruchelvam, Timothy; Bacino, Carlos A.; Langston, Claire; Lupski, James R.; Sen, Partha; Popek, Edwina; Stankiewicz, Paweł

2017-01-01

Alveolar capillary dysplasia with misalignment of pulmonary veins (ACDMPV) is a lethal lung developmental disorder caused by heterozygous point mutations or genomic deletion copy-number variants (CNVs) of FOXF1 or its upstream enhancer involving fetal lung-expressed long noncoding RNA genes LINC01081 and LINC01082. Using custom-designed array comparative genomic hybridization, Sanger sequencing, whole exome sequencing (WES), and bioinformatic analyses, we studied 22 new unrelated families (20 postnatal and two prenatal) with clinically diagnosed ACDMPV. We describe novel deletion CNVs at the FOXF1 locus in 13 unrelated ACDMPV patients. Together with the previously reported cases, all 31 genomic deletions in 16q24.1, pathogenic for ACDMPV, for which parental origin was determined, arose de novo with 30 of them occurring on the maternally inherited chromosome 16, strongly implicating genomic imprinting of the FOXF1 locus in human lungs. Surprisingly, we have also identified four ACDMPV families with the pathogenic variants in the FOXF1 locus that arose on paternal chromosome 16. Interestingly, a combination of the severe cardiac defects, including hypoplastic left heart, and single umbilical artery were observed only in children with deletion CNVs involving FOXF1 and its upstream enhancer. Our data demonstrate that genomic imprinting at 16q24.1 plays an important role in variable ACDMPV manifestation likely through long-range regulation of FOXF1 expression, and may be also responsible for key phenotypic features of maternal uniparental disomy 16. Moreover, in one family, WES revealed a de novo missense variant in ESRP1, potentially implicating FGF signaling in etiology of ACDMPV. PMID:27071622

Whole genome comparison between table and wine grapes reveals a comprehensive catalog of structural variants

PubMed Central

2014-01-01

Background Grapevine (Vitis vinifera L.) is the most important Mediterranean fruit crop, used to produce both wine and spirits as well as table grape and raisins. Wine and table grape cultivars represent two divergent germplasm pools with different origins and domestication history, as well as differential characteristics for berry size, cluster architecture and berry chemical profile, among others. ‘Sultanina’ plays a pivotal role in modern table grape breeding providing the main source of seedlessness. This cultivar is also one of the most planted for fresh consumption and raisins production. Given its importance, we sequenced it and implemented a novel strategy for the de novo assembly of its highly heterozygous genome. Results Our approach produced a draft genome of 466 Mb, recovering 82% of the genes present in the grapevine reference genome; in addition, we identified 240 novel genes. A large number of structural variants and SNPs were identified. Among them, 45 (21 SNPs and 24 INDELs) were experimentally confirmed in ‘Sultanina’ and six SNPs in other 23 table grape varieties. Transposable elements corresponded to ca. 80% of the repetitive sequences involved in structural variants and more than 2,000 genes were affected in their structure by these variants. Some of these genes are likely involved in embryo development, suggesting that they may contribute to seedlessness, a key trait for table grapes. Conclusions This work produced the first structural variants and SNPs catalog for grapevine, constituting a novel and very powerful tool for genomic studies in this key fruit crop, particularly useful to support marker assisted breeding in table grapes. PMID:24397443

Development of a genotyping microarray for Usher syndrome.

PubMed

Cremers, Frans P M; Kimberling, William J; Külm, Maigi; de Brouwer, Arjan P; van Wijk, Erwin; te Brinke, Heleen; Cremers, Cor W R J; Hoefsloot, Lies H; Banfi, Sandro; Simonelli, Francesca; Fleischhauer, Johannes C; Berger, Wolfgang; Kelley, Phil M; Haralambous, Elene; Bitner-Glindzicz, Maria; Webster, Andrew R; Saihan, Zubin; De Baere, Elfride; Leroy, Bart P; Silvestri, Giuliana; McKay, Gareth J; Koenekoop, Robert K; Millan, Jose M; Rosenberg, Thomas; Joensuu, Tarja; Sankila, Eeva-Marja; Weil, Dominique; Weston, Mike D; Wissinger, Bernd; Kremer, Hannie

2007-02-01

Usher syndrome, a combination of retinitis pigmentosa (RP) and sensorineural hearing loss with or without vestibular dysfunction, displays a high degree of clinical and genetic heterogeneity. Three clinical subtypes can be distinguished, based on the age of onset and severity of the hearing impairment, and the presence or absence of vestibular abnormalities. Thus far, eight genes have been implicated in the syndrome, together comprising 347 protein-coding exons. To improve DNA diagnostics for patients with Usher syndrome, we developed a genotyping microarray based on the arrayed primer extension (APEX) method. Allele-specific oligonucleotides corresponding to all 298 Usher syndrome-associated sequence variants known to date, 76 of which are novel, were arrayed. Approximately half of these variants were validated using original patient DNAs, which yielded an accuracy of >98%. The efficiency of the Usher genotyping microarray was tested using DNAs from 370 unrelated European and American patients with Usher syndrome. Sequence variants were identified in 64/140 (46%) patients with Usher syndrome type I, 45/189 (24%) patients with Usher syndrome type II, 6/21 (29%) patients with Usher syndrome type III and 6/20 (30%) patients with atypical Usher syndrome. The chip also identified two novel sequence variants, c.400C>T (p.R134X) in PCDH15 and c.1606T>C (p.C536S) in USH2A. The Usher genotyping microarray is a versatile and affordable screening tool for Usher syndrome. Its efficiency will improve with the addition of novel sequence variants with minimal extra costs, making it a very useful first-pass screening tool.

Development of a genotyping microarray for Usher syndrome

PubMed Central

Cremers, Frans P M; Kimberling, William J; Külm, Maigi; de Brouwer, Arjan P; van Wijk, Erwin; te Brinke, Heleen; Cremers, Cor W R J; Hoefsloot, Lies H; Banfi, Sandro; Simonelli, Francesca; Fleischhauer, Johannes C; Berger, Wolfgang; Kelley, Phil M; Haralambous, Elene; Bitner‐Glindzicz, Maria; Webster, Andrew R; Saihan, Zubin; De Baere, Elfride; Leroy, Bart P; Silvestri, Giuliana; McKay, Gareth J; Koenekoop, Robert K; Millan, Jose M; Rosenberg, Thomas; Joensuu, Tarja; Sankila, Eeva‐Marja; Weil, Dominique; Weston, Mike D; Wissinger, Bernd; Kremer, Hannie

2007-01-01

Background Usher syndrome, a combination of retinitis pigmentosa (RP) and sensorineural hearing loss with or without vestibular dysfunction, displays a high degree of clinical and genetic heterogeneity. Three clinical subtypes can be distinguished, based on the age of onset and severity of the hearing impairment, and the presence or absence of vestibular abnormalities. Thus far, eight genes have been implicated in the syndrome, together comprising 347 protein‐coding exons. Methods: To improve DNA diagnostics for patients with Usher syndrome, we developed a genotyping microarray based on the arrayed primer extension (APEX) method. Allele‐specific oligonucleotides corresponding to all 298 Usher syndrome‐associated sequence variants known to date, 76 of which are novel, were arrayed. Results Approximately half of these variants were validated using original patient DNAs, which yielded an accuracy of >98%. The efficiency of the Usher genotyping microarray was tested using DNAs from 370 unrelated European and American patients with Usher syndrome. Sequence variants were identified in 64/140 (46%) patients with Usher syndrome type I, 45/189 (24%) patients with Usher syndrome type II, 6/21 (29%) patients with Usher syndrome type III and 6/20 (30%) patients with atypical Usher syndrome. The chip also identified two novel sequence variants, c.400C>T (p.R134X) in PCDH15 and c.1606T>C (p.C536S) in USH2A. Conclusion The Usher genotyping microarray is a versatile and affordable screening tool for Usher syndrome. Its efficiency will improve with the addition of novel sequence variants with minimal extra costs, making it a very useful first‐pass screening tool. PMID:16963483

Analysis of the S1 gene of the avian infectious bronchitis virus (IBV) reveals changes in the IBV genetic groups circulating in southern Thailand.

PubMed

Promkuntod, N; Thongmee, S; Yoidam, S

2015-06-01

The new variants of the avian infectious bronchitis virus (IBV) produce a range of symptoms and cause global economic losses to the poultry industry. We investigated the S1 glycoprotein of 24 recent IBV isolates from chickens and demonstrated that two predominant genetic groups were circulating in southern Thailand between 2008 and 2013. Seven IBV variants, isolated from 2008 to 2009, were clustered in the Thailand THA001 group I while 15 IBV variants, isolated from 2009 to 2013, were classified into the QX-like group II. Moreover, a single isolate from a broiler was categorized into the Massachusetts-type, and an isolate from a layer belonged to the 4/91 type virus. Interestingly, both the IBV groups I and II were isolated from native chickens (62.5%) and caused a range of symptoms. Our results indicate that the QX-like viruses were predominant after 2009, replacing the THA001 type viruses. Furthermore, native chickens may contribute to the epidemiology of IB. Copyright © 2015 Elsevier Ltd. All rights reserved.

How Genes Modulate Patterns of Aging-Related Changes on the Way to 100: Biodemographic Models and Methods in Genetic Analyses of Longitudinal Data

PubMed Central

Yashin, Anatoliy I.; Arbeev, Konstantin G.; Wu, Deqing; Arbeeva, Liubov; Kulminski, Alexander; Kulminskaya, Irina; Akushevich, Igor; Ukraintseva, Svetlana V.

2016-01-01

Background and Objective To clarify mechanisms of genetic regulation of human aging and longevity traits, a number of genome-wide association studies (GWAS) of these traits have been performed. However, the results of these analyses did not meet expectations of the researchers. Most detected genetic associations have not reached a genome-wide level of statistical significance, and suffered from the lack of replication in the studies of independent populations. The reasons for slow progress in this research area include low efficiency of statistical methods used in data analyses, genetic heterogeneity of aging and longevity related traits, possibility of pleiotropic (e.g., age dependent) effects of genetic variants on such traits, underestimation of the effects of (i) mortality selection in genetically heterogeneous cohorts, (ii) external factors and differences in genetic backgrounds of individuals in the populations under study, the weakness of conceptual biological framework that does not fully account for above mentioned factors. One more limitation of conducted studies is that they did not fully realize the potential of longitudinal data that allow for evaluating how genetic influences on life span are mediated by physiological variables and other biomarkers during the life course. The objective of this paper is to address these issues. Data and Methods We performed GWAS of human life span using different subsets of data from the original Framingham Heart Study cohort corresponding to different quality control (QC) procedures and used one subset of selected genetic variants for further analyses. We used simulation study to show that approach to combining data improves the quality of GWAS. We used FHS longitudinal data to compare average age trajectories of physiological variables in carriers and non-carriers of selected genetic variants. We used stochastic process model of human mortality and aging to investigate genetic influence on hidden biomarkers of aging and on dynamic interaction between aging and longevity. We investigated properties of genes related to selected variants and their roles in signaling and metabolic pathways. Results We showed that the use of different QC procedures results in different sets of genetic variants associated with life span. We selected 24 genetic variants negatively associated with life span. We showed that the joint analyses of genetic data at the time of bio-specimen collection and follow up data substantially improved significance of associations of selected 24 SNPs with life span. We also showed that aging related changes in physiological variables and in hidden biomarkers of aging differ for the groups of carriers and non-carriers of selected variants. Conclusions . The results of these analyses demonstrated benefits of using biodemographic models and methods in genetic association studies of these traits. Our findings showed that the absence of a large number of genetic variants with deleterious effects may make substantial contribution to exceptional longevity. These effects are dynamically mediated by a number of physiological variables and hidden biomarkers of aging. The results of these research demonstrated benefits of using integrative statistical models of mortality risks in genetic studies of human aging and longevity. PMID:27773987

Rare key functional domain missense substitutions in MRE11A, RAD50, and NBN contribute to breast cancer susceptibility: results from a Breast Cancer Family Registry case-control mutation-screening study

PubMed Central

2014-01-01

Introduction The MRE11A-RAD50-Nibrin (MRN) complex plays several critical roles related to repair of DNA double-strand breaks. Inherited mutations in the three components predispose to genetic instability disorders and the MRN genes have been implicated in breast cancer susceptibility, but the underlying data are not entirely convincing. Here, we address two related questions: (1) are some rare MRN variants intermediate-risk breast cancer susceptibility alleles, and if so (2) do the MRN genes follow a BRCA1/BRCA2 pattern wherein most susceptibility alleles are protein-truncating variants, or do they follow an ATM/CHEK2 pattern wherein half or more of the susceptibility alleles are missense substitutions? Methods Using high-resolution melt curve analysis followed by Sanger sequencing, we mutation screened the coding exons and proximal splice junction regions of the MRN genes in 1,313 early-onset breast cancer cases and 1,123 population controls. Rare variants in the three genes were pooled using bioinformatics methods similar to those previously applied to ATM, BRCA1, BRCA2, and CHEK2, and then assessed by logistic regression. Results Re-analysis of our ATM, BRCA1, and BRCA2 mutation screening data revealed that these genes do not harbor pathogenic alleles (other than modest-risk SNPs) with minor allele frequencies >0.1% in Caucasian Americans, African Americans, or East Asians. Limiting our MRN analyses to variants with allele frequencies of <0.1% and combining protein-truncating variants, likely spliceogenic variants, and key functional domain rare missense substitutions, we found significant evidence that the MRN genes are indeed intermediate-risk breast cancer susceptibility genes (odds ratio (OR) = 2.88, P = 0.0090). Key domain missense substitutions were more frequent than the truncating variants (24 versus 12 observations) and conferred a slightly higher OR (3.07 versus 2.61) with a lower P value (0.029 versus 0.14). Conclusions These data establish that MRE11A, RAD50, and NBN are intermediate-risk breast cancer susceptibility genes. Like ATM and CHEK2, their spectrum of pathogenic variants includes a relatively high proportion of missense substitutions. However, the data neither establish whether variants in each of the three genes are best evaluated under the same analysis model nor achieve clinically actionable classification of individual variants observed in this study. PMID:24894818

Novel Associations between Common Breast Cancer Susceptibility Variants and Risk-Predicting Mammographic Density Measures

PubMed Central

Stone, Jennifer; Thompson, Deborah J.; dos-Santos-Silva, Isabel; Scott, Christopher; Tamimi, Rulla M.; Lindstrom, Sara; Kraft, Peter; Hazra, Aditi; Li, Jingmei; Eriksson, Louise; Czene, Kamila; Hall, Per; Jensen, Matt; Cunningham, Julie; Olson, Janet E.; Purrington, Kristen; Couch, Fergus J.; Brown, Judith; Leyland, Jean; Warren, Ruth M. L.; Luben, Robert N.; Khaw, Kay-Tee; Smith, Paula; Wareham, Nicholas J.; Jud, Sebastian M.; Heusinger, Katharina; Beckmann, Matthias W.; Douglas, Julie A.; Shah, Kaanan P.; Chan, Heang-Ping; Helvie, Mark A.; Le Marchand, Loic; Kolonel, Laurence N.; Woolcott, Christy; Maskarinec, Gertraud; Haiman, Christopher; Giles, Graham G.; Baglietto, Laura; Krishnan, Kavitha; Southey, Melissa C.; Apicella, Carmel; Andrulis, Irene L.; Knight, Julia A.; Ursin, Giske; Grenaker Alnaes, Grethe I.; Kristensen, Vessela N.; Borresen-Dale, Anne-Lise; Gram, Inger Torhild; Bolla, Manjeet K.; Wang, Qin; Michailidou, Kyriaki; Dennis, Joe; Simard, Jacques; Paroah, Paul; Dunning, Alison M.; Easton, Douglas F.; Fasching, Peter A.; Pankratz, V. Shane; Hopper, John; Vachon, Celine M.

2015-01-01

Mammographic density measures adjusted for age and body mass index (BMI) are heritable predictors of breast cancer risk but few mammographic density-associated genetic variants have been identified. Using data for 10,727 women from two international consortia, we estimated associations between 77 common breast cancer susceptibility variants and absolute dense area, percent dense area and absolute non-dense area adjusted for study, age and BMI using mixed linear modeling. We found strong support for established associations between rs10995190 (in the region of ZNF365), rs2046210 (ESR1) and rs3817198 (LSP1) and adjusted absolute and percent dense areas (all p <10−5). Of 41 recently discovered breast cancer susceptibility variants, associations were found between rs1432679 (EBF1), rs17817449 (MIR1972-2: FTO), rs12710696 (2p24.1), and rs3757318 (ESR1) and adjusted absolute and percent dense areas, respectively. There were associations between rs6001930 (MKL1) and both adjusted absolute dense and non-dense areas, and between rs17356907 (NTN4) and adjusted absolute non-dense area. Trends in all but two associations were consistent with those for breast cancer risk. Results suggested that 18% of breast cancer susceptibility variants were associated with at least one mammographic density measure. Genetic variants at multiple loci were associated with both breast cancer risk and the mammographic density measures. Further understanding of the underlying mechanisms at these loci could help identify etiological pathways implicated in how mammographic density predicts breast cancer risk. PMID:25862352

Subjective binge eating with compensatory behaviors: a variant presentation of bulimia nervosa.

PubMed

Watson, Hunna J; Fursland, Anthea; Bulik, Cynthia M; Nathan, Paula

2013-03-01

To determine whether a variant bulimic-type presentation, whereby one meets criteria for bulimia nervosa (BN) except that binge eating episodes are not objectively large (i.e., "subjective bulimia nervosa," SBN), has comparable clinical severity to established eating disorders, particularly BN. Treatment-seeking adults with BN (N = 112), SBN (N = 28), anorexia nervosa restricting type (AN-R) (N = 45), and AN-binge/purge type (AN-B/P) (N = 24) were compared. Overall, SBN could not be meaningfully distinguished from BN. SBN and BN had equivalent eating pathology, depression and anxiety symptoms, low quality of life, impulsivity, Axis I comorbidity, and lifetime psychiatric history, and comparable clinical severity to AN-R and AN-B/P. Individuals with SBN, differing from BN only by the smaller size of their binge eating episodes, had a form of eating disorder comparable in clinical severity to threshold AN and BN and warranting clinical attention. Health professionals and the community require greater awareness of this variant to optimize detection, treatment-seeking, and outcomes. Copyright © 2012 Wiley Periodicals, Inc.

Identification of common variants associated with human hippocampal and intracranial volumes.

PubMed

Stein, Jason L; Medland, Sarah E; Vasquez, Alejandro Arias; Hibar, Derrek P; Senstad, Rudy E; Winkler, Anderson M; Toro, Roberto; Appel, Katja; Bartecek, Richard; Bergmann, Ørjan; Bernard, Manon; Brown, Andrew A; Cannon, Dara M; Chakravarty, M Mallar; Christoforou, Andrea; Domin, Martin; Grimm, Oliver; Hollinshead, Marisa; Holmes, Avram J; Homuth, Georg; Hottenga, Jouke-Jan; Langan, Camilla; Lopez, Lorna M; Hansell, Narelle K; Hwang, Kristy S; Kim, Sungeun; Laje, Gonzalo; Lee, Phil H; Liu, Xinmin; Loth, Eva; Lourdusamy, Anbarasu; Mattingsdal, Morten; Mohnke, Sebastian; Maniega, Susana Muñoz; Nho, Kwangsik; Nugent, Allison C; O'Brien, Carol; Papmeyer, Martina; Pütz, Benno; Ramasamy, Adaikalavan; Rasmussen, Jerod; Rijpkema, Mark; Risacher, Shannon L; Roddey, J Cooper; Rose, Emma J; Ryten, Mina; Shen, Li; Sprooten, Emma; Strengman, Eric; Teumer, Alexander; Trabzuni, Daniah; Turner, Jessica; van Eijk, Kristel; van Erp, Theo G M; van Tol, Marie-Jose; Wittfeld, Katharina; Wolf, Christiane; Woudstra, Saskia; Aleman, Andre; Alhusaini, Saud; Almasy, Laura; Binder, Elisabeth B; Brohawn, David G; Cantor, Rita M; Carless, Melanie A; Corvin, Aiden; Czisch, Michael; Curran, Joanne E; Davies, Gail; de Almeida, Marcio A A; Delanty, Norman; Depondt, Chantal; Duggirala, Ravi; Dyer, Thomas D; Erk, Susanne; Fagerness, Jesen; Fox, Peter T; Freimer, Nelson B; Gill, Michael; Göring, Harald H H; Hagler, Donald J; Hoehn, David; Holsboer, Florian; Hoogman, Martine; Hosten, Norbert; Jahanshad, Neda; Johnson, Matthew P; Kasperaviciute, Dalia; Kent, Jack W; Kochunov, Peter; Lancaster, Jack L; Lawrie, Stephen M; Liewald, David C; Mandl, René; Matarin, Mar; Mattheisen, Manuel; Meisenzahl, Eva; Melle, Ingrid; Moses, Eric K; Mühleisen, Thomas W; Nauck, Matthias; Nöthen, Markus M; Olvera, Rene L; Pandolfo, Massimo; Pike, G Bruce; Puls, Ralf; Reinvang, Ivar; Rentería, Miguel E; Rietschel, Marcella; Roffman, Joshua L; Royle, Natalie A; Rujescu, Dan; Savitz, Jonathan; Schnack, Hugo G; Schnell, Knut; Seiferth, Nina; Smith, Colin; Steen, Vidar M; Valdés Hernández, Maria C; Van den Heuvel, Martijn; van der Wee, Nic J; Van Haren, Neeltje E M; Veltman, Joris A; Völzke, Henry; Walker, Robert; Westlye, Lars T; Whelan, Christopher D; Agartz, Ingrid; Boomsma, Dorret I; Cavalleri, Gianpiero L; Dale, Anders M; Djurovic, Srdjan; Drevets, Wayne C; Hagoort, Peter; Hall, Jeremy; Heinz, Andreas; Jack, Clifford R; Foroud, Tatiana M; Le Hellard, Stephanie; Macciardi, Fabio; Montgomery, Grant W; Poline, Jean Baptiste; Porteous, David J; Sisodiya, Sanjay M; Starr, John M; Sussmann, Jessika; Toga, Arthur W; Veltman, Dick J; Walter, Henrik; Weiner, Michael W; Bis, Joshua C; Ikram, M Arfan; Smith, Albert V; Gudnason, Vilmundur; Tzourio, Christophe; Vernooij, Meike W; Launer, Lenore J; DeCarli, Charles; Seshadri, Sudha; Andreassen, Ole A; Apostolova, Liana G; Bastin, Mark E; Blangero, John; Brunner, Han G; Buckner, Randy L; Cichon, Sven; Coppola, Giovanni; de Zubicaray, Greig I; Deary, Ian J; Donohoe, Gary; de Geus, Eco J C; Espeseth, Thomas; Fernández, Guillén; Glahn, David C; Grabe, Hans J; Hardy, John; Hulshoff Pol, Hilleke E; Jenkinson, Mark; Kahn, René S; McDonald, Colm; McIntosh, Andrew M; McMahon, Francis J; McMahon, Katie L; Meyer-Lindenberg, Andreas; Morris, Derek W; Müller-Myhsok, Bertram; Nichols, Thomas E; Ophoff, Roel A; Paus, Tomas; Pausova, Zdenka; Penninx, Brenda W; Potkin, Steven G; Sämann, Philipp G; Saykin, Andrew J; Schumann, Gunter; Smoller, Jordan W; Wardlaw, Joanna M; Weale, Michael E; Martin, Nicholas G; Franke, Barbara; Wright, Margaret J; Thompson, Paul M

2012-04-15

Identifying genetic variants influencing human brain structures may reveal new biological mechanisms underlying cognition and neuropsychiatric illness. The volume of the hippocampus is a biomarker of incipient Alzheimer's disease and is reduced in schizophrenia, major depression and mesial temporal lobe epilepsy. Whereas many brain imaging phenotypes are highly heritable, identifying and replicating genetic influences has been difficult, as small effects and the high costs of magnetic resonance imaging (MRI) have led to underpowered studies. Here we report genome-wide association meta-analyses and replication for mean bilateral hippocampal, total brain and intracranial volumes from a large multinational consortium. The intergenic variant rs7294919 was associated with hippocampal volume (12q24.22; N = 21,151; P = 6.70 × 10(-16)) and the expression levels of the positional candidate gene TESC in brain tissue. Additionally, rs10784502, located within HMGA2, was associated with intracranial volume (12q14.3; N = 15,782; P = 1.12 × 10(-12)). We also identified a suggestive association with total brain volume at rs10494373 within DDR2 (1q23.3; N = 6,500; P = 5.81 × 10(-7)).

Rare and Coding Region Genetic Variants Associated With Risk of Ischemic Stroke: The NHLBI Exome Sequence Project.

PubMed

Auer, Paul L; Nalls, Mike; Meschia, James F; Worrall, Bradford B; Longstreth, W T; Seshadri, Sudha; Kooperberg, Charles; Burger, Kathleen M; Carlson, Christopher S; Carty, Cara L; Chen, Wei-Min; Cupples, L Adrienne; DeStefano, Anita L; Fornage, Myriam; Hardy, John; Hsu, Li; Jackson, Rebecca D; Jarvik, Gail P; Kim, Daniel S; Lakshminarayan, Kamakshi; Lange, Leslie A; Manichaikul, Ani; Quinlan, Aaron R; Singleton, Andrew B; Thornton, Timothy A; Nickerson, Deborah A; Peters, Ulrike; Rich, Stephen S

2015-07-01

Stroke is the second leading cause of death and the third leading cause of years of life lost. Genetic factors contribute to stroke prevalence, and candidate gene and genome-wide association studies (GWAS) have identified variants associated with ischemic stroke risk. These variants often have small effects without obvious biological significance. Exome sequencing may discover predicted protein-altering variants with a potentially large effect on ischemic stroke risk. To investigate the contribution of rare and common genetic variants to ischemic stroke risk by targeting the protein-coding regions of the human genome. The National Heart, Lung, and Blood Institute (NHLBI) Exome Sequencing Project (ESP) analyzed approximately 6000 participants from numerous cohorts of European and African ancestry. For discovery, 365 cases of ischemic stroke (small-vessel and large-vessel subtypes) and 809 European ancestry controls were sequenced; for replication, 47 affected sibpairs concordant for stroke subtype and an African American case-control series were sequenced, with 1672 cases and 4509 European ancestry controls genotyped. The ESP's exome sequencing and genotyping started on January 1, 2010, and continued through June 30, 2012. Analyses were conducted on the full data set between July 12, 2012, and July 13, 2013. Discovery of new variants or genes contributing to ischemic stroke risk and subtype (primary analysis) and determination of support for protein-coding variants contributing to risk in previously published candidate genes (secondary analysis). We identified 2 novel genes associated with an increased risk of ischemic stroke: a protein-coding variant in PDE4DIP (rs1778155; odds ratio, 2.15; P = 2.63 × 10(-8)) with an intracellular signal transduction mechanism and in ACOT4 (rs35724886; odds ratio, 2.04; P = 1.24 × 10(-7)) with a fatty acid metabolism; confirmation of PDE4DIP was observed in affected sibpair families with large-vessel stroke subtype and in African Americans. Replication of protein-coding variants in candidate genes was observed for 2 previously reported GWAS associations: ZFHX3 (cardioembolic stroke) and ABCA1 (large-vessel stroke). Exome sequencing discovered 2 novel genes and mechanisms, PDE4DIP and ACOT4, associated with increased risk for ischemic stroke. In addition, ZFHX3 and ABCA1 were discovered to have protein-coding variants associated with ischemic stroke. These results suggest that genetic variation in novel pathways contributes to ischemic stroke risk and serves as a target for prediction, prevention, and therapy.

Cytological Diagnosis of Follicular Variant of Papillary Thyroid Carcinoma before and after the Bethesda System for Reporting Thyroid Cytopathology.

PubMed

Fazeli, Roghayeh; VandenBussche, Christopher J; Bishop, Justin A; Ali, Syed Z

2016-01-01

The follicular variant of papillary thyroid carcinoma (FVPTC) is the second most common subtype of papillary carcinoma after the classical variant. The Bethesda System for Reporting Thyroid Cytopathology (TBSRTC) has been introduced to standardize the practice of thyroid fine needle aspiration (FNA) reporting. We evaluated the impact of TBSRTC on the FNA interpretation of histologically proven FVPTCs. Cytology reports of 455 histologically proven FVPTCs were reviewed. The rate of each TBSRTC category was compared between pre- and post-TBSRTC eras. The distribution of FNA diagnoses for pre-TBSRTC cases included suspicious for follicular neoplasm (SFN; n = 51, 28.7%), papillary thyroid carcinoma (PTC; n = 47, 26.4%), suspicious for malignancy (SFM; n = 32, 18%), atypia of undetermined significance (AUS; n = 23, 13%), benign (n = 18, 10.1%), and nondiagnostic (ND; n = 7, 4%). Post-TBSRTC diagnoses were: AUS (n = 68, 24.6%), PTC (n = 64, 23.1%), SFM (n = 50, 18%), SFN and benign (n = 42, 15.2%) and ND (n = 11, 4%). SFN rate decreased significantly from 28.7 to 15.2% (p = 0.001) and AUS increased from 12.9 to 24.5% (p = 0.003). Following implementation of TBSRTC, the frequency of AUS diagnoses on FNA prior to surgical resection increased. Given that the rate of FVPTC diagnoses on thyroidectomy increased over the same period, this suggests that the use of AUS has resulted in greater surgical resection of FVPTC. © 2016 S. Karger AG, Basel.

Triosephosphate isomerase gene promoter variation: -5G/A and -8G/A polymorphisms in clinical malaria groups in two African populations.

PubMed

Guerra, Mónica; Machado, Patrícia; Manco, Licínio; Fernandes, Natércia; Miranda, Juliana; Arez, Ana Paula

2015-06-01

TPI1 promoter polymorphisms occur in high prevalence in individuals from African origin. Malaria-patients from Angola and Mozambique were screened for the TPI1 gene promoter variants rs1800200A>G, (-5G>A), rs1800201G>A, (-8G>A), rs1800202T>G, (-24T>G), and for the intron 5 polymorphism rs2071069G>A, (2262G>A). -5G>A and -8G>A variants occur in 47% and 53% in Angola and Mozambique, respectively while -24T>G was monomorphic for the wild-type T allele. Six haplotypes were identified and -8A occurred in 45% of the individuals, especially associated with the GAG haplotype and more frequent in non-severe malaria groups, although not significantly. The arising and dispersion of -5G>A and -8G>A polymorphisms is controversial. Their age was estimated by analyses of two microsatellite loci, CD4 and ATN1, adjacent to TPI1 gene. The -5G>A is older than -8G>A, with an average estimate of approximately 35,000 years. The -8A variant arose in two different backgrounds, suggesting independent mutational events. The first, on the -5G background, may have occurred in East Africa around 20,800 years ago; the second, on the -5A background, may have occurred in West Africa some 7500 years ago. These estimates are within the period of spread of agriculture and the malaria mosquito vector in Africa, which could has been a possible reason for the selection of -8A polymorphism in malaria endemic countries. Copyright © 2015 Elsevier B.V. All rights reserved.

Association of recently identified type 2 diabetes gene variants with Gestational Diabetes in Asian Indian population.

PubMed

Kanthimathi, Sekar; Chidambaram, Manickam; Bodhini, Dhanasekaran; Liju, Samuel; Bhavatharini, Aruyerchelvan; Uma, Ram; Anjana, Ranjit Mohan; Mohan, Viswanathan; Radha, Venkatesan

2017-06-01

Earlier studies have provided evidence that the gestational diabetes mellitus (GDM) and Type 2 diabetes mellitus (T2DM) share common genetic background. A recent genome wide association study (GWAS) showed a strong association of six novel gene variants with T2DM among south Asians but not with Europeans. The aim of this study was to investigate whether these variants that confer susceptibility to T2DM in Asian Indian population also correlate with GDM in Asian Indian population. In addition to these novel variants, three T2DM associated SNPs that were previously identified by GWAS in Caucasian populations, which also showed association with T2DM in south Indian population in our previous study were also evaluated for their susceptibility to GDM in our population. The study groups comprised unrelated pregnant women with GDM (n = 518) and pregnant women with normal glucose tolerance (NGT) (n = 1220). A total of nine SNPs in or near nine loci, namely AP3S2 (rs2028299), BAZ1B (rs12056034), CDKN2A/B (rs7020996), GRB14 (rs3923113), HHEX (rs7923837), HMG20A (rs7178572), HNF4A (rs4812829), ST6GAL1 (rs16861329) and VPS26A (rs1802295) were genotyped using the MassARRAY system. Among these nine SNPs that previously showed an association with T2DM in Asian Indians, HMG20A (rs7178572) and HNF4A (rs4812829) gene variants showed a significant association with GDM. The risk alleles of rs7178572 in HMG20A and rs4812829 in HNF4A gene conferred 1.24 and 1.28 times higher risk independently and about 1.44 and 1.97 times increased susceptibility to GDM for one and two risk genotypes, respectively. We report that the HMG20A (rs7178572) and HNF4A (rs4812829) variants that have previously shown a strong association with T2DM in Asian Indians also contributes significant risk to GDM in this population. This is the first report of the association of HMG20A (rs7178572) and HNF4A (rs4812829) variants with GDM.

Structural Basis of Activity against Aztreonam and Extended Spectrum Cephalosporins for Two Carbapenem-Hydrolyzing Class D β-Lactamases from Acinetobacter baumannii

DOE PAGES

Mitchell, Joshua M.; Clasman, Jozlyn R.; June, Cynthia M.; ...

2015-02-24

The carbapenem-hydrolyzing class D β-lactamases OXA-23 and OXA-24/40 have emerged world-wide as causative agents for β-lactam antibiotic resistance in Acinetobacter species. Many variants of these enzymes have appeared clinically, including OXA-160 and OXA-225, which both contain a P→S substitution at homologous positions in the OXA-24/40 and OXA-23 backgrounds respectively. We purified OXA-160 and OXA-225 and used steady-state kinetic analysis to compare the substrate profiles of these variants to their parental enzymes, OXA-24/40 and OXA-23. OXA-160 and OXA-225 possess greatly enhanced hydrolytic activities against aztreonam, ceftazidime, cefotaxime and ceftriaxone when compared to OXA-24/40 and OXA-23. These enhanced activities are the resultmore » of much lower Km values, suggesting that the P→S substitution enhances the binding affinity of these drugs. We have determined the structures of the acylated forms of OXA-160 (with ceftazidime and aztreonam) and OXA-225 (ceftazidime). These structures show that the R1 oxyimino side-chain of these drugs occupies a space near the β5-β6 loop and the omega loop of the enzymes. The P→S substitution found in OXA-160 and OXA-225 results in a deviation of the β5-β6 loop, relieving the steric clash with the R1 side-chain carboxypropyl group of aztreonam and ceftazidime. We found that these results reveal worrying trends in the enhancement of substrate spectrum of class D β-lactamases, but may also provide a map for β-lactam improvement.« less

Comparison of the Inhibitory Profiles of Itraconazole and Cimetidine in Cytochrome P450 3A4 Genetic Variants

PubMed Central

Akiyoshi, Takeshi; Saito, Takashi; Murase, Saori; Miyazaki, Mitsue; Murayama, Norie; Yamazaki, Hiroshi; Guengerich, F. Peter; Nakamura, Katsunori; Yamamoto, Koujirou

2011-01-01

CYP3A4, an important drug-metabolizing enzyme, is known to have genetic variants. We have previously reported that CYP3A4 variants such as CYP3A4.2, 7, 16, and 18 show different enzymatic kinetics from CYP3A4.1 (wild type). In this study, we quantitatively investigated the inhibition kinetics of two typical inhibitors, itraconazole (ITCZ) and cimetidine (CMD), on CYP3A4 variants and evaluated whether the genetic variation leads to interindividual differences in the extent of CYP3A4-mediated drug interactions. The inhibitory profiles of ITCZ and CMD on the metabolism of testosterone (TST) were analyzed by using recombinant CYP3A4 variants. The genetic variation of CYP3A4 significantly affected the inhibition profiles of the two inhibitors. In CYP3A4.7, the Ki value for ITCZ was 2.4-fold higher than that for the wild-type enzyme, whereas the Ki value for CMD was 0.64-fold lower. In CYP3A4.16, the Ki value for ITCZ was 0.54-fold lower than that for wild-type CYP3A4, whereas the Ki value for CMD was 3.2-fold higher. The influence of other genetic variations also differed between the two inhibitors. Docking simulations could explain the changes in the Ki values, based on the accessibility of TST and inhibitors to the heme moiety of the CYP3A4 molecule. In conclusion, the inhibitory effects of an inhibitor differ among CYP3A4 variants, suggesting that the genetic variation of CYP3A4 may contribute, at least in part, to interindividual differences in drug interactions mediated by CYP3A4 inhibition, and the pattern of the influences of genetic variation differs among inhibitors as well as substrates. PMID:21212239

Copy number variants in patients with short stature

PubMed Central

van Duyvenvoorde, Hermine A; Lui, Julian C; Kant, Sarina G; Oostdijk, Wilma; Gijsbers, Antoinet CJ; Hoffer, Mariëtte JV; Karperien, Marcel; Walenkamp, Marie JE; Noordam, Cees; Voorhoeve, Paul G; Mericq, Verónica; Pereira, Alberto M; Claahsen-van de Grinten, Hedi L; van Gool, Sandy A; Breuning, Martijn H; Losekoot, Monique; Baron, Jeffrey; Ruivenkamp, Claudia AL; Wit, Jan M

2014-01-01

Height is a highly heritable and classic polygenic trait. Recent genome-wide association studies (GWAS) have revealed that at least 180 genetic variants influence adult height. However, these variants explain only about 10% of the phenotypic variation in height. Genetic analysis of short individuals can lead to the discovery of novel rare gene defects with a large effect on growth. In an effort to identify novel genes associated with short stature, genome-wide analysis for copy number variants (CNVs), using single-nucleotide polymorphism arrays, in 162 patients (149 families) with short stature was performed. Segregation analysis was performed if possible, and genes in CNVs were compared with information from GWAS, gene expression in rodents' growth plates and published information. CNVs were detected in 40 families. In six families, a known cause of short stature was found (SHOX deletion or duplication, IGF1R deletion), in two combined with a de novo potentially pathogenic CNV. Thirty-three families had one or more potentially pathogenic CNVs (n=40). In 24 of these families, segregation analysis could be performed, identifying three de novo CNVs and nine CNVs segregating with short stature. Four were located near loci associated with height in GWAS (ADAMTS17, TULP4, PRKG2/BMP3 and PAPPA). Besides six CNVs known to be causative for short stature, 40 CNVs with possible pathogenicity were identified. Segregation studies and bioinformatics analysis suggested various potential candidate genes. PMID:24065112

Sertraline for the treatment of depression in Alzheimer disease: genetic influences.

PubMed

Peters, Matthew E; Vaidya, Vijay; Drye, Lea T; Rosenberg, Paul B; Martin, Barbara K; Porsteinsson, Anton P; Frangakis, Constantine E; Mintzer, Jacobo; Weintraub, Daniel; Schneider, Lon S; Rabins, Peter V; Munro, Cynthia A; Meinert, Curtis L; Lyketsos, Constantine G; Avramopoulos, Dimitri; Dimitri, Avramopoulos

2011-12-01

To assess the potential for genetic influences on sertraline treatment efficacy for depression of Alzheimer disease (dAD). Four functional genetic variants were studied: 2 serotonin receptors (HTR2A-T102C and HTR2C-Cys23Ser), the serotonin transporter (5HTT-LPR), and brain-derived neurotrophic factor (BDNF-Val66Met). Treatment response by genotype was measured by (1) the modified Alzheimer's Disease Cooperative Study Clinical Global Impression of Change, (2) the Cornell scale for Depression in Dementia, and (3) remission of depression. We utilized data from the Depression in Alzheimer's Disease Study 2 (DIADS-2), a 24-week, randomized, multicenter trial showing no significant treatment effect of sertraline on dAD. Proportional odds logistic regression and mixed effects models were used to examine the above mentioned outcome measures. No significant interactions were seen between any of the genetic polymorphisms and the selected outcomes above at 12 or 24 weeks. Treatment outcomes in the DIADS-2 trial were not significantly influenced by genetic variation at the loci that were assessed. Future studies should continue to examine the interaction of depression-related genetic variants with antidepressant treatment in Alzheimer disease patients with depression.

First case of Hb Fontainebleau with sickle haemoglobin and other non-deletional α gene variants identified in neonates during newborn screening for sickle cell disorders.

PubMed

Upadhye, Dipti S; Jain, Dipty; Nair, Sona B; Nadkarni, Anita H; Ghosh, Kanjaksha; Colah, Roshan B

2012-07-01

To evaluate the significance of non-deletional α gene variants identified in neonates during newborn screening for sickle cell disorders. 1534 newborn babies were screened in the last 2 years for sickle cell disease using a targeted screening approach. Investigations included a complete blood count, high performance liquid chromatography analysis, cellulose acetate electrophoresis (pH 8.9), heat stability test, restriction digestion and Amplified Refractory Mutation System for confirmation of sickle haemoglobin (Hb S), α genotyping by multiplex PCR and DNA sequencing. Three non-deletional α gene variants, Hb Fontainebleau, Hb O Indonesia and Hb Koya Dora, were identified in heterozygous condition in newborns. This is the first report of Hb Fontainebleau in association with Hb S. The baby had anaemia at birth (Hb 11.4 g/dl) with no cyanosis, icterus or need for transfusion. She had occipital encephalocoele and was operated on day 24 to remove the mass. The baby diagnosed with Hb O Indonesia in combination with Hb S also had a low haemoglobin level of 12.7 g/dl. Newborn screening for sickle cell disorders also enabled us to identify three α globin chain variants. Two babies who inherited Hb Fontainebleau and Hb O Indonesia along with Hb S had reduced Hb levels at birth and need to be followed up.

Integrating Sequence-based GWAS and RNA-Seq Provides Novel Insights into the Genetic Basis of Mastitis and Milk Production in Dairy Cattle

PubMed Central

Fang, Lingzhao; Sahana, Goutam; Su, Guosheng; Yu, Ying; Zhang, Shengli; Lund, Mogens Sandø; Sørensen, Peter

2017-01-01

Connecting genome-wide association study (GWAS) to biological mechanisms underlying complex traits is a major challenge. Mastitis resistance and milk production are complex traits of economic importance in the dairy sector and are associated with intra-mammary infection (IMI). Here, we integrated IMI-relevant RNA-Seq data from Holstein cattle and sequence-based GWAS data from three dairy cattle breeds (i.e., Holstein, Nordic red cattle, and Jersey) to explore the genetic basis of mastitis resistance and milk production using post-GWAS analyses and a genomic feature linear mixed model. At 24 h post-IMI, genes responsive to IMI in the mammary gland were preferentially enriched for genetic variants associated with mastitis resistance rather than milk production. Response genes in the liver were mainly enriched for variants associated with mastitis resistance at an early time point (3 h) post-IMI, whereas responsive genes at later stages were enriched for associated variants with milk production. The up- and down-regulated genes were enriched for associated variants with mastitis resistance and milk production, respectively. The patterns were consistent across breeds, indicating that different breeds shared similarities in the genetic basis of these traits. Our approaches provide a framework for integrating multiple layers of data to understand the genetic architecture underlying complex traits. PMID:28358110

Two variants in the KIT gene as candidate causative mutations for a dominant white and a white spotting phenotype in the donkey.

PubMed

Haase, B; Rieder, S; Leeb, T

2015-06-01

White spotting phenotypes have been intensively studied in horses, and although similar phenotypes occur in the donkey, little is known about the molecular genetics underlying these patterns in donkeys. White spotting in donkeys can range from only a few white areas to almost complete depigmentation and is characterised by a loss of pigmentation usually progressing from a white spot in the hip area. Completely white-born donkeys are rare, and the phenotype is characterised by the complete absence of pigment resulting in pink skin and a white coat. A dominant mode of inheritance has been demonstrated for spotting in donkeys. Although the mode of inheritance for the completely white phenotype in donkeys is not clear, the phenotype shows similarities to dominant white in horses. As variants in the KIT gene are known to cause a range of white phenotypes in the horse, we investigated the KIT gene as a potential candidate gene for two phenotypes in the donkey, white spotting and white. A mutation analysis of all 21 KIT exons identified a missense variant in exon 4 (c.662A>C; p.Tyr221Ser) present only in a white-born donkey. A second variant affecting a splice donor site (c.1978+2T>A) was found exclusively in donkeys with white spotting. Both variants were absent in 24 solid-coloured controls. To the authors' knowledge, this is the first study investigating genetic mechanisms underlying white phenotypes in donkeys. Our results suggest that two independent KIT alleles are probably responsible for white spotting and white in donkeys. © 2015 Stichting International Foundation for Animal Genetics.

Genetic diagnosis of developmental disorders in the DDD study: a scalable analysis of genome-wide research data.

PubMed

Wright, Caroline F; Fitzgerald, Tomas W; Jones, Wendy D; Clayton, Stephen; McRae, Jeremy F; van Kogelenberg, Margriet; King, Daniel A; Ambridge, Kirsty; Barrett, Daniel M; Bayzetinova, Tanya; Bevan, A Paul; Bragin, Eugene; Chatzimichali, Eleni A; Gribble, Susan; Jones, Philip; Krishnappa, Netravathi; Mason, Laura E; Miller, Ray; Morley, Katherine I; Parthiban, Vijaya; Prigmore, Elena; Rajan, Diana; Sifrim, Alejandro; Swaminathan, G Jawahar; Tivey, Adrian R; Middleton, Anna; Parker, Michael; Carter, Nigel P; Barrett, Jeffrey C; Hurles, Matthew E; FitzPatrick, David R; Firth, Helen V

2015-04-04

Human genome sequencing has transformed our understanding of genomic variation and its relevance to health and disease, and is now starting to enter clinical practice for the diagnosis of rare diseases. The question of whether and how some categories of genomic findings should be shared with individual research participants is currently a topic of international debate, and development of robust analytical workflows to identify and communicate clinically relevant variants is paramount. The Deciphering Developmental Disorders (DDD) study has developed a UK-wide patient recruitment network involving over 180 clinicians across all 24 regional genetics services, and has performed genome-wide microarray and whole exome sequencing on children with undiagnosed developmental disorders and their parents. After data analysis, pertinent genomic variants were returned to individual research participants via their local clinical genetics team. Around 80,000 genomic variants were identified from exome sequencing and microarray analysis in each individual, of which on average 400 were rare and predicted to be protein altering. By focusing only on de novo and segregating variants in known developmental disorder genes, we achieved a diagnostic yield of 27% among 1133 previously investigated yet undiagnosed children with developmental disorders, whilst minimising incidental findings. In families with developmentally normal parents, whole exome sequencing of the child and both parents resulted in a 10-fold reduction in the number of potential causal variants that needed clinical evaluation compared to sequencing only the child. Most diagnostic variants identified in known genes were novel and not present in current databases of known disease variation. Implementation of a robust translational genomics workflow is achievable within a large-scale rare disease research study to allow feedback of potentially diagnostic findings to clinicians and research participants. Systematic recording of relevant clinical data, curation of a gene-phenotype knowledge base, and development of clinical decision support software are needed in addition to automated exclusion of almost all variants, which is crucial for scalable prioritisation and review of possible diagnostic variants. However, the resource requirements of development and maintenance of a clinical reporting system within a research setting are substantial. Health Innovation Challenge Fund, a parallel funding partnership between the Wellcome Trust and the UK Department of Health. Copyright © 2015 Wright et al. Open Access article distributed under the terms of CC BY. Published by Elsevier Ltd. All rights reserved.

Genetic diagnosis of developmental disorders in the DDD study: a scalable analysis of genome-wide research data

PubMed Central

Wright, Caroline F; Fitzgerald, Tomas W; Jones, Wendy D; Clayton, Stephen; McRae, Jeremy F; van Kogelenberg, Margriet; King, Daniel A; Ambridge, Kirsty; Barrett, Daniel M; Bayzetinova, Tanya; Bevan, A Paul; Bragin, Eugene; Chatzimichali, Eleni A; Gribble, Susan; Jones, Philip; Krishnappa, Netravathi; Mason, Laura E; Miller, Ray; Morley, Katherine I; Parthiban, Vijaya; Prigmore, Elena; Rajan, Diana; Sifrim, Alejandro; Swaminathan, G Jawahar; Tivey, Adrian R; Middleton, Anna; Parker, Michael; Carter, Nigel P; Barrett, Jeffrey C; Hurles, Matthew E; FitzPatrick, David R; Firth, Helen V

2015-01-01

Summary Background Human genome sequencing has transformed our understanding of genomic variation and its relevance to health and disease, and is now starting to enter clinical practice for the diagnosis of rare diseases. The question of whether and how some categories of genomic findings should be shared with individual research participants is currently a topic of international debate, and development of robust analytical workflows to identify and communicate clinically relevant variants is paramount. Methods The Deciphering Developmental Disorders (DDD) study has developed a UK-wide patient recruitment network involving over 180 clinicians across all 24 regional genetics services, and has performed genome-wide microarray and whole exome sequencing on children with undiagnosed developmental disorders and their parents. After data analysis, pertinent genomic variants were returned to individual research participants via their local clinical genetics team. Findings Around 80 000 genomic variants were identified from exome sequencing and microarray analysis in each individual, of which on average 400 were rare and predicted to be protein altering. By focusing only on de novo and segregating variants in known developmental disorder genes, we achieved a diagnostic yield of 27% among 1133 previously investigated yet undiagnosed children with developmental disorders, whilst minimising incidental findings. In families with developmentally normal parents, whole exome sequencing of the child and both parents resulted in a 10-fold reduction in the number of potential causal variants that needed clinical evaluation compared to sequencing only the child. Most diagnostic variants identified in known genes were novel and not present in current databases of known disease variation. Interpretation Implementation of a robust translational genomics workflow is achievable within a large-scale rare disease research study to allow feedback of potentially diagnostic findings to clinicians and research participants. Systematic recording of relevant clinical data, curation of a gene–phenotype knowledge base, and development of clinical decision support software are needed in addition to automated exclusion of almost all variants, which is crucial for scalable prioritisation and review of possible diagnostic variants. However, the resource requirements of development and maintenance of a clinical reporting system within a research setting are substantial. Funding Health Innovation Challenge Fund, a parallel funding partnership between the Wellcome Trust and the UK Department of Health. PMID:25529582

Large-Scale Analysis of Association Between LRP5 and LRP6 Variants and Osteoporosis

PubMed Central

van Meurs, Joyce B. J.; Trikalinos, Thomas A.; Ralston, Stuart H.; Balcells, Susana; Brandi, Maria Luisa; Brixen, Kim; Kiel, Douglas P.; Langdahl, Bente L.; Lips, Paul; Ljunggren, Östen; Lorenc, Roman; Obermayer-Pietsch, Barbara; Ohlsson, Claes; Pettersson, Ulrika; Reid, David M.; Rousseau, Francois; Scollen, Serena; Van Hul, Wim; Agueda, Lidia; Åkesson, Kristina; Benevolenskaya, Lidia I.; Ferrari, Serge L.; Hallmans, Göran; Hofman, Albert; Husted, Lise Bjerre; Kruk, Marcin; Kaptoge, Stephen; Karasik, David; Karlsson, Magnus K.; Lorentzon, Mattias; Masi, Laura; McGuigan, Fiona E. A.; Mellström, Dan; Mosekilde, Leif; Nogues, Xavier; Pols, Huibert A. P.; Reeve, Jonathan; Renner, Wilfried; Rivadeneira, Fernando; van Schoor, Natasja M.; Weber, Kurt; Ioannidis, John P. A.; Uitterlinden, André G.

2012-01-01

Context Mutations in the low-density lipoprotein receptor-related protein 5 (LRP5) gene cause rare syndromes characterized by altered bone mineral density (BMD). More common LRP5 variants may affect osteoporosis risk in the general population. Objective To generate large-scale evidence on whether 2 common variants of LRP5 (Val667Met, Ala1330Val) and 1 variant of LRP6 (Ile1062Val) are associated with BMD and fracture risk. Design and Setting Prospective, multicenter, collaborative study of individual-level data on 37 534 individuals from 18 participating teams in Europe and North America. Data were collected between September 2004 and January 2007; analysis of the collected data was performed between February and May 2007. Bone mineral density was assessed by dual-energy x-ray absorptiometry. Fractures were identified via questionnaire, medical records, or radiographic documentation; incident fracture data were available for some cohorts, ascertained via routine surveillance methods, including radiographic examination for vertebral fractures. Main Outcome Measures Bone mineral density of the lumbar spine and femoral neck; prevalence of all fractures and vertebral fractures. Results The Met667 allele of LRP5 was associated with reduced lumbar spine BMD (n =25 052 [number of participants with available data]; 20-mg/cm2 lower BMD per Met667 allele copy; P=3.3 × 10−8), as was the Val1330 allele (n = 24 812; 14-mg/cm2 lower BMD per Val1330 copy; P=2.6 × 10−9). Similar effects were observed for femoral neck BMD, with a decrease of 11 mg/cm2 (P =3.8 × 10−5) and 8 mg/cm2 (P=5.0×10−6) for the Met667 and Val1330 alleles, respectively (n=25 193). Findings were consistent across studies for both LRP5 alleles. Both alleles were associated with vertebral fractures (odds ratio [OR], 1.26; 95% confidence interval [CI], 1.08–1.47 for Met667 [2001 fractures among 20 488 individuals] and OR, 1.12; 95% CI, 1.01–1.24 for Val1330 [1988 fractures among 20 096 individuals]). Risk of all fractures was also increased with Met667 (OR, 1.14; 95% CI, 1.05–1.24 per allele [7876 fractures among 31 435 individuals)]) and Val1330 (OR, 1.06; 95% CI, 1.01–1.12 per allele [7802 fractures among 31 199 individuals]). Effects were similar when adjustments were made for age, weight, height, menopausal status, and use of hormone therapy. Fracture risks were partly attenuated by adjustment for BMD. Haplotype analysis indicated that Met667 and Val1330 variants both independently affected BMD. The LRP6 Ile1062Val polymorphism was not associated with any osteoporosis phenotype. All aforementioned associations except that between Val1330 and all fractures and vertebral fractures remained significant after multiple-comparison adjustments. Conclusions Common LRP5 variants are consistently associated with BMD and fracture risk across different white populations. The magnitude of the effect is modest. LRP5 may be the first gene to reach a genome-wide significance level (a conservative level of significance [herein, unadjusted P<10−7] that accounts for the many possible comparisons in the human genome) for a phenotype related to osteoporosis. PMID:18349089

Mutation of ATF6 causes autosomal recessive achromatopsia.

PubMed

Ansar, Muhammad; Santos-Cortez, Regie Lyn P; Saqib, Muhammad Arif Nadeem; Zulfiqar, Fareeha; Lee, Kwanghyuk; Ashraf, Naeem Mahmood; Ullah, Ehsan; Wang, Xin; Sajid, Sundus; Khan, Falak Sher; Amin-ud-Din, Muhammad; Smith, Joshua D; Shendure, Jay; Bamshad, Michael J; Nickerson, Deborah A; Hameed, Abdul; Riazuddin, Saima; Ahmed, Zubair M; Ahmad, Wasim; Leal, Suzanne M

2015-09-01

Achromatopsia (ACHM) is an early-onset retinal dystrophy characterized by photophobia, nystagmus, color blindness and severely reduced visual acuity. Currently mutations in five genes CNGA3, CNGB3, GNAT2, PDE6C and PDE6H have been implicated in ACHM. We performed homozygosity mapping and linkage analysis in a consanguineous Pakistani ACHM family and mapped the locus to a 15.12-Mb region on chromosome 1q23.1-q24.3 with a maximum LOD score of 3.6. A DNA sample from an affected family member underwent exome sequencing. Within the ATF6 gene, a single-base insertion variant c.355_356dupG (p.Glu119Glyfs*8) was identified, which completely segregates with the ACHM phenotype within the family. The frameshift variant was absent in public variant databases, in 130 exomes from unrelated Pakistani individuals, and in 235 ethnically matched controls. The variant is predicted to result in a truncated protein that lacks the DNA binding and transmembrane domains and therefore affects the function of ATF6 as a transcription factor that initiates the unfolded protein response during endoplasmic reticulum (ER) stress. Immunolabeling with anti-ATF6 antibodies showed localization throughout the mouse neuronal retina, including retinal pigment epithelium, photoreceptor cells, inner nuclear layer, inner and outer plexiform layers, with a more prominent signal in retinal ganglion cells. In contrast to cytoplasmic expression of wild-type protein, in heterologous cells ATF6 protein with the p.Glu119Glyfs*8 variant is mainly confined to the nucleus. Our results imply that response to ER stress as mediated by the ATF6 pathway is essential for color vision in humans.

Association of sequence variants on chromosomes 20, 11, and 5 (20q13.33, 11q23.3, and 5p15.33) with glioma susceptibility in a Chinese population.

PubMed

Chen, Hongyan; Chen, Yuanyuan; Zhao, Yao; Fan, Weiwei; Zhou, Keke; Liu, Yanhong; Zhou, Liangfu; Mao, Ying; Wei, Qingyi; Xu, Jianfeng; Lu, Daru

2011-04-15

Two genome-wide association studies of glioma in European populations identified 14 genetic variants strongly associated with risk of glioma, but it is unknown whether these variants are associated with glioma risk in Asian populations. The authors genotyped these 14 variants in 976 glioma patients and 1,057 control subjects to evaluate their associations with risk of glioma, particularly high-grade glioma (glioblastoma; n = 312), in a Chinese population (2004-2009). Overall, the authors identified 3 susceptibility loci for glioma risk at 20q13.33 (RTEL1 rs6010620 (P = 2.79 × 10(-6))), 11q23.3 (PHLDB1 rs498872 (P = 3.8 × 10(-6))), and 5p15.33 (TERT rs2736100 (P = 3.69 × 10(-4))) in this study population; these loci were also associated with glioblastoma risk (20q13.33: RTEL1 rs6010620 (P = 3.57 × 10(-7)); 11q23.3: PHLDB1 rs498872 (P = 7.24 × 10(-3)); 5p15.33: TERT rs2736100 and TERT rs2736098 (P = 1.21 × 10(-4) and P = 2.84 × 10(-4), respectively)). This study provides further evidence for 3 glioma susceptibility regions at 20q13.33, 11q23.3, and 5p15.33 in Chinese populations.

Evaluating aggregate effects of rare and common variants in the 1000 Genomes Project exon sequencing data using latent variable structural equation modeling.

PubMed

Nock, Nl; Zhang, Lx

2011-11-29

Methods that can evaluate aggregate effects of rare and common variants are limited. Therefore, we applied a two-stage approach to evaluate aggregate gene effects in the 1000 Genomes Project data, which contain 24,487 single-nucleotide polymorphisms (SNPs) in 697 unrelated individuals from 7 populations. In stage 1, we identified potentially interesting genes (PIGs) as those having at least one SNP meeting Bonferroni correction using univariate, multiple regression models. In stage 2, we evaluate aggregate PIG effects on trait, Q1, by modeling each gene as a latent construct, which is defined by multiple common and rare variants, using the multivariate statistical framework of structural equation modeling (SEM). In stage 1, we found that PIGs varied markedly between a randomly selected replicate (replicate 137) and 100 other replicates, with the exception of FLT1. In stage 1, collapsing rare variants decreased false positives but increased false negatives. In stage 2, we developed a good-fitting SEM model that included all nine genes simulated to affect Q1 (FLT1, KDR, ARNT, ELAV4, FLT4, HIF1A, HIF3A, VEGFA, VEGFC) and found that FLT1 had the largest effect on Q1 (βstd = 0.33 ± 0.05). Using replicate 137 estimates as population values, we found that the mean relative bias in the parameters (loadings, paths, residuals) and their standard errors across 100 replicates was on average, less than 5%. Our latent variable SEM approach provides a viable framework for modeling aggregate effects of rare and common variants in multiple genes, but more elegant methods are needed in stage 1 to minimize type I and type II error.

The discovery of the enteroviruses and the classification of poliovirus among them.

PubMed

Melnick, J L

1993-12-01

The history of the enteroviruses is described, and how poliovirus came to be recognized as the prototype species of the genus, a subdivision of the family Picornaviridae. Albert Sabin was one of the main contributors. He isolated several enterovirus types and established them as causative agents of human disease. The enteroviruses were discovered only after new methods were introduced for working with viruses. They are now recognized as constituting one of the genera of the picornavirus family. Pico-rna-virus stands for viruses which are small (pico), and have an RNA genome. The enterovirus genus includes the polioviruses, the coxsackieviruses and the echoviruses of humans, plus a number of enteroviruses of lower animals (e.g., monkeys, cattle, pigs, mice). Over 100 serotypes are now recognized, the first having been the polioviruses.

Simultaneous PET-MRI Studies of the Concordance of Atrophy and Hypometabolism in Syndromic Variants of Alzheimer's Disease and Frontotemporal Dementia: An Extended Case Series.

PubMed

Moodley, Kuven K; Perani, Daniela; Minati, Ludovico; Della Rosa, Pasquale Anthony; Pennycook, Frank; Dickson, John C; Barnes, Anna; Contarino, Valeria Elisa; Michopoulou, Sofia; D'Incerti, Ludovico; Good, Catriona; Fallanca, Federico; Vanoli, Emilia Giovanna; Ell, Peter J; Chan, Dennis

2015-01-01

Simultaneous PET-MRI is used to compare patterns of cerebral hypometabolism and atrophy in six different dementia syndromes. The primary objective was to conduct an initial exploratory study regarding the concordance of atrophy and hypometabolism in syndromic variants of Alzheimer's disease (AD) and frontotemporal dementia (FTD). The secondary objective was to determine the effect of image analysis methods on determination of atrophy and hypometabolism. PET and MRI data were acquired simultaneously on 24 subjects with six variants of AD and FTD (n = 4 per group). Atrophy was rated visually and also quantified with measures of cortical thickness. Hypometabolism was rated visually and also quantified using atlas- and SPM-based approaches. Concordance was measured using weighted Cohen's kappa. Atrophy-hypometabolism concordance differed markedly between patient groups; kappa scores ranged from 0.13 (nonfluent/agrammatic variant of primary progressive aphasia, nfvPPA) to 0.49 (posterior cortical variant of AD, PCA). Heterogeneity was also observed within groups; the confidence intervals of kappa scores ranging from 0-0.25 for PCA to 0.29-0.61 for nfvPPA. More widespread MRI and PET changes were identified using quantitative methods than on visual rating. The marked differences in concordance identified in this initial study may reflect differences in the molecular pathologies underlying AD and FTD syndromic variants but also operational differences in the methods used to diagnose these syndromes. The superior ability of quantitative methodologies to detect changes on PET and MRI, if confirmed on larger cohorts, may favor their usage over qualitative visual inspection in future clinical diagnostic practice.

Genome-Wide Association Studies of Metabolites in Patients with CKD Identify Multiple Loci and Illuminate Tubular Transport Mechanisms.

PubMed

Li, Yong; Sekula, Peggy; Wuttke, Matthias; Wahrheit, Judith; Hausknecht, Birgit; Schultheiss, Ulla T; Gronwald, Wolfram; Schlosser, Pascal; Tucci, Sara; Ekici, Arif B; Spiekerkoetter, Ute; Kronenberg, Florian; Eckardt, Kai-Uwe; Oefner, Peter J; Köttgen, Anna

2018-05-01

Background The kidneys have a central role in the generation, turnover, transport, and excretion of metabolites, and these functions can be altered in CKD. Genetic studies of metabolite concentrations can identify proteins performing these functions. Methods We conducted genome-wide association studies and aggregate rare variant tests of the concentrations of 139 serum metabolites and 41 urine metabolites, as well as their pairwise ratios and fractional excretions in up to 1168 patients with CKD. Results After correction for multiple testing, genome-wide significant associations were detected for 25 serum metabolites, two urine metabolites, and 259 serum and 14 urinary metabolite ratios. These included associations already known from population-based studies. Additional findings included an association for the uremic toxin putrescine and variants upstream of an enzyme catalyzing the oxidative deamination of polyamines ( AOC1 , P -min=2.4×10 -12 ), a relatively high carrier frequency (2%) for rare deleterious missense variants in ACADM that are collectively associated with serum ratios of medium-chain acylcarnitines ( P -burden=6.6×10 -16 ), and associations of a common variant in SLC7A9 with several ratios of lysine to neutral amino acids in urine, including the lysine/glutamine ratio ( P =2.2×10 -23 ). The associations of this SLC7A9 variant with ratios of lysine to specific neutral amino acids were much stronger than the association with lysine concentration alone. This finding is consistent with SLC7A9 functioning as an exchanger of urinary cationic amino acids against specific intracellular neutral amino acids at the apical membrane of proximal tubular cells. Conclusions Metabolomic indices of specific kidney functions in genetic studies may provide insight into human renal physiology. Copyright © 2018 by the American Society of Nephrology.

Systematic meta-analyses and field synopsis of genetic association studies in colorectal adenomas

PubMed Central

Montazeri, Zahra; Theodoratou, Evropi; Nyiraneza, Christine; Timofeeva, Maria; Chen, Wanjing; Svinti, Victoria; Sivakumaran, Shanya; Gresham, Gillian; Cubitt, Laura; Carvajal-Carmona, Luis; Bertagnolli, Monica M; Zauber, Ann G; Tomlinson, Ian; Farrington, Susan M; Dunlop, Malcolm G; Campbell, Harry; Little, Julian

2018-01-01

Background Low penetrance genetic variants, primarily single nucleotide polymorphisms, have substantial influence on colorectal cancer (CRC) susceptibility. Most CRCs develop from colorectal adenomas (CRA). Here, we report the first comprehensive field synopsis that catalogues all genetic association studies on CRA, with a parallel online database (http://www.chs.med.ed.ac.uk/CRAgene/). Methods We performed a systematic review, reviewing 9750 titles and then extracted data from 130 publications reporting on 181 polymorphisms in 74 genes. We conducted meta-analyses to derive summary effect estimates for 37 polymorphisms in 26 genes. We applied the Venice criteria and Bayesian False Discovery Probability (BFDP) to assess the levels of the credibility of associations. Results We considered the association with the rs6983267 variant at 8q24 as “highly credible”, reaching genome wide statistical significance in at least one meta-analysis model. We identified “less credible” associations (higher heterogeneity, lower statistical power, BFDP>0.02) with a further four variants of four independent genes: MTHFR c.677C>T p.A222V (rs1801133), TP53 c.215C>G p.R72P (rs1042522), NQO1 c.559C>T p.P187S (rs1800566), and NAT1 alleles imputed as fast acetylator genotypes. For the remaining 32 variants of 22 genes for which positive associations with CRA risk have been previously reported, the meta-analyses revealed no credible evidence to support these as true associations. Conclusions The limited number of credible associations between low penetrance genetic variants and CRA reflects the lower volume of evidence and associated lack of statistical power to detect associations of the magnitude typically observed for genetic variants and chronic diseases. The CRAgene database provides context for CRA genetic association data and will help inform future research directions. PMID:26451011

Fine-Scale Mapping of the 5q11.2 Breast Cancer Locus Reveals at Least Three Independent Risk Variants Regulating MAP3K1

PubMed Central

Glubb, Dylan M.; Maranian, Mel J.; Michailidou, Kyriaki; Pooley, Karen A.; Meyer, Kerstin B.; Kar, Siddhartha; Carlebur, Saskia; O’Reilly, Martin; Betts, Joshua A.; Hillman, Kristine M.; Kaufmann, Susanne; Beesley, Jonathan; Canisius, Sander; Hopper, John L.; Southey, Melissa C.; Tsimiklis, Helen; Apicella, Carmel; Schmidt, Marjanka K.; Broeks, Annegien; Hogervorst, Frans B.; van der Schoot, C. Ellen; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Fasching, Peter A.; Ruebner, Matthias; Ekici, Arif B.; Beckmann, Matthias W.; Peto, Julian; dos-Santos-Silva, Isabel; Fletcher, Olivia; Johnson, Nichola; Pharoah, Paul D.P.; Bolla, Manjeet K.; Wang, Qin; Dennis, Joe; Sawyer, Elinor J.; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Burwinkel, Barbara; Marme, Frederik; Yang, Rongxi; Surowy, Harald; Guénel, Pascal; Truong, Thérèse; Menegaux, Florence; Sanchez, Marie; Bojesen, Stig E.; Nordestgaard, Børge G.; Nielsen, Sune F.; Flyger, Henrik; González-Neira, Anna; Benitez, Javier; Zamora, M. Pilar; Arias Perez, Jose Ignacio; Anton-Culver, Hoda; Neuhausen, Susan L.; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Meindl, Alfons; Schmutzler, Rita K.; Brauch, Hiltrud; Ko, Yon-Dschun; Brüning, Thomas; Nevanlinna, Heli; Muranen, Taru A.; Aittomäki, Kristiina; Blomqvist, Carl; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Tanaka, Hideo; Dörk, Thilo; Bogdanova, Natalia V.; Helbig, Sonja; Lindblom, Annika; Margolin, Sara; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M.; Wu, Anna H.; Tseng, Chiu-chen; Van Den Berg, David; Stram, Daniel O.; Lambrechts, Diether; Zhao, Hui; Weltens, Caroline; van Limbergen, Erik; Chang-Claude, Jenny; Flesch-Janys, Dieter; Rudolph, Anja; Seibold, Petra; Radice, Paolo; Peterlongo, Paolo; Barile, Monica; Capra, Fabio; Couch, Fergus J.; Olson, Janet E.; Hallberg, Emily; Vachon, Celine; Giles, Graham G.; Milne, Roger L.; McLean, Catriona; Haiman, Christopher A.; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Simard, Jacques; Goldberg, Mark S.; Labrèche, France; Dumont, Martine; Teo, Soo Hwang; Yip, Cheng Har; See, Mee-Hoong; Cornes, Belinda; Cheng, Ching-Yu; Ikram, M. Kamran; Kristensen, Vessela; Zheng, Wei; Halverson, Sandra L.; Shrubsole, Martha; Long, Jirong; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Kauppila, Saila; Andrulis, Irene L.; Knight, Julia A.; Glendon, Gord; Tchatchou, Sandrine; Devilee, Peter; Tollenaar, Robert A.E.M.; Seynaeve, Caroline; Van Asperen, Christi J.; García-Closas, Montserrat; Figueroa, Jonine; Chanock, Stephen J.; Lissowska, Jolanta; Czene, Kamila; Klevebring, Daniel; Darabi, Hatef; Eriksson, Mikael; Hooning, Maartje J.; Hollestelle, Antoinette; Martens, John W.M.; Collée, J. Margriet; Hall, Per; Li, Jingmei; Humphreys, Keith; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Hui; Cox, Angela; Cross, Simon S.; Reed, Malcolm W.R.; Blot, William; Signorello, Lisa B.; Cai, Qiuyin; Shah, Mitul; Ghoussaini, Maya; Kang, Daehee; Choi, Ji-Yeob; Park, Sue K.; Noh, Dong-Young; Hartman, Mikael; Miao, Hui; Lim, Wei Yen; Tang, Anthony; Hamann, Ute; Torres, Diana; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; McKay, James; Olswold, Curtis; Slager, Susan; Toland, Amanda E.; Yannoukakos, Drakoulis; Shen, Chen-Yang; Wu, Pei-Ei; Yu, Jyh-Cherng; Hou, Ming-Feng; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Jones, Michael; Pita, Guillermo; Alonso, M. Rosario; Álvarez, Nuria; Herrero, Daniel; Tessier, Daniel C.; Vincent, Daniel; Bacot, Francois; Luccarini, Craig; Baynes, Caroline; Ahmed, Shahana; Healey, Catherine S.; Brown, Melissa A.; Ponder, Bruce A.J.; Chenevix-Trench, Georgia; Thompson, Deborah J.; Edwards, Stacey L.; Easton, Douglas F.; Dunning, Alison M.; French, Juliet D.

2015-01-01

Genome-wide association studies (GWASs) have revealed SNP rs889312 on 5q11.2 to be associated with breast cancer risk in women of European ancestry. In an attempt to identify the biologically relevant variants, we analyzed 909 genetic variants across 5q11.2 in 103,991 breast cancer individuals and control individuals from 52 studies in the Breast Cancer Association Consortium. Multiple logistic regression analyses identified three independent risk signals: the strongest associations were with 15 correlated variants (iCHAV1), where the minor allele of the best candidate, rs62355902, associated with significantly increased risks of both estrogen-receptor-positive (ER+: odds ratio [OR] = 1.24, 95% confidence interval [CI] = 1.21–1.27, ptrend = 5.7 × 10−44) and estrogen-receptor-negative (ER−: OR = 1.10, 95% CI = 1.05–1.15, ptrend = 3.0 × 10−4) tumors. After adjustment for rs62355902, we found evidence of association of a further 173 variants (iCHAV2) containing three subsets with a range of effects (the strongest was rs113317823 [pcond = 1.61 × 10−5]) and five variants composing iCHAV3 (lead rs11949391; ER+: OR = 0.90, 95% CI = 0.87–0.93, pcond = 1.4 × 10−4). Twenty-six percent of the prioritized candidate variants coincided with four putative regulatory elements that interact with the MAP3K1 promoter through chromatin looping and affect MAP3K1 promoter activity. Functional analysis indicated that the cancer risk alleles of four candidates (rs74345699 and rs62355900 [iCHAV1], rs16886397 [iCHAV2a], and rs17432750 [iCHAV3]) increased MAP3K1 transcriptional activity. Chromatin immunoprecipitation analysis revealed diminished GATA3 binding to the minor (cancer-protective) allele of rs17432750, indicating a mechanism for its action. We propose that the cancer risk alleles act to increase MAP3K1 expression in vivo and might promote breast cancer cell survival. PMID:25529635

Fine-scale mapping of the 5q11.2 breast cancer locus reveals at least three independent risk variants regulating MAP3K1.

PubMed

Glubb, Dylan M; Maranian, Mel J; Michailidou, Kyriaki; Pooley, Karen A; Meyer, Kerstin B; Kar, Siddhartha; Carlebur, Saskia; O'Reilly, Martin; Betts, Joshua A; Hillman, Kristine M; Kaufmann, Susanne; Beesley, Jonathan; Canisius, Sander; Hopper, John L; Southey, Melissa C; Tsimiklis, Helen; Apicella, Carmel; Schmidt, Marjanka K; Broeks, Annegien; Hogervorst, Frans B; van der Schoot, C Ellen; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Fasching, Peter A; Ruebner, Matthias; Ekici, Arif B; Beckmann, Matthias W; Peto, Julian; dos-Santos-Silva, Isabel; Fletcher, Olivia; Johnson, Nichola; Pharoah, Paul D P; Bolla, Manjeet K; Wang, Qin; Dennis, Joe; Sawyer, Elinor J; Tomlinson, Ian; Kerin, Michael J; Miller, Nicola; Burwinkel, Barbara; Marme, Frederik; Yang, Rongxi; Surowy, Harald; Guénel, Pascal; Truong, Thérèse; Menegaux, Florence; Sanchez, Marie; Bojesen, Stig E; Nordestgaard, Børge G; Nielsen, Sune F; Flyger, Henrik; González-Neira, Anna; Benitez, Javier; Zamora, M Pilar; Arias Perez, Jose Ignacio; Anton-Culver, Hoda; Neuhausen, Susan L; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Meindl, Alfons; Schmutzler, Rita K; Brauch, Hiltrud; Ko, Yon-Dschun; Brüning, Thomas; Nevanlinna, Heli; Muranen, Taru A; Aittomäki, Kristiina; Blomqvist, Carl; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Tanaka, Hideo; Dörk, Thilo; Bogdanova, Natalia V; Helbig, Sonja; Lindblom, Annika; Margolin, Sara; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Wu, Anna H; Tseng, Chiu-chen; Van Den Berg, David; Stram, Daniel O; Lambrechts, Diether; Zhao, Hui; Weltens, Caroline; van Limbergen, Erik; Chang-Claude, Jenny; Flesch-Janys, Dieter; Rudolph, Anja; Seibold, Petra; Radice, Paolo; Peterlongo, Paolo; Barile, Monica; Capra, Fabio; Couch, Fergus J; Olson, Janet E; Hallberg, Emily; Vachon, Celine; Giles, Graham G; Milne, Roger L; McLean, Catriona; Haiman, Christopher A; Henderson, Brian E; Schumacher, Fredrick; Le Marchand, Loic; Simard, Jacques; Goldberg, Mark S; Labrèche, France; Dumont, Martine; Teo, Soo Hwang; Yip, Cheng Har; See, Mee-Hoong; Cornes, Belinda; Cheng, Ching-Yu; Ikram, M Kamran; Kristensen, Vessela; Zheng, Wei; Halverson, Sandra L; Shrubsole, Martha; Long, Jirong; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Kauppila, Saila; Andrulis, Irene L; Knight, Julia A; Glendon, Gord; Tchatchou, Sandrine; Devilee, Peter; Tollenaar, Robert A E M; Seynaeve, Caroline; Van Asperen, Christi J; García-Closas, Montserrat; Figueroa, Jonine; Chanock, Stephen J; Lissowska, Jolanta; Czene, Kamila; Klevebring, Daniel; Darabi, Hatef; Eriksson, Mikael; Hooning, Maartje J; Hollestelle, Antoinette; Martens, John W M; Collée, J Margriet; Hall, Per; Li, Jingmei; Humphreys, Keith; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Hui; Cox, Angela; Cross, Simon S; Reed, Malcolm W R; Blot, William; Signorello, Lisa B; Cai, Qiuyin; Shah, Mitul; Ghoussaini, Maya; Kang, Daehee; Choi, Ji-Yeob; Park, Sue K; Noh, Dong-Young; Hartman, Mikael; Miao, Hui; Lim, Wei Yen; Tang, Anthony; Hamann, Ute; Torres, Diana; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; McKay, James; Olswold, Curtis; Slager, Susan; Toland, Amanda E; Yannoukakos, Drakoulis; Shen, Chen-Yang; Wu, Pei-Ei; Yu, Jyh-Cherng; Hou, Ming-Feng; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Jones, Michael; Pita, Guillermo; Alonso, M Rosario; Álvarez, Nuria; Herrero, Daniel; Tessier, Daniel C; Vincent, Daniel; Bacot, Francois; Luccarini, Craig; Baynes, Caroline; Ahmed, Shahana; Healey, Catherine S; Brown, Melissa A; Ponder, Bruce A J; Chenevix-Trench, Georgia; Thompson, Deborah J; Edwards, Stacey L; Easton, Douglas F; Dunning, Alison M; French, Juliet D

2015-01-08

Genome-wide association studies (GWASs) have revealed SNP rs889312 on 5q11.2 to be associated with breast cancer risk in women of European ancestry. In an attempt to identify the biologically relevant variants, we analyzed 909 genetic variants across 5q11.2 in 103,991 breast cancer individuals and control individuals from 52 studies in the Breast Cancer Association Consortium. Multiple logistic regression analyses identified three independent risk signals: the strongest associations were with 15 correlated variants (iCHAV1), where the minor allele of the best candidate, rs62355902, associated with significantly increased risks of both estrogen-receptor-positive (ER(+): odds ratio [OR] = 1.24, 95% confidence interval [CI] = 1.21-1.27, ptrend = 5.7 × 10(-44)) and estrogen-receptor-negative (ER(-): OR = 1.10, 95% CI = 1.05-1.15, ptrend = 3.0 × 10(-4)) tumors. After adjustment for rs62355902, we found evidence of association of a further 173 variants (iCHAV2) containing three subsets with a range of effects (the strongest was rs113317823 [pcond = 1.61 × 10(-5)]) and five variants composing iCHAV3 (lead rs11949391; ER(+): OR = 0.90, 95% CI = 0.87-0.93, pcond = 1.4 × 10(-4)). Twenty-six percent of the prioritized candidate variants coincided with four putative regulatory elements that interact with the MAP3K1 promoter through chromatin looping and affect MAP3K1 promoter activity. Functional analysis indicated that the cancer risk alleles of four candidates (rs74345699 and rs62355900 [iCHAV1], rs16886397 [iCHAV2a], and rs17432750 [iCHAV3]) increased MAP3K1 transcriptional activity. Chromatin immunoprecipitation analysis revealed diminished GATA3 binding to the minor (cancer-protective) allele of rs17432750, indicating a mechanism for its action. We propose that the cancer risk alleles act to increase MAP3K1 expression in vivo and might promote breast cancer cell survival. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Epidemiological characterizations, pathogen spectrum and molecular characteristics of Coxsackievirus A16 from patients with HFMD in Yantai, Shandong, China between 2011 and 2015

PubMed Central

Sun, Zhenlu; Zhang, Guifang; Guo, Peijun; Liu, Juan; Gao, Qiao; Xu, Xiaowen; Gong, Lianfeng

2017-01-01

ABSTRACT This study aimed to investigate the epidemiological characterizations and pathogen spectrum of hand, foot, and mouth disease (HFMD) in Yantai City, Shandong Province, China, during 2011–2015, and to study the nucleotide evolution and amino acid variation of coxsackievirus A16 (CV-A16) epidemic strains that caused HFMD. The HFMD epidemic began to rise in March, and became prevalent from May to August, reached its peak in June, and then declined in September every year, children aged one to 5 years-old had the highest incidence rate whereas the incidence in children under 6 months was very low, and there were more males than females. Enterovirus nucleic acid detection using real-time reverse transcription polymerase chain reaction was performed on 2130 clinical specimens collected from patients with HFMD between 2011 and 2015, and 2012 enterovirus positive samples were detected, including 678 CV-A16, 639 EV-A71, and 695 other enteroviruses. In total, 60 CV-A16 isolates were randomly selected each year for virus isolation, of which 33 CV-A16 strains were randomly selected for further characterization because CV-A16 is the predominant serotype that caused HFMD in Yantai City, and a phylogenetic tree based on the VP1 region was constructed. All 33 CV-A16 strains belonged to the Bla and B1b genotypes, with a nucleotide similarity of 87.9–100% and deduced amino acid similarity of 98.6–100%. Compared with the reference strain Tainan/5079/98 (AF177911), amino acid mutations were identified at positions 11, 23, 25, 31, 99, 145, and 289, where differences were observed among 33 strains, indicating a unique mutation map of CV-A16 in Yantai City. Our findings demonstrate the etiologic characteristics of HFMD, provide supporting evidence for the prevention and control of HFMD, and open a promising avenue for vaccine development against HFMD, by targeting CV-A16. PMID:28537484

Verrucoid Variant of Invasive Squamous Cell Carcinoma in Oral Submucous Fibrosis: A Clinicopathological Challenge.

PubMed

Ramani, Priya; Krithika, C; Ananthalakshmi, R; Singaram, Mamta; Jagdish, Praveena; Janardhanan, Sunitha; Jeevakarunyam, Sathiyajeeva

2016-11-04

Verrucous carcinoma (VC) is an exophytic, low-grade, well-differentiated variant of squamous cell carcinoma. It is described as a lesion appearing in the sixth or seventh decade of life that has minimal aggressive potential and, in long-standing cases, has been shown to transform into squamous cell carcinoma. Oral submucous fibrosis (OSMF) is a potentially malignant disorder, and about one-third of the affected population develop oral squamous cell carcinoma. The histopathological diagnosis of verrucous carcinoma is challenging, and the interpretation of early squamous cell carcinoma requires immense experience. Here we present a rare case of a 24-year-old male with OSMF transforming to verrucous carcinoma with invasive squamous cell carcinoma. Even though the case had a straightforward clinical diagnosis, the serial sectioning done for pathological diagnosis disclosed the squamous cell carcinoma.

Loss-of-function nuclear factor κB subunit 1 (NFKB1) variants are the most common monogenic cause of common variable immunodeficiency in Europeans.

PubMed

Tuijnenburg, Paul; Lango Allen, Hana; Burns, Siobhan O; Greene, Daniel; Jansen, Machiel H; Staples, Emily; Stephens, Jonathan; Carss, Keren J; Biasci, Daniele; Baxendale, Helen; Thomas, Moira; Chandra, Anita; Kiani-Alikhan, Sorena; Longhurst, Hilary J; Seneviratne, Suranjith L; Oksenhendler, Eric; Simeoni, Ilenia; de Bree, Godelieve J; Tool, Anton T J; van Leeuwen, Ester M M; Ebberink, Eduard H T M; Meijer, Alexander B; Tuna, Salih; Whitehorn, Deborah; Brown, Matthew; Turro, Ernest; Thrasher, Adrian J; Smith, Kenneth G C; Thaventhiran, James E; Kuijpers, Taco W

2018-03-02

The genetic cause of primary immunodeficiency disease (PID) carries prognostic information. We conducted a whole-genome sequencing study assessing a large proportion of the NIHR BioResource-Rare Diseases cohort. In the predominantly European study population of principally sporadic unrelated PID cases (n = 846), a novel Bayesian method identified nuclear factor κB subunit 1 (NFKB1) as one of the genes most strongly associated with PID, and the association was explained by 16 novel heterozygous truncating, missense, and gene deletion variants. This accounted for 4% of common variable immunodeficiency (CVID) cases (n = 390) in the cohort. Amino acid substitutions predicted to be pathogenic were assessed by means of analysis of structural protein data. Immunophenotyping, immunoblotting, and ex vivo stimulation of lymphocytes determined the functional effects of these variants. Detailed clinical and pedigree information was collected for genotype-phenotype cosegregation analyses. Both sporadic and familial cases demonstrated evidence of the noninfective complications of CVID, including massive lymphadenopathy (24%), unexplained splenomegaly (48%), and autoimmune disease (48%), features prior studies correlated with worse clinical prognosis. Although partial penetrance of clinical symptoms was noted in certain pedigrees, all carriers have a deficiency in B-lymphocyte differentiation. Detailed assessment of B-lymphocyte numbers, phenotype, and function identifies the presence of an increased CD21 low B-cell population. Combined with identification of the disease-causing variant, this distinguishes between healthy subjects, asymptomatic carriers, and clinically affected cases. We show that heterozygous loss-of-function variants in NFKB1 are the most common known monogenic cause of CVID, which results in a temporally progressive defect in the formation of immunoglobulin-producing B cells. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Functional variants in the LRRK2 gene confer shared effects on risk for Crohn's disease and Parkinson's disease.

PubMed

Hui, Ken Y; Fernandez-Hernandez, Heriberto; Hu, Jianzhong; Schaffner, Adam; Pankratz, Nathan; Hsu, Nai-Yun; Chuang, Ling-Shiang; Carmi, Shai; Villaverde, Nicole; Li, Xianting; Rivas, Manual; Levine, Adam P; Bao, Xiuliang; Labrias, Philippe R; Haritunians, Talin; Ruane, Darren; Gettler, Kyle; Chen, Ernie; Li, Dalin; Schiff, Elena R; Pontikos, Nikolas; Barzilai, Nir; Brant, Steven R; Bressman, Susan; Cheifetz, Adam S; Clark, Lorraine N; Daly, Mark J; Desnick, Robert J; Duerr, Richard H; Katz, Seymour; Lencz, Todd; Myers, Richard H; Ostrer, Harry; Ozelius, Laurie; Payami, Haydeh; Peter, Yakov; Rioux, John D; Segal, Anthony W; Scott, William K; Silverberg, Mark S; Vance, Jeffery M; Ubarretxena-Belandia, Iban; Foroud, Tatiana; Atzmon, Gil; Pe'er, Itsik; Ioannou, Yiannis; McGovern, Dermot P B; Yue, Zhenyu; Schadt, Eric E; Cho, Judy H; Peter, Inga

2018-01-10

Crohn's disease (CD), a form of inflammatory bowel disease, has a higher prevalence in Ashkenazi Jewish than in non-Jewish European populations. To define the role of nonsynonymous mutations, we performed exome sequencing of Ashkenazi Jewish patients with CD, followed by array-based genotyping and association analysis in 2066 CD cases and 3633 healthy controls. We detected association signals in the LRRK2 gene that conferred risk for CD (N2081D variant, P = 9.5 × 10 -10 ) or protection from CD (N551K variant, tagging R1398H-associated haplotype, P = 3.3 × 10 -8 ). These variants affected CD age of onset, disease location, LRRK2 activity, and autophagy. Bayesian network analysis of CD patient intestinal tissue further implicated LRRK2 in CD pathogenesis. Analysis of the extended LRRK2 locus in 24,570 CD cases, patients with Parkinson's disease (PD), and healthy controls revealed extensive pleiotropy, with shared genetic effects between CD and PD in both Ashkenazi Jewish and non-Jewish cohorts. The LRRK2 N2081D CD risk allele is located in the same kinase domain as G2019S, a mutation that is the major genetic cause of familial and sporadic PD. Like the G2019S mutation, the N2081D variant was associated with increased kinase activity, whereas neither N551K nor R1398H variants on the protective haplotype altered kinase activity. We also confirmed that R1398H, but not N551K, increased guanosine triphosphate binding and hydrolyzing enzyme (GTPase) activity, thereby deactivating LRRK2. The presence of shared LRRK2 alleles in CD and PD provides refined insight into disease mechanisms and may have major implications for the treatment of these two seemingly unrelated diseases. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Characterization of genetic sequence variation of 58 STR loci in four major population groups.

PubMed

Novroski, Nicole M M; King, Jonathan L; Churchill, Jennifer D; Seah, Lay Hong; Budowle, Bruce

2016-11-01

Massively parallel sequencing (MPS) can identify sequence variation within short tandem repeat (STR) alleles as well as their nominal allele lengths that traditionally have been obtained by capillary electrophoresis. Using the MiSeq FGx Forensic Genomics System (Illumina), STRait Razor, and in-house excel workbooks, genetic variation was characterized within STR repeat and flanking regions of 27 autosomal, 7 X-chromosome and 24 Y-chromosome STR markers in 777 unrelated individuals from four population groups. Seven hundred and forty six autosomal, 227 X-chromosome, and 324 Y-chromosome STR alleles were identified by sequence compared with 357 autosomal, 107 X-chromosome, and 189 Y-chromosome STR alleles that were identified by length. Within the observed sequence variation, 227 autosomal, 156 X-chromosome, and 112 Y-chromosome novel alleles were identified and described. One hundred and seventy six autosomal, 123 X-chromosome, and 93 Y-chromosome sequence variants resided within STR repeat regions, and 86 autosomal, 39 X-chromosome, and 20 Y-chromosome variants were located in STR flanking regions. Three markers, D18S51, DXS10135, and DYS385a-b had 1, 4, and 1 alleles, respectively, which contained both a novel repeat region variant and a flanking sequence variant in the same nucleotide sequence. There were 50 markers that demonstrated a relative increase in diversity with the variant sequence alleles compared with those of traditional nominal length alleles. These population data illustrate the genetic variation that exists in the commonly used STR markers in the selected population samples and provide allele frequencies for statistical calculations related to STR profiling with MPS data. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Prognostic Relevance of Urinary Bladder Cancer Susceptibility Loci

PubMed Central

Grotenhuis, Anne J.; Dudek, Aleksandra M.; Verhaegh, Gerald W.; Witjes, J. Alfred; Aben, Katja K.; van der Marel, Saskia L.; Vermeulen, Sita H.; Kiemeney, Lambertus A.

2014-01-01

In the last few years, susceptibility loci have been identified for urinary bladder cancer (UBC) through candidate-gene and genome-wide association studies. Prognostic relevance of most of these loci is yet unknown. In this study, we used data of the Nijmegen Bladder Cancer Study (NBCS) to perform a comprehensive evaluation of the prognostic relevance of all confirmed UBC susceptibility loci. Detailed clinical data concerning diagnosis, stage, treatment, and disease course of a population-based series of 1,602 UBC patients were collected retrospectively based on a medical file survey. Kaplan-Meier survival analyses and Cox proportional hazard regression were performed, and log-rank tests calculated, to evaluate the association between 12 confirmed UBC susceptibility variants and recurrence and progression in non-muscle invasive bladder cancer (NMIBC) patients. Among muscle-invasive or metastatic bladder cancer (MIBC) patients, association of these variants with overall survival was tested. Subgroup analyses by tumor aggressiveness and smoking status were performed in NMIBC patients. In the overall NMIBC group (n = 1,269), a statistically significant association between rs9642880 at 8q24 and risk of progression was observed (GT vs. TT: HR = 1.08 (95% CI: 0.76–1.54), GG vs. TT: HR = 1.81 (95% CI: 1.23–2.66), P for trend = 2.6×10−3). In subgroup analyses, several other variants showed suggestive, though non-significant, prognostic relevance for recurrence and progression in NMIBC and survival in MIBC. This study provides suggestive evidence that genetic loci involved in UBC etiology may influence disease prognosis. Elucidation of the causal variant(s) could further our understanding of the mechanism of disease, could point to new therapeutic targets, and might aid in improvement of prognostic tools. PMID:24586564

Brief Report: Late-Onset Cryopyrin-Associated Periodic Syndrome Due to Myeloid-Restricted Somatic NLRP3 Mosaicism.

PubMed

Mensa-Vilaro, Anna; Teresa Bosque, María; Magri, Giuliana; Honda, Yoshitaka; Martínez-Banaclocha, Helios; Casorran-Berges, Marta; Sintes, Jordi; González-Roca, Eva; Ruiz-Ortiz, Estibaliz; Heike, Toshio; Martínez-Garcia, Juan J; Baroja-Mazo, Alberto; Cerutti, Andrea; Nishikomori, Ryuta; Yagüe, Jordi; Pelegrín, Pablo; Delgado-Beltran, Concha; Aróstegui, Juan I

2016-12-01

Gain-of-function NLRP3 mutations cause cryopyrin-associated periodic syndrome (CAPS), with gene mosaicism playing a relevant role in the pathogenesis. This study was undertaken to characterize the genetic cause underlying late-onset but otherwise typical CAPS. We studied a 64-year-old patient who presented with recurrent episodes of urticaria-like rash, fever, conjunctivitis, and oligoarthritis at age 56 years. DNA was extracted from both unfractionated blood and isolated leukocyte and CD34+ subpopulations. Genetic studies were performed using both the Sanger method of DNA sequencing and next-generation sequencing (NGS) methods. In vitro and ex vivo analyses were performed to determine the consequences that the presence of the variant have in the normal structure or function of the protein of the detected variant. NGS analyses revealed the novel p.Gln636Glu NLRP3 variant in unfractionated blood, with an allele frequency (18.4%) compatible with gene mosaicism. Sanger sequence chromatograms revealed a small peak corresponding to the variant allele. Amplicon-based deep sequencing revealed somatic NLRP3 mosaicism restricted to myeloid cells (31.8% in monocytes, 24.6% in neutrophils, and 11.2% in circulating CD34+ common myeloid progenitor cells) and its complete absence in lymphoid cells. Functional analyses confirmed the gain-of-function behavior of the gene variant and hyperactivity of the NLRP3 inflammasome in the patient. Treatment with anakinra resulted in good control of the disease. We identified the novel gain-of-function p.Gln636Glu NLRP3 mutation, which was detected as a somatic mutation restricted to myeloid cells, as the cause of late-onset but otherwise typical CAPS. Our results expand the diversity of CAPS toward milder phenotypes than previously reported, including those starting during adulthood. © 2016, American College of Rheumatology.

Genetic variants associated with susceptibility to psychosis in late-onset Alzheimer's disease families.

PubMed

Barral, Sandra; Vardarajan, Badri N; Reyes-Dumeyer, Dolly; Faber, Kelley M; Bird, Thomas D; Tsuang, Debby; Bennett, David A; Rosenberg, Roger; Boeve, Bradley F; Graff-Radford, Neill R; Goate, Alison M; Farlow, Martin; Lantigua, Rafael; Medrano, Martin Z; Wang, Xinbing; Kamboh, M Ilyas; Barmada, Mahmud Muhiedine; Schaid, Daniel J; Foroud, Tatiana M; Weamer, Elise A; Ottman, Ruth; Sweet, Robert A; Mayeux, Richard

2015-11-01

Psychotic symptoms are frequent in late-onset Alzheimer's disease (LOAD) patients. Although the risk for psychosis in LOAD is genetically mediated, no genes have been identified. To identify loci potentially containing genetic variants associated with risk of psychosis in LOAD, a total of 263 families from the National Institute of Aging-LOAD cohort were classified into psychotic (LOAD+P, n = 215) and nonpsychotic (LOAD-P, n = 48) families based on the presence/absence of psychosis during the course of LOAD. The LOAD+P families yielded strong evidence of linkage on chromosome 19q13 (two-point [2-pt] ​logarithm of odds [LOD] = 3.8, rs2285513 and multipoint LOD = 2.7, rs541169). Joint linkage and association in 19q13 region detected strong association with rs2945988 (p = 8.7 × 10(-7)). Linkage results for the LOAD-P families yielded nonsignificant 19q13 LOD scores. Several 19q13 single-nucleotide polymorphisms generalized the association of LOAD+P in a Caribbean Hispanic (CH) cohort, and the strongest signal was rs10410711 (pmeta = 5.1 × 10(-5)). A variant located 24 kb upstream of rs10410711 and rs10421862 was strongly associated with LOAD+P (pmeta = 1.0 × 10(-5)) in a meta-analysis of the CH cohort and an additional non-Hispanic Caucasian dataset. Identified variants rs2945988 and rs10421862 affect brain gene expression levels. Our results suggest that genetic variants in genes on 19q13, some of which are involved in brain development and neurodegeneration, may influence the susceptibility to psychosis in LOAD patients. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Evaluation of chromosome 6p22 as a breast cancer risk modifier locus in a follow-up study of BRCA2 mutation carriers

PubMed Central

Stevens, Kristen N.; Wang, Xianshu; Fredericksen, Zachary; Pankratz, Vernon S.; Greene, Mark H.; Andrulis, Irene L.; Thomassen, Mads; Caligo, Maria; Nathanson, Katherine L.; Jakubowska, Anna; Osorio, Ana; Hamann, Ute; Godwin, Andrew K.; Stoppa-Lyonnet, Dominique; Southey, Melissa; Buys, Saundra S.; Singer, Christian F.; Hansen, Thomas V.O.; Arason, Adalgeir; Offit, Kenneth; Piedmonte, Marion; Montagna, Marco; Imyanitov, Evgeny; Tihomirova, Laima; Sucheston, Lara; Beattie, Mary; Neuhausen, Susan L.; Szabo, Csilla I.; Simard, Jacques; Spurdle, Amanda B.; Healey, Sue; Chen, Xiaoqing; Rebbeck, Timothy R.; Easton, Douglas F.; Chenevix-Trench, Georgia; Antoniou, Antonis C; Couch, Fergus J.

2012-01-01

Several common germline variants identified through genome-wide association studies of breast cancer risk in the general population have recently been shown to be associated with breast cancer risk for BRCA1 and/or BRCA2 mutation carriers. When combined, these variants can identify marked differences in the absolute risk of developing breast cancer for mutation carriers, suggesting that additional modifier loci may further enhance individual risk assessment for BRCA1 and BRCA2 mutation carriers. Recently, a common variant on 6p22 (rs9393597) was found to be associated with increased breast cancer risk for BRCA2 mutation carriers [Hazard ratio (HR)=1.55, 95% CI 1.25–1.92, p=6.0×10−5]. This observation was based on data from GWAS studies in which, despite statistical correction for multiple comparisons, the possibility of false discovery remains a concern. Here we report on an analysis of this variant in an additional 6,165 BRCA1 and 3,900 BRCA2 mutation carriers from the Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA). In this replication analysis, rs9393597 was not associated with breast cancer risk for BRCA2 mutation carriers [HR=1.09, 95% CI 0.96–1.24, p=0.18]. No association with ovarian cancer risk for BRCA1 or BRCA2 mutation carriers or with breast cancer risk for BRCA1 mutation carriers was observed. This follow-up study suggests that, contrary to our initial report, this variant is not associated with breast cancer risk among individuals with germline BRCA2 mutations. PMID:23011509

The Structures of the C185S and C185A Mutants of Sulfite Oxidase Reveal Rearrangement of the Active Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qiu, James A.; Wilson, Heather L.; Pushie, M. Jake

Sulfite oxidase (SO) catalyzes the physiologically critical conversion of sulfite to sulfate. Enzymatic activity is dependent on the presence of the metal molybdenum complexed with a pyranopterin-dithiolene cofactor termed molybdopterin. Comparison of the amino acid sequences of SOs from a variety of sources has identified a single conserved Cys residue essential for catalytic activity. The crystal structure of chicken liver sulfite oxidase indicated that this residue, Cys185 in chicken SO, coordinates the Mo atom in the active site. To improve our understanding of the role of this residue in the catalytic mechanism of sulfite oxidase, serine and alanine variants atmore » position 185 of recombinant chicken SO were generated. Spectroscopic and kinetic studies indicate that neither variant is capable of sulfite oxidation. The crystal structure of the C185S variant was determined to 1.9 {angstrom} resolution and to 2.4 {angstrom} resolution in the presence of sulfite, and the C185A variant to 2.8 {angstrom} resolution. The structures of the C185S and C185A variants revealed that neither the Ser or Ala side chains appeared to closely interact with the Mo atom and that a third oxo group replaced the usual cysteine sulfur ligand at the Mo center, confirming earlier extended X-ray absorption fine structure spectroscopy (EXAFS) work on the human C207S mutant. An unexpected result was that in the C185S variant, in the absence of sulfite, the active site residue Tyr322 became disordered as did the loop region flanking it. In the C185S variant crystallized in the presence of sulfite, the Tyr322 residue relocalized to the active site. The C185A variant structure also indicated the presence of a third oxygen ligand; however, Tyr322 remained in the active site. EXAFS studies of the Mo coordination environment indicate the Mo atom is in the oxidized Mo{sup VI} state in both the C185S and C185A variants of chicken SO and show the expected trioxodithiolene active site. Density functional theory calculations of the trioxo form of the cofactor reasonably reproducd the Mo=O distances of the complex; however, the calculated Mo-S distances were slightly longer than either crystallographic or EXAFS measurements. Taken together, these results indicate that the active sites of the C185S and C185A variants are essentially catalytically inactive, the crystal structures of C185S and C185A variants contain a fully oxidized, trioxo form of the cofactor, and Tyr322 can undergo a conformational change that is relevant to the reaction mechanism. Additional DFT calculations demonstrated that such methods can reasonably reproduce the geometry and bond lengths of the active site.« less

A homozygous transthyretin variant associated with senile systemic amyloidosis: evidence for a late-onset disease of genetic etiology.

PubMed Central

Jacobson, D R; Gorevic, P D; Buxbaum, J N

1990-01-01

Senile systemic amyloidosis (SSA) is a late-onset disease characterized by deposition of amyloid fibrils containing transthyretin (TTR). Amino acid sequencing of protein isolated from the amyloid fibrils of a patient with SSA identified TTR containing a position - 122 isoleucine-for-valine substitution. This change led to the prediction of a genomic G-to-A transition, destroying an MaeIII restriction site. We confirmed the presence of the variant DNA fragment both by Southern blotting and by visualization of MaeIII digests of DNA amplified around codon 122, by using the polymerase chain reaction. The patient's DNA was entirely resistant to MaeIII cleavage; therefore, only the mutant sequence was present. DNA from none of either 24 controls or six other SSA patients contained the variant. Quantitative Southern blotting demonstrated that the patient's DNA contained two copies of the TTR gene per genome; the mutation was therefore homozygous rather than hemizygous. In the present case, the homozygous mutation TTR (122 Val----Ile) is associated with SSA, a finding which is consistent with autosomal recessive inheritance of this condition. Images Figure 2 Figure 4 Figure 5 Figure 6 Figure 7 PMID:2349941

A genome-wide association study yields five novel thyroid cancer risk loci

PubMed Central

Gudmundsson, Julius; Thorleifsson, Gudmar; Sigurdsson, Jon K.; Stefansdottir, Lilja; Jonasson, Jon G.; Gudjonsson, Sigurjon A.; Gudbjartsson, Daniel F.; Masson, Gisli; Johannsdottir, Hrefna; Halldorsson, Gisli H.; Stacey, Simon N.; Helgason, Hannes; Sulem, Patrick; Senter, Leigha; He, Huiling; Liyanarachchi, Sandya; Ringel, Matthew D.; Aguillo, Esperanza; Panadero, Angeles; Prats, Enrique; Garcia-Castaño, Almudena; De Juan, Ana; Rivera, Fernando; Xu, Li; Kiemeney, Lambertus A.; Eyjolfsson, Gudmundur I.; Sigurdardottir, Olof; Olafsson, Isleifur; Kristvinsson, Hoskuldur; Netea-Maier, Romana T.; Jonsson, Thorvaldur; Mayordomo, Jose I.; Plantinga, Theo S.; Hjartarson, Hannes; Hrafnkelsson, Jon; Sturgis, Erich M.; Thorsteinsdottir, Unnur; Rafnar, Thorunn; de la Chapelle, Albert; Stefansson, Kari

2017-01-01

The great majority of thyroid cancers are of the non-medullary type. Here we report findings from a genome-wide association study of non-medullary thyroid cancer, including in total 3,001 patients and 287,550 controls from five study groups of European descent. Our results yield five novel loci (all with Pcombined<3 × 10−8): 1q42.2 (rs12129938 in PCNXL2), 3q26.2 (rs6793295 a missense mutation in LRCC34 near TERC), 5q22.1 (rs73227498 between NREP and EPB41L4A), 10q24.33 (rs7902587 near OBFC1), and two independently associated variants at 15q22.33 (rs2289261 and rs56062135; both in SMAD3). We also confirm recently published association results from a Chinese study of a variant on 5p15.33 (rs2736100 near the TERT gene) and present a stronger association result for a moderately correlated variant (rs10069690; OR=1.20, P=3.2 × 10−7) based on our study of individuals of European ancestry. In combination, these results raise several opportunities for future studies of the pathogenesis of thyroid cancer. PMID:28195142

A genome-wide association study yields five novel thyroid cancer risk loci.

PubMed

Gudmundsson, Julius; Thorleifsson, Gudmar; Sigurdsson, Jon K; Stefansdottir, Lilja; Jonasson, Jon G; Gudjonsson, Sigurjon A; Gudbjartsson, Daniel F; Masson, Gisli; Johannsdottir, Hrefna; Halldorsson, Gisli H; Stacey, Simon N; Helgason, Hannes; Sulem, Patrick; Senter, Leigha; He, Huiling; Liyanarachchi, Sandya; Ringel, Matthew D; Aguillo, Esperanza; Panadero, Angeles; Prats, Enrique; Garcia-Castaño, Almudena; De Juan, Ana; Rivera, Fernando; Xu, Li; Kiemeney, Lambertus A; Eyjolfsson, Gudmundur I; Sigurdardottir, Olof; Olafsson, Isleifur; Kristvinsson, Hoskuldur; Netea-Maier, Romana T; Jonsson, Thorvaldur; Mayordomo, Jose I; Plantinga, Theo S; Hjartarson, Hannes; Hrafnkelsson, Jon; Sturgis, Erich M; Thorsteinsdottir, Unnur; Rafnar, Thorunn; de la Chapelle, Albert; Stefansson, Kari

2017-02-14

The great majority of thyroid cancers are of the non-medullary type. Here we report findings from a genome-wide association study of non-medullary thyroid cancer, including in total 3,001 patients and 287,550 controls from five study groups of European descent. Our results yield five novel loci (all with P combined <3 × 10 -8 ): 1q42.2 (rs12129938 in PCNXL2), 3q26.2 (rs6793295 a missense mutation in LRCC34 near TERC), 5q22.1 (rs73227498 between NREP and EPB41L4A), 10q24.33 (rs7902587 near OBFC1), and two independently associated variants at 15q22.33 (rs2289261 and rs56062135; both in SMAD3). We also confirm recently published association results from a Chinese study of a variant on 5p15.33 (rs2736100 near the TERT gene) and present a stronger association result for a moderately correlated variant (rs10069690; OR=1.20, P=3.2 × 10 -7 ) based on our study of individuals of European ancestry. In combination, these results raise several opportunities for future studies of the pathogenesis of thyroid cancer.

dNTP pool levels modulate mutator phenotypes of error-prone DNA polymerase ε variants.

PubMed

Williams, Lindsey N; Marjavaara, Lisette; Knowels, Gary M; Schultz, Eric M; Fox, Edward J; Chabes, Andrei; Herr, Alan J

2015-05-12

Mutator phenotypes create genetic diversity that fuels tumor evolution. DNA polymerase (Pol) ε mediates leading strand DNA replication. Proofreading defects in this enzyme drive a number of human malignancies. Here, using budding yeast, we show that mutator variants of Pol ε depend on damage uninducible (Dun)1, an S-phase checkpoint kinase that maintains dNTP levels during a normal cell cycle and up-regulates dNTP synthesis upon checkpoint activation. Deletion of DUN1 (dun1Δ) suppresses the mutator phenotype of pol2-4 (encoding Pol ε proofreading deficiency) and is synthetically lethal with pol2-M644G (encoding altered Pol ε base selectivity). Although pol2-4 cells cycle normally, pol2-M644G cells progress slowly through S-phase. The pol2-M644G cells tolerate deletions of mediator of the replication checkpoint (MRC) 1 (mrc1Δ) and radiation sensitive (Rad) 9 (rad9Δ), which encode mediators of checkpoint responses to replication stress and DNA damage, respectively. The pol2-M644G mutator phenotype is partially suppressed by mrc1Δ but not rad9Δ; neither deletion suppresses the pol2-4 mutator phenotype. Thus, checkpoint activation augments the Dun1 effect on replication fidelity but is not required for it. Deletions of genes encoding key Dun1 targets that negatively regulate dNTP synthesis, suppress the dun1Δ pol2-M644G synthetic lethality and restore the mutator phenotype of pol2-4 in dun1Δ cells. DUN1 pol2-M644G cells have constitutively high dNTP levels, consistent with checkpoint activation. In contrast, pol2-4 and POL2 cells have similar dNTP levels, which decline in the absence of Dun1 and rise in the absence of the negative regulators of dNTP synthesis. Thus, dNTP pool levels correlate with Pol ε mutator severity, suggesting that treatments targeting dNTP pools could modulate mutator phenotypes for therapy.

The RNA template channel of the RNA-dependent RNA polymerase as a target for development of antiviral therapy of multiple genera within a virus family.

PubMed

van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D; Arnold, Jamie J; Cameron, Craig E; Verdaguer, Nuria; Neyts, Johan; van Kuppeveld, Frank J M

2015-03-01

The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy. Nucleoside-based inhibitors have broad-spectrum activity but often exhibit off-target effects. Most non-nucleoside inhibitors (NNIs) target surface cavities, which are structurally more flexible than the nucleotide-binding pocket, and hence have a more narrow spectrum of activity and are more prone to resistance development. Here, we report a novel NNI, GPC-N114 (2,2'-[(4-chloro-1,2-phenylene)bis(oxy)]bis(5-nitro-benzonitrile)) with broad-spectrum activity against enteroviruses and cardioviruses (another genus in the picornavirus family). Surprisingly, coxsackievirus B3 (CVB3) and poliovirus displayed a high genetic barrier to resistance against GPC-N114. By contrast, EMCV, a cardiovirus, rapidly acquired resistance due to mutations in 3Dpol. In vitro polymerase activity assays showed that GPC-N114 i) inhibited the elongation activity of recombinant CVB3 and EMCV 3Dpol, (ii) had reduced activity against EMCV 3Dpol with the resistance mutations, and (iii) was most efficient in inhibiting 3Dpol when added before the RNA template-primer duplex. Elucidation of a crystal structure of the inhibitor bound to CVB3 3Dpol confirmed the RNA-binding channel as the target for GPC-N114. Docking studies of the compound into the crystal structures of the compound-resistant EMCV 3Dpol mutants suggested that the resistant phenotype is due to subtle changes that interfere with the binding of GPC-N114 but not of the RNA template-primer. In conclusion, this study presents the first NNI that targets the RNA template channel of the picornavirus polymerase and identifies a new pocket that can be used for the design of broad-spectrum inhibitors. Moreover, this study provides important new insight into the plasticity of picornavirus polymerases at the template binding site.

The RNA Template Channel of the RNA-Dependent RNA Polymerase as a Target for Development of Antiviral Therapy of Multiple Genera within a Virus Family

PubMed Central

van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M.; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D.; Arnold, Jamie J.; Cameron, Craig E.; Verdaguer, Nuria

2015-01-01

The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy. Nucleoside-based inhibitors have broad-spectrum activity but often exhibit off-target effects. Most non-nucleoside inhibitors (NNIs) target surface cavities, which are structurally more flexible than the nucleotide-binding pocket, and hence have a more narrow spectrum of activity and are more prone to resistance development. Here, we report a novel NNI, GPC-N114 (2,2'-[(4-chloro-1,2-phenylene)bis(oxy)]bis(5-nitro-benzonitrile)) with broad-spectrum activity against enteroviruses and cardioviruses (another genus in the picornavirus family). Surprisingly, coxsackievirus B3 (CVB3) and poliovirus displayed a high genetic barrier to resistance against GPC-N114. By contrast, EMCV, a cardiovirus, rapidly acquired resistance due to mutations in 3Dpol. In vitro polymerase activity assays showed that GPC-N114 i) inhibited the elongation activity of recombinant CVB3 and EMCV 3Dpol, (ii) had reduced activity against EMCV 3Dpol with the resistance mutations, and (iii) was most efficient in inhibiting 3Dpol when added before the RNA template-primer duplex. Elucidation of a crystal structure of the inhibitor bound to CVB3 3Dpol confirmed the RNA-binding channel as the target for GPC-N114. Docking studies of the compound into the crystal structures of the compound-resistant EMCV 3Dpol mutants suggested that the resistant phenotype is due to subtle changes that interfere with the binding of GPC-N114 but not of the RNA template-primer. In conclusion, this study presents the first NNI that targets the RNA template channel of the picornavirus polymerase and identifies a new pocket that can be used for the design of broad-spectrum inhibitors. Moreover, this study provides important new insight into the plasticity of picornavirus polymerases at the template binding site. PMID:25799064

Hemoglobin Abraham Lincoln, beta32 (B14) leucine leads to proline. An unstable variant producing severe hemolytic disease.

PubMed

Honig, G R; Green, D; Shamsuddin, M; Vida, L N; Mason, R G; Gnarra, D J; Maurer, H S

1973-07-01

An unstable hemoglobin variant was identified in a Negro woman with hemolytic anemia since infancy. A splenectomy had been performed when the patient was a child. The anemia was accompanied by erythrocyte inclusion bodies and excretion of darkly pigmented urine. Neither parent of the proposita demonstrated any hematologic abnormality, and it appeared that this hemoglobin variant arose as a new mutation. Erythrocyte survival in the patient was greatly reduced: the erythrocyte t(1/2) using radiochromium as a tag was 2.4 days, and a reticulocyte survival study performed after labeling the cells with L-[(14)C]leucine indicated a t(1/2) of 7.2 days. When stroma-free hemolysates were heated at 50 degrees C, 16-20% of the hemoglobin precipitated. The thermolability was prevented by the addition of hemin, carbon monoxide, or dithionite, suggesting an abnormality of heme binding. An increased rate of methemoglobin formation was also observed after incubation of erythrocytes at 37 degrees C. The abnormal hemoglobin could not be separated from hemoglobin A by electrophoresis or chromatography, but it was possible to isolate the variant beta-chain by precipitation with p-hydroxymercuribenzoate. Purification of the beta-chain by column chromatography followed by peptide mapping and amino acid analysis demonstrated a substitution of proline for beta32 leucine. It appears likely that a major effect of this substitution is a disruption of the normal orientation of the adjacent leucine residue at beta31 to impair heme stabilization.

Hemoglobin Abraham Lincoln, β32 (B14) Leucine → Proline AN UNSTABLE VARIANT PRODUCING SEVERE HEMOLYTIC DISEASE

PubMed Central

Honig, George R.; Green, David; Shamsuddin, Mir; Vida, Loyda N.; Mason, R. George; Gnarra, David J.; Maurer, Helen S.

1973-01-01

An unstable hemoglobin variant was identified in a Negro woman with hemolytic anemia since infancy. A splenectomy had been performed when the patient was a child. The anemia was accompanied by erythrocyte inclusion bodies and excretion of darkly pigmented urine. Neither parent of the proposita demonstrated any hematologic abnormality, and it appeared that this hemoglobin variant arose as a new mutation. Erythrocyte survival in the patient was greatly reduced: the erythrocyte t½ using radiochromium as a tag was 2.4 days, and a reticulocyte survival study performed after labeling the cells with L-[14C]leucine indicated a t½ of 7.2 days. When stroma-free hemolysates were heated at 50°C, 16-20% of the hemoglobin precipitated. The thermolability was prevented by the addition of hemin, carbon monoxide, or dithionite, suggesting an abnormality of heme binding. An increased rate of methemoglobin formation was also observed after incubation of erythrocytes at 37°C. The abnormal hemoglobin could not be separated from hemoglobin A by electrophoresis or chromatography, but it was possible to isolate the variant β-chain by precipitation with p-hydroxymercuribenzoate. Purification of the β-chain by column chromatography followed by peptide mapping and amino acid analysis demonstrated a substitution of proline for β32 leucine. It appears likely that a major effect of this substitution is a disruption of the normal orientation of the adjacent leucine residue at β31 to impair heme stabilization. Images PMID:4352462

Genetic risk variants for membranous nephropathy: extension of and association with other chronic kidney disease aetiologies.

PubMed

Sekula, Peggy; Li, Yong; Stanescu, Horia C; Wuttke, Matthias; Ekici, Arif B; Bockenhauer, Detlef; Walz, Gerd; Powis, Stephen H; Kielstein, Jan T; Brenchley, Paul; Eckardt, Kai-Uwe; Kronenberg, Florian; Kleta, Robert; Köttgen, Anna

2017-02-01

Membranous nephropathy (MN) is a common cause of nephrotic syndrome in adults. Previous genome-wide association studies (GWAS) of 300 000 genotyped variants identified MN-associated loci at HLA-DQA1 and PLA2R1. We used a combined approach of genotype imputation, GWAS, human leucocyte antigen (HLA) imputation and extension to other aetiologies of chronic kidney disease (CKD) to investigate genetic MN risk variants more comprehensively. GWAS using 9 million high-quality imputed genotypes and classical HLA alleles were conducted for 323 MN European-ancestry cases and 345 controls. Additionally, 4960 patients with different CKD aetiologies in the German Chronic Kidney Disease (GCKD) study were genotyped for risk variants at HLA-DQA1 and PLA2R1. In GWAS, lead variants in known loci [rs9272729, HLA-DQA1, odds ratio (OR) = 7.3 per risk allele, P = 5.9 × 10 -27 and rs17830558, PLA2R1, OR = 2.2, P = 1.9 × 10 -8 ] were significantly associated with MN. No novel signals emerged in GWAS of X-chromosomal variants or in sex-specific analyses. Classical HLA alleles (DRB1*0301-DQA1*0501-DQB1*0201 haplotype) were associated with MN but provided little additional information beyond rs9272729. Associations were replicated in 137 GCKD patients with MN (HLA-DQA1: P = 6.4 × 10 -24 ; PLA2R1: P = 5.0 × 10 -4 ). MN risk increased steeply for patients with high-risk genotype combinations (OR > 79). While genetic variation in PLA2R1 exclusively associated with MN across 19 CKD aetiologies, the HLA-DQA1 risk allele was also associated with lupus nephritis (P = 2.8 × 10 -6 ), type 1 diabetic nephropathy (P = 6.9 × 10 -5 ) and focal segmental glomerulosclerosis (P = 5.1 × 10 -5 ), but not with immunoglobulin A nephropathy. PLA2R1 and HLA-DQA1 are the predominant risk loci for MN detected by GWAS. While HLA-DQA1 risk variants show an association with other CKD aetiologies, PLA2R1 variants are specific to MN. © The Author 2016. Published by Oxford University Press on behalf of ERA-EDTA. All rights reserved.

Distribution of Porphyromonas gingivalis fimA genotypes in primary endodontic infections.

PubMed

Rôças, Isabela N; Siqueira, José F

2010-03-01

Long fimbriae (FimA) are important virulence factors of Porphyromonas gingivalis. Based on the diversity of the fimA gene, this species is classified into 6 genotypes. This study surveyed samples from primary endodontic infections for the presence of these P. gingivalis fimA variants. Genomic DNA isolated from samples taken from 25 root canals of teeth with chronic apical periodontitis and 25 aspirates from acute apical abscess was used as template in polymerase chain reaction (PCR) assays directed toward the detection of the different P. gingivalis fimA genotypes. Porphyromonas gingivalis was detected by a 16S rRNA gene-based PCR in 36% of the total number of cases sampled (44% of chronic apical periodontitis and 28% of abscess aspirates). In cases of chronic apical periodontitis, P. gingivalis variant type IV was the most prevalent (24%), followed by types I (20%), II (16%), and III (8%). In acute abscess samples, variant type II was the most prevalent (12%), followed by types III and IV (8% of each) and type I (4%). Combinations of up to 3 different genotypes were detected in a few cases. No single fimA genotype variant or combination thereof was significantly associated with symptoms. Overall, fimA types IV (16%), II (14%), and I (12%) were the most prevalent. Findings demonstrated that different P. gingivalis fimA genotypes can be present in primary endodontic infections. Copyright 2010 Mosby, Inc. All rights reserved.

Variants of opioid system genes are associated with non-dependent opioid use and heroin dependence.

PubMed

Randesi, Matthew; van den Brink, Wim; Levran, Orna; Blanken, Peter; Butelman, Eduardo R; Yuferov, Vadim; da Rosa, Joel Correa; Ott, Jurg; van Ree, Jan M; Kreek, Mary Jeanne

2016-11-01

Heroin addiction is a chronic, relapsing brain disease. Genetic factors are involved in the development of drug addiction. The aim of this study was to determine whether specific variants in genes of the opioid system are associated with non-dependent opioid use and heroin dependence. Genetic information from four subject groups was collected: non-dependent opioid users (NOD) [n=163]; opioid-dependent (OD) patients in methadone maintenance treatment (MMT) [n=143]; opioid-dependent MMT-resistant patients in heroin-assisted treatment (HAT) [n=138]; and healthy controls with no history of opioid use (HC) [n=153]. Eighty-two variants in eight opioid system genes were studied. To establish the role of these genes in (a) non-dependent opioid use, and (b) heroin dependence, the following groups were compared: HC vs. NOD; HC vs. OD (MMT+HAT); and NOD vs. OD (MMT+HAT). Five unique SNPs in four genes showed nominally significant associations with non-dependent opioid use and heroin dependence. The association of the delta opioid receptor (OPRD1) intronic SNP rs2236861 with non-dependent opioid use (HC vs. NOD) remained significant after correction for multiple testing (OR=0.032; p corrected =0.015). This SNP exhibited a significant gene-gene interaction with prepronociceptin (PNOC) SNP rs2722897 (OR=5.24; p corrected =0.041) (HC vs. NOD). This study identifies several new and some previously reported associations of variants with heroin dependence and with non-dependent opioid use, an important and difficult to obtain group not extensively studied previously. Further studies are warranted to confirm and elucidate the potential roles of these variants in the vulnerability to illicit drug use and drug addiction. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

The mitochondrial respiratory chain has a critical role in the antiviral process in Coxsackievirus B3-induced myocarditis.

PubMed

Ebermann, Linda; Wika, Sylwia; Klumpe, Inga; Hammer, Elke; Klingel, Karin; Lassner, Dirk; Völker, Uwe; Erben, Ulrike; Zeichhardt, Heinz; Schultheiss, Heinz-Peter; Dörner, Andrea

2012-01-01

Well-established differences in Coxsackievirus B3 (CVB3) elimination in resistant C57BL/6 and permissive A.SW/SnJ mice provide suitable models for studying the significance of the link between mitochondrial respiratory chain (RC), antioxidative stress components and mitochondrion-related apoptosis in the context of myocardial virus elimination. Distinct myocardial CVB3 titer in C57BL/6 (2.5 ± 1.4 × 10(4) plaque-forming units (p.f.u.)/g tissue) and A.SW/SnJ mice (1.4 ± 0.8 × 10(7) p.f.u./g) were associated with differences in the cardiac mitochondrial function 8 days post infection (p.i.). Infected C57BL/6 mouse hearts disclosed increased complex I (CI) and CIII activity, but restricted CII and normal CIV activity of RC. Reduced expression of the antioxidative catalase was accompanied by elevated lipid peroxidation (LPO), indicating oxidative stress. Intrinsic apoptosis was activated demonstrated by elevated levels of Bax, Bcl-2, caspase 3 and DNA degradation. In contrast, all myocardial RC complex activities were restricted in CVB3-infected A.SW/SnJ mice. The antioxidative system provided sufficient protection against oxidative stress shown by an elevated catalase expression and unaltered LPO. Bax and Bcl-2 levels were unchanged in CVB3-infected A.SW/SnJ mice, while caspase 3 was moderately increased but no DNA degradation was detectable. Correlation analyses including data from the two mouse strains revealed that reduced CVB3 titer correlated with increased CI and CIII activity, oxidative stress as well as active apoptosis during acute myocarditis (MC). C57BL/6 mice completely eliminated CVB3 and inflammation and normalized all intracellular parameters, while A.SW/SnJ mice showed permanently restricted CI activity in chronic MC 90 days p.i., at which time the replicating virus was no longer detectable but immunological processes were still active. Consequently, the regulation of energy metabolism appears crucial for an effective virus elimination and may be of prognostic and therapeutic significance for patients with virus-induced MC.

Epidemiologic and clinical features of non-polio enteroviral infections in northern Taiwan in 2008.

PubMed

Hsu, Chien-Hui; Lu, Chun-Yi; Shao, Pei-Lan; Lee, Ping-Ing; Kao, Chuan-Liang; Chung, Ming-Yi; Chang, Luan-Yin; Huang, Li-Min

2011-08-01

Non-polio enteroviruses may cause different diseases, including herpangina, hand-foot-mouth disease (HFMD), meningitis, and nonspecific febrile illness; and cause epidemic outbreak annually. This study delineates the diversity of clinical presentations based on different serotypes and different groups [human enterovirus (HEV)-A and HEV-B] of enteroviruses (EVs) during the 2008 epidemic in National Taiwan University Hospital (NTUH). We retrospectively identified patients younger than 18 years who had positive isolates of non-polio EV in throat swabs, rectal swabs, or cerebrospinal fluid, in NTUH from January 1 to December 31, 2008. For serotyping, immunofluorescence assay and polymerase chain reaction followed by viral structure protein-1 sequencing were applied. We analyzed and compared their clinical features among different serotypes and different groups of EVs. Among 172 patients who were enrolled, 16 serotypes were identified. The major serotype in NTUH was EV71 (25.6%) followed by coxsackievirus A (CA)16 and coxsackievirus B (CB)4. EV71 manifested mostly as HFMD (89%) and was complicated with encephalomyelitis in three patients. Serotypes of HFMD included EV71 (70%), CA16 (27%), CA4, and CA6. Serotypes of herpangina were heterogeneous, and the major serotype was CA2 (35.7%) followed by CB4 (23.8%). Aseptic meningitis was entirely caused by HEV-B and mostly infected by echovirus 30 (50%). Among children with EV-related respiratory tract infection, CB4 (32%) was dominant in upper respiratory tract infection, whereas echovirus 4 (71%) was the major cause of lower respiratory tract infection. Cases of HEV-A were significantly younger than the cases of HEV-B (p = 0.04). Multivariate analysis revealed that the most significant factor associated with hospitalization is HEV-B (odds ratio, 2.2; 95% confidence interval, 1.1-4.2; p = 0.02). At least 16 serotypes circulated in northern Taiwan in 2008. EV71 is the predominant strain in this outbreak. All patients with HFMD were infected by HEV-A, but HEV-B was associated with a higher rate of hospitalization and aseptic meningitis, which should be a cause of alert regarding public health. Copyright © 2011. Published by Elsevier B.V.

BPIFB6 Regulates Secretory Pathway Trafficking and Enterovirus Replication

PubMed Central

Morosky, Stefanie; Lennemann, Nicholas J.

2016-01-01

ABSTRACT Bactericidal/permeability-increasing protein (BPI) fold-containing family B, member 3 (BPIFB3) is an endoplasmic reticulum (ER)-localized host factor that negatively regulates coxsackievirus B (CVB) replication through its control of the autophagic pathway. Here, we show that another member of the BPIFB family, BPIFB6, functions as a positive regulator of CVB, and other enterovirus, replication by controlling secretory pathway trafficking and Golgi complex morphology. We show that similar to BPIFB3, BPIFB6 localizes exclusively to the ER, where it associates with other members of the BPIFB family. However, in contrast to our findings that RNA interference (RNAi)-mediated silencing of BPIFB3 greatly enhances CVB replication, we show that silencing of BPIFB6 expression dramatically suppresses enterovirus replication in a pan-viral manner. Mechanistically, we show that loss of BPIFB6 expression induces pronounced alterations in retrograde and anterograde trafficking, which correlate with dramatic fragmentation of the Golgi complex. Taken together, these data implicate BPIFB6 as a key regulator of secretory pathway trafficking and viral replication and suggest that members of the BPIFB family participate in diverse host cell functions to regulate virus infections. IMPORTANCE Enterovirus infections are associated with a number of severe pathologies, such as aseptic meningitis, dilated cardiomyopathy, type I diabetes, paralysis, and even death. These viruses, which include coxsackievirus B (CVB), poliovirus (PV), and enterovirus 71 (EV71), co-opt the host cell secretory pathway, which controls the transport of proteins from the endoplasmic reticulum to the Golgi complex, to facilitate their replication. Here we report on the identification of a novel regulator of the secretory pathway, bactericidal/permeability-increasing protein (BPI) fold-containing family B, member 6 (BPIFB6), whose expression is required for enterovirus replication. We show that loss of BPIFB6 expression correlates with pronounced defects in the secretory pathway and greatly reduces the replication of CVB, PV, and EV71. Our results thus identify a novel host cell therapeutic target whose function could be targeted to alter enterovirus replication. PMID:26962226

BPIFB6 Regulates Secretory Pathway Trafficking and Enterovirus Replication.

PubMed

Morosky, Stefanie; Lennemann, Nicholas J; Coyne, Carolyn B

2016-05-15

Bactericidal/permeability-increasing protein (BPI) fold-containing family B, member 3 (BPIFB3) is an endoplasmic reticulum (ER)-localized host factor that negatively regulates coxsackievirus B (CVB) replication through its control of the autophagic pathway. Here, we show that another member of the BPIFB family, BPIFB6, functions as a positive regulator of CVB, and other enterovirus, replication by controlling secretory pathway trafficking and Golgi complex morphology. We show that similar to BPIFB3, BPIFB6 localizes exclusively to the ER, where it associates with other members of the BPIFB family. However, in contrast to our findings that RNA interference (RNAi)-mediated silencing of BPIFB3 greatly enhances CVB replication, we show that silencing of BPIFB6 expression dramatically suppresses enterovirus replication in a pan-viral manner. Mechanistically, we show that loss of BPIFB6 expression induces pronounced alterations in retrograde and anterograde trafficking, which correlate with dramatic fragmentation of the Golgi complex. Taken together, these data implicate BPIFB6 as a key regulator of secretory pathway trafficking and viral replication and suggest that members of the BPIFB family participate in diverse host cell functions to regulate virus infections. Enterovirus infections are associated with a number of severe pathologies, such as aseptic meningitis, dilated cardiomyopathy, type I diabetes, paralysis, and even death. These viruses, which include coxsackievirus B (CVB), poliovirus (PV), and enterovirus 71 (EV71), co-opt the host cell secretory pathway, which controls the transport of proteins from the endoplasmic reticulum to the Golgi complex, to facilitate their replication. Here we report on the identification of a novel regulator of the secretory pathway, bactericidal/permeability-increasing protein (BPI) fold-containing family B, member 6 (BPIFB6), whose expression is required for enterovirus replication. We show that loss of BPIFB6 expression correlates with pronounced defects in the secretory pathway and greatly reduces the replication of CVB, PV, and EV71. Our results thus identify a novel host cell therapeutic target whose function could be targeted to alter enterovirus replication. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Enterovirus serotypes in patients with central nervous system and respiratory infections in Viet Nam 1997-2010.

PubMed

B'Krong, Nguyen Thi Thuy Chinh; Minh, Ngo Ngoc Quang; Qui, Phan Tu; Chau, Tran Thi Hong; Nghia, Ho Dang Trung; Do, Lien Anh Ha; Nhung, Nguyen Ngoc; Van Vinh Chau, Nguyen; Thwaites, Guy; Van Tan, Le; van Doorn, H Rogier; Thanh, Tran Tan

2018-04-12

Enteroviruses are the most common causative agents of human illness. Enteroviruses have been associated with regional and global epidemics, recently, including with severe disease (Enterovirus A71 and D68), and are of interest as emerging viruses. Here, we typed Enterovirus A-D (EV) from central nervous system (CNS) and respiratory infections in Viet Nam. Data and specimens from prospective observational clinical studies conducted between 1997 and 2010 were used. Species and serotypes were determined using type-specific RT-PCR and viral protein 1 or 4 (VP1, VP4) sequencing. Samples from patients with CNS infection (51 children - 10 CSF and 41 respiratory/rectal swabs) and 28 adults (28 CSF) and respiratory infection (124 children - 124 respiratory swabs) were analysed. Twenty-six different serotypes of the four Enterovirus species (A-D) were identified, including EV-A71 and EV-D68. Enterovirus B was associated with viral meningitis in children and adults. Hand, foot and mouth disease associated Enteroviruses A (EV-A71 and Coxsackievirus [CV] A10) were detected in children with encephalitis. Diverse serotypes of all four Enterovirus species were found in respiratory samples, including 2 polio-vaccine viruses, but also 8 CV-A24 and 8 EV-D68. With the exception of EV-D68, the relevance of these viruses in respiratory infection remains unknown. We describe the diverse spectrum of enteroviruses from patients with CNS and respiratory infections in Viet Nam between 1997 and 2010. These data confirm the global circulation of Enterovirus genera and their associations and are important for clinical diagnostics, patient management, and outbreak response.

Non-polio enteroviruses serotypes circulating in Nigeria.

PubMed

Oyero, O G; Adu, F D

2010-12-01

Enteroviruses is one of the most common group of human pathogens, causing a wide range of acute symptoms involving the cardiac and skeletal muscles, central nervous system, pancreas,skin and mucous membranes. In spite of the success recorded in polio eradication globally, infections with other enteroviruses remain frequent and sometimes very serious, requiring hospitalization. In this study we determined the various circulating serotypes of non-polio enteroviruses (NPEVs) with a view to providing information on the activity of these viruses among the Nigerian children, who usually are the most affected. Stool samples were obtained from hospitalized children at two major secondary community hospitals in Ibadan and acute flaccid paralysis (AFP) cases from 26 states ofNigeria. A presumptive identification of NPEVs was based on growth in RD cells. Isolates were identified by neutralization assay using sera obtained from the Institute for Public Health and the Environment, the Netherlands. The problems associated with this assay prompted the use of genotypic method developed at the Centers for Disease Control, Atlanta, USA for the final identification of isolates. Neutralization assay identified the 138 isolates into echoviruses (43.5%), coxsackie B viruses (29.7%) and untypeable isolates (26.8%). Finally genotyping identified echoviruses (E3, E6, E7, E11, E12, E13, E14, E19, E20, E21, E24, E29, E30, E33), coxsackieviruses (CVA3, CVA4, CVA6, CVA17, CVB3, CVB5, CVB6) and enteroviruses (EV69, EV71). The causal association of isolates with different diseases was also established. Majority of the isolates belonged to the human enterovirus gropup B (HEV-B) specie, followed by 4 and 1 in the HEV-A and HEV-C species respectively. This study forms the basis of molecular epidemiology of NPEVs being established for the first time in Nigeria. The implication of the presence of neurotropic serotypes (E3, E6, E7, E11, E14, E20, E24, E29, E30, EV71, CVB3 and CVB5) is that AFP may still be prevalent following polio eradication.

Synthetic peptides for efficient discrimination of anti-enterovirus antibodies at the serotype level.

PubMed

Routsias, John G; Mavrouli, Maria D; Antonaki, Georgia; Spanakis, Nikolaos; Tsakris, Athanassios

2014-08-01

Enteroviruses are important human pathogens, causing a broad spectrum of diseases from minor common colds to fatal myocarditis. However, certain disease syndromes are caused by one or few serotypes. Serotype identification is difficult due to the laborious neutralization tests that lack of sensitivity, while in commercial ELISAs homotypic antibodies' activities are largely masked by the recognition of genera-specific epitopes by heterotypic antibodies. In the present study homotypic assays were developed with the ability to discriminate different enterovirus serotypes. Seventy-three children sera, positive for IgM antibodies against enterovirus genus and 49 healthy children were examined for the presence of antibodies against 14 synthetic peptides derived from a non-conserved region of the VP1 protein of coxsackieviruses B2, B3, B4, B5, A9, A16, A24, echoviruses 6, 7, 9, 11, 30, enterovirus 71 and parechovirus 1. 50% of the anti-enterovirus IgM positive sera (>150 BU) reacted with the peptides with the majority of them to preferentially recognize one of them, supporting the homotypic nature of our assay. Inhibition studies yielded homologous inhibition rates 67-95% suggesting that specific peptide recognition actually occurred. The diagnostic value of our assay was tested in blood samples drawn over a 1.5-year period from a 5-year old patient. The anti-enterovirus reactivity was clearly attributed to echovirus serotype 11. The IgM/IgG antibody ratio was reversed 4 months later and subsequently IgM antibodies dropped below the cutoff point. In this paper we demonstrate that our assay can be used to discriminate between antibodies targeting different enterovirus serotypes. Copyright © 2014 Elsevier Inc. All rights reserved.

Epidermal growth factor receptor gene polymorphisms are associated with prognostic features of breast cancer

PubMed Central

2014-01-01

Background The epidermal growth factor receptor (EGFR) is differently expressed in breast cancer, and its presence may favor cancer progression. We hypothesized that two EGFR functional polymorphisms, a (CA)n repeat in intron 1, and a single nucleotide polymorphism, R497K, may affect EGFR expression and breast cancer clinical profile. Methods The study population consisted of 508 Brazilian women with unilateral breast cancer, and no distant metastases. Patients were genotyped for the (CA)n and R497K polymorphisms, and the associations between (CA)n polymorphism and EGFR transcript levels (n = 129), or between either polymorphism and histopathological features (n = 505) were evaluated. The REMARK criteria of tumor marker evaluation were followed. Results (CA)n lengths ranged from 14 to 24 repeats, comprehending 11 alleles and 37 genotypes. The most frequent allele was (CA)16 (0.43; 95% CI = 0.40–0.46), which was set as the cut-off length to define the Short allele. Variant (CA)n genotypes had no significant effect in tumoral EGFR mRNA levels, but patients with two (CA)n Long alleles showed lower chances of being negative for progesterone receptor (ORadjusted = 0.42; 95% CI = 0.19–0.91). The evaluation of R497K polymorphism indicated a frequency of 0.21 (95% CI = 0.19 – 0.24) for the variant (Lys) allele. Patients with variant R497K genotypes presented lower proportion of worse lymph node status (pN2 or pN3) when compared to the reference genotype Arg/Arg (ORadjusted = 0.32; 95% CI = 0.17–0.59), which resulted in lower tumor staging (ORadjusted = 0.34; 95% CI = 0.19-0.63), and lower estimated recurrence risk (OR = 0.50; 95% CI = 0.30-0.81). The combined presence of both EGFR polymorphisms (Lys allele of R497K and Long/Long (CA)n) resulted in lower TNM status (ORadjusted = 0.22; 95% CI = 0.07-0.75) and lower ERR (OR = 0.25; 95% CI = 0.09-0.71). When tumors were stratified according to biological classification, the favorable effects of variant EGFR polymorphisms were preserved for luminal A tumors, but not for other subtypes. Conclusions The data suggest that the presence of the variant forms of EGFR polymorphisms may lead to better prognosis in breast cancer, especially in patients with luminal A tumors. PMID:24629097

Neoadjuvant chemotherapy prior to radical cystectomy for muscle-invasive bladder cancer with variant histology.

PubMed

Vetterlein, Malte W; Wankowicz, Stephanie A M; Seisen, Thomas; Lander, Richard; Löppenberg, Björn; Chun, Felix K-H; Menon, Mani; Sun, Maxine; Barletta, Justine A; Choueiri, Toni K; Bellmunt, Joaquim; Trinh, Quoc-Dien; Preston, Mark A

2017-11-15

Neoadjuvant chemotherapy in pure urothelial bladder cancer provides a significant survival benefit. However, to the authors' knowledge, it is unknown whether this benefit persists in histological variants. The objective of the current study was to assess the effect of neoadjuvant chemotherapy on the probability of non-organ-confined disease and overall survival after radical cystectomy (RC) in patients with histological variants. Querying the National Cancer Data Base, the authors identified 2018 patients with histological variants who were undergoing RC for bladder cancer between 2003 and 2012. Variants were categorized as micropapillary or sarcomatoid differentiation, squamous cell carcinoma, adenocarcinoma, neuroendocrine tumors, and other histology. Logistic regression models estimated the odds of non-organ-confined disease at the time of RC for each histological variant, stratified by the receipt of neoadjuvant chemotherapy. Cox regression models were used to examine the effect of neoadjuvant chemotherapy on overall mortality in each variant subgroup. Patients with neuroendocrine tumors (odds ratio [OR], 0.16; 95% confidence interval [95% CI], 0.08-0.32 [P<.001]), micropapillary differentiation (OR, 0.30; 95% CI, 0.10-0.95 [P=.041]), sarcomatoid urothelial carcinoma (OR, 0.40; 95% CI, 0.17-0.94 [P=.035]), and adenocarcinoma (OR, 0.24; 95% CI, 0.06-0.91 [P=.035]) were less likely to harbor non-organ-confined disease at the time of RC when treated with neoadjuvant chemotherapy. An overall survival benefit for neoadjuvant chemotherapy was only found in patients with neuroendocrine tumors (hazard ratio, 0.49; 95% CI, 0.33-0.74 [P=.001]). Patients with neuroendocrine tumors benefit from neoadjuvant chemotherapy, as evidenced by better overall survival and lower rates of non-organ-confined disease at the time of RC. For tumors with micropapillary differentiation, sarcomatoid differentiation, or adenocarcinoma, neoadjuvant chemotherapy decreased the frequency of non-organ-confined disease at the time of RC. However, this favorable effect did not translate into a statistically significant overall survival benefit for these patients, potentially due to the aggressive tumor biology. Cancer 2017;123:4346-55. © 2017 American Cancer Society. © 2017 American Cancer Society.

Non-invasive fetal RHD genotyping for RhD negative women stratified into RHD gene deletion or variant groups: comparative accuracy using two blood collection tube types.

PubMed

Hyland, Catherine A; Millard, Glenda M; O'Brien, Helen; Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Tremellen, Anne; Puddephatt, Rachel; Gaerty, Kirsten; Flower, Robert L; Hyett, Jonathan A; Gardener, Glenn J

2017-12-01

Non-invasive fetal RHD genotyping in Australia to reduce anti-D usage will need to accommodate both prolonged sample transport times and a diverse population demographic harbouring a range of RHD blood group gene variants. We compared RHD genotyping accuracy using two blood sample collection tube types for RhD negative women stratified into deleted RHD gene haplotype and RHD gene variant cohorts. Maternal blood samples were collected into EDTA and cell-free (cf)DNA stabilising (BCT) tubes from two sites, one interstate. Automated DNA extraction and polymerase chain reaction (PCR) were used to amplify RHD exons 5 and 10 and CCR5. Automated analysis flagged maternal RHD variants, which were classified by genotyping. Time between sample collection and processing ranged from 2.9 to 187.5 hours. cfDNA levels increased with time for EDTA (range 0.03-138 ng/μL) but not BCT samples (0.01-3.24 ng/μL). For the 'deleted' cohort (n=647) all fetal RHD genotyping outcomes were concordant, excepting for one unexplained false negative EDTA sample. Matched against cord RhD serology, negative predictive values using BCT and EDTA tubes were 100% and 99.6%, respectively. Positive predictive values were 99.7% for both types. Overall 37.2% of subjects carried an RhD negative baby. The 'variant' cohort (n=15) included one novel RHD and eight hybrid or African pseudogene variants. Review for fetal RHD specific signals, based on one exon, showed three EDTA samples discordant to BCT, attributed to high maternal cfDNA levels arising from prolonged transport times. For the deleted haplotype cohort, fetal RHD genotyping accuracy was comparable for samples collected in EDTA and BCT tubes despite higher cfDNA levels in the EDTA tubes. Capacity to predict fetal RHD genotype for maternal carriers of hybrid or pseudogene RHD variants requires stringent control of cfDNA levels. We conclude that fetal RHD genotyping is feasible in the Australian environment to avoid unnecessary anti-D immunoglobulin prophylaxis. Copyright © 2017. Published by Elsevier B.V.

The effect of CHEK2 variant I157T on cancer susceptibility: evidence from a meta-analysis.

PubMed

Han, Fei-fei; Guo, Chang-long; Liu, Li-hong

2013-06-01

Cell cycle checkpoint kinase 2 (CHEK2) is a checkpoint kinase that plays an important role in the DNA damage signaling network. Numerous epidemiological studies have evaluated the association between the CHEK2 I157T variant and cancer susceptibility. However, the results of these studies on the association remain conflicting. The main purpose of this study was to integrate previous results and explore whether the CHEK2 I157T variant is associated with cancer susceptibility. PubMed, Embase (before 2012-10-1), Google Scholar, and CBMdisc were searched for studies on the relationship of the CHEK2 I157T variant and the incidence of cancer. Eligible articles were included for data extraction. The main outcome was the frequency of CHEK2 I157T polymorphisms between cases and controls. Comparison of the distribution of SNP was mainly performed using Review Manager 5.0. The odds ratio (OR) and its 95% confidence interval (95% CI) were used to assess the strength of association. In total, 26,336 cases and 44,219 controls from 18 case-control studies were used in this meta-analysis, and significant associations of the CHEK2 I157T variant with cancer susceptibility were found (OR, 1.39; 95% CI, 1.19-1.63; p<0.0001), breast cancer (OR=1.58, 95% CI=1.42-1.75, p<0.00001) and colorectal cancer (OR=1.67, 95% CI=1.24-2.26, p=0.0008). We also found an association of the CHEK2 I157T variant with familial cases (OR=1.85, 95% CI=1.51-2.26, p<0.00001). However, the association was not established for other types of cancer (OR=1.09, 95% CI=0.75-1.57, p=0.66). This meta-analysis demonstrates that the CHEK2 I157T variant was an important cancer gene, which increases cancer risk, especially in breast and colorectal cancer in Caucasian, and the bioinformatic analysis showed this change was mainly attributed to the decreased hydrophobicity of CHEK2 157T.

Effect of consecutive alternating administration (CAA) of a triple anti-enteroviral combination on Coxsackievirus B1 neuroinfection in mice.

PubMed

Stoyanova, Adelina; Nikolova, Ivanka; Galabov, Angel S

2015-09-01

Currently, clinically effective antivirals for use in the treatment of enteroviral (EV) infections do not exist. The main reason is the development of drug resistance, the principle obstacle in the development of EV infection chemotherapy, based til now on monotherapy. The most important achievement of our previous studies was the development of a novel scheme for in vivo application of a triple combination of EV inhibitors with different modes of action against Coxsackievirus B (CVB) infections in mice. It consists of consecutive alternating administration (CAA) of the substances in the combination. Here, we tested the effect of the triple combination pleconaril, guanidine-HCl, and oxoglaucine (PGO) via CAA in newborn mice infected with a neurotropic strain of CVB1 (20 LD50 per mouse). This combination manifested a considerable protective effect with pleconaril doses of 25-200mg/kg: it decreased mortality rate (protection index, PI, between 31.3% and 67.7%) and increased mean survival time (MST) by 4-6days. Pleconaril monotherapy demonstrated activity similar to that of PGO via CAA, as measured by PI values, but MST values were slightly lower. However, it also greatly suppressed growth of infected suckling mice, especially at 200mg/kg. This toxic effect was avoided with CAA of PGO at pleconaril doses of 25-100mg/kg. Pleconaril monotherapy administered every 3days was ineffective. The PGO with CAA treatment course decreased infectious virus content, whereas pleconaril monotherapy did not. Analysis of drug-sensitivity in brain samples from CVB1 infected mice, based on IC50 (50% inhibitory concentration) values from cell culture experiments, showed that the CAA course counteracted the development of drug resistance to pleconaril and oxoglaucine in the triple PGO combination and increased drug sensitivity. In contrast, pleconaril and oxoglaucine monotherapies resulted in drug resistance. This data clearly proves the effectiveness of the proposed novel approach-the CAA treatment course-for combined application of EV replication inhibitors. Copyright © 2015 Elsevier B.V. All rights reserved.

N-Terminomics TAILS Identifies Host Cell Substrates of Poliovirus and Coxsackievirus B3 3C Proteinases That Modulate Virus Infection

PubMed Central

Jagdeo, Julienne M.; Dufour, Antoine; Klein, Theo; Solis, Nestor; Kleifeld, Oded; Kizhakkedathu, Jayachandran; Luo, Honglin; Overall, Christopher M.

2018-01-01

ABSTRACT Enteroviruses encode proteinases that are essential for processing of the translated viral polyprotein. In addition, viral proteinases also target host proteins to manipulate cellular processes and evade innate antiviral responses to promote replication and infection. Although some host protein substrates of enterovirus proteinases have been identified, the full repertoire of targets remains unknown. We used a novel quantitative in vitro proteomics-based approach, termed terminal amine isotopic labeling of substrates (TAILS), to identify with high confidence 72 and 34 new host protein targets of poliovirus and coxsackievirus B3 (CVB3) 3C proteinases (3Cpros) in HeLa cell and cardiomyocyte HL-1 cell lysates, respectively. We validated a subset of candidate substrates that are targets of poliovirus 3Cpro in vitro including three common protein targets, phosphoribosylformylglycinamidine synthetase (PFAS), hnRNP K, and hnRNP M, of both proteinases. 3Cpro-targeted substrates were also cleaved in virus-infected cells but not noncleavable mutant proteins designed from the TAILS-identified cleavage sites. Knockdown of TAILS-identified target proteins modulated infection both negatively and positively, suggesting that cleavage by 3Cpro promotes infection. Indeed, expression of a cleavage-resistant mutant form of the endoplasmic reticulum (ER)-Golgi vesicle-tethering protein p115 decreased viral replication and yield. As the first comprehensive study to identify and validate functional enterovirus 3Cpro substrates in vivo, we conclude that N-terminomics by TAILS is an effective strategy to identify host targets of viral proteinases in a nonbiased manner. IMPORTANCE Enteroviruses are positive-strand RNA viruses that encode proteases that cleave the viral polyprotein into the individual mature viral proteins. In addition, viral proteases target host proteins in order to modulate cellular pathways and block antiviral responses in order to facilitate virus infection. Although several host protein targets have been identified, the entire list of proteins that are targeted is not known. In this study, we used a novel unbiased proteomics approach to identify ∼100 novel host targets of the enterovirus 3C protease, thus providing further insights into the network of cellular pathways that are modulated to promote virus infection. PMID:29437971

Genetic Analyses of the NF1 Gene in Turkish Neurofibromatosis Type I Patients and Definition of three Novel Variants

PubMed Central

Ulusal, SD; Gürkan, H; Atlı, E; Özal, SA; Çiftdemir, M; Tozkır, H; Karal, Y; Güçlü, H; Eker, D; Görker, I

2017-01-01

Abstract Neurofibromatosis Type I (NF1) is a multi systemic autosomal dominant neurocutaneous disorder predisposing patients to have benign and/or malignant lesions predominantly of the skin, nervous system and bone. Loss of function mutations or deletions of the NF1 gene is responsible for NF1 disease. Involvement of various pathogenic variants, the size of the gene and presence of pseudogenes makes it difficult to analyze. We aimed to report the results of 2 years of multiplex ligation-dependent probe amplification (MLPA) and next generation sequencing (NGS) for genetic diagnosis of NF1 applied at our genetic diagnosis center. The MLPA, semiconductor sequencing and Sanger sequencing were performed in genomic DNA samples from 24 unrelated patients and their affected family members referred to our center suspected of having NF1. In total, three novel and 12 known pathogenic variants and a whole gene deletion were determined. We suggest that next generation sequencing is a practical tool for genetic analysis of NF1. Deletion/duplication analysis with MLPA may also be helpful for patients clinically diagnosed to carry NF1 but do not have a detectable mutation in NGS. PMID:28924536

Novel mutations in CRB1 gene identified in a chinese pedigree with retinitis pigmentosa by targeted capture and next generation sequencing

PubMed Central

Lo, David; Weng, Jingning; Liu, xiaohong; Yang, Juhua; He, Fen; Wang, Yun; Liu, Xuyang

2016-01-01

PURPOSE To detect the disease-causing gene in a Chinese pedigree with autosomal-recessive retinitis pigmentosa (ARRP). METHODS All subjects in this family underwent a complete ophthalmic examination. Targeted-capture next generation sequencing (NGS) was performed on the proband to detect variants. All variants were verified in the remaining family members by PCR amplification and Sanger sequencing. RESULTS All the affected subjects in this pedigree were diagnosed with retinitis pigmentosa (RP). The compound heterozygous c.138delA (p.Asp47IlefsX24) and c.1841G>T (p.Gly614Val) mutations in the Crumbs homolog 1 (CRB1) gene were identified in all the affected patients but not in the unaffected individuals in this family. These mutations were inherited from their parents, respectively. CONCLUSION The novel compound heterozygous mutations in CRB1 were identified in a Chinese pedigree with ARRP using targeted-capture next generation sequencing. After evaluating the significant heredity and impaired protein function, the compound heterozygous c.138delA (p.Asp47IlefsX24) and c.1841G>T (p.Gly614Val) mutations are the causal genes of early onset ARRP in this pedigree. To the best of our knowledge, there is no previous report regarding the compound mutations. PMID:27806333

Analysis of biliary anatomy according to different classification systems.

PubMed

Deka, Pranjal; Islam, Mahibul; Jindal, Deepti; Kumar, Niteen; Arora, Ankur; Negi, Sanjay Singh

2014-01-01

Variations in biliary anatomy are common, and different classifications have been described. These classification systems have not been compared to each other in a single cohort. We report such variations in biliary anatomy on magnetic resonance cholangiopancreatography (MRCP) using six different classification systems. In 299 patients undergoing MRCP for various indications, biliary anatomy was classified as described by Couinaud (1957), Huang (1996), Karakas (2008), Choi (2003), Champetier (1994), and Ohkubo (2004). Correlation with direct cholangiography and vascular anatomy was done. Bile duct dimensions were measured. Cystic duct junction and pancreaticobiliary ductal junction (PBDJ) were classified. Normal biliary anatomy was noted in 57.8 %. The most common variants were Couinaud type D2, Choi type 3A, Huang type A1, Champetier type a, Ohkubo types D and J, and Karakas type 2a. The Ohkubo classification was the most appropriate; 3.1 % of right ducts and 6.3 % of left ducts with variant anatomy could not be classified using the Ohkubo classification. There was a good agreement between MRCP and direct cholangiography (ĸ = 0.9). Anomalous PBDJ was noted in 8.7 %. Variant biliary anatomy was not associated with gender (p = 0.194) or variant vascular anatomy (p = 0.24). Although each classification system has its merits and demerits, some anatomical variations cannot be classified using any of the previously described classifications. The Ohkubo classification system is the most applicable as it considers most clinically relevant variations pertinent to hepatobiliary surgery.

Identifying Likely Transmission Pathways within a 10-Year Community Outbreak of Tuberculosis by High-Depth Whole Genome Sequencing

PubMed Central

Sadsad, Rosemarie; Martinez, Elena; Jelfs, Peter; Hill-Cawthorne, Grant A.; Gilbert, Gwendolyn L.; Marais, Ben J.; Sintchenko, Vitali

2016-01-01

Background Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways. Methods We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants. Results Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade. Conclusion Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster. PMID:26938641

Clinical Interpretation and Implications of Whole-Genome Sequencing

PubMed Central

Dewey, Frederick E.; Grove, Megan E.; Pan, Cuiping; Goldstein, Benjamin A.; Bernstein, Jonathan A.; Chaib, Hassan; Merker, Jason D.; Goldfeder, Rachel L.; Enns, Gregory M.; David, Sean P.; Pakdaman, Neda; Ormond, Kelly E.; Caleshu, Colleen; Kingham, Kerry; Klein, Teri E.; Whirl-Carrillo, Michelle; Sakamoto, Kenneth; Wheeler, Matthew T.; Butte, Atul J.; Ford, James M.; Boxer, Linda; Ioannidis, John P. A.; Yeung, Alan C.; Altman, Russ B.; Assimes, Themistocles L.; Snyder, Michael; Ashley, Euan A.; Quertermous, Thomas

2014-01-01

IMPORTANCE Whole-genome sequencing (WGS) is increasingly applied in clinical medicine and is expected to uncover clinically significant findings regardless of sequencing indication. OBJECTIVES To examine coverage and concordance of clinically relevant genetic variation provided by WGS technologies; to quantitate inherited disease risk and pharmacogenomic findings in WGS data and resources required for their discovery and interpretation; and to evaluate clinical action prompted by WGS findings. DESIGN, SETTING, AND PARTICIPANTS An exploratory study of 12 adult participants recruited at Stanford University Medical Center who underwent WGS between November 2011 and March 2012. A multidisciplinary team reviewed all potentially reportable genetic findings. Five physicians proposed initial clinical follow-up based on the genetic findings. MAIN OUTCOMES AND MEASURES Genome coverage and sequencing platform concordance in different categories of genetic disease risk, person-hours spent curating candidate disease-risk variants, interpretation agreement between trained curators and disease genetics databases, burden of inherited disease risk and pharmacogenomic findings, and burden and interrater agreement of proposed clinical follow-up. RESULTS Depending on sequencing platform, 10% to 19% of inherited disease genes were not covered to accepted standards for single nucleotide variant discovery. Genotype concordance was high for previously described single nucleotide genetic variants (99%-100%) but low for small insertion/deletion variants (53%-59%). Curation of 90 to 127 genetic variants in each participant required a median of 54 minutes (range, 5-223 minutes) per genetic variant, resulted in moderate classification agreement between professionals (Gross κ, 0.52; 95%CI, 0.40-0.64), and reclassified 69%of genetic variants cataloged as disease causing in mutation databases to variants of uncertain or lesser significance. Two to 6 personal disease-risk findings were discovered in each participant, including 1 frameshift deletion in the BRCA1 gene implicated in hereditary breast and ovarian cancer. Physician review of sequencing findings prompted consideration of a median of 1 to 3 initial diagnostic tests and referrals per participant, with fair interrater agreement about the suitability of WGS findings for clinical follow-up (Fleiss κ, 0.24; P < 001). CONCLUSIONS AND RELEVANCE In this exploratory study of 12 volunteer adults, the use of WGS was associated with incomplete coverage of inherited disease genes, low reproducibility of detection of genetic variation with the highest potential clinical effects, and uncertainty about clinically reportable findings. In certain cases, WGS will identify clinically actionable genetic variants warranting early medical intervention. These issues should be considered when determining the role of WGS in clinical medicine. PMID:24618965

Autism-specific copy number variants further implicate the phosphatidylinositol signaling pathway and the glutamatergic synapse in the etiology of the disorder.

PubMed

Cuscó, Ivon; Medrano, Andrés; Gener, Blanca; Vilardell, Mireia; Gallastegui, Fátima; Villa, Olaya; González, Eva; Rodríguez-Santiago, Benjamín; Vilella, Elisabet; Del Campo, Miguel; Pérez-Jurado, Luis A

2009-05-15

Autism spectrum disorders (ASDs) constitute a group of severe neurodevelopmental conditions with complex multifactorial etiology. In order to explore the hypothesis that submicroscopic genomic rearrangements underlie some ASD cases, we have analyzed 96 Spanish patients with idiopathic ASD after extensive clinical and laboratory screening, by array comparative genomic hybridization (aCGH) using a homemade bacterial artificial chromosome (BAC) array. Only 13 of the 238 detected copy number alterations, ranging in size from 89 kb to 2.4 Mb, were present specifically in the autistic population (12 out of 96 individuals, 12.5%). Following validation by additional molecular techniques, we have characterized these novel candidate regions containing 24 different genes including alterations in two previously reported regions of chromosome 7 associated with the ASD phenotype. Some of the genes located in ASD-specific copy number variants act in common pathways, most notably the phosphatidylinositol signaling and the glutamatergic synapse, both known to be affected in several genetic syndromes related with autism and previously associated with ASD. Our work supports the idea that the functional alteration of genes in related neuronal networks is involved in the etiology of the ASD phenotype and confirms a significant diagnostic yield for aCGH, which should probably be included in the diagnostic workup of idiopathic ASD.

Secretome Screening Reveals Fibroblast Growth Factors as Novel Inhibitors of Viral Replication.

PubMed

van Asten, Saskia D; Raaben, Matthijs; Nota, Benjamin; Spaapen, Robbert M

2018-06-13

Cellular antiviral programs can efficiently inhibit viral infection. These programs are often initiated through signaling cascades induced by secreted proteins such as type I interferons, IL-6 or TNF-α. Here, we generated an arrayed library of 756 human secreted proteins to perform a secretome screen focused on the discovery of novel modulators of viral entry and/or replication. The individual secreted proteins were tested for their capacity to inhibit infection by two replication-competent recombinant vesicular stomatitis viruses (VSV) with distinct glycoproteins utilizing different entry pathways. Fibroblast growth factor 16 (FGF16) was identified and confirmed as the most prominent novel inhibitor of both VSVs and therefore of viral replication and not entry. Importantly, an antiviral interferon signature was completely absent in FGF16 treated cells. Nevertheless, the antiviral effect of FGF16 is broad as it was evident on multiple cell types and also on infection of Coxsackievirus. In addition, other members of the FGF family also inhibited viral infection. Thus, our unbiased secretome screen revealed a novel protein family capable of inducing a cellular antiviral state. This previously unappreciated role of the FGF family may have implications for the development of new antivirals and the efficacy of oncolytic virus therapy. Importance Viruses infect human cells in order to replicate, while human cells aim to resist infection. Several cellular antiviral programs have therefore evolved to resist infection. Knowledge of these programs is essential for the design of antiviral therapeutics in the future. The induction of antiviral programs is often initiated by secreted proteins such as interferons. We hypothesized that other secreted proteins may also promote resistance to viral infection. Thus we tested 756 human secreted proteins for their capacity to inhibit two pseudotypes of vesicular stomatitis virus (VSV). In this first secretome screen on viral infection we identified fibroblast growth factor 16 (FGF16) as a novel antiviral against multiple VSV pseudotypes as well as Coxsackievirus. Subsequent testing of other FGF family members revealed that FGF signaling generally inhibits viral infection. This finding may lead to the development of new antivirals and may also be applicable to enhance oncolytic virus therapy. Copyright © 2018 American Society for Microbiology.

Toward reducing immunogenicity of enzyme replacement therapy: altering the specificity of human β-glucuronidase to compensate for α-iduronidase deficiency.

PubMed

Chuang, Huai-Yao; Suen, Ching-Shu; Hwang, Ming-Jing; Roffler, Steve R

2015-11-01

Enzyme replacement therapy (ERT) is an effective treatment for many patients with lysosomal storage disorders caused by deficiency in enzymes involved in cell metabolism. However, immune responses that develop against the administered enzyme in some patients can hinder therapeutic efficacy and cause serious side effects. Here we investigated the feasibility of a general approach to decrease ERT immunogenicity by altering the specificity of a normal endogenous enzyme to compensate for a defective enzyme. We sought to identify human β-glucuronidase variants that display α-iduronidase activity, which is defective in mucopolysaccharidosis (MPS) type I patients. A human β-glucuronidase library was screened by the Enzyme Cleavable Surface-Tethered All-purpose Screen sYstem to isolate variants that exhibited 100-290-fold greater activity against the α-iduronidase substrate 4-methylumbelliferyl α-l-iduronide and 7900-24 500-fold enzymatic specificity shift when compared with wild-type β-glucuronidase. In vitro treatment of MPS I cells with the β-glucuronidase variants significantly restored lysosome appearance similar to treatment with α-iduronidase. Our study suggests that β-glucuronidase variants can be isolated to display α-iduronidase activity and produce significant phenotype improvement of MPS I cells. This strategy may represent a possible approach to produce enzymes that display therapeutic benefits with potentially less immunogenicity. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Inosine triphosphatase genetic variants are protective against anemia during antiviral therapy for HCV2/3 but do not decrease dose reductions of RBV or increase SVR.

PubMed

Thompson, Alexander J; Santoro, Rosanna; Piazzolla, Valeria; Clark, Paul J; Naggie, Susanna; Tillmann, Hans L; Patel, Keyur; Muir, Andrew J; Shianna, Kevin V; Mottola, Leonardo; Petruzzellis, Daniela; Romano, Mario; Sogari, Fernando; Facciorusso, Domenico; Goldstein, David B; McHutchison, John G; Mangia, Alessandra

2011-02-01

Two functional variants in the inosine triphosphatase (ITPA) gene causing inosine triphosphatase (ITPase) deficiency protect against ribavirin (RBV)-induced hemolytic anemia and the need for RBV dose reduction in patients with genotype 1 hepatitis C virus (HCV). No data are available for genotype 2/3 HCV. We evaluated the association between the casual ITPA variants and on-treatment anemia in a well-characterized cohort of genotype 2/3 patients treated with variable-duration pegylated interferon alfa-2b (PEG-IFN-α2b) and RBV. Two hundred thirty-eight Caucasian patients were included in this retrospective study [185 (78%) with genotype 2 and 53 (22%) with genotype 3]. Patients were treated with PEG-IFN-α2b plus weight-based RBV (1000/1200 mg) for 12 (n = 109) or 24 weeks (n = 129). The ITPA polymorphisms rs1127354 and rs7270101 were genotyped, and an ITPase deficiency variable was defined that combined both ITPA variants according to their effect on ITPase activity. The primary endpoint was hemoglobin (Hb) reduction in week 4. We also considered Hb reduction over the course of therapy, the need for RBV dose modification, and the rate of sustained virological response (SVR). The ITPA variants were strongly and independently associated with protection from week 4 anemia (P = 10(-6) for rs1127354 and P = 10(-7) for rs7270101). Combining the variants into the ITPase deficiency variable increased the strength of association (P = 10(-11) ). ITPase deficiency protected against anemia throughout treatment. ITPase deficiency was associated with a delayed time to an Hb level < 10 g/dL (hazard ratio = 0.25, 95% confidence interval = 0.08-0.84, P = 0.025) but not with the rate of RBV dose modification (required per protocol at Hb < 9.5 g/dL). There was no association between the ITPA variants and SVR. Two ITPA variants were strongly associated with protection against treatment-related anemia in patients with genotype 2/3 HCV, but they did not decrease the need for RBV dose reduction or increase the rate of SVR. Copyright © 2010 American Association for the Study of Liver Diseases.

Enterovirus genotypes causing hand foot and mouth disease in Shanghai, China: a molecular epidemiological analysis.

PubMed

Xu, Menghua; Su, Liyun; Cao, Lingfeng; Zhong, Huaqing; Dong, Niuniu; Xu, Jin

2013-10-22

A rapid expansion of hand, foot, and mouth disease (HFMD) outbreaks has occurred and caused deaths in China in recent years, but little is known about the other etiologic agents except enterovirus 71 (EV71) and coxsackievirus A 16 (CA16). The objective of this study is to determine the genotype compositions of enterovirus causing HFMD in Shanghai and identify any associations between enterovirus types and clinical manifestations. Stool specimens were collected from patients hospitalized for treatment of HFMD, from May 2010 to April 2011. Enterovirus was detected by reverse transcription PCR and directly genotyped by sequencing the PCR products. Phylogenetic analysis was based on the VP1 partial gene. Of 290 specimens, 277 (95.5%) tested positive for enterovirus. The major genotypes were EV71 (63.8%), CA10 (9.0%), CA6 (8.3%), CA16 (6.9%), CA12 (2.4%), and CA4 (1.4%). The EV71 strains belonged to the C4a subtype and CA16 belonged to the B subtype. CA6 was closely related to strains detected in Japan, Taiwan and China, and CA10, CA12 and CA4 were phylogenetically similar to other strains circulating in China. Mean hospital stays and the prevalence of complications in patients with EV71 infection were higher than those in patients in CA6, CA10 or CA16 infection (P < 0.05 for all comparisons). Children with CA12 infection were the youngest, and most likely have the highest risk of complications when compared to the other non-EV71 infection groups. This study demonstrated a diversified pathogen compositions attributing to HFMD and clinical symptoms differing in enterovirus genotypes. It deserves our attention as early identification of enterovirus genotypes is important for diagnosis and treatment of HFMD patients.

Identification of common variants associated with human hippocampal and intracranial volumes

PubMed Central

Stein, Jason L; Medland, Sarah E; Vasquez, Alejandro Arias; Hibar, Derrek P; Senstad, Rudy E; Winkler, Anderson M; Toro, Roberto; Appel, Katja; Bartecek, Richard; Bergmann, Ørjan; Bernard, Manon; Brown, Andrew A; Cannon, Dara M; Chakravarty, M Mallar; Christoforou, Andrea; Domin, Martin; Grimm, Oliver; Hollinshead, Marisa; Holmes, Avram J; Homuth, Georg; Hottenga, Jouke-Jan; Langan, Camilla; Lopez, Lorna M; Hansell, Narelle K; Hwang, Kristy S; Kim, Sungeun; Laje, Gonzalo; Lee, Phil H; Liu, Xinmin; Loth, Eva; Lourdusamy, Anbarasu; Mattingsdal, Morten; Mohnke, Sebastian; Maniega, Susana Muñoz; Nho, Kwangsik; Nugent, Allison C; O’Brien, Carol; Papmeyer, Martina; Pütz, Benno; Ramasamy, Adaikalavan; Rasmussen, Jerod; Rijpkema, Mark; Risacher, Shannon L; Roddey, J Cooper; Rose, Emma J; Ryten, Mina; Shen, Li; Sprooten, Emma; Strengman, Eric; Teumer, Alexander; Trabzuni, Daniah; Turner, Jessica; van Eijk, Kristel; van Erp, Theo G M; van Tol, Marie-Jose; Wittfeld, Katharina; Wolf, Christiane; Woudstra, Saskia; Aleman, Andre; Alhusaini, Saud; Almasy, Laura; Binder, Elisabeth B; Brohawn, David G; Cantor, Rita M; Carless, Melanie A; Corvin, Aiden; Czisch, Michael; Curran, Joanne E; Davies, Gail; de Almeida, Marcio A A; Delanty, Norman; Depondt, Chantal; Duggirala, Ravi; Dyer, Thomas D; Erk, Susanne; Fagerness, Jesen; Fox, Peter T; Freimer, Nelson B; Gill, Michael; Göring, Harald H H; Hagler, Donald J; Hoehn, David; Holsboer, Florian; Hoogman, Martine; Hosten, Norbert; Jahanshad, Neda; Johnson, Matthew P; Kasperaviciute, Dalia; Kent, Jack W; Kochunov, Peter; Lancaster, Jack L; Lawrie, Stephen M; Liewald, David C; Mandl, René; Matarin, Mar; Mattheisen, Manuel; Meisenzahl, Eva; Melle, Ingrid; Moses, Eric K; Mühleisen, Thomas W; Nauck, Matthias; Nöthen, Markus M; Olvera, Rene L; Pandolfo, Massimo; Pike, G Bruce; Puls, Ralf; Reinvang, Ivar; Rentería, Miguel E; Rietschel, Marcella; Roffman, Joshua L; Royle, Natalie A; Rujescu, Dan; Savitz, Jonathan; Schnack, Hugo G; Schnell, Knut; Seiferth, Nina; Smith, Colin; Steen, Vidar M; Valdés Hernández, Maria C; Van den Heuvel, Martijn; van der Wee, Nic J; Van Haren, Neeltje E M; Veltman, Joris A; Völzke, Henry; Walker, Robert; Westlye, Lars T; Whelan, Christopher D; Agartz, Ingrid; Boomsma, Dorret I; Cavalleri, Gianpiero L; Dale, Anders M; Djurovic, Srdjan; Drevets, Wayne C; Hagoort, Peter; Hall, Jeremy; Heinz, Andreas; Jack, Clifford R; Foroud, Tatiana M; Le Hellard, Stephanie; Macciardi, Fabio; Montgomery, Grant W; Poline, Jean Baptiste; Porteous, David J; Sisodiya, Sanjay M; Starr, John M; Sussmann, Jessika; Toga, Arthur W; Veltman, Dick J; Walter, Henrik; Weiner, Michael W; Bis, Joshua C; Ikram, M Arfan; Smith, Albert V; Gudnason, Vilmundur; Tzourio, Christophe; Vernooij, Meike W; Launer, Lenore J; DeCarli, Charles; Seshadri, Sudha; Andreassen, Ole A; Apostolova, Liana G; Bastin, Mark E; Blangero, John; Brunner, Han G; Buckner, Randy L; Cichon, Sven; Coppola, Giovanni; de Zubicaray, Greig I; Deary, Ian J; Donohoe, Gary; de Geus, Eco J C; Espeseth, Thomas; Fernández, Guillén; Glahn, David C; Grabe, Hans J; Hardy, John; Hulshoff Pol, Hilleke E; Jenkinson, Mark; Kahn, René S; McDonald, Colm; McIntosh, Andrew M; McMahon, Francis J; McMahon, Katie L; Meyer-Lindenberg, Andreas; Morris, Derek W; Müller-Myhsok, Bertram; Nichols, Thomas E; Ophoff, Roel A; Paus, Tomas; Pausova, Zdenka; Penninx, Brenda W; Potkin, Steven G; Sämann, Philipp G; Saykin, Andrew J; Schumann, Gunter; Smoller, Jordan W; Wardlaw, Joanna M; Weale, Michael E; Martin, Nicholas G; Franke, Barbara; Wright, Margaret J; Thompson, Paul M

2013-01-01

Identifying genetic variants influencing human brain structures may reveal new biological mechanisms underlying cognition and neuropsychiatric illness. The volume of the hippocampus is a biomarker of incipient Alzheimer’s disease1,2 and is reduced in schizophrenia3, major depression4 and mesial temporal lobe epilepsy5. Whereas many brain imaging phenotypes are highly heritable6,7, identifying and replicating genetic influences has been difficult, as small effects and the high costs of magnetic resonance imaging (MRI) have led to underpowered studies. Here we report genome-wide association meta-analyses and replication for mean bilateral hippocampal, total brain and intracranial volumes from a large multinational consortium. The intergenic variant rs7294919 was associated with hippocampal volume (12q24.22; N = 21,151; P = 6.70 × 10−16) and the expression levels of the positional candidate gene TESC in brain tissue. Additionally, rs10784502, located within HMGA2, was associated with intracranial volume (12q14.3; N = 15,782; P = 1.12 × 10−12). We also identified a suggestive association with total brain volume at rs10494373 within DDR2 (1q23.3; N = 6,500; P = 5.81 × 10−7). PMID:22504417

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bros, Sebastien, E-mail: sebbros@wanadoo.fr; Chabrot, Pascal, E-mail: pchabrot@chu-clermontferrand.fr; Kastler, Adrian, E-mail: a_kastler@chu-clermontferrand.fr

Purpose: To retrospectively identify predictive factors of recurrent bleeding within 24 h after uterine artery embolization (UAE) for postpartum hemorrhage (PPH). Materials and Methods: A total of 194 patients underwent UAE for PPH between August 1999 and April 2009 at our institution. Twelve patients experienced recurrent bleeding within the next 24 h; a second attempt at UAE was thus necessary, which was successful in 10 cases. In two cases, hemostatic hysterectomy was performed. Epidemiological, gynecological-obstetrical, anatomic, and biological data were analyzed. Results: Complete data were available for 148 of the 194 (76%) included patients. Sixty-four (43%) were primiparous, 18 (12.2%)more » had a placenta accreta, 21 (14%) had a coagulopathy, and 28 (18.9%) had an anatomic variant of the uterine arterial vasculature. Mean age and pregnancy term were similar in both recurring and nonrecurrent bleeding groups. After multivariate analysis, three criteria emerged as risk factors of recurrent bleeding: primiparity (10 patients, 83%; odds ratio [OR] = 18.84; P = 0.014), coagulation disorders (6 patients, 50%; OR = 12.08; P = 0.006), and anatomic variant of the uterine arterial vasculature (28 patients; OR = 9.83; P = 0.003). Conclusions: earch for uterine collaterals must be performed before UAE for PPH. Primiparity and coagulation disorders increase the risk of recurrent bleeding after UAE for PPH.« less

Reducing virulence of the human pathogen Burkholderia by altering the substrate specificity of the quorum-quenching acylase PvdQ

PubMed Central

Koch, Gudrun; Nadal-Jimenez, Pol; Reis, Carlos R.; Muntendam, Remco; Bokhove, Marcel; Melillo, Elena; Dijkstra, Bauke W.; Cool, Robbert H.; Quax, Wim J.

2014-01-01

The use of enzymes to interfere with quorum sensing represents an attractive strategy to fight bacterial infections. We used PvdQ, an effective quorum-quenching enzyme from Pseudomonas aeruginosa, as a template to generate an acylase able to effectively hydrolyze C8-HSL, the major communication molecule produced by the Burkholderia species. We discovered that the combination of two single mutations leading to variant PvdQLα146W,Fβ24Y conferred high activity toward C8-HSL. Exogenous addition of PvdQLα146W,Fβ24Y dramatically decreased the amount of C8-HSL present in Burkholderia cenocepacia cultures and inhibited a quorum sensing-associated phenotype. The efficacy of this PvdQ variant to combat infections in vivo was further confirmed by its ability to rescue Galleria mellonella larvae upon infection, demonstrating its potential as an effective agent toward Burkholderia infections. Kinetic analysis of the enzymatic activities toward 3-oxo-C12-L-HSL and C8-L-HSL corroborated a substrate switch. This work demonstrates the effectiveness of quorum-quenching acylases as potential novel antimicrobial drugs. In addition, we demonstrate that their substrate range can be easily switched, thereby paving the way to selectively target only specific bacterial species inside a complex microbial community. PMID:24474783

Accumulation and distribution of α-synuclein and ubiquitin in the CNS of Gaucher disease mouse models

PubMed Central

Xu, YH; Sun, Y; Ran, H; Quinn, B; Witte, D; Grabowski, GA

2011-01-01

Gaucher disease, a prevalent lysosomal storage disease, is caused by insufficient activity of acid β-glucosidase (GCase) and resultant glucosylceramide accumulation. Recently in Parkinson disease (PD) patients, heterozygous mutations in GCase have been associated with earlier onset and more progressive PD. To understand the pathogenic relationships between GCase variants and Parkinsonism, α-synuclein and ubiquitin distributions and levels in the brains of several mouse models containing GCase variants were evaluated by immunohistochemistry. Progressive α-synuclein and ubiquitin aggregate accumulations were observed in the cortex, hippocampus, basal ganglia, brainstem, and some cerebellar regions between 4-24 wks in mice that were homozygous for GCase [D409H (9H) or V394L (4L)] variants and also had a prosaposin hypomorphic (PS-NA) transgene. In 4L/PS-NA and 9H/PS-NA mice, this was coincident with progressive neurological manifestations and brain glucosylceramide accumulation. Ultrastructural studies showed electron dense inclusion bodies in neurons and axons of 9H/PS-NA brains. α-Synuclein aggregates were also observed in ventricular, brainstem, and cerebellar regions of older mice (>42-wk) with the GCase variant (D409H/D409H) without overt neurological disease. In a chemically induced GCase deficiency, α-synuclein aggregates and glucosylceramide accumulation also occurred. These studies demonstrate a relationship between glucosylceramide accumulation and α-synuclein aggregates, and implicate glucosylceramide accumulation as risk factor for the α-synucleinopathies. PMID:21257328

A combination of two variants in PRKAG3 is needed for a positive effect on meat quality in pigs

PubMed Central

2014-01-01

Background Color and pH of meat measured 24 h post mortem are common selection objectives in pig breeding programs. Several amino acid substitutions in PRKAG3 have been associated with various meat quality traits. In our previous study ASGA0070625, a SNP next to PRKAG3, had the most significant association with meat quality traits in the Finnish Yorkshire. However, the known amino acid substitutions, including I199V, did not show any association. The aims of this study were to characterize further variation in PRKAG3 and its promoter region, and to test the association between these variants and the pH and color of pork meat. Results The data comprised of 220 Finnish Landrace and 230 Finnish Yorkshire artificial insemination boars with progeny information. We sequenced the coding and promoter region of PRKAG3 in these and in three additional wild boars. Genotypes from our previous genome-wide scans were also included in the data. Association between SNPs or haplotypes and meat quality traits (deregressed estimates of breeding values from Finnish national breeding value estimation for pH, color lightness and redness measured from loin or ham) was tested using a linear regression model. Sequencing revealed several novel amino acid substitutions in PRKAG3, including K24E, I41V, K131R, and P134L. Linkage disequilibrium was strong among the novel variants, SNPs in the promoter region and ASGA0070625, especially for the Yorkshire. The strongest associations were observed between ASGA0070625 and the SNPs in the promoter region and pH measured from loin in the Yorkshire and between I199V and pH measured from ham in the Landrace. In contrast, ASGA0070625 was not significantly associated with meat quality traits in the Landrace and I199V not in the Yorkshire. Haplotype analysis showed a significant association between a haplotype consisting of 199I and 24E alleles (or g.-157C or g.-58A alleles in the promoter region) and pH measured from loin and ham in both breeds (P-values varied from 1.72 × 10-4 to 1.80 × 10-8). Conclusions We conclude that haplotype g.-157C - g.-58A - 24E - 199I in PRKAG3 has a positive effect on meat quality in pigs. Our results are readily applicable for marker-assisted selection in pigs. PMID:24580963

European Bone Mineral Density Loci Are Also Associated with BMD in East-Asian Populations

PubMed Central

Styrkarsdottir, Unnur; Halldorsson, Bjarni V.; Gudbjartsson, Daniel F.; Tang, Nelson L. S.; Koh, Jung-Min; Xiao, Su-mei; Kwok, Timothy C. Y.; Kim, Ghi Su; Chan, Juliana C. N.; Cherny, Stacey; Lee, Seung Hun; Kwok, Anthony; Ho, Suzanne; Gretarsdottir, Solveig; Pop Kostic, Jelena; Palsson, Stefan Th.; Sigurdsson, Gunnar; Sham, Pak C.; Kim, Beom-Jun; Kung, Annie W. C.; Kim, Shin-Yoon; Woo, Jean; Leung, Ping-C.; Kong, Augustine; Thorsteinsdottir, Unnur; Stefansson, Kari

2010-01-01

Most genome-wide association (GWA) studies have focused on populations of European ancestry with limited assessment of the influence of the sequence variants on populations of other ethnicities. To determine whether markers that we have recently shown to associate with Bone Mineral Density (BMD) in Europeans also associate with BMD in East-Asians we analysed 50 markers from 23 genomic loci in samples from Korea (n = 1,397) and two Chinese Hong Kong sample sets (n = 3,869 and n = 785). Through this effort we identified fourteen loci that associated with BMD in East-Asian samples using a false discovery rate (FDR) of 0.05; 1p36 (ZBTB40, P = 4.3×10−9), 1p31 (GPR177, P = 0.00012), 3p22 (CTNNB1, P = 0.00013), 4q22 (MEPE, P = 0.0026), 5q14 (MEF2C, P = 1.3×10−5), 6q25 (ESR1, P = 0.0011), 7p14 (STARD3NL, P = 0.00025), 7q21 (FLJ42280, P = 0.00017), 8q24 (TNFRSF11B, P = 3.4×10−5), 11p15 (SOX6, P = 0.00033), 11q13 (LRP5, P = 0.0033), 13q14 (TNFSF11, P = 7.5×10−5), 16q24 (FOXL1, P = 0.0010) and 17q21 (SOST, P = 0.015). Our study marks an early effort towards the challenge of cataloguing bone density variants shared by many ethnicities by testing BMD variants that have been established in Europeans, in East-Asians. PMID:20949110

Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

PubMed

Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

2015-07-01

The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

Adenovirus type 5 intrinsic adsorption rates measured by surface plasmon resonance.

PubMed

Roper, D Keith; Nakra, Shamit

2006-01-01

Intrinsic adsorption rates of whole adenovirus type 5 (Ad5) onto a diethylaminoethyl (DEAE) anion exchange surface are measured for the first time by surface plasmon resonance (SPR). Fitting SPR sensorgrams to a two-compartment mass transport reaction model distinguishes intrinsic adsorption rates from slow diffusive Ad5 mass transport. Ad5 is a widely used viral vector for gene therapy that binds electrostatically to surfaces of cells and synthetics such as membranes, chromatographic resins, and glass. Increasing NaCl concentration from 4.8 to 14.4mM shifts binding of whole Ad5 from diffusion control to a regime where both sorption and diffusion affect binding. Intrinsic adsorption rates for Ad5-DEAE interaction are 16 times faster than intrinsic adsorption rates for Ad5 fiber knob interacting with soluble extracellular domain of coxsackievirus adenovirus receptors (s-CAR).

Breaking into the epithelial apical–junctional complex — news from pathogen hackers

PubMed Central

Vogelmann, Roger; Amieva, Manuel R; Falkow, Stanley; Nelson, W James

2012-01-01

The epithelial apical–junctional complex is a key regulator of cellular functions. In addition, it is an important target for microbial pathogens that manipulate the cell to survive, proliferate and sometimes persist within a host. Out of a myriad of potential molecular targets, some bacterial and viral pathogens have selected a subset of protein targets at the apical–junctional complex of epithelial cells. Studying how microbes use these targets also teaches us about the inherent physiological properties of host molecules in the context of normal junctional structure and function. Thus, we have learned that three recently uncovered components of the apical–junctional complex of the Ig superfamily — junctional adhesion molecule, Nectin and the coxsackievirus and adenovirus receptor — are important regulators of junction structure and function and represent critical targets of microbial virulence gene products. PMID:15037310

Breaking into the epithelial apical-junctional complex--news from pathogen hackers.

PubMed

Vogelmann, Roger; Amieva, Manuel R; Falkow, Stanley; Nelson, W James

2004-02-01

The epithelial apical-junctional complex is a key regulator of cellular functions. In addition, it is an important target for microbial pathogens that manipulate the cell to survive, proliferate and sometimes persist within a host. Out of a myriad of potential molecular targets, some bacterial and viral pathogens have selected a subset of protein targets at the apical-junctional complex of epithelial cells. Studying how microbes use these targets also teaches us about the inherent physiological properties of host molecules in the context of normal junctional structure and function. Thus, we have learned that three recently uncovered components of the apical-junctional complex of the Ig superfamily--junctional adhesion molecule, Nectin and the coxsackievirus and adenovirus receptor--are important regulators of junction structure and function and represent critical targets of microbial virulence gene products.

Detailed Investigation of the Role of Common and Low-Frequency WFS1 Variants in Type 2 Diabetes Risk

PubMed Central

Fawcett, Katherine A.; Wheeler, Eleanor; Morris, Andrew P.; Ricketts, Sally L.; Hallmans, Göran; Rolandsson, Olov; Daly, Allan; Wasson, Jon; Permutt, Alan; Hattersley, Andrew T.; Glaser, Benjamin; Franks, Paul W.; McCarthy, Mark I.; Wareham, Nicholas J.; Sandhu, Manjinder S.; Barroso, Inês

2010-01-01

OBJECTIVE Wolfram syndrome 1 (WFS1) single nucleotide polymorphisms (SNPs) are associated with risk of type 2 diabetes. In this study we aimed to refine this association and investigate the role of low-frequency WFS1 variants in type 2 diabetes risk. RESEARCH DESIGN AND METHODS For fine-mapping, we sequenced WFS1 exons, splice junctions, and conserved noncoding sequences in samples from 24 type 2 diabetic case and 68 control subjects, selected tagging SNPs, and genotyped these in 959 U.K. type 2 diabetic case and 1,386 control subjects. The same genomic regions were sequenced in samples from 1,235 type 2 diabetic case and 1,668 control subjects to compare the frequency of rarer variants between case and control subjects. RESULTS Of 31 tagging SNPs, the strongest associated was the previously untested 3′ untranslated region rs1046320 (P = 0.008); odds ratio 0.84 and P = 6.59 × 10−7 on further replication in 3,753 case and 4,198 control subjects. High correlation between rs1046320 and the original strongest SNP (rs10010131) (r2 = 0.92) meant that we could not differentiate between their effects in our samples. There was no difference in the cumulative frequency of 82 rare (minor allele frequency [MAF] <0.01) nonsynonymous variants between type 2 diabetic case and control subjects (P = 0.79). Two intermediate frequency (MAF 0.01–0.05) nonsynonymous changes also showed no statistical association with type 2 diabetes. CONCLUSIONS We identified six highly correlated SNPs that show strong and comparable associations with risk of type 2 diabetes, but further refinement of these associations will require large sample sizes (>100,000) or studies in ethnically diverse populations. Low frequency variants in WFS1 are unlikely to have a large impact on type 2 diabetes risk in white U.K. populations, highlighting the complexities of undertaking association studies with low-frequency variants identified by resequencing. PMID:20028947

[Effect of N-terminal truncation of Bacillus acidopullulyticus pullulanase on enzyme properties and functions].

PubMed

Chen, A'na; Liu, Xiuxia; Dai, Xiaofeng; Zhan, Jinling; Peng, Feng; Li, Lu; Wang, Fen; Li, Song; Yang, Yankun; Bai, Zhonghu

2016-03-01

We constructed different N-terminal truncated variants based on Bacillus acidopullulyticus pullulanase 3D structure (PDB code 2WAN), and studied the effects of truncated mutation on soluble expression, enzymatic properties, and application in saccharification. Upon expression, the variants of X45 domain deletion existed as inclusion bodies, whereas deletion of CBM41 domain had an effective effect on soluble expression level. The variants that lack of CBM41 (M1), lack of X25 (M3), and lack both of CBM41 and X25 (M5) had the same optimal pH (5.0) and optimal temperature (60 degrees C) with the wild-type pullulanase (WT). The K(m) of M1 and M5 were 1.42 mg/mL and 1.85 mg/mL, respectively, 2.4- and 3.1-fold higher than that of the WT. k(cat)/K(m) value of M5 was 40% lower than that of the WT. Substrate specificity results show that the enzymes exhibited greater activity with the low-molecular-weight dextrin than with high-molecular-weight soluble starch. When pullulanases were added to the saccharification reaction system, the dextrose equivalent of the WT, M1, M3, and M5 were 93.6%, 94.7%, 94.5%, and93.1%, respectively. These results indicate that the deletion of CBM41 domain and/or X25 domain did not affect the practical application in starch saccharification process. Furthermore, low-molecular-weight variants facilitate the heterologous expression. Truncated variants may be more suitable for industrial production than the WT.

Characterizing Genetic Susceptibility to Breast Cancer in Women of African Ancestry.

PubMed

Feng, Ye; Rhie, Suhn Kyong; Huo, Dezheng; Ruiz-Narvaez, Edward A; Haddad, Stephen A; Ambrosone, Christine B; John, Esther M; Bernstein, Leslie; Zheng, Wei; Hu, Jennifer J; Ziegler, Regina G; Nyante, Sarah; Bandera, Elisa V; Ingles, Sue A; Press, Michael F; Deming, Sandra L; Rodriguez-Gil, Jorge L; Zheng, Yonglan; Yao, Song; Han, Yoo-Jeong; Ogundiran, Temidayo O; Rebbeck, Timothy R; Adebamowo, Clement; Ojengbede, Oladosu; Falusi, Adeyinka G; Hennis, Anselm; Nemesure, Barbara; Ambs, Stefan; Blot, William; Cai, Qiuyin; Signorello, Lisa; Nathanson, Katherine L; Lunetta, Kathryn L; Sucheston-Campbell, Lara E; Bensen, Jeannette T; Chanock, Stephen J; Marchand, Loic Le; Olshan, Andrew F; Kolonel, Laurence N; Conti, David V; Coetzee, Gerhard A; Stram, Daniel O; Olopade, Olufunmilayo I; Palmer, Julie R; Haiman, Christopher A

2017-07-01

Background: Genome-wide association studies have identified approximately 100 common genetic variants associated with breast cancer risk, the majority of which were discovered in women of European ancestry. Because of different patterns of linkage disequilibrium, many of these genetic markers may not represent signals in populations of African ancestry. Methods: We tested 74 breast cancer risk variants and conducted fine-mapping of these susceptibility regions in 6,522 breast cancer cases and 7,643 controls of African ancestry from three genetic consortia (AABC, AMBER, and ROOT). Results: Fifty-four of the 74 variants (73%) were found to have ORs that were directionally consistent with those previously reported, of which 12 were nominally statistically significant ( P < 0.05). Through fine-mapping, in six regions ( 3p24, 12p11, 14q13, 16q12/FTO, 16q23, 19p13 ), we observed seven markers that better represent the underlying risk variant for overall breast cancer or breast cancer subtypes, whereas in another two regions ( 11q13, 16q12/TOX3 ), we identified suggestive evidence of signals that are independent of the reported index variant. Overlapping chromatin features and regulatory elements suggest that many of the risk alleles lie in regions with biological functionality. Conclusions: Through fine-mapping of known susceptibility regions, we have revealed alleles that better characterize breast cancer risk in women of African ancestry. Impact: The risk alleles identified represent genetic markers for modeling and stratifying breast cancer risk in women of African ancestry. Cancer Epidemiol Biomarkers Prev; 26(7); 1016-26. ©2017 AACR . ©2017 American Association for Cancer Research.

Impact of PNPLA3 variants on liver histology of 168 patients with HIV infection and chronic hepatitis C.

PubMed

Sagnelli, C; Merli, M; Uberti-Foppa, C; Hasson, H; Cirillo, G; Grandone, A; Salpietro, S; Minichini, C; Del Giudice, E M; Lazzarin, A; Sagnelli, E; Coppola, N

2016-04-01

This study analysed the impact of PNPLA3 variants on liver histology of 168 HIV/hepatitis C virus (HCV)-coinfected patients who were naïve for HCV treatment. A athologist unaware of the patients' condition graded liver fibrosis and necroinflammation (Ishak) and steatosis (Kleiner). Patients were tested for PNPLA3 variants and genotyped for the PNPLA3 rs738409 C to G variant underlying the I148M substitution. All were hepatitis B surface antigen negative and stated no alcohol abuse. The mean age was 40.6 (37.6-44.1) years, 72.6% were males, 42% had HCV genotype 3, 38.9% HCV genotype 1 and 79.2% were receiving highly active antiretroviral therapy. The 79 patients with the PNPLA3 p.148I/M or M/M variants more frequently showed severe steatosis (score 3-4) than the 89 with PNPLA3 p.148I/I (43% vs. 24.7%, p 0.001), whereas no difference was observed in the degree of necroinflammation or fibrosis. Compared with 112 patients with lower scores, 56 with severe steatosis showed higher body mass index (p 0.03), higher rate of HCV genotype 3 (55.6% vs. 35.2%, p 0.01), PNPLA3 p.148I/M or M/M (60.7% vs. 39.3%, p 0.01) and lower CD4(+) cells/mm(3) (514.00 (390.5-673.0) vs. 500.00 (399.0-627.0); p 0.002). At multivariate analysis, body mass index (p 0.01), HCV genotype 3 (p 0.006), CD4(+) cell count (p 0.005) and PNPLA3 p.148I/M or M/M variants (p 0.01) were found to be independent predictors of severe liver steatosis. The PNPLA3 p.148 I/M or M/M variants and CD4(+) cell count were the only independent predictors of severe steatosis in patients with HCV non-3 genotypes. This is the first study to show that among HIV/HCV-coinfected patients the PNPLA3 p.148I/M or M/M variant have substantially less impact on steatosis for those with HCV genotype 3 than non-genotype 3. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Gene variants as risk factors for gastroschisis

PubMed Central

Yang, Wei; Schultz, Kathleen; Tom, Lauren; Lin, Bin; Carmichael, Suzan L.; Lammer, Edward J.; Shaw, Gary M.

2016-01-01

In a population‐based case‐control study in California of 228 infants, we investigated 75 genetic variants in 20 genes and risk of gastroschisis with regard to maternal age, race/ethnicity, vitamin use, and smoking exposure. We hypothesized that genes related to vascular compromise may interact with environmental factors to affect the risk of gastroschisis. Haplotypes were constructed for 75 gene variants using the HaploView program. Risk for gastroschisis associated with each gene variant was calculated for both the homozygotes and the heterozygotes, with the homozygous wildtypes as the referent. Risks were estimated as odds ratios (ORs) with 95% confidence intervals (CIs) by logistic regression. We found 11 gene variants with increased risk and four variants with decreased risk of gastroschisis for heterozygous (ORh) or homozygous variants (ORv) genotypes. These included NOS3 (rs1036145) ORh = 0.4 (95% CI: 0.2–0.7); NOS3 (rs10277237) ORv = 2.7 (95% CI: 1.3–6.0); ADD1 (rs12503220) ORh = 2.9 (95% CI: 1.6–5.4), GNB3 (rs5443) ORh = 0.2 (95% CI: 0.1–0.5), ORv = 0.4 (95% CI: 0.2–0.9); ICAM1 (rs281428) ORv = 6.9 (95% CI: 2.1–22.9), ICAM1 (rs3093030) ORv = 2.6 (95% CI: 1.2–5.6); ICAM4 (rs281438) ORv = 4.9 (95% CI: 1.4–16.6), ICAM5 (rs281417) ORh = 2.1 (95% CI: 1.1–4.1), ORv = 4.8 (95% CI: 1.7–13.6); ICAM5 (rs281440) ORh = 23.7 (95% CI: 5.5–102.5), ORv = 20.6 (95% CI: 3.4–124.3); ICAM5 (rs2075741) ORv = 2.2 (95% CI: 1.1–4.4); NAT1 ORv = 0.3 (95% CI: 0.1–0.9). There were additional associations between several gene variants and gastroschisis among women aged 20–24 and among mothers with and without vitamin use. NOS3, ADD1, ICAM1, ICAM4, and ICAM5 warrant further investigation in additional populations and with the interaction of additional environmental exposures. © 2016 Wiley Periodicals, Inc. PMID:27616475

STUDIES ON VARIANTS OF POLIOMYELITIS VIRUS

PubMed Central

Sabin, Albert B.; Hennessen, Walter A.; Winsser, Johan

1954-01-01

Attempts were made to "convert" highly virulent strains of the 3 immunologic types of poliomyelitis virus (Mahoney, Y-SK, and Leon) into avirulent variants. Tests involving intracerebral, intramuscular, or oral administration of virus to cynomolgus monkeys indicated that mere propagation in cultures of kidney tissue of cynomolgus monkeys had no effect on virulence when single or small numbers of virus particles were used as seed, and harvests were delayed for 24 hours or more after the appearance of cytopathogenic change. On the other hand, passages at 24 hour intervals with large inocula (105 to 106 TCD60) produced culture fluids with diminished virulence and unusual patterns of response in cynomolgus monkeys. Purification of such culture fluids by the terminal dilution technique yielded modified strains which proved to be avirulent after administration by the intracerebral, intramuscular, or oral routes in cynomolgus monkeys. Neither paralysis nor CNS lesions were found in any of more than 80 monkeys inoculated intracerebrally with various amounts of virus. However, focal neuronal lesions were found in the spinal cord of 3 of 48 monkeys inoculated intramuscularly with various amounts of the Mahoney variant, in 2 of 20 receiving the Y-SK variant, though in none of 40 inoculated with various amounts of the Leon variant. Virus recovered from the spinal cord of one of the monkeys in the Mahoney group produced no paralysis on intracerebral passage in monkeys. It is assumed that all 3 modified viruses possess a limited capacity to affect lower motor neurones of cynomolgus monkeys when these are directly exposed to them by accidental intraneural or traumatic intracerebral injection. On propagation in cynomolgus kidney cultures the modified viruses reached titers of approximately 107 TCD50 per ml., as measured by cytopathogenic activity on renal epithelial cells in vitro, yet produced no perceptible pathologic changes in the muscles, kidneys, testes, ovaries, heart, pancreas, adrenals, liver, or spleen of cynomolgus monkeys inoculated intramuscularly. The modified viruses were immunogenic after intramuscular injection, but a large proportion of cynomolgus monkeys failed to develop antibody after small doses, indicating that in this host the experimentally produced variants multiplied less readily in non-nervous tissue than the virulent parent strains. Tests with the Type 1 virus showed that the orally administered avirulent variant can induce the formation of antibody and bring about resistance to the occurrence of paralysis such as results from ingestion of the virulent, parent strain. The Types 1 and 2 modified viruses are paralytogenic in mice after direct spinal inoculation whereas the Type 3 virus is not. The Type 1 virus became paralytogenic for mice when it lost its virulence for cynomolgus monkeys by the indicated routes. The Type 2 virus lost its virulence for mice by the intracerebral but not intraspinal routes when it was still fully virulent for cynomolgus monkeys, and retained its paralytogenic activity in intraspinally inoculated mice after it had lost its virulence for cynomolgus monkeys by the indicated routes. The parent Type 3 virus was paralytogenic in intraspinally inoculated mice when it was still fully virulent for cynomolgus monkeys, but this property disappeared in the modified virus when it became avirulent for monkeys. PMID:13163327

Interactions among catechol-O-methyltransferase genotype, parenting, and sex predict children’s internalizing symptoms and inhibitory control: Evidence for differential susceptibility

PubMed Central

SULIK, MICHAEL J.; EISENBERG, NANCY; SPINRAD, TRACY L.; LEMERY-CHALFANT, KATHRYN; SWANN, GREGORY; SILVA, KASSONDRA M.; REISER, MARK; STOVER, DARYN A.; VERRELLI, BRIAN C.

2015-01-01

We used sex, observed parenting quality at 18 months, and three variants of the catechol-O-methyltransferase gene (Val158Met [rs4680], intron1 [rs737865], and 3′-untranslated region [rs165599]) to predict mothers’ reports of inhibitory and attentional control (assessed at 42, 54, 72, and 84 months) and internalizing symptoms (assessed at 24, 30, 42, 48, and 54 months) in a sample of 146 children (79 male). Although the pattern for all three variants was very similar, Val158Met explained more variance in both outcomes than did intron1, the 3′-untranslated region, or a haplotype that combined all three catechol-O-methyltransferase variants. In separate models, there were significant three-way interactions among each of the variants, parenting, and sex, predicting the intercepts of inhibitory control and internalizing symptoms. Results suggested that Val158Met indexes plasticity, although this effect was moderated by sex. Parenting was positively associated with inhibitory control for methionine–methionine boys and for valine–valine/valine–methionine girls, and was negatively associated with internalizing symptoms for methionine–methionine boys. Using the “regions of significance” technique, genetic differences in inhibitory control were found for children exposed to high-quality parenting, whereas genetic differences in internalizing were found for children exposed to low-quality parenting. These findings provide evidence in support of testing for differential susceptibility across multiple outcomes. PMID:25159270

Fetal bovine serum and human constitutive androstane receptor: Evidence for activation of the SV23 splice variant by artemisinin, artemether, and arteether in a serum-free cell culture system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lau, Aik Jiang; Chang, Thomas K.H., E-mail: thomas.chang@ubc.ca

The naturally occurring SV23 splice variant of human constitutive androstane receptor (hCAR-SV23) is activated by di-(2-ethylhexyl)phthalate (DEHP), which is detected as a contaminant in fetal bovine serum (FBS). In our initial experiment, we compared the effect of dialyzed FBS, charcoal-stripped, dextran-treated FBS (CS-FBS), and regular FBS on the basal activity and ligand-activation of hCAR-SV23 in a cell-based reporter gene assay. In transfected HepG2 cells cultured in medium supplemented with 10% FBS, basal hCAR-SV23 activity varied with the type of FBS (regular > dialyzed > CS). DEHP increased hCAR-SV23 activity when 10% CS-FBS, but not regular FBS or dialyzed FBS, wasmore » used. With increasing concentrations (1–10%) of regular FBS or CS-FBS, hCAR-SV23 basal activity increased, whereas in DEHP-treated cells, hCAR-SV23 activity remained similar (regular FBS) or slightly increased (CS-FBS). Subsequent experiments identified a serum-free culture condition to detect DEHP activation of hCAR-SV23. Under this condition, artemisinin, artemether, and arteether increased hCAR-SV23 activity, whereas they decreased it in cells cultured in medium supplemented with 10% regular FBS. By comparison, FBS increased the basal activity of the wild-type isoform of hCAR (hCAR-WT), whereas it did not affect the basal activity of the SV24 splice variant (hCAR-SV24) or ligand activation of hCAR-SV24 and hCAR-WT by 6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde O-(3,4-dichlorobenzyl)oxime (CITCO). The use of serum-free culture condition was suitable for detecting CITCO activation of hCAR-WT and hCAR-SV24. In conclusion, FBS leads to erroneous classification of pharmacological ligands of hCAR-SV23 in cell-based assays, but investigations on functional ligands of hCAR isoforms can be conducted in serum-free culture condition. - Highlights: • FBS leads to erroneous pharmacological classification of hCAR-SV23 ligands. • Artemisinin, artemether, and arteether activate hCAR-SV23 in the absence of FBS. • Serum-free culture condition can be used for identifying ligands of hCAR isoforms.« less

Vulnerability of drinking-water wells in La Crosse, Wisconsin, to enteric-virus contamination from surface water contributions.

PubMed

Borchardt, Mark A; Haas, Nathaniel L; Hunt, Randall J

2004-10-01

Human enteric viruses can contaminate municipal drinking-water wells, but few studies have examined the routes by which viruses enter these wells. In the present study, the objective was to monitor the municipal wells of La Crosse, Wisconsin, for enteric viruses and determine whether the amount of Mississippi River water infiltrating the wells was related to the frequency of virus detection. From March 2001 to February 2002, one river water site and four wells predicted by hydrogeological modeling to have variable degrees of surface water contributions were sampled monthly for enteric viruses, microbial indicators of sanitary quality, and oxygen and hydrogen isotopes. (18)O/(16)O and (2)H/(1)H ratios were used to determine the level of surface water contributions. All samples were collected prior to chlorination at the wellhead. By reverse transcription-PCR (RT-PCR), 24 of 48 municipal well water samples (50%) were positive for enteric viruses, including enteroviruses, rotavirus, hepatitis A virus (HAV), and noroviruses. Of 12 river water samples, 10 (83%) were virus positive by RT-PCR. Viable enteroviruses were not detected by cell culture in the well samples, although three well samples were positive for culturable HAV. Enteroviruses detected in the wells by RT-PCR were identified as several serotypes of echoviruses and group A and group B coxsackieviruses. None of the well water samples was positive for indicators of sanitary quality, namely male-specific and somatic coliphages, total coliform bacteria, Escherichia coli, and fecal enterococci. Contrary to expectations, viruses were found in all wells regardless of the level of surface water contributions. This result suggests that there were other unidentified sources, in addition to surface water, responsible for the contamination.

Vulnerability of Drinking-Water Wells in La Crosse, Wisconsin, to Enteric-Virus Contamination from Surface Water Contributions

PubMed Central

Borchardt, Mark A.; Haas, Nathaniel L.; Hunt, Randall J.

2004-01-01

Human enteric viruses can contaminate municipal drinking-water wells, but few studies have examined the routes by which viruses enter these wells. In the present study, the objective was to monitor the municipal wells of La Crosse, Wisconsin, for enteric viruses and determine whether the amount of Mississippi River water infiltrating the wells was related to the frequency of virus detection. From March 2001 to February 2002, one river water site and four wells predicted by hydrogeological modeling to have variable degrees of surface water contributions were sampled monthly for enteric viruses, microbial indicators of sanitary quality, and oxygen and hydrogen isotopes. 18O/16O and 2H/1H ratios were used to determine the level of surface water contributions. All samples were collected prior to chlorination at the wellhead. By reverse transcription-PCR (RT-PCR), 24 of 48 municipal well water samples (50%) were positive for enteric viruses, including enteroviruses, rotavirus, hepatitis A virus (HAV), and noroviruses. Of 12 river water samples, 10 (83%) were virus positive by RT-PCR. Viable enteroviruses were not detected by cell culture in the well samples, although three well samples were positive for culturable HAV. Enteroviruses detected in the wells by RT-PCR were identified as several serotypes of echoviruses and group A and group B coxsackieviruses. None of the well water samples was positive for indicators of sanitary quality, namely male-specific and somatic coliphages, total coliform bacteria, Escherichia coli, and fecal enterococci. Contrary to expectations, viruses were found in all wells regardless of the level of surface water contributions. This result suggests that there were other unidentified sources, in addition to surface water, responsible for the contamination. PMID:15466536

Vulnerability of drinking-water wells in La Crosse, Wisconsin, to enteric-virus contamination from surface water contributions

USGS Publications Warehouse

Borchardt, M. A.; Haas, N.L.; Hunt, R.J.

2004-01-01

Human enteric viruses can contaminate municipal drinking-water wells, but few studies have examined the routes by which viruses enter these wells. In the present study, the objective was to monitor the municipal wells of La Crosse, Wisconsin, for enteric viruses and determine whether the amount of Mississippi River water infiltrating the wells was related to the frequency of virus detection. From March 2001 to February 2002, one river water site and four wells predicted by hydrogeological modeling to have variable degrees of surface water contributions were sampled monthly for enteric viruses, microbial indicators of sanitary quality, and oxygen and hydrogen isotopes. 18O/ 16O and 2H/1H ratios were used to determine the level of surface water contributions. All samples were collected prior to chlorination at the wellhead. By reverse transcription-PCR (RT-PCR), 24 of 48 municipal well water samples (50%) were positive for enteric viruses, including enteroviruses, rotavirus, hepatitis A virus (HAV), and noroviruses. Of 12 river water samples, 10 (83%) were virus positive by RT-PCR. Viable enteroviruses were not detected by cell culture in the well samples, although three well samples were positive for culturable HAV. Enteroviruses detected in the wells by RT-PCR were identified as several serotypes of echoviruses and group A and group B coxsackieviruses. None of the well water samples was positive for indicators of sanitary quality, namely male-specific and somatic coliphages, total coliform bacteria, Escherichia coli, and fecal enterococci. Contrary to expectations, viruses were found in all wells regardless of the level of surface water contributions. This result suggests that there were other unidentified sources, in addition to surface water, responsible for the contamination.

Combined Detection of NUDT15 Variants Could Highly Predict Thiopurine-induced Leukopenia in Chinese Patients with Inflammatory Bowel Disease: A Multicenter Analysis.

PubMed

Chao, Kang; Wang, Xueding; Cao, Qian; Qian, Jiaming; Wu, Kaichun; Zhu, Xia; Yang, Hong; Liang, Jie; Lin, Lang; Huang, Zicheng; Zhang, Yu; Huang, Yibiao; Sun, Yinghao; Xue, Xianmin; Huang, Min; Hu, Pinjin; Lan, Ping; Gao, Xiang

2017-09-01

NUDT15 c.415C>T was a novel genetic marker confirmed in our center for thiopurine-induced leukopenia in Chinese inflammatory bowel disease (IBD). For validation, a large cohort study is needed. Meanwhile, the newly discovered NUDT15 coding variants (c.36_37insGGAGTC and c.52 G>A) have not been studied in patients with IBD. We aimed to further confirm the influence of 3 NUDT15 variants (c.415C>T, c.36_37insGGAGTC, and c.52G>A) on thiopurine-induced leukopenia in Chinese patients with IBD. Patients prescribed on thiopurines for at least 2 weeks were recruited from 4 tertiary hospitals. Clinical data were collected. NUDT15 genotypes were determined with polymerase chain reaction-RFLP and sequencing. The interactions between variants and leukopenia were analyzed. A total of 732 patients were included, 177 (24.3%) of whom developed leukopenia. There were strong associations of NUDT15 c.415C>T, c.36_37insGGAGTC, and c.52G>A with thiopurine-induced leukopenia (P = 1.81 × 10, P = 4.74 × 10 and P = 0.04, respectively), whereas there was no relevance for thiopurine S-methyltransferase genotypes (P = 0.25). The predictive sensitivity of NUDT15 c.415C>T was 49.2%, whereas it increased to 55.4% when combined analysis with c.36_37insGGAGTC and c.52G>A. Notably, not only the homozygotes with NUDT15 c.415C>T but also the heterozygotes both carrying c.415C>T and c.52G>A developed early leukopenia. The median dosage for NUDT15 c.415C>T carriers was significantly lower than that for wild-type (P < 0.001). We confirmed that NUDT15 c.415C>T, c.36_37insGGAGTC, and c.52G>A variants were risk factors for thiopurine-induced leukopenia. Combined detection of the 3 variants could increase the predictive sensitivity of thiopurine-induced leukopenia and help to distinguish early leukopenia in heterozygote of c.415C>T in Chinese patients with IBD. Treatment monitoring by NUDT15 variants may be promising in individualized therapy.

A Predictive Validity Study of an Assessment Center for Research and Development Supervisors.

DTIC Science & Technology

1981-09-01

Implementation, to All AFSC Organi- zation Commanders, 24 July 1974. Szilagyi , Andrew D., Jr., and Marc J. Wallace , Jr. Organ- izational Behavior and...vali- dation of’ projective personality tests. These tests attempt to assess a person through his or her fantasies and inter- pretations ( Szilagyi ...leniency, strictness, and halo errors ( Szilagyi and W’allace, 1980). Finally, a variant to supervisory ratings are jeer ratings. Peer ratings are

Genetic investigation of sudden unexpected death in epilepsy cohort by panel target resequencing.

PubMed

Coll, Monica; Allegue, Catarina; Partemi, Sara; Mates, Jesus; Del Olmo, Bernat; Campuzano, Oscar; Pascali, Vincenzo; Iglesias, Anna; Striano, Pasquale; Oliva, Antonio; Brugada, Ramon

2016-03-01

Sudden unexpected death in epilepsy (SUDEP) is defined as the abrupt, no traumatic, witnessed or unwitnessed death, occurring in benign circumstances, in an individual with epilepsy, with or without evidence for a seizure and excluding documented status epilepticus (seizure duration ≥ 30 min or seizures without recovery), and in which postmortem examination does not reveal a cause of death. Although the physiopathological mechanisms that underlie SUDEP remain to be clarified, the genetic background has been described to play a role in this disorder. Pathogenic variants in genes associated with epilepsy and encoding cardiac ion channels could explain the SUDEP phenotype. To test this we use the next-generation sequencing technology to sequence a cohort of SUDEP cases and its translation into clinical and forensic fields. A panel target resequencing was used to study 14 SUDEP cases from both postmortem (2 cases) and from living patients (12 cases). Genes already associated with SUDEP and also candidate genes had been investigated. Overall, 24 rare genetic variants were identified in 13 SUDEP cases. Four cases showed rare variants with complete segregation in the SCN1A, FBN1, HCN1, SCN4A, and EFHC1 genes, and one case with a rare variant in KCNQ1 gene showed incomplete pattern of inheritance. In four cases, rare variants were detected in CACNA1A, SCN11A and SCN10A, and KCNQ1 genes, but familial segregation was not possible due to lack of DNA from relatives. Finally, in the four remaining cases, the rare variants did not segregate in the family. This study confirms the link between epilepsy, sudden death, and cardiac disease. In addition, we identified new potential candidate genes for SUDEP: FBN1, HCN1, SCN4A, EFHC1, CACNA1A, SCN11A, and SCN10A. Further confirmation in larger cohorts will be necessary especially if genetic screening for SUDEP is applied to forensic and clinical medicine. Nevertheless, this study supports the emerging concept of a genetically determined cardiocerebral channelopathy.

Atomic and electronic structure of the CdTe(111)B–(2√3 × 4) orthogonal surface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bekenev, V. L., E-mail: bekenev@ipms.kiev.ua; Zubkova, S. M.

2017-01-15

The atomic and electronic structure of four variants of Te-terminated CdTe(111)B–(2√3 × 4) orthogonal polar surface (ideal, relaxed, reconstructed, and reconstructed with subsequent relaxation) are calculated ab initio for the first time. The surface is modeled by a film composed of 12 atomic layers with a vacuum gap of ~16 Å in the layered superlattice approximation. To close Cd dangling bonds on the opposite side of the film, 24 fictitious hydrogen atoms with a charge of 1.5 electrons each are added. Ab initio calculations are performed using the Quantum Espresso program based on density functional theory. It is demonstrated thatmore » relaxation leads to splitting of the four upper layers. The band energy structures and total and layer-by-layer densities of electronic states for the four surface variants are calculated and analyzed.« less

Artificial selection increased body weight but induced increase of runs of homozygosity in Hanwoo cattle

PubMed Central

Kim, Kwondo; Jung, Jaehoon; Caetano-Anollés, Kelsey; Sung, Samsun; Yoo, DongAhn; Choi, Bong-Hwan; Kim, Hyung-Chul; Jeong, Jin-Young; Cho, Yong-Min; Park, Eung-Woo; Choi, Tae-Jeong; Park, Byoungho; Lim, Dajeong

2018-01-01

Artificial selection has been demonstrated to have a rapid and significant effect on the phenotype and genome of an organism. However, most previous studies on artificial selection have focused solely on genomic sequences modified by artificial selection or genomic sequences associated with a specific trait. In this study, we generated whole genome sequencing data of 126 cattle under artificial selection, and 24,973,862 single nucleotide variants to investigate the relationship among artificial selection, genomic sequences and trait. Using runs of homozygosity detected by the variants, we showed increase of inbreeding for decades, and at the same time demonstrated a little influence of recent inbreeding on body weight. Also, we could identify ~0.2 Mb runs of homozygosity segment which may be created by recent artificial selection. This approach may aid in development of genetic markers directly influenced by artificial selection, and provide insight into the process of artificial selection. PMID:29561881

High-density genotyping of immune-related loci identifies new SLE risk variants in individuals with Asian ancestry

PubMed Central

Sun, Celi; Molineros, Julio E.; Looger, Loren L.; Zhou, Xu-jie; Kim, Kwangwoo; Okada, Yukinori; Ma, Jianyang; Qi, Yuan-yuan; Kim-Howard, Xana; Motghare, Prasenjeet; Bhattarai, Krishna; Adler, Adam; Bang, So-Young; Lee, Hye-Soon; Kim, Tae-Hwan; Kang, Young Mo; Suh, Chang-Hee; Chung, Won Tae; Park, Yong-Beom; Choe, Jung-Yoon; Shim, Seung Cheol; Kochi, Yuta; Suzuki, Akari; Kubo, Michiaki; Sumida, Takayuki; Yamamoto, Kazuhiko; Lee, Shin-Seok; Kim, Young Jin; Han, Bok-Ghee; Dozmorov, Mikhail; Kaufman, Kenneth M.; Wren, Jonathan D.; Harley, John B.; Shen, Nan; Chua, Kek Heng; Zhang, Hong; Bae, Sang-Cheol; Nath, Swapan K.

2016-01-01

Systemic lupus erythematosus (SLE) has a strong but incompletely understood genetic architecture. We conducted an association study with replication in 4,492 SLE cases and 12,675 controls from six East-Asian cohorts, to identify novel and better localize known SLE susceptibility loci. We identified 10 novel loci as well as 20 known loci with genome-wide significance. Among the novel loci, the most significant was GTF2IRD1-GTF2I at 7q11.23 (rs73366469, Pmeta=3.75×10−117, OR=2.38), followed by DEF6, IL12B, TCF7, TERT, CD226, PCNXL3, RASGRP1, SYNGR1 and SIGLEC6. We localized the most likely functional variants for each locus by analyzing epigenetic marks and gene regulation data. Ten putative variants are known to alter cis- or trans-gene expression. Enrichment analysis highlights the importance of these loci in B- and T-cell biology. Together with previously known loci, the explained heritability of SLE increases to 24%. Novel loci share functional and ontological characteristics with previously reported loci, and are possible drug targets for SLE therapeutics. PMID:26808113

High-density genotyping of immune-related loci identifies new SLE risk variants in individuals with Asian ancestry.

PubMed

Sun, Celi; Molineros, Julio E; Looger, Loren L; Zhou, Xu-Jie; Kim, Kwangwoo; Okada, Yukinori; Ma, Jianyang; Qi, Yuan-Yuan; Kim-Howard, Xana; Motghare, Prasenjeet; Bhattarai, Krishna; Adler, Adam; Bang, So-Young; Lee, Hye-Soon; Kim, Tae-Hwan; Kang, Young Mo; Suh, Chang-Hee; Chung, Won Tae; Park, Yong-Beom; Choe, Jung-Yoon; Shim, Seung Cheol; Kochi, Yuta; Suzuki, Akari; Kubo, Michiaki; Sumida, Takayuki; Yamamoto, Kazuhiko; Lee, Shin-Seok; Kim, Young Jin; Han, Bok-Ghee; Dozmorov, Mikhail; Kaufman, Kenneth M; Wren, Jonathan D; Harley, John B; Shen, Nan; Chua, Kek Heng; Zhang, Hong; Bae, Sang-Cheol; Nath, Swapan K

2016-03-01

Systemic lupus erythematosus (SLE) has a strong but incompletely understood genetic architecture. We conducted an association study with replication in 4,478 SLE cases and 12,656 controls from six East Asian cohorts to identify new SLE susceptibility loci and better localize known loci. We identified ten new loci and confirmed 20 known loci with genome-wide significance. Among the new loci, the most significant locus was GTF2IRD1-GTF2I at 7q11.23 (rs73366469, Pmeta = 3.75 × 10(-117), odds ratio (OR) = 2.38), followed by DEF6, IL12B, TCF7, TERT, CD226, PCNXL3, RASGRP1, SYNGR1 and SIGLEC6. We identified the most likely functional variants at each locus by analyzing epigenetic marks and gene expression data. Ten candidate variants are known to alter gene expression in cis or in trans. Enrichment analysis highlights the importance of these loci in B cell and T cell biology. The new loci, together with previously known loci, increase the explained heritability of SLE to 24%. The new loci share functional and ontological characteristics with previously reported loci and are possible drug targets for SLE therapeutics.

Novel ZBTB24 Mutation Associated with Immunodeficiency, Centromere Instability, and Facial Anomalies Type-2 Syndrome Identified in a Patient with Very Early Onset Inflammatory Bowel Disease.

PubMed

Conrad, Máire A; Dawany, Noor; Sullivan, Kathleen E; Devoto, Marcella; Kelsen, Judith R

2017-12-01

Very early onset inflammatory bowel disease, diagnosed in children ≤5 years old, can be the initial presentation of some primary immunodeficiencies. In this study, we describe a 17-month-old boy with recurrent infections, growth failure, facial anomalies, and inflammatory bowel disease. Immune evaluation, whole-exome sequencing, karyotyping, and methylation array were performed to evaluate the child's constellation of symptoms and examination findings. Whole-exome sequencing revealed that the child was homozygous for a novel variant in ZBTB24, the gene associated with immunodeficiency, centromere instability, and facial anomalies type-2 syndrome. This describes the first case of inflammatory bowel disease associated with immunodeficiency, centromere instability, and facial anomalies type-2 syndrome in a child with a novel disease-causing mutation in ZBTB24 found on whole-exome sequencing.